text
stringlengths 0
7.84M
| meta
dict |
|---|---|
Many applications, such as a search engine, may create an index of content to allow fast resolution of various types of queries about the content indexed. For many of these applications, the resulting size of an index created is usually too large to fit into computer volatile memory. As a result, a content index must be stored in persistent storage, such as on disk or other permanent storage devices, as it is built. To do so, small individual sub-indexes may be typically first produced in volatile memory and then persisted in permanent storage. Each of these sub-indexes provides a content index for part of the content to be indexed. After each sub-index is created in volatile memory, it may be merged with a single index persisted in permanent storage to build a master index. To allow for resolving queries while still indexing the documents, each small sub-index may be persisted as non-modifiable such as a read-only file.
Several problems arise from building a content index in this manner. First, this process is inefficient for applications that may periodically index a vast amount of content. As the master index grows with each merge, it becomes increasingly expensive to add each additional smaller sub-index created in volatile memory and indexing performance degrades correspondingly. Second, indexing of content is interrupted while such merging occurs. There are some applications that may index content continuously, such as a search engine for the World Wide Web. Such an application must wait until merging is finished. Third, this sequential process is not scalable beyond a single CPU. As content storage progressively grows, multiprocessor systems need to be efficiently leveraged for indexing content storage.
What is needed is a way for building a content index that may offer better performance than the process of indexing part of the content and then interrupting indexing to merge a sub-index with a master index. The solution should support continuous indexing of content for applications, such as a search engine, that may continuously index content. Additionally, such a system should scale as the number of CPUs used by the system increases. Moreover, such a system and method should promote efficient query performance as the index is built.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
Moody's said late Tuesday it made the one notch downgrade to noninvestment territory because it sees a high risk of Ireland needing a second bailout at the end of 2013 when the country is supposed to have weaned itself off its EU and International Monetary Fund €67.5 billion $94.34 billion aid program.
This may involve selecting women employed in noninvestment banking positions, or who are currently insufficiently senior, but who show sufficient potential to be selected and trained for more high-powered roles, the headhunters say.
"Market participants have already factored in a one-notch downgrade for Nomura, so unless Moody's lowers it by two notches to noninvestment grade, it won't affect its share price negatively," one analyst said.
|
{
"pile_set_name": "Pile-CC"
}
|
Marquee Accessories
Mini-Marquee Hire Doncaster were at the Lakeside Village Outlet shopping centre over the weekend providing one of our 3m x 2m Premium Mini-Marquees which was being used as a promotional stand for a competition the shopping centre was holding. Providing premium quality gazebos and ensuring we have very high customer service is something we pride […]
Social Networks
Gazebo Hire Doncaster
Here you can find a rough guide of our pricing structure for hiring our units. For a detailed and accurate quote, please fill in our online contact form or call us on 01302 230 000
Size
Frame & Canopy
Side … [Read More...]
|
{
"pile_set_name": "Pile-CC"
}
|
Ferrous bath-smelting processes with direct injection of ore and reducing agents are attractive from a commercial point of view. This arises from the fact that ore fines can be fed directly, obviating the need for lump feed as required by the blast furnace. Further, steaming coal can be used as reducing agent without prior removal of volatile matter in coke ovens.
Reducing agent (usually coal) consumption on such a system can be excessive, however, and the key to efficient operation of the smelting vessel is post-combustion of smelter offgas. In one embodiment of this concept, an oxygen-containing gas is admitted into the spaced above the bath and some of the carbon monoxide and hydrogen present is oxidised to carbon dioxide and water. The heat thus liberated is transferred back to the bath, and this reduces the amount of reducing agent needed in the process. Such a system is described in Australian Patent Specification 74409/81, the contents of which are incorporated herein by reference.
The smelter offgas from such a process contains appreciable amounts of carbon monoxide and hydrogen, and leaves the main vessel at relatively high temperature (eg. 1600.degree. C.). To further reduce the amount of reductant consumed in the overall process, it is beneficial to pre-reduce incoming iron ore feed with this offgas prior to admitting it to the smelting vessel. One such proposal is described in Australian Patent Specification 28044/84, in which the pre-reduction occurs in a shaft furnace.
Stickiness of particles under pre-reduction conditions is a potential problem. At temperatures above about 1000.degree. C., particles begin to cling to surfaces and thus create serious difficulties in plant operation. To avoid this, it is necessary to arrange the process in such a way as to maintain pre-reduction temperatures in the range 800-1000.degree. C. At temperatures much below 800.degree. C., pre-reduction rates slow appreciably and excessive residence-times are needed.
The proposal in the aforementioned AU-28044/84 aims to avoid this difficulty by cooling the offgas in a pre-conditioning chamber in which the offgas is additionally reduced by an intensive mixing action between the gas and coal dust caused by a special grid or lattice-lining over which the gas is passed. A cyclone is then required to separate the coal dust from the reduced, cooled offgas, prior to passing the gas to a shaft furnace to reduce the iron ore. However, it would be anticipated that a build-up of the sticky particles would occur on the special grid or lattice-lining and other surfaces of the pre-conditioning chamber.
Australian Patent Specification 69827/87 proposes an alternative arrangement in which fine ore having a particle size up to a maximum of 0.1 mm is introduced directly into the hot reducing gas immediately downstream of the offgas outlet from the smelting vessel.
It is an object of the present invention to alleviate the disadvantages of the aforementioned proposals and particularly to facilitate the partial reduction of particulate iron oxide containing material in the smelter offgas in an improved range of particle sizes.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
Q:
Transform flat array of objects intro tree
I have a flat array of objects like this:
[
{
id: "a",
parent-id: ""
},
{
id: "b",
parent-id: "a"
},
{
id: "c",
parent-id: "b"
},
{
id: "d",
parent-id: ""
},
...
]
I would like to parse this flat array into a tree-structure, where objects with parent-ids are inserted as child elements of their parent like this:
[
{
id: "a",
parent-id: "",
children: [
{
id: "b",
parent-id: "a",
children: [
{
id: "c",
parent-id: "b"
}
]
}
]
},
{
id: "d",
parent-id: ""
},
...
]
It doesn't matter if the transformation happens on the client or the server, so my options are PHP or JS. What would be the easiest way to do this?
A:
In PHP you can try:
$foo = // your flat array of associative arrays
// add the top level nodes to an array
$result = array();
foreach ($foo as $node) {
if ($node['parent-id'] === '') {
$node['children'] = array();
array_push($result, $node);
}
}
// recursively iterate this array adding the children
addChildrenToArray($result, $foo);
function addChildrenToArray(&$array, $children) {
$parent_i = 0;
$child_i = 0;
foreach ($array as $parent_node) {
foreach ($children as $child_node) {
if ($child_node['parent-id'] == $parent_node['id']) {
$child_node['children'] = array();
array_push($array[$parent_i]['children'], $child_node);
addChildrenToArray($array[$parent_i]['children'], $children);
$child_i++;
}
}
$parent_i++;
}
}
|
{
"pile_set_name": "StackExchange"
}
|
Category: Tax Deadlines | Blog
Have you ever missed a tax deadline? The E-Lodge team will keep you up-to-date on all tax deadlines and start dates for the year. Check back here periodically for Australian Tax Office updates. We will provide them to you as the ATO releases them to the public.
Questions about tax deadlines? You can leave a comment on our blog or ring our customer support team Monday through Friday and we’ll give you the answers you need!
Archive for the Tax Deadlines | Blog category
The 2017 tax season deadline is approaching quickly.
While most have already filed their returns, the 2017 tax season deadline is 31 October 2017. The ATO provides you with due dates of your tax deadlines.
Oh, the stress that comes with the tax season!
The pressure to file your tax return causes most of us to feel overwhelmed. There are added headaches involved while trying to get anything done by the tax season deadline. Before you give up and let a local accountant take care of it, keep in mind that they can have high fees and long wait times. Avoid the stress and let E-lodge be your remedy! With E-lodge, you can lodge a tax return from the comfort of your own home. Our user-friendly website makes it easy, fast and affordable to lodge your 2017 taxes today!
Always running late? Stay on time this tax season!
The tax deadline to lodge your 2016 tax return is 31 October. Maybe you’ve been late lodging your tax return in the past but we’re going to help you turn over a new leaf. E-Lodge makes it easy for you since you can lodge your 2016 tax return online, right from the comfort of your own couch!
Let’s discuss a few tips that will make this process as stress-free and simple as possible.
Make sure you have your PAYG Summary (and other income documents).
This may seem self explanatory but is easy to overlook sometimes. According to the ATO, employers should have employee PAYG payment summaries issued by 14 July. That being said, you should have your PAYG by mid-July whether or not the withheld amount is nil.
31 October doesn’t only mark the day of scary costumes and lots of candy. It’s also the tax deadline 2015.
The tax deadline 2015 is 31 October. That means, your 2014-2015 tax return is considered late as of 1 November 2015.
It also means some tax services like etax will shut down.
Don’t worry. Even if you can’t make the deadline, you can still prepare your tax return online with E-Lodge.
You may face a ‘failure to lodge on time’ penalty
Not lodging your tax return on time means the ATO could apply a failure to lodge on time penalty.
However, just because you’re lodging late doesn’t necessarily mean you’ll face the ATO penalty. You’ll only face the failure to lodge on time penalty if you fall within one of the three following categories;
The time period covered by Australia’s tax returns does not correspond to a regular calendar year. Instead, the tax year begins in July and ends in June of the following year. Of course, that’s not to be confused with the tax season which will take you on a 4-month stretch from July to October.
Don’t wait until the October deadline to lodge your tax return! Instead, it’s best to get it out of the way as soon as possible.
When does the financial year start and end?
The Australian tax year (aka financial year) begins smack-dab in the middle of your calendar year on 1 July and ends 30 June of the following year. That means that all of your financial successes and mishaps that occur during that time will be reflected on your tax return for that year.
That brings us to the tax season. This begins on 1 July and ends on 31 October each and every year. You have these four months to lodge your current year tax return on time without having to worry about any ATO penalties.
Did you forget to lodge your 2013 tax return? E-Lodge is here to help!
The 2013 Australian tax season ended on 31 October, 2013. Even though it’s time to lodge your current year tax return, you still can lodge a late 2013 return with E-Lodge.
Nervous about lodging late? Don’t be. The ATO accepts late tax returns. In fact, if you’re lodging your late 2013 tax return voluntarily and you do not owe the ATO, than you probably won’t be charged late lodgement penalties.
If you are expecting a refund and lodging late, you’ll still be able to receive your refund. However, it’s always best to lodge sooner rather than later.
ATO Penalties
If you do owe the ATO money or if you’re being forced to lodge a tax return, expect to be charged a late lodgement penalty. Read the rest of this entry »
Make sure to lodge by the 31 October Tax Return Due Date
If you haven’t lodged yet, you should start the process now. Don’t procrastinate any longer. Why? E-Lodge makes lodging easy. There’s no excuse to wait any longer.
Keep in mind, the 2015 tax return is for the financial year running from July 2014 through 30 June 2015. That means, any income you received during this time period, you’ll report on your 2015 tax return.
It’s not too late to lodge a 2012 tax return online.
Even though the 2016 tax season is upon us, it’s not too late to lodge a 2012 tax return. In fact, with E-Lodge you can lodge your tax returns going back to the 2006-2007 tax year. It’s best to get caught up before you go on to lodge a return for the most current financial year but we understand that things happen and we can help you get completely caught up all at once.
You don’t need to complete the 2012 tax forms yourself.
Sure, you always have the option to download the 2012 tax form PDF from the ATO website and take the chance of completing it on your own.
But the beauty of doing your taxes on E-Lodge is that it doesn’t require any forms. All you have to do is enter your information into the online tax application.
When you’re finished, your tax return will be completed with the information you entered. Our application will also make sure that you take advantage of every offset and deduction you’re entitled to. Then before we lodge it with the ATO, one of our accountants will look it over to make sure everything is accurate. Read the rest of this entry »
|
{
"pile_set_name": "Pile-CC"
}
|
'US probes Tunisian man' over Libya raid
Update posted on a social media site about the deadly Benghazi attack being seen as a clue by US agencies, website says.
The attack on US facilities in Benghazi ended with the death of the ambassador and three other Americans [EPA]
A man under arrest in Tunisia is being investigated by the US in connection with the September 11 attacks on US diplomatic facilities in Benghazi, Libya, US government sources say.
The 28-year-old suspect, identified earlier this week by the Daily Beast news website as Ali Ani al-Harzi, was one of two Tunisians detained by authorities in Turkey early in October.
News reports at the time of their detention said that the two men were stopped at an Istanbul airport as they tried to enter the country using false passports. The Turkish embassy in Washington declined to comment.
US government sources have said that only one of the men, now understood to be al-Harzi, was under investigation in connection with the Benghazi attacks, in which Christopher Stevens, the US ambassador to Libya, and three other American officials were killed.
One of the sources said that Turkish authorities subsequently sent al-Harzi back to Tunisia.
Al Jazeera's Hoda Abdel-Hamid reports on the Libyan investigation in the September 11 Benghazi attack.
An official at the Tunisian justice ministry confirmed a man had been arrested, but denied he was linked to the killing of Stevens.
"The arrested person was deported by Turkey last month, but he has nothing to do with the killing of the US ambassador," he told the Reuters news agency without giving more details.
Another US government source said US investigators believed that al-Harzi "had something to do with [the Benghazi violence] for sure".
The sources said, however, that at this point al-Harzi was not being investigated as a leader or organiser of the Benghazi attacks, but rather as a possible participant.
The Daily Beast reported that shortly after the Benghazi attacks began, al-Harzi posted an update on an unspecified social media site about the fighting.
The Daily Beast said this was one of the first clues that US intelligence agencies acquired as to who might be behind the violence.
The Daily Beast said al-Harzi was on his way to Syria when he was detained in Turkey at the behest of US authorities, and that he was affiliated with an armed group in North Africa.
Neither the website nor US government sources identified the group with which he allegedly is associated.
First conviction
Separately, a Tunisian court on Wednesday sentenced a leader of the Ansar al-Sharia group to one year in prison for inciting an attack on the US embassy in Tunis last month in which four people were killed.
The conviction of Abu Ayub was the first in connection with the attack - launched to protest against an anti-Islamic film made in California - and is likely to please the US which has been urging the authorities to jail those responsible.
"The judge decided to jail him on charges of inciting violence ... This decision is unfair ... we will go to appeal," Rafik Ghak, a lawyer for Abu Ayub, said.
The authorities arrested 144 people, including two prominent leaders of Ansar al-Sharia after the embassy attack. Seif Allah Ben Hassine, the leader of the group, has urged the government to release them.
Benahssine on Tuesday accused the country's government of being a puppet of the US and un-Islamic.
The US this month requested Tunisia bring the embassy attackers to trial, pledging to continue its support for the democratic transition in Tunisia.
Tunisia expects the US to guarantee around a fifth of its $2.2-2.5bn borrowing needs next year to help its economy recover from last year's revolution, the country's minister of international co-operation, Riadh Betaib, said last month.
|
{
"pile_set_name": "Pile-CC"
}
|
Sitting volleyball classification
Sitting volleyball classification is the classification system for sitting volleyball. Only people with lower leg paralysis or lower leg extremity amputations are eligible to compete.
The sport is governed by World Paravolley [formerly known as World Organization Volleyball for the Disabled]].
Definition
Sitting volleyball allows for multiple classifications but players effectively play in one class, with eligibility for the sport limited to people with lower leg paralysis or lower leg extremity amputations. This sport has rules that were designed specifically for people with disabilities in mind. Classifications for this sport are based on functional mobility. In total there are three types of classification, whereby only two are eligible to play at international competitions. They are, Disabled (D class), Minimally Disabled (MD), and Abled-Bodied (AB), where the latter is ineligible to play.
Governance
The sport's classification process is governed by the World Organization Volleyball for the Disabled.
History
By the early 1990s, sitting volleyball classification had moved away from medical based system to a functional classification system. Because of issues in objectively identifying functionality that plagued the post Barcelona Games, the IPC unveiled plans to develop a new classification system in 2003. This classification system went into effect in 2007, and defined ten different disability types that were eligible to participate on the Paralympic level. It required that classification be sport specific, and served two roles. The first was that it determined eligibility to participate in the sport and that it created specific groups of sportspeople who were eligible to participate and in which class. The IPC left it up to International Federations to develop their own classification systems within this framework, with the specification that their classification systems use an evidence based approach developed through research.
Eligibility
People with physical disabilities are eligible to compete in this sport. In competitions that are non-sanctioned, such as national cup and league matches, people without disabilities may compete.
Process
At the 1996 Summer Paralympics, on the spot classification required that classifiers have access to medical equipment like Snellen charts, reflex hammers, and goniometers to properly classify competitors.
For Australian competitors in this sport, the sport is not supported by the Australian Paralympic Committee. There are three types of classification available for Australian competitors: Provisional, national and international. The first is for club level competitions, the second for state and national competitions, and the third for international competitions.
At the Paralympic Games
At the 1992 Summer Paralympics, two types of volleyball were played including sitting and amputee, with classification being run through ISOD. At the 2000 Summer Paralympics, 26 assessments were conducted at the Games. This resulted in 1 class change.
For the 2016 Summer Paralympics in Rio, the International Paralympic Committee had a zero classification at the Games policy. This policy was put into place in 2014, with the goal of avoiding last minute changes in classes that would negatively impact athlete training preparations. All competitors needed to be internationally classified with their classification status confirmed prior to the Games, with exceptions to this policy being dealt with on a case by case basis. In case there was a need for classification or reclassification at the Games despite best efforts otherwise, sitting volleyball classification was scheduled for September 5 and September 6 at Riocentro-Pavilion 6. For sportspeople with physical or intellectual disabilities going through classification or reclassification in Rio, their in competition observation event is their first appearance in competition at the Games.
Future
Going forward, disability sport's major classification body, the International Paralympic Committee, is working on improving classification to be more of an evidence-based system as opposed to a performance-based system so as not to punish elite athletes whose performance makes them appear in a higher class alongside competitors who train less.
References
External links
Category:Disability sport classifications
Category:Paralympic volleyball
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Q:
Storing and Searching an Array of Strings in Google App Engine DataStore (Java)
I am trying to implement a many to one relationship. I plan to store an array of keys (datastore entity key) of one model in the other model's entity as List<String>.
e.g. Say 4 entities of Model A (a1,a2,a3,a4) have datastore keys : key1, key2, key3 and key4 respectively. Now I store an entity of Model B which has a property called "ids" as List<String>. "ids" has these String as the elements: key1, key2, key3 and key4.
Its all fine till now.
But how do I query the model B for each of these ids now?
What I want to do is something like this:
query.setFilter(FilterOperator.EQUAL.of(ids,"key1")).
Clearly this can not be done right now.
Now what I am doing is fetching the ids property of each B entity and then manually deserializing into a list of string and then checking if the key is present or not.
As you can see this is highly inefficient. How should I approach here? Should I store these mapping in a separate Model. I don't want to handle Joins, but I will have to if I can't get anything else than the present solution.
I am not using JPA or JDO and I plan not to use them.
Any help would be appreciated.
A:
The query with EQUAL filter works fine for lists of values. Make sure you pass correct value when executing this query.
For example, you can store List, if you only use this entity on the server side.
If you need this list on the client side, and you always store keys for entities of the same kind, you can store a list of ids (List) or 'names` (List) used to create these keys. This will take much less space.
|
{
"pile_set_name": "StackExchange"
}
|
UNPUBLISHED
UNITED STATES COURT OF APPEALS
FOR THE FOURTH CIRCUIT
No. 02-6655
CHARLES S. WRIGHT,
Petitioner - Appellant,
versus
RONALD J. ANGELONE, Director of the Virginia
Department of Corrections,
Defendant - Appellee.
Appeal from the United States District Court for the Eastern
District of Virginia, at Norfolk. Rebecca B. Smith, District Judge.
(CA-01-339-2)
Submitted: June 13, 2002 Decided: June 19, 2002
Before WIDENER, LUTTIG, and WILLIAMS, Circuit Judges.
Dismissed by unpublished per curiam opinion.
Charles S. Wright, Appellant Pro Se. Linwood Theodore Wells, Jr.,
Assistant Attorney General, Richmond, Virginia, for Appellee.
Unpublished opinions are not binding precedent in this circuit.
See Local Rule 36(c).
PER CURIAM:
Charles S. Wright seeks to appeal the district court’s order
denying relief on his petition filed under 28 U.S.C.A. § 2254 (West
1994 & Supp. 2001). We have reviewed the record and the district
court’s opinion accepting the recommendation of the magistrate
judge and find no reversible error. Accordingly, we deny a
certificate of appealability and dismiss the appeal on the
reasoning of the district court. See Wright v. Angelone, No. CA-01-
339-2 (E.D. Va. Apr. 1, 2002). We dispense with oral argument
because the facts and legal contentions are adequately presented in
the materials before the court and argument would not aid the
decisional process.
DISMISSED
2
|
{
"pile_set_name": "FreeLaw"
}
|
Incidence and growth pattern of vestibular schwannomas in a Danish county, 1977-98.
During a period of 21 years 162 acoustic neuromas or vestibular schwannomas (VS) were diagnosed in the county of Aarhus. During this period the incidence increased gradually, probably due to improvement of the quality of computed tomography imaging (CTI), and more widely available access to magnetic resonance imaging (MRI). Sixty-four patients were followed up by repeated CTI or MRI, whereas the remaining patients were referred for immediate operation. Six of the observed patients had their tumours removed after demonstration of continuous tumour growth. The observation of 64 tumours over periods between 5 months and 15 years provided useful information on the natural history of sporadic VS. Our results showed that 14 VS (22%) regressed, 35 VS (55%) did not grow or had only minimal growth (growth rate up to 1 mm/year), whereas 15 VS (23%) grew > 1 mm/year. All VS with positive growth had regular growth patterns.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
The Brexit party, formed by veteran Eurosceptic Nigel Farage, is in danger of imploding after suffering a series of high-profile defections and expulsions a week before the UK’s general election on 12 December.
John Longworth, the former leader of the Federation of Small Businesses, was expelled from the party on Wednesday, while Annunziata Rees-Mogg, the sister of hawkish Conservative cabinet minister Jacob Rees-Mogg, and fellow MEPs Lucy Harris and Lance Forman resigned from the party on Thursday.
The four MEPs say that they will now campaign in favour of Conservative Prime Minister Boris Johnson and his Brexit Withdrawal Agreement.
The Brexit party, formed in March, has been bitterly divided over its stance on Johnson’s Brexit deal, which Farage opposes.
At a press conference on Thursday, John Longworth described the Withdrawal Agreement as “the only game in town”, while Ms Rees-Mogg accused the Brexit party of putting at risk the UK’s exit from the EU.
Having comfortably topped the poll at the European elections in May with 29 seats, the Brexit party has seen support evaporate in recent months.
Farage said the party would not stand candidates in seats won by the Conservatives in 2017, though he ruled out a formal ‘Leave’ alliance with the Conservative party, instead targeting the five million Labour voters who had also voted to leave the EU in 2016. However, the Brexit party is unlikely to win any seats at all next Thursday.
“We are disappointed that four of our MEPs don’t seem to understand that we both saved the Conservative party from large scale losses to the Liberal Democrats in the South and South West of England but we are also hammering the Labour Leave vote in its traditional heartlands, making it much easier for the Conservatives to win many of those seats,” said Farage.
“The only vote on the Leave side that is currently being split is in areas such as Barnsley, the South Wales Valleys, Doncaster and Hartlepool where there is a risk that the Tories will split our vote.”
In an angry exchange, the Brexit party also accused the MEPs of conflicts of interest, implying that they had been offered government jobs, a charge which all have denied.
“We also note that one of the MEPs is the sister of a cabinet minister, another has a partner who works in the office of the same cabinet minister and yet another is a personal friend of both Boris Johnson and Michael Gove,” said a party spokesman.
“In the case of John Longworth, who was for years the firmest advocate of WTO withdrawal that we have ever met, he underwent a metamorphosis into being a supporter of the new EU treaty following two days of meetings in London. We hope that Mr Longworth is well rewarded for his actions.”
With a week until election day, polls suggest that Johnson’s Conservatives is on course to win a narrow majority, although all parties are mindful that tactical voting is likely to be far more prevalent than at previous polls.
[Edited by Zoran Radosavljevic]
|
{
"pile_set_name": "OpenWebText2"
}
|
With barely a day to spare, a southern Minnesota woman showed up at the state's lottery headquarters in Roseville and claimed her $50,000 prize. Another person in the same situation, however, is out of luck.
Debra Newman of Austin had the good fortune to arrive Thursday to cash in the Powerball ticket, which she bought on Jan. 13, 2016. Its value would have plummeted to $0 if she had arrived after 5 p.m. on Friday the 13th.
Of the 12 $50,000 winning tickets sold in Minnesota for that drawing in the multistate game, one did expire. It was bought in Jackson at the SuperAmerica at 514 3rd St. The unclaimed money goes into the state's general fund.
Newman said that she doesn't play the lottery often and bought the ticket only at the urging of co-workers when the jackpot had reached $1.5 billion a year ago.
Newman said she hadn't claimed the prize earlier because "it was a rough year, and I thought for sure [the deadline to claim] was February. I heard on the news that a ticket purchased in Austin was going to expire and I thought, 'Wait a minute, that's me.' "
The Kwik Trip at 1201 W. Oakland Av. in Austin sold Newman the winning ticket, which matched four of the five numbers drawn plus the Powerball.
PAUL WALSH
|
{
"pile_set_name": "OpenWebText2"
}
|
WRITTEN FOR AND FEATURED IN UPCOMIN...
|
{
"pile_set_name": "OpenWebText2"
}
|
🦁 WORLD LION DAY 🦁 To all Leo's and Lion lovers across the world! 💎💎 My cousin and media manager, Ella has written a blog post about today and why it's important. We are giving 10% off AND we are giving 10% of revenues of all prints sold today to @bigcatrescue 🦁🦁🦁🦁CODE:WORLDLIONDAY ⚡️ The link is in my bio if you want to make the most of the 10% off and me donating the other 10 to a worthwhile charity xxxx . . . . . .#worldlionday#sophieteaart#lionart#lionartist#animalartist#londonart
🔥"1001 FLAMES"🔥 A creation of IMAGINE JAGO & L-ION We are inviting you to dream and get carried away by this beautiful fairytale-like adventurous and thrilling fireshow created by @imagineperformances@l_ion_ and @artistjago !
|
{
"pile_set_name": "Pile-CC"
}
|
Q:
Reference a cell if the sheet contains a certain string using VBA
the code below copies "ADXL364" sheet in my active worksheet, but is there way that I can copy the sheet if it contains "XL364" or "364"
if I put asterisk 'C:\data[adxl364.xls]*ADXL364_QC'!A1 in my code it does not work.
Sub GetRange()
With Range("A:Z")
.Formula = "=If('C:\data\[adxl364.xls]ADXL364_QC'!A1 > 0,'C:\data\[adxl364.xls]ADXL364_QC'!A1,Text(,))"
.Formula = .Value
End With
End Sub
the long code will be getting the location of file from the user then copying a worksheet that contains ADXL364 or XL364
With ActiveWorkbook
Sheets.Add.Name = "Flow_table"
Application.EnableEvents = False
TP_location = Left(TextBox1.Value, InStrRev(TextBox1.Value, "\"))
TP_filename = Right(TextBox1.Value, Len(TextBox1.Value) - InStrRev(TextBox1.Value, "\"))
TP_filename = "[" & TP_filename & "]"
TP_formula = "'" & TP_location & TP_filename & TextBox2.Value & "'!A1"
getcellvalue = "=if(" & TP_formula & ">0," & TP_formula & "," & """"")"
With Range("A:Z")
.Formula = getcellvalue
.Formula = .Value
End With
Sheets.Add.Name = "Job_lists"
End With
Unload UserForm2
End Sub
A:
An ugly, but possible, way would be with a brute force error trapping technique.
However, a more elegant solution might be to use ADO. You could for example run two 'queries': the first on the table schema which would give you your sheet names in the specified file, and the second on the found sheet name. This would produce a RecordSet containing the data of your closed sheet which can be written directly to a Range using the .CopyFromRecordset method. Of course, you could just run the first query to find your sheet name and move on as you have in your posted code.
The example below shows the code for the two queries. It's all late bound so you needn't reference the ADO library but I'll leave that decision to you. I've put a few constants at the top of the module which might need changing depending on which version of Excel you have. You'll also need to write your own error handling (especially to close the connection) but, again, I'll leave that one for you.
Option Explicit
Private Const SCHEMA_TABLES As Integer = 20
Private Const OPEN_FORWARD_ONLY As Integer = 0
Private Const LOCK_READ_ONLY As Integer = 1
Private Const CMD_TEXT As Long = 1
Private Const PROVIDER As String = "Microsoft.ACE.OLEDB.12.0"
Private Const XL_PROP As String = """Excel 12.0;HDR=No"""
Private Const SHEETS_FIELD_NAME As String = "TABLE_NAME"
Public Sub AcquireData()
Dim fPath As String
Dim fName As String
Dim key As String
Dim addr As String
Dim oConn As Object
Dim oRS As Object
Dim connString As String
Dim sql As String
Dim found As Boolean
Dim sheetField As String
'Define the path and file name
fPath = "C:\Users\User\Documents\StackOverflow"
fName = "closed_book.xlsx"
'Define the search key
key = "XL364"
'Define the address of closed worksheet
'If reading one cell then use [address:address], eg "A1:A1"
addr = "A1:E5"
'Late bind the ADO objects
Set oConn = CreateObject("ADODB.Connection")
Set oRS = CreateObject("ADODB.Recordset")
'Open conection
connString = "Provider=" & PROVIDER & ";" & _
"Data Source=" & fPath & "\" & fName & ";" & _
"Extended Properties=" & XL_PROP & ";"
oConn.Open connString
'Search for the sheet name containing your key
'in the tables (ie sheets) schema
found = False
oRS.Open oConn.OpenSchema(SCHEMA_TABLES)
Do While Not oRS.EOF
sheetField = oRS.Fields(SHEETS_FIELD_NAME).Value
If InStr(sheetField, key) > 0 Then
found = True
Exit Do
End If
oRS.MoveNext
Loop
oRS.Close
'Read the target data
If found Then
sql = "SELECT * FROM [" & _
sheetField & addr & "];"
oRS.Open sql, oConn, OPEN_FORWARD_ONLY, LOCK_READ_ONLY, CMD_TEXT
'Write the data to your worksheet
If Not oRS.EOF Then
ThisWorkbook.Worksheets("Sheet1").Range("A1") _
.CopyFromRecordset oRS
End If
End If
'Housekeeping
oRS.Close
Set oRS = Nothing
oConn.Close
Set oConn = Nothing
End Sub
|
{
"pile_set_name": "StackExchange"
}
|
R-Z
Circuit Boards
We offer a variety of Circuit Boards and Control Boards from leading manufacturers such as Carrier, Trane, Bryant and Rheem, all at competitive prices. Enjoy lightning fast shipping and the largest selection of HVAC Circuit Boards online.
|
{
"pile_set_name": "Pile-CC"
}
|
Temperature-sensitive translation of MS2 bacteriophage RNA.
A comparison was made of bacteriophage MS2 RNA translation in infected Escherichia coli cells and in a defined cell-free system. A number of temperature-sensitive mutants were used as hosts for viral RNA translation at permissive and restrictive temperatures. The amount of viral coat protein synthesis was determined after gel electrophoresis of proteins from the cell lysates. These results were compared to those obtained with cell-free translation assays conducted with ribosomes isolated from the same mutants. Compared with control cells, a reduced activity in vivo and in vitro was found for each mutant examined at elevated temperatures. A good correlation between the two types of translational assays was observed. These findings are discussed in terms of the translational defects known to be a characteristic of some of these mutant strains.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
July 24, 2012
Today's review is for a cigar that had been hinted at for awhile, but nobody thought was going to be released anytime soon. That was until Dion Giolito, owner of Illusione Cigars, tweeted that the cigars began being shipping to retailers on July 13th. The 2012 version of the Singularé comes packed in a box containing two different cigars. This one (the maduro) and another of the same size and shape, but with a natural wrapper.
Quote from Dion about the Singularé 2012 Maduro: This
was one of the blends I put together while in Miami at our “playpen.”
The blend to this cigar is specific to 2 farms in Esteli, and one in
Jalapa. The wrapper is maduro, San Andreas. This cigar is completely
different in blend and taste profile from the Corojo 2011/2012 that sits
next to it in the box.
The original Singularé was a fantastic stick that I don't think received as much publicity as it deserved. Despite everyone I know who smoked enjoying it very much, it still didn't seem to gain the following other small batch releases have had in the past few years. Let's see how this release stacks up.
This is the first paper-wrapped cigar I have smoked in a long time. I'm not sure what the history is behind this tradition, but it gave it a pretty cool look and made the cigar feel just a hint more special. The maduro wrapper was dark brown and red color with a ton of small veins all over the leaf. The veins were so abundant that I thought it looked like a spiderweb. The aroma from the unlit cigar was full of raisin and coffee notes. The cold draw also tasted strongly of raisins.
First Third
Smooth was the name of the game when it came to the first third of my Singularé 2012 Maduro. The flavor profile consisted of a slight pepper and honey combo on the front, with a coffee and cream taste on the finish. Both were refined in complexity and, again, very smooth. It almost felt like the smoke was liquid floating across my palate. Speaking of the smoke, there was a lot of it. The two of us smoking in the NHC office filled the place in no time. Make sure you have a window cracked if you plan to smoke this stick indoors. The nicotine strength was in the medium to full range.
Second Third
The second third of my Singularé 2012 Maduro had a flavor change up on both ends of the profile. The front end still had some mild pepper taste, but it was now mixed in nicely with some dark baking chocolate flavor. This flavor is one I find I tend to get a lot when smoking sticks with Mexican San Andres wrappers. The finish which was cream and coffee before had evolved into more of a fresh espresso flavor with a bit of a bite. I drink a lot of espresso so you can imagine enjoyed this. What this flavor did do also is ruffen up a bit of the smooth texture that I got so much of in the first third. It didn't make it harsh or unpleasant, just a different texture than before. The nicotine strength level was still medium-full.
Final Third and Final Thoughts
There was nothing new to report in the final third. The flavors continued to be identical to the second third with a mild pepper and baking chocolate front, espresso finish. One thing I should mention that was the consistently flaky ash from start to finish. Keep your ashtray near or you'll be burning holes in your shirt in no time. The stick maintained a medium-full in strength.
Final thoughts on the Singularé 2012 Maduro?
I was worried about this cigar before I smoked it because I was not a fan of the maduro releases from Illusione in 2011. I'm happy to report that, for me, this cigar was way better than those previous releases. The flavors were strong and enjoyable from start to finish. Another release from Dion that will be added to my rotation. If you're looking for som,e you can pick them up here.
Would I buy it again? Yes.
Would I buy a box? Buying a box is almost like buying a sampler with the two different cigars in it. Yes, it's box-worthy.
July 21, 2012
Just like a few days ago, today's review is for a brand new stick coming from L'Atelier Surrogates. The Tramp Stamp (referring to the pop culture name for a tattoo on ones' lower back) is an obvious play on words with Tatuaje (Spanish for tattoo.) Tramp Stamp will be the fourth release in the Surrogates line and the second to be sold through the new L'Atelier Imports company. (Check my last review for info on the origin of Surrogates and L'Atelier.) Pete Johnson (the owner of Tatuaje) has been quoted as saying that it is a blend based off of his personal "Black Label" blend that, up until a few years ago, was only available at Tatuaje events Pete attended. I'm a big fan of most of the Black Label releases, so I was very interested to see what this take on the blend would be like.
The image on the Tramp Stamp band is perfect for the name --a classic, almost cliche "tramp stamp" tattoo-looking butterfly. Props for the creativity. It's not the classiest band, but hey. It's called Tramp Stamp. What did you expect? The wrapper was a very lush, dark brown with a lot of visible oils. There were just a few big veins, but all-in-all, it wasn't too ugly a wrapper. The aroma was faint, but I picked up cedar and hay, especially near the foot which was closed off with extra wrapper. The cold draw was tight (closed foot) but had a strong, distinct fresh almond flavor. Something also to note: this is is the first cigar in the Surrogates line with a smaller ring gauge. I'm sure that will make at least a few cigar enthusiasts happy, since the current model for new cigars seems to be the bigger the better.
First Third
Lighting the closed foot of my Tramp Stamp was no issue and produced a nice, even burn straight away. The immediate Pepin black pepper was on full on the front with a spicy clove element that really had my palate roaring. The finish was just as strong in flavor with a herbal taste that gave way to some oak and leather. I burned about an inch into the stick and the flavors only got stronger, but they also seemed to get smoother and blended a bit more between the spicy front end and complex finish. To say I was happy with this kind of start is an understatement. The construction was excellent; even with the wind we were having, the ash held strong. I'd put the nicotine strength in the medium range.
Second Third
The second third of my Tramp Stamp had many similar characteristics as the first (a good thing), but also a a few changes. The signature black pepper flavor on the front fell off a bit, but that's not to say the spiciness had. What the pepper gave away to was a stronger version of the sweet/spicy clove that had been present in the first third, but at this point, had become a real focal point. I love everything about clove - always have, so I was really enjoying myself. The finish lost the oak notes from the first third, but picked up some hints of espresso in addition to the leather. Espresso and leather sounds like an odd combo, but I have a tendency to pick it up in many of the cigars I smoke. The construction and nicotine strength were consistent with the first third - perfect and medium, respectively.
Final Third and Final Thoughts
The front of the flavor profile in the final third was a clone of the second, but the finish took an interesting twist. The finish (especially down at the nub) took on a very clean and obvious mocha flavor. I was not expecting this, as there were no hints in the first two parts of this cigar. The mocha created a new balance with the spicy clove (and slight pepper) that was still going strong on the front. Truly, this addition was icing on the cake for me. Unlike a lot of cigars I've smoked recently, the nicotine strength didn't ramp up at the end but instead stayed a consistent medium the whole way through - a great smoke for anytime of the day.
Final thoughts on the L'Atelier Surrogates Tramp Stamp (pre-release)? If you read the review above, you'll notice that I pretty much gushed about how much I enjoyed this cigar. It is something I could easily smoke back to back. (I wish I had more!) People are going to ask how it compares to the Tatauje Black label and, in my opinion, it has a lot of the same characteristics but takes them to the next level. A new contender for Cigar of the Year has arrived for me.
July 20, 2012
Up for review is the soon to be released (at the IPCPR 2012 tradeshow) INCH by EP Carrillo. Rumors of this cigar have been around for quite some time and, just in the past two months, pictures have begun to surface.
Some info on the INCH from various sources: This cigar is being produced in both Maduro and Natural wrappers. Connecticut Broadleaf for the Maduro and Ecuador Sumatra wrapper for
the Natural. They both have the same blend of
Nicaraguan binders and Nicaraguan and Dominican fillers. Both cigars are said to be medium to full in strength and
have a suggested price of $8.75-$10.00
It looks like it will take a long time to burn this one down, so let's get to it.
The branding on the INCH is a big departure from what EP Carrillo has done in the past and I think it's great. The vintage ruler image on the band is original and very creative. Big props to whomever did this design work. Next let's talk about size. This cigar is an absolute giant. If you thought the MUWAT from Drew Estate is big, it's got nothing on the INCH. I had to find a different cutter than what I normally use to clip this stick. The broadleaf wrapper was dark and spotty with some reddish hues which really showed up in bright sunlight. There were lots of little veins, which is typical for this type of wrapper. The pre-lit aroma gave off some coffee and vanilla scents. The cold draw was nice, free, and had a strong almond flavor.
First Third
Getting this stick to burn evenly from the start was a bit of a problem, but once I got it going, it produced smoke nicely. The starting profile consisted of dark black coffee on the front, which was very rich, and some mild cayenne pepper on the finish. There was not much spice to the pepper, but a lot of flavor. What surprised me about the first third of this cigar was that I got hardly any of the broadleaf taste that I am used to, but I am guessing it's because of the sheer volume of tobacco used in the fill. The smoke itself was pretty thin, which to me was a good thing with this size, because I'm certain something heavy would have rocked me. The nicotine level was in the medium range.
Second Third
The second third of my INCH from EP Carrillo was where the broadleaf sweetness showed up. The front of the profile still had coffee notes, but now was equaled by a sugary sweetness from the wrapper. The finish lost any pepper it had previously and now tasted strongly of almonds, just like in the cold draw. The burn was pretty wavy and I did have to give it a few touch-ups to stop any running. With a cigar this size, you're gonna have that. Again, the smoke was pretty thin but full of flavor. I'd put the nicotine level up a notch here and say it was in the medium-full range.
Final Third and Final Thoughts
The final third had a little tweak to the flavor profile in the finish and a big tweak to the nicotine power. This cigar was easily in the full power range at this point and I had to smoke slower to avoid any head spins. The front end was still coffee and sugar, but the finish had a lot of anise in the taste which I didn't see coming at all in the first two thirds of this giant. The smoke also seemed to get thicker toward the end which was a nice, but I'm glad it wasn't like that the whole cigar or it would have felt like a workout. The burn was still pretty wavy, so keep your lighter near.
Final thoughts on the EP Carrillo INCH? Even with the jaw breaking size of this cigar, I still enjoyed the heck out of it. I'm glad it was blended to not be full-on power the whole way because it would have been too much. The flavors were strong and definitely had some changes through out to keep me from getting bored on such a long smoke.
Would I buy it again? Yes
Would I buy a box? This would be a great cigar for tailgating because of how long a smoke time you get out of it, so a box purchase isn't out of the question, but I wouldn't smoke something this large on a daily basis.
July 17, 2012
Let's talk about a new stick coming soon from the Surrogates brand of cigars. Surrogates, for those of you who don't know, is a line of cigars owned by Dan Welsh, owner/operator of New Havana Cigars. There were two releases from this line this past year - the Skull Breaker and the Bone Crusher. Much buzz was around these cigars in the early days because Dan was not forthcoming with where these sticks were being made and explained that it was an experiment he was conducting.
Dan explained the experiment as this: I
was curious, given my business model, how much hype goes into our
smoking and buying decisions. Although I am thoroughly an advocate of
educating ourselves as to what we are smoking, eating or drinking - so
as to develop our palate and make better decisions when choosing future
things - I also think that when we try something new without the hype
of a limited release, or a certain manufacturer or claims of aged
tobacco or 100% ligero, etc., that we come across a more authentic
tasting experience. So, being that it is not limited - this seemed
like a great opportunity to tell everyone 'try it and decide'.
Fast forward a few months to now and we all know the cat is out of the bag with the experiment, and that Pete Johnson of Tatuaje fame blended and produced these sticks at the My Father Cigar factory in Esteli. Now to add one more chapter to the story of the Surrogates brand, the former two releases and the two newer releases (this one and Tramp Stamp) are being licensed out to be made for a new company called L’Atelier Imports for the foreseeable future. L'Atelier is a new company formed by Dan Welsh, Pete Johnson, K.C. Johnson, and Shawn Johnson. I don't tend to write news stories on this site, so if you want the full scoop on L'Atelier, check out Cigar Brief's post or Charlie's Halfwheel post.
OK. Now that all of the information is out of the way, let's move on to the review.
The first thing I noticed while looking at my Crystal Baller was the wrapper and just how much lighter a wrapper Surrogates used for this line in comparison to its older brothers. I know it comes from a different seed entirely, so I shouldn't have been surprised, but it was different seeing the standard "Surrogates" band on a lighter, peanut brown-colored wrapper. The artwork was simple and still looked a bit sinister, which kept the design in line with the others, even though there are no bones or death on this one. The box press was not too hard but hard enough to give it that box-pressed feel in your hand. (That sounds dumb, but you know what I mean if you smoke box-pressed cigars). The pre-lit aroma was filled with natural sweetness and light molasses notes at the open foot. I had no problems with clipping the cap; the draw was free with just a slight resistance. The flavors from the cold draw were a mixture of that same natural sweetness but included some citrus and plum flavors.
First Third
Thick and rich doughy flavors hit the center of my palate right away when I got my Crystal Baller sparked up. It was almost like biting into a baguette, but without the crunch (obviously.)
That was the front of the profile, but just as interesting on the finish was a sweet yet salty spice that lasted awhile between puffs. It was in no way a peppery spice, but a combo of sweet and salty. If you've ever had homemade ice cream that wasn't made exactly right and you pick up a lingering bit of salt....that was it exactly. It worked well to cut into some of the richness that came on strong at the beginning of each puff. The burn was straight and the draw excellent. I'd put the nicotine level in the medium range.
Second Third
During the second third of my Crystal Baller, I was still picking up a lot of the "bready" flavor from the first third, but at this point, it wasn't as rich or dominate. Mixing in on the front was a slight hint of graham cracker and burnt sugar that seemed to go back and forth in strength between draws. The finish also had a change up and picked up (at one point, very strongly) some dry cocoa notes. Think dry NESQUIK powder before you add the milk. The salty flavor was still there, too, but not as strongly or in your face as it had been in the first third. Again, no issues at all with the burn nor the draw. Another note worth mentioning was how strong and dense the ash was. At this point, I'd still say the strength was medium but could tell it was building.
Final Third and Final Thoughts
The final third brought on more spice than earlier on the front of the profile. The consistent bread flavor was absolutely still there, but instead of the graham or burnt sugar notes, I picked up a rather strong, spicy nutmeg. Yup. I didn't see that one coming either. This flavor continued to dominate the front of the profile until the end of the cigar. Speaking of domination, the saltiness returned full tilt on the finish during the final third and, again, acted as a nice balance to cut into the deep flavors from the front of each draw. The construction was perfect to the nub and I'd say the nicotine level did pick up in the final third to a solid medium-full. It's not going to knock you over with nicotine power, but it will let you know it's there.
Final thoughts on the L'Atelier Surrogates Crystal Baller (pre-release)? This cigar had a lot going on and noteworthy, staple consistency. The bread flavor is definitely the main taste profile for this smoke, but the other flavors seemed to jump in and out enough to keep anyone from getting anything close to bored. It certainly had unique flavor combos that I don't often get in other cigars. It's nothing at all like the other Surrogates releases that I love, but a solid cigar nonetheless.
Would I buy it again? Yes.
Would I buy a box? I tend to like a more peppery cigar for a full box purchase, but for its uniqueness and my curiosity on how these will age, I'd be in for a box. Plus, the price is excellent.
July 15, 2012
Today's cigar review is for a line a lot of people were very excited about coming out of the 2010 IPCPR trade show. Somehow, over the past two years, I've never taken the time to smoke one or, if I did, I don't remember it. I went with the smallest size in the line because my smoking time was short. An interesting note: while the Avo Heritage line was released in 2010, this size was only released back in February of 2012.
From the AVO Heritage press release: Centuries of tradition, knowledge and passion are what you will dicover in each AVO Heritage cigar created by Master Cigar Composer Avo Uvezian, alongside undisputed Master of Tobacco Hendrik Kelner – assisted by Eladin Diaz and Manuel Peralia, plus the many talented farmers, blenders, and rollers.
A lot of collaboration went into this cigar, and from most of the things I have heard, it has paid off. Time to give the Avo Heritage a go for myself.
This is a small cigar and feels like a small cigar. I smoke a lot of shorter sticks due to weather and timing issues, but this one feels exceptionally small. The wrapper of my AVO Heritage was a medium to dark borwn color with almost perfect circle-shaped black dots. It was a pretty rough looking cigar. The pre-lit aroma smelled like plums and other dark stone fruit. The cold draw was nice, free, and also had a dark, fruity taste to it.
First Half
Lighting my AVO Heritage was no issue, but the first flavors I got out of the cigar were not really to my liking. The front of the profile had a lot of grassy, vegetable flavors that once reaching the end turned sour. The other part of the finish was a rather harsh white pepper taste. It's a little cigar but it produced a lot of flavor that, unfortunately, I was not digging. The construction on the other hand was perfect. I had no issues with running burn lines or tight draws. The nicotine strength was a solid medium from the get go.
Second Half and Final Thoughts
It didn't take long to burn into the second half of my AVO Heritage and really nothing in this half changed from the first. The front profile taste was still very grassy and toward the end, very musty. The back end white pepper flavor did die down a bit and was no longer harsh, but for me was overshadowed by the front. Construction stayed spot on and the cigar burned a very dark ash, which was interesting. The nicotine level never rose above medium.
My final thoughtsthe AVO Heritage: I'm a little surprised by how much this cigar didn't agree with me, but agrees with a lot of other folks I know who, typically, like similar cigars as me. Maybe in this smaller size the blend doesn't hold up? Or maybe I just don't have the taste profile for this stick in my wheelhouse of enjoyable cigars. Anyway, to each there own and, even though I didn't like it, make sure you try it for yourself.
Would I buy it again? Maybe in a different size, but not this size again.
July 11, 2012
Tonight's review is for a stick that comes with a little story. My partner at Cigar Explorer Mario attended a charity event in New York a few weeks back which was hosted by Carlito Fuente. I'm sure Mario took video of the event, but he has been very busy and is back logged with videos at this time. Anyway, during the after party at the Grand Havana Room, Carlito handed Mario a couple of these cigars and said, "Nobody has this one." What does that mean? I don't know. What I do know is Mario saved one for me, so I'm thankful to him for that. From doing some Google research (I will readily admit that I'm an amateur regarding Fuente products), this cigar looked like the Arturo Fuente Don Gran AniverXario Natural.
Some early history on Arturo Fuente Don Gran AniverXario Natural from a Old Prometheus press-release via Halfwheel: Carlito Fuente has created a new cigar, Don Arturo Gran AniverXario, in tribute to his grandfather, Arturo Fuente. These cigars are made with the legendary wrapper leaves from Chateau de la Fuente, the birthplace of a dream. Carlito Fuente made Don Arturo Gran AniverXario cigars in 2001 to celebrate the 100th Anniversary of Arturo Fuente Cigar Company, which was founded by his grandfather in 1912. He planned to release Don Arturo Gran AniverXario cigars every year, starting in 2002, to celebrate the 100th Anniversary. However, these cigars were never released. Don Arturo Gran AniverXario cigars have been aging in the Fuente aging room since 2001. These 7-year-old cigars will finally be presented in the Limited Edition Fuente Story Humidors produced by Prometheus.
So, with all that said, I don't even know if this cigar is the previously-released Arturo Fuente Don Gran AniverXario. Could it be one of the delayed 100th year Anniversary cigars that are not coming until 2013? Speculating is something fun, but in the long run, really doesn't mean anything. For the purpose of this review I'm simply going to call it Gran AniverXario.Specifics
Vitola: Robusto
Length: 5
Ring Gauge: 50
Wrapper: ?
Binder: ?
Filler: ?
Price: ?
Smoking Location: My back deck
Beverage: water Pre-Light
The band on this cigar was awesome. I know...I bet I surprised you, given my tendancy to go for the less-is-more approach to cigar band art, but this one really just worked. There was so much going on -- from the portraits to all the symbols -- yet, to me, it really does look like a well-executed, classic Cuban design. The wrapper was a peanut butter brown color with lots wood spalting characteristics. Easily put, it looks old. There were medium-sized veins running around the leaf, but because the wrapper appeared to be thick, I didn't anticipate any burn issues. The unlit aroma had notes of raw honey and walnuts. The cap clipped without issue and the cold draw had a lot of sweet, sugary flavors with the walnut creeping back in.
First Third
Right out of the gate, my Gran AniverXario produced a lot of strong flavors. The front of the taste profile had a thick raw honey flavor mixing with a twangy sugary sweetness and some wood notes. The finish was a powerful black pepper flavor that was spicy but lacked any mouth burning and was easy on the taste buds. It's only the first third, but wow. This cigar was impressing me. The draw and the burn were perfect; the ash, although looking pretty weak, did not fall even in the breezy weather we were having (Yay, it's not 100+ degrees!) I'd put the nicotine strength in the mild to medium range.
Second Third
The second third of my Gran AniverXario had a slight change on the front of the profile with some toast flavor elements mixing in, but they did not take away at all from the honey, sugar, and wood combo from the first third. The finish was consistent with the black pepper that lingered long between each draw. I know that is a lot of different flavors in my description, but I really was getting all of them and getting them strongly. This cigar was pumping out so much flavor, it was hard to not rush smoking it. Once again, no problems with the burn or draw, and the ash only fell right before reaching the band on the stick. The nicotine strength moved up a bit in the second third and I would call it medium.
Final Third and Final Thoughts
Just when I thought I had this stick figured out, the final third threw another thing into the ring. The front was still producing all the flavors I mentioned above, but the finish now added a tart grapefruit note just after I exhaled. It lasted a very short amount of time before fading into the black pepper from before, but it was definitely there and seemed to work well as a buffer between the sweet front end and the spicy back. I only ashed this cigar once before burning it all the way until my fingers were hot so yeah: constuction doesn't get much better than that. The nicotine strength stayed in the medium range.
Final thoughts on the Arturo Fuente Don Gran AniverXario? This was one hell of a cigar. Like I admitted, I am not a Fuente expert, but I have smoked my fair share of Anjeo and Opus X. For me, this cigar blew any of the ones I have smoked previously out of the water. Tons of full on strong flavors and great balance, even with the complexity. This is in the top five cigars I have smoked this year so far.
Would I buy it again? Yes
Would I buy a box? This (if it's an old Gran AniverXario or a new one) is a very pricy cigar. But if money was no option I would buy a box in a heartbeat.
July 4, 2012
Happy forth of July everyone. I'm sorry content has been a little slow coming out of the site recently but my life has been very busy with summer travel. Excuses excuses I know. Anyway, the cigar up for review today is a fitting one given it's Independence day, the Alec Bradley American Sun Grown Blend. (That's a mouthful). I was given this stick from the infamous @AB_therockstar Barry Blonder while hanging out at Governor's Smoke Shop last week. That was my first time talking to Barry for more than five seconds and what a down to earth great guy he is.
Anyway, I little about the cigar taken from the Alec Bradley Website: On the heels of last year’s “American Classic Blend” release, Alec
Bradley Cigars has announced the release of “American Sungrown Blend,” a
fuller-bodied, all-Nicaraguan leaf blend. Priced affordably, the
“American Sungrown Blend” offers an extension to the American Classic
selection with a little more spice. The cigars will retail between $4.20
to $5.75, and scheduled to arrive at retail cigar stores by [July 4th.
2012].
The price point on these cigars is a great relief to the wallet, and I'm sure that played into the popularity of the American Classic Blend. For me that blend was a little underwhelming, but the description of the Sun Grown sounds right to my liking. On to the review.
The first thing I noticed when holding my American Sun Grown (SG from now on) was how oily the wrapper was. The color of the leaf is dark brown with a few medium sized veins, but again what really stands out is sheen visible when light hits the cigar. Let's talk band. Alec Bradley tends to do a lot of big detail oriented bands. The America is just that. The design is busy, but not so much that it's turns into a mess of color and embossing. Nicely done. The pre-lit aroma was sweet with a lot of cedar scents to it, pretty common. What was far from common was the cold draw which had a fruity concord grape, or even blueberry compote taste. That sounds crazy but it's what I was picking up. And picking up strongly.
First Third
My American SG lit up easily and produced a lot of smoke right away. The draw was perfect with a slight resistance but easy to puff on. The initial flavors were a mild tingly spice (felt and tasted mostly on the sides of my tongue) on the front with some light espresso on the finish to round out the profile. The flavors were nice but somewhat muted. About an inch into the cigar I started to get some leather flavor on the front also mixing in with the mild spice. The burn was spot on. I'd put the nicotine strength level as a solid medium.
Second Third
In the second third of my American SG had the spice on the front dissipate and the leather flavor take over. The finish also changed up completely and tasted now of bitter baking chocolate. Just like the first third the flavors were not super pronounced but were still enjoyable. The draw and burn continued to be excellent and I never had to reach for my lighter to do a touch up. Even with smoking in the extremely humid weather we are having here I had a straight burn line. The nicotine strength was again a consistent medium.
Final Third and Final Thoughts
The final third of my American SG is where the muted flavors from the first two thirds really stepped up. The front was a much more pronounced leather taste, and the finish was very very long with a strong baking chocolate flavor. I'd say this was the most interesting part of the cigar for sure. The nicotine level also ramped up a bit and was now in the medium-full range. Just like the first two thirds to construction was spot on, and it was very easy to nub the stick.
Final thoughts on the Alec Bradley American Sun Grown Blend? This cigar was very easy to smoke which is what I was looking for on such a hot day. The final third is really where it shined for me so if you give this one a shot don't put it down early or you will miss out. A solid release for Alec Bradley.
Would I buy it again? Yes, and the price point is fantastic
Would I buy a box? For my full box purchases I like a bit more of a spicy cigar, but I would do a split with someone.
|
{
"pile_set_name": "Pile-CC"
}
|
Comparative Evaluation of the Efficiency of Manual and Rotary Gutta-percha Removal Techniques.
This study aimed to evaluate the efficiency of 2 manual and 2 rotary gutta-percha (GP) removal techniques in terms of both the total operating time and GP remnants left in the canal. GP was removed with manual techniques using H-files and xylene (H + X) and H-files and System B (H + SB) (SybronEndo, Orange, CA) and with rotary techniques using the ProTaper Univeral Retreatment (PTUR) (Dentsply Maillefer, Ballaigues, Switzerland) and D-RaCe Retreatment (D-RR) (FKG Dentaire, La Chaux-de-Fonds, Switzerland) systems. The total operating time was evaluated as the time taken to reach the working length and completely remove GP until no radiopaque remnants were observed in the final radiograph. Any GP remnants left in the canal were evaluated in terms of percentage in the whole canal. Rotary techniques were significantly faster and left lesser GP remnants than manual techniques (P < .05). In rotary techniques, the D-RR system was significantly faster than the PTUR system (P < .05), but there was no significant difference between them regarding GP remnants (P > .05). In manual techniques, H + X was significantly faster and left lesser GP remnants than H + SB (P < .05). Rotary techniques were more efficient than manual techniques in GP removal. Overall, the D-RaCe Retreatment system was most efficient, whereas manual use of H-files with System B was least efficient. However, because all the techniques showed GP remnants in the canal and radiographs failed to show these remnants, additional measures would be required to ensure complete GP removal and check for cleaner canals during endodontic retreatment.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
'use strict'
function ValidationError (errors) {
this.name = 'ValidationError'
this.errors = errors
}
ValidationError.prototype = Error.prototype
module.exports = ValidationError
|
{
"pile_set_name": "Github"
}
|
Q:
What is the use of 'sep' in paste command of R?
I was working with the paste command in R, when I found that
a <- c("something", "to", "paste")
paste(a, sep="_")
produces the output
# [1] "something" "to" "paste"
Which is same as when I print "a"
# [1] "something" "to" "paste"
So what effect does the sep have on the paste command in R?
A:
sep is more generally applicable when you have more than two vectors of length greater than 1. If you were looking to get "something_to_paste", then you would be looking for the collapse argument.
Try the following to get a sense of what the sep argument does:
paste(a, 1:3, sep = "_")
# [1] "something_1" "to_2" "paste_3"
and compare it to collapse:
paste(a, collapse = "_")
# [1] "something_to_paste"
|
{
"pile_set_name": "StackExchange"
}
|
The Lane Swap Evolution at MSI 2016
Related Articles
The Mid Season Invitational of 2016 has so far defied all our expectations. SKT was mediocre, NA was far better than EU, and RNG somewhat figured out Euro style lane swaps. Yes, I want to talk about all the switcheroos we did not see during the group stage at MSI. I went ahead and noted the approximate position of every ward placed by teams before 2 minutes (Riot does not make stats like ward position available, this was fun). I mapped them on Summoner’s Rift and tried figuring out why we saw more and more successful swaps as the days went by. You can find the map below. Each point on the map represents a ward placed. You can filter for the side, matchup, or team you want on the right side of my visualization. I also wrote short summaries on interesting situations for each team.
Many who follow the Western League scene can appreciate lane swaps on a strategic level. However, they make for a sometimes tedious first 10-15 minutes of the game. In the NA and EU LCS, teams would invade deep into enemy territory on opposite sides of the map. Instead of splitting the map at the river, they would basically split it along the mid lane until their comps reached specific power spikes. Lane swaps are largely based on the information a team can gather in the first 2 minutes of the game. If a team notices anything after that it means it already screwed up somewhere. Here is what Summoner’s Rift looked like at the end of day 5 at MSI. (Unfortunately, if you are reading this on your smartphone, you will see and image instead of a map with filters)
As we can see, the large majority of wards was placed throughout the river in a style similar to what we know from solo queue. When professional teams placed wards like this, their lane swaps largely came down to intuition and maybe some VOD-reviews. Remember, most teams had very little time to prepare for MSI after playoffs ended. So for the first few days, teams either guessed wrong, or more likely, overwhelmingly preferred to simply see where they are at in terms of raw skills and head-to-head matchups. In the larger scheme, this might point to a lack of overall international competition throughout the year. You could also say that every participant stuck to what they already knew. NA’s CLG is the only team that attempted deep invades more than twice. G2 and RNG did it twice and SKT once. As the round-robin went by, teams succeeded more often in their swaps. Working of the information they gathered through days 1 and 2, they managed their swaps differently and looked for favorable matchups. This is why we saw only one successful lane swap based on precise information over the first two days. Throughout the rest of MSI, teams switched around creatively ten times and started tweaking their early game movements, just like they adapted their picks and bans. These are all general trends, so let us break it down on team-by-team basis.
Counter Logic Gaming
CLG stuck to their guns when it comes to macro-play. They initiated all but one deep invade to get a lane swap. They did this versus G2, RNG, SKT, and SUP. It is reasonable to assume that CLG think this is the optimal way to play the game right now. But it was not always the team to move for a deep invade first. Both SKT and G2 start off against CLG by deep invading in one game. Clearly, CLG likes to switch it up, but is adept enough at reacting to what other teams do in the early game. There are the exceptions of Huhi and Stixxay. Both of them were caught out multiple times when teams came from unexpected angles. Stixxay had to burn flash against SKT because Faker, Wolf, and Bang ganged up on him in CLG’s tri-brush. Faker was missing from mid lane, but Huhi pinged way too late. Huhi himself on the other hand almost got killed by RNG when Mata and Wuxx swung around CLG’s red buff. While they could basically autopilot their way to the first wave in the NA LCS, this was not the case at all during the Invitational’s group stage.
G2 Esports
If we ignore the cost that came with G2’s vacation, they actually did not behave very differently over the first 120 seconds of the game than any other team at MSI. They mainly warded the entire river in a defensive way. There are some things that went wrong for them (aside from losing). First of, Perkz was caught out on Day 2 against RNG and almost gave them a kill. This set his Ryze behind in lane quite heavily. The outcome for Hybrid was even worse. He gave CLG first blood 98 seconds into their meeting on Day 2. This time CLG was the team switching things up by sending their botlane through mid, where Perkz recalled at the minute mark. He had already placed his ward far up in mid lane towards CLG’s blue side. So aphromoo and Stixxay snuck through together with Huhi and killed Perkz, who also had no business walking from top to mid at that point in time.
Flash Wolves
The Flash Wolves surprised many when they won against SKT, but this turned out to be SKT underperforming heavily over the first few days of the tournament. FW was one of the teams to actually almost never invade. The only notable exception was against Super Massive’s Achuu when they tried the kind of invade Bang, Faker and Wolf did against CLG earlier. However, they did not time it right with Maple. NL and SwordArt walked out of botlane into SUP’s tri-brush too early and their gank only led to a blown Flash by Dumbledoge instead of Achuu. Dumbledoge could have even saved his summoner, but he had no information on who else was there from FW. Another notable exception was against RNG. FW started on blue side and set Looper pretty far behind to start of that game by hiding their intentions from RNG. They probably used what scouting RNG had done on them to their advantage here.
Royal Never Give Up
RNG did shine when it comes to teamfights and skirmishes as we expected. Despite their solid performances throughout the group stage, they did show a lack of experience with lane swaps. Even though they exploited Super Massive’s lack of sparring partners, they were badly outsmarted by CLG and FW. In the first game of MSI, CLG invaded deep into their blue side jungle and built a large lead before throwing the game on multiple occasions. However, they showed progress in their second meeting on day 4. CLG coming from blue side warded deep for a lane swap. RNG was content with simply clearing CLG’s red and raptors. Now comes the real tweak. Mlxg did not join Mata and Wuxx to push bot tower. Instead he ganked mid and got an easy first blood with xiaohu’s Zed on an overextended Huhi. Against FW, RNG tried a Euro swap and failed miserably. They took 25 seconds longer than FW to secure their first tower. In the meantime, the Wolves did not back after they got the bot outer turret. Instead, they swung around to midlane and killed xiaohu’s Ryze at almost the same time for first blood. This could have happened to CLG or G2, however both Western teams would very likely not have been as far behind, thus limiting FW’s window of opportunity.
SKTelecom T1
The start to MSI 2016 went according to plan for SKT. But after losing four games in a rowthe LCK-champs looked out of sorts. No one knows exactly what was going on there, so let us focus on what we could observe. One trend from day one was that Bang and Wolf attempted late invades on their own to mess with the enemy team’s duo lane at gromp or golems. However, this was not really based on vision prior to the invade. It seems likely that they simply wanted to test their competitions nerves. Apart from this, SKT also tried creative invades based around their enemies’ tendency to simply stand in tri-brush when starting on blue-side. SKT did initiate one deep invade against CLG at their second meeting in a game SKT won pretty handily. However, they guessed wrong and actually did not get their Sivir the time to scale into late game the way they wanted. So their hustle did not even result in what they had intended. This might be attributable to CLG simply knowing what SKT wanted and making the right call.
Super Massive
The Wildcard-team put up a good fight. However, several of their tendencies were exploited by their opponents. First of, SUP tend to ward defensively very late into our 2-minute window. Even more than other teams, they simply did not want to get invaded on while doing their camps. Dumbledoge got killed for not respecting the time RNG had on day one to roam towards dragon after they had warded their top side jungle. It was again Naru who placed his ward into the brush by dragon way too late. At this point, four members of RNG had already roamed down. Achuu’s ward in tri-brush got cleared by Mata and Wuxx. Dumbledoge simply did not know which RNG members were there and died for the lack of information. Antoher example was in their last meeting with RNG. Starting on red side, Stomaged got caught out on Elise at his own red buff. Coming from their blue side, Mlxg, Mata, and Wuxx simply walked up into mid lane and up to red-side raptors. Naru had not warded there yet and got pressured by xiaohu. So they snuck into the river from mid and were able to simply kill him because he was up too far. SUP’s jungler got punished 40 seconds into the game for the entire team not placing their wards about 5 seconds earlier on average. This may point to two things. First, Wildcard-teams still lack practice partners to develop a more diverse skillset of strategies. Second, maybe the lack of better competition led to SUP relying too heavily on mechanical skill and not information, especially in the early game.
This is of course a rough sketch and there simply is not enough data to take this information as evidence. But it was interesting to see how teams tried creating advantages for themselves before they knew their opponents and after they had some time to play against them. The better teams were able to adapt over the course of the tournament and were thus rewarded with better results. You can look through the entire group stage in the graphic I created above. You can filter according to sides, matchups, and teams.
|
{
"pile_set_name": "Pile-CC"
}
|
From arteriographies to computational flow in saccular aneurisms: the INRIA experience.
Saccular aneurisms illustrate usefulness and possible techniques of image-based modeling of flow in diseased vessels. Aneurism flow is investigated in order to estimate the rupture risk, assuming that the pressure is the major factor and that high-pressure zones are correlated to within-wall strong-stress concentrations. Computational flow is also aimed at providing additional arguments for the treatment strategy. Angiographies of aneurismal vessels of large and medium size are processed to provide three-dimensional reconstruction of the vessel region of interest. Different reconstruction techniques are used for a side and a terminal aneurisms. Reconstruction techniques may lead to different geometries especially with poor input data. The associated facetisation is improved to get a computation-adapted surface triangulation, after a treatment of vessel ends and mesh adaptation. Once the volumic mesh is obtained, the pulsatile flow of an incompressible Newtonian blood is computed using in vivo non-invasive flowmetry and the finite element method. High pressure zones are observed in the aneurism cavity. The pressure magnitude in the aneurism, the location and the size of high pressure zones depend mainly on the aneurism implantation on the vessel wall and its orientation with respect to the blood flux in the upstream vessel. The stronger the blood impacts on the aneurismal wall the higher the pressure. The state of the aneurism neck, where a high-pressure zone can occur, and the location of the aneurism, with an easy access or not, give arguments for the choice between coiling and surgical clipping. Mesh size and 3D reconstruction procedure affect the numerical results. Helpful qualitative data are provided rather than accurate quantitative results in the context of multimodeling.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
see by ghinkle when he imported lots of perf plugin resources:
14:15:44,417 WARN [DiscoveryBossBean] Could not perform commit synchronization with agent for server [server-a-6]
java.lang.RuntimeException: java.util.ConcurrentModificationException
at org.rhq.core.pc.inventory.InventoryManager.synchInventory(InventoryManager.java:944)
at org.rhq.core.pc.inventory.InventoryManager.synchronizeInventory(InventoryManager.java:1729)
at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method)
at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39)
at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25)
at java.lang.reflect.Method.invoke(Method.java:597)
at org.rhq.enterprise.communications.command.impl.remotepojo.server.RemotePojoInvocationCommandService.execute(RemotePojoInvocationCommandService.java:184)
at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method)
at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39)
at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25)
at java.lang.reflect.Method.invoke(Method.java:597)
at com.sun.jmx.mbeanserver.StandardMBeanIntrospector.invokeM2(StandardMBeanIntrospector.java:93)
at com.sun.jmx.mbeanserver.StandardMBeanIntrospector.invokeM2(StandardMBeanIntrospector.java:27)
at com.sun.jmx.mbeanserver.MBeanIntrospector.invokeM(MBeanIntrospector.java:208)
at com.sun.jmx.mbeanserver.PerInterface.invoke(PerInterface.java:120)
at com.sun.jmx.mbeanserver.MBeanSupport.invoke(MBeanSupport.java:262)
at com.sun.jmx.interceptor.DefaultMBeanServerInterceptor.invoke(DefaultMBeanServerInterceptor.java:836)
at com.sun.jmx.mbeanserver.JmxMBeanServer.invoke(JmxMBeanServer.java:761)
at javax.management.MBeanServerInvocationHandler.invoke(MBeanServerInvocationHandler.java:288)
at $Proxy0.execute(Unknown Source)
at org.rhq.enterprise.communications.command.server.CommandProcessor.handleIncomingInvocationRequest(CommandProcessor.java:290)
at org.rhq.enterprise.communications.command.server.CommandProcessor.invoke(CommandProcessor.java:184)
at org.jboss.remoting.ServerInvoker.invoke(ServerInvoker.java:809)
at org.jboss.remoting.transport.socket.ServerThread.processInvocation(ServerThread.java:608)
at org.jboss.remoting.transport.socket.ServerThread.dorun(ServerThread.java:420)
at org.jboss.remoting.transport.socket.ServerThread.run(ServerThread.java:173)
Caused by: java.util.ConcurrentModificationException
at java.util.LinkedHashMap$LinkedHashIterator.nextEntry(LinkedHashMap.java:373)
at java.util.LinkedHashMap$KeyIterator.next(LinkedHashMap.java:384)
at org.rhq.core.pc.inventory.InventoryManager.deactivateResource(InventoryManager.java:1590)
at org.rhq.core.pc.inventory.InventoryManager.removeResourceAndIndicateIfScanIsNeeded(InventoryManager.java:1043)
at org.rhq.core.pc.inventory.InventoryManager.uninventoryResource(InventoryManager.java:1018)
at org.rhq.core.pc.inventory.InventoryManager.purgeObsoleteResources(InventoryManager.java:2380)
at org.rhq.core.pc.inventory.InventoryManager.synchInventory(InventoryManager.java:922)
... 25 more
Looks like possible solution is if we change resource.getChildResources() to new ArrayList<Resource>(resource.getChildResources()) on line 1590, the problem gets fixed:
private void deactivateResource(Resource resource) {
this.inventoryLock.writeLock().lock();
try {
ResourceContainer container = getResourceContainer(resource);
if ((container != null) && (container.getResourceComponentState() == ResourceComponentState.STARTED)) {
for (Resource child : resource.getChildResources()) { <<<=====
deactivateResource(child);
}
this involves removing uninventoried resources:
org.rhq.core.pc.inventory.InventoryManager.uninventoryResource(InventoryManager.java:1018)
at
org.rhq.core.pc.inventory.InventoryManager.purgeObsoleteResources(InventoryManager.java:2380)
I'm not sure how to replicate, but clearly it involves uninventorying a
resource and perhaps then quickly committing new resources in inventory?
We should consider changing the impl of Resource.getChildResources() to:
public Set<Resource> getChildResources() {
return new LinkedHashSet(this.childResources);
// or maybe even: return Collections.unmodifiableSet(new LinkedHashSet(this.childResources));
}
And document that the returned Set should not (or can not) be modified. That way callers won't have to remember to wrap the Set before iterating it.
|
{
"pile_set_name": "Pile-CC"
}
|
Marvel Creates Superhero Comic for Hearing-Impaired Boy
Some real-life heroes at Marvel Comics created a hearing-aid-wearing superhero comic book in honor of hearing impaired little boy who didn’t want to wear his own device any more.
The creation of the new character began when Anthony Smith’s mother wrote to Marvel after her son told her he didn’t want to wear his blue hearing aid to school.
The boy said, “Super heroes don’t wear them.”
Bill Rosemann, a Marvel editor, who has a 3-year-old son, sent the email around the office and wheels began to turn on the boy’s behalf.
First, someone remembered that Hawkeye, an Avenger, once had a hearing problem — and that comic book was sent to the family. Then, they went a step further, creating a drawing of a new superhero who has super hearing when he listens through his super-device.
|
{
"pile_set_name": "Pile-CC"
}
|
Adherence to insulin pump treatment declines with increasing age in adolescents with type 1 diabetes mellitus.
This study assessed the impact of illness perceptions, emotional responses to the disease and its management, and patient characteristics on the adherence to optimal insulin pump management in adolescents with type 1 diabetes mellitus. From May to December 2013 and May 2015 to September 2016, we investigated 90 adolescents (50% boys), 12-18 years with type 1 diabetes. We analysed the association of optimal adherence to insulin pump therapy to age, gender, diabetes duration, results of questionnaires relating to fear and problems of self-testing, illness perceptions, emotional distress and family conflicts. Optimal adherence was defined as bolusing insulin on average ≥2.5/3 main meals/d. Adolescents with suboptimal adherence were on average 1.8 years older (95% Confidence Interval 1.09-2.50 years, P < .001) than those with optimal adherence. After adjustment for age, no other patient or parent factors were related to optimal adherence. Adherence to insulin pump self-management in adolescents with type 1 diabetes declined with increasing age, illustrating the challenges of transition of self-management from parents to the adolescent patient themselves.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Q:
data families use cases
Benefits of using type synonym families is clear - it is type-level functions.
But it is not the case with data families - so my question is, what is use-cases for data families? Where should I use it?
A:
One benefit is that data families are injective, unlike type families.
If you have
type family TF a
data family DF a
Then you know that DF a ~ DF b implies that a ~ b, while with TF, you don't -- for any a you can be sure that DF a is a completely new type (just like [a] is a different type from [b], unless of course a ~ b), while a type family can map multiple input types onto the same existing type.
A second is that data families can be partially applied, like any other type constructor, while type families can't.
This is not a particularly real-world example, but for example, you can do:
data instance DF Int = DInt Int
data instance DF String = DString String
class C t where
foo :: t Int -> t String
instance C DF where -- notice we are using DF without an argument
-- notice also that you can write instances for data families at all,
-- unlike type families
foo (DInt i) = DString (show i)
Basically, DF and DF a are actual, first-class, legitimate types, in themselves, like any other type you declare with data. TF a is just an intermediate form that evaluates to a type.
But I suppose all of that's not very enlightening, or at least it wasn't for me, when I was wondering about data families and read similar things.
Here's the rule of thumb I go by. Whenever you find yourself repeating the pattern that you have a type family, and for every input type, you declare a new data type for the type family to map onto, it's nicer to cut out the middleman and use a data family instead.
A real-world example from the vector library. vector has several different kinds of Vectors: boxed vectors, unboxed vectors, primitive vectors, storable vectors. For each Vector type there is a corresponding, mutable MVector type (normal Vectors are immutable). So it looks like this:
type family Mutable v :: * -> * -> * -- the result type has two type parameters
module Data.Vector{.Mutable} where
data Vector a = ...
data MVector s a = ...
type instance Mutable Vector = MVector
module Data.Vector.Storable{.Mutable} where
data Vector a = ...
data MVector s a = ...
type instance Mutable Vector = MVector
[etc.]
Now instead of that, I would rather have:
data family Mutable v :: * -> * -> *
module Data.Vector{.Mutable} where
data Vector a = ...
data instance Mutable Vector s a = ...
type MVector = Mutable Vector
module Data.Vector.Storable{.Mutable} where
data Vector a = ...
data instance Mutable Vector s a = ...
type MVector = Mutable Vector
[etc.]
Which encodes the invariant that for every Vector type there is exactly one Mutable Vector type, and that there is a one-to-one correspondence between them. The mutable version of a Vector is always called Mutable Vector: that is its name, and it has no other. If you have a Mutable Vector, you can get the type of the corresponding immutable Vector, because it's right there as a type argument. With type family Mutable, once you apply it to an argument it evaluates to an unspecified result type (presumably called MVector, but you can't know), and you have no way to map backwards.
|
{
"pile_set_name": "StackExchange"
}
|
Q:
Large animations with AnimationDrawable
I’m trying to animate some things using frame by frame animation with AnimationDrawable.
When I load animation with this code:
animationHolder.setBackgroundResource(R.drawable.secondanimation);
frameAnimation = (AnimationDrawable)animationHolder.getBackground();
The UI become unresponsive for a couple of seconds (3-5). I guess that’s because it’s has to load a lot’s of images (140 png’s to be precise, 400px X 300px, 50KB each).
When I start animation, its running fine, at least on my HTC Desire.
If I run the same code in emulator I get: “OutOfMemoryError” with “bitmap size exceeded VM budget”.
What is the proper way of handling large animations? I guess there should be some kind of “lazy animation loading”.
Does something like that already exist or I have to roll out some sort of custom view?
How other popular app’s like “Talking Tom Cat” duet?
A:
You would not do animations that way... If you need to do heavy animations look into opengl. Android can't handle too many images because it uses a limited bitmap memory.
|
{
"pile_set_name": "StackExchange"
}
|
You are currently viewing the old forums. We have upgraded to a new NFL Forum. This old forum is being left as a read-only archive.
Please update your bookmarks to our new forum at forums.footballsfuture.com.
In creating this mock, the focus was mainly on improving the offense and giving our franchise QB some weapons and added confidence. I realize that this is a lot to ingest. However, before you bash away, keep in mind that under Howie Roseman, we are ALWAYS active in FA, moving around in the draft and in trades. Howie likes to make a lot of noise in the offseason. I mean, who would have predicted last year’s offseason? Anyways, I did this for fun.... enjoy!
CB Nolan Carroll (1 year, 4mil) –For whatever reason, the Eagles are interested in bringing him back, Apparently, we’ve been negotiating with him a bunch… He’s a guy who the Eagles have paid, 2.7, 2.9 and 2mil over the past 3 seasons. We throw 4mil his way and he accepts.
EXTEND:DT Beau Allen(2 year, 3mil) – Allen has been solid as a backup DT, especially as a run stopper. With Bennie Logan leaving for more money, Allen will be relied on even more. We cheaply extend him for the next 2 years.
---------------
TRADES:
-The Eagles trade C Jason Kelce to the Browns for CB Joe Haden – reports were all over the place around the trade deadline that the Browns were shopping the often injured Joe Haden. The Browns are terrible at center, as once again Cam Erving played like a human turnstile (giving up 30 pressures). Which has been the case for Erving at tackle, guard and now center. While Haden has been injured a LOT in his career, he’s always around the football and gets his hands on a lot of balls (footballs). It doesn’t hurt Kelce’s value that he went to the pro bowl this past season. – (+roughly 8 mil to cap)
-The Eagles trade a 2017 2nd, 5th, and LB Mychal Kendricks to the New Orleans Saints for WR Brandin Cooks (I realize the compensation may seem low and I would be open to adding a 2018 pick). There was speculation in early December that due to the emergence of Michael Thomas and Willie Snead, how potent that offense is vs. how horrific that defense is, and Cooks voicing his displeasure over a decrease in targets – that they’d look to move him in the offseason. The Saints currently sit with only 5 draft picks in the 2017 draft. They also sit with the 11th lowest cap room, which isn’t that bad…. But, they have a bunch of role players hitting free agency, a defense that needs SERIOUS help and are going into the last year of Drew Brees’ contract. Kendricks is an upgrade over Dannell Ellerbe for sure. Keep in mind, the Saints traded Kenny Stills after a VERY good year for a 3rd round pick and… Dannell Ellerbe.
FA: WR Kenny Stills (4 year, 40mil) – We bring in Stills to reunite him with Brandin Cooks! That 2014 Saints team had the 3rd best passing offense in the NFL, with Stills seeing a career year in both catches and yardage. He’s only 24, has good speed and good hands. He’s the type of guy that Wentz (also 24) can grow with (also – Cooks is 23 as well)
-CB Marcus Cooper (3 year, 15mil) - Tall corner (6'2") on the #4 pass defense in the NFL. DP knows him well from their time in KC. He's only 27 years old. The Cardinals are sitting in the bottom half of cap space this offseason with a ton of free agents
-WLB Zach Brown (3 year, 15mil) – Brown is a tackling machine who put up 147 tackles, 4 sacks, 2FF, and an INT in Buffalo this past season. When healthy, Brown is a speedy LB who can be disruptive. He’s only 27 as well.
-SLB Gerald Hodges (3 year, 12mil) – Hodges is 26 and is from the area (born in Woodbury, and went to PSU). On a bad team, he still graded very highly (according to PFF) and put up 83 tackles, 3 sacks, 1 FF and 2 INTs. Doubling up on LB help may seem like overkill, but I feel like this is a big area of need for this team. Hodges has versatility as a 4-3 LB, having played all 3 positions in Minnesota. However, his best fit is likely at SLB and as a key reserve. With Nigel Bradham having 2 ongoing cases, suspension may still be possible (add to that, that this is his last season).
-DT Stacy McGee (2 year, 5mil) – McGee was a 9 game starter for the Raiders this past season and was a good pass rusher, putting up 2.5 sacks and 2FF in 221 attempts.
---------------
DRAFT (I realize that the top 3 picks could just as easily be late first rounders, I’m just going off where they typically are in mocks as of today)
TRADE: Once again, we go after the Browns. The Cleveland Browns decide to make a splash and go with three top-15 picks. They trade both their second rounders and a 4th to us for #15. Boooooo!!! Yells the hometown crowd. Why? The Browns currently have the youngest team in the NFL. After last year’s draft, where they drafted 14 players, they again have 13 picks this year (including 11 picks in the first 5 rounds)… to include a MASSIVE amount of money to spend in FA. They’re going to need to develop their young players and focus on consolidating some of those assets to get impact players. 3 top-15 picks is a good start. We make a move to jump up to the top of day 2.
2 : David Njoku – TE – Miami
This may not be a glaring need and will likely be followed by a lot of boo’s. But DP loves to run 2-TE sets. Njoku is a beast who is extremely athletic, breaks a ton of tackles (*pointing at you Ertz) and is a mismatch for most linebackers. Wentz leans heavily on his TE’s and we need an impact one who can break tackles.
TRADE: Howie, Howie, Howie! Sensing an opportunity, Howie offers a 3rd, two 4th rounders and WR Dorial Green-Beckum to the LA Rams for their 2nd rounder (#37). Why? The LA Rams have a total of 2 picks in the first 4 rounds (in the 2nd and 4th). And 5 total picks in this draft. The Rams sport the 30th ranked receiving corp… and 2 of their top 3 receivers (Britt and Quick) are set to be free agents.
2 : Tanoh Kpassagnon – DE – Nova
Tanoh has amazing size (6’7”, 280 pounds) to go with a quick first step and power. He’s raw, but has so much potential as he has the ability to kick inside on passing downs (which is nice to have with Bennie Logan leaving). Tahoh is a guy the Eagles talked to after Senior Bowl practices.
4 : Rasul Douglas – CB – WVU
Douglas is a 6’2”, 200 pound CB who has played extremely well for a wonky 3-3-5 Mountaineers defense that doesn’t really pass rush…. So he’s forced to cover for longer periods of time (ring any bells?). PFF has him on their 2nd team all American list. Questions over whether he’s a safety or corner push him down. But, I think he’s a corner and his playing weight is around 190.
6 : Ethan Cooper – G – Indiana-Pa
Again, we stay in our backyard and target a small school kid who is dominating. Scouts are apparently very high on Cooper, saying that he could be a diamond in the rough, based on his height/weight/speed profile (6’3”, 325). He also offers versatility, as he played LT at IUP, but will stick at guard in the pros. This may be a little low for Cooper… Walterfootball has him ranked as their 15th best guard… but over the past 4 years, the average is 15 guards get drafted.
7 : Riley Sorenson – C – Washington St.
Sorenson is a big upgrade in size over Jason Kelce. At 6’4”, 320 pounds, it’s close to a 35 pound difference.
SELF ANALYSIS
Strengths:
Massive upgrade/overhaul to the WR corp - While I realize that Stills and Cooks have similar skillsets, they have coexisted with a good possession receiver in the past (Colston, who Jordan Matthews is often compared to).
Upgrade at TE – Njoku offers Wentz an uber athletic TE who can break tackles.
Upgrade at DE – Kpass is an upgrade over Barwin
Upgrade/overhaul at CB – Haden (if healthy) is a big upgrade over Mckelvin. Carroll is a one year stopgap as Mills/Douglas develop.
Upgrades at WLB and LB depth
Negatives/unknowns:
Losing Bennie Logan hurts. I like McGee, Allen and Vaeao… However, this may be an area to address in next year’s draft.
Unknown if Kamara can give you (or better) the production of Ryan Mathews
LT is a huge concern next year (although, our LT is already on the roster in Lane – and RT is easier to find).
Now I might not agree with almost everything in said mock but that's why its a mock. Is this what you want Howie to do or something similar to what you expect him to do?
Thanks bud
I think he will definitely be uber active once again. He usually is. In trades, I looked at teams with their backs against the wall (cap space, not a lot of draft picks, problems on defense or wr, etc). We all know he's going to focus on upgrading wr and cb. I just wanted to give a mock that was different._________________Bird Watch: Jordan Hicks //Tackles: 85//Sacks: 1//INT: 5//PD: 11
I don't dislike it as much as it horribly unrealistic. Especially those trades.
Restructuring Chase Daniel is a terrible idea.
This time last year, what would you have thought about moving away from the Maxwell, Kiko and Demarcos contracts... Along with moving up to #2 for our franchise qb, trading Bradford for.a first, signing 7 free agents, trading Sanchez.... I'd argue that last year's actual offseason would've been called horribly unrealistic if posted as a mock prior.
I don't dislike it as much as it horribly unrealistic. Especially those trades.
Restructuring Chase Daniel is a terrible idea.
This time last year, what would you have thought about moving away from the Maxwell, Kiko and Demarcos contracts... Along with moving up to #2 for our franchise qb, trading Bradford for.a first, signing 7 free agents, trading Sanchez.... I'd argue that last year's actual offseason would've been called horribly unrealistic if posted as a mock prior.
Or 2015s offseason... Where we traded our all pro RB for Kiko Alonso. Traded Nick Foles for Sam Bradford. Brought in 5 free agents (including the number one RB and corner)
So your off- season strategy is relying on other teams to make Chip Kelly-like epically awful trades.......smart
Any GM that would trade Brandin Cooks straight up for Mychal Kendricks should not only be fired instantly but probably tarred and feathered._________________
BIRD WATCH: "WR" Nelson Agholor //36 REC//365 YARDS//2 TDS//2 stone hands//1 crippling boneheaded pentaly//1 deactivation//1 tremendous waste of a pick
I don't dislike it as much as it horribly unrealistic. Especially those trades.
Restructuring Chase Daniel is a terrible idea.
This time last year, what would you have thought about moving away from the Maxwell, Kiko and Demarcos contracts... Along with moving up to #2 for our franchise qb, trading Bradford for.a first, signing 7 free agents, trading Sanchez.... I'd argue that last year's actual offseason would've been called horribly unrealistic if posted as a mock prior.
Or 2015s offseason... Where we traded our all pro RB for Kiko Alonso. Traded Nick Foles for Sam Bradford. Brought in 5 free agents (including the number one RB and corner)
So your off- season strategy is relying on other teams to make Chip Kelly-like epically awful trades.......smart
Any GM that would trade Brandin Cooks straight up for Mychal Kendricks should not only be fired instantly but probably tarred and feathered.
OK, I'll say this .....
Propose your trades in the respective threads.
I'd like (you) to see some feedback.
The Daniel restructure is interesting.
The Johnson restructure is unlikely and stupid on his behalf.
The Barwin restructure is missing.
Re-signing Carroll is a mistake in my opinion.
Somehow, the Eagles trade for Marcus Cooper, but get what, Marcus Peters?
Do you know what you're really getting?
This makes a difference in your lack of attention to the single greatest weakness on the team.
I actually like trading down, given certain circumstances, however .....
You sign a career mediocre CB in FA and then don't draft one until the 4th._________________
OK, I'll say this .....
Propose your trades in the respective threads.
I'd like (you) to see some feedback.
The Daniel restructure is interesting.
The Johnson restructure is unlikely and stupid on his behalf.
The Barwin restructure is missing.
Re-signing Carroll is a mistake in my opinion.
Somehow, the Eagles trade for Marcus Cooper, but get what, Marcus Peters?
Do you know what you're really getting?
This makes a difference in your lack of attention to the single greatest weakness on the team.
I actually like trading down, given certain circumstances, however .....
You sign a career mediocre CB in FA and then don't draft one until the 4th.
I have no idea what the bolded part even means. We traded for Joe Haden.... And signed Cooper in FA.
I see what you're saying about Cooper being a meh option. He's not muuuch better than Carroll. It's just tough targeting 2nd tier CBs. Especially given the lack of FA dollars to go around. In hindsight, maybe I would've used one of the second rounders to go after a corner
Restructuring usually moves money from a base salary into a signing bonus. It's used to create cap room now at the expense of future caps_________________Bird Watch: Jordan Hicks //Tackles: 85//Sacks: 1//INT: 5//PD: 11
|
{
"pile_set_name": "Pile-CC"
}
|
1. Introduction {#sec1}
===============
Pregnane X receptor (PXR, encoded by *NR1I2* gene) is a member of the nuclear receptor (NR) superfamily, which includes the steroid, retinoid, and thyroid hormone receptors. PXR is the major xenobiotic receptor that coordinately regulates transcription of key phase I and II biotransformation enzymes, as well as some drug transporters, to detoxify and eliminate xenobiotics and endotoxins from the body. As a ligand-activated nuclear receptor, PXR triggers the transcription of various target genes, such as *CYP3A4* and *CYP2C9*, conjugation enzymes, such as *UGT1A1*, and transporters, such as *ABCB1*[@bib1], [@bib2], [@bib3]. In some cases, however, activation of PXR has been associated with downregulation of gene expression, as exemplified by the *OCT1* gene[@bib4]^,^[@bib5]. In addition to its canonical xenobiotic sensing function, PXR has many other cellular and physiological roles and has been implicated in glucose, lipid and bile acid metabolism, energy homeostasis, inflammatory response, cell proliferation, apoptosis, and cell migration[@bib1]^,^[@bib2]. PXR agonists include a broad spectrum of structurally diverse compounds, such as rifampicin, phenobarbital, SR-12813, and hyperforin, due to the large and considerably flexible ligand-binding domain (LBD) cavity of PXR[@bib3].
Although tremendous effort has been spent studying the function of PXR in both exogenous and endogenous metabolism, less is known about the exact mechanisms that are responsible for its regulation. *NR1I2* expression and transcriptional activity are coordinately regulated at the transcriptional, posttranscriptional, and posttranslational levels, and numerous signaling cascades have been implicated in modulating PXR activity[@bib6]^,^[@bib7]. As a consequence of this multifactorial regulation, human hepatic *NR1I2* mRNA is substantially variable in its expression[@bib8].
Recent *in silico* predictions identified a number of potential binding sites for other NRs within the human *NR1I2* gene proximal promoter (∼2.2 kb) suggesting hormonal or endobiotic regulation of PXR. Forced overexpression of estrogen receptor (ER), glucocorticoid receptor *α* (GR*α*), and peroxisome proliferator-activated receptor *α* (PPAR*α*) exert positive effects on *NR1I2* transcription, but PXR and constitutive androstane receptor (CAR) have negative effects on PXR expression in hepatic cells[@bib7]^,^[@bib9]. However, no putative binding sites for either PXR or CAR have been identified within the *NR1I2* promoter by detailed bioinformatic analysis[@bib9]. Glucocorticoids have been shown to regulate hepatic *NR1I2* expression, and the crosstalk between PXR and GR*α* has been reported in detail in primary human hepatocytes with dexamethasone at submicromolar concentrations[@bib10]^,^[@bib11]. Additionally, positive transactivation of *NR1I2* by HNF4*α* through the direct repeat 1 (DR1) element located in the --88 to --76 bp region or by PPAR*α via* a binding site located in the --1514 to --1321 bp region has been described[@bib9]^,^[@bib12]. Nevertheless, *NR1I2* mRNA expression does not correlate with PXR protein levels in the liver, which is an organ where *NR1I2* is abundantly expressed; this suggests that PXR is subject to posttranscriptional regulation[@bib13].
MicroRNAs (miRNAs) are small noncoding RNAs approximately 22 nt in length that are considered the principal posttranscriptional regulators[@bib14]. To date, more than 2600 mature human miRNAs have been annotated in the miRBase repository (v. 22.1, October 2018)[@bib15]. Primarily but not exclusively, miRNAs bind to responsive elements within the 3ʹ-untranslated region (3ʹ-UTR) of a target gene mRNA, resulting in degradation of the mRNA or translational repression. Interestingly, individual mRNAs can be targeted by many diverse miRNAs, leading to fine-tuning of gene expression. In contrast, specific miRNAs can simultaneously control the expression of many target mRNAs[@bib14]^,^[@bib16]. It is currently supposed that most human genes are under the control of miRNAs. Indeed, a growing body of evidence has also confirmed that miRNAs play a significant role in the regulation of genes involved in xenobiotic metabolism. In addition, drugs may regulate their pharmacokinetics and response *via* miRNAs, which is a topic that has been reviewed elsewhere[@bib17], [@bib18], [@bib19]. In line with this assumption, it has been demonstrated that miRNAs may interfere with *NR1I2* expression, as suggested for miR-18a-5p[@bib20], miR-148a[@bib13], miR-30c-1-3p[@bib21], miR-34a-5p[@bib8]^,^[@bib22], miR-449a[@bib22], and miR-140-3p[@bib23]. Importantly, negative regulation of *NR1I2* expression *via* miR-18a-5p by PXR ligands has been shown recently in LS180 cells[@bib20].
Since ligand-activated NRs are subjects of positive and negative regulation[@bib24] and keeping in mind the complexity of transcriptional and posttranscriptional regulation of *NR1I2* expression, we hypothesized for the first time in this work that miRNAs may be involved in a *NR1I2* autoregulatory feedback loop. To test this hypothesis, we analyzed changes in *NR1I2* expression after PXR activation, employing both primary human hepatocytes and mice. Furthermore, we evaluated the mechanisms underlying such changes with a focus on transcriptional and posttranscriptional regulation. Subsequently, we examined the impact of activated GR on posttranscriptional stabilization of *NR1I2* transcripts. By employing various constructs with the 3ʹ-UTR of *NR1I2* mRNA, we deciphered a key role for miRNA-18a-5p in PXR-mediated and GR-induced regulation of PXR expression through the full-length 3ʹ-UTR of the *NR1I2* gene.
2. Materials and methods {#sec2}
========================
2.1. Chemicals {#sec2.1}
--------------
Rifampicin (a prototypical ligand of the human PXR, Rif), SR-12813 (a human PXR ligand), and phenobarbital (PB) were purchased from Sigma--Aldrich (St. Louis, MO, USA). Dexamethasone (DEX) (a prototypical ligand of GR), RU486 (mifepristone, GR antagonist), DMSO (dimethyl sulfoxide), pregnenolone 16*α*-carbonitrile (PCN, an agonist of mouse PXR), hydrocortisone acetate, corticosterone, triamcinolone acetonide, and 6*α*-methylprednisolone were purchased from Sigma--Aldrich. Stock solutions (1000×) were prepared in DMSO prior to dilution in cell culture medium. The final concentration of DMSO in the media did not exceed 0.2% (*v*/*v*) in any experiments. SPA70, an PXR inhibitor, has been purchased from abcr GmbH Im (Karlsruhe, Germany)[@bib25].
miRCURY LNA microRNA mimics cel-miR-39-3p (mimic control, 479902-001), hsa-miR-18a-5p (471717-001), hsa-miR-148a-3p (339173 YM00472598-ADA), hsa-miR-34a-5p (339173 YM00473212-ADA), hsa-miR-449a (339173 YM00473262-ADA), and miRCURY LNA inhibitors, such as negative control A (inhibitor control, 199006-001), hsa-miR-18a-5p (4100723-001), and hsa-miR-34a-5p (339121 YI04100982-ADA), were obtained from Exiqon (now part of QIAGEN, Germantown, MD, USA).
2.2. Plasmids {#sec2.2}
-------------
The p3A4-luc plasmid bears a distal XREM (--7836/--7208) and a basal promoter sequence (prPXRE, --362/+53) from the *CYP3A4* gene promoter region. The pER6-3A4-tat-luc plasmid carries three copies of the proximal *CYP3A4* promoter ER6 response element cloned into the *NheI* and *BglII* sites of the pGL4.23 (Promega, Madison, WI, USA) upstream of the SV40 minimal promoter.
The pmiRGLO Dual-Luciferase miRNA target expression vector (Promega) is designed for an insertion miRNA target site downstream of the firefly luciferase gene. The pmiRGLO-UTR reporter plasmid, containing the 3ʹ-UTR of the *NR1I2* gene sequence (1--1273 nt downstream the coding region), was prepared by cloning the 3ʹ-UTR sequence into *XhoI* and *SaII* restriction sites of the pmiRGLO vector. The pmiRGLO-18a-5p-Compl construct was generated by insertion of a complementary sequence for miR-18a-5p (5ʹ-ctatctgcactagatgcacctta-3ʹ) into *XhoI* and *SaII* restriction sites of the pmiRGLO vector. The pmiRGLO-MRE-1041-1064 (5ʹ-aagaaccatttacatgcacctta-3ʹ), pmiRGLO-MRE-1041-1064-REV, and pmiRGLO-MRE-69-91 (5ʹ-gccaagacagatggacactgcca-3ʹ) constructs contain either a putative responsive element for miR-18a-5p (1041-1064 nt from the stop codon), a reverse sequence of the putative responsive element for miR-18a-5p, or a putative shared responsive sequence of the 3ʹ-UTR of the *NR1I2* gene for miR-34a-5p and miR-449a (69-91 nt from the stop codon) in the pmiRGLO vector. All constructed vectors were sequence verified.
pMIR-luc-control (LR-1000) and pMIR-luc-34a-5p-Compl (LR-0014) constructs carrying a complementary binding site for miR-34a-5p were purchased from BioCat (Heidelberg, Germany).
pPXR1-Gluc or pPXR2-Gluc reporter vectors (HPRM45199-PG04 and HPRM23633-PG04) with secreted *Gaussia* luciferase (Gluc) were purchased from GeneCopoeia (Rockville, MD, USA) together with a luciferase detection kit. pPXR1-Gluc contains a sequence from --1375 to +238 and pPXR2-Gluc sequence from --1147 to +238 of the promoter region upstream of the human *NR1I2* gene. The sequence from --1375 to --1147 (228 nt) in pPXR1-Gluc, but not in pPXR2-Gluc, contains putative response elements for HNF4*α*, PPAR*α*, Sp1 and NF-*κ*B transcription factors[@bib9] (see schematic in [Fig. 3](#fig3){ref-type="fig"}A). Both reporter constructs contain cDNA for secreted alkaline phosphatase (SEAP) as an internal control for transfection normalization.Figure 1Ligand-dependent activation of PXR downregulates *NR1I2* expression in primary human hepatocytes. *NR1I2* mRNA (A) or *CYP3A4* mRNA (B) expression in primary human hepatocytes (donor Liv13) treated with vehicle (DMSO; 0.1%, *v*/*v*) or rifampicin (Rif, 10 μmol/L) for 12, 24, and 48 h, respectively. The expression data were normalized to the *RPLP0* reference gene, and data are expressed as relative change to corresponding control (DMSO-treated) experiments defined as 100%. (C) Western blotting analysis of PXR, CYP3A4 and RXR*α* expression in primary human hepatocytes (Liv13) treated with vehicle (DMSO; 0.1%) or Rif (10 μmol/L) for 24 or 48 h. *β*-Actin was used as a loading control. (D) *NR1I2* mRNA and (E) *CYP3A4* mRNA expression. Primary human hepatocytes (Liv1--13) and commercial (Liv14) human hepatocyte cultures were treated with vehicle (DMSO; 0.1%), Rif (10 or 5 μmol/L), SR-12813 (3 μmol/L) or phenobarbital (500 μmol/L) for 24 h. The data are presented as fold change in expression after PXR ligand treatment *versus* vehicle (DMSO)-treated controls defined as 1. Nonparametric Wilcoxon matched-pairs tests or paired *t* test were used to statistically compare paired expression data between control and PXR ligand-treated samples in human hepatocytes. \**P* \< 0.05, statistically significant effect of PXR ligand (paired *t* test, *P*-value in parentheses).Figure 1Figure 2PCN-mediated activation of mouse PXR affects *Nr1i2* expression in mouse liver. Mouse PXR (A) or CYP3A11 (B) mRNA expression in mice that were administered a single i.p. injection of vehicle or PCN (50 mg/kg) and sacrificed after 3, 6, 24, 48, 72, or 168 h postapplication. In addition, liver sample homogenates were analyzed for mouse PXR (C) and CYP3A11 (D) protein expression employing Western blotting. *Gapdh* was used as a reference gene for RT-qPCR expression data normalization, and *β*-actin was used for Western blotting data normalization. The data are shown as the mean ± SD (*n* = 5 per group) and are expressed as change relative to vehicle-treated control samples defined as 100%. Mann--Whitney test was used to compare unpaired data in mice. \**P* \< 0.05, ^\*\*^*P* \< 0.01, and ^\*\*\*^*P* \< 0.001 indicate a statistically significant effect of PCN treatment.Figure 2Figure 3Implication of the *NR1I2* promoter region and 3ʹ-UTR in PXR regulation. (A) Scheme depicting the *NR1I2* gene with its regulatory regions. Suggested or confirmed transcription binding sites within the promoter region are shown as green and red boxes, respectively[@bib9]^,^[@bib12]. A schematic overview of reporter plasmids alignment under the scheme. The numbers indicate nucleotide positions either in the promoter region or in mRNA of the *NR1I2* gene. (B) HepG2 cells were transiently transfected with either the pPXR1-Gluc or pPXR2-Gluc *Gaussia* luciferase reporter construct (150 ng/well) concomitantly with the pSG5-RXR*α* expression vector (50 ng) and with either pSG5-PXR, pSG5-T248D or pSG5 (empty) control vector (100 ng). The next day, the medium was changed and after 24 h, *Gaussia* luciferase and SEAP activities were assessed. The results are presented as relative change in SEAP-normalized *Gaussia* luciferase activities to control experiments cotransfected with empty pSG5 vector (100%). The data are shown as the mean ± SD (*n* = 3). (C) HepG2 cells were transiently transfected with either pmiRGLO-UTR or pmiRGLO (empty) vector (50 ng) together with either pSG5-PXR expression vector or pSG5 (empty) control vector (100 ng). The next day, cells were treated with rifampicin (Rif, 10 μmol/L), SPA70 (a PXR antagonist, 10 μmol/L) or vehicle (DMSO; 0.1%) for 24 h. Samples were subsequently analyzed by Dual-Luciferase Reporter Assay System. Firefly luciferase activities were normalized to *Renilla* luciferase activities and further normalized to the corresponding data obtained from experiments with the empty pmiRGLO vector. The data are shown as the mean ± SD (*n* = 3) and are expressed as relative change to DMSO-treated controls cotransfected with the empty pSG5 vector defined as 100%. \**P* \< 0.05 or indicates a statistically significant effect of PXR activation compared to empty pSG5 vector-transfected controls or to rifampicin-treated pSG-PXR cells; ^\*\*^*P* \< 0.01 indicates a statistically significant suppression of pmiRGLO-UTR vector activity; N.S. indicates a statistically insignificant effect.Figure 3
The expression plasmid for human PXR receptor pSG5-hPXRΔATG (further abbreviated as pSG5-PXR) was kindly provided by Dr. S. Kliewer (University of Texas, Dallas, TX, USA). The constitutively active T248D mutant of PXR was described in our previous work[@bib26]. The pSG5-PXR-UTR expression vector, including both open reading frames encoding human wild-type PXR and the 3ʹ-UTR of the *NR1I2* gene mRNA, was constructed by insertion of the 3ʹ-UTR region into the *BamHI* restriction site downstream of the cDNA for PXR. Orientation of the 3ʹ-UTR insert in pSG5-PXR-UTR was verified by sequencing. The expression plasmid encoding human GR*α* (pSG5-hGR*α*) was a generous gift from Dr. J. Palvimo (University of Helsinki, Helsinki, Finland), and the pSG5-RXR*α* construct came from Dr. C. Carlberg (University of Kuopio, Kuopio, Finland). pRL-TK was acquired from Promega. The empty expression vector pSG5 was obtained from Agilent (Santa Clara, CA, USA).
2.3. Cell lines {#sec2.3}
---------------
Human hepatoblastoma-derived (HepG2), human hepatocellular carcinoma (Huh-7), and African green monkey kidney-derived (COS-1) cells were obtained from the European Collection of Authenticated Cell Cultures (ECACC) and cultured in antibiotic-free Dulbecco\'s modified Eagle\'s medium (DMEM, 10569010, Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS, F2442, Sigma--Aldrich) at 37 °C in a humidified incubator under 5% CO~2~.
2.4. Primary human hepatocytes {#sec2.4}
------------------------------
Primary human hepatocytes (PHHs) were provided by QPS Hepatic Biosciences (Barcelona, Spain) or were isolated, as described previously[@bib27], from donor organs unsuitable for transplantation or from liver resections performed in adult patients for medical reasons unrelated to our research program (only noncancerous liver tissue was collected). Liver samples were obtained from the Biological Resource Centre of Montpellier University Hospital (CRB-CHUM; [http://www.chu-montpellier.fr](http://www.chu-montpellier.fr/){#intref0010}; Biobank ID: BB-0033-00031), and this study benefitted from the expertise of Dr. Jeanne Ramos (hepatogastroenterology sample collection) and Prof. Sylvain Lehmann (CRB-CHUM manager). Patient clinical characteristics are presented in [Table 1](#tbl1){ref-type="table"}. The procedures were approved by the French Ethics Committee, and written or oral consent was obtained from all patients or their families.Table 1Donor information and culture conditions of isolated primary human hepatocytes.Table 1LiverOriginAge (years)SexCulture mediumPathologyLiv1QPS61MISOMCholangiocarcinomaLiv2Resection52FHGMCyst adenomaLiv3QPS66FISOMColorectal cancerLiv4Resection70FHGMCholangiocarcinomaLiv5Donor73MHGMStrokeLiv6Resection76MISOM, HGMMetastasis from colon cancerLiv7Resection70MISOMMetastasis from colon cancerLiv8Resection46FISOMCholangiocarcinomaLiv9Resection64MISOMHepatocellular carcinomaLiv10Resection46MLNFAngiomaLiv11Resection62MLNFMetastasis from colon cancerLiv12Resection70MLNFMetastasis of GISTLiv13Resection80FISOMMetastasis of colon cancer
Primary human hepatocytes were seeded at 1.5 × 10^5^ cells/cm^2^ in collagen-coated plates and cultured in a 5% CO~2~ humidified atmosphere at 37 °C in serum-free long-term (Lanford medium, LNF) or short-term (ISOM medium) culture medium[@bib27] or hepatocyte growth medium (HGM: WME medium supplemented with 5 μg/mL insulin, 0.1 μmol/L hydrocortisone, 10 μg/mL transferrin, 250 μg/mL ascorbic acid, 3.75 mg/mL fatty acid-free bovine serum albumin, 2 mmol/L glutamine, penicillin and streptomycin). Primary human hepatocytes were incubated with rifampicin (Rif, 5 or 10 μmol/L), SR-12813 (3 μmol/L) or phenobarbital (500 μmol/L) for 24 or 48 h two days postseeding.
Information about the 13 donors of freshly isolated Primary human hepatocytes is shown. Details are included for each donor regarding age, sex, and pathology. Additionally, origin and cultivation medium are indicated for each individual culture of Primary human hepatocytes. Gender: M (male), F (female). ISOM medium[@bib28]; HGM, hepatocyte growth medium; LNF, Lanford medium.
2.5. Commercial human hepatocytes {#sec2.5}
---------------------------------
Commercial primary human hepatocytes (HEP220A0, Long-term human hepatocytes, batch Hep220980-MA96, a sample Liv14) were purchased from Biopredic International (Saint Gregoire, France). Prior to treatment, commercial Primary human hepatocytes were cultivated in a serum-free medium composed of basal hepatic cell medium (Biopredic, MIL600C, batch MIL600052) and additives for hepatocyte culture medium (Biopredic, ADD222C, batch ADD222039) overnight at 37 °C in a humidified incubator with 5% CO~2~.
2.6. Animal experiments {#sec2.6}
-----------------------
Twelve-week-old male C57/BL6 mice (Velaz, Czech Republic) were housed in a temperature- and light-controlled facility with 12 h light--dark cycling. All mice were fed commercially available laboratory chow diet (Velaz) *ad libitum*. Mice were randomly divided into 12 groups consisting of 5 animals each and were all administered either a single i.p. injection of mouse PXR ligand pregnenolone 16*α*-carbonitrile (PCN, 50 mg/kg) dissolved in corn oil plus 30% DMSO or vehicle (olive oil plus 30% DMSO).
Individual groups of mice were then sacrificed by exsanguination under general anesthesia induced by isoflurane after 3, 6, 24, 48, 72, or 168 h postadministration of vehicle or PCN. Livers were immediately weighted, frozen in liquid nitrogen and subsequently stored at −80 °C until Western blot and RT-qPCR analysis. All animals received humane care in accordance with the EU Directive 2010/63/EU and guidelines for animal experiments set by the Institutional Animal Use and Care Committee of Charles University, Faculty of Medicine in Hradec Kralove, Czech Republic. The protocol for all experiments was approved by the same committee.
2.7. Luciferase reporter gene assays {#sec2.7}
------------------------------------
All reporter gene assays were performed in HepG2, Huh-7 or COS-1 cells using Lipofectamine 3000 Reagent (Thermo Fisher Scientific) following the manufacturer\'s protocol, as described previously[@bib4]^,^[@bib29]^,^[@bib30]. Briefly, cells were seeded into 48-well plates overnight and transfected with different luciferase reporter constructs either alone or in combination with appropriate expression plasmids, miRNA mimics or miRNA inhibitors at indicated concentrations. If necessary, an equivalent amount of an empty plasmid, such as pmiRGLO, pMIR-luc-control, or pSG5, was transfected into the cells to maintain equal quantities of DNA in respective controls. After stabilization, cells were, if needed, further treated with PXR or GR ligands at indicated times and concentrations. Compounds were diluted in Opti-MEM I Reduced Serum Medium (11058021, Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 5% FBS. Then, cells were lysed and measured for both firefly and *Renilla* luciferase activities by a plate reader, Synergy2 (BioTek, Winooski, VT, USA), employing a Dual-Luciferase Reporter Assay System (Promega). Firefly luciferase activities were normalized to *Renilla* luciferase activities to reduce variability in transfection efficiency. Since the pmiRGLO vector contains a *Renilla* luciferase coding sequence for transfection normalization, cotransfection with pRL-TK was performed only in experiments with different reporter vectors than those with pmiRGLO. In the indicated cases, measured firefly luciferase activities were double normalized according to the published protocol to eliminate the background effect of tested ligand or miRNA reagent on activity of the empty parent vector[@bib31]. According to this procedure, the *Renilla*-normalized firefly luciferase activities obtained from different reporter vectors were further normalized to the corresponding data that were obtained under identical conditions with control (empty) reporter vectors. The results are presented as the relative change or fold change in normalized firefly luciferase activities to the control activities (defined as 100% or 1). The data are presented as the mean ± SD acquired from biological replicates performed in at least technical triplicates (*n* ≥ 3).
2.8. Dual secreted Gaussia luciferase and SEAP reporter assays {#sec2.8}
--------------------------------------------------------------
HepG2 cells were seeded into 48-well plates and transiently transfected with a reporter gene construct (either pPXR1-Gluc or pPXR2-Gluc) together with expression vectors using Lipofectamine 3000 Reagent (Thermo Fisher Scientific, Waltham, MA, USA). The next day, the medium was changed based on the experimental setting to either conditioned or nonconditioned Opti-MEM I Reduced Serum Medium supplemented with 5% FBS. After 24 h, medium was analyzed for activities of both SEAP, with Ready-To-Glow Secreted Luciferase Reporter Systems (Clontech, Palo Alto, CA, USA), and *Gaussia* luciferase, with Secrete-Pair *Gaussia* Luciferase Assay Kit (GeneCopoeia, Rockville, MD) and GL-S buffer for more stable activity. The *Gaussia* luciferase and SEAP signals were detected by the plate reader Synergy2 (BioTek, Winooski, VT), and *Gaussia* luciferase activities were normalized to SEAP activities. The data are presented as the relative change in normalized *Gaussia* luciferase activities to control activities, which were defined as 100%. The data are presented as the mean ± SD (*n* = 3).
2.9. RT-qPCR analysis {#sec2.9}
---------------------
HepG2 or Huh-7 cells seeded onto 12-well plates were transfected with expression plasmids and, if needed, further treated with PXR or GR ligands at indicated times and concentrations. Primary human hepatocytes (Liv14) were treated with Rif (10 μmol/L) for 24 h. RT-qPCR analyses (performed at the Faculty of Pharmacy, Charles University) were performed as described previously with gene specific assays for *CYP3A4* (hCYP3A4_Q2), hypoxanthine phosphoribosyltransferase (*HPRT*, 3033-F), glyceraldehyde-3-phosphate dehydrogenase (*GAPDH*, 3058-F) and *NR1I2* (hNR1I2_Q8) (Generi Biotech, Hradec Kralove, Czech Republic)[@bib4]^,^[@bib29]. The results are presented as fold or relative change in gene expression compared to corresponding controls (defined as 1 or 100%). The data are presented as the mean ± SD (*n* = 3).
For mouse experiments (performed at the Medical Faculty, Charles University), total RNA from liver samples was isolated using TRI reagent (Sigma--Aldrich), converted into cDNA by High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, Waltham, MA, USA) and subsequently analyzed on a QuantStudio 7.0 PCR machine (Thermo Fisher Scientific) by using TaqMan Fast Universal PCR Master Mix and TaqMan Gene Expression Assays for detection of *Nr1i2* (Mm01344139_m1) or *Cyp3a11* (Mm00731567_m1) mRNA (Thermo Fisher Scientific). The results were calculated using threshold cycle values and normalized to *Gapdh* mRNA levels. The results are presented as relative change in gene expression compared to corresponding controls. The data are presented as the mean ± SD acquired from five biological samples per group.
RT-qPCR experiments (performed at INSERM) with Primary human hepatocytes were performed after total RNA extraction with TRIzol Reagent and reverse transcription of 500 ng total RNA using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific). qPCR was performed using the Roche SYBR Green reagent and a LightCycler 480 apparatus (Roche Diagnostics, Meylan, France) with the following program: one step at 95 °C for 10 min followed by 50 cycles of denaturation at 95 °C for 10 s, annealing at 65 °C for 15 s, and elongation at 72 °C for 15 s. Primer sequences are listed in [Table 2](#tbl2){ref-type="table"}. Relative quantification was performed delta-delta method and accounting for reaction efficiencies. C~t~ values of genes of interest were normalized to C~t~ values for the reference gene *RPLP0* (Liv3-13) or *GAPDH* (Liv1-2). The results are presented as relative change in gene expression compared to vehicle control (DMSO), which was defined as 1. The data are shown as the mean±SD obtained from biological samples. RTs were run in biological duplicates, and qPCR reactions were run in technical duplicates.Table 2Primer sequences for RT-qPCR with SYBR green chemistry.Table 2GeneForward primerReverse primer*CYP3A4*GCCTGGTGCTCCTCTATCTAGGTGTTGACCATCATAAAG*NR1I2*GGACCAGCTGCAGGAGCAATCATGAGGGGCGTAGCAAAGG*RPLP0*TCGACAATGGCAGCATCTACGCCTTGACCTTTTCAGCAAG*GAPDH*GGTCGGAGTCAACGGATTTGGTCGCAAAGTTGTCATGGATGACC
2.10. Expression analysis of miRNAs {#sec2.10}
-----------------------------------
HepG2 cells that were seeded into 12-well plates were transfected with miRNA inhibitor (50 ng)/mimic (25 ng) reagents or pSG5-PXR expression vector (400 ng) for 24 or 48 h. If needed, the cells were further treated with Rif (10 μmol/L) at the indicated times. Total RNA was isolated with spin column chromatography using a miRCURY RNA Isolation Kit (Cell & Plant; now part of QIAGEN, Germantown, MD, USA). Concentration and purity of total RNA were determined by a NanoDrop spectrophotometer (Thermo Fisher Scientific). Total RNA was reverse-transcribed to miR-18a-5p specific cDNA using the TaqMan MicroRNA Reverse Transcription Kit (Thermo Fisher Scientific) at 16 °C for 30 min followed by incubation at 42 °C for 30 min with subsequent 85 °C for 5 min. cDNA samples were subsequently analyzed with TaqMan assays for miR-18a-5p (Assay ID 002422) and U6 snRNA (Assay ID 001973) using a TaqMan Fast Advanced Master Mix on the StepOnePlus Real-Time PCR System (all Thermo Fisher Scientific). The C~t~ values for miR-18a-5p were normalized to the C~t~ values of the reference gene *U6*. The results are presented as fold or relative change in gene expression compared to corresponding controls (defined as 1 or 100%). The data are shown as the mean±SD acquired from biological replicates performed in technical triplicates (*n* = 3).
2.11. miRNA expression profiling {#sec2.11}
--------------------------------
Huh-7 cells were seeded into 12-well plates and transfected with pSG5-GR*α* (600 ng per well) overnight followed by treatment with DMSO (0.1%, *v*/*v*) or DEX (100 nmol/L) for 24 h. Cells were lysed in QIAzol Lysis Reagent (QIAGEN, Germantown, MD, USA), and total RNA, enriched for small RNAs, was isolated using the miRNeasy Mini Kit (QIAGEN, Germantown, MD, USA). MiRNA expression profiling of 754 miRNAs was performed using TaqMan Array Human MicroRNA Card Set v3.0 (Thermo Fisher Scientific). All procedures followed standard manufacturers\' recommendations. Briefly, total RNA (100 ng) was reverse-transcribed into cDNA using TaqMan MicroRNA Reverse Transcription Kit together with Megaplex RT Primers (Thermo Fisher Scientific). cDNA samples were further analyzed on the 7900HT Real-Time PCR System (Thermo Fisher Scientific) using TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific). Raw data were processed using SDS software version 2.4 (Thermo Fisher Scientific). The primary data were further processed using ExpressionSuite Software v1.1 (Thermo Fisher Scientific). The relative quantification was performed by delta-delta method assuming a PCR efficiency of 100%. *RNU48* was determined to be the most stable reference gene and was thus used for normalization of miRNA expression levels. The results are presented as relative change in miRNA expression compared to DMSO control of a representative experiment. Experiments have been repeated with the same results.
2.12. Western blotting assays {#sec2.12}
-----------------------------
Western blotting experiments were performed using SDS-PAGE electrophoresis for total protein fractions of mouse liver samples as described elsewhere[@bib32]. Primary antibodies used for detection were anti-PXR (PA5-41170) and anti-CYP3A11 (PA1-343, Thermo Fisher Scientific). Protein band intensity on PVDF membranes was quantified using Quantity One imaging software (Bio-Rad, Hercules, CA, USA). Protein expression was normalized to expression of *β*-actin (A5316, Sigma--Aldrich). The results are presented as relative change in protein expression compared to corresponding controls in the same interval after PCN application. The data are shown as the mean ± SD acquired from five biological samples per group. For Western blotting experiments with primary human hepatocytes and cancer cell lines lysates, *β*-actin (A5316, Sigma--Aldrich), PXR (PA5-41170, Thermo Fisher Scientific), CYP3A4 (PA1-343, Thermo Fisher Scientific), and RXR*α* (5388, Cell Signaling Technology, Danvers, MA, USA) primary antibodies were used.
2.13. Statistical analysis {#sec2.13}
--------------------------
Statistical analyses were performed using GraphPad PRISM 7 software (GraphPad Software Inc., San Diego, CA, USA). Differences between groups were compared using Student\'s paired two-tailed *t* test. One-way analysis of variance (ANOVA) with Dunnett\'s test was applied to the data if more than two groups were analyzed. Nonparametric Wilcoxon matched-pairs tests and parametric paired *t* test were used to statistically compare paired expression data between control and PXR ligand-treated samples in human hepatocytes. Nonparametric Mann--Whitney test was used to compare unpaired data in mice.
3. Results {#sec3}
==========
3.1. PXR ligands downregulate PXR expression in human hepatocytes {#sec3.1}
-----------------------------------------------------------------
It has been shown that feed-back regulation is a common phenomenon among nuclear receptors[@bib24]. Therefore, in our preliminary experiment, we explored whether treatment with a model PXR ligand, rifampicin, resulted in pronounced downregulation of *NR1I2* transcripts in one culture of Primary human hepatocytes (Liv13). We observed a time-dependent effect of rifampicin on *NR1I2* gene mRNA expression ([Fig. 1](#fig1){ref-type="fig"}A). Correspondingly, rifampicin induced expression of *CYP3A4*, the dominant PXR target gene, in the same hepatocyte culture ([Fig. 1](#fig1){ref-type="fig"}B). At the protein level, CYP3A4 was consistently upregulated by rifampicin at both 24 and 48 h intervals, however, PXR was apparently downregulated after 24 h treatment but not after 48 h. Expression of the PXR heterodimerzation partner, RXR*α*, was not affected by rifampicin treatment ([Fig. 1](#fig1){ref-type="fig"}C). In a follow-up study with PHH cultures, we confirmed that rifampicin (10 μmol/L) (*P* = 0.001) and another PXR activator, SR-12813 (3 μmol/L) (*P* = 0.022, paired *t* test), significantly suppress *NR1I2* mRNA expression 24 h after treatment ([Fig. 1](#fig1){ref-type="fig"}D), but the expression of *CYP3A4* mRNA was significantly upregulated in cultures of human hepatocytes ([Fig. 1](#fig1){ref-type="fig"}E). Phenobarbital (500 μmol/L) also significantly upregulated CYP3A4 mRNA expression even though the expression of *NR1I2* mRNA was not significantly affected in six hepatocyte cultures ([Fig. 1](#fig1){ref-type="fig"}D and E). The expression of both genes was highly variable among liver donors, reflecting known interindividual variability in hepatic *NR1I2* expression. The genetic variation in 3′UTR may also contribute to the variability.
3.2. PCN significantly downregulates mouse PXR in mice livers {#sec3.2}
-------------------------------------------------------------
A similar pattern of PXR expression was demonstrated in mice administered a single dose of PCN, the agonist of mouse PXR. Decreased expression of *Nr1i2* gene mRNA was observed 24 h after PCN exposure but was preceded by upregulation of *Nr1i2* transcript at 6 h ([Fig. 2](#fig2){ref-type="fig"}A). As expected, the prototypical murine PXR target gene *Cyp3a11* was significantly upregulated in response to PCN in murine livers ([Fig. 2](#fig2){ref-type="fig"}B). In agreement with these findings, the protein levels of PXR were significantly decreased at early intervals after PCN administration ([Fig. 2](#fig2){ref-type="fig"}C), but CYP3A11 protein was increased after 24, 72, and 168 h post-PCN application ([Fig. 2](#fig2){ref-type="fig"}D).
Herein, we can conclude that activation of PXR or its murine orthologue leads to time-dependent downregulation of *NR1I2* expression, which indicates feedback regulation of PXR.
3.3. Confirmation of NR1I2 promoter region and 3′-UTR in PXR regulation {#sec3.3}
-----------------------------------------------------------------------
To further examine PXR regulation, we used several luciferase reporter gene vectors with different promoter regions or the full-length 3ʹ-UTR sequence of *NR1I2* gene mRNA ([Fig. 3](#fig3){ref-type="fig"}A). Our findings revealed that forced overexpression of PXR itself led to decreased activity of the pPXR1-Gluc vector bearing the promoter sequence from --1375 to +238 upstream of the human *NR1I2* gene. Similar findings were shown for the mutant T248D, which produces a constitutively active form of PXR[@bib26] ([Fig. 3](#fig3){ref-type="fig"}B). The activity of the pPXR2-Gluc reporter vector bearing a shorter promoter region (--1147 to +238) of the *NR1I2* gene was statistically significantly downregulated with wild-type PXR construct. The sequence from --1375 to --1147 (228 nt) in pPXR1-Gluc, but not in pPXR2-Gluc, containing numerous putative response elements for HNF4*α*, PPAR*α*, Sp1 and NF-*κ*B transcription factors[@bib9] (see schematic in [Fig. 3](#fig3){ref-type="fig"}A) thus does not seem to be important for the regulation although further detail experiments are needed. In subsequent experiments, we proved that the pmiRGLO-UTR construct harboring the 3ʹ-UTR of the *NR1I2* mRNA was inhibited by PXR overexpression in HepG2 cells ([Fig. 3](#fig3){ref-type="fig"}C). Rifampicin treatment had no further significant effect on the observed inhibition. However, we observed significantly different activation of pmiRGLO-UTR after treatment with rifampicin, an agonist of PXR, or SPA70, a PXR antagonist ([Fig. 3](#fig3){ref-type="fig"}C). We thus suppose that ectopic PXR may be activated by endogenous ligands in HepG2 cells and that the activation can be abrogated by PXR antagonist SPA70.
These data demonstrate that both promoter and 3ʹ-UTR regions of the *NR1I2* mRNA are important for PXR feed-back regulation ([Fig. 3](#fig3){ref-type="fig"}A).
3.4. The 3ʹ-UTR of NR1I2 mRNA is involved in the suppression of PXR expression and the reduction of rifampicin-mediated upregulation of CYP3A4 {#sec3.4}
----------------------------------------------------------------------------------------------------------------------------------------------
It is widely recognized that miRNAs predominantly bind to responsive elements within the 3ʹ-UTR of their target genes. Therefore, to address whether cellular miRNAs may affect the posttranscriptional regulation of PXR, HepG2 cells were transfected with either pmiRGLO (empty) or pmiRGLO-UTR vector. Detected luciferase activity was higher in cells transfected with the control empty vector (pmiRGLO) compared to cells transfected with the luciferase reporter construct bearing the 3ʹ-UTR of the *NR1I2* gene mRNA ([Fig. 4](#fig4){ref-type="fig"}A). Consistently, transfection with the PXR expression vector harboring the 3ʹ-UTR resulted in lower PXR expression at both the mRNA and protein levels in HepG2 cells ([Fig. 4](#fig4){ref-type="fig"}B and C). The same trend was also observed in undifferentiated Huh-7 cells, which are a near PXR-null cellular model ([Supporting Information Figs. S1A--C](#appsec3){ref-type="sec"}). Taken together, it is plausible that some miRNAs in hepatic cell lines may cause general repressive effects on the 3ʹ-UTR of *NR1I2* mRNA.Figure 4The 3ʹ-UTR is involved in downregulation of PXR expression and decreased rifampicin-mediated upregulation of CYP3A4. (A) HepG2 cells were transiently transfected with either pmiRGLO-UTR or empty pmiRGLO vector (50 ng). After 48 h, the samples were analyzed by the Dual-Luciferase Reporter Assay kit. Firefly luciferase activities were normalized to *Renilla* luciferase activities. The data are shown as the mean ± SD (*n* = 3) and are expressed as relative change to an empty pmiRGLO vector defined as 100%. HepG2 cells were transiently transfected with either pSG5-PXR or pSG5-PXR-UTR vector (200 ng) and cotransfected with pSG5-RXR*α* (200 ng) for 24 h. After another 24 or 48 h in fresh medium, total RNA was isolated and analyzed for basal levels of *NR1I2* mRNA by RT-qPCR (B) or for PXR protein expression (C). The *HPRT* reference gene-normalized data are shown as the mean ± SD (*n* = 3) and are expressed as relative change to values gained from pSG5-PXR/pSG5-RXR*α* experiments (100%). Cell lysates were analyzed for expression of PXR protein by Western blotting. *β*-Actin was used as a loading control. Representative Western blotting results are shown. (D) HepG2 cells were transiently transfected with either pSG5-PXR or pSG5-PXR-UTR vector (200 ng) and cotransfected with pSG5-RXR*α* (200 ng). The next day, cells were treated with rifampicin (Rif, 10 μmol/L) for 24 h. Total RNA was isolated and analyzed for induction of *CYP3A4* mRNA by RT-qPCR. The *HPRT* reference gene-normalized data are shown as the mean ± SD (*n* = 3) and are expressed as fold change compared to vehicle-treated controls (defined as 1). (E) COS-1 cells were transiently transfected with a *CYP3A4* promoter luciferase reporter vector (p3A4-luc, 150 ng), pRL-TK (30 ng), and pSG5-RXR*α* (50 ng) together with either pSG5-PXR, pSG5-PXR-UTR or empty pSG5 vector (50 ng). The next day, cells were treated with rifampicin (Rif, 10 μmol/L) or vehicle (DMSO; 0.1%) for another 24 h. Then, samples were analyzed using a Dual-Luciferase Reporter Assay. Firefly luciferase activities were normalized to *Renilla* activities. The data are shown as the mean ± SD (*n* = 3) and are expressed as fold change compared to respective DMSO-treated controls. (F) COS-1 cells were transiently transfected with either a pSG5-PXR or pSG5-PXR-UTR construct (200 ng) and cotransfected with pSG5-RXR*α* (200 ng). The next day, cells were treated with vehicle (DMSO; 0.1%) or rifampicin (Rif, 10 μmol/L) for 48 h. Samples were analyzed for expression of PXR protein by Western blotting. *β*-Actin was used as a loading control. Representative Western blotting results are shown. \**P* \< 0.05, ^\*\*^*P* \< 0.01 indicate statistically significant effects of the 3ʹ-UTR region of *NR1I2* mRNA. (G). Schematic overview showing sequence complementarity between particular miRNAs and *in silico* predicted or experimentally confirmed miRNA-response elements (MREs) within the 3ʹ-UTR of human *NR1I2* mRNA. Green letters depict seed regions of miRNAs. Blue letters refer to sequences within MREs complementary to miRNA seed regions. Numbers above sequences indicate a position of nucleotides downstream from the coding region of *NR1I2* mRNA.Figure 4
Next, we investigated whether this suppressive effect may affect the inducibility of the PXR target gene *CYP3A4* in HepG2 and COS-1 cells. Indeed, rifampicin-mediated upregulation of *CYP3A4* mRNA was mildly decreased in cells transfected with pSG5-PXR-UTR relative to cells transfected with the pSG5-PXR vector ([Fig. 4](#fig4){ref-type="fig"}D). This difference was also pronounced in the *CYP3A4* promoter luciferase reporter gene assay using COS-1 cells ([Fig. 4](#fig4){ref-type="fig"}E). Of particular interest, rifampicin enhanced the suppressive role of the 3ʹ-UTR on PXR protein expression in COS-1 cells transfected with pSG5-PXR-UTR. However, rifampicin did not affect PXR protein expression in COS-1 cells transfected with pSG5-PXR ([Fig. 4](#fig4){ref-type="fig"}F). For this reason, we can assume that rifampicin-induced changes in the cellular miRNA expression profile may result in the suppression of *NR1I2* expression through its 3ʹ-UTR region of *NR1I2* mRNA.
3.5. MiR-18a-5p is a relevant regulator of NR1I2 expression and transcriptional activity {#sec3.5}
----------------------------------------------------------------------------------------
To reveal which miRNAs might be implicated in rifampicin-induced *NR1I2* mRNA destabilization *via* its full-length 3ʹ-UTR, we first screened the effect of a set of miRNA mimics on the pmiRGLO-UTR luciferase reporter vector. The tested miRNAs were selected based on previous literature reports and on our recent bioinformatics study[@bib33]. An overview of sequence complementarity between candidate miRNAs and their putative miRNA-response elements (MREs) within 1273-bp-long 3ʹ-UTR of *NR1I2* mRNA is shown in [Fig. 4](#fig4){ref-type="fig"}G.
Gene reporter assays performed in HepG2 cells indicated that all selected miRNA mimics, such as hsa-miR-18a-5p, hsa-miR-449a, hsa-miR-34a-5p, and hsa-miR-148a-3p, were able to attenuate pmiRGLO-UTR activity compared to the nonspecific control (cel-miR-39-3p) mimic ([Fig. 5](#fig5){ref-type="fig"}A). However, only miR-18a-5p and miR-148a-3p were potent negative regulators of rifampicin-induced and PXR-mediated activation of the CYP3A4-based luciferase reporter construct pER6-3A4-tat-luc in HepG2 cells ([Fig. 5](#fig5){ref-type="fig"}B). In contrast, hsa-miR-449a enhanced the effect of rifampicin on the PXR-responsive reporter construct. Hsa-miR-34a-5p had no effect on the activation of the reporter construct by rifampicin ([Fig. 5](#fig5){ref-type="fig"}B). The latter experiments were performed on the pER6-3A4-tat-luc plasmid, which carries three copies of the proximal *CYP3A4* promoter ER6 response element and displays minimal basal PXR-non-specific activation in HepG2 cells. Of note, miRNA mimics at a concentration of 25 nmol/L were used in these experiments in accordance with manufacturer\'s recommendation.Figure 5MiR-18a-5p is a relevant regulator of *NR1I2* expression and transcriptional activity. (A) Dual-Luciferase Reporter Assay in HepG2 cells transiently transfected with either pmiRGLO or pmiRGLO-UTR construct (50 ng) with one of the following miRNA mimic reagents such as cel-miR-39-3p (mimic control), hsa-miR-18a-5p mimic, hsa-miR-449a mimic, hsa-miR-34a-5p mimic or hsa-miR-148a-3p mimic (25 nmol/L) for 48 h. Firefly luciferase activities were normalized to *Renilla* activities and further normalized to the corresponding data with the empty pmiRGLO vector. The data are shown as the mean ± SD (*n* = 3) and are expressed as relative change compared to the miRNA mimic control cel-miR-39-3p (100%). (B) Dual-Luciferase Reporter Assay in HepG2 cells transiently transfected with pER6-3A4-tat-luc PXR-responsive luciferase reporter vector (150 ng) and pRL-TK (30 ng) together with either cel-miR-39-3p mimic control, hsa-miR-18a-5p mimic, hsa-miR-449a mimic, hsa-miR-34a-5p mimic or hsa-miR-148a-3p mimic (25 nmol/L) for 48 h. Cells were treated with rifampicin (Rif, 10 μmol/L) or vehicle (DMSO; 0.1%) for a further 24 h. Firefly luciferase activities were normalized to *Renilla* activities. The data are shown as the mean ± SD (*n* = 3) and are expressed as fold change compared to DMSO-treated control (defined as 1). (C) Dual-Luciferase Reporter Assay in HepG2 cells transiently transfected with either pmiRGLO, pmiRGLO-UTR, pmiRGLO-MRE-1041-1064, pmiRGLO-MRE-1041-1064-REV or pmiRGLO-18a-5p-Compl construct (50 ng) together with one of the miRNA inhibitor/mimic reagents, such as negative control A (inhibitor control), hsa-miR-18a-5p inhibitor (50 nmol/L), cel-miR-39-3p (mimic control) or hsa-miR-18a-5p mimic (25 nmol/L) for 48 h. Firefly luciferase activities were normalized to *Renilla* activities and further normalized to corresponding firefly luciferase activities obtained from empty pmiRGLO vector experiments. The data are shown as the mean ± SD (*n* = 3) and are expressed as fold change compared to inhibitor miRNA or mimic controls (defined as 1). (D) HepG2 cells were transiently transfected with the pSG5-PXR expression vector (400 ng) for 24 h. Then, cells were treated with vehicle (DMSO; 0.1%) or rifampicin (10 μmol/L) for 6, 12, 24, or 48 h, respectively. Total RNA was isolated and analyzed for miR-18a-5p expression by RT-qPCR. *U6* reference gene-normalized data are shown as the mean ± SD (*n* = 3) and are expressed as relative change compared to corresponding vehicle-treated controls (defined to be 100%). (E) HepG2 cells were transiently transfected with either pmiRGLO or pmiRGLO-18a-5p (50 ng) together with either the pSG5-PXR expression vector or empty pSG5 control vector (100 ng). The next day, cells were treated with rifampicin (Rif, 10 μmol/L), SPA70 (an PXR antagonist, 10 μmol/L) or vehicle (DMSO; 0.1%) for 48 h. Samples were subsequently analyzed by Dual-Luciferase Reporter Assay. Firefly luciferase activities were normalized to *Renilla* activities and further normalized to corresponding firefly luciferase activities obtained from the empty pmiRGLO vector. The data are shown as the mean ± SD (*n* = 3) and are expressed as relative change compared to DMSO-treated control transfected with empty pSG5 vector (defined as 100%). \**P* \< 0.05 or ^\*\*^*P* \< 0.01 indicates a statistically significant effect to vehicle-treated, negative controls or empty vector controls. ^f^*P* \< 0.05 indicates a statistically significant effect of miRNA mimic on Rif-induced action.Figure 5
To further characterize the role of miR-18a-5p in this phenomenon, we performed a reporter assay with a set of luciferase reporter constructs containing the full-length 3′-UTR or native, reversed or miR-18a-5p complementary MREs ([Fig. 5](#fig5){ref-type="fig"}C, left panel). We found that the miR-18a-5p mimic has the ability to significantly decrease activation of constructs generated with both the full-length 3ʹ-UTR and those with one copy of the native MRE for miR-18a-5p. The construct with the reversed MRE exerted no effects on miR-18a-5p in HepG2 ([Fig. 5](#fig5){ref-type="fig"}C, right panel) or COS-1 cells ([Supporting Information Fig. S2A](#appsec3){ref-type="sec"}). In control experiments, we demonstrated functional transfection of the miR-18a-5p mimic and inhibitor into HepG2 cells ([Fig. S2B](#appsec3){ref-type="sec"}) and significant endogenous activity of miR-18a-5p by employing the miR-18a-5p-Compl reporter vector ([Fig. S2C](#appsec3){ref-type="sec"}). Additionally, treatment with rifampicin led to time-dependent changes in miR-18a-5p expression in HepG2 cells, with significant upregulation of miR-18a-5p at 6 h, suppression at 12 h and normalization to original levels between 24 and 48 h posttreatment ([Fig. 5](#fig5){ref-type="fig"}D). Moreover, HepG2 cells transiently transfected with the miR-18a-5p-Compl luciferase construct with the pSG5-PXR expression vector that were treated with rifampicin showed inhibited reporter construct activity, even though the effect was not statistically significant. Treatment with SPA70, a PXR antagonist, reversed the suppressive effect of PXR on pmiRGLO-18a-5p activation, but the effect was statistically significant only in comparison with rifampicin effect ([Fig. 5](#fig5){ref-type="fig"}E). These data confirm augmented miR-18a-5p functional expression in HepG2 cells in response to both overexpressed and activated PXR ([Fig. 5](#fig5){ref-type="fig"}E). Finally, miR-18a-5p mimic down-regulated PXR expression in HepG2 cells (data not shown), which is in agreement with published data in LS180 cells[@bib20]. Taken together, these data suggest that miR-18a-5p is a direct regulator of *NR1I2* gene expression and that rifampicin-mediated changes in miR-18a-5p expression may help to explain the negative regulation of activated PXR.
3.6. Activators of GR upregulate NR1I2 mRNA levels by both increasing NR1I2 mRNA stability via the 3ʹ-UTR and by activating the NR1I2 promoter {#sec3.6}
----------------------------------------------------------------------------------------------------------------------------------------------
In the next series of experiments, we attempted to decipher the role of the 3ʹ-UTR region of *NR1I2* mRNA in GR-mediated PXR expression regulation. To address this aim, pSG5-PXR-UTR was transfected into Huh-7 cells to explore the effect of subsequent treatment with dexamethasone. Huh-7 cells were selected due to their functional activity of GR signaling[@bib34]. We observed significantly higher expression of *NR1I2* mRNA after treatment with dexamethasone (100 nmol/L) than in control experiments with the PXR expression vector lacking the 3ʹ-UTR ([Fig. 6](#fig6){ref-type="fig"}A). Since dexamethasone has been demonstrated to stimulate PXR-mediated *CYP3A4* expression[@bib10], we investigated whether the 3ʹ-UTR of *NR1I2* mRNA may have any impacts on *CYP3A4* mRNA induction. Indeed, dexamethasone induced *CYP3A4* mRNA in the presence of pSG5-PXR expression vector, but *CYP3A4* mRNA upregulation was even greater in the vector with the 3ʹ-UTR ([Fig. 6](#fig6){ref-type="fig"}B). We further showed that dexamethasone enhanced luciferase activity in response to the pmiRGLO-UTR vector, which was reversed by the GR antagonist RU486 in Huh-7 cells ([Fig. 6](#fig6){ref-type="fig"}C) and HepG2 cells ([Supporting Information Figs. S3A and B](#appsec3){ref-type="sec"}). Finally, we found that the observed 3ʹ-UTR stabilization in the pmiRGLO-UTR construct was not selective for dexamethasone but was also present in response to other glucocorticoids ([Fig. 6](#fig6){ref-type="fig"}D). These luciferase gene reporter experiments were performed in parallel with pmiRGLO-UTR and pmiRGLO (empty) controls, and the final activation of the 3ʹ-UTR was calculated as normalized activation (ratio).Figure 6Activators of the glucocorticoid receptor upregulate *NR1I2* mRNA levels both by increasing PXR stability *via* the 3ʹ-UTR and by *NR1I2* promoter activation. (A) Huh-7 cells were transiently transfected with pSG5-PXR or pSG5-PXR-UTR (200 ng) and cotransfected with the glucocorticoid receptor expression vector (pSG5-GR*α*, 600 ng). The next day, cells were treated with vehicle (DMSO; 0.1%) or dexamethasone (DEX, 100 nmol/L) for 24 h. Total RNA was isolated and analyzed for *NR1I2* mRNA expression by RT-qPCR. The data were first normalized to the *GAPDH* reference gene and were acquired from pSG5-PXR-UTR transfected samples, which were further normalized to corresponding experiments transfected with the PXR expression vector lacking the 3ʹ-UTR. The data are shown as the mean ± SD (*n* = 3) and are expressed as relative change compared to DMSO-treated controls (defined as 100%). (B) Huh-7 cells were transiently transfected with either pSG5-PXR or pSG5-PXR-UTR (200 ng) and were cotransfected with the pSG5-GR*α* expression vector (600 ng). The next day, cells were treated with vehicle (DMSO; 0.1%) or DEX (100 nmol/L) for 24 h. Total RNA was isolated and analyzed for *CYP3A4* mRNA expression by RT-qPCR. *GAPDH* reference gene-normalized data are shown as the mean ± SD (*n* = 3) and are expressed as relative change compared to the mean of vehicle-treated pSG5-PXR/pSG5-GR*α*-transfected experiments (defined as 100%). \**P* \< 0.05, ^\*\*^*P* \< 0.01 indicates a statistically significant effect of the 3ʹ-UTR region of *NR1I2* mRNA. Huh-7 cells were transiently transfected with pmiRGLO or pmiRGLO-UTR vector (50 ng) together with pSG5-GR*α* expression vector (150 ng). The next day, cells were treated with DEX (100 nmol/L), RU486 (a GR antagonist, 10 μmol/L), a combination of DEX (100 nmol/L)/RU486 (10 μmol/L) or vehicle (DMSO; 0.2%, *v*/*v*) (C) or with glucocorticoids hydrocortisone acetate, corticosterone, triamcinolone acetonide, and 6*α*-methylprednisolone (100 nmol/L) (D) for 24 h. After treatment, samples were analyzed by Dual-Luciferase Reporter Assay. Firefly luciferase activities were normalized to *Renilla* activities and further normalized to activation of the empty pmiRGLO vector. The data are shown as the mean ± SD (*n* = 3) and are expressed as relative change compared to vehicle-treated control (defined as 100%). \**P* \< 0.05, ^\*\*^*P* \< 0.01, ^\*\*\*^*P* \< 0.001 indicates a statistically significant effect compared to vehicle-treated controls. (E) and (F) HepG2 cells were transiently transfected with either a pPXR1-Gluc or pPXR2-Gluc (150 ng) *NR1I2* promoter luciferase reporter construct concomitantly with pSG5-GR*α* expression vector or pSG5 empty control (100 ng). The next day, cells were treated with dexamethasone (DEX, 100 nmol/L) or vehicle (DMSO; 0.1%) for 24 h. Then, *Gaussia* luciferase and SEAP activities were assessed. The results are presented as relative change in SEAP-normalized *Gaussia* luciferase activities compared to DMSO-treated controls (defined as 100%). The data are shown as the mean ± SD (*n* = 3). \**P* \< 0.05 indicates a statistically significant effect of DEX. (G) The scheme summarizes hypothetical mechanisms for how activated GR enhances *NR1I2* mRNA expression. On one side, GR stabilizes the 3ʹ-UTR of *NR1I2* mRNA and on the other hand, GR triggers *NR1I2* gene transcription.Figure 6
In additional experiments, we confirmed previously reported findings that ligand-activated GR triggers promoter-dependent transcription of *NR1I2* gene by employing *NR1I2* promoter *Gaussia* reporter constructs in HepG2 cells ([Fig. 6](#fig6){ref-type="fig"}E and F). In summary, we propose that activated GR may have a dual role in PXR upregulation, as it stabilizes *NR1I2* mRNA *via* the 3ʹ-UTR potentially by suppression of targeting miRNA(s) and activates *NR1I2* gene transcription from the *NR1I2* promoter ([Fig. 6](#fig6){ref-type="fig"}G).
3.7. Dexamethasone decreases miR-18a-5p expression and activity {#sec3.7}
---------------------------------------------------------------
To determine which miRNAs demonstrate altered expression in response to dexamethasone treatment, we performed screening analysis of 754 miRNAs in response to either dexamethasone- or control-treated samples of Huh-7 cells using a TaqMan Array Human MicroRNA Card. Profiling showed 11 upregulated (≥2) and 22 downregulated (≤0.5) miRNAs after 24 h treatment with dexamethasone ([Fig. 7](#fig7){ref-type="fig"}A and B). Closer inspection also revealed that hsa-miR-148a-3p was slightly upregulated, while hsa-miR-34a-5p was unchanged ([Fig. 7](#fig7){ref-type="fig"}A). In contrast, hsa-miR-18a-5p and hsa-miR-449a were downregulated 24 h posttreatment with dexamethasone ([Fig. 7](#fig7){ref-type="fig"}B). Since hsa-miR-18a-5p was suppressed by dexamethasone and the functional miR-18a-5p responsive element was confirmed to be within the 3ʹ-UTR of *NR1I2* mRNA ([Fig. 5](#fig5){ref-type="fig"}C, [Fig. S2A](#appsec3){ref-type="sec"}, and reported in[@bib20]), miR-18a-5p may be the candidate miRNA responsible for GR-mediated posttranscriptional stabilization of *NR1I2* mRNA. To examine this hypothesis, we transiently transfected HepG2 cells with the pmiRGLO-18a-5p-Compl and pSG5-GR*α* expression vectors followed by treatment with dexamethasone for either 24 or 48 h. As expected, dexamethasone increased normalized activity of the miR-18a-5p-sensitive luciferase reporter compared to vehicle, and this effect was reversed by treatment with RU486 ([Fig. 8](#fig8){ref-type="fig"}A and B). This was not the case for the pMIR-luc-34a-5p-Compl luciferase construct with a perfect matching sequence for miR-34a-5p ([Supporting Information Fig. S4A](#appsec3){ref-type="sec"}). This finding is in agreement with the TaqMan Array analysis data, where dexamethasone did not alter hsa-miR-34a-5p expression ([Fig. 7](#fig7){ref-type="fig"}A), although miR-34a-5p appears to exhibit potent endogenous activity in HepG2 cells ([Figs. S4B and C](#appsec3){ref-type="sec"}). Altogether, these data provide evidence that dexamethasone treatment in hepatic cell lines downregulates expression of hsa-miR-18a-5p, subsequently resulting in stabilization of the 3ʹ-UTR of *NR1I2* mRNA and *NR1I2* mRNA upregulation ([Fig. 9](#fig9){ref-type="fig"}).Figure 7Dexamethasone-induced changes in miRNA expression profiles in Huh-7 cells. Huh-7 cells were transfected with pSG5-GR*α* (600 ng) overnight and then treated with DMSO (0.1%) or dexamethasone (DEX, 100 nmol/L) for 24 h. Total RNA was isolated and analyzed using a miRNA expression TaqMan array card. *RNU48* reference gene-normalized data are expressed as fold change compared to vehicle-treated experiments defined as 1. Only miRNAs with upregulated (≥2) (A) or downregulated (≤0.5) (B) expression in response to DEX treatment are shown. Additionally, the color bars indicate other miRNAs of interest potentially involved in PXR 3ʹ-UTR regulation. Data of a representative experiments are shown.Figure 7Figure 8Dexamethasone treatment stabilizes miR-18a-5p-responsive luciferase construct. HepG2 cells were transiently transfected with pmiRGLO or pmiRGLO-18a-5p-Compl (50 ng) together with the glucocorticoid receptor expression vector (pSG5-GR*α*, 150 ng). The next day, cells were treated with dexamethasone (DEX, 100 nmol/L), a combination of DEX (100 nmol/L)/RU486 (10 μmol/L) or vehicle (DMSO; 0.2%) for 24 (A) or 48 h (B). After treatment, samples were analyzed with Dual-Luciferase Reporter Assay. Firefly luciferase activities were normalized to *Renilla* activities and were further normalized to the corresponding activity of the empty pmiRGLO vector. The data are shown as the mean ± SD (*n* = 3) and are expressed as fold change compared to DMSO-treated controls (defined as 1). \**P* \< 0.05, ^\*\*^*P* \< 0.01 indicate a statistically significant effect compared to vehicle-treated or DEX-treated samples.Figure 8Figure 9Summary of PXR expression regulation. PXR suppresses its own expression *via* a dual mechanism including promoter suppression and mRNA destabilization. The latter may be mediated at least partially *via* upregulation of miR-18a-5p expression. GR receptor triggers transcription of the *NR1I2* promoter and stabilizes *NR1I2* mRNA posttranscriptionally through downregulation of miR-18a-5p.Figure 9
4. Discussion {#sec4}
=============
Drug-metabolizing enzymes (DMEs) are involved in removal of xenobiotics, and maintain the homeostasis of certain endogenous compounds. To achieve balance between these metabolic processes, DMEs must be tightly regulated. Several nuclear receptors have been shown to be involved in mutual feed-back and feed-forward loops that are responsible for orchestrating these metabolic pathways.
In this study, we demonstrated that *NR1I2* expression may be under feed-back loop regulation through dual mechanisms involving both transcriptional and posttranscriptional regulation based on the following observations: (i) rifampicin represses PXR transcript and protein expression in a time-dependent manner in primary human hepatocytes ([Fig. 1](#fig1){ref-type="fig"}A and C); (ii) SR-12813, another PXR activator, downregulated *NR1I2* mRNA expression 24 h posttreatment ([Fig. 1](#fig1){ref-type="fig"}D); (iii) PCN, an agonist of mouse PXR, suppressed both mRNA and protein levels of PXR in mice 24 h after administration ([Fig. 2](#fig2){ref-type="fig"}A and C); and (iv) both the promoter and 3ʹ-UTR regions of the *NR1I2* gene suppress PXR expression ([Fig. 3](#fig3){ref-type="fig"}B and C).
Our results are consistent with another study that used primary rat hepatocytes, where PCN-activated PXR attenuated its own expression at both the mRNA and protein levels after 48 h[@bib35]. Negative PXR feed-back regulation was further supported in *NR1I2* promoter reporter assays using Huh-7 cells[@bib35]. However, discordant data have also been reported in intestinal cell lines[@bib20]^,^[@bib36], in an immortalized human hepatocyte cell line[@bib37] and in a few isolated human hepatocyte experiments[@bib38]^,^[@bib39]. Nevertheless, the extent of changes in *NR1I2* transcript was highly variable among human liver donors used in this study after treatment with PXR ligands. This is not surprising, since donor-dependent differences in the inducibility of PXR target genes have also been previously described[@bib38]^,^[@bib40]. Thus, different tissue models and small sample sizes in studies with human hepatocytes may be the reason for this discrepancy. Moreover, detailed time course analysis is missing in these reports.
In this study, we also confirmed that the overexpression of ectopic PXR suppresses promoter-mediated transcription or *NR1I2* gene. The mechanism explaining this phenomenon remains unclear since no putative binding site for PXR was found within its promoter in *in silico* analysis or in mechanistic studies either for human or mouse PXR[@bib9]. It is interesting that PXR downregulates its own transcription both *via* the promoter and 3ʹ-UTR, regardless of whether PXR is activated by a ligand. We suppose that forced expression of exogenous PXR in the absence of a ligand may mimic activated PXR, which was previously reported[@bib10]. One explanation may be that overexpression of PXR causes increased sensitivity to endogenous ligands. This hypothesis is further confirmed by no subsequent activation of PXR by rifampicin and by reversal of the effect by the PXR antagonist, SPA70, in the experiments ([Fig. 3](#fig3){ref-type="fig"}C).
In addition, we showed for the first time that PXR negatively affects the luciferase gene reporter construct carrying the full-length 3ʹ-UTR of *NR1I2* mRNA. As a result of this finding, we aimed to uncover the precise role of the 3ʹ-UTR in PXR regulation. It is known that the 3ʹ-UTR of *NR1I2* mRNA is the primary site to which miRNAs bind and exert their negative posttranscriptional effects. Although more than one hundred unique miRNAs have been predicted to potentially target the 3ʹ-UTR of *NR1I2* mRNA[@bib33], there is still relatively scarce information on posttranscriptional regulation of PXR. As shown by Takagi et al.[@bib13], levels of *NR1I2* mRNA expression does not correlate with PXR protein levels in human liver samples (*n* = 25), suggesting that PXR is subject to posttranscriptional regulation. However, in a follow-up correlation study, a linear relationship was observed between *NR1I2* mRNA and protein levels in liver samples (*n* = 24) obtained from a Chinese Han population, raising the question of potential ethnic differences in PXR expression regulation[@bib41]. However, relatively small sample sizes have been enrolled in both these studies, impairing adequate statistical power. In a pioneering report, a functional responsive element for miR-148a was found in the 3ʹ-UTR of *NR1I2* mRNA, and an inverse correlation of miR-148a expression with PXR protein/mRNA ratio has been reported[@bib13]. However, this observation was not confirmed by others[@bib41]^,^[@bib42], and Lamba et al.[@bib8] even showed a positive correlation.
In our experiments, we revealed that the 3ʹ-UTR of *NR1I2* mRNA attenuates PXR expression ([Fig. 4](#fig4){ref-type="fig"}A--C) and suppresses rifampicin-mediated upregulation of *CYP3A4* mRNA in HepG2 cells ([Fig. 4](#fig4){ref-type="fig"}D). It is therefore plausible that endogenous miRNAs in these cells may result in a general repressive effect on the 3ʹ-UTR. An analogous observation was reported for HNF4*α*[@bib22]. Moreover, rifampicin enhanced the repressive role of the 3ʹ-UTR in PXR protein expression ([Fig. 4](#fig4){ref-type="fig"}F), thus indicating that rifampicin-induced changes in cellular miRNAs profile may inhibit PXR expression *via* its 3ʹ-UTR. In agreement with this hypothesis, a modulatory effect of rifampicin on miRNA expression profiles has been recently reported in primary human hepatocytes[@bib43]^,^[@bib44].
To shed light on the missing link between rifampicin and miRNA regulation of the PXR 3ʹ-UTR, we decided to include miR-148a[@bib13] and miR-18a-5p[@bib20] in our subsequent analysis, as their binding sites were experimentally confirmed within the 3ʹ-UTR of *NR1I2* mRNA. Additionally, miR-449a and miR-34a-5p, which share the same seed sequences ([Fig. 4](#fig4){ref-type="fig"}G), were also used as they were both predicted in our *in silico* analysis[@bib33]. In addition, miR-34a-5p[@bib8]^,^[@bib22] and miR-449a[@bib22] have been reported to be negatively associated with *NR1I2* mRNA expression. Both miR-34a-5p and miR-449a are also detectable in human hepatic cell line[@bib22]^,^[@bib45], which is in agreement with our experiments where endogenous miR-34a-5p downregulated a luciferase reporter construct with a cloned complementary sequence for miR-34a-5p in HepG2 ([Fig. S4B](#appsec3){ref-type="sec"}). Among the tested miRNAs, we found that only miR-18a-5p and miR-148a mimics attenuated rifampicin-induced PXR-mediated transactivation of CYP3A4-derived luciferase reporter construct ([Fig. 5](#fig5){ref-type="fig"}B), which is consistent with previous findings[@bib13]^,^[@bib20]. Notably, miR-449a even enhanced the activation of the CYP3A4-derived luciferase reporter construct in response to rifampicin, which indicates a possible indirect effect of miR-449a on other factors involved in the PXR-mediated transactivation.
In further experiments, we focused on miR-18a-5p as a potential culprit of PXR negative regulation. MiR-18a-5p is a member of the miR-17/92 cluster dysregulated in cancers and is highly expressed in hepatocellular carcinoma[@bib46]. Very recently, miR-18a-5p was systematically described as a functional and direct regulator of PXR expression based on luciferase gene reporter studies, loss- and gain-of-function methods, and analysis of PXR-mediated inducibility of *CYP3A4* mRNA in LS180 human colorectal adenocarcinoma cells[@bib20]. In the present study, the functional responsive element for miR-18a-5p within the 3′-UTR of *NR1I2* mRNA was confirmed with different luciferase reporter vectors, including the construct with the full-length 3ʹ-UTR ([Fig. 5](#fig5){ref-type="fig"}C and [Fig. S2A](#appsec3){ref-type="sec"}). In contrast to the report by Sharma et al.[@bib20], we observed an oscillating pattern of miR-18a-5p regulation in HepG2 cells after treatment with rifampicin ([Fig. 5](#fig5){ref-type="fig"}D). During early intervals (6 h), rifampicin significantly induced expression of miR-18a-5p, which was followed by its significant reduction at 12 h and return to a slightly increased level after 24 h. The latter is in line with microarray experiments revealing only weak increases (1.64-fold change) in miR-18a-5 expression after 48 h treatment with rifampicin (10 μmol/L) in pooled human hepatocytes[@bib20]. In intestinal LS180 cells, different time-dependent profiles of miR-18a-5p expression was reported with decreased expression during short intervals of treatment (3 and 6 h)[@bib20]. In addition, authors did not observe significant down-regulation of *NR1I2* mRNA expression in any interval in LS180 cells after treatment with two PXR ligands. These findings highlight the tissue-specific manner of the regulation and the importance of time profiling of miRNA and mRNA expression with a stress on early periods of treatment. Additionally, HepG2 cells transfected with a pmiRGLO-18a-5p-Compl luciferase reporter construct with the pSG5-PXR expression vector showed downregulation of reporter vector activity after treatment with rifampicin and without treatment, which indicates an impact of overexpressed PXR on miR-18a-5p expression ([Fig. 5](#fig5){ref-type="fig"}E). In opposite, the PXR antagonist SPA70 displayed opposite effect that rifampicin in the experiments. Our results suggest that miR-18a-5p is a direct regulator of PXR and that rifampicin-mediated changes in miR-18a-5p expression likely contribute to negative regulation of activated PXR.
Additionally, we studied the role of the 3ʹ-UTR region of *NR1I2* mRNA in GR-mediated regulation of PXR expression. In accordance with previous works[@bib10]^,^[@bib11], we confirmed that activated GR by dexamethasone triggers transcription of *NR1I2* gene from its promoter ([Fig. 6](#fig6){ref-type="fig"}E and F). Since it is unclear whether GR also induces posttranscriptional changes in *NR1I2* mRNA, we performed several experiments using reporter and expression vectors harboring the full-length 3ʹ-UTR region of *NR1I2* mRNA. Interestingly, the expression of *NR1I2* mRNA was more enhanced in cells that were transfected with the PXR expression construct with the 3ʹ-UTR region than without the 3ʹ-UTR region after treatment with glucocorticoids ([Fig. 6](#fig6){ref-type="fig"}A). Moreover, dexamethasone-induced *CYP3A4* mRNA expression was significantly higher in the presence of the PXR vector with cloned 3ʹ-UTR than with an expression vector lacking the 3ʹ-UTR ([Fig. 6](#fig6){ref-type="fig"}B). We further observed that dexamethasone increased luciferase activity of pmiRGLO-UTR vector, which was reversed by the GR antagonist RU486 in Huh-7 ([Fig. 6](#fig6){ref-type="fig"}C) and HepG2 cells ([Figs. S3A and B](#appsec3){ref-type="sec"}). Based on these results, we postulate that activation of GR leads to increased *NR1I2* mRNA *via* dual mechanisms involving *NR1I2* promoter activation and 3ʹ-UTR *NR1I2* mRNA stabilization ([Fig. 6](#fig6){ref-type="fig"}G). Dexamethasone was used at nanomolar concentrations in our experiments, which is known to selectively activate GR but not PXR[@bib10]. This experimental precaution limits the downregulation of activated PXR on its 3ʹ-UTR and helps to reveal the specific GR-mediated stabilization of 3ʹ-UTR *NR1I2* mRNA.
Next, we proposed that activated GR may increase *NR1I2* mRNA expression through changes in miRNA expression levels. In our miRNA expression analysis, we revealed that miR-18a-5p is downregulated by dexamethasone. Dexamethasone-induced downregulation of miR-18a expression has been consistently observed in primary rat thymocytes and cultured leukemic cells[@bib47]. As a miR-18a-5p responsive element was previously identified within the 3ʹ-UTR of *NR1I2* mRNA, we believed that miR-18a-5p may also be a candidate miRNA responsible for GR-mediated posttranscriptional stabilization of *NR1I2* mRNA. We observed that dexamethasone increased normalized activation of pmiRGLO-18a-5p-Compl luciferase reporter construct, which was reversed by RU486. Taken together, these data provide insight indicating that dexamethasone treatment downregulates expression of hsa-miR-18a-5p, which may subsequently result in enhanced stability of *NR1I2* mRNA.
5. Conclusions {#sec5}
==============
In conclusion, in this study, our data support the role of miRNAs in feed-back and feed-forward regulation and in glucocorticoid-mediated hormonal upregulation of PXR expression. Based on our results, it is tempting to suppose that PXR feed-back regulation could prevent overstimulation of PXR target genes or control augmented and time-limited metabolic elimination of xenobiotic from the body. This could be a protective mechanism that hinders the unfavorable effects of endogenous compounds in the presence of PXR ligands. In this work, we also propose that glucocorticoids increase PXR expression *via* a dual mechanism involving activation of the *NR1I2* gene promoter and by stabilization of the 3ʹ-UTR of *NR1I2* mRNA for the first time. The positive effect of glucocorticoids on hepatic DME gene expression is an illustrative example of coordination and hormone-controlled liver response to xenobiotic exposure that occurs *via* a multifaceted process.
Author contribution {#appsec1}
===================
Tomas Smutny, Stanislav Micuda, Sabine Gerbal-Chaloin and Petr Pavek designed the experiments. Jan Dusek, Lucie Hyrsova, Jana Nekvindova, and Alzbeta Horvatova performed cellular experiments. Stanislav Micuda performed animal studies, and Tomas Smutny, Stanislav Micuda, Sabine Gerbal-Chaloin and Petr Pavek performed statistical analyses.
Conflicts of interest {#appsec2}
=====================
The authors declare no conflicts of interest.
Appendix A. Supplementary data {#appsec3}
==============================
The following are the Supplementary data to this article:Multimedia component 1Multimedia component 1Multimedia component 2Multimedia component 2Figure S1Effect of the 3ʹ-UTR on PXR expression in Huh-7 cells. Huh-7 cells were transiently transfected with either a pSG5-PXR or pSG5-PXR-UTR construct (200 ng) and cotransfected with pSG5-RXR*α* (200 ng). The next day, cells were cultured in fresh medium for 24 h (A) or for 48 h (B, C), respectively. After treatment, (A, C) total RNA was isolated and analyzed for basal levels of *NR1I2* mRNA by RT-qPCR. *GAPDH* reference gene-normalized data are shown as the mean ± SD (*n =* 3) and are expressed as relative change compared to control pSG5-PXR-transfected cells (100%). (B) Samples were analyzed for expression of PXR protein by Western blotting. *β*-Actin was used as a loading control. Representative Western blotting results are shown. \**P \<* 0.05, \*\**P \<* 0.01 indicate a statistically significant effect of the 3ʹ-UTR region of *NR1I2* mRNA.Figure S1Figure S2miR-18a-5p regulates the 3′-UTR of *NR1I2* mRNA in COS-1 and HepG2 cells. (A) COS-1 cells were transiently transfected with either pmiRGLO, pmiRGLO-UTR, pmiRGLO-MRE-1041-1064, pmiRGLO-MRE-1041-1064-REV or pmiRGLO-18a-5p-Compl (50 ng) together with one of the following miRNA inhibitor/mimic reagents, such as negative control A (inhibitor control), hsa-miR-18a-5p inhibitor (50 nmol/L), cel-miR-39-3p (mimic control) or hsa-miR-18a-5p mimic (10 nmol/L) for 48 h. Samples were subsequently analyzed by Dual-Luciferase Reporter Assay. Firefly luciferase activities were normalized to *Renilla* activities and were further normalized to corresponding firefly luciferase activities obtained from experiments with the empty pmiRGLO vector. The data are shown as the mean ± SD (*n =* 3) and are expressed as fold change compared to miRNA mimic or inhibitor control (defined as 1). (B) HepG2 cells were transiently transfected with miR-18a-5p inhibitor (50 nmol/L) or mimic (25 nmol/L) reagents for 48 h. Total RNA was isolated and analyzed for levels of miR-18a-5p by RT-qPCR. *U6* reference gene-normalized data are shown as the mean ± SD and are expressed as fold change compared to values gained from experiments with mimic or inhibitor controls defined as 1. (C) HepG2 cells were transiently transfected with pmiRGLO, pmiRGLO-UTR, pmiRGLO-18a-5p-Compl, pmiRGLO-MRE-1041-1064, or pmiRGLO-MRE-69-91 (50 ng), respectively. After 48 h, samples were analyzed by Dual-Luciferase Reporter Assay. Firefly luciferase activities were normalized to *Renilla* activities. The data are shown as the mean ± SD (*n =* 3) and are expressed as relative change compared to a pmiRGLO empty vector (defined as 100%). \*\**P* \< 0.01, \*\*\**P* \< 0.001 indicates a statistically significant effect compared to the response of pmiRGLO vector or negative controls.Figure S2Figure S3Dexamethasone stabilizes the 3′-UTR of *NR1I2* mRNA RNA in HepG2 cells. HepG2 cells were transiently transfected with pmiRGLO or pmiRGLO-UTR vector (50 ng) together with pSG5-GR*α* expression vector (150 ng). The next day, cells were treated with dexamethasone (DEX, 100 nmol/L), a combination of DEX (100 nmol/L)/RU486 (10 μmol/L) or vehicle (DMSO; 0.2%) for 24 h **(A)** or 48 h **(B)**, respectively. Next, samples were analyzed by Dual-Luciferase Reporter Assay. Firefly luciferase activities were normalized to *Renilla* activities and were further normalized to the corresponding activity of the pmiRGLO vector. The data are shown as the mean ± SD (*n* = 3) and are expressed as fold change compared to DMSO-treated controls (defined as 1). \**P* \< 0.05, \*\**P* \< 0.01 indicates a statistically significant effect compared to vehicle-treated or DEX-treated samples.Figure S3Figure S4Dexamethasone does not alter the activity of endogenously expressed miR-34a-5p in HepG2 cells. **(A)** HepG2 cells were transiently transfected with either the pMIR-luc-control or pMIR-luc-34a-5p-Compl (50 ng) construct along with pRL-TK (30 ng) and glucocorticoid receptor expression (pSG5-GR*α*, 150 ng) vectors. The next day, cells were treated with dexamethasone (DEX, 100 nmol/L) or vehicle (DMSO; 0.1%) for 48 h. After treatment, samples were analyzed by Dual-Luciferase Reporter Assay. Firefly luciferase activities were normalized to *Renilla* luciferase activities and further normalized to the corresponding activity of the empty pMIR-luc-controls. The data are shown as the mean ± SD (*n* = 3) and are expressed as relative change compared to DMSO-treated controls (defined as 100%). N.S. indicates a statistically insignificant effect. **(B)** HepG2 cells were transiently transfected with either pMIR-luc-control or pMIR-luc-34a-5p-Compl (50 ng) along with pRL-TK (30 ng). After 48 h, samples were analyzed by a Dual-Luciferase Reporter Assay System. Firefly luciferase activities were normalized to *Renilla* luciferase activities. The data are shown as the mean ± SD (*n* = 3) and are expressed as fold change compared to empty pMIR-luc-control vectors (defined as 1). \*\*\**P* \< 0.001 indicates a statistically significant effect of MRE. **(C)** HepG2 cells were transiently transfected with either pMIR-luc-control or pMIR-luc-34a-5p-Compl (50 ng) along with pRL-TK (30 ng) and one of the following miRNA inhibitor/mimic reagents, such as negative control A (inhibitor control), hsa-miR-34a-5p inhibitor (50 nmol/L), cel-miR-39-3p (mimic control) or hsa-miR-34a-5p mimic (25 nmol/L) for 48 h. Samples were subsequently analyzed by a Dual-Luciferase Reporter Assay System. Firefly luciferase activities were normalized to *Renilla* activities and then further normalized to corresponding firefly luciferase activities obtained from experiments with empty pMIR-luc-controls. The data are shown as the mean ± SD (*n* = 3) and are expressed as relative change compared to miRNA mimic or inhibitor controls (defined as 100%). \*\**P* \< 0.01, \*\*\**P* \< 0.001 indicate a statistically significant effect compared to negative controls.Figure S4
This work was supported by grants from the Czech Science Foundation 17-06841S to Petr Pavek and EFSA-CDN (No. CZ.02.1.01/0.0/0.0/16_019/0000841, Czech Republic) co-funded by ERDF to Tomas Smutny.
Peer review under responsibility of Institute of Materia Medica, Chinese Academy of Medical Sciences and Chinese Pharmaceutical Association.
Supporting data to this article can be found online at <https://doi.org/10.1016/j.apsb.2019.09.010>.
|
{
"pile_set_name": "PubMed Central"
}
|
1. Field of the Invention
This invention relates to security networks for computer network applications, and, more particularly, to a security network which provides user authentication by an out-of-band system that is entirely outside the host computer network being accessed. In addition, the out-of-band system optionally includes provision for biometric identification as part of the authentication process.
2. Background of the Invention
In the past, there have typically been three categories of computer security systems, namely, access control, encryption and, message authentication, and intrusion detection. The access control systems act as the first line of defense against unwanted intrusions, and serve to prevent hackers who do not have the requisite information, e.g. the password, etc., from accessing the computer networks and systems. Secondly, the encryption and message authentication systems ensure that any information that is stored or in transit is not readable and cannot be modified. In the event that a hacker is able to break into the computer network, these systems prevent the information from being understood, and, as such, encryption systems as the second line of defense. Further intrusion detection systems uncover patterns of hacker attacks and viruses and, when discovered provide an alarm to the system administrator so that appropriate action can be taken. Since detection systems operate only after a hacker has successfully penetrated a system, such systems act as a third line of defense.
Obviously, as an access control system is the first line of defense, it is important that the selection thereof be well-suited to the application. In access control systems there is a broad dichotomy between user authentication and host authentication systems. In current practice, the most common user authentication systems include simple password systems, random password systems, and biometric systems. The simple password systems are ubiquitous in our society with every credit card transaction using a pin identification number, every automatic teller machine inquiry looking toward a password for access, and even telephone answering messages using simple password systems for control.
Additionally, when random password systems are used, another level of sophistication is added. In these systems, the password changes randomly every time a system is access. These systems are based on encryption or a password that changes randomly in a manner that is synchronized with an authorization server. The Secure ID card is an example of such a system. Random password systems require complimentary software and/or hardware at each computer authorized to use the network.
In biometric systems, characteristics of the human body, such as voice, fingerprints or retinal scan, are used to control access. These systems require software and/or hardware at each computer to provide authorization for the use of the network.
Another category of access control is that of host authentication. Here the commonest systems are those of “callback” and “firewall” systems. Callback systems are those systems which work by calling a computer back at a predetermined telephone number. These systems authenticate the location of a computer and are suitable for dial-up (modem) networks; however, such systems are ineffective when the attack comes via the Internet. On the other hand, firewall systems are designed to prevent attacks coming from the Internet and work by allowing access only from computers within a network. Even though firewall systems are implemented either as standalone systems or incorporated into routers, skilled hackers are able to penetrate host authentication systems.
Typically, access-control security products, as described above, are in-band authentication systems with the data and the authentication information on the same network. Thus, upon accessing a computer, a computer prompt requests that you enter your password and, upon clearance, access is granted. In this example, all information exchanged is on the same network or in-band. The technical problem created thereby is that the hacker is in a self-authenticating environment.
Except for callback systems, the above access control products authenticate only the user and not the location. When computer networks could only be accessed by modems, the authentication of location by dialing back the access-requesting computer, provided a modicum of security. Now, as virtually all computer networks are accessible by modem-independent internet connection, location authentication by callback is no longer secure. The lack of security arises as there is no necessary connection between the internet address and a location, and, in fact, an internet address most often changes from connection to connection. Thus, callback systems are rendered useless against attacks originating from the internet.
In preparing for this application, a review of various patent resources was conducted. The review resulted in the inventor gaining familiarity with the following patents:
Item No.Pat. No.InventorOrig. ClassDate16,408,062Cave, Ellis K.379/210.01June 200225,901,284Hamdy-Swink, Katheryn A.713/200May 199935,898,830Wesinger, Jr., et al.395/187.01April 199945,872,834Teitelbaum379/93.03February 199955,826,014Coley, et al.718,201October 199865,787,187Bouchard382/115July 199875,680,458Spelman, et al.380/21October 199785,621,809Bellegarda, et al.382/116April 199795,615,277Hoffman382/115March 1997105,588,060Aziz380/30December 1996115,548,646Aziz, et al.380/23August 1996125,153,918Tuai, Gregory713/182October 1992
In general terms, the patents all show a portion of the authentication protocol and the data transferred in the same channel or “in-band”. For purposes of this discussion “in-band” operation is defined as one conducted wholly within a single channel or loop. Likewise, an “out-of-band” operation is defined as one using an authentication channel that is separated from the channel carrying the information and therefore is nonintrusive as it is carried over separate facilities, frequency channels, or time slots than those used for actual information transfer.
The patent to E. K. Cave, U.S. Pat. No. 6,408,062, Item 1 above, describes a callback system. Here, the user is prequalified so that he does not get charged for calls that are not completed to the called party. However, here the authentication and the administrative function are in the same loop.
In Item 3, the patent to Wesinger et al., U.S. Pat. No. 5,898,830 ('830) is a firewall patent. Here, the inventor attempts to enhance security by using out-of-band authentication. In his approach, a communication channel, or medium, other than the one over which the network communication takes place, is used to transmit or convey an access key. The key is transmitted from a remote location (e.g., using a pager or other transmission device) and, using a hardware token, the key is conveyed to the local device. In the Wesinger '830 system, to gain access, a hacker must have access to a device (e.g., a pager, a token, etc.) Used to receive the out-of-band information. Pager beep-back or similar authentication techniques may be especially advantageous in that, if a hacker attempts unauthorized access to a machine while the authorized user is in possession of the device, the user will be alerted by the device unexpectedly receiving the access key. The key is unique to each transmission, such that even if a hacker is able to obtain it, it cannot be used at other times or places or with respect to any other connection.
Next, turning to Item 7, the patent to Spelman et al., U.S. Pat. No. 5,680,458 ('458), a method of recovering from the compromise of a root key is shown. Here, following the disruption of a new replacement key, an out-of-band channel is used by a central authority to publish a verification code which can be used by customers to verify the authenticity of the emergency message. The Spelman '458 patent further indicates that the central authority uses the root key to generate a digital signature which is appended to the emergency message to verify that the emergency message is legitimate.
Hoffman, U.S. Pat. No. 5,615,277, Item 9, is next discussed. Here, biometrics are combined with a tokenless security and the patent describes a method for preventing unauthorized access to one or more secured computer systems. The security system and method are principally based on a comparison of a unique biometric sample, such as a voice recording, which is gathered directly from the person of an unknown user with an authenticated unique biometric sample of the same type. The Hoffman technology is networked to act as a full or partial intermediary between a secured computer system and its authorized users. The security system and method further contemplate the use of personal codes to confirm identifications determined from biometric comparisons, and the use of one or more variants in the personal identification code for alerting authorities in the event of coerced access.
Items 10 and 11 have a common assignee, Sun Microsystems, Inc., and both concern encryption/decryption keys and key management.
The patent to Tuai, U.S. Pat. No. 5,153,918 ('918) describes an in-band authentication system which uses a callback system after authentication. Within the authentication system, Tuai '918 employs a voice verification technique.
The submission of the above list of documents is not intended as an admission that any such document constitutes prior art against the claims of the present application. Applicant does not waive any right to take any action that would be appropriate to antedate or otherwise remove any listed document as a competent reference against the claims of the present application. None of the above show the novel and unobvious features of the invention described hereinbelow.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
Pleasant Vale, U.S. Virgin Islands
Pleasant Vale is a settlement on the island of Saint Croix in the United States Virgin Islands.
References
Category:Populated places in the United States Virgin Islands
Category:Saint Croix, U.S. Virgin Islands
|
{
"pile_set_name": "Wikipedia (en)"
}
|
"WILLIAM SHAKESPEARE'S" "HAMLET" " Who's there?" " Nay, answer me: stand, and unfold yourself!" "Long live the king!" " Bernardo?" " He!" "You come most carefully upon your hour." "'Tis now struck twelve." "Get thee to bed, Francisco." "For this relief much thanks: 'tis bitter cold, and I am sick at heart." " Have you had quiet guard?" " Not a mouse stirring." "Well, good night." "If you do meet Horatio and Marcellus, the rivals of my watch," " bid them make haste!" " I think I hear them." " Stand, ho!" "Who is there?" " Friends to this ground." " And liegemen to the Dane." " Give you good-night." "O, farewell, honest soldier, who hath reliev'd you?" "Bernardo has my place." "Give you good-night." "Holla!" "Bernardo!" " What, is Horatio there?" " A piece of him." "Welcome, Horatio." "Welcome, Marcellus." "What, has this thing appear'd again to-night?" " I have seen nothing." " Horatio says 'tis but our fantasy, and will not let belief take hold of him." "Touching this dreaded sight, twice seen of us, therefore I have entreated him along with us to watch the minutes of this night, that, if again this apparition come, he may approve our eyes" " ...and speak to it." " Tush, tush, 'twill not appear." "Sit down awhile, and let us once again assail your ears, that are so fortified against our story, what we two nights have seen." "Well, sit we down, and let us hear Bernardo speak of this." "Last night of all, when yond same star that's westward from the pole had made his course to illume that part of heaven where now it burns," "Marcellus and myself, the bell then beating one..." "Peace, break thee off, look where it comes again!" "In the same figure, like the king that's dead!" "Thou art a scholar, speak to it, Horatio!" "Looks it not like the king?" "Mark it, Horatio!" "Most like." "It harrows me with fear and wonder." " It would be spoke to." " Speak to it, Horatio!" "What art thou, that usurp'st this time of night, together with that fair and warlike form in which the majesty of buried Denmark did sometimes march?" " By heaven I charge thee, speak!" " It is offended!" "See, it stalks away!" "Stay!" "Speak, speak!" "I charge thee speak!" "'Tis gone, and will not answer." "How now, Horatio!" "You tremble and look pale:" "is not this something more than fantasy?" "What think you on't?" "Before my God, I might not this believe... without the sensible and true avouch of mine own eyes." " Is it not like the King?" " As thou art to thyself." "Such was the very armour he had on when he the ambitious Norway combated, so frown'd he once when, in an angry parle, he smote the sledded Polacks on the ice. 'Tis strange." "Thus twice before, and jump at this dead hour, with martial stalk hath he gone by our watch." "In what particular thought to work I know not, but, in the gross and scope of my opinion, this bodes some strange eruption to our state." "Good now, sit down, and tell me, he that knows, why this same strict and most observant watch so nightly toils the subject of the land, and why such daily cast of brazen cannon, and foreign mart for implements of war," "why such impress of shipwrights, whose sore task does not divide the Sunday from the week..." "What might be toward, that this sweaty haste doth make the night joint-labourer with the day?" " Who is't that can inform me?" " That can I." "At least, the whisper goes so." "Our last king, whose image even but now appear'd to us, was, as you know, by Fortinbras of Norway, thereto prick'd on by a most emulate pride, dar'd to the combat, in which our valiant Hamlet," "for so this side of our known world esteem'd him, did slay this Fortinbras, who, by a seal'd compact, well ratified by law and heraldry, did forfeit, with his life, all those his lands," "which he stood seiz'd of, to the conqueror:" "against the which, a moiety competent was gaged by our king, which had return'd to the inheritance of Fortinbras, had he been vanquisher, as by the same cov'nant, and carriage of the article design'd, his fell to Hamlet." "Now, sir, young Fortinbras, of unimproved mettle hot and full, hath in the skirts of Norway, here and there, shark'd up a list of landless resolutes," "For food and diet, to some enterprise that hath a stomach in't, which is no other, as it doth well appear unto our state, but to recover of us, by strong hand, and terms compulsatory," "those foresaid lands so by his father lost:" "and this, I take it, is the main motive of our preparations, the source of this our watch, and the chief head of this post-haste and romage in the land." "I think it be no other but e'en so:" "well may it sort, that this portentous figure comes armed through our watch, so like the king that was and is the question of these wars." "A mote it is to trouble the mind's eye." "In the most high and palmy state of Rome, a little ere the mightiest Julius fell, the graves stood tenantless, and the sheeted dead did squeak and gibber in the Roman streets, and even the like precurse of feared events," "as harbingers preceding still the fates, and prologue to the omen coming on, have heaven and earth together demonstrated unto our climatures and countrymen, as stars with trains of fire and dews of blood, disasters in the sun, and the moist star," "upon whose influence Neptune's empire stands, was sick almost to doomsday with eclipse:" "but, soft, behold!" "Lo, where it comes again!" "I'll cross it, though it blast me." "Stay, illusion!" "If thou hast any sound, or use of voice, speak to me." "If there be any good thing to be done, that may to thee do ease, and grace to me, speak to me: if thou art privy to thy country's fate, which, happily, foreknowing may avoid, o, speak!" "Or if thou hast uphoarded in thy life extorted treasure in the womb of earth for which, they say, you spirits oft walk in death, speak of it!" " Stay, and speak!" " Stop it, Marcellus!" "Shall I strike at it with my partisan?" " Do, if it will not stand." " 'Tis here!" "'Tis here!" "'Tis gone!" "We do it wrong, being so majestical, to offer it the show of violence, for it is, as the air, invulnerable, and our vain blows malicious mockery." "It was about to speak, when the cock crew." "And then it started, like a guilty thing upon a fearful summons." "I have heard the cock, that is the trumpet to the morn, doth with his lofty and shrill-sounding throat awake the god of day, and at his warning, whether in sea or fire, in earth or air," "the extravagant and erring spirit hies to his confine." "And of the truth herein this present object made probation." "It faded on the crowing of the cock." "Some say that ever 'gainst that season comes wherein our Saviour's birth is celebrated, the bird of dawning singeth all night long, and then, they say, no spirit can walk abroad..." "The nights are wholesome." "Then no planets strike, no fairy takes, nor witch hath power to charm, so hallow'd and so gracious is the time." "So have I heard, and do in part believe it." "But, look, the morn, in russet mantle clad, walks o'er the dew of yon high eastward hill:" "break we our watch up:" "and by my advice, let us impart what we have seen to-night unto young Hamlet, for, upon my life, this spirit, dumb to us, will speak to him." "Do you consent we shall acquaint him with it, as needful in our loves, fitting our duty?" "Let's do't, I pray, and I this morning know where we shall find him most conveniently." "Though yet of Hamlet our dear brother's death the memory be green, and that it us befitted to bear our hearts in grief, and our whole kingdom to be contracted in one brow of woe, yet so far hath discretion fought with nature" "that we with wisest sorrow think on him, together with remembrance of ourselves." "Therefore our sometime sister, now our queen, th' imperial jointress to this warlike state, have we, as 'twere with a defeated joy, with an auspicious and one dropping eye, with mirth in funeral, and with dirge in marriage," "in equal scale weighing delight and dole, taken to wife." "Nor have we herein barr'd your better wisdoms, which have freely gone with this affair along." "For all, our thanks." "Now follows, that you know, young Fortinbras, holding a weak supposal of our worth, or thinking by our late dear brother's death our state to be disjoint and out of frame, colleagued with this dream of his advantage," "He hath not fail'd to pester us with message, importing the surrender of those lands lost by his father, with all bonds of law, to our most valiant brother." "So much for him!" "Now for ourself and for this time of meeting:" "thus much the business is: we have here writ to Norway, uncle of young Fortinbras who, impotent and bed-rid, scarcely hears of this his nephew's purpose, to suppress his further gait herein, in that the levies, the lists, and full proportions are all made out of his subject." "and we here dispatch you, good Cornelius, and you, Voltimand for bearers of this greeting to old Norway, giving to you no further personal power to business with the king, more than the scope of these dilated articles allow." "Farewell, and let your haste commend your duty." "In that and all things will we show our duty." "We doubt it nothing." "Heartily farewell!" "And now, Laertes, what's the news with you?" "You told us of some suit, what is't, Laertes?" "You cannot speak of reason to the Dane, and lose your voice:" "what wouldst thou beg, Laertes, that shall not be my offer, not thy asking?" "The head is not more native to the heart, the hand more instrumental to the mouth, than is the throne of Denmark to thy father." " What wouldst thou have, Laertes?" " My dread lord, your leave and favour to return to France, from whence though willingly I came to Denmark, to show my duty in your coronation," "yet now, I must confess, that duty done, my thoughts and wishes bend again toward France," "and bow them to your gracious leave and pardon." "Have you your father's leave?" "What says Polonius?" "He hath, my lord, wrung from me my slow leave by laboursome petition, and at last upon his will I seal'd my hard consent:" "I do beseech you, give him leave to go." "Take thy fair hour, Laertes, time be thine, and thy best graces." "Spend it at thy will." "But now, my cousin Hamlet, and my son..." "A little more than kin, and less than kind!" "How is it that the clouds still hang on you?" "Not so, my lord," "I am too much i' the sun." "Good Hamlet, cast thy nighted colour off, and let thine eye look like a friend on Denmark." "Do not for ever with thy vailed lids seek for thy noble father in the dust." "Thou know'st 'tis common:" "all that lives must die, passing through nature to eternity." "Ay, madam, it is common." "If it be, why seems it so particular with thee?" "Seems, madam!" "Nay, it is, I know not seems." "'Tis not alone my inky cloak, good mother, nor customary suits of solemn black, nor windy suspiration of forc'd breath, no, nor the fruitful river in the eye, nor the dejected 'havior of the visage," "together with all forms, moods, shapes of grief, that can denote me truly:" "these, indeed, seem, for they are actions that a man might play." "But I have that within which passeth show." "These but the trappings and the suits of woe." "'Tis sweet and commendable in your nature, Hamlet, to give these mourning duties to your father, but, you must know, your father lost a father, that father lost, lost his, and the survivor bound, in filial obligation," "for some term to do obsequious sorrow." "But to persevere in obstinate condolement is a course of impious stubbornness." "'Tis unmanly grief, it shows a will most incorrect to heaven, a heart unfortified, a mind impatient, an understanding simple and unschool'd, for what we know must be, and is as common as any the most vulgar thing to sense." "Why should we, in our peevish opposition, take it to heart?" "Fie!" "'Tis a fault to heaven, a fault against the dead, a fault to nature, to reason most absurd whose common theme is death of fathers, and who still hath cried, from the first corpse till he that died to-day," "'This must be so.'" "We pray you, throw to earth this unprevailing woe, and think of us as of a father." "For let the world take note:" "you are the most immediate to our throne!" "And with no less nobility of love than that which dearest father bears his son do I impart toward you." "For your intent in going back to school in Wittenberg, it is most retrograde to our desire:" "and we beseech you bend you to remain here in the cheer and comfort of our eye, our chiefest courtier, cousin, and our son." "Let not thy mother lose her prayers, Hamlet:" "I pray thee stay with us, go not to Wittenberg." "I shall in all my best obey you, madam." "Why, 'tis a loving and a fair reply:" "be as ourself in Denmark." "Madam, come." "This gentle and unforc'd accord of Hamlet sits smiling to my heart:" "in grace whereof, no jocund health that Denmark drinks to-day but the great cannon to the clouds shall tell, and the king's rouse the heaven shall bruit again, re-speaking earthly thunder." "Come away." "O that this too too solid flesh would melt, thaw, and resolve itself into a dew!" "Or that the everlasting had not fix'd his canon 'gainst self-slaughter!" "O God!" "O God!" "How weary, stale, flat, and unprofitable seem to me all the uses of this world!" "Fie on't!" "Ah fie!" "'Tis an unweeded garden, that grows to seed, things rank and gross in nature possess it merely." "That it should come to this!" "But two months dead!" "Nay, not so much, not two." "So excellent a king, that was, to this," "Hyperion to a satyr, so loving to my mother, that he might not beteem the winds of heaven visit her face too roughly." "Heaven and earth!" "Must I remember?" "Why, she would hang on him as if increase of appetite had grown by what it fed on:" "and yet, within a month!" "Let me not think on't..." "Frailty, thy name is woman!" "A little month, or ere those shoes were old with which she followed my poor father's body like Niobe, all tears, why she, even she, o God!" "A beast that wants discourse of reason, would have mourn'd longer!" "Married with mine uncle, my father's brother but no more like my father than I to Hercules: within a month!" "Ere yet the salt of most unrighteous tears had left the flushing in her galled eyes she married." "O, most wicked speed!" "To post with such dexterity to incestuous sheets!" "It is not, nor it cannot come to good." "But break my heart, for I must hold my tongue!" " Hail to your lordship!" " I am glad to see you well:" "Horatio... or I do forget myself?" "The same, my lord, and your poor servant ever." "Sir, my good friend, I'll change that name with you!" "And what make you from Wittenberg, Horatio?" " Marcellus!" " My good lord." "I am very glad to see you." "Good even, sir." "But what, in faith, make you from Wittenberg?" " A truant disposition, good my lord." " I would not hear your enemy say so nor shall you do my ear that violence, to make it truster of your own report against yourself." "I know you are no truant." "But what is your affair in Elsinore?" "We'll teach you to drink deep ere you depart." "My lord, I came to see your father's funeral." "I prithee do not mock me, fellow-student." "I think it was to see my mother's wedding." " Indeed, my lord, it follow'd hard upon." " Thrift, thrift, Horatio!" "The funeral bak'd meats did coldly furnish forth the marriage tables." "Would I had met my dearest foe in heaven, or ever I had seen that day, Horatio!" "My father..." "Methinks I see my father." "Where, my lord?" "In my mind's eye, Horatio." "I saw him once." "He was a goodly king." "He was a man, take him for all in all," " I shall not look upon his like again." " My lord..." "I think" "I saw him yesternight." "Saw... who?" "My lord, the king!" "Your father." " The King my father!" " Season your admiration for awhile with an attent ear, till I may deliver, upon the witness of these gentlemen," " this marvel to you!" " For God's love let me hear!" "Two nights together had these gentlemen, Marcellus and Bernardo, on their watch in the dead vast and middle of the night, been thus encounter'd a figure like your father, armed at point exactly, cap-a-pe," "appears before them and with solemn march goes slow and stately by them." "Thrice he walk'd by their oppress'd and fear-surprised eyes, within his truncheon's length... whilst they, distill'd almost to jelly with the act of fear, stand dumb, and speak not to him." "This to me in dreadful secrecy impart they did, and I with them the third night kept the watch." "Where, as they had deliver'd, both in time, form of the thing, each word made true and good, the apparition comes!" "I knew your father, these hands are not more like!" "But where was this?" "My lord, upon the platform where we watch'd." " Did you not speak to it?" " My lord, I did, but answer made it none." "Yet once methought it lifted up it head, and did address itself to motion, like as it would speak..." "But even then the morning cock crew loud, and at the sound it shrunk in haste away, and vanish'd from our sight." " 'Tis very strange." " As I do live, my honour'd lord, 'tis true, and we did think it writ down in our duty to let you know of it." "Indeed, indeed, sirs, but this troubles me." " Hold you the watch to-night?" " My lord, we do." " Arm'd, say you?" " Arm'd, my lord." " From top to toe?" " My lord, from head to foot." " Then saw you not his face?" " O, yes, my lord: he wore his beaver up." "What, look'd he frowningly?" "A countenance more in sorrow than in anger." " Pale or red?" " Nay, very pale." " And fix'd his eyes upon you?" " Most constantly." " I would I had been there." " It would have much amaz'd you." "Very like, very like." "Stay'd it long?" "While one with moderate haste might tell a hundred." " Longer." " Not when I saw't." "His beard was grizzled, no?" "It was, as I have seen it in his life, a sable silver'd." "I will watch to-night." " Perchance 'twill walk again." " I warrant you it will." "If it assume my noble father's person, I'll speak to it, though hell itself should gape and bid me hold my peace." "I pray you all, if you have hitherto conceal'd this sight, let it be tenable in your silence still, and... whatsoever else shall hap to-night, give it an understanding, but no tongue." "I will requite your loves." "So, fare ye well." "Upon the platform, 'twixt eleven and twelve, I'll visit you." " Our duty to your honour." " Your loves, as mine to you: farewell." "My father's spirit in arms!" "All is not well," "I doubt some foul play:" "would the night were come!" "Till then sit still, my soul." "Foul deeds will rise, though all the earth o'erwhelm them, to men's eyes." "My necessaries are embark'd: farewell:" "and, sister, as the winds give benefit and convoy is assistant, do not sleep," " but let me hear from you." " Do you doubt that?" "For Hamlet, and the trifling of his favour, hold it a fashion, and a toy in blood:" "a violet in the youth of primy nature, forward, not permanent, sweet, not lasting, the perfume and suppliance of a minute, no more." " No more but so?" " Think it no more:" "for nature, crescent, does not grow alone in thews and bulk, but as this temple waxes, the inward service of the mind and soul grows wide withal." "Perhaps he loves you now, and now no soil nor cautel doth besmirch the virtue of his will:" "but you must fear, his greatness weigh'd, his will is not his own, for he himself is subject to his birth:" "he may not, as unvalu'd persons do, carve for himself, for on his choice depends the sanity and health of this whole state, and therefore must his choice be circumscrib'd unto the voice and yielding" "of that body whereof he is the head." "Then if he says he loves you, it fits your wisdom so far to believe it as he in his particular act and place may give his saying deed, which is no further than the main voice of Denmark goes withal." "Then weigh what loss your honour may sustain if with too credent ear you list his songs, or lose your heart," "or your chaste treasure open to his unmaster'd importunity." "Fear it, Ophelia, fear it, my dear sister, and keep you in the rear of your affection, out of the shot and danger of desire." "The chariest maid is prodigal enough if she unmask her beauty to the moon:" "virtue itself 'scapes not calumnious strokes:" "the canker galls the infants of the spring too oft before their buttons be disclos'd:" "and in the morn and liquid dew of youth contagious blastments are most imminent." "Be wary then, best safety lies in fear:" "youth to itself rebels, though none else near." "I shall th' effect of this good lesson keep as watchman to my heart." "But, good my brother, do not, as some ungracious pastors do, show me the steep and thorny way to heaven, whilst, like a puff'd and reckless libertine, himself the primrose path of dalliance treads" "and recks not his own read." "O, fear me not." " I stay too long." " Yet here, Laertes!" "But here my father comes." "A double blessing is a double grace." " Occasion smiles upon a second leave." " Aboard, aboard, for shame!" "The wind sits in the shoulder of your sail, and you are stay'd for." "There, my blessing with thee!" "And these few precepts in thy memory see thou character." "Give thy thoughts no tongue, nor any unproportion'd thought his act." "Be thou familiar, but by no means vulgar." "Those friends thou hast, and their adoption tried, grapple them unto thy soul with hoops of steel, but do not dull thy palm with entertainment of each new-hatch'd, unfledg'd comrade." "Beware of entrance to a quarrel, but, being in, bear't that the opposed may beware of thee." "Give every man thine ear, but few thy voice:" "take each man's censure, but reserve thy judgment." "Costly thy habit as thy purse can buy, but not express'd in fancy, rich, not gaudy: for the apparel oft proclaims the man, and they in France of the best rank and station are most select and generous chief in that." "Neither a borrower nor a lender be:" "for loan oft loses both itself and friend, and borrowing dulls the edge of husbandry." "This above all, to thine own self be true, and it must follow, as the night the day, thou canst not then be false to any man." "Farewell: my blessing season this in thee!" "Most humbly do I take my leave, my lord." "The time invites you, go, your servants tend." "Farewell, Ophelia, and remember well what I have said to you." "'Tis in my memory lock'd," "And you yourself shall keep the key of it." "Farewell." "What is't, Ophelia, he hath said to you?" "So please you, something touching the Lord Hamlet." "Marry, well bethought: 'tis told me he hath very oft of late given private time to you, and you yourself have of your audience been most free and bounteous." "If it be so, as so 'tis put on me, and that in way of caution," "I must tell you, you do not understand yourself so clearly as it behooves my daughter and your honour." "What is between you?" "Give me up the truth." "He hath, my lord, of late made many tenders of his affection to me." "Affection!" "Pooh!" "You speak like a green girl, unsifted in such perilous circumstance." "Do you believe his tenders, as you call them?" "I do not know, my lord, what I should think." "Marry, I'll teach you:" "think yourself a baby, that you have ta'en these tenders for true pay, which are not sterling." "Tender yourself more dearly, or, not to crack the wind of the poor phrase, wronging it thus, you'll tender me a fool." "My lord, he hath importun'd me with love in honourable fashion." "Ay, fashion you may call it, go to, go to." "And hath given countenance to his speech, my lord, with almost all the holy vows of heaven." "Ay, springes to catch woodcocks." "I do know, when the blood burns, how prodigal the soul lends the tongue vows:" "these blazes, daughter, giving more light than heat, extinct in both, even in their promise, as it is a-making, you must not take for fire." "From this time, daughter, be somewhat scanter of your maiden presence, set your entreatments at a higher rate than a command to parley." "For Lord Hamlet, believe so much in him, that he is young, and with a larger tether may he walk than may be given you." "In few, Ophelia, do not believe his vows, for they are brokers, not of that dye which their investments show, but mere implorators of unholy suits, breathing like sanctified and pious bawds, the better to beguile." "This is for all, I would not, in plain terms, from this time forth have you so slander any moment leisure as to give words or talk with the Lord Hamlet." "Look to't, I charge you, come your ways." "I shall obey," "my lord." "The air bites shrewdly, it is very cold." " It is a nipping and an eager air." " What hour now?" " I think it lacks of twelve." " No, it is struck." "Indeed?" "I heard it not..." "Then it draws near the season wherein the spirit held his wont to walk." "What does this mean, my lord?" "The King doth wake to-night and takes his rouse, keeps wassail, and the swaggering up-spring reels, and, as he drains his draughts of Rhenish down, the kettle-drum and trumpet thus bray out the triumph of his pledge." " Is it a custom?" " Ay, marry, is't." "But to my mind, though I am native here, and to the manner born, it is a custom more honour'd in the breach than the observance." "This heavy-headed revel east and west makes us traduc'd and tax'd of other nations:" "they clepe us drunkards, and with swinish phrase soil our addition, and, indeed, it takes from our achievements, though perform'd at height, the pith and marrow of our attribute." "So oft it chances in particular men that, for some vicious mole of nature in them, as in their birth, wherein they are not guilty, since nature cannot choose his origin, by the o'ergrowth of some complexion," "oft breaking down the pales and forts of reason, or by some habit, that too much o'er-leavens the form of plausive manners, that these men, carrying, I say, the stamp of one defect," "being nature's livery, or fortune's star, their virtues else, be they as pure as grace, as infinite as man may undergo, shall in the general censure take corruption from that particular fault." "The dram of evil doth all the noble substance of a doubt" " to his own scandal." " Look, my lord, it comes!" "It beckons you to go away with it..." "As if it some impartment did desire to you alone." "Look with what courteous action it waves you to a more removed ground!" " But do not go with it!" " No, by no means." " It will not speak, then will I follow it." " Do not, my lord." "Why, what should be the fear?" "I do not set my life at a pin's fee, and for my soul, what can it do to that, being a thing immortal as itself?" "It waves me forth again, I'll follow it." "What if it tempt you toward the flood, my lord, or to the dreadful summit of the cliff that beetles o'er his base into the sea, and there assume some other horrible form which might deprive your sovereignty of reason, and draw you into madness?" "Think of it: the very place puts toys of desperation, without more motive, into every brain that looks so many fathoms to the sea and hears it roar beneath." "It waves me still." "Go on, I'll follow thee." " You shall not go, my lord." " Hold off your hands." " Be rul'd, you shall not go!" " My fate cries out, and makes each petty artery in this body as hardy as the Nemean lion's nerve." "Still am I call'd." "Unhand me, gentlemen!" "By heaven," "I'll make a ghost of him that lets me!" "I say, away!" "Go on," " I'll follow thee." " He waxes desperate with imagination." "Let's follow, 'tis not fit thus to obey him." "Have after." "To what issue will this come?" "Something is rotten in the state of Denmark." " Heaven will direct it." " Nay, let's follow him." "Angels and ministers of grace defend us!" "Be thou a spirit of health or goblin damn'd, bring with thee airs from heaven or blasts from hell, be thy intents wicked or charitable, thou comest in such a questionable shape that I will speak to thee!" "I'll call thee Hamlet, king, father, royal Dane: o, answer me!" "Let me not burst in ignorance, but tell why thy canonized bones, hearsed in death, have burst their cerements, why the sepulchre, wherein we saw thee quietly inurn'd, hath oped his ponderous and marble jaws, to cast thee up again." "What may this mean, that thou, dead corse, again in complete steel revisit'st thus the glimpses of the moon, making night hideous, and we fools of nature so horridly to shake our dispositions with thoughts beyond the reaches of our souls?" "Say, why is this?" "Wherefore?" "What should we do?" "Whither wilt thou lead me?" "Speak!" "I'll go no further." " Mark me." " I will." "My hour is almost come, when I to sulfurous and tormenting flames" " must render up myself." " Alas, poor ghost!" "Pity me not, but lend thy serious hearing to what I shall unfold." " Speak, I am bound to hear." " So art thou to revenge," " when thou shalt hear." " What?" "I am thy father's spirit, doom'd for a certain term to walk the night, and for the day confin'd to fast in fires, till the foul crimes done in my days of nature are burnt and purg'd away." "But that I am forbid to tell the secrets of my prison-house," "I could a tale unfold whose lightest word would harrow up thy soul, freeze thy young blood, make thy two eyes, like stars, start from their spheres, thy knotted and combined locks to part, and each particular hair to stand on end" "like quills upon the fretful porcupine:" "but this eternal blazon must not be to ears of flesh and blood." "List, list, O, list!" "If thou didst ever" " thy dear father love..." " O God!" "Revenge his foul and most unnatural murder." " Murder!" " Murder most foul, as in the best it is, but this most foul, strange, and unnatural." "Haste me to know't, that I, with wings as swift as meditation or the thoughts of love," " may sweep to my revenge." " I find thee apt, and duller shouldst thou be than the fat weed that roots itself in ease on Lethe wharf, wouldst thou not stir in this." "Now, Hamlet, hear. 'Tis given out that, sleeping in my orchard, a serpent stung me, so the whole ear of Denmark is by a forged process of my death rankly abus'd!" "But know, thou noble youth, the serpent that did sting thy father's life" " now wears his crown." " O my prophetic soul!" "Mine uncle!" "Ay, that incestuous, that adulterate beast, with witchcraft of his wit, with traitorous gifts, o wicked wit and gifts, that have the power so to seduce!" "won to his shameful lust the will of my most seeming-virtuous queen!" "O Hamlet..." "What a falling-off was there!" "From me, whose love was of that dignity that it went hand in hand even with the vow I made to her in marriage, and to decline upon a wretch whose natural gifts were poor to those of mine!" "But virtue, as it never will be mov'd, though lewdness court it in a shape of heaven, so lust, though to a radiant angel link'd, will sate itself in a celestial bed and prey on garbage." "But soft!" "methinks I scent the morning air, brief let me be." "Sleeping within my orchard, my custom always of the afternoon, upon my secure hour thy uncle stole, with juice of cursed hebenon in a vial, and in the porches of my ears did pour the leperous distilment," "whose effect holds such an enmity with blood of man that, swift as quicksilver, it courses through the natural gates and alleys of the body, and with a sudden vigour it doth posset and curd, like eager droppings into milk, the thin and wholesome blood," "so did it mine, and a most instant tetter bark'd about, most lazar-like, with vile and loathsome crust all my smooth body." "Thus was I, sleeping, by a brother's hand, of life, of crown, of queen, at once dispatch'd:" "cut off even in the blossoms of my sin, unhous'led, disappointed, unanel'd, no reckoning made, but sent to my account with all my imperfections on my head." "O, horrible!" "O, horrible!" "Most horrible!" "If thou hast nature in thee, bear it not, let not the royal bed of Denmark be a couch for luxury and damned incest." "But, howsoever thou pursu'st this act, taint not thy mind, nor let thy soul contrive against thy mother aught:" "leave her to heaven, and to those thorns that in her bosom lodge, to prick and sting her." "Fare thee well at once!" "The glowworm shows the mating to be near, and 'gins to pale his uneffectual fire." "Adieu, adieu!" "Hamlet." "Remember me!" "O all you host of heaven!" "O earth!" "what else?" "And shall I couple hell?" "O, fie!" "Hold, hold, my heart, and you, my sinews, grow not instant old, but bear me stiffly up." "Remember thee!" "Ay, thou poor ghost, whiles memory holds a seat in this distracted globe." "Remember thee!" "Yea, from the table of my memory I'll wipe away all trivial fond records, all saws of books, all forms, all pressures past, that youth and observation copied there, and thy commandment all alone shall live within the book and volume of my brain," "unmix'd with baser matter: yes, by heaven!" "O most pernicious woman!" "O villain, villain, smiling, damned villain!" "My tables, meet it is I set it down, that one may smile, and smile, and be a villain, at least, I am sure, it may be so in Denmark." "So, uncle, there you are." "Now to my word." "It is 'Adieu, adieu!" "Remember me.'" "I have sworn't." "My lord!" "My lord!" " Lord Hamlet," " Heaven secure him!" "So be it!" "Hillo, ho, ho, boy!" " Come, bird, come!" " How is't, my lord?" " What news, my lord?" " O, wonderful!" " Good my lord, tell it." " No, you'll reveal it." " Not I, my lord, by heaven." " Nor I, my lord." "How say you then, would heart of man once think it?" "But you'll be secret?" "Ay, by heaven, my lord." "There's ne'er a villain dwelling in all Denmark but he's an arrant knave." "There needs no ghost, my lord, come from the grave to tell us this." "Why, right." "You are i' the right, and so, without more circumstance at all," "I hold it fit that we shake hands and part you, as your business and desires shall point you, for every man hath business and desire, such as it is, and for my own poor part, look you, I'll go pray." "These are but wild and whirling words, my lord." "I'm sorry they offend you, heartily, yes, faith, heartily." " There's no offence, my lord." " Yes, by Saint Patrick, but there is, Horatio, and much offence too." "Touching this vision here, it is an honest ghost, that let me tell you:" "for your desire to know what is between us, o'ermaster't as you may." "And now, good friends, as you are friends, scholars, and soldiers," " give me one poor request." " What is't, my lord?" "We will." "Never make known what you have seen to-night." " My lord, we will not." " Nay, but swear't." " In faith, my lord, not I." " Nor I, my lord, not I." " Upon my sword." " We have sworn, my lord, already." " Indeed, upon my sword, indeed." " Swear." "Ha, ha boy!" "Say'st thou so?" "Art thou there, truepenny?" "Come on!" "you hear this fellow in the cellarage, consent to swear." "Propose the oath, my lord." "Never to speak of this that you have seen, swear by my sword." " Swear." " Hic et ubique?" "Then we'll shift our ground." "Come hither, gentlemen, and lay your hands again upon my sword never to speak of this that you have heard, swear by my sword." " Swear." " Well said, old mole!" "Canst work i' the earth so fast?" "A worthy pioneer!" "Once more remove, good friends." "O day and night, but this is wondrous strange!" "And therefore as a stranger give it welcome." "There are more things in heaven and earth, Horatio, than are dreamt of in our philosophy." "But come, here, as before, never so help you mercy, how strange or odd soe'er I bear myself, as I, perchance, hereafter shall think meet to put an antic disposition on, that you, at such times seeing me, never shall," "with arms encumber'd thus, or this head-shake, or by pronouncing of some doubtful phrase, as:" "'Well, we know', or 'We could, an if we would', or 'If we list to speak', or 'There be, an if they might', or such ambiguous giving out, to note that you know aught of me:" "this is not to do, so grace and mercy at your most need help you!" " Swear." " Swear." "Rest, rest," "perturbed spirit!" "So, gentlemen, with all my love I do commend me to you:" "and what so poor a man as Hamlet is may do to express his love and friending to you," "God willing, shall not lack." "Let us go in together and still your fingers on your lips, I pray." "The time is out of joint." "O cursed spite, that ever I was born to set it right!" "Nay, come." "Let's go together." "Give him this money and these notes, Reynaldo." "I will, my lord." "You shall do marvellous wisely, good Reynaldo, before you visit him, to make inquiry of his behaviour." " My lord, I did intend it." " Marry, well said, very well said." "Look you, sir, enquire me first what Danskers are in Paris, and how, and who, what means, and where they keep, what company, at what expense, and finding, by this encompassment and drift of question," "that they do know my son, come you more nearer than your particular demands will touch it." "Take you, as 'twere, some distant knowledge of him, as thus, 'I know his father and his friends, and in part him'." " Do you mark this, Reynaldo?" " Ay, very well, my lord." "'And in part him, but', you may say, 'not well: but if't be he I mean, he's very wild, addicted so and so,' and there put on him what forgeries you please." "Marry, none so rank as may dishonour him, take heed of that, but, sir, such wanton, wild, and usual slips as are companions noted and most known to youth and liberty." "As gaming, my lord." "Ay, or drinking, fencing, swearing, quarrelling, drabbing..." "You may go so far." "My lord, that would dishonour him." "Faith, no, as you may season it in the charge." "You must not put another scandal on him, that he is open to incontinency, that's not my meaning:" "but breathe his faults so quaintly that they may seem the taints of liberty, the flash and outbreak of a fiery mind, a savageness in unreclaimed blood," " of general assault." " But, my good lord," " Wherefore should you do this?" " Ay, my lord, I would know that." "Marry, sir, here's my drift, and I believe it is a fetch of warrant." "You laying these slight sullies on my son as 'twere a thing a little soil'd i' the working, mark you, your party in converse, him you would sound, having ever seen in the prenominate crimes the youth you breathe of guilty," "be assur'd he closes with you in this consequence," "'Good sir,' or so, or 'friend,' or 'gentleman' according to the phrase or the addition of man and country." " Very good, my lord." " And then, sir, does he this, he does..." "What was I about to say?" "By the mass, I was about to say something: where did I leave?" "At 'closes in the consequence,' at 'friend or so,' and gentleman.'" "At 'closes in the consequence' ay, marry!" "He closes with you thus:" "'I know the gentleman, I saw him yesterday, or t'other day, or then, or then, with such, or such, and, as you say, there was he gaming, there o'ertook in's rouse, there falling out at tennis':" "or perchance, 'I saw him enter such a house of sale,' videlicet, a brothel, or so forth." "See you now, your bait of falsehood takes this carp of truth:" "and thus do we of wisdom and of reach, with windlaces, and with assays of bias, by indirections find directions out." "So, by my former lecture and advice, shall you my son." " You have me, have you not?" " My lord, I have." "God b' wi' you, fare you well." "Good my lord!" " Observe his inclination in yourself." " I shall, my lord." "And let him ply his music." " Well, my lord." " Farewell!" " My lord!" " How now, Ophelia!" "what's the matter?" " Alas, my lord, I have been so affrighted!" " With what, i' the name of God?" "My lord, as I was sewing in my chamber, lord Hamlet, with his doublet all unbrac'd, no hat upon his head, his stockings foul'd, ungart'red, and down-gyved to his ankle," "pale as his shirt, his knees knocking each other, and with a look so piteous in purport as if he had been loosed out of hell to speak of horrors, he comes before me." " Mad for thy love?" " My lord, I do not know," " but truly I do fear it." " What said he?" "He took me by the wrist, and held me hard, then goes he to the length of all his arm, and with his other hand thus o'er his brow, he falls to such perusal of my face as he would draw it." "Long stay'd he so, at last, a little shaking of mine arm, and thrice his head thus waving up and down, he rais'd a sigh so piteous and profound as it did seem to shatter all his bulk and end his being." "That done, he lets me go and, with his head over his shoulder turn'd" "he seem'd to find his way without his eyes, for out o' doors he went without their help," "and to the last bended their light on me." "Come, go with me:" "I will go seek the king." "This is the very ecstasy of love, whose violent property fordoes itself, and leads the will to desperate undertakings, as oft as any passion under heaven that does afflict our natures." "I am sorry, what, have you given him any hard words of late?" "No, my good lord!" "but, as you did command, I did repel his letters and denied his access to me." "That hath made him mad." "I am sorry that with better heed and judgment I had not quoted him:" "I fear'd he did but trifle, and meant to wreck thee, but beshrew my jealousy!" "By heaven, it is as proper to our age to cast beyond ourselves in our opinions as it is common for the younger sort to lack discretion." "Come, go we to the king:" "this must be known, which, being kept close, might move more grief to hide than hate to utter love." "Come." "Welcome, dear Rosencrantz and Guildenstern!" "Moreover that we much did long to see you, the need we have to use you did provoke our hasty sending." "Something have you heard of Hamlet's transformation, so I call it, since nor the exterior nor the inward man resembles that it was." "What it should be, more than his father's death, that thus hath put him so much from the understanding of himself, I cannot dream of:" "I entreat you both that, being of so young days brought up with him, and since so neighbour'd to his youth and humour, that you vouchsafe your rest here in our court some little time:" "so by your companies to draw him on to pleasures, and to gather, so much as from occasion you may glean, whether aught, to us unknown, afflicts him thus, that, open'd, lies within our remedy." "Good gentlemen, he hath much talk'd of you, and sure I am two men there are not living to whom he more adheres." "If it will please you to show us so much gentry and good-will as to expend your time with us awhile, for the supply and profit of our hope, your visitation shall receive such thanks as fits a king's remembrance." "Both your majesties might, by the sovereign power you have of us, put your dread pleasures more into command than to entreaty." "But we both obey, and here give up ourselves, in the full bent, to lay our service freely at your feet, to be commanded." "Thanks, Rosencrantz and gentle Guildenstern." "Thanks, Guildenstern and gentle Rosencrantz:" "and I beseech you instantly to visit my too-much-changed son." "Go, some of you, and bring these gentlemen where Hamlet is." "Heavens make our presence and our practices pleasant and helpful to him!" "Ay, amen!" "Th' ambassadors from Norway, my good lord, are joyfully return'd." "Thou still hast been the father of good news." "Have I, my lord?" "Assure you, my good liege, I hold my duty, as I hold my soul, both to my God and to my gracious king." "And I do think... or else this brain of mine hunts not the trail of policy so sure as it hath us'd to do, that I have found the very cause of Hamlet's lunacy." "O, speak of that!" "That do I long to hear." "Give first admittance to the ambassadors." "My news shall be the fruit to that great feast." "But thyself do grace to them, and bring them in." "He tells me, my dear Gertrude, he hath found the head and source of all your son's distemper." "I doubt it is no other but the main, his father's death and our o'erhasty marriage." "Well, we shall sift him." "Welcome, my good friends!" "Say, Voltimand, what from our brother Norway?" "Most fair return of greetings and desires." "Upon our first, he sent out to suppress his nephew's levies, which to him appear'd to be a preparation 'gainst the Polack, but, better look'd into, he truly found it was against your highness," "whereat griev'd, that so his sickness, age, and impotence was falsely borne in hand, sends out arrests on Fortinbras, which he, in brief, obeys, receives rebuke from Norway and, in fine, makes vow before his uncle" "never more to give th' assay of arms against your majesty." "whereon old Norway, overcome with joy, gives him three thousand crowns in annual fee, and his commission to employ those soldiers, so levied as before, against the Polack: with an entreaty, herein further shown," "that it might please you to give quiet pass through your dominions for this enterprise, on such regards of safety and allowance" " as therein are set down." " It likes us well, and at our more consider'd time we'll read, answer, and think upon this business." "Meantime we thank you for your well-took labour: go to your rest." "At night we'll feast together: most welcome home!" "This business is well ended." "My liege, and madam, to expostulate what majesty should be, what duty is, why day is day, night night, and time is time, were nothing but to waste night, day, and time." "Therefore, since brevity is the soul of wit, and tediousness the limbs and outward flourishes, I will be brief." "Your noble son is mad: mad call I it, for to define true madness, what is't but to be nothing else but mad?" " But let that go." " More matter, with less art." "Madam, I swear I use no art at all." "That he is mad, 'tis true:" "'tis true 'tis pity, and pity 'tis 'tis true:" "a foolish figure, but farewell it, for I will use no art." "Mad let us grant him then: and now remains that we find out the cause of this effect, or rather say, the cause of this defect, for this effect defective comes by cause:" "thus it remains, and the remainder thus." "Perpend." "Ophelia!" "I have a daughter, have whilst she is mine, who, in her duty and obedience, mark, hath given me this." "Now gather, and surmise." "'To... the... celestial, and my soul's idol, the most beautified Ophelia,'" "That's an ill phrase, a vile phrase, 'beautified' is a vile phrase, but you shall hear." "These:" "'In... her... excellent... white... bosom, these...'" "Came this from Hamlet to her?" "Good madam, stay awhile, I will be faithful." "'Doubt thou the stars are fire, doubt that the sun doth move, doubt truth to be a liar, but never doubt I love.'" "O dear Ophelia, I am ill at these numbers, I have not art to reckon my groans:" "but that I love thee best," "O most best, believe it." "Adieu." "Thine evermore." "'Most dear lady, whilst this machine is to him, Hamlet.'" "This, in obedience, hath my daughter show'd me, and more above, hath his solicitings, as they fell out by time, by means, and place," " all given to mine ear." " But how hath she receiv'd his love?" " What do you think of me?" " As of a man faithful and honourable." "I would fain prove so." "But what might you think, when I had seen this hot love on the wing, as I perceiv'd it, I must tell you that, before my daughter told me, what might you, or my dear majesty your queen here, think," "if I had play'd the desk or table-book, or given my heart a winking, mute and dumb, or look'd upon this love with idle sight, what might you think?" "No, I went round to work, and my young mistress thus I did bespeak:" "'Lord Hamlet is a prince, out of thy star, this must not be' and then I precepts gave her, that she should lock herself from his resort, admit no messengers, receive no tokens." "Which done, she took the fruits of my advice, and he, repulsed, a short tale to make, fell into a sadness, then into a fast, thence to a watch, thence into a weakness, thence to a lightness." "And, by this declension, into the madness wherein now he raves, and all we wail for." " Do you think 'tis this?" " It may be, very like." "Hath there been such a time, I'd fain know that... that I have positively said "Tis so,'" " when it prov'd otherwise?" " Not that I know." "Take this from this, if this be otherwise:" "if circumstances lead me, I will find where truth is hid, though it were hid indeed within the centre." "How may we try it further?" "You know sometimes he walks four hours together here in the lobby." "So he does indeed." "At such a time I'll loose my daughter to him:" "be you and I behind an arras then, mark the encounter:" "if he love her not, and he not from his reason fall'n thereon let me be no assistant for a state, but keep a farm and carters." " We will try it." " But look where sadly the poor wretch comes reading." "Away, I do beseech you, both away I'll board him presently." "O, give me leave." "How does my good Lord Hamlet?" "Well, God-a-mercy." " Do you know me, my lord?" " Excellent well, you're a fishmonger." " Not I, my lord." " Then I would you were so honest a man." " Honest, my lord!" " Ay, sir, to be honest, as this world goes, is to be one man picked out of ten thousand." "That's very true, my lord." "For if the sun breed maggots in a dead dog, being a god-kissing carrion..." " Have you a daughter?" " I have, my lord." "Let her not walk i' the sun:" "conception is a blessing, but not as your daughter may conceive." "Friend, look to't." "How say you by that?" "Still harping on my daughter:" "Yet he knew me not at first, he said I was a fishmonger." "Is far gone, far gone:" "and truly in my youth I suffered much extremity for love, very near this." "I'll speak to him again." " What do you read, my lord?" " Words." "Words." "Words!" " What is the matter, my lord?" " Between who?" " I mean, the matter that you read, my lord." " Slanders, sir:" "for the satirical rogue says here that old men have grey beards, that their faces are wrinkled, their eyes purging thick amber and plum-tree gum, and that they have a plentiful lack of wit, together with most weak hams:" "all which, sir, though I most powerfully and potently believe, yet I hold it not honesty to have it thus set down, for you yourself, sir, shall grow old as I am, if, like a crab, you could go backward." "Though this be madness, yet there is a method in't." "Will you walk out of the air, my lord?" " Into my grave?" " Indeed, that is out o' the air." "How pregnant sometimes his replies are!" "A happiness that often madness hits on, which reason and sanity could not so prosperously be delivered of." "I will leave him and suddenly contrive the means of meeting between him and my daughter." "My lord?" "My lored, I will take my leave of you." "You cannot, sir, take from me anything I would more willingly part withal, except my life." "Except my life..." " Except my life." " Fare you well, my lord." "These tedious old fools!" "My honoured lord!" "You go to seek the Lord Hamlet?" "There he is." "My honoured lord!" " My most dear lord!" " My excellent good friends!" "How dost thou, Guildenstern?" "Ah, Rosencrantz!" " Good lads, how do ye both?" " As the indifferent children of the earth." "Happy in that we are not over-happy, on fortune's cap we are not the very button." " Nor the soles of her shoe?" " Neither, my lord." "Then you live about her waist, or in the middle of her favours?" "Faith, her privates we." "In the secret parts of fortune?" "O, most true, she is a strumpet." "What's the news?" "None, my lord, but that the world's grown honest." "Then is doomsday near, but your news is not true." "Let me question more in particular:" "what have you, my good friends, deserved at the hands of fortune" " that she sends you to prison hither?" " Prison, my lord!" " Denmark's a prison." " Then is the world one." "A goodly one, in which there are many confines, wards, and dungeons," " Denmark being one o' the worst." " We think not so, my lord." "Why, then 'tis none to you, for there is nothing either good or bad but thinking makes it so:" "to me it is a prison." "Why, then, your ambition makes it one, 'tis too narrow for your mind." "O God, I could be bounded in a nutshell, and count myself a king of infinite space, were it not that I have bad dreams." "Which dreams, indeed, are ambition, for the very substance of the ambitious is merely the shadow of a dream." "A dream itself is but a shadow." "Truly, and I hold ambition of so airy and light a quality that it is but a shadow's shadow." "Then are our beggars bodies, and our monarchs and outstretch'd heroes the beggars' shadows." "Shall we to the court?" "For, by my fay, I cannot reason." " We'll wait upon you." " No such matter:" "I will not sort you with the rest of my servants, for... to speak to you like an honest man, I am most dreadfully attended." "But, in the beaten way of friendship, what make you at Elsinore?" "To visit you, my lord, no other occasion." "Beggar that I am, I am even poor in thanks, but I thank you:" "and sure, dear friends, my thanks are too dear a halfpenny." "Were you not sent for?" "Is it your own inclining?" "Is it a free visitation?" "Come, deal justly with me." " Come, come nay, speak." " What should we say, my lord?" "Why, anything but to the purpose." "You were sent for, and there is a kind of confession in your looks, which your modesties have not craft enough to colour:" "I know the good king and queen have sent for you." " To what end, my lord?" " That you must teach me." "But let me conjure you, by the rights of our fellowship, by the consonancy of our youth, by the obligation of our ever-preserved love, and by what more dear a better proposer could charge you withal," "be even and direct with me, whether you were sent for or no." " What say you?" " Nay, then, I have an eye of you." "If you love me, hold not off." "My lord, we were sent for." "I will tell you why, so shall my anticipation prevent your discovery, and your secrecy to the king and queen moult no feather." "I have of late, but wherefore I know not, lost all my mirth, forgone all custom of exercises, and indeed, it goes so heavily with my disposition that this... goodly frame, the earth, seems to me a sterile promontory." "This most excellent canopy, the air, look you, this... brave o'erhanging firmament, this... majestical roof fretted with golden fire, why, it appears no other thing to me than a foul and pestilent congregation of vapours." "What a piece of work is man!" "How noble in reason!" "How infinite in faculties!" "In form and moving, how express and admirable!" "In action how like an angel, in apprehension, how like a god!" "The beauty of the world!" "The paragon of animals!" "And yet, to me, what is this... quintessence of dust?" "Man delights not me." "No, nor woman neither, though by your smiling you seem to say so." "My lord, there was no such stuff in my thoughts." "Why did you laugh then, when I said 'Man delights not me'?" "To think, my lord, if you delight not in man, what lenten entertainment the players shall receive from you." "We coted them on the way, and hither are they coming to offer you service." "He that plays the king shall be welcome, his majesty shall have tribute of me." "The adventurous knight shall use his foil and target, the lover shall not sigh gratis, the humorous man shall end his part in peace." "The clown shall make those laugh whose lungs are tickle o' the sere and the lady shall speak her mind freely, or the blank verse shall halt for't." "What players are they?" "Even those you were wont to take such delight in," " the tragedians of the city." " How chances it they travel?" "Their residence, both in reputation and profit, was better both ways." "I think their inhibition comes by the means of the late innovation." "Do they hold the same estimation they did when I was in the city?" "Are they so followed?" " No, indeed, are they not." " How comes it?" "Do they grow rusty?" "Nay, their endeavour keeps in the wonted pace:" "but there is, sir, an aery of children, little eyases, that cry out on the top of question, and are most tyrannically clapped for't:" "these are now the fashion, and so berattle the common stages, so they call them, that many wearing rapiers are afraid of goose-quills and dare scarce come thither." "What, are they children?" "Who maintains 'em?" "How are they escoted?" "Will they pursue the quality no longer than they can sing?" "Will they not say afterwards, if they should grow themselves to common players, as it is most like, if their means are no better, their writers do them wrong to make them exclaim against their own succession?" "Faith, there has been much to do on both sides and the nation holds it no sin to tarre them to controversy:" "there was, for awhile, no money bid for argument unless the poet and the player went to cuffs in the question." "Is't possible?" "O, there has been much throwing about of brains." "Do the boys carry it away?" "Ay, that they do, my lord, Hercules and his load too." "It is not very strange, for my uncle is king of Denmark, and those that would make mouths at him while my father lived, give twenty, forty, fifty, a hundred ducats a-piece for his picture in little." "'Sblood, there is something in this more than natural, if philosophy could find it out." "There are the players." "Gentlemen, you are welcome to Elsinore." "Your hands, come:" "the appurtenance of welcome is fashion and ceremony." "Let me comply with you in this garb, lest my extent to the players, which I tell you must show fairly outward, should more appear like entertainment than yours." "But my uncle-father and aunt-mother are deceived." " In what, my dear lord?" " I am but mad north-north-west:" "when the wind is southerly I know a hawk from a handsaw." " Well be with you, gentlemen!" " Hark you, Guildenstern, and you too, at each ear a hearer:" "that great baby you see there is not yet out of his swaddling clouts." "Happily he's the second time come to them, for they say an old man is twice a child." "I will prophesy he comes to tell me of the players, mark it." "You say right, sir: o' Monday morning, 'twas so indeed." " My lord, I have news to tell you." " My lord, I have news to tell you." "When Roscius was an actor in Rome..." " The actors are come hither, my lord." " Buzz, buzz!" " Upon my honour," " Then came each actor on his ass," "The best actors in the world, either for tragedy, comedy, history, pastoral, pastoral-comical, historical-pastoral, tragical-historical, tragical-comical-historical-pastoral, scene individable, or poem unlimited:" "Seneca cannot be too heavy nor Plautus too light." "For the law of writ and the liberty, these are the only men." "O Jephthah, judge of Israel, what a treasure hadst thou!" "What treasure had he, my lord?" "Why 'One fair daughter, and no more, the which he loved passing well.'" " Still on my daughter!" " Am I not i' the right, old Jephthah?" "If you call me Jephthah, my lord, I have a daughter that I love passing well." " Nay, that follows not." " What follows, then, my lord?" "Why 'As by lot, God wot,' and then, you know," "'It came to pass, as most like it was...'" "The first row of the pious chanson will show you more, for look where my abridgment comes." "You are welcome, masters!" "Welcome all." "I am glad to see thee well." "Welcome, good friends." "O, my old friend!" "Thy face is valanc'd since I saw thee last, comest thou to beard me in Denmark?" "What, my young lady and mistress!" "By'r lady, your ladyship is nearer to heaven than when I saw you last, by the altitude of a chopine." "Pray God, your voice, like a piece of uncurrent gold, be not cracked within the ring." "Masters, you are all welcome." "We'll e'en to't like French falconers, fly at anything we see: we'll have a speech straight." "Come, give us a taste of your quality." "Come, a passionate speech." " What speech, my good lord?" " I heard thee speak me a speech once, but it was never acted." "Or if it was, not above once, for the play," "I remember, pleased not the million, 'twas caviar to the general, but it was, as I received it, and others, whose judgments in such matters cried in the top of mine, an excellent play," "well digested in the scenes, set down with as much modesty as cunning." "I remember, one said there were no sallets in the lines to make the matter savoury, or no matter in the phrase which might indite the author of affectation, but called it an honest method, as wholesome as sweet," "and by very much more handsome than fine." "One speech in it I chiefly loved: 'twas AEneas' tale to Dido, and thereabout of it especially where he speaks of Priam's slaughter:" "if it live in your memory, begin at this line, let me see, let me see:" "The rugged Pyrrhus, like th' Hyrcanian beast, it is not so..." " It begins with Pyrrhus." " It begins with Pyrrhus." "'The rugged Pyrrhus, he whose sable arms, black as his purpose, did the night resemble when he lay couched in the ominous horse, hath now this dread and black complexion smear'd with heraldry more dismal," "head to foot now is be total gules, horridly trick'd with blood of fathers, mothers, daughters, sons, bak'd and impasted with the parching streets, that lend a tyrannous and a damned light to their vile murders:" "roasted in wrath and fire, and thus o'ersized with coagulate gore, with eyes like carbuncles, the hellish Pyrrhus old grandsire Priam seeks.'" "So, proceed you." "'Fore God, my lord, well spoken, with good accent and good discretion." "Anon he finds him, striking too short at Greeks:" "his antique sword, rebellious to his arm, lies where it falls, repugnant to command:" "unequal match'd, Pyrrhus at Priam drives, in rage strikes wide, but with the whiff and wind of his fell sword the unnerved father falls." "Then senseless Ilium, seeming to feel this blow, with flaming top stoops to his base, and with a hideous crash takes prisoner Pyrrhus' ear." "For lo!" "his sword, which was declining on the milky head of reverend Priam, seem'd i' the air to stick: so, as a painted tyrant, Pyrrhus stood, and, like a neutral to his will and matter, did nothing." "But as we often see, against some storm, a silence in the heavens, the rack stand still, the bold winds speechless, and the orb below as hush as death, anon the dreadful thunder doth rend the region," "so, after Pyrrhus' pause, a roused vengeance sets him new a-work, and never did the Cyclops' hammers fall on Mars's armour forg'd for proof eterne, with less remorse than Pyrrhus' bleeding sword now falls on Priam." "Out, out, thou strumpet, Fortune!" "All you gods, in general synod, take away her power, break all the spokes and fellies from her wheel, and bowl the round nave down the hill of heaven," " as low as to the fiends!" "'" " This is too long." "It shall to the barber's, with your beard." "Pr'ythee say on." "He's for a jig or a tale of bawdry, or he sleeps." "Say on," " come to Hecuba." " 'But who, o who," " had seen the mobled queen...' - 'The mobled queen'?" "That's good!" "'Mobled queen' is good." "'Run barefoot up and down, threatening the flames with bisson rheum, a clout upon that head where late the diadem stood, and for a robe, about her lank and all o'erteemed loins, a blanket, in the alarm of fear caught up," "who this had seen, with tongue in venom steep'd, 'gainst Fortune's state would treason have pronounc'd:" "but if the gods themselves did see her then, when she saw Pyrrhus make malicious sport in mincing with his sword her husband's limbs, the instant burst of clamour that she made, unless things mortal move them not at all," "would have made milch the burning eyes of heaven, and passion in the gods.'" "Look, whether he has not turn'd his colour, and has tears in's eyes." "Pray you, no more!" "'Tis well." "I'll have thee speak out the rest of this soon." "Good my lord, will you see the players well bestowed?" "Do you hear?" "Let them be well used, for they are the abstracts and brief chronicles of the time, after your death you were better have a bad epitaph than their ill report while you live." "My lord, I will use them according to their desert." "God's bodykins, man, better!" "Use every man after his desert, and who should scape whipping?" "Use them after your own honour and dignity:" "the less they deserve, the more merit is in your bounty." " Take them in." " Come, sirs." "Follow him, friends." "We'll hear a play to-morrow." "Dost thou hear me, old friend?" "Can you play 'The Murder of Gonzago'?" " Ay, my lord." " We'll ha't to-morrow night." "You could, for a need, study a speech of some dozen or sixteen lines which I would set down and insert in't?" "Could you not?" " Ay, my lord." " Very well." "Follow that lord and look you:" "mock him not." "My good friends, I'll leave you till night: you are welcome to Elsinore." " Good my lord!" " Ay, so." "Good-bye to you." "Now I am alone." "O, what a rogue and peasant slave am I!" "Is it not monstrous that this player here, but in a fiction, in a dream of passion, could force his soul so to his own conceit that from her working all his visage wan'd, tears in his eyes, distraction in's aspect, a broken voice," "and his whole function suiting with forms to his conceit?" "And all for nothing!" "For Hecuba?" "What's Hecuba to him, or he to Hecuba, that he should weep for her?" "What would he do, had he the motive and the cue for passion that I have?" "He would drown the stage with tears and cleave the general ear with horrid speech, make mad the guilty, and appal the free, confound the ignorant, and amaze, indeed, the very faculties of eyes and ears." "Yet I, a dull and muddy-mettled rascal, peak, like John-a-dreams, unpregnant of my cause, and can say nothing." "No, not for a king upon whose property and most dear life a damn'd defeat was made." "Am I a coward?" "Who calls me villain?" "Breaks my pate across?" "Plucks off my beard and blows it in my face?" "Tweaks me by the nose?" "Gives me the lie i' the throat as deep as to the lungs?" "Who does me this, ha?" "'Swounds!" "I should take it: for it cannot be but I am pigeon-liver'd, and lack gall to make oppression bitter, or ere this" "I should have fatted all the region kites with this slave's offal, bloody, bawdy villain!" "Remorseless, treacherous, lecherous, kindless villain!" "O, vengeance!" "Why, what an ass am I!" "This is most brave, that I, the son of a dear father murder'd, prompted to my revenge by heaven and hell, must, like a whore, unpack my heart with words and fall a-cursing like a very drab, a scullion!" "Fie upon't!" "Foh!" "About, my brain!" "I have heard that guilty creatures, sitting at a play, have by the very cunning of the scene been struck so to the soul that presently they have proclaim'd their malefactions, for murder, though it have no tongue, will speak with most" "miraculous organ, I'll have these players play something like the murder of my father before mine uncle:" "I'll observe his looks, I'll tent him to the quick." "If he but blench, I know my course." "The spirit that I have seen may be the devil, and the devil hath power to assume a pleasing shape, yea, and perhaps out of my weakness and my melancholy, as he is very potent with such spirits," "abuses me to damn me:" "I'll have grounds more relative than this." "The play's the thing wherein I'll catch the conscience of the king." "And can you, by no drift of conference, get from him why he puts on this confusion, grating so harshly all his days of quiet with turbulent and dangerous lunacy?" "He does confess he feels himself distracted, but from what cause he will by no means speak." "Nor do we find him forward to be sounded, but, with a crafty madness, keeps aloof when we would bring him on to some confession of his true state." " Did he receive you well?" " Most like a gentleman." "But with much forcing of his disposition." "Niggard of question, but, of our demands, most free in his reply." "Did you assay him to any pastime?" "Madam, it so fell out that certain players we o'er-raught on the way:" "of these we told him, and there did seem in him a kind of joy to hear of it:" "they are about the court, and, as I think, they have already order" " this night to play before him." " 'Tis most true, and he beseech'd me to entreat your majesties" " to hear and see the matter." " With all my heart!" "And it doth much content me to hear him so inclin'd." "Good gentlemen, give him a further edge, and drive his purpose in to these delights." "We shall, my lord." "Sweet Gertrude, leave us too, for we have closely sent for Hamlet hither, that he, as 'twere by accident, may here affront Ophelia:" "her father and myself, lawful espials, will so bestow ourselves that, seeing, unseen, we may of their encounter frankly judge, and gather by him, as he is behav'd, if't be the affliction of his love or no that thus he suffers for." "I shall obey you." "And for your part, Ophelia, I do wish that your good beauties be the happy cause of Hamlet's wildness," "so shall I hope your virtues will bring him to his wonted way again," " to both your honours." " Madam, I wish it may." "Ophelia, walk you here." "Gracious, so please you, we will bestow ourselves." "Read on this book, that show of such an exercise may colour your loneliness." "We are oft to blame in this, 'tis too much prov'd, that with devotion's visage and pious action" " we do sugar o'er the Devil himself." " O, 'tis too true!" "How smart a lash that speech doth give my conscience!" "The harlot's cheek, beautied with plastering art, is not more ugly to the thing that helps it than is my deed to my most painted word." " O heavy burden!" " I hear him coming:" "let's withdraw, my lord." "To be, or not to be, that is the question:" "whether 'tis nobler in the mind to suffer the slings and arrows of outrageous fortune or to take arms against a sea of troubles, and by opposing end them?" "To die, to sleep, no more, and by a sleep to say we end the heartache, and the thousand natural shocks that flesh is heir to, 'tis a consummation devoutly to be wish'd." "To die, to sleep..." "To sleep!" "Perchance to dream:" "ay, there's the rub, for in that sleep of death what dreams may come, when we have shuffled off this mortal coil, must give us pause:" "there's the respect that makes calamity of so long life, for who would bear the whips and scorns of time, the oppressor's wrong, the proud man's contumely," "the pangs of despis'd love, the law's delay, the insolence of office, and the spurns that patient merit of the unworthy takes, when he himself might his quietus make with a bare bodkin?" "Who would these fardels bear, to grunt and sweat under a weary life," "but that the dread of something after death..." "The undiscover'd country, from whose bourn no traveller returns, puzzles the will, and makes us rather bear those ills we have than fly to others that we know not of?" "Thus conscience doth make cowards of us all, and thus the native hue of resolution is sicklied o'er with the pale cast of thought, and enterprises of great pith and moment, with this regard, their currents turn awry," "and lose the name of action." "Soft you now!" "The fair Ophelia!" "Nymph... in thy orisons" "be all my sins remember'd." "Good my lord, how does your honour for this many a day?" "I humbly thank you." "Well, well," "well." "My lord," "I have remembrances of yours that I have longed long to re-deliver." " I pray you, now receive them." " No." " Not I, I never gave you aught." " My honour'd lord, you know right well you did, and with them words of so sweet breath compos'd as made the things more rich." "Their perfume lost, take these again, for to the noble mind rich gifts wax poor when givers prove unkind." "There, my lord." "Ha?" "Ha?" " Are you honest?" " My lord?" " Are you fair?" " What means your lordship?" "That if you be honest and fair, your honesty should admit no discourse to your beauty." "Could beauty, my lord, have better commerce than with honesty?" "Ay, truly, for the power of beauty will sooner transform honesty from what it is to a bawd than the force of honesty can translate beauty into his likeness:" "this was sometime a paradox, but now the time gives it proof." " I did love you once." " Indeed, my lord," " you made me believe so." " You should not have believ'd me, for virtue cannot so inoculate our old stock but we shall relish of it:" "I loved you not." " I was the more deceived." " Get thee to a nunnery." "Why wouldst thou be a breeder of sinners?" "I am myself indifferent honest, but yet I could accuse me of such things that it were better my mother had not borne me:" "I am very proud, revengeful, ambitious, with more offences at my beck than I have thoughts to put them in, imagination to give them shape, or time to act them in." "What should such fellows as I do crawling between earth and heaven?" "We are arrant knaves, all, believe none of us." "Go thy ways to a nunnery." "Where's your father?" "At home, my lord." "Let the doors be shut upon him, that he may play the fool nowhere but in's own house." "Farewell." "O, help him, you sweet heavens!" "If thou dost marry, I'll give thee this plague for thy dowry, be thou as chaste as ice, as pure as snow, thou shalt not escape calumny." "Get thee to a nunnery, go: farewell." "Or, if thou wilt needs marry, marry a fool, for wise men know well enough what monsters you make of them." "To a nunnery, go, and quickly too." "Farewell." "O heavenly powers, restore him!" "I have heard of your paintings too, well enough, God hath given you one face, and you make yourselves another:" "you jig, you amble, and you lisp, and nickname God's creatures, and make your wantonness your ignorance." "Go to, I'll no more on't, it hath made me mad." "I say, we will have no more marriages." "Those that are married already," "all but one, shall live." "The rest shall keep as they are." "To a nunnery, go." "O, what a noble mind is here o'erthrown!" "The courtier's, soldier's, scholar's, eye, tongue, sword, the expectancy and rose of the fair state, the glass of fashion and the mould of form, the observ'd of all observers," "quite, quite down!" "And I, of ladies most deject and wretched that suck'd the honey of his music vows, now see that noble and most sovereign reason, like sweet bells jangled, out of tune and harsh, that unmatch'd form and feature of blown youth" "blasted with ecstasy." "O, woe is me, to have seen what I have seen," " see what I see!" " Love?" "His affections do not that way tend, nor what he spake, though it lack'd form a little, was not like madness." "There's something in his soul o'er which his melancholy sits on brood, and I do doubt the hatch and the disclose Will be some danger:" "which for to prevent, I have in quick determination thus set it down:" "he shall with speed to England for the demand of our neglected tribute:" "haply the seas, and countries different, with variable objects, shall expel this something-settled matter in his heart, whereon his brains still beating puts him thus from fashion of himself." " What think you on't?" " It shall do well, but yet do I believe the origin and commencement of his grief sprung from neglected love." "How now, Ophelia!" "You need not tell us what Lord Hamlet said, we heard it all." "My lord, do as you please, but if you hold it fit, after the play, let his queen mother all alone entreat him to show his grief:" "let her be round with him, and I'll be plac'd, so please you, in the ear of all their conference." "If she find him not, to England send him, or confine him where your wisdom best shall think." "It shall be so:" "madness in great ones must not unwatch'd go." "Speak the speech, I pray you, as I pronounced it to you, trippingly on the tongue: but if you mouth it, as many of your players do," "I had as lief the town crier spoke my lines." "Nor do not not saw the air too much with your hand, thus, but use all gently:" "for in the very torrent, tempest, and, as I may say, whirlwind of your passion, you must acquire and beget a temperance that may give it smoothness." "O, it offends me to the soul, to hear a robustious periwig-pated fellow tear a passion to tatters, to very rags, to split the ears of the groundlings, who, for the most part, are capable of nothing but inexplicable dumb shows and noise." "I would have such a fellow whipped for o'erdoing Termagant, it out-herods Herod:" "pray you avoid it." " I warrant your honour." " Be not too tame neither, but let your own discretion be your tutor: suit the action to the word, the word to the action, with this special observance, that you o'erstep not the modesty of nature:" "for anything so overdone is from the purpose of playing, whose end, both at the first and now, was and is, to hold, as 'twere, the mirror up to nature, to show virtue her own feature, scorn her own image," "and the very age and body of the time his form and pressure." "Now, this overdone, or come tardy off, though it make the unskilful laugh, cannot but make the judicious grieve, the censure of the which one must in your allowance, o'erweigh a whole theatre of others." "O, there be players that I have seen play, and heard others praise, and that highly, not to speak it profanely, that, neither having the accent of Christians, nor the gait of Christian, pagan, nor man, have so... strutted and bellowed that I have thought" "some of nature's journeymen had made men, and not made them well, they imitated humanity so abominably." "I hope we have reform'd that indifferently with us." "O, reform it altogether." "And let those that play your clowns speak no more than is set down for them:" "for there be of them that will themselves laugh, to set on some quantity of barren spectators to laugh too, though in the meantime some necessary question of the play be then to be considered: that's villanous" "and shows a most pitiful ambition in the fool that uses it." "Go make you ready." "How now, my lord!" "Will the king hear this piece of work?" " And the queen too, and that presently." " Bid the players make haste." " Will you two help to hasten them?" " We will, my lord." " What, ho, Horatio!" " Here, sweet lord, at your service." "Horatio, thou art e'en as just a man as e'er my conversation cop'd withal." " O, my dear lord," " Nay, do not think I flatter for what advancement may I hope from thee, that no revenue hast, but thy good spirits, to feed and clothe thee?" "Why should the poor be flatter'd?" "No, let the candied tongue lick absurd pomp, and crook the pregnant hinges of the knee where thrift may follow fawning" "Dost thou hear?" "Since my dear soul was mistress of her choice, and could of men distinguish, her election hath seal'd thee for herself:" "for thou hast been as one, in suffering all, that suffers nothing, a man that Fortune's buffets and rewards hast ta'en with equal thanks:" "and bles'd are those whose blood and judgment are so well commingled that they are not a pipe for Fortune's finger to sound what stop she please." "Give me that man that is not passion's slave, and I will wear him in my heart's core, ay, in my heart of heart," "as I do thee." "Something too much of this." "There is a play to-night before the king, one scene of it comes near the circumstance, which I have told thee, of my father's death:" "I pr'ythee, when thou see'st that act a-foot, even with the very comment of thy soul observe mine uncle." "If his occulted guilt do not itself unkennel in one speech, it is a damned ghost that we have seen, and my imaginations are as foul as Vulcan's stithy." "Give him heedful note, for I mine eyes will rivet to his face, and, after, we will both our judgments join in censure of his seeming." "Well, my lord:" "if he steal aught the whilst this play is playing, and scape detecting," "I will pay the theft." "They are coming to the play." "I must be idle: get you a place." " How fares our cousin Hamlet?" " Excellent, i' faith, of the chameleon's dish:" "I eat the air, promise-crammed." "You cannot feed capons so." "I have nothing with this answer, Hamlet, these words are not mine." "No, nor mine now." "My lord," "you play'd once i' the university, you say?" "That did I, my lord, and was accounted a good actor." " What did you enact?" " I did enact Julius Caesar," "I was kill'd i' the Capitol, Brutus killed me." "It was a brute part of him to kill so capital a calf there." " Be the players ready?" " Ay, my lord, they stay upon your patience." "Come hither, my good Hamlet, sit by me." "No, good mother, here's metal more attractive." "O, ho!" "Do you mark that?" " Lady, shall I lie in your lap?" " No, my lord." " I mean, my head upon your lap?" " Ay, my lord." " Do you think I meant country matters?" " I think nothing, my lord." "That's a fair thought to lie between maids' legs." " What is, my lord?" " Nothing." " You are merry, my lord." " Who, I?" "O, your only jig-maker!" "What should a man do but be merry?" "For look you how cheerfully my mother looks, and my father died within 's two hours." "Nay, 'tis twice two months, my lord." "So long?" "Nay then, let the devil wear black, for I'll have a suit of sables." "O heavens!" "die two months ago, and not forgotten yet?" "Then there's hope a great man's memory may outlive his life half a year:" "but, by'r lady, he must build churches then, or else shall he suffer not thinking on, with the hobby-horse, whose epitaph is" "'For, O, for, O, the hobby-horse is forgot!" "'" " What means this, my lord?" " Marry, this is miching mallecho, it means mischief." "Belike this show imports the argument of the play." "We shall know by this fellow:" "the players cannot keep counsel, they'll tell all." "Will he tell us what this show meant?" "Ay, or any show that you'll show him:" "show, he'll not shame to tell you what it means." "You are naught, you are naught:" " I'll mark the play." " For us, and for our tragedy," "Here stooping to your clemency, We beg your hearing patiently." "Is this a prologue, or the posy of a ring?" " 'Tis brief, my lord." " As woman's love." "Full thirty times hath Phoebus' cart gone round" "Neptune's salt wash and Tellus' orbed ground, and thirty dozen moons with borrow'd sheen about the world have times twelve thirties been, since love our hearts, and Hymen did our hands, unite commutual in most sacred bands." "So many journeys may the sun and moon make us again count o'er ere love be done!" "but, woe is me, you are so sick of late, so far from cheer and from your former state that I distrust you." "Yet, though I distrust, discomfort you, my lord, it nothing must:" "for women's fear and love hold quantity, in either naught, or in extremity." "Now, what my love is, proof hath made you know, and as my love is siz'd, my fear is so:" "where love is great, the littlest doubts are fear, where little fears grow great, great love grows there." "Faith, I must leave thee, love, and shortly too, my operant powers their functions leave to do:" "and thou shalt live in this fair world behind, honour'd, belov'd, and haply one as kind" " for husband shalt thou," " O, confound the rest!" "Such love must needs be treason in my breast:" "in second husband let me be accurst!" "None wed the second but who kill'd the first." " That's wormwood, wormwood." " The instances that second marriage move are base respects of thrift, but none of love." "A second time I kill my husband dead when second husband kisses me in bed." "I do believe you think what now you speak, but what we do determine oft we break." "Purpose is but the slave to memory, of violent birth, but poor validity:" "which now, like fruit unripe, sticks on the tree, but fall unshaken when they mellow be." "Most necessary 'tis that we forget to pay ourselves what to ourselves is debt:" "what to ourselves in passion we propose, the passion ending, doth the purpose lose." "The violence of either grief or joy their own enactures with themselves destroy:" "where joy most revels, grief doth most lament, grief joys, joy grieves, on slender accident." "This world is not for aye, and 'tis not strange that even our loves should with our fortunes change, for 'tis a question left us yet to prove, whether love lead fortune, or else fortune love." "The great man down, you'll mark his favourite flies, poor men advanc'd make friends of enemies, and hitherto does love on fortune tend:" "for who not needs shall never lack a friend, and who in want a hollow friend doth try, directly seasons him his enemy." "But, orderly to end where I begun, our wills and fates do so contrary run that our devices still are overthrown, our thoughts are ours, their ends none of our own:" "so think thou wilt no second husband wed, but die thy thoughts when thy first lord is dead." "Nor earth to me give food, nor heaven light!" "sport and repose lock from me day and night!" "To desperation turn my trust and hope!" "An anchor's cheer in prison be my scope!" "Each opposite that blanks the face of joy meet what I would have well, and it destroy!" "Both here and hence pursue me lasting strife, if, once a widow, ever I be wife!" "If she should break it now!" "'Tis deeply sworn." "Sweet, leave me here awhile, my spirits grow dull, and fain I would beguile the tedious day with sleep." "Sleep rock thy brain, and never come mischance between us twain!" " Madam, how like you this play?" " The lady does protests too much, methinks." "O, but she'll keep her word." "Have you heard the argument?" "Is there no offence in't?" "No, no!" "They do but jest, poison in jest, no offence i' the world." " What do you call the play?" " "The Mouse-trap"." "Marry, how?" "Tropically." "This play is the image of a murder done in Vienna:" "Gonzago is the duke's name, his wife, Baptista, you shall see anon, 'tis a knavish piece of work:" "but what o' that?" "Your majesty, and we that have free souls, it touches us not:" "let the gall'd jade wince, our withers are unwrung." "This is one Lucianus, nephew to the King." "You are a good chorus, my lord." "I could interpret between you and your love, if I could see the puppets dallying." "You are keen, my lord." "You are keen." "It would cost you a groaning to take off my edge." " Still better, and worse." " So you must take your husbands." "Begin, murderer, pox, leave thy damnable faces, and begin." "Come: 'The croaking raven doth bellow for revenge.'" "Thoughts black, hands apt, drugs fit, and time agreeing, confederate season, else no creature seeing, thou mixture rank, of midnight weeds collected, with Hecate's ban thrice blasted, thrice infected, thy natural magic and dire property" "on wholesome life usurp immediately." "He poisons him i' the garden for's estate." "His name's Gonzago: the story is extant, and written in very choice Italian, you shall see anon how the murderer gets the love of Gonzago's wife!" "The king rises!" "What, frighted with false fire!" " How fares my lord?" " Give o'er the play!" "Give me some light." " Away!" " Lights, lights, lights!" "Horatio!" "Horatio!" "Why, let the strucken deer go weep, the hart ungalled play, for some must watch, while some must sleep: thus runs the world away." "Would not this, sir, and a forest of feathers if the rest of my fortunes turn Turk with me, with two Provincial roses on my razed shoes, get me a fellowship in a cry of players?" " Half a share." " A whole one, I." "For thou dost know, o Damon dear, this realm dismantled was of Jove himself," " and now reigns here a very, very pajock." " You might have rhymed." "O good Horatio," "I'll take the ghost's word for a thousand pound!" "Didst perceive?" " Very well, my lord." " Upon the talk of the poisoning?" " I did very well note him." " Ah, ha!" "Come, some music!" "Come, the recorders!" "For if the king like not the comedy, why then, belike he likes it not, perdy." "Come, some music!" "Good my lord, vouchsafe me a word with you." " Sir, a whole history." " The king, sir..." " Ay, sir, what of him?" " Is, in his retirement, marvellous distempered." " With drink, sir?" " No, my lord, rather with choler." "Your wisdom should show itself more richer to signify this to his doctor." "For, for me to put him to his purgation might perhaps plunge him into far more choler." "Good my lord, put your discourse into some frame," " and start not so wildly from my affair." " I am tame, sir: pronounce." "The queen, your mother, in most great affliction of spirit, hath sent me to you." " You are welcome." " Nay, good my lord, this courtesy is not of the right breed." "If it shall please you to make me a wholesome answer," "I will do your mother's commandment: if not... your pardon and my return shall be the end of my business." " Sir, I cannot." " What, my lord?" "Make you a wholesome answer, my wit's diseased:" "but, sir, such answer as I can make, you shall command, or rather, as you say, my mother: therefore no more, but to the matter:" "my mother, you say," "Then thus she says:" "your behaviour hath struck her into amazement and admiration." "O wonderful son, that can so stonish a mother!" "But is there no sequel at the heels of this mother's admiration?" "Impart." "She desires to speak with you in her closet ere you go to bed." "We shall obey, were she ten times our mother." "Have you any further trade with us?" " My lord, you once did love me." " And so I do still, by these pickers and stealers." "Good my lord, what is the cause of your distemper?" "You do, surely, bar the door upon your own liberty if you deny your griefs to your friend." " Sir, I lack advancement." " How can that be, when you have the voice of the king himself for your succession in Denmark?" "Ay, sir, but 'While the grass grows' the proverb is something musty." "O, the recorders:" "let me see one." "To withdraw with you:" "why do you go about to recover the wind of me, as if you would drive me into a toil?" "O my lord, if my duty be too bold, my love is too unmannerly." "I do not well understand that." "Will you play upon this pipe?" " My lord, I cannot." " I pray you." " Believe me, I cannot." " I do beseech you." " I know, no touch of it, my lord." " 'Tis as easy as lying." "Govern these ventages with your finger and thumb, give it breath with your mouth, and it will discourse most eloquent music." "Look you, these are the stops." "But these cannot I command to any utterance of harmony, I have not the skill." "Why, look you now, how unworthy a thing you would make of me!" "You would play upon me, you would seem to know my stops, you would pluck out the heart of my mystery, you would sound me from my lowest note to the top of my compass, and there is much music, excellent voice, in this little organ," "yet cannot you make it speak." "'Sblood, do you think I am easier to be played upon than a pipe?" "Call me what instrument you will!" "Though you can fret me, yet, you cannot play upon me." "God bless you, sir!" "My lord, the queen would speak with you, and presently." "Do you see yonder cloud that's almost in shape of a camel?" "By the mass, and 'tis like a camel indeed." " Methinks it is like a weasel." " It is backed like a weasel." " Or like a whale." " Very like a whale." "Then will I come to my mother by and by." "They fool me to the top of my bent." "I will come by and by." " I will say so." " By-and-by is easily said." "Leave me, friends." "I like him not, nor stands it safe with us to let his madness range." "Therefore prepare you, I your commission will forthwith dispatch, and he to England shall along with you:" "the terms of our estate may not endure hazard so dangerous as doth hourly grow out of his lunacies." "We will ourselves provide:" "most holy and religious fear it is to keep those many many bodies safe that live and feed upon your majesty." "The single and peculiar life is bound, by all the strength and armour of the mind, to keep itself from 'noyance, but much more that spirit upon whose weal depend and rest the lives of many." "The cease of majesty dies not alone, but like a gulf doth draw what's near it with it:" "it is a massy wheel, fix'd on the summit of the highest mount, to whose huge spokes ten thousand lesser things are mortis'd and adjoin'd, which, when it falls, each small annexment," "petty consequence, attends the boisterous ruin." "Never alone did the king sigh, but with a general groan." "Arm you, I pray you, to this speedy voyage, for we will fetters put upon this fear, which now goes too free-footed." " We will haste us." " My lord... he's going to his mother's closet:" "behind the arras I'll convey myself to hear the process, I'll warrant she'll tax him home:" "and, as you said, and wisely was it said, 'tis meet that some more audience than a mother, since nature makes them partial, should o'erhear the speech, of vantage." "Fare you well, my liege:" "I'll call upon you ere you go to bed, and tell you what I know." "Thanks, dear my lord." "'Tis now the very witching time of night, when churchyards yawn, and hell itself breathes out contagion to this world:" "now could I drink hot blood, and do such bitter business as the day would quake to look on." "Soft!" "Now to my mother." "O heart, lose not thy nature, let not ever the soul of Nero enter this firm bosom:" "let me be cruel, not unnatural," "I will speak daggers to her, but use none, my tongue and soul in this be hypocrites, how in my words somever she be shent, to give them seals never, my soul, consent!" "O, my offence is rank, it smells to heaven, it hath the primal eldest curse upon't, a brother's murder!" "Pray can I not, though inclination be as sharp as will:" "my stronger guilt defeats my strong intent, and, like a man to double business bound, I stand in pause where I shall first begin, and both neglect." "What if this cursed hand were thicker than itself with brother's blood?" "Is there not rain enough in the sweet heaven to wash it white as snow?" "Whereto serves mercy but to confront the visage of offence?" "And what's in prayer but this twofold force, to be forestalled ere we come to fall, or pardon'd being down?" "Then I'll look up, my fault is past." "But, o, what form of prayer can serve my turn?" "Forgive me my foul murder!" "That cannot be, since I am still possess'd of those effects for which I did the murder, my crown, mine own ambition, and my queen." "May one be pardon'd and retain the offence?" "In the corrupted currents of this world offence's gilded hand may shove by justice, and oft 'tis seen the wicked prize itself buys out the law," "but 'tis not so above, there is no shuffling, there the action lies in his true nature, and we ourselves compell'd, even to the teeth and forehead of our faults, to give in evidence." "What then?" "What rests?" "Try what repentance can: what can it not?" "Yet what can it when one cannot repent?" "O wretched state!" "O bosom black as death!" "O limed soul, that, struggling to be free, art more engag'd!" "Help, angels!" "Make assay:" "bow, stubborn knees, and, heart, with strings of steel, be soft as sinews of the new-born babe!" "All may be well." "Now might I do it pat, now he is praying, and now I'll do't," "and so he goes to heaven, and so am I reveng'd." "That would be scann'd:" "a villain kills my father, and for that, I, his sole son, do this same villain send to heaven?" "O, this is hire and salary, not revenge." "He took my father grossly, full of bread, with all his crimes broad blown, as flush as May, and how his audit stands, who knows save heaven?" "But in our circumstance and course of thought, 'tis heavy with him:" "and am I, then, reveng'd, to take him in the purging of his soul, when he is fit and season'd for his passage?" "No!" "Up, sword, and know thou a more horrid hent:" "when he is drunk, asleep, or in his rage, or in the incestuous pleasure of his bed, at gaming, at swearing, or about some act that has no relish of salvation in't, then trip him, that his heels may kick at heaven," "and that his soul may be as damn'd and black as hell, whereto it goes." "My mother stays:" "this physic but prolongs thy sickly days." "My words fly up, my thoughts remain below:" "words without thoughts never to heaven go." "He will come straight." "Look you lay home to him:" "tell him his pranks have been too broad to bear with, and that your grace hath screen'd and stood between much heat and him." "I'll silence me even here." "Pray you, be round with him." " I'll warrant you, fear me not!" " Mother, mother, mother!" "Withdraw, I hear him coming." "Now, mother, what's the matter?" "Hamlet, thou hast thy father much offended." "Mother, you have my father much offended." "Come, come, you answer with an idle tongue." "Go, go, you question with a wicked tongue." " Why, how now, Hamlet!" " What's the matter now?" " Have you forgot me?" " No, by the rood, not so:" "you are the queen, your husband's brother's wife, and, would it were not so, you are my mother..." "Nay, then, I'll set those to you that can speak." "Come, come, and sit you down, you shall not budge, you go not till I set you up a glass where you may see the inmost part of you." "What wilt thou do?" "Thou wilt not murder me?" " Help, help, ho!" " What, ho!" "help, help, help!" "Dead, for a ducat, dead!" "O, I am slain!" "O me, what hast thou done?" "Nay, I know not: is it the king?" "O, what a rash and bloody deed is this!" "A bloody deed!" "Almost as bad, good mother, as kill a king, and marry with his brother." " As kill a king!" " Ay, lady, 'twas my word." "Thou wretched, rash, intruding fool, farewell!" "I took thee for thy better: take thy fortune, thou find'st to be too busy is some danger." "Leave wringing of your hands." "Peace!" "Sit you down, and let me wring your heart for so I shall, if it be made of penetrable stuff, if damned custom have not brass'd it so that it is proof and bulwark against sense." "What have I done, that thou darest wag thy tongue in noise so rude against me?" "Such an act that blurs the grace and blush of modesty, calls virtue hypocrite, takes off the rose from the fair forehead of an innocent love and sets a blister there, makes marriage-vows as false as dicers' oaths:" "o, such a deed as from the body of contraction plucks the very soul, and sweet religion makes a rhapsody of words:" "heaven's face doth glow:" "yea, this solidity and compound mass, with tristful visage, as against the doom, is thought-sick at the act!" "Ay me, what act, that roars so loud, and thunders in the index?" "Look here, upon this picture, and on this, the counterfeit presentment of two brothers." "See, what a grace was seated on this brow," "Hyperion's curls, the front of Jove himself, an eye like Mars, to threaten and command, a station like the herald Mercury new-lighted on a heaven-kissing hill, a combination and a form indeed, where every god did seem to set his seal," "to give the world assurance of a man:" "this was your husband." "Look you now, what follows:" "here is your husband, like a mildew'd ear, blasting his wholesome brother." "Have you eyes?" "Could you on this fair mountain leave to feed, and batten on this moor?" "Ha!" "have you eyes?" "You cannot call it love, for at your age the hey-day in the blood is tame, it's humble, and waits upon the judgment:" "and what judgment would step from this to this?" "Sense, sure, you have, else could you not have motion, but sure, that sense is apoplex'd, for madness would not err, nor sense to ecstasy was ne'er so thrall'd but it reserved some quantity of choice," "to serve in such a difference." "What devil was't that thus hath cozen'd you at hoodman-blind?" "Eyes without feeling, feeling without sight, ears without hands or eyes, smelling sans all, or but a sickly part of one true sense could not so mope." "O shame!" "Where is thy blush?" "Rebellious hell, if thou canst mutine in a matron's bones, to flaming youth let virtue be as wax, and melt in her own fire: proclaim no shame when the compulsive ardour gives the charge, since frost itself as actively doth burn and reason panders will!" "O Hamlet, speak no more: thou turn'st mine eyes into my very soul, and there I see such black and grained spots as will not leave their tinct." "Nay, but to live in the rank sweat of an enseamed bed, stew'd in corruption, honeying and making love over the nasty sty," "O, speak to me no more, these words, like daggers, enter in mine ears!" " No more, sweet Hamlet!" " A murderer and a villain, a slave that is not twentieth part the tithe of your precedent lord, a vice of kings, a cutpurse of the empire and the rule, that from a shelf the precious diadem stole, and put it in his pocket!" " No more!" " A king of shreds and patches!" "Save me, and hover o'er me with your wings, you heavenly guards!" " What would your gracious figure?" " Alas, he's mad!" "Do you not come your tardy son to chide, that, lapsed in time and passion, lets go by the important acting of your dread command?" " O, say!" " Do not forget:" "this visitation is but to whet thy almost blunted purpose." "But, look, amazement on thy mother sits." "O, step between her and her fighting soul." "Conceit in weakest bodies strongest works." "Speak to her, Hamlet." " How is it with you, lady?" " Alas, how is't with you, that you do bend your eye on vacancy and with the incorporal air do hold discourse?" "Forth at your eyes your spirits wildly peep, and, as the sleeping soldiers in the alarm, your bedded hair, like life in excrements, starts up, and stands on end." "O gentle son, upon the heat and flame of thy distemper sprinkle cool patience." "Whereon do you look?" "On him." "On him!" "Look you, how pale he glares!" "His form and cause conjoin'd, preaching to stones, would make them capable." "Do not look upon me, lest with this piteous action you convert my stern effects:" "then what I have to do will want true colour, tears perchance for blood." " To whom do you speak this?" " Do you see nothing there?" " Nothing at all, yet all that is I see." " Nor did you nothing hear?" " No, nothing but ourselves." " Why, look you there!" "Look, how it steals away!" "My father, in his habit as he lived!" "Look, where he goes, even now, out at the portal!" "This the very coinage of your brain:" "this bodiless creation ecstasy is very cunning in." "Ecstasy!" "My pulse, as yours, doth temperately keep time, and makes as healthful music: it is not madness that I have utter'd:" "bring me to the test, and I the matter will re-word, which madness would gambol from." "Mother, for love of grace... lay not that flattering unction to your soul, that not your trespass, but my madness speaks:" "it will but skin and film the ulcerous place, whilst rank corruption, mining all within, infects unseen." "Confess yourself to heaven, repent what's past, avoid what is to come, and do not spread the compost on the weeds, to make them ranker." "Forgive me this my virtue, for in the fatness of these pursy times virtue itself of vice must pardon beg, yea, curb and woo for leave to do him good." "O Hamlet... thou hast cleft my heart in twain." "O, throw away the worser part of it, and live the purer with the other half." "Good night: but go not to mine uncle's bed, assume a virtue, if you have it not." "That monster, custom, who all sense doth eat, of habits devil, is angel yet in this, that to the use of actions fair and good he likewise gives a frock or livery, that aptly is put on." "Refrain to-night, and that shall lend a kind of easiness to the next abstinence:" "the next more easy, for use almost can change the stamp of nature, and either shame the devil, or throw him out with wondrous potency." "Once more, good night:" "and when you are desirous to be bless'd," "I'll blessing beg of you." "For this same lord, I do repent, but heaven hath pleased it so, to punish me with this and this with me, that I must be their scourge and minister." "I will bestow him, and will answer well the death I gave him." "So, again, good night." "I must be cruel, only to be kind:" "thus bad begins and worse remains behind." " One word more, good lady." " What shall I do?" "Not this, by no means, that I bid you do:" "let the bloat king tempt you again to bed, pinch wanton on your cheek, call you his mouse, and let him, for a pair of reechy kisses, or paddling in your neck with his damn'd fingers," "make you to ravel all this matter out, that I essentially am not in madness, but mad in craft. 'Twere good you let him know, for who, that's but a queen, fair, sober, wise," "would from a paddock, from a bat, a gib, such dear concernings hide?" "Who would do so?" "No, in despite of sense and secrecy, unpeg the basket on the house's top." "Let the birds fly, and, like the famous ape, to try conclusions, in the basket creep, and break your own neck down." "Be thou assured, if words be made of breath, and breath of life," "I have no life to breathe what thou hast said to me." "I must to England, you know that?" "Alack, I had forgot." " 'Tis so concluded on." " There's letters seal'd, and my two schoolfellows, whom I will trust as I will adders fang'd, they bear the mandate, they must sweep my way, and marshal me to knavery." "Let it work, for 'tis the sport to have the engineer hoist with his own petard:" "and 't shall go hard but I will delve one yard below their mines, and blow them at the moon." "O, 'tis most sweet, when in one line two crafts directly meet." "This man shall set me packing:" "I'll lug the guts into the neighbour room." "Mother, good night indeed." "This counsellor is now most still, most secret and most grave, who was in life a foolish prating knave." "Come, sir, to draw toward an end with you." "Good night, mother." "There's matter in these sighs, these profound heaves:" "you must translate: 'tis fit we understand them." "Where is your son?" "Bestow this place on us a little while." "Ah, my good lord, what have I seen to-night!" "What, Gertrude?" "How does Hamlet?" "Mad as the sea and wind, when both contend which is the mightier." "In his lawless fit, behind the arras hearing something stir, whips out his rapier, cries, 'A rat, a rat!" "' and, in this brainish apprehension, kills the unseen good old man." "O heavy deed!" "It had been so with us, had we been there!" "His liberty is full of threats to all, to you yourself, to us, to every one." "Alas, how shall this bloody deed be answer'd?" "It will be laid to us, whose providence should have kept short, restrain'd and... out of haunt, this mad young man." "But so much was our love, we would not understand what was most fit, but, like the owner of a foul disease, to keep it from divulging, let it feed even on the pith of life." " Where is he gone?" " To draw apart the body he hath kill'd:" "o'er whom his very madness, like some ore among a mineral of metals base, shows itself pure, he weeps for what is done." "O Gertrude, come away!" "The sun no sooner shall the mountains touch, but we will ship him hence:" "and this vile deed we must, with all our majesty and skill, both countenance and excuse." "Ho, Guildenstern!" "Friends both, go join you with some further aid." "Hamlet in madness hath Polonius slain, and from his mother's closet hath he dragg'd him." "Go seek him out, speak fair, and bring the body into the chapel." "Come on!" "I pray you, haste in this!" "Come, Gertrude, we'll call up our wisest friends, and let them know, both what we mean to do, and what's untimely done." "So envious slander, whose whisper o'er the world's diameter as level as the cannon to his blank, transports the poisoned shot may miss our name and hit the woundless air." "O, come away!" "My soul is full of discord and dismay." " Safely stowed." " Hamlet!" "Lord Hamlet!" "But soft, what noise?" "Who calls on Hamlet?" " Hamlet!" " O, here they come." "What have you done, my lord, with the dead body?" "Compounded it with dust, whereto 'tis kin." "Tell us where 'tis, that we may take it thence and bear it to the chapel." " Do not believe it." " Believe what?" "That I can keep your counsel and not mine own." "Besides, to be demanded of a sponge!" "What replication should be made by the son of a king?" "Take you me for a sponge, my lord?" "Ay, sir, that soaks up the king's countenance, his rewards, his authorities." "But such officers do the king best service in the end." "He keeps them, like an ape, an apple, in the corner of his jaw, first mouthed, to be last swallowed." "When he needs what you have gleaned, it is but squeezing you," " and, sponge, you shall be dry again." " I understand you not, my lord." "I am glad of it: a knavish speech sleeps in a foolish ear." "My lord, you must tell us where the body is, and go with us to the king." "The body is with the king, but the king is not with the body." " The king is a thing..." " A thing, my lord!" "...of nothing." "Bring me to him." " My lord!" " Hide fox, and all after." "My lord!" "My good lord Hamlet!" "My good lord!" "Hamlet!" "I have sent to seek him, and to find the body." "How dangerous is it that this man goes loose!" "Yet must not we put the strong law on him:" "he's loved of the distracted multitude, who like not in their judgment, but their eyes, and, where 'tis so, the offender's scourge is weigh'd, but never the offence." "To bear all smooth and even, this sudden sending him away must seem deliberate pause." "Diseases desperate grown by desperate appliance are relieved, or not at all." "How now!" "What hath befall'n?" "Where the dead body is bestow'd, my lord, we cannot get from him." " But where is he?" " Without, my lord," " guarded, to know your pleasure." " Bring him before us." "Ho, Guildenstern!" "Bring in my lord." " Now, Hamlet, where's Polonius?" " At supper." " At supper!" "Where?" " Not where he eats, but where he is eaten." "A certain convocation of politic worms are e'en at him." "Your worm is your only emperor for diet:" "we fat all creatures else to fat us, and we fat ourselves for maggots:" "your fat king and your lean beggar is but variable service, two dishes, but to one table That's the end." " Alas, alas!" " A man may fish with the worm that hath eat of a king, and eat of the fish that hath fed of that worm." " What dost you mean by this?" " Nothing but to show you how a king may go a progress through the guts of a beggar." "Where is Polonius?" "In heaven." "Send hither to see..." "If your messenger find him not there, seek him i' the other place yourself." "But if indeed you find him not within this month, you shall nose him as you go up the stairs into the lobby." "Go seek him there." " He will stay till ye come." " Hamlet... this deed, for thine especial safety, which we do tender, as we dearly grieve for that which thou hast done, must send thee hence with fiery quickness." "Therefore prepare thyself, the bark is ready, and the wind at help, the associates tend, and every thing" " is bent for England." " For England!" " Ay, Hamlet." " Good." " So is it, if thou knew'st our purposes." " I see a cherub that sees them." "But, come, for England!" "Farewell, dear mother." " Thy loving father, Hamlet." " Mother." "Father and mother is man and wife." "Man and wife is one flesh, and so, my mother." "Come, for England!" "Follow him at foot, tempt him with speed aboard, delay it not, I'll have him hence to-night." "Away!" "For every thing is seal'd and done that else leans on the affair." "Pray you, make haste!" "And, England, if my love thou hold'st at aught as my great power thereof may give thee sense, since yet thy cicatrice looks raw and red after the Danish sword, and thy free awe pays homage to us" "thou mayst not coldly set our sovereign process, which imports at full, by letters congruing to that effect, the present death of Hamlet." "Do it, England, for like the hectic in my blood he rages, and thou must cure me!" "Till I know 'tis done, howe'er my haps, my joys were ne'er begun." "Go, captain, from me greet the Danish king." "Tell him that, by his licence, Fortinbras craves the conveyance of a promised march over his kingdom." "You know the rendezvous." "If that his majesty would aught with us, we shall express our duty in his eye," " and let him know so." " I will do't, my lord." "Go softly on." " Good sir, whose powers are these?" " They are of Norway, sir." " How purposed, sir, I pray you?" " Against some part of Poland." " Who commands them, sir?" " The nephew of old Norway, Fortinbras." "Goes it against the main of Poland, sir, or..." " for some frontier?" " Truly to speak, and with no addition, we go to gain a little patch of ground that hath in it no profit but the name." "To pay five ducats, five, I would not farm it, nor will it yield to Norway or the Pole a ranker rate, should it be sold in fee." " Why, then the Polack never will defend it." " Yes, it is already garrison'd." "Two thousand souls and twenty thousand ducats will not debate the question of this straw." "This is the imposthume of much wealth and peace, that inward breaks, and shows no cause without why the man dies." " I humbly thank you, sir." " God be wi' you, sir." " Wilt please you go, my lord?" " I'll be with you straight." "Go a little before." "How all occasions do inform against me, and spur my dull revenge!" "What is a man, if his chief good and market of his time be but to sleep and feed?" "A beast, no more." "Sure, he that made us with such large discourse, looking before and after, gave us not that capability and god-like reason to fust in us unused!" "Now, whether it be bestial oblivion, or some craven scruple of thinking too precisely on the event, a thought which, quarter'd, hath but one part wisdom and ever three parts coward," "I do not know why yet I live to say 'This thing's to do', sith I have cause and will and strength and means to do't." "Examples gross as earth exhort me:" "witness this army of such mass and charge led by a delicate and tender prince, whose spirit with divine ambition puff'd makes mouths at the invisible event, exposing what is mortal and unsure to all that fortune, death and danger dare," "even for an egg-shell." "Rightly to be great is not to stir without great argument, but greatly to find quarrel in a straw when honour's at the stake." "How stand I then, that have a father kill'd, a mother stain'd, excitements of my reason and my blood, and let all sleep?" "While, to my shame," "I see the imminent death of twenty thousand men, that, for a fantasy and trick of fame, go to their graves like beds, fight for a plot whereon the numbers cannot try the cause, which is not tomb enough and continent to hide the slain?" "O, from this time forth, my thoughts be bloody, or be nothing worth!" "When sorrows come, they come not single spies but in battalions." "First, her father slain, next, your son gone and he most violent author of his own just remove, the people muddied, thick and unwholesome in their thoughts and whispers, for good Polonius' death and we have done but greenly, in hugger-mugger to inter him." "Poor Ophelia divided from herself and her fair judgment, without the which we are pictures, or mere beasts." "Last, and as much containing as all these, her brother is in secret come from France feeds on his wonder, keeps himself in clouds, and wants not buzzers to infect his ear with pestilent speeches of his father's death wherein necessity, of matter beggar'd," "will nothing stick our person to arraign in ear and ear." "O my dear Gertrude, this, like to a murdering-piece, in many places gives me superfluous death." " I will not speak with her." " She is importunate, indeed distract, her mood will needs be pitied." " What would she have?" " She speaks much of her father says she hears there's tricks i' the world and hems, and beats her heart spurns enviously at straws speaks things in doubt, that carry but half sense." "Her speech is nothing, yet the unshaped use of it doth move the hearers to collection they aim at it, and botch the words up fit to their own thoughts which, as her winks, and nods, and gestures yield them," "indeed would make one think there might be thought, though nothing sure, yet much unhappily." "'Twere good she were spoken with for she may strew dangerous conjectures" " in ill-breeding minds." " Let her come in." "To my sick soul, as sin's true nature is, each toy seems prologue to some great amiss," "so full of artless jealousy is guilt, it spills itself in fearing to be spilt." "Where is the beauteous majesty of Denmark?" " How now, Ophelia!" " How should I your true love know from another one?" "By his cockle hat and staff, and his sandal shoon." "Alas, sweet lady, what imports this song?" "Say you?" "Nay, pray you, mark." "He is dead and gone, lady, he is dead and gone at his head a grass-green turf, at his heels a stone." " Nay, but, Ophelia," " Pray you, mark." " White his shroud as the mountain snow," " Alas, look here, my lord." "Larded with sweet flowers, which bewept to the grave did go with true-love showers." "How do you, pretty lady?" "Well, God 'ild you!" "They say the owl was a baker's daughter." "Lord, we know what we are, but know not what we may be." " God be at your table!" " Conceit upon her father." "Pray you!" "Let's have no words of this!" "But when they ask you what it means, say you this:" "To-morrow is Saint Valentine's day, all in the morning betime, and I a maid at your window, to be your Valentine." "Then up he rose, and donn'd his clothes, and dupp'd the chamber-door let in the maid, that out a maid never departed more." " Pretty Ophelia!" " Indeed, la, without an oath, I'll make an end on't." "By Gis and by Saint Charity, alack, and fie for shame!" "Young men will do't, if they come to't by cock, they are to blame." "Quoth she... 'before you tumbled me, you promised me to wed.'" "'So would I ha' done, by yonder sun, an thou hadst not come to my bed.'" "How long hath she been thus?" "I hope all will be well." "We must be patient, but I cannot choose but weep, to think they should lay him i' the cold ground." "My brother shall know of it," "and so I thank you for your good counsel." "Come, my coach!" "Good night, ladies good night, sweet ladies good night, good night." " Sweet ladies, good night!" " Follow her close!" "Give her good watch, I pray you!" "O, this is the poison of deep grief it springs all from her father's death." "And now behold!" "O Gertrude, Gertrude!" " Alack, what noise is this?" " Where are my Switzers?" " Let them guard the door!" " What is the matter?" "Save yourself, my lord." "The ocean, overpeering of his list, eats not the flats with more impetuous haste than young Laertes, in a riotous head, o'erbears your officers!" "The rabble call him lord and, as the world were now but to begin, antiquity forgot, custom not known, the ratifiers and props of every word, they cry 'Choose we:" "Laertes shall be king'" "Caps, hands, and tongues, applaud it to the clouds:" "'Laertes shall be king, Laertes king!" "'." "How cheerfully on the false trail they cry!" "O, this is counter, you false Danish dogs!" "The doors are broke." "Where is this king?" " Sirs, stand you all without." " No, let's come in." " I pray you, give me leave." " We will." "I thank you." "Keep the door." " O thou vile king, give me my father!" " Calmly, good Laertes." "That drop of blood that's calm proclaims me bastard, cries cuckold to my father, brands the harlot even here, between the chaste unsmirched brow of my true mother." "What is the cause, Laertes, that thy rebellion looks so giant-like?" "Let him go, Gertrude do not fear our person:" "there's such divinity doth hedge a king, that treason can but peep to what it would, acts little of his will." "Tell me, Laertes, why thou art thus incensed." "Let him go, Gertrude." " Speak, man." " Where is my father?" " Dead." " But not by him." " Let him demand his fill." " How came he dead?" "I'll not be juggled with." "To hell, allegiance!" "Vows, to the blackest devil!" "Conscience and grace, to the profoundest pit!" "I dare damnation." "To this point I stand, that both the worlds I give to negligence, let come what comes only I'll be revenged most thoroughly for my father." " Who shall stay you?" " My will, not all the world!" "And for my means," "I'll husband them so well, they shall go far with little." "Good Laertes, if you desire to know the certainty of your dear father's death, is't writ in your revenge, that, swoopstake, you will draw both friend and foe," " winner and loser?" " None but his enemies." "Will you know them then?" "To his good friends thus wide I'll ope my arms and like the kind life-rendering pelican, repast them with my blood." "Why, now you speak like a good child and a true gentleman." "That I am guiltless of your father's death, and am most sensible in grief for it, it shall as level to your judgment pierce as day doth to your eye." "Let her come in." "How now!" "What noise is that?" "O heat, dry up my brains!" "Tears seven times salt, burn out the sense and virtue of mine eye!" "By heaven, thy madness shall be paid by weight, till our scale turn the beam." "O rose of May!" "Dear maid, kind sister, sweet Ophelia!" "O heavens!" "Is't possible, a young maid's wits should be as mortal as an old man's life?" "Nature is fine in love, and where 'tis fine, it sends some precious instance of itself" " after the thing it loves." " They bore him barefaced on the bier hey nonny nonny, nonny, hey nonny, nonny, nonny, hey and in his grave rain'd many a tear." "Fare you well, my dove!" "Hadst thou thy wits, and didst persuade revenge," " it could not move thus." " You must sing a-down a-down..." "An you!" "Call him!" "A-down a-down a-down..." "O, how the wheel becomes it!" "It is the false steward, that stole his master's daughter." " This nothing's more than matter." " There's rosemary, that's for remembrance." "Pray, love, remember..." "And there is pansies." "That's for thoughts." "A document in madness, thoughts and remembrance fitted." "There's fennel for you, and columbines..." "There's rue for you and here's some for me." "We may call it herb-grace o' Sundays." "O you must wear your rue with a difference." "There's a daisy." "I would give you some violets, but they withered all when my father died." "They say he made a good end," "For bonny sweet Robin is all my joy." "Thought and affliction, passion, hell itself, she turns to favour and to prettiness." "And will he not come again?" "And will he not come again?" "No, no, he is dead." "Go to thy death-bed, he never will come again." "His beard was as white as snow, all flaxen was his poll." "He is gone, he is gone, and we cast away moan." "God ha' mercy on his soul!" "And of all Christian souls..." "I pray God." "God be wi' ye." "Do you see this, O God?" "Laertes, I must commune with your grief, or you deny me right." "Go but apart, make choice of whom your wisest friends you will and they shall hear and judge 'twixt you and me." "If by direct or by collateral hand they find us touch'd, we will our kingdom give, our crown, our life, and all that we call ours, to you in satisfaction." "But if not, be you content to lend your patience to us, and we shall jointly labour with your soul to give it due content." "Let this be so." "His means of death, his obscure burial..." "No trophy, sword, nor hatchment o'er his bones, no noble rite nor formal ostentation cry to be heard, as 'twere from heaven to earth, that I must call't in question." "So you shall and where the offence is, let the great axe fall." "I pray you, go with me." "What are they that would speak with me?" "Sailors, sir." "They say they have letters for you." "I do not know from what part of the world I should be greeted, if not from Lord Hamlet." " God bless you, sir." " Let him bless thee too." "He shall, sir, an't please him." "There's a letter for you, sir it comes from the ambassador that was bound for England if your name be Horatio, as I am let to know it is." "Horatio, when thou shalt have overlooked this, give these fellows some means to the king: they have letters for him." "Ere we were two days old at sea, a pirate of very warlike appointment gave us chase." "Finding ourselves too slow of sail, we put on a compelled valour, and in the grapple I boarded them." "On the instant they got clear of our ship so I alone became their prisoner." "They have dealt with me like thieves of mercy, but they knew what they did" "I am to do a good turn for them." "Let the king have the letters I have sent and repair thou to me with as much haste as thou wouldst fly death." "I have words to speak in thine ear will make thee dumb yet are they much too light for the bore of the matter." "These good fellows will bring thee where I am." "Rosencrantz and Guildenstern hold their course for England, of them I have much to tell thee." "Farewell." "He that thou knowest thine, Hamlet." "Come, I will give you way for these your letters and do't the speedier, that you may direct me to him from whom you brought them." "Now must your conscience my acquaintance seal, and you must put me in your heart for friend, sith you have heard, and with a knowing ear, that he which hath your noble father slain pursued my life." "It well appears, but tell me why you proceeded not against these feats, so crimeful and so capital in nature, as by your safety, wisdom, all things else, you mainly were stirr'd up." "O, for two special reasons which may to you seem much unsinew'd, but yet to me they are strong." "The queen his mother lives almost by his looks and for myself my virtue or my plague, be it either which" "she's so conjunctive to my life and soul, that, as the star moves not but in his sphere," "I could not but by her." "The other motive, why to a public count I might not go, is the great love the general gender bear him who, dipping all his faults in their affection, would, like the spring that turneth wood to stone, convert his gyves to graces" "so that my arrows, too slightly timber'd for so loud a wind, would have reverted to my bow again, but not where I had aim'd them." "And so have I a noble father lost a sister driven into desperate terms, whose worth, if praises may go back again, stood challenger on mount of all the age for her perfections." " But my revenge will come." " Break not your sleeps for that, you must not think that we are made of stuff so flat and dull that we can let our beard be shook with danger and think it pastime." "You shortly shall hear more." "I loved your father, and we love ourself and that, I hope, will teach you to imagine..." "How now!" "what news?" "Letters, my lord, from Hamlet." " This to your majesty this to the queen." " From Hamlet!" "Who brought them?" "Sailors, my lord, they say." "I saw them not." "They were given me by Claudio he received them of him that brought them." "Laertes, you shall hear them." "Leave us." "'High and mighty, You shall know I am set naked on your kingdom." "To-morrow shall I beg leave to see your kingly eyes." "When I shall, first asking your pardon thereunto, recount the occasion of my sudden and more strange return." "Hamlet.'" "What should this mean?" "Are all the rest come back?" "Or is it some abuse, and no such thing?" " Know you the hand?" " 'Tis Hamlets character." "'Naked!" "' And in a postscript here, he says 'Alone.'" " Can you advise me?" " I'm lost in it, my lord." "But let him come!" "It warms the very sickness in my heart, that I shall live and tell him to his teeth," " 'thus didest thou.'" " If it be so, Laertes as how should it be so?" "How otherwise?" "Will you be ruled by me?" "Ay, my lord if you so not o'errule me to a peace." "To thine own peace." "If he be now return'd, as checking at his voyage, and that he means no more to undertake it," "I will work him to an exploit, now ripe in my device, under the which he shall not choose but fall," "and for his death no wind of blame shall breathe, but even his mother shall uncharge the practise and call it accident." "My lord, I will be ruled the rather, if you could devise it so that I might be the organ." "It falls right." "You have been talk'd of since your travels much, and that in Hamlet's hearing, for a quality wherein, they say, you shine." "Your sum of parts did not together pluck such envy from him as did that one, and that, in my regard, of the unworthiest siege." "What part is that, my lord?" "A very riband in the cap of youth, yet needful too for youth no less becomes the light and careless livery that it wears than settled age his sables and his weeds, importing health and graveness." "Two months since, here was a gentleman of Normandy." "I've seen myself, and served against, the French, and they can well on horseback, but this gallant had witchcraft in't, he grew unto his seat and to such wondrous doing brought his horse," "as he had been incorpsed and demi-natured with the brave beast." "So far he topp'd my thought, that I, in forgery of shapes and tricks, come short of what he did." " A Norman was't?" " A Norman." " Upon my life, Lamond." " The very same." "I know him well, he is the brooch indeed and gem of all the nation." "He made confession of you and gave you such a masterly report for art and exercise in your defence and for your rapier most especially, that he cried out, 'twould be a sight indeed, if one could match you:" "the scrimers of their nation, he swore, had had neither motion, guard, nor eye, if you opposed them, sir." "This report of his did Hamlet so envenom with his envy that he could nothing do but wish and beg your sudden coming o'er, to play with him." " Now, out of this," " What out of this, my lord?" "Laertes, was your father dear to you?" "Or are you like the painting of a sorrow," " a face without a heart?" " Why ask you this?" "Not that I think you did not love your father but that I know love is begun by time and that I see, in passages of proof, time qualifies the spark and fire of it." "there lives within the very flame of love a kind of wick or snuff that will abate it and nothing is at a like goodness still for goodness, growing to a plurisy, dies in his own too much." "That we would do we should do when we would." "for this 'would' changes and hath abatements and delays as many as there are tongues, are hands, are accidents and then this 'should' is like a spendthrift sigh, that hurts by easing." "But, to the quick o' the ulcer, Hamlet comes back." "What would you undertake, to show yourself in deed your father's son" " more than in words?" " To cut his throat i' the church." "No place, indeed, should murder sanctuarize." "Revenge should have no bounds." "But, good Laertes, will you do this?" "Keep close within your chamber." "Hamlet return'd shall know you are come home." "We'll put on those shall praise your excellence and set a double varnish on the fame the Frenchman gave you, bring you in fine together and wager on your heads." "He, being remiss, most generous and free from all contriving, will not peruse the foils so that, with ease, or with a little shuffling, you may choose a sword unbated, and in a pass of practise requite him for your father." "I will do't, and, for that purpose, I'll anoint my sword." "I bought an unction of a mountebank, so mortal that, but dip a knife in it, where it draws blood no cataplasm so rare, collected from all simples that have virtue under the moon, can save the thing from death that is but scratch'd withal." "I'll touch my point with this contagion, that, if I gall him slightly," " it may be death." " Let's further think of this weigh what convenience both of time and means may fit us to our shape." "If this should fail, and that our drift look through our bad performance, 'twere better not assay'd, therefore this project should have a back or second, that might hold, if this should blast in proof." "Soft!" "Let me see, we'll make a solemn wager on your cunnings." "I ha't." "When in your motion you are hot and dry as make your bouts more violent to that end and that he calls for drink, I'll have prepared him a chalice for the nonce, whereon but sipping, if he by chance escape your venom'd stuck," "our purpose may hold there." "But stay, what noise?" "How now, sweet queen!" "One woe doth tread upon another's heel, so fast they follow." "Your sister's drown'd," "Laertes." "Drown'd!" "O..." "Where?" "There is a willow grows aslant a brook, that shows his hoar leaves in the glassy stream." "There with fantastic garlands did she make of crow-flowers, nettles, daisies, and long purples" "that liberal shepherds give a grosser name, but our cold maids do dead men's fingers call them." "There, on the pendent boughs her coronet weeds clambering to hang, an envious sliver broke when down her weedy trophies and herself fell in the weeping brook." "Her clothes spread wide and, mermaid-like, awhile they bore her up, which time she chanted snatches of old tunes as one incapable of her own distress, or like a creature native and indued unto that element." "But long it could not be till that her garments, heavy with their drink, pull'd the poor wretch from her melodious lay to muddy death." " Alas, then, she is drown'd?" " Drown'd." "Drown'd." "Too much of water hast thou, poor Ophelia, and therefore I forbid my tears, but yet it is our trick." "Nature her custom holds," "let shame say what it will." "When these are gone," "the woman will be out." "Adieu, my lord." "I have a speech of fire, that fain would blaze, but that this folly douts it." "Let's follow, Gertrude." "How much I had to do to calm his rage!" "Now fear I this will give it start again." "Therefore... let's follow!" "Is she to be buried in Christian burial that wilfully seeks her own salvation?" "I tell thee she is, and therefore make her grave straight." "The crowner hath sat on her, and finds it Christian burial." "How can that be, unless she drowned herself in her own defence?" " Why, 'tis found so." " It must be 'se offendendo', it cannot be else." "For here lies the point:" "if I drown myself wittingly, it argues an act, and an act hath three branches:" "it is, to act, to do, to perform:" "argal, she drowned herself wittingly." " Nay, but hear you, goodman delver," " Give me leave." "Here lies the water, good." "Here stands the man." "Good." "If the man go to this water, and drown himself, it is, will he, nill he, he goes, mark you that." "But if the water come to him and drown him, he drowns not himself." "Argal, he that is not guilty of his own death," " shortens not his own life." " But is this law?" " Ay, marry, is't." "Crowner's quest law." " Will you ha' the truth on't?" "If this had not been a gentlewoman, she should have been buried out o' Christian burial." "Why, there thou say'st, and the more pity that great folk should have countenance in this world to drown or hang themselves, more than their even Christian." "Come, my spade." "There is no ancient gentleman but gardeners, ditchers, and grave-makers:" " they hold up Adam's profession." " Was he a gentleman?" " He was the first that ever bore arms." " Why, he had none." "What, art a heathen?" "How dost thou understand the Scripture?" "The Scripture says 'Adam digged'." "Could he dig without arms?" "I'll put another question to thee:" "if thou answerest me not to the purpose, confess thyself." " Go to." " What is he that builds stronger than either the mason, the shipwright, or the carpenter?" "The gallows-maker for that frame outlives a thousand tenants." "I like thy wit well, in good faith: the gallows does well but how does it well?" "It does well to those that do ill:" "now thou dost ill to say the gallows is built stronger than the church, argal, the gallows may do well to thee." "To't again, come." "'Who builds stronger than a mason, a shipwright, or a carpenter?" "'" " Ay, tell me that, and unyoke." " Marry, now I can tell." "To't." " Mass, I cannot tell." " Cudgel thy brains no more about it, for your dull ass will not mend his pace with beating and, when you are asked this question next, say: 'a grave-maker':" "the houses that he makes last till doomsday." "Go, get thee to Yaughan, fetch me a stoup of liquor." "In youth, when I did love, did love, methought it was very sweet, to contract, o, the time, for, ah, my behove, o, methought, there was nothing meet." "Has this fellow no feeling of his business, that he sings at grave-making?" "Custom hath made it in him a property of easiness." "'Tis e'en so: the hand of little employment hath the daintier sense." "But age, with his stealing steps, hath claw'd me in his clutch, and hath shipped me intil the land, as if I had never been such." "That skull had a tongue in it, and could sing once." "How the knave jowls it to the ground, as if it were Cain's jaw-bone, that did the first murder!" "It might be the pate of a politician, which this ass now o'er-reaches one that would circumvent God, might it not?" " It might, my lord." " Or of a courtier which could say 'Good morrow, sweet lord!" "How dost thou, good lord?" "'" "This might be my lord such-a-one, that praised my lord such-a-one's horse," " when he meant to beg it might it not?" " Ay, my lord." "Why, e'en so, and now my Lady Worm's chapless, and knocked about the mazzard with a sexton's spade." "Here's fine revolution, an we had the trick to see't." "Did these bones cost no more the breeding, but to play at loggats with 'em?" "Mine ache to think on't." "There's another: why may not that be the skull of a lawyer?" "Where be his quiddities now, his quillets, his cases, his tenures, and his tricks?" "Why does he suffer this rude knave now to knock him about the sconce with a dirty shovel, and will not tell him of his action of battery?" "This fellow might be in's time a great buyer of land, with his statutes, his recognizances, his fines, his double vouchers, his recoveries..." "Is this the fine of his fines, and the recovery of his recoveries, to have his fine pate full of fine dirt?" "Will his vouchers vouch him no more of his purchases, and double ones too, than the length and breadth of a pair of indentures?" "The very conveyances of his lands will scarcely lie in this box and must the inheritor himself have no more, ha?" " Not a jot more, my lord." " Is not parchment made of sheepskins?" "Ay, my lord, and of calf-skins too." "They are sheep and calves which seek out assurance in that." "I will speak to this fellow." " Whose grave's this, sirrah?" " Mine, sir." "O, a pit of clay for to be made for such a guest is meet." "I think it be thine, indeed for thou liest in't." "You lie out on't, sir, and therefore it is not yours." "For my part, I do not lie in't, and yet it is mine." "'Thou dost lie in't, to be in't and say it is thine:" "'tis for the dead, not for the quick therefore thou liest." "'Tis a quick lie, sir 'twill away gain, from me to you." " What man dost thou dig it for?" " For no man, sir." " What woman, then?" " For none, neither." "Who is to be buried in't?" "One that was a woman, sir but, rest her soul, she's dead." "How absolute the knave is!" "We must speak by the card, or equivocation will undo us." "By the Lord, Horatio, these three years I have taken a note of it the age is grown so picked that the toe of the peasant comes so near the heel of the courtier, he gaffs his kibe." " How long hast thou been a grave-maker?" " Of all the days i' the year," "I came to't that day that our last king Hamlet overcame Fortinbras." " How long is that since?" " Cannot you tell that?" "Every fool can tell that:" "it was the very day that young Hamlet was born, he that is mad, and sent into England." " Ay, marry, why was he sent into England?" " Why, because he was mad." "He shall recover his wits there or, if he do not, it's no great matter there." " Why?" " 'Twill not be seen in him there there the men are as mad as he." " How came he mad?" " Very strangely, they say." " How strangely?" " Faith, e'en with losing his wits." " Upon what ground?" " Why, here in Denmark?" "I have been sexton here, man and boy, thirty years." "How long will a man lie i' the earth ere he rot?" "I' faith, if he be not rotten before he die as we have many pocky corses now-a-days, that will scarce hold the laying in he will last you some eight year or nine year." " A tanner will last you nine year." " Why he more than another?" "Why, sir, his hide is so tanned with his trade, that he will keep out water a great while and your water is a sore decayer of your whoreson dead body." "Here's a skull now." "This skull has lain in the earth three and twenty years." " Whose was it?" " A whoreson mad fellow's it was." " Whose do you think it was?" " Nay, I know not." "A pestilence on him for a mad rogue!" "He poured a flagon of Rhenish on my head once." "This same skull, sir, was Yorick's skull, the king's jester." " This?" " E'en that." "Let me see." "Alas, poor Yorick!" "I knew him, Horatio:" "a fellow of infinite jest, of most excellent fancy." "He hath borne me on his back a thousand times and now, how abhorred in my imagination it is!" "my gorge rises at it." "Here hung those lips that I have kissed I know not how oft." "Where be your gibes now?" "Your gambols?" "Your songs?" "Your flashes of merriment, that were wont to set the table on a roar?" "Not one now, to mock your own grinning?" "Quite chap-fallen?" "Now get you to my lady's chamber, and tell her, let her paint an inch thick, to this favour she must come." "Make her laugh at that." " Prithee, Horatio, tell me one thing." " What's that, my lord?" "Dost thou think Alexander looked o' this fashion i' the earth?" "E'en so." " And smelt so?" "pah!" " E'en so, my lord." "To what base uses we may return, Horatio!" "Why may not imagination trace the noble dust of Alexander, till he find it stopping a bung-hole?" "'Twere to consider too curiously, to consider so." "No, faith, not a jot but to follow him thither with modesty enough, and likelihood to lead it, as thus:" "Alexander died, Alexander was buried," "Alexander returneth to dust the dust is earth of earth we make loam and why of that loam, whereto he was converted, might they not stop a beer-barrel?" "Imperious Caesar, dead and turn'd to clay, might stop a hole to keep the wind away." "O, that that earth, which kept the world in awe, should patch a wall to expel the winter's flaw!" "But soft!" "But soft!" "Aside, here comes the king, the queen, the courtiers." "Who is this they follow?" "And with such maimed rites?" "This doth betoken the corse they follow did with desperate hand fordo its own life, 'twas of some estate." "Couch we awhile, and mark." " What ceremony else?" " That is Laertes," " a very noble youth." "Mark." " What ceremony else?" "Her obsequies have been as far enlarged as we have warrantise." "Her death was doubtful and, but that great command o'ersways the order, she should in ground unsanctified have lodged till the last trumpet for charitable prayers, shards, flints and pebbles should be thrown on her" "yet here she has her virgin rights, her maiden strewments and the bringing home of bell and burial." " Must there no more be done?" " No more be done, we should profane the service of the dead to sing a requiem and such rest to her as to peace-parted souls." "Lay her i' the earth" "and from her fair and unpolluted flesh may violets spring!" "I tell thee, churlish priest!" "A ministering angel shall my sister be, when thou liest howling." "What, the fair Ophelia!" "Sweets to the sweet: farewell!" "I hoped thou shouldst have been my Hamlet's wife" "I thought thy bride-bed to have deck'd, sweet maid," " and not have strew'd thy grave." " O, treble woe fall ten times treble on that cursed head, whose wicked deed thy most ingenious sense deprived thee of!" "Hold off the earth awhile, till I have caught her once more in mine arms!" "Now pile your dust upon the quick and dead, till of this flat a mountain you have made, to o'ertop old Pelion, or the skyish head of blue Olympus." "What is he whose grief bears such an emphasis?" "Whose phrase of sorrow conjures the wandering stars, and makes them stand like wonder-wounded hearers?" " This is I, Hamlet the Dane." " The devil take thy soul!" "Thou pray'st not well." "I prithee, take thy fingers from my throat for, though I am not splenitive and rash, yet have I in me something which let thy wiseness fear." "Hold off thy hand!" " Pluck them asunder." " Hamlet, Hamlet!" " Good my lord, be quiet." " Why I will fight with him upon this theme until my eyelids will no longer wag." " O my son, what theme?" " I loved Ophelia!" "Forty thousand brothers could not, with all their quantity of love, make up my sum." "What wilt thou do for her?" " O, he is mad, Laertes." " For love of God, forbear him." "'Swounds, show me what thou'lt do:" "woo't weep?" "Woo't fight?" "Woo't fast?" "woo't tear thyself?" "Woo't drink up eisel?" "Eat a crocodile?" "I'll do't." "Dost thou come here to whine?" "To outface me with leaping in her grave?" "Be buried quick with her, and so will I. And, if thou prate of mountains, let them throw millions of acres on us, till our ground, singeing his pate against the burning zone, make Ossa like a wart!" "Nay, an thou'lt mouth, I'll rant as well as thou." "This is mere madness, and thus awhile the fit will work on him anon, as patient as the female dove, when that her golden couplets are disclosed," " his silence will sit drooping." " Hear you, sir what is the reason that you use me thus?" "I loved you ever but it is no matter." "Let Hercules himself do what he may, the cat will mew and dog will have his day." "I pray you, good Horatio, wait upon him." "Strengthen your patience in our last night's speech we'll put the matter to the present push." "Good Gertrude, set some watch over your son." "This grave shall have a living monument, an hour of quiet shortly shall we see." "Till then, in patience our proceeding be." "So much for this, sir: now shall you see the other." "You do remember all the circumstance?" "Remember it, my lord?" "Sir, in my heart there was a kind of fighting, that would not let me sleep." "Methought I lay worse than the mutines in the bilboes." "Rashly, and praised be rashness for it, let us know, our indiscretion sometimes serves us well, when our deep plots do pall, and that should learn us: there's a divinity that shapes our ends," " rough-hew them how we will." " That is most certain." "Up from my cabin, my sea-gown scarf'd about me, in the dark groped I to find out them had my desire." "Finger'd their packet, and in fine withdrew to mine own room again making so bold, my fears forgetting manners, to unseal their grand commission where I found, Horatio, o royal knavery!" "An exact command, larded with many several sorts of reasons importing Denmark's health and England's too, with, ho!" "Such bugs and goblins in my life, that, on the supervise, no leisure bated, no, not to stay the grinding of the axe, my head should be struck off." " Is't possible?" " Here's the commission: read it at more leisure." "But wilt thou hear me how I did proceed?" "I beseech you." "Being thus be-netted round with villanies, ere I could make a prologue to my brains, they had begun the play." "I sat me down, devised a new commission, wrote it fair." "I once did hold it, as our statists do, a baseness to write fair, and labour'd much how to forget that learning, but, sir, now it did me yeoman's service." " Wilt thou know the effect of what I wrote?" " Ay, good my lord." "An earnest conjuration from the king, as England was his faithful tributary, as love between them like the palm might flourish, as peace should stiff her wheaten garland wear and stand a comma 'tween their amities," "and many such-like 'As'es of great charge, that, on the view and knowing of these contents, without debatement further, more or less, he should those bearers put to sudden death," " not shriving-time allow'd." " How was this seal'd?" "Why, even in that was heaven ordinant." "I had my father's signet in my purse, which was the model of that Danish seal." "Folded the writ up in form of the other, subscribed it, gave't the impression, placed it safely, the changeling never known." "Now, the next day was our sea-fight and what to this was sequent thou know'st already." "So Guildenstern and Rosencrantz go to't." "Why, man, they did make love to this employment they are not near my conscience their defeat does by their own insinuation grow:" "'tis dangerous when the baser nature comes between the pass and fell incensed points of mighty opposites." "Why, what a king is this!" "Does it not, think'st thee, stand me now upon he he that hath kill'd my king and whored my mother, popp'd in between the election and my hopes, thrown out his angle for my proper life," "and with such cozenage is't not perfect conscience, to quit him with this arm?" "And is't not to be damn'd, to let this canker of our nature come in further evil?" "It must be shortly known to him from England what is the issue of the business there." "It will be short:" "the interim is mine and a man's life's" "no more than to say 'One.'" "But I am very sorry, good Horatio, that to Laertes I forgot myself for, by the image of my cause, I see the portraiture of his," "I'll court his favours." "But, sure, the bravery of his grief did put me into a towering passion." "Peace!" "Who comes here?" "Your lordship is right welcome back to Denmark!" "I humbly thank you, sir." " Dost know this water-fly?" " No, my good lord." "Thy state is the more gracious for 'tis a vice to know him." "He hath much land, and fertile." "Let a beast be lord of beasts, and his crib shall stand at the king's mess." "'Tis a chough but, as I say, spacious in the possession of dirt." "Sweet lord, if your friendship were at leisure," "I should impart a thing to you from his majesty." "I will receive it, sir, with all diligence of spirit." "Put your bonnet to his right use 'tis for the head." "I thank your lordship, but 'tis very hot." "No, believe me, 'tis very cold the wind is northerly." "It is indifferent cold, my lord, indeed." "But yet methinks it is very sultry and hot for my complexion." "Exceedingly, my lord it is very sultry, as 'twere," "I cannot tell how." "But, my lord, his majesty bade me signify to you that he has laid a great wager on your head." "Sir, this is the matter," "I beseech you, remember." "Nay, good my lord for mine ease, in good faith." "Sir, here is newly come to court Laertes believe me, an absolute gentleman, full of most excellent differences, of very soft society and great showing." "Indeed, to speak feelingly of him, he is the card or calendar of gentry, for you shall find in him the continent of what part a gentleman would see." "Sir, his definement suffers no perdition in you though, I know, to divide him inventorially would dizzy the arithmetic of memory, and yet but yaw neither, in respect of his quick sail." "But, in the verity of extolment, I take him to be a soul of great article and his infusion of such dearth and rareness, as, to make true diction of him." "His semblable is his mirror and who else would trace him, his umbrage, nothing more." "Your lordship speaks most infallibly of him." "The concernancy, sir?" "Why do we wrap the gentleman in our more rawer breath?" "Sir?" "Is't not possible to understand in another tongue?" "You will do't, sir, really." "What imports the nomination of this gentleman?" " Of Laertes?" " His purse is empty already" " all's golden words are spent." " Of him, sir." "I know you are not ignorant." "I would you did, sir yet, in faith, if you did, it would not much approve me." "Well, sir?" "You are not ignorant of what excellence Laertes is" "I dare not confess that, lest I should compare with him in excellence but, to know a man well, were to know himself." "I mean, sir, for his weapon but in the imputation laid on him by them, in his meed he's unfellowed." " What's his weapon?" " Rapier and dagger." " That's two of his weapons, but, well." " The king, sir, hath wagered with him six Barbary horses" " against the which he has imponed, - 'Imponed'?" "as I take it, six French rapiers and poniards, with their assigns, as girdle, hangers, and so three of the carriages, in faith, are very dear to fancy, very responsive to the hilts, most delicate carriages," " and of very liberal conceit." " What call you the carriages?" "I knew you must be edified by the margent ere you had done." "The carriages, sir, are the hangers." "The phrase would be more german to the matter, if we could carry cannon by our sides I would it might be hangers till then." "But, on: six Barbary horses against six French swords, their assigns," " and three liberal-conceited..." " Carriages." "...carriages that's the French bet against the Danish." "Why is this 'imponed,' as you call it?" "The king, sir, hath laid, sir, that in a dozen passes between yourself and him, he shall not exceed you three hits, he hath laid on twelve for nine and it would come to immediate trial," "if your lordship would vouchsafe the answer." "How if I answer 'no'?" "I mean, my lord, the opposition of your person in trial." "Sir, I will walk here in the hall if it please his majesty, 'tis the breathing time of day with me let the foils be brought, the gentleman willing, and the king hold his purpose," "I will win for him an I can." "If not, I shall gain nothing but my shame and the odd hits." " Shall I re-deliver you e'en so?" " To this effect, sir, after what flourish your nature will." " I commend my duty to your lordship." " Yours, yours." "He does well to commend it himself there are no tongues else for's turn." "This lapwing runs away with the shell on his head." "He did comply with his dug, before he sucked it." "Thus has he, and many more of the same bevy that I know the drossy age dotes on, only got the tune of the time and outward habit of encounter a kind of yesty collection, which carries them through and through" "the most fond and winnowed opinions and do but blow them to their trial, the bubbles are out." "My lord, his majesty commended him to you by young Osric, who brings back to him that you attend him in the hall." "He sends to know if your pleasure hold to play with Laertes," " or that you will take longer time." " I am constant to my purposes, they follow the king's pleasure." "If his fitness speaks, mine is ready now or whensoever," " provided I be so able as now." " The king and queen and all are coming down." " In happy time." " The queen desires you to use some gentle entertainment to Laertes before you fall to play." "She well instructs me." "You will lose this wager, my lord." "I do not think so." "Since he went into France, I have been in continual practise," "I shall win at the odds." "But thou wouldst not think how ill all's here about my heart." " But it is no matter." " Nay, good my lord." "It is but foolery but it is such a kind of gain-giving, as would perhaps trouble a woman." "If your mind dislike any thing, obey it." "I will forestall their repair hither, and say you are not fit." "Not a whit, we defy augury." "There's a special providence in the fall of a sparrow." "If it be now, 'tis not to come if it be not to come, it will be now." "If it be not now," "yet it will come." "The readiness is all." "Since no man knows aught of what he leaves, what is't to leave betimes?" "Let be." "Come, Hamlet, come, and take this hand from me." "Give me your pardon, sir," "I've done you wrong but pardon't, as you are a gentleman." "This presence knows, and you must needs have heard, how I am punish'd with sore distraction." "What I have done, that might your nature, honour and exception roughly awake," "I here proclaim was madness." "Was't Hamlet wrong'd Laertes?" "Never Hamlet: if Hamlet from himself be ta'en away, and when he's not himself does wrong Laertes, then Hamlet does it not," "Hamlet denies it." "Who does it, then?" "His madness." "If't be so, Hamlet is of the faction that is wrong'd his madness is poor Hamlet's enemy." "Sir, in this audience, let my disclaiming from a purposed evil free me so far in your most generous thoughts, that I have shot mine arrow o'er the house," "and hurt my brother." "I am satisfied in nature, whose motive, in this case, should stir me most to my revenge, but in my terms of honour I stand aloof and will no reconcilement, until by some elder masters, of known honour," "I have a voice and precedent of peace, to keep my name ungored." "But till that time, I do receive your offer'd love like love," " and will not wrong it." " I do embrace it freely and will this brother's wager frankly play." " Give us the foils." "Come on." " Come, one for me." "I'll be your foil, Laertes." "In mine ignorance your skill shall, like a star i' the darkest night," " stick fiery off indeed." " You mock me, sir." " No, by this hand." " Give them the foils, young Osric." " Cousin Hamlet, you know the wager?" " Very well, my lord." "Your grace hath laid the odds o' the weaker side." "I do not fear it I have seen you both, but since he is better'd, we have therefore odds." "This one's too heavy, let me see another." "This likes me well." "These foils have all a length?" "Ay, my good lord." "Set me the stoops of wine upon that table." "If Hamlet give the first or second hit, or quit in answer of the third exchange, let all the battlements their ordnance fire." "The king shall drink to Hamlet's better breath and in the cup an union shall he throw, richer than that which four successive kings in Denmark's crown have worn." "Give me the cup and let the kettle to the trumpet speak, the trumpet to the cannoneer without, the cannons to the heavens, the heavens to earth, 'now the king drinks to Hamlet.'" "Come, begin." "And you, the judges," " bear a wary eye." " Come on, sir." "Come, my lord." " One." " No." " Judgment." " A hit, a very palpable hit." " Well again." " Stay give me drink." "Hamlet, this pearl is thine here's to thy health." "Give him the cup." "I'll play this bout first set it by awhile." "Come." " Another hit what say you?" " A touch, a touch, I do confess." " Our son shall win." " He's fat, and scant of breath." "Here, Hamlet, take my napkin, rub thy brows." "The queen carouses to thy fortune, Hamlet." " Good madam!" " Gertrude!" "Do not drink." "I will, my lord." "I pray you, pardon me." "It is the poison'd cup: it is too late." "I dare not drink yet, madam by and by." "Come, let me wipe thy face." " My lord, I'll hit him now." " I do not think't." "And yet 'tis almost 'gainst my conscience." "Attack!" "Come, for the third, Laertes." "You but dally" "I pray you, pass with your best violence" "I am afeard you make a wanton of me." "Say you so?" "Come on." "Have at you now!" " Nothing, neither way." " Part them they are incensed." "Nay, come, again." "Look to the queen there, ho!" "They bleed on both sides." "How is't, Laertes?" "Why, as a woodcock to mine own springe, Osric." "I am justly kill'd with mine own treachery." " How does the queen?" " She swounds to see them bleed." "No, no, the drink, the drink!" "O my dear Hamlet, the drink, the drink!" "I am poison'd." "O villany!" "Ho!" "Let the door be lock'd!" "Treachery!" "Seek it out." "It is here, Hamlet!" "Hamlet, thou art slain no medicine in the world can do thee good in thee there is not half an hour of life the treacherous instrument is in thy hand, unbated and envenom'd, the foul practise hath turn'd itself on me." "Lo, here I lie, never to rise again: thy mother's poison'd." "I can no more:" "the king, the king's to blame." "Treason!" "Treason!" "The point!" "Envenom'd too!" "Then, venom, to thy work." "O, yet defend me, friends I am but hurt." "Here, thou incestuous, murderous, damned Dane, drink off this potion." "Is thy union here?" "Follow my mother." "He is justly served it is a poison temper'd by himself." "Exchange forgiveness with me, noble Hamlet." "Mine and my father's death come not upon thee," " nor thine on me." " Heaven make thee free of it!" "I follow thee." "I am dead, Horatio." "Wretched queen, adieu!" "You that look pale and tremble at this chance, that are but mutes or audience to this act, had I but time" "as this fell sergeant, death, is strict in his arrest" "O, I could tell you... but let it be." "Horatio, I am dead thou livest report me and my cause aright to the unsatisfied." "Never believe it," "I am more an antique Roman than a Dane." " Here's yet some liquor left." " As thou'rt a man, give me the cup, let go!" "By heaven!" "I'll ha't." "O God, Horatio, what a wounded name, things standing thus unknown, shall live behind me!" "If thou didst ever hold me in thy heart absent thee from felicity awhile, and in this harsh world draw thy breath in pain, to tell my story." "What warlike noise is this?" "Young Fortinbras, with conquest come from Poland, to the ambassadors of England gives this warlike volley." "I die, Horatio." "The potent poison quite o'er-crows my spirit." "I cannot live to hear the news from England but I do prophesy the election" "lights on Fortinbras." "He hath my dying voice so tell him, with the occurrents, more and less, which have solicited." "The rest... is... silence." "Now cracks a noble heart." "Good night sweet prince... and flights of angels sing thee to thy rest!" "Why does the drum come hither?" "Where is this sight?" "What is it ye would see?" "If aught of woe or wonder, cease your search." "This quarry cries on havoc." "O proud death!" "What feast is toward in thine eternal cell, that thou so many princes at a shot so bloodily hast struck?" "The sight is dismal and our affairs from England come too late." "The ears are senseless that should give us hearing, to tell him his commandment is fulfill'd, that Rosencrantz and Guildenstern are dead." " Where should we have our thanks?" " Not from his mouth, had it the ability of life to thank you:" "he never gave commandment for their death." "But since, so jump upon this... bloody question," "you from the Polack wars, and you from England, are here arrived." "Give order that these bodies high on a stage be placed to the view and let me speak to the yet unknowing world how these things came about, so shall you hear of carnal, bloody," "and unnatural acts, of accidental judgments, casual slaughters, of deaths put on by cunning and forced cause, and, in this upshot, purposes mistook fall'n on the inventors' heads." "All this can I truly deliver." "Let us haste to hear it, and call the noblest to the audience." "For me, with sorrow I embrace my fortune." "I have some rights of memory in this kingdom, which now to claim my vantage doth invite me." "Of that I shall have also cause to speak, and from his mouth whose voice will draw on more but let this same be presently perform'd, even while men's minds are wild lest more mischance on plots and errors, happen." "Let four captains bear Hamlet, like a soldier, to the stage for he was likely, had he been put on, to have proved most royally, and, for his passage, the soldiers' music and the rites of war speak loudly for him." "Take up the body!" "Such a sight as this becomes the field, but here shows much amiss." "Go." "Bid the soldiers shoot." "# subtitles:" "lyliakar # ** thanks to (c) dcd for his subs in Brazilian **"
|
{
"pile_set_name": "OpenSubtitles"
}
|
---
abstract: 'It is known that infinitely many Medvedev degrees exist inside the Muchnik degree of any nontrivial $\Pi^0_1$ subset of Cantor space. We shed light on the fine structures inside these Muchnik degrees related to learnability and piecewise computability. As for nonempty $\Pi^0_1$ subsets of Cantor space, we show the existence of a finite-$\Delta^0_2$-piecewise degree containing infinitely many finite-$(\Pi^0_1)_2$-piecewise degrees, and a finite-$(\Pi^0_2)_2$-piecewise degree containing infinitely many finite-$\Delta^0_2$-piecewise degrees (where $(\Pi^0_n)_2$ denotes the difference of two $\Pi^0_n$ sets), whereas the greatest degrees in these three “finite-$\Gamma$-piecewise” degree structures coincide. Moreover, as for nonempty $\Pi^0_1$ subsets of Cantor space, we also show that every nonzero finite-$(\Pi^0_1)_2$-piecewise degree includes infinitely many Medvedev (i.e., one-piecewise) degrees, every nonzero countable-$\Delta^0_2$-piecewise degree includes infinitely many finite-piecewise degrees, every nonzero finite-$(\Pi^0_2)_2$-countable-$\Delta^0_2$-piecewise degree includes infinitely many countable-$\Delta^0_2$-piecewise degrees, and every nonzero Muchnik (i.e., countable-$\Pi^0_2$-piecewise) degree includes infinitely many finite-$(\Pi^0_2)_2$-countable-$\Delta^0_2$-piecewise degrees. Indeed, we show that any nonzero Medvedev degree and nonzero countable-$\Delta^0_2$-piecewise degree of a nonempty $\Pi^0_1$ subset of Cantor space have the strong anticupping properties. Finally, we obtain an elementary difference between the Medvedev (Muchnik) degree structure and the finite-$\Gamma$-piecewise degree structure of all subsets of Baire space by showing that none of the finite-$\Gamma$-piecewise structures are Brouwerian, where $\Gamma$ is any of the Wadge classes mentioned above.'
address:
- 'Department of Mathematics and Informatics, Chiba University, 1-33 Yayoi-cho, Inage, Chiba, Japan'
- 'School of Information Science, Japan Advanced Institute of Science and Technology, Nomi 923-1292, Japan'
author:
- 'K. Higuchi'
- 'T. Kihara'
bibliography:
- 'IMref.bib'
title: 'Inside the Muchnik Degrees II: The Degree Structures induced by the Arithmetical Hierarchy of Countably Continuous Functions'
---
The authors were partially supported by Grant-in-Aid for JSPS fellows. The second author (Kihara) would like to thank Douglas Cenzer, Hajime Ishihara, Dick de Jongh, Arno Pauly, and Albert Visser, for valuable comments and helpful discussion, and the second author also would like to thank Makoto Tatsuta and Yoriyuki Yamagata for introducing him to the syntactical study on Limit Computable Mathematics. The second author is also grateful to Sam Sanders who helped his English writing. Finally, the authors would like to thank the anonymous referees for their valuable comments and suggestions.
|
{
"pile_set_name": "ArXiv"
}
|
Hi Guys! I HOPE you are all keeping well and healthy and staying HOME.
Today I have a brand on my blog that I have loved forever – RODIAL
You can read some of my other posts on them
Here, Here & Here
in Canada They are available at Shopper’s Drug Mart
in LUXURY brands
Let’s get into the products – shall we!
Starting with The Vitamin C range
$93 CAD
Brighten, illuminate and protect the skin with the potent Vit C Booster Drops, formulated with 6% vitamin c complex. Vitamin C is a powerful antioxidant, proven to boost skins radiance and luminosity for a youthful, refreshed appearance. My thoughts
These are a delight to apply. There is a light citrus fragrance and the product sinks right into the skin, leaving it dewy and illuminated. You can also apply a few drops to your daily moisturizer for an extra boost. My favourite way to use it so far is with my jade roller after I have cleansed and toned my face. A+ —
Vit C Brightening Cleansing Pads $59 CAD Give skin a shot of glow serum whilst resurfacing and retexturising the canvas of the face with these deep cleansing pads that brighten skin. Formulated with a fusion of pure Vitamin C, 0.5% salicylic acid and 1% fruit acid complex to retexturise the complexion. Each cleansing pad is infused with your daily dose of brightening fruit acids to retexturise and renew the complexion. Sweep over the skin morning and night for a shot of glow enhancing Vitamin C. Fruit AHA acids exfoliate and rejuvenate, while salicylic acid tightens pores – firming and toning the skin. The complexion is glowing with smooth, even, and clear skin.
My Thoughts
These are amazing right after cleansing my face. I am keeping them in my fridge as I do with a lot of my favourite skincare. They have a spa like feel and that’s something I am really into these days. Creating a home spa. They have a light citrus scent and really work well with the Vit C drops.
A+
—
Vit C Face Soufflé $110 CAD This luxurious Vit C Face Soufflé works to deeply hydrate the skin while diminishing the appearance of age spots and hyper pigmentation. Ideal for dry/dehydrated skin, this unique, indulgent formula is enriched with 2% Vitamin C to brighten and renew the complexion.
My Thoughts
The texture of this moisturizer is everything! It’s like a fluffy cloud of deep moisture. Again, amazing for a facial massage with a jade roller. I am super impressed with Vitamin C products, these three all leave my skin feeling refreshed, brightened and deeply renewed.
A ++ for the Soufflé!
Onto the Pink Diamond Products
Pink Diamond Instant Lifting Serum $142 CAD The Pink Diamond Instant Lifting Serum is a triple-action flash radiance serum with an immediate skin-lifting effect, evens skin tone and adds luminosity with real diamond powder. A powerful cocktail of age-defying enzymes and proteins elevate the appearance of facial contours for a visible lift to help tackle sagging skin. Vitamin c and chromabright technology help even skin tone and brighten the complexion. Diamond powder reflects light to give the complexion a soft, natural glow. Skin is visibly firmer, tighter and pigmentation reduced.
My Thoughts
If You have mature skin- I call mature skin -skin over 35, You will adore this. It’s an Immediate smoothing and lifting effect and perfect under makeup. I love to smooth it down my neck as well. Amazing Rodial!
A++
—
$95 CAD
The Pink Diamond Magic Gel Day’s lightweight and hydrating formula delivers moisture deep into the skin, while tightening complexes smooth and plump the appearance of fine lines and wrinkles. Infused with Diamond Powder and blurring actives, this Vitamin C enriched formula gives skin a fresh, dewy glow and can also be used as the perfect canvas for makeup application.
My Thoughts
Obsessed! From the perfect packaging to the great formulation. You only need to push down once to get enough product for your whole face! I love when brands do this. It gives the skin such a soft focus look just like the lifting serum. The feel is luxurious and it has just a hint of a soft powder scent.
A
—
And last but not least
$99 CAD
Transform the appearance of fine lines and wrinkles while you sleep with the Pink Diamond Magic Gel Night, Retinol infused night treatment. This lightweight, hydrating formula works to promote overnight skin renewal and repair for a visibly smooth, lifted and illuminated complexion. Key benefits: Redensifying peptides Diamond powder Retinol Vitamin C
My Thoughts
If you are looking for an overnight treatment that’s going to soften the skin, lessen the look of wrinkles and plump the skin within one application- THIS is for you! As I am doing more and more spa nights at home and really nurturing my skin through these strange times, I notice that the more I really take care of myself, the better I feel. We all can create Self care rituals at home that feel like Sanctuary. I am so glad that Rodial products are part of my routine.
A+++
—
Again, I hope you are all doing well… Sending out a lot of Love
Twitter | IG | Pinterest | Linkedin|
Tumblr– Bloglovin
catforsley.com
*Gifted kindly by Rodial – All views are my own
|
{
"pile_set_name": "OpenWebText2"
}
|
Welcome!
Radiant Wellness Centre (RWC) is advanced energy medicine practice based in Singapore. At RWC, you get the most comprehensive approach to assessment and therapy. We look at physical causes like toxicity and infections, as well as non-physical causes like emotions, belief systems, and even trans generational/inherited issues.
Thank you for visiting – we invite you to your pathway to true healing and experience energy medicine as the solution to reverse your disease naturally.
What is Energy Medicine?
Your physical body may look solid but science has proven that it is made up of energy, vibrations and information. Addressing disturbances at the level of energy allows for a deeper resolution of all types of physical illnesses, as well as mental and emotional afflictions.
You may already have tried to seek help from doctors, psychologists, psychiatrists or Traditional Chinese Medicine (TCM) practitioners. How about getting another perspective for your problem?
Digestive and Stomach Problems: All diseases begins in the gut: Story of Indah
“I have seen a number of naturopaths, homeopaths and ayurvedic medicine practitioners. Some I have even followed for years. I feel a little better but never really got well.”
We told Indah what we found – that the most likely problem she had was an issue with her digestive system. How did we come to that conclusion?
Her tonsils were showing as the weakest organs, which indicate that her tonsils have become hotbed for bacteria. There was a long list of pathogens that she was testing for. She has all the characteristics of the “leaky gut syndrome” – yeast overgrowth, allergies to wheat and milk, and emotions like being neglected, lost, being deprived of safety and intimacy, all negative emotions which are essentially held in the small intestines.
Thousands of years ago, Hippocrates said, “All diseases begin in the gut.” Well, not much had changed since then.
We asked whether she ever had amalgam fillings placed into her mouth before, as metals like mercury, lead and platinum were all showing in her test. She did, but she removed them a few years ago.
“Did you do any detoxification of the metals even though you removed the fillings?”
“No”, she sheepishly admitted, “No one has asked me to.”
She had done all the naturopathy work, but never any work dealing with emotions and trans-generational issues. And yet, that seemed to be where she most needed help in. Her ancestors seemed to have experienced a number of traumas related to being abandoned and neglected.
The memories of these traumas were still activated in Indah, causing a stress response and release of stress hormones like cortisol. Cortisols over time break down the gut lining. This was further exacerbated by use of antibiotics that kill bacteria but not a fungus called candida. Candida grew roots which further break down the gut lining, worsening the “leaky gut” syndrome
Undigested food substances like wheat and dairy in particular went into her bloodstream through the gut, causing the immune system to send inflammatory substances to destroy these foreign “invaders”, leading to further inflammation.
Her liver had to work harder to help with digestion. This started to compromise detoxification. The buildup of toxins provided an optimal environment for pathogens to grow and the immune system became compromised. In her case, the number of viruses, parasites and bacteria in her body was mind-blowing. It didn’t surprise her – she had had her gut issues for over 30 years.
By resolving the stresses and pathogens and toxins, her situation could finally turn around!
She started noticing her condition improving within the first month, she used to not be able to sleep to her side because of how that disturbed her, and she had to resort to sleeping facing up just to minimize her discomfort. She now gladly reported that she no longer had to do that!
Also, she started noticing improvements in her mood and stability. She now felt much calmer and her digestive system seems to function better after a meal, with less indigestion symptoms.
Disclaimer: This website, together with and including all content thereon, is not a substitute for professional advice from your qualified health care professional. All information on the website is of a general nature and for information purposes only. We review all content provided by them but make no representations or warranty that all content or information is complete, up-to-date or appropriate. We do not accept any liability for any injury, loss or damage incurred by use of or in reliance on the information provided through the Web site whether arising from negligence or otherwise.
Although we are able to produce positive healing result, we are not licensed to practice allopathic medicine in Singapore and hence the services we render and the products we recommend should be considered generic in nature, and are not intended, in any way, to be a substitute for a medical exam, or professional medical advice, diagnosis or treatment. We make no claims to diagnose, treat, cure or prevent any diseases.
|
{
"pile_set_name": "Pile-CC"
}
|
// Copyright (C) 2015 Patryk Nadrowski
// This file is part of the "Irrlicht Engine".
// For conditions of distribution and use, see copyright notice in irrlicht.h
#ifndef __C_OPEN_GL_RENDER_TARGET_H_INCLUDED__
#define __C_OPEN_GL_RENDER_TARGET_H_INCLUDED__
#include "IrrCompileConfig.h"
#ifdef _IRR_COMPILE_WITH_DIRECT3D_9_
#include "IRenderTarget.h"
#include "dimension2d.h"
#include "os.h"
#include <d3d9.h>
namespace irr
{
namespace video
{
class CD3D9Driver;
class CD3D9RenderTarget : public IRenderTarget
{
public:
CD3D9RenderTarget(CD3D9Driver* driver);
virtual ~CD3D9RenderTarget();
virtual void setTexture(const core::array<ITexture*>& texture, ITexture* depthStencil, const core::array<E_CUBE_SURFACE>& cubeSurfaces) _IRR_OVERRIDE_;
const core::dimension2d<u32>& getSize() const;
IDirect3DSurface9* getSurface(u32 id) const;
u32 getSurfaceCount() const;
IDirect3DSurface9* getDepthStencilSurface() const;
void releaseSurfaces();
void generateSurfaces();
protected:
core::dimension2d<u32> Size;
core::array<IDirect3DSurface9*> Surface;
IDirect3DSurface9* DepthStencilSurface;
CD3D9Driver* Driver;
};
}
}
#endif
#endif
|
{
"pile_set_name": "Github"
}
|
Survival of the Best Fit is a webgame that simulates what happens when companies automate their recruitment and selection processes.
You – playing as the CEO of a starting tech company – are asked to select your favorite candidates from a line-up, based on their resumés.
As your simulated company grows, the time pressure increases, and you are forced to automate the selection process.
Fortunately, some smart techies working for your company propose training a computer to hire just like you just did.
They don’t need anything but the data you just generated and some good old supervised machine learning!
To avoid spoilers, try the game yourself and see what happens!
The game only takes a few minutes, and is best played on mobile.
Survival of the Best Fit was built by Gabor Csapo, Jihyun Kim, Miha Klasinc, and Alia ElKattan. They are software engineers, designers and technologists, advocating for better software that allows members of the public to question its impact on society.
You don’t need to be an engineer to question how technology is affecting our lives. The goal is not for everyone to be a data scientist or machine learning engineer, though the field can certainly use more diversity, but to have enough awareness to join the conversation and ask important questions. With Survival of the Best Fit, we want to reach an audience that may not be the makers of the very technology that impact them everyday. We want to help them better understand how AI works and how it may affect them, so that they can better demand transparency and accountability in systems that make more and more decisions for us. survivalofthebestfit.com
I found that the game provides a great intuitive explanation of how (humas) bias can slip into A.I. or machine learning applications in recruitment, selection, or other human resource management practices and processes.
If you want to read more about people analytics and machine learning in HR, I wrote my dissertation on the topic and have many great books I strongly recommend.
Finally, here’s a nice Medium post about the game.
Note, as Joachin replied below, that the game apparently does not learn from user-input, but is programmed to always result in bias towards blues.
I kind of hoped that there was actually an algorithm “learning” in the backend, and while the developers could argue that the bias arises from the added external training data (you picked either Google, Apple, or Amazon to learn from), it feels like a bit of a disappointment that there is no real interactivity here.
|
{
"pile_set_name": "OpenWebText2"
}
|
Divided Response to Libyan Crisis 'The Maneuvering of EU Member States Is a Scandal'
In a SPIEGEL ONLINE interview, Martin Schulz, head of the Socialist group in the European Parliament, sharply criticized the way EU member states are putting national interests first over Libya. He called upon the German government to accept refugees from North Africa and warned that military intervention in Libya may be needed as a last resort.
|
{
"pile_set_name": "OpenWebText2"
}
|
Long-term survival of patients with stage IV gastric carcinoma.
Survival of patients with Stage IV (based on general rules established by the Japanese Research Society for Gastric Cancer) gastric carcinoma often is unfavorable. Among patients with a poor prognosis, a few do survive > 5 years. The authors examined pathologic and biologic features of tumors of long term survivors. The authors analyzed data from 442 patients with Stage IV gastric carcinoma, including 20 surviving for > 5 years after gastrectomy (Group A) and 422 who died of gastric carcinoma within 5 years (Group B). Mutant p53 was immunohistochemically stained using the monoclonal antibody PAb1801. Proliferative activity was estimated by argyrophilic nuclear organizer region (AgNOR) staining and proliferating cell nuclear antigen (PCNA) staining. Group A had smaller and more localized tumors than Group B (P < 0.05 and P < 0.01, respectively). Lymphatic or venous invasion and peritoneal dissemination were less frequent in Group A than in Group B (P < 0.01). Abnormalities of p53 expression were found in 3 of the 14 tumors in Group A (21%), a value significantly lower than the 58 of 118 tumors in Group B (49%; P < 0.05). AgNOR count and percentage of PCNA labeling were not significantly different between Groups A and B. A multivariate analysis showed that lymph node dissection, liver metastasis, gastric resection, venous invasion, and tumor size were independent prognostic factors. Even in patients with Stage IV gastric carcinoma, radical gastrectomy and extensive lymph node dissection can lead to long term survival. The authors believe that combination analysis of pathologic features and p53 overexpression predict length of survival for patients with Stage IV gastric carcinoma.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Women and girls should be particularly concerned, as our bodies are uniquely susceptible to certain environmental chemicals. Women have a greater percentage of fat in comparison to men, so fat-soluble chemicals such as parabens and toluene tend to be more readily absorbed and fatty breast tissue can be a long-term storage site for some of the more persistent toxic chemicals. Hormones also play a role: Synthetic chemicals such as alkylphenols (found in some detergents) and bisphenol A (found in hard plastics) can mimic natural estrogens in the body—and excess estrogen can play a role in the development of breast cancer. Childbearing women may also pass toxins to fetuses in utero or to newborns when breastfeeding.
But U.S. consumers are left in the dark about vital safety information: Cosmetic companies are not required to label many of their products’ ingredients, and the Food and Drug Administration does not mandate premarket safety testing of those ingredients.
And that’s why the California Safe Cosmetics Act is such a landmark achievement.
Signed into law by Gov. Arnold Schwarzenegger last October and taking effect in 2007, it requires manufacturers to disclose product ingredients found on state or federal lists of chemicals that cause cancer or birth defects. The law further authorizes the state to investigate the health impacts of chemicals in cosmetics, and requires manufacturers to supply health-related information about their ingredients. Finally, the act enables the state to regulate products in order to assure the safety of salon workers.
California is the first state in the nation to pass such legislation, thus serving as a model for the other 49. “This is an important disclosure bill, and an important victory for women’s health,” says Jeanne Rizzo of the Breast Cancer Fund. “California has set the stage for states to assert regulatory authority around toxic chemicals in cosmetics, which the federal government has thus far refused to lead on.”
Adds California state Sen. Carole Migden, who championed the legislation, “It is beyond belief that consumers are not being told whether or not they are putting carcinogens on their skin, in their hair or on their face. [The law] represents a triumph of grassroots efforts over money and power. Even in the face of a multinationally funded lobbying machine, common sense and the public good prevailed.”
While many known toxic components have been banned in Europe from use in personal-care products, similar ingredients remain legal in products marketed to the American public. Currently, the FDA does not review the ingredients in cosmetic and beauty-care products, but instead relies on self-regulation by the cosmetic industry’s own Cosmetic Ingredient Review (CIR) panel. According to the watchdog Environmental Working Group, only 11 percent of the 10,500-plus ingredients that the FDA has documented in personal-care products have been assessed for safety by the CIR panel.
In response to the lack of government oversight, an international Campaign for Safe Cosmetics was initiated in 2002 to pressure the personal-care industry to phase out known toxic ingredients and replace them with safer alternatives. Manufacturers have been encouraged to sign the “Compact for Safe Cosmetics,” and to date more than 300 have done so, including The Body Shop, Burt’s Bees and Aubrey Organics.
Migden authored the California Safe Cosmetics Act (S.B. 484) in 2004, with co-sponsorship by Breast Cancer Action, Breast Cancer Fund and the National Environmental Trust. They joined with other public-health, environmental, consumer, Asian Pacific Islander, teen and faith-based groups in a yearlong organizing and lobbying campaign—which met aggressive opposition from the Cosmetic, Toiletry and Fragrance Association. The industry group spent more than $600,000 trying to defeat the bill, even going so far as to host a website (www.cosmeticsaresafe.org) to capture searchers looking for the Campaign for Safe Cosmetics. In contradiction to a growing body of science, the website claims that the personal-care products sold in California are the safest in the world.
Julia Liou, of Oakland-based Asian Health Services, advocated particularly for provisions in the bill designed to protect the safety of nail-salon and cosmetology workers. “We realize that Asian nail-salon workers and owners are not fully aware of the long-term health risks facing their sector,” says Liou. Currently, of the more than 83,500 manicurists in California, 80 percent are of Vietnamese descent, more than half of whom are of reproductive age.
Nail-salon and cosmetology workers handle solvents, chemical solutions and glues on a daily basis, yet little research has been conducted on the chronic health effects of such exposures. There is also a dearth of cul turally and linguistically appropriate educational materials to build awareness about environmental exposures and help workers and salon owners implement safety precautions.
Most of the Vietnamese salon workers earn less than $15,700 a year, speak limited English and lack health coverage. Their voices went largely unheard in the safe-cosmetics debate, and some salon owners actually came out against the bill—“based on misinformation and fear about how it might impact small immigrant-owned businesses,” says Liou. “So it is important for us to work with salon workers and owners in a way that empowers them to be leaders and advocates themselves.” In an effort to do so, the California Healthy Nail Salons Collaborative was formed, and now advocates for greater work-place safety, protective policies, research and community education.
The passage of the California Safe Cosmetics Act sets the stage for further advocacy around cosmetic safety, occupational exposures and chemical policy reform. Those who fought to pass it are now working to ensure its adequate funding and enforcement, and hope to see it replicated in other states.
|
{
"pile_set_name": "Pile-CC"
}
|
Maybe you want to take a quick break from replying to sexy Daddies who messaged your gay dating profile. Perhaps you are in the mood for some hot sex, or you're thinking of rubbing one out to release the tension before your next date begins? Daddyhunt has you covered with this exclusive gay porn free video tube collection! Click Here To Learn More
Free Porn Movie Preview:
Leo Rex, for such a small name he has the biggest personality of any model I've ever met, ever! Fun loving, sweet and unbelievably charismatic, he's also unmistakably Essex! I guess you have to be from the UK to know what that means. Leo lives in London is a trained and born performer doing the likes of aerial silks, pole dancing, acrobatics, burlesque as well as dancing and, well, porn! He's toned, tatted, dark skin and comes with a sexual energy like no other, as soon as the camera starts rolling he can turn it ON! Off camera, he's the bubbliest boy you've ever met. He's got a big bright future in the porn industry that's for sure, welcome Leo!
|
{
"pile_set_name": "Pile-CC"
}
|
Terminal Lance “Protest”
I’m sure all of you are aware of the news surrounding Syria over the last couple of weeks. Following the use of chemical weapons in their civil war, the President wants to launch an attack against the Syrian regime (in a nutshell). If you might have missed it, a few service members of varying branches have taken to anonymous online protest against the idea through the use of flash card signs and eerie, dark barracks rooms.
These sorts of protests should be taken with a grain of salt. Of course, no one wants to start another war in the middle east. While this all seems eerily similar to what was happening 10 years ago with Iraq, it is actually pretty different. From what I understand, the President is pushing for surgical airstrikes of military importance, not an invasion. This is a huge difference, as there probably shouldn’t be boots on the ground, which makes these silent, anonymous protests rather moot. It’s also important to note that these protests are mostly being done by the “Armed Forces Tea Party,” which is the same Facebook group that was under that Sergeant that got kicked out a couple years ago for saying he wouldn’t fight under Obama (and was shocked that he got kicked out for it), so your own political leanings will ultimately inform how seriously you take them.
I like to remain a-political, so I’ll keep my own opinion out of it, but it’s all certainly interesting to say the least.
In other news, 3,000 stickers just arrived at my doorstep.
|
{
"pile_set_name": "OpenWebText2"
}
|
Gov. Kate Brown traveled Friday to Douglas County to mark a symbolic end to the contentious debate over the Elliott State Forest, even as a timber company that had hoped to buy the forest vows to fight the state in court.
Brown, joined by Treasurer Tobias Read, a fellow Democrat, made the trip to celebrate the state's decision to keep the forest in public lands. It did so by using $100 million in state debt to buy a portion of the forest that straddles parts of Douglas and Coos counties.
"Oregonians overwhelmingly made it clear that the Elliott's lands should remain in public hands," Brown said in a statement. "Now more than ever, it's imperative that we not scale back any of Oregon's public lands or national monuments."
The Elliott is constitutionally required to make money for the Common School Fund, an account that distributes millions to K-12 education across the state. The fund, currently valued at $1.5 billion, delivered about $136.6 million to schools in the 2015-17 biennium.
But officials began talk of selling the forest soon after timber sales plunged in 2012 amid lawsuits over the presence of threatened species. In February, the state appeared close to accepting a $221 million offer from Lone Rock Timber Partners but reversed course in May.
Environmental, hunting and conservation groups battled the proposed sale, and ultimately the State Land Board – comprising Brown, Wheeler and Secretary of State Dennis Richardson -- unanimously agreed on a plan to remove much of the forest's most valuable environmental and riparian zones from the mandate to produce money from timber harvests.
The forest is known to be home to threatened and endangered species such as the marbled murrelet, northern spotted owl, and coastal Coho salmon.
Oregon lawmakers also approved a bill, which Brown subsequently signed, to set up a process so the state could transfer natural resource-based land that is not producing revenue for the Common School Fund to another state agency. That trust lands transfer process would protect public lands from being privatized. It mimics a policy that has been in place in Washington for decades.
Now, Lone Rock Timber Partners is suing the state for "unilaterally and wrongfully" terminating an agreement to sell off the land. The Roseburg company was the lone bidder for the forest.
The Oregon School Boards Association, a statewide nonprofit, had also challenged the state's decision to issue bonds to buy a swath of the forest. The education association said the state had an obligation to make the Common School Fund whole.
In late April, the association threatened to sue the state if it did not produce a deal that resulted in $220.8 million being deposited into the Common School Fund. A previous state appraisal valued the forest land at nearly one-quarter-of-a-billion dollars.
Asked Friday, whether it was still planning to pursue a lawsuit, the association said it was still weighing its options and hadn't decided on its legal options.
-- Andrew Theen
[email protected]
503-294-4026
@andrewtheen
|
{
"pile_set_name": "OpenWebText2"
}
|
Light
& Focused
At its core akeytsu relies on solid keyframe foundations to bring artistry back into 3D animation. With professional needs in mind, it revisits the traditional animation workflow to deliver impeccable user experience at every step of the way and offer the most accessible 3D animation suite.
No set-up time needed or plug-ins to look for to achieve what you want. From the refined interface to the natively integrated tools, everything is there at first boot to let you unleash your creativity. Load your 3D model or one of the included rigged characters and get started.
|
{
"pile_set_name": "OpenWebText2"
}
|
@testset "Corpus" begin
sample_text1 = "This is a string"
sample_text2 = "This is also a string"
sample_file = joinpath(dirname(@__FILE__), "data", "poem.txt")
sd = StringDocument(sample_text1)
fd = FileDocument(sample_file)
td = TokenDocument(sample_text1)
ngd = NGramDocument(sample_text1)
crps = Corpus(Any[sd, fd, td, ngd])
crps2 = Corpus([ngd, ngd])
documents(crps)
for doc in crps
@test isa(doc, AbstractDocument)
end
lexicon(crps)
update_lexicon!(crps)
lexicon(crps)
inverse_index(crps)
update_inverse_index!(crps)
inverse_index(crps)
hash_function(crps)
hash_function!(crps, TextHashFunction())
crps[1]
crps["string"]
crps = Corpus([StringDocument("1 2 1 4")])
standardize!(crps, StringDocument)
remove_words!(crps, [""])
update_lexicon!(crps)
answer = Dict("1"=> 2, "2"=> 1, "4"=> 1)
@test answer == lexicon(crps)
end
|
{
"pile_set_name": "Github"
}
|
Design Decisions🐾
In this section, our aspects ‘declarative’ and ‘composable’ are the driving forces for the API design. As mentioned in the beginning, it’s heavily inspired by Flutter on the highest layer:
We decided that immutable structs are the best ways for ensuring these two goals. Functions or builder patterns tend to hide information from the user like fields or parameter names. Composability is achieved by stacking these structs in order to form more complex tree hierarchies. Each struct must be self-composed to act as proper building block. Therefore, they share a common trait interface:
Widget Interface: Contexts provide an safe abstraction for internal domain trees.
paw internally represents the GUI as trees. We use different tree types depending on the specific domain (building, layouting, rendering, ..) we have to deal with . This ensures proper separation of different aspects.
On the top we have a root UI object which will dispatch the calls down the widget tree. Each of the functions provided by the Widget trait comes with an context struct to allow inserting new widgets, get access to global resources like rendering device, etc. The content of the context will change during traversal of the tree and depends on the parent widget — fast forward, the current API iteration looks like this:
AppStateless defines the root widget of the UI.
A StatelessWidget is the most primitive composite widget type.
At building it will be expanded into its representation.
You may have noticed the
p << Widget syntax. Child widgets are stored via an widget id. To generate it, the child needs to be added to the ctxt.
This generation operation will be reflected by the << operator. It’s an alternative to the more verbose p.add(widget: W, ..) function call.
We will come back to Stateless widgets later and introduce another composite widget type. It’s important to note that these are merely helper to improve the ergonomic aspect of defining custom widgets and are neither part of the core API nor required.
About States and Worlds
A static UI would be quite boring. We could manually recreate the whole UI each time and handle, for example, button logic outside but this wouldn’t be very pleasing. Therefore, dealing with mutable and long-living data becomes mandetory. This section will brevily look into state handling which is still an open problem in the API:
We decided to split the states into two different concepts:
States denote local data associated with one specific widget. Example would be the current button state: pressed, hovered, etc.
denote data associated with one specific widget. Example would be the current button state: pressed, hovered, etc. Worlds denote global data which propagate down the widget tree. Child widgets will be able to see information provided by ancestor widgets via the context logic. This will be the primary interface between the UI and application. Theme information (i.e color palettes) could be provided to the widgets using this mechanism.
States and Stateful Widgets
A State is linked to an associ-ated StatefulWidget , which defines how to create a state.
When we Widget::build our tree, we will try to check if there is already a State for this specific widget and we will glue them together to avoid losing state information.
It’s important to understand the interplay between StatefulWidget , its State and State::Repr:
The StatefulWidget defines how to construct a new State — in the ideal case this would be done only once over the application lifetime.
defines how to construct a new — in the ideal case this would be done only once over the application lifetime. <StatefulWidget as Widget>::build queries the internally stored State and executes State::build
queries the internally stored and executes State has access to its own data and also of the currently associated StatefulWidget . As it’s a composite widget type we also have an representation, which will be build now by the State
We are still looking into the exact design of worlds and how to propagate changes back to the application. Currently evaluating Reducer as possible approach and underlying implementation.
Blueprints 📘
Taking our third aspect ‘iterative’ back into the equation:
We noticed that manually implementing the Widget trait can be quite complex and repetitive
trait can be quite complex and repetitive Composability shines coupled with constraints! Restricting ourself during the design phase to specific design constraints helps to build a coherent UI
To handle the first aspect, we provide users the concepts of Stateless and Stateful widgets as defined in Flutter and introduced above. Via a procedural derive the necessary trait implementation will be done for user transparently.
Blueprints (or templates/frameworks/styles/…) can be seen as highest level libraries on top of paw. They provide a set of building blocks to achieve a specific look, comparable to frameworks and UI concepts like Windows Fluent Design, Samsung One UI, … By constraining certain parameters (e.g colors, roundings, etc.) it will be easier for users to build up a nice looking UIs based on the blueprint’s primitives.
We believe that these are vital components for making a UI library accessible to the community.
Really Iterative?!
UI design happens step-by-step and a lot of time is spent on getting the details done right — having fast iteration times is key for success of a library! We therefore implemented a hot-reloading library. The UI is built as dynamically linked library if desired. It will be swapped out on recompiles with the new build artefact, nothing fancy. This saves us a few seconds restarting the application everytime and is simple to hook up. See this little fang_load! macro invocation in our draft example above.
Unfortunately, building even small examples (~50 LoC) takes a few seconds.
We will look a bit more into incremental builds but the compile times are interrupting the prototyping process in the current form D:
📄 Conclusion
Looking back at the initial API drafts I’m quite happy with the current state. It required some unsafe sacrifices in the internals to get to this point but I value user experience here more. At some points we need to explicitly declare as-sociated types, which could also be infered by the typechecker from signatures but that’s a rather minor drawback.
The next big topics will be in semi-random order beside the ones already mentioned in the other sections:
|
{
"pile_set_name": "OpenWebText2"
}
|
gms | German Medical Science
Journals
Here you can find the electronic journals of the Association of the Scientific Medical Societies in Germany (AWMF) and individual member associations with peer-reviewed scientific original papers and surveys.
The articles are immediately and permanently available online without charge.
Journals of individual member associations of the AWMF (alphabetical order)
|
{
"pile_set_name": "Pile-CC"
}
|
Q:
Cannot find name 'SafeUrl'
I am trying to remove the unsafe warning from the console I added bypassSecurityTrustUrl method. But I am getting the error
user.component.ts
import {Component,OnInit} from '@angular/core';
import { DomSanitizer } from '@angular/platform-browser';
import { NavParams,Platform,ViewController } from 'ionic-angular';
@Component({
templateUrl:`<a [href]="sanitize('sms:'+user.mobile_no)" class="anchor-default">Text</a>`,
styles:[`
.anchor-black{color: #000; font-size: 2.4rem;}
.anchor-default {text-decoration: none;}
.custom-margin{margin-left:10px;}
.anchor-right{float:right;padding-top:2px;}
.text-content{text-overflow: ellipsis; vertical-align: middle; padding-top:12px;}
`]
})
export class User implements OnInit {
public user;
public bStandings:boolean = false;
constructor(
public navParams:NavParams,
public viewCtrl:ViewController,
public platform:Platform,
public domSanitizer:DomSanitizer
) {}
sanitize(url:string){
return this.sanitizeUrl(url);
}
private sanitizeUrl(url:string):SafeUrl {
this.bStandings = true;
return this.domSanitizer.bypassSecurityTrustUrl(url);
}
}
Related Question:
Class has or is using name 'SafeUrl' from external module but cannot be named
Anyone please help me thanks in advance
A:
Just import SafeUrl as well:
import { DomSanitizer, SafeUrl } from '@angular/platform-browser';
|
{
"pile_set_name": "StackExchange"
}
|
Wireless access devices are becoming more prevalent. Wireless access can be implemented in many different forms, including connecting a wireless access device (client) through a wireless mesh network that provides connection to a wired device. FIG. 1 shows a wireless mesh network that includes a client device 140. The client device 140 is wirelessly connected to an access node 130. The wireless access node 130 is wirelessly connected to a wired gateway 110 through another wireless access node 120. The wired gateway 110 can provide access to the internet 100.
The transfer of information from the client 140 to the gateway 110 is generally two-way. That is, generally information flows from the client device 140 to the gateway 110 (generally referred to as upstream traffic) and information flows from the gateway 110 to the client device 140 (generally referred to as downstream traffic). The amount of data that can flow between the gateway 110 and the client device 140 is called throughput. It is desirable to maximize the throughput of wireless mesh networks.
The communication between the gateway 110, the access nodes 120, 130 and the clients 140 is over a predefined transmission channel. For example, a specific range of the frequency spectrum is typically allocated for the transmission between the devices. Typically, particular frequencies of transmission operate better in particular environments. For example, certain ranges of transmission frequencies suffer from more multi-path and fading than other ranges of frequency transmission in a particular setting, such as, a downtown with car traffic. Other ranges of transmission frequencies suffer more multi-path and fading than other ranges of frequency transmission in other settings, such as, a forest.
Mesh networks can alleviate the effects of fading and multi-path by providing routing path alternatives. However, mesh networks having a single transmission frequency can still suffer from transmission signal degradation.
Upstream traffic of an access node can suffer from congestion if a large number of clients are connected to the access node. That is, a large number of clients demanding high data rates can stress the upstream data path between the access node and the gateway.
It is desirable to have a mesh network having improved throughput, and reliable communication between access nodes and gateways of the mesh network.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
Maléfique
Maléfique is a 2002 French horror film directed by Éric Valette.
Plot
Carrere, a middle-class family man convicted of financial fraud, arrives in prison where he finds himself sharing a cell with three others- Lassalle, an old librarian who murdered his wife; Paquerette, a childlike lunatic who ate his infant sister and Marcus, a beefy young transsexual woman (whose crime is not mentioned) who yearns for a sex-change.
The cellmates discover, hidden behind a loose brick of the cell-wall, an old hand-written journal which belonged to a prisoner named Danvers in the 1920s who mysteriously disappeared from his cell. The book is filled with incantations and symbols of black magic. Although sceptical, Carrere reads aloud one of the incantations and the prisoners are shocked when a bright, burning symbol briefly materialises on the floor. Carrere, and then Lassalle both study the book and they begin to have disturbing visions. Paquerette wakes up one morning to find that during the night, his fingers have vanished.
The cellmates argue over what to do with the book. Paquerette grabs the book and starts to eat its pages only to be over-powered by an unseen force which twists his entire body until his spine and neck snap. The other three prisoners are blamed by the guards for Paquerette's death, condemning them to stay in prison for life. Lasselle believes that the book was defending itself. A new prisoner named Picus arrives, a friendly, eccentric man who always carries a video camera. Later, the others wake up one morning to find that Picus has disappeared, leaving his camera and the journal on the floor. They watch the last piece of footage on the camera in which Picus reads an incantation from the book whereupon a brightly lit doorway appears on the wall through which he walks. They ask the guards about Picus but the latter reply that they do not know who the cellmates are talking about, revealing that Picus was a hallucination concocted by the book, designed to reveal the book's true powers.
Carrere has been abandoned by his wife and he will never see his beloved son again, the only relic of whom he possesses is an action-figure doll that belonged to his offspring. Carrere now sees the book as his only chance to escape. The three prisoners read aloud the same incantation that Picus read and the brightly illuminated door-way again appears in the cell wall, through which they walk. They find themselves in a dirty, much older prison cell and the book does not offer a means of escape. They realise that they have entered Danvers’ cell as it was in the 1920s. Carrere and Marcus become angry but Lassalle remains calm and without warning kills Marcus with a sharpened rock. Carrere is furious but Lassalle explains that he finally understands the nature of the book's powers- it was not intended to let them physically escape but to enable them all to realise their deepest desires albeit at a terrible price. A flashback sequence reveals the true fate of the cell's original inhabitant Danvers. Obsessed with youth, Danvers uttered his final spell and the book transformed him into a young man but the reverse ageing did not stop until he was reduced to an unborn infant, dissolving into nothingness. Lassalle says that Marcus' desire to become a woman was not strong enough and he could only be set free through death. Lassalle, who has always been obsessed with, and terrified of, the powers of the written word, grips the book and merges with it, its powers crushing the life out of him. Now the only survivor, Carrere states aloud his dearest wish- to see his son again- and his mouth opens in a silent scream as his eyes vanish.
The final scenes occur outside the cell. Carrere's estranged wife and son arrive to collect his belongings, a prison official explaining that Carrere and his cellmates have mysteriously vanished. As they drive home, Carrere's young son plays with the action figure that his father had kept in his cell. The doll's head is seen in close-up and is revealed to have Carrere's living eyes, now able to see his son.
Cast
Gérald Laroche - Carrère
Philippe Laudenbach - Lassalle
Clovis Cornillac - Marcus
Dimitri Rataud - Pâquerette
Didier Bénureau - Hippolyte Picus
Geoffrey Carey - Charles Danvers
References
External links
Category:2002 horror films
Category:French films
Category:French horror films
Category:Prison films
Category:2002 films
Category:Trans women in film
Category:LGBT-related horror films
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Background {#Sec1}
==========
Antibiotic resistance in gram-negative bacteria has increased worldwide \[[@CR1]\]. Infections with resistant gram-negative bacteria are a particularly serious threat to public health because they are difficult to treat and are associated with high morbidity and mortality, and great healthcare costs \[[@CR2]\].
*Escherichia coli* (*E. coli*) and *Klebsiella pneumoniae* (*K. pneumoniae*) are among the most important gram-negative pathogens in the hospital setting, accounting for around one fifth of all pathogens causing healthcare-associated infections in the USA \[[@CR3]\]. These two pathogens are frequent causes of catheter-associated urinary tract infections (CAUTI), surgical site infections (SSI) and ventilator-associated pneumonia (VAP) \[[@CR3]\]. Risk factors for the emergence of infections with resistant gram-negative bacteria include existing comorbidities, presence of medical devices, previous invasive procedures and admission from a long-term care facility \[[@CR4]\]. Despite the widespread belief that the most important driver in the selection of bacterial resistance is the use of antimicrobials, the relationship between antibiotic use and resistance rates across individual departments within a single hospital is not well studied. Willemsen et al. comprehensively investigated this relationship in a teaching hospital in the Netherlands and showed a correlation between ward-specific use and resistance rates for ciprofloxacin and amoxicillin-clavulanic acid in *E. coli* \[[@CR5]\]. Compared to Willemsen et al. we have investigated resistance data for *K. pneumoniae* in addition to *E. coli*, included more antibiotics and used the annual antibiotic consumption per 100 bed-days per department over 9 years (2008--2016). Our objective was to identify antibiotics associated with a higher risk of resistance development in order to optimise the antibiotic prescribing practice particularly in those departments in our hospital with the highest antibiotic consumption.
Methods {#Sec2}
=======
Study aim {#Sec3}
---------
We aimed to determine the association between the use of frequently prescribed antibiotics and the corresponding resistance rates in *E. coli* and *K. pneumoniae* among the clinical departments of a tertiary care hospital.
Study design {#Sec4}
------------
We performed a retrospective observational study of antibiotic use and antibiotic resistance rates of *E. coli* and *K. pneumoniae* across 18 departments at the Bern University Hospital in Bern, Switzerland, between January 1st 2008 and December 31st 2016.
Hospital setting {#Sec5}
----------------
Bern University Hospital is a 950-bed tertiary care teaching hospital that covers all medical specialties and includes a 30-bed mixed intensive care unit (ICU). There are around 40′000 admissions annually, resulting in 290′000 patient-days. The following 18 departments were included in the study: abdominal surgery and medicine, cardiology, cardiovascular surgery, critical care, dermatology, general internal medicine, gynecology and obstetrics, nephrology, neurology, neurosurgery, oncology and hematology, ophthalmology, orthopedics, otorhinolaryngology, plastic and hand surgery, rheumatology and clinical immunology, thoracic surgery and pulmonology, and urology.
Data collection {#Sec6}
---------------
Data was extracted from Anresis \[[@CR6]\], the national surveillance program that collects data on antibiotic resistance and antibiotic consumption in all Swiss hospitals, including Bern University Hospital.
Antimicrobial susceptibility testing (AST) for the following frequently prescribed antibiotics active against wild type *E. coli* and *K. pneumoniae* were included: amoxicillin (only active against *E. coli*), amoxicillin-clavulanic acid, ceftriaxone, cefepime, piperacillin-tazobactam, meropenem, ciprofloxacin, norfloxacin, trimethoprim-sulfamethoxazole and gentamicin. Antibiotics mainly prescribed for perioperative prophylaxis (e.g. cefuroxime) were not included. All *E. coli* and *K. pneumoniae* isolates originated from routine clinical diagnostics. AST for isolates from urine was routinely performed only for amoxicillin, amoxicillin-clavulanic acid, quinolones and trimethoprim-sulfamethoxazole; all other isolates were tested for all listed antibiotics. Therefore, the number of tested samples varies for each of the antibiotics. AST was performed at the Institute for Infectious Diseases of the University of Bern and was based on breakpoints for inhibitory zone diameters (disk diffusion method) according to the guidelines of the Clinical and Laboratory Standards Institute (CLSI). Over the study period the approved version of the 9th, 10th and 11th CLSI edition were adopted by the laboratory. Intermediate susceptibility was recorded as resistance. Quinolone resistance was defined as resistance to at least one of the substances in this group (e.g. norfloxacin and/or ciprofloxacin). We included only the last sample per patient per calendar year. In the main analysis, we included only hospital-acquired samples, i.e. samples that had been isolated more than 2 days after hospital admission. In subsequent sensitivity analyses for community-acquired samples, only samples isolated during the first two hospitalization days were analysed. In addition, we repeated the analysis using a stricter definition of hospital-acquired infection including only the bacterial isolates that had been detected more than 5 days after hospital admission.
The hospital pharmacy provided data on antibiotic consumption in numbers of packages delivered to each department from 2008 to 2016. We assumed that deliveries to the departments reflected consumption as all unused antibiotics were returned to the pharmacy and subtracted for our analyses. All departments used the same delivery system without significant storage and without shifting of antibiotics from one department to another. In the Anresis database the aggregated data were converted into defined daily doses (DDD) using the ATC/DDD system promoted by the World Health Organization \[[@CR7]\]. The DDD is the assumed average maintenance dose per day for an antimicrobial used for its main indication in adults.
We obtained annual bed-days per department from the finance and controlling department of Bern University Hospital. In their calculation, the day of admission and the day of discharge were counted together as one bed-day. Annual Antibiotic use in DDD/100 bed-days was calculated for each of the 18 departments.
Statistical analyses {#Sec7}
--------------------
Antibiotic use across the departments was summarized by median, interquartile range (IQR, lower quartile-upper quartile) and total range (minimum-maximum) of the time-averaged data. The change in antibiotic use over time within each department was analysed with a linear regression model with year, department and the interaction of year and department as covariates. The marginal mean per department and the change per year and department are presented as DDD/100 bed-days with 95% confidence intervals (CI).
We used mixed logistic regression to model antibiotic resistance in dependence of consumption. The main analysis was cross-sectional (i.e. consumption and resistance were assessed at the same time) and was restricted to nosocomial strains. We fitted antibiotic-specific models that only considered resistance towards and use of a specific antibiotic and a combined model that considered data from all antibiotics and treated the antibiotic as random effect. The antibiotic-specific model included a fixed effect for antibiotic use and random intercepts for department and year (nested within department). The combined model included a fixed effect for antibiotic use and random intercepts for antibiotic, department (nested within antibiotic), and year (nested within antibiotic and department). Overall resistance proportions and corresponding 95% CI were obtained by marginal predictions. The association of consumption and resistance is expressed as an odds ratio (OR) per each step of 5 DDD/100 bed-days (i.e. referring to the incremental change in the odds for resistance for an increase in consumption by 5 DDD/100 bed-days) with corresponding 95% CI.
We performed four sensitivity analyses. First, resistance was regressed on the antibiotic use of the preceding year to investigate a potential temporal relation. Second, we repeated the analysis for community-acquired bacterial strains to check for a potential spillover of the (hospital) consumption effect. The strength of the association was compared with that found for nosocomial strains by fitting models using both nosocomial and community data with an additional random intercept for the mode of acquisition. We compared models with and without the interaction of antibiotic use and the site of acquisition using likelihood ratio tests; the *p*-value is reported as *p*-value for interaction. Third, we performed the analysis using a stricter definition of hospital-acquired infection including only the strains that were obtained more than 5 days after hospital admission in the analysis. Fourth, we performed separate analyses for isolates from urine, blood and other sites of origin. We calculated a *p*-value for interaction from likelihood ratio tests of models with and without an interaction for consumption and the origin of the sample. All analyses were done with Stata version 15 (StataCorp. 2017. Stata Statistical Software: Release 15. College Station, TX.)
Results {#Sec8}
=======
Antibiotic consumption in 18 individual hospital departments {#Sec9}
------------------------------------------------------------
The average use of the antibiotics selected for this study was 48.5 DDD/100 bed-days, corresponding to 62% of the total antibiotic use in the study departments between 2008 and 2016.
The annual use of these antibiotics varied widely between the 18 departments, from a mean of 19.4 (95% CI: 14.7--24.2) DDD/100 bed-days in neurology to a mean of 117 (95% CI: 112--122) DDD/100 bed-days in urology (Fig. [1](#Fig1){ref-type="fig"} and Additional file [1](#MOESM1){ref-type="media"}: Table S1). Within the departments the antibiotic use changed unequally over the study period. It decreased significantly in critical care, gynecology and obstetrics, nephrology, thoracic surgery/pulmonology and urology departments, and increased significantly in the orthopedics, plastic and hand surgery departments. The trends in antibiotic use within each department are illustrated by fitted lines in Fig. [1](#Fig1){ref-type="fig"} and summarised in Additional file [1](#MOESM1){ref-type="media"}: Table S1.Fig. 1Annual use of the study antibiotics in DDD/100 bed days in 18 departments for the period between 2008 and 2016. The red lines indicate fitted values from a linear regression model, the dashed line the overall average
Overall, amoxicillin-clavulanic acid was by far the most frequently used antibiotic with a median use of 19.0 DDD/100 bed-days (IQR: 10.0--26.5), followed by cefepime with 3.9 DDD/100 bed-days (IQR 1.7--5.2) and ceftriaxone with 2.6 DDD/100 bed-days (IQR: 2.0--5.3) (Table [1](#Tab1){ref-type="table"}).Table 1Annual antibiotic consumption (DDD/100 bed-days) summarized across 18 departments in the years 2008--2016MedianInterquartile rangeTotal rangeAmoxicillin/Ampicillin2.71.2--5.20.3--8.4Amoxicillin-clavulanic acid19.010.0--26.56.4--85.3Ceftriaxone2.62.0--5.30.5--8.7Cefepime3.91.7--5.20.1--30.2Piperacillin-tazobactam0.90.4--1.80.0--11.1Meropenem1.20.3--2.70.1--9.8Quinolones2.41.8--3.50.8--15.4Trimethoprim-sulfamethoxazole1.71.0--3.20.2--13.3Gentamicin0.20.1--0.50.0--2.4
Antibiotic resistances in *E. coli* isolates {#Sec10}
--------------------------------------------
The different origins (urine, blood, respiratory tract, wound swabs and other) of the *E. coli* isolates, the number of AST performed for each antibiotic and the time point of sampling during the hospital stay are shown in Table [2](#Tab2){ref-type="table"}. Sixty-five percent of the isolates originated from urine and 11% from blood. For amoxicillin/ampicillin, amoxicillin-clavulanic acid, quinolones and trimethoprim-sulfamethoxazole, 139 department-years with 2329 (trimethoprim-sulfamethoxazole) and 2330 (other antibiotics) samples, were analysed. For ceftriaxone, cefepime, piperacillin-tazobactam and gentamicin we analyzed 119 department-years with 1083 (cefepime) and 1085 (other antibiotics) samples. The resistance rate was highest for amoxicillin/ampicillin at 62% (95% CI 55--69%), followed by amoxicillin-clavulanic acid at 39% (95% CI 35--44%), and trimethoprim-sulfamethoxazole at 32% (95% CI 27--37%) (Table [3](#Tab3){ref-type="table"}). For all tested antibiotics the resistance rates for hospital-acquired samples was higher than for community-acquired samples (Additional file [1](#MOESM1){ref-type="media"}: Table S3).Table 2Number of *E. coli* samples with antimicrobial susceptibility testing (AST) by origin across 18 departments in the years 2008--2016Origin of the samplesTested forAll nosocomial samples (*N* = 2330)Samples obtained after 2 to 5 hospital days (*N* = 525)Samples obtained after 5 hospital days (*N* = 1805)UrineAM-CL, Amox/AMP, Quinolones, TMP-SMX1503 (65%)377 (72%)1126 (62%)CFP256 (11%)53 (10%)203 (11%)CFT, Gent, MER^a^, PIP-TZ,258 (11%)55 (10%)203 (11%)BloodAM-CL, Amox/AMP, CFP, CFT, Gentamicin, MER^a^, PIP-TZ, Quinolones, TMP-SMX264 (11%)32 (6%)232 (13%)Respiratory -tractAM-CL, Amox/AMP, CFP, CFT, Gent, MER^a^, PIP-TZ, Quinolones, TMP-SMX86 (4%)29 (6%)57 (3%)Wound swabsAM-CL, Amox/AMP, CFP, CFT, Gent, MER^a^, PIP-TZ, Quinolones83 (4%)12 (2%)71 (4%)TMP-SMX82 (4%)12 (2%)70 (4%)OtherAM-CL, Amox/AMP, CFP, CFT, Gent, MER^a^, PIP-TZ, Quinolones, TMP-SMX394 (17%)75 (14%)319 (18%)*Abbreviations*: *Amox* amoxicillin, *AMP* ampicillin, *AM-CL* amoxicillin-clavulanic acid, *CFP* cefepime, *CFT* ceftriaxone, *Gent* gentamicin, *MER* meropenem, *PIP-TZ* piperacillin-tazobactam, *TMP-SMX* trimethoprim-sulfamethoxazole^a^Not included in the models for resistance because all samples were susceptible to MeropenemTable 3Antibiotic resistance and association with antibiotic use for *E. coli*ResistanceAssociation with antibiotic useNo. of tests/strataProportion resistant (95% CI)Odds ratio (95% CI)*p*-valueAmoxicillin/Ampicillin2330 / 13962 (55--69)1.08 (0.84--1.40)0.53Amoxicillin-clavulanic acid2330 / 13939 (35--44)1.07 (1.02--1.12)0.004Ceftriaxone1085 / 11918 (13--24)1.10 (0.68--1.76)0.71Cefepime1083 / 1198 (6--12)1.06 (0.90--1.25)0.49Piperacillin-tazobactam1085 / 11917 (13--21)2.11 (1.45--3.07)\< 0.001Quinolones2330 / 13920 (17--23)1.52 (1.25--1.86)\< 0.001Trimethoprim-sulfamethoxazole2329 / 13932 (27--37)1.59 (1.19--2.13)0.002Gentamicin1085 / 11918 (14--22)1.30 (0.45--3.71)0.63Combined13,657 / 103224 (15--36)1.09 (1.04--1.14)\< 0.001Results from logistic mixed models for antibiotic resistance in relation to consumption. Odds ratios represent the change in the odds for resistance per increase in antibiotic use by 5 DDD/100 bed-days. Strata refer to year/department combinations*CI* confidence interval
Association of antibiotic consumption and resistance in *E. coli* isolates {#Sec11}
--------------------------------------------------------------------------
We found a significant positive association between use and resistance rates in *E. coli* for amoxicillin-clavulanic acid (OR per each step of 5 DDD/100 bed-days 1.07, 95% CI 1.02--1.12; *p* = 0.004), piperacillin-tazobactam (OR 2.11, 95% CI 1.45--3.07; *p* \< 0.001), quinolones (OR 1.52, 95% CI 1.25--1.86; *p* \< 0.001) and trimethoprim-sulfamethoxazole (OR 1.59, 95% CI 1.19--2.13; *p* = 0.002). An association between antibiotic use and antimicrobial resistance was also found in the combined analysis (OR 1.09, 95% CI 1.04--1.14; *p* \< 0.001). No significant association between use and resistance rates in *E. coli* were found for amoxicillin/ampicillin, ceftriaxone, cefepime or gentamicin. (Table [3](#Tab3){ref-type="table"}, Fig. [2](#Fig2){ref-type="fig"}). Due to the absence of meropenem-resistant strains of *E. coli* the association between meropenem use and the resistance rate could not be studied.Fig. 2Comparison of the proportions of resistant nosocomial *E. coli* and antibiotic use. Each point indicates the time-averaged values for an individual department for the period between 2008 and 2016. The size corresponds to the number of bacteria tested for resistance, i.e. reflects the precision of the resistance estimate. The dashed lines indicate the fitted value from the logistic mixed models
The association between antimicrobial resistance and the preceding year's antibiotic consumption was similar to the analysis for all study antibiotics (Additional file [1](#MOESM1){ref-type="media"}: Table S2). The association of antibiotic use and resistance appeared to be stronger in hospital-acquired than in community-acquired strains for most antibiotics and a significant effect of resistance on consumption in community strains was only found for trimethoprim-sulfamethoxazole However, we could hardly prove systematic differences and a significant interaction was only found for piperacillin-tazobactam (*p* = 0.034) (Additional file [1](#MOESM1){ref-type="media"}: Table S3).
Using a stricter definition for hospital-acquired strains --- by only considering samples obtained more than 5 days after hospital admission --- did not have significant influence on the results and all main findings were identical (Additional file [1](#MOESM1){ref-type="media"}: Table S4). Analysis of subgroups according to sample origin confirmed an association of antibiotic use and resistance for amoxicillin/clavulanic acid, quinolones, trimethoprim-sulfamethoxazole and for the combined analysis in urine. An association for piperacillin-tazobactam was only found in the samples other than urine and blood (Additional file [1](#MOESM1){ref-type="media"}: Table S5). However, we did not find much evidence for systematic differences and a significant *p*-value for interaction was only observed for gentamicin.
Antibiotic resistance in *K. pneumoniae* isolates {#Sec12}
-------------------------------------------------
For amoxicillin-clavulanic acid, quinolones and trimethoprim-sulfamethoxazole we included 115 department-years with 648 samples; for cefepime, ceftriaxone, gentamicin and piperacillin-tazobactam 92 department-years with 369 samples. Fifty one percent of the *K. pneumoniae* samples were isolated from urine, 14% from blood and 11% from the respiratory tract (Table [4](#Tab4){ref-type="table"}). The resistance rate was highest for piperacillin-tazobactam at 21% (95% CI 17--25%), followed by amoxicillin-clavulanic acid at 17% (95% CI 14--21%) and trimethoprim-sulfamethoxazole at 15% (95% CI 12--19%) (Table [5](#Tab5){ref-type="table"}).Table 4Number of *K. pneumoniae* samples with antimicrobial susceptibility testing (AST) by origin across 18 departments in the years 2008--2016Origin of the samplesTested forAll nosocomial samples (*N* = 648)Samples obtained after 2 to 5 hospital days (*N* = 124)Samples obtained after 5 hospital days (*N* = 524)UrineAM-CL, Amox/AMP^b^, Quinolones, TMP-SMX329 (51%)72 (58%)257 (49%)CFP, CFT, Gent, MER^a^, PIP-TZ51 (8%)12 (10%)39 (7%)BloodAM-CL, Amox/AMP^b^, CFP, CFT, Gent, MER^a^, PIP-TZ, Quinolones, TMP-SMX89 (14%)9 (7%)80 (15%)Respiratory samplesAM-CL, Amox/AMP^b^, CFP, CFT, Gent, MER^a^, PIP-TZ, Quinolones, TMP-SMX69 (11%)16 (13%)53 (10%)Wound swabsAM-CL, Amox/AMP^b^, CFP, CFT, Gent, MER^a^, PIP-TZ, Quinolones, TMP-SMX22 (3%)3 (2%)19 (4%)OtherAM-CL, Amox/AMP^b^, CFP, CFT, Gent, MER^a^, PIP-TZ, Quinolones, TMP-SMX139 (21%)24 (19%)115 (22%)PIP-TZ138 (21%)24 (19%)114 (22%)*Abbreviations*: *Amox* amoxicillin, *AMP* ampicillin, *AM-CL* amoxicillin-clavulanic acid, *CFP* cefepime, *CFT* ceftriaxone, *Gent* gentamicin, *MER* meropenem, *PIP-TZ* piperacillin-tazobactam, *TMP-SMX* trimethoprim-sulfamethoxazole^a^Not included in the models for resistance because only two samples were resistant to Meropenem^b^Not included in the models for resistance because all samples were resistant to Amoxicillin/AmpicillinTable 5Antibiotic resistance and association with antibiotic use for *K. pneumoniae*ResistanceAssociation with antibiotic useNo. of tests/strataProportion resistant (95% CI)Odds ratio (95% CI)*p*-valueAmoxicillin-clavulanic acid648 / 11517 (14--21)1.07 (1.01--1.14)0.025Ceftriaxone369 / 9210 (5--18)1.12 (0.52--2.45)0.77Cefepime369 / 923 (1--9)0.86 (0.59--1.25)0.43Piperacillin-tazobactam369 / 9221 (17--25)0.84 (0.61--1.18)0.32Quinolones648 / 1156 (3--9)1.37 (0.94--2.01)0.10Trimethoprim-sulfamethoxazole648 / 11515 (12--19)2.02 (1.44--2.84)\< 0.001Gentamicin369 / 928 (4--16)1.82 (0.13--25.42)0.66Combined3420 / 71312 (8--16)1.06 (0.99--1.14)0.07Results from logistic mixed effects models. The odds ratios represent the relative change in the odds for resistance for an increase in antibiotic use by 5 DDD/100 bed-days. Strata refers to year/department combinations*CI* confidence interval
Association of antibiotic consumption and resistance in *K. pneumoniae* isolates {#Sec13}
--------------------------------------------------------------------------------
There was a significant association between use and resistance rates for amoxicillin-clavulanic acid (OR per 5 DDD/100 patient-days 1.07, 95% CI 1.01--1.14; *p* = 0.025) and trimethoprim-sulfamethoxazole (OR 2.02, 95% CI 1.44--2.84; *p* \< 0.001) No association between use and resistance rates were found for ceftriaxone, cefepime, piperacillin-tazobactam, quinolones or gentamicin. The combined analysis did not show an overall association between consumption and resistance (Table [5](#Tab5){ref-type="table"}, Fig. [3](#Fig3){ref-type="fig"}).Fig. 3Comparison of the proportions of resistant nosocomial K. pneumoniae and antibiotic use. Each point indicates the time-averaged values for an individual department for the period between 2008 and 2016. The size corresponds to the number of bacteria tested for resistance, i.e. reflects the precision of the resistance estimate. The dashed lines indicate the fitted value from the logistic mixed models
We did not analyse meropenem and amoxicillin/ampicillin because only two meropenem-resistant strains were observed and *K. pneumoniae* has an intrinsic resistance to amoxicillin/ampicillin.
Using last year's antibiotic use did not show any major differences to the main analysis (Additional file [1](#MOESM1){ref-type="media"}: Table S6). In community strains, we observed an association between antibiotic use and resistance for trimethoprim-sulfamethoxazole (OR 1.62, 95% CI 1.08--2.42; *p* = 0.021) and for quinolones (OR 1.42, 95% CI 1.04--1.96; *p* = 0.029). Evidence for an interaction was not found (Additional file [1](#MOESM1){ref-type="media"}: Table S7).
Using a stricter definition for hospital-acquired strains largely confirmed the main analysis but the ORs tended to be increased and the combined analysis was now significant (OR 1.09, 95% CI 1.02--1.18; *p* = 0.012) (Additional file [1](#MOESM1){ref-type="media"}: Table S8). In the sample origin subgroups, we only found significant associations for trimethoprim-sulfamethoxazole use and resistance in urine and blood samples. We did not observe much evidence for an influence of sample origin on the relationship of use and resistance (Additional file [1](#MOESM1){ref-type="media"}: Table S9).
Discussion {#Sec14}
==========
Our analysis showed an association between use and resistance for amoxicillin-clavulanic acid, piperacillin-tazobactam, quinolones and trimethoprim-sulfamethoxazole in *E. coli* and for amoxicillin-clavulanic acid and trimethoprim-sulfamethoxazole in *K. pneumoniae* across different hospital departments.
It is intuitive that antibiotic resistance emerges predominantly in environments with high antibiotic consumption. This has been shown for individual countries \[[@CR8]\] and individual hospitals \[[@CR9]--[@CR11]\]. It is however conceivable that even antibiotic prescription within individual departments of the same hospital may affect bacterial resistance in the patients sharing the same environment, as bacteria can be transmitted from patient to patient and antibiotic resistance can spread between bacteria. In this regard, the results of our study confirmed the main findings reported by Willemsen et al. demonstrating that a higher use of amoxicillin-clavulanic acid and quinolones was associated with higher antimicrobial resistance in *E. coli*.
Interestingly, we only found associations between antibiotic use and resistance for some antibiotics and different associations between *E. coli* and *K. pneumoniae*.
A plausible explanation is the considerable difference in the quantitative use of the antibiotics studied across our hospital's departments. Considering the substantial use of amoxicillin-clavulanic acid at our institution, it is not surprising that its use was associated with resistance in both microorganisms analysed. A wide quantitative range of antibiotic use across different departments may also facilitate the detection of an association, as observed for piperacillin/tazobactam, where the median consumption was low, but the range was very wide.
However, the resistance barrier of the individual antibiotics may also be relevant for the emergence of resistance. For cefepime, which is recommended in our internal antibiotic guidelines \[[@CR12]\] as first-line antibiotic for several nosocomial infections (e.g. pneumonia and fever in neutropenia), we did not find an association between use and resistance, even though it was the second most frequently used antibiotic overall. Cefepime is a robust fourth generation cephalosporin, which is relatively stable against β-lactamases and maintains activity even against difficult organisms. In contrast, *Enterobacteriaceae* may acquire resistance to quinolones and trimethoprim-sulfamethoxazole more readily and we indeed observed significant associations between their use and resistance in *E. coli.*
Results for *K. pneumoniae* were less clear than for *E. coli*, mainly because the sample size was much smaller. In particular, for ceftriaxone, cefepime, piperacillin-tazobactam and gentamicin the number of susceptibility tests performed for *K. pneumoniae* (*n* = 369) was substantially lower than for *E. coli* (*n* = 1085).
Our first sensitivity analysis examined the potential temporal relationship between the consumption of antibiotics and the development of resistance a year later. However, the last year's use did not have a stronger influence than the current use. Possible explanations are the relatively stable antibiotic use over time in our setting or a different timing of the emergence of resistance. Even a reverse causation is possible --- the reduction in use due to the emergence of resistance.
The antibiotic use varied widely between the different departments and within the individual departments; there were significant variations in antibiotic use over time. Notably, the antibiotic use was high in predominantly surgical departments like urology, plastic and hand surgery, and otorhinolaryngology. Even though cefuroxime, which is recommended for perioperative prophylaxis, was not included in the analysis the high antibiotic use of these departments is probably due to the frequent use of amoxicillin-clavulanic acid and quinolones (urology) for perioperative prophylaxis that in some cases is given longer than suggested by international guidelines. During the study period, there were no specific antimicrobial stewardship interventions in any hospital department. Improving perioperative prophylaxis in the mentioned surgical departments will be a priority in the future.
To address the specificity of the association we compared nosocomial and community strains, given that the latter was not exposed to antibiotic use in the hospital. As expected, the association between antibiotic consumption and resistance tended to be systematically stronger for nosocomial strains than for community strains in *E. coli* even though we did not always find significant interactions. This result is consistent with another Swiss study showing that strains isolated ≥48 h after admission were less susceptible than those stemming from the community \[[@CR13]\]. The same pattern was not found for *K. pneumoniae*, mainly because we did not observe many clear associations in the first place. Trimethoprim-sulfamethoxazole, for which the association persisted in community-acquired *K. pneumoniae* strains, is also frequently prescribed in the outpatient setting \[[@CR14]\]. Furthermore, we could not distinguish patients with previous contacts with the healthcare system and some community-acquired infections could actually be healthcare-associated.
The accuracy of distinguishing community- from hospital-acquired pathogens plays an important role in our analyses. We chose a 2-day cut-off according to the Centers for Disease Control and Prevention (CDC) definition \[[@CR15]\]. A stricter definition for hospital-acquired samples (i.e. a cut-off of five instead of 2 days after hospital admission) did not change any of the main findings, as the vast majority of samples (79% for *E. coli* and 81% for *K. pneumoniae*) was obtained after 5 days of hospital admission.
In recent years, several studies have analyzed the relationship between antibiotic use and development of resistance in *Enterobacteriaceae*. Consistent with our findings, several studies have described an association between in-hospital antibiotic use and resistance to quinolones in *E. coli* \[[@CR16]--[@CR18]\]*.* This association may be particularly relevant for Switzerland with its comparatively higher quinolone consumption than other European countries \[[@CR19]\].
Two other studies have reported associations in *E. coli* between amoxicillin-clavulanic acid \[[@CR5], [@CR20]\] and piperacillin-tazobactam \[[@CR21], [@CR22]\]. The main discrepancy between our results and those of other studies is the absence of an association between the use of ceftriaxone and the emergence of third-generation cephalosporin resistance in our study \[[@CR20], [@CR23], [@CR24]\]. This may be due to a relatively low median use of ceftriaxone of 2.6 DDD/100 patient days compared to other studies.
Our study has several limitations. First, the number of AST available differed considerably among the antibiotics and the sample size was low for some. The majority of samples (65% of *E. coli*, and 51% of *K. pneumoniae*) originated from urine and a complete AST of these samples is only performed if routine testing shows several resistances. Therefore, the resistance data for cefepime, ceftriaxone, piperacillin-tazobactam and gentamicin was only available in one sixth of the urine samples. The low sample size reduces the power of the analysis, which was particularly problematic for *K. pneumoniae* where it severely hampered the conclusions*.* Moreover testing some antibiotics only in higher resistant isolates may lead to an overestimation of resistance in urinary samples against these antibiotics, due to sampling bias. Second, this was a single-centre study, therefore our results may not be generalizable to other contexts with potential differences in case-mix and epidemiologic characteristics. Third, we could not take into account individual risk factors for infections with resistant microorganisms (such as underlying diseases or previous antimicrobial therapy), because of the anonymization of the samples. Fourth, we did not analyse the association between the use of one particular antibiotic and the resistance to a second antibiotic. Fifth, the antibiotic consumption expressed in DDD per 100 bed-days does not reflect the adequacy of treatment in terms of proper dosage and duration. Sixth, we calculated antibiotic use based on deliveries to the hospital departments rather than administration to the patients. The departments of our hospital are advised to order only those antibiotics that are needed for daily use. Antibiotics that are delivered to the departments but are for some reason not administrated to the patients must be returned to the hospital pharmacy. We subtracted the returned antibiotics from the deliveries and are confident that our data reflect the real antibiotic administration to the patients.
However, to the best of our knowledge, our study is the first comprehensive analysis of the use of the most important antibiotics for the treatment of gram-negative bacteria and corresponding antimicrobial resistance across multiple departments within one institution. We included all clinical *E. coli* and *K. pneumoniae* samples isolated across 18 departments at our institution over the study period of 9 years and used the well-established, standardized ATC/DDD system. The study therefore has important relevance for clinical practice.
Conclusions {#Sec15}
===========
We have demonstrated that antibiotic use in different hospital departments is associated with resistance rates in *E. coli* and in *K. pneumoniae* for some but not all antibiotics and antibiotics differ in the strength of the association. Despite a high consumption of cefepime we could not demonstrate an association between its use and resistance rates. We will therefore continue to promote the use of cefepime over piperacillin/tazobactam as an empiric broad-spectrum antibiotic in our guidelines.
Keeping resistance in *Enterobacteriaceae* in check requires a comprehensive approach including infection control strategies and an antibiotic stewardship program. Our data support targeted antibiotic stewardship interventions, such as department-specific or antimicrobial agent-specific interventions, to improve antimicrobial prescribing and reduce the development of antimicrobial resistance.
Additional file
===============
{#Sec16}
Additional file 1:**Table S1.** Mean antibiotic use and change per year in 18 departments in years 2008-2016. **Table S2.** Antibiotic resistance and association with last year\'s antibiotic use for *E. coli*. **Table S3.** Antibiotic resistance and association with antibiotic use for nosocomial and community *E. coli*. **Table S4.** Antibiotic resistance and association with antibiotic use for *E. coli* with an alternative definition of nosocomial. **Table S5.** Antibiotic resistance in *E. coli* and association with antibiotic use according to the origin of the sample. **Table S6.** Antibiotic resistance and association with last year\'s antibiotic use for *K. pneumoniae*. **Table S7.** Antibiotic resistance and association with antibiotic use for nosocomial and community *K. pneumoniae.* **Table S8.** Antibiotic resistance and association with antibiotic use for *K. pneumoniae* with an alternative definition of nosocomial. **Table S9.** Antibiotic resistance in *K. pneumoniae* and association with antibiotic use according to the origin of the sample. (DOCX 77 kb)
AM-CL
: Amoxicillin-clavulanic acid
Amox
: Amoxicillin
AMP
: Ampicillin
AST
: Antimicrobial susceptibility testing
CAUTI
: Catheter-associated urinary tract infections
CDC
: Centers for Disease Control and Prevention
CFP
: Cefepime
CFT
: Ceftriaxone
CI
: Confidence interval
CLSI
: Clinical and Laboratory Standards Institute
DDD
: Defined daily doses
*E. coli*
: *Escherichia coli*
ESBL
: Extended-spectrum beta lactamase
Gent
: Gentamicin
ICU
: Intensive care unit
IQR
: Interquartile range
*K. pneumoniae*
: *Klebsiella pneumoniae*
MER
: Meropenem
OR
: Odds ratio
PIP-TZ
: Piperacillin-tazobactam
SSI
: Surgical site infections
TMP-SMX
: Trimethoprim-sulfamethoxazole
VAP
: Ventilator-associated pneumonia
WHO
: World Health Organisation
Andreas Kronenberg and Jonas Marschall contributed equally to this work.
**Electronic supplementary material**
The online version of this article (10.1186/s13756-018-0387-0) contains supplementary material, which is available to authorized users.
We would like to acknowledge Roswitha Halder Tobler of the Bern University Hospital pharmacy department for providing the antibiotic consumption data and Bettina Bächler from our hospital's medical controlling for providing the annual bed days data.
Funding {#FPar1}
=======
We did not receive any dedicated financial support for performing the study.
Availability of data and materials {#FPar2}
==================================
The datasets used and analysed during the current study are available from the corresponding author on reasonable request.
AC was involved in concept, design, data analysis and interpretation and writing of the article. DH contributed to data collection, data analysis and interpretation, and writing of the article. AK contributed to concept and design and data collection. LB performed data analysis and statistics. CPS contributed to data collection. JM contributed to data analysis and critical revision of the article. All authors read and approved the final manuscript.
Ethics approval {#FPar3}
===============
Given that this study was performed without accessing patient information, approval of the ethics committee was not required.
Consent for publication {#FPar4}
=======================
Not applicable
Competing interests {#FPar5}
===================
A.C. received travel grants and meeting expenses from Abbott, MSD, BMS, Gilead and Astellas. A. K. received travel grants and meeting expenses from Gilead, Viofor and the World Health Organisation (WHO). A.K. is advisor of the Swiss Federal Office of Public Health concerning antibiotic resistance epidemiology in Switzerland. He provides annual resistance data without commentary to pharmaceutical company LEO and the Swiss government. J.M. received travel grants from Gilead and served on an advisory board for Astellas Switzerland and is co-applicant for SNSF grant 153,377 (PI: Andrea Endimiani) on carriage of resistant Enterobacteriaceae. D.H., L.B. and C.P.S. have no competing interest.
Publisher's Note {#FPar6}
================
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
|
{
"pile_set_name": "PubMed Central"
}
|
In vitro binding of mutagenic heterocyclic aromatic amines by Bifidobacterium pseudocatenulatum G4.
Consumption of probiotics has been associated with decreased risk of colon cancer and reported to have antimutagenic/ anti-carcinogenic properties. One possible mechanism for this effect involves physical binding of the mutagenic compounds, such as heterocyclic amines (HCAs), to the bacteria. Therefore, the objective of this study was to examine the binding capacity of bifidobacterial strains of human origin on mutagenic heterocyclic amines which are suspected to play a role in human cancers. In vitro binding of the mutagens Trp-p-2, IQ, MeIQx, 7,8DiMeIQx and PhIP by three bacterial strains in two media of different pH was analysed using high performance liquid chromatography. Bifidobacterium pseudocatenulatum G4 showed the highest decrease in the total HCAs content, followed by Bifidobacterium longum, and Escherichia coli. pH affects binding capacity; the highest binding was obtained at pH 6.8. Gram-positive tested strains were found to be consistently more effective than the gram-negative strain. There were significant decreases in the amount of HCAs in the presence of different cell concentrations of B. pseudocatenulatum G4; the highest decrease was detected at the concentration of 10(10) cfu/ml. The results showed that HCAs were able to bind with all bacterial strains tested in vitro, thus it may be possible to decrease their absorption by human intestine and increase their elimination via faeces.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Radiographic manifestations of experimental aluminum toxicity in growing bone.
To evaluate the effect of aluminum on growing bone in the presence of normal renal function, the following experiment was performed. Eight littermate pair-fed pigs (5 weeks old) were randomly assigned to one of two study groups: control C, n = 4, or aluminum treated Al, n = 4. Daily intravenous injections of either aluminum 1.5 mg/kg/day (Al group) or vehicle only (C group) were given during the 8-week duration of the study. The radiographic findings which appeared in the aluminum-treated group and not in the controls consisted of areas of sclerosis in the submetaphyseal regions and the periphery of epiphyses. In addition there was separation of the anterior tibial tubercle. The growth plates did not increase in width despite the presence of osteomalacia and histologic evidence of extensive deposition of aluminum in bone. The area of sclerosis visualized in the radiographs correlated histologically with thickened bony trabeculae. The increased width of these trabeculae is attributable to an increase in primary spongiosum and broadened seams of osteoid.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
AboutWe Are The Ocean
We Are the Ocean are a 5 piece post-hardcore band from Harlow, England. The band has played hundreds of shows since their formation, including several festivals during 2008 such as Slam Dunk, Offset Festival, Middlesbrough Music Live, and Taste Of Chaos.
|
{
"pile_set_name": "Pile-CC"
}
|
SAN ANTONIO – As the FBI and Texas Rangers raided her office Monday, Precinct 2 Constable Michelle Barrientes Vela made time to formally announce her run at the Bexar County Sheriff's Office in 2020.
"I've reconsidered my position here to seek another four years. I think with the support of my husband standing right next to me. We are going to go ahead and get formally announced (Monday) that yes, I will be seeking the chair and seat of the Sheriff’s Office within Bexar County," Barrientes Vela said.
The declaration comes less than two months after Barrientes Vela announced she will seek a second term in her current office.
For Barrientes Vela, however, the statement to run for Bexar County sheriff could mean invoking Article 16, Section 65, of the Texas Constitution.
The section: Automatic Resignation on Becoming Candidate for Another Office.
According to the section – which applies to several offices including constables – any officer who has more than 13 months left in their current office but announces their candidacy shall result in an "automatic resignation."
SCROLL BELOW TO VIEW ARTICLE 16, SECTION 65
Barrientes Vela, who has 15 months left as a Pct. 2 Constable, later backtracked when asked about the state law, claiming she was not in uniform when sharing her nomination for Bexar County sheriff.
"I haven't announced anything as far as campaigning. I've never been campaigning when I announced anything in regular clothes," Barrientes Vela said.
Barrientes Vela and several Pct. 2 deputies have been the subject of repeated scandals this year, including a proposed cavity search and warrantless blood draw on a teen, and the delayed booking of her political opponent.
The political opponent was arrested on criminal charges that were quickly dismissed by prosecutors.
Barrientes Vela declined to respond to questions about those incidents Monday.
READ ARTICLE 16, SECTION 65: Automatic Resignation on Becoming Candidate for Another Office
"This section applies to the following offices: District Clerks; County Clerks; County Judges; Judges of the County Courts at Law, County Criminal Courts, County Probate Courts and County Domestic Relations Courts; County Treasurers; Criminal District Attorneys; County Surveyors; County Commissioners; Justices of the Peace; Sheriffs; Assessors and Collectors of Taxes; District Attorneys; County Attorneys; Public Weighers; and Constables.
If any of the officers named herein shall announce their candidacy, or shall in fact become a candidate, in any General, Special or Primary Election, for any office of profit or trust under the laws of this State or the United States other than the office then held, at any time when the unexpired term of the office then held shall exceed one year and 30 days, such announcement or such candidacy shall constitute an automatic resignation of the office then held, and the vacancy thereby created shall be filled pursuant to law in the same manner as other vacancies for such office are filled."
KSAT COVERAGE OF PCT. 2:
Barrientes Vela accused of sex discrimination in latest lawsuit filed by deputy constable
Barrientes Vela, top Pct. 2 officials charged county for training, then skipped it
Delayed booking of deputy constable at center of federal lawsuit
Breakdown Booth: Dillon Collier breaks down coverage on embattled Bexar County constable
Records: Pct. 2 deputies proposed cavity search on teen, ordered warrantless blood draw
Embattled Precinct 2 constable to seek reelection
Lawsuit accuses Precinct 2 constable of trying to caress deputy in hot tub during work trip
WATCH: Precinct 2 deputies delayed booking of constable's political opponent
Deputy constables fired in training record fiasco win back jobs as blame shifts to constable
|
{
"pile_set_name": "OpenWebText2"
}
|
The present disclosure relates to semiconductor memory devices and, more particularly, to a block status storage unit of a flash memory device.
Flash memory devices are kinds of nonvolatile memories that are electrically programmable and that are erasable. Flash memory devices provide great interest to many users in applications for large-capacity or coded memories of mobile apparatuses with requirements for higher storage capacity and faster speed of operation. Flash memory devices may be classified into NAND and NOR types. A cell array of the NOR flash memory device is configured such that pluralities of memory cells are connected in parallel to one bit line. On the other hand, in a cell array of the NAND flash memory device, pluralities of memory cells are connected in series to one bit line. Comparing the two types with each other, the NOR flash memory devices are advantageously used in high frequency applications, because they are operable with a fast speed during programming and reading of data relative to the NAND types. A cell array of the NOR flash memory device includes a plurality of blocks forming erasing units. The plurality of blocks constitute a memory bank. A NOR flash memory device with a plurality of memory banks is able to carry out an erasing or a programming operation for one block while conducting a read operation for another block, both at the same time. Generally, the blocks are included in different respective memory banks. Further, a multi-block erasing mode is provided to erase pluralities of blocks, which are each selected by banks, all at a time. Additionally, in the NOR flash memory device, a suspended read mode is provided to carry out a read operation while suspending a writing operation during a period of writing. For these modes, storing and detecting status information to each block is required. Especially, in a flash memory device associated with the multi-block erasing mode or a read-while-write (RWW) mode, there is a need of simultaneously conducting operations for detecting block status information by write and read addresses. FIG. 1A shows a cell structure of a general purpose block status latch for storing and outputting block status information each in response to write and read addresses.
Referring to FIG. 1A, the general purpose block status latch includes a latch loop formed of inverters INV1 and INV2 coupled in opposite directions to each other between first and second nodes N1 and N2. The block status latch further includes set and reset transistors connected to SET and RESET inputs, for storing block status information in the latch loop. A NAND gate G1 outputs status information of the second node N2 in response to a read address RD_ADD, and a NAND gate G2 provides status information to another output terminal in response to a write address WD_ADD. Inverters INV3 and INV4 are respectively connected to outputs of the NAND gates G1 and G2. FIG. 1B shows output circuits summing a plurality of block status information provided from the block status latches shown in FIG. 1A.
Such a structure of a block status latch, which provides block status information independently of the read and write addresses, is disadvantageous to integration density, because the capacity of the flash memory device must be made larger. As the capacity of the flash memory device becomes larger, the number of blocks in a memory cell array also increases. With the increase of the number of blocks, the number of block status latches must also be increased. This means the area occupied by the block status latches in a peripheral circuit of a memory core is also increased. Furthermore, the area of the circuits, such as Summator1, Summator2 in FIG. 1B, summing a plurality of block status information enlarges the whole area of the peripheral circuit.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
Falls from heights.
Falls from heights are most commonly due to accidents in children and suicide, accident, and crime-related incidents in adults. Two types of injury result from falls from heights: injury resulting from direct impact and deceleration-type injury. The injuries resulting from direct impact are mostly fractures. The body position at impact is crucial. The deceleration forces immediately post-impact result primarily in visceral and internal injury, including cranial injury. There is a lack of correlation between os calcis fractures and vertebral fractures. Spinal cord injury is infrequent. Survival figures are higher than usually assumed.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
React Native ART and D3 - hswolff
http://hswolff.com/blog/react-native-art-and-d3/
======
harel
I would really like to see a real world useful application done in react
native. Nothing too arty, but more functional, business like even. Something
that goes beyond an app for an event or an art project.
~~~
lewisl9029
The Discord iOS app is built with React Native:
[https://discord.engineering/using-react-native-one-year-
late...](https://discord.engineering/using-react-native-one-year-
later-91fd5e949933#.vt4jip632)
And it's quite good by most accounts.
They also have a showcase of other projects built with React Native on their
official site:
[https://facebook.github.io/react-
native/showcase.html](https://facebook.github.io/react-native/showcase.html)
------
macavity23
This is excellent. Thanks for posting.
|
{
"pile_set_name": "HackerNews"
}
|
Enhanced adsorption of arsenite from aqueous solution by an iron-doped electrospun chitosan nanofiber mat: Preparation, characterization and performance.
A novel iron-doped chitosan electrospun nanofiber mat (Fe@CTS ENM) was synthesized, which was proven to be effective for the removal of arsenite (As(III)) from water at neutral pH condition. The physiochemical properties and adsorption mechanism were explored by SEM-EDS and X-ray photoelectron spectroscopy (XPS). Batch adsorption experiments were carried out to evaluate the As(III) adsorption performance of the Fe@CTS ENM with various process parameters, such as adsorbent dose, solution pH, initial As(III) concentration, contact time, ionic strength, coexisting anions, and natural organic matter. The experimental results indicated that the maximum adsorption capacity was up to 36.1 mg g-1. Especially, when the adsorbent dosage was higher than 0.3 g L-1, the As(III) concentration was reduced from 100 µg L-1 to less than 10 µg L-1, which indicated the Fe@CTS ENM could effectively remove trace As(III) from water over a wide pH range (from 3.3 to 7.5). Kinetics study demonstrated that the adsorption equilibrium was achieved within 2.0 h, corresponding to a fast uptake of As(III). The presence of common co-ions and humic acid had little effect on the As(III) adsorption. XPS analysis suggested that the FeO, COH, COC and CN groups on the adsorbent surface play dominant roles in the adsorption of As(III). Adsorption-desorption regeneration test further demonstrated that no appreciable loss in the adsorption capacities was observed, which confirmed that the Fe@CTS ENM maintained a desirable life cycle that was free of complex synthesis processes, expensive and toxic materials, qualifying it as an efficient and low-cost As(III) adsorbent.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
A new study suggests that young men are weathering the gender revolution just fine. Relying on data compiled by the Bureau of Labor Statistics, sociologists at the University Connecticut have found that when women take on greater financial responsibility in their marriages, both wives and husbands tend to experience a boost in well-being. Conversely, when men are the primary breadwinners for their families, their health and happiness tends to decline.
The male-breadwinner, female-homemaker model has long been thought of as an advantage for men. Working outside the home gives men financial power in the relationship, skills to rely on should they ever be widowed or divorced, and an ability to wield influence on public life and shape public discourse. But as new research demonstrates, such opportunities are bound up with responsibilities, ones that translate into a burden for many men.
“While a host of research demonstrates the ways in which men, as a class, are advantaged by gendered expectations in marriage, the present study contributes to a growing body of literature that emphasizes the ways in which the performance of masculinity is harmful to men,” the study’s authors write. “Further, we find that decoupling breadwinning from masculinity is associated with concrete benefits for both men and women.”
For the study, Christin Munsch, an assistant professor of sociology at the University of Connecticut, and graduate students Matthew Rogers and Jessica Yorks analyzed data collected from 1996 through 2011, during which 3,100 married adults, ages 18 to 32, from around the country were asked questions about their well-being. Participants were asked to report on which emotional states they experienced in the previous month, and how often they felt that way. They were also asked about their physical health.
The team compared this data with couples’ earnings, both household and individual, and discovered a pattern of decreased well-being for men the more they supported their families, and an increased well-being for women the more they supported theirs. They controlled for things like total income, education, age, hours worked, and whether or not the couples have children.
Munsch and her team explain this gap as the result of cultural expectations, both old and new. Men in breadwinning roles tend to be there because of a sense of obligation, and feel under pressure to maintain this status. Women, on the other hand, are relatively new to the whole breadwinning thing, and therefore continue to see it as an opportunity or choice. “Breadwinning women may feel a sense of pride and accomplishment. After all, they have accomplished something rare for their gender. Should they fail to maintain this status, however, they have less to lose,” they write.
It’s likely that previous generations of men would not have experienced the same well-being boost from being outearned by their wives, when such arrangements were uncommon. But as the number of U.S. households with men as the primary breadwinner decreases, so has the social stigma of not organizing one’s family life according to traditional patterns. According to Pew, in 1960, only 3.5 percent of married women in households with children under 18 were the primary provider; today that figure is 15 percent. (There’s been a far more significant rise of breadwinner moms among unmarried women.) The share of households where both parents work full time went from 31 percent in 1970 to 46 percent in 2015. And this shift in our workplaces has been matched by a shift in our homes. Study after study show that today’s fathers want to play an active role in their children’s lives, and are doing more childrearing and domestic work than their fathers did.
There’s a cloud around all this silver lining, however. The study also found that “at virtually every relative income score, women’s anxiety is higher than men’s anxiety, yet breadwinning men and breadwinning women experience virtually identical levels of anxiety.” The researchers interpret this as to mean that while men and women may feel similar stress levels as breadwinners, the experience of being economically dependent is very different for a man or a woman. A husband may feel liberated when supported by his spouse, whereas a wife who’s fully dependent on her spouse may feel a “strange stirring” familiar to generations of relatively well-off women who came before her. Another possible scenario? She’s earning 40 percent of the income but doing 80 percent of the childrearing and domestic work and totally freaking out.
Still, the study offers hope that the more gender and marital responsibility become decoupled, and the more spouses can feel free to make decisions based on what they want to do rather than what they feel they should do, the better all husbands and wives will feel. A high incidence of feelings of security and ease among married women who don’t work or who work part-time may not be common yet, but these new findings suggest that there’s reason enough to believe that one day it will.
|
{
"pile_set_name": "OpenWebText2"
}
|
The latest entry in one of Electronic Arts' biggest game franchises is now available to play for free. The full digital version of FIFA 16, the best selling pro soccer game, has been added to the list of games available to play on the EA Access service for the Xbox One and Origin Access for PC gamers.
EA says:
FIFA 16 innovates across the entire pitch to deliver a balanced, authentic, and exciting football experience that lets you play your way. You'll have Confidence in Defending, take Control in Midfield, and produce more Moments of Magic than ever before. Build your Squad in FIFA Ultimate Team and experience FUT Draft, a brand new way to play.
Both EA Access and Origin Access give subscribers a way to play a number of full Electronic Arts' titles for free, along with a 10% discount on purchasing any full digital games or DLC packs. EA Access for the Xbox One costs $4.99 a month or $29.99 a year, while Origin Access also costs $4.99 a month, but without the yearly subscription option.
|
{
"pile_set_name": "OpenWebText2"
}
|
Smoothened inhibitors in the treatment of advanced basal cell carcinomas.
The Hedgehog pathway has been identified as a key element in the development of many forms of cancer. Smoothened (Smo) inhibitors are known to beneficially interfere with the Hedgehog pathway and are currently under investigation as anticancer drugs for many tumor entities. Reviewed here are the most recent developments in clinical research on Smo inhibitors for the treatment of advanced basal cell carcinoma (BCC). When reviewing the literature of the past 12 months, it is striking to see the rapid evolution of the field. Compounds that have been presented as powerful new drug candidates 12 months ago have now been discontinued, whereas new ones have emerged. Reports on 13 drug candidates have been identified: one marketed, vismodegib, eight currently under development (phase I-II) and four for which clinical investigation for BCC is currently not being pursued. Smo inhibitors are a promising drug class for the treatment of BCC. To date, most candidates are in early stage development and are expected to enter the market in approximately 5-8 years, if successful.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Christian Hermann Weisse
Christian Hermann Weisse (; ; Weiße in modern German; 10 August 1801 – 19 September 1866) was a German Protestant religious philosopher and professor of philosophy at the University of Leipzig. He was the son of theologian (1766–1832).
Biography
Weisse was born in Leipzig, and studied at the university there, at first adhering to the Hegelian school of philosophy. In the course of time, his ideas changed, and became close to those of Schelling in his later years. He developed (along with I. H. Fichte with whom he regularly corresponded after 1829) a new speculative theism, and became an opponent of Hegel's pantheistic idealism. In his addresses on the future of the Protestant Church (Reden über die Zukunft der evangelischen Kirche, 1849), he finds the essence of Christianity in Jesus' conceptions of the heavenly Father, the Son of Man and the kingdom of Heaven. In his work on philosophical dogmatics (Philosophische Dogmatik oder Philosophie des Christentums, 3 vols., 1855–1862) he seeks, by idealizing all the Christian dogmas, to reduce them to natural postulates of reason or conscience.
Weisse was the first theologian to propose the two-source hypothesis (1838), which is still held by a majority of biblical scholars today. In the two-source hypothesis, the Gospel of Mark was the first gospel to be written and was one of two sources to the Gospel of Matthew and the Gospel of Luke, the other source being the Q document, a lost collection of Jesus's sayings.
Weisse was a contributor to I. H. Fichte's academic journal Zeitschrift für Philosophie und spekulative Theologie.
He died in his native city of Leipzig, aged 65.
Works
System der Ästhetik (2 vols., 1830)
Die Idee der Gottheit (1833)
Die philosophische Geheimlehre von der Unsterblichkeit des menschlichen Individuums (1834)
Büchlein von der Auferstehung (1836)
Die evangelische Geschichte, kritisch und philosophisch bearbeitet (2 vols., 1838)
Reden über die Zukunft der evangelischen Kirche (1849)
Philosophische Dogmatik oder Philosophie des Christentums (3 vols., 1855–1862)
Die Evangelienfrage in ihrem gegenwärtigen Stadium (1856)
Psychologie und Unsterblichkeitslehre (edited by R. Seydel, 1869)
Notes
References
This work in turn cites:
Otto Pfleiderer, Development of Theology (1890)
Rudolf Seydel, Christian Hermann Weisse (1866)
Rudolf Seydel, Religion und Wissenschaft (1887)
External links
Category:1801 births
Category:1866 deaths
Category:People from Leipzig
Category:German philosophers
Category:19th-century German Protestant theologians
Category:19th-century philosophers
Category:19th-century German male writers
Category:German male non-fiction writers
|
{
"pile_set_name": "Wikipedia (en)"
}
|
**New Penrose Limits and AdS/CFT**
1.8cm
0.5cm
*$^1$ Dipartimento di Fisica, Università di Perugia,\
I.N.F.N. Sezione di Perugia,\
Via Pascoli, I-06123 Perugia, Italy\
0.4cm *$^2$ NORDITA\
Roslagstullsbacken 23, SE-106 91 Stockholm, Sweden 0.4cm *$^3$ The Niels Bohr Institute\
*Blegdamsvej 17, DK-2100 Copenhagen Ø, Denmark\
****
0.5cm
[email protected], [email protected], [email protected], [email protected]
1.5cm
**Abstract**
0.2cm
We find a new Penrose limit of $\mbox{AdS}_5 \times S^5$ giving the maximally supersymmetric pp-wave background with two explicit space-like isometries. This is an important missing piece in studying the AdS/CFT correspondence in certain subsectors. In particular whereas the Penrose limit giving one space-like isometry is useful for the $SU(2)$ sector of ${\mathcal{N}}=4$ SYM, this new Penrose limit is instead useful for studying the $SU(2|3)$ and $SU(1,2|3)$ sectors. In addition to the new Penrose limit of $\mbox{AdS}_5 \times S^5$ we also find a new Penrose limit of $\mbox{AdS}_4 \times {\mathbb{C}}P^3$.
0.5cm
Introduction {#sec:intro}
============
AdS/CFT duality identifies ${\mathcal{N}}=4$ superconformal Yang-Mills (SYM) theory with gauge group $SU(N)$ to type IIB superstring theory on the $\mbox{AdS}_5\times S^5$ background [@Maldacena:1997re; @Gubser:1998bc; @Witten:1998qj]. The AdS/CFT correspondence relates gauge theory and string theory in different regimes, thus, on the one hand, this makes it powerful as it can be used to compute the strong coupling regime of either theory using the weak coupling limit of the other, on the other hand this makes it hard to test directly since it is not easy to find situations where approximate computations in both theories have an overlapping domain of validity.
In [@Berenstein:2002jq] a way out of this difficulty was presented by introducing a Penrose limit of the $\mbox{AdS}_5\times S^5$ background. Taking the Penrose limit one gets the maximally supersymmetric pp-wave background [@Blau:2001ne; @Blau:2002dy] where type IIB string theory can be quantized [@Metsaev:2001bj; @Metsaev:2002re]. On the gauge theory side the Penrose limit corresponds to considering a certain sector of the operators. This enables one to compare directly the spectrum of operators in the planar limit of ${\mathcal{N}}=4$ SYM to the energy spectrum of quantum strings on the pp-wave. In [@Bertolini:2002nr] an alternative Penrose limit of $\mbox{AdS}_5\times S^5$ was found also giving the maximally supersymmetric background but in a coordinate system with an explicit space-like isometry [@Michelson:2002wa; @Bertolini:2002nr]. As explained in [@Harmark:2006ta] having this explicit isometry makes it particularly well-suited to study the $SU(2)$ sector of ${\mathcal{N}}=4$ SYM.
Building on the Penrose limit of [@Berenstein:2002jq] many very interesting results in matching gauge theory and string theory were found in the case of the planar limit using the idea of integrability and the connection to spin chains [@Minahan:2002ve; @Beisert:2003tq; @Beisert:2003yb][^1] particularly by considering a near plane wave limit with curvature corrections to the pp-wave background [@Callan:2003xr; @Callan:2004uv]. A high point of this is the development of the Asymptotic Bethe Ansatz describing the dimension of infinitely long operators for any ’t Hooft coupling in the planar limit [@Staudacher:2004tk; @Beisert:2005tm; @Beisert:2006ez]. Going beyond the planar limit seems instead to be very difficult [@Kristjansen:2002bb]. New ideas are needed in order to further explore the AdS/CFT correspondence in the non-planar limit and its potential applications.
Recently another example of an exact duality between ${\mathcal{N}}= 6$ superconformal Chern-Simons theory (ABJM theory) and type IIA string theory on $\mbox{AdS}_4 \times CP^3$ have been found [@Aharony:2008ug]. Also here certain Penrose limits and near plane wave limits have been explored [@Nishioka:2008gz; @Gaiotto:2008cg; @Grignani:2008is; @Astolfi:2008ji; @Astolfi:2009qh].
The difficulty of going beyond the planar limit, where integrability most likely is absent, makes it desirable to consider alternative approaches to match the spectrum of operators and string states. One of the cornerstones in comparing the operator spectrum to the string spectrum in a Penrose limit or near-plane wave limit is that in comparing the spectrum of operators one assumes that most of the operators of the gauge theory receive an infinitely large correction to the bare dimension in the large ’t Hooft coupling limit $\lambda \rightarrow \infty$. This is of course a built in feature of the Asymptotic Bethe Ansatz for ${\mathcal{N}}=4$ SYM. However, an alternative approach to this problem of taking the strong coupling limit of ${\mathcal{N}}=4$ SYM has been proposed in [@Harmark:2006di; @Harmark:2006ta; @Harmark:2006ie; @Harmark:2007et; @Harmark:2007px; @Harmark:2008gm] where a regime of AdS/CFT was found in which both gauge theory and string theory are reliable and the correspondence can be tested in a precise way.
Applying the approach of [@Harmark:2006di; @Harmark:2006ta; @Harmark:2006ie; @Harmark:2007et; @Harmark:2007px; @Harmark:2008gm][^2] to match the spectrum of operators and string states in the $SU(2)$ sector uses in an essential way the alternative Penrose limit of [@Bertolini:2002nr] where the maximally supersymmetric pp-wave has an explicit isometry. This is because for this pp-wave background the string states having an energy just above the vacuum energy are the states dual to the operators in the $SU(2)$ sector of ${\mathcal{N}}=4$ SYM.
However, as shown in [@Harmark:2007px] there are several other sectors of ${\mathcal{N}}=4$ SYM that one can explore as well, and these sectors are crucial for approaching non-perturbative physics of type IIB string theory in $\mbox{AdS}_5\times S^5$, such as D-branes and black holes. This means that there should be additional Penrose limits of $\mbox{AdS}_5\times S^5$ in addition to the ones of [@Blau:2002dy; @Berenstein:2002jq; @Bertolini:2002nr].
In this paper we address these issues by deriving a new Penrose limit of $\mbox{AdS}_5 \times S^5$ which leads to a new pp-wave background with two explicit space-like isometries. As for the two previously found Penrose limits [@Blau:2002dy; @Berenstein:2002jq; @Bertolini:2002nr] this leads to a pp-wave background where type IIB string theory can be quantized and the spectrum can be matched to the spectrum of operators of ${\mathcal{N}}=4$ SYM. Our analysis completes the study of all possible pp-wave backgrounds which can be obtained as Penrose limits of the $\mbox{AdS}_5 \times S^5$ geometry. It also represents a further step in the investigation of the matching of strongly coupled gauge theory and string theory in certain sectors which are relevant for describing non-perturbative physics of type IIB string theory on $\mbox{AdS}_5\times S^5$. In particular, the new Penrose limit is relevant for studying the $SU(1,2|3)$ sector, which is the maximally possible subsector of ${\mathcal{N}}=4$ SYM [@Harmark:2007px].
In addition to the new Penrose limit of $\mbox{AdS}_5\times S^5$ we also explore Penrose limits of $\mbox{AdS}_4 \times {\mathbb{C}}P^3$. Here two different classes of Penrose limits have been found, one in which there are no explicit space-like isometries [@Nishioka:2008gz; @Gaiotto:2008cg] and another in which there are two explicit space-like isometries [@Grignani:2008is; @Astolfi:2009qh] which makes it suitable for studying the $SU(2)\times SU(2)$ sector of ABJM theory. We find in this paper a new Penrose limit of the $\mbox{AdS}_4 \times {\mathbb{C}}P^3$ background giving a pp-wave background with one explicit space-like isometry.
The new Penrose limit of $\mbox{AdS}_5\times S^5$ found in this paper is also relevant for studying the finite temperature behavior of AdS/CFT. It is conjectured that the confinement/deconfinement transition temperature of planar $\mathcal{N}=4$ SYM on $R\times S^3$ is dual to the Hagedorn temperature of type IIB string theory on $\mbox{AdS}_5 \times S^5$ [@Witten:1998zw; @Sundborg:1999ue; @Polyakov:2001af; @Aharony:2003sx]. Using the Penrose limit [@Bertolini:2002nr] this was shown quantitatively to be true [@Harmark:2006ta] by matching the confiment/deconfinement temperature of planar $\mathcal{N}=4$ SYM on $R\times S^3$ in a limit with R-charge chemical potentials to the Hagedorn temperature of type IIB string on the pp-wave background of [@Bertolini:2002nr][^3]. We furthermore expect that our results could help in understanding more generally the behavior of string theory above the Hagedorn temperature and to study the connection between gauge theory and black holes in $\mbox{AdS}_5 \times S^5$ [@Grignani:2009ua][^4].
Interesting related work in other less supersymmetric gauge theories can be found in Refs. [@Grignani:2007xz; @Larsen:2007bm; @Hamilton:2007he].
The paper is organized as follows. In Section \[sec:stringtheory\] we first review the Penrose limit of string theory that lead to pp-wave backgrounds with zero and one spatial isometry. Then, we find a new Penrose limit giving rise to a pp-wave background with two space-like isometries in which string theory can be quantized. In Section \[sec:stringrotspectra\] we obtain a general form for a pp-wave metric that reproduces all the pp-wave backgrounds analyzed in the previous section. We moreover show that string theory can be directly quantized on this background which we dub “[*rotated pp-wave background*]{} " and we compute the spectrum. In Section \[sec:decsectors\] we show that, after taking an appropriate limit, the spectrum of type IIB string theory on the rotated pp-wave background can be exactly matched to the spectrum of the dual gauge theory operators in certain decoupled sectors of ${\mathcal{N}}=4$ SYM. Finally, in Section \[sec:ads4\] we find a new Penrose limit of the ${\mbox{AdS}}_4\times {\mathbb{C}}P^3$ background of type IIA supergravity with one explicit space-like isometry.
Penrose limits and pp-waves with explicit isometries {#sec:stringtheory}
====================================================
In this section we derive a Penrose limit of $\mbox{AdS}_5 \times S^5$ which results in a new pp-wave background with two space-like isometries. We then show how to obtain a general pp-wave background which, for appropriate choices of the parameters of the background, reproduces all the known pp-wave backgrounds which are obtained through a Penrose limit procedure on $\mbox{AdS}_5 \times S^5$. We begin the section by writing down a slightly generalized version of the previously found Penrose limits of $\mbox{AdS}_5 \times S^5$ with zero and one explicit space-like isometries [@Blau:2002dy; @Berenstein:2002jq; @Bertolini:2002nr].
In $\mbox{AdS}_5 \times S^5$, the Penrose limit consists in considering a particle in the center of $\mbox{AdS}_5 $ that is moving very rapidly on a geodesic of $S^5$. This means that the angular momentum along the direction in which the particle is moving is very large ($J \to
\infty$). Then by taking the limit $R \to \infty$, where $R$ is the radius of $\mbox{AdS}_5$ and $S^5$, but such that the ratio $J/R^2$ remains fixed, the geometry of $\mbox{AdS}_5 \times S^5$ reduces to a plane-wave geometry.
An important point to emphasize is that one can choose any light-like geodesic of $\mbox{AdS}_5 \times S^5$ for implementing the procedure. While the pp-wave background always corresponds to the maximally supersymmetric pp-wave background of type IIB supergravity [@Blau:2001ne], different choices of light-like geodesics can give this background in different coordinate systems [@Bertolini:2002nr]. Naively this should not matter, however, the different coordinate systems can correspond to different choices of lightcone time on the pp-wave background. And this corresponds moreover to different dictionaries between the physical quantities of the $\mbox{AdS}_5\times S^5$ background and of the maximally supersymmetric pp-wave background. Therefore, the different coordinate systems for the pp-wave background are connected to the fact that the different Penrose limits that we consider correspond to zooming in to different regimes of type IIB string theory on $\mbox{AdS}_5\times S^5$. This in turns corresponds to zooming in to different regimes of ${\mathcal{N}}=4$ SYM. Furthermore, as we discuss in section \[sec:decsectors\], the different Penrose limits correspond to different decoupling limits of ${\mathcal{N}}=4$ SYM on ${\mathbb{R}}\times S^3$.
In the literature the “canonical” coordinate system used for the maximally supersymmetric pp-wave background is that of [@Blau:2001ne; @Blau:2002dy; @Berenstein:2002jq] which we here dub the [*BMN pp-wave background*]{}. This coordinate system is such that the quadratic potential terms for the transverse directions are massive for all eight transverse directions. Another coordinate system was introduced in [@Michelson:2002wa; @Bertolini:2002nr] and we will refer to it as the [*one flat direction pp-wave background*]{} due to the presence of a space-like isometry in the pp-wave metric and since in this case the quadratic terms for the transverse directions have a massless direction.
Here we find a new pp-wave background corresponding to a new coordinate system for the maximally supersymmetric pp-wave of type IIB supergravity. This new background is again obtained as a Penrose limit of $\mbox{AdS}_5 \times S^5$ with an appropriate choice of light-cone coordinates. The new pp-wave background differs from the other two because of the presence of two spacial isometries in the metric, namely two flat directions, corresponding to two massless directions in the potential terms for the transverse directions. Hence we call it the [*two flat directions pp-wave background*]{}.
This new pp-wave background is important in the context of the AdS/CFT correspondence. In fact, as shown explicitly in Section \[sec:stringrotspectra\], string theory can be quantized on this background. Moreover, as discussed in Section \[sec:decsectors\], after taking a certain limit on the spectrum of type IIB string theory in this new background, we can complete the matching between the spectrum of anomalous dimensions of gauge theory operators in certain sectors of $\neqf$ SYM theory and the spectrum of the dual string theory states.
We show below in Section \[sec:stringrotspectra\] that all the pp-wave s achievable through the Penrose limit are connected by a time-dependent coordinate transformation. This proves that mathematically they are all equivalent. The same is not true from the physical point of view, since the transformation involves time. Thus what changes from a to another is what we call time, and consequently what we call Hamiltonian. Therefore the physics is different when we consider the theory on different pp-wave backgrounds.
It is also interesting to notice which regimes of ${\mathcal{N}}=4$ SYM the different Penrose limits correspond to. We give these regimes for each of the three different limits below. To consider this, we record the following dictionary between strings on $\mbox{AdS}_5\times S^5$ and ${\mathcal{N}}=4$ SYM on ${\mathbb{R}}\times S^3$. We have $$\frac{R^4}{l_s^4} = 4 \pi^2 \lambda {\,, \ \ }g_s = \frac{\pi \lambda}{N}$$ where $R$ is the radius of $\mbox{AdS}_5$ and $S^5$, $g_s$ and $l_s$ are the string coupling and string length, respectively, and $\lambda = {g_{\rm YM}}^2 N/(4\pi^2)$ is the ’t Hooft coupling of $SU(N)$ ${\mathcal{N}}=4$ SYM.[^5] The energy $E$ of type IIB string states on $\mbox{AdS}_5\times S^5$ is identified with the energy $E$ of the dual ${\mathcal{N}}=4$ SYM states on ${\mathbb{R}}\times S^3$, or equivalently, with the scaling dimension of the dual operators of ${\mathcal{N}}=4$ SYM on ${\mathbb{R}}^4$. Similarly the angular momenta $J_{1,2,3}$ on $S^5$ for string states are identified with the three R-charges $J_{1,2,3}$ for states/operators of ${\mathcal{N}}=4$ SYM. Moreover the angular momenta $S_{1,2}$ for strings on $\mbox{AdS}_5$ are identified with the Cartan generators for the $SO(4)$ symmetry of the $S^3$ for the dual ${\mathcal{N}}=4$ SYM states on ${\mathbb{R}}\times S^3$, or equivalently, the $SO(4)$ symmetry of the ${\mathbb{R}}^4$ for the dual operators of ${\mathcal{N}}=4$ SYM on ${\mathbb{R}}^4$.
The string theory that we are interested in is type IIB string theory on $\mbox{AdS}_5 \times S^5$. The metric for this background is given by $$\label{adsmet}
ds^2 = R^2 \left[ - \cosh^2 \rho dt^2 + d\rho^2 +
\sinh^2 \rho d{\Omega'_3}^2 + d\theta^2 + \sin^2 \theta d\alpha^2
+ \cos^2 \theta d\Omega_3^2 \right]\, ,$$ with the five-form Ramond-Ramond field strength $$\label{adsF5}
F_{(5)} = 2 R^4 ( \cosh \rho \sinh^3 \rho dt d\rho d\Omega_3' +
\sin \theta \cos^3 \theta d\theta d\alpha d\Omega_3 )\, .$$ We parameterize the two three-spheres as $$\begin{aligned}
\label{3sph}
d\Omega_3^2 &= d\psi^2 + \sin^2 \psi d\phi^2 + \cos^2 \psi d\chi^2\, , \\
\label{3sphAdS}
d\Omega_3'^2 &= d\beta^2 + \sin^2 \beta d\gamma^2 + \cos^2 \beta d\xi^2\, .\end{aligned}$$ The three angular momenta on the five sphere $S^5$ are defined as $$\begin{aligned}
\label{eq:JJJ}
J_1= -i\partial_\chi\, , \quad J_2= -i\partial_\phi\, , \quad J_3= -i\partial_\alpha\, ,\end{aligned}$$ and the two angular momenta on the $S^3$ inside $\mbox{AdS}_5$ are defined as $$\begin{aligned}
\label{eq:SS}
S_1 = -i \partial_\gamma\, , \qquad S_2=-i\partial_\xi \, .\end{aligned}$$ We moreover define the quantity $J\equiv J_1 + \eta_1 J_2 + \eta_2 J_3 + \eta_3
S_1 + \eta_4 S_2$, where $\eta_1$, $\eta_2$, $\eta_3$, $\eta_4$ are some parameters that characterize the background. We will show that they play an important role in Section \[sec:decsectors\] where we compare the results we obtain on the string theory side with previous computations done in the dual gauge theory.
The “no flat direction” Penrose limit
-------------------------------------
In order to derive the new Penrose limit, we first review the Penrose limit giving rise to the [*BMN pp-wave* ]{}. We introduce new coordinates $\varphi_0,...,\varphi_4$ defined by $$\begin{aligned}
\label{eq:noflatphi}
\chi &= \varphi_0, \quad
\phi = \eta_1 \varphi_0 + \varphi_1\, , \quad
\alpha = \eta_2 \varphi_0 + \varphi_2\, , \quad
\gamma = \eta_3 \varphi_0 + \varphi_3\, , \quad
\xi = \eta_4 \varphi_0 + \varphi_4\,,\end{aligned}$$ and we define the light-cone coordinates as $$\begin{aligned}
z^- = \frac{1}{2} \mu R^2 (t-\varphi_0)\, , \quad
z^+ = \frac{1}{2\mu} (t+\varphi_0)\, .
\label{lcc}\end{aligned}$$ By defining $r_1,...,r_4$ such that $$\begin{aligned}
r_1= R \psi\, , \quad
r_2 = R \theta\, ,\quad
r_3 = R \rho \sin\beta\, ,\quad
r_4= R \rho \cos\beta\, .\end{aligned}$$ we can parametrize the eight $z^i$ coordinates in the following way $$\begin{aligned}
\label{coordinates}
z^1+iz^2 = r_1e^{i\varphi_1}\, , \quad z^3+iz^4 = r_2e^{i\varphi_2}\, , \cr
z^5+iz^6 = r_3e^{i\varphi_3}\, , \quad z^7+iz^8 = r_4e^{i\varphi_4}\, .\end{aligned}$$
Writing the background – in terms of the coordinate $z^\pm$ and $z^i$ and taking the Penrose limit by sending $R\to\infty$ while keeping $z^\pm$ and $z^i$ fixed, we obtain the following metric $$\label{eq:dsnoflat}
\begin{split}
ds^2=&-4dz^+dz^- + dz^i dz^i - \mu^2 \sum_{k=1}^{4}
\left(1-\eta_{k}^{2}\right)\left[\left(z^{2k-1}\right)^2+\left(z^{2k}\right)^2\right]\left(dz^+\right)^2 \\
&+ 2\mu \sum_{k=1}^{4}\eta_k \left[z^{2k-1}dz^{2k}- z^{2k}dz^{2k-1}\right]dz^+.
\end{split}$$ and five-form field strength $$\begin{aligned}
\label{eq:F5z}
F_{(5)} = 2 \mu \,dz^+ \left(dz^1 dz^2 dz^3 dz^4 + dz^5 dz^6 dz^7 dz^8 \right)\, .\end{aligned}$$ We see that by setting the parameters $\eta_k$’s all to zero, we precisely recover the pp-wave background derived in [@Blau:2002mw; @Berenstein:2002jq]. In this sense, the background – is a generalization of it. Type IIB string theory can be quantized on this background and the light-cone Hamiltonian that one obtains is $$\begin{aligned}
H_\textrm{lc} \sim E-J_1, \qquad p^+ \sim \frac{E+J_1}{R^2}\, .\end{aligned}$$ From the condition that $H_\textrm{lc}$ and $p^+$ should stay finite in the limit, we get that $J_1=-i\partial_{\varphi_0}$ must be large. On the other hand since $\varphi_1, ..., \varphi_4$ are all fixed in the limit $R\to \infty$, we deduce from , and that $J_2$, $J_3$, $S_1$ and $S_2$ are also fixed.
We see from the above that the “no flat direction” Penrose limit corresponds to the following regime of type IIB string theory on $\mbox{AdS}_5\times S^5$ $$R \rightarrow \infty \ \mbox{with}\ E-J_1\ \mbox{fixed} , \quad \frac{E+J_1}{R^2}\ \mbox{fixed}, \quad \frac{J_1}{R^2} \ \mbox{fixed}, \quad g_s,l_s \ \mbox{fixed}$$ Translating this into ${\mathcal{N}}=4$ SYM language, it corresponds to the regime $$N \rightarrow \infty \ \mbox{with}\ E-J_1\ \mbox{fixed} , \quad \frac{E+J_1}{\sqrt{N}}\ \mbox{fixed}, \quad \frac{J_1}{\sqrt{N}} \ \mbox{fixed}, \quad {g_{\rm YM}}^2 \ \mbox{fixed}$$
The “one flat direction” Penrose limit
--------------------------------------
Now we repeat an analogous procedure and show that, by a different choice of light-cone coordinates, we obtain a generalization of the pp-wave background derived in [@Bertolini:2002nr]. We define the coordinates $\varphi_0,...,\varphi_4$ in the following way $$\begin{aligned}
\label{eq:oneflatphi}
\chi = \varphi_0 -\varphi_1\, , \quad
\phi = \varphi_0 + \varphi_1\, , \quad
\alpha = \eta_2 \varphi_0 + \varphi_2\, , \quad
\gamma = \eta_3\varphi_0 + \varphi_3\, , \quad
\xi = \eta_4\varphi_0 + \varphi_4\, ,\end{aligned}$$ with the light-cone variables still given by eq.n .
We moreover define $z^1$ and $z^2$ as $$\begin{aligned}
z^1 = R\varphi_1\, , \quad z^2=R\left(\frac{\pi}{4}-\psi\right)\, ,\end{aligned}$$ while $z^3,...,z^8$ are defined as before (see Eq.) and $$\begin{aligned}
r_2 = R \theta\, , \quad
r_3 = R \rho \sin\beta\, ,\quad
r_4= R \rho \cos\beta\, ,\end{aligned}$$ $$\begin{aligned}
z^3+iz^4 =r_2 e^{i\varphi_2}\, , \quad
z_5+iz_6 = r_3e^{i\varphi_3}\, , \quad z_7+iz_8 = r_4e^{i\varphi_4}\, .\end{aligned}$$ The Penrose limit is then the limit $R\to\infty$ keeping $z^\pm,z^i$ fixed. Plugging the coordinates $z^\pm, z^i$ into the background – and taking the limit described above the metric becomes $$\label{eq:dsoneflat}
\begin{split}
ds^2=&-4dz^+dz^- + dz^i dz^i - \mu^2 \sum_{k=2}^{4}
\left(1-\eta_{k}^{2}\right)\left[\left(z^{2k-1}\right)^2+\left(z^{2k}\right)^2\right]\left(dz^+\right)^2 \\
&+ 2\mu \sum_{k=2}^{4}\eta_k \left[z^{2k-1}dz^{2k}- z^{2k}dz^{2k-1}\right]dz^+ -4 \mu z^2 dz^+ dz^1.
\end{split}$$ with the five-form given by .
From we see that $z^1$ is an explicit isometry of the above pp-wave background and therefore we call this background [*one flat direction pp-wave background*]{}.
As before we have that $\varphi_2,\varphi_3,\varphi_4$ are fixed in the Penrose limit which, using , means that $J_3$, $S_1$ and $S_2$ are fixed. But now the condition that $H_\textrm{lc}$, $p^+$ and $p^1$ have to remain finite in the limit tells us that the quantities $$E-J_1-J_2 , \quad \frac{E+J_1+J_2}{R^2}, \quad \frac{J_1+J_2}{R^2} , \quad \frac{J_1-J_2}{R} , \quad g_s,l_s$$ are all fixed when $R \to \infty$. This is the regime corresponding to the “one flat direction” Penrose limit of type IIB string theory on $\mbox{AdS}_5\times S^5$, as found in [@Bertolini:2002nr]. Translating this into ${\mathcal{N}}=4$ SYM language, it corresponds to the regime where [@Bertolini:2002nr] $$E-J_1-J_2 , \quad \frac{E+J_1+J_2}{\sqrt{N}}, \quad \frac{J_1+J_2}{\sqrt{N}} , \quad \frac{J_1-J_2}{N^{1/4}} , \quad {g_{\rm YM}}^2$$ are fixed for $N \to \infty$.
The “two flat directions” Penrose limit
---------------------------------------
We finally consider the Penrose limit that leads to a new pp-wave with two flat directions. The variables $\varphi_0,$ $\varphi_1,$ $\varphi_2,$ $\varphi_3,$ $\varphi_4$ are now defined as $$\begin{gathered}
\label{phi2fd}
\chi = \varphi_0 - \sqrt{2}\varphi_1 - \varphi_2 \, , \qquad
\phi = \varphi_0 + \sqrt{2}\varphi_1 - \varphi_2\, , \qquad
\alpha = \varphi_0 + \varphi_2 \, ,{\nonumber}\\[2mm]
\gamma = \eta_3 \varphi_0 + \varphi_3 \, , \qquad
\xi = \eta_4 \varphi_0 + \varphi_4 \, ,\end{gathered}$$ whereas the light-cone coordinate are as usual given by .
The coordinates $z^1$, $z^2$, $z^3$ and $z^4$ are defined as $$\begin{array}{lcl}
z^1 = R \varphi_1 \, , & \phantom{qquad} & z^2 =
\displaystyle{ \frac{R}{\sqrt{2}}} \left(\displaystyle{\frac{ \pi}{4}-\psi}\right) \, , \\[4mm]
z^3 = R \varphi_2 \, , & & z^4 = R \left(\displaystyle{\frac{ \pi}{4}}-\theta \right) \, .
\end{array}$$ while $z^5$, $z^6$, $z^7$, $z^8$ are again given by Eq.. More explicitly we have $$\begin{aligned}
r_3 = R \rho \sin \beta \, , \qquad r_4 = R \rho \cos \beta\, ,\end{aligned}$$ $$\begin{aligned}
z^5 + i z^6 = r_3 \displaystyle{ e^{i \varphi_3}} \, , \qquad z^7 + i z^8 = r_4 \displaystyle{ e^{i \varphi_4}}\, .\end{aligned}$$ Substituting the new coordinates in the background – and taking the Penrose limit we get the following pp-wave metric $$\label{eq:dstwoflat}
\begin{split}
ds^2&=-4dz^+dz^- + dz^i dz^i - \mu^2 \sum_{k=3,4}
\left(1-\eta_{k}^{2}\right)\left[\left(z^{2k-1}\right)^2+\left(z^{2k}\right)^2\right]\left(dz^+\right)^2 \\
&+ 2\mu \sum_{k=3,4}\eta_k\left[ z^{2k-1}dz^{2k}- z^{2k}dz^{2k-1}\right]dz^+
- 4\mu\left(z^2 dz^1 + z^4 dz^3\right)dz^+.
\end{split}$$ and the five-form is defined in . This is a new pp-wave background and it has two explicit isometries, $z^1$ and $z^3$ We will therefore refer to it as [*two flat directions pp-wave background*]{}.
In this case $\varphi_3,\varphi_4$ are fixed, thus, keeping in mind , we have that also the angular momenta $S_1$ and $S_2$ are fixed. In a similar fashion as before if we compute $H_\textrm{lc}$, $p^+$, $p^1$ and $p^3$ and request that they should stay finite in the Penrose limit we get that the quantities $$E-J_1-J_2-J_3 , \quad \frac{E+J_1+J_2+J_3}{R^2},
\quad
\frac{J_1+J_2+J_3}{R^2}, \quad \frac{J_1 - J_2}{R} ,\quad \frac{J_3 -J_1 - J_2}{R}, \quad g_s,l_s$$ are fixed as $R$ goes to infinity. This is the regime corresponding to the “two flat directions” Penrose limit of type IIB string theory on $\mbox{AdS}_5\times S^5$. Translating this into ${\mathcal{N}}=4$ SYM it corresponds to the regime where $$E-J_1-J_2-J_3 , \quad \frac{E+J_1+J_2+J_3}{\sqrt{N}}, \quad
\frac{J_1+J_2+J_3}{\sqrt{N}}, \quad \frac{J_1 - J_2}{N^{1/4}} ,\quad \frac{J_3 -J_1 - J_2}{N^{1/4}} , \quad {g_{\rm YM}}^2$$ are fixed for $N \rightarrow \infty$. Here $J_1-J_2$ and $J_3-J_1-J_2$ correspond to the two momenta for the two space-like isometries of the [*two flat directions pp-wave background*]{} .
Type IIB string theory on the pp-wave backgrounds , (with five-form field strength given by ) can be easily quantized. The spectra in all these three cases are worked out in the next section.
String theory spectrum on a rotated pp-wave background {#sec:stringrotspectra}
======================================================
In this section we obtain a pp-wave metric, which depends on parameters introduced through a coordinate transformation on the maximally of [@Blau:2001ne]. For this reason, in practice, this metric describes an infinite set of pp-wave s (one for each point of the parameter space). We refer to them as to *rotated pp-wave backgrounds*.
Note that the backgrounds obtained in this way do not necessarily have any specific meaning in an AdS/CFT context. They will only have a meaning in the AdS/CFT context if we derive them from a Penrose limit of $\mbox{AdS}_5 \times S^5$. Despite this, the procedure that we are going to show results to be very useful because allows to obtain a general formula that contains all the physically interesting pp-wave s. In fact we will show that by appropriately choosing the values of the parameters of the background, this general formula describes exactly the s studied in the previous section which are indeed obtained by taking Penrose limits of the $\mbox{AdS}_5 \times S^5$ .
We can then proceed in finding the spectra on these generic rotated s. An important result is that, by taking an appropriate limit on these spectra, we will show that one can reproduce the spectra found in [@Harmark:2007px] for the nine decoupled sectors of $\neqf$ SYM which contain scalars.
Coordinate transformation
-------------------------
We start from the simplest pp-wave background metric without flat directions $$\label{BMNmetric}
ds^2=-4dx^+dx^- - \mu^2 x^ix^i\left(dx^+\right)^2+dx^idx^i\, ,$$ where $i=1,2,\dots,8$ and five-form field strength $$\label{fff}
F_{(5)}=2\mu dx^{+}\left(dx^{1}dx^{2}dx^{3}dx^{4}+dx^{5}dx^{6}dx^{7}dx^{8}\right)\, .$$ We consider the following coordinate transformation $$\label{transfrot}
\begin{split}
x^- =z^- &+\frac{\mu}{2}\left(C_1 z^1z^2 + C_2z^3z^4 + C_3z^5z^6 + C_4z^7z^8\right)\, , \\[2mm]
\left( \begin{array}{c}
x^{2k-1} \\[2mm]
x^{2k}
\end{array} \right) &=
\left( \begin{array}{cc}
\cos(\eta_k \mu z^+) & -\sin(\eta_k \mu z^+) \\[2mm]
\sin(\eta_k \mu z^+) & \cos(\eta_k \mu z^+)
\end{array} \right)
\left( \begin{array}{c}
z^{2k-1} \\[2mm]
z^{2k}
\end{array} \right)\, ,
\end{split}$$ where $C_{k}$ and $\eta_{k}$, $k=1, 2, 3, 4$, are parameters.
Note that the transformations for the transverse coordinates are rotations whose angles depend on the $\eta_k$ parameters, hence the name “[*rotated pp-wave* ]{}”.
The metric then becomes $$\label{rotmetric}
\begin{split}
ds^2=&-4dz^+dz^- + dz^i dz^i - \mu^2 \sum_{k=1}^{4} \left(1-\eta_{k}^{2}\right)\left[\left(z^{2k-1}\right)^2+\left(z^{2k}\right)^2\right]\left(dz^+\right)^2 \\
&- 2\mu \sum_{k=1}^{4}\left[(C_k-\eta_k)z^{2k-1}dz^{2k}+(C_k+\eta_k)z^{2k}dz^{2k-1}\right]dz^+\, ,
\end{split}$$ while the five-form field strength is invariant under the coordinate transformation . It is straightforward to check that the metric contains all the s obtained in Section \[sec:stringtheory\]. In fact, for various values of the $C_k$ and $\eta_k$ parameters, we have the following possibilities
------------------------------------------- --------------- ----------------------
$C_1=C_2=C_3=C_4=0$ $\Rightarrow$ no flat direction;
$C_1=\eta_1=1$ and $C_2=C_3=C_4=0$ $\Rightarrow$ one flat direction;
$C_1=\eta_1=C_2=\eta_2=1$ and $C_3=C_4=0$ $\Rightarrow$ two flat directions.
------------------------------------------- --------------- ----------------------
String theory can be quantized on the general background and we now proceed in finding the superstring spectrum.
Bosonic sector
--------------
We work in the light-cone gauge $z^+ = p^+ \tau$ with $l_s=1$. The light-cone Lagrangian density of the bosonic $\sigma$-model is given by $$\label{boslagr}
\begin{split}
\mathscr{L}_{lc}^{B}= &- \frac{1}{4\pi p^+}\left(\partial^{\alpha}z^i\partial_{\alpha}z^i+
f^2 \sum_{k=1}^{4}\left(1-\eta_{k}^{2}\right)\left[\left(z^{2k-1}\right)^2+\left(z^{2k}\right)^2\right] \right. \\
&+\left. 2f \sum_{k=1}^{4}\left[(C_k-\eta_k)z^{2k-1}\dot{z}^{2k}+(C_k+\eta_k)z^{2k}\dot{z}^{2k-1}\right]\right)\, ,
\end{split}$$ where we have defined $f = \mu p^+$. The conjugate momenta are computed to be $$\Pi_{2k-1} = \frac{\dot{z}^{2k-1}-f\left(C_k + \eta_k \right) z^{2k}}{2\pi }\, ,~~~~~
\Pi_{2k} = \frac{\dot{z}^{2k}-f\left(C_k - \eta_k \right) z^{2k-1}}{2\pi }\, ,$$ and the bosonic light-cone Hamiltonian is given by $$H_{lc}^{B}= \frac{1}{4\pi p^+}\int_{0}^{2\pi}d\sigma \Bigg[ \dot{z}^i \dot{z}^i+ (z^i)'(z^i)'
+f^2 \sum_{k=1}^{4}\left(1-\eta_{k}^{2}\right)\left[\left(z^{2k-1}\right)^2+\left(z^{2k}\right)^2\right]\Bigg]\, .$$ In order to solve the equations of motion
$$\begin{aligned}
&\partial^{\alpha}\partial_{\alpha}z^{2k-1}+2f\eta_k \dot{z}^{2k} - f^2 \left(1-\eta_{k}^{2}\right) z^{2k-1}=0\label{moteq1}\, ,\\
&\partial^{\alpha}\partial_{\alpha}z^{2k}-2f\eta_k \dot{z}^{2k-1} - f^2 \left(1-\eta_{k}^{2}\right) z^{2k}=0\label{moteq2}\, ,\end{aligned}$$
it is useful to introduce four complex fields $$X^k = z^{2k-1}+ iz^{2k}\, ,$$ in terms of which the above equations read
$$\begin{aligned}
&\partial^{\alpha}\partial_{\alpha}X^{k}-2 i f\eta_k \dot{X}^{k} - f^2 \left(1-\eta_{k}^{2}\right) X^{k}=0\, ,\label{moteqd1}\\
&\partial^{\alpha}\partial_{\alpha}\bar{X}^{k}+2 i f\eta_k \dot{\bar{X}}^{k} - f^2 \left(1-\eta_{k}^{2}\right) \bar{X}^{k}=0\label{moteqd2}\, .\end{aligned}$$
One can see that a solution of the form $$X^k=e^{-i f \eta_k \tau} Y^k$$ solves if $Y^k$ satisfy the equation $$\partial^{\alpha}\partial_{\alpha}Y^{k} -f^2 Y^k=0\, .$$ Therefore for $Y^k$ and its conjugate $\bar{Y}^k$ we have the following mode expansions
\[bosmodeex\] $$\begin{aligned}
Y^k&=i \sum_{n=-\infty}^{+\infty} \frac{1}{\sqrt{\omega_n}}\left(a_{n}^{k}e^{-i (\omega_n \tau -n\sigma)}- \left(\tilde{a}_{n}^{k}\right)^\dagger e^{i (\omega_n \tau -n\sigma)}\right)\, , \\
\bar{Y}^k&=i \sum_{n=-\infty}^{+\infty} \frac{1}{\sqrt{\omega_n}}\left(\tilde{a}_{n}^{k}e^{-i (\omega_n \tau -n\sigma)}- \left(a_{n}^{k}\right)^\dagger e^{i (\omega_n \tau -n\sigma)}\right)\, .\end{aligned}$$
The bosonic Hamiltonian now reads $$\label{Hcomplexfield}
H_{lc}^{B}= \frac{1}{4\pi p^+}\int_{0}^{2\pi}d\sigma \sum_{k=1}^{4}\left(\dot{\bar{X}}^k \dot{X}^k+ (\bar{X}^k)'(X^k)'
+f^2 \left(1-\eta_{k}^{2}\right)\bar{X}^{k}X^{k}\right)\, .$$ Then we quantize the theory imposing the canonical equal time commutation relations $$\label{etcr}
\left[a_{n}^{k},a_{m}^{k'}\right]=0\, , \qquad \left[a_{n}^{k},(a_{m}^{k'})^{\dagger}\right]=\left[\tilde{a}_{n}^{k},(\tilde{a}_{m}^{k'})^{\dagger}\right]=\delta^{kk'}\delta_{nm}\, .$$ We obtain the following bosonic spectrum in this background $$\label{rotbosH}
\begin{split}
H_{lc}^{B}=& \frac{1}{ p^+}\sum_{n=-\infty}^{+\infty} \sum_{k=1}^2
\left[\left(\omega_n + \eta_k f\right) M_{n}^{(k)}+\left(\omega_n - \eta_k f\right) \tilde{M}_{n}^{(k)}\right. \\
+&\left.\left(\omega_n + \eta_{(k+2)} f\right) N_{n}^{(k)}+\left(\omega_n - \eta_{(k+2)} f\right) \tilde{N}_{n}^{(k)}\right]\, ,
\end{split}$$ where $\omega_n = \sqrt{n^2 + f^2}$ for all $n\in \mathbb{Z}$ and the number operators are defined as $$M_{n}^{(k)}=a_{n}^{k\dagger}a_{n}^{k}\, , ~~ \tilde{M}_{n}^{(k)} =\tilde{a}_{n}^{k\dagger}\tilde{a}_{n}^{k} \, ,~~N_{n}^{(k)}=a_{n}^{(k+2)\dagger}a_{n}^{(k+2)}\, , ~~\tilde{N}_{n}^{(k)} =\tilde{a}_{n}^{(k+2)\dagger}\tilde{a}_{n}^{(k+2)}$$ for $k=1,2$.
Fermionic sector
----------------
We now work out the fermionic part of the spectrum. The light-cone gauge and $\kappa$-symmetry gauge fixing condition are $$z^+ = p^+ \tau, \qquad \Gamma^{+}\theta^A=0\,$$ where $\theta^A$, with $A=1,2$, is a Majorana-Weyl spinor with $32$ components. The Green-Schwarz fermionic light-cone action is then given by [@Metsaev:2002re] $$\label{GSaction}
S_{lc}^{F}= \frac{i}{4\pi p^+}\int d\tau d\sigma \left[ \left(\eta^{\alpha\beta}\delta_{AB}-\epsilon^{\alpha\beta}\left(\sigma_{3}\right)_{AB}\right)\partial_{\alpha}z^+ \bar{\theta}^A \Gamma_+ \left(\mathcal{D}_{\beta}\theta\right)^B\right]\, ,$$ with covariant derivative $$\mathcal{D}_{\alpha}=\partial_{\alpha}+\frac{1}{4}\partial_{\alpha}z^+ \left(\omega_{+\rho\sigma}\Gamma^{\rho \sigma}-\frac{1}{2\cdot 5!}F_{\lambda\nu\rho\sigma\kappa}\Gamma^{\lambda\nu\rho\sigma\kappa}i\sigma_2 \Gamma_+ \right)\, ,$$ where $\sigma_{k}$’s are the Pauli matrices and $\omega_{a,b,c}$ are the spin connections. The non-vanishing components of the five-form field strength are $F_{+1234}=F_{+5678}=2\mu$.
We can write the action as $$\label{feract}
\begin{split}
S_{lc}^{F}=& \frac{i}{2\pi p^+ }\int d\tau d\sigma \Bigg\{{\left(S^1\right)^T} \left[\partial_{+}-\frac{f}{2}\sum_{k=1}^{4}\eta_{k}\gamma^{2k-1,2k}\right]S^1\\
+& {\left(S^2\right)^T} \left[\partial_{-}-\frac{f}{2}\sum_{k=1}^{4}\eta_{k}\gamma^{2k-1,2k}\right]S^2 -2f {\left(S^1\right)^T} \Pi S^2\Bigg\}\, .
\end{split}$$ where $S^A$, $A=1,2$, is a eight component real spinor and we introduced the matrix $\Pi=\gamma^{1234}$, where $\gamma_i$ are $8\times 8$ Dirac matrices [^6]. Moreover, $\partial_{\pm}=\partial_{\tau}\pm\partial_{\sigma}$. The equations of motion are
\[eqmotferm\] $$\begin{aligned}
&\left(\partial_{+}-\frac{f}{2}\sum_{k=1}^{4}\eta_{k}\gamma^{2k-1,2k}\right)S^{1}-f\Pi S^{2}=0\, ,\\
&\left(\partial_{-}-\frac{f}{2}\sum_{k=1}^{4}\eta_{k}\gamma^{2k-1,2k}\right)S^{2}+f\Pi S^{1}=0\, .\end{aligned}$$
It is useful to observe that a field of the form $$S^{A}=e^{\displaystyle \frac{f}{2}\sum_{k=1}^{4}\eta_{k}\gamma^{2k-1,2k}\tau}\Sigma^{A}$$ satisfies the above equations if the fields $\Sigma^{A}$ obey the equations of motion of the fermionic fields in the usual pp-wave background [@Metsaev:2001bj; @Metsaev:2002re]: $$\partial_{+}\Sigma^{1}-f\Pi \Sigma^{2}=0\, ,~~~~~~\partial_{-}\Sigma^{2}+f\Pi \Sigma^{1}=0\, ,$$ whose solutions are
$$\begin{aligned}
&\Sigma^{1}=c_0\, e^{-i f \tau}S_0 - \sum_{n>0}c_n e^{-i \omega_{n}\tau}
\left(S_n e^{i n \sigma}+\frac{\omega_{n}-n}{f} S_{-n}e^{-i n \sigma} \right)
+\textrm{h.c. },\\
&\Sigma^{2}=-c_0\, e^{-i f \tau}i\Pi S_0 - i \Pi\sum_{n>0}c_n e^{-i \omega_{n}\tau}
\left(S_{-n} e^{-i n \sigma}-\frac{\omega_{n}-n}{f} S_{n}e^{i n \sigma} \right)+\textrm{h.c. },\end{aligned}$$
where, for all values of $n$, $\omega_{n}=\sqrt{n^2+f^2}$, while $c_n =
\frac{1}{\sqrt{2}}[1+(\frac{\omega_{n}-n}{f})^{2}]^{-1/2}$.
The fermionic conjugate momenta can be computed from the action $$\lambda^{A}=\frac{i}{2\pi}S^{A}\, ,$$ and the fermionic part of the Hamiltonian can be written in the form $$H_{lc}^{F}= \frac{i}{2\pi p^+ }\int^{2\pi}_{0}d\sigma
\left({\left(S^1\right)^T}\dot{S^1}+{\left(S^2\right)^T}\dot{S^2}\right)\,$$ where we used the equations of motion . Now we quantize the theory imposing the canonical equal time anticommutation relations $$\left\{S_{n}^{a},\left(S_{m}^{b}\right)^{\dagger}\right\}=\delta^{ab}\delta_{nm}\,$$ and the fermionic Hamiltonian reads $$H_{lc}^{F}=\frac{1}{ p^+ }{\sum_{n=-\infty}^{+\infty}}S_{n}^{\dagger}
\left(\omega_{n}+i\frac{f}{2}{\sum_{k=1}^{4}\eta_{k}\gamma^{2k-1,2k}}\right)S_{n}\, .$$ The matrices $i\,\gamma^{2k-1,2k}$ are commuting matrices and have eigenvalues $\pm 1$, each with multiplicity four. Since they commute we can find a set of common eigenvectors. Choosing this set as basis we can write the fermionic spectrum as $$\label{rotferH}
H_{lc}^{F}= \frac{1}{ p^+}{\sum_{n=-\infty}^{+\infty}} \sum_{b=1}^{8}
\left(\omega_n + \frac{f}{2} d_b \right)F_{n}^{(b)}\, ,$$ where $F_{n}^{(b)}$ are the fermionic number operators defined by the relation $$F_{n}^{(b)}=\left(S_{n}^{b}\right)^{\dagger}S_{n}^{b}\,$$ and where we have defined the coefficients $d_b$ as the following combinations of the $\eta_k$ parameters $$\begin{array}{lll}
d_1 = -\eta_{1}-\eta_{2}+\eta_{3}+\eta_{4} \, , \phantom{qquad} & d_5 = -\eta_{1}+\eta_{2}+\eta_{3}-\eta_{4} \, ,\\[1mm]
d_2 = -\eta_{1}-\eta_{2}-\eta_{3}-\eta_{4} \, , & d_6 = \eta_{1}-\eta_{2}+\eta_{3}-\eta_{4} \, ,\\[1mm]
d_3 = \eta_{1}+\eta_{2}+\eta_{3}+\eta_{4} \, , & d_7 = \eta_{1}-\eta_{2}-\eta_{3}+\eta_{4} \, ,\\[1mm]
d_4 = \eta_{1}+\eta_{2}-\eta_{3}-\eta_{4} \, , & d_8 = -\eta_{1}+\eta_{2}-\eta_{3}+\eta_{4} \, .
\end{array}$$
At this point we can write the total light-cone Hamiltonian, $H_{lc}$, of type IIB string theory on the [*rotated pp-wave s*]{} $$\label{eq:rotH}
\begin{split}
H_{lc}=&H_{lc}^{B} +H_{lc}^{F}= \frac{1}{ p^+}\sum_{n=-\infty}^{+\infty} \left\{\sum_{k=1}^2
\left[\left(\omega_n + \eta_k f\right) M_{n}^{(k)}+\left(\omega_n - \eta_k f\right) \tilde{M}_{n}^{(k)}\right]\right. \\
+&\left.\sum_{k=1}^2\left[\left(\omega_n + \eta_{(k+2)} f\right) N_{n}^{(k)}+\left(\omega_n - \eta_{(k+2)} f\right) \tilde{N}_{n}^{(k)}\right]
+ \sum_{b=1}^{8}\left(\omega_n + \frac{f}{2} d_b \right)F_{n}^{(b)}\right\}\, ,
\end{split}$$ and the level matching condition is $$\sum_{n=-\infty}^{+\infty}\left[\sum_{k=1}^2\left(M_{n}^{(k)}+\tilde{M}_{n}^{(k)}
+N_{n}^{(k)}+\tilde{N}_{n}^{(k)}\right)+ \sum_{b=1}^{8}F_{n}^{(b)}\right]=0 \, .$$ Note that the spectrum does not depend on the $C_k$ parameters since they just represent a gauge choice, but only on the $\eta_k$ parameters.
The decoupled sectors {#sec:decsectors}
=====================
In this section we show that by taking a certain limit of the spectra , we can reproduce the spectrum of anomalous dimensions of gauge theory operators in the dual sectors of $\mathcal{N}=4$ SYM theory found in [@Harmark:2007px]. The procedure follows that of [@Harmark:2006ta] where the spectrum in the $SU(2)$ sector is matched. Here we generalize this to all sectors that include scalar fields on the gauge theory side.
According to the AdS/CFT correspondence, the string light-cone Hamiltonian $H_{\rm lc}$ should be dual to $D-J$ on the gauge theory side, $$\frac{H_{\rm lc}}{\mu}\, \longleftrightarrow \, D-J \, .$$ where $D$ is the dilatation operator and $J$ is the total charge defined by $J = n_1 S_1 + n_2 S_2 + n_3 J_1 + n_4 J_2 + n_5 J_3$ with the $n_i$ characterizing the decoupling limit giving a particular sector of ${\mathcal{N}}=4$ SYM [@Harmark:2007px]. As explained in more detail below, the decoupling limit on the gauge theory consists of taking the limit $D-J \rightarrow 0$ and $\lambda\rightarrow 0$ keeping $(D-J)/\lambda$ fixed. On the string theory side, this decoupling limit corresponds to the limit $\mu \to \infty$, or equivalently $f \to \infty$. We now apply this limit to the string spectra . Remembering the definition of $\omega_n$, its expansion for $f \to \infty$ takes the form $$\omega_n=\sqrt{f^2 + n^2}\simeq f+\frac{n^2}{2f} +\mathcal{O}(f^{-2})\, .$$ In order for the spectra to be finite, the divergent term contained in the expansion of $\omega_n$ should cancel.
In the bosonic part of the Hamiltonian we deal with terms of the kind
$$\begin{aligned}
\left(\omega_n + \eta_k f\right)M_{n}^{(k)} &
\simeq \left[f\left(1+\eta_k \right) + \frac{n^2}{2f}
+\mathcal{O}(f^{-2})\right] M_{n}^{(k)}\, ,\\
\left(\omega_n - \eta_k f\right)\tilde{M}_{n}^{(k)} &
\simeq \left[f\left(1-\eta_k \right) + \frac{n^2}{2f}
+\mathcal{O}(f^{-2})\right] \tilde{M}_{n}^{(k)}\, ,
\end{aligned}$$
and the analogous ones for $N_{n}^{(k)}$ and $\tilde{N}_{n}^{(k)}$. Instead in the fermionic part of the Hamiltonian we have $$\left( \omega_n + \frac{f}{2} d_b\right)F_{n}^{(b)} \simeq \left[f\left(1+\frac{d_b}{2}\right)
+ \frac{n^2}{2f} +\mathcal{O}(f^{-2})\right]F_{n}^{(b)}\, .$$ The only terms that survive the limit $f \to \infty$ are those for which the coefficient of the linear part in $f$ vanishes. All the other terms are divergent and thus decouple in the large $f$ limit. The bosonic number operators will survive only if the corresponding $\eta_k$ results to be $\pm 1$ and the fermionic number operators only if the corresponding $d_b$ results to be $-2$.
In the following we want to show that by appropriately fixing the values of the parameters $\eta_k$, the string theory spectra that survive the limit $\mu \to \infty$ precisely reproduce the spectra of the dual gauge theory sectors. As an important consequence of the matching of the spectra, it follows that also the Hagedorn temperature of the gauge theory matches the one of string theory in these sectors. This can also be used to verify the conjectured relation between the Hagedorn/deconfinement temperature of planar ${\mathcal{N}}=4$ SYM on ${\mathbb{R}}\times S^3$ and the Hagedorn temperature of string theory on $\mbox{AdS}_5\times S^5$. Moreover, these results show that the decoupling limits [@Harmark:2006di; @Harmark:2006ta; @Harmark:2006ie; @Harmark:2007et; @Harmark:2007px] of thermal $SU(N)$ $\mathcal{N}=4$ SYM on ${\mathbb{R}}\times S^3$ provide a very useful and powerful tool to match gauge theory and string theory.
On the gauge theory side the idea [@Harmark:2006di; @Harmark:2006ta; @Harmark:2006ie; @Harmark:2007et; @Harmark:2007px; @Harmark:2008gm] is to consider decoupling limits of weakly coupled ${\mathcal{N}}=4$ SYM on ${\mathbb{R}}\times S^3$ with gauge group $SU(N)$. The decoupling limit is defined by $$\label{limit2} \lambda \rightarrow 0 {\,, \ \ }J_i,\, N \ \mbox{fixed}
{\,, \ \ }H_{\rm g.t.} \equiv \frac{E-J}{\lambda} \ \mbox{fixed}$$ where $\lambda={g_{\rm YM}}^2 N/4\pi^2$ is the ’t Hooft coupling of $\mathcal{N}=4$ SYM theory, $E$ is the energy of a state measured in units of the three sphere radius and $J\equiv n_1 S_1 +
n_2 S_2 + n_3 J_1 + n_4 J_2 + n_5 J_3$ is the total charge with $n_i$, $i=1,\ldots,5$ being fixed numbers. $S_1$ and $S_2$ denote the two charges of the $SO(4)$ group of $S^3$ and $J_1$, $J_2$ and $J_3$ are the three R-charges. Here we only consider the gauge theory in the planar limit $N=\infty$. In terms of operators we have that the Hamiltonian is given by $H_{\rm g.t.} = (D-J)/\lambda$. $D$ is the dilatation operator of $\mathcal{N}=4$ SYM which, at weak ’t Hooft coupling, can be expanded as $$D = D_0 + \lambda D_2 + \lambda^{\frac{3}{2}}D_3 + \lambda^2D_4 + \ldots$$ where $D_0$ is the bare scaling dimension, $D_2$ is the one-loop part of the dilatation operator and so on. One can see that in the limit , the operators with $D_0>J$ decouple and only the ones with $D_0=J$ survive the limit. One thus gets the effective Hamiltonian $H_{\rm g.t.}=D_2$, namely only the one-loop part of the dilatation operator survive the limit [@Harmark:2006di; @Harmark:2006ta; @Harmark:2006ie; @Harmark:2007et; @Harmark:2007px; @Harmark:2008gm].
Among the possible decoupling limits of $\mathcal{N}=4$ SYM theory found in [@Harmark:2007px], here we are interested only in the decoupled sectors that contain scalars. The presence of the scalars is in fact crucial in order to analyze the regime of the gauge theory which is related to the dual string theory. These sectors are the $SU(2)$, $SU(1|1)$, $SU(1|2)$, $SU(2|3)$, bosonic $SU(1,1)$, $SU(1,1|1)$, $SU(1,1|2)$, $SU(1,2|2)$ and $SU(1,2|3)$ sectors.
**Sector** $(n_1,n_2,n_3,n_4,n_5)$
--------------- --------------------------------------------------------
$SU(2)$ (0,0,1,1,0)
$SU(1,1)_{b}$ (1,0,1,0,0)
$SU(1|1)$ $\left(\frac{2}{3},0,1,\frac{2}{3},\frac{2}{3}\right)$
$SU(1|2)$ $\left(\frac{1}{2},0,1,1,\frac{1}{2}\right)$
$SU(2|3)$ (0,0,1,1,1)
$SU(1,1|1)$ $\left(1,0,1,\frac{1}{2},\frac{1}{2}\right)$
$SU(1,1|2)$ (1,0,1,1,0)
$SU(1,2|2)$ (1,1,1,0,0)
$SU(1,2|3)$ (1,1,1,1,1)
: The table shows the nine decoupled sectors that contain at least one scalar: in the left column are listed the sectors that survive the decoupling limit for the corresponding choice of $n=(n_1,n_2,n_3,n_4,n_5)$ reported in the right column. $SU(1,1)_b$ is the bosonic $SU(1,1)$ sector.[]{data-label="tab:sectors"}
For more details see Ref. [@Harmark:2007px].
The spectra for these nine different sectors all take the form [@Harmark:2007px] $$\label{eq:ABCspectrum2} H_{\rm g.t.} =
\frac{2\pi^2}{J^2} \sum_{n\in \mathbb{Z}} n^2
\left( \sum_{i=1}^a M_n^{(i)} +\sum_{j=1}^b N_n^{(j)} +
\sum_{\alpha=1}^c F_n^{(\alpha)} \right)$$ The cyclicity (zero momentum) constraint is $$\begin{aligned}
\label{eq:ABCconstraint} P \equiv \sum_{n\in \mathbb{Z}} n \left(
\sum_{i=1}^a M_n^{(i)} +\sum_{j=1}^b N_n^{(j)} + \sum_{\alpha=1}^c
F_n^{(\alpha)} \right) = 0.\end{aligned}$$ Note that $F_n^{(\alpha)} \in \{0,1\}$ while $M_n^{(i)}, N_n^{(j)}
\in \{0,1,2,...\}$. The numbers $a,b$ and $c$ are given in Tab. \[tab:abc\].
$SU(\cdot)$ $(2)$ $(1,1)_b$ $(1|1)$ $(1|2)$ $(2|3)$ $(1,1|1)$ $(1,1|2)$ $(1,2|2)$ $(1,2|3)$
------------- ------- ----------- --------- --------- --------- ----------- ----------- ----------- -----------
$a$ 1 0 0 1 2 0 1 0 2
$b$ 0 1 0 0 0 1 1 2 2
$c$ 0 0 1 1 2 1 2 2 4
: The table shows how many number operators we have of each type ($a$ for scalars $M_n$, $b$ for derivatives $N_n$, and $c$ for fermions $F_n$) in each of the nine theories that contain at least one scalar. $SU(1,1)_b$ is the bosonic $SU(1,1)$ sector. \[tab:abc\]
We want to show that there is a direct relation between the critical values of the numbers $(n_1,...,n_5)$ that characterize the various sectors on the gauge theory side and the parameters $\eta_1,...,\eta_4,$ that give the corresponding decoupled sectors on the string theory side.
From table \[tab:sectors\], we see that all the nine sectors containing scalars have $n_3 = 1$. It is not hard to see that a suitable choice of $\eta_k$ parameters to match the string theory spectrum with the spectrum of the gauge theory side is the following $$\label{eq:etaasn}
\eta_1 =n_4 \, ,\phantom{qquad} \eta_2 =n_5 \, , \phantom{qquad}
\eta_3 =-n_1 \, ,\phantom{qquad} \eta_4 =n_2 \, .$$ Using the previous relations in the spectrum and taking the limit $f\to \infty$ we see that the string theory spectrum precisely matches the spectrum of the nine decoupled sectors of the gauge theory side.
As an example we can consider the $SU(1,1|1)$ sector: in this case $n=\left(1,0,1,\frac{1}{2},\frac{1}{2}\right)$ (see Table \[tab:sectors\]) so using the relations we have that $\eta=\left(\frac{1}{2},\frac{1}{2},-1,0\right)$. Since the only $\eta_k$ equal to -1 is $\eta_3$ and the only $d_b$ equal to -2 is $d_1$ we have that only one bosonic and one fermionic number operator survive the limit $f \to \infty$. The string theory spectrum thus becomes $$\label{strsect2}
\frac{H_{lc}}{\mu}\sim \frac{1}{2 \mu p^+ f} \sum_{n\in \mathbb{Z}} n^2 \left( N_n^{(1)}
+ F_n^{(1)} \right)\, ,$$ which, using the dictionary between gauge theory and string theory, can be written as $$\label{strsect}
\frac{H_{lc}}{\mu}= \lambda D_2=\frac{2\pi^2\lambda}{J^2} \sum_{n\in \mathbb{Z}} n^2 \left( N_n^{(1)}
+ F_n^{(1)} \right)\, ,$$ where we used that $f=J/(2\pi\sqrt{\lambda})$. It is easy to check that is in accordance with the corresponding result in the gauge theory side which can be deduced from .
We can repeat an analogous check for all the other decoupled sectors and we can show that the field content of the surviving spectrum is exactly the same as the one obtained on the gauge theory side.
Using again Table \[tab:abc\], we can thus write the reduced spectrum for all the nine sectors on the string theory side at once. It is given by $$\frac{H_{lc}}{\mu}=\frac{1}{2 \mu p^+ f} \sum_{n\in \mathbb{Z}}
n^2 \left( \sum_{i=1}^a M_n^{(i)} +\sum_{j=1}^b N_n^{(j)} +
\sum_{\alpha=1}^c F_n^{(\alpha)} \right)$$ which indeed coincides with Eq. once we use the dictionary between gauge theory and string theory.
New Penrose limit of ${\mbox{AdS}}_4 \times {\mathbb{C}}P^3$ {#sec:ads4}
============================================================
In the above we have found a new Penrose limit of ${\mbox{AdS}}_5 \times S^5$ with two explicit space-like isometries in addition to the existing Penrose limits with zero and one space-like isometries [@Blau:2002dy; @Berenstein:2002jq; @Bertolini:2002nr]. A natural question is whether one can similarly find new Penrose limits of the ${\mbox{AdS}}_4\times {\mathbb{C}}P^3$ background of type IIA supergravity. The known Penrose limits for this background are with either zero explicit space-like isometries [@Nishioka:2008gz; @Gaiotto:2008cg] or with two space-like isometries [@Grignani:2008is; @Astolfi:2009qh]. In particular the one with two space-like isometries of [@Grignani:2008is; @Astolfi:2009qh] is connected to studying the $SU(2) \times SU(2)$ sector of string theory on ${\mbox{AdS}}_4\times {\mathbb{C}}P^3$.
We find in this section a new Penrose limit of the ${\mbox{AdS}}_4\times {\mathbb{C}}P^3$ background of type IIA supergravity with one explicit space-like isometry, $i.e.$ with one flat direction. We find furthermore the spectrum of type IIA string theory on this background by finding the spectrum for a general rotated pp-wave background that for certain choices of parameters corresponds to both the new pp-wave background with one explicit space-like isometry, as well as the two known backgrounds with zero and two explicit space-like isometries.
The “one flat direction” Penrose limit
--------------------------------------
In this section we present a new Penrose limit of ${\mbox{AdS}}_4 \times {\mathbb{C}}P^3$, here called the “one flat direction” Penrose limit. The metric is given by $$ds^2=R^2\left(\frac{1}{4}ds^2_{AdS_4}+ ds^2_{\CP^3}\right) \, ,$$ where $$\label{metricAdS4}
ds^2_{AdS_4} =
-\cosh^2\rho \, dt^2 +d\rho^2 +\sinh^2 \rho \, d\Omega_2^2 \, ,$$ and $$\label{metricCP3}
\begin{split}
ds^2_{\CP^3} & = d\theta^2+4\cos^2 \theta \sin^2 \theta \left(d\delta+\frac{\cos\theta_1}{4}d\vp_1-
\frac{\cos\theta_2}{4}d\vp_2\right)^2 \\
&+\frac{1}{4}\cos^2 \theta\left(d\theta_1^2+\sin^2\theta_1
d\vp_1^2\right)+\frac{1}{4}\sin^2 \theta (d\theta_2^2+\sin^2\theta_2
d\vp_2^2)\, .
\end{split}$$ We introduce the new variables $\chi$, $\xi$ and $\psi$ by $$2\delta = \chi + \frac{\vp_2}{2}\, ,\qquad \vp_2=\xi+b\chi\,, \qquad 2\theta = \psi+ \frac{\pi}{2}\, ,$$ where $b$ is a parameter. The coordinate transformation that defines the Penrose limit is $$\begin{split}
&x^+ = \frac{t+\chi}{2} \,, \qquad x^- = R^2\frac{t-\chi}{8} \,, \qquad \rho= \frac{2r}{R} \, ,\qquad \psi=\frac{2 u_4}{R} \, ,\\
&\vp_1 = \frac{2\sqrt{2}\,x_1}{R} \, ,\qquad \theta_1=\frac{2\sqrt{2}\,y_1}{R}+\frac{\pi}{2} \, ,\qquad
\theta_2=\frac{2\sqrt{2}\,z}{R}\, .
\end{split}$$ Taking the limit $R \to \infty$ while keeping $x^\pm$, $r$, $u_4$, $x_1$, $y_1$, $z$ finite, the metric becomes $$\label{metric1fd}
\begin{split}
ds^2 = &-4dx^+ dx^- + {\sum_{i=1}^{4}}\left(du_i^2-u_i^2 {dx^+}^2\right) + \sum_{a=1}^{2}\left(dx_a^2+dy_a^2 \right) \\
&+b(1+b)\left(x_2^2+y_2^2\right){dx^+}^2- 2 y_1 dx_1 dx^+
+(1+2b)\left[x_2 dy_2 - y_2 dx_2\right]dx^+ \, ,
\end{split}$$ where $x_2+iy_2=z\,e^{i\xi}$. The metric describes exactly a a pp-wave with a flat direction, namely $x_1$.
Rotated s and the string spectrum
---------------------------------
Let us start from the pp-wave metric found in [@Nishioka:2008gz] $$ds^2=-4d\tilde{x}^+d\tilde{x}^- -\left(\sum_{i=1}^4
\tilde{x}_i^2+\frac{1}{4}\sum_{i=5}^8\tilde{x}_i^2\right){d\tilde{x}^+}^2+\sum_{i=1}^8 d\tilde{x}_i^2,$$ We consider the following coordinate transformation $$\label{transfrot2}
\begin{split}
\tilde x^+ &=x^+ \, \\[2mm]
\tilde x^- &=x^- + \sum_{a=1}^{2} C_a x_a y_a \, , \\[2mm]
\tilde x_i &=u_i \, , \quad i=1,\dots,4\, ,\\[2mm]
\left( \begin{array}{c}
\tilde x_{3+2a} \\[2mm]
\tilde x_{4+2a}
\end{array} \right) &=
\left( \begin{array}{cc}
\cos(\eta_a x^+ ) & -\sin(\eta_a x^+ ) \\[2mm]
\sin(\eta_a x^+ ) & \cos(\eta_a x^+ )
\end{array} \right)
\left( \begin{array}{c}
x_a \\[2mm]
y_a
\end{array} \right)\, , \quad a=1,2\, ,
\end{split}$$ where $C_{1}, C_{2}$ and $\eta_{1}, \eta_{2}$ are parameters. Under this tranformation the metric becomes $$\begin{aligned}
\label{rotmet}
ds^2 =& -4dx^+ dx^- + {\sum_{i=1}^{4}}\left(du_i^2-u_i^2 {dx^+ }^2\right)
+ \sum_{a=1}^{2}\Bigg[dx_a^2+dy_a^2+\left(\eta_a^2-\frac{1}{4}\right)\left(x_a^2+y_a^2\right){dx^+ }^2 {\nonumber}\\
& +2\left(\eta_a-2C_a\right)x_a dy_a dx^+ - 2\left(\eta_a+2C_a\right)y_a dx_a dx^+ \Bigg]\, .\end{aligned}$$ It is easy to see that if one chooses the $C_a$ and $\eta_a$ parameters so the terms $dx^+ {}^2$ and $dx_a dx^+ $ in the metric vanish, i.e. $$\eta_a=-\frac{1}{2}\, ,\qquad \quad C_a=\frac{1}{4} \, ,$$ then one gets the with two flat directions found in [@Grignani:2008is] $$ ds^2 = -4dx^+ dx^- + {\sum_{i=1}^{4}}\left(du_i^2-u_i^2 {dx^+ }^2\right) + \sum_{a=1}^{2}\left[dx_a^2+dy_a^2 - 2 y_a dx_a dx^+ \right]$$
Eq. also contains the pp-wave with one flat direction that we just obtained through a Penrose limit of the geometry for the following choice of parameters $$\begin{array}{lcl}
\eta_1=- \displaystyle \frac{1}{2} \, , & \phantom{aaa}& \eta_2=b+ \displaystyle \frac{1}{2} \, , \\[2mm]
C_1= \displaystyle \frac{1}{4} \, ,& & C_2=0 \, .
\end{array}$$
### Spectrum {#spectrum .unnumbered}
Now we derive the string spectrum on the rotated pp-wave .
In the light-cone gauge $x^+ = c \tau$ the bosonic Lagrangian density is $$\label{penboslagr}
\begin{split}
&\mathscr{L}_{\rm lc}^{B}= - \frac{1}{4\pi c}\bigg\{\sum_{i=1}^4\left[\dot{u}_i^2
-u_i'^2-c^2u_i^2\right]+\sum_{a=1}^2\Big[\dot{x}_a^2+\dot{y}_a^2
-x_a'^2-y_a'^2 \\
&+c^2\left(\eta_a^2-\frac{1}{4}\right)\left(x_a^2+y_a^2\right)+2c\left(\eta_a-2 C_a\right)x_a \dot{y}_a
-2c\left(\eta_a+2C_a\right)y_a \dot{x}_a\Big]\bigg\}\, .
\end{split}$$ where $c$ is fixed by requiring that the conjugate momentum to $x^-$ is constant. The bosonic light-cone Hamiltonian is then given by $$\label{penbosham}
\begin{split}
c H^B_{\rm lc}=& \frac{1}{4\pi } \int_0^{2\pi} d\sigma
\bigg\{\sum_{i=1}^4\left[\dot{u}_i^2
+u_i'^2+c^2u_i^2\right] \\
&+\sum_{a=1}^2\left[\dot{x}_a^2+\dot{y}_a^2
+x_a'^2+y_a'^2+c^2\left(\frac{1}{4}-\eta_a\right)\left(x_a^2+y_a^2\right)\right] \bigg\}\, .
\end{split}$$ The mode expansion for the bosonic fields can be written as $$u_i (\tau,\sigma ) = \frac{i}{\sqrt{2}} \sum_{n\in {\mathbb{Z}}}
\frac{1}{\sqrt{\Omega_n}} \Big[ \hat{a}^i_n e^{-i ( \Omega_n \tau -
n \sigma ) } - (\hat{a}^i_n)^\dagger e^{i ( \Omega_n \tau - n \sigma
) } \Big] \, ,$$ $$\label{zmode}
z_a(\tau,\sigma) = \, e^{-i c \eta_a
\tau} \sum_{n \in {\mathbb{Z}}} \frac{1}{\sqrt{\omega_n}} \Big[ a_n^a
e^{-i ( \omega_n \tau - n \sigma ) } - (\tilde{a}^a)^\dagger_n e^{i
( \omega_n \tau - n \sigma ) } \Big]\, ,$$ where $\Omega_n=\sqrt{c^2+n^2}$, $\omega_n=\sqrt{\frac{c^2}{4}+n^2}$ and we defined $z_a(\tau,\sigma)=x_a(\tau,\sigma)+iy_a(\tau,\sigma)$. The canonical commutation relations $[x_a(\tau,\sigma),p_{x_b}(\tau,\sigma')] =
i\delta_{ab} \delta (\sigma-\sigma')$, $[y_a(\tau,\sigma),p_{y_b}(\tau,\sigma')] = i\delta_{ab}\delta
(\sigma-\sigma')$ and $[u_i(\tau,\sigma),p_j(\tau,\sigma')] =
i\delta_{ij} \delta (\sigma-\sigma')$ follows from $$\label{comrel} [a_m^a,(a_n^b)^\dagger] = \delta_{mn} \delta_{ab}{\,, \ \ }[\tilde{a}_m^a,(\tilde{a}_n^b)^\dagger] = \delta_{mn}
\delta_{ab}{\,, \ \ }[\hat{a}^i_m,(\hat{a}^j_n)^\dagger] = \delta_{mn}
\delta_{ij} \, .$$ Employing we obtain the bosonic spectrum $$\label{penspectrum}
c H^B_{\rm lc} = \sum_{i=1}^4 \sum_{n\in {\mathbb{Z}}} \sqrt{n^2+c^2}\,
\hat{N}^i_n+\sum_{a=1}^2\sum_{n\in {\mathbb{Z}}} \left\{
\left(\sqrt{\frac{c^2}{4}+n^2} + \eta_a c \right) M_n^a + \left(\sqrt{\frac{c^2}{4}+n^2}-
\eta_a c\right) N_n^a \right\} \, ,$$ with the number operators $\hat{N}^i_n = (\hat{a}^i_n)^\dagger
\hat{a}^i_n$, $M_n^a = (a^a)^\dagger_n a^a_n$ and $N_n^a =
(\tilde{a}^a)^\dagger_n \tilde{a}_n^a$.
Now we compute the fermionic part of the spectrum. We start from the type IIA superstring Lagrangian density on the $$\label{penferlagr}
\mathscr{L}^{F}= \frac{i \,c }{2} \, \bar{\theta} \Gamma_+ \left[\partial_\tau -\Gamma_{11} \partial_\sigma
+\frac{c}{4}\left(-2\eta_1\Gamma_{56}-2\eta_2\Gamma_{78}+\Gamma_{11}\Gamma_4-3\Gamma_{123}\right)\right]\theta \, ,$$ where $\theta$ is a 32 component real spinor and we used the zehnbeins $$\begin{split}
&e^+_{\phantom{+}+}=\frac{1}{2} \, , \qquad e^-_{\phantom{+}+}=\frac{1}{2}\left[\left({\sum_{i=1}^{4}}u_i^2\right) -
\sum_{a=1}^{2} \left(\eta_a^2-\frac{1}{4}\right) \left(x_a^2+y_a^2\right)\right] \, ,\\
&e^-_{\phantom{+}-}=2\, , \qquad e^-_{\phantom{+}x_a}=\left(\eta_a+2C_a\right)y_a \, ,
\qquad e^-_{\phantom{+}y_a}=-\left(\eta_a-2C_a\right)x_a \, , \\
&e^i_{\phantom{+}u_i}=1 \, , \qquad e^5_{\phantom{+}x_1}=1\, , \qquad e^6_{\phantom{+}y_1}=1\, ,
\qquad e^7_{\phantom{+}x_2}=1\, , \qquad e^8_{\phantom{+}y_2}=1\, ,
\end{split}$$ where $i=1,2,3,4$, and the relevant components of the spin connection $$\omega_+^{\phantom{+}56}=-\eta_1\, , \qquad \omega_+^{\phantom{+}78}=-\eta_2\, .$$
Let us decompose $\theta=\theta_+ +\theta_-$ by writing $$\Gamma_{5678}\theta_\pm=\pm \theta_\pm \, ,$$ In terms of $\theta_\pm$ the light-cone gauge conditions are [@Astolfi:2009qh] $$\Gamma_- \theta_- =0\, , \qquad \Gamma_{4956}\theta_+=\theta_+\, .$$ Using the spinor conventions of Appendix \[AppendixA\] we can write the Lagrangian as $$\mathscr{L}^{F} = \mathscr{L}_+ +\mathscr{L}_- \, ,$$ with $\mathscr{L}_+$ and $\mathscr{L}_-$ given by $$\mathscr{L}_+=i \psi^* \dot{\psi} - \frac{i}{2}\left(\psi \psi' + \psi^* {\psi^*}'\right) +\frac{i\, c}{2}\Delta_1 \psi \gamma_{56} \psi^*
+ \frac{c}{2} \psi \psi^* \, ,$$ $$\mathscr{L}_-=i \chi^* \dot{\chi} - \frac{i}{2}\left(\chi \chi' + \chi^* {\chi^*}'\right) -\frac{i\, c}{2}\Delta_2 \chi \gamma_{56} \chi^*
- c \chi \chi^* \, ,$$ where $\Delta_1=\eta_2-\eta_1$ and $\Delta_2=\eta_1+\eta_2$.
The mode expansions for the 8 component spinors $\psi$ and $\chi$ are $$\psi_{\alpha} = \left( e^{- \frac{c}{2} \Delta_1 \gamma_{56}\tau} \right)_{\alpha \beta}
\sum_{n\in Z} \left[ f^+_n d_{n,\alpha}e^{-i ( \omega_n \tau - n \sigma ) } - f^-_n d^\dagger_{n,\alpha}
e^{i ( \omega_n \tau - n \sigma ) } \right]\, ,$$ $$\chi_{\alpha} = \left( e^{ \frac{c}{2} \Delta_2 \gamma_{56}\tau} \right)_{\alpha \beta} \sum_{n\in Z} \left[ - g^-_n b_{n,\beta}
e^{-i ( \Omega_n \tau - n \sigma ) } + g^+_n b^\dagger_{n,\beta}
e^{i ( \Omega_n \tau - n \sigma ) } \right] \, ,$$ with the constants $f^\pm_n$ and $g^\pm_n$ defined by $$f^\pm_n = \frac{\sqrt{\omega_n+n} \pm
\sqrt{\omega_n-n}}{2\sqrt{\omega_n}} {\,, \ \ }g^\pm_n =
\frac{\sqrt{\Omega_n+n} \pm \sqrt{\Omega_n-n}}{2\sqrt{\Omega_n}}$$ The fermionic Hamiltonian density is therefore $$\label{CH2F}
c \mathcal{H}^{F}_{\rm lc} =
\frac{i}{2} \left( \psi \psi' -\rho \rho' \right) + \frac{c}{2} \Delta_1 \psi \gamma_{56}\rho - \frac{i\, c}{2} \psi \rho
+ \frac{i}{2}\left(\chi \chi' - \lambda \lambda'\right) - \frac{i\,c}{2} \Delta_2 \chi \gamma_{56}\lambda + i c \chi \lambda \, ,$$ where the fermionic momenta are $$\rho = - i \psi^* {\,, \ \ }\lambda = - i \chi^* \, .$$ The fermionic spectrum can then be computed and reads $$\label{fermppwave}
\begin{split}
c H^{F}_{\rm lc} &= \sum_{n\in {\mathbb{Z}}} \Bigg[ \sum_{b=1,2}\left(\omega_n +\frac{c}{2} \Delta_1 \right)F_n^{(b)} +
\sum_{b=3,4}\left(\omega_n -\frac{c}{2} \Delta_1 \right)F_n^{(b)} \\
&+ \sum_{b=5,6} \left( \Omega_n - \frac{c}{2}\Delta_2 \right) F_n^{(b)} +
\sum_{b=7,8} \left( \Omega_n + \frac{c}{2}\Delta_2 \right) F_n^{(b)} \Bigg]
\end{split}$$ with the number operators $F^{(b)}_n= d_{n,\alpha}^\dagger d_{n,\alpha}$ for $b=1,\ldots ,4$, and $F_n^{(b)} = b^\dagger_{n,\alpha} b_{n,\alpha}$ for $b=5,\ldots,8$. The level-matching condition, including also the bosonic part, is $$\label{levelmbf} \sum_{n\in {\mathbb{Z}}}n \left[\sum_{i=1}^4
\hat{N}^i_n+\sum_{a=1}^2 \left(M_n^a + N_n^a\right) +\sum_{b=1}^8
F^{(b)}_n\right]
= 0$$
Acknowledgments {#acknowledgments .unnumbered}
===============
GG and AM thank the Galielo Galilei Institute for Theoretical Physics for hospitality and the INFN for partial support during the completion of this work. The work of GG is supported in part by the MIUR-PRIN contract 2007-5ATT78.
Gamma matrices and spinors {#AppendixA}
==========================
We briefly review our conventions for the representations of Dirac matrices in ten dimensions and for Majorana-Weyl spinors. As usual, we shall use the mostly plus metric.
Gamma matrices {#gamma-matrices .unnumbered}
--------------
Let $I_n$ denote the $n \times n$ unit matrix, $\sigma_1,\, \sigma_2,\, \sigma_3$ the $2\times 2$ Pauli matrices $$\label{Paulimatr}
\sigma_1 = {\left( \begin{array}{cc} 0 & 1 \\ 1 & 0 \end{array} \right) }{\ \ ,\ \ \ \ }\sigma_2 = {\left( \begin{array}{cc} 0 & -i \\ i & 0 \end{array} \right) } {\ \ ,\ \ \ \ }\sigma_3 = {\left( \begin{array}{cc} 1 & 0 \\ 0 & -1 \end{array} \right) }\, ,$$ and $\epsilon$ the antisymmetric tensor of rank two $$\epsilon = i \sigma_2 ={\left( \begin{array}{cc} 0 & 1 \\ -1 & 0 \end{array} \right) } \, .$$ We can define the real $8 \times 8$ matrices $\gamma_1,...,\gamma_8$ as $$\label{gammadirac}
\begin{array}{ll}
\gamma_1 = \epsilon \times \epsilon \times \epsilon\, , \phantom{qquad} & \gamma_5 = \sigma_3 \times \epsilon \times I_2\, , \\[1mm]
\gamma_2 = I_2 \times \sigma_1 \times \epsilon \, , & \gamma_6 =\epsilon \times I_2 \times \sigma_1 \, , \\[1mm]
\gamma_3 = I_2 \times \sigma_3 \times \epsilon \, ,& \gamma_7 = \epsilon \times I_2 \times \sigma_3 \, , \\[1mm]
\gamma_4 = \sigma_1 \times \epsilon \times I_2 \, , & \gamma_8 = I_2\times I_2 \times I_2\, .
\end{array}$$ This should be read as $$\label{notgammamatr}
\gamma_7 = \epsilon \times I_2 \times \sigma_3 = {\left( \begin{array}{cc} 0 & I_2
\times \sigma_3 \\ -I_2 \times \sigma_3 & 0 \end{array} \right) } {\,, \ \ }I_2 \times \sigma_3 =
{\left( \begin{array}{cc} \sigma_3 & 0 \\ 0 & \sigma_3 \end{array} \right) }\, ,$$ and so on. It is easy to verify that the matrices $\gamma_1,...,\gamma_8$ obey the following relations $$\label{smallgamma9}
\begin{split}
&\gamma_i \gamma_j^T + \gamma_j \gamma_i^T = \gamma_i^T \gamma_j +
\gamma_j^T \gamma_i = 2 \delta_{ij} I_8 {\ \ ,\ \ \ \ }i,j=1,...,8 \\[1mm]
& \gamma_1 \gamma_2^T \gamma_3 \gamma_4^T \gamma_5
\gamma_6^T \gamma_7 \gamma_8^T = I_8 {\ \ ,\ \ \ \ }\gamma_1^T \gamma_2
\gamma_3^T \gamma_4 \gamma_5^T \gamma_6 \gamma_7^T \gamma_8 = - I_8\, .
\end{split}$$ Now we introduce the $16 \times 16$ matrices $\hat{\gamma}_1,...,\hat{\gamma}_9$ defined as $$\label{gam9}
\begin{split}
&\hat{\gamma}_i = {\left( \begin{array}{cc} 0 & \gamma_i \\ \gamma_i^T & 0 \end{array} \right) }\, , \qquad
i,j=1,...,8 \\[1mm]
&\hat{\gamma}_{9} = \sigma_3 \times I_8 =
{\left( \begin{array}{cc} I_8 & 0 \\ 0 & -I_8 \end{array} \right) }\, .
\end{split}$$ The matrices $\hat{\gamma}_1,...,\hat{\gamma}_9$ are symmetric and real, and they obey $$\begin{split}
\{ \hat{\gamma}_i, \hat{\gamma}_j \} &= 2 \delta_{ij} I_{16} \, , \qquad
i,j=1,...,9 \\[1mm]
&\hat{\gamma}_9 = \hat{\gamma}_1 \hat{\gamma}_2 \cdots \hat{\gamma}_8 \, .
\end{split}$$ At this point we are ready to define the Dirac matrices in ten dimensions, which are the following $32 \times 32$ matrices: $$\begin{split}
\Gamma_0 &= - \epsilon \times I_{16} = {\left( \begin{array}{cc} 0 & -I_{16} \\ I_{16} & 0 \end{array} \right) } \, , \\
\Gamma_i &= \sigma_1 \times \hat{\gamma} =
{\left( \begin{array}{cc} 0 & \hat{\gamma}_i \\ \hat{\gamma}_i & 0 \end{array} \right) } \, , \quad i=1,...,9 \\
\Gamma_{11} &= \sigma_3 \times I_{16} =
{\left( \begin{array}{cc} I_{16} & 0 \\ 0 & -I_{16} \end{array} \right) }\, .
\end{split}$$ We see that these matrices are real and satisfy the relations $$\label{gam11}
\begin{split}
\{ \Gamma_a,\Gamma_b \} = 2 \eta_{ab} I_{32} \, ,& \quad
a,b=0,1,...,9,11 \\[1mm]
\Gamma_{11} = \Gamma^0 & \Gamma^1 \cdots \Gamma^9 \, .
\end{split}$$ It is convenient to introduce the light-cone Dirac matrices $\Gamma_\pm$, given by $$\begin{split}
\Gamma_\pm = &\Gamma_0 \pm \Gamma_9 \, , \\
\Gamma^\pm = - \frac{1}{2} \Gamma_\mp &= \frac{1}{2} ( \Gamma^0 \pm
\Gamma^9 )\, .
\end{split}$$ The raising and lowering of these indices are done according to a flat space metric with $\eta_{+-} = -2$.\
We then define $$\Gamma_{a_1 a_2 \cdots a_n} = \Gamma_{[a_1} \Gamma_{a_2} \cdots
\Gamma_{a_n]} \, ,$$ and analogously the $16 \times 16$ matrices $$\hat{\gamma}_{i_1 \cdots i_n } = \hat{\gamma}_{[i_1}
\hat{\gamma}_{i_2} \cdots \hat{\gamma}_{i_n]} \, ,$$ with $i_l = 1,...,8$. Since $\hat{\gamma}_i$ is symmetric we have that $$\hat{\gamma}_{ijkl}^T = \hat{\gamma}_{ijkl} \, ,$$ i.e. that $\hat{\gamma}_{ijkl}$ is also symmetric.
Furthermore we define the $8\times 8$ matrices $$\label{gammai1ik}
\gamma_{i_1 \cdots i_{2k} } = \gamma_{[i_1} \gamma^T_{i_2}\cdots
\gamma^T_{i_{2k}]} {\,, \ \ }\gamma_{i_1 i_2 \cdots i_{2k+1} } =
\gamma^T_{[i_1} \gamma_{i_2} \cdots \gamma^T_{i_{2k+1}]} \, .$$ with $i_l = 1,...,8$. In particular we call $\Pi$ the matrix $$\Pi \equiv \gamma_{1234} = \gamma_1 \gamma_2^T \gamma_3 \gamma_4^T \, ,$$ which has the following proprieties $$\label{piids1} \Pi^2 = I_8 {\,, \ \ }\Pi^T = \Pi {\,, \ \ }\Pi = \gamma_{5678} \, .$$ The last equation follows from . Finally it is possible to show that $\Pi$ satisfies the relations $$\label{piids2}
\Pi \gamma_{ij} = \gamma_{ij} \Pi = - \epsilon_{ijkl}
\gamma^{kl} {\,, \ \ }\Pi \gamma_{i'j'} = \gamma_{i'j'} \Pi = -
\epsilon_{i'j'k'l'} \gamma^{k'l'} \, ,$$ with $i,j=1,2,3,4$ and $i',j'=5,6,7,8$.
Spinors for type IIB {#spinors-for-type-iib .unnumbered}
--------------------
The spinors $\theta^A$ are 32-component Majorana-Weyl spinors. The Majorana condition imposes that the 32 components of $\theta^A$ are real. The Weyl condition is $$\label{weylcond}
\Gamma_{11} \theta^A = \theta^A \, ,$$ for both $A=1,2$. Note here that we choose the two spinors to have the same chirality since we are considering type IIB string theory. Using we see that the Weyl condition means that only the first 16 components of $\theta^A$ are non-zero, whereas the last 16 components are zero. We write therefore $$\label{defpsi}
\theta^A = {\left( \begin{array}{c} \psi^A \\ 0 \end{array} \right) } \, ,$$ where $\psi^A$, $A=1,2$, are two real 16 component spinors.
The light-cone gauge $\Gamma_- \theta^A = 0$ results to be equivalent to $$\hat{\gamma}_9\psi^A = \psi^A \, ,$$ which resembles a Weyl condition for the transverse directions. Indeed, using , we see that the last 8 components of $\psi^A$ are zero. Thus, we write $$\label{defS}
\psi^A = {\left( \begin{array}{c} S^A \\ 0 \end{array} \right) } \, ,$$ where $S^A$, $A=1,2$, are two real 8 component spinors.
Spinors for type IIA {#spinors-for-type-iia .unnumbered}
--------------------
For the type IIA GS string we have two Majorana-Weyl spinors $\theta^{1,2}$ with opposite chirality, $i.e.$ $\Gamma_{11} \theta^1 = \theta^1$ and $\Gamma_{11} \theta^2 = - \theta^2$. We collect these into a 32 component real spinor $\theta = \theta^1 + \theta^2$.
We can then decompose $\theta$ in terms of eigenstates of $\Gamma_{5678}$ namely $\theta=\theta_+
+\theta_-$ with $\Gamma_{5678}\theta_{\pm}=\pm\theta_{\pm}$ so that, keeping into account the representation we chose for $\Gamma_{11}$, (\[gam11\]), $\theta_{\pm}$ has the following decomposition in terms of 16-component spinors $$\theta_\pm={\left( \begin{array}{c} \vartheta^1_{\pm} \\ \vartheta^2_\pm \end{array} \right) } \, ,$$ The gauge conditions that should be imposed to fix $\kappa$-symmetry are different on $\theta_+$ and on $\theta_-$ [@Astolfi:2009qh] and read $$\label{kappacond} \Gamma_{-} \theta_- =0~~~{\,, \ \ }~~~\Gamma_{4956}\theta_+=\theta_+$$ It is thus useful to rotate the $\theta_+$ spinor so as to impose also on the rotated spinor the same gauge condition we have on $\theta_-$. This is done by defining $\widetilde\theta_+$ according to $$\label{tildetheta} \theta_+=(I-\Gamma_{0456})\widetilde\theta_+$$ Again we have the decomposition in terms of spinors of opposite chirality $$\widetilde\theta_+={\left( \begin{array}{c} \widetilde\vartheta^1_{+} \\ \widetilde\vartheta^2_+ \end{array} \right) } \, ,$$ The gauge choice on $\widetilde\theta_+$ is thus $\Gamma_{-} \widetilde\theta_+ =0$.
It is then useful to define also a rotated 16-component spinor $\hat\vartheta^2_+=\hat\gamma_4\widetilde\vartheta^2_+$ so that both $\widetilde\vartheta^{1}_+$ and $\hat\vartheta^2_+$ have the same eigenvalue +1 of $\hat\gamma_9$. This rotations make the quantization on this type IIA background very similar to that of the type IIB.
We can now define the rescaled 8-component spinors $$\label{defS2}\widetilde\vartheta^{1}_+ = \frac{1}{\sqrt{c}}{\left( \begin{array}{c} S^1_+ \\ 0 \end{array} \right) }~~{\,, \ \ }~~~\hat\vartheta^2_+
= \frac{1}{\sqrt{c}}{\left( \begin{array}{c} S^2_+ \\ 0 \end{array} \right) } \, ,$$ In the main text we used then the 8-component complex spinors $$\psi=S^1_++i S^2_+~~~{\,, \ \ }~~~\psi^*=S^1_+-i S^2_+$$ Let us now turn to $\theta_-$. Again to have the same eigenvalue +1 of $\hat\gamma_9$ for the upper and the lower 16-component spinors, we perform a rotation of $\vartheta_-^2$ with $\hat\gamma_4$ according to $\hat\vartheta_-^2=\gamma_4\vartheta_-^2$. We can now define as before the rescaled 8-component spinors $$\label{defS3}\widetilde\vartheta^{1}_- = \frac{1}{\sqrt{c}}{\left( \begin{array}{c} S^1_- \\ 0 \end{array} \right) }~~{\,, \ \ }~~~\hat\vartheta^2_-
= \frac{1}{\sqrt{c}}{\left( \begin{array}{c} S^2_- \\ 0 \end{array} \right) } \, ,$$ In the main text we then used then the 8-component complex spinors $$\chi=S^1_-+i S^2_-~~~{\,, \ \ }~~~\chi^*=S^1_--i S^2_-$$
[10]{}
J. M. Maldacena, “[The large N limit of superconformal field theories and supergravity]{},” [*Adv. Theor. Math. Phys.*]{} [**2**]{} (1998) 231–252, [[arXiv:hep-th/9711200]{}](http://arxiv.org/abs/hep-th/9711200). S. S. Gubser, I. R. Klebanov, and A. M. Polyakov, “[Gauge theory correlators from non-critical string theory]{},” [[*Phys. Lett.*]{} [ **B428**]{} (1998) 105–114](http://dx.doi.org/10.1016/S0370-2693(98)00377-3), [[arXiv:hep-th/9802109]{}](http://arxiv.org/abs/hep-th/9802109). E. Witten, “[Anti-de Sitter space and holography]{},” [*Adv. Theor. Math. Phys.*]{} [**2**]{} (1998) 253–291, [[arXiv:hep-th/9802150]{}](http://arxiv.org/abs/hep-th/9802150). D. Berenstein, J. M. Maldacena, and H. Nastase, “Strings in flat space and pp waves from [${\mathcal{N}}= 4$]{} super [Yang Mills]{},” [*JHEP*]{} [**04**]{} (2002) 013, [[hep-th/0202021]{}](http://arxiv.org/abs/hep-th/0202021). M. Blau, J. Figueroa-O’Farrill, C. Hull, and G. Papadopoulos, “A new maximally supersymmetric background of [IIB]{} superstring theory,” [*JHEP*]{} [**01**]{} (2002) 047, [[hep-th/0110242]{}](http://arxiv.org/abs/hep-th/0110242). M. Blau, J. M. Figueroa-O’Farrill, C. Hull, and G. Papadopoulos, “[Penrose limits and maximal supersymmetry]{},” [*Class. Quant. Grav.*]{} [**19**]{} (2002) L87–L95, [[arXiv:hep-th/0201081]{}](http://arxiv.org/abs/hep-th/0201081). R. R. Metsaev, “[Type IIB Green-Schwarz superstring in plane wave Ramond- Ramond background]{},” [[*Nucl. Phys.*]{} [ **B625**]{} (2002) 70–96](http://dx.doi.org/10.1016/S0550-3213(02)00003-2), [[arXiv:hep-th/0112044]{}](http://arxiv.org/abs/hep-th/0112044). R. R. Metsaev and A. A. Tseytlin, “[Exactly solvable model of superstring in plane wave Ramond-Ramond background]{},” [[*Phys. Rev.*]{} [ **D65**]{} (2002) 126004](http://dx.doi.org/10.1103/PhysRevD.65.126004), [[arXiv:hep-th/0202109]{}](http://arxiv.org/abs/hep-th/0202109). M. Bertolini, J. de Boer, T. Harmark, E. Imeroni, and N. A. Obers, “Gauge theory description of compactified pp-waves,” [*JHEP*]{} [**01**]{} (2003) 016, [[hep-th/0209201]{}](http://arxiv.org/abs/hep-th/0209201). J. Michelson, “(twisted) toroidal compactification of pp-waves,” [*Phys. Rev.*]{} [**D66**]{} (2002) 066002, [[hep-th/0203140]{}](http://arxiv.org/abs/hep-th/0203140). T. Harmark and M. Orselli, “Matching the [Hagedorn]{} temperature in [AdS/CFT]{},” [*Phys. Rev.*]{} [**D74**]{} (2006) 126009, [[hep-th/0608115]{}](http://arxiv.org/abs/hep-th/0608115). J. A. Minahan and K. Zarembo, “The [Bethe-ansatz]{} for [${\mathcal{N}}= 4$]{} super [Yang-Mills]{},” [*JHEP*]{} [**03**]{} (2003) 013, [[hep-th/0212208]{}](http://arxiv.org/abs/hep-th/0212208). N. Beisert, C. Kristjansen, and M. Staudacher, “The dilatation operator of [${\mathcal{N}}= 4$]{} super [Yang-Mills]{} theory,” [*Nucl. Phys.*]{} [**B664**]{} (2003) 131–184, [[hep-th/0303060]{}](http://arxiv.org/abs/hep-th/0303060). N. Beisert and M. Staudacher, “[The N=4 SYM Integrable Super Spin Chain]{},” [[*Nucl. Phys.*]{} [**B670**]{} (2003) 439–463](http://dx.doi.org/10.1016/j.nuclphysb.2003.08.015), [[arXiv:hep-th/0307042]{}](http://arxiv.org/abs/hep-th/0307042). F. Berruto, G. Grignani, G. W. Semenoff, and P. Sodano, “[Chiral symmetry breaking on the lattice: A study of the strongly coupled lattice Schwinger model]{},” [[*Phys. Rev.*]{} [**D57**]{} (1998) 5070–5083](http://dx.doi.org/10.1103/PhysRevD.57.5070), [[arXiv:hep-lat/9710066]{}](http://arxiv.org/abs/hep-lat/9710066). F. Berruto, G. Grignani, G. W. Semenoff, and P. Sodano, “On the correspondence between the strongly coupled 2-flavor lattice [Schwinger]{} model and the [Heisenberg]{} antiferromagnetic chain,” [*Annals Phys.*]{} [**275**]{} (1999) 254–296, [[hep-th/9901142]{}](http://arxiv.org/abs/hep-th/9901142). J. Callan, Curtis G. [*et al.*]{}, “Quantizing string theory in [${\mbox{AdS}}_5
\times S^5$]{}: Beyond the pp- wave,” [[*Nucl. Phys.*]{} [**B673**]{} (2003) 3–40](http://dx.doi.org/10.1016/j.nuclphysb.2003.09.008), [[arXiv:hep-th/0307032]{}](http://arxiv.org/abs/hep-th/0307032). J. Callan, Curtis G., T. McLoughlin, and I. Swanson, “[Holography beyond the Penrose limit]{},” [[*Nucl. Phys.*]{} [**B694**]{} (2004) 115–169](http://dx.doi.org/10.1016/j.nuclphysb.2004.06.033), [[arXiv:hep-th/0404007]{}](http://arxiv.org/abs/hep-th/0404007). M. Staudacher, “The factorized [S]{}-matrix of [CFT/AdS]{},” [*JHEP*]{} [**05**]{} (2005) 054, [[hep-th/0412188]{}](http://arxiv.org/abs/hep-th/0412188). N. Beisert, “The [$\mathfrak{su}(2|2)$]{} dynamic [S]{}-matrix,” [[hep-th/0511082]{}](http://arxiv.org/abs/hep-th/0511082). N. Beisert, B. Eden, and M. Staudacher, “[Transcendentality and crossing]{},” [*J. Stat. Mech.*]{} [**0701**]{} (2007) P021, [[hep-th/0610251]{}](http://arxiv.org/abs/hep-th/0610251). C. Kristjansen, J. Plefka, G. W. Semenoff, and M. Staudacher, “[A new double-scaling limit of N = 4 super Yang-Mills theory and PP-wave strings]{},” [[*Nucl. Phys.*]{} [ **B643**]{} (2002) 3–30](http://dx.doi.org/10.1016/S0550-3213(02)00749-6), [[arXiv:hep-th/0205033]{}](http://arxiv.org/abs/hep-th/0205033). N. R. Constable [*et al.*]{}, “[PP-wave string interactions from perturbative Yang-Mills theory]{},” [*JHEP*]{} [**07**]{} (2002) 017, [[arXiv:hep-th/0205089]{}](http://arxiv.org/abs/hep-th/0205089). M. Spradlin and A. Volovich, “[Superstring interactions in a pp-wave background]{},” [[*Phys. Rev.*]{} [**D66**]{} (2002) 086004](http://dx.doi.org/10.1103/PhysRevD.66.086004), [[arXiv:hep-th/0204146]{}](http://arxiv.org/abs/hep-th/0204146). G. De Risi, G. Grignani, M. Orselli, and G. W. Semenoff, “[DLCQ]{} string spectrum from [${\mathcal{N}}= 2$]{} [SYM]{} theory,” [[*JHEP*]{} [**11**]{} (2004) 053](http://dx.doi.org/10.1088/1126-6708/2004/11/053), [[arXiv:hep-th/0409315]{}](http://arxiv.org/abs/hep-th/0409315). G. Grignani, M. Orselli, B. Ramadanovic, G. W. Semenoff, and D. Young, “[Divergence cancellation and loop corrections in string field theory on a plane wave background]{},” [*JHEP*]{} [**12**]{} (2005) 017, [[arXiv:hep-th/0508126]{}](http://arxiv.org/abs/hep-th/0508126). G. Grignani, M. Orselli, B. Ramadanovic, G. W. Semenoff, and D. Young, “[AdS/CFT vs. string loops]{},” [[*JHEP*]{} [**06**]{} (2006) 040](http://dx.doi.org/10.1088/1126-6708/2006/06/040), [[arXiv:hep-th/0605080]{}](http://arxiv.org/abs/hep-th/0605080). P. Y. Casteill, R. A. Janik, A. Jarosz, and C. Kristjansen, “[Quasilocality of joining/splitting strings from coherent states]{},” [[*JHEP*]{} [**12**]{} (2007) 069](http://dx.doi.org/10.1088/1126-6708/2007/12/069), [[arXiv:0710.4166 \[hep-th\]]{}](http://arxiv.org/abs/0710.4166). C. Kristjansen, M. Orselli, and K. Zoubos, “[Non-planar ABJM Theory and Integrability]{},” [[ *JHEP*]{} [**03**]{} (2009) 037](http://dx.doi.org/10.1088/1126-6708/2009/03/037), [[arXiv:0811.2150 \[hep-th\]]{}](http://arxiv.org/abs/0811.2150). O. Aharony, O. Bergman, D. L. Jafferis, and J. Maldacena, “[${\mathcal{N}}=6$]{} superconformal [Chern-Simons-matter]{} theories, [M2-branes]{} and their gravity duals,” [[arXiv:0806.1218 \[hep-th\]]{}](http://arxiv.org/abs/0806.1218). T. Nishioka and T. Takayanagi, “[On Type IIA Penrose Limit and N=6 Chern-Simons Theories]{},” [[arXiv:0806.3391 \[hep-th\]]{}](http://arxiv.org/abs/0806.3391). D. Gaiotto, S. Giombi, and X. Yin, “[Spin Chains in N=6 Superconformal Chern-Simons-Matter Theory]{},” [[*JHEP*]{} [**04**]{} (2009) 066](http://dx.doi.org/10.1088/1126-6708/2009/04/066), [[arXiv:0806.4589 \[hep-th\]]{}](http://arxiv.org/abs/0806.4589). G. Grignani, T. Harmark, and M. Orselli, “[The SU(2) x SU(2) sector in the string dual of N=6 superconformal Chern-Simons theory]{},” [[*Nucl. Phys.*]{} [**B810**]{} (2009) 115–134](http://dx.doi.org/10.1016/j.nuclphysb.2008.10.019), [[arXiv:0806.4959 \[hep-th\]]{}](http://arxiv.org/abs/0806.4959). D. Astolfi, V. G. M. Puletti, G. Grignani, T. Harmark, and M. Orselli, “[Finite-size corrections in the SU(2) $\times$ SU(2) sector of type IIA string theory on [${\mbox{AdS}}_4 \times {\mathbb{C}}P^3$]{}]{},” [[*Nucl. Phys.*]{} [**B810**]{} (2009) 150–173](http://dx.doi.org/10.1016/j.nuclphysb.2008.10.020), [[arXiv:0807.1527 \[hep-th\]]{}](http://arxiv.org/abs/0807.1527). D. Astolfi, V. G. M. Puletti, G. Grignani, T. Harmark, and M. Orselli, “[Full Lagrangian and Hamiltonian for quantum strings on [${\mbox{AdS}}_4 \times {\mathbb{C}}P^3$]{} in a near plane wave limit]{},” [[arXiv:0912.2257 \[hep-th\]]{}](http://arxiv.org/abs/0912.2257). T. Harmark and M. Orselli, “Quantum mechanical sectors in thermal [${\mathcal{N}}= 4$]{} super [Yang-Mills]{} on [${\mathbb{R}}\times S^3$]{},” [*Nucl. Phys.*]{} [**B757**]{} (2006) 117–145, [[hep-th/0605234]{}](http://arxiv.org/abs/hep-th/0605234). T. Harmark, K. R. Kristjansson, and M. Orselli, “Magnetic [Heisenberg-chain]{} / pp-wave correspondence,” [*JHEP*]{} [**02**]{} (2007) 085, [[hep-th/0611242]{}](http://arxiv.org/abs/hep-th/0611242). T. Harmark, K. R. Kristjansson, and M. Orselli, “[The [Hagedorn]{} temperature in a decoupled sector of [AdS/CFT]{}]{},” [*Fortsch. Phys.*]{} [**55**]{} (2007) 754–759, [[hep-th/0701088]{}](http://arxiv.org/abs/hep-th/0701088). T. Harmark, K. R. Kristjansson, and M. Orselli, “Decoupling limits of [${\mathcal{N}}=4$]{} super [Yang-Mills]{} on [${\mathbb{R}}\times S^3$]{},” [[*JHEP*]{} [**09**]{} (2007) 115](http://dx.doi.org/10.1088/1126-6708/2007/09/115), [[arXiv:0707.1621 \[hep-th\]]{}](http://arxiv.org/abs/0707.1621). T. Harmark, K. R. Kristjansson, and M. Orselli, “[Matching gauge theory and string theory in a decoupling limit of AdS/CFT]{},” [[arXiv:0806.3370 \[hep-th\]]{}](http://arxiv.org/abs/0806.3370). D. Astolfi, G. Grignani, T. Harmark, and M. Orselli, “[Finite-size corrections to the rotating string and the winding state]{},” [[*JHEP*]{} [**08**]{} (2008) 099](http://dx.doi.org/10.1088/1126-6708/2008/08/099), [[arXiv:0804.3301 \[hep-th\]]{}](http://arxiv.org/abs/0804.3301). E. Witten, “[Anti-de Sitter space, thermal phase transition, and confinement in gauge theories]{},” [*Adv. Theor. Math. Phys.*]{} [**2**]{} (1998) 505–532, [[arXiv:hep-th/9803131]{}](http://arxiv.org/abs/hep-th/9803131). B. Sundborg, “The [Hagedorn]{} transition, deconfinement and [${\mathcal{N}}= 4$ SYM]{} theory,” [*Nucl. Phys.*]{} [**B573**]{} (2000) 349–363, [[hep-th/9908001]{}](http://arxiv.org/abs/hep-th/9908001). A. M. Polyakov, “Gauge fields and space-time,” [*Int. J. Mod. Phys.*]{} [ **A17S1**]{} (2002) 119–136, [[hep-th/0110196]{}](http://arxiv.org/abs/hep-th/0110196). O. Aharony, J. Marsano, S. Minwalla, K. Papadodimas, and M. Van Raamsdonk, “[The Hagedorn / deconfinement phase transition in weakly coupled large N gauge theories]{},” [*Adv. Theor. Math. Phys.*]{} [**8**]{} (2004) 603–696, [[arXiv:hep-th/0310285]{}](http://arxiv.org/abs/hep-th/0310285). N. Deo, S. Jain, and C.-I. Tan, “String statistical mechanics above [Hagedorn]{} energy density,” [*Phys. Rev.*]{} [**D40**]{} (1989) 2626. R. C. Brower, J. McGreevy, and C. I. Tan, “[Stringy model for QCD at finite density and generalized Hagedorn temperature]{},” [[arXiv:hep-ph/9907258]{}](http://arxiv.org/abs/hep-ph/9907258). G. Grignani, M. Orselli, and G. W. Semenoff, “[Matrix strings in a B-field]{},” [*JHEP*]{} [**07**]{} (2001) 004, [[arXiv:hep-th/0104112]{}](http://arxiv.org/abs/hep-th/0104112). G. Grignani, M. Orselli, and G. W. Semenoff, “[The target space dependence of the Hagedorn temperature]{},” [*JHEP*]{} [**11**]{} (2001) 058, [[arXiv:hep-th/0110152]{}](http://arxiv.org/abs/hep-th/0110152). G. De Risi, G. Grignani, and M. Orselli, “[Space / time noncommutativity in string theories without background electric field]{},” [*JHEP*]{} [**12**]{} (2002) 031, [[arXiv:hep-th/0211056]{}](http://arxiv.org/abs/hep-th/0211056). G. Grignani, J. L. Karczmarek, and G. W. Semenoff, “[Hot Giant Loop Holography]{},” [[arXiv:0904.3750 \[hep-th\]]{}](http://arxiv.org/abs/0904.3750). T. Harmark and N. A. Obers, “[Thermodynamics of spinning branes and their dual field theories]{},” [*JHEP*]{} [**01**]{} (2000) 008, [[arXiv:hep-th/9910036]{}](http://arxiv.org/abs/hep-th/9910036). G. Grignani, L. Griguolo, N. Mori, and D. Seminara, “Thermodynamics of theories with sixteen supercharges in non-trivial vacua,” [[arXiv:0707.0052 \[hep-th\]]{}](http://arxiv.org/abs/arXiv:0707.0052 [hep-th]). K. J. Larsen and N. A. Obers, “[Phases of Thermal [${\mathcal{N}}=2$]{} [Quiver Gauge Theories]{}]{},” [ [ **JHEP0801**]{} (2008) 057](http://dx.doi.org/10.1088/1126-6708/2008/01/057), [[arXiv:0708.3199 \[hep-th\]]{}](http://arxiv.org/abs/0708.3199). A. Hamilton, J. Murugan, and A. Prinsloo, “[A note on the universality of the Hagedorn behavior of pp- wave strings]{},” [[*JHEP*]{} [**02**]{} (2008) 108](http://dx.doi.org/10.1088/1126-6708/2008/02/108), [[arXiv:0712.3059 \[hep-th\]]{}](http://arxiv.org/abs/0712.3059). M. Blau, J. M. Figueroa-O’Farrill, and G. Papadopoulos, “[Penrose limits, supergravity and brane dynamics]{},” [[*Class. Quant. Grav.*]{} [**19**]{} (2002) 4753](http://dx.doi.org/10.1088/0264-9381/19/18/310), [[arXiv:hep-th/0202111]{}](http://arxiv.org/abs/hep-th/0202111).
[^1]: Early attempts in describing gauge theories in terms of spin chains can be found in [@Berruto:1997jv; @Berruto:1999ga].
[^2]: See also [@Astolfi:2008yw] for work on the winding state with the space-like isometry compactified.
[^3]: For related computations of the Hagedorn temperature in the presence of background fields see for example Refs. [@Deo:1989bv].
[^4]: See also [@Harmark:1999xt] for a related study of black holes with R-charged chemical potentials.
[^5]: The $4\pi^2$ factor is included in the ’t Hooft coupling for our convenience.
[^6]: See Appendix \[AppendixA\] for our conventions on the spinors and the representation of the Dirac matrices.
|
{
"pile_set_name": "ArXiv"
}
|
#!/usr/bin/env bash
##############################################################################
##
## Gradle start up script for UN*X
##
##############################################################################
# Add default JVM options here. You can also use JAVA_OPTS and GRADLE_OPTS to pass JVM options to this script.
DEFAULT_JVM_OPTS=""
APP_NAME="Gradle"
APP_BASE_NAME=`basename "$0"`
# Use the maximum available, or set MAX_FD != -1 to use that value.
MAX_FD="maximum"
warn ( ) {
echo "$*"
}
die ( ) {
echo
echo "$*"
echo
exit 1
}
# OS specific support (must be 'true' or 'false').
cygwin=false
msys=false
darwin=false
case "`uname`" in
CYGWIN* )
cygwin=true
;;
Darwin* )
darwin=true
;;
MINGW* )
msys=true
;;
esac
# For Cygwin, ensure paths are in UNIX format before anything is touched.
if $cygwin ; then
[ -n "$JAVA_HOME" ] && JAVA_HOME=`cygpath --unix "$JAVA_HOME"`
fi
# Attempt to set APP_HOME
# Resolve links: $0 may be a link
PRG="$0"
# Need this for relative symlinks.
while [ -h "$PRG" ] ; do
ls=`ls -ld "$PRG"`
link=`expr "$ls" : '.*-> \(.*\)$'`
if expr "$link" : '/.*' > /dev/null; then
PRG="$link"
else
PRG=`dirname "$PRG"`"/$link"
fi
done
SAVED="`pwd`"
cd "`dirname \"$PRG\"`/" >&-
APP_HOME="`pwd -P`"
cd "$SAVED" >&-
CLASSPATH=$APP_HOME/gradle/wrapper/gradle-wrapper.jar
# Determine the Java command to use to start the JVM.
if [ -n "$JAVA_HOME" ] ; then
if [ -x "$JAVA_HOME/jre/sh/java" ] ; then
# IBM's JDK on AIX uses strange locations for the executables
JAVACMD="$JAVA_HOME/jre/sh/java"
else
JAVACMD="$JAVA_HOME/bin/java"
fi
if [ ! -x "$JAVACMD" ] ; then
die "ERROR: JAVA_HOME is set to an invalid directory: $JAVA_HOME
Please set the JAVA_HOME variable in your environment to match the
location of your Java installation."
fi
else
JAVACMD="java"
which java >/dev/null 2>&1 || die "ERROR: JAVA_HOME is not set and no 'java' command could be found in your PATH.
Please set the JAVA_HOME variable in your environment to match the
location of your Java installation."
fi
# Increase the maximum file descriptors if we can.
if [ "$cygwin" = "false" -a "$darwin" = "false" ] ; then
MAX_FD_LIMIT=`ulimit -H -n`
if [ $? -eq 0 ] ; then
if [ "$MAX_FD" = "maximum" -o "$MAX_FD" = "max" ] ; then
MAX_FD="$MAX_FD_LIMIT"
fi
ulimit -n $MAX_FD
if [ $? -ne 0 ] ; then
warn "Could not set maximum file descriptor limit: $MAX_FD"
fi
else
warn "Could not query maximum file descriptor limit: $MAX_FD_LIMIT"
fi
fi
# For Darwin, add options to specify how the application appears in the dock
if $darwin; then
GRADLE_OPTS="$GRADLE_OPTS \"-Xdock:name=$APP_NAME\" \"-Xdock:icon=$APP_HOME/media/gradle.icns\""
fi
# For Cygwin, switch paths to Windows format before running java
if $cygwin ; then
APP_HOME=`cygpath --path --mixed "$APP_HOME"`
CLASSPATH=`cygpath --path --mixed "$CLASSPATH"`
# We build the pattern for arguments to be converted via cygpath
ROOTDIRSRAW=`find -L / -maxdepth 1 -mindepth 1 -type d 2>/dev/null`
SEP=""
for dir in $ROOTDIRSRAW ; do
ROOTDIRS="$ROOTDIRS$SEP$dir"
SEP="|"
done
OURCYGPATTERN="(^($ROOTDIRS))"
# Add a user-defined pattern to the cygpath arguments
if [ "$GRADLE_CYGPATTERN" != "" ] ; then
OURCYGPATTERN="$OURCYGPATTERN|($GRADLE_CYGPATTERN)"
fi
# Now convert the arguments - kludge to limit ourselves to /bin/sh
i=0
for arg in "$@" ; do
CHECK=`echo "$arg"|egrep -c "$OURCYGPATTERN" -`
CHECK2=`echo "$arg"|egrep -c "^-"` ### Determine if an option
if [ $CHECK -ne 0 ] && [ $CHECK2 -eq 0 ] ; then ### Added a condition
eval `echo args$i`=`cygpath --path --ignore --mixed "$arg"`
else
eval `echo args$i`="\"$arg\""
fi
i=$((i+1))
done
case $i in
(0) set -- ;;
(1) set -- "$args0" ;;
(2) set -- "$args0" "$args1" ;;
(3) set -- "$args0" "$args1" "$args2" ;;
(4) set -- "$args0" "$args1" "$args2" "$args3" ;;
(5) set -- "$args0" "$args1" "$args2" "$args3" "$args4" ;;
(6) set -- "$args0" "$args1" "$args2" "$args3" "$args4" "$args5" ;;
(7) set -- "$args0" "$args1" "$args2" "$args3" "$args4" "$args5" "$args6" ;;
(8) set -- "$args0" "$args1" "$args2" "$args3" "$args4" "$args5" "$args6" "$args7" ;;
(9) set -- "$args0" "$args1" "$args2" "$args3" "$args4" "$args5" "$args6" "$args7" "$args8" ;;
esac
fi
# Split up the JVM_OPTS And GRADLE_OPTS values into an array, following the shell quoting and substitution rules
function splitJvmOpts() {
JVM_OPTS=("$@")
}
eval splitJvmOpts $DEFAULT_JVM_OPTS $JAVA_OPTS $GRADLE_OPTS
JVM_OPTS[${#JVM_OPTS[*]}]="-Dorg.gradle.appname=$APP_BASE_NAME"
exec "$JAVACMD" "${JVM_OPTS[@]}" -classpath "$CLASSPATH" org.gradle.wrapper.GradleWrapperMain "$@"
|
{
"pile_set_name": "Github"
}
|
US Senate honours Ada Lovelace
US Senator Ron Wyden has introduced a resolution honouring Ada Lovelace and recognising Ada Lovelace Day to the Senate, the upper chamber of the United States Congress. The senator, who represents Oregon, submitted S.Res.592 – A resolution designating October 9, 2018, as “National Ada Lovelace Day” and honoring the life and legacy of Ada Lovelace, the first computer programmer.
The statement is a Simple Resolution, which is “used to express nonbinding positions of the Senate”. These resolutions often “express public gratitude for distinguished contributions; dramatize the virtues of individuals, groups, and causes; and perpetuate the remembrance of significant events” says a congressional report. “During the past two centuries, commemoratives have become an integral part of the American political tradition,” the report says.
We are delighted that Ada Lovelace’s achievements have been recognised in this way, and that the Senate chose to support our mission of raising the profile of women in STEM by giving Ada Lovelace Day itself official status in the US.
Designating October 9, 2018, as ‘‘National Ada Lovelace Day’’ and honoring the life and legacy of Ada Lovelace, the first computer programmer.
IN THE SENATE OF THE UNITED STATES
Mr. WYDEN (for himself and Mrs. FISCHER) submitted the following resolution; which was referred to the Committee on [25 July 2018]
RESOLUTION
Designating October 9, 2018, as ‘‘National Ada Lovelace Day’’ and honoring the life and legacy of Ada Lovelace, the first computer programmer.
Whereas Augusta Ada King-Noel, Countess of Lovelace, now known as Ada Lovelace, was born on December 10, 1815, in London, United Kingdom;
Whereas, from a young age, Lovelace displayed a gift for mathematics, languages, and the sciences;
Whereas, at the age of 17, Lovelace began to study mathematics under the guidance of scientist and translator Mary Somerville and, later, logician Augustus de Morgan;
Whereas, in 1833, Lovelace was introduced to inventor and mechanical engineer, Charles Babbage, and began to study his designs for the Analytical Engine, a mechanical computer;
Whereas Lovelace was the first person to recognize that the Analytical Engine could be used to manipulate symbols and letters and was the first person to theorize that the Analytical Engine could be used to create music and graphics;
Whereas, in 1843, Lovelace published step-by-step instructions for using the Analytical Engine to calculate Bernoulli numbers ‘‘without having been worked out by human head and hands first’’;
Whereas these insights gave Lovelace an unparalleled vision of the future of computer science, and she stated that ‘‘[a] new, a vast and a powerful language is [being] developed for the future use of analysis, in which to wield its truths so that these may become of more speedy and accurate practical application for the purposes of mankind’’;
Whereas the work of Lovelace went widely unrecognized until the 1950s, when her papers were republished, and their significance and her contributions to the fields of computer science and mathematics were finally acknowledged;
Whereas, in the 1980s, to honor the contributions of Lovelace, the Department of Defense named its newly created computer language ‘‘Ada’’ after Lovelace;
Whereas the second Tuesday in October is annually celebrated as Ada Lovelace Day and is intended to honor women in science, technology, engineering, and mathematics and their accomplishments and contributions to academia and the world; and
Whereas Ada Lovelace died on November 27, 1852, leaving behind a legacy of poetic science and reasoning, in which the arts and sciences are woven together to find new insights:
Now, therefore, be it
1 Resolved, That the Senate—
2 (1) designates October 9, 2018, as ‘‘National
3 Ada Lovelace Day’’; and
4 (2) honors the life and contributions of Ada
5 Lovelace, a leading woman in science and mathematics and the first computer programmer.
Senator Wyden tweeted:
Yesterday, the Senate passed two resolutions I introduced with @SenatorFischer honoring the lives of Grace Hopper and Ada Lovelace, two pioneers who paved the way for the information age. https://t.co/7kOsr1gtSB
This week, the U.S. passed a resolution for a “National Ada Lovelace Day”. Keep reading to find out more about the life and work of the British woman who became the world’s first computer programmer. pic.twitter.com/TyR9FmAKHk
Born in 1815, when she was only 12 years old, Ada Lovelace conceptualized a flying machine that she described as “a thing in the form of a horse with a steam engine in the inside so contrived as to move an immense pair of wings.” pic.twitter.com/7iWu0bNNM0
Lovelace left an incredible legacy as both an ingenious analytical thinker & a pioneer of computer science innovation. She has been honoured with numerous awards bearing her name, a programming language named after her & now an 🇺🇸 day of honor. Ada Lovelace’s legacy lives on. pic.twitter.com/aQI4jjLA8q
ALD 2009's Pledge
"I will publish a blog post on Tuesday 24th March about a woman in technology whom I admire but only if 1,000 other people will do the same."
— Suw Charman-Anderson
Tuesday 8 October 2019 is Ada Lovelace Day, an international day celebrating the achievements of women in science, technology, engineering and maths.
With thanks to our partners
Ada Lovelace Day is dependent on the generosity of its partners, volunteers and supporters for survival. If you would like to sponsor Ada Lovelace Day, please get in touch. We would like to thank the following organisations for their support of Ada Lovelace Day and women in STEM.
|
{
"pile_set_name": "Pile-CC"
}
|
Saturday, August 27, 2011
This is a character that exists with in the world of Thaddeus Stormfist, he is a cousin to Thaddeus by super natural means. Anyway this is an illustration of him that I've been working on, I've started coloring it and am leaning to a more monochromatic color scheme.
|
{
"pile_set_name": "Pile-CC"
}
|
Air Vietnam
Active from 1951 to 1975, Air Viet Nam (Air VN) () was South Vietnam's first commercial air carrier, headquartered in District 1, Saigon. Established under Emperor Bảo Đại, the airline flew over one million passengers, including during the Vietnam War, before its collapse due to Fall of Saigon.
History
Air Viet Nam's initial fleet consisted of five Cessna 170s, with the airline flying mainly between small towns throughout Vietnam. By 1975, Air Viet Nam started using Douglas DC-3s and Boeing 727s on both regional and international routes.
As passenger traffic increased with the start of the Vietnam War, Air Viet Nam added aircraft, initially Viscounts, DC-3s, and DC-4s. It eventually obtained more modern aircraft, including Boeing 727s, some of which were obtained from Air France and Pan Am. At least one C-46 was leased from China Airlines, and was flown by a Taiwanese crew. That aircraft had a color scheme different from the rest of the Air Viet Nam fleet.
In an unusual joint venture, Air Viet Nam was joined by Continental Air Services (CASI), a subsidiary airline of Continental Airlines set up to provide operations and airlift support in Southeast Asia, in the mid-1960s. Under this agreement, CASI would share passengers and cargo routes with Air Viet Nam on certain domestic and international routes. In addition, CASI and Air Viet Nam would share hangars and flight lines. CASI also picked up a portion of aircraft maintenance. Heavy engine overhaul was done in Hong Kong, by China Airlines, and some in Taiwan, by Air Asia (a subsidiary of Air America). CASI paid a portion of its revenues to Air Viet Nam for the routes and privileges. Many CASI aircraft operating from Saigon carried the dragon/flag roundel of Air Viet Nam.
In 1974, Air Vietnam had 1 B747-200 leased from Air France
Fall of Saigon
During the Fall of Saigon and the impending invasion of North Vietnam into South Vietnam, Air Viet Nam decided to assist and help all South Vietnamese citizens to escape to neighboring countries. Many of their pilots and crew worked long hours ferrying South Vietnamese citizens to Thailand, Taiwan, the Philippines, and other Southeast Asian countries to escape the invading North Vietnamese army.
One Air Vietnam Boeing 727 was returned to Vietnam from Hong Kong in early June 1975, by lead pilot Huynh Minh Boong, who had married General Pham Hung's sister. Captain Huynh Minh Boong with over 10,000 flight hours, was a pilot on Vietnam Airlines overseas flights due to his IATA credentials, then in early 1980 he was appointed as head of training of Vietnam Airlines, now retired and lives in Ho Chi Minh City.
The only commercial jet airplanes transferred from Air Vietnam to Vietnam Airlines are: one (1) Boeing 707 and one (1) Boeing 727-100.
Destinations
According to a timetable published in 1969 Air Vietnam served these cities:
Asia
East Asia
(Fukien and Formosa area)
Taipei – Taipei Songshan Airport
Osaka – Osaka International Airport
Tokyo – Tokyo International Airport
Hong Kong – Kai Tak Airport
Southeast Asia
Cambodia
Phnom Penh – Phnom Penh International Airport
Siem Reap - Siem Reap International Airport
Laos
Vientiane – Wattay International Airport
Kuala Lumpur – Subang International Airport
Philippines
Manila – Manila International Airport
Singapore – Singapore International Airport
South Vietnam
Saigon – Tan Son Nhut International Airport (Hub)
Da Nang - Da Nang International Airport
Bangkok – Don Mueang International Airport
Europe
Paris – Orly Airport
Oceania
Sydney - Sydney Airport
Codeshare partners
According to the timetable published in 1962, Air Vietnam codeshared with the following airlines:
Japan Airlines
Cathay Pacific
Pan American World Airways
Air France
British Overseas Airways Corporation
Flight crew
Air Viet Nam flight crews were composed of civilians with a mixture of ex-military pilots, (mostly former Republic of Vietnam Air Force), along with a few Americans. However, one American CASI pilot reported that the Taiwanese crew of the leased C-46 always parked its aircraft separately at Tân Sơn Nhất International Airport in Saigon and kept its distance from the regular Air Viet Nam and CASI crews.
Uniforms
Pilots for Air Viet Nam wore a distinctive gold/bronze wing with a center shield containing a colored enamel version of the dragon/flag. It can be presumed that some senior grades of pilot and crew existed, although how these were indicated is not clear.
Stewardesses, or flight attendants, wore a gold or bronze metal wing with embossed/relief dragon/flag roundel. Uniforms consisted of the traditional Áo dàis in a variety of colors.
Aircraft livery
Air Vietnam aircraft generally had a single or dual green stripe down the main fuselage. The top fuselage was generally white with a natural metal (silver) lower. The colorful dragon/flag roundel appeared in various sizes, most often on the tail rudder. Sometimes the roundel would appear alone and occasionally with a dual green stripe. The wording "Air Viet Nam" appeared in red/orange lettering above the windows on all large aircraft except the 727s, which were marked "Hang Không Viet Nam". Exceptions to these schemes included the early Viscount aircraft, which were all white with a green stripe and had the roundel appearing on the front fuselage. The Chinese C-46 aircraft had a blue and red nose-side stripe with the roundel appearing on the rudder.
Marketing
Advertisements used from the mid-1960s included South Vietnamese Olympians, such as Thach Thi Ngoc, and flamboyant military officer Nguyễn Cao Kỳ, whose wife Madame Nguyễn Cao Kỳ was a flight stewardess before they were married. These celebrities promoted the airline's operation of Viscounts on the "Green Dragon Route", alternating flights from Saigon to Siem Reap, Cambodia; Bangkok, Thailand; and Hong Kong. Timetables indicate domestic routes covering destinations as far north as Huế, as far south as Cà Mau, and including almost every major city in between.
Incidents and accidents
16 August 1954 Bristol Freighter 21E F-VNAI crashed into the Mekong River while on approach to Pakse for an emergency landing due to engine problems, killing 47 of 55 on board. The aircraft was operating a flight from Hanoi to Tan Son Nhut International Airport.
10 November 1962 Douglas C-47B XV-NID crashed into a mountain northwest of Da Nang Airport due to a navigation error in bad weather, killing all 27 on board. The aircraft was operating on a flight route from Phu Bai Airport to Da Nang Airport.
1962 Douglas C-54B XV-NUA was reportedly written off at an unknown location.
16 September 1965 Douglas C-47A XV-NIC was shot down by Communist ground fire shortly after takeoff and crashed northeast of Quảng Ngãi, killing all 39 on board; one passenger survived, but died a few hours later.
2 April 1969 Douglas DC-6B XV-NUC was destroyed on the ground at Hue-Citadel Airfield during a Communist attack.
1 May 1969 Douglas C-54B F-BELL burned out on the ground while parked at Saigon Airport.
20 September 1969 Douglas C-54D XV-NUG collided with US Air Force McDonnell Douglas F-4 Phantom II 67-0393 and crashed into a field near Da Nang, killing 74 of 75 on board and two people working in the field; the Phantom was able to land safely. The C-54 was operating on a flight route from Saigon to Pleiku Airport to Da Nang Airport. When the pilot of the Phantom was cleared to land on Runway 17R by ATC, the pilot of the C-54, cleared to land on Runway 17L, thought that the message was addressed to his aircraft and turned right for approach to Runway 17R. This brought the C-54 in the path of the Phantom and the two aircraft collided.
22 December 1969 Douglas DC-6B B-2005 suffered an explosion and hydraulic failure while descending for Nha Trang Airport. After a low level pass to check the landing gear, a nose-high flapless approach was made. The aircraft touched down, but became airborne again after application of reverse thrust. The throttles were closed and the aircraft landed again, but overran the runway, struck a concrete pylon and caught fire, killing 10 of 77 on board and 24 on the ground. A bomb placed in the front left lavatory detonated during approach.
22 July 1970 A U.S. Army private, George M. Hardin, hijacked a DC-4 en route from Pleiku to Saigon. Hardin allowed the 65 passengers aboard to disembark from the plane before moving to the cockpit and threatening the pilot with a small knife. He was detained in Saigon after attempting to force the pilot, Floyd R. Derieux, to take him to Hong Kong, but the pilot told him the DC-4 could not carry enough fuel to make the trip. There were no fatalities.
30 September 1970 Douglas DC-3DST-318A B-305 crashed into a hill in the Hai Van Mountains at near Da Nang while attempting to divert to Da Nang Airport due to weather conditions at its intended destination of Phu Bai Airport, Huế. Three of the 38 people on board were killed.
1 November 1970 Curtiss C-46 B-1543 force-landed on a beach at Quy Nhơn due to fuel system problems; the aircraft sank in sand and flooded out at high tide. The aircraft was operating on a flight from Saigon to Quang Ngai.
22 August 1971 Douglas DC-3A-375 B-304 was written off at Kampot Airport.
24 September 1972 Douglas C-54D XV-NUH crashed into a marshy area 23 miles from Saigon, killing 10 of 13 on board. The aircraft was operating a flight from Vientiane Airport to Tan Son Nhat International Airport.
19 March 1973 Douglas C-54D XV-NUI crashed 4.1 mi S of Buon Ma Thuot Airport after an explosion in the cargo hold near the wing spar, killing all 58 on board. The aircraft was operating a flight from Tan Son Nhat International Airport to Buon Ma Thuot Airport.
5 September 1973 Boeing 727-121C XV-NJC suffered an explosion in the galley at 15 minutes after takeoff from Bangkok, injuring two passengers and a stewardess; the aircraft was able to return and land safely at Bangkok. Although it was thought that a bomb exploded, a Royal Thai Air Force investigation concluded that a defective broiler in the galley caused the explosion. Although the aircraft was repaired and returned to service, it was written off following the hijacking and crash of Flight 706 in 1974.
17 November 1973 Douglas C-47B XV-NIE struck a mountain at NNW of Quảng Ngãi killing all 27 people on board. The crew had gotten lost and flew too low in a mountainous area while attempting to reach Chu Lai, near the crash site. The aircraft was operating a domestic scheduled passenger flight from Tan Son Nhat International Airport to Quảng Ngãi Airport.
20 February 1974 Douglas C-54A XV-NUM was hijacked en route from Quy Nhơn to Da Nang. The hijacker was a 19-year-old South Vietnamese man demanding to go to Dong Hoi, North Vietnam. When the aircraft landed at Huế, the hijacker realized he had been tricked and detonated a grenade, killing himself and two police officers. The explosion also blew a 2 x 3 m hole in the port side of the fuselage and broke three starboard side windows. The aircraft was written off.
15 September 1974 Flight 706 - Le Duc Tan, a ranger in the South Vietnamese army who had recently been demoted from captain to lieutenant for the theft of two cars in Da Nang, smooth-talked his way past security checkpoints and hijacked the Boeing 727 en route from Da Nang to Saigon, demanding to go to Hanoi. He detonated two hand grenades, and the aircraft crashed at Phan Rang when it overshot the runway on an attempted landing. All 75 persons on board, including 67 passengers and eight crew members, were killed.
12 March 1975 Douglas C-54D XV-NUJ crashed 16 mi from Pleiku, killing all 26 on board; the wreckage was not examined due to hostile conditions in the area. The aircraft, operating a flight from Vientiane to Saigon, was probably shot down by a missile.
See also
Royal Air Cambodge
Royal Air Lao
References
External links
Timetables of Air Vietnam
Photos of Air Vietnam
Photos of Air Vietnam
Photos of Air Vietnam planes
Category:Defunct airlines of Vietnam
Category:Defunct airlines of South Vietnam
Category:Airlines established in 1951
Category:Airlines disestablished in 1975
Category:1951 establishments in French Indochina
Category:1951 establishments in South Vietnam
Category:1975 disestablishments in Vietnam
Category:1950s in French Indochina
Category:1950s in South Vietnam
Category:1960s in South Vietnam
Category:1970s in South Vietnam
Category:Former IATA members
|
{
"pile_set_name": "Wikipedia (en)"
}
|
In vivo regulation of granulocyte production in acute inflammation.
In order to study in vivo the enhanced granulopoiesis that occurs during acute inflammation, 1-3 sterile metallic copper rods were inserted subcutaneously into mice either at the same place (one abscess) or at different sites (multiple abscesses). Diffusion chambers filled with bone marrow cells were implanted intraperitoneally for 3 days. When a single abscess was created, the granulocytic content of the diffusion chamber increased similarly whatever the number of inserted copper rods. However, there was a direct relationship between the number of abscesses and the number of granulocytic cells harvested from the diffusion chambers. In order to investigate the role of T-lymphocytes in the production of diffusible stimulating factors that act on diffusion chamber granulopoiesis, cyclosporin A (CyA) was given to the mice with implanted copper rods. CyA abrogated the induced enhancement of CFU-S, CFU-GM and mature granulocyte numbers inside the diffusion chamber. The stimulatory effect of inflammation on diffusion chamber granulopoiesis was not observed in T-lymphocyte-deficient nude mice. These data suggest that in vivo stimulation of granulopoiesis is related to the level of inflammation, and that this effect requires the functional integrity of T-lymphocytes.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
The use of silicon-on-insulation architecture (SOI) for high temperature operation of a pressure transducer is depicted in U.S. Pat. No. 7,231,828 entitled High Temperature Pressure Sensing System issued on Jun. 14, 2007 to A. D. Kurtz et al and assigned to Kulite Semiconductor Products Inc., the assignee herein. In that patent, there is disclosed a high temperature pressure sensing system including a pressure transducer. The system includes a pressure sensing piezoresistive sensor formed by a silicon-on-insulator (SOI) process. There is a SOI amplifier circuit which is coupled to the piezoresistive sensor, a SOI gain controller circuit, including a plurality of resistances that when selectively coupled to the amplifier, adjusts the gain. There is a plurality of off chip contacts corresponding to the resistors respectively, for electrically activating the corresponding resistors and using a metallization layer for the SOI sensor and SOI ASIC suitable for high temperature interconnections wherein the piezoresistive sensor amplifier circuit and gain control circuit are suitable for use in environments having a temperature greater than 175° C. and reaching between 250° C. and 300° C. Thus in the above noted patent namely U.S. Pat. No. 7,231,828 there is a described a SOI or silicon-on-insulator structure which employs a SOI pressure sensor device.
As is clear from the above-noted patent, by utilizing such devices, one can achieve high temperature operation and for example, operation in temperature ranges greater than 175° C. The above-noted patent describes various techniques utilized for providing SOI CMOS structures where the components are N-channel and P-channel transistors, diodes, capacitors and so on. Basically the fabrication process consists of producing a thin, single crystalline layer of silicon separated from the substrate via a high quality silicon dioxide or SiO2 layer. This can be done by using an oxygen implantation approach where the implanted oxygen creates an insulating silicon dioxide layer some distance from the top surface establishing a thin silicon layer isolated from the substrate. This can also be produced by fusion bonding an oxidized substrate wafer to a second wafer followed by selective etching of the second wafer to leave only a thin, high quality, layer of silicon over the SiO2 layer on the substrate. The process for the selective etching of the second silicon wafer can use either a conductivity selective etching process or a lap and polish process or a hydrogen implant and micro-splitting process. Once the silicon-on-insulator wafers are produced, selective doping and patterning, additional film growing and other semiconductor processing can be used to fabricate different features and components in the device. With controlled doping, the appropriate drain and source regions in the respective transistors are provided. A high quality oxide layer is then grown to serve as a gate oxide, over which a poly-crystalline P-type silicon will be deposited to act as a gate material. The same poly-crystalline material can also be used to form resistors as well as other components utilized in the chip. In this process, unlike bipolar technology where NI-CR having very low thermal temperature coefficient of resistance typically are used, resistors can not be made as metal layers. As a result, the utilized poly-crystalline resistors have a relatively large TCR of about 1500 ppm/0° C. orders of magnitude higher than that of the metal film resistors. With the SOI approach, all associated components are dielectrically isolated from each other and from the substrate, thus eliminating the effects of leakage currents and substrate parasitic capacitance. The use of SOI enables the fabrication of very stable devices operational up to and above 300° C. and suitable for high voltage and low voltage applications. This technology has been explained in detail in the above-noted patent, namely U.S. Pat. No. 7,231,828 which is incorporated herein in its entirety. In any event, that patent describes in detail the advantages of SOI technology in providing sensor devices.
It is an object of the present invention to provide circuitry which adds significant capabilities to the operation of pressure transducers while maintaining high temperature operations and so on. As indicated above, the above-noted patent, namely U.S. Pat. No. 7,231,828 depicts the implementation and advantages gained by using a SOI sensor with SOI electronics. In this manner, one can implement a transducer with a high level output capable of operating at temperatures in excess of 250° C. and potentially up to 300° C. The circuit to be described uses analog components as well as digital components. The analog components, for example, may be operational amplifiers and regulators. Thus, as will be shown, the present invention includes further enhancements of the electronic circuit with significant advantages. The enhancements disclosed here are digital circuits which add significant capabilities to the operation of the transducer, while maintaining the capability of operation at high temperatures of +250° C. and even up to 300° C. This feature is possible due to the dielectric isolation of each device in the SOI chip which eliminates leakage currents. The leakage currents are the major factor limiting the operation of circuits using conventional technologies.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
% Generated by roxygen2: do not edit by hand
% Please edit documentation in R/net.utils.R
\name{copy_nwattr_to_datattr}
\alias{copy_nwattr_to_datattr}
\title{Copies Vertex Attributes From Network to dat List}
\usage{
copy_nwattr_to_datattr(dat)
}
\arguments{
\item{dat}{Master data object passed through \code{netsim} simulations.}
}
\description{
Copies the vertex attributes stored on the network object to the
master attr list in the dat data object.
}
\seealso{
\code{\link{get_formula_term_attr}}, \code{\link{get_attr_prop}},
\code{\link{auto_update_attr}}, and \code{\link{copy_datattr_to_nwattr}}.
}
\keyword{internal}
\keyword{netUtils}
|
{
"pile_set_name": "Github"
}
|
Q:
Using Subversion for general purpose backup
Is it possible to use Apache Subversion (SVN) as general purpose backup tool? (As a kind of rsync alternative.)
A:
I found this article to be a pretty cool description of using svn to backup your home directory, and more:
I use Subversion to backup my Linux boxes. With some minor creativity, it easily covers:
Daily snapshots and offsite backup.
Easy addition and removal of files and folders.
Detailed tracking of file versions.
It also allows for a few bonus features:
Regular log emails to keep track of filesystem activity via Subversion's event hooks.
Users may request a checkout of their home folders from any respository revision.
New or replacement servers can be setup with a few svn checkout commands.
Source: http://www.mythago.net/svn_for_backup.html
Also found this article which shows an example of versioning your home directory. This allows you to bring your environment with you by checking out your home directory into a new machine. I used to do something similar and found it very useful.
A:
One thing to bear in mind when using SVN as a backup for binary files is that SVN will double the size of your files, because it keeps a local copy of each file (in the .svn/text-base) file.
Apart from that I use SVN for a backup as well. Simply add all files then commit via script.
A:
As a "general purpose" backup, I'd say it's probably not the greatest idea, mainly for the reasons given by others (lots of excess folders and wasted disk space). If you want to just keep backups, again I'd say there's probably better options, depending on your needs, eg: do you need to keep every single version of every single file, or would certain snapshots of your data be sufficient?
However, at my office, we have a small team of 6 who work with shared files (eg: policies and procedures manuals, registration forms, etc). A lot of the time, team members will be working remotely (from home or while travelling), and often offline. Rather than using a central shared-folder setup, we use SVN to give each person an entire working copy of the folder which they can work on and refer to and synchronise whenever possible. This kills two birds with one stone: everyone can access and edit the files even while offline, plus it gives us really great redundancy in our backups. If my laptop catches on fire, it's no hassle because I can just check out another copy (obviously on another computer). If the server catches on fire, we'll have the backups of the repository to restore. If the server AND all the repo backups catch on fire, then all that you've lost are old versions of files. The only way that you'll lose any current data is if the server, your repo backups and every single computer which has a checkout all mysteriously catch on fire.
As some people have said though, SVN will never remove information from the repository, meaning that if you only want to keep backups for 60 days, then, well, you can't. This isn't exactly true. Through use of export, dump and import you could effectively wipe out older versions of files. It's not pretty, but it's possible.
|
{
"pile_set_name": "StackExchange"
}
|
Unfinished: PlayerUnknown's Battlegrounds (Xbox One) 12/12/17
Jeff and Jason take a trip to Murder Island. Watch them as they make sick jumps, light fires, and throw some blows in this early access version of PlayerUnknown's Battlegrounds on the Xbox One!
Sometimes we look at a game before it's done. When that's the case? Well... it must be Unfinished.
Dec. 12 2017
Cast: Jeff, Jason
Posted by: Jan
|
{
"pile_set_name": "OpenWebText2"
}
|
Q:
Xcode error Invalid Image Path - CFBundleIconFiles 144x144,152x152,76x76 and 120x120
When I try to validate my app in archive I get an error that tells me
"Invalid Image Path - No image found at the path referenced under key 'CFBundleIconFiles': '144x144'" I get the exact same error aswell with the resolutions 76x76, 152x152 and 120x120.
I created icons in this resolutions and uploaded them in Xcode but I still get this error...
It looks like this: http://screencast.com/t/hNWHqyBHSoz7
And this is my info.plist: http://screencast.com/t/SL0lSG4xhChU
A:
Make sure those images are a members of target you are building:
http://i.imgur.com/wLPGJMD.jpg
Otherwise they are not gonna be a part of your IPA file.
Also be aware that names are case sensitive - all files you have problems with are lower "i" and working ones are uppercase.
|
{
"pile_set_name": "StackExchange"
}
|
<?php
/**
* Magento
*
* NOTICE OF LICENSE
*
* This source file is subject to the Open Software License (OSL 3.0)
* that is bundled with this package in the file LICENSE.txt.
* It is also available through the world-wide-web at this URL:
* http://opensource.org/licenses/osl-3.0.php
* If you did not receive a copy of the license and are unable to
* obtain it through the world-wide-web, please send an email
* to [email protected] so we can send you a copy immediately.
*
* DISCLAIMER
*
* Do not edit or add to this file if you wish to upgrade Magento to newer
* versions in the future. If you wish to customize Magento for your
* needs please refer to http://www.magento.com for more information.
*
* @category Unserialize
* @package Unserialize_Reader
* @copyright Copyright (c) 2006-2020 Magento, Inc. (http://www.magento.com)
* @license http://opensource.org/licenses/osl-3.0.php Open Software License (OSL 3.0)
*/
/**
* Class Unserialize_Reader_Int
*/
class Unserialize_Reader_Int
{
/**
* @var int
*/
protected $_status;
/**
* @var string|int
*/
protected $_value;
const READING_VALUE = 1;
/**
* @param string $char
* @param string $prevChar
* @return int|null
*/
public function read($char, $prevChar)
{
if ($prevChar == Unserialize_Parser::SYMBOL_COLON) {
$this->_value .= $char;
$this->_status = self::READING_VALUE;
return null;
}
if ($this->_status == self::READING_VALUE) {
if ($char !== Unserialize_Parser::SYMBOL_SEMICOLON) {
$this->_value .= $char;
} else {
return (int)$this->_value;
}
}
return null;
}
}
|
{
"pile_set_name": "Github"
}
|
It's gonna be a nightmare for said person though
with there being about 50 jumpscares, which are usually 20 frames (so about 100 frames)
and the camera rendres, office renders, it's gonna take a while
|
{
"pile_set_name": "OpenWebText2"
}
|
738 F.2d 452
Johnson, In re
84-626
United States Court of Appeals,Federal Circuit.
4/10/84
PTO
Affirmed
|
{
"pile_set_name": "FreeLaw"
}
|
Performers of Latin jazz have extended the genre around the
world. This disc introduces a group known as Banda Mandacarinho,
a Tokyo-based big band specializing in Brazilian popular music,
known as MPB. The band members are an international mix of players
from Brazil, Japan, Cuba, Canada, and the United States. This
is the bandís first album, a collection of tunes from Brazil with
new arrangements. Festa com Amor is a bright, cheerful
number with a quick Latin beat colored with a touch of funk. The
tight brass sections smoothly take turns with the lead before
combining for rich and heavy staccato accents. Cangalha,
composed by guitarist Joao Lyra, is performed with a driving Latin
rhythm featuring a soaring trumpet solo by Luis Valle, which contrasts
well with the deep baritone sax solo by Kazuki Nagashima. Drummer
Juasa Kanoh is the glue that holds these songs together, and his
prodigious talent is apparent on Caxanga, composed by
Milton Nascimento, which Minako Yagi has arranged as a jazzy Latin
march. Fine solos by pianist Hiroko Miyano, bassist Toru Kase
and Andy Wulf on tenor sax round out the tune. Bolero de Paulinho
was composed by Paulo Cesar Gomes, and the band plays the smooth,
sultry dance number with a rich, layered brass arrangement that
showcases solos by trumpeter Ryuichi Takase and alto saxophonist
Gustavo Anacleto, who also provided the excellent arrangement.
Emoldurada is a light, dancing samba featuring solos
by alto saxophonist Steve Sacks and trumpeter Mitsuriu Tanaka
and some fine background work on the vibraphone by Chie Suzuki.
This disc was released in June, 2017. The music was recorded
at HMVP Studio in Tokyo. Mixing and mastering was performed by
recording engineer Yuichiro Hiraoka. No booklet is included; notes
and credits are listed on the disc cover in English and Japanese.
The sound quality is excellent, the musical arrangements are interesting,
and the performances are well-done. A minor complaint would be
that the entire disc runs a little under 25 minutes long, less
than half of what a listener would expect. Another five songs
of this quality would have been a welcome addition and an easy
fit onto this disc.
|
{
"pile_set_name": "Pile-CC"
}
|
Blue on Blue (Leigh Nash album)
Blue on Blue is Leigh Nash's debut solo album and consists of pop songs. Nash began working on the album a year after Sixpence None the Richer disbanded. Produced by Pierre Marchand who is best known for his collaborations with Sarah McLachlan.
"My Idea of Heaven" was released to US radio on the July 14, 2006. A video was also made to accompany the song.
Critical and commercial response
The album met mixed to positive reviews upon release. Nash's vocals, lyrics and music direction were lauded. Blue on Blue was criticized mainly because of the songs not being as immediately appealing as the ones released by Sixpence None the Richer. Collaborators on this album are Sixpence bandmate Matt Slocum, and the songwriting/production team of Rick Nowels and Billy Steinberg.
Commercially, the album did not perform well. One of the main reasons for this is the fact that the album remains unknown among the masses due to the lack of promotion and airplay. So far, it managed to reach No. 25 in the Billboard Top Heatseekers charts; however, the bonus track "Blue Sky" reached No. 5 in Japanese pop music Chart due to its frequent airplay and the advertisement of "Toyota Prius" in Japan in 2007.
Track listing
"Along the Wall" (Pierre Marchand, Leigh Nash) - 4:30
"Nervous in the Light of Dawn" (Rick Nowels, Billy Steinberg, Matt Slocum, Leigh Nash) - 4:40
"My Idea of Heaven" (Nowels, Steinberg, Leigh Nash) - 4:05
"Ocean Size Love" (Leigh Nash, Scott Cutler, Anne Preven) - 4:58
"Never Finish" (Ron Aniello, Leigh Nash) - 3:44
"Between the Lines" (Leigh Nash, Pierre Marchand) - 4:07
"More of It" (Greg Wells, Leigh Nash) - 3:09
"Angel Tonight" (Holly Knight, Leigh Nash) - 3:17
"Blue" (Jude Cole, Leigh Nash) - 3:32
"Cloud Nine" (Cutler, Preven, Leigh Nash) - 3:47
"Just a Little" (Leigh Nash, Danielle Brisboise, Wayne Rodrigues) - 4:01
iTunes edition bonus track
"Thank You" - 3:59
Japanese edition bonus tracks
"Run Together" (Rick Nowels, Billy Steinberg, Matt Slocum, Leigh Nash) - 4:13
"Blue Sky" (Rick Nowels, Billy Steinberg, Leigh Nash) - 4:09
"Blue Sky" (A cappella version) - 4:01
"Along the Wall" can be heard at the Kyle XY episode "Hands on a Hybrid".
"Blue Sky" is the theme to Toyota Prius in Japan.
Chart performance
References
Category:Leigh Nash albums
Category:2006 debut albums
Category:Albums produced by Pierre Marchand
|
{
"pile_set_name": "Wikipedia (en)"
}
|
---
abstract: 'In this paper we discuss the strong coupling limit of chiral $N=1$ supersymmetric gauge theory via their embedding into M-theory. In particular we focus on the brane box models of Hanany and Zaffaroni and show that after a T-duality transformation their M-theory embedding is described by supersymmetric 3-cycles; its geometry will encode the holomorphic non-perturbative information about the gauge theory.'
bibliography:
- '3-cycle1.bib'
---
-5mm ====
I
\#1\#2[\#2]{}
**$N=1$ Supersymmetric Gauge Theories and Supersymmetric 3-cycles**
**Andreas Karch[^1] , Dieter Lüst[^2] and André Miemiec[^3]**
Introduction
============
Recently it was demonstrated that many interesting non-perturbative results in superstring theory and supersymmetric field theories can be derived from 11-dimensional M-theory. In particular Witten [@witten] has shown that $N=2$ supersymmetric gauge theories can be solved via M-theory by lifting the corresponding 10-dimensional type II brane configurations [@hanwit] to 11 dimensions. As a result the intersection of $n$ parallel NS 5-branes and $k$ suspended D 4-branes is described in 11 dimensions by an one-dimensional complex curve, which can be seen as a two-dimensional supersymmetric cycle embedded in the flat four-dimensional space ${\Bbb{R}}^3\times S^1$. This curve precisely agrees with the famous Seiberg-Witten curves [@sw] of $N=2$ supersymmetric field theories.
Non-chiral $N=1$ gauge theories can be obtained by rotating one or several of the NS 5-branes such that they intersect by a certain angle. The corresponding continuous parameter can be regarded in field theory as a mass parameter which explicitly breaks $N=2$ supersymmetry down to $N=1$. The M-theory embedding of the non-chiral $N=1$ models, constructed in this way, leads again to supersymmetric 2-cycles, now embedded in the flat six-dimensional space ${\Bbb{R}}^5\times S^1$ [@hori; @witten1; @9706127]. Analyzing these curves, the form of the corresponding $N=1$ superpotentials can be derived.
A generic way to construct [*chiral*]{} $N=1$ gauge theories in four dimensions is provided by the brane box models of Hanany and Zaffaroni [@hanzaf][^4]. Here one deals with a type IIB configuration of intersecting NS and D 5-branes. We will show that upon a T-duality transformation to the IIA superstring, the M-theory lifting of the chiral $N=1$ brane box configurations leads to supersymmetric 3-cycles suitably embedded into ${\Bbb{C}}^3$. These supersymmetric 3-cycles precisely correspond to the $SU(3)$ special Lagrangian calibrations (SLAG), discussed e.g. in [@gibpap; @9803216], which reduce the original supersymmetry by a factor 1/8. This is just the right amount of supersymmetry breaking for a generic chiral $N=1$ gauge theory which cannot be smoothly deformed into a $N=2$ gauge theory.
Following [@witten] one can study quantum effects in the corresponding gauge theory by analyzing how the branes bend each other. Especially it is easy to study the $\beta$ function: the gauge coupling is encoded in the distance between two NS branes or in the area of the box in the case of boxes respectively. So the shape of the bent branes directly gives some information about the running gauge coupling. In order to obtain the exact quantum information (or at least the information protected by holomorphy) one can lift the brane configuration to M-theory and use 11d SUGRA to solve it. For IIA brane configurations like those studied in [@witten] this is straight forward, since 11d SUGRA on a circle is dual to IIA.
The boxes of [@hanzaf] live in IIB theory, so in order to perform the M-theory lift on has to use the relation that IIB on a circle is M-theory on a torus, so we have to compactify one of the common wordvolume directions. Like in the 5d case studied in [@kol] this means that we are really solving the 4d theory on $R^3 \times S^1$. In the limit where the area of the M-theory torus shrinks to zero or grows to infinity we recover the $N=1$ $d=4$ and $N=2$ $d=3$ gauge theories respectively. We will show that this way all the holomorphic information about these gauge theories is encoded in the geometry of a SUSY 3-cycle. Especially we expect the superpotential to correspond to the volume and the gauge couplings on the Coulomb branches to be related to periods of the cycle. The possible 3-cycles for given boundary values will encode the vacuum structure of the theory. Gauge theories which dynamical SUSY breaking will correspond to situation, where the minimal area cycle for the given boundary problem is not a SUSY 3-cycle.
In Section 2 we will review Witten’s rediscovery of the Seiberg-Witten curve in terms of the lift to M-theory. In Section 3 we will introduce the classical brane box setups and show how they relate to 3-cycles. We will develop some tools which we believe are very helpful in constructing the 3-cycles. For the special case of finite theories and theories that satisfy the uniform bending requirement of [@gimongremm] we are able to perform the lift explicitly. However the corresponding cycles turn out to be superpositions of special 3-cycles that are of the form 2-cycle times line. We end with some preliminary results about more general cases.
[***N=2***]{} Gauge Theories and 2-cycles
=========================================
In order to understand better the supersymmetric 3-cycles in the $N=1$ brane box models, let us first recall the M-theory embedding of the $N=2$ models which leads to supersymmetric 2-cycles. The four-dimensional $N=2$ gauge theories are based on the following brane set up in type IIA superstring theory on ${\Bbb R}^{10}$:
- $n$ NS 5-branes with world volumes parametrized by $x^0$, $x^1$, $x^2$, $x^3$, $x^4$ and $x^5$; they are located at $x^7=x^8=x^9=0$ and at some fixed value of $x^6_\alpha$ ($\alpha=1,\dots n$), at least in classical approximation.
- $k_\alpha$ ($\alpha=0,\dots n$) D 4-branes with world volumes in the $x^0$, $x^1$, $x^2$, $x^3$ and $x^6$ directions, being suspended in the $x^6$ direction between the $(\alpha)^{\rm th}$ and $\alpha^{\rm th}+1$ NS 5-brane. For $\alpha=0$ or $\alpha=n$ the D 4-branes are semi-infinite to the left of the first NS 5-brane or, respectively, to the right of the $n^{\rm th}$ NS 5-brane[^5]. The 4-branes are located in $x^4$-$x^5$ plane at the complex coordinate $v=x^4+ix^5$.
This $N=2$ brane configuration, which preserves 1/4 of the original supersymmetries, is summarized in figure \[figureBraneConfiguration\].
The four-dimensional gauge group is given by $$G=\prod_{\alpha=1}^{n-1} SU(k_\alpha).$$ In addition one finds hypermultiplets in the representations: $$(k_0,\bar k_1)\oplus (k_1,\bar k_2)\oplus\dots\oplus (k_{n-1},\bar k_n).$$ (Here, $k_0$ and $\bar k_n$ act as global flavor representations.) The gauge coupling constants $g_\alpha$ of every $SU(k_\alpha)$ group factor are determined by the differences between the positions of the NS 5-branes: $$\frac{1}{g^2_\alpha}=\frac{x^6_{\alpha+1}-x^6_{\alpha}}{g_s},\label{gaugeco}$$ where $g_s$ is the string coupling constant.
After having discussed the classical picture, let us now come to solution of the model after taking into account the quantum corrections. The D 4-branes exert a force on the NS 5-branes causing them to bend. Since the tensions of the NS 5-brane and the tensions of the D branes have a different behavior in terms of the string coupling constant, $T_{NS}\sim g_s^{-2}$ compared to $T_{D}\sim g_s^{-1}$, this bending is a quantum effect. As a result, a NS 5-brane on which 4-branes end does not have a definite value of $x^6$ in contrast to the classical picture. More specifically, when there is a bending which moves the two NS branes towards each other, the coupling becomes strong at high energies, i.e. we deal with an IR free theory. Conversely, if the bending is outwards, there is an asymptotically free theory. In four dimensions the bending is logarithmic with the distance $r$, whereas in $d$ dimensions the local bending of the NS branes goes like $r^{d-4}$, $r$ being the ‘position’ of the D brane on the world volume of the NS brane. This shows that in dimensions $d<4$ all gauge theories are asymptotically free, and all gauge theories with finite gauge coupling are IR free for $d>4$. The bending is absent if the number of left D branes ending on a given NS 5-brane is equal to the number of D branes ending from the right.
In one-loop perturbation theory in four dimensions, the bending of the NS 5-branes leads to a logarithmic variation of $x^6_\alpha$ in terms of $v$: $$x^6_\alpha=(k_\alpha-k_{\alpha-1})\log |v|.
\label{1loop}$$ Inserting this into eq.(\[gaugeco\]), the logarithmic running of the gauge coupling $g_\alpha$ is determined as $$\frac{1}{g_\alpha^2}=\frac{-2k_\alpha+k_{\alpha+1}+k_{\alpha-1}}{g_s}\log |v|.$$ Note that the prefactor $b_\alpha^{N=2}=-2k_\alpha+k_{\alpha+1}+k_{\alpha-1}$ precisely agrees with the $N=2$ $\beta$-function coefficient of the gauge group $SU(k_\alpha)$ with $N_f=k_{\alpha+1}+k_{\alpha-1}$ fundamental matter fields. In this way the shape of the branes incorporates the 1-loop effects in field theory.
In $N=2$ field theory there are no higher loop effects. However there are still non-perturbative effects due to instantons. These instantons can be seen directly in the brane picture, namely the D 0-branes are instantons within D 4-branes. The problem is now to solve the theory by including all these effects. This can be done by “lifting” the IIA configuration to M-theory [@witten]. The advantage of considering the above configuration of branes in M-theory is that the D 4-branes and NS 5-branes are in fact the same object, the M 5-brane. The intersection of the D 4- and NS 5-branes in IIA was singular but this is smoothed out in M-theory and in fact it is possible to consider all the D 4-branes and NS 5-branes as a single M 5-brane with complicated worldvolume. However the conditions for preserving N=2 supersymmetry restrict the embedding of the M 5-brane worldvolume and it is possible to find the function describing this embedding explicitly. Clearly this must incorporate the classical IIA brane set up as well as the field theory 1-loop corrections through the shape of the M 5-brane. However the non-perturbative instantons are also automatically included since D 0-branes are simply Kaluza-Klein momentum modes of compactified M-theory.
Let us discuss in slightly more detail how the M-theory embedding of the $N=2$ brane configurations is constructed. The lifting to M-theory is performed by adding the 11th coordinate $x^{10}$ which is periodic with period $2\pi R_{11}$. Now, the complex coordinate $s_\alpha=(x^6_\alpha+ix^{10}_\alpha)/R_{11}$ describes the asymptotic positions of the M 5-branes in the $x^6$-$x^{10}$ plane, whereas as before $v$ denotes the asymptotic positions of the M 5-branes in the $x^4$-$x^5$ plane (all M 5-branes have common world volume in the 0123-directions, and are fixed at $x^7=x^8=x^9=0$). Regarding $x^{10}$ as $\theta$-parameter one can introduce a complex coupling constant $$\tau_\alpha=\frac{\theta_\alpha}{2\pi}+i\frac{4\pi}{g^2_\alpha}=
i(s_{\alpha+1}-s_{\alpha}).$$ Concentrating on the directions $x^4$, $x^5$, $x^6$ and $x^{10}$ we see that the M 5-brane world volume spans a two-dimensional surface $\Sigma^{(2)}_{n,k_\alpha}$ in the four-manifold ${\mathbb{R}}^3\times S^1$. A priori, $\Sigma^{(2)}_{n,k_\alpha}$ is determined by two real functions of the coordinates $x^4$, $x^5$, $x^6$ and $x^{10}$: $$\begin{aligned}
f_{n,k_\alpha}(x^4,x^5,x^6,x^{10})&=&0,\nonumber \\
g_{n,k_\alpha}(x^4,x^5,x^6,x^{10})&=&0.\end{aligned}$$ However $N=2$ space-time supersymmetry requires that $s$ varies holomorphically with $v$, such that $\Sigma^{(2)}_{n,k_\alpha}$ is a Riemann surface in ${\Bbb{R}}^3\times S^1$: $$\Sigma^{(2)}_{n,k_\alpha}:\quad F_{n,k_\alpha}(s,v)=f_{n,k_\alpha}+
ig_{n,k_\alpha}
=0.$$ This means that $\Sigma^{(2)}_{n,k_\alpha}$ is a supersymmetric 2-cycle, or in terms of [@gibpap], $\Sigma^{(2)}_{n,k_\alpha}$ describes a $SU(2)$ Kähler calibration. The holomorphy of the equation $F_{n,k_\alpha}(s,v)$ implies that the real functions have to obey the Cauchy-Riemann differential equations, where $f_i$ denotes $\frac{\partial f}{\partial x_i}$: $$\begin{aligned}
& & f_4=g_5,\qquad\;\;\;\; f_6=g_{10},\nonumber\\
& & f_5=-g_4,\qquad f_{10}=-g_6.\end{aligned}$$
As explained in [@witten], it is very useful to perform an holomorphic change of variables, $t=\exp(-s)$, in order to describe the asymptotic positions of the M 5-branes in the correct way. Specifically consider the complex equation $$F(t,v)=0.\label{sw}$$ At a given value of $v$, the roots of $F$ in $t$ are the positions of the NS 5-branes, i.e. $F$ is a polynomial of degree $n$ in $t$. On the other hand, for fixed $t$, the roots of $F$ in $v$ are the positions of the IIA D 4-branes. Therefore $n$ parallel NS 5-branes with positions at $t_i$ ($i=1,\dots ,n$) are simply described by the function $F(t,v)=\prod_{i=1}^n(t-t_i)$, and $k$ parallel D 4-branes, positioned at values $v_j$ ($j=1,\dots k$), correspond to the choice $F(t,v)=\prod_{j=1}^k(v-v_j)$. Then it immediately follows that $n$ NS 5-branes intersected by $k$ D 4-branes correspond to $$F(t,v)=\prod_{i=1}^n(t-t_i)\prod_{j=1}^k(v-v_j).\label{orth}$$ In this case, since the number of D 4-branes to the left and to the right of each NS 5-brane is the same, there is no bending of the NS 5-branes by the D 4-branes.
Next, let us briefly discuss, how the perturbative, one-loop bending can be described [@witten]. Consider the situation of one NS 5-brane with $k_0$ ($k_1$) D 4-branes ending on it from the left (right). Then the induced bending in the region, where $t$ is very large, corresponds to the following choice for $F$: $$F(t,v)=v^{k_0}(t-\epsilon v^{k_1-k_0}),\label{bendtv}$$ where $\epsilon$ is a constant. Introducing back the variable $s$, this equation immediately leads to eq.(\[1loop\]), namely the logarithmic bending of $s$ in terms of the Higgs field $v$: $$s=(k_1-k_0)\log v.$$
Putting all these informations from eqs.(\[orth\],\[bendtv\]) together, the supersymmetric 2-cycle equation for a general $N=2$ brane configuration takes the form $$\Sigma^{(2)}_{n,k_\alpha}:
\quad F_{n,k_\alpha}(t,v)=p_{k_0}(v)t^n+p_{k_1}(v)t^{n-1}+\dots
+p_{k_{n-1}}(v)t+p_{k_n}(v),\label{n=2pol}$$ where the $p_{k_\alpha}(v)$ are polynomials in $v$ of degree $k_\alpha$. The up to now unspecified parameters of the polynomials $p_{k_\alpha}(v)$ appear as the moduli of the gauge theory. This describes the non-perturbative solution of the model with gauge group $\prod_{\alpha=1}^{n-1}SU(k_\alpha)$ with hypermultiplets in bi-fundamental representations. For example, the pure $SU(k)$ gauge theory without matter fields, i.e $n=2$, $k_0=k_2=0$, $k_1=k$, is described by the curve $$F(t,v)=t^2+p_k(v)t+1.$$ This is nothing else than the famous Seiberg-Witten curve of genus $k-1$ [@sw; @9411048; @klemm; @argyres].
Why does this procedure work? The solution of the gauge theory is found by using the duality between 11d SUGRA and IIA string theory. When $R_{11}$ is large, 11d SUGRA is valid. Solving for the exact shape of the M5 brane means solving the classical minimal area problem for a tensile brane (the shape of a soap bubble) with given boundary conditions. The requirement of supersymmetry tells us that we should only consider special minimal area configurations, the SUSY 2-cycles.
On the other hand we identified the gauge group and matter content at small $R_{11}$, where we have weakly coupled IIA string theory and the analysis of [@hanwit] applies. In order to decouple the bulk modes from the gauge theory we have to take the string scale $M_s \rightarrow \infty$ and $M_{pl} \rightarrow
\infty$ and in order to decouple the KK modes from the finite interval, we have to also send $L \rightarrow 0$, where $L$ is the length of the $x^6$ intervals. This all has to be done holding $g^2_{YM}=\frac{g_s}{M_s L}$ fixed. In 11d units $g^2_{YM}=\frac{R_{11}}
{L}$. In order to keep the interacting gauge theory (fixed $g^2_{YM}$) while decoupling the KK modes ($L\rightarrow 0$) $R_{11}$ has to go to zero! This is the limit in which the brane setup reduces to 4d SYM. But this is the opposite limit of the one we were able to solve, where $R_{11}$ and hence $L$ have to be very large and we can use 11d SUGRA. So we should only expect quantities protected by holomorphy, like the $N=2$ prepotential, which can’t depend on the real parameter $R_{11}$, to come out correctly. Indeed it was shown in [@berkeley] that unprotected quantities like the 4-derivative terms in the effective action disagree with field theory results.
[***N=1***]{} Gauge Theories and Supersymmetric 3-cycles
========================================================
$N=1$ brane boxes {#sectionN1BraneBox}
-----------------
Now let us discuss the brane boxes of [@hanzaf] which can be used to construct $N=1$ supersymmetric gauge theories with chiral matter content[^6]. The starting point is now a type IIB superstring with the following branes included (see figure \[figureGeneralBraneBoxWeb\]):
- $n$ parallel NS 5-branes with world volumes along the (012345)-directions. These 5-branes are fixed at $x^7=x^8=x^9=0$ and are placed at arbitrary positions in $x^6$.
- $n'$ parallel NS’ 5-branes with world volumes along the (012367)-directions. The NS’ branes are fixed at $x^5=x^8=x^9=0$ and are placed at arbitrary positions in $x^4$.
- D 5-branes with world volumes along the (012346)-directions. The D 5-branes can take different position on the NS 5-branes in the $x^5$-direction and also different positions on the NS’ 5-branes in the $x^7$-direction. Depending on the specific model one likes to discuss, the directions $x^4$ and $x^6$ can be either uncompactified or periodic (elliptic models). We will concentrate on the non-elliptic models. It follows that the D 5-branes are finite in the directions $x^6$, $x^4$ in case they are placed inside the ‘inner’ boxes. However they are semi-infinite in case they end only on one NS (NS’) brane (‘outer’ boxes).
This brane configuration preserves 1/8 of the original supersymmetry. We see that a generic configurations consists of a grid of $(n+1)(n'+1)$ boxes built by $n$ NS 5-branes branes and $n'$ NS’ 5-branes in the $x^4$-$x^6$ plane. We are labelling the boxes by the two indices $\alpha,\alpha'$ where $\alpha=0,\dots , n$ and $\alpha'=0,\dots , n'$. The $(n-1)(n'-1)$ ‘inner’ boxes with $\alpha=1,\dots, n-1$, $\alpha'=1,\dots ,n'-1$ have always finite area whereas the remaining ‘outer’ boxes have infinite size in case of uncompactified directions $x^4$ and $x^6$.
Now, let $k_{\alpha,\alpha'}$ denote the number of D 5-branes which are placed in the box $\lbrack\alpha,\alpha'\rbrack$. The suspended D 5-branes inside the inner boxes give rise to the following gauge group in four dimensions: $$G=\prod_{\alpha=1}^{n-1}\prod_{\alpha'=1}^{n'-1}SU(k_{\alpha,\alpha'}).$$ The associated classical gauge coupling constants are given by the area of the corresponding box $\lbrack\alpha,\alpha'\rbrack$: $$\frac{1}{g_{\alpha,\alpha'}^2}=
\frac{(x^4_{\alpha+1}-x^4_\alpha)(x^6_{\alpha'+1}-x^6_{\alpha'})}{g_s}.
\label{n=1gaugec}$$
The matter content of the model consists of three types of chiral $N=1$ representations. First they are ‘horizontal’ chiral bi-fundamentals $H_{\alpha,\alpha'}$ in the representations $(k_{\alpha,\alpha'},\bar k_{\alpha+1,\alpha'})$ of $SU(k_{\alpha,\alpha'})\times SU(k_{\alpha+1,\alpha'})$. Second there exist ‘vertical’ chiral bi-fundamentals $V_{\alpha,\alpha'}$ in the representations $(k_{\alpha,\alpha'},\bar k_{\alpha,\alpha'+1})$ of $SU(k_{\alpha,\alpha'})\times SU(k_{\alpha,\alpha'+1})$; finally we have ‘diagonal’ chiral fields $D_{\alpha,\alpha'}$ in the representations $(k_{\alpha,\alpha'},\bar k_{\alpha-1,\alpha'-1})$ of $SU(k_{\alpha,\alpha'})\times SU(k_{\alpha-1,\alpha'-1})$ ($\alpha,\alpha'>1$). In this context the groups $SU(k_{\alpha,\alpha'})$ with $\alpha=0,n$ or $\alpha'=0,n'$ act as global flavor symmetries if the directions $x^4$ and $x^6$ are uncompactified. Note that the choices for the $k_{\alpha,\alpha'}$ are severely constrained by the requirement of absence of anomalies. If all three types of matter multiplets are present then there exists a classical superpotential of the following form: $$W=\sum_{\alpha,\alpha'}H_{\alpha,\alpha'}V_{\alpha+1,\alpha'}
D_{\alpha+1,\alpha'+1}-\sum_{\alpha,\alpha'}H_{\alpha,\alpha'+1}
V_{\alpha,\alpha'}D_{\alpha+1,\alpha'+1}. \label{supo}$$
One of the simplest (non-elliptic) models is given by the choice $n=n'=2$, $k_{1,1}=N_c$ and $k_{0,1}=k_{2,1}=N_f$, whereas $k_{\alpha,\alpha'}=0$ for $\alpha'=0,2$. This choice of brane boxes corresponds to the supersymmetric QCD with $G=SU(N_c)$ and with $N_f$ fundamental plus antifundamental chiral fields. A second way to obtain SUSY QCD with $N_f$ fundamental plus antifundamental matter fields is given by the choice $k_{1,1}=N_c$ and $k_{0,1}=k_{2,1}=
k_{1,0}=k_{1,2}=N_f/2$ and zero otherwise. Finally the same spectrum can by realized by the choice $k_{1,1}=N_c$ and $k_{\alpha,\alpha'}=N_f/3$ ($\alpha,\alpha'\neq1$). However in this case a superpotential of the type eq.(\[supo\]) is present.
So far we have only discussed the classical field theory. Of course it is essential to understand the quantum features as well. Chiral $N=1$ exhibit a huge variety of interesting quantum phenomena. Especially the generic theory will have an anomaly which should show up as an inconsistency of the brane box as a string background. In these general cases the bending of the brane boxes isn’t well understood yet, but some special cases can be analyzed.
It is clear that the bending of the NS and NS’ branes depends on the number $k_{\alpha,\alpha'}$ of D 5-branes in each box. A very special class of $N=1$ gauge theories is given by the [*finite*]{} models for which all $\beta$-functions and all anomalous dimensions vanish to all orders in perturbation theory [@leighstrassler; @HaStrUr]. This condition includes the vanishing of the one-loop $\beta$-functions. In the brane picture complete finiteness means that all NS and NS’ branes do not bend at all, i.e. if the number of D 5-branes in every box is the same [@HaStrUr]. Then obviously, $N_f=3N_c$ for every gauge group factor, and the one-loop $\beta$-functions are zero.
The corresponding brane setup consists of several branes put on top of each other. Each of the branes preserves 1/2 of the supersymmetries, together they still preserve 1/8, so the intersection is BPS. This ensures that the static branes don’t exert any force on each other. We can freely move the constituent branes since they don’t feel the presence of the other branes at all. Motions of the branes in the 46 plane corresponds to changing the areas of the various boxes and hence to changing the gauge couplings. Taking NS (NS’) branes away along the $x^7$ ($x^5$) direction destroys the box structure and corresponds to turning on FI terms.
Another special situation is that of uniform bending. The condition of uniform bending was first introduced by [@gimongremm]. There it was argued to be necessary for consistency. As we will see this is too stringent. However uniform bent setups are very special and allow for a precise treatment of the quantum properties. To motivate the uniform bending requirement consider the basic cross configuration of figure \[figureUniformBasic\].
For $x^6 \rightarrow - \infty$ (to the far left) the effects of the NS brane on the bending of the NS’ brane should be negligible. The D5 ending on the NS’ brane just looks like a 5d gauge theory with 8 supercharges and leads to the standard linear bending [@aharonyhanany]. The slope of the bending is given by the difference of branes ending from either side, hence $$\mbox{slope}_{x^6 \rightarrow - \infty} = k_{\alpha,\alpha'}
- k_{\alpha,\alpha'+1}.$$ For the same reason we will have linear bending to the far right, that is for $x^6 \rightarrow \infty$, the slope this time given by $$\mbox{slope}_{x^6 \rightarrow \infty} = k_{\alpha+1,\alpha'}
- k_{\alpha+1,\alpha'+1}.$$
The observation of [@gimongremm] was that if $$\label{uniform}
k_{\alpha,\alpha'} - k_{\alpha,\alpha'+1} = k_{\alpha+1,\alpha'}
- k_{\alpha+1,\alpha'+1}$$ the bending on the far left is the same as on the far right and one may expect that the shape of the NS’ in fact does not change at all as a function of $x^6$. In [@haur] it was observed that the most general setup compatible with condition (\[uniform\]) can be achieved by “sewing” together $N=2$ models, that is we take branes corresponding to 5d gauge theory built out of NS and D5 branes and move them on top of a similar setup build out of NS’ and D5 branes[^7], as illustrated in figure \[figureUniformBraneBoxWeb\].
This sewing can be taken quite literally: as in the finite case there is a no force condition between the constituent pieces, since their intersection still preserves some supersymmetry. So we are free to move them independently. These deformations should correspond to marginal couplings in the field theory. Since we are not just tuning the distance between two NS branes but are actually moving around compound systems, these marginal operators won’t just be the gauge coupling as in the finite case but will also involve the superpotential couplings. Using the methods of [@leighstrassler], [@HaStrUr] were indeed able to show that the field theory has these marginal operators if the conditions (\[uniform\]) are satisfied for all boxes. Since the subsystems don’t influence each other, the exact bending is given in terms of the linear bending of the subsystems. All uniform bent systems are anomaly free.
The question remains, how to decide whether the more general setups are anomaly free. So far we were only able to discuss some very special cases, e.g. not including pure SYM. Some progress in understanding the bending in these cases has been made in [@randall], however without reaching a final answer. Several aspects of this problem can be easier understood in a T-dual picture. Consider an elliptic model, that is we take the $x^4 - x^6$ plane to be compactified on a torus. For a finite model, T-dualizing these two compact directions turns the D5 branes into D3 branes on an ${\Bbb{C}}^3/\Gamma$ orbifold background. Following [@LKS] it was argued in [@haur] that the generic box T-dualizes into an orbifold with fractional branes, that is where the orbifold group is embedded into the gauge group via some other representation than the regular one. On the orbifold side one immediately faces the issue of tadpole cancellations. Non-vanishing tadpoles signal the presence of a source, that is a net charge sitting in the internal space. So in orbifold compactifications the tadpoles have to vanish for consistency. Since we are dealing with non-compact backgrounds some non-vanishing tadpoles may be tolerated. The relevant space is the FP set of the orbifold action transverse to the D3 brane. For the $N=2$ case (a D3 brane in 0123 with an orbifold acting on 6789 space) the FP set is 2 dimensional. A net charge in 2d will give rise to a logarithmic singularity. In [@LKS] it was shown that this divergence is nothing else but the running of the gauge coupling. Tadpole cancellation is hence not required for consistency. Vanishing of the tadpoles is equivalent to finiteness of the gauge theory.
In the same spirit Leigh and Rozali analyzed the orbifold dual of the brane boxes [@leighrozali]. A generic orbifold element will leave a 0d FP set. These tadpoles have to vanish. Otherwise the gauge theory is anomalous. However some orbifold elements will leave a 2d FP set untouched. The corresponding tadpoles will only lead to logarithmic divergences which once more can be identified as the running gauge coupling. So vanishing of all tadpoles again implies finiteness of the gauge theory. Vanishing of the tadpoles for the 0d FP is required for anomaly freedom. Leigh and Rozali indeed showed that for all brane boxes leading to anomaly free gauge theories these 0d tadpoles vanish.
T-duality, M-theory embedding and the emergence of the 3-cycles
---------------------------------------------------------------
Now let us describe the the strong coupling limit of the $N=1$ via embedding the brane boxes into M-theory. Since our original brane configurations is in the type IIB string, we have first to perform a T-duality transformation to the type IIA superstring before we can perform the M-theory embedding. We do not want to touch the NS and NS’ 5-branes, and we also do not want to create any D6-branes; therefore we will T-dualize over one of the spatial directions common to all branes. To be specific we now assume that $x^3$ is periodic with radius $R_3^{IIB}$ and we perform the T-duality with respect to the $x^3$-direction. This leads to the following brane configuration:
- $n$ parallel NS 5-branes with world volumes along the (012345)-directions. These 5-branes are fixed at $x^7=x^8=x^9=0$ and are placed at arbitrary positions in $x^6$.
- $n'$ parallel NS’ 5-branes with world volumes along the (012367)-directions. The NS’ branes are fixed at $x^5=x^8=x^9=0$ and are placed at arbitrary positions in $x^4$.
- D 4-branes with world volumes along the (01246)-directions. These D 4-branes take different $x^5$ positions on the NS 5-branes and also different $x^7$ positions on the NS’ 5-branes. In addition the D 4-branes can have arbitrary positions in the compactified spatial $x^3$-direction.
This configuration preserves like before 1/8 of the original supersymmetries and corresponds to a three-dimensional gauge theory with $N=2$ space-time supersymmetry. The three-dimensional gauge theory can be simply obtained from the four-dimensional $N=1$ models by circle compactification on $S^1$ in the $x^3$-direction. In the decompactification limit, $R_3^{IIB}\rightarrow\infty$, the four-dimensional $N=1$ gauge theories are rediscovered. On the hand, for $R_3^{IIB}\rightarrow 0$, the theory is truly three-dimensional. Note that in three dimensions, a new Coulomb branch can be opened, since the three-dimensional vector multiplets contain one real scalar degree of freedom. The corresponding modulus $v$ is associated in the brane picture with the positions of the D 4-branes in the $x^3$-direction.
The three-dimensional gauge coupling is classically related to the 4d gauge coupling as $1/g_3^2=R_3^{IIB}/g_4^2$. So in the limit $R_3^{IIB}\rightarrow\infty$ one must send $g_3\rightarrow 0$ in order to have a finite coupling $g_4$. The scalar field in the vector multiplet live on a dual circle with radius $R_3^{IIA}=1/R_3^{IIB}$. So in the 4d limit, $R_3^{IIA}\rightarrow 0$, one has to integrate out the fields with masses of order $v$ corresponding to the Coulomb branch. In this way we can regard $v$ as the parameter which sets the scale $\Lambda$ of the four-dimensional gauge theory. So in order to determine the logarithmic ‘running’ of the four-dimensional gauge coupling $g_4$ in terms of $\Lambda$, $1/g_4^2=b^{N=1}\log\Lambda$, we will be in particular interested in the bending of the coordinates $x^4$ and $x^6$ in terms of $x^3$. (This precisely corresponds to the logarithmic running of $x^6$ in terms of the Higgs field vev $v=x^4+ix^5$ in case of the $N=2$ brane models.) This will be further discussed in section \[sectionUniformBending\]. Note that in the 3-dimensional limit, $R_3^{IIB}\rightarrow 0$, the pure Yang-Mills gauge theory has no stable supersymmetric groundstate unlike the 4d theory. Many more details of the dynamics and superpotentials of three-dimensional, $N=2$ supersymmetric gauge theories can be found in [@3dgauge].
After the duality in $x^3$ we are now ready for lifting the above configuration to M-theory by adding the period direction $x^{10}$ with radius $R_{11}$.
Then the intersection of all branes is described by the smooth configurations of M 5-branes. Like in the $N=2$ case the singular intersections of the NS, NS’ and D 4-branes are described in M-theory by a single smooth M 5-brane. Asymptotically, this M 5-brane takes the shape of the classical IIA branes:
- The NS 5-branes asymptotically correspond to M 5-branes which extend in the (012345)-space and take different positions in the $x^6$, $x^7$, $x^8$, $x^9$ and $x^{10}$ directions.
- The NS’ 5-branes asymptotically look like M 5-branes with world volumes along the (012367)-space and positions in $x^4$, $x^5$, $x^8$, $x^9$ and $x^{10}$.
- Finally, the asymptotics of the D 4-branes is given by M 5-branes with world volumes in $x^0$, $x^1$, $x^2$, $x^4$, $x^6$ and $x^{10}$ and positions in $x^3$, $x^5$, $x^7$, $x^8$ and $x^9$.
So all branes have common world volumes in the (012)-space and are all located at $x^8=x^9=0$. Therefore, to characterize the M-theory configurations we have to focus on the six-dimensional space spanned by the coordinates $x^3$, $x^4$, $x^5$, $x^6$, $x^7$ and $x^{10}$. Each asymptotic brane fills three particular directions in this space. This means that the general embedding of the M-theory 5-branes is described by a three-dimensional submanifold in ${\mathbb{R}}^4\times T^2$. Supersymmetry requires this to be a supersymmetric 3-cycle. In the language of [@gibpap] this is called a $SU(3)$ special Lagrangian calibration (SLAG) which breaks 7/8 of the supersymmetries.
Let us again briefly consider the validity of our approach. In 11d units the 3d gauge coupling is given by $g^2_{YM}=\frac{R_{11}}
{A}$ where $A$ is the area of the box. As in the $N=2$ case there are two distinct limits if we want to keep $g^2_{YM}$ fixed: for small $R_{11}$ and $A$ the KK modes decouple and the brane setup reproduces the gauge theory. For large $R_{11}$ we can solve using 11d SUGRA, that is by solving for the SUSY 3-cycle. So we are again only solving MQCD and not really the gauge theory. However, as for $N=2$, all holomorphic quantities should be encoded in the geometry of the 3-cycle. That is of the terms in the 2-derivative approximation of the effective action, the holomorphic gauge coupling and the superpotential should be encoded in the 3-cycle, whereas the Kähler potential probably escapes our control.
Brane Cubes and M-theory
------------------------
As already mentioned in the original work of [@hanzaf] the idea of brane boxes can naturally be extended to brane cubes and brane hypercubes. Each time we add one more NS brane with yet another orientation breaking another half of the supersymmetry. The D brane ends on these new NS branes as well, so that the brane spans a 3d cube or 4d hypercube instead of the 2d box we considered so far. Let us briefly discuss, how these configurations are lifted to M-theory. We will find that the situation is especially interesting in the case of brane cubes, where one can find two distinct models, one with chiral and one with non-chiral SUSY.
For simplicity let us consider the brane cubes directly on the IIA side with the D4 brane suspended between the NS branes. This is the setup that lifts to M-theory in a straight forward fashion. The third NS brane that we add should have a fixed $x^2$ position, so that the D4 brane is finite in this direction as well as in $x^4$ and $x^6$. There are two distinct possibilities to do so. The first is to add an NS” brane along 014567. This is the setup considered in [@9806177]. It leads to a chiral $N=(2,0)$ supersymmetric gauge theory in $d=2$. Rotations in 89 space give rise to the $U(1)_R$ symmetry. The dual orbifold consists of D1 branes living on top of an ${\mathbb{C}}^4/ \Gamma$ orbifold, where $\Gamma$ is a subgroup of $SU(4)$. By the same reasoning as for the brane box we find that this chiral brane cube should lift to M-theory via a SUSY 4-cycle in the 7d 234567 space, that is via a SUSY 4-cycle associated with $G_2$ holonomy.
The second possibility is to have the NS” brane in 012468. This leaves us with $N=(1,1)$ in 2 dimensions. Since this time all three types of NS branes have a common direction ($x^3$) we can perform a T-duality to type IIB as for the box, leading to a 3d $N=1$ theory. This time the dual orbifold is a $G_2$ orbifold while the lift to M-theory has to be performed via an $SU(4)$ SLAG 4-cycle in ${\mathbb{C}}^4$. Therefor this non-chiral cube requires the same techniques as the SLAG 3-cycle. By simply adding another NS along 23469 we find the brane hypercube and its lift via an $SU(5)$ SLAG.
The supersymmetric $d$-cycles
-----------------------------
### The $d$-cycle equations {#SectiondCycleEquation}
A d-dimensional ‘curve’ $\Sigma^{(d)}$, embedded into $2d$-dimensional flat space ${\mathbb{R}}^{2d}$ with coordinates $x^i$ ($i=1,{\ldots\,},2d$) can be described at least locally by the zero locus of $d$ real functions $f^m(x^1,{\ldots\,},x^{2d})$: $$\Sigma^{(d)} = {\Bbb{V}}(f^1,{\ldots\,},f^d) = \{(x_1,{\ldots\,},x_{2d})\,|\,
f^m(x^1,{\ldots\,},x^{2d})=0,\; m=1,{\ldots\,},d\}.
\nonumber$$ If one wants to deal with a so called supersymmetric $d$-cycle, the choice of the functions $f^m$ is highly constrained. To study these restrictions we first introduce $d$ real coordinates $\xi_i$ ($i=1,\dots ,d$) which parametrize the curve $\Sigma^{(d)}$. Furthermore we consider complex coordinates $u^i$, $u^i=x^{2i-1}+ix^{2i}$, of ${\mathbb{C}}^d$. Then the $d$-cycle can be characterized by making the complex $u^i$ to be functions of the real coordinates $\xi_i$, i.e. by the following embedding map $i$ from $\Sigma^{(d)}$ into ${\mathbb{C}}^d$: $$i:\Sigma^{(d)}\longrightarrow {\mathbb{C}}^d:
\qquad \xi_i \longrightarrow u^i(\xi_i),\quad i=1,\ldots, d.$$ The intersection configuration (for the case $d=3$) is depicted in figure \[figureIntersection\].
Now by applying the partial derivative $\partial_{\xi_k}$ to the defining equations $f^m$ of the $d$-cycle, we get the following relations: $$\sum_{n=1}^d (f^m_{u^n} u^n_{\xi_k} + f^m_{\bar{u}^n}
\bar{u}^n_{\xi_k}) =0$$ (here $f^m_{u^n}=\frac{\partial f^m}{\partial u^n}$, $u^n_{\xi_k}=\frac{\partial u^n}{
\partial\xi_k}$). These can be grouped into the following matrix expressions $$\begin{aligned}
\left(\begin{array}{cccc}
f^1_{u^1} & f^1_{u^2} & \dots & f^1_{u^d}\\
f^2_{u^1} & f^2_{u^2} & \dots & f^2_{u^d} \\
\dots &\dots &\dots &\dots \\
f^d_{u^1} & f^d_{u^2} & \dots &f^d_{u^d} \\
\end{array}
\right)\cdot
\left(\begin{array}{c}
u^1_{\xi_k} \\
u^2_{\xi_k} \\
\dots \\
u^d_{\xi_i} \\
\end{array}
\right) &=& (-1)^{d}
\left(\begin{array}{cccc}
f^1_{\bar{u}^1} & f^1_{\bar{u}^2} & \dots &f^1_{\bar{u}^d} \\
f^2_{\bar{u}^1} & f^2_{\bar{u}^2} & \dots &f^2_{\bar{u}^d} \\
\dots & \dots &\dots &\dots \\
f^d_{\bar{u}^1} & f^d_{\bar{u}^2} & \dots &f^d_{\bar{u}^d} \\
\end{array}
\right)\cdot
\left(\begin{array}{c}
\bar{u}^1_{\xi_k} \\
\bar{u}^2_{\xi_k} \\
\dots \\
\bar{u}^d_{\xi_k} \\
\end{array}
\right)\nonumber\end{aligned}$$ We will denote the left matrix by $M$ and the right matrix as $\bar{M}$, henceforth. Note, the sign in front of $\bar{M}$ depends on the dimension $d$ of the cycle. With the help of these matrices we can express the bared derivatives by the unbared ones in the following way: $$\
\partial_k \bar{U} = (-1)^d \bar{M}^{-1}M\cdot\partial_k U
= N\cdot\partial_k U .\label{lemma}$$ By definition $N$ shares the properties:
1. $N^{-1} = (-1)^d M^{-1}\bar{M} = \bar{N}$
2. $\left|\det \, N\right| = 1$
3. If $\;N=N^T\;\;\;\Rightarrow N\in U(d)$
4. If further $\;\det \, N=1\;\;\Rightarrow N\in SU(d)$
Remembering the $d$-cycle should be supersymmetric we can ask for restrictions of the matrix $N$ following from this condition. It is well known that the notion of supersymmetric cycles [@BBS] coincides with the notion of special Lagrangian submanifolds [@HL][^8] which can be rephrased in terms of the embedding map $i$: $d$-cycle $\longrightarrow {\mathbb{C}}^d$ and the two conditions: $$\begin{aligned}
i^\ast {\Im{\mathfrak{m}}}\Omega &=& 0 \;\;\;\; {\rm volume\;\; minimizing}
\nonumber\\
i^\ast \omega &=& 0 \;\;\;\; {\rm Lagrangian\;\; submanifold}
\label{volmin}\end{aligned}$$ Here $\Omega$ is the complex structure of ${\mathbb{C}}^d$, which we can choose to be $\Omega=du^1\wedge du^2\wedge\dots\wedge du^d$; $\omega$ is the canonical Kähler form, $\omega = \frac{1}{2i}\sum_{i} du^i\wedge d\bar{u}^i$. As it is shown in appendix \[AppendixDerivationOfTheCycleEquation\] for the case of $d$-cycles, from the first equation we derive straightforward that $N$ restricted to the $d$-cycle must be of unit determinant. $$\begin{aligned}
\det \, N\,|_{{\Bbb{V}}(f^1,{\ldots\,},f^d)} & = & 1\end{aligned}$$ But then to utilize this for computation in the embedding space we reformulate that condition a little bit. If $$\begin{aligned}
I({\Bbb{V}}) = \{f\in C^{\infty}({\Bbb{R}}^{2d})\,|\,
f|_{\Bbb{V}} = 0 \} \nonumber\end{aligned}$$ denotes the ideal of functions vanishing on ${\Bbb{V}}(f^1,{\ldots\,},f^d)$, the above equation can be rewritten as $$\begin{aligned}
\det \, N & = & 1 + \left[\,{\rm some}\; g\in I({\Bbb{V}})\,\right]
\nonumber\end{aligned}$$ This kind of non uniqueness is apparent through out the equations. To get a handle for that is the main obstruction for concrete computations.
To keep that difference in mind but deal with the equations as there is no difference at the same time, we replace the equality sign by the congruence symbol ($\equiv$), i.e. $$\begin{aligned}
\det \, N & \equiv & 1.\label{detcond}\end{aligned}$$
By close inspection of the second equation in (\[volmin\]) (see again appendix \[AppendixDerivationOfTheCycleEquation\]) one is led to a further restriction on $N$, namely $$N\equiv N^T.\label{ntcond}$$ So, in this way, we have translated the conditions of having a supersymmetric cycle to restrictions on our defining equations $f^m$.
In summary, all what we have done so far can be formulated in a short but important proposition which is the starting point for all further computations:\
[**Proposition:** ]{}[*A $d$-cycle, represented as an intersection of $d$ real valued functions issupersymmetric, iff $N\equiv N^{T}$ and $\det \, N\equiv 1$.*]{}\
It will turn out to be very useful to reformulate the last proposition $N\equiv N^{T}$ in a different, but equivalent way. Namely, it is not difficult to show that the requirement $N\equiv N^T$ is equivalent to the condition that the matrix $MM^+$ should be real modulo $I({\Bbb{V}})$. To prepare this reformulation we remark that by the split of the coordinates of ${\Bbb{R}}^{2d}$ into the coordinates of ${\mathbb{C}}^d$ they inherit an intrinsic meaning as the spatial and momentum variables of symplectic geometry. This is given by $$u^i=q^i+ip^i,$$ i.e. the real part of $u^i$ gets the meaning of a spatial coordinate whereas the $p^i$ is a momentum variable. Then we are free to define the convenient Poisson brackets of phase-space functions $\{ f,g\}$. This is done in the standard way as $$\{ f,g\} = \sum_{i=1}^d
\left(
\frac{\partial f}{\partial q^i}\frac{\partial g}{\partial p^i}
-\frac{\partial f}{\partial p^i}\frac{\partial g}{\partial q^i}
\right)
= \sum_{i=1}^d (f_{2i-1}g_{2i}-f_{2i}g_{2i-1}),$$ where $f_{2i-1}=\frac{\partial f}{
\partial q^i}=\frac{\partial f}{\partial x^{2i-1}}$ and $f_{2i}=\frac{\partial f}{\partial p^i}=\frac{\partial f}{\partial x^{2i}}$. Then the matrix $MM^+$ reads $$\begin{aligned}
(MM^+)_{mn} =\,<\nabla\,f^m,\nabla\,f^n\,>\pm\, i\cdot\{ f^m,f^n\} .\end{aligned}$$ So $MM^+$ is a real matrix modulo $I({\Bbb{V}})$, i.e. $N\equiv N^T$, if all Poisson brackets among the defining functions $f^m$ and $f^n$ vanish: $$\{ f^m,f^n\}\equiv 0.\label{poisson}$$ So we get a more suitable set of equations for concrete calculations. On the other side the last equations can be understood very natural (see appendix \[AppendixLiouville\]).\
[**Corollary:** ]{}[*A $d$-cycle, represented as an intersection of $d$ real valued functions issupersymmetric, iff $\{f^i,f^j\}\equiv 0$ and $\det \,
N\equiv 1$\[Tragik\][^9].*]{}
### Supersymmetric 2-cycles
Now we want to rederive the known result for the case of supersymmetric two-cycles to give a simple check of our formalism and to establish our point of view on the meaning of the defining equations of the $d$-cycle. If we look at the brane configuration,
------ --- --- --- --- --- --- --- -- -- -- ----
NS : 0 1 2 3 4 5
D4 : 0 1 2 3 6 10
------ --- --- --- --- --- --- --- -- -- -- ----
: N=2 Hanany-Witten setup[]{data-label="HananyWitten"}
we parametrise 4 space by $u^1=x_4+ix_{10}$ and $u^2=x_5+ix_{6}$. Note that D 4-brane positions $x^4$ and $x^5$ correspond to the $q^i$-variables, whereas the NS 5-brane positions $x^{10}$ and $x^6$ are the conjugated $p^i$ variables. Now we work out the two-cycle conditions on the two real function $f^1=f(x^4,x^5,x^6,x^{10})$ and $f^2=g(x^4,x^5,x^6,x^{10})$. With $$\begin{aligned}
M=\left(
\begin{array}{cc}
f_{u^1} & f_{u^2} \\
g_{u^1} & g_{u^2} \\
\end{array}\right)\nonumber\end{aligned}$$ one can calculate the two-cycle equations which result in: $$\begin{aligned}
\{f,g\}\equiv 0\;\;\; \Rightarrow \;\;\;
0&\equiv& g_4f_{10}-g_{10}f_4+g_5f_6-g_6f_5,\\
\det \, N\equiv 1\;\;\; \Rightarrow \;\;\;
0&\equiv& \; g_6f_4-g_{10}f_5-g_4f_6+g_5f_{10}.\end{aligned}$$ In analysing these equations it is a simple task to verify that all functions $f$ and $g$ satisfying $$\begin{aligned}
f_6 &=&g_{10}\;\;\;\;\;\;f_{10} = - g_6\nonumber\\
f_4 &=&g_5 \;\;\;\;\;\;\;\;\, f_5 = - g_4\nonumber\end{aligned}$$ do solve our equations. These are the “Cauchy-Riemann” differential equations which state that $f$ and $g$ are the real and imaginary part of a holomorphic function in the variables $v=x_4+ix_5$ and $s=x_6+ix_{10}$, respectively. Then we choose as our coordinates $$\begin{aligned}
v &=& x_4+i\cdot x_{5}\nonumber \\
t &=& e^{-s} = e^{-(x_6+i\cdot x_{10})}\nonumber \end{aligned}$$ to respect the compactness of the $x_{10}$ direction. Hence $f$ and $g$ fit into a holomorphic function in two variables $v$ and $t$.
Up to now we have shown, that there is a subclass of solutions to our equations, which coincides with the well known holomorphicity argument. But as they stand our equations are more general and we have to think about that difference. Nevertheless in a certain sense every geometrical two-cycle should be described by a holomorphic function, yet. That is to say in the whole variety of functions specifying the same geometrical two-cycle, there is a distinguished holomorphic function, i.e. there is a lot of redundancy in the description, which could be exploited for constructing solutions, maybe. Therefore we are looking for a way of to mod out that redundancy.
This will be done by imposing some additional differential constraints in a generic way. To do that, recall the following properties of the matrix $N$:
1. By definition: $N=(-1)^d \bar{M}^{-1} M$.
2. As shown in appendix \[AppendixDerivationOfTheCycleEquation\], N can be factorized through $a \in U(d)$ $$\begin{aligned}
N=\lambda^{-1} = \bar{a} a^{-1}.\nonumber
\end{aligned}$$
Note that this does not imply that $M$ must be unitary. But we want to choose M as close as possible to being unitary. We hope that this resolves the redundancy problem.
A unitary matrix $M$ does have orthonormalized rows and columns. Thus to begin with the construction of an unitary $M$ we want to orthogonalize the rows and columns of $M$. Since we know the expression for $MM^+$ in geometrical this is straightforward. Simply we have to require orthogonality of the gradients of $F$ and $G$ $$\begin{aligned}
<\nabla\,F,\nabla\,G >\,=\,0.\nonumber\end{aligned}$$ Of course one has to be careful in doing that. One has to ensure that by requiring these additional properties, the common zero set is unchanged. In fact, this can be done without getting into trouble. If the length of these both gradients coincides, our equations reduce to the Cauchy-Riemann equations, indeed.
There are problems in generalizing this nice looking observation to higher dimensional cycles but we hope that this construction works, too.
### Supersymmetric 3-cycles
Recall the characteristic $N=1$ brane configuration:\
Since the NS branes together with the D 4-branes build a $N=2$ subsystem, two conjugated $(q,p)$ pairs are given by $(q_1,p_1)=(x^{10},x^{3})$ and $(q_2,p_2)=(x^6,x^5)$. Then a single NS brane as well as a single D 4-brane is automatically a supersymmetric 3-cycle, namely a supersymmetric 2-cycle in the $x^3$-$x^5$-$x^6$-$x^{10}$ space times the line $x^7={\rm const}$ in $x^4$-$x^7$ space. The last pair of coordinates is fixed by the requirement that also the NS’ brane is a supersymmetric 3-cycle: $(q_3,p_3)=(x^4,x^7)$. Note that with this choice the three coordinates $x^3$, $x^5$, $x^7$ of the D 4-branes are all momentum variables. In summary, the complex structure of ${\mathbb{C}}^3$ takes the following form: $$\begin{aligned}
u^1 &=& x^{10}+i\cdot x^3\nonumber \\
u^2 &=& x^4 +i\cdot x^7\nonumber \\
u^3 &=& x^6 +i\cdot x^5\nonumber\end{aligned}$$ Now we can work out the supersymmetric 3-cycle conditions on the three functions$f^1=f(x^3,x^4,x^5,x^6,x^7,x^{10})$, $f^2=g(x^3,x^4,x^5,x^6,x^7,x^{10})$ and $f^3=h(x^3,x^4,x^5,x^6,x^7,x^{10})$. First, the three Poisson brackets are given by the following set of equations: $$\begin{aligned}
0\equiv\{ f,g\}&=&f_{10}g_3-f_3g_{10}+f_4g_7-f_7g_4+f_6g_5-f_5g_6,
\nonumber\\
0\equiv\{ f,h\}&=&f_{10}h_3-f_3h_{10}+f_4h_7-f_7h_4+f_6h_5-f_5h_6,
\nonumber\\
0\equiv\{ g,h\}&=&g_{10}h_3-g_3h_{10}+g_4h_7-g_7h_4+g_6h_5-g_5h_6.
\label{poisson3}\end{aligned}$$ The $\det \, N\equiv 1$ equation takes the following form: $$\begin{aligned}
0&\equiv&\left(f_4g_6-f_7g_5-f_6g_4+f_5g_7 \right)h_{10}
+\left(g_{10}f_6-g_{3}f_5-f_{10}g_6+f_{3}g_5\right)h_4\nonumber\\
&+&\left(f_{10}g_4-f_{3}g_7-g_{10}f_4+g_{3}f_7\right)h_6
+\left(g_{3}f_4+g_{10}f_7-f_{10}g_7-f_{3}g_4\right)h_5\nonumber\\
&+&\left(f_{10}g_5+f_{3}g_6-g_{3}f_6-g_{10}f_5\right)h_7
+\left(f_6g_7-f_7g_6-f_4g_5+f_5g_4 \right)h_{3}.\label{detn3}\end{aligned}$$ For a supersymmetric 3-cycles these four equations must be zero, but not necessarily identically, but in general only on the 3-cycle, i.e. modulo the ideal of vanishing functions determined by $f$, $g$ and $h$.
One particular class of solutions for these equations is of course given by all 3-cycles which are a supersymmetric 2-cycle in the $x^3$-$x^5$-$x^6$-$x^{10}$ space times the line $x^7={\rm const}$ in $x^4$-$x^7$ space: $\Sigma^{(3)}=\Sigma^{(2)}\times {\Bbb{R}}$. The corresponding choice of functions is $f=f(x^3,x^5,x^6,x^{10})$, $g=g(x^3,x^5,x^6,x^{10})$, $f$ and $g$ being real and imaginary parts of a holomorphic function $F(x^3+ix^5,x^6+ix^{10})$, and $h=x^7-{\rm const}$.
As a first and very simple check we can verify that flat, parallel M5-branes in their three possible asymptotic limits, namely being NS, NS’ or D4-branes, are indeed supersymmetric 3-cycles. For example consider the $n$ parallel NS 5-brane, positioned at $x^6_i$, $x^7_i$ and $x^{10}_i$ ($i=1,\dots ,n$). Hence the three functions $f$, $g$ and $h$ are given as $$\begin{aligned}
f&=&\prod_{i=1}^n(x^6-x^6_i),\nonumber\\
g&=&\prod_{i=1}^n(x^7-x^7_i),\nonumber \\
h&=&\prod_{i=1}^n(x^{10}-x^{10}_i).\end{aligned}$$ It is easy to show that all eqs.(\[poisson3\]) and (\[detn3\]) are identically zero. The same is of course true for $n'$ parallel NS’ 5-branes and $k$ parallel D 4-branes. In the following sections we will discuss more complicate brane intersections and bent brane configurations.
Supersymmetric 3-cycles for intersecting branes and $N=1$ brane boxes
---------------------------------------------------------------------
### Branes as quaternionic coordinates
In the following sections we like to construct the defining equations $f$, $g$ and $h$ for those supersymmetric 3-cycles, which correspond to intersecting NS, NS’ and D 4-branes, and in particular for those, which correspond to $N=1$ brane box configurations. For this purpose we would like to introduce three types of ‘coordinates’, called $s$, $s'$ and $v$, which denote the asymptotic positions in ${\Bbb{C}}^3$ of the NS, NS’ and D 4-branes respectively. These ‘coordinates’ should be one the same footing as the complex variables $s=x^6+ix^{10}$ and $v=x^4+ix^5$ of the $N=2$ (NS-D4) brane configurations.
To achieve this aim we will now extend the dimension of the space by including also the directions $x^2$ and $x^8$. This means that we are now dealing with supersymmetric 4-cycles which are embedded into the space ${\mathbb{C}}^4$, which is spanned by the directions (2,3,4,5,6,7,8,10). All our branes now fill 4 dimensions of this eight dimensional space: their world volumes completely fill $x^2$, and they are all positioned at $x^8=0$. That means that the 4-cycles, which correspond to the brane boxes of the NS, NS’ and D 4-branes are in fact nothing else than supersymmetric 3-cycles times the line $x^8=0$. As discussed in detail above, we could add yet another type of NS-branes, called NS” branes, with world volumes along the (3,4,6,8)-directions and positions in the (2,5,7,10) space. Considering intersections of all four types of branes (NS-NS’-NS”-D4) one can construct brane cube models, where the D 4-branes are now finite in the directions $x^2$, $x^4$ and $x^6$. These brane cubes provide two-dimensional gauge theories with (1,1) supersymmetry. A generic brane cube configuration corresponds to a supersymmetric 4-cycle, which is not a direct product of supersymmetric 3-cycle times ${\Bbb R}$.
The positions of the branes in ${\Bbb{C}}^4$ can now nicely described by introducing quaternionic numbers. A general quaternion $q\in {\Bbb{H}}$ has the structure $$q=q^0\sigma_0+q^1\sigma_1+q^2\sigma_2+q^3\sigma^3,$$ where $\sigma_0={{\1I}}_2$ and the $\sigma_i$ ($i=1,2,3$) are the Pauli matrices, satisfying $\sigma_i\sigma_j=\epsilon_{ijk}\sigma_k$. Clearly, a quaternion is zero, $q=0$, if all its components $q_i$ ($i=0,\dots ,3$) are vanishing. Alternatively, we can also define the quaternions via two complex numbers $z_1=q^0+iq^1$ and $z_2=q^2-iq^3$ as $q=z_1+jz_2$, where $i=\sigma_1$, $j=\sigma_2$ and $k=i\cdot j=\sigma_3$.
Now we can associate to every brane a particular quaternion $q$, which describes its asymptotic position in ${\Bbb{C}}^4$, and hence is a function of the position variables of every brane: $$\begin{aligned}
NS\,:\; \quad q_{NS}&=&q(x^6,x^7,x^8,x^{10}),\nonumber\\
NS': \quad q_{NS'}&=&q(x^4,x^5,x^8,x^{10}),\nonumber\\
D4\;\,:\, \quad q_{D4}\,\,&=&q(x^3,x^5,x^7,x^{8}).\end{aligned}$$ The four defining equations $f^m(x^2,x^3,x^4,x^5,x^6,x^7,x^8,x^{10})$ ($m=1,\dots ,4$) for the 4-cycle can be now simply written in terms of a single quaternionic function function $F(q_{NS},q_{NS'},q_{D4})$: $$F(q_{NS},q_{NS'},q_{D4}) = f^1(x^i)+if^2(x^i)+jf^3(x^i)+kf^4(x^i).$$ Of course, for a general function $F(q_{NS},q_{NS'},q_{D4})$ one still has to verify whether the 4-cycle is supersymmetric. This is not automatic unlike the case of the supersymmetric 2-cycles, where every holomorphic function corresponds to a supersymmetric 2-cycle. Specifically, as discussed in section \[SectiondCycleEquation\], the supersymmetry conditions are given by the requirement that six Poisson brackets $\{ f^m,f^n\}$ plus $(\det N-1)$ have to vanish (modulo the ideal of vanishing functions determined by the zero locus of the $f^m$). In addition, since we want the supersymmetric 4-cycle $\Sigma^{(4)}$ to be of the form $\Sigma^{(4)}=\Sigma^{(3)}\times{\mathbb{R}}_{x^8=0}$, the function $F(s,s',v)$ has to be chosen in such a way that the common zero locus of the $f^m$ always contains the line $x^8=0$. In principle it is also possible to obtain the three 3-cycle equations $f$, $g$ and $h$ by solving one of the four equations $f^m$ with respect to $x^8$ and substituting the result into the remaining equations.
To understand this procedure of constructing supersymmetric 3-cycles let us first consider case of classical brane configurations which are not bent by quantum effects. To describe flat branes we introduce the following quaternionic coordinates in analogy to the complex variables $s$ and $v$[^10]: $$\begin{aligned}
NS\,: \quad s\,&=&x^6+ix^{10}+jx^7-kx^8,\nonumber\\
NS': \quad s'&=&x^{4}+ix^5+jx^{10}-kx^8,\nonumber\\
D4\;\;: \quad v\,&=&x^3+ix^5+jx^7-kx^8.\end{aligned}$$ A single NS brane is a supersymmetric 4-cycle simply defined by the equation $F=s=0$ and likewise for the other branes. Next consider the triple intersection of $n$ parallel NS branes with $n'$ parallel NS’ branes and $k$ parallel D 4-branes. This configuration corresponds to un-bent NS and NS’ branes. In the language of field theory it leads to finite $N=1$ gauge theories. The associated quaternionic function $F$ is given by the following polynomial: $$F(s,s',v)=\prod_{i=1}^n(s-s_i)\prod_{j=1}^{n'}(s'-s_j')\prod_{l=1}^k(v-v_l).$$ Here $s_i$, $s_j'$ and $v_l$ are constant quaternionic numbers with zero $\sigma_3$-component, which denote the positions of the three types of branes. It is not a difficult but a tedious calculation to show that this function $F$ corresponds to a supersymmetric 4-cycle. However note that the supersymmetric 4-cycle equations are not identically satisfied but only on the branes themselves, i.e. only modulo the ideal of vanishing functions of the $f^m$.
### Uniform Bending – Sewing of $N=2$ models {#sectionUniformBending}
Now we will construct the supersymmetric 3-cycles which correspond to those $N=1$ brane boxes which can be obtained via the sewing or superposition of two $N=2$ subsystems. As explained in section (3.1), this means that all the NS branes as well as all the NS’ branes are bent in an uniform way.
In general, the bending of the NS and NS’ branes should be parametrized by the $x^3$ position of the D 4-branes, where $x^3$ is nothing else that the parameter which is associated to the Coulomb branch in three dimensions. In addition, we roughly expect that the bending of the NS brane is encoded in the functions $x^6(x^3)$ and $x^{10}(x^3)$, and analogously, the bending of the NS’ branes is determined by $x^4(x^3)$ and $x^{10}(x^3)$. Since $x^3$ takes in four dimensions the role of $\Lambda_{QCD}$, $x^4$, $x^6$ and $\cos{x^{10}}$ ($x^{10}$ is periodic!) should be logarithmic functions of $x^3$.
For the case of uniform bending we can be much more explicit. Consider first the uniform bending of the NS brane caused by $k$ D 4-branes. From the $N=2$ models we know that the perturbative bending is described by a two dimensional Laplace equation with the holomorphic, logarithmic solution $x^6+ix^{10}=k\log (x^3+ix^5)$. In the same way, for the other $N=2$ subsystem, NS’– k’D4, the following perturbative solution for the bending holds: $x^4+ix^{10}=k'\log ( x^7+ix^3)$. This behaviour now suggest that we define the following quaternionic coordinates which describe the asymptotic positions of the bent branes in a correct way: $$\begin{aligned}
NS: &{}&\quad t\;=e^{x^6}\cos x^{10}+ie^{x^6}\sin x^{10},
\nonumber\\
NS': &{}&\quad t'=e^{x^4}\cos x^{10}+je^{x^4}\sin x^{10},
\nonumber\\
D4: &{}&\quad v\,=x^3+ix^5+jx^7-kx^8.\label{ttv}\end{aligned}$$ Sewing together the perturbative bending of the two $N=2$ subsystems provides us with the following quaternionic function for the supersymmetric 3-cycle, which corresponds to the simple brane box shown in figure \[figureN2BraneBox\]:
For $k=k'=1$ the quaternionic function simply takes the form $$F(t,t',v)=\lbrack t-v\rbrack\lbrack t'-v\rbrack
=0.\label{n=1bend}$$ Similar one can write down an expression for arbitrary $k$ and $k'$. It is possible to show that this function satisfies the conditions for a supersymmetric cycle. The vanishing locus which is defined by $F(t,t',v)$ is a true 3-cycle; it consists out of two branches, namely the superposition of the curve $t-v^k=0$, which is a 2-cycle in the $3-5-6-10$-directions times the $x^4$-axis, together with the curve $t'-v^{k'}=0$, which represents a 2-cycle, now in the directions $3-4-7-10$ times the $x^6$-axis. After having understood the most simple $N=1$ brane box with uniform bending (see figure \[figureN2BraneBox\]) we can now construct the non-perturbative, supersymmetric 3-cycle equations which describe the generic $N=1$ brane box with uniform bending situation. It is given by the superposition of two $N=2$ subsystems: the first one consists out of $n$ NS 5-branes with $k_\alpha$ D 4-branes suspended between the NS branes (see figure \[figureBraneConfiguration\]). The second $N=2$ subsystem has the same structure, but now $n'$ NS’ branes with $k_{\alpha '}'$ suspended D 4-branes. After sewing together these two subsystems, the $N=1$ brane box has the form shown in figure \[figureUniformBraneBoxWeb\]. Now recall that, non-perturbatively, every $N=2$ system of this kind is characterized by the complex 2-cycle polynomial eq.(\[n=2pol\]). Then the sewing procedure simply corresponds to the multiplication of the two $N=2$ polynomials, where we replace the complex variables by the corresponding quaternionic variables. In this way we get a supersymmetric 3-cycle which consists out of two branches, namely the direct sum $$\Sigma^{(3)}_{n,n',k_\alpha,k_{\alpha '}'}= (\Sigma^{(2)}_{n,k_\alpha}
\times{\mathbb{R}})\oplus (\Sigma^{(2)}_{n',k_{\alpha '}'}\times{\mathbb{R}})
.$$ Note that the two superposed 3-cycles have a common volume in the 3-10 space. In general the quaternionic 3-cycle equations will have the following structure: $$\Sigma^{(3)}:\quad
F(t,t',v)=\lbrack p_{k_0}(v)t^n+\dots
+p_{k_n}(v)\rbrack\lbrack
p_{k_0'}(v){t'}^n+\dots
+p_{k_{n'}'}(v)\rbrack .\label{n=3pol}$$ This expression can be expanded and one obtains a polynomial of the following structure: $$F(t,t',v)=\sum_{\alpha=0}^n\sum_{\alpha'=0}^{n'}p_{k_\alpha}(v)
p_{k_{\alpha '}'}(v)
\, t^{n-\alpha}\, {t'}^{n'-\alpha '}.\label{unifpol}$$ Note that the degree of the polynomial in $v$ in front of each term $t^{n-\alpha}\, {t'}^{n'-\alpha '}$ precisely agrees with the number of D 4-branes in each box $\lbrack \alpha,\alpha '\rbrack$.
For example the sewing of two pure $N=2$ gauge theories with $G=SU(k)$ and $G'=SU(k')$ leads to a $N=1$ gauge theory with $N_c=N_f=k+k'$ (see figure \[figureUniformBending\]).
The corresponding 3-cycle equations are then simply given in terms of the product of two Seiberg-Witten elliptic curves of genus $(k-1)$ resp. $(k'-1)$. This strongly suggests that the instanton numbers of the pure $N=2$ Yang-Mills theory with gauge group $SU(k)$ are intimately related to those of SUSY QCD with $G=SU(2k)$ and $N_f=2k$.
At the end of this section let us compute the perturbative running of the $N=1$ gauge coupling constant. A priori we deal with two different Coulomb branches parametrized by $x^3+ix^5$ resp. by $x^3+ix^7$. In the following we will consider the common direction, $x^3$, and freeze the other directions, i.e. $x^5=x^7=0$. Now consider the box $\lbrack \alpha, \alpha '\rbrack$ with the corresponding gauge group $SU(k_\alpha+k_{\alpha '}')$. From eq.(\[n=1bend\]) we derive that $$\begin{aligned}
x^4_{\alpha '+1}-x^4_{\alpha '}&=& L+(k_{\alpha '+1}'+k_{\alpha '-1}'-
2k_{\alpha '}')\log x^3,\nonumber\\
x^6_{\alpha +1}-x^6_{\alpha }&=& L+({k}_{\alpha +1}+{k}_{\alpha -1}-
2{k}_{\alpha })\log x^3,\end{aligned}$$ where $L$ is the classical distance between the NS and NS’ branes. Then using eq.(\[n=1gaugec\]), the gauge coupling constants exhibits the following running behaviour: $$\begin{aligned}
\frac{1}{g_{\alpha,\alpha'}^2}&=&
({g_s})^{-1}\biggl(L^2+L( k_{\alpha '+1}'+k_{\alpha '-1}'+
{k}_{\alpha +1}+{k}_{\alpha -1}-2k_{\alpha '}'-2{k}_{\alpha })\log x^3
\nonumber\\
&+&(k_{\alpha ' +1}'+k_{\alpha '-1}'-
2k_{\alpha '}')({k}_{\alpha +1}+{k}_{\alpha -1}-
2{k}_{\alpha })(\log x^3)^2
\biggr).
\label{n=1gaugerun}\end{aligned}$$ Since $N_c=k_\alpha+k_{\alpha '}'$ and $N_f=k_{\alpha '+1}'+k_{\alpha '-1}'+
k_{\alpha '}'+{k}_{\alpha +1}+{k}_{\alpha -1}+
{k}_{\alpha }$, the coefficient in front of $\log x^3$ precisely agrees with the one-loop $N=1$ $\beta$-function coefficient $b_{N=1}=-3N_c+N_f$[^11].
### General $N=1$ brane boxes
In the last section we have discussed already a quite large class of $N=1$ gauge theories, namely those $N=1$ models with $N_f\geq N_c$ can be obtained by sewing $N=2$ brane configurations. On the other hand, $N=1$ gauge theories with $N_f<N_c$ like pure $N=1$ Yang-Mills and also models with chiral fermions are more general and cannot be obtained by the $N=2$ sewing procedure. Of course these models are very interesting to study dynamical supersymmetry breaking and the effect of anomalies. In general, we expect that a brane box which corresponds in field theory to a model without vacuum at finite value of the moduli, like supersymmetric QCD with $0<N_f<N_c$, leads to a 3-cycle which does not satisfy the minimal area requirement. In this case the 3 Poisson brackets may still be zero, i.e. $N\equiv N^T$, but $Re(\det \, N)$ is non-vanishing. Similarly, in chiral $N=1$ gauge theories with dynamical supersymmetry breaking we expect a stable non-supersymmetric ground state. That is the $det$ requirement will be satisfied, while the cyle won’t be a Lagrangian submanifold anymore. If furthermore the model is anomalous, the 3-cycle should not exist at all.
In the following we like to propose a specific ansatz for the 3-cycle equations for a general $N=1$ brane box model. We will again use the quaternionic formalism with quaternions $t$, $t'$ and $v$ (see eq.(\[ttv\])). Motivated by the previous discussions, our ansatz will consist out of an polynomial in these variables, where the degree of the polynomial in $t$ ($t'$) corresponds to the number of NS (NS’) branes in the corresponding brane box. Hence, for a general brane box as shown in figure (\[figureGeneralBraneBoxWeb\]) the quaternionic 3-cycle equations are assumed to take the following form $$\Sigma^{(3)}:\quad
F(t,t',v)=\sum_{\alpha=0}^n\sum_{\alpha'=0}^{n'}p_{k_{\alpha,\alpha '}'}(v)
\, t^{n-\alpha}\, {t'}^{n'-\alpha '}.\label{n=3pol1}$$ $p_{k_{\alpha,\alpha '}}(v)$ is a polynomial in $v$ whose degree is given by the number $k_{\alpha,\alpha '}$ of D 4-branes in each box $\lbrack \alpha,\alpha '\rbrack$. As already said, for a brane box which corresponds in field theory to an anomaly free gauge theory with supersymmetric vacuum, one should be able to proof [@workinpro] that this polynomial provides a supersymmetric 3-cycle. At the moment it is however not possible for us to show this in general; the main technical difficulty is the observation that the supersymmetric 3-cycle equations must be satisfied only modulo the ideal $I({\Bbb{V}})$ of functions vanishing on the 3-cycle ${\Bbb{V}}(f,g,h)$. Note however that in case of uniform bending the polynomial eq.(\[n=3pol1\]) takes the form of eq.(\[unifpol\]), namely it factorizes as in eq.(\[n=3pol\]), and the supersymmetric 3-cycle equations are satisfied.
A particularly interesting case is pure supersymmetric QCD with gauge group $SU(k)$. Here the 3-cycle polynomial should have the following structure. $$F(t,t',v)=
\sum_{\alpha=0}^2\sum_{\alpha'=0}^{2}
\, t^{2-\alpha}\, {t'}^{2-\alpha '}+p_k(v) \, t \, t',$$ where $p_k(v)$ is a polynomial in $v$ of degree $k$. For finite $R_3^{IIB}$ which includes the decompactification limit to four dimensions, $R_3^{IIB}\rightarrow\infty$, there exist a supersymmetric vacuum in field theory such the supersymmetric 3-cycle equations should be satisfied for this ansatz. On the other hand, in the 3-dimensional limit, $R_3^{IIB}\rightarrow 0$, the supersymmetric 3-cycle equations should be violated, since there is no supersymmetric vacuum in 3-dimensional pure Yang-Mills gauge theory [@workinpro].
Conclusions
===========
We have shown that SUSY 3-cycles play a similar role in $N=1$ SUSY gauge theories as the Seiberg-Witten curve in $N=2$ in the sense that their geometry encodes the holomorphic information about the gauge theory. Especially we expect the superpotential to correspond to the volume and the couplings on the Coulomb branch (if present) to the periods of the cycle [@workinpro]. We were able to construct these cycles for gauge theories that satisfy the uniform bending requirement of [@gimongremm]. The tools we used in establishing these cycles should be useful for the more general cases as well.\
See the footnote on page .\
[**Acknowledgements:**]{}
Work partially supported by the E.C. project ERBFMRXCT960090 and the Deutsche Forschungs Gemeinschaft. We like to thank Douglas Smith for collaboration during early stages of this work. In addition we acknowledge useful discussions with A. Hanany, A. Krause, Y. Oz, R. Reinbacher, S. Theisen and A. Zaffaroni.
Appendix : Derivation of the d-cycle equations {#AppendixDerivationOfTheCycleEquation .unnumbered}
==============================================
Consider the embedding map $i:d-{\rm cycle}\longrightarrow M^{2d}_{\mathbb{R}}$ and the two conditions: $$\begin{aligned}
i^\ast {\Im{\mathfrak{m}}}\Omega &=& 0 \;\;\;\; {\rm volume\;\; minimizing}
\nonumber\\
i^\ast \omega &=& 0 \;\;\;\; {\rm Lagrangian\;\; submanifold}
\nonumber \end{aligned}$$ With $\Omega=du^1\wedge\ldots\wedge du^d$ the requirement of minimal volume reads $$\begin{aligned}
0 = i^\ast{\Im{\mathfrak{m}}}\Omega&=&{\Im{\mathfrak{m}}}(du^1(\xi_1,{\ldots},\xi_d)\wedge
\ldots\wedge
du^d(\xi_1,{\ldots},\xi_d))\nonumber\\
&=&{\Im{\mathfrak{m}}}( \epsilon_{i_1{\ldots}i_d}u^{i_1}_{\xi_1}u^{i_2}_{\xi_2}{\ldots}u^{i_d}_{\xi_d})\;
d\xi^1\wedge{\ldots}\wedge d\xi^d\nonumber\\
\Rightarrow\;\;\;\;
0
&=&\frac{1}{2i}(\epsilon_{i_1{\ldots}i_d}u^{i_1}_{\xi_1}{\ldots}u^{i_d}_{\xi_d} -
\epsilon_{i_1{\ldots}i_d}\bar{u}^{i_1}_{\xi_1}{\ldots}
\bar{u}^{i_d}_{\xi_d} )\nonumber\\
&=&\frac{1}{2i}(\epsilon_{i_1{\ldots}i_d}u^{i_1}_{\xi_1}{\ldots}u^{i_d}_{\xi_d}
-\epsilon_{i_1{\ldots}i_d} N^{i_1}_{j_1}{\ldots}N^{i_d}_{j_d} u^{j_1}_{\xi_1}
{\ldots}u^{j_d}_{\xi_d})\nonumber\\
&=&\frac{1}{2i}(\epsilon_{i_1{\ldots}i_d}
-\epsilon_{j_1{\ldots}j_d}N^{j_1}_{i_1}{\ldots}N^{j_d}_{i_d})
u^{i_1}_{\xi_1}{\ldots}u^{i_d}_{\xi_d}\nonumber\\
&=&\frac{1}{2i}\left(1-\det\,N\right)
\cdot\frac{\partial (u^1,{\ldots},u^d)}{\partial (\xi_1,{\ldots},\xi_d)}
\nonumber\end{aligned}$$ which yields $$\begin{aligned}
\det \, N|_{{\Bbb{V}}(f^1,{\ldots},f^n)} = 1\;\;\;\;
&{\rm or\; for\; short}&\;\;\;\;
\det\, N \equiv 1.\nonumber\end{aligned}$$ For the calculation of the det-equation the following relation is useful. $$\begin{aligned}
\det\, N &\equiv& 1\;\;\;\Leftrightarrow\;\;\;
\det\, M - (-1)^d \det\, \bar{M}\equiv 0\nonumber\end{aligned}$$
Now we turn to the second equation. Choosing the canonical Kähler (symplectic) form $\omega = \frac{1}{2i}\sum\limits_{i} du^i\wedge d\bar{u}^i$, the pull back operation results in $$\begin{aligned}
0 = i^\ast\omega &=&\frac{1}{2i}\sum\limits_{i}du^i\left(\xi_1\ldots\xi_d\right)
\wedge d\bar{u}^i\left(\xi_1\ldots\xi_d\right)\nonumber\\
&=& \frac{1}{2i}\sum\limits_{i}\left(\sum\limits_k u^i_{\xi_k}d\xi_k\right)
\wedge\left(\sum\limits_l\bar{u}^i_{\xi_l}d\xi_l\right)\nonumber\\
&=& \frac{1}{2i}\sum\limits_{k<l}\sum\limits_{i} \left[
u^i_{\xi_k}\bar{u}^i_{\xi_l} -
u^i_{\xi_l}\bar{u}^i_{\xi_k}
\right] d\xi_k\wedge d\xi_l\nonumber\end{aligned}$$ $$\begin{aligned}
\Rightarrow\;\;\; 0 &=& \sum\limits_{i} \left[
u^i_{\xi_k}\bar{u}^i_{\xi_l}-
u^i_{\xi_l}\bar{u}^i_{\xi_k}
\right] \nonumber\\
&=& \sum\limits_{i} \left[
u^i_{\xi_k}\left(\sum\limits_m N^i_m u^m_{\xi_l}\right)-
u^i_{\xi_l}\left(\sum\limits_m N^i_m u^m_{\xi_k}\right)
\right] \nonumber\\
&=& \sum\limits_{i}
u^i_{\xi_k}\left(\sum\limits_m N^i_m u^m_{\xi_l}\right)-
\sum\limits_{i}
u^i_{\xi_l}\left(\sum\limits_m N^i_m u^m_{\xi_k}\right)
\nonumber\\
&=& \sum\limits_{i}
u^i_{\xi_k}\left(\sum\limits_m N^i_m u^m_{\xi_l}\right)-
\sum\limits_{m}\left(\sum\limits_i
u^i_{\xi_l} N^i_m\right) u^m_{\xi_k}
\nonumber\\
&=& \sum\limits_{i}
u^i_{\xi_k}\left(\sum\limits_m N^i_m u^m_{\xi_l}\right)-
\sum\limits_{i}\left(\sum\limits_m
u^m_{\xi_l} {N^T}^i_m\right) u^i_{\xi_k}
\nonumber\\
&=& \sum\limits_{i,m}\left(N^i_m-{N^T}^i_m\right)u^i_{\xi_k} u^m_{\xi_l}
\nonumber\end{aligned}$$ which is satisfied if we set $N\equiv N^T$. However, as it stands, this requirement is sufficient, only. Now we intend to give a proof that the condition is necessary, too.
To proof $N\equiv N^T$ we remember some facts from symplectic geometry especially various ways of characterising Lagrangian planes in symplectic vector spaces. The utility of this investigation rest on the simple observation that our conditions on the d-cycle to be a special Lagrangian submanifolds are in fact conditions on its tangent bundle, i.e. Lagrangian planes locally.\
To begin with, we consider a complex vector space ${\mathbb{C}}^d$ furnished with a Hermitian structure $$\begin{aligned}
<x,y>\, = \sum\limits_i x_i\bar{y}_i = g(x,y) + i\,\sigma(x,y) \nonumber\end{aligned}$$ which splits into an Euclidean metric $g$ and a symplectic form $\sigma$. One can check that $\sigma$ coincides with $$\begin{aligned}
\omega = \frac{1}{2i}\sum\limits_i du^i\wedge d\bar{u}^i. \nonumber\end{aligned}$$ given before. Therefore we identify both objects. The two-form $\omega$ is non degenerated, antisymmetric and bilinear. With help of $\omega$ we can define the notion of symplectic orthogonality.
The orthogonal complement of a vector subspace $E\in {\mathbb{C}}^d$ is defined by $$\begin{aligned}
E^\perp = \{ x\in {\mathbb{C}}^d \mid \omega(x,E) = 0 \} \nonumber
\end{aligned}$$
In the special case that $E=E^\perp$ we call $E$ a Lagrangian plane. Obviously on a Lagrangian plane the symplectic form restricts to zero. So we recognize the content of the constraint $i^\ast\omega=0$. It simply states that all tangent spaces to the supersymmetric cycle are Lagrangian planes embedded in the tangent space of the embedding space. Here we collect some facts:
1. $Sp(E)$ operates transitively on Lagrangian planes
2. Since $U(d)$ preserves the Hermitian form, it is contained in $Sp(E)$.
3. By $\Lambda(d)$ we denote the Gra[ß]{}mannian of Lagrangian planes
4. $\lambda\in\Lambda(d)$ is characterized by choosing an orthonormal basis $(a_1,\ldots ,a_n)$ with respect to the Euclidean metric $g$. But then it is orthonormal with respect to the Hermitian form, too: $$\begin{aligned}
< a_i,a_j >\, = g(a_i,a_j) + i\,\omega(a_i,a_j)
\buildrel !\over = \delta_{ij}, \nonumber
\end{aligned}$$ i.e. the matrix $a=(a_1,\ldots , a_n)$ is unitary. The other direction works, too. Hence $$\begin{aligned}
\lambda\in \Lambda(d) \;\; \Leftrightarrow\;\; \exists\, a\in U(d),\;
\lambda = a({\mathbb{R}}^d) \nonumber
\end{aligned}$$
5. Obviously each Lagrangian plane will be stabilized by any element in $O(n)$, i.e. we can regard the Gra[ß]{}mannian of Lagrangian planes as the quotient space $$\begin{aligned}
\Lambda(d) = \frac{U(d)}{O(d)} \nonumber
\end{aligned}$$
How can we define a projection from $U(d)$ onto $\Lambda(d)$? We observe that two elements $a$ and $a'$ determine the same Lagrangian plane, iff $$\begin{aligned}
\lambda = a({\mathbb{R}}^d) ={a'}({\mathbb{R}}^d)
\Leftrightarrow\;\;\;
a\bar{a}^{-1} = {a'}{\bar{a}}^{\prime -1}, \nonumber\end{aligned}$$ which is constant on the $O(d)$-orbits of the fibration. Now we can identify $\Lambda(d)$ with the image of the projection map $$\begin{aligned}
\pi : U(d) &\rightarrow& \Lambda(d)\nonumber\\
a &\mapsto& \lambda = a\bar{a}^{-1} \nonumber\end{aligned}$$ By abuse of language we denote the matrix representative $a\bar{a}^{-1}$ of the Lagrangian plane $\lambda=a({\Bbb{R}}^n)$ by $\lambda$ again. But how can we associate the geometrical object with this artificial matrix representative? The connection between the matrix $\lambda$ on the one side and the concrete Lagrangian plane $\lambda$ on the other side is given through the central equation $$\begin{aligned}
x\in\lambda\; \Leftrightarrow\; x=\lambda\bar{x} \nonumber \end{aligned}$$ In the last formula we recognize the familiar equation (\[lemma\]). But now we know, that we can represent $\lambda$ as $\lambda=a\bar{a}^{-1}$ and this yields straight forward $$\begin{aligned}
\lambda^{+} &=& {\bar{a}^{-1^{+}}}a^{+} = {a^{-1}}^T a^{-1} = \bar{a}a^{-1}
= \bar{\lambda} \nonumber\\
\Rightarrow\;\; \lambda^T &=& \lambda \nonumber\end{aligned}$$ But then we can finally conclude by identifying $\lambda = N^{-1}$ and performing some mild manipulations that $$\begin{aligned}
N \equiv N^T\nonumber\end{aligned}$$
Appendix : Some facts from Hamiltonian dynamics {#AppendixLiouville .unnumbered}
===============================================
[(Liouville)]{}
Suppose $(f^1,\ldots, f^d)$ is a set of smooth functions on a symplectic manifold $M^{2d}$ that are pairwise in involution, i.e. $\{f^i,f^j\}=0$. Let $M_{\xi}$ be the joint level surface determined by a system of equations$f^1(x)=\xi_1,\ldots,f^d(x)=\xi_d$. Suppose the functions are functionally independent on $M_\xi$ (that is, the gradients of the functions are linearly independent at each point of $M_\xi$). Then the following assertions are true:
1. The level surface $M_{\xi}$ is a smooth $n$-dimensional submanifold that is invariant with respect to the flows determined by the vector fields $X_{f^i}$.
2. The connected components of $M_\xi$ are diffeomorphic to $T^k\times{\mathbb{R}}^{d-k}$.
3. If $M_{\xi}$ is compact and connected, then it is diffeomorphic to the $d$-dimensional torus $T^d$
Now we want to show how we utilize this theorem for our purposes. At first we identify the functions $(f^1,\ldots, f^d)$ as the defining equations of our searched for intersection. Then we start with such functions $f_i$, such that the gradients are linear independent everywhere.\
Then the gradients span the normal directions to our d-cycle. Can we construct in a canonical way a set of vector fields, which form a basis for the orthogonal complement of these normal directions? To answer this questions we have a look on some simple properties of these vector fields and very natural associated objects. We start with a simple but important definition:
[(Hamiltonian vector field)]{}[A Hamiltonian vector field $X$ is defined by the property $$\begin{aligned}
d(X{{\raisebox{0.2ex}{$\,\lrcorner\:$}}}\omega) =0,\nonumber
\end{aligned}$$ i.e. ${\mathcal{L}}_X\omega = 0$ which reflects the property of the Hamiltonian flow to preserve the symplectic form. In the case of mild topology closeness implies exactness and we can write $$\begin{aligned}
df + X_f{{\raisebox{0.2ex}{$\,\lrcorner\:$}}}\omega = 0\nonumber
\end{aligned}$$ assigning to the Hamiltonian vector field its generating function $f$. ]{}
We will show that the Hamiltonian vector fields corresponding to the $f_i$ do span the orthogonal complement mentioned before. At first we observe that $X_f\perp grad\,f$ by construction. By using the “symplectic involution” $\sigma$ given by $$\begin{aligned}
\sigma&=&\left(\begin{array}{cc}
0 & -{\1I}_d \\
{\1I}_d & 0
\end{array}\right) \;\;\;\;\;\; \sigma^2 = -{\1I}_{2d} \nonumber\end{aligned}$$ we can write $X_f$ as $X_f=\sigma\cdot grad\, f$. Sometimes $X_f$ is called the symplectic gradient, therefore. Now we calculate $$\begin{aligned}
<grad\,f,\sigma\cdot grad\,f>\,&=&\,-<\sigma^2\cdot grad\,f,
\sigma\cdot grad\,f>\nonumber\\
&=&\,-<\sigma\cdot grad\,f, \sigma^+\sigma
\cdot grad\,f> \nonumber\\
&=&\,-<grad\,f,\sigma\cdot grad\,f>\nonumber\end{aligned}$$ Evidently $grad\,f$ and $X_f$ are orthogonal vectors. But is $X_{f^i}$ orthogonal to all gradients $grad\,f^i$? Now we exploit the integrability condition. Since all functions do commute with respect to the Poisson bracket we conclude: $$\begin{aligned}
0 \buildrel !\over = \{f^i,f^j\} &\buildrel Def \over
=& \omega(X_{f^i},X_{f^j})
= X_{f^j}{{\raisebox{0.2ex}{$\,\lrcorner\:$}}}X_{f^i}{{\raisebox{0.2ex}{$\,\lrcorner\:$}}}\omega
= -X_{f^j}{{\raisebox{0.2ex}{$\,\lrcorner\:$}}}df^i
= -df^i(X_{f^j}) \nonumber\\
&=& -< grad\,f^i,\sigma\cdot grad\,f^j > \nonumber \end{aligned}$$ So we recognize that our integrability condition guarantees the orthogonality of the span $X_{f^i}$ to the normal directions. Since the normal span is linear independent and $$\begin{aligned}
<X_{f^i},X_{f^j}>\,&=&\,<\nabla\,f^i,\nabla\,f^j>\nonumber\end{aligned}$$ the Hamiltonian vector fields are independent, too. Now we have to care for the Lagrangian property. Does the symplectic form $\omega$ vanish on the subspace spanned by the $X_{f^i}$? Reading the last formula in the other direction $$\begin{aligned}
\omega(X_{f^i},X_{f^j}) &=& \{f^i,f^j\} \nonumber\end{aligned}$$ this wish becomes true, too. The next question touches the sore spot of the whole business. Is the space spanned by the $X_{f^i}$ tangent to the level surface $M_\xi$? We want to investigate the Hamiltonian flow generated by $f^i$. Obviously the Hamiltonian $f^i$ is a constant of motion. Further since the other $f_j$ are in involution with $f^i$ they are constants of motion, too. Hence the level surface $M_\xi$ is preserved by all Hamiltonian flows corresponding to the associated Hamiltonian vector fields $X_{f^i}$. But for $f^i$ to be a constant of motion $$\begin{aligned}
X_{f^j}(f^i) \buildrel ! \over = 0, \nonumber\end{aligned}$$ i.e. $X_{f^i}$ is tangent to $M_\xi$ everywhere.
The level surface $M_\xi$ is a Lagrangian submanifold.
[^1]: [email protected]
[^2]: [email protected]
[^3]: [email protected]
[^4]: An alternative, but more restricted construction of chiral $N=1$ models via orientifolds was introduced in [@Landsteiner; @alter].
[^5]: Alternatively, within the so called elliptic models, the coordinate $x^6$ is compact, such that $k_0=k_n$ and the correspond D 4-branes are also finite and suspended between the first and the $n^{\rm th}$ NS 5-brane.
[^6]: Like for the $N=2$ brane models, the $N=1$ brane box models can be related to fractional branes via T-duality [@haur].
[^7]: In [@haur] they also allowed sewing in a third kind of $N=2$ system connected to diagonal lines in the box setup. This doesn’t lead to uniform bent models anymore and should hence be treated separately.
[^8]: see the footnote on page
[^9]: After finishing and submitting our paper we became aware of [@HL] where it was already stated, however without detailed proofs, that a special Lagrangian submanifold is determined by the eqs. (\[detcond\], \[poisson\])
[^10]: The NS”-brane corresponds to the quaternion $s''=x^{10}+ix^5+jx^7-kx^2$.
[^11]: It was already observed in refs.[@haur; @AB] that the brane box models with uniform bending lead to the correct $N=1$ $\beta$-function coefficients.
|
{
"pile_set_name": "ArXiv"
}
|
With his license, Shulgin invented and tested over 230 unique drugs. Keeping rigorous notes, he eventually published a book detailing how each one was manufactured, and what its effects were. In 1994, two years after publishing a compilation of this work, he had drawn too much of a public eye to his controversial research and questionable self-experimentation. The DEA raided his lab, fined him for breaching license terms, and revoked his research license.
If this whole thing seems ridiculously dangerous and illegal, that's because it absolutely would be. Yet for over 20 years, Shulgin had a strong relationship with the US Drug Enforcement Administration (DEA), where he regularly gave talks to agents and even wrote their definitive texts on pharmacology. In return, the DEA awarded him several service plaques and gave him a research license to produce Schedule I drugs, which are the most highly restricted substances in the US.
Dr. Alexander "Sasha" Shulgin (1925 - 2014), was an incredibly productive scientist. While he enjoyed success as an industry chemist, he left his job in 1965 to pursue independent studies in a laboratory he built behind his house in Lafayette, California. His research was fair from mainstream chemistry: it entailed him inventing new psychoactive drugs and testing them with himself, his wife, and his friends.
Because scientific research is usually presented impersonally, it's easy to forget that there's an incredible amount of toil, frustration, and excitement behind every single discovery. And the story of a discovery doesn't just end after a paper is published, it continues to grow so long as similar research is being done. This post will tell the story behind some unusual research and investigate a question raised by its findings.
Alexander Shulgin in his laboratory, discussing his research
While Shulgin's research was shut down, his work continues to heavily influence pharmacological research through his inventive methods and informative publications. Today, we look at one notable compound that Shulgin invented, DiPT.
DiPT: A Pitch-Distorting Drug
Most of the 230 drugs Shulgin invented were hallucinogens, and DiPT is no exception. But while DiPT is structurally similar to traditional hallucinogens, which tend to cause visual distortions, DiPT does not affect a person's vision. Instead, it changes the pitch and tone of what is heard. For example:
"There was a decrease in high frequency acuity with an unusual tonal shift of all frequencies to a lower pitch... All familiar sounds became foreign, including the chewing of food. No effects were noted with respect to clarity of speech, and both comprehension and interpretation were normal. Music was rendered completely disharmonious although single tones sounded normal. There were no changes in vision, taste, smell, appetite, vital signs, or motor coordination." (Shulgin and Shulgin, 1997)
Because DiPT is completely unique in its ability to distort hearing, some researchers have been eager to examine its microbiological behavior to figure out what exactly can happen in somebody's brain to distort pitch. Thinking broadly, this could also inform the science of tone deafness, which causes about 5% of the population in the United States to misperceive pitch.
The chemical structure of DiPT (N, N-Diisopropyltryptamine)
Neurobiology of DiPT
All psychoactive drugs, which alter one's experience, work by acting as neurotransmitters in the brain. Neurotransmitters bind to receptors on neurons in the brain, triggering or repressing activity in that particular cell. For example, dopamine binds to dopamine receptors in the reward system in the brain, which stimulates activity in the brain cells there. Lets look at some common neurotransmitter receptors:
Receptor Type Role in Brain Color in Figure Serotonin Regulates mood, appetite, sleep Beige Dopamine Mood regulation, reward Red Adrenergic Stimulation, alertness, arousal Green Histamine Regulation of wakefulness, body temperature, and apetite Yellow
All classic hallucinogens (like LSD) work in part by stimulating similar receptors. However, each unique drug has a certain "receptor profile" that shows how different drugs binds to different receptors. Each drug's unique receptor profile is may help us understand why intoxication of different compounds can cause such different experiences. Let's look at the receptors that DiPT binds to, as determined by a study in 2010. If any of these receptors are unique to DiPT, perhaps we can discover a molecular explanation for this unique auditory phenomena!
The receptor profile for DiPT. The left axis indicates how likely DiPT
is to bind to that particular receptor. Refer to the table above for
color codes of common receptor types. From Ray, 2010.
After examining each of these receptors, in turns out that every single receptor DiPT binds to is also bound to by hallucinogens that are known to cause visual distortions, such as psilocin, LSD, and DOI. Unless DiPT engages receptors interactions that we are not accounting for (which is very possible), it is not obvious which molecular-level behaviors account for the auditory affects of DiPT. This is a common thing to find in science: a promising pursuit might not actually take you anywhere conclusive. My personal experience is that whenever I look to answer a particular hypothesis, I end up finding very few real answers, and a ton of new things to test.
Conclusion
When studying something as complicated as hallucinations, there are no easy answers, and many interesting questions. Animal research into DiPT has shown that rats are able to discriminate between DiPT and other hallucinogens, and mice under the influence of DiPT are less likely to learn to recognize tones, which may reflect that they experience pitch distortion.
The discovery of a compound DiPT teaches us that we in fact understand very little about the process of hearing in the brain, and gives us a tool to investigate. Future research directions could include continued microbiological research on receptors, neuroimaging to examine activity in different parts of a brain under the influence of DiPT, or continued animal research.
Sources
Arnie Battaglene. (2007). Sasha Shulgin in his lab.
Bennett, D. (2005, January 30). Dr. Ecstasy. The New York Times. Retrieved from https://www.nytimes.com/2005/01/30/magazine/dr-ecstasy.html
Carbonaro, T. M., Forster, M. J., & Gatch, M. B. (2013). Discriminative stimulus effects of N,N-diisopropyltryptamine. Psychopharmacology, 226(2), 241–246. https://doi.org/10.1007/s00213-012-2891-x
Hamlet, W. R. (2010). The effect of N, N-Diisopropyltryptamine on modified acoustic startle reflex tasks. Retrieved from https://www.researchgate.net/publication/261322305_The_effect_of_NN-Diisopropyltryptamine_on_modified_acoustic_startle_reflex_tasks
Kalmus, H., & Fry, D. B. (1980). On tune deafness (dysmelodia): frequency, development, genetics and musical background. Annals of Human Genetics, 43(4), 369–382. https://doi.org/10.1111/j.1469-1809.1980.tb01571.x
Power, M. (2014, June 3). Alexander Shulgin. The Guardian. Retrieved from http://www.theguardian.com/science/2014/jun/03/alexander-shulgin
Ray, T. S. (2010). Psychedelics and the Human Receptorome. PLOS ONE, 5(2), e9019. https://doi.org/10.1371/journal.pone.0009019
Shulgin, A., & Shulgin, A. (1997). Tihkal: The Continuation (First Edition edition). Berkeley: Transform Pr. Retrieved from https://www.erowid.org/library/books_online/tihkal/tihkal04.shtml
Shulgin, A. T., & Carter, M. F. (1980). N, N-Diisopropyltryptamine (DIPT) and 5-methoxy-N,N-diisopropyltryptamine (5-MeO-DIPT). Two orally active tryptamine analogs with CNS activity. Communications in Psychopharmacology, 4(5), 363–369. Retrieved from http://europepmc.org/abstract/med/6949674
Related posts
Steemit for Students – more about this post series
How to Keep Track of Facts – tips for citing information
|
{
"pile_set_name": "OpenWebText2"
}
|
Image: Yle / Mika Mäkeläinen
The clearing of the Amazon rainforest has revealed mysterious patterns in the earth. The large-scale patterns are best visible from the air, where Finnish archaeologist Martti Pärssinen takes pictures of them.
The geometrical patterns have been made with earth mounds and moats. Many of them are huge, with sides measuring up to a few hundred metres. Over 300 such structures have been discovered in the Brazilian state of Acre alone.
The construction feat involved can be compared to that achieved by those that built the pyramids in Egypt.
Pärssinen points out that people here must have expended as much energy as the workers in Egypt, shaping the earth into vast motes and mounds, in complex, multiple structures.
Sensational finds
The find has been a sensation for researchers, as it was previously thought that much of the Amazon was merely sparsely populated, wild rainforest.
Graduate student Ivandra Rampanelli from Spain's University of València says the patterns are rewriting the history of habitation of the Amazon – an area that was before seen as devoid of great civilizations.
Radiocarbon dating shows the oldest patterns were built some 2,000 years ago, and that the civilisation suddenly ended 700 years ago, possibly due to foreign diseases brought by Europeans.
Now the archaeological excavations are shedding light on the life of this ancient people. Record quantities of ceramics have been unearthed, including 300 kilograms of pot shards.
Some of the ornamentation on these is totally new to science, while other figures prove connections with faraway populations in the Andes.
Pärssinen couldn’t be more excited, noting that this may be one of the last places in the world where such rich findings can still be made. Almost everything that is discovered here brings new knowledge of the past, he says.
You can watch a TV report on this story here.
|
{
"pile_set_name": "OpenWebText2"
}
|
PROLOGUE
"You're doing a good job Ivan," Felix informed his agent, "Keep it up."
Ivan smiled, he enjoyed obeying his boss. This hit would be his second hit; the first was to eliminate a drug dealer. He knew he was a loyal agent; trustworthy.
He watched his target from a scope in the distance. The targets name was James Killer; he knew that and he knew that he had to kill him. They were outside of their safe house; there were five of them, including the target.
The rest of them were unfamiliar to him, they stood and sat around by the stairs out front of their safe house.
"You see your target?" Felix asked him.
"Yes," He informed, "When do I kill?"
"Patience; wait until the right moment, then shoot him." Felix ordered.
Ivan gripped the sniper rifle and focused on his target as has James swayed back and forth. His lips moved but Ivan couldn't hear what was said.
Ivan reduced his heart rate, focused on his target, and fired.
CHAPTER 1
DEREK
After I joined the Triton Agency, Felix gave me a whole new life. A new amazing safe house, a team, and all the weapons I could want.
I did miss the Crew; after all I've been with them for as long as I could remember. But this was a new beginning for me, I got what I wanted.
Ever since I took that deal, I haven't talked to or seen my friends. I guess I couldn't blame them; I wouldn't want to see me after what I had done to them.
It was kind of like what Ken did to us, the bastard. But I feel for him, it was a good deal, this was a good deal.
"Are you listening to me?" Felix asked.
I came back to the real world, "Yeah, you were talking about something to do with a hit job."
"No, I was talking about a hit job that I am assigning you and your crew."
I smiled, "Oh, well in that case."
He laughed, "Yeah, I want you guys to eliminate your old crew."
My eyes got wide, "Are you kidding?"
He shook his head, "No, it's about time, and you're the perfect guy to do it."
I shook my head, "No, I won't do it, they're my friends."
"They were your friends, in case you haven't noticed, you're their enemy."
I rolled my eyes.
"Derek, it has to be done. You know that."
I sighed, "If it has to be done, how would you like it to go?"
He smiled, "That's for you to decide."
I nodded, "Okay then, I'll do it. But only if you pay me double."
He held out his hand, "Deal."
We shook and I smiled, "When would you like it done?"
"By the end of the week; this Friday,"
I nodded, "Sure thing, boss."
COLE
We were at the hospital all night. After getting the news that Derek had quit to join the new uprising Triton Agency, we had called James up to help with settling things.
I couldn't believe it, Derek, the one who ties us all together, quit.
But when we called James we talked outside, then the unexpected happened. The bullet penetrated his shoulder, didn't kill him—scared us half to death.
The doctor told us he was going to be alright. We needed him to help us decided on what to do with Derek, he was the enemy now.
"You alright boss?" Joey came up to me.
I looked up at him and smiled, "Yeah man, it's all good."
"You seemed a little bummed." He said sitting down next to me.
I sighed, "A little."
"I know it's tough, I mean we did lose a dear friend."
I smiled and looked down.
"But, we'll get through this. We always do Cole." He finished.
"I know, it's just Derek was the last person I'd expect to betray the team."
"Same here, I don't know what changed him."
Ken came up to us, "I know who it was; it was fucking that asshole Felix."
"You really think he has something to do with this?" I asked.
"Or Kyle," Joey guessed, "He could have something to do with it."
"They both probably do," I informed, "That's why we need to take them out."
"What about Derek?" Sean asked coming up to us, "We can't kill him."
"I don't know man, he is the enemy now." Ken crossed his arms.
"Don't say that!" Sean yelled.
"You were the one who said it!" Ken argued.
"Lower your voices." I ordered.
"He started it." Sean rolled his eyes.
"You're like a child." I sighed.
"At least... I'm not a fish!" He huffed.
I rolled my eyes.
"We can't stay here." Joey sighed, "Let's go to the safe house and I'll call Vern and Dane."
I got up and nodded, "Okay, good idea."
JOEY
I felt bad for Cole. Derek was the second person to betray the Crew. I don't know what he was thinking; we needed him to complete the Crew.
We left the hospital and headed back to the safe house. We were all unhappy that Derek left, I mean who wouldn't be?
But I guess we had to make the best of it, the Crew must move on, we have a job to do.
We haven't talked to or went back to the P.O.O.P Agency since Derek left. I mean, how can we confront them about him leaving? Boss can't do it, and sure of hell Kenneth can't do it either.
That leaves me and the idiot, and hell; Sean can't even tie his shoe. So I would be the one to confront the agency.
"Hello? Yeah, Vern listen, we kind of need your help." I said in the phone.
"What's up?" Vern asked.
"We're in a tight spot, James is in the hospital and Derek is now the enemy, life's tough." I informed.
"Wait, why is James in the hospital?"
"He got shot."
"Damn, okay want me to call Dane?"
I sighed, "Yeah, please."
"Okay, we'll be over in a couple."
"Thanks man."
"Hey, what're friends for?"
I laughed and hung up.
"When they coming?" Ken asked.
I put my phone away, "Soon."
He nodded.
We were all in the safe house slouching around, depressed. The television was on but no one was watching it. Ace sat next to me on the floor. I put my hand down and pat him on his head.
He was a loyal dog, trustworthy like most dogs. Man's best friend.
"I wonder if Derek was the one who shot James." Ken said.
"Why would he shoot him?" I asked, "No motive."
He nodded, "Then Felix did because he always hated him."
"I'm pretty sure that Felix would kill me before he tried to kill James." Cole informed.
"Because we know how much Felix hates your ass." Ken smirked.
I laughed, "Like the time he came to me and asked if you had a boyfriend because you were so gay."
"He said that?" They asked at the same time.
I made a straight face, "Yeah, why?"
"Sounds like something Sean would say." Ken laughed.
Sean laughed, "Yeah, we are related."
"No you're not." I spit, "But you two are so idiotic, you might just be related."
"S'not fair." Sean crossed his arms, "Why so mean?"
I rolled my eyes, "And you're not?"
He shook his head, "No, I am the nicest person alive."
"That would be Obama." Ken informed.
"What?" I asked confused, "Who is that?"
"What!" Cole yelled, "You don't know who Obama is?"
I shook my head.
"Yet you watch TV." Ken rolled his eyes.
"Still..." I laughed, "Who is it?"
"The President of the United States," Cole informed.
"Really? I thought that was Abraham Lincoln." I knit my eyes.
"What year are you in?" Cole asked.
"1910." Sean laughed.
We looked at him. The doorbell rung and we jumped up.
"It's only Vern and Dane." I informed going to the front door.
Ace barked and I shushed him. I opened the front door and was surprised at what I saw. A man had a pistol pointed at my head. He was in a spy outfit and had a sniper rifle around his back.
"Well it ain't Vern." I informed.
"You okay?" Cole asked.
I held up my hands as the man motioned me to hold them up.
"Joey?" Cole asked again.
I backed up as he came forward.
"Who are you?" Ken asked as the man smiled.
"The name is Ivan." He said.
"And why do you have my bud at gun range?" Ken asked.
"Aw." I smiled.
"Shut up." Ken fumed.
"I'm here on behalf of the Triton Agency." Ivan said.
"What do they want?" Cole asked.
"You guys dead, but I can't do that because I need your help." He informed.
"For what?" Ken asked.
"Felix Morris, you know him?"
They nodded.
"He tried to kill me after I shot your friend." Ivan said.
"You shot James?" I asked.
He looked at me, "I was ordered to take him out."
I charged but he cocked the gun and stopped me in my tracks.
"Why do you need our help?" Cole asked him.
He looked at him, "Your team is the enemy of the Triton Agency, and you used to work for them before you destroyed them. Correct?"
Cole studied him, "Yeah."
"What's your point?" Ken urged.
"We can work together to bring them down." Ivan offered.
"We don't work with murderers." I spit.
He looked at me and sighed then moved the gun over and fired.
SEAN
When the gun went off we jumped, Joey dropped to the ground obviously in pain.
"He was getting annoying." Ivan lowered his weapon.
"So you fucking shoot him?" Ken asked.
Ivan stepped forward and shrugged, "Can you help me or not?"
"Not now!" Cole yelled.
"I'm sorry." He cried.
"Cole, fuck this guy up." Joey held his bloody wound.
"I would, if I had a gun." Cole informed.
I held up my fists, "I'll fuck him up boss."
"Man back up!" Ivan raised the gun to me.
I stopped and lowered my hands, "Never mind."
"I need your help, the agency... they need to go down, again." He said.
"What makes you think we're the ones that can take them out?" Cole asked.
"Because you took them out once before," He responded, "I believe you can do it again."
"Yeah but, we had James to help us do it to." I looked at him.
He looked down, "He's alive."
"Yeah, we were the ones who took him to the hospital after you shot him." Ken crossed his arms.
"Like I said, I was sent to kill him, be lucky I didn't kill him." He rolled his eyes.
I looked over at Joey who lay on the ground holding his bloody shoulder. I looked up at Ivan, "You shot two of our friends, what makes you think we'll help you?"
I looked at me and raised his gun. Cole stepped in front of me, "Now that's enough, no one is getting shot on my watch."
Joey huffed, "Uh, hello?"
"This is your team?" Ivan asked Cole, "I was told that Derek Johnson was a part of your team also, before he... quit."
"He betrayed us, which is different." Cole said.
"He's no longer a part of your stupid Crew; it's the same to me." Ivan snapped.
Ken stepped forward, "I'm about sick of your attitude."
Ivan smiled, "Aren't you supposed to be the one with anger issues?"
Ken balled his fist and came at him but Ivan raised the gun and Ken backed off.
"Funny how intimidating a gun can be." Ivan laughed.
"Funny how you think it's funny but it's really not." I laughed.
"It's funny how you're so gay." Ivan cocked his head to the side.
I gave him the finger and he looked at Cole, "This is the last time," He lowered the gun to Joey, "You either help me, or I kill your man."
I huffed, "What're we gay now?"
"You can be as gay as you want man." Ivan laughed.
I knit my eyes, "Dick..."
Ivan looked at Cole, "You have ten seconds to answer me or not. Ten, nine, eight,"
Cole bit his lip.
"Seven, six, five, four,"
Cole looked at us.
"Three... Two—"
"Fine! We'll help you! Just, put down your weapon." Cole sighed.
"About damn time," Joey seethed.
Ivan lowered the gun and put it away, "Thanks, how can we start?"
Cole sighed and rolled his eyes, "I'm the leader, and I'll tell you what to do.
"Oh, you're the leader?" Ivan asked, "Is that why Derek betrayed you? Because you were the sucky ass leader?"
Cole came at him, "You fucking asshole!"
Ivan crossed his arms as Ken and I held back Cole. Ivan laughed, "I heard if you get mad, that it's the truth. And look at you."
Cole backed off, "If we're going to help you, you better stop that cocky attitude."
Ivan crossed his arms and sighed, "Sorry, it's who I am."
"So you're saying that you're a cocky bastard?" I asked.
He laughed, "Yeah, I am."
"We can tell." Ken mumbled.
Ivan nodded, "If I calm down, will you help me?"
Cole sighed, "I guess, but we'll need James, and you can't tell him you tried to kill him; he won't help."
"But boss, he's still in the hospital." Joey informed.
"He won't be in there long; they're getting filled up by the minute." He said.
Ivan took a step forward, "Ya'll cool now? Can I come in?"
Joey got up and held his shoulder, "You can come in, but I do not like you so far."
Ivan stepped forward, "Okay, and sorry. I just... got annoyed."
"Wait until you meet Sean." I smiled.
"Who's that?" He asked.
I held up my hand, "Me."
He nodded and went over to Joey, "Here, let me help you stitch that wound up."
"Don't touch me!" Joey moved away.
Cole sighed and went to shut the door. Ken came up to Joey who sat in a chair by the kitchen.
"Do you want me to stitch it up?" He asked.
"Could you clean it out too?" Joey suggested.
Ken nodded, "Sure come on let's go to the back room."
They got up and walked off. Ivan and Cole sat at the couch talking.
"Don't mind me." I said walking over to the couch sitting next to them, "Just gonna snoop..."
COLE
Ivan and I sat at the couch talking about stuff, he was a good talker. Kind of reminded me of my dad, the one person who can make any conversation last.
Only thing was, he shot two of my friends and I didn't like that.
"Let's get back to the topic." I offered, "How about you give me some details on why you, out of everybody, need our help."
Ivan sighed, "Like I said, the agency I gave my all to, betrayed me and left me for dead."
I nodded, "Yeah it happened to me also."
"I want to get revenge." He finished, "And you guys are the only ones who can help me get it."
I looked over at Sean who tried not to be obvious as he ease dropped on our conversation. I smiled, amused.
He looked at me and winked sexually. I knit my eyes and looked away at Ivan who stared at us.
"Did he... just?" He started.
I laughed, "He does that."
"Who does that? Chicks, that's who," He huffed.
"Are you calling me a chick?" Sean asked him.
"More like a girl." Ivan informed.
"Fish," Sean crossed his arms.
It was silent then Ivan spoke out of confusion, "What?"
Out-of-nowhere there was a scream that sounded like a woman yelling, "fuck," in pain. I knew it was Joey.
"Everything okay in there?" I called.
Ken came to the doorway, "Yes boss, just a minor... never mind, carry on."
He walked back into the room.
I laughed, "Okay then."
"Those two are idiots." Sean said.
Ivan looked at him, "And you are not?"
Sean flipped him off, "You're an ass."
Ivan nodded, "So I've been told."
"Anyway, the last time we destroyed the Triton Agency we went in and took out some of the agents and then we blew it up from the basement." I informed, "How do you want to do it this time?"
"We could take it over from the inside and become the new leaders." Ivan suggested.
"Well that's something." I laughed, "How about we try that and see how it goes."
They nodded and Sean spoke, "I'll go tell the boys."
KENNETH
While Cole and the others were in the living room taking, I was in the back room stitching up Joey because the jerk Ivan shot him.
In the middle of it all I had to stop the bleeding so I heated a blade and went around the wound with it and he screamed.
It hurt my ears because he screamed like a girl. Cole heard it and said something; he should have known what was up though. I mean it happens every time we stitch someone up.
"Done," I finished patching up Joey and started to put the stuff away.
"Thanks man." Joey grabbed his shirt off the bed next to him.
I nodded, "Anytime."
Sean entered the room and sat down on the bed next to me, "What's up fishes?"
"Not much." Joey laughed.
"I got some news." He said.
"Good or bad?" I asked.
"I don't know, I guess mutual," Sean looked at me, "Want to hear it?"
"No, we're just going to walk away." I rolled my eyes.
"Okay, well Cole got a plan to eliminate the Triton Agency again." He informed.
"What's the plan?" Joey asked.
"To go in and take it over."
I cocked my head, "Then after that?"
He smiled, "We're going to be the new leaders of the Triton Agency."
"What about the P.O.O.P Agency?" Joey asked, "What about Ryan?"
"Forget the shit agency, man; we're going to rule," Sean rejoiced, "We can change the world; one agency against the country."
"What're you talking about?" Joey asked him.
"What am I talking about?" He looked at us, "I'm talking about ruling the world, man think about it; I have been. We rule the agency; take out as much of these fuckers the world has. Then we go big; take out the main guy this country is protecting."
"Are you talking about the fucking president?" I retorted.
He smiled, "Genius? I know."
"More like fucking suicide." I informed him, "Man, stop fucking talking like that."
He shrugged, "It's a thought."
"Yeah well it ain't working." Joey stood up and came up to him, "I know why you're acting like this."
"What do you mean?" Sean looked at him.
Joey placed his hand on his shoulder, "It's because Derek left."
Sean pulled away, "Fuck you!"
Joey knit his eyes, "Sean..."
"No!" Sean stepped back, "Fuck you!"
He went into the living room. Joey and I stood up and followed him out of the room.
"What happened?" Cole asked standing up with Ivan.
Joey shrugged, "I don't know."
Sean walked towards the door and turn when he place his and on the knob, "Fuck you guys!"
"Sean!" Cole yelled, "What the fuck?"
"From the words of a dear friend," Sean gave us finger, "I'm leaving the Crew."
DEREK
"Today is the day." Felix rejoiced, "Tonight you will eliminate The Crew."
We were in his office at the Triton Agency, we were talking about Cole and the guys; he was informing me on how to kill them.
I won't say some of the ways he said to do.
"You have the files and the names?" Felix asked me.
I held the file folder up, "No, just a folder filed with my old friend's name."
He laughed, "You're a joker mate, you bloody funny."
I smiled, "Well, I was the class clown in my high school year."
He nodded, "I bet. That'll be all, good day mate."
I nodded, "Alright then." I stood up.
"I want to talk to Derek!" The stunning familiar voice gave me chills.
Felix stood with me and we left his office.
"Let me see Derek!" Sean yelled.
He was in the main lobby holding an agent at gun point while everyone was holding him at gun range.
Felix sighed, "Will you handle this?"
I looked at him and nodded, "Yeah, sure."
"Thanks." He smiled and walked away.
I sighed and started towards the stairs then down to the lobby. When I got down to the main floor I yelled his name.
"Sean!"
He looked at me.
"Sean, what the fuck are you doing?" I yelled at him.
He started tearing up, "I'm sorry."
"What're you doing here?" I asked.
"I—I quit the Crew." He stammered.
"What?" I asked confused.
He sniffled, "Yeah, I don't need them anymore."
"Sean, are you okay?" I studied him.
He shrugged, "My eyes are open for once, I know what I've always didn't want to know and for the first time it's clear to me."
"What're you talking about?" I asked.
He lowered the gun, "We can be the ones who take over the white house, all we have to do it bring down the Triton Agency."
"Sean, go home, you're confused." He shook his head and raised his weapon to me, "No! I'm not! For the first time I can see clearly! Why won't you help me?!"
I stepped forward, "Because you're talking crazy! Man, I know where you're coming from, I do, but you're talking about talking over the fucking white house!"
He cocked the gun, "Fuck you!"
I stepped back.
"Now that's enough!" Felix came in front of me, "Sean, stop it!"
Sean's eyes were red and he looked us through as he lowered the gun.
"Put the weapon on the ground." Felix ordered in a calm voice.
Sean dropped the gun.
Felix sighed and looked over at his agent, "Take him into the interrogation room."
Sean looked up at me, his eyes wide as he was taken into the back. I looked at him and mouthed, "I'm sorry."
JOEY
After Sean left a knock on the front door minutes later gave us hope. We didn't want two people of the Crew to leave. Derek was bad enough. When I answered the door it was Vern and Dane coming in late as usual.
The first thing Vern said was, "So what happened to James?"
Cole sighed, "He got shot."
"By me," Ivan stepped up.
Dane looked at him, "His puny ass shot James?"
Ivan got in his face, "You got a problem with that?"
Vern stepped up to him, "Actually yeah."
"Okay guys, that's enough, we've already settled this." Cole separated them.
"What I want to know is why the hell did he shoot him in the first place?" Vern asked.
Ivan stepped back, "Felix Morris ordered me to take him out."
Vern nodded, "Right, that asshole."
Ken smirked, "That's why we're going to take him and the agency out."
"Nice, when are we doing it?" Dane asked.
"We're going to go tonight." Cole informed him.
He nodded, "Care if we join?"
"That's the entire reason I called you." I said.
He shrugged, "Well, let's get started then."
SEAN
I just love getting hit in the face by some asshole who thinks just because I'm tied to a chair I won't kill a fucker. Every time he hit me, I just got madder.
They weren't even saying why the fuck they were hitting me! They were just having at it, asking stupid questions and getting on my nerves.
"Where were you born?!"
Smack!
"How old are you?!"
Smack!
"What's your real name?!"
Smack!
"Where'd you lose your virginity?!"
Smack!
"Are you gay?!"
Smack!
Okay, okay, okay... last two were lies. But it seemed like they were asking questions like that. It was two of them, one in the back of me and one in the front of me.
I didn't catch their names, but I was sure if I did there'd be hell to pay.
A knock on the door made them stop hitting me. Felix poked his head through, "We got a problem."
They looked at him, "What do you mean?"
"Let's talk out here." He looked at me.
They nodded and walked out of the interrogation room. I struggled in my bonds and tried to get free, I don't know what I'd do if I actually got free; this place is filled with trained Triton Agents.
Then Felix and the agents came back in, I noticed a blade in Felix's hand.
I sat back, "What're you doing?"
In an instant he pulled his hand back and jabbed the blade into my gut then pulled it out.
"Sorry bro." Felix's voice was fading.
COLE
This was not happening, first Derek now Sean? The Crew was falling apart and I couldn't do anything to stop it. And even if I did, they wouldn't listen to me, we weren't a team anymore.
"You okay boss?" Joey asked coming up to me.
I sighed and laughed, "You know how many times we've asked each other that same question?"
He smiled and sat next to me on the couch, "We ask each other that almost once a week."
I nodded, "I'm alright, just thinking."
"Yeah? What about?"
I shrugged, "The Crew. What am I going to say to Ryan?"
"Don't say anything, forget him." Joey sat back.
"He is my boss." I informed.
He nodded, "I know, but, I've been thinking too. We don't need the agency to tell us what to do anymore, why can't we just live out our lives normal?"
"What're you saying?" I looked at him confused.
"Six years in the Triton Agency was enough for me, I think I'm done."
"Joey?"
"What?" He laughed.
I studied him, "You serious?"
He smiled, "Nah man, I wouldn't do that to you."
I laughed, "You and Kenneth are the only ones I can trust."
"Uh, hello?" Vern said from the kitchen.
"I trust you too, both of you guys, I'm just saying!" I reasoned.
They laughed, "We know."
I nodded smiling, "Right."
A bang on the front door made us jump up in alarm. I grabbed my silenced pistol from the kitchen counter and approached.
"Who is it?" Ken whispered.
I shrugged and leaned toward the door, "Who is it!?"
"It's Derek!"
I quickly opened the door and grabbed him in here, throwing him on the ground. We stood around him.
"Look who has balls!" Ken yelled.
"I don't want trouble!" Derek got on his knees, "I came here to tell you something, and then I'm leaving!"
"We don't want to hear it!" Joey yelled.
"I'm sure you do!" He argued.
Ken kicked him on the side, "How could you?!"
Derek was on his side, "I'm sorry!"
"We were your friends!" Ken kicked him again.
"Kenneth!" I yelled, "Stop!"
He backed off.
I sighed, "What is it?"
Derek coughed, "Its Sean."
"What'd he do?" Joey asked.
"Nothing," Derek looked up at me, "He's at the Triton Agency, Felix is gonna kill him."
"Why would you care?" Ken asked.
Derek sighed, "I don't; we're enemies."
I nodded, "Leave."
He got up, "If that's what you want, fine." He started towards the door looking back once the door was opened, "Bye."
KENNETH
When Derek showed up at the safe house, I was pissed. He betrayed us and had the balls to come back? He said Sean was at the agency and Felix was going to kill him.
I had no doubt, but, how could he? Both of them left and they expect us to help them? It was bullshit.
"What do we do?" Joey asked.
"I say fuck them." I sat back on the couch.
"Ken, I know your mad but come on." Cole looked at me, "They're our friends."
"No! I case you haven't noticed, they left us, betrayed the Crew!" I yelled, "We're no longer friends!"
He sighed.
I shook my head, "We're the only ones left."
"They're still a part of the Crew wither you like it or not." He turned away.
I shook my head and rolled my eyes, "Whatever you say boss."
"Don't get sassy with me asshole." He rolled his eyes.
I stood up, "What the fuck did you just say?"
He turned and Joey got in between us, "Stop! You two are friends!"
"Some friends we are." I huffed and walked away.
COLE
The Crew is falling apart and I don't know how many times I can say it. Time after time shit happens and I can't keep up with it. But every time we stick through it, together.
This time I don't have my doubts that we'll pull through. We have had our wrong turns in life.
"You guys shouldn't be fighting, there is three hours before we leave to the Triton Agency and we need to get ready." Vern said.
I nodded, "Yeah, Ken, I'm sorry." I held out my hand to him, "Truce?"
He sighed and we shook, "I still think we should forget them, I mean I'm making a good point."
I laughed, "I can't do that."
"I understand. But you're still an ass." He laughed, patted my shoulder and walked off.
"All that fighting for nothing," Dane laughed.
I shrugged, "Let's get ready to eliminate the Triton Agency... Again,"
"I'll call Jackson." Dane informed.
"No need," I informed, "We still have weapons from the last time we took them out."
He nodded, "Okay cool, let's see them."
"Alright then, follow me." I started towards the practice room where we keep all our weapons and ammo, everyone followed.
"Our weapon court, we have the best." Ken opened the basement door.
We entered the training room and pressed the yellow button on the wall, the training mat on the floor sank in then came up showing all sorts of weapons we had.
"Holy crap, this is beautiful man." Vern gawked.
"Thanks." I blushed jokingly.
"I know what weapon I want," Joey informed, "Where's my baby?"
I expected Sean to yell, "Right here!" but I realized he wasn't here. We had to find him, before Felix tries to kill him again.
Joey grabbed his MPS-503 from his special place and reloaded it.
"So," Dane came up to me, "We can choose any gun?"
I nodded, "Any weapon you like."
He grinned, "Hehehe."
I knit my eyes, "Okay?"
"Can I have a grenade launcher?" Vern asked.
I nodded, "Its right in the middle of it all."
"Yes." Vern ran to get it.
Joey came up to me with his MPS, "We're like kids in a candy store."
I smiled, "Yeah I know."
"More like...Psychopaths in a zombie apocalypse." Ken looked at us.
"Whatever we are, we're good at what we do." Vern cocked his weapon.
I sighed, "I can't believe we're doing this again."
Joey nodded, "Remember what happened last time?"
I huffed, "Hell yeah. But we had the perfect plan."
Everyone cheered, Ken spoke, "Fuck yeah we did."
I smiled, "The Crew is true."
They got quiet, Joey laughed, "Yeah, The Crew is true."
"So," Ivan chirped, "What time are we leaving?"
"As soon as we're done getting a plan together and finished packing weapons dude, chill." Cole informed.
"I just, I want to go and kill that bastard sooner than now." He said.
I nodded, "Yeah well we can't just break in there, we have to go in undetected because they won't just let us stroll right in there."
He huffed, "I know."
"So why're you complaining?" I asked.
"I'm not!" He yelled, "I'm just saying!"
I nodded, "Okay, um, pick your weapons and gadgets and gizmos and attachments you want then meet me in the middle of the training mat."
They nodded and I turned and proceeded in the middle of the mat waiting for the guys. The first one over was Ivan, who told the others not to touch his AK-47 and scope.
Vern and Dane were next; Vern had his grenade launcher and Dane, I don't know what he chose. Joey and Ken were last; they got what they usually get; the shotgun and MPS-503.
"What're we doing?" Joey asked me.
I took my jacket off, "We're going to do some warm ups."
"But what about getting to the Triton Agency?!" Ivan yelled.
"And Sean?" Vern added.
I sighed, "Fine. You all ready? Let's go!"
DEREK
"Where'd you go?" Felix's British voice sounded direct and intimidating in the phone.
I sighed and looked around as I was sitting at a table outside of Café Black, "I went to grab some food for lunch."
"Uh-hm. Listen, we need you back at the agency, we got some news." He informed.
I nodded, "When?"
"Now would be nice."
"Okay. See ya soon boss."
He hung up.
I put the phone away then sat back and sighed. I had to go back in there to help Sean, even though we were enemies we were still best buds.
I stood up and took out a ten dollar from my wallet and dropped it on the table in front of me. As I turned and walked away, I started to put my wallet away.
The Crew's safe house was just down the street from where I was. The Triton Agency was around the block and down the street to the right from where I was. I had to make a choice.
Cole didn't want me there and I had to be at the agency so the choice was obvious.
I started right and continued down to the Triton Agency. I kept on the sidewalk and avoided eye contact with anyone who seemed interested to speak with me.
Things past through my mind; what would happen to Sean? Felix already tried to kill him once, I'm sure he'll do it again.
The Crew, what I did to them and how they might not be able to forgive me.
Felix and my Crew; how I shouldn't disappoint them. I had to be the best; better then Cole.
The screeching sound of tires made me stop and look up, before I could process what was happening something that felt like metal hit me. I then hit glass and fell to the ground with a killing pain on my right side.
JOEY
We pulled up out front of the Triton Agency in a black van; it was dark so no one could see us. We wore black outfits, something that could hide us from the people that are on guard in the darkness.
And there were people on guard.
"The plans good," Ivan said, "All we got to do is to not get caught."
We were still in the van waiting for the right moment to jump out and go up to the agency.
Cole nodded, "Correct. Joey you know what you're doing?"
I nodded, "Sneak into the basement and cut the lights."
"And the lights will be on so you will have to sneak silently. If you kill; hide the bodies." He ordered.
I nodded, "Okay boss."
He smiled, "Let's go kick ass."
We got out of the van and I started in a different direction then they did. I started towards the back, it was empty half the time, people only came out to smoke and take a break.
There were two men with pistols on guard smoking by the back door.
"You got them?" Cole asked in my ear piece.
I sighed, "No problem. I hope."
I made my way towards the targets with my silenced pistol at a ready. They took drags of their cigarettes and blew smoke in the air.
"Disgusting," I mumbled.
"Hurry up and take them out." Ivan said.
"Bite me, asshole." I spit.
Cole and the Crew laughed, Ivan, who I knew had a smug look on his face snorted, "Just wait till you come back, you're mine."
"Bitch," I sighed.
"Dick. Now get moving." He ordered.
"Fuck you college boy!" I hissed like a cat.
"Do the fucking mission!" Ivan snapped.
I sighed, "Cole, get him."
"Ivan, maybe you should let Joey get back to work." Cole sympathized.
"Yeah, work little bitch." Ivan joked.
I rolled my eyes, "We'll settle this when I'm done."
I hid behind a barrel in the dark as the two guys were finishing up their smokes. I gripped the gun and stood up, shooting both of them in the middle of the forehead.
"Nice." Ken hissed like a snake.
I huffed, "You see that Ivan?"
"I can do better." He miffed.
"As if," I rolled my eyes.
"Continue." Cole ordered.
I nodded, "Sorry boss."
I proceeded inside of the agency. I stayed low and kept on guard, aiming the pistol at anything that moved.
There was light coming from the main room, next to the lighted hall, there was a door.
"That's the basement." Cole informed.
I nodded, "Roger."
I stayed low and opened the basement door, continuing down the stairs.
"The electricity panel should be behind the stairs." Ken said.
"Copy," I headed towards the back of the stairs.
"Why are you acting like a secret agent?" Ivan asked me.
"Because I am," I informed.
"Bitch please; you ain't nothing but a hound dog." He laughed.
Cole and Ken laughed.
I rolled my eyes, "Tell me when Vern and Dane are ready."
"Oh, we've been ready." Vern informed me.
I cursed, "Well thanks for saying so."
"Anytime."
I rolled my eyes, "You guys are assholes."
They laughed. I shook my head.
"Are you there yet?" Cole asked.
"Patience virtue," I smiled.
"That's my line." He informed.
I opened the cover to the electricity panel, "I know."
"Now flip the first switch." Cole ordered.
I nodded and took out my flashlight then flipped the switch. Nothing happened.
"Cole?"
"It worked," He informed, "Put on your night vision goggles and wait for us to infiltrate."
"Copy," I switched on my goggles and waited by the stairs for further instructions.
KENNETH
We infiltrated the agency as soon as Joey cut the lights. Ivan was a funny guy, he and Joey didn't get along, I couldn't blame them; I didn't get along with him at first either.
We had our night vision goggles on as we stayed low going into the agency. The agents had flash lights and were searching for the culprits.
"Joey." Cole whispered in the ear piece.
"Yes boss?"
"Stay down there; kill anyone who comes at you and wait for my orders. We're going to clear out the lobby." He ordered.
"Copy," Joey said, "Be careful guys."
"Deal," I smiled.
"And boss," Joey paused, "You were right, The Crew is true."
Cole smiled, "I'm not the one who says it."
Joey huffed, "I know, now let's go rescue the idiot."
I laughed, "With pleasure."
Out of the corner of my eye I saw a figure run past.
"Three O'clock boss," I informed.
They got on guard and aimed their weapons at nothing, backing up into the darkness.
"Where?" Cole asked me.
I shrugged, "Somewhere over in that direction."
He nodded, "Thanks."
"Ass," I rolled my eyes.
"Pay attention!" Ivan yelled.
"We have intruders on the first floor!" A walkie talkie blared.
"Great!" Cole sighed, "Thanks a lot Ivan."
I came out of cover and shot the first thing I saw—a Triton agent. He went down and it got silent.
"Nice shot hot head." Ivan said.
I glared at him, "Fuck you."
He laughed, "Let's move on Crew."
"That's my line." Cole fumed.
Ivan looked at him and shrugged, "It doesn't fit you." He stood up and crept away.
I looked at Cole, "Boss, can I kill him?"
"Not yet." He answered, "Come on."
COLE
Ivan was a fucking show off, taking my shit. Screw him!
I sighed and calmed down a bit.
Ivan, whatever his last name was, is a bitch. I can't say that aloud due to him killing us. The guy's crazy, mentally insane—like Ken.
But worse, the dude would threaten a bird.
"Which way boss?" Ken asked me.
"To the left, we have to meet up with Vern and Dane." I informed.
"I don't like them." Ivan scolded, "How long did you know them?"
We stopped behind a wall and I rolled my eyes, "Focus on the job."
He laughed, "Right, because your Crew always does that."
I just wanted to shoot him in the middle of the head right then and there, but someone, and I know who, came out of the dark to talk to us.
"Funny seeing you here Cole!" Felix yelled, "Well, I guess it wouldn't be funny being that I expected you and your Crew to be here to kill me."
I motioned to Ken and Ivan to quickly move over to the other side of the hall. They did.
"But Cole, what I don't understand is why you chose to come here when half your team is in the ruins." Felix said.
I stood up, took off my goggles and came out of the open, "See that's the thing Felix, it doesn't matter if half my team is in the ruins, we're still a Crew wither you like it or not. So, you can tear and rip us apart all you like... We'll still come back to whip your ass."
He laughed, "There's my mate, how you been?"
"What the fuck does it matter to you?" I laughed.
Felix cocked his head, "It matters because of how you gonna be in about 10.5 seconds. Ivan!"
Behind me Ivan came out with Ken at gun point, Kenneth mumbling under his breath` words I shall not repeat. Ivan pushed him next to me and pressed the gun to my head.
"I knew you weren't trustable." I said to Ivan.
He smirked, "Did you really?"
I looked at Felix, "So you have us, big deal, what's next?"
He looked at the agent next to him, "Take his weapon and go to the basement, there's someone I want you to meet."
The agent nodded and came up to me, snatching my pistol and walking past me to find Joey who was on guard in the basement.
"Don't hurt him Felix." I said.
He smiled, "I'm going to do more than hurt him."
A gun shot made me jump and turn to run, but two Triton agents grabbed me and held me back.
"No!" I yelled, "Joey!"
"You son of a bitch!" Ken went at Felix but as he came close Felix sucker punched him in the face.
Ken dropped to the ground holding his bloody nose, cursing.
"Don't fuck with me asshole!" Felix yelled, "I will make your entire team my bloody bitches!"
I turned to him, "Oh really?"
He made his bitch face and looked at his agent on his right, "Take them to the interrogation room, there's something I want them to see."
KENNETH
My nose was bloody as Cole helped me up. I could kill Felix.
They led us towards the interrogation room, which, in good timing, was a long way from the front of the agency, where we were.
As we went past the agents each of them stared at us, gave us dirty looks and I recognized a few of them.
"Ken, is that, Gordon?" Cole whispered to me.
I looked over to where he was looking, yes; it was the asshole Gordon and his team of law breakers.
"Keep moving!" an asshole shoved us forward.
I growled, "Bite me."
The asshole grabbed the back of my head and got in my face, "Do I look like the type of person to be fucking with?"
"To be truthful... You look gay."
He threw me to the ground, "Who do you think you are?"
I got up and got in his face, "I think I'm Kenneth fucking Meginley."
He snorted, "Take this punk into the interrogation room."
Two hands opened the door in front of us and we were pushed in to the ground.
I looked up, "Sean!"
The door slammed shut behind us and we both got up and went to our friend's side.
"Shit Sean." Cole sounded upset.
Sean was tied to a chair, face bloody and a stab wound on his side. He wasn't moving.
Cole bent down next to him, "Come on Sean, not like this, you can't go out like this."
He started shaking his shoulders, "No, man. I can't lose you like this, fuck, Sean!"
"Cole..."
"No, this can't happen, not again," He cried shaking Sean's shoulders and lifting his head.
"Cole."
"First Alan, then Ken, now you? Come on man!" He cried.
"Cole!" I yelled.
"What!" He looked at me with tears in his eyes.
"He's gone." I sympathized.
He got up and paced the room, "No, no, no, I can't lose another not in a time like this." He went back to Sean and felt his pulse.
He looked at me with his eyes wide, "We have to get him out of here, take him to a hospital."
"He's alive?" I asked.
He walked to the locked door, "Barely."
I looked at the mirror, I knew behind it was Felix or some of his agents.
"Cole." I looked at him, "I got a plan."
He cocked his head, "Go on..."
COLE
"Oh Felix!" Ken yelled facing the mirror in the interrogation room.
I looked at him, "This ain't going to work."
He shushed me, "Don't jinx it."
I rolled my eyes, "Felix! Felix I have to tell you something!"
It was silent.
"What're you doing?" Ken asked.
"Trying something," I informed, "Felix! Do you want to know what happened to your father?!"
It was still silent.
"Well he killed himself!" I yelled, "The bastard took himself out of your life!"
I looked at Ken, "And Felix! We were your father's best agents before he betrayed us!"
I looked back at the mirror, "We cared for him, he trained us to do what we do today," I looked down, "We wouldn't be agents if it weren't for Jesse."
"Isn't that touching?" An unfamiliar voice said in a speaker phone from behind the mirror, "Felix is not here though, want me to take a message?"
I rolled my eyes, "Shit."
Ken shrugged, "I guess it's time for plan B. Pick up a chair."
"What?" I asked confused.
"Just trust me. Pick up a fucking chair and follow my lead." He said.
"Okay." I picked up one of the chairs that were next to Sean, one of two.
Ken did the same, "On the count of three."
I nodded.
"One, two..."
"What're you doing?" The guy asked.
"Three!" Ken yelled.
I flung the chair at the mirror as Ken did. The chairs hit the mirror and the glass shattered into a million pieces.
"Get them!" Ken yelled.
I ran and dived through the broken mirror and attacked one of the guys that were standing behind it. He had a silenced pistol.
I took it from him and shot him in the head. I looked over at Ken, a great hand-to-hand combat expert, he was kicking ass.
He punched the guy in the face and he fell on his back, old cold.
"Nice." I smiled.
He rubbed his fist, "Thanks, now come on."
We left the room and went back into the interrogation room to help Sean out of the chair.
As we were untying him he came to it, just barely.
He smiled and mumbled, "Break a mirror, seven years bad luck."
I laughed, "I'm not really worried about that right now man."
He laughed, "I'm sorry."
"Don't even worry about that man." Ken said.
We grabbed each of his arms and carried him out of the interrogation room.
"Ken, take him out of the agency, take him to the hospital. I'm going to get Felix." I informed.
"Alone?" He asked.
I handed him the silenced pistol, "I believe in you."
He smiled, "I was talking about you."
I smiled, "I know."
He took the pistol, "Good luck boss."
"I'll need it." I huffed.
He smiled, turned and walked away. I sighed and turned, walking down the hall silently.
The agency seemed empty, I mean, there should at least be agents about. There are none where I am.
I had no weapon, no communication with Vern and Dane, and no idea where anyone was. I was alone and unarmed.
I got against a wall and proceeded forward stealthily. I noticed to my left was a room filled with weapons.
"This wasn't here before." I thought to myself.
I looked around then went in.
"Damn..." I mumbled.
There was a silenced pistol on a stool, I took it and check it for a magazine. It was full. I smiled and grabbed two more clips, stuffing them in my pant pockets.
"This is bullshit!" Someone yelled in the hall, "Felix is a complete idiot!"
I quickly hid in a pitch black room next to me as they came in.
"You have to give him some credit; this place is home for the homeless agents." The other said.
"Yeah, but it's stupid, I mean they aren't going to escape, they're locked in the interrogation room."
"They might." The one informed.
"Whatever, come on, grab a weapon, we have to dispose of Derek,"
I froze, Derek? Uh-oh...
"Yeah man, shame too, I was starting to like him and his crew too." One said.
As they turned I came out and shot them both in the back of the head silently. They fell to the ground and I stepped over them and left the room with the pistol I had taken.
I continued down the hall with my pistol at ready. One light was out and flickering as I walked underneath it and past it.
I realized that the lights were back on. I shook my head and looked behind me.
"They have to be somewhere." I thought.
"Cole." A familiar voice whispered behind me.
I turned, "Joey?"
Joey came up to me, "How'd you get free, where's Ken?"
"He took Sean to the hospital." I informed him.
"Is he okay?"
"We found him tied to a chair with a stab wound to his side; he lost a lot a blood and was unconscious." I said.
He nodded, "I was coming to look for you two after Felix grabbed you guys."
I huffed, "We were in the interrogation room."
"Damn, the only place I didn't check."
I smiled, "Did you see Vern and Dane?"
He shook his head, "No, you?"
"No." I admitted.
He pointed behind him, "Well they aren't that way."
"Is anyone on that side?" I asked.
"I killed a bunch of off guard agents and then they started to disappear." He responded.
I nodded, "Let's go back to the front."
"Okay, hopefully we'll find the guys."
"Yeah," I sighed, "Hopefully."
JOEY
"So you thought I was dead?" I asked Cole as we walked back to the front of the agency.
He peeked around the corner, "Yeah, we heard a gunshot and thought that guy had killed you."
I laughed, "Ha, I can't die."
Cole waved, "Let's go."
I nodded and we ran to the front door.
"Hold it!" a familiar voice yelled.
We froze and turned.
"Oh shit." Cole held his hands up in surrender.
I copied.
"Look who it is." Marshall said.
"You son of a bitch," Cole miffed.
Marshall was the guy at the hospital when I was drugged a while back. Sean talks about him.
"What're you doing here?" I asked him.
"Looking for my cousin," He informed lowering the gun.
"You're not going to kill us?" I asked.
He shook his head, "No. Bye."
"Wait, we sure could use your help." Cole suggested.
Marshall perked his lips, "On one condition."
"What?" Cole asked.
"You promise not to kill me."
I looked at Cole, "Boss..."
Cole looked at Marshall, "Fine."
Marshall smiled, "Good."
I rolled my eyes, "Great."
Marshall walked past us.
Cole looked at me, "Give him a chance," He leaned in, "If it seems strange, put a bullet in him."
"You two coming?" Marshall asked us.
Cole looked at him, "Yup." He started towards him.
I sighed, "Okay, but I call the shots!"
"You wish Captain Bob." Cole laughed.
I followed him, "You're an ass."
"I know." He chipped.
"Pay attention!" Marshall yelled.
We stopped at a corner. The room in front of us was filled with Triton agents, they were taking point all around the room, with their weapons aimed at the doorway in front of us.
"That's where they all went." Cole huffed.
"Yeah, they've been there for a while. Felix ordered them to gather and shoot anything that moves within the doorway." Marshall informed.
"Is there another way to—"
"Cole Phillips!" a voice yelled from inside of the room, "We have something you may want back!"
Cole peeked into the room, "Oh shit," He looked at us, "They have Vern and Dane."
KENNETH
After I made it out of the agency safely, I took Sean to the hospital. They took him right away.
I waited in the waiting room until he was out of surgery.
I have to say, I was worried. He lost a lot of blood from the wound. I hated Felix. We all did.
When the doctor told me that I could go in and see him, he also said that he was asleep and that I couldn't stay long.
I went in and sat down next to him in a chair.
"Hey bud." I knew he couldn't hear me, but whatever.
"We've been friends since forever, right?" I smiled, "We've been through everything together. But, I told some lies to the Crew, to boss. You're probably going to hate me if I tell you the truth, but what the hell right?"
I sighed, "I lied about my name. I'm not Kenneth Meginley. I'm Kenneth Williams, son of Mary and Kevin Williams... I'm your older brother man."
COLE
So that's where Vern and Dane went.
And to think I had thought they were lost somewhere in the agency.
Marshall cocked his gun, "I suppose they're your friends?"
I nodded, "Kind of, yeah."
He nodded, "Well, let's save them."
"Good idea sport!" Joey mocked in an accent.
I laughed, "Joey, stop being a dick."
Marshall had a bitch face, "Or, we cannot save them and let Felix kill them?"
Joey looked down and mumbled, "You're a party pooper."
"I got an idea, but it would take mad skills." Marshall informed.
JOEY
"I'm going to need you to infiltrate into the basement and cut the lights." He ordered.
I looked at Cole, "You do it."
Cole cocked his head, "I don't know, it does take mad skills to pull off something like that."
Marshall nodded, "Mad people skills."
I sighed, "Boss."
"Fine," Cole pouted away.
I looked at Marshall, "So, you're good all of a sudden?"
He shrugged, "I guess."
"What's your story?"
He sighed, "I came for Bobby."
"What do you mean?" I asked.
"Bobby's supposed to be in here."
"Why do you care?"
He sighed, "He's my—"
"Let me guess, brother?" I cut him off.
He shook his head, "Cousin."
"Ah."
"We grew up together, me, him, and Frankie. But, of course Frankie was a jerk." He informed.
"Yeah... Wait, what about John?" I asked.
He shrugged, "Yeah, I guess he was around too, John was a loner."
I cocked my head to the side, "Really?"
"Yeah, people made fun of him at school. Well, until Frankie did something about it."
"What'd he do?" I asked.
"He fucked up some kid who called John a loser." He informed.
I nodded, "Damn, so Frankie was protective."
"Yeah, towards John, not Bobby,"
"Why?"
He shrugged, "I don't know."
Suddenly the lights shut off and everything was dark. I put on my night vision goggles.
"You're a lucky son of a bitch." Marshall said.
"Why?" I asked.
"Because you can see,"
I laughed.
"Hey guys." Cole whispered.
"Yeah?"
"I can't see shit."
I don't know why, but I laughed my ass off and started clapping like a fucking seal. I needed that laugh.
"Pull it together!" Marshall hissed at me, "You guys are the only people in the world that will screw around during a mission."
Cole came up to us, "We get that from Sean."
Marshall rolled his eyes, "Get low, and follow Joey," He nodded to me, "Go."
COLE
We entered the room filled with agents silently. The entire agency was dark only Joey could see. They had taken my goggles away from me.
We grabbed each other's shirts and crept along behind all of the agents.
"I can't see!" an agent yelled.
"Shut up and shoot anything you see!" another responded.
We made it to the right side of the room before the lights came back on and Joey took the goggles off.
"What now?" Joey whispered.
I looked around, "Kill them?"
Marshall shook his head, "I got another idea."
"What?" I asked him.
"How good can you guys act?"
Joey and I looked at each other.
JOEY
"QUICK!" I bellowed, "There's a bomb about to go off!"
Cole came out next to me, "Go, before it's too late!"
The agents looked at us insanely, they stayed still.
"Go! Now!" I yelled.
Some of them ran out of the room, others stayed looking confused.
I looked at them, "You have a minute! Save yourselves!"
More of them ran out of the building, but still a little but stayed.
"Go!" Cole yelled at them.
"Shut up Cole." A familiar voice said.
Cole cocked his head to the side, "Holy shit, I know I don't see who I think I see."
Gordon came up to us with his team behind him.
"I heard you were in town, but I didn't think it was true. Why're you in here?" Cole asked.
"I'm a Triton agent," He smiled, "What about you?"
"I came to destroy it; this is the agency that betrayed me and my Crew." Cole informed.
Gordon nodded, "Have you seen Derek?"
Cole shook his head, "No."
"Why?" I asked.
"He's our boss." He informed.
Cole nodded, "I know. Thanks again."
"For what?" I looked at him.
"The plan went well." Gordon smiled.
"What plan?" I asked.
Cole looked at me, "After Derek went to the Triton agency; I called Gordon to see if he could act as his new crew."
"Oh."
Gordon nodded, "Plan went well; he didn't expect a thing."
"Good, now could you help us? We need our friends back." Cole said.
Gordon nodded and turned to his team, "Kill the agents."
His team nodded then turned to the rest of the agents that stood by Vern and Dane.
They lifted their hands up and shot the three agents that were next to them. Then Vern and Dane came up to us.
I started laughing, "How'd you get caught?"
Dane gave his bitch face, "Your mom."
I laughed, "Screw you."
Marshall looked at Cole, "We done here?"
He shook his head, "Not even close. I need to find Felix and Derek."
"Yeah, I need to find Bobby too." Marshall cocked his weapon.
"I guess this is goodbye?" I suggested.
Marshall looked at me, "Yeah man... bye," He faced Cole, "It was fun."
"Yeah, thanks again." Cole held out his hand.
They shook hands.
Marshall turned and walked out of the room to finish looking for his cousin.
COLE
"What now boss?" Joey asked me.
I sighed, "We have to search the—"
A familiar face caught my attention.
"Hello Cole." Derek said coming up to us.
"Aren't you a badass?" Joey mocked.
He rolled his eyes and looked at me, "I came for blood."
"Why do this?" I asked him.
He shrugged, "I like the fight."
"Where's Felix?" Joey asked.
Derek rolled his eyes, "Not here ass."
Joey sighed, "Okay then."
"How are going to do this?" I asked.
"Fight to the death." Derek informed
I huffed, "Why?"
"Derek!" Joey yelled, "We're your friends! You don't kill your friends!"
"No Joey, it's okay. He wants to fight, we'll fight." I said.
Derek smiled, "No weapons."
I nodded and handed Vern my pistol.
Derek backed up and put his hands up, "Come on boss; show me what you can do."
I sighed then stepped forward and put my hands up. Derek came at me, kicked and kicked with each foot but missed.
I pushed each foot away and smacked him in the face.
"Get him Cole!" Dane cheered.
I rolled my eyes and Derek caught me in the jaw. I stumbled backwards and held my jaw.
"Ouch." I huffed.
He smiled, "Sorry boss."
I sighed, "I've heard that before."
I shook my hands and put them up, "Come at me."
Derek smiled and charged. He grabbed me and threw me onto the ground behind him. Gordon stepped up and grabbed Derek.
"Calm down boss." He ordered.
Derek pulled away, "Get off me; I knew your guys' trick! You got on my team so I wouldn't have a new crew!"
"This is crazy!" Joey yelled.
Derek shook his head, "No, this is life."
"This isn't what life's about!" I stood up, "Life is about making choices and being happy!"
"I am happy, and I am making a choice!" He informed.
"Yeah, but is it the right choice?" Joey asked.
Derek looked at him, "Fuck you white boy!"
"Derek, that's so racist." A familiar voice joked behind me.
I turned, "Ken, what're you doing?"
"Proving a point, Derek, I think Sean has something to say."
Derek looked down, "Why'd you bring him here?"
Sean was leaning on Ken, "Don't talk to me like I'm not here, I heard your story."
"What am I some kind of legend?" Derek asked.
Sean shifted, "Sort of, man listen, you need to chill."
"What do you mean chill?"
"I mean stop with the shit!" Sean yelled, "We've been friends forever and Felix can't change that!"
"Looks like he already did!" Derek argued.
Sean sighed, "Remember that job in Vegas we did?"
"Don't start Sean..."
"Remember Henry?" Sean asked, "Do you remember what he did to me?! And do you remember what you said to me as my friend?!"
Derek sighed and looked away.
"You said that throughout it all, we'd always be tight. Even when the monsters try to pull us apart," Sean said, "Do you even remember those words? How many times do they cross through your mind?! Because they cross through my damn mind every fucking day,"
A tear ran down Derek's face as he lifted his head up, "You don't think, not for a second, that I don't think about those words? That I don't blame myself for what Henry did to you? Because I do, every damn day I blame myself for not finding you earlier."
"You told me that you never did understand the true value of friendship. Is that what all this is? Trying to understand the value of friendship? Because all you had to do was come to me, I would have told you." Sean looked at him.
Derek laughed, "Never thought about that."
Sean smiled, "What do you say? Come back to the Crew?"
"We need ya bud." I told him.
"The Crew is not The Crew with four people." Ken informed.
"You're the fifth Musketeer." Joey added.
"What do you say?" Sean asked.
Derek sighed, "I'm sorry, for everything, I just..."
"We know." I smiled.
"It just seemed like a good deal at the time." Ken smiled.
Derek laughed, "I guess so."
"Isn't this sweet?" a familiar British voice miffed, "Too bad it's over in three... two... one..."
Felix whipped out a pistol, aimed it at me, and fired.
"Boss!"
SEAN
As they lowered the casket, we all said our final goodbyes. Joey, Ken, and Derek and I were in tears—our boss, our couch, our trainer... our lifelong friend, gone.
After Felix shot him, Joey, Derek and I ran to his side, Ken ran after Felix who ran after he dropped the gun.
We didn't get to see Cole after he was taken to the hospital. The ambulance came sooner than expected, but we were told it was too late.
As they were filling the hole with the dirt, what was left of the Crew walked past me and put their hand on my shoulder.
People we knew, like James, Dane, Vern, Gordon and his team, and Marshall and Bobby were at the funeral.
They each left and it was Ken and I left at the cemetery. I noticed to my right a familiar face.
Felix.
"You son of a bitch!" I charged him.
I went to swing but he just stood there.
"Nice to see you here bro," His British accent was annoying.
"Fuck you! What the fuck are you doing here?!" I yelled.
"Have some respect, you are at a funeral."
I pushed him back, "Fuck you!"
"Don't touch me." He looked down.
"You killed my boss!" I seethed, "I should fucking kill you right now!"
"Stop!" he yelled, "Listen to me!"
I sighed, "What the fuck do you have to say?"
"Things you see aren't the truth."
"What the fuck does that mean?" I asked.
"You see those people over there in the suits and sunglasses?" He nodded behind me.
I looked over my shoulder to three guys in suits who were behind Ken.
I looked at Felix, "Who are they?"
"That's for you to find out." He turned and walked off.
Ken ran up to me, "I thought you were for sure going to kill him."
I looked at the guys behind him.
"Sean?" Ken studied me, "You okay?"
I looked at him, "Yeah, I'm fine... Bro..."
Ken looked at me, "This stays between us."
I put my arm around him and we started walking away, "But you have to tell me... how in the world are we related?"
He laughed, "Sean, can I ask you a question?"
I nodded, "Sure, bro, what's up?"
He looked down as a smile tug at his lip, "Do you remember Alan?"
I took my hand away, "Of course. Why?"
He sighed, "Boss said something about him when we found you in that chair."
"What'd he say?" I asked.
"Said he couldn't lose another agent like he lost Alan," He informed.
"And he didn't." I sympathized.
Ken nodded, "Thank god."
I smiled, "That all he said?"
"Yeah, why?"
I shrugged, "Nothing."
He studied me, "You alright?"
I looked back at the men in suits who were standing in the same spot, "Yeah..."
Ken looked over my shoulder, "Who are they?"
I shrugged, "I honestly don't know."
He snorted, "Then I'm going to find out."
Ken stomped past me and stormed up to the men in suits, they saw him coming and ran. Ken, being the smart one, didn't follow.
When they were out of sight, he turned and came back to me.
"So, I'm guessing you never got to introduce yourself?" I asked.
He sighed and looked behind him, "I recognized them."
"You did?"
He nodded, "Yeah..."
"Who were they?"
He sighed and looked at me, "They were Ryan's agents."
"What were they doing here?" I questioned.
He shrugged, "No clue."
I huffed, "Call Joey and Derek, we're going to find out what they were doing here."
KENNETH
Sean and I called the Crew, well, what's left of it. They met us at the agency and we went in causing trouble.
"Where's Ryan?!" Joey asked an agent.
The woman pointed to the right.
"Thank you." Sean winked at her.
I rolled my eyes, "Idiot."
We strolled in a line towards Ryan's office.
"Ryan Barson!" Derek yelled.
Ryan came out of his office with his arms crossed, "Where's Cole at?"
We stopped in front of him.
"Fuck you Ryan!" Sean snapped.
Joey looked at him, "Chill fish."
"What'd you just say?!" Sean asked.
Joey rolled his eyes, "You heard me. Now shut up and stay still."
Sean huffed and crossed his arms.
"Now Ryan," I looked at the leader of our agency, "May we come in and talk to you?"
Ryan nodded, "Yes, come in."
I smiled, "Good, come on Crew."
We started forward and went into Ryan's office. He motioned for us to sit, but there were only two seats in front of his desk.
Joey and I took them.
"What can I do you for?" Ryan asked sitting in his chair.
"We like to talk to you about our boss." I informed.
"Cole? What about him?" He asked.
Joey sighed, "He's dead."
Ryan perked his lips, "Oh, I'm sorry."
"No you're not." I shook my head.
He looked at me, "Excuse me?"
"Don't play games with us Ryan; we know what you're up to." Derek said.
"Says the one who turned his back on the people who needed him the most," Ryan looked at Derek.
"Hey!" Sean snapped, "You better watch your fucking mouth!"
"You too!" Ryan yelled, "You all are fucked up in the head! I even wonder why Cole called you friends! Or even his team!"
"Fuck you!" We screamed.
We started talking at once.
"Fuck you Ryan!" Derek yelled.
"You're an asshole!" Joey added.
"Yeah! You fish!" Guess who.
I shook my head, "Quiet guys."
They looked at me.
"Now Ryan, I know you didn't mean to insult my friends, now did you?" I looked at him.
He looked at me and swallowed, "You don't scare me Kenneth."
I smiled, "I don't?"
He shook his head, "What do you want?"
"I want to know why your agents were at our boss' funeral." I informed.
He coughed, "We weren't."
"Bullshit!" Joey stood up, "We saw your agents!"
"You sure?" Ryan asked.
Joey looked at me.
I nodded, "Yeah, we are."
"Mm-hm, and you did what after your boss was shot?"
"What the fuck does that matter?!" I yelled at him.
"Nothing," He admitted, "I just wanted to make sure you actually tried to do something after your boss was shot, like kill his assassin."
I huffed, "Yeah, we did."
"Good," He smiled, "Let's see who actually cares—who chased him?"
We got quiet.
"Ken did." Derek informed.
Ryan nodded, "You know they say that the one who was there at the beginning cares the most."
I rolled my eyes, "We all care."
"Yeah, and I'm gay." Ryan joked.
Sean laughed, "You are gay."
We laughed and Ryan stared at him.
Sean smiled, "You're being an ass so I have the right to call you gay."
Ryan huffed, "Dick."
Sean laughed, "What!? I'm stating a fact!"
We laughed.
"Sean, I don't think Ryan knows how to take a joke." I informed.
Ryan gave his bitch face, "Get out of my office."
Joey laughed, "Nah man."
"Yeah," I looked at him, "We actually came to quit."
"Can't do that," He said.
"What do you mean?" Joey asked.
"I mean, you can't quit, you're my agents for life." Ryan informed.
I shook my head and stood up, "No way, how?"
"Your boss came in and signed a contract, if he dies; The Crew becomes the P.O.O.P Agency's property."
"What?" Joey gawked.
Ryan nodded and held a piece of paper up in front of us, "Proof."
I looked at Joey, "He didn't."
"Oh, but he did!" Ryan cheered, "Now leave!" Joey got up and we exited Ryan's office.
We walked down the hall with Ryan yelling as we exited.
"Yeah, you better leave!"
"And make sure you check in!"
"We now own you!"
"You're our bitches!"
We walked down the stairs as I grumbled, "Can't wait to shoot him."
"Trust me," Joey said, "You'll get your chance."
JOEY
"Boss is a dick." Sean sighed.
"It's not his fault man." Derek informed him.
"Yeah, he was probably tricked into it, knowing fucking Ryan." Ken plopped down on the couch.
We were in our safe house and it was around two in the morning.
"I just wish he was alive again." I admitted.
"Yeah," They agreed.
"Guy's I have to tell you something." Ken said.
"What?" I asked.
He sighed, "It's something about Alan."
We were silent. We haven't talked about or mentioned our old friend Alan Loki in almost ten years. He was the sixth member in The Crew. He was there from the beginning until he went M.I.A.
"What about him?" Derek asked.
"Well before boss died, when we found this one in the interrogation room," Ken pointed to Sean, "Boss said something about Alan."
"What's he say?" I questioned.
"He just said that he can't lose another agent like he lost Alan." He informed.
"Oh, what does that mean?" Derek asked.
Ken shrugged, "I don't know, but I think Alan's still alive."
"No, he couldn't be, it's been ten years." I informed.
"I know it sounds strange, but think about it. When Alan went missing, we vowed to never speak about him due to the Triton Agency making us continue, right?" He asked.
We nodded.
"And to think, his body was never found, right?" He continued, "Face it guys, he's still alive."
We were silent.
"Well if he's still alive, then we have to find him." Sean ordered.
"Yeah, you're right." Ken agreed.
"A new job boss?" I looked at Ken.
"Joey..." He sighed.
"You're our new leader Ken." Derek said.
Ken smiled, "Maybe I am."
"And maybe you're not gay." Sean laughed.
Ken held up his hand, "Sean please, don't ruin the moment."
"Fine, I take it back, you are gay." He smiled.
Derek and I laughed.
Ken huffed, "You're an ass."
"And your brother," Sean miffed.
"Hold up!" I held, "What?"
"Nothing," Ken growled.
"Me and Kenneth are related." Sean smiled.
"Shut the fuck up!" Ken pulled his fist back.
"What!?" Sean flinched, "We are!"
I smiled, "Holy shit."
"No way!" Derek looked at me, "Tell me this ain't so."
"It is!" Sean chirped.
Ken sighed, "Found out back when we first started."
"Ten years ago?!" I asked.
He nodded, "Sorry for the secret."
"But wait, how the hell are you guys related?" Derek asked.
"Long story," Ken sighed.
"It all started with his dad fucking my mom." Sean laughed.
"You're an idiot." Ken rolled his eyes.
"No, I'm a genius!" he cheered.
"Whatever." Ken huffed.
I smiled, "Look at the cute brothers."
Derek laughed, "Dude it's going to be so fun fucking with them."
I smiled, "Who's older?"
Derek looked at me, "We all know Sean's a baby."
I laughed, "Yeah I know."
"Fishes," Sean mumbled.
Derek and I laughed.
"I'm sorry, it's just too funny." I laughed.
Sean rolled his is eyes, "I hate each of you to a different level."
"You know damn well you love us." I smiled.
Sean looked down and smiled, "Cole said something like that to me a while back."
"Oh," I looked at him.
Ken placed his hand on Sean's shoulder, "We miss him too man."
I sighed, "He wasn't just a leader, but a best friend."
"More than a friend; like a freaking brother." Derek added.
Sean started towards the front door.
"Where are you going?" Derek asked.
Sean turned; "Ya'll coming?" he turned back around.
We got up and started towards the front door.
He turned again and winked, "Might want to bring a weapon."
DEREK
When we pulled up to Cole's house I knew something was up. We didn't know where we were going before we pulled up in his drive way.
"What're we doing here Sean?" Ken asked.
Sean got out of the van and approached the house.
I sighed and looked at the guys, "Let's go in."
We got out and followed Sean.
"Where are you going?" I asked Sean.
He messed with the doorknob, "Who has a lock pick?"
"We're not going to break into Cole's house." Joey said.
Sean looked back at us, "I need a fucking lock pick! Will you help me or not?!"
"Okay!" Joey yelled, "Here, I have one."
He dug into his pocket and took out the lock pick and handed it to Sean. Sean started messing with the lock and soon opened it.
We entered Cole's house slowly, looking for police around in the streets.
"Haven't been in here in almost a year," Ken informed.
"I know right, seems so..."
"Strange." Sean finished Joey's words.
I sighed, "Almost different."
"I think he did get new furniture." Ken smiled.
"Ha-ha-ha, very funny Meginley," Joey rolled his eyes.
Ken smiled and looked around.
"What are we doing here for?" I asked Sean.
He sighed, "We came here to look for clues."
"For what?" Ken asked.
"Boss had a secret." He informed.
"I think we all have our secrets." Ken huffed.
Sean shook his head, "No, his secret was big, bigger than any of ours."
"Whatcha think it was?" I asked.
He shrugged, "That's what we came to find out."
"But how do you know he had a secret in the first place?" Ken asked.
Sean looked down, "He uh, told me."
"What?" Ken looked confused.
"How?" I questioned.
"He left me a note in my mailbox."
We looked at each other.
"You don't think that there's a note in our mail?" I looked at Ken.
"Probably not," Ken smirked, "But I guess we'll find out now wont we."
"For now, we look around for clues to Cole's secret. That's what he wants." Joey informed.
We nodded and started looking around Cole's house. I went into the kitchen and looked inside the oven.
"Hey, Derek, why don't you go look in his bedroom?" Ken suggested.
I looked at him, "Why?"
He shrugged, "Just a suggestion."
I shut the oven and came up to him, "You think I take orders from you?"
He looked at me, "Whoa, Derek what the fuck?"
I pushed him, "Do I look like a guy who takes orders from a sick person like you?"
"Derek." Sean cautioned.
I looked Ken in the eyes and winked, "Gotcha."
He laughed and looked away, "Dude, you almost made me shoot you."
"That would have been a boner." Sean laughed.
"What?" I looked at him.
He laughed and waved his hand, "Inside joke."
I shook my head and started into Cole's room.
"You're an idiot Sean." I heard Joey say.
I opened Cole's bedroom door and went in. The place seemed normal, a bed, a dresser, a night stand, and even a TV.
I smiled; boss had his normal life in his hand the entire time. Nice cover up.
But being a hit man does come with its perks. I mean we do keep the creeps off of the streets and that's a plus.
I sighed and clapped my hands, "Let's get started then."
SEAN
Some things are better left unsaid.
I learnt that from experience. After Derek went into Cole's old room we started fighting. And I mean talking to each other in a childish way. I was the center of it all.
"You're an idiot Sean." Joey rolled his eyes.
I sucked my teeth, "Screw you white boy!"
"That's Derek's line." Ken sighed.
"Well now it's mine." I seethed.
"As if," Joey rolled his eyes.
"Why don't we get back to work?" Ken suggested.
"Nah, I'd just like messing with the idiot." Joey laughed.
"Why would you mess with Ken?" I asked.
"I'm talking about you dumbass." Joey informed.
I knit my eyes, "You're an asshole!"
Joey smiled, "I know."
I rolled my eyes, "Idiot."
"Who's the idiot!?" Joey yelled.
"You are!" I argued.
"Pssh, as if,"
Cole's bedroom door opened and Derek came out, "Guys, I found something."
"What is it?" Ken asked.
He held up a pistol in a plastic bag, "I found this."
Joey sighed and turned, "A freaking gun in a plastic bag, whoopty damn doo."
"It's not just an ordinary bag," Derek informed, "It's an evidence bag."
"Who's evidence?" Ken asked.
Derek looked at the bag closely, "Loki."
"You don't think..." Joey cocked his head.
Ken looked at Derek, "Does it have a date?"
Derek looked at it then back up at us, "11/23...2013."
"Shit..." Ken looked down.
"Why would boss have this?" Joey asked.
"I was right," Ken smiled, "The bastard's alive."
"Maybe..." Joey started.
Ken shook his head, "No, he is. Why would Cole have a phony evidence bag?"
"It makes total sense!" I boasted, "Boss knew Alan was alive the entire time, he lied to us...He wanted to help Alan alone."
"Or maybe he didn't tell us due to him being K.I.A?" Derek suggested.
I shook my head, "No, he knew Alan was alive for a while. He just didn't tell us."
"What makes you say that?" Ken asked.
I sighed and took out the note that Cole had given me and read it aloud:
"Dear Sean,
I know times were tough, but we stuck it through. The Crew has been through a lot, and I mean a shit load of crap.
But isn't that what makes us so special?
If you are reading this, then I am no longer with you. I just wanted you to know that even though you were kicked out, you're still a part huge part of this Crew. Without you there wouldn't be laughter and an upside to our missions.
The reason I am saying this is to inform you that our biggest mission is not over. Jesse is gone, and now our biggest threat is Felix.
But before we can kill him like we all want, we have to get through something big, something we've all been ignoring, what I've been ignoring.
I've kept a secret, a dark secret that you all will probably hate me when you find out. But before you find out there are some clues you will have to find that leads to my secret.
Until then, get ready for hell because that's what it's going to be until you find out the truth.
Sincerely,
Your boss and friend, CP
P.S. The first clue is this:
Look no further because it's right down the street. Just take a left."
"That boss, always taking the long way to explain things," Joey sighed.
I folded the paper and put it back in my pocket.
"What did the last part mean?" Derek asked.
"The P.S?" I questioned.
He nodded.
"I didn't know at first either, but then I looked it over and sorted it out." I said.
"What'd you get?" Ken asked.
"Cole's house," Joey awed.
I nodded, "Yeah."
"What?" Derek looked confused.
"Because think about it, what's down the street and to the left of the safe house?" I looked at them.
They were silent.
"Cole's house!" I informed, "Come on guys, didn't know you were that stupid."
"Shut up Sean," Ken huffed, "We got the first clue, now let's go."
JOEY
We went back to the safe house and took the clue with us. We didn't know what to do when we got there. We started to lie around and think—then someone got an idea.
"What if we go ask Josh?" Sean suggested.
I huffed, "Nah, let's not bother him."
"Why?" Ken asked, "That's a brilliant idea."
"Yeah ask the cop about the case." Derek said.
I sighed, "Don't expect me to come."
"Come on! Joey, he's your brother." Ken informed.
I rolled my eyes, "Don't mean I want to see him."
"Don't be a dick." Sean huffed.
"I'm not being a dick, I'm just saying!" I explained.
"Well don't, come on, we're going." Ken grabbed my shirt and lifted me up from the couch.
"Why're you doing this to me?" I asked.
"Because he's your brother, you should go talk to him." Ken said.
I stopped in my tracks, "But it's awkward!"
"I don't care!" He pushed my back.
We went out the door.
"But it's awkward!"
KENNETH
"What can I do for you boys?" an officer asked.
We were at Josh's police station.
Sean came in front of me with a smile on his face, "Remember me?"
The officer gave his bitch face, "How could I forget?"
"Did you remember my glazed donuts?" Sean asked.
I pushed him aside, "We're here to see Josh Walker."
The officer nodded, "As always. Give me a minute."
He turned and walked off.
I looked at Sean, "What the fuck is wrong with you? Seriously,"
He shrugged, "People like you don't get it."
"People like me?" I asked, "You mean the smart ones?"
He rolled his eyes, "Yeah."
I laughed, "Loser!"
"Gay boy!" a familiar Russian voice said from across the room.
"James! My man!" Sean smiled.
James smirked, "In which way do you mean?"
I had given a look of confusion, "Well that moment just crashed."
"In what way do you mean, gay boy?" James asked.
"Do you have to make everything sexual?" I questioned him.
He nodded and that's when I noticed that he was in cuffs.
I looked at him, "Dude got caught?"
He nodded, "Yeah, the fuckers got me."
Sean laughed, "You got caught slipping!"
"Man I'd backslap you if I weren't cuffed!" James yelled.
The officers around him shushed him and he rolled his eyes. I looked to the side to notice Josh coming up to us.
"What're you guys doing here?" He asked.
"We need to talk." Joey informed.
Josh nodded, "Okay, but let's take this outside."
I pointed to James, "But we get to take him with us."
"But he's a criminal." Josh said.
I looked at him, "He's a friend."
He sighed and nodded, "Wait for me outside."
We nodded and started out of the station. We congregated by the van and waited until Josh came out with James.
"I wonder what James did to get busted." Joey said.
I huffed, "Probably touched someone inappropriately."
They laughed.
"Man, the dude's nuts." Derek informed.
"Got to love him though," Sean smiled.
I looked at him, "You really are a gay boy."
Sean winked, "You know it."
I rolled my eyes, "Idiot."
He laughed as Josh and James came up to us. Josh took the cuffs off of James.
"What do you want?" Josh looked at us.
"We need to know about a case." Derek informed.
"Which one?" Josh asked.
"Alan Loki, his case." I said.
He looked at me, "I'll tell you all you need to know, that's my case."
"Good." Sean smiled.
Josh looked at Joey then looked away.
"What's up with you two?" I asked.
Josh sighed, "Nothing."
"Something is. What?" I looked at the two of them.
Joey sighed and walked away.
I looked at Josh, "What?"
He sighed, "Something happened."
"What?" I asked.
"Geez nosey." Sean smiled.
Josh looked at me, "Our dad came to visit a couple days ago."
"So."
"So? In case you haven't heard, or fathers not exactly the role model."
I huffed, "How bad could he be?"
"He stabbed Joey when he was seventeen then left our lives without even apologizing or even saying why he did it." He informed.
"Damn..." I managed.
He nodded, "And I didn't find this out until a while back."
I huffed, "God."
"I'd like to meet him." Sean cracked his knuckles.
I rolled my eyes, "The most you can do is call him a fish."
"Yeah, why do you do that again?" Derek asked.
Sean smiled, "Because it's funny."
Josh looked at us, "Where can we do this?"
"What're we having sex?" Sean asked.
Derek rolled his eyes, "Idiot."
I looked at Josh, "Anytime you want, princess."
Part 2
Joey Walker
When the agents asked me questions to personal things and I didn't have the answer they whacked me in the face with a dildo. It was the most uncomfortable thing that ever happened to me.
I had to admit, it stung like a bitch.
I didn't know the people who took me. They just grabbed me at my house as I was walking in. Put a pillow case on my head and tied my hands behind my back as they threw me into the back of a car.
They knew who I was, hell, they knew a lot about me. When they took the pillow case off there was a girl in front of me. She was pretty; tall, white, medium dark purple hair and a smile of a killer.
I didn't catch her name, only her sweet and sassy attitude.
"Joey Martin Walker, it's a pleasure." She crossed her arms.
I smiled up at her, "The pleasure's all mine."
"I've been watching you and your friends for quite a while; I know more about you guys then you know about yourselves." She said.
"Then what's my favorite color?"
She smiled, "That's easy... before you were born your mother sewed you a pink blanket thinking you were a girl and later your father made you wear it until you grew out of it. You called the blanket 'Captain Bob' for the rest of your life, thus your call-sign, Captain Bob. So your favorite color is pink."
"I'll never forget Captain Bob." I sniffled.
"Any more questions?" She looked at me.
"Yeah," I looked up at her, "Me and my friends, what're we called?"
"Pssh! You mean, The Crew? The only hit men in the world that fucks up during a job?"
I rolled my eyes, "Lucky guess."
"Anything else?"
"One more," I smiled, "How many people betrayed the Crew?"
"Enough with all the easy questions; everyone but you, because that's how trustworthy you are," she smiled.
"Psychic much?" I huffed.
She smiled, "Maybe."
I nodded, "So, why am I here?"
"I want you to do me a favor. Actually, it's more like I'm doing a favor for you."
"Why would I do ANYTHING for you?" I asked, "You were the one whose friend kept freaking smacking me in the face with a freaking DILDO!"
"That was just me getting to know you better," She smiled and approached me, "I like you Mr. Walker, and I think we can make a deal together."
"I ain't making no deals, sorry to burst your bubbles sweetheart." I looked up at her.
"Oh, but I'll make it worth your while," She came and sat on my lap; she put her hands around my neck and whispered softly in my ear, "100,000,000 to kill the Crew."
My eyes were wide, I swallowed and looked at her as she backed away licking her lips.
"Take it or leave it, the choice is yours." She smiled at me.
I looked around at the agents in their uniforms, all six of them. Then back at her.
Without a second thought; I gave my answer:
"I'll do it."
They let me go and told me to call them when the job was over. I went back to my house and cleaned up the mess that has been there for a week.
I sighed and thought about my friends. It has been a week since my disappearance. They must be worried or looking for me.
I felt around in my pocket for my phone and took it out to call Ken, the new leader of The Crew.
"Hello?" He answered on the fourth ring.
"Ken, its Joey," I looked around awkwardly.
"Oh hey, what's up?"
I sighed, "Not much."
"Cool, listen, I'm uh, kind of busy at the moment. Wanna chat later?" He asked.
I coughed, "Yeah, sure."
"Good, later man." He hung up.
"Later..." I took the phone away from my ear and put it back in my pocket.
I looked up and smiled at myself in the mirror then went out the front door, slamming it behind me.
I got in my car and headed towards the safe house—hoping it would be empty for me to do what I needed and get out.
As I drove towards the safe house I looked into the back mirror three times to notice that I was being followed by a black van.
"Oh no, not again," I sighed.
I made a right turn and sped up a little. The van followed.
"Come get me fuckers." I smirked and stepped on the gas.
I swerved past other cars and kept my speed at 70 mph with the follower not far behind. I made a sudden right turn and continued forward.
The van sped up and rammed my bumper.
"Ah! You mother—if you do that one more freaking time!" They rammed it again.
I slammed on the breaks and they crashed into the back of my car. I waited a second and grabbed my pistol and exited the car, approaching the wrecked van.
I went up to the driver's door and placed the gun against the cracked window.
"Get the fuck out of the van!" I yelled.
The man inside slowly came out with his hands in the air. There was another guy next to him who was out cold.
"We weren't following you." He said.
I hit him in the face with the side of the gun, "Silence!"
Blood came out of his mouth as he looked at me.
"Who are you?" I asked.
"You're about to find out." He smiled.
I looked at him as something went around my head. I was brought to my knees and grabbed by my arms. I heard a van screech to a stop and I was thrown in the back as the doors slammed shut and it sped off.
"Someone wants to speak with you."
The pillow case was snatched from my head. I was tied to a chair, my hands bond behind my back. The light burnt my eyes so I squinted to see the face in front of me.
"Hello there, Joey." A familiar voice greeted.
"Ryan?" his face was clear in front of me.
"Sorry to have you brought here like this, but it was necessary." He smiled.
"What do you mean? Where am I?" I looked around.
"Your safe." He informed.
"For now." A voice behind me added.
I looked up at Ryan, "Why am I here? What the fuck is going on?"
"I just need to ask you a few questions." He said.
I nodded, "What about?"
"Your decision making... It needs to improve."
I looked at him, "What do you mean?"
He smirked, "You know exactly what I mean."
An arm went around my neck and held my head up.
"Now, I'm going to ask you some questions and you need to answer truthfully." Ryan ordered.
"And if I don't?" I looked at him.
He smiled and dug into his pocket and took out a switch blade, "If you don't then I'm going to make you my bitch."
I looked at him, "You wouldn't dare..."
"Oh, I wouldn't would I?" He came closer and went for it.
I yelled in pain as he pressed the tip of the blade through my shirt and sliced open my skin.
"How's that feel Captain Bob!?"
The tires screeched to a halt, the door opened and two hands pushed me out onto the concrete. I cringed in pain as I tried to lift myself up.
"Geez, who fucked you up gay boy?" two hands grabbed my arm and helped me stand.
I looked at our Russian friend James Killer, "It's not the time for joking, man."
"You alright?" He put my arm over his shoulders and we slowly started towards my front door.
"I'll live." I admitted.
"Who did this?" He asked me reaching for the door knob.
"No one." I lied.
He opened the unlocked door and we went in.
"You telling me that no one fucked you up?" He asked, "That you fucked yourself up?"
He sat me down on the couch and went to shut the front door. I reached over painfully and switched on the light.
"Yeah, I mean, I didn't do this to myself if that's what you're asking." I informed him.
He sat down next to me, "Who did this?"
I sighed, "I don't know."
"Come on, Joey, you can tell me."
I shook my head, "I don't know."
He nodded, "Okay."
I looked around my house then back at him, "How'd you'd get here?"
He smiled, "What a man with connections can't take care of himself?"
"What's that mean?"
He laughed, "I took your guys' white van."
I nodded, "Oh."
He looked at me, "What? That not funny?"
I shrugged, "I don't know."
"You in no mood to laugh," He got up, "I'll leave."
"No, stay, I'm sorry to be a dick. I just..." I sighed.
"You want me to drive you to the safe house? We're supposed to be meeting there in ten minutes."
"Okay," I slowly stood up, "Let's go gay boy."
James looked at me.
James helped me out of the car. I had to admit, I've been in greater pain when being shot. I got punched in the face a few times and cut with a knife three times.
My chest stung and shirt was bloody, I didn't even get a chance to change my clothes.
My face hurt less. My eyebrow was cut, so was my lip and cheek. My right eye was bruised up and was not swelled—thank god.
He helped me up the steps and I pulled away from him.
"I'm good now man, thanks." I told him.
"You sure?" He looked at me.
I nodded, "Yeah, I don't want to go in there with you carrying me—they might think we're a couple."
He laughed, "But I thought you loved me!"
I rolled my eyes, turned and opened the safe house door.
"Hey! Its James!" a familiar voice cheered.
"Hey gay boy!" James yelled behind me.
We went in and shut the door behind us. The safe house was dark instead of the kitchen light.
"Who is that with you?" Ken asked.
I took the first seat that was close to me and sat down by the TV, "It's me, dipshit."
"Joey?" Josh asked.
"Yeah it's me."
"Where have you been stranger?" Derek laughed.
I sighed, "It's been a hell of a week."
"You okay?" Josh asked, "Turn the light on and let me see you."
I shifted, "Why?"
"Joey! Now!" Josh sounded upset.
I sighed and reached over painfully and flicked the switch to turn the lights on.
"What the fuck happened?" Ken asked.
Josh came up to me, "Who do I have to kill?"
I smiled, "Trust me, they'd kill you first."
"Tell me what happened? Who the hell did this to you?" Ken asked.
"I don't know." I lied.
"He wouldn't tell me either." James informed sitting across from me.
"Was it that bitch Felix?" Sean asked.
I shook my head, "My week has been hell; I got kidnapped twice, cut, punched and hit in the face with a fucking dildo!"
They tried not to laugh.
"D—do you know who did it?" Ken asked.
I sighed and looked down, "No."
"I think you do, but you're not telling us." Josh looked at me.
I looked up at him then at Ken, "It was Ryan—and some chick."
"Wait. Ryan? As in Ryan Barson?" Ken asked.
I nodded, "Yeah, Ryan knew some shit I was kind of about to do."
"What do you mean?" Josh looked at me.
I looked to the side, "There was this chick—right? And she was... Really, really hot—right? But she was a total bitch—right?"
Ken looked at me, "Was her name Harper?"
I shrugged, "Didn't catch a name just her good looks."
"She's really pretty, tall, white, medium dark purple hair and a smile of a killer, with her sweet and sometimes sassy attitude?" He asked.
"Um, yeah,"
"Jesus..." Ken huffed.
"What? You know who she is?" I asked.
Sean laughed, "Wasn't Harper your lesbian girlfriend?"
"Shut up!" Ken turned.
I laughed, "Oh my god, I almost forgot about your first."
He sighed, "What'd she want?"
I looked down, "Sorry."
"For what?" Josh asked, "What did the chick want from you?"
"She knew a lot about us, I mean a lot, she asked me if, uh, I could, um... kill... the... crew."
"Hold up! What'd you say to her?" Sean asked.
I looked up a bit, "Yes."
"You said... yes?" Josh looked at me.
I cocked my head, "Yeah, I did."
"Why? Do you hate us or something?" Sean asked.
I looked at him, "Man, I wasn't going to actually do it! God, man! I'd rather die than turn on you guys! You actually think that I'd turn on the Crew? I am not like the rest of you!"
"What does that mean?" Ken snapped.
"You know exactly what that means! Everyone betrayed the Crew other than me and Cole! You, Sean, and even Derek! You guys are a disappointment to boss! You left him when he needed you the most!"
"That's not true!" Ken came at me but Josh stopped him, "We made mistakes! Like everyone else in the world! You even made a mistake—remember John, Bobby, Frankie, Kyle, Rose?! MEGAN!"
I quickly stood up and pain filled my chest, but I didn't care.
"Fuck you Ken! Megan's death was not my fault!" I yelled.
"Oh, same as like Cole's family's death wasn't his fault? It's always is someone's fault! The agency killed them! And it wouldn't have happened if we weren't hit men!" Ken argued.
I looked away.
"And I'm not saying that it was your fault," He informed, "It was—I don't know—I'm sorry."
"Are you apologizing? Mr. Tough-Guy does have a heart!" Sean smiled.
Ken blushed, "This is the only time you gonna hear it from me."
I looked at him, "I'm sorry too big guy."
He gave me the finger and smiled.
"I noticed that you flip people off a lot." Derek informed.
Ken smirked, "The finger don't lie!"
"So, the finger can tell if you're a gay boy?" James joked.
Ken looked at him, "What the hell is wrong with you? Is that all you think about—gay boys?"
James looked at him and gave his bitch face as we laughed uncontrollably. James smiled embarrassed and shook his head.
Ken patted him on his shoulder, "Ah, I'm just fucking with you man."
James nodded, "I know."
I sat back down I pain as awkward silence filled the safe house for a couple minutes until I finally spoke.
"So what were you guys talking about before me and James came in?"
"About Cole's clue." Ken informed.
"The gun?" I asked.
He nodded.
"Turns out, that your brother knew a lot about the murder that happened some time back," Derek said.
I nodded and looked at Josh, "Inform me."
"Well, as you knew, the gun that was used to kill Officer Walker belonged to your friend Alan Loki." Josh pointed out.
"Wait—Officer Walker?" I looked at him.
"He's not related in any way to us. He's just another cop like me." He informed.
I nodded, "And why did Alan kill him?"
"Never found that out," He said, "Walker was found dead in an alley with a bullet to the head. When police got there Alan was checking in his victims pockets and fled the scene."
"Damn. Are you sure it was him?" I asked, "Because he's supposed to be dead."
"That's what I said." Derek admitted.
"Then I told him that a witness saw him and knew him." Josh informed.
"What was the witness's name?" I asked him.
"Bobby Adams." Ken put.
"Wait—that's..."
"John's brother." Josh finished my words.
"We were just as surprised." Sean said.
"But... this entire thing couldn't have happened just because Kyle robbed the wrong bank." I looked at them.
"But it all did," James informed, "See, Kyle knew that your job was at that bank, he was watching you the same as Felix was—same as Harper was, this entire dilemma all started when you saved that kid. They knew—out of all of you—that he would be the one to stop and help that little girl."
I looked down.
"But it wasn't his fault," Josh spoke up, "I mean, it's never anyone's fault."
"We know it wasn't Joey's fault." Ken said.
"It was Jesse's fault—if he fucking trusted us..." Derek balled his fist.
"What's done is done. What's our plan now?" Sean asked.
"Well the Triton Agency is still standing, Felix is still alive, Ryan needs to pay, Harper wants the Crew to die and Cole's secrets still unknown—I think we need to have the perfect plan to get all this drama off our backs." Ken informed.
"What a life we have guys." I huffed.
James looked at me, "It can't be that bad, I know there's a lot of crap on your plate, but, come on—at least your alive and have great friends."
"Because that's what matters most—right?" Ken rolled his eyes, "I'm glad we're alive, but we're the only great friends we have. We ain't friends—but brothers, always have been."
I smiled, "The Crew Is True."
"Hey guys, I got a plan." Josh informed.
We looked at him.
"Whatcha got, pope?" Sean asked.
Josh rolled his eyes, "Well, since you we have a lot on our plate—"
"No, everything is on our plate—not yours." I interrupted.
"Will you let me finish?" Josh laughed, "Anyway—we should settle things one by one."
"Yeah but, what do we start with?" Derek asked.
"How about this: why don't we call Felix?" I looked at them.
"Why?" Ken snorted, "What can he do?"
"For one, he can help us get Ryan." I informed.
"But he's the enemy." Derek pointed out.
I looked around and sighed, which hurt my chest.
"Let's get you patched up. We'll speak about this later." Josh informed.
I slowly got up as he gently grasped my arm and helped me stand. Ken turned and dug in the top cabinet for the first aid kit we kept for emergencies.
I sat down at a chair in the kitchen as Ken approached me with the stitches.
"This might hurt a bit." He smiled.
"Something tells me that you enjoy hurting me." I said to Ken as he finished stitching up my wounds on my chest.
He laughed and put the first aid kit away, "I do."
I rolled my eyes, "What now?"
Josh sighed, "Well, your plan sounds do-able."
"But it's Felix!" Ken pointed out, "The asshole killed boss!"
"I don't think he actually did it." Sean said.
"What do you mean? He shot him! We all saw it!" Ken argued.
I sighed, "Do we have another plan?"
They were silent.
"Then we have to do it!" I yelled to them, "Cole would have wanted us to go through with it!"
"No, Cole would have wanted us to kill him." Ken looked at me.
"You don't know what he'd really want." I mumbled.
"Neither do you! God, all of you are the same! Don't care about anyone else but yourselves!"
"Who the fuck are you talking about!?" I yelled.
"You! Sean! Derek!" He pointed to each of us.
I rolled my eyes.
"All of you are assholes! Self-centered assholes!" He yelled.
"Look who's talking!" Sean stood up for himself.
"Why don't you go take a look in the mirror Kenneth!?" Derek joined.
Josh and James backed off away from the argument. They stood off looking awkward by the front door.
I stood up, "You shouldn't be talking Ken. We all know you were the first one to betray the Crew to go get fucking high!"
Ken came at me and pushed me back—hitting my stitched wounds. I immediately plopped onto a chair and cringed as I took the pain.
Josh pushed him back, "That's enough!"
"Oh and you're just brother of the year!" Ken miffed with a look of disgust on his face as he tuned and stormed off out of the safe house.
"Who needs Ken anyways?" Sean asked.
"Yeah, the ass." Derek huffed.
I looked down and slowly got back up with my chest stinging.
Josh looked at me, "You okay?"
I nodded, "Yeah."
James huffed, "What're we going to do now?"
"What about my plan?" I asked.
"I think it's worth a shot," Sean responded, "I mean Felix said something to me back at boss's funeral. He really got me thinking about what Cole's secret is."
"What'd he say exactly?" I asked.
"He said something like things aren't what you seem. I don't remember exactly." He informed.
I nodded, "Maybe he knows something we don't."
"Maybe we should go ask the little bugger?" James suggested.
"Good idea," I smiled, "Let's go."
I knew the only place to find Felix was the Triton Agency. And the agency was where it always has been—it's a classified location.
We parked out front of the agency and got out then started approaching the entrance.
"What're we going to say?" Josh asked.
"Hi Felix, wanna help me kill Ryan Barson? Easy as that." I informed.
We approached the front door and I pressed the call button.
"Hello, welcome to Triton's Insurance. How may I help you?" a voice in a speaker asked.
"We're here to see Mr. Morris." I informed.
"Okay, who may I say is asking?"
I sighed, "The Crew."
"One moment please."
Sean looked at me, "Mr. Morris?"
I shrugged, "Formal."
He nodded, "Yeah I guess."
The doors opened and a man stepped out.
"Good evening, Felix is waiting for you. Follow me." The man turned.
We followed him to Felix's office. Felix was there waiting like he said.
"G'day mates, what can I do for ya?" Felix smiled.
We piled in his office.
"Well," I tried to keep calm, "We...kind of...need...your help."
"Me mate?" he asked, "You come to me for help?"
"You're our last hope." Derek informed.
"Actually... You're our first hope." Sean corrected.
Felix smiled, "What can I do for you boys?"
"We need your help to kill Ryan Barson." I said.
"Why him?" He asked.
"Because of this," I lifted up my shirt revealing my stitches.
"That looks like it bloody hurt. Why'd he do that?"
"Because he thought that I was going to betray the Crew." I informed slowly lowering my shirt.
"Were you?"
"No!" I yelled.
"Geez mate, just a question."
I rolled my eyes, "Can you help us or not?"
He looked us through, "I don't know."
"What do you mean?" Derek asked.
"I mean, I don't know. Should I trust you guys?" Felix responded.
I laughed, "Should you trust us?"
"I don't know if you might turn on me and kill me." He stood up from his chair.
"We won't." Josh assured.
"And who might you be?" Felix looked at Josh.
"The name's Josh. Josh Walker."
"Ah, you wouldn't be Joey's older brother would you?" Felix asked.
"Yeah, I am." Josh admitted.
"Aw, brothers reunite." He smiled.
I looked at him, "What?"
He shook his head, "Nothing. How can we start?"
I smiled, "Whenever you're ready."
"Good, let's start now." He walked out from behind his desk.
We backed up cautious.
He laughed, "What's the matter? Don't trust me yet? You will."
I motioned for Derek and them to move out of the way. When they did I looked back at Felix, "After you."
Felix took us to his best agents, because—as he said, we needed an army. I didn't know why we needed an army, but he said that Ryan has good agents and that we needed to take out the entire agency.
I just wanted him to pay.
His best agents looked as if they came straight from the Military. Buff, shaved army buzz, and hot headed. Their names were Wade and Tony.
Wade was the hot head and Tony was the calm one. Together they were powerful hit men. We met with them in the training room.
"How's it going Boss?" Wade greeted Felix.
"Got another job for ya guys." Felix informed.
"What kind?" Tony asked.
"And who are they?" Wade nodded to us.
"They're your new partners in crime." Felix informed.
"Yay, new pray." Wade rubbed his hands together.
James and Sean laughed.
"That rhymes." Sean said.
"More gay boys," James mumbled.
"I can see that some of you aren't that smart. Well, this should be fun," Tony studied us, "Names?"
"James."
"Joey."
"Josh."
"Sean"
"Derek."
We each nodded as we said our names.
"Ah, some of you are The Crew? Right? Which ones?" Wade asked.
Derek, Sean and I raised our hands.
"Why only three?" Felix asked.
I looked at him, "You should know, ass."
"What'd I do?" He cocked his head, "Oh right."
I sighed, trying not to kill him. This was the only way to get to Ryan.
"We need a plan to get to the target: Ryan Barson." Felix informed.
Wade looked at Tony, "Do a background check on the target."
Tony nodded and looked at us, "Any of you know how to work a computer?"
Derek nodded and raised his hand, "I do."
Tony smiled, "Then come with me, have I got something to show you."
Derek looked at me.
I nodded, "Go ahead."
He proceeded forward and followed Tony out of the training room.
"What was that?" Felix looked at me, "Are you the new boss?"
I shrugged, "I can be."
"That would make us enemies." He smiled.
"We already are enemies." I smirked.
He nodded, "Well, can we push that aside? I figure we have work to do."
"What work can you do?" Sean said disgusted.
"I can do a lot... Bro," Felix smiled.
"We ain't related." Sean huffed.
"More than you know."
Sean rolled his eyes, "I can't." he turned out of the training room.
"Sean?" I called.
He continued. As he started towards the exit, I went after him.
"Sean!" I stopped in front of him, "What's up with you? Like your brother much?"
He sighed, "I thought I could deal with the fact that Felix almost killed me and killed Cole, but, I can't. There has to be another way to get to Ryan. The Crew an do it alone."
I shook my head, "No, we can't. And with a shit load of crap on our shoulders, we need all the help we can get."
"But why him?"
I sighed, "Because boss said to."
"What do you mean?"
"Do you remember the letter you got from him?" I asked.
He nodded, "Yeah, did you get one?"
"A week ago." I took the letter out of my pocket and read it aloud:
"Dear Joey,
If you are reading this, I am no longer with you. That's okay though, I believe in you to fulfill the duty of a member of The Crew.
There are clues that lead to a secret I've been keeping for a couple years. You may hate me for it, but I don't care. If you found the first clue, good, if not, ask Sean—he knows.
Joey, you're like a brother to me. I'm sorry about all the stupid fights we had, all the bad things I said about you and Josh. It was dumb of me to judge a book by its cover.
You saw yourself how a fucked up brother he is, and you understand that you deserve more. We all do.
I am most importantly sorry for deserting you in time of need. But, you know I can't make the future.
As you know, there are clues that lead up to my secret. Can't say how much, or why I'm doing this—just go with it.
Like Sean puts...The Crew is true.
Your Friend and Boss—CP
P.S. The second clue is this: Look to the one that took us for granted, the one that needs to burn, for he is the one that hold the secrets."
"Felix holds the secret?" Sean looked at me, "What secret?"
"That's what we need to figure out." I said.
He huffed and looked over his shoulder, "And what I'm about to find out."
He turned and started back towards the training room.
"Sean? Sean!" I ran after him.
He went in the training room and confronted Felix.
"Hello... mate! G'day we're having huh?!" He yelled.
I stopped behind Sean.
"Are you making fun of me?" Felix asked.
"What makes you say that, mate?" Sean faked a British accent which sounded more like Australian accent.
Felix studied him, "Can't tell if he's joking."
"Oh, he's joking... Sean stop it!" I hissed.
Felix lifted his hand, "No, no, let him continue."
Sean looked at me then back at Felix, "I want to know what you're hiding and I want to know now."
Felix smiled, "What I'm hiding?"
Sean nodded, "Tell me everything."
"Everything?"
"Everything..."
"Everything, everything?" Felix looked at him.
"Will you just tell me!?" He snapped.
Felix smiled and I looked at James and Josh. Worried about what was about to happen next.
"About your boss?" he asked.
Sean nodded.
"Well," Felix begun, "about a month ago he came to me, just like you did."
"For what?" Sean asked.
"He needed help. He said that someone he knew was in deep."
"Did he say who?" I questioned him.
He shook his head, "Just told me that he needed help. That he wanted me to do something for him."
"Kill him." Josh looked at him.
"Yeah, I didn't know why. So I went with it." Felix informed.
"You killed him? Why? Because he said so? So if someone asked you to jump off a bridge, you'd do it?" Sean snapped.
"I did it because he begged me to! Your boss begged me to kill him because he couldn't do it himself! I did him a favor!" Felix yelled.
Sean came at him and pushed him before I grabbed him and held him back.
"You're fucking lying! Cole would never do that!" Sean fumed.
"Oh he wouldn't?!" Felix argued, "Your boss hated his life! He lost everything he care for and still carried on! Then he just couldn't face the fact that he was a terrible leader!"
I just lost it. All the very little respect I had for Felix went down the drain. I let go of Sean and we both went for him. Luckily Josh and James were there to stop us for we would have killed Felix right then and there.
"Ooh, feisty ones." Felix smirked looking over to Wade.
"You mother fucker! I swear if my brother wasn't holding me back I'd fucking kill you!" I yelled.
"You wouldn't dare," He laughed, "Because I'm the only ticket to seeing your boss alive again." He walked out of the room with Wade behind him, "You coming?"
Felix (the asshole) led us to the interrogation room. We didn't go in; we went into the other room next to it to watch what was happening inside.
"Looks like you replaced the broken glass," Sean huffed, "Nothing but bad memories here."
We stopped in front of the see-through glass and looked inside.
"Why is Derek in there?" I asked Felix.
He smiled and looked over at me, "I want to make you a deal."
I knit my eyebrows, "What're you talking about?"
"You are going to kill Harper Ortiz."
"Ken's ex? Why? What's in it for me?" I asked.
He looked over at the mirror. Derek and Tony were inside talking and on a computer.
He pressed the speaker button, "Do it."
Tony in an instant whipped out a pistol and aimed it at Derek's head. The speaker was on so we heard what they were saying.
"What're you doing?" Derek asked him.
"Orders sorry," Tony stood up.
I looked at Felix, "What the fuck do you think you're doing?"
"You kill Harper, Derek goes free. You don't kill the bitch; he dies—easy as that." Felix continued.
I huffed, "You're a sick son of a bitch you know that?"
He cocked his head, "Maybe I am and maybe I ain't."
"And maybe you should kiss my ass." Sean snapped.
"Not today bro," He looked at Wade, "Escort them out of the Agency."
Wade started pushing each of us out of the room. James, Josh, me, then Sean.
"Thanks Wade." Sean joked, "I really appreciate it."
Wade smiled, "Anything for you fish."
Sean stood there shocked. Wade laughed and pushed him forward.
We were escorted out of the Triton Agency. As we were walking towards the van Sean went on about the whole 'fish' thing.
"I don't understand!" he bitched, "How could he know my thing?!"
"Maybe he's psychic?" I suggested.
He shook his head, "No, there's something they're not telling us."
"And the whole Cole thing? Dude's hiding something." Josh pointed out.
"But what?" I asked.
"We have to find out." James said.
"No, we have to kill Harper." Sean corrected.
"He's right, we need to save Derek." I informed, "Let's go back to the safe house. We need to figure out what we're going to do."
Sean sighed, "Why is it always the safe house?"
"You know what? I got a better place. Let's go." I unlocked the van and we got in.
"Why're we here?" Sean asked.
"He's a part of the Crew too, plus, he's your older brother so we have to get him back on our side." I said.
He sighed, "Don't remind me that he's my brother. It's sick enough."
Josh laughed, "Wait, Sean and Ken are related?"
"Crazy right?" James agreed.
We approached Ken's front door and I knocked three times. We were quiet as it took time for him to come to the door.
Footsteps stomped towards the door and before he opened it Ken yelled,
"Who the fuck is disturbing me at a time like this!?"
I forgot to mention, it was about one in the morning.
The door swung open and the next thing I saw was Ken in his boxers standing with his hand on his hip looking pissed off.
"What the fuck do you want?!" He yelled.
We just stood there, shocked and estranged from our surroundings. Ken smiled, "Enjoying the view gay boys?"
I blinked and Sean screamed,
"MY EYES! I CAN'T FEEL MY EYES!"
We laughed—even Ken, then we just stared at Ken, looking down and sighing, unknown of what to say.
"I know. I know," Ken smirked, "I'm sorry too."
I smiled, "Yeah well, we need ya man."
"I know," He looked at me, "did Felix turn on you?"
I looked down, "How'd you know. Is it that obvious?"
He nodded, "Yeah, what'd he do this time?"
Sean looked up, "He wants us to kill your lesbian ex-girlfriend."
"What? Why?" he asked.
"We don't know, but he took Derek for leverage." I informed.
"What?" He sounded pissed, "Fucking Felix."
"Can we come in?" Sean pleaded.
Ken looked around, "Yeah, come in."
We stepped up the step and walked inside his house as he shut the door behind us.
Each of us plumped down on the couch as Ken sat on the love seat in front of us.
"So," He began, "Tell me what's up."
"Well, Felix, as you predicted it, lied to us, deceived us, and is making us kill your ex-girlfriend, Harper." I huffed.
"Plus he had Derek." Sean added.
Ken nodded, "What did I tell you about him? He's no good."
"I just, thought he could help." I admitted.
He huffed, "Didn't turn out quite as planned, did it?"
I laughed, "Nah, not at all."
"And do you guys know exactly why he wants to kill my ex?" He looked at us.
I shrugged, "Just said he wants her to die."
"Oh,"
"Do you still have feelings for her Kenneth?" Sean asked.
"No." He smirked.
"Guys, why don't we go to Harper? Tell her that Felix wants her dead, maybe she'll kill him for us." I suggested.
"Or maybe she'll kill you for not killing us and then take us out," Sean informed, "Because in case you forgot, she 'hired' you to kill us."
I raised my eyebrows, "Almost forgot about that bitch hitting me in the face with a dildo."
"Still funny." James laughed.
I rolled my eyes, got up and went into the kitchen. Ken's house was always clean. It was like the white house, clean with maids, without the maids.
"What're you doing in my kitchen?" Ken asked me.
"I'm hungry." I admitted.
"So, go somewhere."
I flipped him off, "Screw you."
"We can step this outside."
I shook my head, "Nah man, I quit."
"Pussy." He mumbled.
I looked back at him, "What was that?"
He shook his head, "Nothing."
I rolled my eyes, "Ken, you're all bark and no bite."
He came at me, "No Bite?"
We stayed at Ken's house for another hour, thinking of something that may have never came to us without the help of my brother Josh.
We thought of a way to stop Felix and end all this once and for all. But if this does work, then we are the lucky ones and we haven't been so lucky lately.
I came up with the idea to have me go to Harper stating that I killed The Crew so she lets me off and with Ken and the others having my back I'm going to ask her if she could kill Felix because he wants her dead and she should strike first. *huff*
"Sounds like a plan." Ken recited.
We went to Harper's home. It was a ways from the safe house but about down the street from Ken's house. They stayed in the van while I approached the front door.
I knocked three times, "Anyone home?"
My heart pounded, part of me was scared—knowing—expecting the worst of the situation. But I sucked it up and moved on.
No one answered the door so I decided to go back, for my safety.
"What's up? No answer?" Josh asked.
I shook my head and got in the van, "No, she's not home."
"That's because she's never there." Ken informed.
We looked at him.
"What do you mean?" Sean asked.
He rolled his eyes, "Bro, it's easy, if you would have asked me earlier I would have informed you that Harper is never home."
"Why isn't she? Where is she?"
"Geez, you don't quit. She's at work."
"Why are you being a dick?" I asked Ken.
He looked at me, "Excuse me?"
"You're being an asshole, be nicer."
He rolled his eyes, "Stick with the plan."
"What plan? We had no plan!" I yelled.
Josh placed his hand on my shoulder, "Quiet."
I sighed, "I just think you should be nicer to your brother, he's the only one you have."
Ken looked down, "My bad."
Sean placed his arm around Ken's shoulder, "It's okay pookie."
Ken gave him the finger and then looked over at me, "I wouldn't be an ass if he wasn't such a pain."
"Can we go?" James asked us.
Ken nodded, "Yeah, I know where she is."
Ken drove us to an old abandoned building which was up the street from her house. He told me to go in asking for Harper, and I did.
"Harper!?" I yelled.
The talking stopped and it was quiet. I took a step forward.
"Harper? You here girl?"
"Look who it is," the familiar voice was heart breaking, "Joey Martin Walker. Pleasure."
I smiled, turned and faced the dildo bitch.
"The pleasures all mine, sweetheart."
She laughed, "You were always such a gentleman. Did you do it?"
"If you're asking me if I killed The Crew, then yes." I informed.
She nodded, "Great. Well a deals a deal. You go free—with a cost."
I looked at her sideways, "What do you mean princess?"
"I always keep my bargains, but this time I'm taking things to the next level." She wrapped her arms around me and kissed me gently on the cheek, "I can make it worth your wild."
"Too late, where's my money?" I asked her.
"It's coming, patience."
"Moo."
"What?"
"Nothing..."
"Why'd you just moo?" She asked.
"I did not!" I protested.
"You totally just did," She backed up, "Why?"
I shrugged, "I felt like mooing."
"Bullshit!"
I looked to the side, "What?"
"You were signaling someone! Weren't you?!" She fumed.
I shook my head, "What? No! There all dead!"
"THEN WHO'S THIS?!" She bellowed.
I looked to the side to see Sean being dragged in by two of her men. They threw him up on his feet and made him stand.
I looked at him crossed, "Sean! What the fuck?"
"There's a problem." He informed.
"Ya think!?" I yelled.
"Don't yell at me!" He said, "I'm sensitive!"
I rolled my eyes and looked at Harper, "Okay, well maybe one escaped."
"Then who's that?" She pointed behind me.
I rolled my eyes, "Josh, what did I tell you!"
I turned but didn't face my brother. I faced Felix. My first instinct was to hit and keep on hitting, but I used my second instinct to stop and talk—because I'm a genius.
"Hello mate." Felix greeted with a smile.
"See the problem?" Sean whispered to me.
I watched as Felix kissed Harper on the lips, she pulled away. I felt a sort of envy but pushed that aside and stood there.
Felix looked at me, "Nice to see you with my ex, Joey."
"Wait," Sean said, "Your Ex?"
He nodded, "Yeah, Harper and I dated, why's that so important?"
I laughed, "Oh, Ken's not going to like this. You know she's a lesbian?"
"What're you doing here Felix?" Harper asked him.
He smiled, "I came because I overheard the plan to kill me from these guys."
Shit, I thought, he knows.
He looked at me and smiled his evil smile, "I had a friend snoop a mike in each of your houses—if you didn't mind."
"No, not at all," Sean grinned.
I smacked him on the shoulder, "Shut up, of course we mind."
"Oh, you won't even know they're there." He assured us.
I looked at Sean, "Where's everyone else at?"
He looked down then back up at me, "They were taken."
"What?" I raised my voice, "All of them? By who?"
He looked at Felix who smiled and raised his hand.
I looked crossed at Felix, "You did what?"
"I took your friends, you didn't need them." He said.
"We didn't need them? Felix, I can't go on without them." I informed.
"What're you gay?" he asked.
I raised my hands to my chest, "I just have a lot of feelings okay?!"
He smiled, "I'm just kidding mate."
I rolled my eyes, "Give me my friends back and you won't get hurt."
"What are ya gonna do?"
I got in his face, "Don't make me mad, you will not like me when I'm mad."
"Like I said: what are you going to do about it?"
I sighed and backed off, "Come on Sean." I turned and walked off out of the building.
"Where're we going?" Sean asked me as we stormed out of the building and headed towards the van.
"Cole's house." I informed opening the driver's side door and getting in.
Sean got in his side, "Why?"
I started the van, "I have to see something."
We pulled up out front of Cole's house about an hour later. I quickly got out and saw that the front door was open.
I looked at Sean, "Did we?"
He shook his head, "No."
I took out my pistol from underneath the driver's seat as Sean did the same on his side. We approached the front door cautiously with our weapons at ready. I motioned for Sean to go around back and he did.
I slowly opened the front door and went in and looked around at a messy house. We didn't leave it like this, I thought and proceeded forward deeper in the house. The living room was clear, no one in sight.
It was until I got into the kitchen when the noise started up. Glass breaking, pots banging, and cabinets slamming. I went in without thinking and aimed my weapon at the intruder.
"Don't move!" I yelled.
His back was turned and hood was up and when he turned and when I saw his face, I almost instantly dropped my pistol.
My jaw dropped, "Boss?"
Cole Phillips
Sometimes goodbye isn't forever.
"I went away for a bit to help out an old friend." I informed Joey and Sean as we sat down in my living room.
"Why? Why'd you leave us like that?" Joey asked me.
I sighed and looked down, "You'd do it if it was you."
He shook his head, "I'd think about The Crew before myself."
"I was thinking about The Crew!" I yelled.
"How?" he looked at me.
"Alan is a part of The Crew."
"You left for Alan? He's dead." Sean snapped.
I sat back and looked at them.
"Don't look at us like that boss, we can't read your mind." Sean said.
I sighed, "You can't tell what I'm thinking or about to say just by reading my expression?"
They shook their heads.
I rolled my eyes, "Alan's alive."
"Whatcha talking about Willis?" Sean cocked his head to the side.
I smirked, "He's alive, all these years he's been undercover for the Triton Agency."
"So he's the bad guy?" Joey asked.
I shook my head, "No, he's the good guy."
"But the Triton Agency betrayed us, left us for dead. If he's a part of the agency then he must be bad." He said.
"Unless the agency isn't bad," Sean suggested.
I smiled, "You guys get my letters?"
They nodded.
"Both of them?" I asked.
"You only sent two?" Joey looked at me.
I nodded, "Didn't have time to send all four. Did you read them? Do what they said?"
"Geez, yeah we did. And could you have not made it so difficult to do to?" he asked.
I laughed, "Sorry. Say, where's everyone else at?"
"Felix took them." Sean informed.
"He what?" I fumed, "Why?"
They shrugged.
"I don't know, he just, took them." Sean said.
"He didn't say why?" I looked at them.
"Nope," Sean chirped.
"Actually he said that he wanted us to kill Harper." Joey corrected.
"Ken's Ex?" I asked.
He nodded, "Yeah, apparently Felix had a thing with her."
"Felix shouldn't be doing these things." I huffed.
"I think he's free to date anyone he wants boss." Joey laughed.
"I mean doing these things to you guys, he's just showing off." I said.
"What do you mean?" Joey asked me.
"He's on our side." I informed them.
"How? He's Jesse's son." Sean pointed out.
I perked my lips, "Actually, he's your brother."
"No the fuck he's not." Sean snapped, "We already went through that shit."
"Actually he is, and everything happened for a reason. It's all a lie, everything started because Joey helped that kid—at least that's what you think. Alan planned this whole thing, this all started because of him. It was his idea to have us betray the agency because Jesse was such a dick to us. Everything happened because of the one that left. He started this entire thing because of what he 'accidently' did."
"What did he accidently do?" Sean asked.
I sighed, "Remember John?"
"Adams?" Joey looked at me.
I nodded, "He made a deal with him and some other guy."
"What kind of deal?" Sean asked.
"Not really sure of the details but something about drugs." I informed.
"Who was the other guy? We know him?" Joey questioned.
"His name is Kendall Maslow." I said.
"Wait... as in the Kendall Maslow? Tall guy with shaggy blonde hair and a goatee?" Joey asked.
"Yeah, how'd you know?" I knit my eyes.
"Trust me boss, that dude is all kinds of crazy." He said.
I shook my head, "Good thing he's tied up."
"Wait—what?"
I laughed, "We need to go see Felix."
"Don't change the subject."
I took out my cell phone, "I'll call him."
The phone rang three times before he answered with his British accent.
"Hello?"
"Felix my man, how's it going?" I greeted.
"Who is this?" He asked.
"Cole."
"Oh hey,"
I sighed, "Listen, I'm with Joey and Sean and they say that you have the rest of my team. That true?"
"Yep."
"Oh..."
"Yeah," He said, "We're chilling."
"Dude, you're 29 years old, leave that to the teenagers." I laughed.
"So what do you want?"
"Where are you?"
"The agency."
"We're gonna come down and talk—if that's okay."
"Yeah, sure mate. Come right ahead." He said.
"Okay, see you then man." I hung up.
We drove to the Triton Agency which was about half a mile from my house. It was silent half the way there. We didn't know what to talk about, let alone say.
"Hey guys," I made a right turn, "I'm sorry I had to lie to you, but it was what Alan wanted."
"You'd do anything for him, huh?" Joey asked.
I sighed, "I'd do anything for any of you guys. You're my team. We're family."
"Then tell me this: why is it that if we're family, everyone has betrayed The Crew? And I mean everyone." Joey asked me.
"I can't say why everyone betrayed The Crew, they have their reasons, but I can tell you this: The Crew is true." I responded.
He shook his head, "No—no we're not true—anything but true. We're barely even a team, I mean who does that? Who lets down the one's they care about the most?"
"How could you say that?" I looked at him next to me.
"Because it's true!" He raised his voice, "Everything everyone says about us is true!"
"So we are gay boys?" Sean asked.
"Shut up!" Joey fumed, "let me out! Pull over! Let me the fuck out!"
I pulled over to the side and he stormed out of the van.
"What's biting his nipples?" Sean asked.
I unbuckled my seatbelt and got out, "Not the time Sean."
I shut the door and walked in front of the van. Joey was walking away from the van.
"Hey Captain Bob!" I called.
He continued ahead ignoring me.
I stopped, "Fine! Walk away! But don't come crying to me when you learn the truth!"
He turned, "The Truth? The truth wouldn't matter if we actually cared for each other!"
"Actually care?" I yelled, "You might be the only one who doesn't care!"
He turned and started away.
"You have to take a look in the mirror sometime Joey! You act just like your brother! Troublesome and hard-headed!"
He raised his hand over his head and gave me the finger.
"Yeah screw you too!" I rolled my eyes.
"That's not what it means!" He yelled.
A van pulled up next to him and he stopped and turned. A head poked out of the window and they exchanged words as I watched them suspiciously.
Then hands grabbed Joey and they started going at it. Joey hit the guy in the face and turned and ran towards me as three men came out of the van and grabbed him.
"Shit Joey!" I darted towards the van.
I got to the van and punched the guy that had Joey in his grip and he went out cold and dropped to the ground. The other two guys backed up in front of us.
We looked at each other.
Sean came up to the van and stopped next to us and watched them as we did. They had on all black and dark brown with their faces showing.
"Do you know them Joey?" I asked.
He shook his head, "No boss."
I huffed, "And they're handling you like that?"
"What balls they have." Sean added.
I nodded and looked at the remaining men, "Get back in the van now and forget this ever happened or die."
They paused for a minute then grabbed their friend that was lying on the ground and threw him in the back of the van as they got in and drove off.
Sean laughed, "Did you have to be so harsh?"
I turned to him and shrugged, "I don't know."
Joey sighed, "Assholes."
"Who were they?" I looked at him.
He shrugged, "They asked for directions to the Triton Agency and I was confused and said that I didn't know what they were talking about. That's when they grabbed me."
"The Triton Agency?" I looked to the side, "Felix..."
"Felix!" I called.
We arrived at the Triton Agency about five minutes later and went in calling for Felix. He and Kyle were talking to an agent when we came up to them with an attitude.
"Felix Gulber." I smiled as I stopped in front of them.
The agent they were talking to walked away.
"That's not my name." Felix said.
I nodded, "Oh right, it's Felix Morris."
"What do you want Cole?" Kyle looked at me.
Joey laughed, "You've grown kid."
"Unlike your penis." He snapped.
Joey gave his bitch face as we tried not to laugh.
"We're here for the rest of my team." I informed Felix.
He looked at me, "Let's walk."
I nodded and we turned and started towards the interrogation room with Joey and Sean behind us.
"Sorry about taking your team mate." Felix said, "It was for the best—had to play bad."
I nodded, "Just don't do it again."
He laughed, "You tell the fish the truth?"
I looked back at Sean and Joey who were watching us as they followed us, "Yeah."
"How'd he take it?"
I sighed and looked forward, "Like I did at first too, confused and in denial."
"You got any new questions?" he asked.
I nodded, "Yeah. If he's your brother, then why'd you stab him?"
"I've been asking myself that question every day after I did it. I didn't kill him, stabbed him in the side not in the stomach or gut—thank god."
"He hates you."
He sighed, "I know."
As we went inside of the interrogation room all that was heard were gasps and then silence.
I smiled, "Hello boys."
Ken came up to me and almost instantly hugged me.
"We thought you were dead." he cried as he backed away.
"Sorry I had to lie to you Crew, but it was what I had to do." I informed.
Derek looked at me, "How are you alive? We saw you get shot."
I lifted my shirt up to reveal my stitches, "I did get shot. Just didn't kill me."
I lowered my shirt and nodded to Felix, "We were working with him to settle something."
"We?" Ken asked.
"Me and Alan." I informed.
"And settle what?" Derek questioned.
Felix stepped up, "Alan Loki made a deal with John Adams and Kendall Maslow."
"What type of deal?" Ken asked.
"Something about drugs." I informed them.
"You don't know the details?" James spoke up.
I shook my head, "No. He never told me."
"Hey Cole," Josh looked at me, "I know you just came back from the dead and all, but uh, I would really like to get out of here."
I laughed, "Yeah, sure man. Let's go."
"Where are we going boss?" Joey asked me.
"To drop your brother off at his house." I made a right turn.
"What?" Josh knit his eyes, "I can't go with you?"
"Sorry Josh, this thing is only for The Crew." I informed.
"Does that mean I can't go either?" James asked.
I shook my head, "Sorry man."
James huffed, "Gay boy."
I looked in the rearview mirror as the light was red, "What was that?"
"Nothing." He looked down.
The light changed and I drove off.
"Tell me again why they cannot go but he can?" Sean studied Felix.
"Because he is a part in this thing as well," I told him.
He crossed his arms, "but why do I have to sit next to him?"
"Because he's your brother." Joey said.
"Wait—I thought Ken was his brother." Derek pointed out.
I looked over at Ken who had his head down next to me, "What?"
"Yeah," Sean agreed, "That's what he said to me at the hospital."
"Ken... what did you do?" I seethed.
"I might have lied." He admitted.
"Doesn't anyone in this team tell the truth?" Joey snapped.
"You lied to me?" Sean asked Ken.
He sighed, "I didn't want you have to deal with the fact that your real brother stabbed you."
"I had to do it!" Felix defended himself, "You think I wanted to stab my little brother?"
"You had a choice! You almost killed me!" Sean yelled.
"But I didn't!" Felix responded, "I could have stabbed you in the throat! But I didn't!"
"But you still fucking stabbed me in the side!" he argued.
"I'm sorry!" Felix cried, "Okay? I'm sorry! I wouldn't have done it if it weren't for John and Alan!"
"What do they have to do with it?" Sean asked.
"Everything!" Felix yelled, "Everything you thought you knew was a lie! Your entire life and these last few years—everything was a lie! And I'm sorry!"
The entire van was silent.
"That's it." I snapped and pulled over to the side.
I turned and faced them, "You two are brothers... act like it."
"But boss—"
"I don't care if he slept with your wife and smacked your best friend—you're brothers! You're the only family you have left! You take care of each other and always have one's back, no matter what happened!" each other.
Joey and Josh looked at each other. The van was silent again as I stepped on the gas and sped away.
The entire ride to Josh's house was silent; no music and no talking. We arrived at his house and he said his goodbyes as he and James got out and we pulled off.
We headed towards the place where Alan had told me to meet him when I had the Crew. It was an abandoned building about five minutes from the safe house.
"Where we going Cole?" Ken asked.
"You'll see." I informed him and made a left turn.
"Why don't you just tell us?" Joey sighed.
"Fine grumpy. We're going to meet up with Alan." I said.
"After all these years." Sean huffed.
I nodded, "I know, seems like forever."
I stopped at a traffic light and waited.
"Cole?" Joey looked at me.
"Yeah?"
He sighed, "Did you make a deal with Ryan saying that if you die the Crew is his?"
I turned and looked at him, "What? No."
"Really? Because that's what Ryan said when we tried quitting on him." Ken informed.
"Wait," I turned, "Why would you guys quit?"
They got quiet and looked away.
"Crew?" I studied each of them.
Felix laughed, "Looks like you got played—again!"
I gave him a look, "Do you mind?"
He shook his head, "Not at all, love."
I rolled my eyes and huffed, "We need to pay Ryan a little visit."
Joey huffed, "You should have seen what he did to me when he kidnapped me."
"Wait, he did what?!" I fumed.
"Long story." He said as the light changed.
I sighed and stepped on the gas.
I pulled up with The Crew to the abandoned building and as we all got out Alan came running out of the building.
"Cole!" He called.
"Yeah?"
"Come quick!" he yelled.
I ran up to him and with my team behind me we went inside.
"What's wrong?" I asked him.
He led us to the back room, "Its Kendall."
"Boss..." Joey cautioned, "Tell me you do not have Kendall taped up somewhere in this building."
"We don't," Alan informed, "We have him tied up in this room."
We entered the back room and Joey let out a deep sigh.
"Come on guys!" He complained.
"What?" Alan looked at him.
I sighed, "That was his friend."
"This guy?" He pointed to Kendall, "This guys a bloody wanker!"
"Excuse me?" Sean cocked his head.
"Almost forgot you were British." Derek mumbled.
"Yeah, it's nice to see you too Derek." Alan retorted.
"Why is he here?" Joey asked him.
Alan huffed, "Did you not just hear me? The guys a douche."
"Doesn't give you the right to fucking kidnap him!" he yelled.
"Yeah it fucking does mate!"
Joey rolled his eyes, "And you hit him?"
"What was I supposed to do? Tickle him to death?" He asked.
Joey laughed, "Yeah!"
"That's enough you two," Felix butted in, "Let's see what he has to say."
"Oh, he already has something to say—a lot to say actually." Alan informed.
"Like what?" I asked him.
"Well he said something about the deal we made and how it turned sour," he started, "and he said something about how John threatened to kill him and take the money for himself. Then he said something that I didn't understand."
"Another language?" Sean asked.
He shook his head, "No, something like: what hurts you will make you suffer. I don't know."
"That sounds familiar." Joey scratched his chin.
"Yeah I don't know what it means." Alan shrugged.
I looked at Joey as he was looking down at the floor with a concerning look on his face.
"What's up?" I asked him.
He looked up at me, "John said something to me a while back. Something like what Kendall said to Alan."
"What'd he say?" Ken asked.
"He said: What doesn't hurt you; will kill you. Then he said that soon I will know what that means." Joey looked at us.
"Do you know what it means?" Derek wondered.
Alan looked at Joey, "That's what he said, what doesn't hurt you; will kill you. But what in bloody hell does that mean?"
"Let's ask him." I suggested looking at Kendall tied to a chair.
"Good idea mate." Felix patted my shoulder and walked towards Kendall who studied us with his mouth taped shut.
"You've been listening to what we've been saying this entire time?" Felix looked at him.
Kendall's eyes got wide and he started shaking his head.
"Just tell us this mate," Felix continued, "Who did it!?"
Kendall knit his eyes, "Hm?"
"Felix?" I asked.
He looked at me, "Yeah?"
"I don't think that's how it works... mate."
"It's how I work you bloody wanker." He snapped.
"Hey!" Alan yelled, "That's my thing."
"Sorry, just seemed right." Felix admitted.
"Well it's wasn't." Alan smirked.
Felix nodded, "Whatever."
Sean started laughing, "Two British guys fighting—classic!"
Alan smiled and nodded, "Seems like you haven't changed a bit."
"I didn't." Sean laughed.
"Obviously." Alan rolled his eyes.
"Can we get on with the interrogation? Please?" I looked at the two of them.
Alan nodded and moved over towards Kendall, "Okay, time to play my favorite game," He took out his lucky switch blade and opened it, "I'm going to ask you a question and you're going to answer truthfully. And if I even think it's a lie... I swear on my bollocks will you get what's coming to ya mate."
"Does that even make sense?" Sean asked him.
Alan looked at him, "It doesn't have to—I'm awesome."
Sean smiled and nodded, "Yeah."
He turned back to Kendall and ripped the tape from his mouth.
"HELP!" Kendall screamed, "SOMEONE HELP ME!"
Alan bitch smacked him across his face.
"Ooh, damn!" Ken covered his mouth.
"Silence!" Alan yelled at Kendall, "You no talk unless I ask you a question!"
"Well he asked me a question—"
Smack!
We busted out laughing and Joey gave his angry bitch-face and I cracked up even more.
"Are you bloody high?" Felix asked Alan.
Sean laughed, "No! He's fucking awesome!"
Joey rolled his eyes, "And I'm spider-man."
"Maybe you are." Alan looked at him.
"Okay we are not good with the whole interrogation thing!" he yelled.
"Yeah—I can tell." Kendall huffed.
Alan pulled his hand back and he flinched.
"Alan!" Joey yelled, "Why do you have to be so harsh?!"
"Why do you care what happens to the asshole?" he asked.
Joey sighed, "Because he saved my life."
"When?" I asked looking at him.
"Back when those guys jumped me, he was there to save me." He informed.
"I thought that was Josh?" Ken questioned.
"It was Josh and Kendall. Kendall fucked up the guys and Josh took me to the hospital. Cole they fucking pulled out a gun on me."
I looked at him then at Alan, "Let him go."
"But boss—"
"Do it!" I ordered.
He sighed and cut the tape that was holding Kendall with his blade. Kendall sat there and stared at us then looked at Joey.
"Why'd they bring me here?" he asked.
Joey sighed, "That deal you made with John and Alan... tell us about it."
"That stupid deal?" he looked at him, "John wanted it all to himself—5.3 million all to himself. And that's exactly what he did. The fucker," He lifted his shirt, "See this scar? John gave me that, said that I was 'robbing his bank'."
"We're you?" I asked him.
He shook his head, "Fuck no! I wouldn't do that to him!"
"But you'd do it to me!?" Alan yelled.
"No! Man, it was all John's doing! He's the one that left me for dead! He's the one that almost killed you!" Kendall informed loudly.
Joey huffed, "Looks like John played a lot of people."
"He played you too?" they asked at the same time.
Joey nodded, "Yeah for about two years."
"The bastard kidnapped us." I informed.
Alan shook his head, "I hate that bloody wanker."
"He's a fish," Sean agreed, "A catfish."
"And he's dead." Derek knit his eyes.
"He is?" Kendall questioned.
I nodded, "Yep. So can we all go home?"
They were silent.
"Yeah, so Kendall and Alan—kiss and make up." Ken nodded his head.
Alan looked at Kendall and sighed, "What do ya say mate? Truce?" he held out his hand.
Kendall studied him then got up and took his hand and they shook.
"Yeah I guess I can forget and forgive," Kendall smiled, "but if you do it again, I won't be so forgetful."
Alan laughed, "I won't."
"Good, what now?" Felix asked.
I looked at him, "Now we go pay a visit to Ryan."
"What did this Ryan fella do?" Alan asked as we approached our vehicles.
"What did he not do?" Joey rolled his eyes.
"No seriously mate, what'd he do?"
I stopped in front of the van, "Joey tell him."
Joey sighed and lifted his shirt to reveal the patched up wounds, "He kidnapped and interrogated me."
"The bloody wanker, let's go." He got in his car.
"Now you're talking." I opened the driver's side door on the van and got in.
The rest of the Crew and Felix got in and we drove off down the street. We got caught at a red light and waited until it changed to green. We sat in silence.
"Cole," Joey spoke, "Can you drop me off at Josh's house?"
I looked at him behind me, "Why? Don't you want to see the look on Ryan's face when I whack him?"
He laughed, "Yeah but... its just—today—it's a special day."
"Is it your birthday?" Felix asked him.
He shook his head, "Nah it's uh, the day Megan was killed."
"Oh, I'm sorry mate." Felix patted his back.
He looked down and smiled, "It's okay. Do you mind boss?"
I faced forward and shook my head, "No, just call Alan." I handed him my phone, "His number's under A-rod"
He laughed, "A-rod? What's wrong with you?"
"Everything Captain Bob, everything is wrong with me." I stepped on the gas and we sped off.
Things past through my mind, things that we actually needed to worry about. Things that we needed to talk about.
I sighed, "Crew?"
"Yeah boss?" Ken looked at me.
"We got to talk about something." I informed.
"Sure," Derek said, "What about?"
I glanced at Ken next to me, "When we're done all this... I want out."
"What?" Joey's voice was shaky.
"Yeah, I've been thinking about it and it's want I really want." I stopped at a traffic light.
"Why? Why do you want to leave the Crew?" Sean asked.
"No," I huffed, "I'm saying that we all need to settle down."
It was silent.
"So, no more Crew?" Derek asked.
I stepped on the gas, "Yeah... no more Crew."
Kenneth Meginley
"Yeah, no more Crew." Cole's words hit us hard.
I couldn't believe it! Our boss and friend for years wants the Crew to be no more? Why? Here's why:
"I found someone to I want to settle down with."
I mean come on! What kind of selfish, low level bastard does that? Retires from what he does just because he found someone he loves?
I couldn't blame him; I guess that's why I stood up for him. That, and the fact that we've known each other since we were young and basically grew up together. We always dreamed of being hit men, playing games and acting it out.
Anyway, we were on our way to drop Joey off at Josh's before something happened. We pulled up at Josh's to see him being dragged out by two men with guns.
Joey immediately jumped out.
"Hey!" He yelled, "What the fuck do you think you're doing?"
One of the guys dropped Josh and aimed his pistol at Joey. The rest of us jumped out of the van and stood behind him protectively.
"Joey, nice to see you again." The man with the gun said.
"Who are you?" Joey asked.
"Don't you recognize me?"
Joey studied him, "No."
"Ugh, I'm hurt." He laughed, "Harper sent me."
"That bitch?" I asked, "Why does she want that loser?" I nodded to Josh.
"Oh thanks." Josh rolled his eyes.
"She wants him too." he nodded to Joey.
"Don't fucking touch him!" Josh struggled in the guy's arms.
"Don't worry big brother, they wouldn't dare. Not with The Crew here to back me up." Joey informed him.
"That's right Captain Bob—can I call you that?" the man asked, "Well, it's too late. So, you can come with us or we can kill each of your friends and force you to come."
"Can I see door number three Carl?" Joey joked.
"Yeah, door number three is a bullet in your head." He raged.
"I'll take that please."
The man cocked his gun.
"No!" Josh yelled, "Joey god dammit! Why do you have to be such a smart ass?"
Joey shrugged, "It kind of runs in the family, bro."
"Enough with the bullshit—time to get this party started." He whipped out a grenade and pulled out the pin and threw it towards us.
"Grenade!" Cole yelled.
We twirled around and started running away from the soon to be explosion. When it went off the explosion threw us against the van.
"Ah shit!" Alan yelled.
His voice sounded demonic as a car started and sped off. I held my ears and tried to get up.
"Crew?" Cole called.
"I'm good!" Sean informed.
"Same here!" Derek added.
I stood up as Josh's front lawn burned.
"Kenneth? Joey? Alan?" Cole called.
"I'm good mate!" Alan yelled.
"Ken?" he looked at me.
I looked around, "Where's Josh and Joey?"
"So, Harper took Josh and Joey?" Felix asked.
We were back at the safe house.
Cole nodded, "Yeah."
"I never should have dated that bitch." I shook my head.
"You too mate?" Felix looked at me.
"What?" I knit my eyes.
"You dated her too?" He asked.
"You mean you dated Harper?" I seethed.
He nodded, "Yeah."
"Did you know she's a lesbian?" I whispered to him.
He laughed, "Yeah mate, I found out when she dumped me."
"Same here!" I gasped.
"Okay Crew—and friends—time to plan." Cole ordered.
"What's next on our to-do list?" Sean asked.
"Well," Cole begun, "We dealt with the whole Alan thing."
"Yeah, thanks for that." Alan spoke.
Cole nodded, "Just don't ask me to fake my death again."
He held up his hand, "I won't mate."
Cole gave him thumbs up then looked at me, "What's up with you?"
I knit my eyes, "Me? Nothing! Why?"
He shrugged, "Just asking."
I huffed, "We should be asking if you're okay boss."
"Me? I'm fine. Why?" he asked.
I shrugged, "Just asking."
He laughed and pointed at me, "I see what you did there."
I nodded, "So... how are we going to get Joey and Josh back?"
"We need to go see Harper." Felix said.
"Why're we always going to see someone?" Sean asked, "Why can't they come see us?"
"Because they're too lazy to see us." Derek joked.
"That, and the fact that we rule." I added.
"Harper stays at her job most of the time." Felix informed.
"Where's that at?" Alan asked him.
"She works as a banker at Wells Bank." I informed.
Sean smiled, "Boss?"
"Yeah?"
"Are we going to rob a bank?"
Cole laughed, "Yeah. We are."
"You got it Crew?" Cole asked us.
I looked at the blueprints that he had laid down on the table and nodded, "Yeah."
"How much money are we going to get?" Sean asked.
Derek smacked him on the back of the head, "You dimwit, you don't ask that!"
"What?" he yelled, "It's just a question!"
Derek rolled his eyes, "Fish."
Sean pushed him, "What'd you call me?"
"You heard me!" Derek pushed him back.
"You asshole!" Sean yelled.
"Screw you!" Derek came in his face.
"Whatcha gonna do about it Frank?" Sean pushed him back.
"Frank?" I looked at him confused.
He turned to me, "Don't judge me!"
Derek rolled his eyes and turned away. Sean looked at him, "Don't turn away from me!"
"Bitch please!" he walked next to Cole.
"Okay Crew, time to bring out the secret weapon." Cole rubbed his hands together.
"And what might that be?" Felix asked.
"It's more like whom." Cole smiled.
"But whose that whom?" Alan turned his head to him.
"His name is Jackson." Cole informed.
"Jared 'Jackson' Hayes." A familiar Russian voice said by the front door.
"Hey gay boy." Sean joked.
"Hey!" James snapped, "That's my line."
"What ever floats your boat." Sean sighed.
"That's so gay." I rolled my eyes.
James came up to me, "Gay boy?"
"I don't understand." I said.
"Gay boy?" He raised his voice.
"Still..."
He stared at me, then came at me head on. He knocked me on my ass and got on top of me.
"Awe."
"Shut up!" I snapped at Alan, "Get off me James!"
"Say it!" James snapped.
"Fuck you!" I spit.
He grabbed my head, "Say it!"
"Say what?" I asked.
"You know what to say! Now say it!" James bitched.
"I will not!" I protested.
"Do it!" He ordered harshly.
"James." Cole sighed, "That'll be enough."
He looked up at him, "You cannot tell me what to do, Cole."
"I'm not telling you, I'm ordering you to stop!" Cole snapped.
James snorted then backed off and I got up pissed.
I faced him, "You ever do that again... you dead."
He held out his hands, "Come at me bro."
I shook my head, "Now you can finish boss."
Cole nodded, "Well, James, we're gonna need you to call Jackson."
"If we don't already have what we need." Derek informed.
"Yeah, he's right we probably already do have enough weapons to do this one mission," Cole said, "Let's look in the back room."
We started towards the back room and Sean started humming an all too familiar tune.
"Can you stop?" I turned to him.
"Guys," Derek spoke, "Joey and Josh need our help, so if you'd stop screwing around."
"You're right, sorry. Move on." Sean put his head down.
Derek and I met eyes and we continued to the back room.
"Looks like we have quite enough weapons." Cole informed looking at the supply of weapons we had in the back room against the wall.
"Yeah, MPS-503, Desert Eagle, pump shot gun, hell, even a grenade launcher." Derek boasted.
Sean turned to Cole, "Boss?"
"Yeah."
"I have an idea about what we could do." He said.
"Let's hear it."
I walked towards her, the only woman that stood out to me. This building was her's—all of it. I walked past the security guard and smiled as he waved to me.
I stopped behind her, "Hello Harper."
She twirled around with shock on her face, "Kenneth."
"How are you?" I asked.
"Good. I guess you don't take no for an answer?" She put her hand on her hip.
"I just need a few seconds." I informed.
"You have ten. Shoot."
I smiled at the word and looked her in the eyes, "I want you back."
"Oh come on Kenneth!"
"No, listen!" I hissed, "I don't care if you're a lesbian, I love you, I always have."
"I'm not a lesbian." She said.
"What?"
"I'm Bi."
I nodded, "So am I."
"What?" she held back a smile.
"I can tell you still have a thing for me." I informed.
"Pssh, please Kenneth. If I'd ever be so obligated as to still have feelings for someone like you?"
I shook my head, "So you don't have feelings for me?"
She smiled, "Not exactly."
"Well, what does that mean?" I looked at her.
She smiled and looked down.
I bit my lip, "I love when you do that."
She looked up at me, "Not the time."
I backed up, "What? All I'm saying is that we should start over."
"And all I'm saying is that it'll never happen, Kenneth you're not right for me. I need someone who's gonna be there for me."
"But I will, I never stopped loving you Harper." I admitted.
She sighed, "Kenneth. I can't."
I came close to her, "I know why you choose to say no. you don't want to get hurt, but I won't hurt you. I'll love you till the day you grow old—and then some."
She smiled and looked me in the eye, "But I took your team mate."
I leaned in closer, her lips just away from mine, "I don't care." I moved in, pressing my lips against hers.
An explosion behind us made us stop and get down. Gun shots filled the bank and masked men entered.
"What the fuck!" Harper yelled.
I shielded her behind me as one came up to me and hit me with the base of his shot gun. I fell to the ground in pain as he pushed Harper onto the ground.
I quickly got up, "No! Don't touch her!"
He came at me and hit me in the head with his shot gun once more. I dropped to the ground and blacked out.
I woke up on the couch in the safe house with my head hurting. I got up and looked around.
"Boss?" I called.
"In here!" He answered.
I walked drowsily to the back room and leaned on the door frame. The sight on the inside made me smile.
"Hello babe."
"Fuck you Kenneth, let me outta here!" Harper was tied to a chair.
Cole looked at me, "Sorry about knocking you out."
I shrugged, "Had to play it off, right boss?"
He nodded, "Right."
I looked at Harper, "Where's Joey and Josh?"
"Who?" She asked in a peppy voice.
I came up and hit the wall next to her, "Where are they?!"
"I don't know what you're talking about!" She yelled.
I got in her face, "You know exactly what I'm talking about."
Someone placed their hand on my shoulder, I backed off and faced Cole.
He leaned in closer, "Don't you think you're too hard on her?"
I knit my eyes, "Too hard? Boss, she kidnapped Josh and Joey."
"I know, but, she's a girl." He explained.
I pulled my head away, "I don't care if she's a little girl. If she'd bad we have to deal with her. No one take's my friends and gets away with it."
He nodded, "Good point, but—"
"No, no buts," I said, "this is the only time we have to do this. Are you with me?"
He pointed at me, "No hitting."
I rolled my eyes, "Deal." I turned back to Harper and sighed.
"Look at you," she smirked, "Listening to your boss like the little bitch you are."
I clenched my fist, "Shut the fuck up!"
She smiled, "You were always the good soldier. That is until you faked your death and got hooked on drugs for a year and a half."
"That was a mistake!" I yelled, "Everything I did was a mistake!"
Everyone was looking at me. I turned and walked out of the room with my arms crossed and head down.
Cole followed me, came up to me and placed his hand on my shoulder.
"You okay?" He asks.
I sighed, "No."
He came in front of me, "What's up?"
"Everything!" I yelled, "Everything is up! We can't do anything without someone fucking it up!"
"Don't you think I know that by now?" He raised his voice, "Ken, why do you think we're retiring when this is all over?"
I turned away, "Boss, I'm sorry."
"For what?"
I sighed, "Everything I did to the Crew. Everything I did to you."
He huffed, "Don't even worry about that man."
"But I do," I admitted turning around, "I worry about that every single day."
He sighed and looked down, "You don't think that I think about things like that either? That I betrayed the Crew too? Because I do, I think about that all the time. How you, Sean, Derek and even me, betrayed the team."
"You didn't betray us..." I informed.
He looked up at me, "I didn't? Ken, I lied about my death, you guys thought that I was dead—to me, that's betrayal."
I shook my head, "No boss, that's being a good leader. Alan needed your help, and you were there. I would have done the same thing."
Cole looked at me, "And the fact that Sean and Derek left." He shook his head. "I can't sleep at night thinking that they left... because of me."
"But that's not true. They left because of them. You had nothing to do with that! And stop thinking you do!" I told him.
"Hey guys!" Sean called from the back room.
I looked at Cole as he turned to Sean, "Yeah?"
"Might wanna get in here."
We turned and went back in the back room where Harper was tied.
"What's going on?" Cole asked.
"She spoke." James informed.
"What'd she say?" I looked at him.
Alan looked at us, "She told us where Joey is."
Derek Johnson
We had convinced Harper to tell us where Josh and Joey were. We talked to her and made her a deal. Cole might not be happy but at least we get our friends back.
The deal was to let her go, new name, new identity, and new life if she just tells us where they are. And she bought it. She actually bought into it and told us where they were.
I guess we're just that good.
Actually... the truth is; it was Alan that did it—talked her into spitting it out. He was always good at things like that.
When she told us, we headed to the place she said with our weapons. James stayed at the safe house to watch Harper. There was really nothing to watch but her tied up.
"The place, the uh, location where they are, is a, um, a uh," Sean couldn't get the words out.
I laughed, "Yeah we know."
The place they were being held was a fish shop and Sean did not like that.
He kept complaining.
"Why does it have to be here?"
"Can't we get them another time?"
"Come on boss, why?"
It almost got annoying until he said this:
"Fine, I'll go, but I ain't gonna touch any fish—fish!"
The way he said it made us bag up, he said it with such enthusiasm it made it sound funny.
Kendall shook his head, "You guys, I'm starting to like."
Cole made a right turn and sped past a red light.
"Can you slow down?" Alan asked him.
Cole gave him the finger.
He nodded, "Right."
Ken pointed forward, "Right up here."
"I know." Cole turned with a screech
We parked outside of the fish store and got out with our weapons at ready.
"Derek, and Ken with me," Cole ordered, "Kendall and Sean with Alan. You guys go in the front and we'll go around back."
"Don't I get a weapon?" Kendall asked Cole.
He laughed, "No."
"Come on." Kendall pleaded.
Cole shook his head, "No, I'm not giving you a weapon."
"I wouldn't either." I told him.
"Why?"
Cole looked at him, "I don't trust you."
"What? Why?" He asked.
Cole shook his head and looked at Alan, "Make sure he doesn't wiz."
"Make sure I don't what?" Kendall asked.
"Wiz, it's a term he uses to represent bugging out." I explained to him.
"Why doesn't he just say bugging out?" he looked at us.
Cole smiled, "It sounds cool. Can we go?"
"Oh shit, yeah come on guys." Ken waved us forward.
We split up; Cole, Ken and I went around back while the others stayed and went around front. We had our weapons in our hands and approached the back door.
Cole signaled us to go ahead and we obeyed. We got on either sides of the door as Cole slowly reached down to see if it's open. When he opened it we aimed our silenced pistols inside at nothing.
Cole motioned for us to move forward and we did. We moved into the store and we split up. I went into the basement with my gun at a ready.
I walked down the stairs and kept look in front of me. The basement was dark and kind of scared me, but I sucked it up and moved on.
We didn't have ear pieces and I got worried; what if something happened? What if?
I molested the wall to find the light switch.
I found it and turned it on.
"Don't move!" a voice yelled.
I froze and looked to the side. A man with a gun aimed at me spoke:
"Drop the gun...Who are you?"
I dropped my pistol, "Put the gun down." I persuaded.
He shook his head, "What're you doing down here?"
I sighed, "Looking for a bathroom."
He moved the gun, "Come down here."
I took a step forward and proceeded down the steps.
"What's your name?" He asked me.
"Derek." I informed.
"Derek?"
I nodded.
He huffed, "I knew a Derek. His last name was Johnson."
I coughed, "What did he look like?"
He shrugged, "Don't know. The bastard took off when we were young—wait—why am I telling you this?" he moved a step forward.
I looked around, "What's your name?"
He looked at me, "My name? Why?"
I shrugged, "You know my name."
He nodded, "Its Dyrek."
I froze... I know that name.
I swallowed, "Dyrek... Junior?"
He raised his gun to my head, "Do I know you?"
I laughed, "You might."
He looked to the side, "You're Derek? As in, Derek Johnson?"
I smiled, "Hey bud."
Dyrek Junior was an old friend of mine, we were tight. Basically grew up together. When I was young my parents and I had to get up and leave; I left Dyrek alone with his abusive father.
"How longs it been?" He asked with the gun still pointed at my head.
"Too long," I tried to move forward but he cocked the gun.
"Don't," he warned.
"Can't we talk?" I inched slowly towards him.
He shook his head, "Nah bro."
I knit my eyes, "You're working for Harper?"
"Yeah and I like it." He slowly pulled the trigger back.
"Whoa, whoa, whoa! Dyrek listen! Don't do this! Harper's using you!"
"How?" he let the trigger go.
I let out a sigh of relief, "She's an evil bitch; she uses all of us."
"Even you?"
I nodded, "Even me."
He grunted, "I don't believe you!"
It all happened so quickly. He went to pull the trigger and I immediately went after him. The gun went off then he dropped it and we were on the floor fighting.
I got on top of him and punched him in the face. He kicked me off of him then got on me and started punching me in the face.
He backed off and suddenly his hands were around my neck. As I gasped for air I tried to fight him off me.
"Don't do this!" I managed.
"I'm sorry Derek, but it's what I have to do!" He yelled.
The grip around my neck got tighter and I reached up to his face but it wasn't enough. A gunshot went off behind us, his grip on my neck reduced and he fell to the side motionless.
I laid there gasping for air and Sean came down next to me.
"You okay?" he asked.
I sat up and looked at Dyrek, "Yeah, and thanks man."
He nodded, "Anytime. You know him?"
I sighed, "Yeah. His name is Dyrek, we used to be tight."
"Sorry." He looked down.
I shook my head and got up, "Don't worry about it." I walked over and picked up my gun, "Shall we go?"
The fish place was huge; it was easy to get lost. Sean and I stuck together, went the way Cole ordered him to go.
I could tell Sean wanted to talk but couldn't get the words out, I knew him long enough to understand. But we couldn't talk, we both knew that well. If we talked, the enemy could hear us and take advantage.
We stopped at the sound of a gunshot and then yelling.
"Alan!" a familiar voice yelled.
Sean and I looked at each other then ran ahead.
We entered a room that was filled with bad guys with guns.
"Oh shit!" I yelled and went to turn back.
"Don't move!" Someone yelled.
I sighed and we turned around and faced the men with guns. Cole and the others were on the ground with their hands in the air. There were more than them then there was of us.
"More of you?" One asked.
I nodded, "The name's Derek."
One of them smiled, "I know you."
I looked at him, "Do you?"
He nodded, "You're Derek Johnson. Dyrek told me about you."
"Speaking of Dyrek, where is the son of a bitch?" another asked.
Sean and I looked at each other then back at them.
"Dead," Sean spoke.
I nudged him to stop talking but he continued. "I killed him, shot the bastard in the head."
"And why'd you go and do something like that?" The guy sounded like a pirate.
Sean started laughing, "Why the fuck do you sound like a pirate?"
The guy came at him but Felix quickly got up and pushed him back then they stood face to face.
"Felix Gulber. My, my." A man approached us.
"Do I know you?" Felix asked.
"You don't remember your own brother? I'm disappointed."
I looked at Sean, "You have another brother?"
He knit his eyes and shrugged helplessly.
"No you idiot, I'm not the morons brother," the man nodded to Felix, "I'm his."
"He's his brother too." Ken informed.
Felix looked down, "I'm sorry Nate."
"For what? Having another brother?" I asked.
Nate looked at me, "You shut your mouth."
I rolled my eyes and mocked, "Shut your mouth."
He gave me the evil eye and looked at Felix, "Back down brother."
"You gonna kill us mate?" Felix asked.
Nate shook his head, "Nah I already killed one of you. No more needs to die. What're you here for?"
I looked at Kendall who lay dead on the ground not far from us. Poor guy.
"It's who we're here for." Cole corrected.
"And who might that be?" Nate looked at him.
"The two guys you are protecting, they're our friends." Felix told him.
Nate nodded and signaled to his friends, "Bring them out."
Two guys left the room and then came back a minute later carrying Joey out. They threw him on the ground and The Crew automatically ran up to him.
"Joey?" Ken sympathized.
Joey got up and charged Nate but Cole and Ken held him back.
"You son of a bitch!" He yelled, "Bring him to me!"
I looked at Joey speechless, who was he talking about? Then it hit me—Josh.
"Joey, Joey... where's Josh?" I looked at him.
His face was red and tears were coming down his face.
"He's dead." Nate said.
Joey put his face in his hands.
"Bullshit!" Cole got up and faced Nate.
"Don't believe me?" he asked turning to his friends. "Bring him out."
Joey clenched up into a ball.
Two of Nate's guys left and after a couple seconds brought back Josh, whom, as they threw him on the ground, lay there motionless.
I knit my eyes, "You son of a bitch."
"What?" Nate backed up, "I didn't kill him."
Joey got up and started to walk away.
"Joey?" Cole called after him.
He bent down and grabbed a pistol.
As he turned I yelled, "Oh shit, Joey no!"
But it was too late; Joey had grabbed the pistol and began shooting into the crowd of bad guys.
We darted to the side as he let out a couple shots, killing three people.
"Joey! Put the fucking gun down!" Cole ordered.
He let off two more shots then ran away, that's when I saw movement from the gound. Josh was alive.
"You have three seconds to leave my sight!" Nate yelled. "One!"
Felix grabbed Cole's arm, "Let's go mate!"
Sean and I ran and grabbed Josh then we all got up and ran out of the room before Nate counted to three.
"We have to find Joey." Cole pointed out the obvious.
When we exited the building we entered our cars and sped off down the street heading back to the safe house.
We dropped Josh off at the hospital ad didn't stay long. We had to leave to find Joey.
"Guys," Sean looked at us, "I just noticed something."
"What?" Ken looked up from his seat.
"Harper's gone."
The back room got our immediate attention.
"Mother—" Ken got up and clenched his fist.
"That bitch." I shook my head.
"We'll get her later, for now, come on Crew, we're going to look for Joey." Cole got up.
"Us to?" Felix asked.
Cole looked at him, "No, you guys stay here, The Crew is going."
We started out the door when Cole stopped and turned to Alan.
"You coming?" he asked.
"Me?" Alan pointed to himself.
"Aren't you a part of the Crew?" Cole smiled, "Come on."
He followed us out the door.
"So where we going boss?" Alan asked.
Cole shook, "Hearing you call me boss again gives me the chills."
Alan laughed, "I am not used to it too mate."
"I'll get used it... Trust me." He said.
We got into the car and Cole started it.
"We're going to the one place I'm guessing Joey is." Cole said backing up.
"Where's that?" I asked.
He huffed, "His house."
"Joey!?" Ken yelled through Joey's house.
The front door was open so we went in without a second thought.
"Joey?" I looked around in his room.
Nothing.
"It's all clear boss!" Sean yelled.
"Okay regroup!" Cole ordered.
We all went back to Joey's living room.
"What now?" Ken asked.
I had to urge to turn on the TV and went for the button on the wall.
"What're you doing?" Cole asked me.
I sighed and turned on the TV, "I don't know. Just trust me."
The channel that was on was news. I went to change it but Ken stopped me.
"What?" I asked him.
"Look!" He yelled.
We all turned to the television.
"Breaking news! A triple homicide leaves FBI in the ruins," The reporter said, "the victims have been identified as Harper Ortiz, Henry Jackson, and Brady Kent. No news on the investigation, but police are on the lookout for this man; Joey Walker, male, 27, blue eyes, black hair and 6 foot. If you have any information on his ware-a-bouts police ask you to call this hotline. He is considered armed and extremely dangerous—" Cole snatched the remote from my hand and turned the TV back off.
"We have to find him—now!"
"If I were an enraged hit men with a pistol and the FBI was looking for me, where would I hide?" Sean rubbed his chin.
"We could check the hospital." Alan suggested.
Ken shook his head, "No, he wouldn't go there."
"If he's wounded he would." He informed him.
"He's right," Cole looked up, "Ken and Alan go check the hospital, and don't take the van."
They nodded and soon left.
"Where else?" Cole crossed his arms.
"What about Megan's old house? S'not far from here." Sean suggested.
Cole nodded, "Go."
"We'll find him before the police do." Sean smiled then left.
I looked at Cole, worry on his face.
I placed my hand on his shoulder, "We will find him boss."
He looked at me, "I know, we always do." He sighed, "I just knew he would crack if this happened again."
"Yeah, he lost his sister and he thinks he lost his brother? The fuckers," I said disgusted, "They shouldn't have said he was dead."
"Tell that to Nate." Cole looked away, "If Josh was here..."
I looked at him, "That's it!"
"What?" he turned to me.
"The one Joey would go to hide would be somewhere no one would expect."
Silence.
"Josh's house!"
We drove to Josh's house in silence; no words were exchanged except our thoughts.
Was Joey at Josh's?
Would he have changed?
Would he have remorse?
Is the still a part of The Crew?
Every minute more questions raced through my mind. I couldn't help but feel guilty. Was this our fault?
Then I looked at Cole who stared at the car in front of us and automatically knew that this, this was our time to prove that none of this was ever our fault.
"Boss?" I sighed.
He looked at me.
I smiled, "Step on the gas."
He knit his eyes, "Why?"
"Just do it."
"Why? Why would I step on the gas?" he asked.
I rolled my eyes, "To go faster."
"Why would I go faster? I'm going to get pulled over."
I sighed, "Do you have to make everything complicated?"
"Yeah." He smiled then put his foot on the gas and went faster.
"Whoa, Cole... COLE!"
We crashed into a truck that stopped suddenly. A car next to us and behind us rammed into us making our air bags bust open and hit us in the face.
"Fuck!" I yelled holding my bloody nose and patted the air bag down.
Cole got mad and stormed out of the van.
"What the fuck man!" He yelled.
I held my nose and got out.
The man in the truck in front of us got out and came up to Cole.
"Look asshole, can't you see it's a red light!?" He asked.
"Why'd you have to stop so abruptly?" Cole shoved him.
The man shoved him back, "Why were you going so fast?"
I took my hand away from my nose and saw the blood. A woman came up to me and handed me a ripped shirt. I took it and held it against my bloody nose.
"Are you alright?" She asked.
I nodded, "Yeah. Thanks."
She smiled, "What's your name?"
I looked at Cole who was still arguing with the man then back at her, "Derek Johnson."
She held out her hand, "I'm Natasha, Natasha Jordan."
I took her hand and we shook.
She smiled, "Sorry I hit you."
I shook my head, "Ah, don't worry about it."
I looked back at Cole who was face-to-face with the guy ready to kill him. I ran over there and got between them.
"Calm down Cole!" I pushed him back.
He turned and walked away.
I looked at the guy, "What's your problem, asshole?"
"My problem?" He shoved me back, "I don't have a fucking problem!"
"Don't touch me." I warned.
"Or what?" he shoved me again.
"I said don't fucking touch me faggot." I pushed him.
He stumbled backwards then came forward and swung his arm, catching me in the jaw.
I swung back, hitting him with my fist.
He stumbled backwards and fell to the ground.
"Derek!" Cole called.
I looked at him as he waved for me come on.
SEAN WILLIAMS
Cole told me to go to Megan's old house—and I did. I went there and kicked the door down expecting to see Joey, but who do I find?
Mister Bobby Adams.
He was asleep on the couch. I went up to him and placed my pistol in his face.
Without opening his eyes, he spoke.
"Get your dick out of my face."
I knit my eyes and laughed, "Excuse me?"
He opened his eyes, "Oh it's you."
I took the weapon away, "What're you doing here?"
"I live here asshole." He sat up.
"What? Since when?" I asked.
"Since the last owner was killed. What are you doing here? Long time no see."
I nodded, "Yeah it's been awhile. I came here to look for Joey, remember him?"
He nodded, "I remember all of you guys."
"Can you help me find him?"
"Joey?"
I nodded, "Yeah he's uh, kind of on a rampage."
"What happened?"
I sighed, "His sister was killed then he thought his brother was killed. He flipped."
He nodded, "Where would he be?"
I shrugged, "I don't know."
My phone rang in my pocket, I took it out and answered it.
"Hello?"
"Sean, it's Cole, listen. We found Joey." Cole said.
"What? Where?" I asked.
"At Josh's, meet us there. No weapons."
"Okay boss." I hung up and looked at Bobby, "You're coming with me."
Good thing Bobby had a car because I wasn't planning on walking to Josh's. I hid my pistol in the glove box as he drove off down the street.
"So where exactly is the house?" Bobby asked.
"It's about five minutes this way." I pointed to the right, "Just keep going straight."
He turned onto the main road and stayed to the right. The rest of the ride was silence.
When we arrived at Josh's we got out and approached.
"They in there?" Bobby asked.
I nodded and looked at him, "You wanna come in?"
He shrugged, "Just get in there."
I nodded and walked up the steps then opened the door and went in.
"Slowly Sean," Cole warned.
In Josh's house was the rest of the Crew; Ken, Derek, Cole... and Joey—with a gun aimed at them.
"Whoa Captain Bob, what're you doing?" I left the door open and Bobby stood next to me.
"What is he doing here?" Joey nodded to Bobby.
"He was at Megan's house." I admitted.
"What!" He moved the weapon to Bobby.
I got in the way, "He's the owner, Joey. Megan's dead."
"Sean!" Ken hissed.
I looked at him then back at Joey, "Listen man, Josh isn't dead."
He eyed Bobby with the pistol still aimed at him. I took a step towards him and he moved the gun to me.
"Get back!" He yelled.
"You ain't going to shoot me," I said hoping it was true.
He blinked, "Don't test me, Sean."
I looked at the gun and made a choice that might just cost me my life.
"Go head and shoot me, but just remember all the times we had together, all the times you guys found me half dead and brought me back to life, or the time Cole lost the one's he loved, remember what he did?" I looked at him, "he stuck it through, our boss, stuck it through. Now that's what you need to do... stick it through. Can you do that? For us?"
He looked at me, "Why do you guys care? We're not a team."
Cole stepped up, "We're not a team? After everything we've been through—drug dealers, psychopaths, murderers, gang members, bikers, and even our own fucking agency! Don't you dare, don't you fucking dare say we aren't a team!"
Joey looked at us sadness in his eyes, "I—I'm sorry. I don't know what got over me."
"You lost your family; I know exactly how you feel man. I lost my family too. But Josh is still alive, he's at the hospital." Cole sympathized.
Joey sighed and lowered the gun, "Boss?"
"Yeah?"
Joey looked at him, "Are we really retiring?"
"Yeah." He said.
"Good," Joey smiled, "We lost too much from this game. Glad it's going to be over."
"What now?" Derek asked.
"Now we disguise Joey because Americas looking for his ass." Cole said.
Joey smiled and nodded, "How you suppose we do that?"
Cole looked at him, "I have some ideas."
"You look like Shady." I told Joey.
"I know." He said rubbing his hair.
When we got back to the safe house the building was empty and he shaved his soul patch and bleached his hair to hide from the police. He looked like the rapper.
"Now all you have to do is lay low. Stay away from the police." Cole said.
"Okay boss." Joey looked in the mirror, "I cannot get used to this."
"You will in time." Alan assured him.
Joey sighed, "It's over."
"We still have to pay a visit to Ryan." Cole informed.
"Nah fuck him." Joey spit.
"Look what he did to you!" he raised his voice.
"I don't care; the fucker will get what's coming to him eventually." Joey told him.
"I guess if you think about it that way then it's the right thing to do." Cole said.
"Yeah plus we're not even hit men anymore." I informed.
"Yeah..." Alan sighed.
"So, what now?" I asked.
Cole shrugged, "For the first time in almost fifteen years, I don't know."
Ken stood up, "Well I better start looking for a job."
"Same goes for me." Derek said.
It was silent as we looked at each other. One by one we each stood up and formed a circle. When we were all together Cole held out his fist.
"Here's to The Crew," He smiled.
Ken placed his fist in front of Coles, Joey then placed his next to Ken's, Derek followed with his next to Joey's, Alan put his next to Derek's, and I copied and put my fist next to Alan's for the biggest Brofist the world has ever seen.
We smiled and took our hands away.
Ken started towards the door, "I guess I'll see you faggots in the mid-future?"
"Yeah see you gay boy." Joey joked.
Ken gave him the finger and shut the door behind him.
"I better head out too." Derek started to the door.
"Yeah same here," Joey followed him out the door, "See ya guys."
Cole, Alan, and I looked at each other.
"You leaving too?" Alan asked me.
I shrugged, "I guess."
I looked at Cole who was off in a daze at the front door.
"Boss?" I studied him.
He looked at me, "Yeah?"
I sighed, "Just because it's over doesn't mean we're through being friends."
He smiled, "I know."
"We'll still hang out." I told him walking towards the front door.
"I know." He said watching me.
"And don't hesitate to call us if you ever need backup at some bar off the freeway." I opened the door and looked at him.
He nodded, "Goodbye Sean Williams."
I laughed, "It ain't goodbye, Cole Fred Phillips."
He smiled, "See you later."
I smiled, "See ya, boss."
###
|
{
"pile_set_name": "BookCorpus2"
}
|
Tag Team Title & Battle Royal Plans For WrestleMania 30
It looks like The Usos will be defending the WWE Tag Team Titles against Jack Swagger & Cesaro and Curtis Axel & Ryback. If that is the case, then Axel and Ryback will be removed from the Andre the Giant Memorial Battle Royal.
|
{
"pile_set_name": "Pile-CC"
}
|
Q:
Make xs and xmls:xsi attributes required in XSD
I have the following schema
<?xml version="1.0" encoding="UTF-8"?>
<xs:schema xmlns:xs="http://www.w3.org/2001/XMLSchema">
<xs:element name="translator">
...
</xs:element>
</xs:schema>
How I can define the following required attributes, so when adding a new translator node, those attributes are also added?
xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance"
xsi:noNamespaceSchemaLocation="Translator.xsd"
If I put them in XSD, like this
<?xml version="1.0" encoding="UTF-8"?>
<xs:schema xmlns:xs="http://www.w3.org/2001/XMLSchema">
<xs:element name="translator">
<xs:attribute name="xmlns:xsi" type="xs:string" default="http://www.w3.org/2001/XMLSchema-instance"/>
<xs:attribute name="xsi:noNamespaceSchemaLocation" type="xs:string" default="Translator.xsd"/>
</xs:element>
</xs:schema>
The following problem is reported by Xerces
[Error] :678:114: s4s-att-invalid-value: Invalid attribute value for 'name' in element 'attribute'. Recorded reason: cvc-datatype-valid.1.2.1: 'xmlns:xsi' is not a valid value for 'NCName'.
[Error] :678:114: src-attribute.3.1: One of 'ref' or 'name' must be present in a local attribute declaration.
[Error] :679:117: s4s-att-invalid-value: Invalid attribute value for 'name' in element 'attribute'. Recorded reason: cvc-datatype-valid.1.2.1: 'xsi:noNamespaceSchemaLocation' is not a valid value for 'NCName'.
[Error] :679:117: src-attribute.3.1: One of 'ref' or 'name' must be present in a local attribute declaration.
A:
A warning first: the XML Schema specification forbids declaring attributes in the XML Schema instance namespace, and explicitly discourages attempts to alter its behavior.
Having said that, the reason for the errors you are getting is that the name attribute only supports definition of new elements in the target namespace (or in this case in no namespace) by providing their local names.
You could technically do something like this, by referencing the xsi:noNamespaceSchemaLocation attribute, which is already defined in the builtin XML Schema instance namespace:
<?xml version="1.0" encoding="UTF-8"?>
<xs:schema
xmlns:xs="http://www.w3.org/2001/XMLSchema"
xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance">
<xs:element name="translator">
<xs:complexType>
<xs:simpleContent>
<xs:extension base="xs:string">
<xs:attribute ref="xsi:noNamespaceSchemaLocation" default="Translator.xsd"/>
</xs:extension>
</xs:simpleContent>
</xs:complexType>
</xs:element>
</xs:schema>
However, you cannot change its definition, and since this attribute is builtin and processed in a special way, I am not sure you can much influence its behavior.
|
{
"pile_set_name": "StackExchange"
}
|
The woman also alleges that over the last 10 years, he extorted almost Rs 2 crore from her.
A 36-year-old Japanese woman who has flown down from Tokyo to Delhi to file a complaint alleging rape and extortion. Twelve years ago, she alleges, she was first raped by the man who had promised to marry her. She landed in the city Wednesday for 72 hours. The cops are yet to file an FIR. It will take time, she has been told.An engineer in Tokyo, she claims that Praveen Gautam, a Khajuraho-based travel agency owner, made promises that they would settle down in India after marriage and raped her for years. She also alleges that over the last 10 years, he extorted almost Rs 2 crore from her.They had first met in 2004 in Tokyo when the man had projected himself as a successful businessman, she said. "We got into a relationship. But in 2005, he asked for money. He said he needed the money as his friend's wife was in coma. When I hesitated, he told me that Indian women gave all their money to their men. He started demanding money almost regularly," she said.She added, "But when I stopped, his behaviour changed and he started threatening me. He even physically assaulted me. I got scared and didn't report the matter."The woman registered an FIR in Madhya Pradesh last year after she met Chief Minister Shivraj Singh Chouhan during a business conference in Tokyo 2015. She told him about Mr Gautam and Mr Chouhan helped her file an FIR at Khajuraho in April last year. A case of rape and attempt to murder (for physically assaulting her) was registered. But the accused is out on bail.She now wants to file a complaint in Delhi as she says that "laws here are stronger than in Japan". "I want the police to put the case on trial. The cops said it is a 12-year-old complaint," she said.Her lawyer, Jai Dehadrai, said that they had written to the Delhi Police Commissioner Amulya Patnaik twice in the beginning of this month, but there has been no response. They finally approached SHO of Connaught Place police station and a sub inspector has been appointed to verify circumstantial evidence."We admit that there has been a delay. But according to Supreme Court guidelines, a case can still be filed. The insensitivity shown by cops is appalling," Mr Dehadrai said.
The Delhi police deny allegations of insensitivity. "Since it is a very old case we need to verify facts and consult our legal experts," said BK Singh, DCP (New Delhi).Mr Gautam's lawyer, however, said, "Why has she come to file a case after more than 10 years? The allegations are false."
|
{
"pile_set_name": "OpenWebText2"
}
|
#region Copyright & License Information
/*
* Copyright 2007-2020 The OpenRA Developers (see AUTHORS)
* This file is part of OpenRA, which is free software. It is made
* available to you under the terms of the GNU General Public License
* as published by the Free Software Foundation, either version 3 of
* the License, or (at your option) any later version. For more
* information, see COPYING.
*/
#endregion
using System.Collections.Generic;
using OpenRA.FileSystem;
using OpenRA.Graphics;
using OpenRA.Traits;
namespace OpenRA.Mods.Common.Traits
{
[Desc("Load VGA palette (.pal) registers.")]
class PaletteFromFileInfo : TraitInfo, IProvidesCursorPaletteInfo
{
[PaletteDefinition]
[FieldLoader.Require]
[Desc("internal palette name")]
public readonly string Name = null;
[Desc("If defined, load the palette only for this tileset.")]
public readonly string Tileset = null;
[FieldLoader.Require]
[Desc("filename to load")]
public readonly string Filename = null;
[Desc("Map listed indices to shadow. Ignores previous color.")]
public readonly int[] ShadowIndex = { };
public readonly bool AllowModifiers = true;
[Desc("Whether this palette is available for cursors.")]
public readonly bool CursorPalette = false;
public override object Create(ActorInitializer init) { return new PaletteFromFile(init.World, this); }
string IProvidesCursorPaletteInfo.Palette { get { return CursorPalette ? Name : null; } }
ImmutablePalette IProvidesCursorPaletteInfo.ReadPalette(IReadOnlyFileSystem fileSystem)
{
return new ImmutablePalette(fileSystem.Open(Filename), ShadowIndex);
}
}
class PaletteFromFile : ILoadsPalettes, IProvidesAssetBrowserPalettes
{
readonly World world;
readonly PaletteFromFileInfo info;
public PaletteFromFile(World world, PaletteFromFileInfo info)
{
this.world = world;
this.info = info;
}
public void LoadPalettes(WorldRenderer wr)
{
if (info.Tileset == null || info.Tileset.ToLowerInvariant() == world.Map.Tileset.ToLowerInvariant())
wr.AddPalette(info.Name, ((IProvidesCursorPaletteInfo)info).ReadPalette(world.Map), info.AllowModifiers);
}
public IEnumerable<string> PaletteNames
{
get
{
// Only expose the palette if it is available for the shellmap's tileset (which is a requirement for its use).
if (info.Tileset == null || info.Tileset == world.Map.Rules.TileSet.Id)
yield return info.Name;
}
}
}
}
|
{
"pile_set_name": "Github"
}
|
Caleb Walton West
Caleb Walton West (May 25, 1844 – January 25, 1909) was an American politician and Governor of Utah Territory twice, 1886–1888 and 1893–1896.
Born in Cynthiana, Kentucky in Harrison County, Kentucky, he was a Confederate veteran and a municipal judge in Kentucky. He was the last Governor of Utah before statehood.
References
Category:1844 births
Category:1909 deaths
Category:People from Cynthiana, Kentucky
Category:People of Kentucky in the American Civil War
Category:Governors of Utah Territory
Category:Kentucky state court judges
|
{
"pile_set_name": "Wikipedia (en)"
}
|
'use strict';
var BoundingBoxLockXCtrl = function ($element, dragularService) {
var boundingBox = $element.children().children()[0];
dragularService.cleanEnviroment();
dragularService(boundingBox, {
boundingBox: boundingBox,
lockX: true
});
};
BoundingBoxLockXCtrl.$inject = ['$element', 'dragularService'];
module.exports = BoundingBoxLockXCtrl;
|
{
"pile_set_name": "Github"
}
|
493 N.W.2d 160 (1992)
242 Neb. 1
Frank and Deldine YOUNG, Husband and Wife, Appellees,
v.
DODGE COUNTY BOARD OF SUPERVISORS et al., Appellants.
No. S-89-1476.
Supreme Court of Nebraska.
December 11, 1992.
*161 Dean Skokan, Dodge County Atty., and Joe Stecher, Fremont, for appellants.
Warren R. Whitted, Jr., and Christopher R. Knust, of Lieben, Dahlk, Whitted, Houghton & Jahn, P.C., Omaha, for appellees.
HASTINGS, C.J., and BOSLAUGH, WHITE, CAPORALE, SHANAHAN, GRANT, and FAHRNBRUCH, JJ.
SHANAHAN, Justice.
The Dodge County Board of Supervisors appeals from the judgment in a bench trial of a mandamus action, see Neb.Rev. Stat. § 25-2156 et seq. (Reissue 1989), in which the district court for Dodge County ordered the board to provide public "access" to isolated real estate owned by Frank and Deldine Young since its acquisition in 1977.
The mandamus was based on Neb.Rev. Stat. § 39-1713 (Reissue 1978), which provided:
When any person shall present to the county board an affidavit satisfying it (1) that he is the owner of the real estate described therein located within the county, (2) that the same is shut out from all public roads, other than a waterway, by being surrounded on all sides by real estate belonging to other persons, or by such real estate and by water, (3) that he is unable to purchase from any of such persons the right-of-way over or through the same to a public road or that it cannot be purchased except at an exorbitant price, stating the lowest price for which the same can be purchased by him, and (4) asking that a public road be laid out in accordance with section 39-1716, the county board shall appoint a time and place for hearing the matter....
Neb.Rev.Stat. § 39-1716 (Reissue 1978) stated: "The county board shall, if it finds that the conditions set forth in section 39-1713... exist, proceed to lay out a public road of not more than four nor less than two rods in width, to such real estate...."
STANDARD OF REVIEW
An action for a writ of mandamus is a law action. Nuss v. Pathfinder Irr. Dist., 214 Neb. 888, 336 N.W.2d 584 (1983); State ex rel. Blome v. Bridgeport Irr. Dist., 205 Neb. 97, 286 N.W.2d 426 (1979); State ex rel. Goetz v. Lundak, 199 Neb. 585, 260 N.W.2d 589 (1977); State ex rel. Rittenhouse v. Newman, 189 Neb. 657, 204 N.W.2d 372 (1973); State ex rel. Charvat v. Sagl, 119 Neb. 374, 229 N.W. 118 (1930); State v. Porter, 90 Neb. 233, 133 N.W. 189 (1911).
In a bench trial of a law action, a trial court's factual findings have the effect of a verdict and will not be set aside unless clearly erroneous. In reviewing a judgment awarded in a bench trial of a law action, an appellate court does not reweigh evidence, but considers the evidence in the light most favorable to the successful party and resolves evidentiary conflicts in favor of the successful party, *162 who is entitled to every reasonable inference deducible from the evidence.
Broekemeier Ford, Inc. v. Clatanoff, 240 Neb. 265, 267, 481 N.W.2d 416, 418 (1992). Accord, Ballard v. Giltner Pub. Sch., 241 Neb. 970, 492 N.W.2d 855 (1992); Albee v. Maverick Media, Inc., 239 Neb. 60, 474 N.W.2d 238 (1991); Justice v. Hand, 227 Neb. 856, 420 N.W.2d 704 (1988); Alliance Nat. Bank v. State Surety Co., 223 Neb. 403, 390 N.W.2d 487 (1986).
"Regarding a question of law, an appellate court has an obligation to reach a conclusion independent from a trial court's conclusion in a judgment under review." Huffman v. Huffman, 232 Neb. 742, 748, 441 N.W.2d 899, 904 (1989). Accord, Maack v. School Dist. of Lincoln, 241 Neb. 847, 491 N.W.2d 341 (1992); Albee v. Maverick Media, Inc., supra; Boisen v. Petersen Flying Serv., 222 Neb. 239, 383 N.W.2d 29 (1986).
FACTUAL BACKGROUND
Following is a diagram based on introduced exhibits that shows various locations pertinent to the proceedings:
Hartman Island consists of 280 acres surrounded by the Platte River. There is no public road on the island. Youngs' tract, located on the south side of the island, is bounded on three sides by real estate owned by others and on the fourth side by the main channel of the Platte River.
When Youngs bought their island property in 1977, Hartman Island was accessible as follows: After exiting from the county road, which ended at the Platte's north bank, one drove eastward one-half mile on Ames Dike, which was situated near the river's north bank and was maintained by Ames Diking and Drainage District, a political subdivision of the State of Nebraska. At that ½-mile point, and after leaving Ames Dike, one proceeded south to the river across land owned by Tom Wolf, and then forded the Platte's channel for entry at the northwest corner of Hartman Island. Once on the island, and to reach their property, Youngs crossed tracts of adjacent landowners.
In 1988, Ames Diking and Drainage District, prompted by liability concerns, prohibited vehicular traffic on Ames Dike. Although Youngs filed an action for judicial acknowledgment of their prescriptive right to travel on Ames Dike, Youngs dismissed their suit. See, State v. Cheyenne County, 123 Neb. 1, 241 N.W. 747 (1932) (title by adverse possession cannot be acquired against the State); Neb.Rev.Stat. § 39-1404 (Reissue 1988) (title by prescription *163 cannot be acquired in a political subdivision's real estate).
After Youngs were unable to acquire a right-of-way for access to their insular property, they filed their affidavit with the Dodge County Board of Supervisors (County Board) on July 7, 1988, and requested that the county provide public access to Youngs' island property pursuant to the "isolated land" statutes, §§ 39-1713 and 39-1716. After a hearing, the County Board, on August 10, 1988, rejected Youngs' request for public access to their island property.
Youngs sued the County Board in a mandamus action to compel access to Youngs' island property. At trial, Youngs, without factual dispute by the County Board, established that Youngs' island tract lacked public access. The district court declined to apply the 1982 amendment of § 39-1716, namely, § 39-1716 (Reissue 1988), which, in addition to the requirements expressed in § 39-1713, required
(2) that the isolated land was not isolated at the time it was purchased by the owner, (3) that the isolation of the land was not caused by the owner or by any other person with the knowledge and consent of the owner, and (4) that access is necessary for existing utilization of the isolated land [and] that the amount of use and the number of persons served warrants such action....
Consequently, applying the isolated land statutes that existed when Youngs acquired their island property, that is, §§ 39-1713 and 39-1716 (Reissue 1978), the court ordered Dodge County and its supervisors to provide Youngs with "access" to their island property and awarded Youngs an attorney fee pursuant to § 25-2165 (writ of mandamus granted; recoverable costs may include an attorney fee for plaintiff's lawyer).
ASSIGNMENTS OF ERROR
The County Board contends that the district court erred in (1) failing to apply § 39-1716 (Reissue 1988), one of the isolated land statutes amended after Youngs acquired their real estate; (2) using the isolated land statutes as a basis for mandamus; (3) concluding, as a matter of law, that Youngs' island property was isolated land within the purview of §§ 39-1713 and 39-1716; (4) failing to rule that the county could not utilize the power of eminent domain to take real estate of another governmental subdivision, and (5) awarding an attorney fee as part of the costs recoverable by Youngs in their mandamus action.
1982 AMENDMENT OF § 39-1716
First, the County Board contends that the district court should have applied § 39-1716 (Reissue 1988) in disposing of Youngs' mandamus action. Section 39-1716 (Reissue 1988) contains in part: "For any real estate purchased or otherwise acquired after January 1, 1982, for which public access is granted pursuant to sections 39-1713 to 39-1719, the person petitioning for such access shall also reimburse the county for all engineering and construction costs incurred in providing such access."
"Statutes covering substantive matters in effect at the time of the transaction govern, not later enacted statutes." Schall v. Anderson's Implement, 240 Neb. 658, 662-63, 484 N.W.2d 86, 89-90 (1992). Accord Holthaus v. Parsons, 238 Neb. 223, 469 N.W.2d 536 (1991). "A legislative act operates only prospectively and not retrospectively unless the legislative intent and purpose that it should operate retrospectively is clearly disclosed." Moore v. Peterson, 218 Neb. 615, 617, 358 N.W.2d 193, 195 (1984). Accord, State v. Von Dorn, 234 Neb. 93, 449 N.W.2d 530 (1989); Larson v. Jensen, 228 Neb. 799, 424 N.W.2d 352 (1988); Welsh v. Anderson, 228 Neb. 79, 421 N.W.2d 426 (1988); Wheelock & Manning OO Ranches, Inc. v. Heath, 201 Neb. 835, 272 N.W.2d 768 (1978).
Youngs' right to obtain access in the form of a public road for their isolated land was governed by §§ 39-1713 and 39-1716 (Reissue 1978), the law existing when Youngs acquired the real estate for which access was later sought. Moreover, the 1982 amendment of § 39-1716 contains: "For any real estate purchased or otherwise *164 acquired after January 1, 1982...." Quite apart from the acquisition date for Youngs' real estate, the express language of § 39-1716 (Reissue 1988) does not evidence an intent for retroactive application of the statute, but evidences a legislative intent that the 1982 amendment of § 39-1716 apply prospectively, that is, apply to any real estate acquired after January 1, 1982. We conclude that the 1982 amendment to § 39-1716 was inapplicable to Youngs' mandamus action and, consequently, the district court correctly employed §§ 39-1713 and 39-1716 (Reissue 1978) in disposing of Youngs' mandamus action.
WAS MANDAMUS AN AVAILABLE REMEDY?
The County Board argues that mandamus is unavailable to obtain a public road for access pursuant to §§ 39-1713 and 39-1716, but, rather, that review by petition in error, see Neb.Rev.Stat. §§ 25-1901 to 25-1908 (Reissue 1989), is the appropriate procedure in Youngs' case.
As stated in State ex rel. Pederson v. Howell, 239 Neb. 51, 56, 474 N.W.2d 22, 26 (1991):
Mandamus is defined as an extraordinary remedy, not a writ of right, State ex rel. Thompson v. Alderman, 230 Neb. 335, 431 N.W.2d 625 (1988), issued to compel the performance of a purely ministerial act or duty, State ex rel. Freezer Servs., Inc. v. Mullen, 235 Neb. 981, 458 N.W.2d 245 (1990), imposed by law upon an inferior tribunal, corporation, board, or person, see Neb.Rev.Stat. § 25-2156 (Reissue 1989), where (1) the relator has a clear legal right to the relief sought; (2) there is a corresponding clear duty existing on the part of the respondent to do the act in question, State ex rel. Mercurio v. Board of Regents, 213 Neb. 251, 329 N.W.2d 87 (1983), cert. denied 463 U.S. 1214, 103 S.Ct. 3554, 77 L.Ed.2d 1400; and (3) there is no other plain and adequate remedy available in the ordinary course of law, State ex rel. PROUD v. Conley, 236 Neb. 122, 459 N.W.2d 222 (1990).
In Singleton v. Kimball County Board of Commissioners, 203 Neb. 429, 279 N.W.2d 112 (1979), a writ of mandamus was recognized as a proper remedy to compel a county board, in accordance with §§ 39-1713 and 39-1716, to lay out a public road for access to isolated land. In Singleton, this court concluded that compliance with the isolated land statutes is a ministerial duty and, "[a]s the duty is ministerial, petition in error proceedings are ... not available," 203 Neb. at 435, 279 N.W.2d at 116; hence, mandamus is an appropriate remedy for obtaining access to isolated land. See, also, Burton v. Annett, 215 Neb. 788, 341 N.W.2d 318 (1983) (establishment of a public road on satisfaction of the statutory requirements of isolated land statutes is a ministerial duty).
Youngs' case is controlled by Singleton v. Kimball County Board of Commissioners, supra, which, as Nebraska precedent, authorizes mandamus as a proper remedy to compel the County Board to act consistent with Neb.Rev.Stat. §§ 39-1713 to 39-1719 (Reissue 1978), the isolated land statutes.
IS YOUNGS' TRACT "ISOLATED"?
The question of law raised by Youngs and the County Board, concerning the isolated land statutes is based on undisputed facts: Youngs' island tract is bounded on three sides by land owned by others and on the fourth side by the main channel of the Platte River. Youngs have been unable to acquire access to their island property. From the north, Youngs' property was previously accessible via the county road and the Ames Dike with permission of the Ames Diking and Drainage District and by crossing land owned by others. The County Board argues that there is an "island exception" to § 39-1713. However, in examining § 39-1713 we find no "island exception"; rather, land may be isolated, and, therefore, the subject of § 39-1713(2), if the land is shut off from all public roads, other than a waterway, by (1) being surrounded on all sides by real estate belonging to other persons or (2) by being surrounded on all sides by real estate belonging to others and by water. In view of its *165 location on Hartman Island, Youngs' tract meets the requirement of § 39-1713(2) for qualification as isolated land. Thus, Youngs are entitled to a writ of mandamus for access to their island tract in accordance with §§ 39-1713 and 39-1716. The location and type of road eventually provided by the county are matters for decision by the County Board pursuant to §§ 39-1713 and 39-1716, see Singleton v. Kimball County Board of Commissioners, supra, and are outside the present appeal and outside the question whether the County Board must provide a public road to Youngs' island property from an existing public road. Concerning the preceding question, we affirm the district court's judgment, subject to the modification that the County Board shall lay out a "public road" in connection with Youngs' island property, see § 39-1716 (Reissue 1978), rather than "public access," see § 39-1716 (Reissue 1988).
CONDEMNATION OF THE AMES DIKE
The County Board claims that the district court erred in failing to hold that the county could not utilize the power of eminent domain to acquire property of the Ames Diking and Drainage District, that is, condemnation for the purpose of access via or across the Ames Dike. The district court properly refrained from deciding whether the county could condemn property of Ames Diking and Drainage District, a political subdivision. Involvement of the Ames Dike as a site or means for access to Youngs' island tract relates to location of a future public road to Youngs' property. As mentioned above, the only issue presented in Youngs' case is whether the County Board has a ministerial duty to lay out a public road for access to Youngs' insular property. Locating and laying out a public road are matters for the County Board and not matters for judicial consideration and determination in the present posture of Youngs' case. For that reason, the County Board's assignment of error relating to the power of eminent domain regarding property of the Ames Diking and Drainage District need not, and, therefore, will not, be considered for resolution of the issues raised in Youngs' mandamus action.
AN ATTORNEY FEE AS COSTS
The County Board contends that an attorney fee for Youngs' lawyer is unauthorized because Youngs were not entitled to the mandamus granted by the district court. However, we have determined that mandamus was proper under the circumstances.
Section 25-2165 provides for an attorney fee as part of the costs in a successful mandamus action.
As we expressed in Chambers-Dobson, Inc. v. Squier, 238 Neb. 748, 765, 472 N.W.2d 391, 402 (1991): "In Nebraska, the general rule is that an attorney fee may be recovered only when authorized by statute, or when a recognized and accepted uniform course of procedure allows recovery of an attorney fee." When an attorney fee is authorized, the amount of the fee is addressed to the discretion of the trial court, whose ruling will not be disturbed on appeal in the absence of an abuse of discretion. Megel v. City of Papillion, 194 Neb. 819, 235 N.W.2d 876 (1975); Insurance Co. of North America v. Omaha Paper Stock, Inc., 189 Neb. 232, 202 N.W.2d 188 (1972); Anoka-Butte Lumber Co. v. Malerbi, 180 Neb. 256, 142 N.W.2d 314 (1966). We find no abuse of discretion in the district court's awarding an attorney fee as part of the costs recoverable by Youngs in their mandamus action. Therefore, the trial court's judgment for costs is affirmed.
Youngs have also requested an attorney fee be awarded for their counsel in this appeal. Youngs have submitted information in compliance with Neb.Ct.R. of Prac. 9 F (rev. 1992). In view of the factors for judicial consideration in awarding an attorney fee, see, Smith v. Union Ins. Co., 218 Neb. 797, 359 N.W.2d 113 (1984); Weber v. Weber, 200 Neb. 659, 265 N.W.2d 436 (1978); and Schmer v. Hawkeye-Security Ins. Co., 194 Neb. 94, 230 N.W.2d 216 (1975), and after reviewing the information supplied by the parties in conjunction with Youngs' request for an attorney fee and expenses to be awarded in this court, we *166 determine that $2,500 is appropriate for an attorney fee and expenses in this appeal and, therefore, order that the County Board shall pay $2,500 as an attorney fee and expenses for Youngs' counsel in proceedings before this court.
CONCLUSION
Subject to the modification hereinbefore expressed, we affirm the district court's judgments and order the County Board to pay the attorney fee for the services of Youngs' lawyer in this appeal.
AFFIRMED AS MODIFIED.
|
{
"pile_set_name": "FreeLaw"
}
|
Derinkuyu Underground City
Derinkuyu Underground City
Derinkuyu Underground City
The antiquated Derinkuyu underground city is verification of what man can accomplish when his life is debilitated. It is a mind-boggling system of passages and rooms that shaped a city 100 meters under the ground. Several years back, when the territory was assaulted, subjects used to surge to the underground city and remain until it was protected to re-enter the place that is known for the living.
Derinkuyu underground city is not a place to visit on the off chance that you experience the ill effects of claustrophobia, hypertension, a dickey heart or fits of anxiety. Strolling down the flight of stairs in the Derinkuyu City here and there turns out to be cramped to the point that you start to bring down your head and feel choked by the absence of space.
There is a mass of passages and rooms and the best way to discover your path is by taking after the bolts put there by the affiliation that deals with the city. Red means you are going further into the city, blue means you are going out and go down to the surface. When going by Cappadocia, I entered the Derinkuyu gives in and investigated eight levels of this man-made city which makes me give credit where it is expected.
The city was huge and complex yet there was a general format to it. Creatures were jammed into the top level of the city; the kitchens were put on the following level, local lounges on the following level after that et cetera. The natives that constructed the Derinkuyu underground city considered everything. This city was not expected for the perpetual living anyway it could be months that they remained in there until it was protected to backpedal up.
Realities about Derinkuyu Underground City
> Sometimes individuals would go insane. Days without the sun and outside air can influence a man’s brain. In the event that individuals went insane, there were stone spaces that they were fixing to with a bit of rope. This would keep them from attempting to escape to the surface or assaulting other individuals
> If anybody attempted to escape the underground city, they would be executed and their bodies were altogether placed in one space to counteract sickness. This was done as an obstruction in light of the fact that on the off chance that anybody got at first glance, it is conceivable they would give away the mystery of several individuals living under the ground
> Stone wheels were moved crosswise over passageway approaches to shape entryways and they must be opened from within.
> There was new well that gave water to specific levels and air pipes guaranteed a crisp supply of oxygen.
> Weekly supplication occurred in the congregation. A storage space would hold the supply of wheat and grain while a winery would create liquor so everybody could get plastered and overlook where they were living.
I need to state, that when I turn out into outside air, I was extremely happy. I felt suffocated simply spending an hour in there; would you be able to envision how individuals felt in the past when they needed to invest months in there? Be set up for a surge of touts offering things when you leave the underground city, aside from that it is an awesome place to visit and makes you feel extremely humble without a doubt. On the off chance that underground urban communities are your thing, then make your vacation a long one as there are 36 of them to find in Cappadocia.
Recent Posts
About Cappadocia
Cappadocia is one of the best unique areas for visiting in Turkey. Cappadocia landscape and rock formations are uncommon and it is famous for its unique Fairy Chimneys, underground cities and cave hotels. Also, Hot Air Balloon Ride in Cappadocia is the most interesting activity. You will fall in love with Cappadocia while you are on the Balloon Flight in Cappadocia.
|
{
"pile_set_name": "Pile-CC"
}
|
Neisser
Neisser is a German surname. Notable people with the surname include:
Albert Ludwig Sigesmund Neisser (1855–1916), German physician
Kersten Neisser (born 1956), German rower
Ulric Neisser (1928–2012), American psychologist
See also
Nysa (disambiguation)
Category:German-language surnames
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Cortical bone thickening in Type A posterior atlas arch defects: experimental report.
To date, no information about the cortical bone microstructural properties in atlas vertebrae with posterior arch defects has been reported. To test if there is an increased cortical bone thickening in atlases with Type A posterior atlas arch defects in an experimental model. Micro-computed tomography (CT) study on cadaveric atlas vertebrae. We analyzed the cortical bone thickness, the cortical volume, and the medullary volume (SkyScan 1172 Bruker micro-CT NV, Kontich, Belgium) in cadaveric dry vertebrae with a Type A atlas arch defect and normal control vertebrae. The micro-CT study revealed significant differences in cortical bone thickness (p=.005), cortical volume (p=.003), and medullary volume (p=.009) values between the normal and the Type A vertebrae. Type A congenital atlas arch defects present a cortical bone thickening that may play a protective role against atlas fractures.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Koptsevo, Vyaznikovsky District, Vladimir Oblast
Koptsevo () is a rural locality (a village) in Vyaznikovsky District, Vladimir Oblast, Russia. The population was 56 as of 2010.
References
Category:Rural localities in Vladimir Oblast
|
{
"pile_set_name": "Wikipedia (en)"
}
|
The race in Michigan's 6th congressional district between incumbent Republican Congressman Fred Upton and Democrat Paul Clements has become surprisingly close—with Clements trailing the chairman of the powerful House Committee on Energy and Commerce by just a few points.
But until a few days ago, almost no one outside of the district was watching or involved in the race.
"It is now possible, if not likely, that this could be one of the biggest surprises coming out of the Midwestern congressional races," said Barry Rabe, an expert on the politics of climate change at the University of Michigan.
Upton was largely considered unbeatable thanks to his fourteen-term incumbency and ties to the fossil fuel industry, which has kept his campaign coffers full year after year. National environmental and political organizations like the League of Conservation Voters, the NRDC Action Fund and the Democratic Congressional Campaign Committee focused their efforts elsewhere. Even pollsters weren't tracking the race, at least not publicly.
Only two small super PACs got involved to help boost Clements, a political science professor at Western Michigan University. One was Climate Hawks Vote, which works to get climate-conscious candidates into office. The other was MaydayPAC, a crowdfunded group that strives to elect officials who support campaign finance reform.
"There should have been more groups involved, especially more environmental groups, considering this is the chair of the House energy committee," said RL Miller, founder of Climate Hawks Vote. "But they all saw it as a long shot. I got involved partly to send a message, but also because I didn't think it was quite as long a shot."
Climate Hawks Vote runs on a shoestring budget, opting for phone banking and door-to-door campaigning instead of running more expensive print and broadcast ads. The super PAC has had someone on the ground in Michigan since the beginning of September. Its strategy has been to boast about Clements' pro-climate action position while drawing attention to Upton's ties to the oil industry.
Upton has represented the district since 1987. Once a moderate on environmental issues, he started pushing a pro-fossil fuel agenda when the Tea Party movement took hold in 2010, including challenging the Environmental Protection Agency's ability to regulate greenhouse gas emissions. Upton's campaign website names him "a champion of the Keystone XL pipeline," a project that could send 800,000 barrels of carbon-heavy crude oil from Alberta to refineries in Texas. He is frequently one of the top Congressional recipients of oil, gas, and coal campaign contributions. He's received $222,650 from oil and gas companies so far this election season, according to the campaign finance website OpenSecrets.org.
But residents in Michigan's 6th congressional district seem to be losing patience with Upton's anti-environmental activities. The region has a long legacy of industrial pollution. It is also home to several pipelines carrying fossil fuels from Canada to Texas, and is the site of the largest inland oil pipeline spill in U.S. history, the 1-million barrel tar sands crude leak along the Kalamazoo River in 2010.
In September, a natural gas pipeline leak within the district displaced 500 people and gave pro-Clements campaigners another example in their fight.
A poll released last week by the Clements campaign shows that Upton's support has declined 10 points in a month, dropping from 57 percent to 47 percent. The race now stands at 47-43, with Upton's 4-point lead within the survey's 5-point margin of error. The Cook Political Report, a well-respected election forecast group, lowered Upton's likelihood of winning from "solid" to "likely" last week.
Political donors from both sides of the aisle have swept in to make last minute campaign contributions to sway undecided voters. Republicans are projected to increase their majority in the House. Even if Upton wins, a close race portends an opportunity for Democrats to prevail in the district in 2016.
The American Future Fund, a group largely funded by Charles and David Koch, made a new $300,000 ad buy last week, according to Politico.
MaydayPAC, which already committed $1.5 million to defeating Upton, announced last week it would spend another $650,000 in the race's final days. Betsy Taylor, president of Breakthrough Strategies & Solutions and an adviser to climate donors, and Marc Weiss, a producer and climate activist, have urged their informal network of climate-conscious donors to give money to the Clements campaign.
"We had not targeted this race before because the general wisdom was that Upton is untouchable," Taylor told InsideClimate News. "But Clements is running a strong challenge and at the very least, he is forcing Big Oil super PACs to unexpectedly redirect funds to Upton and away from the tight Senate races."
|
{
"pile_set_name": "OpenWebText2"
}
|
Cheetah's
Cheetah's Topless Club is a "gentleman's club" or topless bar located in San Diego, and Las Vegas, best known for being featured in the 1995 movie Showgirls, and also for having been owned by Mike Galardi, a nightclub owner who was investigated by the FBI with a controversial invocation of the Patriot Act. The Cheetah's club in San Diego is a full nude club where no alcohol is served. It has achieved notoriety for having been frequented by some of the September 11 hijackers.
Las Vegas Club
The Las Vegas club was founded in 1991 by Michael Galardi, and employs about 150 dancers. In 2004, Galardi admitted in a San Diego federal trial that he bribed Las Vegas officials in an attempt to influence strip club regulations. In a Las Vegas federal court, he stated that he paid between $200,000 and $400,000.
The club is managed by Charles Wright, a retired professional wrestler best known for his stints in World Wrestling Entertainment as a voodoo witch doctor ("Papa Shango") and as a pimp ("The Godfather"), and was also part of the factions: (The rebooted)Nation of Domination and the Million Dollar Corporation, under the name Kama “The Supreme Fighting Machine” Mustafa. He also was part of the Right To Censor as The Goodfather.
In an April 2012 episode of NBC's Smash, the New York City club entrance can be seen when Megan Hilty's character Ivy Lynn walks down the street.
See also
Planning of the September 11, 2001 attacks
Showgirls, 1995 film shot on location
Operation G-Sting - About the FBI's "Operation G-Sting"
Charles Wright - General manager of the club
Brent Jordan, bouncer from 1991–2003 who wrote a book, Stripped, about working at the club
References
Jordan, Brent Kenton, Stripped: Twenty Years of Secrets from inside the Strip Club, Satsu Multimedia Press, 2005,
"Cheetah's owner to contest LV fine" Las Vegas Review Journal, January 24, 2004
"FBI raids Vegas strip clubs, San Diego city offices" CNN, May 15, 2003
"Time to fix the Patriot Act"San Francisco Chronicle, April 7, 2005
"Patriot Act aided Feds in probe" Las Vegas Sun, November 4, 2003
Notes
Category:Strip clubs in the United States
Category:Nightclubs in the Las Vegas Valley
Category:Companies established in 1991
Category:Drinking establishments in Nevada
Category:1991 establishments in Nevada
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Top darknet drug marketplace, Dream Market, is shutting down - biofunsf
https://www.zdnet.com/article/top-dark-web-marketplace-will-shut-down-next-month/
======
arthurcolle
Another one bites the dust.
Does anyone have any theories on the methodologies being used in these
Operation Onymous/Bayonet/Shrouded Horizon to figure out who tor users are? I
heard one theory related to 'traffic confirmation' attacks which DDOS a
particular hidden service, and then basically flood the Tor network with 'LEO
relays' which are then used to figure out the point of origin.
[https://www.techdirt.com/articles/20151201/07281232952/tor-d...](https://www.techdirt.com/articles/20151201/07281232952/tor-
devs-say-theyve-learned-lessons-carnegie-mellon-attack-worries-remain-that-
theyre-outgunned-outmanned.shtml)
With the amount of busts happening these days, it is definitely a scary time
for those brave enough to host hidden services that engage in illegal
activity.
|
{
"pile_set_name": "HackerNews"
}
|
The Piercing Truth
This is right from the dictionary and seems to describe Albuquerque, Berry and Schultz. Fascism (f ash ,izem) noun An authoritarian right wing system of government and/or social organization. (in general use) extreme right wing, authoritarian, chauvinistic and/or intolerant views or practices. Fascism tends to include a belief in the supremacy of one group over another, national, ethnic, especially social strata or monetarily; a contempt for democracy, an insistence on obedience to a powerful leader, and a strong demagogic approach. Compliments of one of our Eyes
May 20, 2013
Hold Berry and Schultz Accountable
The City of
Albuquerque leaders are responsible to protect, serve and defend the citizens
of Albuquerque against all perils under the City’s control.This includes notifying the public of predators
and pedophiles when information is available.Sound correct? Not so, when you are elitists like Berry and
Schultz.This story centers on
negligence and nonfeasance of duty by Mayor Berry and APD’s Chief Schultz
regarding a horrific child abduction and molestation case.
On Friday the
public learned about the attempted abduction of a six year old little
girl.Fortunately, the mother of the
child learned of the abduction almost immediately and began a search. Her
diligent efforts paid off! Her child was returned safely and the offender
turned himself into police.
Here is where the
public received shocking news; approximately a week prior, a four year old girl
was abducted (kidnapped) and molested about thirty feet away from where the six
year old girl was abducted.Here is the
big question; why didn’t the police immediately notify the community about the
abduction and molestation? It is the duty (responsibility) of Mayor Berry and
Chief Schultz to protect, serve and defend the citizens of Albuquerque.This includes notifying the public about a
pedophile who has kidnapped and violated the innocents of a four old little
girl.Is this a racial bias or prejudice
with Berry and Shultz?Or is it a social
economic bias?The St. Anthony Apartments
is a primarily low-income housing of Hispanic minorities.
According to KRQE
News, “Police took a report on Monica Aragon's daughter's abduction and
molestation on May 9th but didn’t officially notify the neighborhood
or the public.” (READ IT HERE) Can you hear the double talk in this
statement?What do they mean they “didn’t
officially notify the neighbors or the public?”They did NOT notify ANYONE!This
is called nonfeasance of duty.This was
a reckless act of negligence and Berry and Schultz must be held accountable; no
excuses, no double talk.
The child’s mother
of the four year old stated, she got the impression the Albuquerque Police
Department wasn’t taking her seriously.APD
Sergeant Peterson stated they didn't release information on the first abduction
because they had very limited information.Let’s see if this is true: A four year old child was kidnapped and
molested.This wasn’t enough information
to notify the complex and/or the community that a pedophile had struck? Here is
another lie from APD.
According to
Peterson, “So the two can't really be held to the same standard…” Let’s see if
this is true by comparison: First case, a pedophile abducts and molests a four
year old little girl and APD says nothing about it.Second case, a pedophile kidnaps a six year
old little girl and releases her before he has a chance to abuse her because
her mother got involved. Here is another
lie from APD.
According to APD,
if you see a police car in the immediate area you are to assume that a six year
old child has been abducted and molested. Does this sound ridiculous?Here is the statement from APD “Police say
they also didn't send out an official alert after the first abduction because
neighbors in the immediate area saw the police scene and knew what happened.”
Lies, lies, lies and more lies…
According to a
story on KOAT Channel 7 (READ IT HERE), Albuquerque police told Target 7 they
hadn't alerted the media or the public of the prior week's incident because
they didn't have enough concrete evidence yet and no eyewitnesses besides the
victim herself.Since when does APD
operate on “concrete evidence” only?Providing needed information to the public has to be concrete now?Here is another lie.
The Eye on
Albuquerque ran a story about a mother who beat her child to death (READ IT HERE) and we placed Berry and Schultz on notice:
[For every child that is injured or killed
and nothing is done about it by the mayor and/or the chief; we find they are just
as guilty of hurting that child as are the offender. We desperately need a new
mayor and chief who will serve the people and not be self-serving.]
Here we are now;
another two children traumatized and now damaged for life. The first child’s situation may not have been
preventable but the second child’s situation was completely preventable! By failing to protect the community and
withholding information from the public is by proxy showing support for this
pedophile.Mayor Berry and Chief
Schultz; you are both at fault and need to be held accountable for your lack of
leadership and accountability.This is
another disgrace and black eye for the City as a whole, because Berry’s and
Schultz’s failed leadership.
It is time for a
positive change; a new responsible and capable leadership. Facts DO NOT
LIE.Vote your conscience on October 8th,
2013.
25 comments:
Anonymous
said...
Woodhead halitosis breath small fruit Berry only cares about bullshitting and talking down to citizens like they are morons in order to pull another 4 years over their eyes. This coward clown is pathetic. Hey Berry, go shine your bald spot you fake. I refuse to vote for a fake person who smiles in your face when you know he thinks he is better than you. You wear your fraud on your soft frail sissy little face you jackass.
Yes, Berry is one arrogant idiot. HE says the citizens appreciate responsible leadership. Hahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahaha!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!That was the funniest load of crap that liar has said his whole term. More lies from a liar who supports and promotes lies and liars. What responsible leadership. If APD was a ship you could compare it to all of the crew abandoning it as the rudder breaks and it takes on water. Yea, that's right. The command staff of APD, namely Feist, Paiz, Schultz, Warfield and the rest of the liars and malfeasants dropped APD like a hot potato, and are running for their lives from the DOJ after ruining the department, and sacrificing officers to save their own asses. Does this guy think people are blind?!?!? The city just lost 10 MILLION to such responsible leadership. What a buffoon? I guess taking illegal campaign contributions is responsible leadership too. How about intimidating campaign workers? Hmmmmmm.... It seems this guy is either warped, looking at everything through a kaleidoscope, or just an outright blatant arrogant liar who thinks everyone is blind and stupid. Watch that bullshit 59% drop to 2 by election time mister liar.
holy crap kob (aka fox jr) has an poll that shows berry with 57% lead in the poll over heh and dinelli ? wtf tell everyone to vote for someone other than berry, otherwise you all gonna end up with less proctection (if that's even possible) and more corruption.
Hey Ray, how red did you turn when you say an ex-officer that you tried to screw over step up to the plate and help the victim's mom fix her car due to wrecking into this offender that is probably the same guy that attacked a week prior. Your the head coach of APD and you should of been fired a long time ago like any coach with a losing record. I can not wait for you to leave.
The only thing transparent about Berry is his scheme. And schultz, that fairy. I get a kick out of his porky pig pink complexion. I get an even bigger laugh when he turns beet red when he gets punked. Get ready to get punked flabby turkey neck boy. After the shit thats coming for you, you might as well plan on being red for the rest of your pathetic life. Asshole.
Shots fired dispatched as priority three. WTF does it take to be a priority one. Oh yeah, we are only reporting response times to priority ones. Wouldn't want the public to know that even if they report the shooter squealing away from the parking lot we won't get there anytime soon.
Scumbag Rob Perry's former office buddy is having a fundraiser for Berry on Wedsday night, the citizens RTCC will be posted to exactly who shows up at 201 12th NW to feed at Paul Kennedy's trough and fork over cash for Berry....
Berry is the little white dot on the top of chicken shit. If this weasel wants to run for election he should fork his own money over. God knows that he and his cronies have cost this city more money than ever in lawsuits and payouts. His foolish decision to keep Schultz and Levy alone has bankrupted the lawsuit fund reserves. And Schultz has the balls to point the finger at everyone else. This fucking idiot has cost the city MILLIONS! Ray, you really better start looking in the mirror and shutting your big fat lying mouth. Oh.... and is karma finally coming around on Levy???? Hahahahaha. It will be better when she is facing federal civil rights and conspiracy charges. Best of Luck Virginia, Petunia, or whatever your name is today.
Berry and Schultz don't give a shit about poor people.... Need more proof... KOB is reporting about APDs warning of a serial flasher in Mariposa.... Little girl in the ghetto gets sexually attacked no news coverage but a guy just flashing in the rich people park KOB has the story because APD wants women on the lookout for him
Some places should be watched to see just who is connected to who, so the dots can be connected to a recent lawsuit, those involved, those involved peripherally, and those clandestinely involved. See what birds of a feather flock together, and who is a southwest companion, who knows their friends are southwest companions, and who conspired to cover for their southwest companions through treachery, attempted obstruction of the Department of Justice, violation of civil rights, witness intimidation and perjury. Wiretaps, Warrants, Federal witnesses..... Oh My! Plea Bargains, Deals, Prison... Oh My!
What a scumbag. First a fundraiser at Emcore. Now a fundraiser with Kennedy. Beats next a fundraiser at Paseo/Eagle Ranch? How bout one over at that 7-Eleven? Or better yet, have one at Abq Downs with ur butt buddy Darren Whit!!!
Speaking of Paseo/Eagle Ranch...looks like Casaus's credit report will soon be fk'd like BLT's! Can you say multi-millions??? Guess what? I don't see the Browder family settling for some miniscule 1 million either. It looks like the CCTV video footage from the BCSO Comm. Center will be his and CABQ's demise. It took him 8 minutes to go 9 miles on W/B Paseo. Assuming he had green lights the whole distance (we know he didn't), that calculates to 69.23 mph was his avg. rate of speed. Can you say negligence resulting in homicide? 69.23 mph deserves prison time!!
You are right, no shame. These scum bags would have a fund raiser at Sandy Hook Elementary and at the Century Movie theater in Aurora if they could. Hopefully the feds will find enough to bury these filthy miscreant deviants and then they can put those funds on their commissary books.
Look for us on Facebook at
Contact The Eye with Questions, Concerns, or Information
Contributors
Comment Policy
The Eye On Albuquerque does not read through each comment for accuracy, Eye On Albuquerque does not edit nor does the Eye On Albuquerque pre-moderate any comments. Eye On Albuquerque welcomes all kinds of thoughts- supportive, dissenting, critical or otherwise. Eye On Albuquerque acknowledges the diversity of our community and respects it.
Eye On Albuquerque does not delete comments unless they have content that:
• is abusive
• is off-topic
• is repetitive in nature to a prior post
• contains ad-hominem attacks
• promotes hate of any kind
• uses excessively foul language
• is spam
We ask that you try to keep your comments focused, respectful and appropriate. If you find that your comment is not immediately showing up, it may have been erroneously flagged as spam. Please email us at [email protected] to follow up on the status of your comment. Please allow 24 hours for posting.
If you wish to dispute any comment for its truth or factual basis; contact us. The content of “comments” contained in the comments section does not necessarily reflect the thoughts, feelings or opinions of the Eye On Albuquerque.
Public Disclaimer
The Eye On Albuquerque is not affiliated with any City, County, State or Federal agency. The Eye On Albuquerque is a "stand alone" blog and is not affiliated with any other group(s), organization(s) or site(s). The Eye On Albuquerque is not a "social media site." The Eye On Albuquerque is a public opinion blog.
"We the people; by the people and for the people."
Many of our images are from Google Images. If you feel there has been an infringement, please contact the Eye On Albuquerque with proof of ownership; including licensing and Copyright information. It is not the Eye On Albuquerque's intent to infringe on any others property.
The Eye On Albuquerque is a "Not for Profit" public opinion Blog Site.
|
{
"pile_set_name": "Pile-CC"
}
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.