arg_1
stringlengths 4
5.08k
| round_1
float64 2
8
⌀ | ann_1
float64 1
2
⌀ | arg_2
stringlengths 8
2.19k
| round_2
float64 1
7
⌀ | ann_2
float64 1
2
⌀ | annotation_name
stringclasses 131
values | is_attacks
int64 0
1
|
|---|---|---|---|---|---|---|---|
We added “as the presence of fluid or gas can locally alter the seismic signal”
| 2 | 1 |
Lines 323-324: The authors should explain why low magnitude local seismic signals can be believed to represent permeable pathways promoting water or gas migration.
| 1 | 2 |
geosciences12010037_makarova
| 1 |
We added: “We define as recent tectonic activity the events that are recorded at the surface and can alter the surface with active tectonic features, such as modifications of the drainage system” • Discussion: One general comment, could the use of other tracers (radon, of stable isotopes of water) yield also insight on the origin of the fluids sampled in this study?
| 2 | 1 |
Line 360: Here and throughout the text, the word ‘recent’ is used to describe some tectonic activity. It would be good define what recent means in the context of this study. An indication is provided in the Discussion (Line 414), but it would go to state this value upfront in the text.
| 1 | 2 |
geosciences12010037_makarova
| 1 |
Radon cannot give this information since with the short half-live of 3.8days it's signal comes only from the direct vicinity of the sampled location. Stable isotopes of water could in principle do this if there is a geothermal signature on them (such as plotting far left to the meteoric water line - see inset in Figure 1 of McIntosh and Ferguson, 2020 – Geophysical research Letter) - but we have not seen such a signature. We may mention that in the text - but for such a signature to be discernible the bulk of the water needs to be geothermal, and what we see is only a small admixture.
| 2 | 1 |
Discussion: One general comment, could the use of other tracers (radon, of stable isotopes of water) yield also insight on the origin of the fluids sampled in this study?
| 1 | 2 |
geosciences12010037_makarova
| 1 |
The revisited figure 43 is now providing this information Seismic reflection 2D lines (1989-2015).
| 2 | 1 |
Aeromagnetic survey data acquired over the last 50+ years were employed for mapping structural and lithological features. Although the aeromagnetic data is said to be employed for structural interpretation, details somewhat sketchy. Reference is made to “…prominent […] magnetic lineaments which can be caused by faulting”, and “…several circular low magnetization anomalies, approximately two kilometers in diameter, aligned with northwest trending lineaments”. It would be nice to include a map with these features and lineaments interpreted from the aeromagnetic datasets. This would also tie the observations based on this dataset closer to the seismic interpretation (see below).
| 1 | 2 |
geosciences12010037_makarova
| 1 |
Thank you, the details comments on those figures have been followed and new figures are provided Helium measurements from groundwater samples.
| 2 | 1 |
Seismic reflection 2D lines (1989-2015). 8500 km. Interpretation of shallow horizons and faults using all publicly available geological and geophysical data of the Beetaloo region. Fault polygons defined for five horizons. Depth conversion using check-shot velocities from 26 wells. See comments to Figure 4. The depth maps provided in Figure 5 should be supplemented by isochore maps for the rock volumes between pairs of mapped reflectors. See also comments to Figure 7.
| 1 | 2 |
geosciences12010037_makarova
| 1 |
There is no other reference to date to the "primary documentation" but the link to the data (they should now be online) which are in the fact sheets.
| 2 | 1 |
Helium measurements from groundwater samples. With respect to the helium measurements, no detailed documentation of where these samples were collected is provided beyond referring to Geological and Bioregional Assessment Program (2021a) Fact sheet 12, and Geological and Bioregional Assessment Program (2021b) Regional tracer results from the Cambrian Limestone Aquifer. These are both summary documents. Please provide a reference to the primary documentation.
| 1 | 2 |
geosciences12010037_makarova
| 1 |
We have redone the figure 2 and added explanations on the process (see reply to comments on figure 2). Figure 8 should now be easier to read The surface drainage network line dataset was indeed based on the simplified (n=130) network following the following approach: Small segments with less than 10 nodes were automatically removed in SKUA (Paradigm/Emerson Trademark) and one iteration of smoothing was applied that further removed small irregularities without changing the overall orientation of major drainage lines.
| 2 | 1 |
Fault and surface drainage network mapping (tectonic geomorphology). The drainage network was extracted automatically. It is not clear if the “simplified” drainage network shown in Figure 2 was also extracted automatically. The data is summarized in Figure 8 (see also comments to Figure 8 below). It is not clear if the surface drainage network line dataset is based on the “unfiltered” or “simplified” data shown in Figure 2. Since n=130, one can assume the latter. It is however not made clear how this “simplified” network was generated, but there appear to be a substantial number of instances where the “simplification” provides apparent mismatches with the original data (see examples included in comments to Figure 2 below). The accuracy of the resulting plot can therefore be questioned. If the “simplified” network was generated automatically, I encourage the authors to do a manual QC of the results.
| 1 | 2 |
geosciences12010037_makarova
| 1 |
There is indeed an error on the figure referencing, we modified to Figure 3B where the lineaments are now clearly indicated.
| 2 | 1 |
Line 303: “We reviewed the seismic data in detail at the intersections with north-northwest trending lineaments observed on the magnetic dataset (Figure 4).” No such lineaments are shown in Figure 4.
| 1 | 2 |
geosciences12010037_makarova
| 1 |
We indeed need to add this link- we will put a link in place upon acceptance of the paper Figures Figure 1A.
| 2 | 1 |
Line 582. Link for supplementary materials does not work.
| 1 | 2 |
geosciences12010037_makarova
| 1 |
done, we also modified the fault legend to add clarity - Replace white labels with black lettering with no labels and white lettering.
| 2 | 1 |
- Poor visual discretization of main surface fault traces and Post Wilton geophysical faults (maybe use different colour for the two?)
| 1 | 2 |
geosciences12010037_makarova
| 1 |
We separated the legends from figures 1A and 1B as to add clarity. This article is focused on the Beetaloo subbasin and we use the direct input for Geoscience Australia in this stratigraphic column. We are not willing to add complexity by presenting in detail the Basins that are covering the Beetaloo Sub-Basin. We removed from the legend the details on the different basins as we understand that it is leading the reviewer in directions we are not exploring on the CLA stratigraphy- we do not refer this complexity in the results and discussion.
| 2 | 1 |
Figure 1B - Consider adding a small inset table or schematic to showing the Cambrian Limestone Aquifer stratigraphy in the Georgina, Daly and Wiso basin. Although this is described in the caption, it is not easy to grasp for someone not familiar with the stratigraphy in the area without spending time some time with paper and pencil.
| 1 | 2 |
geosciences12010037_makarova
| 1 |
Quality improved - Very, very overloaded figure, screen-dump from a mapping programme?
| 2 | 1 |
Figure 2 - Poor quality figure (low resolution) in the version available to the reviewer.
| 1 | 2 |
geosciences12010037_makarova
| 1 |
Thanks, the figure have been entirely revisited and divided into four subfigures as advised below -Consider splitting into several maps, e.g.
| 2 | 1 |
- Very, very overloaded figure, screen-dump from a mapping programme?
| 1 | 2 |
geosciences12010037_makarova
| 1 |
This output was then overlayed upon satellite and magnetic images where lineaments are evident for checking and quality control. In this process, minor mismatches of the automated simplified lines were removed and small drainage segments were connected along major lineaments for further simplification and reduction of the dataset. The adopted approach was: Small segments with less than 10 nodes were automatically removed in SKUA (Paradigm/Emerson Trademark) and one iteration of smoothing was applied that further removed small irregularities without changing the overall orientation of major drainage lines. We added this description of the adopted approach in the legend Figure 3 -Very small/illegible typeface on map coordinates – consider simplifying scales and use larger typeface.
| 2 | 1 |
- How the authors arrive at the simplified drainage network is not very clear
| 1 | 2 |
geosciences12010037_makarova
| 1 |
figure redrawn - Replace white labels with black typeface with white typeface.
| 2 | 1 |
Figure 4 - Poor quality figure (low resolution) in the version available to the reviewer.
| 1 | 2 |
geosciences12010037_makarova
| 1 |
Well label typos modified -Thin grey seismic lines are not explained in the legend or caption.
| 2 | 1 |
-Many well-name labels are hard difficult to read/illegible. Consider replacing well names on the map with numbers at the well position (white circles, black typeface) and add a table in the legend listing number and corresponding name of the well.
| 1 | 2 |
geosciences12010037_makarova
| 1 |
Legend added for those lines -The outline of the Eastern and Western Beetaloo Basin in Figure 3 and 4 should be kept identical in order to position Figure 6 A, B and C in relation to the seismic lines shown in Figure 4.
| 2 | 1 |
-Thin grey seismic lines are not explained in the legend or caption. Why are these not classified in terms of signal quality?
| 1 | 2 |
geosciences12010037_makarova
| 1 |
sochores added as supplementary material
| 2 | 1 |
Consider adding isochore maps for intervals between interpreted reflectors. These often highlight tectonic accommodation space creation better than maps.
| 1 | 2 |
geosciences12010037_makarova
| 1 |
done, legend cleared from information not represented
| 2 | 1 |
d) Explain/improve labels (what do you mean by “ntspr_2M_gw”? “Coast_10million”? “frameworkboundaries”? “State_Borders_10million”. Amend labels or explain in caption.
| 1 | 2 |
geosciences12010037_makarova
| 1 |
checked and clarified Clean up map: 1.
| 2 | 1 |
e) Several items in the legend appear to have the same or very similar signatures.
| 1 | 2 |
geosciences12010037_makarova
| 1 |
Clearly identified in the legend and representation 2.
| 2 | 1 |
Clean up map: Not possible to differentiate post-Wilton fault types properly in the figure.
| 1 | 2 |
geosciences12010037_makarova
| 1 |
removed
| 2 | 1 |
Could not find “Coast_10million”, “frameworkboundaries” or “State_Borders_10million” on the map. If these items are present, please use a more contrasting signatures to make it more visible. If they are not present on the map, remove these items from the legend.
| 1 | 2 |
geosciences12010037_makarova
| 1 |
Outline size modified and homogenised with other figures 4.
| 2 | 1 |
Consider replacing the purple outline of the eastern and western sub-basin with light grey shading.
| 1 | 2 |
geosciences12010037_makarova
| 1 |
Red selected 5.
| 2 | 1 |
Consider using the most prominent colour (red) for the possible fluid escape features as this is the key element of the map. Bright green might also bee an option.
| 1 | 2 |
geosciences12010037_makarova
| 1 |
modified
| 2 | 1 |
Not possible to differentiate “ntspr_2M_gw” (whatever that is) and “PossibleFluidEscapeStructures” (same colour).
| 1 | 2 |
geosciences12010037_makarova
| 1 |
modified accordingly Consider adding a simple conceptual sketch highlighting the stratigraphic position of the different faults (and possible fluid escape structures– this would also help visualizing which stratigraphic intervals the potential fluid escapes originate from and which stratigraphic intervals are potentially connected along potential fault-related fluid flow pathways.
| 2 | 1 |
The link between interpreted faults and fluid or gas escape features is a key feature of this figure. The map differentiates between “BaseCambrian seismic faults”, Post-Wilton “Strike-slip” and “Reverse” faults, and “FAULTS”. The categorization is not adequately explained (e.g. what differentiates “FAULT” from a “BaseCambrianSeismic fault”?).
| 1 | 2 |
geosciences12010037_makarova
| 1 |
With the new classification the reader should be able to better read the paper and can now directly refer to the stratigraphic table Figure 8.
| 2 | 1 |
Consider adding a simple conceptual sketch highlighting the stratigraphic position of the different faults (and possible fluid escape structures– this would also help visualizing which stratigraphic intervals the potential fluid escapes originate from and which stratigraphic intervals are potentially connected along potential fault-related fluid flow pathways.
| 1 | 2 |
geosciences12010037_makarova
| 1 |
Done, figure clarified as well Figure 9.
| 2 | 1 |
Please provide a more informative caption to what these plots show. What is included in the “Drainage and structural lineament analysis” plot?
| 1 | 2 |
geosciences12010037_makarova
| 1 |
done, we also totally revisited this figure as to have a cleared output
| 2 | 1 |
Figure 9. Poor resolution in the copy provided for the review. Consider using higher contrast colours or thicker lines to highlight different faults on the map.
| 1 | 2 |
geosciences12010037_makarova
| 1 |
The helium measurements have been added as supplementary data and the author made a clear difference between this study Helium measurements and other tracer studies we are citing.
| 4 | 1 |
With respect to the helium measurements, the references to the primary documentation requested by the reviewer in comments to v.1 of the manuscript are not provided, nor do the authors provide any comment as to why they deem this unnecessary. Section 4.3 Helium concentrations and isotopic composition measured in groundwater, is framed around results from previous studies. Providing references to these original studies (including access to the actual data that allow objective verification) rather than referencing to summary papers would be more in line with scientific publishing practice. If the primary documentation is not accessible, the authors should state this clearly.
| 3 | 2 |
geosciences12010037_makarova
| 1 |
Done, thank you
| 4 | 1 |
Figure 4. Seismic reflection data quality is ranked and colour-coded as “Excellent”, “Average” and “Poor”. Where does the fourth category, “Fair”, which also is a qualitative category, fit in, and why not include this category in the legend?
| 3 | 2 |
geosciences12010037_makarova
| 1 |
The isochores have been added in the seismic supplementary dataset
| 4 | 1 |
Figure 5. Isochron maps have been included in the supplementary material, the initial review suggested isoCHORE maps. Including these is maybe not critical, but as mentioned in the initial review, thickness maps sometimes highlight structural lineaments quite well. I don't know if this is the case here, but if they do, including isochore maps would enhance the readers' understanding of basin geometry and -infill.
| 3 | 2 |
geosciences12010037_makarova
| 1 |
Post Wilton “Strike-slip” and “Reverse” faults have been redrawn in all figures (Figure 1, 7, 9) with a new colour code, the fluid escape features are now shown as red dots in the legend as well.
| 4 | 1 |
If I understand the map correctly, fluid escape features on the map are shown as red dots. Why does the legend show these as thick red lines?
| 3 | 2 |
geosciences12010037_makarova
| 1 |
Number of measurements added in each plot. Figure 2a correspond to the SEEBASE structural lineaments (n=681).
| 4 | 1 |
Figure 8. Please keep the number of measurements included in each plot. The plot “Surface drainage network from this study” is identical to the original figure and should have n=130 measurements. According to the new caption shows the unfiltered surface drainage network. To my understanding this should correspond to Figure 2 a, which shows substantially more than 130 lineaments. How did you pick the ones you measured? Please clarify.
| 3 | 2 |
geosciences12010037_makarova
| 1 |
we are very sorry for the mistake, and the manuscript was modified accordingly.
| 2 | 1 |
In the Abstract you state that “two patients during their course of Rivaroxaban presented severe hematoma”, but in Table 1 it appears that the two hematomas occurred in the enoxaparin group? Please clarify.
| 1 | 2 |
healthcare10030476_makarova
| 1 |
The criticism of the reviewer has been accepted and the manuscript was modified accordingly.
| 2 | 1 |
The introduction is not well written. The structure is unclear, and the authors repeat themselves many times. For example, the section begins with introducing inherited thrombophilias and VTE risk in these conditions, then proceeds to surgery, then back again to thrombophilia where it repeats itself and even states other numbers for prevalences and VTE risks than previously stated. Furthermore, suitable references are lacking in some places. For the present study to be acceptable for publication, the introduction should be thoroughly revised.
| 1 | 2 |
healthcare10030476_makarova
| 1 |
The observation of the reviewer has been accepted and the manuscript was modified accordingly.
| 2 | 1 |
The Discussion section could benefit from a language revision, especially in the latter part, to make the flow better. Also, a brief discussion on the limitations of your study should be included.
| 1 | 2 |
healthcare10030476_makarova
| 1 |
The observation of the reviewer has been accepted and the table 1 was modified accordingly.
| 4 | 1 |
It is still not clear how thrombophilia was defined. You write (page 3, lines 129-130): "Only women with thrombophilia defined as a factor correlated with thrombotic phenomena linked to congenital or acquired factors. [21,40-43]" I suggest you alter the sentence, e.g. to something like: "Thrombophilia was defined as either the diagnosis of an inherited thrombophilia, a personal history of VTE or a familial history of VTE." If that is how you defined thrombophilia?
| 3 | 2 |
healthcare10030476_makarova
| 1 |
The new manuscript has been evaluated by an expert of English language.
| 4 | 1 |
Also, another round of language editing may be suitable.
| 3 | 2 |
healthcare10030476_makarova
| 1 |
The observation of the reviewer has been accepted and the table 1 was modified accordingly.
| 4 | 1 |
I have one major comment. It is still not clear how thrombophilia was defined. You write (page 3, lines 129-130): "Only women with thrombophilia defined as a factor correlated with thrombotic phenomena linked to congenital or acquired factors. [21,40-43]" I suggest you alter the sentence, e.g. to something like: "Thrombophilia was defined as either the diagnosis of an inherited thrombophilia, a personal history of VTE or a familial history of VTE." If that is how you defined thrombophilia?
| 3 | 2 |
healthcare10030476_perova
| 1 |
The new manuscript has been evaluated by an expert of English language.
| 4 | 1 |
Also, another round of language editing may be suitable.
| 3 | 2 |
healthcare10030476_perova
| 1 |
we are very sorry for the mistake, and the manuscript was modified accordingly.
| 2 | 1 |
In the Abstract you state that “two patients during their course of Rivaroxaban presented severe hematoma”, but in Table 1 it appears that the two hematomas occurred in the enoxaparin group? Please clarify.
| 1 | 2 |
healthcare10030476_perova
| 1 |
The criticism of the reviewer has been accepted and the manuscript was modified accordingly.
| 2 | 1 |
The introduction is not well written. The structure is unclear, and the authors repeat themselves many times. For example, the section begins with introducing inherited thrombophilias and VTE risk in these conditions, then proceeds to surgery, then back again to thrombophilia where it repeats itself and even states other numbers for prevalences and VTE risks than previously stated. Furthermore, suitable references are lacking in some places. For the present study to be acceptable for publication, the introduction should be thoroughly revised.
| 1 | 2 |
healthcare10030476_perova
| 1 |
The observation of the reviewer has been accepted and the manuscript was modified accordingly.
| 2 | 1 |
The Discussion section could benefit from a language revision, especially in the latter part, to make the flow better. Also, a brief discussion on the limitations of your study should be included.
| 1 | 2 |
healthcare10030476_perova
| 1 |
The quoted literature has been adapted to the ACS Style Guide. For that, the authors used to software package Zotero.
| 2 | 1 |
The citations are not formatted according to the journal guidelines. Please revise.
| 1 | 2 |
healthcare10040723_perova
| 1 |
STD are included in the all tables were indicated: sum+STD has been added in the legend.
| 2 | 1 |
Include the full form of STD described in the results.
| 1 | 2 |
healthcare10040723_perova
| 1 |
In Table 3 (=) has been changed into (0). It was a typo, sorry.
| 2 | 1 |
Table 3 “Health apps and computer algorithms are for patients disturbing (=)…” should “(=)” be “(0)”?
| 1 | 2 |
healthcare10040723_perova
| 1 |
Line 252: 7/24 has been changed into 24/7.
| 2 | 1 |
Line 252, 24/7 is the commonly accepted form of 7/24.
| 1 | 2 |
healthcare10040723_perova
| 1 |
Line 267 and 268, the description of figure 1 “focused on senses” means that the diagnostic workup should be more focused on the physical examination (the doctor’s senses) rather than based on technical diagnostics. In the revised manuscript has been added in line 270 “and use their senses in physical examinations rather than rely on impersonal technical tools for the diagnostic work-up”.
| 2 | 1 |
Line 267 and 268, the description of figure 1 is not clear. Does “focused on senses” mean in-person patient-doctor interaction?
| 1 | 2 |
healthcare10040723_perova
| 1 |
In Line 266/267 the term “undermine” was wrong. It has been changed into “ease”. Thank you for the hint.
| 2 | 1 |
Table 4 data suggest Digital networks increase doctor nurse communication but Line 266 says it undermines the same. Can you clarify?
| 1 | 2 |
healthcare10040723_perova
| 1 |
Table 5: The students could rank their answer. 1 = don’t know, 2= false up to 7 = fully agree. The statistical calculation was done only for ranks 2 to 7, excluding the students, who could not or didn’t want to answer the question. The authors knew from the qualitative study part, that some students had no knowledge about AI. Therefor the “don’t know” option was included. In the first draft of the manuscript the legends contained a mistake, because the “fully agree” option had the highest number (7) but not 3. This has been changed in the revised manuscript.
| 2 | 1 |
Table 5, what does numbers 1 through 7 represent?
| 1 | 2 |
healthcare10040723_perova
| 1 |
2. The reviewer discussed in much detail which design might better describe the method used in our study. In the sequential exploratory strategy a qualitative component is followed by a quantitative component (Creswell, JW. ; Plano Clark, VL. Designing and Conducting Mixed Methods Research. Thousand Oaks, CA: Sage; 2011). Aspects of the organizational environment (e.g., creative problem solving) were identified in the qualitative component and statistically confirmed or rejected in the preceding quantitative study phase, which is exactly what the authors did in this study. However, the reviewer suggested that the convergent parallel design might fit our methodology even better. In the convergent parallel strategy, quantitative and qualitative data collection occurred concurrently. The components are given equal weight, and the two datasets are analyzed and compared in parallel. Quantitative data identified factors statistically, which were integrated with qualitative data from in depth interviews with a subset of participants to understand how and why the identified factors influenced participants’ attitudes. In the method’s section of our study we lined out that the results of the first qualitative study part were the basis for the development of the online survey. Based on the qualitative study part, the questions for the qualitative study were formulated when students’ attitudes were expressed frequently. In this sense, the first (quantitative) phase informs the next, but the reviewer is right, that both phases are interlinked. Although our study integrates components of both strategies, the authors still think, that the sequential exploratory strategy describes our methods better than the convergent parallel design (see also: Curry et al Circ. Cardiovasc, Qual. Outcomes 2013, 6:119-123). As suggested by the reviewer, the authors specified in the method section that we used an additive rather than a parallel integrative strategy.
| 2 | 1 |
The fundamental issue that needs clarity is whether or not the study design was ‘exploratory mixed methods design’ or ‘convergent parallel design.’ As far as exploratory mixed methods design is concerned, the researcher begins with qualitative data and then collects quantitative information. Typically, in this design, the researcher presents the study in two phases, with the first phase involving qualitative data collection and the second phase involving quantitative data. In this regard, your study fits with the exploratory nature. In an exploratory sequential mixed-methods design, the researcher emphasizes the qualitative data (QUAL) more than the quantitative data (quan). This emphasis may reveal by presenting the overarching question as an open-ended question or discussing the qualitative results in more detail than the quantitative results. However, in this manuscript, I have not seen elements of these characteristics in the paper. As I have seen a complementary role of the qualitative and quantitative pieces is apparent instead of the qualitative piece informing the quantitative pieces. For example, the description of the study design says the following. Page 2, lines 90-92, ‘This was then integrated into the second study phase consisting of a nationally representative sample of the same sort of cohort.’ This description shows the integration of the two phases instead of the preceding phase informing the next phase. From the explanation in the study design and the presentation of your results, it sounds to me as if the mixed-methods nature of this study fits more with the convergent parallel design. Please, give your readers more information that conveniences the exploratory nature.
| 1 | 2 |
healthcare10040723_perova
| 1 |
The manuscript has been changed accordingly.
| 2 | 1 |
In the abstract, lines 23-27, I suggest to use the following expression or something like that. Around 38% of the students felt ill-prepared and could not answer AI-related questions because digitization in medicine and AI are not a formal part of the medical curriculum.
| 1 | 2 |
healthcare10040723_perova
| 1 |
The authors followed the reviewer’s suggestions and re-wrote this para as follows: “The overall objective of this study was to investigate the today’s medical students attitudes towards AI and other digital working tools. We wanted to understand if age, gender, semester level and curriculum type influences their views. This study also assembled information on students’ understanding of AI algorithms and digital applications in health care and assessed their level of confidence in working alongside these tools after graduation in patient care. It is our belief that this information may possess the means to employ digital tools including AI into the curriculum of medical students efficiently, enhancing their confidence in using them and therefor to better equip our future physicians with sufficient knowledge.” On page 2, line 111, the phrase ‘to affirm or dismiss,’ does not make sense.
| 2 | 1 |
Page 2, line 42, ‘the computation of compounding factors,’ I did not understand what it means. I suggest the authors to replace this with appropriate phrase.
| 1 | 2 |
healthcare10040723_perova
| 1 |
The phrase in question has been replaced by “to confirm”.
| 2 | 1 |
On page 2, line 111, the phrase ‘to affirm or dismiss,’ does not make sense. Replace this phrase with a more appropriate phrase.
| 1 | 2 |
healthcare10040723_perova
| 1 |
The authors choose 4 pre-clinical and 4 clinical students. The intention was - as outlined in the initial manuscript version - “… to understand how they perceive the subject of interest”. The wording has been specified, to clarify that in total 8 students tested the items but not 4 as the reviewer assumed. This number was considered sufficient a) to detect inconsistencies and b) to verify the correct meaning of the questions. AG and JE are two of the authors (first letter of the first and last name). In order to avoid any misunderstanding, this has been changed to “the authors” in the revised manuscript.
| 2 | 1 |
Page 3, lines 117-118, the statement has two issues. ‘The items were then tested through a pilot study consisting of a 117 group of 4 pre- and clinical students, mediated by AG and JE’ First, why did you use only 4 students for pilot testing? Second, what do ‘AG’ and ‘JE’ represent?
| 1 | 2 |
healthcare10040723_perova
| 1 |
Convenience sampling is defined as a method to collect data from a conveniently available pool of respondents. We used it, because it is the most commonly used sampling technique as it's incredibly prompt, uncomplicated, and economical.
| 2 | 1 |
Page 3, line 132, it says, Convenience sampling was used. I would ask, why did you use cconvenience sampling?
| 1 | 2 |
healthcare10040723_perova
| 1 |
The captation has been changed to “Characteristics of the study cohort.
| 2 | 1 |
Page 4, table 1, the caption and the table content do not match. Revise either of them.
| 1 | 2 |
healthcare10040723_perova
| 1 |
The sampling procedure was clearly described in the initial manuscript. For phase 1: “All participants of the first phase were students from from 1st to 6th year (undergraduate 1st to 2th year, graduate 3th to 6th year) from German Universities. The inclusion criteria were to actively study medicine and their agreement for their voluntarily participation. In the same way, the exclusion criteria were to have suspended their studies, as well as other exceptional situations. Prior to start, informed consent was obtained, which was followed by the collection of telephone numbers and email addresses. They were selected purposely and consecutively, in part by snowball until theoretical saturation was reached.” For phase 2: “For the second, quantitative study phase identical inclusion/exclusion criteria applied.” This referred to medical students of all semesters, excluding students from other faculties. “The online survey was sent to all medical faculties in Germany from which most forwarded the survey invitation by email to about 80 000 medical students to fulfill the principle of maximum diversity through convenience sampling method. Each contained an invitation letter and an information sheet.” Surely, sampling procedures in mixed method studies are phase depended different.
| 2 | 1 |
In the methods section, clearly describe the sampling procedure for the quantitative and qualitative study parts separately. Also describe the final study sample for both. I am suggesting this because the logic of quantitative sampling and qualitative sampling are different.
| 1 | 2 |
healthcare10040723_perova
| 1 |
The statement has been changed into: “The focus on German educational system and the fact that only a small fraction of the total number of medical students filled out the online survey makes a generalization of the answers difficult”.
| 2 | 1 |
Page 12, line 389, the statement which says, ‘The non-probabilistic sampling makes a generalization of the answers difficult,’ is confusing. I suggest to re-write this sentence.
| 1 | 2 |
healthcare10040723_perova
| 1 |
The authors agree and the phase “so called” has been removed.
| 2 | 1 |
I suggest to remove the phrase ‘so called,’ that has been used in the conclusion section or any other section.
| 1 | 2 |
healthcare10040723_perova
| 1 |
The authors agree and this statement has been re-written in the revised manuscript version.
| 2 | 1 |
Page 13, lines 409-410, in the conclusion section, the statement which says, ‘This study also found significant differences between those groups indicating differences in subgroups of students from the quantitative survey.’ This is a confusing statement. Re-write this sentence clearly.
| 1 | 2 |
healthcare10040723_perova
| 1 |
The authors fully agree. Therefore, the conclusion paragraph has been split into the “Conclusion” paragraph, in which the study’s conclusions has been outlined, and into a the new para “Implications” where the usefulness of the integration of eHealth aspects (including AI) into the curriculum is discussed.
| 2 | 1 |
I suggest the authors to include a short section including the implications of the study after the conclusions.
| 1 | 2 |
healthcare10040723_perova
| 1 |
We have modified this part in revised manuscript (Line 233-236). This sentence has been changed to “A suspension of A. rhizogenes strain GV3101 containing the pORER4-OfSPL11-GFP recombinant plasmid was aspirated using a 1 mL range syringe (needle not included), and the suspension was gently injected into the abaxial surface of four-week-old tobacco leaves avoiding the leaf veins.” Point 2: Rephrase lines 266-268 is unclear; wording, grammar and punctuation are wrong.
| 2 | 1 |
In line 227 “back of tobacco” is not clear be more specific.
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
Special thanks to you for your good suggestion, we had made correction carefully (Line 38).
| 2 | 1 |
Minor corrections In line 38 replace “Fortunately” with However.
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
Thank for your kindly suggestion, we have replaced this word in the revised version (Line 63).
| 2 | 1 |
In line 63 replace “trancroptoma” with transcriptome.
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
Special thanks to you for your good suggestion, we had made correction carefully (Line 65)
| 2 | 1 |
In line 65 replace “And” with In addition.
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
We are very sorry for our negligence, we had made correction in the manuscript (Line 69).
| 2 | 1 |
In line 69 add period after assay.
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
We had made correction in the manuscript (Line 83-84). The statements of “RNA extractions” were corrected as “total RNA was extracted using the RNA prep Pure Plant Plus Kit (Tiangen, Beijing, China).” Point 10: In line 91 what brand was Taq polymerase from?
| 2 | 1 |
In line 83 what extraction method was used? Mention kit of reagent brand.
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
We had made correction in the manuscript (Line 92). Taq polymerase was purchased from TaKaRa Biotechnology, Inc, Dalian, China.
| 2 | 1 |
In line 91 what brand was Taq polymerase from?
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
Special thanks to you for your good suggestion, we had made correction carefully (Line 102-103). The pORER4-GFP vector and the plant expression vector OfSPL11-GFP were purchased from Tsingke, Biotechnology, Inc, Hangzhou, China.
| 2 | 1 |
In line 100 replace “ligated” with was ligated and quote a reference for pORERA-GFP vector or mention brand if it is commercial.
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
We are very sorry for our negligence, we had made correction carefully (Line 115 and 270).
| 2 | 1 |
In line 113 replace “psoup” with pSOUP and “tobaccos” with tobacco plants.
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
Thank for your kindly suggestion, we had made correction carefully (Line 119 and 276).
| 2 | 1 |
In line 117 and 267 replace “vacuuming penetration” with vacuum infiltration.
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
We are very sorry for our negligence, we had made correction in the manuscript (Line 129).
| 2 | 1 |
In line 123 delete the first phrase which is repetitive (was already written before in Line 100).
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
Special thanks to you for your good suggestion, we had made correction carefully (Line 136).
| 2 | 1 |
In line 129 replace “strains” and “strain” with lines and line.
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
We are very sorry for our negligence, we had made correction carefully (Line 138).
| 2 | 1 |
In line 131 delete the period after experiments.
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
We are very sorry for our negligence, we had made correction in the manuscript (Line 145).
| 2 | 1 |
In line 138 Seedling should be lowercase.
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
We had made correction in the manuscript (Line 156-157). The statements of “the MDA assay kit” were corrected as “the MDA assay kit (Jiancheng Bioengineering Institute, Nanjing, China).” Point 20: In line 154 add "strain" after receptor and mention kit brand Response 20: Thank you for your comment.
| 2 | 1 |
In line 149 mention the kit brand.
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
We had made correction in the manuscript (Line 162 and 163). The statements of “the yeast Y187 receptor strain preparation and transformation kit” were corrected as “the yeast Y187 receptor strain preparation and transformation kit (Coolaber, Beijing, China).” Point 21: In line 169 add "were done" at the end.
| 2 | 1 |
In line 154 add “strain” after receptor and mention kit brand.
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
Thank for your kindly suggestion, we had made correction carefully (Line 177).
| 2 | 1 |
In line 169 add “were done” at the end. A phrase must have a verb.
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
Thank you for your comment, we had made correction in the manuscript (Line 270).
| 2 | 1 |
In line 261 replace “tobaccos” with tobacco plants.
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
Thank for your kindly suggestion, we had made correction carefully (Line 271).
| 2 | 1 |
In line 262 replace “were treatment by” with were treated with.
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
We are very sorry for our negligence, we had made correction carefully (Line 273).
| 2 | 1 |
In line 264 replace “indicate” with indicated.
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
We are very sorry for our negligence, we had made correction in the manuscript (Line 301).
| 2 | 1 |
In line 292 “The” must be lowercase.
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
We are very sorry for our negligence, we had made correction carefully (Line 327).
| 2 | 1 |
In line 318 “We” must be lowercase.
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
Thank for your kindly suggestion, we had made correction carefully (Line 403).
| 2 | 1 |
In line 395 replace “it revealed” with revealed.
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
Thank you for your comment, we had made correction in the manuscript (Line 415).
| 2 | 1 |
In line 406 delete period after stress.
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
We have modified this part in revised manuscript (Line 326-328).
| 2 | 1 |
Line 302: plant leaves instead of plants leaves.
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
genes. We feel sorry for the unclear statement. In our study, we used the amino acid sequence of OfSPL11 to compute the protein model. Secondary structure predictions were conducted on the PRABI (http://www.prabi.fr/spip.php?page=sommaire) protein structure prediction server. The ExPASy (http://web.expasy.org) was used to analyze the molecular weight, theoretical isoelectric point, and other physiochemical properties of the translated protein. Similar methods of operation and efforts can be found in other articles (Islam, 2021). Once again,we sincerely thank you for the recommended method, which we will use in future studies. Islam, M.D.; Rahman, M.M.; Rahman, M.M. ; Jin, X.J. ; Sun, L.L. ; Zhao, K.; Wang, S.; Sikdar, A.; Noor, H.; Jeon, J.S. ; Zhang, W.J. ; Sun, D.Z. In Silico and Transcription Analysis of Trehalose-6-phosphate Phosphatase Gene Family of Wheat: Trehalose Synthesis Genes Contribute to Salinity, Drought Stress and Leaf Senescence. 2021, 12, 1652. https://doi.org/10.3390/genes12111652 Point 2: Auhtors report that Actin was used as housekeeping gene.
| 2 | 1 |
Why the authors do not consider to use aminoacidic sequence to compute a protein model (e.g., by using gromacs)?
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
We tested the amplification efficiency before using housekeeping genes. Referring to the previous study of Arabidopsis housekeeping genes (Dheda, 2004; Czechowski, 2005; Hou, 2018), we selected Atactin1 (F: AGGCACCTCTTAACCCTAAAGC, R: GGACAACGGAATCTCTCAGC), Atactin2 (F: TTGTGCTGGATTCTGGTGATGG, R: CCGCTCTCTGCTGTTGTGGTG) and Atactin8 (F: GAATTACCCGACGGACA, R: ACGGTCTGCAATACCT) were tested for efficiency, and we found that the best result was Atactin2. The best housekeeping gene for O. fragrans is OfACT, which has been reported in a previous study (Zhang, 2015). Dheda, K.; Huggett, J.F. ; Bustin, S.A. Validation of housekeeping genes for normalizing RNA expression in real-time PCR. Biotechniques. 2004, 37: 112-119. https://doi.org/10.2144/04371RR03 Czechowski, T.; Stitt, M.; Altmann, T. Genome-wide identification and testing of superior reference genes for transcript normalization in Arabidopsis. Plant Physiol. 2005, 139: 5-17. https://doi.org/10.1104/pp.105.063743 Hou, H.; Jia, H.; Yan, Q.; Wang, X. Overexpression of a SBP-Box Gene (VpSBP16) from Chinese Wild Vitis Species in Arabidopsis Improves Salinity and Drought Stress Tolerance. Int. J. Mol. Sci. 2018, 19, 940. https://doi.org/10.3390/ijms19040940 Zhang, C.; Fu, J.X. ; Wang, Y.G. ; Bao, Z.Y. ; Zhao, H.B. Identification of Suitable Reference Genes for Gene Expression Normalization in the Quantitative Real-Time PCR Analysis of Sweet Osmanthus (Osmanthus fragrans Lour.). Plos one. 2015, 10,1-17. https://doi.org/10.1371/journal.pone.0136355 Point 3: Line 124: generat instead of generate.
| 2 | 1 |
Auhtors report that Actin was used as housekeeping gene. Do the authors have performed an efficiency test before using it? Do they tried to use otherHK genes?
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
We are very sorry for our negligence, we had made correction in the manuscript (Line 130).
| 2 | 1 |
Furthermore, I reccomend a text revision since some errors are present in the main text. Line 124: generate instead of generate
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
We have revised the manuscript according to your comments (Line 274-277). This sentence has been changed to “A. tumefaciens suspensions containing the fusion vector OfSPL11pro: LUC was transiently transformed into O. fragrans callus using vacuum infiltration, and then the O. fragrans callus were cultured in a symbiotic medium containing 0 mM and 200 mM NaCl.” Point 3: Rephrase lines 317-318.
| 2 | 1 |
Line 267-268: Please, check this sentence. It ends with "then". Figure 5 caption: activates instead of activate Line 302: plant leaves instead of plants leaves
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
We had made correction carefully (Line 283).
| 2 | 1 |
Figure 5 caption: activates instead of activate.
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
We are very sorry for our negligence, we had made correction in the manuscript (Line 310).
| 2 | 1 |
Line 302: plant leaves instead of plants leaves.
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
We are very sorry for our negligence, we had made correction in the manuscript (Line 319).
| 2 | 1 |
Line 311: plant leaves instead of plants leaves
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
Thank for your kindly suggestion, we had made correction carefully (Line 324).
| 2 | 1 |
Line 315: maybe a semicolon after "salt stress" is appropriate.
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
We are very sorry for our negligence, we had made correction in the manuscript (Line 366).
| 2 | 1 |
Line 360: remove the space after "assay"
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
Special thanks to you for your good suggestion. We had made correction carefully (Line 381).
| 2 | 1 |
Figure 9 caption: measure instead of measuring
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
Special thanks to you for your good suggestion, we had made correction in the manuscript (Line 398).
| 2 | 1 |
Line 392: I suggest to change the sentence in the following way ".. to drive the expression of target
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
Thank for your kindly suggestion. We have revised the manuscript according to your comments (Line 456). The statements of “participate in salt stress responses” were corrected as “participate in salt stress.” Point 12: Line 448: check the word "redycing" Response 12: Thank you for your comment.
| 2 | 1 |
Line 446: "...participate in salt stress"Line 448: check the word "redycing"
| 1 | 2 |
horticulturae8050412_makarova
| 1 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.