arg_1
stringlengths 4
5.08k
| round_1
float64 2
8
⌀ | ann_1
float64 1
2
⌀ | arg_2
stringlengths 8
2.19k
| round_2
float64 1
7
⌀ | ann_2
float64 1
2
⌀ | annotation_name
stringclasses 131
values | is_attacks
int64 0
1
|
|---|---|---|---|---|---|---|---|
We have modified this part in revised manuscript (Line 233-236). This sentence has been changed to “A suspension of A. rhizogenes strain GV3101 containing the pORER4-OfSPL11-GFP recombinant plasmid was aspirated using a 1 mL range syringe (needle not included), and the suspension was gently injected into the abaxial surface of four-week-old tobacco leaves avoiding the leaf veins.” Point 2: Rephrase lines 266-268 is unclear; wording, grammar and punctuation are wrong.
| 2 | 1 |
In line 227 “back of tobacco” is not clear be more specific.
| 1 | 2 |
horticulturae8050412_perova
| 1 |
We have modified this part in revised manuscript (Line 326-328). This sentence has been changed to “To better understand why OfSPL11 transgenic lines exhibit enhanced abiotic stress tolerance, we analyzed the expression of known abiotic stress response genes in 3-week-old wild-type and transgenic Arabidopsis.” Point 4: In lines 271-272 and 395-396, how do you explain that salt induced promoter trans-activation?
| 2 | 1 |
Rephrase lines 317-318. Comments as above.
| 1 | 2 |
horticulturae8050412_perova
| 1 |
In a previous study (Ding, 2021), the LlWRKY39 promoter was fused to a pGreenII-0800-LUC vector using a recombinant ligase (Vazyme, Nanjing, China). The constructed vector and an empty vector (control) were transformed into A. tumefaciens strain GV3101 (pSoup), which was used to transform N. benthamiana leaves. The LUC signal increased profoundly after subjection to HS (37℃), although under normal conditions (room temperature), the LUC signal was very low, which implied that HS activated the promoter activity of LlWRKY39. In this study, the experimental operations, reagents and plant materials were were the same as the previous study, except for the different treatment conditions. Therefore, we suggest that salt stress can induce the activity of the OfSPL11 promoter.
| 2 | 1 |
In lines 271-272 and 395-396, how do you explain that salt induced promoter trans-activation? Is there any published precedent?
| 1 | 2 |
horticulturae8050412_perova
| 1 |
Special thanks to you for your good suggestion, we had made correction carefully (Line 38).
| 2 | 1 |
Write appropriate brand of kits and reagents, followed by country. Check journal format.
| 1 | 2 |
horticulturae8050412_perova
| 1 |
Thank for your kindly suggestion, we have replaced this word in the revised version (Line 63).
| 2 | 1 |
In line 38 replace “Fortunately” with However.
| 1 | 2 |
horticulturae8050412_perova
| 1 |
Special thanks to you for your good suggestion, we had made correction carefully (Line 65).
| 2 | 1 |
In line 63 replace “trancroptoma” with transcriptome.
| 1 | 2 |
horticulturae8050412_perova
| 1 |
We are very sorry for our negligence, we had made correction in the manuscript (Line 69).
| 2 | 1 |
In line 65 replace “And” with In addition.
| 1 | 2 |
horticulturae8050412_perova
| 1 |
We had made correction in the manuscript (Line 83-84). The statements of “RNA extractions” were corrected as “total RNA was extracted using the RNA prep Pure Plant Plus Kit (Tiangen, Beijing, China).” Point 10: In line 91 what brand was Taq polymerase from?
| 2 | 1 |
In line 69 add period after assay.
| 1 | 2 |
horticulturae8050412_perova
| 1 |
We had made correction in the manuscript (Line 92). Taq polymerase was purchased from TaKaRa Biotechnology, Inc, Dalian, China.
| 2 | 1 |
In line 83 what extraction method was used? Mention kit of reagent brand.
| 1 | 2 |
horticulturae8050412_perova
| 1 |
Special thanks to you for your good suggestion, we had made correction carefully (Line 102-103). The pORER4-GFP vector and the plant expression vector OfSPL11-GFP were purchased from Tsingke, Biotechnology, Inc, Hangzhou, China.
| 2 | 1 |
In line 91 what brand was Taq polymerase from?
| 1 | 2 |
horticulturae8050412_perova
| 1 |
We are very sorry for our negligence, we had made correction carefully (Line 115 and 270).
| 2 | 1 |
In line 100 replace “ligated” with was ligated and quote a reference for pORERA-GFP vector or mention brand if it is commercial.
| 1 | 2 |
horticulturae8050412_perova
| 1 |
Thank for your kindly suggestion, we had made correction carefully (Line 119 and 276).
| 2 | 1 |
In line 113 replace “psoup” with pSOUP and “tobaccos” with tobacco plants.
| 1 | 2 |
horticulturae8050412_perova
| 1 |
We have modified this part in revised manuscript (Line 121-125). This sentence has been changed to “Symbiotic medium was prepared by weighing 4.414 g MS, 20 g sucrose, 10 g glucose, 7 g agar into a conical flask, sterile water was fixed to 1 L. The medium was sterilized in an autoclave for 30 min and the temperature was lowered to 55℃, add 100 μl naphthalene acetic acid (0.1 mg L-1), 500 μl zeatin (1mg L-1), 1 mL folic acid (1mg L-1), 1 mL 6-BA (2mg L-1), 500 μl acetosyringone (0.1 mol L-1).” Point 15: In line 123 delete the first phrase which is repetitive (was already written before in Line 100).
| 2 | 1 |
In line 117 and 267 replace “vacuuming penetration” with vacuum infiltration.
| 1 | 2 |
horticulturae8050412_perova
| 1 |
We are very sorry for our negligence, we had made correction in the manuscript (Line 129).
| 2 | 1 |
In line 118 define “symbiotic medium”.
| 1 | 2 |
horticulturae8050412_perova
| 1 |
Special thanks to you for your good suggestion, we had made correction carefully (Line 136).
| 2 | 1 |
In line 123 delete the first phrase which is repetitive (was already written before in Line 100).
| 1 | 2 |
horticulturae8050412_perova
| 1 |
We are very sorry for our negligence, we had made correction carefully (Line 138).
| 2 | 1 |
In line 129 replace “strains” and “strain” with lines and line.
| 1 | 2 |
horticulturae8050412_perova
| 1 |
We are very sorry for our negligence, we had made correction in the manuscript (Line 145).
| 2 | 1 |
In line 131 delete the period after experiments.
| 1 | 2 |
horticulturae8050412_perova
| 1 |
We had made correction in the manuscript (Line 156-157). The statements of “the MDA assay kit” were corrected as “the MDA assay kit (Jiancheng Bioengineering Institute, Nanjing, China).” Point 20: In line 154 add "strain" after receptor and mention kit brand Response 20: Thank you for your comment.
| 2 | 1 |
In line 138 Seedling should be lowercase.
| 1 | 2 |
horticulturae8050412_perova
| 1 |
We had made correction in the manuscript (Line 162 and 163). The statements of “the yeast Y187 receptor strain preparation and transformation kit” were corrected as “the yeast Y187 receptor strain preparation and transformation kit (Coolaber, Beijing, China).” Point 21: In line 169 add "were done" at the end.
| 2 | 1 |
In line 149 mention the kit brand.
| 1 | 2 |
horticulturae8050412_perova
| 1 |
Thank for your kindly suggestion, we had made correction carefully (Line 177).
| 2 | 1 |
In line 154 add “strain” after receptor and mention kit brand.
| 1 | 2 |
horticulturae8050412_perova
| 1 |
Thank you for your comment, we had made correction in the manuscript (Line 270).
| 2 | 1 |
In line 169 add “were done” at the end. A phrase must have a verb.
| 1 | 2 |
horticulturae8050412_perova
| 1 |
Thank for your kindly suggestion, we had made correction carefully (Line 271).
| 2 | 1 |
In line 261 replace “tobaccos” with tobacco plants.
| 1 | 2 |
horticulturae8050412_perova
| 1 |
We are very sorry for our negligence, we had made correction carefully (Line 273).
| 2 | 1 |
In line 262 replace “were treatment by” with were treated with.
| 1 | 2 |
horticulturae8050412_perova
| 1 |
We are very sorry for our negligence, we had made correction in the manuscript (Line 301).
| 2 | 1 |
In line 264 replace “indicate” with indicated.
| 1 | 2 |
horticulturae8050412_perova
| 1 |
We are very sorry for our negligence, we had made correction carefully (Line 327).
| 2 | 1 |
In line 292 “The” must be lowercase.
| 1 | 2 |
horticulturae8050412_perova
| 1 |
Thank for your kindly suggestion, we had made correction carefully (Line 403).
| 2 | 1 |
In line 318 “We” must be lowercase.
| 1 | 2 |
horticulturae8050412_perova
| 1 |
Thank you for your comment, we had made correction in the manuscript (Line 415).
| 2 | 1 |
In line 395 replace “it revealed” with revealed.
| 1 | 2 |
horticulturae8050412_perova
| 1 |
We feel sorry for the unclear statement. In our study, we used the amino acid sequence of OfSPL11 to compute the protein model. Secondary structure predictions were conducted on the PRABI (http://www.prabi.fr/spip.php?page=sommaire) protein structure prediction server. The ExPASy (http://web.expasy.org) was used to analyze the molecular weight, theoretical isoelectric point, and other physiochemical properties of the translated protein. Similar methods of operation and efforts can be found in other articles (Islam, 2021). Once again,we sincerely thank you for the recommended method, which we will use in future studies.
| 2 | 1 |
Why the authors do not consider to use aminoacidic sequence to compute a protein model (e.g., by using gromacs)?
| 1 | 2 |
horticulturae8050412_perova
| 1 |
We tested the amplification efficiency before using housekeeping genes. Referring to the previous study of Arabidopsis housekeeping genes (Dheda, 2004; Czechowski, 2005; Hou, 2018), we selected Atactin1 (F: AGGCACCTCTTAACCCTAAAGC, R: GGACAACGGAATCTCTCAGC), Atactin2 (F: TTGTGCTGGATTCTGGTGATGG, R: CCGCTCTCTGCTGTTGTGGTG) and Atactin8 (F: GAATTACCCGACGGACA, R: ACGGTCTGCAATACCT) were tested for efficiency, and we found that the best result was Atactin2. The best housekeeping gene for O. fragrans is OfACT, which has been reported in a previous study (Zhang, 2015).
| 2 | 1 |
Auhtors report that Actin was used as housekeeping gene. Do the authors have performed an efficiency test before using it? Do they tried to use otherHK genes?
| 1 | 2 |
horticulturae8050412_perova
| 1 |
We are very sorry for our negligence, we had made correction in the manuscript (Line 130).
| 2 | 1 |
Line 124: generate instead of generate
| 1 | 2 |
horticulturae8050412_perova
| 1 |
We have revised the manuscript according to your comments (Line 274-277). This sentence has been changed to “A. tumefaciens suspensions containing the fusion vector OfSPL11pro: LUC was transiently transformed into O. fragrans callus using vacuum infiltration, and then the O. fragrans callus were cultured in a symbiotic medium containing 0 mM and 200 mM NaCl.” Point 3: Rephrase lines 317-318.
| 2 | 1 |
Line 267-268: Please, check this sentence. It ends with "then".
Reviewer_2 Author 1 5 0 2 Figure 5 caption: activates instead of activate
Reviewer_2 Author 1 6 0 2 Line 302: plant leaves instead of plants leaves
Reviewer_2 Author 1 7 0 2 Line 311: plant leaves instead of plants leaves
Reviewer_2 Author 1 8 0 2 Line 315: maybe a semicolon after ""salt stress"" is appropriate"
| 1 | 2 |
horticulturae8050412_perova
| 1 |
We are very sorry for our negligence, we had made correction in the manuscript (Line 366).
| 2 | 1 |
Line 360: remove the space after "assay"
| 1 | 2 |
horticulturae8050412_perova
| 1 |
Special thanks to you for your good suggestion. We had made correction carefully (Line 381).
| 2 | 1 |
Figure 9 caption: measure instead of measuring
| 1 | 2 |
horticulturae8050412_perova
| 1 |
Special thanks to you for your good suggestion, we had made correction in the manuscript (Line 398).
| 2 | 1 |
Line 392: I suggest to change the sentence in the following way ".. to drive the expression of target genes.."
| 1 | 2 |
horticulturae8050412_perova
| 1 |
Thank for your kindly suggestion. We have revised the manuscript according to your comments (Line 456). The statements of “participate in salt stress responses” were corrected as “participate in salt stress.” Point 12: Line 448: check the word "redycing" Response 12: Thank you for your comment.
| 2 | 1 |
Line 446: "...participate in salt stress"
| 1 | 2 |
horticulturae8050412_perova
| 1 |
Thank you for your comment. We are very sorry for our negligence. We had made correction carefully (Line 457). The word of “redycing” were corrected as “reducing.” 2 1
| 2 | 1 |
Line 448: check the word "redycing"
| 1 | 2 |
horticulturae8050412_perova
| 1 |
Thanks for your reminder. In our study, 66 children were taken part in our analysis. But we failed to get all children’s feces and urine sample every day. Thus, we collected sample number was less the involved 66 children.
| 2 | 1 |
Lines 116-118: The amounts of samples were confused. Although there were 66 children involved in this study, 66 food samples, 62 feces and 64 urine samples were collected.
| 1 | 2 |
ijerph19127332_makarova
| 1 |
Thank you for your reminder. We have uniformed the units to “(mL/d)” Point 4.
| 2 | 1 |
Lines 176-178: Different units between manuscript and SM (figure S1).
| 1 | 2 |
ijerph19127332_makarova
| 1 |
At present, the related content in manuscript has been revised to: “The SIR values based on the measured tracer element concentrations of food, feces, urine, soil and dust are presented in Table 1 and Figure 1.
| 2 | 1 |
Lines 209-211: Different SIR values between manuscript and figure 1.
| 1 | 2 |
ijerph19127332_makarova
| 1 |
In the manuscript, the data is with outlier. However, we used the data without outlier to construct the figure. The median (minimum and maximum) of SIR values were ‒124.3 (‒278.0 to 228.2), ‒210.2 (‒490.1 to 273.8), 27.1 (0.4 to 106.0), ‒22532.8 (‒29443.8 to ‒6215.9), 23.9 (‒45.3 to 268.0), 175.3 (‒56.4 to 1040.7), 39.2 (‒36.4 to 284.0), and ‒263.2 (‒491.4 to 132.3) mg/d for Al, Ba, Ce, Mn, Sc, Ti, Y, and V.” Point 5. At present, the related content in manuscript has been replaced to: “The SIR values based on the measured tracer element concentrations of food, feces, urine, soil and dust are presented in Table 1 and Figure 1.
| 2 | 1 |
Lines 209 and 214: check the values of Al and Sc, because they were different among discussion, Table 1 and figure 1.
| 1 | 2 |
ijerph19127332_makarova
| 1 |
We have reorganized the SM figures and the manuscript content. The modifications are as follows: “The frequency distribution histograms show few outliers, most being high values (Figure S3 (a) and Figure S4). Experimental factors such as measurement error, source error, and transit time misalignment, may lead to some of these outliers. Other outliers may be due to the behavior of certain children, such as pica behavior or spending unusually large amounts of time playing in grassland. The medians of the SIR values after removing the high values (see Figure S3(b) and Figure 1) were taken as the final SIR values for children living in the studied e‒waste dismantling site in South China.” Point 7.
| 2 | 1 |
Lines 218 and 223: check the Figure 3 and figure S1.
| 1 | 2 |
ijerph19127332_makarova
| 1 |
It has been changed to “The LRL is ‒112.4‒100.9 mg/d which is considered as the lower limit of the 90% confidence interval (CI) of the 2.5th percentile (P2.5), whereas the URL is 516.9‒730.2 mg/d, which is considered as the upper limit of the 90% CI of the 97.5th percentile (P97.5). However, since negative SIR values are physically meaningless, the RI of the SIR for children living in e‒waste dismantling sites is 0‒730.4 mg/d. In this study, 95th per-centile values (383.3 mg/g) would be as recommended value.” Point 8.
| 2 | 1 |
Lines 253 and 377: different values between SIR and figure 3.
| 1 | 2 |
ijerph19127332_makarova
| 1 |
It has been changed to “The 95th HQ values based on SIR mean value decreased in the order of Pb > As > Cr > Cu > Ni > Zn > Cd and all of them were below 1.” Point 9.
| 2 | 1 |
Lines 348-349: correct the order of HQs.
| 1 | 2 |
ijerph19127332_makarova
| 1 |
We have revised all the figure captions in SM.
| 2 | 1 |
correct the figure caption in SM.
| 1 | 2 |
ijerph19127332_makarova
| 1 |
Thanks for your advice, we have made the changes to the title following:” Estimation of Children’s Soil/Dust Ingestion Rates and Health Risk at E‑Waste Dismantling Area”
| 2 | 1 |
Title- ‘in’ should be used for larger areas, can you add the study locations? Otherwise replace ‘in’ with ‘at’Rephrase title so as not to repeat ‘and’ Answer:
| 1 | 2 |
ijerph19127332_makarova
| 1 |
Thanks for your suggestion. We have introduced the sampling sites and added the following information: “The e-waste dismantling area we studied is an E-Waste Recycling Town located in South China, where the possible human body burden and health consequences of heavy metals exposure have been reported [30].” Huang, W.L. International Journal of Environmental Research and Public Health, 2021, 18(23):12428. https://doi.org/10.3390/ijerph182312428 Point 3.
| 2 | 1 |
It was only mentioned towards the end – Discussion Answer: Thanks for your suggestion. Materials and Methods:I would like to see a better description of the study location.
| 1 | 2 |
ijerph19127332_makarova
| 1 |
Thanks for your suggestion, we have sorted out the method part again, and now the modification is as follows: “Feces samples and food samples were pretreated in the same way. The digestion process was repeated until the sample becomes sticky.
| 2 | 1 |
Better explanation needed - why different processing for different samples?
| 1 | 2 |
ijerph19127332_makarova
| 1 |
For this question, our answer is following: this data is from the Technical Guidelines for Soil Pollution Risk Assessment of Construction Land in China. The website address of the guidelines is https://www.mee.gov.cn/ywgz/fgbz/bz/bzwb/trhj/201912/W020191224560850148092.pdf
| 2 | 1 |
Line190 – why was 350d/y taken? Explain for better understanding
| 1 | 2 |
ijerph19127332_makarova
| 1 |
For this problem, we conducted a questionnaire survey when collecting samples before the experiment, and all the guardians of the sample providers knew and agreed to the experiment.
| 2 | 1 |
Will like to see ethical approval for the project/research? Ethical approval from which institution? Were Consent/assent from participants obtained?
| 1 | 2 |
ijerph19127332_makarova
| 1 |
Collecting samples followed the USEPA recommendation of a period of 28 hours from food to feces and urine. Thus, we cannot provide the data for each day. And we also revised the table 1 legend (removing the “each day”).
| 2 | 1 |
Results and Discussion: Table 1 – is it possible to list/ summarise the data for each day?
| 1 | 2 |
ijerph19127332_makarova
| 1 |
For the convenience of you and readers, we have made full descriptions of some acronyms, and the modifications are as follows: “Therefore, in this study, the Best Tracer Method (BTM) was employed. This method has been used before”, “the Hazard Quotients (HQ) values between 1 and 10 indicate likely damage to human health”.
| 2 | 1 |
Line 294 – what is meaning of BTM, Would prefer re-introduction of the full meaning of acronyms in each sub-section Answer: Thank you for your suggestions.
| 1 | 2 |
ijerph19127332_makarova
| 1 |
Thank you for your suggestions. We have added the description of sampling site in the materials and methods. We have replied to your first suggestion on Materials and Methods for the specific content to be added.
| 2 | 1 |
Line 320 -Also descript the study location in the method section Answer: Thank you for your suggestions.
| 1 | 2 |
ijerph19127332_makarova
| 1 |
We have added the values for carcinogenic risk and non-carcinogenic risks in the support information.
| 2 | 1 |
Line 342- Describe with references the values for carcinogenic risk and non-carcinogenic risks in the methos sections before mentioning it in the discussion section.
| 1 | 2 |
ijerph19127332_makarova
| 1 |
Thank you for your proposal. For this part, we have added to the methods section, and followed as: “The Hazard Quotients (HQ) is the ratio of daily intake dose of pollutants to reference dose, which is used to characterize the levels of human exposure to non-carcinogenic contaminants through a single pathway which represents the level of non‒carcinogenic risk”.
| 2 | 1 |
Line 346 – What is HQ? Also describe in the methods section Answer:
| 1 | 2 |
ijerph19127332_makarova
| 1 |
Thanks for your advice, for the first question, this part of the ambiguous expression has been modified to “schools should keep desks and teaching AIDs clean and tidy, and urge children to clean up after outdoor activities”
| 2 | 1 |
Line 368 – what is the meaning of ‘Whatever’? please rephrase Answer:
| 1 | 2 |
ijerph19127332_makarova
| 1 |
Thank you for your advice. At first, the soil heavy metal data has been added in the supporting information (Table S4 and S5). Besides, our study focuses on estimating the children’s SIRs of from e‒waste disassembly areas by collecting and analyzing selected tracer elements in matched samples of their consumed food, feces, and urine, as well as soil samples from their play areas. We have examined the tracer elements in the food. And when we calculated the SIR, we also used the parameter “Cfood” (equation 1) to analyze the food intake. In addition, children’s feces and urine belong to biological samples, which is sufficient to calculate the SIR. Application of more biotic samples that you suggested is useful for our study, however, it is hard to get other samples from children, such as blood and tissue. At last, we also added the heavy metals information in resident or park green areas: “In resident and park green areas, the highest concentration of heavy metals is Zn and the lowest is Cd. The concentrations of heavy metals in park green areas were slightly higher than that in residential area, which may attribute to the difference of soil environmental quality management and control policy between these areas. Integrated data from the resident and park green areas, the median concentrations (mg/kg) of Cr, Ni, Cu, Zn, As, Cd, and Pb were 48.8, 63.9, 128, 413, 6.30, 0.513, and 115, respectively.” Point 2.
| 2 | 1 |
Will like to see references on the metal concentrations at the e-waste recycling site.
| 1 | 2 |
ijerph19127332_makarova
| 1 |
Thanks for your advice, and this explanation has been removed from the manuscript, it is changed to “this method analyzes the concentration of tracer elements in the soil to which children are exposed, the children's intake of food, their excreted feces and urine, and the content of the tracer element in the children’s food, feces, and urine.”
| 2 | 1 |
Page 2, lines 76-78: You can remove this sentence: a class of elements in the human body that are not easily absorbed by the human gastrointestinal tract and are also difficult to be transformed into other substances it’s not necessary Answer:
| 1 | 2 |
ijerph19127332_makarova
| 1 |
; Shi, X.L. ; Wu, K.S. Human Body Burden of Heavy Metals and Health Consequences of Pb Exposure in Guiyu, an E-Waste Recycling Town in China. Thanks for your advice, and we have added references to support this view, it is added “[30] Huang, W.L. International Journal of Environmental Research and Public Health, 2021, 18(23):12428. https://doi.org/10.3390/ijerph182312428” And we changed content as “The e-waste dismantling area we studied is an E-Waste Recycling Town located in South China, where the possible human body burden and health consequences of heavy metals exposure have been reported [30].” Point 3.
| 2 | 1 |
Page 3, lines 99-100: please, add references for the following information South China's economic conditions are better than in North China, but the environmental pollution is worse. The site we studied is an e‒waste dismantling area with severe soil pollution that is typical of e‒waste dismantling areas in South China.
| 1 | 2 |
ijerph19127332_makarova
| 1 |
Thanks for your advice, we have added the specific parameters and modified them as follows:” When the collection was completed, the samples were taken back to the laboratory and stored first in the refrigerator (‒20°C). Then, the feces were freeze‒dried (under vacuum conditions, the vacuum freeze drier temperature is ‒40°C to ‒50°C for 48 h) after measuring the weight with a vacuum freeze dryer.” Point 4.
| 2 | 1 |
Freeze-drying conditions of feces. Page 3, lines 116 and 120: Please, add technical details about: lyophilization of food samples.
| 1 | 2 |
ijerph19127332_makarova
| 1 |
Thank you for your suggestion. We have added the content we did not mention in this part, but the soil was not quartered, so there is no supplement. Now the modification is as follows: “Collect dust indoors or outdoors by cleaning dust from areas such as tables and windowsills. And 20 g of soil and as much dust (5-20 g) as possible were collected during the sampling process.” Point 5.
| 2 | 1 |
How much soil (kg) did you collect for each sample? Was the soil quartered? Page 3, lines 121-124: Please, add some information: How did you collect dust samples?
| 1 | 2 |
ijerph19127332_makarova
| 1 |
Dried samples (1 g) were digested to evaporate at low temperatures of 55°C on a heating plate with 3 mL concentrated nitric acid, 3 mL hydrogen fluoride, and 1 mL perchloric acid (HNO3‒HF‒HClO4). Crushed Evaporated samples were microwaved with 2 mL concentrated nitric acid and 3 mL hydrogen peroxide (HNO3‒H2O2). Digestion was performed at 120°C for 5 min, then 160°C for 5 min, and finally 180°C for 15 min. The digested product was diluted to 30 ml with ultrapure water and then stored at 4°C. The supernatant was extracted and analyzed by High Resolution Inductively Coupled Plasma Mass Spectrometry (HR‒ICP‒MS, Nu Attom, England) to determine Mn, Al, Ba, Ti, Ce, V, Sc, and Y. Urine samples (15 mL) were placed in a digestion tube and digested by microwaving with 2 mL of H2O2 and 3 mL of concentrated HNO3. The conditions of microwave digestion are the same as mentioned above. Finally, the digest was analyzed by HR‒ICP‒MS. Dried soil and dust samples (0.5 g) were digested as same as feces and food samples on a heating plate by HNO3‒HF‒HClO4. And then samples were microwaved with HNO3‒H2O2. The supernatant was analyzed for Al, Ba, Mn, Ti, and V by Inductively Coupled Plasma Optical Emission Spectroscopy (ICP‒OES, Spectra Arcos SOP, German) which is a method for atomic emission spectroscopy analysis using a light source that generates plasma discharge through high-frequency inductive coupling and by ICP‒MS for Ce, Sc, and Y. In addition, dried soil samples from living spaces (0.5 g) were digested with the same pre-treated and analyzed by ICP‒MS for Pb, As, Cr, Cu, Ni, Cd, and Zn. The standard curve of concentration was used to determine the sample concentration was established by heavy metal standard (all standards were from The Nonferrous Metals Society of China).” Point 4. Thanks for your advice! In view of the imperfection of the method and the defects of expression, we have added and improved this part, and the modification is as follows: “Feces samples and food samples were pre-treated in the same way. The digestion process is repeated until the sample becomes sticky.
| 2 | 1 |
Lines 137-138: Please, modify as suggested The supernatant was then extracted and analyzed by HR‒ICP‒MS to determine Mn, Al, Ba, Ti, Ce, V, Sc, and Y, Answer: Thanks for your advice!
| 1 | 2 |
ijerph19127332_makarova
| 1 |
Thank you for your correction. We have added (a, b, c, ect) to Figure 1 and Figure S1,2,3,4. The title of Figure 1 has been changed to “Figure 1. Frequency distribution histogram and outlier box of soil ingestion rate (SIR) based on tracer Al(a), Ba(b), Ce(c), Mn(d), Sc(e), Ti(f), V(g), and Y(h).” The title of Figure S1 has been changed to “Fig. S1 Histogram and basic statistical parameters of investigated child population age (a), height (b), and weight (c)”. The title of Figure S2 has been changed to “Fig. S2 Histogram and basic statistical parameters of daily food ingestion (a) (g/d, ww) and feces (b) (g/d, dw) and urine (c) (mL/d) excretion for investigated child population.”. The title of Figure S3 has been changed to “Fig. S3 Frequency distribution histogram and outlier box (a) and Frequency distribution histogram and outlier box (b) of soil ingestion rate (SIR) based on Al”. The title of Figure S4 has been changed to “Fig. S4 Frequency distribution histogram and outlier box of soil ingestion rate (SIR) based on tracer Al(a), Ba(b), Ce(c), Mn(d), Sc(e), Ti(f), V(g), and Y(h) separately”.
| 2 | 1 |
Please, add labels (a, b, c, etc.) in each figure and update the captions. Also in the supplementary. Please, check captions of figures S2 and 3 that are identical.
| 1 | 2 |
ijerph19127332_makarova
| 1 |
Thanks for your reminder. In our study, 66 children were taken part in our analysis. But we failed to get all children’s feces and urine sample every day. Thus, we collected sample number was less the involved 66 children.
| 2 | 1 |
Lines 116-118: The amounts of samples were confused. Although there were 66 children involved in this study, 66 food samples, 62 feces and 64 urine samples were collected.
| 1 | 2 |
ijerph19127332_perova
| 1 |
Thank you for your reminder. We have uniformed the units to “(mL/d)” Point 4.
| 2 | 1 |
Lines 176-178: Different units between manuscript and SM (figure S1).
| 1 | 2 |
ijerph19127332_perova
| 1 |
At present, the related content in manuscript has been revised to: “The SIR values based on the measured tracer element concentrations of food, feces, urine, soil and dust are presented in Table 1 and Figure 1.
| 2 | 1 |
Lines 209-211: Different SIR values between manuscript and figure 1.
| 1 | 2 |
ijerph19127332_perova
| 1 |
In the manuscript, the data is with outlier. However, we used the data without outlier to construct the figure. The median (minimum and maximum) of SIR values were ‒124.3 (‒278.0 to 228.2), ‒210.2 (‒490.1 to 273.8), 27.1 (0.4 to 106.0), ‒22532.8 (‒29443.8 to ‒6215.9), 23.9 (‒45.3 to 268.0), 175.3 (‒56.4 to 1040.7), 39.2 (‒36.4 to 284.0), and ‒263.2 (‒491.4 to 132.3) mg/d for Al, Ba, Ce, Mn, Sc, Ti, Y, and V.” Point 5. At present, the related content in manuscript has been replaced to: “The SIR values based on the measured tracer element concentrations of food, feces, urine, soil and dust are presented in Table 1 and Figure 1.
| 2 | 1 |
Lines 209 and 214: check the values of Al and Sc, because they were different among discussion, Table 1 and figure 1.
| 1 | 2 |
ijerph19127332_perova
| 1 |
We have reorganized the SM figures and the manuscript content. The modifications are as follows: “The frequency distribution histograms show few outliers, most being high values (Figure S3 (a) and Figure S4). Experimental factors such as measurement error, source error, and transit time misalignment, may lead to some of these outliers. Other outliers may be due to the behavior of certain children, such as pica behavior or spending unusually large amounts of time playing in grassland. The medians of the SIR values after removing the high values (see Figure S3(b) and Figure 1) were taken as the final SIR values for children living in the studied e‒waste dismantling site in South China.” Point 7.
| 2 | 1 |
Lines 218 and 223: check the Figure 3 and figure S1.
| 1 | 2 |
ijerph19127332_perova
| 1 |
It has been changed to “The LRL is ‒112.4‒100.9 mg/d which is considered as the lower limit of the 90% confidence interval (CI) of the 2.5th percentile (P2.5), whereas the URL is 516.9‒730.2 mg/d, which is considered as the upper limit of the 90% CI of the 97.5th percentile (P97.5). However, since negative SIR values are physically meaningless, the RI of the SIR for children living in e‒waste dismantling sites is 0‒730.4 mg/d. In this study, 95th per-centile values (383.3 mg/g) would be as recommended value.” Point 8.
| 2 | 1 |
Lines 253 and 377: different values between SIR and figure 3.
| 1 | 2 |
ijerph19127332_perova
| 1 |
It has been changed to “The 95th HQ values based on SIR mean value decreased in the order of Pb > As > Cr > Cu > Ni > Zn > Cd and all of them were below 1.” Point 9.
| 2 | 1 |
Lines 348-349: correct the order of HQs.
| 1 | 2 |
ijerph19127332_perova
| 1 |
We have revised all the figure captions in SM.
| 2 | 1 |
correct the figure caption in SM.
| 1 | 2 |
ijerph19127332_perova
| 1 |
Thanks for your advice, we have made the changes to the title following:” Estimation of Children’s Soil/Dust Ingestion Rates and Health Risk at E‑Waste Dismantling Area”
| 2 | 1 |
Title- ‘in’ should be used for larger areas, can you add the study locations? Otherwise replace ‘in’ with ‘at’Rephrase title so as not to repeat ‘and’ Answer:
| 1 | 2 |
ijerph19127332_perova
| 1 |
Thanks for your suggestion. We have introduced the sampling sites and added the following information: “The e-waste dismantling area we studied is an E-Waste Recycling Town located in South China, where the possible human body burden and health consequences of heavy metals exposure have been reported [30].” Huang, W.L. International Journal of Environmental Research and Public Health, 2021, 18(23):12428. https://doi.org/10.3390/ijerph182312428 Point 3.
| 2 | 1 |
I would like to see a better description of the study location. It was only mentioned towards the end – Discussion Answer: Thanks for your suggestion.
| 1 | 2 |
ijerph19127332_perova
| 1 |
Thanks for your suggestion, we have sorted out the method part again, and now the modification is as follows: “Feces samples and food samples were pretreated in the same way. The digestion process was repeated until the sample becomes sticky.
| 2 | 1 |
Better explanation needed - why different processing for different samples?
| 1 | 2 |
ijerph19127332_perova
| 1 |
For this question, our answer is following: this data is from the Technical Guidelines for Soil Pollution Risk Assessment of Construction Land in China. The website address of the guidelines is https://www.mee.gov.cn/ywgz/fgbz/bz/bzwb/trhj/201912/W020191224560850148092.pdf Will like to see ethical approval for the project/research? Ethical approval from which institution? Were Consent/assent from participants obtained? For this problem, we conducted a questionnaire survey when collecting samples before the experiment, and all the guardians of the sample providers knew and agreed to the experiment.
| 2 | 1 |
Line190 – why was 350d/y taken? Explain for better understanding Answer:
| 1 | 2 |
ijerph19127332_perova
| 1 |
Collecting samples followed the USEPA recommendation of a period of 28 hours from food to feces and urine. Thus, we cannot provide the data for each day. And we also revised the table 1 legend (removing the “each day”).
| 2 | 1 |
Table 1 – is it possible to list/ summarise the data for each day?
| 1 | 2 |
ijerph19127332_perova
| 1 |
For the convenience of you and readers, we have made full descriptions of some acronyms, and the modifications are as follows: “Therefore, in this study, the Best Tracer Method (BTM) was employed. This method has been used before”, “the Hazard Quotients (HQ) values between 1 and 10 indicate likely damage to human health”.
| 2 | 1 |
Line 294 – what is meaning of BTM, Would prefer re-introduction of the full meaning of acronyms in each sub-section Answer: Thank you for your suggestions.
| 1 | 2 |
ijerph19127332_perova
| 1 |
Thank you for your suggestions. We have added the description of sampling site in the materials and methods. We have replied to your first suggestion on Materials and Methods for the specific content to be added.
| 2 | 1 |
Line 320 -Also descript the study location in the method section Answer: Thank you for your suggestions.
| 1 | 2 |
ijerph19127332_perova
| 1 |
We have added the values for carcinogenic risk and non-carcinogenic risks in the support information.
| 2 | 1 |
Line 342- Describe with references the values for carcinogenic risk and non-carcinogenic risks in the methos sections before mentioning it in the discussion section.
| 1 | 2 |
ijerph19127332_perova
| 1 |
Thank you for your proposal. For this part, we have added to the methods section, and followed as: “The Hazard Quotients (HQ) is the ratio of daily intake dose of pollutants to reference dose, which is used to characterize the levels of human exposure to non-carcinogenic contaminants through a single pathway which represents the level of non‒carcinogenic risk”.
| 2 | 1 |
Line 346 – What is HQ? Also describe in the methods section Answer:
| 1 | 2 |
ijerph19127332_perova
| 1 |
Thanks for your advice, for the first question, this part of the ambiguous expression has been modified to “schools should keep desks and teaching AIDs clean and tidy, and urge children to clean up after outdoor activities”
| 2 | 1 |
Line 368 – what is the meaning of ‘Whatever’? please rephrase Answer:
| 1 | 2 |
ijerph19127332_perova
| 1 |
Thank you for your advice. At first, the soil heavy metal data has been added in the supporting information (Table S4 and S5). Besides, our study focuses on estimating the children’s SIRs of from e‒waste disassembly areas by collecting and analyzing selected tracer elements in matched samples of their consumed food, feces, and urine, as well as soil samples from their play areas. We have examined the tracer elements in the food. And when we calculated the SIR, we also used the parameter “Cfood” (equation 1) to analyze the food intake. In addition, children’s feces and urine belong to biological samples, which is sufficient to calculate the SIR. Application of more biotic samples that you suggested is useful for our study, however, it is hard to get other samples from children, such as blood and tissue. At last, we also added the heavy metals information in resident or park green areas: “In resident and park green areas, the highest concentration of heavy metals is Zn and the lowest is Cd. The concentrations of heavy metals in park green areas were slightly higher than that in residential area, which may attribute to the difference of soil environmental quality management and control policy between these areas. Integrated data from the resident and park green areas, the median concentrations (mg/kg) of Cr, Ni, Cu, Zn, As, Cd, and Pb were 48.8, 63.9, 128, 413, 6.30, 0.513, and 115, respectively.” Point 2.
| 2 | 1 |
Will like to see references on the metal concentrations at the e-waste recycling site.
| 1 | 2 |
ijerph19127332_perova
| 1 |
Thanks for your advice, and this explanation has been removed from the manuscript, it is changed to “this method analyzes the concentration of tracer elements in the soil to which children are exposed, the children's intake of food, their excreted feces and urine, and the content of the tracer element in the children’s food, feces, and urine.”
| 2 | 1 |
Page 2, lines 76-78: You can remove this sentence: a class of elements in the human body that are not easily absorbed by the human gastrointestinal tract and are also difficult to be transformed into other substances it’s not necessary Answer:
| 1 | 2 |
ijerph19127332_perova
| 1 |
; Shi, X.L. ; Wu, K.S. Human Body Burden of Heavy Metals and Health Consequences of Pb Exposure in Guiyu, an E-Waste Recycling Town in China. Thanks for your advice, and we have added references to support this view, it is added “[30] Huang, W.L. International Journal of Environmental Research and Public Health, 2021, 18(23):12428. https://doi.org/10.3390/ijerph182312428” And we changed content as “The e-waste dismantling area we studied is an E-Waste Recycling Town located in South China, where the possible human body burden and health consequences of heavy metals exposure have been reported [30].” Point 3.
| 2 | 1 |
Page 3, lines 99-100: please, add references for the following information South China's economic conditions are better than in North China, but the environmental pollution is worse. The site we studied is an e‒waste dismantling area with severe soil pollution that is typical of e‒waste dismantling areas in South China.
| 1 | 2 |
ijerph19127332_perova
| 1 |
Thanks for your advice, we have added the specific parameters and modified them as follows:” When the collection was completed, the samples were taken back to the laboratory and stored first in the refrigerator (‒20°C). Then, the feces were freeze‒dried (under vacuum conditions, the vacuum freeze drier temperature is ‒40°C to ‒50°C for 48 h) after measuring the weight with a vacuum freeze dryer.” Point 4.
| 2 | 1 |
Page 3, lines 116 and 120: Please, add technical details about:lyophilization of food samples. Freeze-drying conditions of feces.
| 1 | 2 |
ijerph19127332_perova
| 1 |
Thank you for your suggestion. We have added the content we did not mention in this part, but the soil was not quartered, so there is no supplement. Now the modification is as follows: “Collect dust indoors or outdoors by cleaning dust from areas such as tables and windowsills. And 20 g of soil and as much dust (5-20 g) as possible were collected during the sampling process.” Point 5.
| 2 | 1 |
Page 3, lines 121-124:Please, add some information: How did you collect dust samples? How much soil (kg) did you collect for each sample? Was the soil quartered?
| 1 | 2 |
ijerph19127332_perova
| 1 |
Dried samples (1 g) were digested to evaporate at low temperatures of 55°C on a heating plate with 3 mL concentrated nitric acid, 3 mL hydrogen fluoride, and 1 mL perchloric acid (HNO3‒HF‒HClO4). Crushed Evaporated samples were microwaved with 2 mL concentrated nitric acid and 3 mL hydrogen peroxide (HNO3‒H2O2). Digestion was performed at 120°C for 5 min, then 160°C for 5 min, and finally 180°C for 15 min. The digested product was diluted to 30 ml with ultrapure water and then stored at 4°C. The supernatant was extracted and analyzed by High Resolution Inductively Coupled Plasma Mass Spectrometry (HR‒ICP‒MS, Nu Attom, England) to determine Mn, Al, Ba, Ti, Ce, V, Sc, and Y. Urine samples (15 mL) were placed in a digestion tube and digested by microwaving with 2 mL of H2O2 and 3 mL of concentrated HNO3. The conditions of microwave digestion are the same as mentioned above. Finally, the digest was analyzed by HR‒ICP‒MS. Dried soil and dust samples (0.5 g) were digested as same as feces and food samples on a heating plate by HNO3‒HF‒HClO4. And then samples were microwaved with HNO3‒H2O2. The supernatant was analyzed for Al, Ba, Mn, Ti, and V by Inductively Coupled Plasma Optical Emission Spectroscopy (ICP‒OES, Spectra Arcos SOP, German) which is a method for atomic emission spectroscopy analysis using a light source that generates plasma discharge through high-frequency inductive coupling and by ICP‒MS for Ce, Sc, and Y. In addition, dried soil samples from living spaces (0.5 g) were digested with the same pre-treated and analyzed by ICP‒MS for Pb, As, Cr, Cu, Ni, Cd, and Zn. The standard curve of concentration was used to determine the sample concentration was established by heavy metal standard (all standards were from The Nonferrous Metals Society of China).” Point 4. Thanks for your advice! In view of the imperfection of the method and the defects of expression, we have added and improved this part, and the modification is as follows: “Feces samples and food samples were pre-treated in the same way. The digestion process is repeated until the sample becomes sticky.
| 2 | 1 |
Lines 131-135: Please, modify as suggested Crushed food samples (1 g) were microwaved with concentrated nitric acid and hydrogen peroxide (HNO3‒H2O2). The supernatant was extracted and analyzed by High Resolution Inductively Coupled Plasma Mass Spectrometry (HR‒ICP‒MS) to determine Mn, Al, Ba, Ti, Ce, V, Sc, and Y. Lines 137-138: Please, modify as suggested The supernatant was then extracted and analyzed by HR‒ICP‒MS to determine Mn, Al, Ba, Ti, Ce, V, Sc, and Y, Answer: Thanks for your advice!
| 1 | 2 |
ijerph19127332_perova
| 1 |
Thank you for your correction. We have added (a, b, c, ect) to Figure 1 and Figure S1,2,3,4. The title of Figure 1 has been changed to “Figure 1. Frequency distribution histogram and outlier box of soil ingestion rate (SIR) based on tracer Al(a), Ba(b), Ce(c), Mn(d), Sc(e), Ti(f), V(g), and Y(h).” The title of Figure S1 has been changed to “Fig. S1 Histogram and basic statistical parameters of investigated child population age (a), height (b), and weight (c)”. The title of Figure S2 has been changed to “Fig. S2 Histogram and basic statistical parameters of daily food ingestion (a) (g/d, ww) and feces (b) (g/d, dw) and urine (c) (mL/d) excretion for investigated child population.”. The title of Figure S3 has been changed to “Fig. S3 Frequency distribution histogram and outlier box (a) and Frequency distribution histogram and outlier box (b) of soil ingestion rate (SIR) based on Al”. The title of Figure S4 has been changed to “Fig. S4 Frequency distribution histogram and outlier box of soil ingestion rate (SIR) based on tracer Al(a), Ba(b), Ce(c), Mn(d), Sc(e), Ti(f), V(g), and Y(h) separately”.
| 2 | 1 |
Please, add labels (a, b, c, etc.) in each figure and update the captions. Also in the supplementary. Please, check captions of figures S2 and 3 that are identical.
| 1 | 2 |
ijerph19127332_perova
| 1 |
Thank you for this suggestion. While it would have been interesting to explore this further, our study focuses on retrospectively assessing and comparing disease progression within subgroups of patients receiving TOC. Patients not receiving TOC would have likely had a different presentation, progression and their follow-up would be slightly out of the scope of our observational retrospective study. When we compared patients who received TOC with the 86 severe patients who did not receive TOC (excluded from this analysis), the TOC group was far more severe, so there is no control group that could be matched. In addition, these patients did not have control CT scans.
| 2 | 1 |
The impact of Tocilizumab on radiological changes can not be adequately analyzed without a control group not receiving the drug.
| 1 | 2 |
jcm11051247_makarova
| 1 |
Following this suggestion, we have included in the analysis a calculation according to the FiO2. This has a cut-off which correlates to the oxygen flow cut-off.
| 2 | 1 |
The proposed timing of Tocilizumab administration based on oxygen flow rate is interesting but undoubtedly requires a more detailed statistical analysis to convince the readers.
| 1 | 2 |
jcm11051247_makarova
| 1 |
This is an interesting point. While knowledge of variants is of great importance from an epidemiologic point of view as they have different transmission rates and can cause diseases of different severity, the mechanism of the acute inflammatory response in severe infection seems to be similar regardless the strain. While we did not perform specific sequencing of the strain for every patient as this wouldn’t have been feasible, patients were included before the Delta variant emerged and we expect most of them to have had the initial D614G and UK B.1.1.7. Nonetheless, we have included a comment addressing this aspect in our limitations section to highlight this area of uncertainty.
| 2 | 1 |
Materials and Methods 2.1. Study design and population If there are mutations or differences in viral strains during the course of the study, should differences in response to TOC and timing of administration depending on the strain be considered?
| 1 | 2 |
jcm11051247_makarova
| 1 |
We agree with the referee that the reasons for the exclusions were unclear and have rephrased accordingly. Addresed in text: „All those excluded were not administered TOC either because of contraindications or TOC supply gaps.” Point 3: 3.
| 2 | 1 |
Results 86 cases are excluded from 187 cases, which is too many. What is the reason?
| 1 | 2 |
jcm11051247_makarova
| 1 |
We added the data using FiO2 ROC curve. The area under the curve for FiO2 ROC curve was smaller than the area under the curve for oxygen flow. In addition, the cut-off value for FiO2 corresponded to the cut-off for the oxygen flow rate, so the two groups in Table 3 would be similar.
| 2 | 1 |
Results When comparing different oxygen delivery methods, isn't it more appropriate to compare FiO2 rather than oxygen flow rate?
| 1 | 2 |
jcm11051247_makarova
| 1 |
We added this information also in Table 3. We analysed FiO2 (depending on the method of oxygen delivery - nasal canulae, HNF, MV), as you suggested and the cut-off value of FiO2 corresponded to the cut-off for the oxygen flow rate, so the two groups in Table 3 would be similar.
| 2 | 1 |
Results The median oxygen flow rate is shown to be 14 L/min, but FiO2 may vary depending on the method of oxygen delivery (nasal canulae, HNF, MV).
| 1 | 2 |
jcm11051247_makarova
| 1 |
Addressed in text and in Table 3.
| 2 | 1 |
The oxygen flow rate of 13 L/min measured by ROC as a cutoff value for TOC administration should be presented by FiO2.
| 1 | 2 |
jcm11051247_makarova
| 1 |
Thank you for pointing this out, we have changed Table 1 accordingly and we removed the imaging data, which as you mentioned, was the same as “before TOC” in Table 2.
| 2 | 1 |
Comparative radiologic changes before and after TOC administration In Table 2, about the change in CT findings in fatal and non-fatal patients before and after TOC administration, isn't it the same as the difference in imaging findings between patients who survive after severe illness and those who do not, regardless of TOC?
| 1 | 2 |
jcm11051247_makarova
| 1 |
Addressed, see previous comments and answers.
| 2 | 1 |
Timing of TOC administration according to the oxygen flow rates As mentioned above, the cutoff value is O2 13L/min, but the oxygen volume is difficult to interpret because FiO2 varies depending on the method of oxygen delivery.
| 1 | 2 |
jcm11051247_makarova
| 1 |
separation of sections and subheadings, revising all the text, adding paragraphs & references, adding/changing Tables & Figures): 1) Abstract was revised.
| 2 | 1 |
Especially in the results and discussion section, most of the content is to state the experimental results (correlation of data), while the discussion (eg. prediction mechanism, prediction accuracy, etc.) is not in-depth, and the analysis of model accuracy is rarely involved in the discussion.
| 1 | 2 |
land11030363_makarova
| 1 |
Sorry for the technical error. The sample set was divided into two subsets (75% and 25%) for calibration (86 samples) and validation (28 samples).
| 2 | 1 |
When the samples are grouped, it is generally carried out according to 7:3 or 3:1 or a certain ratio. There are 114 soil samples in this study, what is the basis for grouping by 88/26 (77.2%/22.8%)?
| 1 | 2 |
land11030363_makarova
| 1 |
The sections were separated as recommended.
| 2 | 1 |
Should the writing of the results and discussion sections be separated? Please think carefully.
| 1 | 2 |
land11030363_makarova
| 1 |
The comment was fully considered: the PCA and partial correlation analysis was adopted form the recommended study (e.g., Cheng et al., 2019). Correspondingly, separate subheadings (with new Table 4 and Figure 4) were added. Generally it was considered in Introduction and Materials & Methods, Results and Discussion sections. Such approach helped to analyze the underlying mechanisms.
| 2 | 1 |
In addition, partial correlation analysis (e.g., Cheng et al., 2019) could be helpful and bring more insights given the fact that soil spectra are simultaneously influenced by several soil properties (e.g., SOM and Iron oxide).
| 1 | 2 |
land11030363_makarova
| 1 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.