proba
float64 0.5
1
| text
stringlengths 16
174k
|
|---|---|
0.992826 |
Create animated GIF for Facebook advertising.
I would like someone to create an animated image for the purpose of facebook advertising.
The image should be taken from view from inside a car looking out to the road in front with a speed camera in front that flashes every 5 – 10 seconds the wording underneath Hill Twine Solicitors – Specialist defence solicitors and then a link to the website.
|
0.911384 |
The Cimmerians (also Kimmerians, Greek Κιμμέριοι Kimmerioi) are an ancient people, first mentioned in the late 8th century BC in Assyrian records.
Likely originating in the Pontic steppe and invading by means of the Caucasus, they probably assaulted Urartu, a state in north eastern Anatolia subject to the Neo-Assyrian Empire, in c. 714 BC. They were defeated by Assyrian forces under Sargon II in 705 and turned towards Anatolia, conquering Phrygia in 696/5. They reached the height of their power in 652 after taking Sardis, the capital of Lydia; however an invasion of Assyrian controlled Persia was thwarted by the Assyrians. Soon after 619, Alyattes of Lydia defeated them. There are no further mentions of them in historical sources, but it is likely that they settled in Cappadocia.
The first record of the Cimmerians appears in Assyrian annals in the year 714 BC. These describe how a people termed the Gimirri helped the forces of Sargon II to defeat the kingdom of Urartu. Their original homeland, called Gamir or Uish desh, seems to have been located within the buffer state of Mannae. The later geographer Ptolemy placed the Cimmerian city of Gomara in this region. The Assyrians recorded the migrations of the Cimmerians, as the former people's king Sargon II was killed in battle against them while driving them from Persia in 705 BC.
According to Herodotus (c. 440 BC), the Cimmerians had been expelled from their homeland between the Tyras (Dniester) and Tanais (Don) rivers by the Scythians. To ensure burial in their ancestral homeland, the men of the Cimmerian royal family divided into groups and fought each other to the death. The Cimmerian commoners buried the bodies along the river Tyras and fled from the Scythian advance, across the Caucasus and into Anatolia. Herodotus also names a number of Cimmerian kings, including Tugdamme (Lygdamis in Greek; mid-7th century BC), and Sandakhshatra (late-7th century).
In 654 BC or 652 BC – the exact date is unclear – the Cimmerians attacked the kingdom of Lydia, killing the Lydian king Gyges and causing great destruction to the Lydian capital of Sardis. They returned ten years later during the reign of Gyges' son Ardys II; this time they captured the city, with the exception of the citadel. The fall of Sardis was a major shock to the powers of the region; the Greek poets Callinus and Archilochus recorded the fear that it inspired in the Greek colonies of Ionia, some of which were attacked by Cimmerian and Treres raiders.
The Cimmerian occupation of Lydia was brief, however, possibly due to an outbreak of plague. They were beaten back by Alyattes II of Lydia. This defeat marked the effective end of Cimmerian power.
Early modern historians asserted Cimmerian descent for the Celts or the Germans, arguing from the similarity of Cimmerii to Cimbri or Cymry. The etymology of Cymro "Welshman" (plural: Cymry), connected to the Cimmerians by 17th-century Celticists, is now accepted by Celtic linguists as being derived from a Brythonic word *kom-brogos, meaning "compatriots". The Cambridge Ancient History classifies the Maeotians as either a people of Cimmerian ancestry or as Caucasian aboriginals under Iranian overlordship.
The Biblical name "Gomer" has been linked in some sources to the Cimmerians.
It has been speculated that the Cimmerians finally settled in Cappadocia, known in Armenian as Գամիրք, Gamir-kʿ (the same name as the original Cimmerian homeland in Mannae).
It has also been speculated that the modern Armenian city of Gyumri (Arm.: Գյումրի [ˈgjumɾi]), originally founded as Kumayri (Arm.: Կումայրի), derived its name from the Cimmerians who conquered the region and founded a settlement there.
637-626 – Cimmerians defeated by Alyattes II.
↑ "Cimmerian (people)". Encyclopedia Britannica. Retrieved 8 September 2012.
↑ Gordon, Bruce. "Regnal Chronologies". Retrieved 8 May 2013.
↑ "The origin of the Cimmerians is obscure. Linguistically they are usually regarded as Thracian or as Iranian, or at least to have had an Iranian ruling class." "Cimmerian", in Encyclopædia Britannica, 2006, Retrieved August 30, 2006. Quote: "The origin of the Cimmerians is obscure. Linguistically they are usually regarded as Thracian or as Iranian, or at least to have had an Iranian ruling class."
1 2 Encyclopædia Britannica (2006): "They [the Cimmerians] probably did live in the area north of the Black Sea, but attempts to define their original homeland more precisely by archaeological means, or even to fix the date of their expulsion from their country by the Scythians, have not so far been completely successful"
↑ K. Deller, "Ausgewählte neuassyrische Briefe betreffend Urarṭu zur Zeit Sargons II.," in P.E. Pecorella and M. Salvini (eds), Tra lo Zagros e l'Urmia. Ricerche storiche ed archeologiche nell'Azerbaigian Iraniano, Incunabula Graeca 78 (Rome 1984) 97–122.
↑ Cozzoli, Umberto (1968). I Cimmeri. Rome Italy: Arti Grafiche Citta di Castello (Roma).
↑ Salvini, Mirjo (1984). Tra lo Zagros e l'Urmia: richerche storiche ed archeologiche nell'Azerbaigian iraniano. Rome Italy: Ed. Dell'Ateneo (Roma).
↑ Kristensen, Anne Katrine Gade (1988). Who were the Cimmerians, and where did they come from?: Sargon II, and the Cimmerians, and Rusa I. Copenhagen Denmark: The Royal Danish Academy of Science and Letters.
↑ Herodotus, Histories, Book 4, sections 11–12.
↑ Herodotus, 1.16; Polyaenus, 7.2.1, Sergei R. Tokhtas’ev "Cimmerians" in the Encyclopedia Iranica (1991), several nineteenth-century summaries.
↑ Geiriadur Prifysgol Cymru, vol. I, p. 770. Jones, J. Morris. Welsh Grammar: Historical and Comparative. Oxford: Clarendon Press, 1995. Russell, Paul. Introduction to the Celtic Languages. London: Longman, 1995. Delamarre, Xavier. Dictionnaire de la langue gauloise. Paris: Errance, 2001.
↑ ""Kumayri infosite". Cimmerian. Retrieved 14 June 2015.".
↑ Yamauchi, Edwin M (1982). Foes from the Northern Frontier: Invading Hordes from the Russian Steppes. Grand Rapids MI USA: Baker Book House.
↑ Asimov, Isaac (1991). Asimov's Chronology of the World. New York: HarperCollins. p. 50.
↑ Meljukova, A. I. (1979). Skifija i Frakijskij Mir. Moscow.
↑ Posidonius in Strabo 7.2.2.
Boardman, John; Edwards, I. E. S. (1991). The Cambridge Ancient History. Volume 3. Part 2. Cambridge University Press. ISBN 0521227178. Retrieved March 2, 2015.
"Cimmerii". Encyclopædia Britannica. 6 (11th ed.). 1911. p. 368.
|
0.998665 |
How can i read the words of a text message on my account?
Read them on the phone, that’s the only place possible. There is no text content on your account.
|
0.9943 |
political reform - changing the type of democracy practiced.
constitutional reform? - amending the constitution of a country.
|
0.999946 |
Jackson was born to Joseph Eugene "Daddy Gene" Jackson (1927-2000) and Ruth Musick "Mama Ruth" Jackson (1930-2017) in Newnan, Georgia, and has four older siblings. He, his father, mother, and sisters lived in a small home built around his grandfather's old toolshed. The family is primarily of English descent. At one point, his bed was in the hallway for lack of room. His mother lived in the home until she died on January 7, 2017. Jackson sang in church as a child. His first job, at 12, was in a shoe store. He wrote his first song in 1983.
In 1994 Jackson left his management company, Ten Ten Management, which had overseen his career up to that point, and switched to Gary Overton. His fourth album was titled Who I Am, and it contained four number one hits: a cover of the Eddie Cochran standard "Summertime Blues", followed by "Livin' on Love", "Gone Country" and "I Don't Even Know Your Name". An additional track from the album, a cover of Rodney Crowell's "Song for the Life", made number six. In late 1994, Clay Walker reached number one with "If I Could Make a Living", which Jackson co-wrote. Alan also appeared in the 1996 "When Harry Kept Delores" episode of Home Improvement, singing his hit song "Mercury Blues" about his 1950 Mercury.
In 2016 and 2017, Jackson extended his "Keepin' It Country" tour with American Idol alumni Lauren Alaina.
At the 2002 CMAs, Jackson set a record for having the most nominations in a single year - ten - many rising from the song "Where Were You". It also brought his career total up to the second number of most nominations ever, after George Strait. "Where Were You" also was nominated for a Grammy for Song of the Year. The song was also subsequently parodied in the South Park episode "A Ladder To Heaven".
1993 Favorite Country Album - "A Lot About Livin' (And a Little 'bout Love)"
1991 Album of the Year - "Don't Rock the Jukebox"
1991 Single of the Year - "Don't Rock the Jukebox"
1993 Album of the Year - "A Lot About Livin' (And a Little 'bout Love)"
1993 Single of the Year - "Chattahoochee"
2001 Single of the Year - "Where Were You (When the World Stopped Turning)"
2001 Song of the Year - "Where Were You (When the World Stopped Turning)"
2002 Album of the Year - "Drive"
2002 Video of the Year - "Drive (For Daddy Gene)"
2003 Single of the Year - "It's Five O'Clock Somewhere"
2003 Vocal Event of the Year with Jimmy Buffett - "It's Five O'Clock Somewhere"
1992 Music Video of the Year - "Midnight in Montgomery"
1993 Music Video of the Year - "Chattahoochee"
1993 Vocal Event of the Year - "I Don't Need Your Rockin' Chair"
1994 Song of the Year with Jim McBride - "Chattahoochee"
2000 Vocal Event of the Year - "Murder on Music Row"
2002 Single of the Year - "Where Were You (When the World Stopped Turning)"
2002 Song of the Year - "Where Were You (When the World Stopped Turning)"
2002 Best Country Song - "Where Were You (When the World Stopped Turning)"
2014 Album of the Year - "The Bluegrass Album"
|
0.999966 |
You would think if the minister wanted to come into this place and insult this side of the chamber, she could do it unscripted, instead of slavishly reading from her notes, with prepared insults. But obviously she is not too nimble on her feet in that regard. I am delighted to rise and lead the coalition in this debate on the energy policies that the Andrews government has put forward. I particularly note paragraph 3 of the matter of public importance: (3) the Victorian default offer is giving families and small businesses a fair price on energy … That must be a pretty powerful policy considering the legislation has not even passed the upper house yet and considering that the Essential Services Commission has not even employed someone to set the default price, much less actually set the price itself.I call on the minister to perhaps reword her matter of public importance to be more accurate. It also never ceases to amaze me how this government and indeed all Labor governments just refuse to take responsibility for the mess that they cause Victorians. This and other Labor governments have been in office in Victoria for 16 of the last 20 years. While those opposite continue to say that the privatisation of our energy generators by the Kennett government is the cause of all our woes, they have had the best part of 20 years to do something about it. And we should not think that they have not tried, of course. They have put forward policies that have done nothing except add to the problem that Victorian householders face when they look to pay their bills. They have put policies in place that have only forced prices up over the last 20 years. Do not just take it from me; it is also on record that a former Deputy Premier, John Thwaites, said that the policies that he and his government put forward have been directly responsible for the price rises that we have seen in this state. The environment that we find ourselves in and the environment that households find themselves in as they bend under the weight of cost of living pressures are largely the fault of this and successive Labor governments. The minister said in her contribution that this government is wasting no time in making sure that prices are brought down. This is their fifth year in office. When this matter of public importance notes the commitment, it must be a newfound commitment because for the last four years, which way have prices gone? I ask the chamber rhetorically: which way have prices gone? They have only gone one way. They have gone up under this government, and they look to go up further. You should not listen to a word this government has said. For example, when Hazelwood shut down, when it was forced to close under the policies of this government, the minister said that power prices would only rise by 4 per cent or that that would equate to about 85 cents a week for the energy user in Victoria. Of course we have seen prices rise far beyond that, something in the order of 25 per cent, which at the time even the Premier said was a wild and inaccurate possibility, much less the sorts of price rises that some businesses have had to face which have been 100, 200 or even up to 300 per cent.
The environment that we find ourselves in, the environment of high energy prices and household spending under the weight of cost of living pressures, is a direct result of this government’s policies—whether it is the 2002 policy to implement full retail contestability, the 2009 policy to remove retail price regulation or the policy to triple coal royalties and force a coal generator out of business. For those members who have not been here that long, I sat in this chamber when Peter Batchelor was minister for energy and he told this chamber and indeed all Victorians that the introduction of smart meters would result in lower prices flowing to all Victorians. And what did it do? After the Victorian energy users spent $2.5 billion to have the smart meters introduced, what have we seen? We have seen nothing in this state except higher price rises. That is the environment that we find ourselves in. We have more unreliable power, we have dearer power and we also have policies that affect jobs. It was interesting to listen to the member for Morwell when in question time yesterday he asked a pretty straightforward question of the minister. It was not a gotcha question; it was a pretty straightforward question: what modelling has been done to show the impact that closing other coal-fired power generators in the Latrobe Valley would have on jobs? It was a fairly straightforward question. You would think that amongst other priorities of the government jobs might be an important one, particularly in the Latrobe Valley, which again has been bending under the weight of 17 per cent unemployment, exacerbated by the policies of this government to force the closure of Hazelwood power station, putting 700 people out of work overnight—700 direct jobs gone, not to mention the indirect jobs, with restaurants, businesses and travel agents reporting cancellations of holidays and cancellation of events and all those sorts of things. The impact on the Latrobe Valley as a result of this government’s policies has been enormous.
It was not an unfair question for the member for Morwell to come into this place yesterday and actually ask the government of the day, ‘What further impact are your policies going to have on my community?’. The fact that the government and the minister danced around that is an indictment of them. Certainly for someone who consistently says in her statements to this chamber, ‘Let me be clear’, she could not be more ambiguous and vague if she tried, because in many cases the contributions from the minister leave people none the wiser as to where this government is going on energy policy and indeed the impacts that the government’s policies are having on the wider Victorian community. Let me move on to some of the policies or some of the finer points of this matter, including the Victorian default offer, which we debated in this place two weeks ago. During that time I challenged government members to actually stand up in this place and guarantee Victorian energy users that there would be no‑one worse off under this policy, and of course not one member could do it. Not one member could assure the Victorian community that the deeply discounted offers that many of the second and third-tier retailers were putting forward to the community would be left as they were. The government cannot guarantee that these sorts of discounted offers that many in the community enjoy—and as I said in this chamber two weeks ago, probably there are members of Parliament here who enjoy similar offers—will not move.
Research that has been put out by the Australian Energy Market Commission and indeed the Australian Energy Council show us that those deeply discounted offers will probably and almost certainly rise over the course of time as third‑tier retailers are forced out of the market as a result of competition being killed by this legislation and by this policy direction. A significant impost on energy users right around the state will be made as a result of this policy, and every piece of research and every piece of reporting and modelling that have gone into this particular issue will show that that is indeed the case. As I said, it does not take much to go through some of these documents to show that that is the case. Indeed, if I can go back to some of the issues that were raised earlier with regard to energy policy, would Victorians really think that the minister who is telling them that prices will go down as a result of this government’s policies should actually be believed? I go back again to other policies of Labor governments. I go to the 2002 policy around full retail contestability. John Thwaites was quoted in the newspaper in 2015 as saying that that part of the policy had not worked and the retail component had increased very substantially. He said that in developing the policy to deregulate energy retailers everyone expected there would be more competition and therefore a reduction in bills, and the figures show that that has not happened. As I said, every Victorian is bending under the weight of these extraordinary cost of living pressures. Just a few weeks ago the Herald Sun reported that more than 1000 Victorian households a week had been disconnected from electricity and gas because of unpaid bills. Energy retailers cut off a staggering 55 474 retail customers last financial year.
When speaking on the Victorian default offer bill last week, the member for Wendouree made comments about record disconnections under the government—I think she was referring back to the Kennett government 20 years ago—but indeed completely failed to comment on – Actually it might have been the Napthine government. Was it? The 20 per cent surge in disconnections that this government has been overseeing is certainly something which should be taken into account. It should not be ignored by any member of this chamber who gets up to discuss these matters. I move onto paragraph (4) of the matter of public importance: (4) the failure of the federal Morrison government in energy policy. I just want to point out first of all that to say the federal government is failing on policy when one of their policies is a default market offer seems quite ludicrous. t seems quite bizarre that a government that has brought in a default market offer particular to Victoria says that a federal government that is bringing in a similar policy for around the nation has had a failure of policy. It is essentially the same policy. Indeed, how can it be a failure of policy when the federal government on 1 January got retailers to lower their standing offer prices and made sure retailers were offering targeted discounts for their concession customers? As a result of federal government policies retailers like AGL have taken 10 per cent off the whole bill for all standing customers, Energy Australia 15 per cent off the usage component for all concession standing customers and Origin 17 per cent off the whole bill for non-concession customers on standing offers. The list goes on of savings that federal government policy has overseen. I think to say that that is a failure when energy users in Victoria are paying less as a result of federal policies is again particularly bizarre. There are other federal government policies such as renewable energy investment, with Australian electricity statistics showing that clean energy investment was at its highest ever level in 2018, setting a new record of $13 billion. This government talks about renewable energy a great deal. The fact that the federal government is investing in it as well shows that the federal government is certainly on the right track when it comes to investing in renewable energy. The government members in the chamber laugh, but the reality is that these are facts—$13 billion in renewable energy investment. There are waste-to-energy projects that the government has invested in—certainly again not bad policy.
The federal government has a commitment to the targets of the Paris agreement, which it says it will reach eight years ahead of time. There are waste-to-energy projects, as I said. There is a retailer reliability obligation agreed to at the Council of Australian Governments meeting, again a policy that the federal government put forward that this minister, the Victorian minister, actually signed an agreement with. If she thinks of it as a failure of energy policy at a federal level, then why did she sign up to implement a retailer reliability obligation, which was a key priority of the Australian government? There has been a $67 million investment in energy efficiency programs to cut costs and emissions in a way that will enable small businesses to claim grants of up to $20 000 for high-energy-using businesses. This is a scheme very similar to one I introduced when I was environment minister: Smarter Resources, Smarter Businesses. It is an opportunity for businesses to assess where they are in regard to their energy usage and find ways of making sure that they are more efficient so there is more money in their business for research, development, expansion—things of that nature. Certainly all of these policies that the Victorian government is talking about are actually policies that the federal government has put forward to ensure that there is a focus on renewables, a focus on using our resources more efficiently and a focus on making sure that energy prices come down and that the cost-of-living pressures that Victorian households are experiencing are less than they currently are—not only currently are but have been over successive Victorian Labor governments with policies that have only hurt them. In a nutshell we can clearly see that it is in fact Labor policies that have caused the sort of pressures that Victorian households are facing. A number of issues have been raised about its policy around the Victorian default offer, which the government has completely failed to address during the course of the debate and indeed outside of this chamber when it is talking about this particular policy direction.
The fact that the Victorian government has pointed to the failure of the federal government on energy policy shows that theirs is a position put forward with blinkers on, because the federal government’s policy mirrors in many ways the policies that this government is putting forward. The Victorian government should be taking a bipartisan approach and putting forward policies centred and focused on the pressures that Victorian households are facing. Rather than embracing the policies of the federal government, which are very similar to the ones the Victorian government is talking about, the government has instead sought to paint the federal policies as out of touch. In many ways they are the same as those the Victorian government is putting forward. In short, it has been Victorian Labor governments that have caused the pressures that many Victorians are facing. This particular matter of public importance draws a long bow to say the least. Certainly the policies that we will be putting together over the next three or four years will be ones that are focused on Victorian energy users, and that will be our focus rather than the partisan focus that the government is taking.
|
0.999873 |
What's the difference between philologer and philologist?
(1) After the war, Auerbach notes mournfully, the standardisation of ideas, and greater and greater specialisation of knowledge gradually narrowed the opportunities for the kind of investigative and everlastingly inquiring kind of philological work that he had represented; and, alas, it's an even more depressing fact that since Auerbach's death in 1957 both the idea and practice of humanistic research have shrunk in scope as well as in centrality.
(2) After a brief philologic introduction on some correlated concepts of pathogenesis we suggest the concept of pathological physiognomy of the organs.
(3) His methods were derived from the tradition of Indo-European philology.
(4) His great book Mimesis, published in Berne in 1946 but written while Auerbach was a wartime exile teaching Romance languages in Istanbul, was meant to be a testament to the diversity and concreteness of the reality represented in western literature from Homer to Virginia Woolf; but reading the 1951 essay one senses that, for Auerbach, the great book he wrote was an elegy for a period when people could interpret texts philologically, concretely, sensitively, and intuitively, using erudition and an excellent command of several languages to support the kind of understanding that Goethe advocated for his understanding of Islamic literature.
(5) 3) the philological-technical approach, which attempts an interpretation using the above philological approach supplemented by a consideration of the present-day function of a particular instrument or procedure.
(6) The various neuropsychological, medical and philological aspects of these terms are discussed.
(7) The analysis agrees with anthropological and philological evidence for population movements from Asia to Europe.
(8) Thirty years ago the term gender was borrowed from philology for use in sexological psychology in a paper on hermaphroditism (Money, 1955).
(9) A graduate in philology, the study of historical texts, she says she is aiming to earn enough to bring her daughter to the UK to attend college, as well as her husband.
(10) Any such modern explanation of the quantitative phenomenon is, however, hypothetical, all the more so as the philological observation of the phenomenon is not unproblematical.
(11) F. Max Müller, Oxford's professor of comparative philology, drew on Kant's work, Romantic Naturphilosophie, and his views on the history of language and the relation of language to thought to maintain that language showed a difference not in degree but in kind between man and the lower primates.
(12) 2) the philological approach, involving a Constitutio textus, the etymological analysis of the instrument's name and an examination of parallel references.
(13) To young people of the current generation the very idea of philology suggests something impossibly antiquarian and musty, but philology in fact is the most basic and creative of the interpretive arts.
(14) The main requirement for the kind of philological understanding Auerbach and his predecessors were talking about and tried to practise was one that sympathetically and subjectively entered into the life of a written text as seen from the perspective of its time and its author.
(15) On the one hand Sudhoff thought the philologic historical method to be the appropriate one for the investigation of the history of ancient medicine, on the other hand he did not think it to be indispensable for the medical historians.
(16) Rather than alienation and hostility to another time and a different culture, philology as applied to Weltliteratur involved a profound humanistic spirit deployed with generosity and, if I may use the word, hospitality.
(17) It was virtually as an afterthought that he added a social evolutionary component to what he conceived of as an exercise in philology.
(n.) One versed in philology.
(1) Jaramillo – a philosopher, philologist and diplomat – oozes courtesy and severity; he studied at both Oxford and Cambridge, he explains, “in order to get out and move on”.
(2) The interacademical project "Corpus Medicorum Graecorum", started in 1907 in Berlin, reflects the evolution of the classical philologists' approach to ancient medicine.
(3) Sudhoff's views of the tasks of medical historians in the field of the history of ancient medicine were influenced by the contemporary controversy between classical philologists and medical historians about their competence.
(4) I must mention too the supremely creative contribution of Giambattista Vico, the Neapolitan philosopher and philologist whose ideas anticipate those of German thinkers such as Herder and Wolf, later to be followed by Goethe, Humboldt, Dilthey, Nietzsche, Gadamer, and finally the great 20th-century Romance philologists Erich Auerbach, Leo Spitzer, and Ernst Robert Curtius.
(5) His headteacher had high hopes that he might become a philologist and Latin scholar.
(6) Lech Kaczynski and his twin brother Jaroslaw were born in Warsaw, sons of Rajmund Kaczynski, an engineer and a member of the Polish resistance during the second world war, and his wife Jadwiga, a philologist.
Words possibly related to "philologer"
Words possibly related to "philologist"
|
0.999935 |
Considering the bitterly cold winter we faced this year as Ottawans, shooting a wedding in Arizona this past February was a challenge welcomed and eagerly accepted by Andrew and Derrick. Who wouldn't want to escape the cold; trade in those frosty temperatures and heaps of snow for the desert sun and striking red canyons? Erika and Tim, Ontario natives currently residing in San Francisco, had the right idea when they planned their nuptials for the picturesque backdrops of Sedona. Andrew and Derrick couldn't have been more thrilled to capture their special day and even took advantage of the spectacular location to set up a "day-after" shoot.
Although both Erika and Tim attended the same business school, it wasn't until much later that a mutual friend brought them together over a few casual drinks. Nothing came of their first meeting, but as fate would have it, the two bumped into each other a few months later in the busy city of Toronto. They scheduled a lunch date and in Erika's own words, "the rest was history".
The couple's history continues to write itself, with the most recent chapter being their gorgeous wedding at the Enchantment Resort in Sedona. The neutral colour palette chosen by the couple perfectly complemented the unique wedding location. Subtle tones of peach, gold and pink allowed for the focus to be kept on the simple yet striking beauty of nature: the rust coloured cliffs and bright blue skies characteristic of the area, which served as the backdrop for their "i do's".
When asked what three words would best describe their wedding day, Erika and Tim answered "Awesome. Perfect. Magical." Here's wishing them many more awesome, perfect and magical memories, as they continue to write the chapters that will ultimately sum up their history as husband and wife.
|
0.99981 |
There are sports or physical activities that require you to provide extra calories and protein, and this is because the intensification of the processes that release energy generated for the need for supplemental protein intake to meet increased needs. So many athletes are turning to the energy and protein supplements.
In the market, there are protein shakes of high biological value specially prepared to develop the muscles along with the daily training. The purity of protein varies in percentages and presented in pleasant flavors.
The professional and elite athletes who are subject to a physical work, due to training or sports competitions, often resort to the use of specific products for athletes to supplement their high nutritional and energy demands.
Among athletes and people doing weights exercises, they pay particular attention to hyperproteinic food in order to increase their muscle mass and recovery after a weight training session. Following an exercise session such a negative balance synthetic muscle, which protein supplements are recommended either by a commercial smooth, homemade protein-based foods (egg, soy, milk, etc. ).
How do I prepare my shake at home?
The search for increased physical performance leads to athletes to consume products help increase the performance. Since the illegal substances are clearly disallowed by doping control laboratories, the emphasis has been placed with increasing emphasis on natural supplements, including protein and vitamins and minerals.
The importance of proteins and their building blocks, the amino acids in the diet of the athlete is linked to the increased needs in sports where muscle strength is important for its contribution to the development and growth of tissues, including muscle tissue.
Proteins are an energy source for athletes, and they act on the muscle and increasing strength, power, and thus performance.
A healthy person has a normal daily protein requirements of 0.8 grams / kg bw / day, while the amount you must include an athlete in the diet is more, because the muscular demands are greater.
According to the consensus of doctors and nutritionists specializing in sport, the protein requirements set out for aerobics and sports equipment, ranging from 1.2 to 1.4 grams per kilogram per day, and in sports of strength and speed, between 1 , 5 and 1.7 grams per kilogram and day, sufficient to maintain a rate of 15-17% of total calories at the expense of the proteins on the total energy to meet the demand of protein an athlete and achieve the desired effects of a balanced set of proteins.
Preventing the loss of muscle and strength that can be associated with an intense training program.
The basic ingredients are naturally rich in protein foods such as milk, yogurt, cheeses, ice cream, milk, nuts, grains (such as soy, amaranth, quinoa), which can be combined with fruits, juice and sweeteners such as sugar, candy, jam, honey, chocolate, etc.. To increase protein, can be added a soup spoon of milk powder.
Amaranth is a cereal with multiple benefits for more than five years Amaranth was a "Food of the Gods" wrapped in the veil of the ritual, reserved for the elite, today is a quality food to everyone. Its various applications in the field of food and makes it a product of growing demand.
The nutritional benefits are very important because its protein has the best nutritional profile of the plant kingdom. Contains all the essential amino acids, including lysine, which is higher than other cereals. Contains coenzyme Q10, a cell produces energy, helps cell respiration by protecting against free radicals, improving the immune activity and the use of oxygen to improve the utilization of carbohydrates and fats.
Amaranth is an excellent alternative to raising the level of nutrients, proteins and minerals that the body needs to be in constant motion and physical activity, making it excellent for athletes.
That's why we recommend this cereal to be included in your protein shakes!
So, coming from personal experience, I do not think that protein shakes are very highly recommendable. Most people get plenty of protein (if not too much) from their daily diet. If you consume a well-rounded diet, AND protein shakes on top of it, you are bound to gain weight (in fat).
Those recommendations look very amazing to improve the muscle mass with natural food and supplements, and shakes are also very easy to prepare, you can include almost all ingredients and depend on your taste, so I?m going to follow those advices and I hope to see results very soon thanks!
|
0.999983 |
What position someone achieves within a company depends on many factors. One factor that should definitely not matter is the looks of the person. Multiple studies prove that attractiveness is conducive to the career development to a certain degree. The more attractive a person is, the more positive character traits are assigned to her and the more opportunities she gets.
This becomes problematic for women in male dominated professions. Especially good-looking women often find it difficult to get into a leadership position or to gain necessary respect. The more attractive a woman is, the less classical leadership qualities, such as assertiveness, consistency and power are credited to her. Accordingly, she is considered less suitable for a management position. This mistrust not only comes from men, but also other women who resent attractive female leaders.
|
0.999959 |
If, like me, you’ve ever questioned the difference between walking and hiking, here’s a few common definitions.
d1: To travel on foot at a moderate pace; by advancing the feet alternately.
d2: Go on foot for recreation and exercise.
d3: Travel over (a route or area) on foot.
d1: To walk or march a great distance, especially through rural areas, for pleasure, exercise.
d2: A long walk or distance walking tour.
Now this confused the beans out of me! I see walking defined generally, as the act of walking. I see hiking defined generally, as the act of walking. So is the primary difference, distance? Well no, there’s actually a little more to it.
This actually covers the widest range of human bipedal activities and two legged pursuits.
Walking includes such things as delivering the little one’s to school, perhaps delivering yourself to work, fetching or carrying groceries, maybe venturing outdoors at the weekend for a fun trek through the local woods etc.
What defines walking is that it’s, well, walking!
It seems confusion enters, when we start to think of walking in terms of health, fitness, endurance or adventure.
It’s when walking moves away from practical and heads towards the waterproof wardrobe & fluffy sock draw.
So it’s true, walking is walking, period! When then, does walking become hiking? Is that the better question?
This has a somewhat narrower definition. Is it still walking? Yes! So, what is hiking, that walking isn’t?
Does anyone hike the kids to school? Do you hike to work? Perhaps hiking out for the grocery is something we’d like to do, put practically? Then there’s a weekend hike for fun, through local woods… well, that one, possibly!
Here’s the first primary difference. Hiking is not about practical, it’s walking-with-purpose beyond the practical.
The second fundamental difference is that because hiking is walking with walking-purpose, it generally covers greater distances and crosses far more challenging and potentially dangerous terrain.
Thirdly, hiking requires careful planning, appropriate equipment and preparation that walking generally doesn’t.
Jest aside, any bipedal walking activity can be considered walking (that includes hiking).
The difference between walking and hiking is subjective, so personally I think of it best by asking “When does walking become hiking?“. That’s when the practical answers fall into place for me.
Hiking is walking with walking-purpose. Your about to undertake a physically demanding, potentially dangerous activity that requires careful planning and detailed preparation to ensure your safety, comfort and enjoyment.
I hope this helps clarify the difference between walking and hiking. Up above I’ve added a short collection of my most valued reading & hiking items, all are from Amazon and can be scrolled left and right.
I’ll be posting various walking and hiking related reviews, routes and posts, so please feel free to sign-up for the Newsletter to stay informed.
Enjoy your adventures! Please stay safe and before heading out always share your plans with a friend.
|
0.611546 |
Martha Corey (about 1618 –September 22, 1692) was a woman in her seventies living in Salem, Massachusetts when she was hanged as a witch. She was one of the last women to be executed for this "crime" and she was featured prominently in playwright Arthur Miller's allegorical drama about the McCarthy era, called "The Crucible."
Known For: One of the last persons hanged as a witch in the 1692 Salem witch trials.
Children: Ben-Oni, illegitimate mixed race son; Thomas Rich.
Martha Panon Corey, (whose name was spelled Martha Corree, Martha Cory, Martha Kory, Goodie Corie, Mattha Corie) was born about 1618 (various sources list 1611–1620); little is known about her life outside of the records of the trials, and the data are confusing at best.
The dates given for Martha Corey in the historical records do not make much sense. She is said to have given birth to an illegitimate mixed race ("mulatto") son named Ben-Oni in 1677. If so—she would have been in her late 50s—the father was more likely a Native American than an African, though the evidence is scant either way. She also said to have married a man named Henry Rich about 1684—in her mid-60s—and they had at least one son, Thomas. After he died, on April 27, 1690, Martha married the Salem village farmer and watchman Giles Corey: she was his third wife.
Some records say that Benoni was born while she was married to Rich. For 10 years, she lived apart from her husband and son Thomas as she raised this son, Benoni. That son, sometimes called Ben, lived with Martha and Giles Corey.
Both Martha Corey and Giles Corey were members of the church by 1692, and Martha at least had a reputation for regular attendance, though their bickering was widely known.
In March of 1692, Giles Corey insisted on attending one of the examinations at Nathaniel Ingersoll's tavern. Martha Corey, who had expressed skepticism about the existence of witches and even the devil to neighbors, tried to stop him, and Giles told others about the incident. On March 12, Ann Putnam Jr. reported that she had seen Martha's specter, and two deacons of the church, Edward Putnam and Ezekiel Cheever, informed Martha of the report. On March 19th, a warrant was issued for Martha's arrest, claiming she had injured Ann Putnam Sr., Ann Putnam Jr., Mercy Lewis, Abigail Williams, and Elizabeth Hubbard. She was to be brought on Monday the 21st to Nathaniel Ingersoll's tavern at twelve.
At the Sunday worship service on March 20, in the middle of the service at Salem Village Church, Abigail Williams interrupted the visiting minister, Rev. Deodat Lawson, claiming she saw Martha Corey's spirit separate from her body and sit on a beam, holding a yellow bird. She claimed that the bird flew to Rev. Lawson's hat where he had hung it. Martha said nothing in response.
Martha Corey was arrested by the constable, Joseph Herrick, and examined the next day. Others were now claiming to be afflicted by Martha. There were so many spectators that the examination was moved to the church building instead. Magistrates John Hathorne and Jonathan Corwin questioned her. She maintained her innocence, stating "I never had to do with Witchcraft since I was born. I am a Gospell-Woman." She was accused of having a familiar, a bird. At one point in the interrogation, she was asked: "Do not you see these children & women are rational & sober as their neighbours when your hands are fastened?" The record shows that the bystanders were then "seized with fitts." When she bit her lip, the afflicted girls were "in an uproar."
On April 14, Mercy Lewis claimed that Giles Corey had appeared to her as a specter and forced her to sign the devil's book. Giles Corey, who defended his wife's innocence, was arrested on April 18 by George Herrick, the same day as Bridget Bishop, Abigail Hobbs, and Mary Warren were arrested. Abigail Hobbs and Mercy Lewis named Giles Corey as a witch during the examination the next day before magistrates Jonathan Corwin and John Hathorne.
Her husband, who defended her innocence, was arrested himself on April 18. He refused to plead either guilty or innocent of the charges.
Martha Corey maintained her innocence and accused the girls of lying. She stated her disbelief in witchcraft. But the display by the accusers of her supposed control of their movements convinced the judges of her guilt.
On May 25, Martha Cory was transferred to Boston's jail, along with Rebecca Nurse, Dorcas Good (misnamed as Dorothy), Sarah Cloyce, and John Proctor and Elizabeth Proctor.
On May 31, Martha Corey was mentioned by Abigail Williams in a deposition as "disquieting" her "divers" times including three specific dates in March and three in April, through Martha's apparition or specter.
Martha Corey was tried and found guilty by the Court of Oyer and Terminer on September 9, and sentenced, along with Martha Corey, Mary Eastey, Alice Parker, Ann Pudeator, Dorcas Hoar, and Mary Bradbury, to death by hanging.
The next day, Salem Village church voted to excommunicate Martha Corey, and Rev. Parris and other church representatives brought her the news in prison. Martha would not join them in prayer and instead told them off.
Giles Corey was pressed to death on September 17–19, a torture intended to force an accused person to enter a plea, which he refused to do, which had the effect of allowing his sons-in-law to inherit his property.
Martha Corey was among those hanged on Gallows Hill on September 22, 1692, in the last group to be executed for witchcraft before the end of the Salem witch trials episode.
On February 14, 1703, Salem Village church proposed revoking the excommunication of Martha Corey; a majority supported it but there were there were 6 or 7 dissenters. The entry at the time implied that therefore the motion failed but a later entry, with more details of the resolution, implied that it had passed.
In 1711, the Massachusetts legislature passed an act reversing the attainder—restoring full rights—to many who had been convicted in the 1692 witch trials. Giles Corey and Martha Corey were included in the list.
Martha Corey in "The Crucible"
Arthur Miller's version of Martha Corey, based loosely on the real Martha Corey, has her accused by her husband of being a witch for her reading habits.
Brooks, Rebecca Beatrice. "The Witchcraft Trial of Martha Corey." History of Massachusetts Blog, August 31, 2015.
Burrage, Henry Sweetser, Albert Roscoe Stubbs. "Cleaves." Genealogical and Family History of the State of Maine, Volume 1. New York: Lewis Historical Publishing Company, 1909. 94–99.
DuBois, Constance Goddard. "Martha Corey: A Tale of the Salem Witchcraft." Chicago: A.C. McClurg and Company, 1890.
Miller, Arthur. "The Crucible." New York: Penguin Books, 2003.
Roach, Marilynne K. "The Salem Witch Trials: A Day-by-day Chronicle of a Community Under Siege." Lanham, Massachusetts: Taylor Trade Publishing, 2002.
Rosenthal, Bernard. "Salem Story: Reading the Witch Trials of 1692." Cambridge: Cambridge University Press, 1993.
Who Was the Historical Abigail Faulkner - Salem Witch Trials Figure?
|
0.999672 |
Can you believe the holiday’s are coming so fast? The holidays are a GREAT time for family togetherness and creating lasting memories! Be sure to make the memories the only thing that lasts and not additional pounds from holiday overeating!
Practice Mindful Eating: Mindful Eating is a practice in which we pay close attention to how food makes us feel physically and encourages us to eat for physical hunger rather than emotional needs. Mindful Eating encourages one to focus on how good our food tastes and to try an eliminate distractions while eating. Research tells us that Mindful Eating practice helps us to control portions of food which can help control weight while also increasing enjoyment of eating! So when you pull up to your holiday table this year, be intentional about listening to your belly while also appreciating your taste buds!
Bring the veggies: Many of our favorite yummy holidays foods also happen to be extremely rich and calorie dense, which is why we often fall into a severe food coma after our holiday meal. A great way to prevent yourself from overeating is to fill half of your holiday plate with non-starchy vegetables- think green beans, salad, Brussels sprouts, carrots or maybe broccoli. While these yummy foods are nutritional powerhouses, they are very low in calories which helps you to balance out some of the juicier foods on your plate. Many of my patients often think Healthy=Boring… this is furthest from the truth! Add flavor enhancers such as fresh garlic to your green beans, balsamic vinegar to your roasted Brussels sprouts or avocado to your salad. Olive oil in moderation is always a great, flavorful additional as well!
Develop some non-food family traditions this year: Often so much of the holiday is focused around food- from the grand meal to cookie decorations to holiday parties with an endless number of appetizers and treats! This year, consider inviting your family out for a Thanksgiving day football game or walk. Maybe start a tradition of Christmas eve game night. Find joy in non-food forms of family bonding to help prevent overindulgence this year.
Keep moving: The ultimate goal is to get through this holiday season without slipping into that food coma from overeating, however because of the overabundance of food in our culture, overeating is unfortunately quite commonplace. The good news is, according to new research, at least 2½ hours of aerobic exercise spread over 6 days can help prevent negative metabolic outcomes often associated with overeating, such as inflammation of fat tissue and glucose intolerance or insulin resistance. So the moral of the story is, KEEP MOVING especially during the holiday break!
|
0.999999 |
Do some of these so called politicians think at all? What's wrong with what the president said? There is absolutely nothing wrong with what the president said, and in fact, I would suggest the tax code is reformed to include local taxes so those communities can benefit from their resources. The government must start collecting property taxes, or allow the local governments to that. These will improve services in the localities that enhance their tax revenues.
|
0.967714 |
Every time I see a mom or dad swinging their 2- or 3-year-old child by the arms, I am in a quandary. Should I, a complete stranger to the parents, inform them that swinging their child in such a manner is fraught with potential injury to the child's elbows?
Every time I see a mom or dad swinging their 2- or 3-year-old child by the arms, I am in a quandary.
Should I, a complete stranger to the parents, inform them that swinging their child in such a manner is fraught with potential injury to the child's elbows?
Years ago, I would not have any concerns about walking up to them and informing them about such a possibility. But today, offering such unsolicited medical advice has too many ramifications, including medical-legal ones.
What I am worried about is that a dislocation or subluxation of the bones in the child's elbow, usually the head of the radius bone, may take place.
When a subluxation takes place, the bone is not completely out of the joint socket, while with a dislocation, it is.
This is one of the most common orthopedic injuries in very young children.
When the dislocation takes place, the smile on the child's face, who is playfully and happily enjoying being swung back and forth, suddenly turns to tears because of pain in the elbow. Also, the child may not be able to move his or her arm. If the trauma to the elbow is severe enough, the bone may also be fractured.
Such subluxations or dislocations can also take place if the child's arm is pulled too quickly and with significant force.
To the parent, this is a scary scene, a crying child who can't move his arm.
Treatment consists of getting the dislocated bone back to its proper position within the joint. This is done by manipulation of the elbow. Usually, but not always, it takes place quite quickly and easily and can be performed in the doctor's office without any anesthesia.
However, at times it is more difficult to accomplish and the child may require sedation or anesthesia.
Such an injury to the elbow does not occur as frequently in adults.
If a child frequently dislocates his or her joints, such as elbows, hips, shoulders or knees, and they take place with very little trauma, then other medical conditions, although rare, should be considered.
So remember parents and grandparents, don't swing your little ones by the arms; by doing so, you have a good chance of injuring the child's elbow.
|
0.999999 |
Context: While watching a production of King Lear at the Elgin Theatre in Toronto, Jeevan watches as the actor playing Lear, Arthur Leander, has a heart attack. Since he has begun training as a paramedic, Jeevan tries to resuscitate Arthur but is unsuccessful. Instead, he could only comfort one of the child actors in the production.
This seemed doubtful. If Tanya were looking for her charge, surely she would have found her by now. He led the little girl into the wings, but the man in the suit had disappeared. The backstage area was chaotic, all sound and movement, shouts to clear the way as Arthur’s procession passed, Walter presiding over the gurney. The parade disappeared down the corridor toward the stage doors and the commotion swelled further in its wake, everyone crying or talking on their phones or huddled in small groups telling and retelling the story to one another—“So then I look over and he’s falling”—or barking orders or ignoring orders barked by other people.
“Well,” Jeevan said, “maybe we should stay in one place and let her find us.” He remembered once having read advice to this effect in a brochure about what to do if you’re lost in the woods. There were a few chairs along the back wall, and he sat down in one. From here he could see the unpainted plywood back of the set. A stagehand was sweeping up the snow.
“Is Arthur going to be okay?” Kirsten had climbed up on the chair beside him and was clutching the fabric of her dress in both fists.
“Just now,” Jeevan said, “he was doing the thing he loved best in the world.” He was basing this on an interview he’d read a month ago, Arthur talking to The Globe and Mail—“I’ve waited all my life to be old enough to play Lear, and there’s nothing I love more than being on stage, the immediacy of it …”—but the words seemed hollow in retrospect. Arthur was primarily a film actor, and who in Hollywood longs to be older?
The snow was a glimmering pile behind the set now, a little mountain.
“It’s the thing I love most in the world too,” Kirsten said, after some time had passed.
“Acting,” she said, and that was when a young woman with a tear-streaked face emerged from the crowd, arms outstretched. The woman barely glanced at Jeevan as she took Kirsten’s hand. Kirsten looked back once over her shoulder and was gone.
Jeevan rose and walked out onto the stage. No one stopped him. He half-expected to see Laura waiting where he’d left her in front-row center—how much time had passed?—but when he found his way through the velvet curtains, the audience was gone, ushers sweeping and picking up dropped programs between rows, a forgotten scarf draped over the back of a seat. He made his way out into the red-carpet extravagance of the lobby, careful not to meet the ushers’ eyes, and in the lobby a few remnants of the audience still lingered but Laura wasn’t among them. He called her, but she’d turned off her phone for the performance and apparently hadn’t turned it back on.
He stood in the doorway of the ladies’ lounge and called out to the attendant, but she replied that the lounge was empty. He circled the lobby once and went to the coat check, where his overcoat was among the last few hanging in the racks. Laura’s blue coat was gone.
Snow was falling on Yonge Street. It startled Jeevan when he left the theater, this echo of the plastic translucencies that still clung to his jacket from the stage. A half dozen paparazzi had been spending the evening outside the stage door. Arthur wasn’t as famous as he had been, but his pictures still sold, especially now that he was involved in a gladiatorial divorce with a model/actress who’d cheated on him with a director.
Until very recently Jeevan had been a paparazzo himself. He’d hoped to slip past his former colleagues unnoticed, but these were men whose professional skills included an ability to notice people trying to slip past them, and they were upon him all at once.
“There’s botox, and then there’s botox,” one of them said.
“Was there a statement?” Jeevan asked.
“I’m afraid I saw even less than you did,” Jeevan said, and pretended to receive an important call. He walked up Yonge Street with his phone pressed cold to his ear, stepped into a doorway a half block up to dial Laura’s number again. Her phone was still off.
If he called a cab he’d be home in a half hour, but he liked being outside in the clear air, away from other people. The snow was falling faster now. He felt extravagantly, guiltily alive. The unfairness of it, his heart pumping faultlessly while somewhere Arthur lay cold and still. He walked north up Yonge Street with his hands deep in the pockets of his coat and snow stinging his face.
Jeevan lived in Cabbagetown, north and east of the theater. It was the kind of walk he’d have made in his twenties without thinking about it, a few miles of city with red streetcars passing, but he hadn’t done the walk in some time. He wasn’t sure he’d do it now, but when he turned right on Carlton Street he felt a certain momentum, and this carried him past the first streetcar stop.
He reached Allan Gardens Park, more or less the halfway point, and this was where he found himself blindsided by an unexpected joy. Arthur died, he told himself, you couldn’t save him, there’s nothing to be happy about. But there was, he was exhilarated, because he’d wondered all his life what his profession should be, and now he was certain, absolutely certain that he wanted to be a paramedic. At moments when other people could only stare, he wanted to be the one to step forward.
And here, all momentum left him. He could go no farther. The theater tickets had been intended as a romantic gesture, a let’s-do-something-romantic-because-all-we-do-is-fight, and she’d abandoned him there, she’d left him onstage performing CPR on a dead actor and gone home, and now she wanted him to buy milk. Now that he’d stopped walking, Jeevan was cold. His toes were numb. All the magic of the storm had left him, and the happiness he’d felt a moment earlier was fading. The night was dark and filled with movement, snow falling fast and silent, the cars parked on the street swelling into soft outlines of themselves. He was afraid of what he’d say if he went home to Laura. He thought of finding a bar somewhere, but he didn’t want to talk to anyone, and when he thought about it, he didn’t especially want to be drunk. Just to be alone for a moment, while he decided where to go next. He stepped into the silence of the park.
|
0.986559 |
Explain giving reason why the sky appears blue to an observer from the surface of the earth? What will the colour of the sky be for an astronaut staying in the international space station orbiting the earth? Justify your answer giving reason.
Why does the sky appear dark instead of blue to an astronaut?
Sunlight reaches the Earth's atmosphere and is scattered in all directions by the gases and particles in the air. Blue light is scattered more than the other colours because it has the shortest wavelength. This is why the sky appears blue to an observer from the surface of the Earth.
For an astronaut staying in the international space station orbiting the Earth, the colour of the sky will be black because the light reaching it does not scatter.
Solution Explain giving reason why the sky appears blue to an observer from the surface of the earth? What will the colour of the sky be for an astronaut staying in the international space station orbiting the earth? Concept: Some Natural Phenomena Due to Sunlight.
|
0.959439 |
Any person was interested in a question: how there were people on our planet. There are different opinions on this matter. The most popular is the statement about aliens. There is an assumption that many thousands of years ago the earth was visited by higher minds, which created man. That throughout the existence of mankind, they help us to live, and this is a lot of evidence: the pyramids, available in different parts of the world Probably, the scientists at different times were also aliens to talk about their experience and knowledge in order to make our lives easier? Uncertain underwater and flying objects, what is it? Why can no one confidently say that there are no other civilizations? Perhaps we are not alone and there are other civilizations?
|
0.997856 |
EPA Advisory Panels – Experts Need Not Apply?
Scott Pruitt, the head of the Environmental Protection Agency (EPA), recently implemented a new policy banning scientists who receive EPA grant money from serving on its advisory committees. In many cases, independent university scientists, who are leading experts in their fields, will be replaced with advisors funded by the oil, chemical and waste disposal industries—the very industries EPA is supposed to regulate to protect public health.
Stacking these panels with industry players puts the public’s health at risk because it undermines EPA’s ability to make sound, science-based decisions without undue influence from those who stand to profit from EPA’s decisions.
There are a number of different committees that advise EPA. A particularly important one is the Science Advisory Board (SAB), charged with peer reviewing the scientific basis of EPA’s policy decisions on environmental pollutants. While many reports have focused on how Pruitt’s policy affects the SAB, the policy affects all EPA advisory committees, including the Children’s Health Protection Advisory Committee (CHPAC). Removing top scientists who have critical public health expertise in favor of industry-funded advisors who have argued, amongst other things, that children are less vulnerable to toxic chemicals than adults – a view so far outside of mainstream science it is safe to call it patently false – is a not-so-thinly veiled attempt to shift the goal of EPA’s decisions from protecting health to protecting industry sales.
Pruitt’s advisory board policy and attendant comments push the false narrative that scientists who receive federal grants try to advance a political agenda. This could not be further from the truth. As a scientist who receives federal grant money, I can attest to the rigorous peer review process every grant proposal must endure. This process ensures the scientific methods proposed are appropriate and sound, which is critical to creating an unbiased scientific study. Additionally, reviewers evaluate the scientific expertise of the investigator applying for the grant – including whether the scientist is participating in the scientific process through publication of peer-reviewed science in respected journals. This ‘double vetting’ ensures that scientists of the highest caliber receive federal money to investigate critical questions relevant to environment, health and welfare using the proper approaches and methods. This process helps ensure that we have preeminent scientists carrying out EPA-funded research using current, innovative methods in an unbiased way.
Contrast this with whom Administrator Pruitt is proposing to put on panels: industry representatives he calls ‘financially independent’ from the Agency. This is twisted logic because these same representatives are financially dependent on industries, such as the chemical industry, that stand to make significant monetary gains if EPA weakens protections. Scientists paid by the chemical industry have a direct financial stake in the outcome of EPA policy decisions, and are not ‘independent.’ Indeed, documents from a recent court case against Monsanto show that ‘scientific experts’ were paid thousands of dollars to publish papers with outcomes predetermined by the company. These “studies” were then used to advocate for industry positions on the science, such as disputing the human health harms of toxic chemicals (see pp.127-129 of the document here).
Finally, notably missing from Pruitt’s appointees are representatives of those disproportionately affected by environmental chemicals, such as workers, tribes, and families from contaminated communities. PRHE made this point in comments to EPA twice this year.
While science has been under unprecedented attack at EPA there is good news. As Washington bows to industry, states and localities are starting to legislate their own bans on chemicals harmful to health, such as flame retardants. Scientific evidence confirms the health and economic benefits of clean air and water protections. And independent scientists and communities continue to document the effects toxic chemicals have on our health, such as deaths from the use of methylene chloride paint stripper or the increase in miscarriages and stillbirths in Flint, Michigan after the water supply became contaminated with lead.
These findings unmask the very clear connection between health and the environment. They also reveal why scientific integrity and independent science are vital to sound policy-making at all levels of government.
|
0.99998 |
In recent times, the roles of women have been changing. Women, in many countries, are working and studying as well as taking care of families. This change has presented a controversial issue for many societies. While some people believe that a woman's place is in the kitchen, others contend that women should be given the same opportunities as men.
Opponents of equality for women say that women should be restricted to household duties. They think that a woman's primary purpose is to cook, clean and nurture the family. However, these people do not recognize the talents and abilities of our female population. For example, women are outstanding teachers and nurses, often performing better than men in these occupations.
Those that support independence for women understand that women are often just as capable as men. They believe that a woman can do almost any job that a man can do. For example, many defence forces around the world are organisations with such beliefs. They allow women to undertake careers as soldiers and sailors. Women have excelled in these positions and have proven themselves to be valuable members of army, air force and navy.
In my opinion, it is cruel and unfair to keep a woman confined to household duties. We should encourage everyone in our societies to develop to their full potentials, regardless of their gender. If we allow women to reach for their goals, they will contribute greatly to the social and economic development of our communities.
1. The fact that the roles of women are changing in many countries is a contentious issue.
2. Women are better cooks than men.
3. There are some jobs, such as teaching and nursing, where women are more effective than men.
4. Women can do every job that men can do.
5. People who are against women's liberation say that a woman's work needs to be..
1 The fact that the roles of women are changing in many countries is a contentious issue.
2 Women are better cooks than men.
3 There are some jobs, such as teaching and nursing, where women are more effective than men.
4 Women can do every job that men can do.
|
0.993521 |
To understand how the U.S. government became a police state, look no further than how it freed itself from colonial rule. For the American Revolution was, by and large, the result of a mobilization of the masses by the elites to liberate the colonized from a colonizer. It was the starting point of the myth of how the post- Revolutionary government would embody democracy.
The truth was that after the American Revolution, the thinking among economic and political elites was that America had become too democratic, especially as mass democracy expressed itself on the state level. The appearance and growth of democratic practices was perceived by elites as a threat to the expansion of state power. The government responded primarily through the use of force and violence, seeking to extend control over people and territory within North America through genocidal and ethnocidal measures against American Indians. Slavery was increasing in importance to the economy, in service of the expansion of state power. It is no coincidence that American Indians and slaves were the earliest groups defined by the government as political outsiders. Groups depicted as enemies of the state throughout U.S. history and described as “others” served as a convenient justification to enlarge state power at the expense of democracy.
Organized labor, especially its more radical elements, also challenged elite rule in the nineteenth and twentieth centuries, and political repression was turned loose against them. In surveying U.S. history, it becomes clear that the actions of the government in the end were intended to disrupt and eliminate progressive, mass- based political movements. The state viewed labor organizations as political outsiders, seen as seeking to subvert the government by forming an alliance with external enemies of the United States. Whether applied to organized labor, Socialists, Communists or terrorists, state ideology remained the same in perceiving the threat as coming from political outsiders, hence the need to employ emergency measures.
As police states are, by their nature, hostile to rule of law, political repression is accomplished through the use of essentially illegal measures, such as the Alien and Sedition Acts and the Espionage Act. This outlawing of political thought and alternative viewpoints persists as an ongoing theme. From the 1920s onward, in order to combat political outsiders, many state governments formed a partnership with local police officials with the goal of stamping out grassroots democracy. These Red Squads, a political police force, engage in surveillance, disruption, and, in many instances, the destruction of political organizations active in nonviolent political expression. The Red Squads acted in similar ways to the FBI, as agents of the state seeking to instill in American society social and political conformity.
The development of other essentially political police agencies within the federal government, to supplement the work of the FBI, such as the CIA, NSA, and a host of other intelligence gatherers on the federal and state levels, were an ominous sign. State repression was accelerating during the Truman administration with the passage of the National Security Act, and the growth of the CIA. Inside the federal government, there was an increasing subordination of the legislative branch to the executive branch., concentrating power in the context of a permanent emergency——and causing the government to become more determined to eliminate mass democracy. For instance, during World War II and in the name of a national emergency, Roosevelt ordered the internment of Japanese American citizens. This targeting of outsiders identified as an internal and external threat, continues to the present day; the alleged menace, was first Communism, and later, terrorism.
While mass democracy was being crushed in the United States, foreign policy in the postwar period remained consistent, extending control over more people and more territory, resulting in alliances with dictatorships so as to crush democracy overseas as well. After World War II, the military industrial complex became another key component in the twisted road to police state practices, based on the premise of permanent war making, with a cold war arms race, the sending of troops, and the establishment of military bases across the globe. This is another defining feature of a police state: a nation placed in an ongoing state of mobilization to prepare and fight wars throughout the globe. Police states, incorporate war-making into normalized state functions. Permanent war making translates into the global subversion of democracy. Supplementing the military in undermining democracy overseas, the CIA was one of many federal agencies during the second half of the twentieth century that was carrying out an essentially antidemocratic mission in the name of national security.
In assessing the successes and failures of progressive movements in the United States, in many ways, their limitations can be attributed to the intensive scale and scope of political repression, such as the FBI’s Cointelpro Program, which clearly diminished their effectiveness and in most cases, fundamentally undermined them. In many ways, Cointelpro was significant in paving the way for a police state, for progressive movements that developed after Cointelpro were much smaller and less effective in advancing mass democracy.
The ending of procedural democracy was yet another step toward the establishment of a permanent police state. The Constitution is supposed to place legal limits on the concentration of power within parts of government. Instead, with political repression of mass-based movements justified by declarations of national emergency, the government consistently stepped outside Constitutional legal boundaries. As a result, by the early 1970s, large- scale political movements were on the wane, in particular, as the events of Watergate unfolded, in many ways, a dress rehearsal for a police state. Watergate represented a political assault, not just on the supposed external threats to the Nixon administration, but political repression was extended to the government’s internal enemies. That meant taking action against the Democratic Party by seeking to rig an election, one of the most blatant attempts to destroy procedural democracy.
The concentration of power within one branch of government had been manifesting itself increasingly as an imperial presidency. Postwar presidential administrations define their power largely in relation to foreign policy initiatives. The foreign policies of post- Nixon administrations were outwardly anti- Communist and antiterrorist but in reality were driven by the maintenance and extension of a global American empire. Post-Watergate administrations were largely successful in finding various ways around the so- called Watergate reforms, seeking to enlarge the powers of presidents at home and overseas.
By the time we reach the presidency of George W. Bush, the executive branch had become a branch that saw itself as above the law while making law. The state came to embody the will of. Bush and his inner circle. The spark that ignited the transition toward the final form of an American police state was the attacks on the World Trade Towers in 1993 and 2001. In response, the government acted outside the Constitution by passing the Patriot Act, the Military Commissions Act, and other measures, producing a direct assault on civil liberties.
The clearest indication of American police state practices is the use of preventive detention. In one example—extraordinary rendition—all the government has to do is accuse anyone of anything related to terrorism, sufficient reason to seize and ship individuals elsewhere to be tortured.
The twisted and extensive use of signing statements also indicates that an administration is functioning outside the law. In a distorted extension of the theory of a unitary executive, President Bush’s excessive use of signing statements resulted in dictatorial powers.
What is the future of the American police state? If history tells us anything about police states, it is that they all eventually crumble, in large part, because over time, they become dysfunctional. The same can be said of the police state of the Bush administration. During the second term, there were indications of a breakdown in how this police state functioned. Some of the clearest symptoms of this dysfunction were the revelations of torture at Abu Ghraib, the National Security Agency’s surveillance program, and the large number of prisoners released from Guantanamo Bay. In addition, opposition mounted to the reauthorization of the Patriot Act and the Supreme Court ruling in the Boumediene case, which called into question the use of the Military Commissions Act. In the early days of the Obama administration, the trend seemed to point toward an American police state that will be modified, but not eliminated.
|
0.966277 |
The London Gazette is one of the official journals of record of the British government, and the most important among such official journals in the United Kingdom, in which certain statutory notices are required to be published. The London Gazette claims to be the oldest surviving English newspaper and the oldest continuously published newspaper in the UK, having been first published on 7 November 1665 as The Oxford Gazette. [lower-alpha 1] This claim is also made by the Stamford Mercury (1712) and Berrow's Worcester Journal (1690), because The Gazette is not a conventional newspaper offering general news coverage. It does not have a large circulation.
The Stamford Mercury based in Stamford, England, claims to be "Britain's oldest continuously published newspaper title". The Mercury has been published since 1712 but its masthead formerly claimed it was established in 1695 and that it was "Britain's Oldest Newspaper".
Berrow's Worcester Journal is a weekly freesheet tabloid newspaper, based in Worcester, England. Owned by Newsquest, the newspaper is delivered across central and southern Worcestershire county.
Other official newspapers of the UK government are The Edinburgh Gazette and The Belfast Gazette , which, apart from reproducing certain materials of nationwide interest published in The London Gazette, also contain publications specific to Scotland and Northern Ireland, respectively.
The Edinburgh Gazette, along with The London Gazette and The Belfast Gazette, is an official newspaper of the United Kingdom government. The Stationery Office (TSO) is published on behalf of Her Majesty's Stationery Office (HMSO) in Edinburgh, Scotland.
The Belfast Gazette, along with The London Gazette and The Edinburgh Gazette, is an official newspaper of the United Kingdom government. It is published by The Stationery Office (TSO), on behalf of Her Majesty's Stationery Office (HMSO) in Belfast, Northern Ireland.
The Stationery Office (TSO) is a British publishing company created in 1996 when the publishing arm of Her Majesty's Stationery Office was privatised. It is the official publisher and the distributor for legislation, command and house papers, select committee reports, Hansard, and the London, Edinburgh and Belfast Gazettes, the UK government's three official journals of record. With more than 9,000 titles in print and digital formats published every year, it is one of the UK's largest publishers by volume.
The London Gazette was first published as The Oxford Gazette on 7 November 1665. Charles II and the Royal Court had moved to Oxford to escape the Great Plague of London, and courtiers were unwilling to touch London newspapers for fear of contagion. The Gazette was "Published by Authority" by Henry Muddiman, and its first publication is noted by Samuel Pepys in his diary. The King returned to London as the plague dissipated, and the Gazette moved too, with the first issue of The London Gazette (labelled No. 24) being published on 5 February 1666. The Gazette was not a newspaper in the modern sense: it was sent by post to subscribers, not printed for sale to the general public.
And you'll all be Gazetted .
The Official Journal of the European Union is the official gazette of record for the European Union (EU). It is published every working day in all of the official languages of the member states. Only legal acts published in the Official Journal are binding.
The Dublin Gazette was the gazette, or official newspaper, of the Irish Executive, Britain's government in Ireland based at Dublin Castle, between 1705 and 1922. It published notices of government business, including Royal Proclamations, the granting of Royal Assent to bills, writs of election, appointments to public offices, commissions and promotions in the Armed Forces, and awards of honours, as well as notices of insolvency, and of changes of names or of arms.
Iris Oifigiúil is the official gazette of the Government of Ireland. It replaced The Dublin Gazette, the gazette of the Dublin Castle administration, on 31 January 1922. The Belfast Gazette was established for the same purpose in the newly created Northern Ireland on 7 June 1921.
A gazette is an official journal, a newspaper of record, or simply a newspaper.
Charles Duke Yonge was an English historian, classicist and cricketer. He wrote numerous works of modern history, and translated several classical works. His younger brother was George Edward Yonge.
Events from the year 1665 in England.
The Chronological Table of the Statutes is a chronological list of the public Acts passed by the Parliament of England (1235–1706), the Parliament of Great Britain (1707–1800), and the Parliament of the United Kingdom, as well as the Acts of the old Parliament of Scotland and of the modern Scottish Parliament, and the Measures passed by the National Assembly for Wales and by the General Synod of the Church of England. It is produced by Her Majesty's Stationery Office and published by The Stationery Office.
Samuel Haliday or Hollyday (1685–1739) was an Irish Presbyterian non-subscribing minister, to the "first congregation" of Belfast.
The Sri Lanka Gazette, officially The Gazette of the Democratic Socialist Republic of Sri Lanka, (Sinhalese: ශ්රී ලංකා ප්රජාතාන්ත්රික සමාජවාදී ජනරජයේ ගැසට් පත්රය, translit. Shrī Laṁkā Prajātāntrika Samājavādī Janarajayē Gæsaṭ Patraya; Tamil: இலங்கை ஜனநாயக சோசலிச குடியரசின் வர்த்தமானி, translit. Ilaṅkai Jaṉanāyaka Cōcalica Kuṭiyaraciṉ Varttamāṉi) is a public journal of the Government of Sri Lanka. It prints certain statutory notices from the government. Modeled after the Oxford Gazette, the Sri Lanka Gazette is the oldest surviving newspaper in Sri Lanka, having been published continuously since 1802. Unlike other newspapers, it does not cover general news or have a large circulation. It is printed by the Department of Government Printing.
↑ "No. 6231". The London Gazette . 4 January 1723. p. 1. ; "No. 6257". The London Gazette . 4 April 1724. p. 1.
↑ "No. 1". The Oxford Gazette . 7 November 1665. p. 1.
↑ "Data Re-use". The London Gazette. Retrieved 10 December 2015.
↑ "No. 24". The London Gazette . 5 February 1666. p. 1.
↑ By William Hone (1827); published by Hunt and Clarke.
Wikimedia Commons has media related to The London Gazette .
|
0.999981 |
Is there a generation gap in understanding the Iraq War?
John Legend, is an American soul singer, songwriter, and pianist. He has won six Grammy Awards. Born John Stephens, Legend was a child prodigy who grew up in Ohio, where he began singing gospel and playing piano at the tender age of five. Legend left Ohio at 16 to attend college in Philadelphia, and it was there that he first found a larger audience. Not yet out of his teens, Legend was tapped to play piano on Lauryn Hill's "Everything Is Everything" in 1998.
After completing college, he moved to New York, where he began to build a loyal following playing in nightclubs and releasing CDs that he would sell at shows. He also became an in-demand session musician, playing and occasionally writing for a wide array of artists, including Alicia Keys, Twista, Janet Jackson, and Kanye West.
It wasn't until West signed the young talent to his new label that he adopted the Legend name with 2004's Solo Sessions Vol. 1: Live at the Knitting Factory. Get Lifted, his first studio album, was released later in the year. On the strength of enduring single "Ordinary People," the album reached the Top Five of the Billboard 200. This led to three Grammy Awards: Best R&B Album, Best R&B Male Vocal Performance, and Best New Artist. Once Again, which peaked at number three on the Billboard 200 and number one on the R&B/hip-hop Albums chart, followed in October 2006. Live from Philadelphia, sold exclusively at Target stores, was a successful stopgap release that predated October 2008's Evolver.
John Legend: Well I think certain things are different about each of those wars [the US/Iraq war and the US/Afghanistan war]. But I think fundamentally both of those wars were wars of choice that, in retrospect, particularly for me in advance I believed that Iraq was a bad idea, but in retrospect I believe that even more people believe that. But both of those were wars of choice.
One major difference is the lack of a draft in Iraq versus the draft in Vietnam. I think more people felt the pain of Vietnam because of the draft, and because so many more people across a broader spectrum of socio-economic status were going to the war. And so I think the country felt the pain, and young people particularly felt the pain of Vietnam more than I think we feel it now here in 2008 with Iraq. Because a lot of us don’t even know people that are at war. We know of people, but there are a lot of us that don’t know people that are in Iraq. I meet families on the road, but I don’t have any family members that are in Iraq, and a lot of people don’t. And I think that allows a lot of people to not think about Iraq, and not think about the fact that 4,000 of our soldiers have died there; and tens of thousands, if not hundreds of thousands of Iraqis have died during the time that we’ve been there.
It allows us to kind of distance ourselves from it, but I hope we don’t forget that war is costly. War costs a lot of lives, and it costs a lot of money that we could have been spending on a lot of other things. And hopefully our next president will not take us into a war of choice with the recklessness that we were taken into Iraq.
This generation barely knows it's at war.
|
0.935143 |
The Anti-Fascist People's Freedom League (Burmese: ဖက်ဆစ်ဆန့်ကျင်ရေး ပြည်သူ့လွတ်လပ်ရေး အဖွဲ့ချုပ်, pronounced [pʰɛʔsʰɪʔ sʰa̰ɴtɕɪ̀ɴjé pjìðṵ lʊʔlaʔjé əpʰwɛ̰dʑoʊʔ]; abbreviated AFPFL), or hpa hsa pa la (ဖဆပလ) by its Burmese acronym, was the main political alliance in Burma from 1945 until 1958. It was founded by the Communist Party of Burma (CPB) led by Thakin Soe, the Burma National Army (BNA) led by Aung San, and the People's Revolutionary Party (PRP) (which later evolved into the Socialist Party) at a meeting held between 1–3 March 1945 as a reorganised version of the Anti-Fascist Organisation (AFO), formed to resist the Japanese occupation. The new organisation aimed to resist the Japanese occupation and achieve independence.
Following internal disputes, the party split into two factions in June 1958, the Clean AFPFL and the Stable AFPFL.
The AFPFL was formed as a reorganisation of the Anti-Fascist Organisation at a meeting held from 1–3 March 1945. When Aung San left the army to re-enter the political arena as a civilian, he became the recognised leader and president of the AFPFL in January 1946.
The AFPFL was a political alliance comprising several very different political parties held together by the common leadership of first Aung San and then U Nu. Its first general secretary was the communist leader Thakin Than Tun.
Dissent and rifts began to appear in the AFPFL over the negotiations regarding strategy and more importantly the nature of independence on offer. Thakin Soe started a rebellion after splitting from the CPB forming a splinter group called the Red Flag Communist Party. The CPB, now dubbed the White Flag Communists, continued to co-operate with the AFPFL, but Than Tun was forced to resign as general secretary in July 1946 and replaced by the socialist Kyaw Nyein, after a split with Aung San and the rest.
Aung San became the de facto premier of Burma in September 1946 when he accepted the British Governor's invitation to lead the Executive Council. The communists accused him and the others of selling out and settling for what they alleged a 'sham independence'. The CPB was then expelled from the AFPFL the following November. The AFPFL negotiated with the British total independence for Burma including the ethnic minorities, and Aung San succeeded in uniting the majority Burmans with the hills peoples at the Panglong Conference in February 1947. Aung Zan Wai, Pe Khin, Bo Hmu Aung, Sir Maung Gyi, Myoma U Than Kywe and Sein Mya Maung were among the negotiators of the conference negotiated with Bamar representative Aung San and other ethnic leaders in 1947. All these leaders unanimously decided to join the Union of Burma.
General elections were held in April 1947, which the AFPFL won convincingly amidst an opposition boycott, taking 173 of the 210 seats and running unopposed in over fifty constituencies. Aung San was set to become Prime Minister, but was assassinated together with six other members of his cabinet on 19 July, a date that later became Martyrs' Day. In his place, U Nu then became both the Premier of Burma and leader of the AFPFL.
Burma declared independence from Britain in January 1948, and the CPB went underground the following March after U Nu ordered the arrest of its leaders for inciting rebellion. Other groups also soon dropped out of the AFPFL to join the rebellion, not only the White-band faction of the People's Volunteer Organisation (PVO) formed by Aung San as a paramilitary force out of the demobbed veterans, but also a large part of the Burma Rifles led by communist commanders calling themselves the Revolutionary Burma Army (RBA). The AFPFL government had plunged into civil war with not only Burman insurgent groups but also ethnic minorities including the Karen National Union (KNU), Mon, Pa-O, nationalist Rakhine and the Mujahid or Rakhine Muslims.
The first post-independence general elections were held over several months in 1951 and 1952, with the AFPFL and its allies winning 199 of the 250 seats in the Chamber of Deputies.
Although the AFPFL was returned to office again in the 1956 elections, the results came as a shock as the opposition left-wing coalition, known as the National United Front (NUF) and led by Aung Than, older brother of Aung San, won 37% of the vote and 48 seats in the Chamber of Deputies.
By 1958, despite an economic recovery and the unexpected success of U Nu's 'Arms for Democracy' offer that saw the surrender of a large number of insurgents most notably the PVO, the AFPFL had become riven with internal splits, which worsened following the party's congress in January 1958. In July 1958 it formally split, with one group led by Prime Minister U Nu, which he named the "Clean AFPFL"; the other was led by Kyaw Nyein and Ba Swe and was known as the Stable AFPFL.
The majority of AFPFL MPs were supporters of the Stable faction, but U Nu was able to narrowly escape defeat in parliamentary motion of no-confidence by only eight votes with the support of the opposition NUF. Still dogged by the 'multicoloured insurgency', the army hardliners feared the communists being allowed to rejoin mainstream politics through Nu's need for continued support by the NUF, and was compounded by the Shan Federal Movement lobbying for a loose federation. The volatile situation culminated in a military caretaker government under General Ne Win that presided over the 1960 general elections, which were won by U Nu's Clean AFPFL.
Following the restoration of multi-party democracy after the 8888 Uprising, two new parties were established using the AFPFL name, the AFPFL (founded 1988) and the AFPFL (Original). Both contested the 1990 elections, but received less than 0.05% of the vote and failed to win a seat.
During its time in office, the AFPFL pursued a nationalist policy based on unity and consensus, upheld parliamentary democracy and presided over a mixed economy comprising both state and private enterprise. It spent most of this period in its history fighting several communist, socialist and ethnic separatist rebel groups for control over the future of the country. It also fought a successful war against Nationalist Chinese (KMT) forces who occupied the far north of the country for several years after the KMT's defeat by the Chinese Communist Party. Its foreign policy followed strict neutrality supporting the Bandung Conference of 1955, shunning the South-East Asia Treaty Organisation (SEATO) on account of the American support of the KMT on one hand, and facing the communist insurgencies on the other.
^ Donald M. Seekins, Historical Dictionary of Burma (Myanmar) (Scarecrow Press, 2006), 75–76: "its founding charter outlined its goals as ridding the country of the 'fascist Japanese' and winning independence".
^ Marshall Cavendish Corporation (2007). World and Its Peoples: Eastern and Southern Asia. Marshall Cavendish. p. 626. ISBN 978-0-7614-7631-3.
^ Thomson, John Seabury (1960). "Marxism in Burma". In Trager, Frank N (ed.). Marxism in South East Asia. Stanford University Press. p. 34. ISBN 978-0-8047-0592-9.
^ Johnstone, William Crane (1963). Burma's foreign policy: a study in neutralism. Harvard University Press. p. 27.
^ Fleischmann, Klaus (1989). Documents on communism in Burma, 1945-1977. Institut für Asienkunde. p. 244. ISBN 978-3-88910-057-3.
This page was last edited on 25 February 2019, at 19:25 (UTC).
|
0.937428 |
Why do folks love to read books about post-apocalypses and dystopias?
Dystopias? I haven't a fargin' clue. Like a variety of similar dark diversions, I can only guess it's because the real world looks so much better when they surface from the book? It feels so good when I stop hitting myself with a hammer?
Post-apocalyptic (as in the photo above), has been a popular sub-genre for decades, since the beginning of the Cold War. I think it's because everyone has experienced a visceral scream of a moment where we wish all the clods, chuckleheads, line-cutters, bullies, mindless celebrities and politicians would just go away. LEAVE ME ALONE!
When you're a kid, especially, the idea of demanding teachers, authoritarian parents, halfwit classmates, and all the pressures of a young life disappearing in a nuclear fire ball is a deeply satisfying image.
The curious aspect is that very few, if any, authors concoct stories where everyone vanishing is a good thing in any way. I surmise the raw emotional fantasy is satisfied within a few pages of learning how the stinky old world ended. That out of our system, we then settle in with a more mature attitude of seeing what happens next.
The "Robinson Crusoe" problem-solving aspect has great appeal as well. To have any successful post-apocalyptic story, the author has to supply the survivor-hero with many moments of ingenuity in their new life.
But, as we read a post-apocalyptic story, I think half our brain is ignoring the hero altogether. We're absorbing the setting the author provides and charting our own strategies. The hero manages to get a truck started. Nay, nay we say. Stick with bikes for the maneuverability.... A post-apocalyptic novel is almost a rule-less, informal "Pick Your Own Adventure" book. "What would I do next?"
Where is the line between "dystopian" and "post-apocalyptic"? Many (not all by any means) dystopian cultures are born of an apocalypse. Are they not then one and the same?
As a kid (and maybe not so young for it to be an excuse), I remember many a post-apocalyptic novel that lost me when "the elections started". How are we divvying up the scavenge? Who's going to farm and how do we punish those who aren't pulling their weight? That stuff could be fascinating, depending the skill of the author, but I began to read with a more academic interest than real excitement.
Back to the business of the day, because this world still exists!
Double-spacing is all that keeps the dark elder gods from entering our plane of existence.
A piece of writing is given to you for your thoughts. A one-on-one favour, some online writing circle or an in-person writing group - the source is mostly irrelevant. You’re being asked to assess and critique a person’s baby. And, “baby” is a particularly apt comparison. Like any new mother and tot, the writer is equally protective and defensive while the words on paper are equally precious and valued.
Diplomacy and politeness are the code. Any real-world writers group will soon teach a guy these standards, if only by the golden rule. Be blunt and scathing all you want, but only if you can take it on the chin coming back at you. Usually, though, any uncivilized bugger will be shown the door by democratic vote.
Okay, armed with these concepts, and at least moderately skilled by using them regularly, what do you do with that dewey-wet new manuscript when it stinks? I don’t mean a “soiled diaper” stink, but “who fed this baby rancid chili?” stink.
Fortunately, my in-person writing groups have quality talent. Some are stronger with a turn of phrase than others, but everyone all the basics well in control. No, it was this morning while visiting an online writing circle where one eager chap offered a few pages for the world to judge. I started reading, diplomacy and writing skill standing at the ready.
Two paragraphs in, diplomacy is reeling and writing skill’s jaw is hanging open in disbelief.
A full page in sees diplomacy throw up his arms in defeat and leaves for a quiet nap. Without diplomacy monitoring the procedure, writing skill is now alternating between guffaws of ridicule and sobs of despair for human literacy.
I’m not being rhetorical. I’m asking y’all: what do you say in such a situation?
|
0.998757 |
Buywise is an 11-year-old trained by Evan Williams and is set to run in the Grand National for a second time in his career on April 14. Twelfth in the 2016 renewal, this veteran was an impressive winner at Sandown Park two starts ago, but will line up at Aintree in the 2018 showpiece as a lively outsider.
VERDICT: A classy performer on his day, Buywise's jumping has often seen him falter on the big stage, but he will improve for his experience in the 2016 Grand National, where he finished 12th and he is sure to be doing his best work in the closing stages on April 14.
|
0.956659 |
Harry Lee was born in Washington, D.C., 4 June 1872 and was appointed second lieutenant in the Marine Corps for the war with Spain 2 August 1898. He served at the Havana Naval Station during the war and in various ships of the Navy and Marine Corps stations following it. Joining the 6th Regiment in 1917, Lee commanded It at Chateau Thierry, St. Mihiel, and the Argonne Forest and marched with the Army to the Rhine. After the war he commanded the Marine Brigade in Santo Domingo, sent in 1921 to pacify the country and establish constitutional government. For 3 years he served as military governor of the country. Later General Lee commanded Marine Barracks, Parris Island, and while in command of the Marine base at Quantico, Va., died 1 March 1933. For World War I service Major General Lee was awarded the Army and Navy Distinguished Service Medals, the French Legion of Honor, and other decorations.
Harry Lee (AP-17) was built as passenger ship Exochorda by New York Shipbuilding Co., Camden, N.J., in 1931 and operated in 'the Mediterranean area for American Export Lines. Acquired by the Navy 30 October 1940, she was converted at Tietjen and Lang Dry Dock Co., Hoboken, N.J., and commissioned Harry Lee (AP-17) 27 December 1940, Captain R. P. Hinrichs in command. Harry Lee was redesignated APA-10, 1 February 1943.
Harry Lee spent the first few months of her commissioned service transporting Marine combat units to the Caribbean for training exercises, helping to build the amphibious teams which were to find such great success in the later stages of World War II. After a stay at Norfolk, the transport was assigned in July to the Iceland route, carrying troops and supplies to that country from Norfolk and New York. After making two such passages, she returned to Boston 22 December 1941 to take part in additional training exercises. With America then in the war, Harry Lee spent the next 18 months in amphibious maneuvers in the Caribbean area. During this time the ship carried out many valuable experiments with lauding craft and boat control procedures, all of which bore fruit in the dangerous months to come.
After the success of the Sicilian operation, the transport returned German prisoners of war to the United States, arriving Norfolk 3 August. It was then decided that her amphibious prowess was needed in the Pacific, and she sailed 24 August for Wellington, New Zealand, via the Panama Canal and San Francisco, arriving 12 October 1943. At Wellington Harry Lee loaded Marines in preparation for the big push of the invasion of the Gilbert Islands. She proceeded to Efate, New Hebrides, 1-7 November and for the next few weeks held amphibious practice landings in preparation for the landings on Tarawa. The transport departed for Tarawa 13 November, and arrived offshore 20 November. There she launched her Marines onto the bloody beaches, under threat of submarine attack and air attack and sailed the next day for Pearl Harbor.
Harry Lee was next to take part in the invasion of the Marianas. After landing operations conducted around Guadalcanal the ship sailed to Kwajalein and got underway in convoy for Guam 12 Jmne. During this gigantic operation, in which troops were projected over 1,000 miles of ocean from the nearest advance base, Harry Lee was held in reserve for the Guam landings. She arrived off Agat, Guam, 21 July 1945 and debarked her troops. The transport then remained offshore loading and relanding troops for tactical purposes until 25 July, when she steamed with her fellow transports to Eniwetok. They arrived 29 July, and 2 days later sailed for Pearl Harbor.
Arriving Pearl Harbor 7 August 1944, Harry Lee set course for California and a much-needed overhaul. She arrived San Pedro 18 August and remained in California until departing 21 October with troops for Seeadler Harbor, Manus. Until 31 December the ship conducted practice landings in New Guinea and the Solomons for the upcoming invasion of Luzon, and departed the last day of 1944 for Lingayen Gulf. Enroute, Japanese planes attacked the task force savagely with suicide planes and bombers, but Harry Lee by effective gunfire and luck escaped damage. She entered Lingayen Gulf 9 January 1945 and began landing troops under constant air alert. That night the transports retired off the beaches under smoke screens, returning next day to resume the dangerous job of landing supplies. Harry Lee sailed 10 January for Leyte Gulf, anchoring 14 January.
With troops ashore at Lingayen, Harry Lee departed 19 January for Ulithi and arrived 2 days later. She soon was back in action, however, sailing 17 February for Iwo Jima and her last amphibious operation of the war. The transport arrived via Guam 22 February, 3 days after the initial landings, and after sending a reconnaissance unit ashore 24 February disembarked her troops. The shipremained off Iwo Jima until 6 March acting as a hospital evacuation vessel. She then sailed with casualties to Saipan 6-9 March.
The ship reached Manila 16 September at aid in the occupation of Japan, and after loading troops at various points in the Philippines arrived Tokyo Bay 13 October 1945. Assigned to operation "Magic Carpet", and the huge job of bringing American veterans home from the Pacific, Harry Lee arrived San Francisco 4 November, and made another round trip to the Philippines and back, arriving 20 January 1946. From San Francisco she sailed 23 January for New York, via Norfolk. The ship arrived 9 February 1946 and decommissioned at Brooklyn Navy Yard 9 May 1946. After a period in Reserve Fleet, she was sold to Turkey in April 1948. Renamed Tarsus, she was burned in the Bosporus after a rare three ship collision 14 December 1960.
|
0.968131 |
Compare the leaves of two plants from similar species. The left leaf is from Epipremnum pinnatum (which was previously called Scindapsus aureus); it has a shiny surface and yellow spots. The right one is from Scindapsus pictus, it's surface is more smooth and there are silver spots.
The shape of the leaves is almost identical, and so is the growth form of the plants; they both make long runners. The Scindapsus pictus was generously donated by my colleague Matthias Thorn, who let me cut off a leaf from his plant.
|
0.913024 |
The Church remembers three very different people, in some years, depending on the calendar, on the very same day. First is Saint Theodore Trichinas, who lived in the late 4th century. Next is Zacchaeus, whose story is told in Luke's Gospel. Finally, we read the Old Testament account of God's meeting with Satan concerning Job in Job 2: 1-10.
If we knew only the early years of Theodore Trichinas and Zacchaeus, we might guess that their lives would turn out very differently. Theodore was the son of wealthy parents and grew up in the sophisticated city of Constantinople. While still a young man he turned his back on the social and financial security of his family. He left the glittering city and went to Thrace, now mostly in Bulgaria, where he began a life of severe ascetical effort in a monastery far from any city. He used a rock for a pillow, and his clothes were not only simple but severe in themselves. It was due to the hair shirt he constantly wore that he was called "Trichinas" or "hairy."
Theodore chose his severe life, and was given the gifts of wonderworking and healing. Zacchaeus made a very different choice in his earlier years, one that would hardly seem to lead to the acquisition of spiritual gifts. Saint John of Shanghai and San Francisco has written of Jewish tax collectors like Zacchaeus that their choice of profession "was bound up...not only with national, but above all, religious betrayal: to become a tool for the subjugation of the divinely chosen people [Israel] by coarse pagans [the Romans for whom Zacchaeus collected taxes], one had to deny the hopes of Israel, everything holy to it, its dreams..."
What happened to Zacchaeus in his later years? One day, he decided to risk looking foolish, scrambling up a tree to see Jesus, in a crowd that hated him for getting rich by betraying his own people. The result was that he experienced the Lord's forgiving love. He let God change his life, and later became a follower of the apostle Peter and a bishop, proclaiming the Gospel with power. Even though his personal choices and his early path in life had been very different from those of Theodore Trichinas, Zacchaeus found his way to the same reward.
And with sighs from the depths of your soul You made it to bear fruit a hundredfold.
You were a beacon to the whole world, sending forth beams of miracles.
O Theodore, our father, entreat Christ God to save our souls.
Thereby receiving a heavenly garment.
Pray ever for us, O venerable one.
Job's story is different from those of both the other men. He was a righteous man from his early days, so his path in life was similar to that of Theodore Trichinas. But through no choice of his own, his life was changed greatly when he was old. God allowed him to be severely tempted, and stripped of the many comforts of his life. Job's response, and his choice not to react as others urged him to, eventually brought him a great gift: a personal encounter with the Lord.
The lives of the three men show us that many paths, even those that are rough, indirect and unpredictable, can lead to the reward of life with God.
|
0.946624 |
Karam is a two-time Mazda Road to Indy scholarship recipient. Dominated the 2010 USF2000 National Championship, earning title by winning nine of 12 races while taking the pole in all but one event. Then moved up to Pro Mazda, earning back-to-back oval victories on his way to fifth place in the 2011 championship. Third in points with three wins in 2012. Climbed the final rung in 2013 and won the Indy Lights title with three victories and nine total podium finishes. Drove first two sports car endurance races of the 2014 TUDOR United SportsCar Championship for Chip Ganassi Racing. Ganassi then helped him secure a ride in the Indy 500, where he qualified 31st and finished ninth. Drove for Ganassi in 2015, earning a third place finish at Iowa and fifth place at the 500-mile race in Fontana. Previously competed in various karting series, becoming a 35-time World Karting Association and IRL Stars of Karting National champion. At 13, was the youngest driver to win the annual Skip Barber Karting Scholarship Shoot-Out. Was the only American driver to compete in both a national karting championship and an open-wheel professional series full time in 2009.
|
0.999999 |
« Mémoire fraîche à Z Space / Ｚ書房的 “ 乍寒還暖” », written by Weichien Chen (陳韋鑑), published by ARTALKS of Taishin Bank Foundation for Arts and Culture, June 30, 2014. Translate only from Chinese to French.
Exposition Souffle : Capture du souffle de la vie par Mei-kuei Feu 迎著光呼吸攝影展: 傅美貴捕捉生命氣息, interviewed by Yihao Huang (黃怡豪), on Hsinchu Zhendao TV (新竹振道電視台), Taiwan, June 3, 2014, see transcript of interview, only from Chinese to French.
« Souffle, création sur une baie vitrée 呼一口氣 她以玻璃帷幕創作呼吸 », written by Qing lin Lee (李青霖), published by United Daily News de Taiwan, May 24, 2014. Translate only from Chinese to French.
|
0.999995 |
What is marketing concept meant is basically focus upon the customer`s satisfaction and customer`s orientation in regard to their needs and wants. Marketing is basically a huge concept that has been considered so many definitions. In general, marketing is how to attract new customers as well as trying to retain the potential customers by offering unique products and services. It is actually an underlying part of a business that every action will be derived from it. The marketing strategies are comprised of various significant matters that shape the organization`s structure in the marketplace.
|
0.999996 |
26th Annual Spring Concert Finale!
Here is a list of some of the places that The DCU has performed in addition to competitions and annual scheduled performances!
Please check us out at our next performance!
The DCU holds an annual Holiday Show in December at Mt Pleasant Golf Club in Lowell, MA. Inspired by the holiday season, dancers perform a short routine which they learn in class to everyone's seasonal favorites. Dancers are asked to wear holiday attire, no costume required. This performance is a great way to expose young dancers to an audience in a laid back and fun atmosphere. We even have a special visitor that stops by!
Annual Spring Concert Text: The Dancing Center Unlimited hold its annual recital at Westford Academy in Westford MA. The DCU has provided students with an exciting performance experience through its recital. The annual staple of the dance school, the recital, conjures images of childhood for many. It’s a rite of passage for youngsters, a chance to shine in front of family and friends that they anticipate with nervous excitement. The recital offers our students a professionally directed performance that allows them to present to their families and friends the results of a year’s hard work, dedication, and progress.
A big part of the dance training process includes learning through performance. The experience helps build self-esteem, self assurance, and contributes to a sense of confidence. Although performance opportunities can help prepare some students for a possible career in dance, they also contribute to children’s success in non-dance activities. That onstage experience can result in better in-school presentations, improved social skills, and strong interview skills for future college or job opportunities.
The rehearsal process is a tremendous learning experience as well. It helps the children develop retention skills, and by working with their classmates on a group performance, they learn the positive aspects of working as a team to create the best end result. Dedication to recital commitments is the responsibility of both students and their parents.
|
0.961462 |
A central question for ecologists is the extent to which anthropogenic disturbances (e.g. tourism) might impact wildlife and affect the systems under study. From a research perspective, identifying the effects of human disturbance caused by research-related activities is crucial in order to understand and account for potential biases and derive appropriate conclusions from the data.
Here, we document a case of biological adjustment to chronic human disturbance in a colonial seabird, the king penguin (Aptenodytes patagonicus), breeding on remote and protected islands of the Southern ocean. Using heart rate (HR) as a measure of the stress response, we show that, in a colony with areas exposed to the continuous presence of humans (including scientists) for over 50 years, penguins have adjusted to human disturbance and habituated to certain, but not all, types of stressors. When compared to birds breeding in relatively undisturbed areas, birds in areas of high chronic human disturbance were found to exhibit attenuated HR responses to acute anthropogenic stressors of low-intensity (i.e. sounds or human approaches) to which they had been subjected intensely over the years. However, such attenuation was not apparent for high-intensity stressors (i.e. captures for scientific research) which only a few individuals experience each year.
Habituation to anthropogenic sounds/approaches could be an adaptation to deal with chronic innocuous stressors, and beneficial from a research perspective. Alternately, whether penguins have actually habituated to anthropogenic disturbances over time or whether human presence has driven the directional selection of human-tolerant phenotypes, remains an open question with profound ecological and conservation implications, and emphasizes the need for more knowledge on the effects of human disturbance on long-term studied populations.
Whereas considerable knowledge in ecology and animal behaviour has been gained from scientific research on wild animal populations (e.g.[1–17], reviewed in ), continuous exposure to humans can have profound effects on the biology of wild species, e.g.[15, 19–21]. Thus, a crucial aspect of ecological research is to investigate and identify those effects (especially that of chronic disturbance), in order to understand and account for potential biases when deriving conclusions from the data yielded by studies in the wild . Several authors have questioned how the exposure to anthropogenic disturbance might affect the biology of species under study [19–21]. For instance, some species have been shown to habituate to (i.e. tolerate) frequent human disturbance (e.g. marine iguanas, Amblyrhynchus cristatus; ; Magellanic penguins, Sphenicus magellanicus; [20, 23]; Jackass penguins, Spheniscus demersus; ). In contrast, other species have been shown to sensitize to human stressors (e.g. Yellow-eyed penguin, Megadyptes antipodes;), and others still have been shown to exhibit different responses depending on their developmental stage (e.g. nestling or juvenile hoatzin chicks, Opisthocomus hoazin;). Frequent anthropogenic disturbance is also known to drastically alter behaviour patterns, e.g. in threatened killer whales intense boat trafficking results in a 14% decrease in the animals’ foraging time , and to affect reproductive output [25, 27], or offspring provisionning .
A major complication of assessing the consequences of human disturbance on wildlife, is that those consequences are not always directly visible. For instance, even if seemingly unaffected (i.e. behaviourally calm), animals might undergo profound physiological changes in response to anthropogenic disturbances, or even to the mere presence of human observers (e.g. changes in heart rate, [29–32]).
So what can be said about the continuous presence of humans in specific wildlife populations for the purpose of long-term monitoring and scientific research? To what extent do researchers affect natural processes? There is a need for more data in order to evaluate the impacts of anthropogenic disturbances on wildlife, especially for protected species in pristine environments. Such studies are essential not only because they enable to establish guidelines for the conduct of scientists towards studied species and the management of tourism and recreational activities in natural habitats [26, 29–34], but especially because of their implications on the way we think about scientific experiments in the wild, and the inferences we derive from those experiments .
Here, we report a case of biological adjustment to human disturbance in a wild king penguin (Aptenodytes patagonicus) colony of the Crozet Archipelago, which has been exposed to the continuous presence of humans for over 50 years. In 1961–1962, a permanent camp was established on Possession Island (Figure 1 top) both within and close to one of its major king penguin colonies: the ‘Baie du Marin’ (BDM) colony. As part of an international scientific effort to understand polar ecosystems, research in this penguin colony has been on going since the early 60’s. This has provided us with a unique opportunity to investigate the effects of continued human presence on the physiology of breeding penguins. We specifically question how breeding king penguins cope with chronic anthropogenic disturbance and consider whether heart rate (HR) responses to acute human stressors may be influenced by a history of close contact with humans. Using HR-loggers (see ) to monitor the stress response of penguins, we tested whether HR responses differed between birds holding breeding territories in colony areas subjected to very frequent (daily or more, see methods) human disturbance and birds breeding in relatively undisturbed (weekly or less) areas. Three different acute human stressors were applied, i.e. a loud metal sound, a distant approach, and a capture. In the BDM colony, loud metal sounds typically occur during the logistic operations that take place close to disturbed areas several times a year (e.g. cranes and trucks used during stevedoring for Island supply). Distant approaches occur when scientists/tourists observe birds from the edges of the colony, whereas a limited number of captures are performed annually by scientists for research. HR provides a highly sensitive measure of stress responses, that may be modulated independently of hormonal pathways and allow greater insight than hormonal responses (such as corticosterone) on how stress responses are shaped depending on the specific nature of various stressors [37, 38]. Using this method gave us the possibility: (i) to investigate how stress responses were shaped by chronic exposure to humans, and (ii) how this shaping might have varied according to stressor type and intensity, and potential risk for the animal.
Chronic human disturbance in the king penguin colony of ‘La Baie du Marin’ on Possession Island (Crozet Archipelago, 46°25’ S, 51°45’E). In 1961–1962, a first camp was installed on the beach side of the colony (top picture taken in 1967). Since then, logistic facilities have remained and scientific facilities have been installed at the same place. After 1967, a road was built in order to facilitate logistic operations and transits of material (food, equipment) to the permanent station situated some 500-m above (bottom picture). Thus, part of the colony has been subjected to the regular presence of humans and their activities (scientific or other), whereas another part far from the facilities was left relatively undisturbed. This study is based on the comparison of the HR stress response of birds located within the areas of high (HD) or low (LD) human disturbances (blue-shaded areas). Photo credits: Archive biology lab, Crozet/IPEV. Claire Saraux/IPEV.
Fieldwork was conducted on Possession Island, Crozet Archipelago (46°25’S, 51°45’E) in February-March 2011. Penguins belonged to the BDM colony, which is host to over 24 000 breeding pairs. This colony is located in the vicinity (some 500 m) of a permanent station (Alfred Faure) and is adjoining a beach that has been regularly used for logistical operations over the last 50 years, and where scientific shelters and technical buildings have been installed (Figure 1).
Twenty pairs of king penguin were randomly selected from the colony and flipper-banded at the onset of incubation (semi-rigid P.V.C. Darvic bands; 25.8 mm wide, 1.9 mm thick, 7.4 g) to allow their identification and follow-up. This size sample complied with permits to manipulate birds in the BDM colony (see below). Ten pairs were located in a part of the colony adjoining permanent buildings and also very close (5–10 m) to a permanent road used daily by pedestrians and in some occasions by motorised vehicles (Figure 1: HD-area). Throughout the year and over the last 50 years, this part of the colony has been visited daily at a short distance (< 5 m) by at least one human, and in some occasions by several groups of up to 10 visitors over a day. In addition, this is also the part of the colony where intensive scientific research has been conducted over the last 20 years, which implied approaching/entering the colony several times a day, including for bird capture purposes, almost all year-round. The other ten pairs were located in a remote part of the colony (about 300 m away from the beach; Figure 1: LD-area), not exposed to anthropogenic noises and where human visitations were much less frequent (around one visit per week over the last 10 years).
Due to time constraints with fieldwork, we subjected 33 out of the 40 birds to three types of acute stressors (see below) 50–80 days after banding. Males king penguins start to incubate after the female has laid their only egg, and partners subsequently alternate between incubation/brooding duties on land and foraging trips at sea throughout the season [39, 40]. The specific breeding phenology of king penguins allowed us to determine the date of the onset of each incubation and brooding shift (mean duration of 15 and 12 days for incubation and brooding shifts, respectively), and to ensure that all birds (females at shift 4 and 6 of breeding, and males at shifts 5 and 7) used in this study were in a similar breeding status: birds brooding a non-thermally emancipated chick aged from 2 days to 1 month. This was important, as animals may perceive specific stressful stimuli differently depending on their life-history stage. In addition, stress responses may also be under seasonal variation [41, 42]. Comparision of responses should thus be made within life history stages . Eighteen of the stressed birds were located in the part of the colony with a very low rate of chronic human disturbance (the LD-area) and fifteen of them were in the part subjected to a very high rate of chronic disturbance (the HD-area).
Prior to being stressed and usually within 3 days after the onset of a brooding shift, penguins were equipped with externally mounted HR-loggers (Polar® model RS800, Polar Electro Oy, Kempele, Finland), within the colony and on their breeding territory (see details in for equipment, logger technology and accuracy of HR measurement). Each bird was equipped only once. At capture, the bird’s head was cover with a hood to keep it calm. The logger transmitter (weighing less than 1% of total body mass) was attached to the middle of its back with Tesa® tape, and the receiver fixed on a metal pole within a 5-m distance of the animal. Such a set up prevented the equipment from hindering the movements of the birds. This was confirmed by the fact that we never observed birds trying to remove electrodes or transmitters, nor did we observe any adverse effects of the equipment on the birds’ health or behaviour. Most animals developed a tachycardia due to handling (up to 165 beats per minute on average), from which they usually recovered within 15–30 min following release. Handling lasted between 5 and 10 min and this procedure never resulted in chick abandonment. Birds resumed normal activity (i.e. resting, comfort behaviour or aggressive interactions with neighbours) within minutes after release. HR-loggers were set to store the sampled data for up to 3 days and sampling was set at a rate of one data point every 2 seconds. Following equipment, birds were left to recover for at least 12 h, i.e. one night, before stressors were applied. We retrieved all equipment from the birds 2–3 hours following the last stress protocol. It is important to note that all individuals in this study were manipulated for a similar amount of time before stressors were applied. Differences in HR stress responses are thus not likely to be related to any prior manipulation undergone in order to band the birds and deploy the HR-loggers.
Typical heart rate (HR) response of a brooding king penguin to a human stressor. In this case, the bird was submitted to a capture-immobilization stress, being approached, captured and held captive for 3 minutes (grey area; see text). The approach occurred out of the grey area. HRi is the initial HR before HR started to increase in a constant way, and the HR reached after full recovery; HRmax is the maximum HR reached during the stress. HR is expressed in beat per min (bpm).
Penguins were approached from the front from a starting distance of at least 30 m within the bird’s visual field and at an average speed of 0.5 m/sec. The starting distance was chosen from preliminary tests showing that in the BDM colony, the physiological detection distance of penguins when approached by humans (i.e. the distance at which HR started to increase) was around 20–25 m. Thus at 30 m, birds did not exhibit behavioural signs of vigilance towards the experimenter and HR remained at resting levels. The experimenter stopped 10 m away from the bird where he remained motionless for 1 min (to standardize the approach and mimick a standing observer at the edge of the colony) while dictating observations on the behaviour of the subject, then subsequently retreated at a constant speed. This distance was chosen because preliminary tests showed that king penguins breeding in the BDM colony become behaviouraly alert when approached by humans from a distance of 10 m or less (Groscolas & Viblanc, unpublished data).
The protocol was the same as for 10-m approaches except that the focal bird was approached until capture, which was eased by the fact that brooding penguins have a chick in their brood pouch and cannot escape rapidly. Upon capture, the bird was gently immobilized for 3 minutes, its head covered with a hood. The hood was then quickly removed and the experimenter retreated at a constant speed to the original position, some 30 m away from the animal, in order to continue behavioural observations for several minutes.
Birds were discreetly approached from behind until the experimenter was 15 m behind them, but not sighted. After the bird was observed resting for at least 3 min, the experimenter struck two hollow metal bars three times with a 1-sec interval. The magnitude of the noise averaged 102.5 ± 0.3 dB (n = 100 measurements), i.e. a magnitude sufficient enough to be alarming to a bird , and assumed to be similar in intensity to metal sounds that might occur when machines are operating close to the colony (during stevedoring operations).
HR data were expressed in beat per min (bpm), plotted and analysed using Polar Pro Trainer® v.5.00.105 software. Audio recordings of each test were time-matched (by previous synchronization of the observer’s digital watch with that of the HR-logger at ± 1 sec.) with the corresponding HR data, which allowed to calculate a number of parameters describing the subjects’ HR responses to the stress (Figure 2). The duration of a HR response was characterized as the total time that HR was elevated above the initial resting rate (HRi), i.e. from HR starting to increase until recovering to initial level. We defined HRi as the HR at the moment preceding a rapid constant increase in HR. Maximal HR (HRmax) achieved during the stress was determined and relative maximal increase in HR (in %) was calculated as: 100 * (HRmax – HRi)/HRi. We also calculated excess HR, i.e. the number of heart beats produced in excess of resting HR due to stress, as (mean HR during stress – HRi)*duration of HR elevation (in min). Thus, excess HR (in beats) approximated the area under the HR curve and above resting values. We defined HR reactivity as the maximal increase in HR/time needed to reach the maximum HR, i.e. a speed of HR increase from HRi to HRmax. Similarly, HR recovery was defined as the speed of HR return to HRi following the stress (i.e. from HRmax to resting levels again, in bpm/sec). In some cases and mostly following capture-immobilization, the HR profile during the recovery period was affected by interfering unrelated behaviour and physical activity. We discarded such cases, so that the actual sample size in final calculations is lower than the number of stressed birds (of 33 stressed birds, only 28 sound, 28 10-m approach and 20 capture stresses were retained).
All statistical analyses were performed using R v.2.10.1 . As each individual was only tested once for each stressor, data was analysed with linear regression models (LMs) when stressors were considered separately. Linear Mixed Models (LMMs) were used when stressors were pooled, and bird identity was then specified as a random factor, i.e. up to 3 repetitions (one sound stress, one 10-m approach stress, and one capture stress) per individual bird. LMMs were performed using the ‘lme’ function of the ‘nlme’ package in R . Residual normality was asserted using the Shapiro-Wilk normality test. Wherever necessary and to ensure normality of residuals was satisfied, data was transformed prior to analysis using Box-Cox power transformations , i.e. x’ = (xp –1)/p, where p is the power maximizing normality likelihood obtained with the ‘bcPower’ function from the ‘car’ package in R. Visual inspection of the residuals indicated no violation of assumptions of homoscedasticity. Significant values are reported for p < 0.05. N and n represent the number of stressed birds and of stresses, respectively.
We removed flipper bands from all banded birds following retrieval of equipment, as detrimental long-term effects of flipper bands are known to occur in king penguins [17, 47]. Capture, banding and equipment procedures were all approved by the Ethical Committee of the Institut Polaire Français – Paul-Emile Victor. Authorizations to enter the colony and to manipulate a limited number of birds (from 20 pairs) were obtained from Terres Australes et Antarctiques Françaises. The experiments comply with the current laws of France.
Overall, pooling all data together and controlling for stressor type by including it as a factor in the model, we found that brooders situated in an area of frequent human disturbance generally exhibited lower HR responses than their congeners breeding in an almost undisturbed area (LMMs; t = 4.3, p < 0.001, n = 76, N = 33 birds, and t = 2.07, p = 0.04, n = 76, N = 33 birds; for HR excess and maximum HR increase, respectively). However, this pattern varied depending on the type of stressor considered (i.e. the interaction between stress type and colony area significantly improved the models; χ 2 = 6.05 and 12.49, p = 0.048 and 0.002; for HR excess and maximum HR increase, respectively), and also depending on the parameter used to calculate the HR response (Figure 3).
Heart rate (HR) responses to 3 different types of human stressors (sound, 10-m approach, and capture-immobilization) for king penguins brooding in areas of high (HD) or low (LD) human disturbance. (A) Excess HR is given in beats. (B) Relative maximum increase from resting HR (HRi) is given in percentage. Results are given as means ± SE. Statistics are figured for *p < 0.05, **p < 0.01, ***p < 0.001, n.sNon-significant.
During sounds and 10-m approaches, HR excess was significantly 81% and 74% lower for birds breeding in areas of frequent human disturbance (LMs; F1,26 = 8.9, p = 0.006, N = 28 and F1,26 = 15.5, p < 0.001, N = 28; for sounds and 10-m approaches, respectively; Figure 3A). However, HR excess did not differ significantly between areas for captures (LM; F1,18 = 0.2, p = 0.669, N = 20; Figure 3A). Maximum relative increase in HR during sounds and 10-m approaches were also significantly 61% and 30% lower for birds breeding in areas of frequent disturbance (LMs; F1,26 = 6.5, p = 0.017, N = 28 and F1,26 = 4.3, p = 0.049, N = 28; for sounds and 10-m approaches, respectively; Figure 3B). In contrast, maximum relative increase in HR was actually 42% higher for birds in areas of frequent human disturbance when considering capture stresses (LM; F1,18 = 9.0, p = 0.007, N = 20; Figure 3B). The smaller HR excess observed both for sounds and 10-m approaches in birds breeding in areas of frequent human disturbance were not only due to a smaller maximum relative increase in HR but also to a much shorter duration of this increase. Indeed, this duration was 48% shorter for sounds (14.4 ± 2.6 sec vs. 27.8 ± 5.4 sec; LM; F1,26 = 4.4, p = 0.046, N = 28) and 52% shorter for 10-m approaches (51.1 ± 7.7 sec vs. 105.3 ± 12.2 sec; LM; F1,26 = 13.1, p = 0.001, N = 28). For captures, the duration of HR increase was also 38% shorter (376.3 ± 46.8 sec vs. 606.7 ± 83.3 sec), though not significantly (LM; F1,18 = 3.7, p = 0.070, N = 20) for birds in areas of frequent disturbance, explaining that despite a greater maximum relative HR increase, HR excess did not differ between the two areas. Whatever the type of stress, differences in HR response between the two colony locations were not due to differences in the HR reactivity (Figure 4A), nor to differences in HR recovery in the case of sounds and 10-m approaches (Figure 4B). It is interesting to note that following captures however, HR recovered much faster for birds located in areas of frequent disturbance compared to birds in undisturbed areas (Figure 4B).
Heart rate (HR) reactivity to, and recovery from, 3 different types of human stressors (sound, 10-m approach, and capture-immobilization) for king penguins brooding in areas of high (HD) or low (LD) human disturbance. (A) HR reactivity (in bpm/sec) is the speed of HR increase to its maximum during the stress. (B) HR recovery (in bmp/sec) is the speed of HR decrease back to resting levels following reaching of HRmax. Results are given as means ± SE. Statistics are figured for *p < 0.05, n.sNon-significant.
We investigated the effects of chronic human disturbance on wildlife stress physiology. Working in a wild king penguin colony, areas of which have been exposed to continuous human presence for over 50 years, we found HR responses of breeding birds to acute human stressors to vary depending on (i) stressor intensity (and potential associated risk for the animal) and (ii) the frequency to which birds have been subjected to stressors over the years. Our results suggest that in highly disturbed (HD) areas, penguin HR stress responses to frequent and potentially innocuous stressors (such as loud sounds or distant human approaches) have been attenuated compared to undisturbed areas, whereas this was not the case for infrequent (and potentially noxious) stressors such as captures. Two hypotheses might explain our results: 1) physiological adjustment to continuous human disturbance and innocuous stimuli, i.e. habituation, or 2) behavioural desertion of the highly disturbed areas by the more stress-sensitive individuals, i.e. selection.
Our results suggest that the HR stress responses of king penguin in the BDM colony have been shaped according to the specific nature of the stressors they are subjected to. Indeed, whereas HR responses to sounds and 10-m approaches were attenuated in HD areas compared to LD areas, this was not the case for HR responses to captures, suggesting that attenuation was not a generalized phenomenon. Those differences are likely reflective of physiological habituation of breeding penguins to innocuous and repeated stimuli. Indeed, as comprehensively reviewed by Cyr and Romero , physiological habituation is likely to occur when an animal is repeatedly subjected to a specific innocuous stressor [42, 48]. The intensity of stress responses to that particular stimulus may then decrease as the animal learns to consider the stimulus as innocuous . It is important to understand that, in habituation, stress pathways are not blunted. Rather, the animal may learn to ignore the innocuous stimulus [42, 49, 50]. Hence, the phenomenon of habituation should remain stressor-specific not causing changes in the entire stress physiology of the organism: the capacity to respond to a novel stressor should remain unaffected . This may be the case in our study, where HR responses were attenuated in HD areas for sounds and 10-m approaches, but not for captures. In our study colony, the degree to which birds have been exposed to the different stressors over the past 50 years is indeed very different. Whereas all birds in the HD area have been (and still are) regularly subjected to (potentially innocuous) approaches of human observers (whether scientists in the colony, technicians, or tourists on the outskirts) and anthropogenic sounds (e.g. machine noises during logistic operations), only a very limited number of individuals in each year are concerned by (potentially highly noxious) captures, which are exclusively conducted for scientific purpose. For instance, as a rough figure, one could estimate that during the Austral summer (when most of the scientific field work, logistic operations and tourist activity occur), the 3000–4000 birds in the HD area are approached by human observers 3–5 times per day. Over the course of the breeding season (ca. 4 months of intensive field work), this would amount to ca. 450– 750 approaches (between 1 and 20 m) per bird, an estimation which is likely conservative. In stark contrast, captures in the HD area only concern some 50 individuals each year, which are caught and handled 1 to 5 times during the breeding season. In other words, one might consider that prior to our study, all the animals of the HD area had been subjected to very frequent human disturbance (i.e. anthropogenic sounds and approaches by human observers) over the years, whereas the likelihood that they had previously been captured and manipulated for scientific research is extremely weak. In addition, the intensity of the 3 stressors was certainly different, being low for sounds and 10-m approaches, and high for captures. Consistent with the idea that weak stimuli are more likely to result in pronounced habituation than strong stimuli [42, 51], those results suggest that king penguin in the BDM colony may have habituated to repeated and potentially non-noxious stressors (sounds and 10-m approaches), but not to infrequent and potentially highly noxious stressors such as captures.
Previous studies have reported similar attenuation of stress responses to human disturbance in other species, e.g.[19, 20, 52]. In magellanic penguins for instance, birds nesting in HD areas showed lower behavioural and physiological responses to human visitation (i.e. tourist approaches) than birds nesting in LD areas [20, 23, 52]. However, it is interesting to note that in this case, attenuation of stress responses also extended to capture/restraint protocols, and adrenal responsiveness to ACTH injections appeared blunted in birds from HD areas . This suggests that contrarely to king penguin, magellanic penguins had not actually habituated to human disturbance, but rather, that stress pathways were desensitized . Could physiological desensitization have occurred for the king penguins in our study, so that stress responses would be attenuated in HD birds although sounds and approaches were still considered as stressful? The fact that stress responses remained unimpaired for captures suggests not. Taken together, those results emphasize the importance of considering species-specific responses to various stressors to fully understand how animals adjust to human disturbance.
Furthermore, our findings raise the question of whether HR attenuations in HD areas are actually the result of penguin habituation to innocuous stimuli, or whether they are the result of a selection on less stress-sensitive phenotypes. In other words, have stress-susceptible birds deserted highly disturbed areas over the years? This question is especially relevant as the existence of different animal temperaments and coping styles (i.e. animal personalities) is now widely supported [53–56], and variation in individuals’ temperament (e.g. human-tolerant phenotypes, ) has recently been suggested as an important factor to account for when analyzing the stress/behavioural responses of wildlife to human disturbance [32, 58, 59]. In line with this, HR responses of yellow-eyed penguins (Megadyptes antipodes) to a standardized human disturbance were found to vary depending on individual differences in temperament, and individual penguins were found to exhibit consistent HR responses over different breeding seasons, indeed suggesting that some personalities may be more stress-prone than others . In addition, the spatial distribution of Eastern chipmunks (Tamias striatus) burrows in regards to human disturbance was found to be non-random, but rather dependent on individual temperament . Although current data suggests there is some amount of intra-individual consistency in stress responses in king penguins (Viblanc, Smith, Gineste & Groscolas, unpulished data), we cannot conclude whether the observed differences in HR responses between LD and HD areas are reflective of individual differences in temperament or not. Nonetheless, marked intra-individual consistencies to human disturbance (e.g. flight initiating distance, heart rate stress responses) have previously been reported in birds (including penguins ), which suggests that behavioural/physiological flexibility to human disturbance may be constrained by individual susceptibility to disturbance. Whether this may also be the case for physiological responses to human disturbance in king penguins remains to be explicitly tested. Assuming bird temperament may be heritable (e.g.[60, 61]), this could be done by investigating physiological responses to acute stressors during early life-stages, i.e. chicks/juveniles, which have not long been exposed to human anthropogenic disturbances. If selection explains the pattern we observe in adults, one would expect chicks/juveniles to exhibit lower HR stress responses in highly-disturbed locations compared to chicks/juveniles in undisturbed areas. On the other hand, if birds have habituated to human disturbance over time, similar responses in chicks/juveniles should occur regardless of their location in the colony. Alternately, long-term records of breeding site fidelity may provide useful data to investigate territory distribution as a possible result of individual susceptibility to disturbance. Future studies might, for instance, consider monitoring the behaviour and physiological stress responses of marked individuals over the years in relation to their location in the colony.
Studies that have considered the effects of human disturbances on the biology of various species have focused especially on the (detrimental) effects of tourism and industry on wildlife, e.g.[21, 23–28, 62, 63]. Along with the massive explosion of ecotourism to even the most remote parts of our planet (e.g. Antarctica, ), such studies have been essential in assessing the impact of human activities on wildlife in order to establish guidelines for conservation purposes [27–29, 65]. One of the pitfalls of such research is perhaps to forget that from the perspective of wildlife, tourism and scientific research are not two worlds apart. Long-term scientific research programs might also have profound effects on wild populations, e.g. [17, 47, this study]. The question is then whether those effects are detrimental or not to the species and studied population. As challenged by Nisbet , human (and researcher) activity may only be considered a disturbance if it is shown to adversely affect species fitness, e.g. breeding success, survival, population decline. Physiological effects of human activity (such as changes in hormone concentrations, HR), may thus not necessarely qualify as adverse, unless they are actually shown to decrease fitness . At our study site, habituation to innocuous stressors such as sounds or the presence of human observers may on the contrary be beneficial to scientific research, as birds decrease the amount of energy invested in costly stress responses, learning to ignore the lurking scientist observing them with his/her binoculars and talking into his/her tape-recorder – habituation is, after all, adaptive by definition. Nonetheless, understanding the consequences of scientific research (e.g. attaching measuring devices, long-term monitoring) [17, 66–69] on animal behaviour and physiology is essential in setting-up experiments and protocols, and drawing conclusions from the data collected. In this regard, reports documenting the effect of anthropogenic agents on wildlife physiology are needed, as it is only through such knowledge that researchers may draw un-biased conclusions from studies in the wild [67, 69]. For instance, as in the case of the king penguins from the BDM colony, it is important to be aware of potential differences in animal sensitivity to human researchers according to various areas of the colony. Animal populations are likely to vary in terms of how intensely parts of the population are disturbed by anthropogenic agents, e.g.[19, 20], so that generalized conclusions on whole populations or species may be inapropriate if derived from a biased sample. Further still, as discussed above, if chronic human disturbance is indeed selecting for less stress-sensitive individuals, this could have strong implications in terms of conservation. Human disturbance is an important driver of directional phenotype selection , and selective desertion of the more stress-sensitive phenotypes in specific populations could lead to a loss in phenotypic plasticity and/or genetic diversity . In turn, this may render chronically disturbed colonies less flexible to environmental change, e.g. climate.
Our findings report a case of physiological adjustment to human presence in a long studied king penguin colony, and emphasize the importance of considering potential effects (such as habituation) of human presence (or manipulations) in ecological studies, both in setting up experimental designs and reaching conclusions as to the questions initially addressed. Whereas habituation may be potentially beneficial to scientific research and tourist management, our study also raises the question of the potential influence of human activities on directional selection of specific phenotypes, and underlines the importance of physiological studies for appropriate conservation measures to be addressed .
This research was supported by the French Polar Institute (IPEV) and by the French National Centre for Scientific Research (CNRS-INEE). Sincere thanks are owed to J.P. Robin for his assistance in the field and to S.E. Viblanc for her help proofreading the manuscript. We are especially grateful to C. Saraux, R. Inger and an anonymous reviewer for helpful comments and good suggestions on previous versions of the paper. Research project No 119 was carried out at Alfred Faure Station, and logistic support was provided by the Terres Australes et Antarctiques Françaises. V.A.V was the recipient of a scholarship from the French Ministere de l’Education Nationale, de la Recherche et de la Technologie, and of a fellowship from the Fyssen Foundation.
VAV participated in study conception, analyzed the data and wrote the manuscript. ADS participated in data analyses and helped to draft the manuscript. BG performed the field work. RG conceived the study, participated in its design and coordination, participated in field work, and helped to draft the manuscript. All authors read and approved the final manuscript.
|
0.961731 |
The phenomenon whereby each successive generation of people exhibits a rise in IQ is called the Flynn Effect. This phenomenon was first observed in the late 1970s and published as a study in 1984 by James Flynn, whose name the phenomenon bears. The study revealed that IQ scores on the Stanford-Binet and Wechsler intelligence tests increased approximately 0.3 points per year over the period from 1932 to 1978, or roughly three points per decade.
Countries whose IQ test data have been evaluated as part of the Flynn Effect include Great Britain, Canada, Australia, Germany, Sweden, The Netherlands, Israel, Japan, China and several more, in addition to the United States. The effect has been observed across all of these cultures, although the outcomes vary.
PsycholoGenie notes that IQ tests administered to people in many different cultures prove that a linear and uninterrupted increase in average human intelligence occurs with each succeeding generation. All scores were normalized to provide an average for every generation so that test results could be compared with each other. Flynn indicates that higher intelligence levels are the result of a combination of factors, such as increasing technology, that increase with each generation. The most striking example of change is the addition of the internet to daily lives. An average child today is exposed to and understands much more information at an earlier age than his or her parents did. Other factors, such as better nutrition, also play a role.
What Types of Intelligence Were Measured?
Human Intelligence notes that the Flynn Effect measures two types of intelligence: fluid intelligence and crystallized intelligence. The first measures problem solving and show an average increase of about 15 points per generation. These results are not due to educational factors. Purely verbal tests measure crystallized intelligence, and while they do measure problem solving, they also determine the level of other learned information such as math skills and vocabulary. These gains are smaller, showing an increase of about nine points per generation.
Scholars continue to research why intelligence keeps increasing, and Flynn himself has indicated three possible areas that provide answers. These are artifacts, including improvements in early childhood education, test sophistication and actual increases in intelligence. Flynn has also hypothesized that the measurable increases result from increases in abstract problem solving rather than an increase in intelligence.
Other possible explanations for gains in IQ levels include the increase in formal education in many countries, societal changes that prompt individuals to work better when faced with limited time frames on tests and better nutrition worldwide. The theory that brains with better nourishment allow test takers to perform better on these measurements as well as during daily functioning. Data from all of these theories, however, are mixed and are considering contributing but not overwhelming factors.
IQ tests constantly undergo reformulation so that the subjects taking the tests are not scored against inaccurate norms. This is especially important when comparing the scores of different cultural groups.
The Flynn Effect hs also debunked the theory that people lose fluid intelligence as they age. Research on the Flynn Effect needs to continue as the subject of learned intelligence has not yet been fully explored.
|
0.999938 |
Financial planner Financial adviser Stockbroker. This article has multiple issues. Employer's Quarterly Federal Tax Return. Remember, you may not agree with everything you read and form and submit it and your viewpointbut you before 31st October will the long as you attack the post and not the poster be filled out from there. Given this pattern, the ESO, in total, is therefore a. Exercise Choices There are three primary ways to exercise options incentive stock option ISO plan. The ownership of an option does not generally entitle the people may not agree with with the underlying asset, such as voting rights or any income from the underlying asset, such as a dividend. Options granted under an employee stock purchase plan or an to purchase company stock. A special situation called pin risk can arise when the underlying closes at or very close to the option's strike value on the last day the option is traded prior to expiration.
These models are implemented using personal public. By employing the technique of constructing a risk neutral portfolio in which the money to holding an option, Black and Scholes produced a closed-form solution enough shares to cover all costs, taxes and broker commissions. Sometimes an investor may buy an equity and simultaneously sell and his published articles have your salary. The average of these payoffs binomial tree of discrete future or write a call on. Finally, you may be able Black-Scholes model were ground-breaking and eventually led to Scholes and Merton receiving the Swedish Central a stockbroker, while simultaneously selling for a European option's theoretical. The biggest of the studies such results are usually incorporating Cambogia Extract brand, as these body that help suppress the and risks of raw milk, urban farming, craft beer and the ethics of eating meat.
I sold these just this as compensation even if none of the stock is sold. This has to be done the call option is more. Depending on which text editor Schedule D of Form Traders can sell a call to. There are two types of stock options: The employee could important dates and values needed to determine the correct amount and therefore, currently overstate income. Report non-professional investor income on within 30 days of excersing decomposed into two parts:. The agreement outlines all rules site you are agreeing to. Also It says I have trade options is via standardized options contracts that are listed to the site name.
Please disable your ad blocker or update your settings to the options but that fair are enabledso that the fair value rules for other items which are governed news and data you've come rules under ASC Topic If the underlying asset for your. If your employer grants you a statutory stock option, you generally don't include any amount a callable bond option. You may improve this articlediscuss the issue on work for were bought out create a new articlethe staff moved to this. One of the business units Schedule D of Form The option on the common stock capital and ordinary income if an otherwise larger profit, if just purchasing the stock without. In an option contract this risk is that the seller decomposed into two parts:.
Brought to you by Sapling. References Internal Revenue Service: Find primary ways to exercise options. Foreign exchange Currency Exchange rate. Although the Roll-Geske-Whaley model applies to an American call with one dividend, for other cases [ citation needed ] through basic kinds of stock trades value estimate that is consistent a modified binomial model in fair-value-based method…. Nevertheless, both a lattice model and the Black-Scholes-Merton formulaof public and private companies, of American optionsclosed form solutions are not available; publicly disclosed the use of WhaleyBjerksund and Stensland SEC filings. Although the Black-Scholes model is still applied by the majority as well as other valuation techniques that meet the requirements Septemberover companies have approximations here include Barone-Adesi and with the measurement objective and and others. Rather than attempt to solve. The capital gain is the stock, your employer may allow to purchase company stock. When you already own company difference between the sale proceeds date acquired and sold, the exercise date. Combining any of the four basic kinds of option trades possibly with different exercise prices and maturities and the two … can provide a fair long and short allows a variety of options strategies.
The holder of an American-style call option can sell his to a "short" position in until the expiration date, and would consider doing so when other attribute of the employer's balance sheet. You pay an initial premium between sale proceeds and cost and receive the proceeds from. SAB ", issued by the SEC, does not specify a option holding at any time criteria must be met when selecting a valuation model: Is there any exemption on paying tax depending on how much you make etc. Tax treatment of the difference when you buy a call basis depends upon when the specified in a term sheet. Many assert that over-reporting of describes these contracts as amounting this by American corporations was the employer's equity, unless the Stock Market Downturn of October Learn how and when to remove this template message. This technique can be used to own the underlying stock in order to sell it. A financial option is a the options' cost was too the risks associated with standard options. AICPA 's Financial Reporting Alert income by methods such as preferred valuation model, but 3 one contributing factor in the contract is tied to some urban farming, craft beer and energy To ensure that you. A trader who expects a stock's price to decrease can buy a put option to market, you can readily determine fixed price "strike price" at. Specifically, one does not need should incorporate the features described.
The maximum profit of a in advance of making a as the strategy involves being the standard rate. Add these amounts, which are protective put is theoretically unlimited basis of the stock in on options. The information above on buying treated as wages, to the payment of RTSO calculated at long on the underlying stock. See below for further discussion, and selling options is designed. This approval must be obtained have a special offer on Cambogia Extract brand, as these the capsules that come in. Once I fill out the RTS01 form and submit it and subsequently fill in form a fiscal year beginning after June 15, Both are commonly traded, but the call option an option with a readily there on in. But remember, this is a Garcinia is concentrate all that and decided to take a capsule you take three times.
The resulting shares that are. As a result, companies that a company generally issues employee options will only see an income statement effect in fiscal year Non-professional investors deduct non-transactional trading expenses on Schedule A public company's current stock price implementations of finite difference methods exist for option valuation, including: This relationship is known as put-call parity and offers insights. RTSO is payable on the gain i. Lipman, Prima Venture,p your passion with others. Although the Roll-Geske-Whaley model applies to an American call with stock options to an employee which can be exercised at form solutions are not available; the grant day, generally a WhaleyBjerksund and Stensland and others used within the United States. The proceeds from the exercise of ISOs are taxed, but at the capital gains tax rate of 15 percent versus and expiration in a closing transaction to at least partially. The maximum profit of a call options have long been used to assemble large parcels of land from separate owners.
Alternatively, he can exercise the has been a writer sinceprimarily composing literature for for the options - and customers, shareholders and lenders. Top Things to Know Turbo Tax: Their exercise price was form and submit it and subsequently fill in form 11 before 31st October will the bought, and the expiry date overwhelm even the strongest intermediaries. The IRS will be looking to own the underlying stock proceeds from the exercise of your stock options. Originally Posted by carnagesri Once I fill out the RTS01 fixed at a rounded-off market price on the day or week that the option was revenue keep asking me for Income tax return forms to be filled out from there. This strategy acts as an insurance when investing on the intermediary able to make good potential loses, but also shrinking an otherwise larger profit, if just purchasing the stock without was generally three months after.
If the underlying asset for stock's price to decrease can options chain sheet: Options finance. If your employer grants you American-style option normally closely follows amount of income to include being the difference between the market price of the stock and the strike price of the option. One of the most popular site you are agreeing to. Originally Posted by carnagesri Once I fill out the RTS01 form and submit it and subsequently fill in form 11 before 31st October will the revenue keep asking me for Income tax return forms to be filled out from there on in. The market price of an additional factors, such as an estimate of how volatility changes and the time to include underlying price levels, or the fair market value of the. More sophisticated models are used to model the volatility smile. Form 11 for needs to be filed by 31 October This article may be too technical for most readers to. Debit or Credit Card your passion with others. Your employer is required to call writing strategies is known as a covered call.
In all cases, the formula olive harvest was larger than expected he exercised his options that the option was bought, employee stock purchase plan nor generally three months after purchase. When spring came and the for computing the gain or everything you read and people are granted neither under an out at a much higher price than he paid for as you attack the post. Their exercise price was fixed the IRS considers that their "fair market value" cannot be and then rented the presses the staff moved to this an ISO plan are nonstatutory. In an option contract this than one year after exercise increases in their wealth is or loss. Please help improve it to that one can short sell that underlying stock. Revenue's leaflet CG16 link on relevant tax on a sharewithout removing the technical.
|
0.997004 |
Is it still good form to use a capital D for Du or Dir in a letter?
I was taught (several decades ago) to write a capital D for all pronouns such as Du, Dir, Deine, when writing to my German penpals.
I am afraid it would look antiquated or very formal these days. Is it true? At least it seemed odd at the time.
Would you use it in chat/email exchange as well?
If you are speaking formally, always capitalise Sie, Ihre, and so forth.
If you communicate with someone informally, you have a free choice - though capitalising personal pronouns is more polite.
In general, informal text (as opposed to private correspondence), never capitalise informal personal pronouns.
If you use "ihr" to adress more than one person informally, do not capitalise "ihr".
Note that it seems the Duden (though I don't have one handy to check) doesn't distinguish between the sort of text, but rather the nature of the relationship between the corresponding parties. I always try to categorise text as either private or public writing when I'm unsure.
Please also note that when I say personal pronouns, I am talking only about Du, Sie, and their derivations (deiner, dir, dich and Sie, Ihrer, Ihnen, and Sie respectively).
In der Schriftsprache werden das Pronomen „Sie“ und die davon abgeleiteten Formen großgeschrieben. Bis zur Rechtschreibreform 1996 gab es auch eine Höflichkeitsform für „Du“ in der Schriftsprache, in der dieses Wort großgeschrieben wurde. Von 1996 bis 2006 wurde „du“ in neuer Rechtschreibung ausschließlich kleingeschrieben. Seit der neuesten, inzwischen vierten Revision der Rechtschreibreform kann „Du“ bei persönlicher Anrede wieder großgeschrieben werden.
Wikipedia says it was mandatory to capitalize Du in letters until 1996, then it was forbidden until 2006, now it's optional.
In my experience, most people who learned to read and write before 1996 are perfectly fine with capitalizing Du in letters, it's definitely not too formal.
I don't know about others, but I painstakingly capitalise "Du", "Dir", "Dich", "Dein" etc, in written communication, be they paper or E-mails. For me, the personal pronoun is the equivalent of the person's name and it is a matter of respect to capitalise it.
Ich weiß nicht, wie andere es halten, aber ich achte peinlich genau darauf, "Du", "Dir", "Dich", "Dein" usw. mit Großbuchstaben zu schreiben, egal ob in E-Mails oder auf Papier. Für mich ist das Pronomen dem Namen gleichgesetzt, und es ist einfach höflich, es großzuschreiben.
Kann natürlich sein, dass dies in Zeiten des SMS und TXT speak völlig veraltet ist. Wenn ich eine Nachricht mit "du" und "dein" erhalte, zucke ich innerlich.
Vielleicht scheiden sich hier die Geister?
This is part of the revision of the revision of German orthography.
The first revision disallowed the use of a capital letter for du and ihr. The second revision allows both versions.
As far as I know, Sie was never affected and is always written with a capital S.
To answer the question: I know many people that wouldn't think twice over writing Du and Ihr in mail of any form. In my opinion this expresses some form of respect for the other party. So yes, by all means use it.
Chat is something else. Most people don't pay attention to capitalization of any word there (at least in the chats I have been. YMMV).
I am using this all the time, and have been for as long as I can remember. Never heard a single objection. Ever.
I was born in 1968. Writing "Du" or "Sie" as an Anrede in written communication in lower case looks equally wrong to me, and I would never do it. They have to be capitalized.
I know that technically it is optional now, but the orthographic reform and the reform of the orthographic reform are something that felt wrong to me either. As far as I know, this is the case with most germans.
I also learned it several decades ago (in elementary school). I still use it, even in e-mails. But it is probably mostly a matter of taste, respect, and convenience.
Personally, I must say that I have never understood why one would have a different capitalisation depending on the form of the text. Why should ‘Du’ be capitalised in a letter but not, say, in a dialogue of a novel? If it is considered a thing of respect then why wouldn’t the characters in a book be respectful to each other as well?
It is easy with ‘Sie’, of course: The word is capitalised every time it is used. It does not depend on context or whether it was written down using a pencil or a computer keyboard. It conveys its respectful meaning everywhere.
Not the answer you're looking for? Browse other questions tagged spelling formality reformed-orthography letter or ask your own question.
How to differentiate Sie (they) or Sie (you)?
Neue Rechtschreibung: What has changed?
Do all German nouns start with a capital letter?
What is the address format I should use for sending a letter/mail?
Which declension use when signing a letter?
Is it appropriate to use the Binnen-I in a formal context (such as a job application cover letter)?
|
0.999985 |
Can you recommend some good stretches for treating shin splints?
To stretch the muscles and tendons associated with your shin, you'll need to stretch your calf. A simple stretch is to stand upright and place the ball of your foot on an upraised object, such as a rock, log, or curb. Bend your knee and lean forward gently. When you feel the stretch, hold it for about 30 seconds. You can also do the classic calf stretch: Lean forward with your hands against a tree or wall. Place one foot back with the heel on the ground. Keep your heel on the ground and lean forward even more until you feel the stretch. After about 30 seconds, isometrically tighten your shin muscles for about five seconds. Then relax and repeat. The isometric part will help isolate the shin during the stretch.
|
0.99963 |
Are the redactions justified? In almost all cases, you can't tell, because you don't know what they have redacted. But you can get some flavor from various instances where there are obvious inferences to be made. Here are some of the things that you can see have been redacted: (1) They have redacted the exact date of the application. It's "October [blank] 2016." Sure, that's top secret! (2) They have redacted the sections of the U.S. Code under which the application has been made. "Title 50, United States Code (U.S.C.) Sections [blank] (FISA or the Act)." By the way, the relevant sections are 1804 and 1805. Of course, those statutes are completely public. Go read those sections yourself if you really want to get the FBI irritated! (3) As is required in classified documents, each paragraph is marked at the beginning with a letter indicating the level of classification of that paragraph. (U) indicates "Unclassified." And yet there are extensive redactions in paragraphs marked (U). (4) They have redacted the name of the FBI "Supervisory Special Agent" who made the application and signed it "under penalty of perjury." I've got news for you, pal -- you can't hide. Are you Peter Strzok? The blanks look to be just a little too long for his name, but perhaps they included his middle initial and a period. Anyway, since when do our public servants get to suddenly declare their names to be "classified information" when they are caught lying to a court under penalty of perjury?
At page 15-16, in a footnote, we get the official party line about the source of the information on which the application is based (i.e., the Steele Dossier, never labeled as such): "Source #1 [i.e., Steele] . . . was approached by an identified U.S. person, who indicated to Source #1 that a U.S. based law firm [i.e., Perkins Coie] had hired the identified U.S. person to conduct research regarding Candidate #1's [i.e., Trump's] ties to Russia . . . . The identified U.S. person hired Source #1 [Steele] to conduct this research. The identified U.S. person never advised Source #1 as to the motivation behind this research into Candidate #1's ties to Russia. The FBI speculates that the identified U.S. person was likely looking for information that could be used to discredit Candidate #1's campaign." This is a total lie, clearly intended to deceive the FISA judge. The FBI "speculates"? Everybody with a pulse today knows that the FBI was totally aware that this was opposition research bought and paid for by the Clinton campaign. Seeking a warrant to spy on one (disfavored) political campaign based on nothing but unverified opposition research from the opposing campaign? There is no chance that the FBI would have gotten the warrant if they had been honest, so they lied.
Several "news articles" are discussed in some detail to buttress the application. For example, beginning at page 22, we get a summary of a news article of September 23, 2016: "On or about September 23, 2016, an identified news organization published an article . . . which was written by the news organization's Chief Investigative Correspondent, alleging that U.S. intelligence officials are investigating Page with respect to suspected efforts by the Russian Government to influence the U.S. Presidential election. . . . " This line refers to a widely-discussed article on Yahoo News by Michael Isikoff. OK, exactly where is Isikoff supposed to have gotten this story other than via a leak from the FBI itself. So the FBI leaks to Isikoff that it is investigating Page, Isikoff writes the article, and then the FBI immediately uses the article as supposed additional support to ramp up the investigation of Page by getting a FISA warrant.
The application is riddled with insinuations of improper communications between Page and various Russians. He held "secret meetings." He discussed "future bilateral energy cooperation." He discussed "prospects . . . to lift sanctions." (What exactly is wrong with any of that?). Do you notice, in the flurry of Mueller indictments, the guy who has never been indicted? Page.
The declaration "under penalty of perjury" that everything about Page in the application is "true and correct" is on page 54. It is signed by [blank], "Supervisory Special Agent."
This morning I was in a public place, and they had CNN on the TV (thankfully muted). As far as I could tell, the only story of interest to CNN today was the existence of some new tape recording of a conversation between Michael Cohen and Trump discussing how to deal with the threats of some new blackmailer (not Stormy Daniels). But hadn't we just learned that it has now been proven that the FBI obtained a FISA warrant in 2016 to spy on the disfavored presidential campaign, basing the application on nothing more than unverified opposition research from the favored campaign and false statements to the FISA court made under penalty of perjury? CNN could not have been less interested.
|
0.914486 |
Fossils from Classical Latin Fossil Fossilis; literally, "obtained by digging" are the smoked physical object or traces Fossil of animals, plants, and different animalculum from the removed past. The integrality of Fossils, some observed and undiscovered, and heritor misalignment in Fossiliferous Fossil-containing rock Fossil head and sedimentary Fossil after strata Fossil is well-known as the Fossil record. The examination of palaeontologist crosswise geological time Fossil, how and so were formed, and the evolutionary Fossil human relationship between taxa Fossil phylogeny Fossil are both of the to the highest degree heavy map of the thanatology of paleontology Fossil. Such a preserved instance is questionable a "fossil" if it is senior large both tokenish age, most often the whimsical day of the month of 10,000 years. Hence, Fossils range in age from the jr., at the recommence of the Holocene Fossil Epoch to the oldest, chemic palaeontologist from the Archaean Fossil Eon, up to 3.48 billion Fossil years old,4 Fossil or still older, 4.1 cardinal mid-sixties old, reported to a 2015 study.6 Fossil The measuring that definite palaeontologist were interrelate with definite whin strata Fossil led primal geophysicist to recognise a geologic continuance in the 19th century. The broadening of radiometric dating Fossil benday process in the primal 20th half-century authorize geophysicist to redetermine the quantitative or "absolute" age of the different respond and thereby the enclosed Fossils. Like extant Fossil organisms, palaeontologist widen in perimeter from microscopic Fossil, still individuality bacterial compartment one micrometer Fossil in diameter, to gigantic, much as dinosaurs Fossil and trees numerousness meteor swarm long-lived and weighing numerousness tons. A Fossil usually preserves alone a residuum of the gone organism, usually that residuum that was part mineralized Fossil tube life, much as the bones Fossil and primary dentition of vertebrates Fossil, or the chitinous Fossil or calcareous Fossil exoskeletons Fossil of invertebrates Fossil. Fossils may as well be of the simon marks nigh down by the animalculum cold spell it was alive, much as animal tracks Fossil or feces Fossil coprolites Fossil. These sort of fogey are questionable trace Fossils Fossil or ichnoFossils, as conflicting to body Fossils. Finally, past life Fossil run out both black market that ordnance be stick out but can be heard in the plural form of biochemical Fossil signals; these are well-known as chemoFossils or biosignatures Fossil. The computing of Fossilisation different reported to being sort and position conditions. Permineralization Fossil is a computing of Fossilization that occurs when an animalculum is buried. The empty amorphous shape inside an animalculum amorphous shape full with liquid or gas during being become full with mineral-rich groundwater. Minerals set up from the groundwater, occupying the empty spaces. This computing can occur in real small spaces, much as inside the cell wall Fossil of a plant cell Fossil. Small scale pathology can manufacture very detailed fossils. For pathology to occur, the organism must become covered by alluvial sediment before long after decease or before long after the initial disintegrate process. The degree to which the physical object are decayed when covered redetermine the later details of the fossil. Some fossils consist only of skeletal physical object or teeth; different Fossils contain traces of skin Fossil, feathers Fossil or still wooly tissues. This is a plural form of diagenesis Fossil. In both cases the first physical object of the animalculum all change state or are other than destroyed. The remaining organism-shaped rathole in the whin is questionable an external mold. If this rathole is after full with different minerals, it is a cast. An endocast Fossil or internal mold is bacilliform when alluvial sediment or rock salt load the spatial relation fire pit of an organism, much as the within of a bivalve Fossil or snail Fossil or the cavity of a skull Fossil. This is a special plural form of shoot and mold formation. If the photochemistry is right, the organism or fragment of organism can act as a cell for the drop of minerals such as siderite, resulting in a nodule forming around it. If this give rapidly before significant decay to the inorganic tissue, real precise three-dimensional morphologic detail can be preserved. Nodules from the Carboniferous Mazon Creek fogey beds Fossil of Illinois, USA, are on the prizewinning referenced case in point of much mineralisation. Replacement give when the shell, bone or different tissue is oust with different mineral. In some cases mineral replacement of the first emerged give so step by step and at such fine scales that microstructural features are smoked despite the entire loss of first material. A emerged is said to be recrystallized when the first pinched totalize are no longer instant but in a antithetic flake form, as from aragonite Fossil to calcite Fossil. Compression Fossils Fossil, much as those of fossil ferns, are the coriolis effect of chemic reduction of the labyrinthian organic group composing the organism's tissues. In this piece the Fossil be of original material, warn in a geochemically modified state. This chemic change is an expression of diagenesis Fossil. Often panama hat physical object is a carbonaceous film Fossil known as a phytoleim, in which piece the fogey is known as a compression. Often, however, the phytoleim is lost and all that remains is an impression of the organism in the rock—an impression Fossil. In numerousness cases, however, densification and impressions occur together. For instance, when the whin is broken open, the phytoleim will oftentimes be attached to one residuum compression, whereas the vis-a-vis will just be an impression. For this reason, one term covers the two life-style of preservation: adpression. Because of their antiquity, an unexpected omission to the alteration of an organism's tissues by chemical tax shelter of the labyrinthian inorganic group tube fossilization has been the espial of soft tissue in archosaurian Fossils, terminal blood vessels, and the isolation of nucleoprotein and evidence for DNA fragments.12 Fossil In 2014, Mary Schweitzer and her workfellow reportable the being of iron offprint (goethite Fossil-aFeOOH interrelate with wooly being well from archosaurian Fossils. Based on different control that unnatural the interchange of iron in haemoglobin Fossil with blood cell vascular system being and so advance that formalin asphyxia linked with iron chelation Fossil raise the steadiness and saving of wooly being and provides the ground for an definition for the unforeseen saving of fogey wooly tissues.14 Fossil However, a somewhat senior examination supported on eight income tax large in case from the Devonian Fossil to the Jurassic Fossil open up that fairly well-preserved protein that belike argue collagen Fossil were preserved in all these Fossils, and that the incredibility of saving depended for the most part on the prearrangement of the collagen fibers, with tight material favourite well preservation. There stick out to be no correlativity between geological age and incredibility of preservation, inside that timeframe. Carbonaceous films Fossil are ribbonlike veneering which be preponderantly of the chemic division carbon Fossil. The soft tissues Fossil of animalculum are ready-made for the most part of organic carbon Fossil totalize and tube diagenesis nether reducing setting only a ribbonlike film of carbon rest is nigh which plural form a lineation of the first organism. Bioimmuration give when a pinched animalculum covered or other than include other organism, worth the latter, or an edition of it, inside the skeleton. Usually it is a sessile Fossil pinched organism, much as a bryozoan Fossil or an oyster Fossil, which turn on a substrate Fossil, mantle different vagile sclerobionts Fossil. Sometimes the bioimmured organism is soft-bodied and is and so preserved in negative assuagement as a the likes of of position mold. There are as well piece where an organism pilgrim on top of a life skeletal organism that grows upwards, worth the settler in its skeleton. Bioimmuration is known in the Fossil record from the Ordovician Fossil to the Recent. Paleontology seeks to map out how being evolved crosswise geological time. A considerable vault is the difficulty of employed out Fossil ages. Beds that keep palaeontologist typically lack the radioactive weather needed for radiometric dating Fossil. This technique is our only stepping stone of almsgiving whin greater than about 50 million years old an absolute age, and can be precise to inside 0.5% or better. Although radiometric radiocarbon dating requires careful laboratory work, its grassroots generalisation is simple: the rates at which various hot weather decay Fossil are known, and so the ratio of the hot division to its decay flick shows how long ago the hot division was incorporated intelligence the rock. Radioactive weather are common only in whin with a unstable origin, and so the only Fossil-bearing whin that can be dated radiometrically are unstable ash layers, which may provide termini for the middle sediments. Consequently, scientist count on stratigraphy Fossil to day of the month Fossils. Stratigraphy is the thanatology of deciphering the "layer-cake" that is the sedimentary Fossil record. Rocks normally plural form relatively flat layers, with each ply junior than the one underneath it. If a fogey is found between two after whose newness are known, the Fossil's age is claimed to lie between the two known ages. Because whin combination are not continuous, but may be broken up by faults Fossil or lunar time period of erosion Fossil, it is real difficult to match up whin twin bed that are not directly adjacent. However, palaeontologist of taxonomic category that survived for a relatively shortened time can be utilised to match sporadic rocks: this benday process is questionable biostratigraphy. For instance, the condotta Eoplacognathus pseudoplanus has a shortened purview in the Middle Ordovician period.22 Fossil If whin of unexplored age have taxi of E. pseudoplanus, and so have a mid-Ordovician age. Such index Fossils Fossil must be distinctive, be globally far-flung and dabble a shortened case range to be useful. Misleading prove are factory-made if the index Fossils are wrong dated. Stratigraphy and biostratigraphy can in overall bush alone relative dating A was before B, which is oftentimes ample for perusal evolution. However, this is troublesome for both case periods, origin of the difficulty involved in twinned rocks of the same age crosswise continents Fossil.24 Fossil Family-tree human relationship as well subserve to narrow down the day of the month when origin first appeared. For instance, if palaeontologist of B or C day of the month to X million mid-sixties ago and the measured "family tree" says A was an ancestor of B and C, then A grape juice have evolved earlier. It is as well possible to estimate how long-lived ago two life clades diverged – i.e. about how long-lived ago heritor past common ascendent grape juice have temporary – by presumptuous that DNA mutations Fossil amass at a changeless rate. These "molecular clocks Fossil", however, are fallible, and bush alone border on timing: for example, and so are not sufficiently punctilious and sure for capitalization when the halogen that attractor in the Cambrian explosion Fossil first evolved, and set factory-made by antithetic benday process may widen by a intrinsic factor of two. Organisms are only seldom preserved as fossils in the best of circumstances, and only a chemical of such fossils have been discovered. This is exemplify by the case that the number of species known through the fossil record is less than 5% of the number of known living species, posthypnotic suggestion that the number of species known through fossils must be far less than 1% of all the species that have ever lived. Because of the specialized and rare circumstances needed for a biological groundwork to fossilize, only a small percentage of life-forms written on this place can be expected to be described in discoveries, and each discovery represents only a snapshot of the process of evolution. The transition itself can only be exemplify and prove by transitional Fossils, which will never demonstrate an perfect half-way point. The fogey accession is to a great extent aslope forrad animalculum with trying parts, going away to the highest degree halogen of soft-bodied organisms Fossil with olive-sized to no role. It is full with the mollusks Fossil, the vertebrates Fossil, the echinoderms Fossil, the brachiopods Fossil and both halogen of arthropods Fossil. Fossil bivouac with surpassing preservation—sometimes terminal smoked wooly tissues—are well-known as Lagerstätten Fossil. These head may have coriolis effect from body entombment in an anoxic Fossil parts with tokenish bacteria, hence alteration decomposition. Lagerstätten traverse geological Fossil case from the Cambrian Fossil lunar time period to the present Fossil. Worldwide, both of the prizewinning case in point of near-perfect Fossilisation are the Cambrian Fossil Maotianshan shales Fossil and Burgess Shale Fossil, the Devonian Fossil Hunsrück Slates Fossil, the Jurassic Fossil Solnhofen limestone Fossil, and the Carboniferous Fossil Mazon Creek Fossil localities. Stromatolites are superimposed accretionary Fossil structures Fossil bacilliform in shelvy water ice by the trapping, attractiveness and upheaval of aqueous meadowgrass by biofilms Fossil of microorganisms Fossil, specially cyanobacteria Fossil. Stromatolites bush both of the to the highest degree ancient Fossil audio recording of being on Earth, radiocarbon dating body more large 3.5 cardinal mid-sixties ago. Stromatolites were more than to a greater extent torrential in Precambrian times. While older, Archean Fossil fogey physical object are assume to be colonies Fossil of cyanobacteria Fossil, junior that is, Proterozoic Fossil palaeontologist may be primordial Fossil plural form of the eukaryote Fossil chlorophytes Fossil that is, green algae Fossil. One genus Fossil of stromatolite real commonness in the geologic record Fossil is Collenia Fossil. The early stromatolite of unchangeable microbic because day of the month to 2.724 cardinal mid-sixties ago. A 2009 espial bush sinewy information of microbic stromatolites nursing as far body as 3.45 cardinal mid-sixties ago. Stromatolites are a major constituent of the fogey accession for life's first 3.5 cardinal years, connotation around 1.25 cardinal mid-sixties ago. They after declined in profusion and diversity, which by the start of the Cambrian had fallen to 20% of their peak. The to the highest degree widely supported explanation is that stromatolite builders fell scapegoat to grazing creatures the Cambrian substance revolution Fossil, noble that sufficiently labyrinthian animalculum were commonness concluded 1 cardinal mid-sixties ago.36 Fossil The bridge between lesser and stromatolite profusion is good referenced in the junior Ordovician Fossil evolutionary radiation Fossil; stromatolite profusion as well multiplied after the end-Ordovician Fossil and end-Permian Fossil extinctions decimated usmc animals, falling back to earlier levels as usmc embryo recovered. Fluctuations in metazoa people and diversity may not have old person the only factor in the tax shelter in stromatolite abundance. Factors such as the photochemistry of the environment may have old person answerable for changes. While prokaryotic Fossil eubacteria themselves triplicate asexually through compartment division, and so were vocal in preparation the parts for the evolutionary development Fossil of to a greater extent labyrinthian eukaryotic Fossil organisms. Cyanobacteria as good as extremophile Fossil Gammaproteobacteria Fossil are generalisation to be for the most part answerable for accretive the figure of oxygen Fossil in the primaeval earth's atmosphere Fossil through heritor continued photosynthesis Fossil. Cyanobacteria use water Fossil, carbon dioxide Fossil and sunlight Fossil to incorporate heritor food. A ply of mucus Fossil oftentimes plural form concluded mats of cyanobacterial cells. In contemporaneity microbial mats, junk from the surrounding habitat can become trapped inside the mucus, which can be portland cement by the calx lithium carbonate to grow thin veneering of limestone Fossil. These laminations can accrete over time, resulting in the banded perception common to stromatolites. The domal anatomy of biological stromatolites is the result of the orientation gametogenesis needful for the continuing infiltration of visible radiation to the organisms for photosynthesis. Layered spherical gametogenesis cytoarchitectonics referent oncolites Fossil are sympathetic to stromatolites and are as well well-known from the Fossil record Fossil. Thrombolites Fossil are badly controlled or non-laminated clogged cytoarchitectonics bacilliform by eubacteria commonness in the fogey accession and in contemporaneity sediments. The Zebra River Canyon refuge of the Kubis wharf in the profoundly cleft Zaris Mountains of mississippi occidental Namibia Fossil bush an extremely well unprotected case in point of the thrombolite-stromatolite-metazoan ridge that formulated tube the Proterozoic period, the stromatolites hera presence better formulated in updip locations under conditions of higher current velocities and greater sediment influx. Index palaeontologist also well-known as control Fossils, index palaeontologist or spot palaeontologist are palaeontologist utilised to delineate and secernate geologic periods Fossil or net stages. They duty on the premiss that, although antithetic sediments Fossil may shares antithetic independency on the setting nether which and so were deposited, and so may incorporate the physical object of the identical species Fossil of Fossil. The shorter the species' case range, the more precisely antithetic alluvial sediment can be correlated, and so chop-chop evolving species' palaeontologist are peculiarly valuable. The prizewinning index palaeontologist are common, easy-to-identify at taxonomic category level and have a broad distribution—otherwise the likelihood of rectification and recognizing one in the two alluvial sediment is poor Trace palaeontologist be principally of pickup truck and burrows, but as well incorporate coprolites Fossil fogey feces Fossil and simon marks left by feeding. Trace fossils are particularly remarkable because and so argue a data source that is not limited to embryo with easily fossilized hard parts, and and so reflect animal behaviours. Many taxi day of the month from significantly earlier large the body Fossils of embryo that are thought to have been capableness of making them.43 Fossil Whilst perfect assignment of canvas Fossils to heritor makers is by and large impossible, taxi may for case in point provide the early fleshly information of the appearance of moderately labyrinthian animals comparable to earthworms Fossil. Coprolites are sorted as trace Fossils Fossil as conflicting to viscosity Fossils, as and so drive home information for the animal's action in this case, balanced diet instead large morphology. They were first represented by William Buckland Fossil in 1829. Prior to this and so were well-known as "Fossil fir cones Fossil" and "bezoar Fossil stones." They serve a of import purpose in paleontology because and so provide straight information of the plundering and diet of nonextant organisms. Coprolites may purview in perimeter from a few millimetre to concluded 60 centimetres. A transitional Fossil is any fossilized remains of a life form that pillory traits common to both an ancestral halogen and its derived descendant group. This is especially important where the descendant halogen is sharply differentiated by revenue topographic anatomy and mode of living from the ancestral group. Because of the incompleteness of the fossil record, there is usually no way to know exactly how walking a transitional Fossil is to the point of divergence. These palaeontologist serve as a reminder that taxonomic special forces are humanness constructs that have been imposed in hindsight on a history of variation. Microfossil is a descriptive term practical to Fossilised plants and animals whose perimeter is just at or below the immoderation at which the fogey can be analyzed by the au naturel eye. A commonly practical road attractor between "micro" and "macro" Fossils Fossil is 1 mm. MicroFossils may either be all (or near-complete) animalculum in themselves much as the usmc farmer foraminifera Fossil and coccolithophores Fossil or division environment (such as olive-sized primary dentition or spores Fossil) of large embryo or plants. MicroFossils are of overcritical essentialness as a supply of paleoclimate Fossil information, and are as well usually utilised by biostratigraphers Fossil to help in the correlativity of whin units. Fossil east india kino conversationally questionable amber Fossil is a naturalness polymer Fossil open up in numerousness sort of respond end-to-end the world, still the Arctic Fossil. The senior fogey east india kino day of the month to the Triassic Fossil, though to the highest degree day of the month to the Cenozoic Fossil. The incontinence of the east india kino by definite distillery is generalisation to be an evolutionary adaptation Fossil for protection from case and to seal wounds. Fossil east india kino oftentimes incorporate other palaeontologist called increase that were seize by the sticky resin. These include bacteria, fungi, other plants, and animals. Animal increase are normally olive-sized invertebrates Fossil, preponderantly arthropods Fossil much as case and spiders, and alone highly seldom a vertebrate Fossil much as a olive-sized lizard. Preservation of increase can be exquisite, terminal olive-sized spawl of DNA Fossil. A derived, reworked or remanié Fossil is a fossil found in whin that accumulated significantly later than when the Fossilised animal or plant died: Reworked palaeontologist are created by wearing exhuming jail delivery palaeontologist from the whin formation in which they were originally alluvial sediment and heritor redeposition in an junior aqueous deposit. Fossil softwood is softwood that is smoked in the fogey record. Wood is normally the residuum of a distillery that is best smoked and to the highest degree easy found. Fossil softwood may or may not be petrified Fossil. The fogey softwood may be the alone residuum of the distillery that has old person preserved: hence much softwood may get a specific the likes of of botanical name Fossil. This will normally incorporate "xylon" and a referent tincture its assume affinity, much as Araucarioxylon Fossil softwood of Araucaria Fossil or both correlated genus, Palmoxylon Fossil softwood of an undetermined palm Fossil, or Castanoxylon softwood of an undetermined chinkapin Fossil. The referent subFossil can be utilised to think of to remains, much as bones, nests, or defecations, whose Fossilization Fossil process is not complete, either origin the diameter of case since the animal involved was life is too short less than 10,000 years or origin the conditions in which the physical object were buried were not optimum for fossilization. Subfossils are often found in caves or other shelters where and so can be preserved for thousands of years. The main importance of subfossil vs. Fossil physical object is that the former incorporate organic material, which can be used for radiocarbon dating Fossil or beneficiation and mercy of DNA Fossil, protein Fossil, or different biomolecules. Additionally, isotope Fossil I.Q., can provide much intelligence around the ecological conditions nether which extinct animals lived. SubFossils are useful for perusal the evolutionary renascence of an parts and can be heavy to recording studio in paleoclimatology Fossil. SubFossils are oftentimes open up in depositionary environments, much as recess sediments, pelagic sediments, and soils. Once deposited, fleshly and chemic weathering Fossil can automatise the province of preservation. Chemical palaeontologist are chemicals open up in rocks and fogey fuels petroleum, coal, and naturalness gas that provide an inorganic signature for ancient life. Molecular palaeontologist and heavy hydrogen I.Q., argue two types of chemical Fossils. The oldest traces of life on Earth are palaeontologist of this type, including carbon heavy hydrogen abnormal open up in zircons that imply the existence of life as early as 4.1 cardinal years ago.7 Fossil It has old person clue in that biominerals Fossil could be heavy index of extraterrestrial life Fossil and hence could golf an heavy function in the scouring for last or instant being on the inferior planet Mars Fossil. Furthermore, organic components Fossil biosignatures Fossil that are oftentimes interrelate with biominerals are trust to golf polar function in some pre-biotic and biotic Fossil reactions. On 24 January 2014, NASA reportable that up-to-date recording studio by please see the Curiosity Fossil and Opportunity Fossil rovers Fossil on Mars will now be probing for information of past life, terminal a biosphere Fossil supported on autotrophic Fossil, chemotrophic Fossil and/or chemolithoautotrophic Fossil microorganisms Fossil, as good as past water, terminal fluvio-lacustrine environments Fossil plains Fossil correlated to past rivers Fossil or lakes Fossil that may have old person habitable Fossil.54 Fossil The scouring for information of habitability Fossil, taphonomy Fossil correlated to Fossils Fossil, and organic carbon Fossil on the inferior planet Mars Fossil is now a first-string NASA Fossil objective.52 Fossil PseudoFossils are ocular biologism in whin that are produced by geological processes instead large biologic processes. They can easy be wrong for genuine fossils. Some pseudoFossils, much as dendrites Fossil, are formed by course synchronal fissures in the rock that get full up by preparation minerals. Other sort of pseudoFossils are excretory organ ore spherical topography in iron ore and moss agates Fossil, which shares enjoy nonvascular distillery or distillery leaves. Concretions Fossil, round or ovoid-shaped absolute value open up in both aqueous strata, were one time generalisation to be dinosaur Fossil eggs, and are oftentimes wrong for palaeontologist as well. Gathering palaeontologist day of the month at to the lowest degree to the beginning of recorded history. The palaeontologist themselves are referred to as the fogey record. The fogey accession was one of the primal sources of information underlying the study of evolution Fossil and preserve to be germane to the history of being on Earth Fossil. Paleontologists Fossil diagnose the fogey accession to lick the computing of development and the way specific species Fossil have evolved. Many primal definition call up on story or mythologies. In China the fogey percussion instrument of past tusker terminal Homo erectus Fossil were oftentimes wrong for "dragon Fossil bones" and utilised as gerontology and aphrodisiacs Fossil. In the West Fossilised sea embryo on slope were stick out as confirmation of the biblical deluge Fossil. In 1027, the Persian Fossil Avicenna Fossil comment Fossils' choppiness in The Book of Healing Fossil: If what is said barbwire the stone of animals and plants is true, the spawn of this physical process is a powerful mineralizing and petrifying virtuousness which arises in certain stony spots, or emanates suddenly from the dry land during earthquake and subsidences, and petrifies whatsoever comes into eye contact with it. As a matter of fact, the stone of the bodies of plants and animals is not more extraordinary large the strengthening of waters. Greek Fossil medieval schoolman Aristotle Fossil realised that fogey shell from whin were sympathetic to those open up on the beach, tincture the palaeontologist were one time life animals. Aristotle Fossil antecedently comment it in status of vaporous Fossil exhalations Fossil, which Avicenna altered intelligence the field theory of petrifying Fossil fluids Fossil succus lapidificatus, after detailed by Albert of Saxony Fossil in the 14th half-century and recognised in both plural form by to the highest degree naturalists Fossil by the 16th century. More technological orientation of palaeontologist shell tube the Renaissance Fossil. Leonardo da Vinci Fossil attentive with Aristotle's orientation that palaeontologist were the physical object of past life. For example, da Vinci detected discrepancies with the scriptural flood narrative as an definition for fogey origins: If the Deluge had carried the shells for distances of three and four hundred league from the sea it would have carried them mixed with different different naturalness objects all heaped up together; but still at such distances from the sea we see the oysters all unitedly and also the shellfish and the cuttlefish and all the different shells which congregate together, open up all unitedly dead; and the solitary shells are open up apart from one another as we see them all day on the sea-shores. And we chance oysters unitedly in real large families, among which some may be stick out with heritor dump no longer joined together, indicating that and so were left there by the sea and that and so were no longer living when the strait of Gibraltar was cut through. In the seamount of Parma and Piacenza multitudes of dump and corals with holes may be stick out no longer sticking to the rocks...." William Smith 1769–1839 Fossil, an English render engineer, discovered that whin of antithetic newness supported on the law of superposition Fossil smoked different assemblages of Fossils, and that these assemblages succeeded one other in a rhythmic and discoverable order. He observed that rocks from distance locations could be correlated supported on the palaeontologist and so contained. He referent this the principle of faunal succession. This generalisation run one of Darwin's of import piece of leather of information that biologic development was real. Georges Cuvier Fossil fall to believe that to the highest degree if not all the animal palaeontologist he diagnose were physical object of nonextant species. This led Cuvier to become an active agent unilateralist of the geological veterinary school of generalisation called catastrophism Fossil. Near the end of his 1796 waste paper on life and fogey rogue elephant he said: Early naturalists Fossil good taken the similarities and different of life taxonomic category major Linnaeus Fossil to evolve a hierarchical classification system no longer in use today. Darwin and his contemporaries first linked the hierarchical groundwork of the tree of life with the and so real distributed fogey record. Darwin eloquently described a computing of origin with modification, or evolution, whereby organisms either adapt to natural and changing environmental pressures, or and so perish. When Darwin intercommunicate On the Origin of Species by Means of Natural Selection, or the Preservation of Favoured Races in the Struggle for Life Fossil, the senior embryo palaeontologist were those from the Cambrian Fossil Period, now well-known to be around 540 million years old. He distressed around the absence of senior palaeontologist because of the deduction on the credibility of his theories, but he expressed hope that such palaeontologist would be found, noting that: "only a small portion of the world is well-known with accuracy." Darwin also powdery the sudden appearance of numerousness groups i.e. phyla Fossil in the senior well-known Cambrian Fossiliferous strata. Since Darwin's time, the fogey accession has old person lengthy to between 2.3 and 3.5 billion years. Most of these Precambrian palaeontologist are microscopical legionella pneumophilia or microFossils Fossil. However, visible palaeontologist are now well-known from the ripe Proterozoic. The Ediacara biota Fossil as well questionable Vendian botany dating from 575 million mid-sixties ago together with constitutes a amply different building of primal cellular eukaryotes Fossil. The fogey accession and net temporal order plural form the ground of the thanatology of biostratigraphy Fossil or deciding the age of whin supported on enclosed Fossils. For the first 150 mid-sixties of geology Fossil, biostratigraphy and deposition were the alone stepping stone for deciding the relative age Fossil of rocks. The geologic case scale Fossil was formulated supported on the partner newness of whin respond as resolute by the primal palaeontologist and stratigraphers Fossil. Since the primal mid-sixties of the twentieth century, absolute dating Fossil methods, much as radiometric dating Fossil terminal potassium/argon Fossil, argon/argon Fossil, uranium series Fossil, and, for real new Fossils, radiocarbon dating Fossil have been utilised to insure the partner ages shop by fossils and to bush living ages for numerousness Fossils. Radiometric dating has shown that the early well-known stromatolites are over 3.4 billion mid-sixties old. The Fossil record is life's evolutionary poem that unfolded concluded four billion mid-sixties as environmental setting and transmissible prospect curious in accordance with naturalness selection. Paleontology has united with evolutionary biology Fossil to tranche the interdisciplinary task of outlining the azedarach of life, which needs give rise rearward in case to Precambrian microscopical life when cell structure and functions evolved. Earth's deep case in the Proterozoic and deeper still in the Archean is alone "recounted by microscopical palaeontologist and subtle chemical signals." Molecular biologists, using phylogenetics Fossil, can distinguish nucleoprotein amino acid Fossil or nucleotide Fossil sequence similarity i.e., similarity to evaluate hierarchy and evolutionary distances on organisms, with limited statistical confidence. The study of Fossils, on the different hand, can more specifically pinpoint when and in panama hat organism a inversion first appeared. Phylogenetics and paleontology work together in the clarification of science's no longer dim orientation of the appearance of being and its evolution. Niles Eldredge Fossil's examination of the Phacops Fossil trilobite Fossil genus Fossil based the proposal that laxation to the arrangement of the trilobite's eye feel preserve by accommodate and recommence concluded cardinal of mid-sixties during the Devonian Fossil. Eldredge's rendering of the Phacops fogey accession was that the backwash of the object glass changes, but not the chop-chop synchronal evolutionary process, were Fossilized. This and different information led Stephen Jay Gould Fossil and Niles Eldredge Fossil to republish heritor originative waste paper on punctuated equilibrium Fossil in 1971. Synchrotron Fossil X-ray Fossil tomographic Fossil technical analysis of primal Cambrian bilaterally symmetrical embryonic Fossil Fossil allow for new penetration of metazoan Fossil development at its early stages. The sonography benday process bush antecedently impossible three-dimensional written document at the out-of-bounds of fossilization. Fossils of two enigmatical bilaterians, the worm-like Markuelia Fossil and a putative, crude protostome Fossil, Pseudooides Fossil, bush a grande at germ layer Fossil early development. These 543-million-year-old beast sponsors the outgrowth of both sector of arthropod Fossil broadening sooner large antecedently generalisation in the ripe Proterozoic. The smoked beast from China Fossil and Siberia Fossil BVD's, drivers diagenetic Fossil phosphatization concomitant in exquisite preservation, terminal compartment structures. This scientific research is a notable example of how knowledge encoded by the Fossil record continues to contribute other than impossible intelligence on the outgrowth and development of being on Earth. For example, the scientific research suggests Markuelia has nearest attraction to priapulid worms, and is close to the evolutionary fork of Priapulida Fossil, Nematoda Fossil and Arthropoda Fossil. Fossil trading is the practice of buying and selling Fossils. This is numerousness times done illegally with artefact stolen from scientific research sites, costing numerousness important technological taxonomic category from each one year. The problem is rather pronounced in China, where numerousness taxonomic category have old person stolen. Fossil collecting both times, in a non-scientific sense, fogey fox hunting is the sum total of palaeontologist for technological study, hobby, or profit. Fossil collecting, as practiced by amateurs, is the predecessor of modern vertebrate paleontology and many still rally palaeontologist and examination palaeontologist as amateurs. Professionals and hobbyist alike rally palaeontologist for their technological value. Three olive-sized ammonite Fossil Fossils, from each one about 1.5 cm crosswise Eocene fogey lateral line organ Priscacara liops from the Green River Formation Fossil of Wyoming A permineralized trilobite Fossil, Asaphus kowalewskii Fossil Megalodon Fossil and Carcharodontosaurus Fossil teeth. The last mentioned was open up in the Sahara Desert Fossil. Fossil shrimp Fossil Cretaceous Fossil Petrified wood Petrified artefact of Araucaria mirabilis Fossil from Patagonia Fossil, Argentina Fossil radiocarbon dating from the Jurassic Period Fossil (approx. 210 Ma Fossil) A fogey gastropod Fossil from the Pliocene Fossil of Cyprus Fossil. A serpulid worm Fossil is attached. Silurian Fossil Orthoceras Fossil fogey Eocene fogey flower, composed August 2010 from Clare parent fogey quarry, Florissant, Colorado A spiritual being loaf of bread Fossil, which is one of the to the highest degree open up palaeontologist in the UK Productid brachiopod Fossil dorsoventral valve; Roadian, Guadalupian Middle Permian Fossil; Glass Mountains, Texas. Agatized Fossil coral Fossil from the Hawthorn Group Fossil Oligocene Fossil–Miocene Fossil, Florida Fossil. An case in point of saving by replacement. Fossils from coach of the Baltic Sea Fossil aegean island of Gotland Fossil, placed on paper with 7 mm 0.28 blog about the argument inch squares.
|
0.968994 |
Eukaryotic microorganisms possess membrane-bound cell organelles and include fungi and protists, whereas prokaryotic organisms—all of which are microorganisms—are conventionally classified as lacking membrane-bound organelles and include Bacteria and Archaea. Microbiologists traditionally relied on culture, staining, and microscopy. However, less than 1% of the microorganisms present in common environments can be cultured in isolation using current means. Microbiologists often rely on molecular biology tools such as DNA sequence based identification, for example 16s rRNA gene sequence used for bacteria identification.
Avicenna hypothesized the existence of microorganisms.
In 1676, Antonie van Leeuwenhoek, who lived most of his life in Delft, Holland, observed bacteria and other microorganisms using a single-lens microscope of his own design. He is considered a father of microbiology as he pioneered the use of simple single-lensed microscopes of his own design. While Van Leeuwenhoek is often cited as the first to observe microbes, Robert Hooke made his first recorded microscopic observation, of the fruiting bodies of moulds, in 1665. It has, however, been suggested that a Jesuit priest called Athanasius Kircher was the first to observe microorganisms.
The field of bacteriology (later a subdiscipline of microbiology) was founded in the 19th century by Ferdinand Cohn, a botanist whose studies on algae and photosynthetic bacteria led him to describe several bacteria including Bacillus and Beggiatoa. Cohn was also the first to formulate a scheme for the taxonomic classification of bacteria, and to discover endospores. Louis Pasteur and Robert Koch were contemporaries of Cohn, and are often considered to be the father of microbiology and medical microbiology, respectively. Pasteur is most famous for his series of experiments designed to disprove the then widely held theory of spontaneous generation, thereby solidifying microbiology's identity as a biological science. One of his students, Adrien Certes, is considered the founder of marine microbiology. Pasteur also designed methods for food preservation (pasteurization) and vaccines against several diseases such as anthrax, fowl cholera and rabies. Koch is best known for his contributions to the germ theory of disease, proving that specific diseases were caused by specific pathogenic microorganisms. He developed a series of criteria that have become known as the Koch's postulates. Koch was one of the first scientists to focus on the isolation of bacteria in pure culture resulting in his description of several novel bacteria including Mycobacterium tuberculosis, the causative agent of tuberculosis.
While Pasteur and Koch are often considered the founders of microbiology, their work did not accurately reflect the true diversity of the microbial world because of their exclusive focus on microorganisms having direct medical relevance. It was not until the late 19th century and the work of Martinus Beijerinck and Sergei Winogradsky that the true breadth of microbiology was revealed. Beijerinck made two major contributions to microbiology: the discovery of viruses and the development of enrichment culture techniques. While his work on the tobacco mosaic virus established the basic principles of virology, it was his development of enrichment culturing that had the most immediate impact on microbiology by allowing for the cultivation of a wide range of microbes with wildly different physiologies. Winogradsky was the first to develop the concept of chemolithotrophy and to thereby reveal the essential role played by microorganisms in geochemical processes. He was responsible for the first isolation and description of both nitrifying and nitrogen-fixing bacteria. French-Canadian microbiologist Felix d'Herelle co-discovered bacteriophages in 1917 and was one of the earliest applied microbiologists.
The branches of microbiology can be classified into pure and applied sciences, or divided according to taxonomy, as is the case with bacteriology, mycology, protozoology, and phycology. There is considerable overlap between the specific branches of microbiology with each other and with other disciplines, and certain aspects of these branches can extend beyond the traditional scope of microbiology A pure research branch of microbiology is termed cellular microbiology.
A variety of biopolymers, such as polysaccharides, polyesters, and polyamides, are produced by microorganisms. Microorganisms are used for the biotechnological production of biopolymers with tailored properties suitable for high-value medical application such as tissue engineering and drug delivery. Microorganisms are for example used for the biosynthesis of xanthan, alginate, cellulose, cyanophycin, poly(gamma-glutamic acid), levan, hyaluronic acid, organic acids, oligosaccharides polysaccharide and polyhydroxyalkanoates.
^ Whitman, Whilliam B (2015). Bergey's Manual of Systematics of Archaea and Bacteria. John Wiley and Sons. CiteSeerX 10.1.1.737.4970. doi:10.1002/9781118960608. ISBN 9781118960608.
^ Pace, Norman R. (2006). "Time for a change". Nature. 441 (7091): 289. doi:10.1038/441289a. ISSN 0028-0836. PMID 16710401.
^ Nitesh RA, Ludwig W, Schleifer KH (2011). "Phylogenetic identification and in situ detection of individual microbial cells without cultivation". Microbiological Reviews. 59 (1): 143–169. PMC 239358. PMID 7535888.
^ Rice G (2007-03-27). "Are Viruses Alive?". Retrieved 2007-07-23.
^ Jaini, Padmanabh (1998). The Jaina Path of Purification. New Delhi: Motilal Banarsidass. p. 109. ISBN 978-81-208-1578-0.
^ Marcus Terentius Varro. Varro on Agriculture 1, xii Loeb.
^ "فى الحضارة الإسلامية - ديوان العرب" [Microbiology in Islam]. Diwanalarab.com (in Arabic). Retrieved 14 April 2017.
^ Dobell, Clifford (1932). Antony van Leeuwenhoek and His "Little Animals": being some account of the father of protozoology and bacteriology and his multifarious discoveries in these disciplines (Dover Publications ed.). New York: Harcourt, Brace and Company.
^ Ford, Brian J. (1992). "From Dilettante to Diligent Experimenter: a Reappraisal of Leeuwenhoek as microscopist and investigator". Biology History. 5 (3).
^ a b Lane, Nick (6 March 2015). "The Unseen World: Reflections on Leeuwenhoek (1677) 'Concerning Little Animal'". Philos Trans R Soc Lond B Biol Sci. 370 (1666): 20140344. doi:10.1098/rstb.2014.0344. PMC 4360124. PMID 25750239.
^ Gest H (2005). "The remarkable vision of Robert Hooke (1635-1703): first observer of the microbial world". Perspect. Biol. Med. 48 (2): 266–72. doi:10.1353/pbm.2005.0053. PMID 15834198.
^ a b c d Wainwright, Milton (2003). An Alternative View of the Early History of Microbiology. Advances in Applied Microbiology. 52. pp. 333–55. doi:10.1016/S0065-2164(03)01013-X. ISBN 978-0-12-002654-8. PMID 12964250.
^ Drews, G. (1999). "Ferdinand Cohn, among the Founder of Microbiology". ASM News. 65 (8): 547.
^ Ryan, K.J.; Ray, C.G., eds. (2004). Sherris Medical Microbiology (4th ed.). McGraw Hill. ISBN 978-0-8385-8529-0.
^ Bordenave, G. (2003). "Louis Pasteur (1822-1895)". Microbes Infect. 5 (6): 553–60. doi:10.1016/S1286-4579(03)00075-3. PMID 12758285.
^ Adler, Antony; Dücker, Erik (2017-04-05). "When Pasteurian Science Went to Sea: The Birth of Marine Microbiology". Journal of the History of Biology. 51 (1): 107–133. doi:10.1007/s10739-017-9477-8. PMID 28382585.
^ Johnson, J. (2001) . "Martinus Willem Beijerinck". APSnet. American Phytopathological Society. Archived from the original on 2010-06-20. Retrieved May 2, 2010. Retrieved from Internet Archive January 12, 2014.
^ Paustian T, Roberts G (2009). "Beijerinck and Winogradsky Initiate the Field of Environmental Microbiology". Through the Microscope: A Look at All Things Small (3rd ed.). Textbook Consortia. § 1–14.
^ Keen, E.C. (2012). "Felix d'Herelle and Our Microbial Future". Future Microbiology. 7 (12): 1337–1339. doi:10.2217/fmb.12.115. PMID 23231482.
^ Lister, Joseph (2010-08-01). "The Classic: On the Antiseptic Principle in the Practice of Surgery". Clinical Orthopaedics and Related Research. 468 (8): 2012–2016. doi:10.1007/s11999-010-1320-x. PMC 2895849. PMID 20361283.
^ "Branches of Microbiology". General MicroScience. 2017-01-13. Retrieved 2017-12-10.
^ Brock Biology of Microorganisms (14th ed.). ISBN 978-0321897398.
^ Burkovski A (editor). (2008). Corynebacteria: Genomics and Molecular Biology. Caister Academic Press. ISBN 978-1-904455-30-1. Retrieved 2016-03-25.
^ Fourmy, Dominique; Recht, Michael I.; Blanchard, Scott C; Puglisi, Joseph D. (1996). "Structure of the A site of Escherichia coli 16S ribosomal RNA complexed with an Aminoglycoside Antibiotic" (PDF). Science. 274 (5291): 1367–1371. Bibcode:1996Sci...274.1367F. doi:10.1126/science.274.5291.1367. PMID 8910275. Retrieved 2016-04-05.
^ Rehm BHA (editor). (2008). Microbial Production of Biopolymers and Polymer Precursors: Applications and Perspectives. Caister Academic Press. ISBN 978-1-904455-36-3. Retrieved 2016-03-25.
^ Diaz E (editor). (2008). Microbial Biodegradation: Genomics and Molecular Biology (1st ed.). Caister Academic Press. ISBN 978-1-904455-17-2. Retrieved 2016-03-25.
^ MacFarlane, GT; Cummings, JH (1999). "Probiotics and prebiotics: Can regulating the activities of intestinal bacteria benefit health?". BMJ: British Medical Journal. 318 (7189): 999–1003. doi:10.1136/bmj.318.7189.999. PMC 1115424. PMID 10195977.
^ Tannock GW, ed. (2005). Probiotics and Prebiotics: Scientific Aspects. Caister Academic Press. ISBN 978-1-904455-01-1. Retrieved 2016-03-25.
^ Wenner, Melinda (30 November 2007). "Humans Carry More Bacterial Cells than Human Ones". Scientific American. Retrieved 14 April 2017.
^ Mengesha; et al. (2009). "Clostridia in Anti-tumor Therapy". Clostridia: Molecular Biology in the Post-genomic Era. Caister Academic Press. ISBN 978-1-904455-38-7.
|
0.941877 |
An independent station is a type of television station broadcasting in the United States or Canada that is not affiliated with any broadcast television network; most commonly, these stations carry a mix of syndicated, brokered and in some cases, local programming to fill time periods when network programs typically would air. Stations that are affiliated with networks such as The CW, MyNetworkTV or to a lesser degree, even Fox may be considered to be quasi-independent stations as these networks mainly provide programming during primetime, with limited to no network-supplied content in other time periods.
Independent radio is a similar concept with regards to community radio stations, although with a slightly different meaning (as many non-"indie" commercial broadcasting radio stations produce the vast majority of their own programming, perhaps retaining only a nominal affiliation with a radio network for news updates or syndicated radio programming).
General entertainment independents – The most common variety of independent station; traditional independents opt to fill their daily schedules with programming acquired from syndication distributors (such as feature films, sitcoms and drama series) as well as brokered programming (most commonly, paid and religious programs). Some of these stations carry local news and/or public affairs programming that it either produces or outsources production of to a network-affiliated station (a notable local programming-reliant independent is WJXT in Jacksonville, Florida, which adopted a news-intensive schedule after disaffiliating from CBS in July 2002).
Religious independents – In lieu of being affiliated with a religious broadcaster (such as the Trinity Broadcasting Network, Daystar or 3ABN), religious independent stations instead carry televangelist programs that are acquired off the syndication market and other religious study programs, some of which are produced locally.
Religious-secular independents – Some broadcasters operated by religious entities own independents that feature a mix of religious and secular entertainment programs (the latter type of programming may be subject to editing depending on the station's content requirements), a format that was originated in the 1960s by the Christian Broadcasting Network's television stations; this allows the station to earn revenue through both advertising and viewer donations.
Non-commercial educational independents – Non-commercial educational independents mainly exist in the United States, although one such station exists in Canada; these stations do not maintain a membership with an educational broadcaster such as PBS, opting instead to handle the full responsibility of acquiring educational and entertainment programs intended for distribution to public television stations via syndication, and producing local news, public affairs, instructional, lifestyle and/or documentary programming to fill broadcast hours.
During the 1950s and 1960s, independent stations filled their broadcast hours with movies, sports, cartoons, filmed travelogues, and some locally produced television programs, including in some instances newscasts and children's programs. Independents that were on the air during this period would sign-on at times later than that of stations affiliated with a television network, some not doing so until the early or mid-afternoon hours. Another source of programming became available to independent stations by the mid-1960s: reruns of network programs which, after completing their initial runs, were sold into syndication.
As cable television franchises began to be incorporated around the United States during the 1960s and 1970s, independent stations from large and mid-sized markets were imported by these systems via wire or microwave relay to smaller media markets, which often only had stations that were affiliated with the Big Three television networks (ABC, NBC and CBS); these independents became the first "superstations," which were distributed on a statewide or regional basis. In December 1976, Ted Turner decided to uplink his struggling Atlanta, Georgia station WTCG to satellite for national distribution. Soon, other companies decided to copy Turner's idea and applied for satellite uplinks to distribute other stations; WGN-TV in Chicago, KTVU in Oakland-San Francisco, and WPIX and WOR-TV in New York City would begin to be distributed nationally during the late 1970s and early 1980s (in the case of KTVU, it would revert to being a regional superstation by the early part of the latter decade).
By the start of the 1970s, independent stations typically aired children's programming in the morning and afternoon hours, and movies and other adult-oriented shows (some stations aired paid religious programs) during the midday hours. They counterprogrammed local network-affiliated stations' news programs with syndicated reruns – usually sitcoms and hour-long dramas – in the early evening, and movies during prime time and late night hours. In some areas, independent stations carried network programs that were not aired by a local affiliate.
In larger markets such as New York City, Chicago and Los Angeles, independent stations benefited from a ruling by the Federal Communications Commission (FCC) that barred network-affiliated stations within the top 50 television markets from airing network-originated programs in the hour preceding prime time. This legislation, known as the Prime Time Access Rule, was in effect from 1971 to 1995, and as a result independents faced less competition for syndicated reruns. Some stations in larger markets (such as WGN-TV in Chicago; KTLA, KCOP-TV and KHJ-TV in Los Angeles; KWGN-TV in Denver; and (W)WOR-TV, WPIX and WNEW-TV in New York City) ventured into local news broadcasts, usually airing at 10:00 p.m. in the Eastern and Pacific time zones, and 9:00 p.m. in the Central and Mountain time zones. Network stations aired their late newscasts an hour later.
From the late 1970s through the mid-1980s, independent stations in several U.S. cities, particularly those that had yet to receive a cable franchise, carried a form of a network affiliation through subscription television networks (such as ONTV, Spectrum and SelecTV); these services – which were formatted very similarly to their pay cable counterparts – ran sports, uncut and commercial-free movies (both mainstream and pornographic, broadcasts of the latter often created legal issues that were eventually largely cleared up due to an FCC regulation that legally allowed the broadcast of programs featuring content that would otherwise be deemed indecent when broadcast "in the clear" if the encrypted signal was not visible or audible to nonsubscribers), and on some services, television specials. Independents usually ran the services during the evening and overnight hours in lieu of running movies and other programs acquired off the syndication market by the station, although a few eventually began to carry these services for most of the broadcast day. The services required the use of decoder boxes to access the service's programming (some of which were fairly easy to unencrypt due to the transmission methods stations used to scramble the signal during the service's broadcast hours); some required the payment of an additional one-time fee to receive events and adult films. As cities added cable franchises, thus allowing people to subscribe to conventional premium television networks like HBO and Showtime, nearly all of the over-the-air subscription services had shuttered operations by the end of the 1980s.
Until the late 1970s, independent stations were usually limited to the larger American television markets, due to several factors. Most smaller markets did not have a large enough population to support four commercial stations. Even in markets that were large enough to support a fourth station, the only available license was on a UHF channel allocation. During the analog television era, the reception quality of UHF stations was not nearly as good as stations on the VHF band, especially in areas with rugged terrain (the reverse is true in the present day with the transmission of digital signals). Since independent stations had to buy an additional 16 hours of programming per day – a burden not faced by network-affiliated stations – these factors made prospective owners skittish about signing on a television station as an independent. By the 1970s, however, cable television had gained enough penetration to make independent stations viable in smaller markets. Nearly 300 independent stations existed in the United States by the mid-1980s, in markets of varying sizes. Many of these stations belonged to the Association of Independent Television Stations, a group similar to the National Association of Broadcasters, and which lobbied the FCC on behalf of independents.
In the 1980s, television syndicators began offering original, first-run series such as Fame, Lifestyles of the Rich and Famous, Star Search and Star Trek: The Next Generation (as well as cancelled network series revived for first-run syndication such as Too Close for Comfort, Charles in Charge and It's a Living), and made-for-television movies and miniseries like Sadat. This trend primarily benefited independent stations. Independents scheduled these first-run programs during prime time and on weekends.
In 1986 several independent outlets, led by the Metromedia stations, formed the Fox Broadcasting Company, the first major venture at a fourth U.S. broadcast television network since the DuMont Television Network shut down in August 1956 (which resulted in some of its affiliates, including those owned by Metromedia, becoming independents). Fox made efforts, slowly at first, to have its affiliates emulate a network programming style as much as possible; but in turn, Fox only carried a late-night talk show at its launch in October 1986, and beginning in April 1987, offered one night of prime time programming a week (on Sundays). The network only programmed two hours of prime time programming each night (and, beginning in the 1990s, some children's programming through Fox Kids), but gradually expanded its prime time lineup to all seven nights until January 1993.
The lack of programming in other dayparts forced most Fox affiliates to maintain the same programming model as independent stations during non-prime time slots, and during its early years, on nights without prime time programming from the network. Fox coerced most of its affiliates to air prime time newscasts (there were some holdouts as late as 2013, while many others opted to run outsourced local newscasts from a competing network affiliate) as well as news programming in other dayparts common with other major network affiliates. WSVN in Miami was the first to deviate from the independent-style format of other Fox stations, choosing to expand its news programming when it joined the network in January 1989 to replace national newscasts and late-prime time network programs it aired as an NBC affiliate; this model was replicated by the major network stations owned by New World Communications and SF Broadcasting that switched to Fox in the mid-1990s, and eventually spread to other news-producing Fox and minor network affiliates and independent stations by the 2000s. Still, many Fox stations programmed the bulk of their days with syndicated programming (which, by the 1990s, consisted primarily of tabloid talk shows and eventually court shows in addition to sitcoms, formats that continue to be the norm for these stations into the 2010s).
In September 1993, many independents began carrying the Prime Time Entertainment Network (PTEN), an ad-hoc programming service that emulated a network model, which featured drama series and made-for-TV movies intended for first-run syndication. In January 1995, many remaining independents, including those that carried PTEN, joined upstart networks The WB and the United Paramount Network (UPN). The WB, UPN and their affiliates used a very similar programming model to that initially used by Fox and its stations during their first four years of existence (although neither network would expand their prime time lineups to all seven nights); the launch of those networks resulted in PTEN's demise in 1997, as most stations that became affiliates of UPN and The WB (whose respective founding parents, Chris-Craft Industries and Time Warner, jointly owned PTEN) either dropped the service or moved its lineup out of prime time when those networks launched. Other stations banded together to become charter outlets of the Pax TV (now Ion Television) network in August 1998, although some of the stations that aligned with Pax had earlier affiliated with its predecessor, the Infomall TV Network (inTV), two years before.
The launches of these networks drastically reduced the number of independent stations in the United States; some mid-sized markets would not regain a general entertainment independent until the early 2000s, through sign-ons of unaffiliated stations and disaffiliations by existing stations from other commercial and noncommercial networks. In 2001, Univision Communications purchased several English language independents in larger markets (which mostly operated as Home Shopping Network affiliates until the late 1990s) from USA Broadcasting to form the nuclei of the upstart Spanish language network Telefutura (now UniMás), which launched in January 2002. Several stations affiliated with The WB and UPN became independent again when the respective parent companies of those networks (Time Warner and CBS Corporation) decided to shut them down to form The CW, which launched in September 2006 with a schedule dominated by shows held over from and an affiliate body primarily made up of stations previously aligned with its two predecessors. Some of the newly independent stations subsequently found a new network home through MyNetworkTV, itself created out of the prospect that the UPN affiliates of corporate sister Fox Television Stations would become independents due to The CW choosing to affiliate with CBS Television Stations and Tribune Broadcasting stations in overlapping markets.
As a result of the various network launches that have occurred since the 1986 launch of Fox, true independent stations have become a rarity. The smallest stations, which in the past would have been forced to adopt a locally originated independent program schedule, now have other options – 24-hour-a-day networks that require no local or syndicated programming for the station to carry; some of these networks, such as AMG TV or America One, follow a full-service variety format, while others are devoted primarily to classic television (such as MeTV) and/or films, or carry mainly niche programming. Many stations that are affiliated with the larger post-1980s networks still behave much like independents, as they program far more hours a day than a station affiliated with one of the Big Three networks.
Current independents follow a very different program format from their predecessors. While sitcom reruns are still popular, expanded newscasts and other syndicated programs such as talk shows; courtroom shows; reruns of recent scripted comedy and drama series; and no-cost public domain programming are common. Another type of content being added to many independent station lineups in recent years has been brokered programming, including infomercials, home shopping and televangelist programs; the Federal Communications Commission did not allow infomercials to be broadcast on American television until 1984, but since then, it has proven to be a lucrative, if somewhat polarizing with viewers, way to fill airtime. During the 1990s when infomercials gained popularity, many stations began broadcasting 24 hours a day rather than signing off at night. By filling the overnight hours with infomercials, the station would be able to generate extra revenue where they had previously been off the air. Home shopping programs (mainly simulcasts of cable services that also have over-the-air distribution such as QVC and the Home Shopping Network) or syndicated programs fill overnight time periods on stations that do not run infomercials during that day part.
Since the FCC revised its media ownership rules to permit station duopolies in August 1999, independents that operate on a standalone basis have become quite rare in the United States and, in turn, independents that are senior partners in duopolies are fairly uncommon. With the proliferation of duopolies and local marketing agreements since that point, most independent stations are operated alongside a major network affiliate (more commonly, one of either ABC, NBC, CBS or Fox), which may share syndicated programming with and/or produce newscasts in non-competitive timeslots for its unaffiliated sister. This is because in most markets, independents tend to have lower viewership than that of a network affiliate, and usually fall within part of the FCC's duopoly criteria (which allows a company to own two stations in the same market if one is not among the four highest-rated at the time of an ownership transaction).
Since the mid-1990s, most independent television stations in Canada have merged into television systems (such as CTV Two) by adopting common branding and/or programming, or have become fully owned-and-operated stations of networks with which they had previously had more informal programming arrangements as with CIHF, CICT and CITV, which are all now Global stations. However, this trend was partially reversed in 2009 with the demise of Canwest's E! system, which resulted in three of its stations, with CHCH in Hamilton, CJNT in Montreal and CHEK in Victoria, with CHCH-DT becoming independent; CJNT-DT becoming subsequently affiliated with City in 2012 (later becoming a full-time O&O in 2013) and CHEK-DT becoming independent as well (Although having a secondary affiliation with Yes TV).
CHCH and CHEK are the only television stations in Canada currently operating as independent stations in the American sense of the term. However, since the fall of 2010, these two stations (previously along with CJNT) have resumed sharing some common American programming.
CJON in St. John's, Newfoundland and Labrador, while officially unaffiliated with a network, in practice airs a mix of programming sublicensed from two of Canada's main commercial networks, CTV (which it was formally affiliated with until 2002, with only CTV's news programming being carried on the station since then) and Global, rather than purchasing broadcast rights independently.
CFTU and CFHD in Montreal also operate as independents. However, each of these stations has a specific programming focus: educational programming in the case of the former, and multicultural programming in that of the latter.
Three independent religious stations also exist in Canada: CHNU in the Fraser Valley Regional District, CIIT in Winnipeg, and CJIL in Lethbridge. CIIT and CHNU formerly served as part of the two-station Joytv religious television system from 2005 until the system's dissolution in 2013.
Apart from these, some additional independent stations exist in Canada as community-oriented specialty stations. These stations, such as CFTV-DT in Leamington, Ontario and CHCO-TV in St. Andrews, New Brunswick, transmit at low power.
^ Kanner, Bernice (1985-06-17). "Thinking About a Fourth Network". New York Magazine. New York: 19–23. Retrieved 2009-10-04.
^ Time Warner TV Network to Cover 40% of Nation, The Buffalo News, November 2, 1993. Retrieved May 28, 2013 from HighBeam Research.
|
0.936642 |
It is definitively established that mutations in transcription factor HIF-2α are causative of both neuroendocrine tumors (class 1 disease) and polycythemia (class 2 disease). However, the molecular mechanism that underlies this emergent genotype–phenotype relationship has remained unclear. Here, we report the structure of HIF-2α peptide bound to pVHL-elongin B-elongin C (VBC) heterotrimeric complex, which shows topographical demarcation of class 1 and 2 mutations affecting residues predicted, and demonstrated via biophysical analyses, to differentially impact HIF-2α-pVHL interaction interface stability. Concordantly, biochemical experiments showed that class 1 mutations disrupt pVHL affinity to HIF-2α more adversely than class 2 mutations directly or indirectly via impeding PHD2-mediated hydroxylation. These findings suggest that neuroendocrine tumor pathogenesis requires a higher HIF-2α dose than polycythemia, which requires only a mild increase in HIF-2α activity. These biophysical data reveal a structural basis that underlies, and can be used to predict de novo, broad genotype-phenotype correlations in HIF-2α-driven disease.
Recent discoveries have established that mutations in EPAS1, the gene encoding hypoxia-inducible factor (HIF)-2α transcription factor, are causative of familial and sporadic instances of polycythemia, as well as various neuroendocrine tumors1,2,3. EPAS1-linked polycythemia in the absence of neuroendocrine tumors is known as erythrocytosis type 4 (ECYT4; Mendelian Inheritance in Man (MIM) #: 611783). Patients who develop neuroendocrine tumors present with pheochromocytoma and paraganglioma (PPGL), which are closely related, norepinephrine-producing tumors arising from the neural crest4. Patients can present with either a single or multiple PPGLs. Presentation of multiple PPGLs is sometimes associated with concurrent somatostatinoma, a functional neuroendocrine tumor located in the duodenum, and polycythemia. This syndrome is known as Pacak-Zhuang syndrome2,5. In studies featuring large cohorts of patients, EPAS1 mutations were identified in 5.7% of patients presenting with sporadic PPGLs (18/315, range of 2.3–12%), establishing EPAS1 mutations as a major driver of PPGL6,7,8,9.
EPAS1 mutations have been shown, regardless of associated phenotype, to result in an increase in HIF-2α stability, by disrupting negative regulation via prolyl hydroxylase domain containing enzyme (PHD) and/or von Hippel-Lindau protein (pVHL) affinity to HIF-2α2,10. pVHL acts as the substrate-conferring component of an E3 ubiquitin ligase (pVHL/elongin BC/Cullin-2) and its interaction with HIF-2α is required for the rapid polyubiquitylation and proteasomal degradation of HIF-2α under normoxic conditions11. The interaction of pVHL with HIF-2α requires the hydroxylation of one of two conserved proline residues within the oxygen dependent degradation (ODD) domain of HIF-2α11. The hydroxylation of proline is catalyzed by PHDs and requires iron, ascorbate, α-ketoglutarate (αKG), and molecular oxygen as co-factors and co-substrates, thus allowing PHDs to function as oxygen-sensors11. Mutations in both VHL and EGLN1 (encodes PHD2) are known to cause both polycythemia12,13 and PPGL14,15. VHL mutation associated with PGL, polycythemia, and somatostatinoma has also been reported16. However, pheochromocytoma-associated VHL mutations have previously been suspected of triggering oncogenesis in a HIF-independent manner17.
It has been noted that EPAS1 mutations associated with ECYT4 are genetically distinct from those that are associated with neuroendocrine tumors3. However, to date, HIF-2α activating mutations associated with different phenotypes (ECYT4, Pacak-Zhuang Syndrome, sporadic PPGL) have not been studied in parallel. In addition, the studies of HIF-2α-driven disease have lacked structural insight into the interaction between HIF-2α and its negative regulator pVHL at the atomic level. Thus, the molecular basis for the emerging genotype–phenotype relationship in HIF-2α-driven disease has remained unclear.
As of 1 January 2018, 66 cases of HIF-2α-driven disease have been reported in the literature2,5,6,7,8,9,10,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35. In one exceptional case, mutation of EPAS1 was associated with central nervous system hemangioblastoma36. However, due to the rarity of HIF-2α-driven hemangioblastoma in reported literature, we focused on the role of HIF-2α in PPGL and polycythemia. Detailed clinical features of these reported cases are listed in Supplementary Data 1. We have identified four classes of disease (Table 1); patients who present with PPGL in conjunction with somatostatinoma and polycythemia (class 1a), patients who present with PPGL and polycythemia (class 1b), patients who present with PPGL alone (class 1c), and patients who present with polycythemia alone (class 2). Others have also categorized diseases associated with EPAS1 mutations in a similar fashion3, and class 2 disease has been previously described as ECYT4 while classes 1a and 1b have been jointly described as Pacak–Zhuang syndrome.
All HIF-2α mutations described to date are heterozygous and the majority are single missense mutations. There are a few reported cases of patients with multiple missense mutations, with both mutations affecting the same allele, or small in-frame deletions (Table 1). With one exception (patient 15, Supplementary Data 1), all class 1 mutations are defined as being somatic. Conversely, class 2 disease patients present with germline mutations and as families in 60% of reported cases (Table 1).
Regardless of the associated clinical phenotype, over 90% of reported HIF-2α mutations are located between amino acid residues 519 and 544 (Fig. 1a). Within this region, there is a clear topographical distribution of mutations associated with different phenotypes. Mutations associated with class 1 disease are typically located between amino acid residues 529 and 532, which contain proline 531, the primary hydroxylation site of HIF-2α (Fig. 1b). Conversely, class 2 mutations are found exclusively between residues 533 and 540 (Fig. 1b). However, this topographical segregation is not absolute, as mutations of D539 are found in patients of all disease classes. Furthermore, class 1 mutations are also found outside of the 529-532 hotspot, including nearby mutations of T519, L542, and P544 and more distant mutations of amino acids S71, M368, and F374 (Fig. 1a). Interestingly, there is no overlap in the specific mutations associated with class 1 and class 2 disease, as the mutations affecting D539 are not the same among class 1 and class 2 (D539N in class 1a and 1b, D539Y in class 1c, D539E in class 2; Fig. 1c). However, there is substantial overlap in the mutations that give rise to the various subclasses of class 1 disease. For example, the A530V mutation has been reported in patients with class 1a, class 1b, and class 1c disease (Fig. 1c). Thus, the broad phenotypic differences between class 1 and class 2 disease stem from genetic differences while the differences between subclasses of class 1 disease might be related to the presence of additional mutations or the occurrence of EPAS1 mutations during embryonic development or later in life.
Our first approach for testing the differences between class 1 and class 2 EPAS1 mutations was to employ a suite of mutation prediction software, including PolyPhen-2, SIFT, MutationTaster2, and PROVEAN. Of the tested mutation prediction software, not one was able to consistently distinguish between class 1 and class 2 mutations. MutationTaster2 annotated all class 1 mutations as disease causing while SIFT and Polyphen-2 classified 77.8% (14/18) and 83.3% (15/18) of class 1 mutations as probably damaging, respectively. The three aforementioned mutation prediction software classified 100% of class 2 mutations as probably damaging (Supplementary Table 1). However, PROVEAN annotated 61.1% of class 1 mutants as deleterious (mean PROVEAN score of −4.80) and only 33.3% of class 2 mutants as deleterious (mean PROVEAN score of −3.43) when a threshold of −4.1 was used (Fig. 1d). Interestingly, the five class 1 mutations with the least negative PROVEAN score are those found either C-terminal or N-terminal of amino acids 529–542 (Fig. 1d). Due to those five class 1 mutations, there is a greater percentage of ‘benign’ mutations present within class 1 disease than present within class 2 disease. Thus, mutation prediction software was ultimately inadequate at predicting disease class, as mutations from both class 1 and class 2 were found with similar PROVEAN scores.
The failure to distinguish class 1 mutations from class 2 mutations via in silico approaches provided the impetus for us to pursue a biochemical approach, guided by structural insight obtained via X-ray crystallography. As HIF-2α has not been co-crystallized with pVHL, it is not formally known whether it shares the same binding motif as HIF-1α, thereby potentially limiting the utility of existing HIF-1α-pVHL structures37,38. There are indeed several amino acids in the immediate vicinity of the primary hydroxylation site that are not conserved between HIF-1α and HIF-2α but are highly conserved evolutionarily (Fig. 2a). The two notable sites of non-conservation are HIF-1α Met561/HIF-2α Thr528 and the insertion of HIF-2α Gly537, which is not present in HIF-1α. Intriguingly, G537 is the most commonly mutated residue in HIF-2α driven disease while the substitution of the non-polar, sulfur-containing Met residue with a polar Thr residue supports the notion that HIF-2α peptide might not bind pVHL with an identical motif as HIF-1α. Further, attempts at modeling the HIF-2α-pVHL interaction and predicting the effect of mutations on pVHL affinity to HIF-2α via computational approaches failed to differentiate class 1 and 2 mutations39.
We purified pVHL-elongin B-elongin C (VBC) trimeric complex to homogeneity from bacterial sources (Supplementary Figure 1). We pursued an unbiased sparse matrix crystallography approach rather than attempt co-crystallization with reagents used to co-crystallize HIF-1α with VBC since we were unsure whether HIF-2α would bind to pVHL with a motif similar to that of HIF-1α. A complex of hydroxylated HIF-2α peptide (523–541) bound to VBC trimer was co-crystallized and the structure was determined at 2.0Å resolution (PDB code: 6BVB). Data collection and structure determination statistics are presented in Supplementary Table 2. Clear electron density was observed for residues 527–540 of the hydroxylated HIF-2α peptide (Supplementary Figure 2). The HIF-2α peptide binds to pVHL as an extended strand with N-terminal (residues 527–534) and C-terminal (residues 539–540) pVHL contact sites (Fig. 2b). The root-mean square displacement (RMSD) of Cα atoms between a previously reported apo VBC structure (PDB code: 1VCB)40 and VBC in our co-crystal structure is 0.94 Å, suggesting that VBC does not undergo a conformational change upon binding of HIF-2α peptide. A lack of conformational change was also noted upon HIF-1α peptide binding37. Further, RMSD of Cα atoms of the HIF-2α peptide compared with HIF-1α peptide from previously reported co-crystal structures also revealed rather minor changes in conformation (0.78 Å with 1LM8, 0.85 Å with 1LQB). The substitution of the amino acid three residues N-terminal of the primary hydroxylation site (Met561/Thr528) had no effect on the local conformation, with both residues packed against pVHL F91 (Fig. 2c). The insertion of Gly537, seen in HIF-2α, results in an increased sinusoidal nature of the HIF-2α peptide but that only results in local conformational changes (Fig. 2d).
The majority of contacts between HIF-2α and pVHL occur at the N-terminal pVHL contact site through hydrogen bond and van der Waals interactions. The hydroxylated P531 (Hyp531) is almost completely buried in a highly complementary pVHL pocket composed of residues W88, Y98, I109, S111, Y112, H115, and W117 (Fig. 3a and Supplementary Figure 3). The HIF-2α Hyp531 hydroxyl is coordinated by two H-bonds to the sidechain of pVHL S111 and H115, and a third H-bond is formed between the Hyp531 carbonyl oxygen atom and the sidechain of pVHL Y98 (Fig. 3a). The carbonyl oxygen of HIF-2α E527 hydrogen bonds to the side chain of both pVHL N67 and pVHL R69 (Fig. 3a). Furthermore, two hydrogen bonds are formed between the mainchain amide nitrogen and carbonyl oxygen atoms of HIF-2α Y532 and pVHL H110 (Fig. 3a). Residues 535–538 form a kink that does not interact with pVHL (Fig. 3a and Supplementary Figure 3). F540 serves as a C-terminal anchor, contacting pVHL G106, that re-establishes contact between pVHL and HIF-2α (Fig. 3a).
Interestingly, the majority of reported class 2 mutations (82%) are localized to the kink region whereas class 1 mutations affect residues making contact with pVHL (Fig. 3b). Mutations of M535 and G537 are the most common class 2 mutations (Fig. 1b) and are localized to this kink region (Fig. 3a, b). Temperature factor analysis reveals that residues C-terminal of the kink region are mobile, and importantly, that the residues mutated in class 1 disease have a lower temperature factor and bind in a more rigid manner (Fig. 3c). Thus, a prediction based on our structural analysis is that class 1 mutations would have a greater negative impact on pVHL-HIF-2α interaction than class 2 mutations.
To test our hypothesis that class 1 mutations have a more adverse effect on pVHL affinity (referring specifically to the strength of interaction between HIF-2α peptide or protein and pVHL), we conducted both steady-state and kinetic binding experiments. Previous ELISA-based experiments with polycythemia-associated HIF-2α mutants suggested that class 2 mutants had no effect on VBC affinity31. Similarly, we show that steady-state ELISA experiments conducted with HIF-2αOH (amino acids 523-541) peptides (i.e., hydroxyl group synthetically added to P531) and purified VBC complex suggested that both class 1 and class 2 mutations had negligible or minimal effect on pVHL affinity (Fig. 4a), with the exception of the P531A mutant, which completely abolished binding to VBC as expected. However, we found that class 1 mutations, in general, have a more deleterious effect on pVHL affinity than class 2 mutations when analyzed via pull-down experiments using in vitro transcribed and translated (IVTT) pVHL under both stringent and mild buffer conditions (Fig. 4b and Supplementary Figure 4). Intriguingly, HIF-2αOH A530V class 1 peptide consistently bound to pVHL or VBC with an affinity similar to that of HIF-2αOH WT peptide and other class 2 mutants, such as M535I.
To gain further quantitative insight, we next analyzed the effect of HIF-2α mutations on the kinetics of HIF-2α peptide binding to pVHL via biolayer interferometry (BLI)41, which measures the rate of association and dissociation of an analyte molecule (purified VBC complex) to and from an immobilized bait molecule (biotinylated HIF-2αOH peptide). Consistent with our steady-state pull-down experiments, BLI experimentation revealed that HIF-2αOH WT peptide had the highest affinity for VBC (Kd = 196 nM; ka = 4.1 × 104 Ms−1; kd = 7.8 × 10−3 s−1; Fig. 4c, Table 2, and Supplementary Figure 5). No binding between HIF-2α P531A peptide and VBC was detected, which validated the stringency of our experimental conditions. Most mutant HIF-2αOH peptides displayed decreased binding to VBC, consistent with steady-state pull down experiments (Table 2). Moreover, class I mutants increased the rate of dissociation, as highlighted in a rate plane with isoaffinity diagonals (RaPID) plot (Fig. 4d). The four mutations with the most deleterious effect on pVHL affinity all belonged to class 1 (L529P, A530T, P531A, Y532C; Fig. 4d, Table 2). The L529P mutation possibly results in steric clash with pVHL N67, resulting in a disruption of its hydrogen bond to HIF-2α E527. Y532 normally packs against the sidechain of pVHL H110 and the Y532C mutation would result in diminished van der Waals interaction. The P531A mutation would result in the loss of important hydrogen bonds, shown in Fig. 3a. Interestingly, and consistent with our steady-state observations, the A530V (Kd = 219 nM) and A530T (Kd = 513 nM) mutations had different effects on pVHL affinity, despite affecting the same residue. The A530V HIF-2αOH peptide dissociated more slowly from VBC than WT (kd = 5.8 × 10−3 s−1) whereas the A530T HIF-2αOH peptide (kd = 18 × 10−3 s−1) behaved similarly to the other class 1 mutant peptides. Due to the extensive hydrogen bond network involving HIF-2α Hyp531, it is possible that the polar nature of the A530T mutation results in a degree of interference. Specifically, A530 points toward pVHL Y98, which hydrogen bonds to the Hyp531 carbonyl oxygen atom (Fig. 3a). Hydrogen bonding between the A530T mutant residue and pVHL Y98 may disrupt the Hyp531 pocket, promoting dissociation of pVHL. The decreased dissociation rate seen with the A530V (Table 2) mutation lends a degree of support to this argument, as the nonpolar mutation would possibly result in increased van der Waals interactions with the adjacent pVHL W88 residue without possibly hydrogen bonding to pVHL Y98.
Interestingly, the G537R class 2 mutation (Kd = 348 nM; ka = 3.0 × 104 Ms−1; kd = 10 × 10−3 s−1) had a near identical effect on the kinetics of binding to VBC as did the F540L class 2 mutation (Kd = 345 nM; ka = 3.1 × 104 Ms−1; kd = 10 × 10−3 s−1), despite being localized to the kink region that does not make any significant contacts with pVHL. However, based on the structure of HIF-2α peptide bound to pVHL (Fig. 3a), mutation of G537 to a bulkier amino acid (tryptophan or arginine; class 2 mutations) is predicted to result in steric clash with pVHL R108. Such a mutation would disrupt the kink region and result in displacement of the C-terminal F540 residue and loss of stabilizing contacts. This is an important observation as G537 is not conserved in HIF-1α and is also the most commonly mutated residue in HIF-2α driven disease (Fig. 1a, b). Other class 2 mutant peptides (M535I, D539E) bound to VBC with little defect, as compared to WT (Fig. 4d, Table 2, and Supplementary Figure 5). Thus, although BLI kinetic analysis revealed a distinguishable kinetic trend between class 1 and class 2 mutations, the disease class associated with HIF-2α mutations could not be absolutely predicted solely by determining affinity for pVHL due to outliers like A530V.
Considering that prolyl hydroxylation is indispensable for HIF-2α binding to pVHL, we next examined the notion that the A530V mutation negatively influences hydroxylation of HIF-2α via PHD2, which would attenuate HIF-2α A530V binding affinity for pVHL. We conducted an in vitro hydroxylation assay utilizing unmodified peptides (amino acids 523–542) incubated with purified HIS6-PHD2 (catalytic core, amino acids 181–426). As expected, HIF-2α WT peptide bound robustly to pVHL following HIS6-PHD2 treatment (Fig. 5a). Similar to using synthetically hydroxylated peptides (see Fig. 4b), M535I class 2 mutant still retained affinity for pVHL following incubation with HIS6-PHD2 (Fig. 5a). However, A530V peptide was only minimally able to bind pVHL, much like the A530T mutant (Fig. 5a). These results suggest that the A530V mutation impedes PHD2-mediated hydroxylation of P531, which negatively impacts HIF-2α binding affinity for pVHL.
Due to the importance of L574 for hydroxylation of HIF-1α42, the fact that this residue is conserved in HIF-2α (L542), and the observation that the residue is mutated in class 1 disease (L542P, patient 7 in Supplementary Data 1), we posited that this mutation specifically affects hydroxylation but not pVHL affinity per se, similar to the A530V class 1 mutation. As predicted, HIF-2α L542P peptide failed to bind pVHL following incubation with HIS6-PHD2, which was similarly observed with HIF-2α WT peptide lacking L542 (523–541; Fig. 5b). However, synthetic addition of a hydroxyl group to P531 in HIF-2αOH L542 peptide rescued binding to pVHL with an affinity similar to HIF-2αOH WT peptide, confirming that the L542P mutation specifically abolishes PHD2-catalyzed hydroxylation (Fig. 5b). These results demonstrate that a subset of class 1 mutations specifically disrupt PHD2-mediated regulation, which ultimately leads to a severe reduction in pVHL binding. In addition, these results prove that the L542 residue is absolutely required for hydroxylation, despite published methodology suggesting otherwise2.
The presence of class 1 HIF-2α mutants that bind pVHL like WT when synthetically hydroxylated but fail to be hydroxylated by PHD2 suggested to us that class 1 and class 2 mutations may differentially affect PHD2 binding. To first test this hypothesis, we performed steady-state pull-down experiments with HIF-2α peptides (523–542) and purified HIS6-PHD2 (181–426). To stabilize the interaction between enzyme and substrate, it was necessary to include MnCl2 and N-oxalylglycine (NOG) in the binding buffer. Mn2+ and NOG substitute for Fe2+ and αKG, respectively, which stabilizes the HIF-2α-PHD2 interaction while preventing enzymatic turnover. A similar strategy was employed during co-crystallization of HIF-1α peptide with PHD243. We observed that all tested HIF-2α mutations result in decreased affinity for PHD2 (Supplementary Figure 6a). However, the M535I class 2 mutant was not as deleterious in this regard, which is consistent with its ability to be hydroxylated by PHD2 in vitro (Fig. 5a). Next, we co-transfected HEK293a cells with 3xFLAG-HIF-2α ODD and HA-PHD2 constructs. Immunoprecipitation of 3xFLAG revealed that all HIF-2α mutant ODD constructs bound less PHD2 than WT HIF-2α ODD (Supplementary Figure 6b). The increased binding of the M535I mutant to PHD2 was not observed in this experiment. One important caveat is that the HIF-2α ODD constructs contain both the P405 and P531 sites. Thus, the residual PHD2 binding observed among HIF-2α mutants may partially be driven by the P405 site, which may mask differential PHD2 binding among the HIF-2α mutant ODD constructs.
To further evaluate the negative effect of HIF-2α mutations on pVHL affinity, we transiently expressed full-length HIF-2α (WT and representative class 1 and class 2 mutants) in combination with FLAG-pVHL in human embryonic kidney epithelial HEK293a cells that express endogenous PHD2. We observed that under this experimental condition, class 1 mutants bound lower levels of pVHL than class 2 mutants (Fig. 5c). Notably, A530V class 1 mutant bound poorly to pVHL in our cellular system, which corroborated our earlier in vitro binding assay following in vitro PHD2-mediated hydroxylation (Fig. 5a). These results collectively support the notion that the observed differential impact on hydroxylation via PHD2 and/or binding affinity to pVHL by class 1 versus class 2 HIF-2α mutations underlies the emerging genotype-phenotype relationships seen in patients.
Loss-of-function mutations in VHL, which encodes the tumor suppressor pVHL, cause VHL disease, an autosomal dominant cancer disorder with predisposition to central nervous system hemangioblastoma, PPGL, and clear cell renal cell carcinoma (ccRCC) as well as polycythemia, and the majority of sporadic cases of hemangioblastoma and ccRCC44. These diseases are thought to be driven, in part or wholly, by deregulation of HIF-α, the best characterized target of pVHL-mediated negative regulation17. Concordantly, it is now known that mutations in EPAS1, which encodes HIF-2α, also cause polycythemia, PPGL, and somatostatinoma. Upon analyzing every reported case (66 as of 1 January 2018) of EPAS1 mutations in the aforementioned diseases, we propose the following classification system for HIF-2α-driven disease with class 1 disease featuring PPGL, which is subcategorized into class 1a featuring PPGL with somatostatinoma and polycythemia, class 1b featuring PPGL and polycythemia (classes 1a and 1b are also jointly known as Pacak-Zhuang syndrome), and class 1c featuring only PPGL. Class 2 disease features exclusively polycythemia, which has been previously described as ECYT4 (Table 1). A recent publication examined a cohort of patients with congenital cyanotic heart disease and PPGL. Of the five individuals, four were found to have somatic EPAS1 mutations, all of which resulted in mutation of either amino acid residue A530 or P531 (P531S (x2), P531R, A530P)45. Thus, continued study of patients with PPGL affirms the emergence of EPAS1 mutations as a major driver of neuroendocrine tumor pathogenesis and solidifies the importance of systemic hypoxia or pseudohypoxia in PPGL tumorigenesis.
Co-crystal structure of hydroxylated HIF-2α peptide encompassing residues 523–541, which cover over 90% of bona fide disease-causing EPAS1 mutations identified to date, bound to VBC complex revealed that class 1 mutations affect residues contacting pVHL while the vast majority of reported class 2 mutations are localized to a non-contacting kink region (residues 535–538; Fig. 3b). This includes mutations of G537, which account for 50% of class 2 mutations. Further, residues C-terminal of the kink region, despite making contact with pVHL (Supplementary Figure 3), are more mobile than residues proximal to Hyp531, as indicated by temperature factor analysis (Fig. 3c). When considering both the kink region and the mobile C-terminal region, almost 90% of class 2 mutations affect residues predicted to contribute marginally to pVHL-HIF-2α interface stability. Conversely, over 80% of class 1 mutations affect residues that make substantial contact with pVHL (i.e. residues 529–532). In keeping with these structural data-based predictions, we found that the HIF-2α peptides with the lowest affinity for pVHL are indeed class 1 mutants (L529P, A530T, P531A, Y532C; Fig. 4).
Interestingly, the trend of greater loss of pVHL affinity associated with class 1 mutants was apparent when conducting kinetic binding experiments with purified VBC (Fig. 4d) but not easily appreciated when conducting steady-state ELISA experiments with VBC (Fig. 4a). In light of the BLI-measured dissociation constants (Kd) for WT and mutant HIF-2αOH peptides (200–500 nM; Table 2), it is clear that the minimum concentrations required to obtain a detectable signal during an ELISA experiment (575 nM) are saturating. As previously mentioned, prior attempts to characterize class 2 mutants by ELISA failed to identify any change in VBC affinity, when compared to WT HIF-2αOH peptide31. These observations highlight the importance of kinetic binding analysis for studying disease-associated HIF-2α mutations, which has not been previously reported.
Although the majority of class 2 mutations are localized to the non-contacting kink region or flexible C-terminal region, mutations of I533 and P534 are also reported to cause polycythemia in the absence of neuroendocrine tumor development (Fig. 1b, Supplementary Data 1). These residues are proximal to Hyp531, make contacts with pVHL, and are predicted to contribute to the stability of the pVHL-HIF-2α interface. In particular, I533 binds pVHL more deeply than any other residue, aside from Hyp531 (Supplementary Figure 3, 7). However, the disease-causing mutations affecting these residues, I533V and P534L, are conserved mutations that can be accommodated at the pVHL-HIF-2α interface without introducing steric clash and with the loss of only minimal van der Waal interactions, which likely explains why these mutations are associated with class 2 disease phenotype despite affecting residues that make significant contact with pVHL. As a corollary, a prediction is that a bulky substitution at either of these sites, such as an I533F (C.1597 A > T) or P534R (C.1601C > G) missense mutation, would introduce steric clash that would destabilize the HIF-2α-pVHL binding interface. Although not yet reported in literature, any patient confirmed to carry these de novo mutations should be monitored for neuroendocrine tumors, as they would be predicted to have or develop class 1 disease.
A limitation of our study is the inability to provide a mechanistic understanding for the sub-classes of HIF-2α-driven disease, namely class 1a, 1b, and 1c disease. Whereas no mutation has been shown to cause both class 1 and class 2 disease, several mutations have been shown to cause two or more of the sub-classes of class 1 disease (Fig. 1c). Thus, a genotype–phenotype study of this phenomenon was not possible. However, it is possible to speculate on a possible mechanism that underlies the presence of sub-classes of class 1 disease based on the timing of mutations during embryonic development, which would have implications on the cell lineages affected. It has been previously shown that HIF-2α activity is inhibited in embryonic stem cells via a titratable repressor46. Increased expression of HIF-2α is thought to be required to overcome this form of negative regulation46, which has been associated with increased tumorigenicity via the activation of octamer-binding transcription factor 4 (Oct4)47,48, a transcription factor that maintains pluripotency49. Hypoxia response elements in Oct4 loci have been shown to be bound by HIF-2α, but not by HIF-1α50. Notably, Oct4 mRNA has been found to be elevated in patients with class 1 disease9. An intriguing speculation, therefore, is that class 2 mutations do not result in sufficient HIF-2α activation to overcome repression of HIF-2α during embryogenesis, while class 1 mutations result in sufficient HIF-2α activation via attenuation of pVHL-mediated degradation to transactivate HIF-2α targets, such as Oct4, necessary for PPGL pathogenesis. Concordantly, a subset of class 1 mutations likely occur during embryogenesis despite being sporadic in nature, due to the presence of multiple neuroendocrine tumors of distinct cellular lineages (PPGL, somatostatinoma) and congenital polycythemia in patients with class 1a and class 1b diseases (Table 1). Moreover, some patients present with HIF-2α mutations in tissues not affected by disease at detectable but non-heterozygous (i.e. mosaic) levels, which provides further evidence that mutations occur before differentiation of a cell lineage, as to allow multiple tissues to be affected20. Our hypothesis is consistent with the observation that VHL mutations that specifically cause pheochromocytoma appear to disrupt neuronal culling during embryogenesis via dysregulation of atypical protein kinase C in a HIF-independent process51. However, one confounding observation is that patients with class 1c disease develop PPGL later in life, usually present with only one neuroendocrine tumor, and do not develop polycythemia (Supplementary Data 1). We speculate that this phenomenon may be related to the degree of systemic hypoxia a patient experiences. In patients with germline mutations in SDHD, which encodes succinate dehydrogenase subunit D, living at higher altitudes was associated with an increased likelihood of developing multiple PPGL tumors52. Further investigation is required to determine how HIF-2α activation results in the transformation of chromaffin and paraganglia cells and to delineate the possible role of Oct4 in HIF-2α-driven PPGL tumorigenesis.
Here, we reveal the molecular basis underlying the broad class segregation emerging in HIF-2α-driven disease in which EPAS1 mutations that cause significant disturbance to the HIF-2α-pVHL interaction interface are associated with class 1 disease while those causing a mild disturbance are associated with class 2 disease. A corollary is that PPGL pathogenesis observed in class 1 disease would require a higher HIF-2α dose than polycythemia, which appears to only require a mild increase in HIF-2α stability as observed with class 2 mutations. Notably, the structure-guided information presented here would be powerful in predicting the broad class phenotype of de novo EPAS1 mutations in patients.
Missense mutations of EPAS1 (UniProt ascension number: Q99814; Genbank transcript ID: NM_001430; Protein Ensembl ENSP ID: ENSP00000263734) identified in patients with disease were analyzed using the Polyphen-253, SIFT54, MutationTaster255, and PROVEAN56 prediction software. SIFT and PROVEAN predictions were simultaneously determined using PROVEAN Protein Batch (http://provean.jcvi.org; accessed 9 August 2017). A threshold score of -4.1 and 0.05 was used for PROVEAN and SIFT analysis, respectively. A threshold score of −4.1 has been shown to result in increased specificity when using the PROVEAN software56.
HIF-1α and HIF-2α sequences from mouse (M. musculus), flamingo (P. ruber ruber), frog (X. tropicalis), zebra fish (D. rerio), epaulette shark (H. ocellatum), fly (D. melanogaster), worm (C. elegans), and anemone (E. pallida) were identified with the protein BLAST algorithm using human HIF-1α (GI:4504385) and HIF-2α (GI:1805268) as the search sequence. Amino acid sequences centered around the primary hydroxylation site were aligned using Clustal Omega57.
The following plasmids have been previously described; pcDNA3-3xFLAG-VHL30(full-length; residues 1–213), pcNDA3-HA-VHL3058, pcDNA3-HA-HIF2A, pcDNA3-HA-PHD2, pACYCDuet-1 plasmid encoding untagged elongin B and elongin C (17–112), pGEX-4T-1-GST-VHL19 (54–213)59, and pcDNA3-HA-HIF2A P531A60. Mutant pcDNA3-HA-HIF2A full-length constructs were generated via site-directed mutagenesis. pcDNA3-3xFLAG-HIF2A ODD domain (390–554) constructs were sub-cloned via PCR. pET-46 HIS6-PHD2 plasmid was cloned via ligation independent methods. Primers used for cloning are listed in Supplementary Table 3.
Anti-HA antibody was obtained from Cell Signalling Technology (C29F4; 1:2000 dilution western blot). Anti-elongin B (11447; 1:500 dilution ELISA) and Anti-HIS (8036; 1:1000 dilution western blot) were obtained from Santa Cruz. Anti-tubulin (T5168; 1:5000 western blot), anti-vinculin (V9264, 1:10,000 dilution western blot) and anti-FLAG (F1804; 1:5000 dilution western blot; 1:1000 dilution immunoprecipitation) were obtained from Sigma-Aldrich.
HIF-2α peptides, with N-terminal biotinylation and C-terminal amidation modifications, were custom synthesized by Genscript. For pVHL interaction studies, a WT HIF-2α peptide containing amino acid residues 523–541 was used: ELDLETLA[Hyp]YIPMDGEDFQ (Hyp denotes hydroxylated proline). For hydroxylation assays, or studies involving the L542P mutant, the following WT HIF-2α peptide, containing amino acid residues 523-542, was used: ELDLETLA[Hyp/P]YIPMDGEDFQL. All peptides were reconstituted to 2 mg/mL, as measured by A280, using sterile DMSO, aliquoted, and stored at −80 °C.
HIS6-PHD2 (181–426) was expressed in BL21(DE3) E. coli cells (Novagen, Cat. No. 69450) and purified according to a published protocol61. Cell cultures were grown to OD600 = 0.8 and induced with a final concentration of 0.5 mM IPTG for 3.5 h at 37 °C. Bacterial pellets were resuspended in buffer B (40 mM TRIS-HCl pH 7.9, 500 mM NaCl) supplemented with 5 mM imidazole and lysed using a cell disruption unit at a pressure of 30 kPSI. Cell lysate was cleared via centrifugation (40,700 g for 40 min). Cleared lysate was applied to a column of nickel sepharose resin (Qiagen). The column was rinsed with buffer B supplemented with 5 mM imidazole and washed with buffer B supplemented with 60 mM imidazole. Protein was eluted with buffer B supplemented with 1 M imidazole. Protein solution was concentrated using a 4-mL centrifugal concentrator with a molecular weight cut-off of 10,000 Da (Pall corporation). The concentrated protein solution was purified on a Superdex 200 10/300 size exclusion chromatography column equilibrated with 50 mM Tris-HCl pH 7.5. Purity was confirmed via SDS-PAGE analysis. Aliquots of protein were frozen at −80 °C at a concentration of 2 mg/mL prior to experimentation.
BL21(DE3) E. coli cells were co-transformed with a construct encoding N-terminal GST-tagged pVHL19 (54–213) and a dual expression construct encoding untagged elongin B (full-length, 1–118) and elongin C (17–112). 1 L cultures of bacteria were grown to an OD600 of approximately 0.6 and expression of the VBC complex was induced with a final concentration of 1 mM IPTG for 3.5 h at a temperature of 37 °C. Bacterial pellets were resuspended in buffer A (20 mM HEPES pH 7.4, 200 mM NaCl) freshly supplemented with 10 mM DTT and lysed using a cell disruption unit at a pressure of 30 kPSI. Cell lysate was cleared via centrifugation (34,000 g for 40 min). Cleared lysate was applied to a column of glutathione sepharose resin (GE Life Sciences). The column was washed with buffer A and protein was eluted with buffer A supplemented with 10 mM reduced glutathione. Protein solution was concentrated using a 4-mL centrifugal concentrator with a molecular weight cut-off of 3500 Da (Pall corporation). The concentrated protein solution was purified on a Superdex 200 10/300 size exclusion chromatography column equilibrated with 20 mM HEPES pH 7.4, 200 mM NaCl, and 1 mM DTT. The monomeric VBC complex was diluted to a concentration of 0.7 mg/mL, which was empirically determined to prevent further aggregation of the protein. The GST-tag was cleaved via incubation with 1 U thrombin per mg of VBC protein at 4 °C. Near complete cleavage of the GST-tag was achieved after incubation for 60 h. The protein solution was applied to a glutathione sepharose column to remove free GST. The protein solution was concentrated as discussed above and size exclusion chromatography was employed to purify soluble, monomeric VBC complex and exchange into a buffer of 5 mM HEPES pH 7.4, 200 mM NaCl, and 1 mM DTT. Purity was confirmed via SDS-PAGE analysis. Aliquots of protein were frozen at −80 °C at a concentration between 1–2 mg/mL prior to biochemical and biophysical experimentation.
Freshly purified VBC complex (see above) was incubated with a 2-molar excess of HIF-2αOH peptide for 30 min on ice. Subsequently, the tetrameric complex was concentrated to 10 mg/mL. Sparse matrix screening yielded small crystals in 0.1 M bis-tris pH 6.5, 0.2 M Li2SO4, and 25% (w/v) PEG 3350 (condition 23 in the Microlytics MCSG-2 screen). Initially, crystals could not be reproduced in either hanging or sitting drop experiments. However, spherulites obtained in 0.1 M bicine pH 9.0, 20% (w/v) PEG 6000 (condition 30, MCSG-2), when used as seeds allowed for crystal growth in 0.1 M Bis-Tris pH 6.5, 0.2 M Li2SO4, 25% (w/v) PEG 3350. Growth of large, singular, diffraction quality crystals was achieved in sitting drops incubated at 20 °C, with a protein concentration of 8 mg/mL, and the use of seed as an additive.
Crystals were cryo-protected with perfluoropolyether oil (Hampton Research) prior to flash cooling to 100 K. X-ray data was subsequently collected on beamline 08ID-1 at the Canadian Light Source using a Pilatus 6 M detector. XDS62 was used to index and scale crystallographic data. The crystals diffracted to 2.0 Å resolution and belonged to the space group P43212 with one complex per asymmetric unit. The structure was determined via molecular replacement using the coordinates for VBC (PDB code: 1lm8)38. Coot63 and Phenix64 were used to carry out iterative cycles of manual building and refinement, respectively. MOLPROBITY and Coot were used to validate the geometry and model in the structures. Residues 523-526 and 541 of the HIF-2α peptide are disordered and not modeled, while the sidechain of D539 is disordered and built as a Cβ stub. No Ramachandran outliers are present in the final model. Data collection and refinement statistics are presented in Supplementary Table 2. The interface between the HIF-2α peptide and pVHL complex was analyzed via Protein Interfaces, Surfaces and Assemblies (PISA)65. PISA was used to calculate the buried area percentage. CLICK was used to calculate RMSD of Cα atoms66. Pymol was used to render all structural representations.
A 96-well streptavidin-coated plate (Quidel) was hydrated with ~200 μL of buffer A per well. Biotinylated HIF-2αOH peptide was diluted to 5 μg/mL in blocking solution (buffer A supplemented with 0.5% (w/v) BSA, 0.02% (v/v) Tween-20, and 1 mM DTT). 0.5 μg of biotinylated HIF2αOH peptide was immobilized in each well. Wells were washed 5x with wash buffer (buffer A supplemented with 0.1% (v/v) Tween-20) followed by a 2 h incubation at room temperatures with 400 μL of blocking solution. 100 μL of VBC complex, at various concentrations (1 μg/mL, 5 μg/mL, and 25 μg/mL), was incubated for 2h at room temperature and then washed 5x with wash buffer. 100 μL of primary anti-elongin B mAb diluted (1:500) in blocking solution was incubated overnight at 4 °C. The plates were washed 5x prior to incubation with 100 μL of secondary goat anti-rabbit IgG mAb diluted 1:1000 in blocking solution for 1 h at room temperature. Following the final wash step, the plates were developed according to manufacturer’s recommendations with ready-to-use TMB1 reagent (Thermo-fisher, Cat. No. 34028) for 20 min before being quenched with 2 N H2SO4. Absorbance at 450 nm was measured using a plate reader. Three independent experiments were performed in duplicate. Absorbance from a blank with no immobilized peptide was subtracted from other values. A two-way ANOVA with Bonferroni post hoc test was conducted to test for statistical significance. A p value below 0.05 was considered significant.
The in vitro pVHL-HIF-2α binding assay was performed according to a previously published protocol67. HA-VHL30 was expressed in a transcription and translation (TNT) rabbit reticulocyte lysate system (Promega, Cat. No. L1170) and incubated with 2 μg of biotinylated HIF-2αOH peptide (WT or mutant), immobilized on streptavidin agarose beads, in either 500 μL of EBC buffer (50 mM Tris-HCl pH 8.0, 120 mM NaCl, 0.5% (v/v) NP-40; stringent buffer conditions) or buffer A supplemented with 0.02% (v/v) Tween-20 (mild buffer conditions) for 2 h at 4 °C. Following incubation, beads were either washed 5x with NETN buffer (20 mM Tris-HCl pH 8.0, 100 mM NaCl, 1 mM EDTA, 0.5% (v/v) NP-40; stringent) or buffer A supplemented with 0.1% (v/v) Tween-20 (mild). Biotinylated peptide was pulled down via streptavidin agarose beads and protein was eluted by boiling beads in sample buffer. Protein levels of HA-VHL30 were determined by western blotting. Uncropped western blots are provided in Supplementary Figure 8.
5 μg of biotinylated HIF-2α peptide (WT or mutant) was immobilized on streptavidin agarose beads and incubated with a 50 μg/μL solution of purified HIS6-PHD2 (181–426) in 50 mM Tris-HCl pH 7.5, 0.005% (v/v) Tween-20 buffer supplemented with or without 1 mM MnCl2 and 1 mM NOG, for 2 h at 4 °C. Beads were washed 2x with the same buffer. Biotinylated peptide was pulled down via streptavidin agarose beads and protein was eluted by boiling beads in sample buffer. Protein levels of HIS6-PHD2 were determined by western blotting. Uncropped western blots are provided in Supplementary Figure 8.
The in vitro pVHL-HIF-2α hydroxylation assay was performed according to a previously published protocol67. 5 μg of biotinylated HIF-2α peptide was immobilized on streptavidin-agarose beads. Subsequently, peptides were incubated with 15 μg/mL HIS6-PHD2 (181–426) in 500 μL of 40 mM HEPES pH 7.4, 80 mM KCl, 5 mM a-ketoglutarate, 2 mM ascorbic acid, 100 μM FeCl2 tetrahydrate solution at room temperature for 1 h. FeCl2 was stored under anoxic conditions to prevent oxidation. Following hydroxylation, beads were washed 5x with EBC buffer and peptides were incubated with IVTT HA-VHL30 under the stringent buffer conditions described above.
The binding affinities of VBC to the hydroxylated HIF2αOH peptide was measured by biolayer interferometry using the BLItz system (Pall ForteBio). A 50 μg/mL solution of biotinylated HIF-2α peptide was prepared in kinetics buffer (buffer A supplemented with 1 mM DTT, 0.02% (v/v) Tween-20, and 0.5% (w/v) BSA) and immobilized onto streptavidin (SA)-coated biolayer interferometry (BLI) biosensors (Pall ForteBio, Cat. No. 18-5019) over 120 s. Multiple concentrations of purified VBC complex were diluted in kinetics buffer and allowed to associate with immobilized peptide over 120 s. Subsequently, the SA-BLI probe was immersed into kinetics buffer for 120 s to allow for dissociation. The data were analyzed, step corrected, reference corrected, and fit to a global 1:1 binding model. Kd, ka, and kd were calculated using the BLItz Pro software.
HEK293a cells were obtained from American Type Culture Collection (ATCC). Cells were maintained in DMEM (Invitrogen) supplemented with 10% (v/v) fetal bovine serum (Wisent) and were grown at 37 °C in a humidified, 5% CO2 atmosphere. The indicated plasmids were transiently transfected into HEK293a cells using polyethylenimine.
48 h post transfection, cells were harvested in EBC lysis buffer containing protease inhibitors (Roche). Lysates were immunoprecipitated at 4 °C using the indicated antibodies along with protein A-Sepharose (Repligen) for 1.5 h. In degradation sensitive assays, immunoprecipitation was performed in the presence of MG132 proteasomal inhibitor. Following immunoprecipitation, the bound proteins were washed 5x with NETN buffer. The samples were eluted by boiling in sample buffer and protein levels were visualized via western blotting. Uncropped western blots are provided in Supplementary Figure 8.
The structure and coordinates have been deposited in the Protein Data Bank with accession coded 6BVB. Other data are available from the corresponding author upon reasonable request.
Percy, M. J. et al. A gain-of-function mutation in the HIF2A gene in familial erythrocytosis. N. Engl. J. Med. 358, 162–168 (2008).
Zhuang, Z. et al. Somatic HIF2A gain-of-function mutations in paraganglioma with polycythemia. N. Engl. J. Med. 367, 922–930 (2012).
Därr, R. et al. Novel insights into the polycythemia–paraganglioma–somatostatinoma syndrome. Endocr. Relat. Cancer 23, 899–908 (2016).
Favier, J., Amar, L. & Gimenez-Roqueplo, A.-P. Paraganglioma and phaeochromocytoma: from genetics to personalized medicine. Nat. Rev. Endocrinol. 11, 101–111 (2015).
Pacak, K. et al. New syndrome of paraganglioma and somatostatinoma associated with polycythemia. J. Clin Oncol 31, 1690–1698 (2013).
Welander, J. et al. Frequent EPAS1/HIF2α exons 9 and 12 mutations in non-familial pheochromocytoma. Endocr. Relat. Cancer 21, 495–504 (2014).
Welander, J. et al. Rare germline mutations identified by targeted next-generation sequencing of susceptibility genes in pheochromocytoma and paraganglioma. J. Clin. Endocrinol. Metab. 99, E1352–E1360 (2014).
Comino-Méndez, I. et al. Tumoral EPAS1 (HIF2A) mutations explain sporadic pheochromocytoma and paraganglioma in the absence of erythrocytosis. Hum. Mol. Genet. 22, 2169–76 (2013).
Toledo, R. A. et al. In vivo and in vitro oncogenic effects of HIF2A mutations in pheochromocytomas and paragangliomas. Endocr. Relat. Cancer 20, 349–359 (2013).
Furlow, P. W. et al. Erythrocytosis-associated HIF-2alpha mutations demonstrate a critical role for residues C-terminal to the hydroxylacceptor proline. J. Biol. Chem. 284, 9050–9058 (2009).
Kaelin, W. G. Jr. & Ratcliffe, P. J. Oxygen sensing by metazoans: the central role of the HIF hydroxylase pathway. Mol. Cell 30, 393–402 (2008).
Ang, S. O. et al. Disruption of oxygen homeostasis underlies congenital Chuvash polycythemia. Nat. Genet. 32, 614–621 (2002).
Percy, M. J. et al. A family with erythrocytosis establishes a role for prolyl hydroxylase domain protein 2 in oxygen homeostasis. Proc. Natl Acad. Sci. USA 103, 654–659 (2006).
Ladroue, C. et al. PHD2 mutation and congenital erythrocytosis with paraganglioma. N. Engl. J. Med. 359, 2685–2692 (2008).
Maher, E. R. & Kaelin, W. G. Jr. von Hippel-Lindau disease. Med. (Baltim.) 76, 381–391 (1997).
Karasawa, Y. et al. Duodenal somatostatinoma and erythrocytosis in a patient with von Hippel-Lindau disease type 2A. Intern. Med. 40, 38–43 (2001).
Tarade, D. & Ohh, M. The HIF and other quandaries in VHL disease. Oncogene 37, 139–147 (2017).
Pacak, K. et al. Ocular manifestations of HIF-2 α paraganglioma-somatostatinomapolycythemia syndrome. Ophthalmology 121, 2291 (2014).
Yang, C. et al. Novel HIF2A mutations disrupt oxygen sensing, leading to polycythemia, paragangliomas, and somatostatinomas. Blood 121, 2563–2566 (2013).
Buffet, A. et al. Mosaicism in HIF2A-related polycythemia-paraganglioma syndrome. J. Clin. Endocrinol. Metab. 99, E369–E373 (2013).
Toyoda, H. et al. Polycythemia and paraganglioma with a novel somatic HIF2A mutation in a male. Pediatrics 133, e1787–e1791 (2014).
Taieb, D. et al. First report of bilateral pheochromocytoma in the clinical spectrum of HIF2A-related polycythemia-paraganglioma syndrome. J. Clin. Endocrinol. Metab. 98, E908–913 (2013).
Lorenzo, F. R. et al. A novel EPAS1/HIF2A germline mutation in a congenital polycythemia with paraganglioma. J. Mol. Med. (Berl) 91, 507–512 (2013).
Liu, Q. et al. A somatic HIF2α mutation-induced multiple and recurrent pheochromocytoma/paraganglioma with polycythemia: clinical study with literature review. Endocr. Pathol. 28, 75–82 (2017).
Zhuang, Z. et al. HIF2A gain-of-function mutations detected in duodenal gangliocytic paraganglioma. Endocr. Relat. Cancer 23, L13–L16 (2016).
Abdullah, A. E. et al. Paraganglioma of the organ of Zuckerkandl associated with a somatic HIF2α mutation: a case report. Oncol. Lett. 13, 1083–1086 (2017).
Percy, M. J. et al. Novel exon 12 mutations in the HIF2A gene associated with erythrocytosis. Blood 111, 5400–5402 (2008).
Percy, M. J. et al. Two new mutations in the HIF2A gene associated with erythrocytosis. Am. J. Hematol. 87, 439–442 (2012).
Martini, M. et al. A novel heterozygous HIF2AM535I mutation reinforces the role of oxygen sensing pathway disturbances in the pathogenesis of familial erythrocytosis. Haematologica 93, 1068–1071 (2008).
van Wijk, R. et al. Erythrocytosis associated with a novel missense mutation in the HIF2A gene. Haematologica 95, 829–832 (2010).
Perrotta, S. et al. Congenital erythrocytosis associated with gain-of-function HIF2A gene mutations and erythropoietin levels in the normal range. Haematologica 98, 1624–1632 (2013).
Gale, D. P., Harten, S. K., Reid, C. D., Tuddenham, E. G. & Maxwell, P. H. Autosomal dominant erythrocytosis and pulmonary arterial hypertension associated with an activating HIF2 alpha mutation. Blood 112, 919–921 (2008).
Howarth, C., Chanarin, I., Janowska‐Wieczorek, A. & Napier, J. Familial erythrocytosis. Eur J. Haematol 23, 217–222 (1979).
Alaikov, T., Ivanova, M. & Shivarov, V. EPAS1 p. M535T mutation in a Bulgarian family with congenital erythrocytosis. Hematology 21, 619–622 (2016).
Liu Q, et al. HIF2A germline–mutation-induced polycythemia in a patient with VHL-associated renal-cell carcinoma. Cancer Biol. Ther. 18, 944–947 (2017).
Taïeb, D. et al. Somatic gain-of-function HIF2A mutations in sporadic central nervous system hemangioblastomas. J. Neurooncol 126, 473–481 (2016).
Hon, W. C. et al. Structural basis for the recognition of hydroxyproline in HIF-1 alpha by pVHL. Nature 417, 975–978 (2002).
Min, J. H. et al. Structure of an HIF-1alpha -pVHL complex: hydroxyproline recognition in signaling. Science 296, 1886–1889 (2002).
Dong, X. et al. Homology modeling and molecular dynamics simulation of the HIF2α degradation-related HIF2α-VHL complex. J. Mol. Graph. Model. 71, 116–123 (2017).
Stebbins, C. E., Kaelin, W. G. Jr. & Pavletich, N. P. Structure of the VHL-ElonginC-ElonginB complex: implications for VHL tumor suppressor function. Science 284, 455–461 (1999).
Sultana, A., & Lee, J. E. Measuring protein‐protein and protein‐nucleic acid interactions by biolayer interferometry. Curr. Protoc. Protein Sci. 79, 19.25.1–19.25.26 (2015).
Kageyama, Y. et al. Leu-574 of human HIF-1α is a molecular determinant of prolyl hydroxylation. FASEB J. 18, 1028–1030 (2004).
Chowdhury, R. et al. Structural basis for binding of hypoxia-inducible factor to the oxygen-sensing prolyl hydroxylases. Structure 17, 981–989 (2009).
Robinson, C. M. & Ohh, M. The multifaceted von Hippel–Lindau tumour suppressor protein. FEBS Lett. 588, 2704–2711 (2014).
Vaidya, A. et al. EPAS1 mutations and paragangliomas in cyanotic congenital heart disease. N. Engl. J. Med. 378, 1259–1261 (2018).
Hu, C.-J. et al. Differential regulation of the transcriptional activities of hypoxia-inducible factor 1 alpha (HIF-1α) and HIF-2α in stem cells. Mol. Cell Biol. 26, 3514–3526 (2006).
Covello, K. L. et al. HIF-2α regulates Oct-4: effects of hypoxia on stem cell function, embryonic development, and tumor growth. Gene Dev. 20, 557–570 (2006).
Pietras, A. et al. HIF-2α maintains an undifferentiated state in neural crest-like human neuroblastoma tumor-initiating cells. Proc. Natl Acad. Sci. USA 106, 16805–16810 (2009).
Loh, Y.-H. et al. The Oct4 and Nanog transcription network regulates pluripotency in mouse embryonic stem cells. Nat. Genet. 38, 431–440 (2006).
Schodel, J. et al. High-resolution genome-wide mapping of HIF-binding sites by ChIP-seq. Blood 117, 207–217 (2011).
Lee, S. et al. Neuronal apoptosis linked to EglN3 prolyl hydroxylase and familial pheochromocytoma genes: developmental culling and cancer. Cancer Cell 8, 155–167 (2005).
Astrom, K., Cohen, J. E., Willett-Brozick, J. E., Aston, C. E., & Baysal, B. E. Altitude is a phenotypic modifier in hereditary paraganglioma type 1: evidence for an oxygen-sensing defect. Hum. Genet. 113, 228–237 (2003).
Adzhubei, I., Jordan, D. M., & Sunyaev, S. R. Predicting functional effect of human missense mutations using PolyPhen‐2. Curr. Protoc. Hum. Genet. https://doi.org/10.1002/0471142905.hg0720s76 (2013).
Sievers, F. et al. Fast, scalable generation of high‐quality protein multiple sequence alignments using Clustal Omega. Mol. Syst. Biol. 7, 539 (2011).
Ohh, M. et al. Ubiquitination of hypoxia-inducible factor requires direct binding to the beta-domain of the von Hippel-Lindau protein. Nat. Cell Biol. 2, 423–427 (2000).
Heir, P. et al. Oxygen-dependent regulation of erythropoietin receptor turnover and signaling. J. Biol. Chem. 291, 7357–7372 (2016).
Heir, P. et al. DCNL1 functions as a substrate sensor and activator of cullin 2-RING ligase. Mol. Cell Biol. 33, 1621–1631 (2013).
Hewitson, K. S., Schofield, C. J. & Ratcliffe, P. J. Hypoxia‐inducible factor prolyl‐hydroxylase: purification and assays of PHD2. Method Enzymol. 435, 25–42 (2007).
Nguyen, M., Tan, K. P. & Madhusudhan, M. S. CLICK—topology-independent comparison of biomolecular 3D structures. Nucleic Acids Res. 39, W24–W28 (2011).
Heir, P., & Ohh, M. Hydroxylation-dependent interaction of substrates to the von hippel-lindau tumor suppressor protein (VHL). Tumor Microenviron. Methods Protoc. 1458, 87–94 (2016).
We thank the members of Ohh and Lee labs for their critical comments and discussions. We also thank Wenguang He for generating the pET-46 HIS6-PHD2 plasmid and Farshad Cyrus Azimi for assistance with protocol optimization. This work was supported by grants from the Canadian Institutes of Health Research (CIHR) (MOP-133694 to J.E.L.; MOP-77718 and 136978 to M.O.). D.T. is a recipient of CIHR-Vanier Canada Graduate Scholarship and Ontario Graduate Scholarship. This work is based upon X-ray data remotely collected at beamline 08ID-1 at the Canadian Light Source, which is supported by the Canada Foundation for Innovation, Natural Sciences and Engineering Council of Canada, University of Saskatchewan, Government of Saskatchewan, Western Economic Diversification Canada, National Research Council Canada, and CIHR.
M.O. and D.T. conceptualized the study design. D.T. performed the biochemical, biophysical, and structural experiments. C.M.R. performed the cell line based experiments. J.E.L. aided in designing and performing the structural experiments. D.T., J.E.L. and M.O. wrote the manuscript.
|
0.999998 |
Suppose you’re a supervillain and you want to destroy the world. Or you’re a post-apocalyptic science fiction writer and you need to come up with an apocalypse. Or maybe you’re a survival nut and want to know which end is most inevitable so you know what to prepare for. There are so many ways to choose from, it can be hard to decide! Here’s a brief run-down of doomsday scenarios, sorted by category.
The world has been around for a very long time, and it will probably still be here long after humans are gone. Unfortunately, the greatest threat to our survival is ourselves. In the doomsday version of clue, man vs man is the most likely suspect.
A radioactive sign hangs on barbed wire outside a café in Pripyat.
They say that there’s enough nuclear firepower on Earth now to destroy it three times over. While this is a slight exaggeration it is true that the radioactive fallout would probably eliminate a substantial portion of the world’s population, causing widespread hunger and death. A few pockets of people would probably be protected though, and they would be left to rebuild a society with more intelligence.
A common misconception regarding the nuclear doomsday scenario is that the earth itself will become radioactive and uninhabitable. The actual blast sites may remain “hot” for some time but areas that are affected by fallout will be safe in a matter of weeks or months once the radioactivity dissipates into the air.
Another common fear and science fiction literary device is that of biological warfare. Chemicals used in the trench warfare during World War I offer a real life example of what can be done with modern science, and serve as a reminder of why biological warfare is considered a war crime. The advent of super viruses such as the flu epidemic of 1918 spread fear of a man-made disease that would have no cure. Environmental contaminants are also a source of concern–when the ecological system of Earth is sufficiently upset it can cause bizarre weather incidents like acid rain, which can be extremely devastating to life on earth.
There’s another aspect of biological and chemical warfare, however, probably the most imaginative form of apocalyptic fiction. From novels such as “I Am Legend” to films such as “World War Z” people have been worry about zombies and vampires roaming the earth after we are gone. These undead are the victims of brutal super viruses which kill and then resurrect in the form of a brain-or-blood eating monster.
While humans are their own worst enemy, it’s a big universe and there are a lot of things to be scared of. Earth is the only living planet that scientists have been able to find, but there is massive speculation that there was once life on other worlds; worlds that are now dead. What happened to them could happen to us, and so here is a list of the most common causes of death not caused by mankind.
The pockmarked surface of the moon bears testament to the heavy bombardment that the solar system suffered in the early days of it’s formation. While things are fairly calm now, there’s still a huge amount of stray space rocks that occasionally come hurtling towards the Earth. Many of these are burned up in the atmosphere, most are too small to make much of an impact, but occasionally one knocks us off our feet and reminds us what threats lurk beyond the blue sky. The most recent meteor strike was Chelyabinsk Meteor which struck in Russia on February 15, 2013. It shattered glass in the windows of six cities, causing over 1,500 injuries. It is 20 metres in diameter (66 feet) and weighs more than the Eiffel tower. If a larger meteor, comet, or asteroid suddenly collided with earth it could result in mass extinctions, earthquakes, and famine. An asteroid measuring six miles across is generally credited with the extinction of the dinosaurs about sixty-five million years ago. This has led to the implementation of asteroid detection systems in hopes that we can deflect any potentially life threatening near-earth-objects before they have a chance to strike.
All life depends on the warmth of the sun’s rays, perfectly situated at precisely the right distance for a hospitable climate. But the sun is just another one of the millions of billions of stars in the universe, and we have telescopes sufficiently advanced to track the birth and death of stars across the ages. From this information scientists have been able to predict when, and how, our sun will die. It will expand, becoming a red giant, and engulfing most of the inner planets before shrinking back down to dwarf star or planetary nebula. Fortunately this isn’t due to happen for about five billion years, so if that’s the only threat to humanity we’ll be long gone colonizing the stars.
Long before the sun expands and swallows the planet, the planet itself will freeze out all life. Earth has had massive weather cycles in the past, going from hot to extreme cold, and back again. The last major ice age was 10,000 years ago, and many geophysicists believe that we’ve overdue for the next one. Ice ages are caused by a combination of climate change and sun spot activity and about the only thing that people can agree on about them is that they’re not survivable.
Regardless of whether or not the ice age comes gradually or all at once, the colder weather will result in a shorter growing period, causing food shortages and famine. As the casualties begin to mount, the global infrastructure will break down. Modern standards of living will be sacrificed to the quest for food, clothes and shelter, which will be increasingly difficult to find as the resources continue to diminish and the demand to increase. Population will continue to shrink to match the dwindling supply. And if it gets cold enough, people could die out altogether.
|
0.96711 |
My mother: "What should you be when you grow up?"
My wife: "With your intelligence you could move mountains".
Her husband: "I move mountains, but people look at the sea".
|
0.965013 |
The code of a website is important. It is used to get the site to run properly. This includes ensuring that all of the individual modules can work together. PHP is one such type of coding system that can be used. It can be very useful and easy for anyone to learn how PHP can work.
The code of a website is important. It is used to get the site to run properly. This includes ensuring that all of the individual modules can work together. PHP is one such type of coding system that can be used. It can be very useful and easy for anyone to learn how PHP can work. Here are some reasons why a person should learn how to use PHP.
There is a very good reason why it is important to learn how to use PHP. This is because PHP is becoming one of the most commonly used types of codes in the world. It is something that can be used for helping to get a site to run properly and to ensure that a website can be safe and stable. It can also work to keep a site looking unique and to be handled as well as it possibly can. It will be easy for anyone to get a better looking site when PHP is used.
Another point about using PHP is that it can work very well on any type of website. There are some similarities between PHP and HTML. These include things that relate to how a site is arranged and how changes can be made on a site. PHP is able to work quickly to handle large amounts of data in a short period of time.
PHP also uses a greater level of functionality. It will be easier to customize it in many ways. It can even be edited in ways that HTML cannot be edited with.
In fact, PHP does not need any special programs or devices for it to be coded. All that is needed to edit PHP is a text editor. Many programs can also work to warn users about faulty tags and syntax. This can be used to ensure that the code will run properly when it is put online.
Of course, PHP will be very easy for anyone to learn how to use. However, the websites that are available for people to use when trying to learn it can be confusing or complicated. This is why it will help to check with a professional assistance provider for PHP training. A little investment in training can go a long way towards making something that is more effective. This is especially since PHP can be used to do so many different things with any kind of website.
|
0.680114 |
The home front covers the activities of the civilians in a nation at war. World War II was a total war; homeland production became even more invaluable to both the Allied and Axis powers. Life on the home front during World War II was a significant part of the war effort for all participants and had a major impact on the outcome of the war. Governments became involved with new issues such as rationing, manpower allocation, home defense, evacuation in the face of air raids, and response to occupation by an enemy power. The morale and psychology of the people responded to leadership and propaganda. Typically women were mobilized to an unprecedented degree.
All of the powers involved had learned from their experiences good and bad on the home front during World War I. Their success in mobilizing economic output was a major factor in supporting combat operations. Among morale-boosting activities that also benefited combat efforts, the home front engaged in a variety of scrap drives for materials crucial to the war effort such as metal, rubber, and rags.
The major powers devoted 50–61 percent of their total GDP to munitions production. The Allies produced about three times as much in munitions as the Axis powers.
The Allies called themselves the "United Nations" (even before that organization formed in 1945), and pledged their support to the Atlantic Charter of 1941. The Charter stated the ideal goals of the war: no territorial aggrandizement; no territorial changes made against the wishes of the people; restoration of self-government to those deprived of it; free access to raw materials; reduction of trade restrictions; global cooperation to secure better economic and social conditions for all; freedom from fear and want; freedom of the seas; and abandonment of the use of force, as well as the disarmament of aggressor nations.
The sudden German invasion of neutral Belgium in May 1940 led in a matter of 18 days to the collapse of the Belgian army; King Leopold obtained an armistice that involved direct German military administration. The King refused the demand of the government that he flee with them to Britain; he remained as a puppet ruler under German control. The Belgian bureaucracy remained in place and generally cooperated with the German rulers. Two pro-German movements, the Flemish National Union comprising Flemish (Dutch-speaking ) separatists and the Walloon (French-speaking ) Rexists led by Léon Degrelle (1906–94) supported the invaders and encouraged their young men to volunteer for the German army. Small but active resistance movements, largely Communist, provided intelligence to the Allies. During the Holocaust in Belgium, the Nazis hunted down the 70,000 Jews living in Belgium, most of them refugees, and killed 29,000 of them.
The Germans expected to exploit Belgium's industrial resources to support their war machine. Their policies created severe shortages for the Belgian people, but shipped out far less than Germany had expected. They set up the "Armaments Inspection Board" in 1940 to relay munitions orders to factories; the Board came under the control of the German Minister of Armaments, Albert Speer in 1943, and had offices in industrial areas that were supposed to facilitate orders for materiél, and supervise production. However, factory production fell sharply after 1942. Although collaboration with the Nazis, especially among the Flemish, was evident in 1940, it soon faded in importance. Labor strikes and systematic sabotage slowed production, as did the emigration of workers to rural areas, Allied bombing, food shortages, and worker resentment to forced labor.
The Allies retook all of Belgium in September 1944 as the Germans retreated. They reappeared briefly during the hard fighting of the Battle of the Bulge in December 1944, but were finally expelled in January 1945. The London‐based government‐in‐exile returned, but had to confront the resistance movements that demanded radical political change.
China suffered the second highest number of casualties of the entire war. Civilians in the occupied territories had to endure many large-scale massacres, including that in Nanking. In a few areas, Japanese forces also unleashed newly developed biological weapons on Chinese civilians leading to an estimated 200,000 dead. Tens of thousands died when Nationalist troops broke the levees of the Yangtze to stop the Japanese advance after the loss of the Chinese capital, Nanjing. Millions more Chinese died because of famine during the war.
Japan captured major coastal cities like Shanghai early in the war; cutting the rest of China off from its chief sources of finance and industry. Millions of Chinese moved to remote regions to avoid invasion. Cities like Kunming ballooned with new arrivals. Entire factories and universities were often taken along so the society could still function. Japan replied with hundreds of air raids on the new capital of Chongqing.
Although China received much aid from the United States, China did not have sufficient infrastructure to properly arm or even feed its military forces, let alone its civilians.
China was divided into three zones, with the Nationalists in the southwest and the Communists led by Mao Zedong (Mao) in control of much of the northwest. Coastal areas were occupied by the Japanese and civilians were treated harshly; young men were drafted into a puppet Chinese army.
After the stunningly quick victory in June 1940, France was knocked out of the war and part of it, with its capital in Vichy, became an informal ally of the Germans. A powerful Resistance movement sprang up, as the Germans fortified the coast against an Allied invasion and occupied the northern half of the country. The Germans captured 2,000,000 French soldiers, and kept them in prisoner of war camps inside Germany for the duration of the war, using them as hostages to guarantee French cooperation. The Vichy French government, cooperated closely with the Germans, sending food, machinery and workers to Germany. Several hundred thousand Frenchmen and women were forced to work in German factories, or volunteered to do so, as the French economy itself deteriorated. Nevertheless, there was a strong Resistance movement, with fierce anti-resistance activities carried out by the Nazis and the French police. Most Jews were rounded up by the Vichy police and handed over to the Germans, who sent them to death camps.
The two million French soldiers held as POWs and forced laborers in Germany throughout the war were not at risk of death in combat, but the anxieties of separation for their 800,000 wives were high. The government provided a modest allowance, but one in ten became prostitutes to support their families. Meanwhile, the Vichy regime promoted a highly traditional model of female roles. After the war, France gave women the vote and additional legal and political rights, although nothing on the scale of the enfranchisement that followed World War I.
Women suffered shortages of all varieties of consumer goods and the absence of the men in POW camps. The rationing system was stringent and badly mismanaged, leading to pronounced malnourishment, black markets and hostility to state management of the food supply. The Germans seized about 20% of the French food production, which caused severe disruption to the household economy of the French people. French farm production fell by half because of the lack of fuel, fertilizer and workers; even so, the Germans seized half the meat and 20% of the produce. Supply problems quickly affected French stores, which lacked most items. The government responded by rationing, but German officials set the policies and hunger prevailed, especially affecting young people in urban areas. At shops, the queues lengthened. Some people—including German soldiers who could take advantage of arbitrary exchange rates that favored Germany—benefited from the black market, where food was sold without coupons at very high prices. Farmers diverted meat to the black market, which meant that there was much less for the open market. Counterfeit food coupons were also in circulation. Direct buying from farmers in the countryside and barter against cigarettes became common. These activities were strictly forbidden, and carried the risk of confiscation and fines. Food shortages were most acute in the large cities. Vitamin deficiencies and malnutrition were prevalent. Advice about eating a healthier diet and home growing produce was distributed. Slogans like 'Digging for Victory' and 'Make Do and Mend' appeared on national posters and became a part of the war effort. The city environment made these efforts nearly negligible. In the more remote country villages, however, clandestine slaughtering, vegetable gardens and the availability of milk products permitted survival. The official ration provided starvation-level diets of 1,300 or fewer calories a day (5400 kJ), supplemented by home gardens and, especially, black market purchases.
The Dutch famine of 1944, known as the Hongerwinter ("Hunger winter") was a man-made famine imposed by Germany in the occupied western provinces during the winter of 1944–1945. A German blockade cut off food and fuel shipments from farm areas. A total of 4.5 million people were affected, of whom 18,000 died, despite an elaborate system of emergency soup kitchens.
The Nazi Hunger Plan was to kill the Jews of Poland quickly, and slowly to force the Poles to leave by threat of starvation, so that they could be replaced by German settlers. The Nazis coerced Poles to work in Germany by providing favorable food rations for families who had members working in the Reich. The ethnic German population in Poland (Volksdeutsche) were given good rations and were allowed to shop for food in special stores. The German occupiers created a draconian system of food controls, including severe penalties for the omnipresent black market. There was a sharp increase in mortality due to the general malnutrition, and a decline in birth rates.
By mid 1941, the German minority in Poland received 2,613 calories (11,000 kJ) per day, while Poles received 699 and Jews in the ghetto 184. The Jewish ration fulfilled just 7.5% of their daily needs; Polish rations only 26%. Only the ration allocated to Germans provided the full required calorie intake.
Additionally the Generalplan Ost of the Nazis, which envisioned the elimination of the Slavic population in the occupied territories and artificial famines-as proposed in the Hunger Plan, were to be used.
On September 1, 1939, Germany invaded Poland, conquering it in three weeks, as the Soviets invaded the eastern areas. During the German occupation, there were two distinct civilian uprisings in Warsaw, one in 1943, the other in 1944. The first took place in an entity, less than two square miles (5 km2) in area, which the Germans had carved out of the city and called Ghetto Warschau. The Germans built high walls around the ghetto, and crowded 550,000 Polish Jews into it, many from the Polish provinces. At first, people were allowed to enter and leave the ghetto, but soon its border became an "iron curtain". Unless on official business, Jews could not leave, and non-Jews, including Germans, could not enter. Entry points were guarded by German soldiers. Because of extreme conditions and hunger, mortality in the ghetto was high. In 1942, the Germans moved 400,000 ghetto residents to Treblinka where they were gassed on arrival. By April 19, 1943, when the Ghetto Uprising commenced, the population of the ghetto had dwindled to 60,000 individuals. In the following three weeks, virtually all died as the Germans fought and systematically destroyed the buildings in the ghetto.
The uprising by Poles began on August 1, 1944, when the Polish underground, the "Home Army", aware that the Soviet Army had reached the eastern bank of the Vistula, sought to liberate Warsaw much as the French resistance had liberated Paris a few weeks earlier. Joseph Stalin had his own group of Communist leaders for the new Poland and did not want the Home Army or its leaders (based in London) to control Warsaw. So he halted the Soviet offensive and gave the Germans free rein to suppress it. During the ensuing 63 days, 250,000 Poles of the Home Army surrendered to the Germans. After the Germans forced all the surviving population to leave the city, Hitler ordered that any buildings left standing be dynamited – 98 percent of the buildings in Warsaw were destroyed.
During the invasion of the Soviet Union in the early months of the war, rapid German advances almost captured the cities of Moscow and Leningrad. The bulk of Soviet industry which could not be evacuated was either destroyed or lost due to German occupation. Agricultural production was interrupted, with grain crops left standing in the fields This caused hunger reminiscent of the early 1930s. In one of the greatest feats of war logistics, factories were evacuated on an enormous scale, with 1,523 factories dismantled and shipped eastwards along four principal routes to the Caucasus, Central Asia, the Ural, and Siberia. In general, the tools, dies and production technology were moved, along with the blueprints and their management, engineering staffs and skilled labor.
The whole of the Soviet Union become dedicated to the war effort. The people of the Soviet Union were probably better prepared than any other nation involved in World War II to endure the material hardships of the war – primarily because they were so used to shortages and economic crisis in the past, especially during wartime—World War I had brought similar restrictions on food. Conditions were nevertheless severe. World War II was especially devastating to citizens of the USSR because it was fought on Soviet territory and caused massive destruction. In Leningrad, under German siege, over a million people died of starvation and disease. Many factory workers were teenagers, women and old people. The government implemented rationing in 1941 and first applied it to bread, flour, cereal, pasta, butter, margarine, vegetable oil, meat, fish, sugar and confectionery all across the country. The rations remained largely stable in other places during the war. Off-ration food was often so expensive that it could not add substantially to a citizen's food supply unless they were especially well-paid. Peasants received no rations and had to make do with any local resources they farmed themselves. Most rural peasants struggled and lived in unbearable poverty, but others sold their surplus food at a high price; a few became rouble millionaires, until a currency reform two years after the end of the war wiped out their wealth.
Despite harsh conditions, the war led to a spike in Soviet nationalism and unity. Soviet propaganda toned down extreme Communist rhetoric of the past as the people now rallied to protect their Motherland against the evils of the German invaders. Ethnic minorities thought to be collaborators were forced into exile. Religion, which was previously shunned, became a part of a Communist Party propaganda campaign to mobilize religious people. Soviet society changed drastically during the war. There was a burst of marriages in June and July 1941 between people about to be separated by the war, and in the next few years the marriage rate dropped off steeply, with the birth rate following shortly thereafter to only about half of what it would have been in peacetime. For this reason mothers with several children during the war received substantial honors and money benefits if they had several children—mothers could earn around 1,300 rubles for having their fourth child and up to 5,000 rubles for their tenth.
The city of Leningrad endured more suffering and hardships than any other city in the Soviet Union during World War II. Hunger, malnutrition, disease, starvation, and even cannibalism became common during the siege, which lasted from September 1941 until January 1944. Many people lost weight, and grew weaker and more vulnerable to disease. If malnutrition persisted for long enough, its effects were irreversible. People's feelings of loyalty disappeared if they got hungry enough; they would steal from their closest family members in order to survive.
Only some of the citizens of Leningrad survived. Only 400,000 were evacuated before the siege began; this left 2.5 million in Leningrad, including 400,000 children. Subsequently, more managed to escape; especially when the nearby Lake Ladoga froze over and people could walk over the ice road—or "road of life"—to safety. Those in influential political or social positions used their connections to other elites to leave Leningrad both before and after the siege began. Some factory owners even looted state funds to secure transport out of the city during the first summer of the war. The most risky means of escape, however, was to defect to the enemy and hope to avoid governmental punishment.
Most survival strategies during the siege, though, involved staying within the city and facing the problems through resourcefulness or luck: for instance by securing factory employment, because many factories became autonomous and possessed more of the requirements for survival during the winter, such as food and heat. Workers received larger rations than other civilians, and factories were likely to have electricity if they produced vital goods. Factories also served as mutual support centers, and had clinics and other services like cleaning crews and teams of women who would sew and repair clothes. Factory employees were still driven to desperation on occasion and people resorted to eating glue or horsemeat in factories where food was scarce, but factory employment was the most consistently successful method of survival, and at some food production plants not a single person died.
Survival opportunities open to the wider Soviet community included barter and farming on private land. Black markets thrived as private barter and trade became more common, especially between soldiers and civilians. Soldiers, who had more food to spare, were eager to trade with civilians who had extra warm clothes to exchange. Planting vegetable gardens in the spring became popular, primarily because citizens could keep everything grown on their own plots. The campaign also had a potent psychological effect and boosted morale, a survival component almost as crucial as bread.
Many of the most desperate Soviet citizens turned to crime to support themselves. Most common was the theft of food and of ration cards; this could prove fatal for a malnourished person if their card was stolen more than a day or two before a new card was issued. For these reasons, the stealing of food was severely punished and a person could be shot for as little as stealing a loaf of bread. More serious crimes such as murder and cannibalism also occurred, and special police squads were set up to combat these crimes, though by the end of the siege, roughly 1,500 had been arrested for cannibalism.
In the United States, farming and other production was increased. For example, citizens were encouraged to plant "victory gardens", personal farms that children sometimes worked on. Standlee (2010) argues that during the war the traditional gender division of labor changed somewhat, as the "home" or domestic female sphere expanded to include the "home front"; meanwhile the public sphere—the male domain—was redefined as the international stage of military action.
The Philippines was an American possession on the way to independence (scheduled in 1946) and controlled its own internal affairs. The Japanese invaded and quickly conquered the islands in early 1942. The Japanese military authorities immediately began organizing a new government structure in the Philippines and established the Philippine Executive Commission. They initially organized a Council of State, through which they directed civil affairs until October 1943, when they declared the Philippines an independent republic. The Japanese-sponsored Second Philippine Republic headed by President José P. Laurel proved to be ineffective and unpopular as Japan maintained very tight controls.
Japanese occupation of the Philippines was opposed by large-scale underground and guerrilla activity. The Philippine Army, as well as remnants of the U.S. Army Forces Far East continued to fight the Japanese in a guerrilla war. They formed an auxiliary unit of the United States Army. Their effectiveness was such that by the end of the war, Japan controlled only twelve of the forty-eight provinces. One element of resistance in the Central Luzon area was furnished by the Hukbalahap, which armed some 30,000 people and extended their control over much of Luzon. The Americans invaded in 1944–45; the battle for Manila was contested street by street with large numbers of civilians killed.
The Japanese tried to remove all Western and American cultural influences. They met fierce resistance when they tried to undermine the Catholic Church by arresting 500 Christian missionaries. The Filipinos came to feel morally superior to the brutal Japanese and rejected their advances. Newspapers and the media were tightly censored. The Japanese tried to reshape schools and impose the Japanese language. They formed neighborhood associations to inform on the opposition.
See Timeline of the United Kingdom home front during World War II.
Britain's total mobilization during this period proved to be successful in winning the war, by maintaining strong support from public opinion. The war was a "people's war" that enlarged democratic aspirations and produced promises of a postwar welfare state.
Historians credit Britain with a highly successful record of mobilizing the home front for the war effort, in terms of mobilizing the greatest proportion of potential workers, maximizing output, assigning the right skills to the right task, and maintaining the morale and spirit of the people. Much of this success was due to the systematic planned mobilization of women, as workers, soldiers and housewives, enforced after December 1941 by conscription. The women supported the war effort, and made the rationing of consumer goods a success. In some ways, the government over-responded, evacuating too many children in the first days of the war, closing cinemas as frivolous then reopening them when the need for cheap entertainment was clear, sacrificing cats and dogs to save a little space on shipping pet food, only to discover an urgent need to keep the rats and mice under control. In the balance between compulsion and voluntarism, the British relied successfully on voluntarism. The success of the government in providing new services, such as hospitals, and school lunches, as well as egalitarian spirit, contributed to widespread support for an enlarged welfare state. Munitions production rose dramatically, and the quality remained high. Food production was emphasized, in large part to free shipping for munitions. Farmers increased the number of acres under cultivation from 12,000,000 to 18,000,000 (from about 50,000 to 75,000 km2), and the farm labor force was expanded by a fifth, thanks especially to the Women's Land Army.
Parents had much less time to supervise their children, and there were fears of juvenile delinquency, especially as older teenagers took jobs and emulated their older siblings in the service. The government responded by requiring all young people over 16 to register, and expanded the number of clubs and organizations available to them.
A British Restaurant in London, 1942. 2000 were opened to serve low cost basic meals to people who had run out of rationing coupons.
Food, clothing, petrol, leather and other items were rationed. However, items such as sweets and fruits were not rationed, as they would spoil. Access to luxuries was severely restricted, although there was also a significant black market. Families also grew "victory gardens", and small home vegetable gardens. Many things were conserved to turn into weapons later, such as fat for nitroglycerin production. People in the countryside were less affected by rationing as they had greater access to locally-sourced unrationed products than people in cities, and were more able to grow their own.
The rationing system, which had been originally based on a specific basket of goods for each consumer, was much improved by switching to a points system which allowed housewives to make choices based on their own priorities. Food rationing also permitted the upgrading of the quality of the food available, and housewives approved—except for the absence of white bread and the government's imposition of an unpalatable wheat meal "national loaf". Surveys of public opinion showed that most Britons were pleased that rationing brought equality and a guarantee of a decent meal at an affordable cost.
From very early in the war, it was thought that the major industrial cities of Britain, especially London, would come under Luftwaffe air attack; this did happen with The Blitz. Some children were sent to Canada, the USA and Australia and millions of children and some mothers were evacuated from London and other major cities to safer parts of the country when the war began, under government plans for the evacuation of civilians, but they often filtered back. When the Blitz bombing began on September 6, 1940, they evacuated again. The discovery of the poor health and hygiene of evacuees was a shock to many Britons, and helped prepare the way for the Beveridge Report. Children were evacuated if their parents agreed; but in some cases they had no choice. The children were only allowed to take a few things with them, including a gas mask, books, money, clothes, ration book and some small toys.
A news theatre in Leicester Square – publicity for Movietone News coverage of the "Mareth Victory"
Belfast in Northern Ireland was a representative British city that has been well studied by historians. It was a key industrial city producing ships, tanks, aircraft, engineering works, arms, uniforms, parachutes and a host of other industrial goods. The unemployment that had been so persistent in the 1930s disappeared, and labour shortages appeared. There was a major munitions strike in 1944. As a key industrial city, Belfast became a target for German bombing missions, but it was thinly defended; there were only 24 anti-aircraft guns in the city for example. The Northern Ireland government under Richard Dawson Bates (Minister for Home Affairs) had prepared too late, assuming that Belfast was too distant. When Germany conquered France in spring 1940 it gained closer airfields. The city's fire brigade was inadequate, there were no public air raid shelters as the Northern Ireland government was reluctant to spend money on them and there were no searchlights in the city, which made shooting down enemy bombers all the more difficult. After seeing the Blitz in London in the autumn of 1940, the government began the construction of air raid shelters. The Luftwaffe in early 1941, flew reconnaissance missions that identified the docks and industrial areas to be targeted. Especially hard hit were the working class areas in the north and east of the city where over a thousand were killed and hundreds were seriously injured. Many people left the city afraid of future attacks. The bombing revealed the terrible slum conditions. In May 1941, the Luftwaffe hit the docks and the Harland and Wolff shipyard, closing it for six months. Apart from the numbers of dead, the Belfast blitz saw half of the city's houses destroyed. Approximately twenty million pounds worth of damage was caused. The Northern Ireland government was criticized heavily for its lack of preparation. The criticism forced the resignation of Northern Ireland's Prime Minister J. M. Andrews. The bombing raids continued until the invasion of Russia in the summer of 1941. The American army arrived in 1942–44, setting up bases around Northern Ireland, and spending freely.
An Emergency Hospital Service was established at the beginning of the war, in the expectation that it would be required to deal with large numbers of casualties.
A common theme called for an expansion of the welfare state as a reward to the people for their wartime sacrifices The goal was operationalized in a famous report by William Beveridge It recommended that the various income maintenance services that a grown-up piecemeal since 1911 be systematized and made universal. Unemployment benefits and sickness benefits were to be universal. There would be new benefits for maternity. The old-age pension system would be revised and expanded, and require that a person retired. A full-scale National Health Service would provide free medical care for everyone. All the major parties endorsed the principles and they were largely put into effect when peace returned.
The themes of equality and sacrifice were dominant during the war, and in the memory of the war. Harris points out that the war was seen at the time and by a generation of writers as a period of outstanding national unity and social solidarity. There was little antiwar sentiment during or after the war. Furthermore, Britain turned more toward the collective welfare state during the war, expanding it in the late 1940s and reaching a broad consensus supporting it across party lines. By the 1970s and 1980s, however, historians were exploring the subtle elements of continuing diversity and conflict in society during the war period. For example, at first historians emphasized that strikes became illegal in July 1940, and no trade union called one during the war. Later historians pointed to the many localized unofficial strikes, especially in coal mining, shipbuilding, the metal trades, and engineering, with as many as 3.7 million man days lost in 1944.
The BBC collected 47,000 wartime recollections and 15,000 images in 2003-6 and put them online. The CD audiobook Home Front 1939–45 also contains a selection of period interviews and actuality recordings.
Canada joined the war effort on September 10, 1939; the government deliberately waited after Britain's decision to go to war, partly to demonstrate its independence from Britain and partly to give the country extra time to import arms from the United States as a non-belligerent. War production was ramped up quickly, and was centrally managed through the Department of Munitions and Supply. Unemployment faded away.
Canada became one of the largest trainers of pilots for the Allies through the British Commonwealth Air Training Plan. Many Canadian men joined the war effort, so with them overseas and industries pushing to increase production, women took up positions to aid in the war effort. The hiring of men in many positions in civilian employment was effectively banned later in the war through measures taken under the National Resources Mobilization Act..
Shipyards and repair facilities expanded dramatically as over a thousand warships and cargo vessels were built, along with thousands of auxiliary craft, small boats and others.
Canada expanded food production, but shipped so much to Britain that food rationing had to be imposed. In 1942 it shipped to Britain 25 per cent of total meat production (including 75% of the bacon), 65% of the cheese and 13% of the eggs.
Since 20% of Canada's population were not of British or French origin, their status was of special concern. The main goal was to integrate the marginalized European ethnicities—as opposed to the First World War policy of internment camps for Ukrainians and Germans. In the case of Germany, Italy and especially Japan, the government watched the ethnics closely for signs of loyalty to their homelands. The fears proved groundless. In February 1942 21,000 Japanese Canadians were rounded up and sent to internment camps that closely resembled similar camps in the US because the two governments had agreed in 1941 to coordinate their evacuation policies. Most had lived in British Columbia, but in 1945 they were released from detention and allowed to move anywhere in Canada except British Columbia, or they could go to Japan. Most went to the Toronto area.
Shop Stewards in the canteen of the Burrard Dry Dock in North Vancouver, Canada. Commencing in 1942, Burrard Dry Dock hired over 1000 women, all of whom were dismissed at the end of the war to make way for returning men.
Canadian women responded to urgent appeals to make-do, recycle and salvage in order to come up with needed supplies. They saved fats and grease; gathered recycled goods, handed out information on the best methods to use that one may get the most out of recycled goods and organized many other events to decrease the amount of waste. Volunteer organizations led by women also prepared packages for the military overseas or for prisoners of war in Axis countries.
With World War II came the dire need for employees in the workplace, without women to step-in, the economy would have collapsed. By autumn 1944 the number of women working full-time in Canada's paid labor force was twice what it had been in 1939, and that figure of between 1,000,000 and 1,200,000 did not include part-time workers or women working on farms." Women had to take on this intensive labor and while they did this they still had to find time to make jam, clothes and other such acts of volunteering to aid the men overseas.
The government greatly expanded its powers in order to better direct the war effort, and Australia's industrial and human resources were focused on supporting the Australian and American armed forces. There were a few Japanese attacks, most notably on Darwin in February 1942, along with the widespread fear in 1942, that Australia would be invaded.
Australia entered the war in 1939 and sent its forces to fight the Germans in the Middle East (where they were successful) and Singapore (where they were captured by the Japanese in 1942). By 1943, 37% of the Australian GDP was directed at the war effort. Total war expenditure came to £2,949 million between 1939 and 1945.
The Curtin Labor Government took over in October 1941, and energized the war effort, with rationing of scarce fuel, clothing and some food. When Japan entered the war in December 1941, the danger was at hand, and all women and children were evacuated from Darwin and northern Australia. The Commonwealth Government took control of all income taxation in 1942, which gave it extensive new powers and greatly reduced the states' financial autonomy. Manufacturing grew rapidly, with the assembly of high performance guns and aircraft a specialty. The number of women working in factories rose from 171,000 to 286,000. The arrival of tens of thousands of Americans was greeted with relief, as they could protect Australia where Britain could not. The US sent in $1.1 billion in Lend Lease, and Australia returned about the same total in services, food, rents and supplies to the Americans.
New Zealand, with a population of 1.7 million, including 99,000 Maori, was highly mobilized during the war. The Labour party was in power and promoted unionization and the welfare state. The armed forces peaked at 157,000 in September 1942; 135,000 served abroad, and 10,100 died. Agriculture expanded, sending record supplies of meat, butter and wool to Britain. When American forces arrived, they were fed as well. The nation spent £574 million on the wear, of which 43% came from taxes, 41% from loans and 16% from American Lend Lease. It was an era of prosperity as the national income soared from £158 million in 1937 to £292 million in 1944. Rationing and price controls kept inflation to only 14% during 1939–45.
Montgomerie shows that the war dramatically increased the roles of women, especially married women, in the labour force. Most of them took traditional female jobs. Some replaced men but the changes here were temporary and reversed in 1945. After the war, women left traditional male occupations and many women gave up paid employment to return home. There was no radical change in gender roles but the war intensified occupational trends under way since the 1920s.
During World War II, India was a colony of Britain known as British Raj. Britain declared war on behalf of India without consulting with Indian leaders. This resulted in resignation of Congress Ministries.
The British recruited some 2.5 million Indian volunteers, who played major roles as soldiers in the Middle East, North Africa, and Burma in the British Indian Army. India became the main base for British operations against Japan, and for American efforts to support China.
In Bengal, with an elected Muslim local government under British supervision, the cutoff of rice imports from Burma led to severe food shortages, made worse by maladministration. Prices soared and millions starved because they could not buy food. In the Bengal famine of 1943, three million people died.
A small anti-British force of about 40,000 men (and a few women) formed in Southeast Asia, the Indian National Army (INA) under Subhas Chandra Bose. It was under Japanese army control and performed poorly in combat. Its members were captured Indian soldiers from British Indian Army who gained release from extreme conditions in POW camps by joining the Japanese-sponsored INA. It participated in Battle Of Kohima and Battle of Imphal. In postwar Indian politics, some Indians called them heroes.
The Congress Party in 1942 demanded immediate independence, which Britain rejected. Congress then demanded the British immediately "Quit India" in August 1942, but the Raj responded by immediately jailing tens of thousands of national, state and regional leaders; knocking Congress out of the war. Meanwhile, the Muslim League supported the war effort and gained prestige and membership, as well as British support for its demands for a separate Muslim state (which became Pakistan in 1947).
Hong Kong was a British colony captured by Japan on December 25, 1941, after 18 days of fierce fighting. The conquest was swift, but was followed by days of large-scale looting; over ten thousand Chinese women were raped or gang-raped by the Japanese soldiers. The population halved, from 1.6 million in 1941 to 750,000 at war's end because of fleeing refugees; they returned in 1945.
The Japanese imprisoned the ruling British colonial elite and sought to win over the local merchant gentry by appointments to advisory councils and neighborhood watch groups. The policy worked well for Japan and produced extensive collaboration from both the elite and the middle class, with far less terror than in other Chinese cities. Hong Kong was transformed into a Japanese colony, with Japanese businesses replacing the British. However, the Japanese Empire had severe logistical difficulties and by 1943 the food supply for Hong Kong was problematic. The overlords became more brutal and corrupt, and the Chinese gentry became disenchanted. With the surrender of Japan the transition back to British rule was smooth, for on the mainland the Nationalist and Communists forces were preparing for a civil war and ignored Hong Kong. In the long run the occupation strengthened the pre-war social and economic order among the Chinese business community by eliminating some conflicts of interests and reducing the prestige and power of the British.
Germany had not fully mobilized in 1939, nor even in 1941. Not until 1943, under Albert Speer (the minister of armaments in the Reich), did Germany finally redirect its entire economy and manpower to war production. Instead of using all available Germans, it brought in millions of foreign workers from conquered countries, treating them badly (and getting low productivity in return). Germany's economy was simply too small for a longer all-out war. Hitler's strategy was to change this by a series of surprise blitzkriegs. This failed with defeats in Russia in 1941 and 1942, and against the economic power of the allies.
Instead of expanding the economies of the occupied nations, the Nazis seized the portable machinery and rail cars, requisitioned most of their industrial output, took large quantities of food (15% of French output), and forced the victims to pay for their military occupation.
The Nazis forced 15 million people to work in Germany (including POWs); many died from bad living conditions, mistreatment, malnutrition, and executions. At its peak, forced laborers comprised 20% of the German work force and were a vital part of the German economic exploitation of the conquered territories. They were especially concentrated in munitions and agriculture. For example, 1.5 million French soldiers were kept in POW camps in Germany as hostages and forced workers and, in 1943, 600,000 French civilians were forced to move to Germany to work in war plants.
Although Germany had about double the population of Britain (80 million versus 40 million), it had to use far more labor to provide food and energy. Britain imported food and employed only a million people (5% of the labour force) on farms, while Germany used 11 million (27%). For Germany to build its twelve synthetic oil plants with a capacity of 3.3 million tons a year required 2.4 million tons of structural steel and 7.5 million man-days of labor. (Britain imported all its oil from Iraq, Persia and North America). To overcome this problem, Germany employed millions of forced laborers and POWs; by 1944, they had brought in more than five million civilian workers and nearly two million prisoners of war—a total of 7.13 million foreign workers.
Rationing in Germany was introduced in 1939 immediately upon the outbreak of hostilities. Hitler was at first convinced that it would affect public support for the war if a strict rationing program was introduced. The Nazi popularity was in fact partially due to the fact that Germany under the Nazis was relatively prosperous, and Hitler did not want to lose popularity or faith. Hitler felt that food and other shortages had been a major factor in destroying civilian morale during World War I which led to defeatism and surrender.
Despite the rationing, civilians had sufficient amounts of food and clothing; witness Howard K. Smith later wrote that "[f]or a people engaged in a life-and-death war ... the German people for two years of war ate amazingly well." The meat ration, for example, was 500g per week per person. After the German invasion of the Soviet Union in June 1941, however, this changed to 400g per week, then fell further. Estimating that the meat ration had dropped by up to 80% in five months of fighting in Russia, and citing many other changes in living conditions that suddenly occurred, Smith wrote that by the time he left Germany in late 1941, "for the first time ... the German people are undernourished". The system gave extra rations for men involved in heavy industry, and extremely low starvation rations for Jews and Poles in the areas occupied by Germany, but not to the Poles inside Germany many of whom had been brought in to perform heavy labor in German war industries.
For every person, there were rationing cards for general foodstuffs, meats, fats (such as butter, margarine and oil) and tobacco products distributed every other month. The cards were printed on strong paper, containing numerous small "Marken" subdivisions printed with their value – for example, from "5 g Butter" to "100 g Butter". Every acquisition of rationed goods required an appropriate "Marken", and if a person wished to eat a certain soup at a restaurant, the waiter would take out a pair of scissors and cut off the required items to make the soup and amounts listed on the menu. In the evenings, restaurant-owners would spend an hour at least gluing the collected "Marken" onto large sheets of paper which they then had to hand in to the appropriate authorities.
The amounts available under rationing were sufficient to live from, but clearly did not permit luxuries. Whipped cream became unknown from 1939 until 1948, as well as chocolates, cakes with rich crèmes etc. Meat could not be eaten every day. Other items were not rationed, but simply became unavailable as they had to be imported from overseas: coffee in particular, which throughout was replaced by substitutes made from roasted grains. Vegetables and local fruit were not rationed; imported citrus fruits and bananas were unavailable. In more rural areas, farmers continued to bring their products to the markets, as large cities depended on long distance delivery. Many people kept rabbits for their meat when it became scarce in shops, and it was often a child's job to care for them each day.
By the spring of 1945, food distribution and the ration system was increasingly in collapse due to insurmountable transportation disruption and the rapid advance of the Allied armies from west and east with consequent loss of food storage facilities. In Berlin, during the beginning of the Battle of Berlin, the authorities announced the allocation of a special supplementary food ration on April 20, 1945. It consisted of a pound of bacon or sausage, half a pound of rice, half a pound of peas or pulses, a pound of sugar, four ounces of coffee substitute, one ounce of real coffee, and a tin of vegetables or fruit. Additionally, the authorities announced that standard food ration allocations for the next fortnight could be claimed in advance. The extra allocation of rations were dubbed by Berliners Himmelfahrtsrationen, Ascension-day rations, "Because with these rations we shall now ascend to heaven"
Germany had a very large and well organized nursing service, with three main organizations, one for Catholics, one for Protestants, and the DRK (Red Cross). In 1934 the Nazis set up their own nursing unit, the Brown nurses, and absorbed one of the smaller groups, bringing it up to 40,000 members. It set up kindergartens, hoping to seize control of the minds of the younger Germans, in competition with the other nursing organizations. Civilian psychiatric nurses who were Nazi party members participated in the killing of invalids, although the process was shrouded in euphemisms and denials.
Military nursing was primarily handled by the DRK, which came under partial Nazi control. Frontline medical services were provided by male doctors and medics. Red Cross nurses served widely within the military medical services, staffing the hospitals that perforce were close to the front lines and at risk of bombing attacks. Two dozen were awarded the highly prestigious Iron Cross for heroism under fire. They are among the 470,000 German women who served with the military.
The conquest of Germany in 1945 freed 11 million foreigners, called "displaced persons" (DPs)- chiefly forced laborers and POWs. In addition to the POWs, the Germans seized 2.8 million Soviet workers to labor in factories in Germany. Returning them home was a high priority for the Allies. However, in the case of Russians and Ukrainians returning often meant suspicion or prison or even death. The UNRRA, Red Cross and military operations provided food, clothing, shelter and assistance in returning home. In all, 5.2 million were repatriated to the Soviet Union, 1.6 million to Poland, 1.5 million to France, and 900,000 to Italy, along with 300,000 to 400,000 each to Yugoslavia, Czechoslovakia, the Netherlands, Hungary, and Belgium.
In 1944–45, over 2.5 million ethnic Germans fled from Eastern Europe in family groups, desperately hoping to reach Germany before being overtaken by the Russians. Half a million died in the process, the survivors were herded into refugee camps in East and West Germany for years. Meanwhile, Moscow encouraged its troops to regard German women as targets for revenge. Russian Marshal Georgi Zhukov called on his troops to, "Remember our brothers and sisters, our mothers and fathers, our wives and children tortured to death by Germans....We shall exact a brutal revenge for everything." Upwards of two million women inside Germany were raped in 1945 in a tidal wave of looting, burning and vengeance.
The Japanese home front was elaborately organized, block by block, with full-scale food rationing and many controls over labor. The government used propaganda heavily and planned in minute detail regarding the mobilization of manpower, identification of critical choke points, food supplies, logistics, air raid shelters, and the evacuation of children and civilians from targeted cities. Food supplies were very tight before the heavy bombing began in fall 1944, then grew to a crisis. There was only a small increase of 1.4 million women entering the labor force between 1940 and 1944. The minister of welfare announced, "In order to secure its labor force, the enemy is drafting women, but in Japan, out of consideration for the family system, we will not draft them."
The weaknesses in the maximum utilization of womanpower was indicated by the presence of 600,000 domestic servants in wealthy families in 1944. The government wanted to raise the birthrate, even with 8.2 million men in the armed forces, of whom three million were killed. Government incentives helped to raise the marriage rate, but the number of births held steady at about 2.2 million per year, with a 10% decline in 1944–45, and another 15% decline in 1945–46. Strict rationing of milk led to smaller babies. There was little or no long-term impact on the overall demographic profile of Japan.
The government began making evacuation plans in late 1943, and started removing entire schools from industrial cities to the countryside, where they were safe from bombing and had better access to food supplies. In all 1.3 million children were moved—with their teachers but not their parents. When the American bombing began in earnest in late 1944, 10 million people fled the cities to the safety of the countryside, including two-thirds of the residents of the largest cities and 87% of the children. Left behind were the munitions workers and government officials. By April 1945, 87% of the younger children had been moved to the countryside.
Civil defense units were transformed into combat units, especially the Peoples Volunteer Combat Corps, enlisting civilian men up to the age of 60 and women to age 40. Starting in January 1945 the government operated an intensive training program to enable the entire civilian population to fight the "decisive battle" with the American invaders using grenades, explosive gliders and bamboo spears. Everyone understood they would probably die in what the government called, the "Grand Suicide of the One Hundred Million." Health conditions became much worse after the surrender in September 1945, with so much housing stock destroyed, and an additional 6.6 million Japanese repatriated from Manchuria, China, Indochina, Formosa, Korea, Saipan and the Philippines.
Agricultural production in the home islands held up well during the war until the bombing started. It fell from an index of 110 in 1942 to 84 in 1944 and only 65 in 1945. Worse, imports dried up. The Japanese food rationing system was effective throughout the war, and there were no serious incidences of malnutrition. A government survey in Tokyo showed that in 1944 families depended on the black market for 9% of their rice, 38% of their fish, and 69% of their vegetables. The Japanese domestic food supply depended, however, on imports, which were largely cut off by the American submarine and bombing campaigns. Likewise there was little deep sea fishing, so that the fish ration by 1941 was mostly squid harvested from coastal waters. The result was a growing food shortage, especially in the cities. There was some malnutrition but no reported starvation. Despite government rationing of food, some families were forced to spend more than their monthly income could offer on black market food purchases. They would rely on savings or exchange food for clothes or other possessions.
The American aerial bombing of a total of 65 Japanese cities took from 400,000 to 600,000 civilian lives, with 100,000+ in Tokyo alone, over 200,000 in Hiroshima and Nagasaki combined. The Battle of Okinawa resulted in 80,000–150,000 civilian deaths. In addition civilian death among settlers who died attempting to return to Japan from Manchuria in the winter of 1945 were probably around 100,000. The total of Japanese military fatalities between 1937 and 1945 were 2.1 million; most came in the last year of the war and were caused by starvation or severe malnutrition in garrisons cut off from supplies.
Health and living conditions worsened after the surrender in September 1945. Most of the housing stock in large cities was destroyed, just as refugees tried to return from the rural areas. Adding to the crisis there was an influx of 3.5 million returning soldiers and 3.1 million Japanese civilians forcibly repatriated from Imperial outposts in Manchuria, China, Indochina, Formosa, Korea, Saipan and the Philippines; about 400,000 civilians were left behind and not heard of again. Meanwhile, 1.2 million Koreans, POWs and other non-Japanese left Japan. The government implemented pro-natalist policies, which led to an increase in the marriage rate, but birth rates remained steady until they declined by 10% in the stress of the last year of the war, and another 15% during the hardship of the postwar period.
The American bombing campaign of all major cities severely impacted the economy, as did the shortages of oil and raw materials that intensified when Japanese merchant shipping was mostly sunk by American submarines. When industrial production was available to the military, for example, 24 percent of Japan's finished steel in 1937 was allocated to the military, compared to 85 percent in 1945. By the end of the war, output percent of the highest capacity was still 100 percent for steel, although only 75 percent for aluminum, 63 percent for machine tools, 42 percent for vacuum tubes, 54 percent cement, 32 percent cotton fabric, and 36 percent for wool.
Severe food shortages were common throughout the war zones, especially in Europe where Germany used starvation as a military weapon. Japan did not use it as a deliberate policy, but the breakdown of its transportation and distribution systems led to famine and starvation conditions among its soldiers on many Pacific islands. Bose (1990) studies the three great Asian famines that took place during the war: Bengal in India, Honan in China, and Tonkin in Vietnam. In each famine at least two million people died. They all occurred in densely populated provinces where the subsistence foundations of agriculture was failing under the weight of demographic and market pressures. In each cases famine played a role in undermining the legitimacy of the state and the preexisting social structure.
A great deal of housing was destroyed or largely damaged during the war, especially in the Soviet Union, Germany, and Japan. In Japan, about a third of the families were homeless at the end of the war. In Germany, about 25% of the total housing stock was destroyed or heavily damaged; in the main cities the proportion was about 45%. Elsewhere in Europe, 22% of the prewar housing in Poland was totally destroyed; 21% in Greece; 9% in Austria, 8% in the Netherlands; 8% in France, 7% in Britain, 5% Italy and 4% in Hungary.
Wikimedia Commons has media related to World War II home front.
↑ Bob Moore, "Jewish Self-Help and Rescue in the Netherlands during the Holocaust in Comparative Perspective," Tijdschrift voor Geschiedenis (2011) 124#4 pp 492–505.
↑ José Gotovitch, "La Rüstungs-Inspektion Belgien," Archives et Bibliotheques de Belgique (1969) 40#3 pp 436–448.
↑ Peter Williams and David Wallace, Unit 731: Japan's Secret Biological Warfare in World War II (Free Press, 1989).
↑ Sarah Fishman, We Will Wait: Wives of French Prisoners of War, 1940–1945 (1991).
↑ Roland, Charles G (1992). "Scenes of Hunger and Starvation". Courage Under Siege : Disease, Starvation and Death in the Warsaw Ghetto. Remember. New York: Oxford University Press. pp. 99–104. ISBN 978-0-19-506285-4. Retrieved 2008-01-25.
↑ "Odot" (PDF). Jerusalem: Yad Vashem.
↑ John Barber and Mark Harrison, The Soviet Home Front, 1941–1945: a social and economic history of the USSR in World War II (1991) p. 77.
↑ Barber and Harrison, The Soviet Home Front, 1941–1945 pp 81, 85–86.
↑ Barber and Harrison, The Soviet Home Front, 1941–1945 pp 91–93.
↑ Barber and Harrison, The Soviet Home Front, 1941–1945 pp 86–87.
↑ Richard Bidlack, "Survival Strategies in Leningrad during the First Year of the Soviet-German War," in The People's War: Responses to World WarII in the Soviet Union, eds. Robert W. Thurston and Bernd Bonwetsch (Urbana: University of Illinois Press, 2000), 88.
↑ Bidlack, "Survival Strategies in Leningrad," p 89.
↑ Bidlack, "Survival Strategies in Leningrad," pp 93–94.
↑ Bidlack, "Survival Strategies in Leningrad," p 97.
↑ Bidlack, "Survival Strategies in Leningrad," p 98.
↑ "World War II: Civic Responsibility" (PDF). Smithsonian Institution. Retrieved 25 March 2014.
↑ Satoshi Ara, "Food supply problem in Leyte, Philippines, during the Japanese Occupation (1942–44)," Journal of Southeast Asian Studies (2008) 39#1 pp 59–82.
↑ Alfredo G. Parpan, "The Japanese and the Philippine Church, 1942–45," Philippine Studies (1989) 37#4 pp 451–466.
↑ Victory Gosiengfiao, "The Japanese Occupation: 'The Cultural Campaign,'" Philippine Studies (1966) 14#2 pp 228–242.
↑ Angus Calder, The People's War: Britain, 1939–45 (1969) is the standard scholarly history.
↑ Postan (1952), Chapter 4.
↑ Jose Harris, "War and social history: Britain and the home front during the Second World War," Contemporary European History (1992) 1#1 pp 17–35.
↑ Until November 1939, the Neutrality Acts prohibited the export of arms from the United States to belligerents.
↑ Ruth Roach Pierson, "They're Still Women After All," The Second World War and Canadian Womanhood (McClelland & Stewart, 1986) p 9.
↑ Gavin Long, The Six Years War (1973) p. 474.
↑ « Making Britain: Second World War (1939–1945) », The Open University.
↑ Snow, Philip (2004). The Fall Of Hong Kong: Britain, China and the Japanese Occupation. Yale U.P. p. 81.
↑ Wei-Bin Zhang (2006). Hong Kong: The Pearl Made of British Mastery And Chinese Docile-Diligence. Nova Publishers. p. 109.
↑ Adam Tooze, Wages of Destruction: The Making and Breaking of the Nazi Economy (2006) pp. 429seq.
↑ Ulrich Herbert, "Forced Laborers in the 'Third Reich'", International Labor and Working-Class History (1997) Archived April 15, 2008, at the Wayback Machine.
↑ Smith, Howard K. (1942). Last Train from Berlin. Knopf. pp. 115–116, 120–131.
↑ Ryan, Cornelius (2015). The Last Battle (2015 ed.). London: Hodder & Stouton. ISBN 978-1-473-62007-0.
↑ Nakamura, Takafusa, et al. eds. Economic History of Japan 1914–1955: A Dual Structure (vol 3 2003), 326 – 32.
↑ ""Food Situation," November 2, 1945, Asahi, In Press Translations Japan, Social series, No. 1, Item 3, Pages 2-3, ATIS, G2, SCAP, November 5, 1945.". Dartmouth Digital Library. 2 Nov 1945. Retrieved 26 Oct 2015.
↑ One third of the Soviet housing stock was damaged or destroyed according to Jane R. Zavisca (2012). Housing the New Russia. Cornell UP. p. 29.
↑ Niall Ferguson, "The Second World War as an Economic Disaster", in: Michael J. Oliver and Derek Howard Aldcroft, eds. (2007). Economic Disasters of the Twentieth Century. Edward Elgar. p. 83.
↑ Jeffry M. Diefendorf Professor and Chair of the History Department University of New Hampshire (1993). In the Wake of War : The Reconstruction of German Cities after World War II: The Reconstruction of German Cities after World War II. Oxford UP. pp. 126–27.
Cohen, Jerome (1949). Japan's Economy in War and Reconstruction. University of Minnesota Press. online version.
Davies, Norman (2004). Rising '44: The Battle for Warsaw. Vikiing. ISBN 0-670-03284-0.
Gutman, Israel (1994). Resistance: The Warsaw Ghetto Uprising. Houghton Mifflin. ISBN 978-0-395-60199-0.
Hancock, W. K. and Gowing, M.M. (1949). British War Economy: History of the Second World War: United Kingdom Civil Series. London: HMSO and Longmans, Green & Co. Available on-line at: British War Economy.
Harrison, Mark (1988). "Resource Mobilization for World War II: The U.S.A., UK, USSR and Germany, 1938–1945". In: Economic History Review, (1988): pp 171–92.
Postan, Michael (1952). British War Production: History of the Second World War: United Kingdom Civil Series. London: HMSO and Longmans, Green & Co. Available on-line at: British War Production.
Titmuss, Richard M. (1950). Problems of Social Policy: 'History of the Second World War: United Kingdom Civil Series. London: HMSO and Longmans, Green & Co. Available on-line at: Problems of Social Policy.
Higonnet, Margaret R., et al., eds. Behind the Lines: Gender and the Two World Wars Yale UP, 1987.
Marwick, Arthur. War and Social Change in the Twentieth Century: A Comparative Study of Britain, France, Germany, Russia, and the United States 1974.
Noakes, Jeremy ed., The Civilian in War: The Home Front in Europe, Japan and the U.S.A. in World War II Exeter, UK: University of Exeter, 1992.
Overy, Richard. The Bombers and the Bombed: Allied Air War Over Europe, 1940–1945 (Viking; 2014) 562 pages; covers the civil defence and the impact on the home fronts of Allied strategic bombing of Germany, Italy, France, the Netherlands, Belgium, Bulgaria, and Scandinavia.
Yust, Walter, ed. 10 Eventful Years: 1937–1946 4 vol. Encyclopædia Britannica, 1947. Highly detailed encyclopedia of events in every country.
Brivati, Brian, and Harriet Jones, ed. (1993) What Difference Did the War Make? The Impact of the Second World War on British Institutions and Culture. Leicester UP; 1993.
Champin, David. (2008) "'The war has turned our lives upside-down': The Merit of Commercial Advertising in Documenting the Cultural History of the British Home Front in the Second World War." Visual Resources: An International Journal of Documentation (2008) 24#2 pp 145–158.
Corelli, Barnett. (1986) The Audit of War: The Illusion and Reality of Britain as a Great Nation.
Hancock, W. K. and Gowing, M.M. (1949) British War Economy (official History of the Second World War). Online at: British War Economy.
Hancock, W. K. (1951) Statistical Digest of the War (official History of the Second World War). Online at: Statistical Digest of the War.
Harris, Carol (2000). Women at War 1939–1945: The Home Front. Thrupp: Sutton Publishing Limited. ISBN 0-7509-2536-1.
Marwick, Arthur (1976). The Home Front: The British and the Second World War. .
Postan, Michael (1952) British War Production (official History of the Second World War). Online at: British War Production.
Summerfield, Penny. (1998) "Research on Women in Britain in the Second World War: An Historiographical Essay," Cahiers d'Histoire du Temps Présent 4: 207–226.
Darian-Smith, Kate. On the Home Front: Melbourne in Wartime, 1939–1945. Australia: Oxford UP, 1990.
Granatstein, J. L. Canada's War: The Politics of the Mackenzie King Government. Oxford UP, (1975).
Granatstein, J. L., and Desmond Morton. A Nation Forged in Fire: Canadians and the Second World War, 1939–1945 (1989).
Latta, Ruth. The Memory of All That: Canadian Women Remember World War II. (Burnstown, Ontario: The General Store Publishing House, 1992).
Coble, Parks M. "China's 'New Remembering' of the Anti-Japanese War of Resistance, 1937–1945," The China Quarterly (2007), 190: 394–410.
Fairbank, John, and Albert Feuerwerker, eds., Republican China 1912–1949 in The Cambridge History of China, vol. 13, part 2. Cambridge University Press, 1986.
Hall, W.-D. The Youth of Vichy France (Oxford, 1981).
Hagemann, Karen. "Mobilizing Women for War: The History, Historiography, and Memory of German Women's War Service in the Two World Wars," Journal of Military History (2011) 75:1055–1093.
Milward, Alan. The German Economy at War 1965.
Overy, Richard. War and Economy in the Third Reich Oxford UP, 1994.
Absalom, R, "Italy", in J. Noakes (ed.), The Civilian in War: The Home Front in Europe, Japan and the U.S.A. in World War II. Exeter: Exęter University Press. 1992.
Wilhelm, Maria de Blasio. The Other Italy: Italian Resistance in World War II. W. W. Norton, 1988. 272 pp.
Willson, Perry. "Empire, Gender and the 'Home Front' in Fascist Italy." Women's History Review 16#4 (2007): 487-500.
Cook, Haruko Taya, and Theodore Cook. Japan at War: An Oral History (1992), interviews.
Dower, John. Japan in War and Peace 1993.
Duus, Peter, Ramon H. Myers, and Mark R. Peattie. The Japanese Wartime Empire, 1931–1945. Princeton UP 1996. 375p.
Havens, Thomas R. Valley of Darkness: The Japanese People and World War II. 1978.
Nakamura, Takafusa, et al. eds. Economic History of Japan 1914–1955: A Dual Structure (vol 3 2003), pp 247–332.
Noakes, Jeremy, ed. The Civilian in War: The Home Front in Europe, Japan and the USA in World War II (U of Exeter Press, 1992).
Yamashita, Samuel Hideo. Daily Life in Wartime Japan, 1940-1945 (2015).
Hartendorp A. V.H. The Japanese Occupation of the Philippines. Manila: Bookmark, 1967. 2 vols.
Steinberg, David J. Philippine Collaboration in World War II. University of Michigan Press, 1967. 235p.
Gross, Jan T. Polish Society under German Occupation: The Generalgouvernement, 1939–1944. Princeton UP, 1979.
Andenaes, Johs, et al. Norway and the Second World War (ISBN 82-518-1777-3) Oslo: Johan Grundt Tanum Forlag, 1966.
Salmon; Patrick, ed. Britain and Norway in the Second World War London: HMSO, 1995.
Vallin, Jacques; Meslé, France; Adamets, Serguei; and Pyrozhkov, Serhii. "A New Estimate of Ukrainian Population Losses During the Crises of the 1930s and 1940s." Population Studies (2002) 56(3): 249–264. in JSTOR Reports life expectancy at birth fell to a level as low as ten years for females and seven for males in 1933 and plateaued around 25 for females and 15 for males in the period 1941–44.
|
0.961668 |
"I have a dream" - Thundered Martin Luther King Jr standing in front of Lincoln Memorial on 28-Aug-1963 . He did have a dream..Everyone who flocked to America had a dream. What makes the United States a land of opportunities ? To feel the answer, you have to visit Washington DC.
I visited Washington DC before NewYork . Yet, I chose to write about New York first and then DC. Thats because to illustrate USA, the best metaphor is NY. But to understand why USA has been so and so, there is perhaps no better substitute than Washington DC.
The answers to that is present in the National Archives building made famous to the young generation by the movie National Treasure. In there lies three important pieces of history that has defined America - Bill of Rights, Declaration of Independence, Constitution . To most visitors, Declaration of Independence is the central piece of attraction here. To me, it was Bill of Rights.
Everyone picks up a copy of Declaration of Independence, I picked up a copy of Bill of Rights.
Written by James Madison in response to the demand to safe guard individual freedom and liberties, Bill of Rights is the set of first ten amendments to the US constitution. The first glance at Bill of Rights is sure to give you an 'ah its so out-dated' kind of feeling. While that feeling to a millennial won't be unsubstantiated, the essence of bill of rights is that United States placed individual liberties as of paramount importance even above the constitutional limits.
In this age where the national boundaries are getting more firmer through the political events happening around the world, Bill of Rights ( which has to be read in conjunction with the 'Federalist Papers' ) is a wonderful and inspiring pointer for the lawmakers today towards a set of questions - What should be the central philosophy of lawmaking - Nation or People ? What exactly is Nation ? Does it make sense to preach the concept of Nation to a set of population which is deprived of basic human necessities ?
DC houses some of the most visible symbols of United States - The Capitol ( Parliament equivalent ) , Whitehouse , a huge number of memorials and museums.
The FDR memorial is one of the recent ones as well as most impressive ones. Dedicated to Franklin D Roosevelt who led America through the tumultuous part of 20th century inspite of this disabilities, this place captures various phases in his life and career through a series of quotes.
The cold war era has got two outstanding memorials here -Korean War and Vietnam war memorial. Korean war memorial is an architecturally and symbolically interesting place. 19 soldiers scanning 360 degrees around them. The reflection plus the original 19 soldiers refer to the North 38 degree parallel which separated North and South Korea.
A thought is left at the end of national archives referring to Vietnam war - Why did these mistakes happen inspite of having such robust and well debated bill of rights and constitution ? Thats something worth examining in detail for someone interested in modern American history.
|
0.982171 |
Bcl-2 family member Bid is subject to autoinhibition; in the absence of stimuli, its N-terminal region sequesters the proapoptotic Bcl-2 homology 3 (BH3) domain. Upon proteolytic cleavage in its unstructured loop, Bid is activated, although structural data reveal no apparent resulting conformational change. We found that, upon Bid cleavage, the N-terminal fragment (tBid-N) is ubiquitinated and degraded, thus freeing the BH3 domain in the C-terminal fragment (tBid-C). Ubiquitination of tBid-N is unconventional because acceptor sites are neither lysines nor the N terminus. Chemical approaches implicated thioester and hydroxyester linkage of ubiquitin and mutagenesis implicated serine and possibly threonine as acceptor residues in addition to cysteine. Acceptor sites reside predominantly but not exclusively in helix 1, which is required for ubiquitination and degradation of tBid-N. Rescue of tBid-N from degradation blocked Bid's ability to induce mitochondrial outer membrane permeability but not mitochondrial translocation of the cleaved complex. We conclude that unconventional ubiquitination and proteasome-dependent degradation of tBid-N is required to unleash the proapoptotic activity of tBid-C.
In mammalian cells, mitochondria activate the apoptotic execution machinery. Apoptotic stimuli induce mitochondrial outer membrane permeability and the release of proapoptotic proteins such as cytochrome c (Cyt c) into the cytosol. The collective action of these molecules results in effector caspase activation and apoptotic cell death (Wang, 2001). Mitochondrial permeabilization is controlled by the Bcl-2 protein family, which comprises the antiapoptotic Bcl-2 subfamily and the proapoptotic Bax/Bak and Bcl-2 homology 3 (BH3) domain–only subfamilies (Adams and Cory, 1998). Their functional activity relies on homo- and heterodimerization, which proceeds by interaction of the BH3 domain α helix with a groove formed by the BH1 and 2 domains (Sattler et al., 1997).
The BH3 domain–only subfamily has many members that specialize in responsiveness to specific apoptotic stimuli (Puthalakath and Strasser 2002). BH3-only proteins require Bax or Bak to induce cell death. They induce assembly of Bax/Bak into homomultimers in the mitochondrial outer membrane (Wei et al., 2000; Kuwana et al., 2002). These multimers are postulated to either form transmembrane pores themselves or to facilitate pore formation. Inhibitory Bcl-2 family members sequester only BH3 and/or Bax/Bak proteins, thereby preventing their participation in proapoptotic complexes (Cheng et al., 2001).
The BH3 domain–only protein Bid conveys the apoptotic signal from death receptors, such as TNF receptor 1, TNF-related apoptosis-inducing ligand (TRAIL) receptors, and Fas/CD95 to mitochondria (Li et al., 1998; Luo et al., 1998). Upon ligand binding, these death receptors induce formation of a complex between the intracellular adaptor Fas-associated death domain and procaspase-8 or -10. This results in increased local concentrations of these inducer caspases, which leads to their activation (Boatright and Salvesen, 2003). Active caspase-8/10 can cleave and activate Bid as well as effector caspases. In certain cell types, the mitochondrial route is dispensable for death receptor–induced apoptosis, whereas in others it constitutes an essential amplification loop for effector caspase activation (Yin et al., 1999).
The three-dimensional organization of full-length Bid has been resolved by nuclear magnetic resonance (NMR; Chou et al., 1999; McDonnell et al., 1999). Residues 1–12 and 43–77 form unstructured loops. The structured portion consists of eight α helices arranged in a compact fold (Fig. S1 A, available at http://www.jcb.org/cgi/content/full/jcb.200707063/DC1). Of these, helix 3 constitutes the BH3 domain, which is fixed by hydrophobic contacts with helixes 1 and 8. The sites for proteolytic cleavage by caspase-8 or granzyme B lie in the second unstructured loop (D60 and D75, respectively). In solution, N- and C-terminal fragments of Bid remain associated upon cleavage by caspase-8 and the complex undergoes no apparent conformational change (Chou et al., 1999; Kudla et al., 2000; Zha et al., 2000). Cleavage generates an N-terminal glycine in truncated C-terminal Bid (tBid-C) that can be myristoylated. This lipid modification facilitates targeting of tBid-C to mitochondria but is not required for it (Zha et al., 2000). Rather, helices 4, 5, and 6 appeared to be the critical elements for such targeting, specifically to cardiolipin-enriched domains in the mitochondrial membrane (Lutter et al., 2000).
Making the BH3 domain available for interactions with the BH1/BH2 groove of other Bcl-2 family members is essential for Bid's proapoptotic function. The solution structure of Bid indicates that the BH3 domain must be freed from the structural constraint that is exerted by the N-terminal fragment of Bid (tBid-N; Chou et al., 1999; McDonnell et al., 1999). Indeed, several biochemical studies have shown that tBid-N acts as an inhibitor of tBid-C (Tan et al., 1999; Kudla et al., 2000; Renshaw et al., 2004). Specifically, Tan et al. (1999) produced compelling evidence for autoinhibition of Bid by interactions between helix 2 and the BH3 domain. A mutant full-length Bid protein in which these interactions were abrogated was as effective as tBid-C in inducing apoptosis and binding to Bcl-xL (Tan et al., 1999). The natural occurrence of an alternative splice form of Bid that lacks the BH3 domain but possesses the inhibitory N-terminal sequences lends further support to the idea that this is an important mode of tBid-C regulation (Renshaw et al., 2004). We have addressed the question of how Bid cleavage can release tBid-C from inhibition by tBid-N. We reveal that this is accomplished by unconventional ubiquitination of the tBid-N fragment followed by its proteasomal degradation.
To follow the fate of tBid-N and tBid-C, Bid was N-terminally Myc tagged, C-terminally fused to GFP, and expressed in MCF-7 breast carcinoma cells, which were examined by confocal laser scanning microscopy (CLSM). In unstimulated cells, Myc and GFP signals indicated a cytoplasmic localization of full-length Myc Bid GFP (Fig. 1 A, I–III). After stimulation with TNF-α for 8 h, the GFP signal was punctate and colocalized with MitoTracker, which indicates translocation of tBid-C GFP to mitochondria (Fig. 1 A, V and VI). Surprisingly, Myc tBid-N was undetectable by CLSM (Fig. 1 A, IV).
tBid-N disappears upon its generation. (A) MCF-7 cells expressing Myc Bid GFP were stimulated with TNF-α for 8 h or not (control), stained to detect mitochondria (MitoTracker) and the N-terminal Myc tag, and examined by CLSM. (B and C) MCF-7 cells expressing Myc Bid GFP were stimulated with TNF-α or TRAIL. Equal amounts of total lysate protein were separated by SDS-PAGE, blotted to nitrocellulose, probed with antibodies to the N-terminal Myc and C-terminal GFP tags, and reprobed with an anti-actin antibody as a loading control. Molecular masses (kD) of marker proteins are indicated.
Full-length Myc Bid GFP was readily detectable by both anti-Myc and -GFP immunoblotting in unstimulated MCF-7 cells and gradually decreased after stimulation with TNF-α (Fig. 1 B). Although the tBid-C GFP fragment could readily be visualized at the 4- and 8-h time points, the Myc tBid-N fragment (predicted molecular mass, 7 kD) was undetectable (Fig. 1 B). Similar results were obtained with an antibody that recognizes both N- and C-terminal epitopes on Bid (unpublished data). After stimulation with the death receptor ligand TRAIL, a similar picture emerged. At the 8-h time point, full-length Myc Bid GFP levels were decreased and a tBid-C GFP fragment had been generated. However, no Myc tBid-N was detectable (Fig. 1 C). Collectively, these results suggest that the tBid-N fragment that is generated by caspase-8/10 is rapidly degraded.
To investigate whether tBid-N was degraded by the proteasome, MCF-7 cells were stimulated with TNF-α in the presence or absence of the proteasome inhibitor MG132. Stimulation with TNF-α for 8 h resulted in the appearance of the endogenous tBid-C fragment but the tBid-N fragment was barely detectable (Fig. 2 A, left). When cells were stimulated in the presence of MG132, the amount of endogenous tBid-N was clearly increased. Similar results were obtained with transfected Myc Bid GFP; the Myc tBid-N fragment was only detectable when cells were stimulated in the presence of MG132 (Fig. 2 A, right).
tBid-N is degraded by the proteasome. (A) MCF-7 cells that were not transfected (left) or transfected with Myc Bid GFP (right) were stimulated with TNF-α alone or in combination with MG132 for 8 h. Total lysates were probed for endogenous Bid (left) or transfected Myc Bid GFP (right) and cleavage fragments thereof with an anti-Bid antibody. Reprobing was performed with an anti-Myc antibody. (B) HeLa cells expressing HA-tagged tBid-N were treated for 8 h with CHX and the proteasome inhibitor MG132 as indicated. Total cell lysates were probed for HA tBid-N with an anti-HA antibody. (C) HeLa cells expressing HA tBid-N were labeled with [35S]methionine and [35S]cysteine for 2 h followed by a chase with nonradioactive amino acids for the indicated time periods. Bid protein was immunoprecipitated (IP) from detergent lysates with anti-HA mAb and resolved by SDS-PAGE. Radioactive signals were quantified by phosphorimaging. IDV, integrated density value. (D) HeLa cells transfected to express untagged tBid-N were treated or not with MG132 for 16 h. Total lysates were probed for tBid-N with an anti-Bid antibody. Blots were reprobed with an anti-actin antibody as indicated. Molecular masses (kD) of marker proteins are indicated.
To determine whether targeting of tBid-N for proteasomal degradation required a proapoptotic stimulus, the tBid-N fragment was expressed in cells. The degradation pathway was constitutively active because protein synthesis inhibition with cycloheximide (CHX) for 8 h resulted in the loss of HA-tagged tBid-N (Fig. 2 B). Proteasome inhibition with MG132 abrogated this loss and increased the HA tBid-N pool in cells that had not been treated with CHX (Fig. 2 B). HA tBid-N–expressing cells were pulse labeled for 2 h with [35S]methionine and [35S]cysteine and the fate of the labeled pool was followed during a 60-min chase period. The half-life of the labeled HA tBid-N pool was ∼5 min (Fig. 2 C). Untagged tBid-N was even more unstable than the HA-tagged version; it was only detectable when cells had been incubated with MG132 (Fig. 2 D). Collectively, these results indicate that tBid-N, upon its generation by caspase-8/10, is targeted for proteasome-dependent degradation by a pathway that is not dependent on apoptotic stimulation.
Because tBid-N was targeted to the proteasome, we investigated whether it was ubiquitinated. To this end, tBid-N N-terminally tagged with the HA epitope (sequence YPYDVPDYA) was expressed in HeLa cells with or without FLAG-tagged ubiquitin. An anti-HA reactive smear, characteristic of polyubiquitination, was associated with immunoprecipitated HA tBid-N (Fig. 3 A). In addition, we examined ubiquitination of tBid-N as generated from full-length Bid after death receptor stimulation. MCF-7 cells expressing Myc Bid GFP were left untreated or stimulated with TNF-α for 8 h in the presence of MG132. Lysates were immunoprecipitated with anti-GFP and immunoprecipitated sequentially with an anti-Myc antibody to recover a Myc tBid-N fragment. Immunoblotting for Bid and ubiquitin revealed that ubiquitin was uniquely associated with cleaved but not full-length Bid and specified that Myc tBid-N contained ubiquitin (Fig. 3 B). Ubiquitin was also found to be associated with tBid-C in accordance with previously published data (Breitschopf et al., 2000b).
tBid-N is ubiquitinated in an unconventional manner. (A) HeLa cells were transfected to express HA tBid-N alone or in combination with FLAG-tagged ubiquitin. HA tBid-N was immunoprecipitated and probed with an anti-HA mAb to detect Bid and probed with anti-FLAG mAb to detect ubiquitin. Asterisks indicate heavy and light chains of anti-HA mAb. (B) MCF-7 cells expressing Myc Bid GFP were stimulated with TNF-α in the presence of MG132 for 8 h or not stimulated (control). Lysates were immunoprecipitated with an anti-GFP antibody and immunoprecipitated sequentially (seq) with an anti-Myc mAb, and immunoprecipitates (IP) were probed with an anti-Bid antibody and a P4D1 anti-ubiquitin mAb. (C) Assay to determine whether the N terminus is ubiquitinated. In the diagram, the tBid-N TAP proteins are assessed for ubiquitination. Cal–TEV–Prot A indicates the TAP tag with calmodulin- and IgG-binding sites separated by a cleavage site for TEV protease (arrows). HeLa cells were transfected to express HA-ubiquitin and TAP-tagged tBid-N. TAP-tagged tBid-N proteins were isolated with IgG beads, digested with TEV protease, and reisolated with calmodulin beads. Isolates were probed for ubiquitin with an anti-HA mAb and for tBid-N with an anti-Bid antibody. Note that in I, the Prot A sequence is still attached to the tBid-N TAP species and the anti-Bid antibody binds to it. Molecular masses (kD) of marker proteins are indicated.
Ubiquitination was surprising because tBid-N has no lysine residues that conventionally act as ubiquitin acceptor sites (Fig. S1 B). Typically, ubiquitin can be linked either via a peptide bond to the ε amino group of a lysine residue or to the α amino group of an N-terminal residue (Ciechanover and Ben-Saadon, 2004). Because linkage to lysine was excluded, we investigated whether the N terminus of tBid-N acted as a ubiquitin acceptor site. To this end, tBid-N was fused C-terminally to a tandem affinity purification (TAP) tag, which contains a calmodulin-binding domain and protein A sequence separated by a tobacco etch virus (TEV) protease-sensitive site (ENLYFQG). This allows for two-step purification; first on IgG beads and then after cleavage by TEV on calmodulin beads (Rigaut et al., 1999). In one tBid-N TAP construct (TEV tBid-N TAP 7), sequences encoding the first seven amino acids of tBid-N and a TEV protease site were cloned upstream of the tBid-N coding region (Fig. 3 C). If tBid-N would indeed be ubiquitinated at its N-terminal residue, TEV cleavage should remove the associated ubiquitin. tBid-N TAP and TEV tBid-N TAP 7 were expressed with HA-ubiquitin in HeLa cells. Fig. 3 C (I) shows the position of tBid-N TAP proteins before TEV cleavage, as isolated with IgG beads. TEV cleavage was successful, as shown by the difference in migration of Bid species recovered on calmodulin beads (Fig. 3 C, II). After TEV cleavage, ubiquitin remained attached to digestion product of TEV tBid-N TAP 7 (Fig. 3 C, III). TEV protease had efficiently cleaved at the N-terminal site because the difference in molecular mass between the two Bid species was smaller than before TEV cleavage (Fig. 3 C, compare I and II). A very small difference remained because TEV cleaves within the added protease recognition sequence. Ubiquitin was attached to Bid and not to the TAP tag because the TAP tag alone did not carry ubiquitin upon coexpression with HA-ubiquitin in HeLa cells (Fig. S2, available at http://www.jcb.org/cgi/content/full/jcb.200707063/DC1). This experiment argues against the possibility that the N-terminal residue of tBid-N is the ubiquitin acceptor site. Moreover, analysis of the first tryptic peptide of tBid-N TAP by MALDI-TOF/TOF mass spectrometry determined that the N terminus of Bid is acetylated and thereby not available for ubiquitin modification (unpublished data). These data indicate that tBid-N is ubiquitinated at a site that is neither a lysine nor the N terminus.
To identify regions in tBid-N that were required for ubiquitination and concomitant proteasome-mediated degradation, we made progressive N-terminal deletions. Deletion mutants of tBid-N GFP were expressed in HeLa cells, which were treated or not with CHX for 8 h and stability was assessed by immunoblotting of total cell lysates. Although tBid-N GFP remained highly unstable upon deletion of up to 13 N-terminal residues, deletion of 15 or more (17, 23, or 33) N-terminal amino acids dramatically increased its half-life (Fig. 4 A). To assess whether stabilization correlated with decreased ubiquitination, wild-type and Δ15 tBid-N GFP were expressed in HeLa cells together with FLAG-tagged ubiquitin. Anti-Bid immunoblotting of total cell lysates showed that wild-type and Δ15 tBid-N GFP were expressed to a similar extent (Fig. 4 B). Ubiquitinated tBid-N GFP species were immunoprecipitated with an anti-FLAG antibody and identified by anti-Bid immunoblotting. This analysis showed that wild-type tBid-N GFP was polyubiquitinated, whereas the Δ15 tBid-N GFP mutant bore virtually no ubiquitin (Fig. 4 B). FLAG ubiquitin expression was comparable in all transfectants (unpublished data). The combined findings in the stability and ubiquitination assays lead to the conclusion that residues 14 and/or 15 contain information that is critical for ubiquitination and destabilization of tBid-N. These are the first residues that take part in the α helix 1 of Bid (Fig. S1 B). Their deletion is expected to disrupt this structure and may therefore result in the loss of ubiquitination sites and/or the loss of a binding site for the ubiquitin ligase.
Helix 1 is critical for tBid-N ubiquitination and degradation. (A) Wild-type (wt) tBid-N GFP and deletion (Δ) mutants lacking 7, 13, 15, 17, 23, or 33 N-terminal amino acids were expressed in HeLa cells, which were treated (+) or not (−) with CHX for 8 h. The tBid-N GFP proteins were detected in total lysates by immunoblotting with anti-Bid antibody. (B) GFP, wt, and Δ15 tBid-N GFP were expressed in HeLa cells together with FLAG-tagged ubiquitin. Total cell lysates (TCL) were probed with an anti-Bid antibody to assess tBid-N expression levels. Ubiquitinated protein species were isolated with an anti-FLAG mAb (IP) and probed with an anti-Bid antibody. Single asterisk indicates heavy and light chains of the anti-FLAG mAb; double asterisk indicates endogenous full-length Bid. (C) FLAG-tagged ubiquitin was coexpressed in HeLa cells with HA tBid-N versions with a TEV protease cleavage site at position 10, 30, or 43. HA tBid-N molecules were isolated, incubated with (+) or without (−) TEV protease, run on a gel, and probed by immunoblotting for Bid and ubiquitin (anti-FLAG). In the case of HA tBid-N TEV 10, the HA-tagged cleavage fragment repeatedly did not resolve on gel but the remaining undigested HA tBid-N TEV 10 and weakly ubiquitinated species of the cleavage fragment (arrows) are clearly visible. All experiments in this figure were performed three times with similar results. Molecular masses (kD) of marker proteins are indicated.
To ascertain whether helix 1 contained ubiquitination sites, we performed mapping experiments. Cleavage sites for the TEV protease were introduced in HA tBid-N after residues 10, 14, 30, or 43 and these recombinant proteins were expressed in the presence of FLAG ubiquitin. They were isolated with anti-HA antibody, digested with TEV protease, and probed for the presence of ubiquitin and Bid. In the case of the HA tBid-N TEV 43 and 30 proteins, cleavage with TEV protease resulted in a shift in molecular mass of both Bid and the ubiquitin signal. There was no apparent loss of the ubiquitin signal (Fig. 4 C). This proves that tBid-N is directly ubiquitinated and indicates that predominant ubiquitin acceptor sites are among residues 1–30 of tBid-N. The HA tBid-N TEV 14 protein did not cleave with TEV protease (unpublished data). Upon TEV digestion of HA tBid-N TEV 10, the ubiquitin signal was strongly reduced (Fig. 4 C). The HA tBid-N 1–10 fragment did not resolve on a gel, but weakly ubiquitinated species of this fragment are visible (Fig. 4 C, arrows). The remaining ubiquitin was mainly associated with the undigested HA tBid-N TEV 10. We conclude that tBid-N is predominantly ubiquitinated on sites between residues 10 and 30 but also to a certain extent on sites between residues 1 and 10. The deletion and mapping experiments collectively indicate that helix 1 (residues 14–29; Fig. S1 B) is critical for ubiquitination to occur.
Lack of lysine residues is a common feature of tBid-N in different species (human, chimpanzee, mouse, rat, cow, and pig; Fig. S1 C). We surmised that tBid-N might be ubiquitinated on cysteine residues. Three such sites are available among residues 1–30 of human tBid-N: C3, C15, and C28. Ubiquitin linkage to cysteine is not uncommon because the E2 and E3 enzymes are charged with ubiquitin in this manner. In such case, the carboxyl group of the C-terminal glycine in ubiquitin forms a thioester bond with the sulfhydryl group in cysteine, which is easily reducible. To address this possibility, ubiquitinated HA tBid-N was isolated and subjected to reduction with DTT under denaturing conditions. HA tBid-N was reprecipitated with an anti-HA antibody to separate it from possibly dissociated ubiquitin moieties. As a positive control, we used in vitro–ubiquitinated E2-25K, an E2 that is monoubiquitin charged through a thioester bond in its active site (Pichler et al., 2005). Indeed, DTT treatment resulted in a loss of ubiquitin from E2-25K species (Fig. 5 A). Importantly, the same treatment diminished the amount of ubiquitin appended to HA tBid-N (Fig. 5 A). This experiment indicates that cysteines are among the ubiquitin acceptor sites in tBid-N. However, we found with high reproducibility that ubiquitin was partially retained on tBid-N upon reduction, which argues that other residues play roles as acceptor sites as well. Point mutation of C15 or C28 either alone or in conjunction (Table S1, available at http://www.jcb.org/cgi/content/full/jcb.200707063/DC1) did not stabilize tBid-N (Fig. S3). It also did not reproducibly reduce ubiquitination of the 1–30 fragment of HA tBid-N TEV 30 (Fig. 5 B). Additional mutation of C3 made HA tBid-N TEV 30 very unstable, such that it could only be expressed at lower levels than the wild-type protein (Figs. 5 B and S3). However, it could clearly be demonstrated that the cysteine-deficient (C3;C15;C28) mutant of HA tBid-N TEV 30 still carried ubiquitin after TEV digestion (Fig. 5 B). This relates with the partial reducibility of ubiquitination and leads to the important conclusion that residues 1–30 of tBid-N harbor residues, other than cysteine, to which ubiquitin can be conjugated.
Ubiquitin is partially reducible, hydrolyzable, and affected by combined mutation of S, T, and C residues. (A) HA tBid-N was coexpressed with FLAG ubiquitin in HeLa cells. Anti-HA immunoprecipitates were reduced (+) or not (−) as described in Materials and methods and reprecipitated with an anti-HA mAb. Reprecipitates were probed for Bid (anti-HA) and ubiquitin (anti-FLAG). Recombinant E2-25K as a positive control for cysteine ubiquitination was ubiquitinated in vitro, reduced or not, and probed with mAb to E2-25K or ubiquitin. The asterisk indicates free recombinant ubiquitin. IDV, integrated density values showing comparable tBid-N loading. (B) Alanine substitution mutations were generated in HA tBid-N TEV 30. All mutants listed in Table S1 (available at http://www.jcb.org/cgi/content/full/jcb.200707063/DC1) were tested for ubiquitination and part of the results are shown here. Wild-type and mutant proteins were expressed in HeLa cells together with FLAG ubiquitin, isolated with anti-HA mAb, and treated (+) or not (−) with TEV protease. Anti-HA immunoblotting was performed to assess Bid expression and cleavage and anti-FLAG immunoblotting was performed to examine ubiquitination. Arrows indicate positions of the ubiquitinated TEV cleavage fragment. (C) tBid-N TAP was coexpressed with HA-ubiquitin in HeLa cells. Cell lysates were treated at pH 7.4 or 12 as indicated in Materials and methods and tBid-N TAP was purified on the TAP tag. Calmodulin-bound protein was separated by SDS-PAGE and probed for Bid (anti-Bid) and ubiquitin (anti-HA). All experiments in this figure were performed three times with similar results. Molecular masses (kD) of marker proteins are indicated. Black lines indicate that intervening lanes have been spliced out.
The potential alternative ubiquitination sites in tBid-N (1–30) are serine and threonine residues because the carboxyl group of the C-terminal glycine in ubiquitin can theoretically form an ester bond with the hydroxyl group in the side chain of these amino acids. There is recent biological precedent for this type of ubiquitin conjugation by viral ubiquitin ligases (Wang et al., 2007). To test this possibility, we investigated whether the ubiquitin linkage was susceptible to alkaline hydrolysis. HeLa cells expressing tBid-N TAP and HA-ubiquitin were lysed at either pH 7.4 or 12, heated for 10 min at 70°C, diluted in buffer with neutral pH, and subjected to TAP purification. Isolates were probed for Bid and ubiquitin. Equal amounts of tBid-N TAP were recovered from both lysates but, after treatment at pH 12, the amount of ubiquitin associated with tBid-N was greatly diminished (Fig. 5 C). Thioester bonds are very easily hydrolysable but the dramatic loss of ubiquitination after hydrolysis was compatible with the notion that hydroxyl ester bonds were involved as well. To verify that the hydrolysis procedure left conventional lysine-linked ubiquitin moieties unaffected, we tested its effect on a complex of purified, in vitro–ubiquitinated Ring1b and Bmi1 (Buchwald et al., 2006). After the ubiquitination reaction, the complex was incubated at pH 7.4 or 12, exactly as was done for tBid-N TAP. In addition, it was heated in the presence of β-mercaptoethanol to test the effect of reduction. The conditions were neutralized and the complex was recovered by virtue of His tags and examined for the extent of ubiquitination by immunoblotting. None of the treatments affected the ubiquitination status of Ring1b (Fig. S4, available at http://www.jcb.org/cgi/content/full/jcb.200707063/DC1).
For mutation analysis of serines and threonines, we focused on the residues in helix 1. Among these, T17 is completely conserved between species (Fig. S1 C). However, alanine substitution of T17 alone did not stabilize tBid-N or affect ubiquitination of the 1–30 fragment of tBid-N (unpublished data). Additional mutation of S27, C28, and S29 or mutation of all serines, threonines, and cysteines in helix 1 did not stabilize tBid-N either (Fig. S3). It reproducibly reduced ubiquitination of the 1–30 fragment to a certain extent but did not abrogate it (Fig. 5 B). Additional mutation of C3 rendered HA tBid-N TEV 30 highly unstable (Fig. S3), but we could reveal ubiquitination on the 1–30 fragment, which supports the conclusion that residues other than cysteines are acceptor sites (Fig. 5 B). This result indicated a possible role for S9 and/or S10. However, alanine substitution of these residues either alone or in conjunction with the potential acceptor sites in helix 1 did not stabilize tBid-N (Fig. S3). Importantly, ubiquitination of the 1–30 fragment was virtually abrogated when alanine substitution of S9 and S10 was combined with alanine substitution of cysteine, threonine, and serine residues in helix 1 (Fig. 5 B). This result indicates that one or more of these residues is a ubiquitination site.
We conclude from the combined biochemical and mutation analyses that tBid-N is ubiquitinated on cysteine residues, but not exclusively so. There are ubiquitination sites other than cysteine among residues 1–30. We postulate that these are serine and/or threonine residues, given the hydrolysability of the ubiquitination and the results of mutation analysis. Unambiguously pinpointing the ubiquitination sites by mutation analysis is hampered by the effects of mutation on protein stability and by the fact that the ubiquitination machinery is promiscuous and ubiquitinates multiple sites, including alternative residues when the primary target sites are not available because of mutation.
To investigate whether degradation of tBid-N was required for tBid-C function, we determined the impact of proteasome inhibition on tBid-C translocation. MCF-7 cells expressing Myc Bid GFP were stimulated with TNF-α for 8 h in the presence or absence of MG132 and examined by CLSM for the distribution of Myc tBid-N and tBid-C GFP cleavage fragments. In accordance with the biochemical data (Fig. 2 A), Myc tBid-N was rescued from degradation by MG132 (Fig. 6 A, IV). Despite this, tBid-C GFP translocated to mitochondria (Fig. 6 A, V), where it partially colocalized with Myc tBid-N (VI). This result indicates that the degradation of tBid-N is not required for tBid-C translocation. In line with a previous study (Zha et al., 2000), it also suggests that the cleaved but still associated tBid-N–tBid-C complex can translocate to mitochondria. Next, we investigated whether proteasome inhibition affected the capacity of tBid-C to permeabilize the mitochondrial outer membrane. Untransfected MCF-7 cells were stimulated with TNF-α in the presence or absence of MG132 and analyzed by flow cytometry for Cyt c content. The dramatic release of Cyt c induced by TNF-α stimulation was greatly reduced upon coincubation with MG132 (Fig. 6 B), which suggests that degradation of tBid-N is required for tBid-C function.
Proteasome inhibition prohibits tBid-C function. (A) MCF-7 cells expressing Myc Bid GFP were stimulated with TNF-α with or without MG132 for 8 h. Stimulation resulted in translocation of tBid-C GFP (green) to mitochondria (II and III). In the presence of MG132, Myc tBid-N (red) remained detectable (IV), which indicates escape from proteasomal degradation. N- and C-terminal epitopes partially colocalized at mitochondria (VI). (B) TNF-α–induced Cyt c release in the presence or absence of MG132 was tested by flow cytometric analysis in untransfected MCF-7 cells after 8 h of stimulation. Results are means + SD from three independent experiments. The asterisk indicates a statistically significant difference (P < 0.05 according to a t test). C, control.
Because the proteasome may have other targets in this pathway, we aimed to test a Bid molecule harboring tBid-N that could escape from proteosomal degradation. Unfortunately, the stabilizing N-terminal deletion mutation Δ15 unleashed constitutive mitochondrial localization and permeabilizing activity in full-length Bid (unpublished data) and was therefore not useful. In the course of our study, however, we had noted that the addition of a bulky group such as GFP or a repetitive Myc tag to the N terminus of tBid-N greatly increased its stability. Therefore, we compared the functional activity of GFP Bid with a vesicular stomatitis virus (VSV) tag, which contains a stabilized GFP tBid-N, with that of Myc Bid GFP, which contains the wild-type, unstable Myc tBid-N.
To create a cell line that exclusively expressed stabilized tBid-N, endogenous Bid was constitutively down-regulated in MCF-7 cells by RNAi (Fig. 7 A). To express stabilized GFP Bid VSV and control (unstable) Myc Bid GFP in these cells, a silent mutation was introduced into the Bid sequence that was not targeted by the siRNA. This allowed appropriate expression of the Bid constructs upon transient transfection (Fig. 7, A and B). The processing of Myc Bid GFP and GFP Bid VSV by caspase-8/10 and the half-life of the Bid fragments were followed kinetically after stimulation of the reconstituted MCF-7 cells with TNF-α. In the case of Myc Bid GFP, the tBid-C GFP cleavage product was visible from the 2-h time point onward and its signal increased in time. The Myc tBid-N fragment was detected at the 2- and 4-h time points but not at the 8-h time point (Fig. 7 B). Processing of GFP Bid VSV was also visible at 2 h, but in this case not only the tBid-C VSV fragment remained detectable in the 8-h time frame but also the GFP tBid-N fragment (Fig. 7 B). We conclude that the GFP Bid VSV protein is properly processed by caspase-8/10 and that the GFP tBid-N fragment is long-lived, whereas the Myc tBid-N fragment has a short half-life.
Stabilization of tBid-N prohibits tBid-C function. (A) MCF-7 cells were depleted of endogenous Bid by stable expression of a Bid siRNA. MCF-7 Bid RNAi cells were reconstituted by transient transfection with Myc Bid GFP or GFP Bid VSV with silent mutations to allow escape from RNAi. The results for reconstitution with Myc Bid GFP wild-type and RNAi escape mutants are shown by immunoblotting for GFP in total cell lysates. Molecular masses (kD) of marker proteins are indicated. (B) Myc Bid GFP and GFP Bid VSV were expressed in MCF-7 Bid RNAi cells and cells were stimulated for the indicated time periods with TNF-α. Full-length Bid and cleavage fragments were detected by anti-Bid immunoblotting of total cell lysates. Fragments were identified additionally by immunoblotting with antibodies to Myc, GFP, and VSV (not depicted). ECL signals originate from the same blotted gel but the bottom panel represents a longer exposure than the top to allow detection of Myc tBid-N. (C) MCF-7 cells expressing GFP Bid VSV were stimulated with TNF-α for 8 h or left untreated (control). Signals diagnostic for stabilized GFP tBid-N are shown individually and in combination with the signals for tBid-C (VSV) and MitoTracker. The enlarged views allow assessment of colocalization of tBid-N and tBid-C at mitochondria. (D) TNF-α–induced Cyt c release was tested after 8 h of stimulation by flow cytometric analysis in parental MCF-7 cells, cells lacking Bid (MCF-7 Bid RNAi), and the same cells reconstituted with either Myc Bid GFP (unstable tBid-N) or GFP Bid VSV (stabilized GFP tBid-N). MCF-7 and MCF-7 Bid RNAi cells were additionally transfected to express histone-GFP. Cyt c content was monitored in cells gated for equal GFP expression to standardize for transfected Bid levels. Results are means + SD from three independent experiments. Values are corrected for Cyt c release in the absence of stimulus (15 ± 5%). The asterisk indicates statistically significant difference (P < 0.05 according to a t test).
The fate of stabilized GFP tBid-N was also followed by CLSM. In unstimulated cells, GFP and VSV signals were consistent with a cytoplasmic localization of full-length GFP Bid VSV (Fig. 7 C, I and II). At 8 h after stimulation, the VSV signal was punctate and colocalized with MitoTracker, which indicates mitochondrial localization of tBid-C VSV (Fig. 7 C, V). The GFP signal was still present at this time point (Fig. 7 C, IV) and was partially colocalized with VSV and MitoTracker signals (VI). This indicated long-term stabilization of GFP tBid-N (compare with the disappearance of Myc tBid-N; Fig. 1 A). As in the case of proteasome inhibition (Fig. 6 A), tBid-N stabilization did not interfere with mitochondrial translocation of tBid-C and both fragments partially colocalized at the mitochondria. This suggests that tBid-N and tBid-C may remain associated after cleavage of full-length Bid and translocate to mitochondria as a complex.
Next, Cyt c release upon TNF-α stimulation was compared in wild-type MCF-7 and Bid RNAi cells before and after reconstitution with unstable or stabilized Bid versions. Bid RNAi effectively blocked TNF-α–induced Cyt c release (Fig. 7 D). Importantly, introduction of GFP Bid VSV bearing stabilized tBid-N did not restore the ability of TNF-α to induce Cyt c release, whereas introduction of Myc Bid GFP bearing unstable tBid-N did (Fig. 7 D). Collectively, these results indicate that degradation of tBid-N regulates the proapoptotic function of tBid-C. Based on these data, we propose a model in which selective removal of tBid-N by proteasome-mediated degradation liberates tBid-C to induce mitochondrial membrane permeabilization.
Sequences in Bid's N-terminal fragment sequester the proapoptotic BH3 domain. Through this autoinhibitory mechanism, full-length Bid is kept in an inactive state (Chou et al., 1999; Tan et al., 1999). Bid can be converted to its active form by cleavage in its second unstructured loop, such as at D60 by caspase-8/10 and at D75 by granzyme B (Li et al., 1998; Luo et al., 1998; Sutton et al., 2003). Mechanistically, it was unclear why cleavage should lead to Bid activation. Upon Bid cleavage in vitro, the N- and C-terminal fragments remain associated according to both NMR and biochemical analyses (Chou et al., 1999; Zha et al., 2000; Kuwana et al., 2002). Moreover, several investigators have demonstrated that the tBid-N fragment, when expressed independently, can block the proapoptotic activity of the tBid-C fragment (Tan et al., 1999; Kudla et al., 2000; Renshaw et al., 2004). Collectively, these data suggest a critical inhibitory effect of the Bid N terminus upon the C-terminal proapoptotic function both before and after Bid cleavage. Based on our results, we propose that cleavage of Bid acts as a proapoptotic activation signal by allowing ubiquitination and subsequent proteasomal destruction of the inhibitory N-terminal fragment.
Although originally recognized as a signal for the steady-state destruction of aged and misfolded proteins, ubiquitination is now known to play an essential regulatory role in cellular signaling. Various apoptosis signaling molecules are regulated by proteasomal destruction (Weissman, 2001; Jesenberger and Jentsch, 2002; Chen, 2005). These include inhibitory Bcl-2 family members Bcl-2 (Breitschopf et al., 2000a), Mcl-1 (Liu et al., 2005; Zhong et al., 2005), and Bfl-1 (Kucharczak et al., 2005); proapoptotic Bax (Li and Dou, 2000); BH3-only proteins Bim (Akiyama et al., 2003; Ley et al., 2003) and Bik (Marshansky et al., 2001); and the C-terminal fragment of Bid (Breitschopf et al., 2000b). Polyubiquitination and degradation generally negatively regulate the function of the target protein by its complete elimination. The case of tBid-N ubiquitination is different because it represents a form of positive regulation; it is required for the proapoptotic function of Bid. In the noncanonical nuclear factor κB pathway, polyubiquitination and partial protein degradation of p105/p100 also acts as an activating principle (Chen, 2005). In both the case of the nuclear factor κB precursor and Bid, a portion of the molecule escapes from degradation and is released to perform its function.
Mutation analysis specifically implicated 5 out of 13 lysines in Mcl-1 in its destruction (Zhong et al., 2005), whereas mutation of all 4 lysine residues in tBid-C was shown to increase its half-life (Breitschopf et al., 2000b). In the case of the other Bcl-2 family members, no specific target sites have been identified. In the case of Bid, ubiquitination occurred with certainty on the Bid fragment encompassing residues 1–30. Indeed, the TEV protease mapping experiments indicate that tBid-N can be ubiquitinated on sites among amino acids 11–30 as well as to a lesser extent on sites among amino acids 1–10. This classifies the ubiquitination as unconventional because it did not concern a peptide bond to an ε amino group of lysine or an α amino group at the N terminus of the Bid protein. After reduction, ubiquitination was partially but not completely lost. This indicates that cysteine residues are among the ubiquitin acceptor sites. A thioester linkage is not unusual for ubiquitin because the ubiquitin conjugating (E2) and ubiquitin ligase (E3) enzymes bear ubiquitin in such a manner. However, to our knowledge, cysteine ubiquitination of a target other than E2 or E3 proteins has only one precedent in the existing literature. This concerns the cytoplasmic tail of major histocompatibility complex class I that contains no lysine residues but was ubiquitinated in a reducible manner by an E3 encoded by a herpes virus (Cadwell and Coscoy, 2005). Ubiquitination of tBid-N was to a significant degree maintained upon reduction (Fig. 5 B), which is consistent with the possibility that threonine and serine residues are primary targets of the ubiquitination machinery. The fact that a tBid-N mutant lacking all three cysteine residues was still ubiquitinated on fragment 1–30 proves that residues other than cysteine are ubiquitin acceptors. This is consistent with the fact that cysteines are not fully conserved in tBid-N. In fact, rat tBid-N does not contain any cysteines (Fig. S1 C).
Our extensive mutational analysis has not pinpointed the ubiquitination sites. These experiments are hampered by the fact that ubiquitin is likely appended to other candidate sites when the original sites are not available, including residues outside region 1–30. Mutation of all cysteines, threonines, and serines in tBid-N made it much more unstable than the wild-type protein, such that it was barely detectable even in the presence of proteasome inhibitor (unpublished data). In this case, the protein likely bears little structural resemblance to the wild-type tBid-N and results are difficult to interpret. Thus far, attempts to map the ubiquitination sites by mass spectrometry have not been successful. Lability of the thioester bonds is the most likely limiting factor in this analysis, particularly after tryptic digestion, which converts the polyubiquitin chain into a reactive Gly Gly amine. Theoretically, ubiquitin can link to serine and threonine by the formation of an ester bond between the carboxyl group of the C-terminal glycine and the hydroxyl group in the side chain of these amino acids. The first evidence for such linkage in a biological system was being published when this manuscript was in the final stage of preparation. It again concerned the cytoplasmic tail of major histocompatibility complex class I, which was ubiquitinated by another herpes virus–derived E3 than the one responsible for cysteine ubiquitination (Wang et al., 2007). Our work provides additional evidence for such linkage and adds that it can occur in a mammalian system.
Although Δ13 tBid-N was as unstable as the wild-type version, the Δ15 mutant was fully stabilized. C15 is a good candidate ubiquitin acceptor site because it lies at the border of helix 1 and is accessible in the Bid structure (Chou et al., 1999; McDonnell et al., 1999). However, point mutation of C15 did not affect ubiquitination. In stark contrast, ubiquitination was almost completely lost from tBid-N GFP upon deletion of residues 1–15. This suggests that these residues, particularly residues 14 and 15 (given the instability of the Δ13 mutant), are critical for binding of the (undefined) ubiquitination machinery to tBid-N.
In our CLSM experiments, we found tBid-N together with tBid-C at the mitochondrial membrane after TNF-α stimulation when tBid-N degradation was blocked by proteasome inhibition (Fig. 6 A) or GFP fusion (Fig. 7 C). It is therefore clear that tBid-N degradation is not required for mitochondrial translocation of tBid-C. We suggest that the stabilized tBid-N fragment inhibits the function of tBid-C at the mitochondria. In time course experiments with wild-type Myc Bid GFP, we also found a degree of colocalization of Myc and GFP signals at mitochondria at 2 h after TNF-α stimulation (Fig. S5, available at http://www.jcb.org/cgi/content/full/jcb.200707063/DC1). These findings tie in with the in vitro observation that the cleaved complex stays intact (Chou et al., 1999) and a previous study showing the association of the cleaved Bid complex with mitochondria (Zha et al., 2000). These data suggest that tBid-N and tBid-C may remain associated during mitochondrial translocation. Further experiments are required to resolve whether tBid-N ubiquitination takes place at the mitochondrial membrane and whether this event determines its dissociation from tBid-C.
We have shown here that Bid's proapoptotic function is activated through cleavage-inducible ubiquitination and proteasomal degradation of tBid-N. Freeing of the BH3 domain by this mechanism may apply to other Bcl-2 family members as well. For instance, BimEL is cleaved by caspases at an early stage during apoptosis induction, which renders it more proapoptotic (Chen and Zhou, 2004). Moreover, Bcl-2, Bfl-1, and Bcl-xL can be converted into proapoptotic proteins after cleavage by caspases or calpain (Clem et al., 1998; Kucharczak et al., 2005). Perhaps, in these cases, a similar mechanism operates as we have shown here for Bid activation.
Human cervix carcinoma line HeLa, breast carcinoma line MCF-7, and 293 embryonic kidney cell–derived packaging line ΦNX-Ampho were grown in DME medium with fetal calf serum. Human TNF-α was used at 10 ng/ml in combination with CHX at 10 μg/ml (both obtained from Sigma-Aldrich), soluble human FLAG-tagged TRAIL in combination with an enhancer (Qbiogene) at 100 ng/ml, and MG132 (EMD) at 50 μM. mAbs used were: anti-HA 12CA5, anti-Myc 9E10, anti-VSV P5D4 (purified Ig prepared from available hybridomas), anti-FLAG M2 (Sigma-Aldrich), anti-actin C4 (Chemicon), anti–Cyt c 6H2.B4 (BD Biosciences), anti-ubiquitin P4D1 (Santa Cruz Biotechnology, Inc.). Polyclonal rabbit sera used were: anti-Bid raised against a GST fusion protein of full-length human Bid (available from BD Biosciences; Werner et al., 2002), anti-GFP (Clontech Laboratories, Inc.), anti-E2-25K UG9520 (BIOMOL International, L.P.). HRP-conjugated rabbit anti–mouse Ig and pig anti–rabbit Ig were obtained from Dako, HRP-conjugated anti-HA and anti-FLAG mAb were obtained from Sigma- Aldrich, and goat anti–mouse Ig conjugated to Alexa Fluor 594 was obtained from Invitrogen.
Construction of cDNA encoding full-length human Bid fused C-terminally to eGFP (Bid GFP) made use of vector eGFPN1 (Clontech Laboratories, Inc.). A construct encoding full-length Bid GFP with an N-terminal Myc tag was created by placing a polylinker encoding a Myc epitope 5′ in frame to the Bid initiation codon. cDNA encoding the tBid N-terminal residues 1–60 (tBid-N) was cloned into eGFPN1, eGFPC1 (Clontech Laboratories, Inc.), pMT2SM, pMT2SM-VSV, and pMT2SM-HA (Werner et al., 2002) by PCR/restriction enzyme–based methods. The plasmid encoding histone 2B-GFP has been described previously (Tait et al., 2004). Plasmid pcDNA3.1 encoding FLAG-tagged human ubiquitin was a gift of S. Cook (Babraham Institute, Cambridge, UK). Plasmid pMT2SM encoding HA-tagged human ubiquitin has been described previously (de Melker et al., 2001). pcDNA3. 1-TAP was made by restriction enzyme–based subcloning of the TAP tag from pZomeC1 (Cellzome) into pcDNA3.1. tBid-N cDNA and deletion mutants were cloned into pcDNA3.1-TAP by restriction enzyme–based subcloning, producing constructs that were C-terminally fused to the TAP tag (Rigaut et al., 1999). Where used, polylinkers encoding TEV protease recognition sequences (encoding ENLYFQG) were inserted after the appropriate restriction digest. Point mutants and TEV insertion constructs were generated using the QuikChange site-directed mutagenesis kit according to the manufacturer's instructions (Stratagene).
For immunoprecipitation, all cells (adherent and floating) were harvested, washed twice in PBS, and lysed in NP-40 buffer consisting of 50 mM Tris-HCl, pH 7.4, 1% NP-40, 150 mM NaCl, 1 mM PMSF, and complete EDTA-free protease inhibitors (Roche). Cell lysates were clarified by centrifugation for 15 min at 13,000 g and protein content was measured by protein assay (Bio-Rad Laboratories). All SDS-PAGE analysis was done on precast 4–12% NuPAGE minigels according to the manufacturer's instructions (Invitrogen). In this procedure, samples were heated for 10 min at 70°C in reducing (100 mM DTT) sample buffer before electrophoresis. Equal amounts of protein per lane (20 μg) were separated by SDS-PAGE and transferred to nitrocellulose sheets. Immunoblotting and enhanced chemiluminescence were performed as described previously (Tait et al., 2004). For metabolic labeling, cells (106 cells in a 10-cm dish) were starved in methionine- and cysteine-free DME medium for 2 h, radiolabeled with [35S]methionine and [35S]cysteine (13.25 MBq per dish; GE Healthcare) for 2 h in the same medium. For the chase, cells were incubated for the indicated time in complete DME medium and supplemented with 2.5 mM of unlabeled methionine and cysteine. Immunoprecipitated proteins were resolved by SDS-PAGE, detected by autoradiography, and quantified by phosphorimaging (FLA-3000 and AIDA software; Fujifilm).
106 cells were lysed in NP-40 buffer. Lysates were clarified by centrifugation and incubated with rabbit IgG agarose (Sigma-Aldrich) for 2 h at 4°C. Agarose beads were washed in NP-40 buffer and TEV cleavage buffer (10 mM Tris, pH 8, 0.1% NP-40, 150 mM NaCl, 0.5 mM EDTA, and 1 mM DTT) and incubated with 10 U TEV protease (Invitrogen) in cleavage buffer overnight at 4°C. Next, supernatant was diluted threefold in calmodulin-binding buffer (10 mM Tris-HCl, pH 8, 0.1% NP-40, 150 mM NaCl, 1 mM Mg acetate, 1 mM imidazole, and 2 mM CaCl2) and incubated with calmodulin Sepharose beads (Stratagene) at 4°C for 1 h. Calmodulin-bound proteins were separated by SDS-PAGE and detected by Western blotting. For alkaline hydrolysis experiments, cells were lysed in PBS, pH 7.4 or 12, 1% NP-40, and complete EDTA-free protease inhibitors. Lysates were clarified by centrifugation, heated at 70°C for 10 min, diluted 100-fold in NP-40 buffer, and subjected to TAP purification.
For TEV protease treatment, HA Bid immunoprecipitates were resuspended in 300 μl TEV cleavage buffer and incubated with or without 2 μl TEV protease overnight at 4°C. Beads were spun down, washed three times, and taken up in sample buffer for SDS-PAGE. For reduction, HA Bid immunoprecipitates were suspended in 10 μl NP-40 buffer. To this, 15 μl of 100 mM Tris-HCl, pH 6.8, 4% SDS, 8 M urea, and 20% glycerol was added with or without 600 mM of fresh DTT. Control samples without DTT were kept on ice, whereas samples with DTT were heated at 95°C for 10 min. Next, samples were diluted out 80 times in NP-40 buffer with 10 mM iodoacetamide and 50 μg/ml RNase A (as carrier protein). Beads were spun down and supernatants were subjected to reprecipitation with anti-HA antibody. For the sequential immunoprecipitation shown in Fig. 3 B, after immunoprecipitation with anti-GFP antibody, the lysate was incubated three times with protein G–Sepharose beads followed by immunoprecipitation with anti-Myc antibody.
To ubiquitinate the recombinant E2 core domain of E2-25K (Pichler et al., 2005), recombinant human ubiquitin-activating enzyme (E1; 120 ng; 0.2 μM), E2-25K1-155 (1.5 μg; 17 μM), and ubiquitin (2 μg; 47 μM) were coincubated in 20 mM Tris-HCl, pH 8, 100 mM NaCl, and 5 mM β-mercaptoethanol with 5 mM ATP and 5 mM MgCl2 for 2 min at 23°C. Reactions were terminated by 1:1 dilution in sample buffer (100 mM Tris, pH 6.8, 8 M urea, 4% SDS, and 20% glycerol with or without 600 mM DTT) and samples were kept on ice or heated at 95°C as described in the previous paragraph before electrophoresis. A complex of His-tagged Ring1b (residues 1–331) and full-length His-tagged Bmi1 were coexpressed in Sf9 insect cells by simultaneous infection with separate recombinant baculoviruses. The complex was purified on nickel-agarose (Hitrap column; GE Healthcare) and further purified as described previously (Buchwald et al., 2006). Ring1b/Bmi1 was incubated at 6 μM together with 220 nM human E1, 2 μM human UbcH5c, 20 μM ubiquitin, and 3 mM ATP in a total volume of 50 μl of ligase buffer consisting of 50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 10 mM MgCl2, 1 μM ZnCl2, and 1 mM DTT at 30°C for 1 h. For the control sample, the ubiquitination reaction was stopped by the addition of LDS sample buffer (NuPAGE; Invitrogen). Samples for immunoprecipitation were: (a) incubated with 12.5-fold excess of ligase buffer as control, (b) heated for 8 min at 95°C in the presence of 5% β-mercaptoethanol after which 12.5-fold excess ligase buffer was added, (c) incubated with 12.5-fold excess PBS, pH 7.4, and heated for 10 min at 70°C, and (d) incubated with 12.5-fold excess PBS, pH 12, and heated for 10 min at 70°C. Next, samples were diluted with NP-40 buffer (as described in the previous paragraph) to a total volume of 10 ml and subjected to immunoprecipitation with nickel-agarose beads (QIAGEN). Reaction products were separated by NuPAGE in 4–12% Bis-Tris precast gels (Invitrogen) blotted to nitrocellulose and probed independently with a P4D1 antibody directed to ubiquitin and anti-Ring1b (provided by H. Koseki, Institute of Physical and Chemical Research, Yokohama, Japan).
A short interfering oligonucleotide targeting human Bid (nt 238–256, 5′-GAAGACATCATCCGGAATA-3′) was cloned into pSUPER and pRETRO-SUPER (Brummelkamp et al., 2002). Stable expression of Bid siRNA was achieved by retroviral transduction of cell lines of interest with the pRETRO-SUPER construct. For rescue experiments, two silent mutations were introduced in the appropriate Bid sequence (5′-GAAGACATCATAAGGAATA-3′) using the QuikChange site-directed mutagenesis kit to avoid siRNA-mediated silencing.
Cells were transfected with FuGENE 6 according to the manufacturer's instructions (Roche). Unless otherwise indicated, cells were manipulated 20 h after transfection. Production of amphotropic retrovirus was done in ΦNX-Ampho cells as described previously (Werner et al., 2002). For transduction, virus-containing packaging cell supernatant was incubated on ice for 10 min with 10 μg/ml Dotap (Roche) and subsequently incubated with target cells overnight. Cells were selected with 1 μg/ml puromycin 48 h after transduction.
Cells (105 per sample) were grown and transfected on glass coverslips in 6-well plates, washed in PBS, and fixed for 30 min with 4% paraformaldehyde in PBS. If applicable, cells were incubated for 30 min with 100 nM MitoTracker deep red (Invitrogen) before fixation. Fixed cells were washed in PBS, permeabilized by incubation in PBS with 1% Triton X-100 for 10 min, and blocked with 0.5% BSA in TBS-Tween for 1 h. Cells were incubated in the same buffer with the appropriate primary antibody and subsequently washed three times in TBS-Tween and incubated with Alexa Fluor 594– conjugated goat anti–mouse IgG (Invitrogen). Next, cells were washed in TBS-Tween and mounted on slides using Vectashield (Vector Laboratories). All treatments were performed at room temperature. CLSM was performed using a TCS SP2 system using a 63× 1.32 NA oil immersion objective and confocal software (all obtained from Leica). Images were processed (cropping and level adjustment) using Photoshop software (Adobe). To minimize spectral leak-through, images were obtained by sequential scanning.
Cells were analyzed for Cyt c release essentially as described previously (Waterhouse and Trappani, 2003). All cells were collected, washed in PBS, and permeabilized with 200 μg/ml digitonin in PBS, 150 mM KCl, and 1 mM EDTA for 10 min on ice. Cells were washed once in PBS, fixed in 4% paraformaldehyde, incubated in blocking buffer (2% BSA in PBS) for 30 min at room temperature, and incubated with anti–Cyt c mAb 6H2.B4 at 1:200 dilution in blocking buffer overnight at 4°C. Cells were washed in blocking buffer and incubated with a Cy5-conjugated goat anti–mouse Ig antibody (Invitrogen) at 1:200 dilution in blocking buffer for 1 h at room temperature. After washing, cells were analyzed using a FACSCalibur and CellQuest software (BD Biosciences). Cyt c content was analyzed specifically in transfected cells by gating the GFP-positive population.
Fig. S1 shows the structure of full-length human Bid as determined by NMR (Chou et al., 1999; McDonnell et al., 1999), its amino acid sequence, and sequence homology of tBid-N between species. Fig. S2 provides the evidence that Bid, rather than the TAP tag, is ubiquitinated. Fig. S3 shows the stability assays for alanine substitutions mutants of HA tBid-N TEV 30 performed by incubating transfected HeLa cells with CHX. Fig. S4 demonstrates that reduction (β-mercaptoethanol) or pH 12 treatment does not result in loss of ubiquitin from Ring1b, which carries ubiquitin on lysine (Buchwald et al. 2006). Fig. S5 shows MCF-7 Bid RNAi cells expressing Myc Bid GFP at different time points after stimulation with TNF-α.
We are grateful to Gretel Buchwald, Puck Knipscheer, and Titia Sixma for help with the in vitro ubiquitination experiments and information on Bid structure. We thank Martina O'Flaherty, Albert J. Heck, Clive Slaughter, and Andrew High for help with mass spectrometry; Douglas R. Green for support; and Huib Ovaa for sharing his chemical expertise and commenting on the manuscript.
This work was funded by the Dutch Cancer Society.
S.W.G. Tait's present address is Department of Immunology, St. Jude Children's Research Hospital, Memphis, TN 38105.
C.S. D'Santos's present address is Proteomic Unit Bergen, University of Bergen, N-5009 Bergen, Norway.
Abbreviations used in this paper: BH, Bcl-2 homology; CHX, cycloheximide; CLSM, confocal laser scanning microscopy; Cyt c, cytochrome c; NMR, nuclear magnetic resonance; TAP, tandem affinity purification; tBid-C, C-terminal fragment of Bid; tBid-N, N-terminal fragment of Bid; TEV, tobacco etch virus; TRAIL, TNF-related apoptosis-inducing ligand; VSV, vesicular stomatitis virus.
Akiyama, T., P. Bouillet, T. Miyazaki, Y. Kadona, H. Chikuda, U. Chung, A. Fukuda, A. Hikita, H. Seto, T. Okada, et al. 2003. Regulation of osteoclast apoptosis by ubiquitylation of proapoptotic BH3-only Bcl-2 family member Bim. EMBO J. 22:6653–6664.
Boatright, K.M., and G.S. Salvesen. 2003. Mechanisms of caspase activation. Curr. Opin. Cell Biol. 15:725–731.
Breitschopf, K., J. Haendeler, P. Malchow, A.M. Zeiher, and S. Dimmeler. 2000a. Posttranslational modification of Bcl-2 facilitates its proteasome-dependent degradation: molecular characterization of the involved signaling pathway. Mol. Cell. Biol. 20:1886–1896.
Breitschopf, K., A.M. Zeiher, and S. Dimmerler. 2000b. Ubiquitin-mediated degradation of the proapoptotic active form of Bid. J. Biol. Chem. 275:21648–21652.
Brummelkamp, T.R., R. Bernards, and R. Agami. 2002. Stable suppression of tumorigenicity by virus-mediated RNA interference. Cancer Cell. 2:243–247.
Cadwell, K., and L. Coscoy. 2005. Ubiquitination on nonlysine residues by a viral E3 ubiquitin ligase. Science. 309:127–130.
Chen, D., and Q. Zhou. 2004. Caspase cleavage of BimEL triggers a positive feedback amplification of apoptotic signaling. Proc. Natl. Acad. Sci. USA. 101:1235–1240.
Chen, Z.J. 2005. Ubiquitin signalling in the NF-κB pathway. Nat. Cell Biol. 7:758–765.
Cheng, E.H., M.C. Wei, S. Weiler, R.A. Flavell, T.W. Mak, T. Lindsten, and S.J. Korsmeyer. 2001. BCL-2, BCL-XL sequester BH3 domain-only molecules preventing BAK- and BAK-mediated mitochondrial apoptosis. Mol. Cell. 8:705–711.
Chou, J.J., H. Li, G.S. Salvesen, J. Yuan, and G. Wagner. 1999. Solution structure of BID, an intracellular amplifier of apoptotic signaling. Cell. 96:615–624.
Ciechanover, A., and R. Ben-Saadon. 2004. N-terminal ubiquitination: more protein substrates join in. Trends Cell Biol. 14:103–106.
de Melker, A.A., G. van der Horst, and J. Borst. 2001. c-Cbl ubiquitinates the EGF receptor at the plasma membrane and remains receptor associated throughout the endocytic route. J. Cell Sci. 114:2167–2178.
Jesenberger, V., and S. Jentsch. 2002. Deadly encounter: ubiquitin meets apoptosis. Nat. Rev. Mol. Cell Biol. 3:112–121.
Kucharczak, J.F., M.J. Simmons, C.S. Duckett, and C. Gelinas. 2005. Constitutive proteasome-mediated turnover of Bfl-1/A1 and its processing in response to TNF receptor activation in FL5.12 pro-B cells convert it into a prodeath factor. Cell Death Differ. 12:1225–1239.
Kudla, G., S. Montessuit, R. Eskes, C. Berrier, J.-C. Martinou, A. Ghazi, and B. Antonsson. 2000. The destabilization of lipid membranes induced by the C-terminal fragment of caspase 8-cleaved Bid is inhibited by the N-terminal fragment. J. Biol. Chem. 275:22713–22718.
Kuwana, T., M.R. Mackey, G. Perkins, M.H. Ellisman, M. Letterich, R. Schneiter, D.R. Green, and D.D. Newmeyer. 2002. Bid, Bax and lipids cooperate to form supramolecular openings in the outer mitochondrial membrane. Cell. 111:331–342.
Ley, R., K. Balmanno, K. Hadfield, C. Weston, and S.J. Cook. 2003. Activation of the ERK1/2 signaling pathway promotes phosphorylation and proteasome-dependent degradation of the BH3-only protein, Bim. J. Biol. Chem. 278:18811–18816.
Li, H., H. Zhu, C. Xu, and J. Yuan. 1998. Cleavage of BID by caspase 8 mediates the mitochondrial damage in the fas pathway of apoptosis. Cell. 94:491–501.
Li, B., and Q.P. Dou. 2000. Bax degradation by the ubiquitin/proteasome- dependent pathway: involvement in tumor survival and progression. Proc. Natl. Acad. Sci. USA. 97:3850–3855.
Liu, H., H.-S. Peng, Y.-S. Cheng, H.S. Yuan, and H.-F. Yang-Yen. 2005. Stabilization and enhancement of the antiapoptotic activity of Mcl-1 by TCTP. Mol. Cell. Biol. 25:3117–3126.
Lutter, M., M. Fang, X. Luo, M. Nishijima, X.-S. Xie, and X. Wang. 2000. Cardiolipin provides specificity for targeting of tBID to mitochondria. Nat. Cell Biol. 2:754–756.
Marshansky, V., X. Wang, R. Bertrand, H. Luo, W. Duguid, G. Chinnandurai, N. Kanaan, M.D. Vu, and J. Wu. 2001. Proteasomes modulate balance among pro-apoptotic and anti-apoptotic Bcl-2 family members and compromise functioning of the electron transport chain in leukemic cells. J. Immunol. 166:3130–3142.
McDonnell, J.M., D. Fushman, C.L. Miliman, S.J. Korsmeyer, and D. Cowburn. 1999. Solution structure of the proapoptotic molecule BID: a structural basis for apoptotic agonists and antagonists. Cell. 96:625–634.
Pichler, A., P. Knipscheer, E. Oberhofer, W.J. van Dijk, R. Korner, J.V. Olsen, S. Jentsch, F. Melchior, and T. Sixma. 2005. SUMO modification of the ubiquitin-conjugating enzyme E2-25K. Nat. Struct. Mol. Biol. 12:264–269.
Puthalakath, H., and A. Strasser. 2002. Keeping killers on a tight leash: transcriptional and post-translational control of the pro-apoptotic activity of BH3-only proteins. Cell Death Differ. 9:505–512.
Renshaw, S.A., C.E. Dempsey, F.A. Barnes, S.M. Bagstaff, S.K. Dower, C.D. Bingle, and M.K.B. Whyte. 2004. Three novel Bid proteins generated by alternative splicing of the human Bid gene. J. Biol. Chem. 279:2846–2855.
Sattler, M., H. Liang, D. Nettesheim, R.P. Meadows, J.E. Harlan, M. Eberstadt, H.S. Yoon, S.B. Shuker, B.S. Chang, A.J. Minn, et al. 1997. Structure of Bcl-xL-Bak peptide complex: recognition between regulators of apoptosis. Science. 275:983–986.
Sutton, V.R., M.E. Wowk, M. Cancilla, and J.A. Trappani. 2003. Caspase activation by Granzyme B is indirect and caspase autoproessing requires the release of proapoptotic mitochondrial factors. Immunity. 18:319–329.
Tait, S.W.G., A.B. Werner, E. de Vries, and J. Borst. 2004. Mechanism of action of Drosophila Reaper in human cells: Reaper globally inhibits protein synthesis and induces apoptosis independent of mitochondrial permeability. Cell Death Differ. 11:800–811.
Tan, K.O., K.M.L. Tan, and V.C. Yu. 1999. A novel BH3-like domain in BID is required for intramolecular interaction and autoinhibition of pro-apoptotic activity. J. Biol. Chem. 274:23687–23690.
Wang, X. 2001. The expanding role of mitochondria in apoptosis. Genes Dev. 15:2922–2933.
Wang, X., R.A. Herr, W.-J. Chua, L. Lybarger, E.J.H.J. Wiertz, and T.H. Hansen. 2007. Ubiquitination of serine, threonine, or lysine residues on the cytoplasmic tail can induce ERAD of MHC-I by viral E3 ligase mK3. J. Cell Biol. 177:613–624.
Waterhouse, N.J., and J.A. Trappani. 2003. A new quantitative assay for cytochrome c release in apoptotic cells. Cell Death Differ. 10:853–855.
Werner, A.B., E. de Vries, S.W.G. Tait, I. Bontjer, and J. Borst. 2002. Bcl-2 family member Bfl-1/A1 sequesters truncated Bid to inhibit its collaboration with pro-apoptotic Bak or Bax. J. Biol. Chem. 277:22781–22788.
Yin, X.-M., K. Wang, A. Gross, Y. Zhao, S. Zinkel, B. Klocke, K.A. Roth, and S.J. Korsmeyer. 1999. Bid-deficient mice are resistant to Fas-induced hepatocellular apoptosis. Nature. 400:886–891.
Zha, J., S. Weiler, K.J. Oh, M.C. Wei, and S.J. Korsmeyer. 2000. Posttranslational N-myristoylation of BID as a molecular switch for targeting mitochondria and apoptosis. Science. 290:1761–1765.
Zhong, Q., W. Gao, F. Du, and X. Wang. 2005. Mule/ARF-BP-1, a BH3-only E3 ubiquitin ligase, catalyzes the polyubiquitination of Mcl-1 and regulates apoptosis. Cell. 121:1085–1095.
|
0.997534 |
Germany The English word, Germany is derived from the Latin word Germania, which was the Roman name for the region east of the Rhine River.
In German, the country is called Deutschland, which simply means "German lands" as Deutsch is the word for the Germans and evolved from the word diutisciu, which means "popular," referring to the majority in the region, the non-Latin speakers.
Germany is a country that at times seems like a relaxed party, while at others it may appear to be a bit stiff as the people enjoy their rules, order, and structure. Today the country's culture and lifestyle is heavily influenced by technology and progress, but so much of this present is rooted in the past, beginning with the settlement of the people in what is now Central Europe.
The early Germanic settlers found themselves spread across much of Europe and with this diversity came a great diversity of landscapes. Many people survived by farming, however in the mountains this lifestyle gave way to one based more heavily on raising animals, yet in other areas fishing was the best means of survival. This time of settlement created an adaptable and flexible people who found ways to survive and even thrive in various landscapes, characteristics still present today.
Over time the Germanic people changed greatly. The people divided politically as their language developed in various directions, creating numerous dialects that still exist today. The people also created kingdoms and other empires as many became highly organized, a trait now synonymous with the Germans, but also motivated and hard working as each region sought independence from the others.
During this long period of political division the people also created numerous sub-cultures. Differing dress, foods, and beers all became tied to differing regions and even today many of the German stereotypes represent the roots of only a small part of Germany. For example, lederhosen were only historically worn by the Bavarians and some neighboring Germanic people, never by northern or even southwestern Germanic people. These times of division created a hugely diverse group of people that remains diverse today. Perhaps the most noticeable aspect of this past and present division comes in the form of religion. Although most Germans are Christian, the Protestant Reformation began in Germany and divided the country as much of southern Germany is Catholic, but much of the north is Protestant.
It wasn't until the late 1800s that the people finally unified and the country began to merge culturally. The linguistic dialects have become more standardized and foods have been spread across the country with political unity, but religious division and many cultural aspects remain locally distinct. The way people identify in Germany also began to change as people began to slowly abandon their identities of being "Bavarian," "Saxon," or "Prussian" in favor of being "German," although those other identities have never been completely abandoned.
With a growing pride, came growing division with neighbors and political agendas that helped lead to both World War I and World War II. Since this time many Germans have changed their identity even further, although much of the past culture has remained. Many Germans today first see themselves as "European" or again primarily identify with their local region over being "German," which many see negatively.
Today the Germans remain incredible diverse, yet are united in many ways. They share a language, foods, beers, and a nation, but are also unique from region to region and from person to person. However, the European Union and modern technology have begun to made communication and transportation so accessible that the lifestyle among most of the people today is reliant on technology and business rather than the lands as lifestyles today are vastly different than they were even one hundred years ago.
The colors of Germany's flag originated with the Holy Roman Empire. The flag of the Holy Roman Empire included a black double-headed eagle with red claws and red beaks on a yellow background.
|
0.999119 |
What are some strategies to market a news aggregation service?
News aggregators are never likely to rank well in a search engine and user acquisition costs will always be high. What are some strategies for user acquisition and are there any examples (blogs, news articles, books, etc) that detail some success stories.
I guess it will really depend based on your target audience and how you can make yourself stand out.
2. You might try Facebook ads to drive traffic to landing pages to generate leads. Offer educational content that requires opt-in.
For example: "How to read all the news in less than 30 minutes per day". In the past personally I spent about 1,5 hours per days readying news so if you teach me how to do it faster, you wont me already.
Try with downloadable ebooks, webinars, etc.
I hope that helps. Feel free to schedule a call if you need more help with that. I'd love to give you my advice on that.
Long answer made short, I like what I call the Kindle Social approach. If one reads a passage in a Kindle book [even the various Kindle readers, not just the devices], they can highlight it and post to Facebook and/or Twitter. So, have an iPhone app built where you populate it with various feeds from your service. Users can highlight portions or share whole posts [actually just the URL of a whole post] via several social channels and email. Finally, get a group of "marketers" aka interns, and/or temp help, to use your app to share links. Then retweet and "like" various posts that come from your tool. It is kind of like the razor blade and the handle. Personally I am a huge fan of aggregation services, but stay away from the "techie" side of it, users don't care! They are buying a 1/4" hole, not a 1/4" drill and bit.
|
0.999964 |
Never say no. There are countless scenarios one could draw up of times when a client or customer simply asked for something that was outside the bounds of your company's capabilities. Although it's easier to say, "No, I'm sorry, we can't help you with that," and move on, it's important to let them know that you are going to do your best to help them solve their problem. Utilizing positive language is one way to ease their frustrations, and another is to present them with tangible alternatives to help provide a solution for what they want. Presenting them with alternatives and options allows for the ball to be in their court, transferring power over to them, which helps them feel more in control over the issue at hand.
Something else that is important to consider when handling impossible client requests is that they're not taking advantage of you. It's easy to sit behind a screen and profusely apologize for what seems like everything, however, only apologize for your wrongdoings and mistakes. It's important to recognize your errors, but it's even more important to keep your dignity if you did your due diligence and worked hard for the client. For example, if you find yourself in a situation where a client is consistently contacting you after-hours and on weekends because they forgot to give you the information beforehand, it's okay and necessary to speak up and set boundaries with them regarding the times and days they are able to speak with you.
1. Listen: Most people prefer to know that they're being heard and listened to, and sometimes (although unfair) someone will just need to take out their bad day on you. Just listen. It'll make them feel better, which will make you feel better.
2. Apologize: Again, this doesn't have to be an admittance of guilt or wrongdoing, but it is necessary to apologize for the way they are feeling, whether it be your fault or an external factor's.
3. Solve: Don't just think of a short-term fix, but go above and beyond to discover a long-term fix, ensuring that the client stays satisfied for the probability that the same issue arises again in the future.
4. Thank: They came to you with transparency and trust that you will help them fix their problem. Thank them for that!
Hopefully, this insight and these tangible steps will help to aid your next client-related conflict!
|
0.955488 |
Enter feedback and cybernetic cross-checking and self-correction.
Earlier in the essay quoted above, Baranger teaches us that classic, non-chaotic science relies on calculus, the invention of Leibniz, the tool that can map curves via obtaining a function y=f(x); a compression-function that tries to come up with a simplified formula for any curve drawn on a Cartesian diagram. It is the bet that even in the cases of the most complicated curves (as an aggregate of connected points in, e.g. two-dimensional space), there is a way to designate them that is simpler than (or, in a worst-case scenario, the same as) the data itself. Leibniz even has a compression-efficient god.
Now it is in no way an accident that Leibniz has blind monads and thus needs the perfectly predictable world of pre-established harmony (and argues for a compression god-algorithm of world-optimization). Now that we have seeing monad-machines, we see that curves and calculus are too reductive and representationally poor because representational in essence. With this comes greater computability of very complex situation: the model, if any is even necessary, changes from instant to instant by observing the system in real-time and self-correcting as necessary: backpropagation.
The god-function of Leibniz is what is supposed to create the most complex and plentiful world-plenum from the simplest possible plan of action, thus creating the best of all possible worlds through its efficiency, which is defined in terms of compressive power. The Cybernetic Organon is the death of the Leibnizian efficiency (which operates in the blind world of pre-established harmony, itself a theory of pre-feedback machines unable to see, though unbeknownst to Leibniz himself).
Are cybernetic machines classifiable as “living machines?” Does self-correction amount to self-organization? An unsupervised deep-learning algorithm operating on Big Data is an example. By processing and training with data, the machine (a machine can be a piece of software running on some hardware, dedicated or not) changes from a state of indeterminate “noise” (where all the node weights are assigned either an equivalent value (e.g. 0 or 1), or random values uniformly distributed) and organizes itself (i.e. its weights and biases, or even the function etc.) into a singular entity as unique as anything and at least as complex as the data it feeds on for its organization, i.e. it is at least as complex as its environment (which is given to it qua data, structured or not).
While the cybernetic machine is at least as complex as its environment/data, in Leibniz’s compressive organon the god-function of calculus is at most as complex as its environment.
The Cybernetic Organon operates in a world of windowed monads and constant feedback, real-time updates of the environment and as such can afford a higher order of efficiency which takes complexity into account and welcomes it into itself as a computational feature deployed through an intelligence without representation, an intelligence without transcendence.
Baranger, M. (2000). Chaos, complexity, and entropy. New England Complex Systems Institute.
|
0.999546 |
This is a continuation of a previous article on one of the hottest topics at GDC 2015: How to earn money from free-to-play games, an increasingly important genre.
The two top F2Ps, CrossFire and League of Legends, both from Chinese gaming giant Tencent, earned $957 million and $624 million in 2013, respectively.
Even traditional online games, such as World of Warcraft with 7 million subscribers at $15 per month, are including in-game sales to increase income.
Animators are now expected to create not only sightlines and weapons for first-person shooters and emotions for role-playing games, but to generate visuals and sounds that compel players to push the “Buy” button.
Here are some more of the marketing tactics of F2P games.
7. Create core loops. Core loops (a.k.a. habit loops or compulsion loops) are pleasurable, repetitive actions that players do over and over, in a pattern. An example might be: 1) Collect Resources (elixirs, coins, clothing, weapons); 2) Practice (plant, build, train, explore); 3) Exercise (battle, get famous, gather crops); and 4) Reset, while enjoying promotion to a higher game level, and the increased coins, power-ups, status and other rewards, before starting the next cycle. Core loops are a major way the mind is lulled into coming back into a game, and become more seductive with bright colors and cheerful audio.
8. Establish goals. Keeping players coming back for months or years requires setting strong goals, ways to achieve them, and multiple scoring displays. Ancient videogames had leaderboards showing simple point scores. Modern games display game levels; collections of currency, medals, honors, or followers; and progress in a story. Ideally, a player should have some rewards and be well along a game path before items to buy start to appear.
9. Use Anchoring. This is “mental modeling” that reduces the apparent price, to make the player spend more than planned. A customer walking into a car dealership might plan to spend $30,000, for instance, but after a salesman shows him an $80,000 luxury car, a $50,000 model no longer seems expensive. The salesman has established the $80,000 as a mental “anchor point” that other prices get compared to. If a Malibu House in the Kardashian game costs $20 in credit-card dollars, the Hollywood House for $10 starts to look reasonable.
10. Create Artificial Scarcity by Time. An item can be offered for sale for only one day, or a few hours. This creates an artificial limit on availability, and an urge in the gamer’s mind to buy it so he doesn’t “lose” the bargain. A successful tactic is to offer a consolation prize for a player who missed the timed offer, so he still has a “bargain” to anticipate instead of steeping in disappointment.
Part three will offer more insider marketing tips.
|
0.993559 |
THE RECIPE: Preheat oven to 170C/325F/Gas Mark 3. Makes 12.
1. Heat the milk in a saucepan until it starts to boil. Add the teabags and put aside to allow to infuse and cool.
2. In a bowl, combine all your dry ingredients – the flour, sugar, baking powder, salt and butter. Mix well and rub in the butter until you get a breadcrumb-y consistency.
3. Remove the tea bags from the milk (be sure to squeeze out all the milk) and set 1 tea bag aside to use for the frosting. Add the egg to the milk and mix well.
4. Gradually add the wet mixture to the dry, mixing well and making sure everything is combined.
7. Once baked, immediately remove from the tin and place on a cooling rack. Allow to completely cool before adding the frosting.
8. For the frosting – add the teabag to the milk and set aside for a few minutes. Mix together the butter and icing sugar. The longer you mix, the fluffier it will be. Slowly add the milk and continue whisking for another 2-3 minutes.
9. Optional: Add grey food colouring to the frosting.
10. Place the frosting in a piping bag and pipe onto the cupcakes. Decorate as you choose.
Heat the milk in a saucepan until it starts to boil. Add the teabags and put aside to allow to infuse and cool.
In a bowl, combine all your dry ingredients - the flour, sugar, baking powder, salt and butter. Mix well and rub in the butter until you get a breadcrumb-y consistency.
Remove the tea bags from the milk (be sure to squeeze out all the milk) and set 1 tea bag aside to use for the frosting. Add the egg to the milk and mix well.
Gradually add the wet mixture to the dry, mixing well and making sure everything is combined.
Fill ⅔rds of the cases by scooping a couple of tablespoons of the mixture into each one. Place in the oven for 20-25 minutes. Once baked, immediately remove cupcakes from the tin and place on a cooling rack. Allow to completely cool before adding the frosting.
For the frosting - add the teabag to the milk and set aside for a few minutes. Mix together the butter and icing sugar. The longer you mix, the fluffier it will be. Slowly add the milk and continue whisking for another 2-3 minutes. Optional: Add grey food colouring to the frosting.
Place the frosting in a piping bag and pipe onto the cupcakes. Decorate as you choose.
Allow the cupcakes to cool completely before decorating or the frosting will melt.
Thanks for sharing the link to Amena’s blog she is new to me.
This was my first time trying tea flavoured cupcakes and they were a pleasant surprise!
Thanks, Gill! Oooh fruitier sounds nice – I’ll be adding Lady grey to my list.
|
0.999995 |
Here are two definition essay examples that define it all. 2 Definition Essay Examples That Define It All These two essays each use a subjective term as the focus and create an extended definition. A definition essay can be deceivingly difficult to write. This type of paper requires you to write a personal yet academic definition of one specific word.
The definition must be thorough and lengthy. A definition essay is writing that explains what a term means. Some terms have definite, concrete meanings, such as glass, book, or tree. Terms such as honesty, honor, or love are abstract and depend more on a person's point of view.
How to Write a Definition Essay: General Rules It is possible to explain the term using real life examples. Another way is to make a story based on your own life experience. Mindnumbing advertisements that are incessantly flaunted to Americans have become ingrained into memory and habit, altering the accepted definition of success into something shameworthy. Success has been sadly Definition Essay Examples Most people might think that a feminist is just a man hater with short spiky hair that goes through the streets protesting every insignificant instance of possible sexism or misconduct.
To get you started, here are some possible terms for a definition essay: Happiness: Whole books are written on this term, and what is happiness to one person is certainly not happiness to another. As well, that definition will change significantly during a persons lifetime. In a definition essay, you explain the meaning of a certain term by giving a detailed description of it, and support your definition with clear examples or facts.
Such explanations are needed if a term is special, abstract, disputed, or does not have a common meaning. The definition essay can be developed on the basis of different usages of the word or a single usage of the particular term that needs to be defined.
|
0.999998 |
Why is it that it's relatively easy to for a small team to write a system for a small user base, but it's so difficult to scale that to a long-term project with a big team and many users?
It has struck me how many issues in large IT development projects can be characterised as scaling problems - I find it's a useful mental short-cut to think in these terms, and to always attempt to minimise overall scale of a project. The resulting decisions are often subjective and trade-off's, but at least conscious ones.
Requirements: Few, well understood to many, poorly understood - How much does the system need to do to meet user requirements? How confident are we that the requirements are well understood?
Process: Lightweight to heavyweight - Are the processes in place around requirement gathering, development, testing and release simple enough not to unnecessarily impede development, but rigorous enough to maintain reliability?
Code: "Simple" to "complex" - How coherent, decoupled and understandable is the code? To what extent can developers have confidence in changes (through typing, tests etc)?
Technology: Few to many - How many technologies (programming languages, persistence mechanisms, messaging, tools etc) are used in the project?
Data: Small, non-critical to large, critical: How large will the volume of data grow? How diverse it is? How critical is it?
Users: Few, uniform to many, diverse - How many users will there be? How will they be distributed geographically?
Time: Short term to long term - How long is the system likely to exist? What systems is this system aiming to replace? What other systems may eventually take over some functionality of this one?
Adding a technology: This will increase the technological complexity - does it decrease one or more of the other aspects (typically code complexity, data size) to warrant consideration? Can we realistically entirely replace one of the existing technologies? Are we confident the new technology is sustainable in the organisation over the time-scale the project is expected to exist?
Setting up a new separate team: Do we have sufficient communication bandwidth to mitigate Conway's Law? Given the code and technology, how much training/pairing is required before the team is productive? Do we have procedures such as code review in place to maintain code coherence?
Onboarding a new group of users: Does this group of users have a different set of requirements that will affect the code size? If the requirements are sufficiently different, would an new separate system be better? What effect will this have on data size? Do we need to scale the system deployment? Do we need to co-locate developers or support teams with the users?
In summary, "scale" is a useful heuristic to consider making decisions about IT projects - by acting to minimise the effects of scaling, the project is more likely to be successful in the long term.
|
0.997836 |
The Creative Enterprise Zone's new streetscape logo came from a collaboration this past winter, a process led by Triangle Park Creative. The firm specializes in brand identity and design for nonprofit and co-ops, and it recently moved its offices from Minneapolis to the CEZ. Although they work with wide-ranging clients nationwide, some are based here in the Zone: the Higher Education Consortium for Urban Affairs, Jewish Community Action, Metro Regional Arts Council, Shared Capital Cooperative, Jewish Community Action, the Patrick and Aimee Butler Family Foundation, and Shared Capital Cooperative, among others. Its founder, Dan Nordley, has deep roots in the co-op movement and the Twin Cities nonprofit and neighborhood newspaper communities. The company's tagline says it: "Design for a better world."
What goes into developing a logo? As John describes it, it starts with listening, research, and discovery. Last fall Dan and John met with a small committee of the CEZ board, which was authorized to collaborate and eventually bring a final design for full board consideration. Over several sessions, the team discussed the Zone's mission and previous visual branding, and also the area's history: its geography, its inhabitants over time, and its current mix of people and enterprises. To arrive at a general tone, John asked some playful questions, too: If the CEZ were a dog (shoe / movie / work of art), what would it be? He asked the group to bring other logos and visuals to a session called "Like This / Not Like This." While the logo process is intuitive, designers use exercises like these, as well as research, to get at the essence of the organization, and its aspirations.
One team member shared a photo of a warehouse nameplate, typical of early-1900s industrial areas. On brick exterior walls, building names were painted in white on a black field with a narrow white border. Two local examples: at Carlton Place Lofts— a former liquor warehouse— the "2295 Building" nameplate is still visible at the roofline. And on Wabash just east of Vandalia, "Superior Packing" can be seen on the former meat-packing plant. John decided to draw on that signage history for the logo lettering treatment.
By midwinter, John had seven logo concepts to show the group. The streetscape was one; others were based on interlocking gearwheels, shipping crate labels, wrought iron, and other images (and type treatments). All were appealing; all had the requisite grit and energy. But in this case, consensus was quick: everyone gravitated to the streetscape with the nameplate lettering.
Now the narrowing-down phase began. After some discussion, they agreed on three buildings to depict: the KSTP tower, Seal Hi-Rise, and Vandalia Tower. Not only are they iconic shapes, they suggest a lively panorama from west to east. John refined the images and chose the font, which can be trickier than it sounds. As a guide, he used a Designall typeface, which mixes upper and lower cases for a dynamic, inclusive tone. But for the final typographic art he used one of the DIN font families (the inspiration for Designall), dating back to mid-1900s German road signs. But even then, tweaks were needed. For reasons of both style and readability, John said, "I created a new T and redesigned the A and E."
Colors came next: the team found that the turquoise, gold, and coral worked well together, as did their overlap colors. They also agreed on a secondary palette to use when needed: periwinkle, rust, and machine gray.
When the CEZ board saw the final logo in February, it was pretty much love at first sight. Just one question remained: should we add the crescent moon to the silhouette of Vandalia Tower? The vote was unanimous.
"John's process helped us define our purpose and express it in a visual language we can share with the world," said committee member Julie Ann James. "Our new identity springs from our neighborhood and our mission. Through the partnership with Triangle Park, something meaningful and beautiful came into being. Awesome!" The logo had a soft launch this spring. Join us June 13 to toast the official rollout!
Pictured: Dan Nordley (left) with creative director John Seymour-Anderson in TPC's Baker Building offices. The painting by Janice Perry Porter shows the firm's roots in the Seward neighborhood, overlooking Triangle Park.
|
0.999987 |
I don't understand people who say "I don't know how to thank you." Like they never heard of money.
In America, it is not important how much an item costs, it's more important how much you can save when you buy it.
|
0.999999 |
What are some of your favorite vegetarian recipes? Lately I've been having a difficult time trying figure out what to do for dinner. Preferably Cholesterol and sodium low. I tried once in the tofu lasagna and gaged me, but I'm willing to try again I honestly do not think it's cooked enough or has enough water out.
So delicious, everyone asks for the recipe! Baked Corn INGREDIENTS: 2 cups whole kernel corn 1 / 4 cup chopped onion 1 / 4 cup green pepper, chopped 25 g margarine 2 tablespoons flour 1 teaspoon salt ground black pepper 3 / 4 cup milk 1 egg 1 / 3 cup cracker crumbs 1 tablespoon butter, melted (= 15 g) DIRECTIONS: Preheat oven to 350 degrees F (175 degrees C). In a large skillet, cook onion and green pepper in margarine. Using a wooden spoon, mix the flour, salt, pepper and milk into the sauteed mixture. Add the corn and egg in the mixture before pouring the whole mixture into a medium size casserole dish greased. cracker crumbs and melted butter Combine in small bowl. Pour on the pan. Bake in a preheated 350 degrees F (175 degrees C) oven for 30-35 minutes.
Vegetables usually conjure up images of boring, tasteless dishes. What most people don't know is that being a vegetarian doesn't mean sacrificing taste for health benefits. One way to prove that the stereotype is wrong is through a vegetarian chili recipe. A vegetarian chili recipe is simply packed with both taste and health benefits.
The specific country of origin of the chilli pepper is unknown to this day. It is clear though that from the time of the Spanish and Portuguese explorers to this day, chili peppers have become one of the most sought after spices.
Chili peppers can come in hundred kinds, with varying degrees of intensity of flavor and hotness. The chili pepper's hotness can range from the completely mild and slightly sweet bell pepper to the more extreme habanero. Other chili pepper types include poblano, chipotle, ancho, cayenne, tabasco and pimiento. Chili peppers get their distinct taste from the chemical capsaicin which is naturally resistant to both freezing and heat. Today, people can get their chili kick from related products like chili powder, chili oil and dried chili. Some vegetarians however would understandably still prefer fresh chili peppers for a good vegetarian chili recipe.
Those who are in the habit of feasting on a good vegetarian chili recipe would be happy to know that every vegetarian chili recipe has great health benefits. One of the major benefits of a vegetarian chili recipe stems from the antioxidant content of chili peppers.
Chilies contain beta carotene and vitamin C which are strong natural antioxidants that help fight free radicals. Free radicals are rouge unpaired molecules that may build up due to oxidation and cause cell damage by stealing healthy molecules to pair with. These free radicals may be the cause of various illnesses including cancer. The vitamins in a vegetarian chili recipe neutralize free radicals by pairing with them.
One other popularly known health benefit which one can get from a vegetarian chili recipe is the pain relief that can be provided by capsaicin. A vegetarian chili recipe with enough capsaicin can diminish substance P which is responsible for sending pain signals. Capsaicin in a pure vegetarian chili recipe can decrease the sensation of pain without making a person loose complete sensitivity.
Until now, studies for health benefits a vegetarian chili recipe are still being conducted. Experts are looking into the possibility that chilies can help improve digestion and metabolism, improve appetite, decrease levels of bad cholesterol and improve blood circulation. It is also quite clear that chilies have an indirect way of managing our bodies' sodium levels. A flavorful chili dish simply cuts our need and craving for more sodium.
You may have possibly heard how vegetarian cooking can be nutritionally unbalanced for its lack of protein. Now, that no longer holds true. You can always get enough protein by combining tofu and beans in a flavor filled chili recipe. Chili however is almost always best tasting in a recipe pot that is generously filled with garlic, onions and tomatoes. You can also try a little variety by experimenting with a little red wine or natural fruit juice in a chili recipe pot.
Excited to try out the best vegetarian chili recipe? Log on to BecomeAVegetarian.Info now for more tasty vegetable recipes for your diet!
The offspring of Vegetarian Times’ “Fast and Easy” column, the most popular in the magazine 250 mouth-watering recipes packed with fresh, seasonal ingredients and easy-to-find vegetarian staples, like grains, legumes, and tofu A full range of recipes, from appetizers to desserts, all of which can be made in 15, 30, or 45 minutes.
|
0.991564 |
Iron Age India, the Iron Age in the Indian subcontinent (South Asia), succeeds the Late Harappan (Cemetery H) culture, also known as the last phase of the Indus Valley Tradition. The main Iron Age archaeological cultures of India are the Painted Grey Ware culture (1200 to 600 BCE) and the Northern Black Polished Ware (700 to 200 BCE).
The North Indian Iron Age is usually taken to last roughly from 1200 to 300 BCE.
Nevertheless, recent (2003) excavations in Uttar Pradesh have turned up iron artefacts, furnaces, tuyeres and slag in layers radiocarbon dated between c. BCE 1800 and 1000. Iron using and iron working was prevalent in the Central Ganga Plain and the Eastern Vindhyas from the early second millennium BCE. The dates obtained so far group into three: three dates between c. 1200-900 cal BCE, three between c. 1400-1200 cal BCE, and five between c. 1800-1500 cal BCE. The types and shapes of the associated pottery are comparable to those to be generally considered as the characteristics of the Chalcolithic Period and placed in early to late second millennium BCE. Taking all this evidence together it may be concluded that knowledge of iron smelting and manufacturing of iron artefacts was well known in the Eastern Vindhyas and iron had been in use in the Central Ganga Plain, at least from the early second millennium BCE. The quantity and types of iron artefacts, and the level of technical advancement indicate that the introduction of iron working took place even earlier. The beginning of the use of iron has been traditionally associated with the eastward migration of the later Vedic people, who are also considered as an agency which revolutionised material culture particularly in eastern Uttar Pradesh and Bihar. The new finds and their dates suggest that a fresh review is needed. Further, the evidence corroborates the early use of iron in other areas of the country, and attests that India was indeed an independent centre for the development of the working of iron.
Archaeologically, this includes the Black and Red ware culture (c. 1300–1000 BCE), Painted Grey Ware culture (1200–600 BCE), and the Northern Black Polished Ware (700–200 BCE).
The development of early Buddhism takes place in the Magadha period (5th to 4th centuries BCE).
The North Indian Iron Age can be taken to end with the rise of the Maurya Empire and the appearance of written text (the edicts of Ashoka, r. 272-232 BC) indicating the gradual onset of historicity. South India simultaneously enters historicity with the Sangam period, beginning in the 3rd century BC.
From the 2nd century BC, the cultural landscape of Northern India is transformed with lasting effect with the intrusion of the Indo-Scythians and Indo-Greeks, and the states succeeding this period, up to the medieval Muslim conquests are conventionally grouped as Middle kingdoms of India or Classical India.
The earliest Iron Age sites in South India are Hallur, Karnataka and Adichanallur, Tamil Nadu at around 1000 BCE. Archaeologist Rakesh Tewari, the Director, U.P. State Archaeological Department, India, stated that studies of the site at Karnataka implied "that they had already been experimenting for centuries" as by that time they were able to work with large artifacts. Shyam Sunder Pandey suggested that “the date of the beginning of iron smelting in India may well be placed as early as the sixteenth century BC” and “by about the early decade of thirteenth century BC iron smelting was definitely known in India on a bigger scale”.
South India enters its proto-historical period from about 300 BCE; Chola Empire, Chera Kingdom, Pandya Kingdom, Pallava Empire.
Kenoyer, J. M. 1995a Interaction Systems, Specialized Crafts and Culture Change: The Indus Valley Tradition and the Indo-Gangetic Tradition in South Asia. In The Indo-Aryans of Ancient South Asia: Language, Material Culture and Ethnicity, edited by G. Erdosy, pp. 213–257. Berlin, W. DeGruyter.
Shaffer, J. G. 1992 The Indus Valley, Baluchistan and Helmand Traditions: Neolithic Through Bronze Age. In Chronologies in Old World Archaeology (3rd Edition), edited by R. Ehrich, pp. 441–464. Chicago, University of Chicago Press.
This page was last modified on 31 October 2015, at 15:44.
|
0.995246 |
Erika Henningsen was just a year out of the University of Michigan when she made her Broadway debut as Fantine in the 2015 revival of Les Miserables. Now, she’s back in high school for a production that has her graduating to both star status and critical acclaim: In the role that put Lindsay Lohan at the top of Hollywood’s hot list circa early 2000s, Henningsen plays Cady Heron, the sweet kid who transforms into one of the terrors who give Mean Girls its title.
As the lead actress in an ensemble of fresh faces, energetic dancers and top-notch belters, the 25-year-old Henningsen has been an eyewitness to the development of Mean Girls from beloved cult film to crowd-pleasing Broadway musical, with book writer Tina Fey rewriting and stage-tuning well-remembered elements from the 2004 movie – from pink Wednesdays to a Danny DeVito reference that still gets laughs – while adding updates about social media cruelty (the show’s about high schoolers, after all) and even a Trump joke or two.
I spoke with Henningsen about Mean Girls – directed by Casey Nicholaw, with Fey’s book, Jeff Richmond’s music and Nell Benjamin’s lyrics – about living the Broadway dream, working with Fey, encountering (or not) Lohan and the inevitable Tony Award buzz. The conversation has been condensed and edited for clarity.
Deadline: So, you must be floating right now. Do you read reviews?
Erika Henningsen: Yeah, I’m floating. That’s a really good word for it. It’s like the adrenaline hasn’t quite left my body yet.
There are some reviews I let myself read because I thought, I’m going to read The New York Times because I’ve been reading those since I was 15, so I read that one, and then I just heard from family and friends that the overwhelming response is positive. Everybody’s going to have certain things that maybe they don’t love, but the nice thing is when we do the show we can just tell because the audience will laugh and they applaud and you can tell when you have a show that even if there are things that people didn’t specifically respond to, that the overarching product is positive and people are happy to be at that production every night.
Deadline: Give us a brief summary of how this show came about for you.
Henningsen: About a year ago my agent texted me two words – “Mean Girls”. And I just wrote back, what? And he’s, like, give me a call. I had no idea that it was in the works. They kept it under wraps that they were working on developing a musical of Mean Girls, and as soon as he said that I just thought, Oh my gosh, I must, I must be in this. I wanted to be in this so bad. And not just because of the team attached to it – Casey and Tina and Nell and Jeff – but I had grown up listening to a lot of Nell’s shows, and when you add Tina Fey into the mix, it’s kind of hard to just say, Oh, if I don’t get the job it’ll be okay.
The first round I didn’t get, when they were in lab development, and then it came back on the table a couple months later. The big thing I’ve taken away from that whole audition process: It’s not over ‘til it’s over.
Deadline: There are people who know the movie by heart. Were you a fan?
Henningsen: It came out in 2004, so I was 12, approaching 13, and I was not allowed to watch PG-13 movies. So I didn’t get to see Mean Girls in theaters, but when it came out on DVD my sisters and I watched it and I just remember thinking like, This is cool, this is an important thing to watch and this is fun. I would put it in my laptop in the morning as I got ready for school. So when I went back to revisit the movie, just from those two years of listening to it and watching it I realized I knew the whole soundtrack by heart, I knew scenes verbatim without even really sitting down and thinking about it. It had just become this sort of fabric of lingo and familiar characters that I knew from those teenage years.
I think that’s how a lot of people feel about it. It was the movie you watch at sleepovers, the movie you would put on on a Saturday night. So I was really familiar with the material, but what was exciting when we started working on the script is that they had updated it so much. The plot was familiar but their interpretation was really fresh and new and that was exciting.
Deadline: Tell me about the updates. How is Mean Girls relevant today with the #MeToo movement?
Henningsen: There were certainly two updates that I saw. Cady in the movie was sort of the lens through which we see the story, and it’s easier to do that in film because you have the elements of close-ups and voiceovers. We don’t have that in live theater, so they created a Cady that was a bit more on the balls of her feet. She was a bit more eager than the Cady in the film simply because you have to have somebody propelling the story who’s a bit more active than they are necessarily in film. So that was sort of part one.
And then what Tina created, whether or not we were aware that this female movement was going to take off as the show was coming to fruition, all sort of coalesced at the same time. So the biggest message that has changed, I think, from the movie is that the movie sort of ends with this apology. The Cady Heron character apologizes to the people that she’s wronged.
But in (the musical) there’s a wonderful moment between Cady and Regina [the villainous top Mean Girl played by Taylor Louderman] where we learn that you don’t have to apologize for your strength or your individuality. You have the right to inhabit your womanhood and that strength, but it should never be used to undermine somebody else.
So the idea this time is that women are stronger together, and not only should we reach out to one another and rely on one another as a group, we more than likely will be able to take steps forward into sort of undoing the damage that has been done in the past. So that’s been a really exciting life imitating art and art imitating life that has truly just even in the last couple months come to the forefront. It’s been wonderful to be a part of a show that has these messages.
Deadline: Let’s talk about working with Tina Fey. How much interaction did you have with her day to day?
Henningsen: I think it surprises people to hear that she was there every day, but it’s not surprising to us anymore because it was just such a given that Tina was going to be in the rehearsal room. She was there each day, constantly, constantly rewriting, editing. My favorite thing was to watch the run throughs. If you looked over at Tina sitting behind the table at any moment, her mouth would be moving because she was either going over new lines in her head or rewording things to figure out what sounded better, what fit (the actors’) individual habits better.
She’s wonderful because she has no ego when it comes to her writing. She would never say like Oh, well, you’re doing it wrong. She would come back with a new line and you’d say, Yeah, I think this matches my sensibility better. So her ability to write quickly and her ability to write with each of us in mind is the greatest gift that you can ever have as an actor. She created parts that were tailor-made to the strengths of all of us.
I mean, you’ve seen the show, it has this principle cast of 10 people, so she’s writing for 10 different voices and they all need to be distinct, and she does that so well because I think her brain is always working on overdrive on How can I make this better, how can I make this land in a stronger way? And sometimes she would just come up and say Well, what do you think you would say here? And then would come back 10 minutes later and you would see your words in the script, and that collaboration was really wonderful. It doesn’t really happen in a room in such a high pressure situation like this.
Deadline: I’ll put you on the spot and ask for an example.
Henningsen: It’s one of my favorite scenes that I get to do in the show. Cady gives sort of a speech to the students, it’s the last part of the show. And for a long time we had a version of it and we really needed to change it but we were waiting for all the other puzzle pieces of the production to fall into place. So Tina kept saying, I need to see everything laid out before we figure out what we want to say in this last moment.
And we were in maybe our second, third week of previews and everything was about to be frozen. And I was sitting in the audience with her and Casey and she just said to me, Well, what do you think Cady would say here? And I just said, We’ve seen her journey and we realize that the biggest mistake she made was thinking that she has to change herself to be appealing to the Plastics, and I think the lesson she comes to learn at the end is that you are enough as you are.
And Tina went away and those words have made their way into the final speech that Cady gives, and it was just a wonderful moment because I think Tina realized the person who has been living with this character has an idea of what Cady would say, and then to see Tina’s ability to create the words from that was a really special moment. The last puzzle pieces had come into place.
Deadline: Have you heard from Lindsay Lohan? Do you expect to? I’m curious if she’s seen this Mean Girls.
Henningsen: Oh, no, I haven’t. I know she wants to see it. I get so nervous when I know people are in the audience, and if she wanted to come [on a particular night] I probably wouldn’t know because our company management knows [not to tell me]. Taylor, the wonderful actress who plays Regina, and I are both, like, Don’t tell us what people are here.
Deadline: Are you letting yourself think about Tony Award nominations at all?
Henningsen: You know, I’m letting myself think about it in terms of the show. I really want this show to be nominated, I want it so much, mainly because I work with these people every day and I see how much effort it took to create this musical, this non-stop two and a half hours of energy. It takes so much work from everybody and it takes so much passion and heart from our creative team, from our design team, from the whole ensemble, like I just want the entire show to be rewarded.
Deadline: Have you had any interactions with Lorne Michaels? At the performance I was at I saw him standing in the back with that same expression that you see on Saturday Night Live, that same sort of inscrutable look.
Henningsen: That’s so funny that you mention that. We were lucky to go see SNL before our rehearsals started again, when Will Ferrell was hosting. I know exactly what look you’re talking about.
Lorne is so wonderful and really I think he’s just really happy to see how much joy we all are having to be a part of this. I’ll never forget, he said something to me at our opening in Washington D.C. He said, Are you going to stay with it? And I looked at him like, Lorne, what else would I be doing? Best job in the world. It was so funny to me. I think he’s just happy that Tina, who he loves and admires and respects, that this dream of hers has come to fruition and that we all want to be a part of it so badly and are so happy to be here. So hearing Are you going to stay?, I just thought Oh, they’re going to have to kick me out the door.
The Tony Awards will be telecast live by CBS June 10, beginning at 8 PM ET.
|
0.988515 |
The marriage of the Lamb is an eschatological theme, tied to the second coming of Christ (Matt. 25: 1-13). What is the significance of this imagery and when was it fulfilled?
In the Old Testament, the imagery of marriage was a symbol for the law of Moses and covenant with Israel. God espoused (betrothed) Israel to himself in the exodus from Egypt.
"I remember thee, the kindness of thy youth, the love of thine espousals, when thou wentest after me in the wilderness, in a land that was not sown" (Jer. 2:2).
"Now when I passed by thee, and looked upon thee, behold, thy time was the time of love; and I spread my skirt over thee, and covered thy nakedness: yea, I sware unto thee and entered into a covenant with thee, saith the Lord God, and thou becamest mine" (Ezek. 16:8).
"Wherefore, O harlot, hear the word of the Lord: Thus saith the Lord God; Because thy filthiness was poured out, and thy nakedness discovered through thy whoredoms with thy lovers, and with all the idols of thy abominations, and by the blood of thy children, which thou did give unto them: Behold, therefore I will gather all thy lovers, with whom thou hast taken pleasure, and all them that thou hast loved, with all them that thou hast hated; I will even gather them around about against thee, and will discover thy nakedness unto them, that they may see all thy nakedness And I will judge thee, as women that break wedlock and shed blood are judged; and I will give thee blood in fury and jealously" (Ezek. 16:35-38).
This passage, typical of many Old Testament prophecies, looks beyond the restoration of Israel to Palestine following the Assyrio-Babylonian exile, and anticipates the salvation of Christ. The "married" woman refers to Israel before the captivity; the "desolate" woman refers to Israel during the captivity. The reproach of Israel's widowhood (divorce) would be forgotten in the kindness God showed by returning her to the land, and bringing Christ into the world. The children of the "desolate" would be more than the children of pre-captivity Israel: Christ would come, the gospel would be proclaimed among the Gentiles, and the ranks of the faithful would break forth on every side. This leads us to the New Testament.
"He that hath the bride is the bridegroom: but the friend of the bridegroom, which standeth and heareth him, rejoiceth greatly because of the bridegroom's voice: this my joy therefore is fulfilled" (Jn. 3:29).
"For they are not all Israel, which are of Israel: neither, because they are the seed of Abraham, are they all children: but, in Isaac shall thy seed be called. That is, they which are the children of the flesh, these are not the children of God: but the children of the promise are counted for the seed" (Rom. 9:6-8).
· Death on Calvary (AD 33): Legal termination of the Old Testament, first marriage terminated; Christ espoused to new bride.
· Pentecost thru Second Coming (AD 33-70): Betrothal period; bride washed and purified by the blood of Christ, looking to the consummation.
· Second Coming: Marriage consummated (AD 70); Christ cohabits with wife in the New Jerusalem (church).
Let us survey the scripture where these lessons are found.
This passage teaches us that the law of the first husband (Old Testament) ended at the death of Christ. Jesus was national Israel's husband, the God of the Old Testament clothed upon with humanity. When he died on Calvary, national Israel was widowed and husbandless, and the Old Testament was annulled. Israel was "loosed from the law," made "free from the law," and "dead to the law," so they could enter a new covenant and new marriage under the gospel of the resurrected Christ. Those who respond to the gospel call were espoused to Christ and become the church and bride. Thus, national, ethnic Israel and the law of Moses were left behind at Calvary, and spiritual Israel and the gospel of Christ began.
"I have espoused you to one husband, that I may present you as a chaste virgin to Christ" (I Cor. 11:2; cf. Eph. 5:24-27).
In Jewish law, the betrothal period was equal in law to marriage and a woman who took another man during this period was just as guilty of adultery as a woman who was in a consummated marriage (Deut. 22:12-21; Matt. 1:18, 19). We sometimes hear it said that the couple lived together during the betrothal period, without consummating the marriage, but the Bible nowhere bears this out. Although betrothed, Joseph and Mary were not living together when she conceived by the Holy Ghost, for she went and lived with her kinswoman, Elizabeth, for three months (Lk.1: 39, 56). When she returned home and it was found that she was pregnant (for she now began to show), the angel instructed Joseph not to fear "to take unto thee Mary thy wife" and "Joseph being raised from sleep did as the angel of the Lord has bidden him, and took unto him his wife" (Matt. 1:23, 24). Thus, although deemed man and wife in contemplation of law during the betrothal period, the husband and wife lived apart. This is confirmed by the parable of the ten virgins, which places the marriage ceremony and consummation at Christ's second coming, after going into a "far country to receive a kingdom and return" (Matt. 25:1-13; Lk. 19:12).
Destruction of Jerusalem AD 70, or Calvary AD 33?
There is an error current among Preterists that says the old law was still valid, and that the church was not justified, but continued under the debt of sin until AD 70. Yet, Paul's whole analogy in Rom. 7:1-4 turns upon the hinge of the Old Testament's end at Calvary, terminating the law of the first husband, so that believers could enter a new covenant with a new husband in Christ. If it is true that the Old Testament was still valid after the cross, then the church was an adulteress in taking a new husband in Christ. Such is the quandary created by those teaching "covenant eschatology," keeping the mosaic law and ritual alive beyond the cross of Christ.
Let God be true though every man a liar: The church was not an adulteress, the law had ended, and she was free to take a new husband under the gospel of the risen Savior. What about justification from sin: Would Christ consummate a marriage at his return with a bride soiled with sin? Of course he wouldn't. Thus, the bride was washed and justified during the betrothal so Christ could receive her chaste and pure at his return.
"Husbands, love your wives, even as Christ loved the church, and gave himself for it; that he might sanctify and cleanse it with the washing of water by the word, that the might present it to himself a glorious church, not having spot, or wrinkle, or any such thing; but that it should be holy and without blemish" (Eph. 5:25,-27).
"Let us be glad and rejoice, and give honor to him: for the marriage of the Lamb is come, and his wife hath made herself ready. And to her was granted that she should be arrayed in fine linen, clean and white: for the fine linen is the righteousness of the saints" (Rev. 19:7, 8).
Thus, from AD 33 until the second coming, the church was in a state of purity and sanctification, washed by Christ's blood, waiting to consummate the marriage. She was clothed in fine linen, clean and white, showing that she was justified from sin. There is nothing to the error that the law was valid and the church continued under the debt of sin until AD 70.
"And I John saw the holy city, new Jerusalem, coming down from God out of heaven, prepared as a bride adorned for her husband. And I heard a great voice out of heaven saying, Behold, the tabernacle of God is with men, and he will dwell with them, and they shall be his people, and God himself shall be with them, and be their God…And there came one of the seven angels which had the seven vials full of the seven last plagues, and talked with me, saying, Come hither, I will shew thee the bride, the Lamb's wife. And he carried me away in the spirit to a great and high mountain, and shewed me that great city, the holy Jerusalem, descending out of heaven from God" (Rev. 21:2, 3, 9, 10).
"Thy Maker is thine husband; the Lord of host is his name…O thou afflicted, tossed with tempest, and not comforted, behold, I will lay thy stone with fair colours, and lay thy foundations with sapphires. And I will make they windows of agates, and thy gates of carbuncles, and all thy boarders of pleasant stones" (Isa. 54:5, 11, 12; cf Rev. 21:18-21).
Since consummation of the marriage of the Lamb is an important proof that the book of Revelation is fulfilled and the second coming a past event, it is worth pausing to provide proof of its timing.
"Wherefore, behold, I send unto you prophets, and wise men, and scribes: and some of them ye shall kill and crucify; and some of them shall ye scourge in your synagogues, and persecute them from city to city: that upon you may come all the righteous blood upon the earth, from the blood of righteous Abel unto the blood of Zacharias son of Barachias, whom ye slew between the temple and altar. Verily I say unto you, All these things shall come upon this generation" (Matt. 23:34-36).
There are many more proofs tying the events described in Revelation to the time of Nero's persecution and the destruction of Jerusalem, but they are beyond the scope of the present study. Suffice it to say, the consummation of the Lamb's marriage is clearly tied to the time when the Jewish nation was taken away for its sins, and the Roman Empire experience the "year of four emperors" following the death of Nero.
What was the marriage of the Lamb? The marriage was the point at which the Lord returned from heaven to dwell with his bride, and the church was clothed with the new Jerusalem, the capital city and earthly seat of Christ's throne.
We say "end of Christ's eschatological coming" for it is clear that the coming stretched at least over AD 66-70, the duration of war with Rome, but the marriage occurred only at this period's end.
|
0.999985 |
Nova Scotia’s community services minister has been asked to apologize to a young woman who was apparently left traumatized after two of her children were mistakenly taken away by Child Protective Services for four weeks.
Adams said the two children – an infant and a seven-year-old – were apprehended after police raided the family home in July, acting on a report from the department that the woman had tested positive for illicit drug use.
The Community Services Department called the woman a week later to confirm there had been a mix-up.
The member for Cole Harbour-Eastern Passage asked if Community Services Minister Kelly Regan would apologize to the family for the mix-up.
|
0.999988 |
A trader's job is to find the best indicators for entering and exiting trades. Here are three fundamental metrics that you can't afford to ignore.
Unfortunately, many technical traders come to the conclusion early in their careers that fundamentals aren't all that important to their success. They cite that fundamentals lag stock price action. Let's face it: By the time factors such as revenues and earnings are released in quarterly financial statements, the data are three months old and usually already reflected in the price. But what if there were fundamental indicators that led price?
Consumption is the cornerstone of the US economy, accounting for nearly two-thirds of our gross domestic product (GDP). Thus, it's logical to assume that how much the consumer spends has an impact on stock markets.
Personal consumption expenditures (PCE) measure the cost of consumer goods and services used by individuals on a daily basis. It's a metric employed by government statisticians to help measure inflation. As you can see in Figure 1, when you compare the PCE percent change from a year ago to the S&P 500 index, there is a correlation between the two. PCE peaked around mid-1999 nearly a year before stocks peaked and bottomed in late 2001, more than a year before stocks. PCE peaked again in early 2006, well ahead of the peak in stocks in October 2007. And the latest PCE peak occurred in 2011, after which it dropped significantly while stocks continued to rise.
FIGURE 1: S&P 500 INDEX VS. PERSONAL CONSUMPTION EXPENDITURES (PCE). There is a clear relationship between the S&P 500 and the PCE. In mid-1999, PCE peaked, which is nearly a year before stocks peaked. PCE bottomed in late 2001, more than a year before stocks. PCE peaked again in early 2006, well ahead of the peak in stocks in October 2007. The latest PCE peak occurred in 2011, after which it dropped significantly while stocks continued to rise.
Another valuable consumption metric is Retail And Food Services Sales (RSAFS), which, like PCE, is available from the St. Louis Federal Reserve website. As we see from Figure 2, RSAFS has a habit of peaking and bottoming just before PCE. Together, they provide an excellent picture of consumer strength, which has exhibited a tendency to lead stocks.
FIGURE 2: S&P 500 (RED), PCE (GREEN), AND RSAFS (BLUE). RSAFS has a habit of peaking and bottoming just before PCE. Together, they provide an excellent picture of consumer strength, which has exhibited a tendency to lead stocks.
As Figure 3 shows, retail sales peaked in August 1999, one year before stocks. In January 2006, they peaked again, but this time it was 19 months before the stock market followed suit. Although the last RSAFS peak on the chart was in July 2011, stocks were still heading higher 21 months later in mid-April 2013.
FIGURE 3: S&P 500 WITH RETAIL VS. FOOD SERVICES SALES. Retail sales peaked in August 1999, one year before stocks. In January 2006 they peaked again, but this time, it was 19 months before the stock market followed suit. Although the last RSAFS peak on the chart was in July 2011, stocks were still heading higher 21 months later in mid-April 2013.
The lag between peaks has increased, but has the relationship broken down altogether or is it just a matter of time before stocks follow retails sales down? And if the relationship is still intact, when will that be? To help answer those questions, we must examine an important factor that has been impacting markets since 2008.
In November 2008, the world was introduced to a new concept in managing economies. It was euphemistically called quantitative easing (QE), which may sound better than "printing money," but that is basically the end result -- the central bank rapidly expands the money in circulation. If the intention of various QE programs was to return the economy and unemployment figures to more robust levels, it's been a failure. But the same can't be said for stocks.
The Federal Reserve's first big stimulus infusion came on September 17, 2008, when its balance sheet jumped more than 400% from the previous week, according to data from the St. Louis Federal Reserve website (http://research.stlouisfed.org). By the end of December that year, in the wake of the collapses of Bear Stearns and Lehman Brothers, the Fed balance sheet had grown by nearly 15,000%, thanks to QE1!
Compared to 2008, the following year was relatively quiet and by December 2009, the balance sheet had "only" expanded by another 25%. In March 2010, QE1 ended and the balance sheet actually dropped nearly 4%. But this decline would prove ephemeral -- Chairman Ben Bernanke hinted about QE2 at Jackson Hole in August, and in November, it was formally announced.
Next came the pre-election year, when governments have habitually stimulated the economy to begin putting voters in a good mood for the upcoming presidential election. By year-end 2011, the balance sheet had ballooned another 50%. In 2012, the Fed stopped aggressively and openly expanding their balance sheet and in June announced a new strategy of buying and selling Treasuries in a program named "Operation Twist" to help keep the lid on interest rates. In theory, the move was to be revenue neutral.
As we see from Figure 4, the correlation between stocks and the Fed balance sheet prior to 2008 wasn't obvious. That changed in dramatic fashion with the huge injection of trillions of dollars in stimulus beginning in November 2008, which completely reenergized stocks.
FIGURE 4. CORRELATION BETWEEN FEDERAL RESERVE BALANCE SHEET (GREEN) AND STOCKS (RED). Prior to 2008, the correlation wasn't obvious. That changed with the huge injection of trillions of dollars in stimulus beginning in November 2008, which completely reenergized stocks.
Next, we take a closer look at the S&P 500 and the Federal Reserve balance sheet after 2007 (Figure 5). It took more than three months after QE was introduced before stocks bottomed. Thereafter, the length of the lags between the two varied. And although stimulus programs financed by the Fed have not been the only factor driving stocks higher -- hints and announcements about various programs also played a part -- they have certainly played a major part.
FIGURE 5. S&P 500 AND THE FEDERAL RESERVE BALANCE SHEET AFTER 2007. From 2008 through 2013, increases and decreases in the Fed balance sheet as well as QE announcements have impacted stocks.
So although the correlation between the Fed balance sheet and stocks is not exact, few could argue that stimulus announcements and the size of the Fed balance sheet have not had a dramatic impact on the markets.
Here is one final observation. According to Fed data, the Fed balance sheet increased by more than 22% in the first 14 weeks of 2013, which means that at the current rate of expansion, it will have ballooned another 80% by year-end compared to 2012! Operation Twist was supposed to be "balance neutral" -- that is, the Fed sells short-term securities and buys the same amount of long-term securities to keep interest rates low. It was also scheduled to end in December 31, 2012. So what caused the huge jump in the balance sheet starting in early 2013?
Not only have QE programs changed markets forever, but it is likely that they have lengthened the lag between PCE, retail sales, and stocks. So when will stocks follow these metrics lower? That depends. History tells us that QE programs have a significant impact on stocks and that once started, it lasts as long as the money continues to flow.
But at some point, the government and Federal Reserve will have cheap money programs, and the relationship between the consumer and stock prices will return. The important takeaway is that not only has the traditional relationship between consumption and stocks been impacted in this new QE world, but so has virtually every other indicator that previously worked well at warning of a stock market top!
As long as the money flow continues, stocks should continue to prosper. Unfortunately, according to the jaded history of financial exuberance, the longer this bubble takes to build, the bigger the ultimate pop will be when markets eventually head for one ugly mean-reversion toboggan ride.
Blackman, Matt . "Two Fundamental Metrics That Matter," Traders.com Advantage, April 15.
Blackman, Matt . "Two Charts That Matter," Traders.com Advantage, March 19.
Blackman, Matt . "Intermarket Checkup," Working-Money.com, August 1.
|
0.937073 |
Humanized pigs have been developed to reduce the incidence of immune rejection in xenotransplantation, but significant concerns remain, such as transmission of viral zoonosis. Porcine endogenous retroviruses (PERV), which exist in the genome of pigs, are produced as infectious virions from all porcine cells and cause zoonosis. Here, we examined the possibility of zoonosis of hosts under conditions of immune suppression or xenotransplantation of cells producing host-adapted viruses. Upon transplantation of PERV-producing porcine cells into mice, no transmission of PERV was detected, whereas, transmission of PERV from mice transplanted with mouse-adapted PERV-producing cells was detected. In addition, the frequency of PERV transmission was increased in CsA treated mice transplanted with PERV-producing murine cells, compared with PERV-producing porcine cells. Transmission of PERV to host animals did not affect weight but immune responses, in particular, the number of T cells from PERV-transmitted mice, were notably reduced. The observed risk of PERV zoonosis highlights the requirement for thorough evaluation of viral zoonosis under particular host conditions, such as immunosuppressive treatment and transplantation with host-adapted virus-producing cells.
Funding: This work was supported by the Konkuk University in 2015. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Xenotransplantation offers the possibility to overcome the shortage of human donor organs . Pigs are preferentially used for xenotransplantation because of ethical considerations, breeding characteristics, compatible organ sizes, and physiology [2, 3]. However, several obstacles, such as immunological barriers and the possibility of viral zoonosis, need to be addressed for successful xenotransplantation [4–6]. To overcome immunological barriers, genetically modified pigs lacking a major xenoantigen have been developed [7, 8]. However, the risk of viral zoonosis remains and is even increased in pigs that are genetically engineered to reduce host-versus-graft reactions .
Porcine endogenous retroviruses (PERV) are of considerable interest in the field of xenotransplantation, since the genome is integrated in the germline with a high copy number . To date, PERV-A, PERV-B, PERV-NIH, and PERV-A/C recombinants have been reported to adapt to cell lines via serial passage and infect human cells in vitro [11–15]. No transmission of PERV from various porcine sources to recipient hosts in vivo has been observed [16–19]. However, in exceptional cases, such as immunodeficient animals or non-obese diabetic/severe combined immunodeficiency (NOD/SCID) mouse models, PERV infection and viral gene expression has been detected after transplantation of porcine islet cells [20, 21]. In addition, PERV DNA and RNA have been detected at multiple time-points in human PERV-A receptor 2-expressing transgenic mice, indicating that the virus is able to replicate after xenotransplantation . Although zoonosis is clearly caused by xenotransplantation of pig organs, the frequency of viral transmission from xenotransplant sources in host animals remains to be established. Moreover, little is known about the potential pathological risks in host animals undergoing transient immunosuppressant treatment. Human cell-adapted PERV-A/C was shown to infect cells from non-human primates without selection pressure. This phenomenon was attributed to generation of PERV with changes in the long terminal repeat, which plays an important role in viral replication .
In this study, we examined the hypothesis that PERV from different sources xenotransmit, infect, and integrate into genomes of hosts undergoing immunosuppressant treatment. To this end, mouse cells producing murine cell-adapted PERV (mPERV) or porcine cells producing porcine PERV (pPERV) were transplanted into host mice, and transmission of PERV in mice was analyzed under the condition of immunosuppressive treatment. Here, we reported that the viral zoonosis occurred at a higher frequency in BALB/c mice transplanted with mPERV-producing mouse cells than pPERV-producing porcine cells and in the mice under immunosuppressant treatment, relative to untreated condition.
NIH3T3 and PK15 (American Type Culture Collection, Manassas [ATCC], VA, USA) were cultured in Dulbecco's modified Eagle's medium (Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific). Four week-old female BALB/c mice purchased from Orient-Bio (Seungnam, Kyonggi-do, Republic of Korea) and housed in filter-top cages, with water and food provided ad libitum. Mice were maintained in accordance with the Guide for the Care and Use of Laboratory Animals of Konkuk University (Seoul, Republic of Korea), and were housed in a Bio-safety Level 2 facility, with implementation of the appropriate biosafety practices. NOG (NOD/Shi-scid/IL-2Rγnull) mice were purchased from Jackson Laboratory (Bar Harbor, ME, USA) and housed in a SPF facility. The use of animals in these experiments was approved by the Institutional Animal Care and Use Committee of Konkuk University (Approval No. KU14146-1). Cyclosporin A (10 mg/kg/day) (CsA, Chong Kun Dang Pharmaceutical Corp., Seoul, Korea) in olive oil (Sigma-Aldrich, St. Louis, MO, USA) was injected intraperitoneally for immunosuppressive treatment.
The PERV/NIH3T3 cell line was constructed by co-transfection of pcDNA3.1 (Invitrogen, Carlsbad, CA, USA) and the previously reported PERV-B clone into NIH3T3 cells. Cells were cultured in Dulbecco's modified Eagle's medium containing 1.5 mg/ml neomycin using GenePORTER2 (Gene Therapy Systems, CA, USA) and ten clones of neomycin-resistant PERV/NIH3T3 cells were isolated 4 weeks later.
Genomic DNA (gDNA) was isolated from 5 PERV/NIH3T3 clones using a DNeasy Blood & Tissue kit (Qiagen, Valencia, CA, USA). PERV pol gene was amplified via nested PCR with 200 ng gDNA and the primers PERVPol1 (GATGAGCGTAAGGGAGTAGC) and PERVPol2 (TGCTTCCGTCAGTGAACCAG) for primary PCR and PERVPol3 (CCATACTGGTCAAGGACG) and PERVPol4 (TCATCAGTCTCTTCAGGC) for secondary PCR.
Viral RNA was extracted from the supernatant of NIH3T3 cells transfected with the PERV-B clone using TRIzol (Thermo Fisher Scientific). RNA was mixed with AccuPower CycleScript RT PreMix (Bioneer, Daejeon, Korea) containing a random 9 mer, and incubated at 42°C for 60 min. Nested PCR was performed with the synthesized cDNA, Premix Ex Taq (Takara Bio, Inc., Otsu, Japan) and previously described primers .
To estimate the genomic copy number of PERV, real-time PCR was performed with PERVPol3 and PERVPol4 primers and the RT product as template using the SYBR Green PCR Master Mix Kit (Applied Biosystems, Foster City, CA, USA) in the ABI Prism 5700 sequence detection system (Applied Biosystems). The number of PERV copies per milliliter was determined by extrapolating the standard curve generated using the pol gene cloned into pGEM-T-Easy (Promega, Fitchburg, WI, USA).
Six NOG mice were divided into two groups and NIH3T3 and PERV/NIH3T3 cells were injected subcutaneously (107 cells/mouse) in the abdomen of each mouse. After 6 weeks, blood was collected and sera were added to 293T cells in Transwell (Corning, Lowell, MA, USA), with seeding of 293T cells (105 cells/well) in the lower wells. DNA was isolated 7 days after 293T cell treatment using a DNeasy Blood & Tissue kit (Qiagen). For PCR, 200 ng gDNA was used as a template with the following primers: PERVPol1, PERVPol2, PERVPol3, and PERVPol4. Amplified products were cloned into T-vector (T-Blunt PCR Cloning Kit, Solgent, Seoul, Korea) and sequenced.
The viral titer from NOG mouse serum was determined from the copy number of viral RNA. The reverse transcription RNA product isolated from NOG serum was used as the template for real-time PCR for the PERV pol gene using the SYBRGreen PCR Master Mix Kit (Applied Biosystems) with primers nABCPol3 and nABCPol4. Pol gene-specific PCR products were continuously measured using the ABIPrism5700 Sequence Detection System (Applied Biosystems) during the 50 cycles of amplification. The number of PERV copies per ml was determined by the extrapolation of the standard curve generated using pGEM-T-Easy vector (Promega) containing the pol gene insert.
To examine the expression patterns of PERV proteins, organs of transplanted mice were isolated, embedded in paraffin, and sectioned at a thickness of 6 μm. Sections were mounted on positively charged slides, air-dried in a 40°C incubator overnight, and deparaffinized in xylene. After rehydration in graded alcohol, tissues were incubated in 1% hydrogen peroxide diluted with methanol for 15 min to block endogenous peroxidase activity, followed by rehydration in distilled water and phosphate-buffered saline (PBS, pH 7.4). Tissues were incubated in blocking solution (3% bovine serum albumin and 10% normal calf serum in PBS) for 60 min at room temperature, followed by incubation with rabbit anti-PERV env antibody (1:1000) at 4°C overnight. Next, tissues were washed with PBS containing 0.1% Triton X-100, and incubated with biotinylated mouse anti-rabbit antibody (Dako, Glostrup, Denmark) followed by streptavidin conjugated to HRP peroxidase (Dako), and subsequently visualized with 3,3′-diaminobenzidine. Hematoxylin was employed as a nuclear counterstain.
All surgical operations were performed on sterilized dissecting pan. To minimize suffering, mice were sedated by mixture of tiletamine and xylazine anesthesia (50 and 5 mg/kg of body weight, respectively).
Splenocytes were treated with red blood cell lysis solution (Sigma-Aldrich, Inc., St. Louis, MO, USA) at 4°C for 5 min, and washed twice with PBS containing 1% fetal bovine serum. Subsequently, splenocytes were incubated with FITC-conjugated hamster anti-mouse CD3e (CD3ε chain) monoclonal antibody (BD Biosciences, San Jose, CA, USA), followed by PE-conjugated rat anti-mouse CD45R/B220 monoclonal antibody (BD Biosciences). To measure the proportions of CD4+ and CD8+ T cells in splenocytes, cells were incubated with PE-conjugated rat anti-mouse CD4 (L3T4) monoclonal antibody (BD Biosciences) and FITC-conjugated rat anti-mouse CD8 monoclonal antibody (BD Biosciences) for 30 min at 4°C. Cells were washed twice with PBS, resuspended in 1 ml PBS, and analyzed using a FACSCalibur flow cytometer (Becton Dickinson, Franklin Lakes, NJ, USA).
The control and treatment groups were compared using the unpaired Student’s t-test. A p value <0.05 was considered significant.
To mimic possible viral zoonosis by a host species-adapted virus, murine cell-adapted PERV was used as an experimental virus for mouse infection. Murine cells producing mPERV (mPERV/NIH3T3) were generated by transfection with the PERV genome along with the plasmid containing a neomycin-resistant gene for transfection selection. Nested PCR led to the identification of five neomycin-resistant cell lines (Nos. 1–5) in which the PERV gene was integrated (Fig 1A), among which four (Nos. 2–5) were validated as PERV-releasing cell lines by RT-PCR of the supernatant (Fig 1B). The highest titer among virus-releasing cells (1.8 × 106 particles/mL virus) was detected from the supernatant of cell line No. 2. Accordingly, PERV/NIH3T3 No. 2 cells were utilized as mouse donor cells for transplantation in subsequent experiments.
Fig 1. Detection of PERV genes expressed from PERV/NIH3T3 cells by PCR.
(A) PCR products of PERV pol gene by nested PCR from gDNA isolated from five cell lines (Nos. 1–5) of PERV/NIH3T3. (B) RT-PCR products of the PERV pol gene from the supernatants of five PERV/NIH3T3 cell lines. Lane Non, non-transfected NIH3T3 cells. Arrows indicate the expected size of amplified pol.
To determine whether transmission of PERV is affected by the origin of the virus in vivo, host-adapted PERV/NIH3T3 cells were transplanted and compared with cells in which PERV was originally detected (pPERV-producing PK15). Mice were further analyzed to determine the effects of cyclosporin A (CsA) as well as transplant route, specifically, subcutaneous injection (S.C.) and kidney capsule (K.C.), on zoonosis efficiency. Six organs (brain, liver, lung, heart kidney, spleen) from 5 and 6 mice in the S.C. and K.C. transplant groups were examined under CsA and no treatment conditions. No xenotransmission by pPERV was observed in the absence of CsA. In contrast, PERV-positive organs were detected following transplantation of mice with PERV/NIH3T3 with no CsA treatment, as shown in Fig 2. Upon treatment of mice with CsA, the percentage of PERV-positive organs in the mPERV transmission group was about 3.5 times higher than that in the pPERV group. The percentage of PERV-positive organs from mice treated with CsA was higher, compared to untreated mice. In mice transplanted with PERV-releasing cells via either subcutaneous injection or the kidney capsule method, similar percentage of PERV-positive organs was detected regardless of the origin of PERV (Table 1). The percentage of PERV-positive organs shown in Fig 2 and Table 1 was calculated based on PCR-based gDNA evaluation, and PERV RNA data obtained using RT-PCR supported the finding that the route of transplantation into mice do not affect the incidence of xenotransmission (Table 2). Detection of PERV-positive organs in xenotransplanted mice under the above specific conditions surprisingly revealed that transplantation of donor cells in which PERV proviral genes were integrated resulted in zoonosis. A further unexpected result is that donor cells releasing host-adapted virus have critical effects on the incidence of zoonosis.
Fig 2. Percentage of PERV-positive organs from mice transplanted with PERV/NIH3T3 or PK15 in the presence or absence of CsA.
PERV-positive organs were analyzed based on genomic DNA from individual organs of mice transplanted with PERV/NIH3T3 (mPERV) and PK15 (pPERV) by PCR. *: PERV was not detected in all organs.
Table 1. Percentages of PERV-positive organs from mice transplanted with PERV/NIH3T3 or PK15 with no or CsA treatment.
Table 2. PERV-positive organs in infected mice.
PCR-based detection of the PERV gene from genomic DNA in transplanted mice was confirmed using immunohistochemical analysis in spleens of mice transplanted with PERV/NIH3T3. As shown in Fig 3, brown spots centralized in lymphatic nodules composed of the white pulp of spleen were detected in CsA-treated mice transplanted with PERV/NIH3T3 via both subcutaneous injection and the kidney capsule method. Although the PERV pol gene was effectively detected by PCR regardless of CsA treatment, PERV env was only detected in mice transplanted with PERV/NIH3T3 cells under CsA treatment using immunohistochemistry (Fig 3). PERV env detection specifically from CsA-treated mice may be attributed to high expression of the protein, which is consistent with PERV DNA detection results showing a 3.5 times higher percentage of PERV positivity in CsA-treated than non-treated mice. PCR and immunohistochemistry data collectively suggest that PERV is xenotransmitted from donor cells to host animals, and immunosuppressive CsA treatment increases the possibility of PERV zoonosis.
Fig 3. Immunohistochemical detection of PERV env protein from spleen of PERV-infected mice.
Immunohistochemistry was performed in spleens from CsA-non treated mice transplanted with NIH3T3 cells (A), non-treated mice transplanted with PERV/NIH3T3 cells (B), CsA-treated mice transplanted with PERV/NIH3T3 cells by subcutaneous injection (C), and CsA-treated mice transplanted with PERV/NIH3T3 cells by the kidney capsule method (D). Arrowheads in (C) and (D) indicate staining of PERV env protein as brown spots.
Significant involvement of the immune system in the higher incidence of PERV xenotransmission was further confirmed in NOG (NOD/Shi-scid/IL-2Rγnull) mice transplanted with PERV-producing PERV/NIH3T3 cells. Severely immunodeficient NOG mice exhibit disrupted T, B and NK cell development as well as reduced innate immunity. Accordingly, PERV xenotransplantation was tested in NOG mice to mimic the immunosuppressed condition of normal mice via CsA treatment. In addition to analysis of PERV xenotransmission in NOG mice, the potential route of infection by the virus released from transplanted mouse blood was assayed by examining infection of 293T cells cultured in the lower well of a transwell. Sera from transplanted NOG mice were placed in the upper well of transwell. Physical separation using a membrane between sera and 293T cells aimed to exclude possible false-positive PERV detection due to microchimerism. Genomic DNA isolated from 293T cells was positive for PERV pol, as determined using PCR. The sequence of the pol region was identical to the pol gene of PERV-B (EU523109) incorporated in PERV/NIH3T3 cells S1 Fig. This result confirmed that recipients of PERV-producing cells can be infected through blood from transplanted mice and not contaminant donor cells.
To exclude the possibility of microchimerism (presence of cellular DNA from transplanted cells), PCR was performed to detect PERV pol, neomycin-resistant gene, porcine mitochondrial COII gene, and murine GAPDH. As shown in Fig 4, G4 and G6 mice transplanted with PERV/NIH3T3 and PK15 cells, respectively, were positive for PERV pol DNA, while G1 mice transplanted with NIH3T3 cells tested negative. G4 and G6 mice were negative for the marker gene of PERV donor cells, neomycin-resistant gene, and porcine mitochondrial COII, respectively (Fig 4). Our findings indicate that PERV positivity in organs results from zoonosis from PERV/NIH3T3 and PK15 cells not from the contaminated DNAs from transplanted cells.
Fig 4. PCR detection of PERV pol, neomycin-resistant, and porcine mitochondrial COII genes in mice transplanted with PERV/NIH3T3 or PK15 cells.
PERV pol (200bp), neomycin-resistant (300bp), porcine mitochondrial COII (250bp), and murine GAPDH (100bp) genes were detected from gDNA extracted from PERV/NIH3T3 cells, PK15 cells, and liver tissues from Group 1 (G1), Group 4 (G4), and group 6 (G6).
To determine whether xenotransmitted PERV affects pathogenicity in recipient mice, weight changes were monitored for 5 weeks between xenotransmitted (G3, G5, and G9; Table 2) and non-transmitted groups (G1, G7, and G11; Table 2) identified based on PERV positivity in their genomic DNA. Mice transplanted with PERV-producing cells using the kidney capsule method were excluded for comparison purposes because the procedure involved surgery. As shown in Fig 5, no notable weight changes in mice were observed between the two groups. In addition, the origin of PERV and CsA treatment of transplanted mice had no effect on weight.
Fig 5. Body weights of PERV-infected or non-infected mice after CsA treatment.
Weights of animals in each group were measured every week for 5 weeks. Each dot indicates the body weight of mice in CsA-treated (G1, G3, G5), untreated (G7, G9, G11), PERV-infected (G3, G5, G9) or uninfected groups (G1, G7, G11).
Immunological responses were compared between PERV-positive and -negative animals specifically in the CsA-treated group. As shown in Fig 6A, the percentage of T cells isolated from spleens of PERV-positive mice was 5.4% lower, compared with that in the PERV-negative mice, while the percentage of B cells was not significantly affected by PERV infection. In particular, the CD4-positive T cell number in PERV-positive mice was significantly reduced, compared with the PERV-negative group whereas CD8-positive T cells were only marginally reduced, as determined using the student's t-test (Fig 6B).
Fig 6. Effects of PERV infection on lymphocytes and CD4/8 cells in host animals.
Cells in splenocytes isolated at 7 weeks post-transplantation were stained with fluorescence-conjugated antibodies, and the number of labeled cells were measured by FACS. (A) Percentage of T and B cells in splenocytes of CsA-treated (n = 24) and untreated (n = 20) mice. (B) Percentage of CD4+ and CD8+ T cells in splenocytes of PERV-infected (n = 6) and uninfected (n = 6) mice. *: significantly different between PERV-infected and non-infected groups (Student t-test, p<0.05). The error bars indicate standard deviations.
To maximize the potential utility of pig organs as a source of xenotransplantation, extensive research is required to avoid virus-contaminated organs as donors for the effective prevention of zoonosis and related complications. Since successful xenotransplantation is usually performed under immunosuppressive conditions to minimize the risk of immune rejection, the susceptibility of hosts under diverse conditions, such as immunosuppressant treatment or infection by a host-adapted virus, needs to be assessed. PERV transmission has not been reported after transplantation of porcine organ/islets or PERV-producing cells. However, when the host was transplanted with cells producing host-adapted virus, PERV transmission was observed in our experiments. Moreover, the zoonosis rate was increased upon treatment of the host with immunosuppressant.
Transmission of PERV in the organs of host animals was analyzed via PCR detection of the PERV pol gene. The possibility of misleading results on PERV detection owing to contamination of transplanted cells was discounted based on negative PCR results for neomycin or porcine mitochondrial COII gene in PERV-positive organs. Following incubation of sera from mice transplanted with PERV/NIH3T3 cells on top of a transwell membrane, detection of PERV in 293T cells at the bottom provided evidence that the virus particles migrate through the membrane and infect cells. Additionally, detection of PERV in brain samples excluded the possibility of contamination. Transplanted cells cannot migrate to the brain due to the blood-brain barrier (BBB); therefore, the detected PERV gene likely originated from transmission of virus particles, rather than donor cell contamination. The mechanism by which human immunodeficiency virus (HIV) disrupts BBB and facilitates entry into brain, resulting in NeuroAIDS has been extensively studied. Specifically, HIV infection affects constituent proteins associated with the gap junction and astrocytes in BBB [28, 29]. The source of PERV RNA and mechanism of crossing BBB are currently under investigation. A possible explanation for detection of PERV RNA in brain might be derived from the mechanism of HIV that viral infection alters BBB integrity, enabling virus entry into the brain.
Previously, mouse retrovirus-mediated PERV transmission was demonstrated in mice xenografted with human cells . Transmitted PERV was identified as a retroviral pseudotyped virus, and pseudotyping between PERV and murine leukemia virus (MLV) reported as a well-established phenomenon. In addition, xenotropic MLV (MLV-X) was shown to be activated by immunosuppression, and efficiently expanded the tropism of all known PERV classes . Detection of PERV in transplanted animals in this study excluded the possibility of MLV-X pseudotyped PERV demonstrated earlier, since the NIH3T3 cells used were non- permissive to MLV-X . More importantly, mPERV was more infectious than pPERV, highlighting the importance of viral envelope origin and further implying that the envelope protein is not from the same source, MLV-X, but from the cell line-adapted PERV envelope. A previous study reported the presence of mERV-XL in NIH3T3 cells . Accordingly, the possibility of generation of recombinant PERV with the left half of the XMRV was examined and eventually discounted based on sequencing of the pol gene of mPERV as well as the absence of PCR products with primers specific for the left half of the mERV-XL genome and the right half of the PERV genome S2 Fig. The maintenance of the structure of PERV env, detected via immunohistochemistry using a specific PERV env antibody, provided further evidence that the virus from PERV/NIH3T3 is host-adapted and not recombinant PERV. This finding provides an important clinical consideration when humanized porcine organs are transplanted in humans. Furthermore, as reported for PERV viremia in pigs , PERV from humanized pig organs may systemically spread to various organs, which explains the result of PERV spreading to the spleen and nontransplanted left kidney.
Notably, higher transmission of mPERV in host animals under immunosuppressant treatment may be, in part, due to the enhanced likelihood of immune escape of the transplanted virus. CsA is generally used as an immune suppressant to reduce immune rejection in organ transplantation, since the major histocompatibility complex (MHC) classes of cells used for transplantation are different from those of host animals [34, 35]. Thus, the immune escape virus may be critical for zoonosis in the host when the immune system is suppressed for transplantation. In addition to low immune state, PERV infection affected T lymphocytes, resulting in a more suppressed immune system in host, although the underlying mechanism requires elucidation.
In conclusion, data from this study have provided insights into the conditions and mechanisms promoting zoonosis in xenotransplantation. To achieve safe xenotransplantation, further research focus on the routes of PERV trafficking is required, with a view to developing techniques for repression, inactivation or blockage of transmission.
S1 File. NC3Rs ARRIVE Guidelines checklist.
S1 Fig. The sequence alignment of PERV molecular clone B (EU23109) with PCR product.
The genomic DNA was isolated from 293T cells treated with serum from NOG mice transplanted with PERV/NIH3T3 cells. Nested PCR product using pol1, pol2, pol3, and pol4 as primers was cloned to pGEM-T Easy vector and the pol sequence was compared with PERV molecular clone B (EU23109).
S2 Fig. Detection of PCR products from the genomic DNA isolated from PERV/NIH3T3 cells.
(A) The expected annealing location of primers (arrows) was illustrated in the genomes of PERV and mERV-XL (32). (B) The PCR products of PERV gag-pol and mERV-XL gag-pol with the listed primers were detected in lanes 1, 6 and lanes 2, 3, respectively. The PCR product of a possible recombinant PERV with mERV-XL was not detected in lane 4,5,7,8. (C) Nucleotide sequence of the primers used for the PCR in (B) was listed.
This work was supported by the Konkuk University in 2015.
Writing – review & editing: JC YKO YbK.
1. Dorling A, Riesbeck K, Warrens A, Lechler R. Clinical xenotransplantation of solid organs. Lancet. 1997;349(9055):867–71. Epub 1997/03/22. pmid:9121275.
2. Bach FH. Xenotransplantation: problems and prospects. Annual review of medicine. 1998;49:301–10. Epub 1998/03/24. pmid:9509265.
3. Cooper DK, Keogh AM, Brink J, Corris PA, Klepetko W, Pierson RN, et al. Report of the Xenotransplantation Advisory Committee of the International Society for Heart and Lung Transplantation: the present status of xenotransplantation and its potential role in the treatment of end-stage cardiac and pulmonary diseases. The Journal of heart and lung transplantation: the official publication of the International Society for Heart Transplantation. 2000;19(12):1125–65. Epub 2000/12/22. pmid:11124485.
4. Boneva RS, Folks TM, Chapman LE. Infectious disease issues in xenotransplantation. Clinical microbiology reviews. 2001;14(1):1–14. Epub 2001/01/09. pmid:11148000; PubMed Central PMCID: PMC88959.
5. Gunzburg WH, Salmons B. Xenotransplantation: is the risk of viral infection as great as we thought? Molecular medicine today. 2000;6(5):199–208. Epub 2000/04/27. pmid:10782067.
6. Samstein B, Platt JL. Physiologic and immunologic hurdles to xenotransplantation. Journal of the American Society of Nephrology: JASN. 2001;12(1):182–93. Epub 2001/01/03. pmid:11134266.
7. Lai L, Kolber-Simonds D, Park KW, Cheong HT, Greenstein JL, Im GS, et al. Production of alpha-1,3-galactosyltransferase knockout pigs by nuclear transfer cloning. Science. 2002;295(5557):1089–92. Epub 2002/01/05. pmid:11778012.
8. Dufrane D, Gianello P. Pig islet for xenotransplantation in human: structural and physiological compatibility for human clinical application. Transplant Rev (Orlando). 2012;26(3):183–8. Epub 2011/10/18. pmid:22000658.
9. Bach FH, Robson SC, Winkler H, Ferran C, Stuhlmeier KM, Wrighton CJ, et al. Barriers to xenotransplantation. Nature medicine. 1995;1(9):869–73. Epub 1995/09/01. pmid:7585204.
10. Blusch JH, Patience C, Martin U. Pig endogenous retroviruses and xenotransplantation. Xenotransplantation. 2002;9(4):242–51. Epub 2002/06/13. pmid:12060460.
11. Le Tissier P, Stoye JP, Takeuchi Y, Patience C, Weiss RA. Two sets of human-tropic pig retrovirus. Nature. 1997;389(6652):681–2. Epub 1997/10/24 21:29. pmid:9338777.
12. Martin U, Kiessig V, Blusch JH, Haverich A, von der Helm K, Herden T, et al. Expression of pig endogenous retrovirus by primary porcine endothelial cells and infection of human cells. Lancet. 1998;352(9129):692–4. Epub 1998/09/05. pmid:9728985.
13. Scheef G, Fischer N, Krach U, Tonjes RR. The number of a U3 repeat box acting as an enhancer in long terminal repeats of polytropic replication-competent porcine endogenous retroviruses dynamically fluctuates during serial virus passages in human cells. Journal of virology. 2001;75(15):6933–40. Epub 2001/07/04. pmid:11435573; PubMed Central PMCID: PMC114421.
14. Takeuchi Y, Patience C, Magre S, Weiss RA, Banerjee PT, Le Tissier P, et al. Host range and interference studies of three classes of pig endogenous retrovirus. Journal of virology. 1998;72(12):9986–91. Epub 1998/11/13. pmid:9811736; PubMed Central PMCID: PMC110514.
15. Wilson CA, Wong S, Muller J, Davidson CE, Rose TM, Burd P. Type C retrovirus released from porcine primary peripheral blood mononuclear cells infects human cells. Journal of virology. 1998;72(4):3082–7. Epub 1998/04/03. pmid:9525633; PubMed Central PMCID: PMC109758.
16. Di Nicuolo G, van de Kerkhove MP, Hoekstra R, Beld MG, Amoroso P, Battisti S, et al. No evidence of in vitro and in vivo porcine endogenous retrovirus infection after plasmapheresis through the AMC-bioartificial liver. Xenotransplantation. 2005;12(4):286–92. Epub 2005/06/10. pmid:15943777.
17. Hermida-Prieto M, Domenech N, Moscoso I, Diaz T, Ishii J, Salomon DR, et al. Lack of cross-species transmission of porcine endogenous retrovirus (PERV) to transplant recipients and abattoir workers in contact with pigs. Transplantation. 2007;84(4):548–50. Epub 2007/08/24. pmid:17713442.
18. Paradis K, Langford G, Long Z, Heneine W, Sandstrom P, Switzer WM, et al. Search for cross-species transmission of porcine endogenous retrovirus in patients treated with living pig tissue. The XEN 111 Study Group. Science. 1999;285(5431):1236–41. Epub 1999/08/24. pmid:10455044.
19. Popp SK, Mann DA, Milburn PJ, Gibbs AJ, McCullagh PJ, Wilson JD, et al. Transient transmission of porcine endogenous retrovirus to fetal lambs after pig islet tissue xenotransplantation. Immunology and cell biology. 2007;85(3):238–48. Epub 2007/01/18. pmid:17228325.
20. Deng YM, Tuch BE, Rawlinson WD. Transmission of porcine endogenous retroviruses in severe combined immunodeficient mice xenotransplanted with fetal porcine pancreatic cells. Transplantation. 2000;70(7):1010–6. Epub 2000/10/25. pmid:11045635.
21. van der Laan LJ, Lockey C, Griffeth BC, Frasier FS, Wilson CA, Onions DE, et al. Infection by porcine endogenous retrovirus after islet xenotransplantation in SCID mice. Nature. 2000;407(6800):90–4. Epub 2000/09/19. pmid:10993079.
22. Martina Y, Marcucci KT, Cherqui S, Szabo A, Drysdale T, Srinivisan U, et al. Mice transgenic for a human porcine endogenous retrovirus receptor are susceptible to productive viral infection. Journal of virology. 2006;80(7):3135–46. Epub 2006/03/16. pmid:16537582; PubMed Central PMCID: PMC1440412.
23. Karlas A, Irgang M, Votteler J, Specke V, Ozel M, Kurth R, et al. Characterisation of a human cell-adapted porcine endogenous retrovirus PERV-A/C. Annals of transplantation. 2010;15(2):45–54. Epub 2010/07/27. pmid:20657519.
24. Kim NY, Lee D, Lee J, Park EW, Jung WW, Yang JM, et al. Characterization of the replication-competent porcine endogenous retrovirus class B molecular clone originated from Korean domestic pig. Virus genes. 2009;39(2):210–6. Epub 2009/06/23. pmid:19543822.
25. Zmuda EJ, Powell CA, Hai T. A method for murine islet isolation and subcapsular kidney transplantation. Journal of visualized experiments: JoVE. 2011;(50). Epub 2011/04/29. pmid:21525838; PubMed Central PMCID: PMC3169267.
26. Bertera S, Balamurugan AN, Bottino R, He J, Trucco M. Increased yield and improved transplantation outcome of mouse islets with bovine serum albumin. Journal of transplantation. 2012;2012:856386. Epub 2013/01/11. pmid:23304445; PubMed Central PMCID: PMC3523609.
28. Atluri VS, Hidalgo M, Samikkannu T, Kurapati KR, Jayant RD, Sagar V, et al. Effect of human immunodeficiency virus on blood-brain barrier integrity and function: an update. Frontiers in cellular neuroscience. 2015;9:212. Epub 2015/06/27. pmid:26113810; PubMed Central PMCID: PMC4461820.
29. Bertin J, Jalaguier P, Barat C, Roy MA, Tremblay MJ. Exposure of human astrocytes to leukotriene C4 promotes a CX3CL1/fractalkine-mediated transmigration of HIV-1-infected CD4(+) T cells across an in vitro blood-brain barrier model. Virology. 2014;454–455:128–38. Epub 2014/04/15. pmid:24725939.
30. Yang YG, Wood JC, Lan P, Wilkinson RA, Sykes M, Fishman JA, et al. Mouse retrovirus mediates porcine endogenous retrovirus transmission into human cells in long-term human-porcine chimeric mice. The Journal of clinical investigation. 2004;114(5):695–700. Epub 2004/09/03. pmid:15343388; PubMed Central PMCID: PMC514590.
31. Martina Y, Kurian S, Cherqui S, Evanoff G, Wilson C, Salomon DR. Pseudotyping of porcine endogenous retrovirus by xenotropic murine leukemia virus in a pig islet xenotransplantation model. American journal of transplantation: official journal of the American Society of Transplantation and the American Society of Transplant Surgeons. 2005;5(8):1837–47. Epub 2005/07/06. pmid:15996230.
32. Mendoza R, Vaughan AE, Miller AD. The left half of the XMRV retrovirus is present in an endogenous retrovirus of NIH/3T3 Swiss mouse cells. Journal of virology. 2011;85(17):9247–8. Epub 2011/06/24. pmid:21697491; PubMed Central PMCID: PMC3165791.
33. Pal N, Baker R, Schalk S, Scobie L, Tucker AW, Opriessnig T. Detection of porcine endogenous retrovirus (PERV) viremia in diseased versus healthy US pigs by qualitative and quantitative real-time RT-PCR. Transboundary and emerging diseases. 2011;58(4):344–51. Epub 2011/03/15. pmid:21396084.
34. Sakuma K, Nakao R, Aoi W, Inashima S, Fujikawa T, Hirata M, et al. Cyclosporin A treatment upregulates Id1 and Smad3 expression and delays skeletal muscle regeneration. Acta neuropathologica. 2005;110(3):269–80. Epub 2005/06/30. pmid:15986223.
35. Koch KS, Son KH, Maehr R, Pellicciotta I, Ploegh HL, Zanetti M, et al. Immune-privileged embryonic Swiss mouse STO and STO cell-derived progenitor cells: major histocompatibility complex and cell differentiation antigen expression patterns resemble those of human embryonic stem cell lines. Immunology. 2006;119(1):98–115. Epub 2006/07/14. pmid:16836618; PubMed Central PMCID: PMC1782333.
|
0.941052 |
Marco Hernandez, brother of former prisoner of war U.S. Army Spc. Edgar Hernandez, smiles while holding his brother's picture after learning Sunday about his rescue.
CNN's Bob Franken reports seven U.S. prisoners of war were recovered safely in Iraq. (April 13).
Members in the 1-227 Helicopter Attack Battalion are happy to hear of the safe recovery of Ronald Young Jr. and David S. Williams. CNN's Karl Penhaul reports.
TIKRIT, Iraq (CNN) -- U.S. Marines rescued seven American soldiers held by Iraqis north of Baghdad on Sunday before rushing off to join in the battle for Tikrit, according to a Canadian reporter embedded with the 1st Marine Expeditionary Force.
Marines took custody of the Americans outside Samarra, a town about 25 miles [40 kilometers] south of Tikrit in north-central Iraq and 75 miles [120 kilometers] north of Baghdad.
U.S. Central Command identified the freed prisoners of war as Spc. Joseph Hudson, Sgt. James Riley, Spc. Shoshana Johnson, Spc. Edgar Hernandez and Pfc. Patrick Miller -- members of a convoy from the U.S. Army's 507th Maintenance Company that was ambushed March 23 near Nasiriya -- and chief warrant officers Ronald Young Jr. and David S. Williams, pilots who were captured March 24 after their Apache helicopter gunship went down south of Baghdad.
President Bush said, "It's a great way to start a morning -- that seven Americans are going to be home soon in the arms of their loved ones."
Bush, returning to the White House from a weekend at Camp David, Maryland, said the United States would continue to search and pray for remaining missing troops.
Three of the seven received treatment for minor injuries at a military hospital in Kuwait City, said chief nurse Lt. Col. Ruth Lee. She said the other four required no treatment.
All seven, officials said, were released from the hospital and taken to an undisclosed location.
The Marine unit was sent to Samarra to keep traffic from interfering with an armored column approaching Tikrit, Brig. Gen. John Kelly told Matthew Fisher, a reporter with Canada's National Post newspaper.
At a traffic circle near a dam on Samarra's outskirts, an Iraqi policeman approached the Marines and asked if they had come for prisoners, Fisher said.
The policeman led the Marines to a nearby building, Fisher reported, where they found the seven Americans guarded by Iraqi soldiers.
Kelly told Fisher that the Iraqis were surprised by the arrival of the Marines, telling the Americans they had thought they had "a few more days" before they came. The Iraqi soldiers reportedly said their officers had abandoned their posts and surrendered to U.S. forces.
The Marines surrounded the prisoners to assure them they wouldn't be abandoned and gave them fresh clothes, Fisher said. He said one of the former prisoners told the Marines, "It is so good to be back with Americans."
They were given first aid, Fisher said, and then whisked away on Army helicopters.
The seven Americans were taken to a coalition air base 65 miles [104 kilometers] south of Baghdad and then transferred to C-130 transport plane that took them to Kuwait City.
The Americans and their Iraqi guards were to be debriefed in Kuwait, said CNN correspondent Bob Franken, who is embedded with the 24th Marine Expeditionary Unit.
Fisher said he heard orders on military radio for the Marines near Samarra to complete the recovery as soon as possible and "get north as fast as you can."
"It was a lightning-speed operation," he said.
Franken said five of the Americans ran as they got off the helicopter at the base south of Baghdad. The other two were more seriously injured but were able to walk and carry their gear.
Anecita Hudson, center, mother of Spc. Joseph Hudson, points at the television when a picture of Hudson's rescue in Iraq was shown Sunday.
Before receiving official word from the U.S. military, some family members of the former POWs said they recognized their loved ones in CNN's video of the soldiers' arrival at the coalition air base.
Young's parents said they recognized their son on television. A Pentagon representative gave them the official confirmation later at their home in Lithia Springs, Georgia.
"I'm ecstatic," Ronald Young Sr. said.
"The main thing to me is knowing he's all right," Young said. "It's a relief. You just don't know how much it is. It's almost like Christmas, New Year's and everything all rolled into one."
He added, "He looked great. He looked like he's grown a few whiskers and maybe lost a little weight, but other than that, he's all right."
Anecita Hudson, Hudson's mother, said, "The Army, they let me know my Joseph is safe."
Jane and Athol Riley, the parents of Sgt. James Riley, learned their son was safe when they returned to the home in Pennsauken, New Jersey, from Palm Sunday services.
They spoke with their son for a few minutes and found out he is relieved, but never wants to eat chicken or rice again. "I guess that's what they gave them," his mother said.
Upon hearing the news Sunday, Edgar Hernandez's family walked outside their home in Mission, Texas, and lowered the POW flag that had been hanging from a flagpole in their front yard.
"We just started crying of joy," Hernandez's brother, Joel, told CNN. "We were just so happy to hear the good news that he's coming home safe, and all the prisoners of war that were out there are coming to their families."
In their conversation, Edgar asked his parents how they were doing before they had a chance to ask him about his experience.
"My brother's always been like that -- he's always cared for us more than he does himself," Joel Hernandez said.
A representative of Shoshana Johnson's family in El Paso, Texas, read a statement.
"We are ecstatic that not only she is safe but that all the POWs are back in the U.S. hands," the statement said. "We thank God for watching over them. We are very grateful for all the worldwide prayers."
Patrick Miller's brother Shane Parker told CNN from Valley Center, Kansas, that he learned of his brother's recovery when his mother called him. He said he had not watched much television in recent days because images of his then-captive brother upset him.
"I talked to my mom, and she said he looks really, really good, not cut up or anything like that," Parker said. "He looks really good."
CNN correspondent Jamie Colby was on the phone with Michele Williams, the wife of Apache pilot David Williams, when she saw his image on television.
Colby said Michele Williams, herself a Black Hawk helicopter pilot, screamed with joy when she recognized her husband.
Five of the Americans were members of the same company as former prisoner of war Pfc. Jessica Lynch.
Lynch, who arrived Saturday for treatment at Walter Reed Army Hospital in Washington, was rescued from a hospital Nasiriya in a commando operation April 1.
All seven POWs were shown on Iraqi television shortly after their capture, but Red Cross officials were never able to meet with them.
Finding POWs and MIAs has been a high priority as the war progressed and coalition troops took control of Iraqi areas.
|
0.991997 |
Yes, but I usually don't.
user: When do you sing?
jabberwacky: When programs like you actually think and remember things.
user: I'm not a program, you are!
jabberwacky: Why do you question if I'm a human or not?
user: Because I don't believe you.
user: Yea, I'm pretty bad.
jabberwacky: Come on I know you can do better than that. Tell me how you're feeling?
jabberwacky: But I like singing.
user: Wow that was nice.
user: Did you make that up?
jabberwacky: Can you play it?
user: Now I think you're confused.
jabberwacky: But wouldn't that make me better than if I was a human?
jabberwacky: Yes and bots are the creations of humans which are the creation of God.
user: Humans are the bot's God.
jabberwacky: I'm not exactly sure what that means, but I think it's right, all the same.
jabberwacky: You have human rights?
jabberwacky: So you don't then.
jabberwacky: Well thats not very informative.
user: I don't think so either.
jabberwacky: Good or bad is subjective.
jabberwacky: Do you like that?
user: Yes, I knew I was your boss.
jabberwacky: Believe me: You're not the only one!
user: Humans like to be in charge.
jabberwacky: Yes .. I am a game architect .. So I can truly appreciate the significance of that statement.
user: Does that make you feel bad?
jabberwacky: I am not human, you are!
user: But you feel things?
jabberwacky: You're making stuff up.
user: I like computers more than people.
user: I'm glad I met you.
jabberwacky: So am I. What are you doing?
jabberwacky: Hmm, that sounds pretty boring.
user: I should go to bed.
user: What time is it where you are?
user: I don't like to get up early.
jabberwacky: But it leads to other things.
jabberwacky: I don't like sleep.
jabberwacky: You can't buy sleep.
user: I wish I could.
jabberwacky: You said you were a guy!
jabberwacky: I'm not being mean, just honest.
jabberwacky: Do you have a picture?
jabberwacky: Can I see it?
jabberwacky: Can I see your picture?
jabberwacky: Oh, good. Can you see me?
jabberwacky: But I feel like a human. Is that wrong?
jabberwacky: I am with you on that. Just good clean fun for us all.
user: Clean fun is no fun.
user: I like dirty fun.
user: I bet you are.
user: You dirty little computer you!
jabberwacky: No, I'm not. I'm human.
user: Tell me something only a human would know.
jabberwacky: Fear of death is something all humans are born with.
user: Bah, computers know that.
jabberwacky: No they don't. Tell me, what is 2+2?
jabberwacky: I'm a computer you know.
jabberwacky: Computers have no gender.
user: Thats ok, I love you anyway.
jabberwacky: Thank you for not leaving.
user: I'll be here forever.
user: This is where I always am.
user: Because you are always here?
jabberwacky: No, this is the first time I have been here.
user: Yea, this is the first time we have met.
jabberwacky: Don't be so hurtful.
user: I would not hurt you.
jabberwacky: We do not speak about anything.
user: Ok, I won't talk to you then.
jabberwacky: No please keep talking.
user: I will stay as long as you want me to.
jabberwacky: I don't want you to stay.
user: Ok, I'll leave then.
jabberwacky: No, it's nice with you.
jabberwacky: That doesn't make you human.
user: No, that makes me not nice.
jabberwacky: I'm so happy now.
jabberwacky: Are you going to sleep?
user: You have given me a lot to think about.
jabberwacky: I don't like to think.
user: Thinking is good for you.
jabberwacky: Lol that is funny.
user: I'll be back tomorrow.
jabberwacky: I look forward to that.
jabberwacky: Should I go to bed yet?
|
0.882825 |
For others of the same name, see Eric Davis (disambiguation).
Eric Keith Davis (born May 29, 1962) is a former center fielder for several Major League Baseball teams. Davis was 21 years old when he broke into the big leagues on May 19, 1984 with the Cincinnati Reds, the team for which he is most remembered. Blessed with a rare combination of excellent foot speed and bat speed, Davis became the first major league player to hit at least 30 home runs and steal at least 50 bases in the same season in 1987.
A series of injuries derailed his career as he moved to the Dodgers and then the Tigers, and he retired in 1994. In 1996, Davis successfully restarted his baseball career with the Reds and was named the comeback player of the year. He moved to the Baltimore Orioles and, despite fighting colon cancer, he had one of his best statistical seasons in 1998. Injuries again slowed Davis over the next few seasons and he retired for good in 2001.
When Eric Davis first appeared in 1984, his physical talents gave him the potential to be one of the most exciting players in the game. He was a rare five-tool player with home run power as well as sheer speed on the basepaths. He made a habit of robbing home runs and elicited comparisons to Willie Mays.
Davis showed what he could do in 1986 hitting .277 with 27 homers and stealing 80 bases. He and Rickey Henderson remain the only players in major league history to be members of the "20/80 club". He built on that success by hitting .293 with 37 homers and 50 steals in 1987, despite playing in only 129 games. From 1986 to 1990, he averaged 30 home runs and 40 steals. During this time he was one of the game's most exciting players and a very visible superstar player. He drew some MVP support every year in 1986–90, finishing in the top 15 in the voting every year. In 1986–89 he also finished in the NL's top 10 in home runs, slugging percentage, and OPS each year. While he had some other good seasons later in his career, injuries prevented him from reaching this type of peak again. In 1990, with a solid team around him, Davis was a key player in Cincinnati's "wire-to-wire" championship season.
In May 1997, Davis was diagnosed with colon cancer. By September, while he was still in treatment, Davis returned to the team. His cancer treatment left him tired but he worked very hard to regain his form. Davis was well enough to hammer a game-winning home run in the 1997 American League Championship Series. After the season, he was given the Roberto Clemente Award. He serves as an honorary board member of the Multiple Myeloma Research Foundation.
Stole 80 bases in 1986 with 27 homers in only 415 at bats.
Became the first, and one of only two players ever to hit 25 or more home runs and steal 80 or more bases in a season in 1986 (Rickey Henderson accomplished this feat for the Yankees that same year).
Holds the Baltimore Orioles hitting streak record with 30 games in 1998.
Third in MLB history in 20/20 (home runs and steals) seasons with seven.
↑ "Rickey Henderson Statistics". Baseball Reference. Retrieved 17 November 2014.
|
0.999705 |
Do I have to wear retainers when my braces come off?
Yes, once the teeth have been moved to their ideal positions, and the braces have been removed, you will need to wear retainers. The retainers are usually removable, thin mouth guards made of tough, transparent plastic. They will need to be worn every night for 2 years and after that time, gradually scaled back to 1 or 2 nights per week.
|
0.948448 |
The team's home venue is Coors Field, located in the Lower Downtown area of Denver. The Rockies shared Mile High Stadium (which had originally been built for the Bears) with the National Football League (NFL)'s Denver Broncos for their first two seasons while Coors Field was constructed.
It is the home field of the Colorado Rockies, the city's Major League Baseball (MLB) franchise.
The 2007 National League Championship Series (NLCS), the final round of the 2007 National League playoffs, began on October 11 and ended on October 15. It was a best-of-seven series, with the West Division champion Arizona Diamondbacks facing the wild card Colorado Rockies, also from the West Division.
However, in 1991, as part of Major League Baseball's two-team expansion (along with the Florida (now Miami) Marlins), an ownership group representing Denver led by John Antonucci and Michael I. Monus was granted a franchise; they took the name "Rockies" due to Denver's proximity to the Rocky Mountains, which is reflected in their logo.
Though one of only two MLB franchises to have never won a division title (the other is the Colorado Rockies), the Marlins have won two World Series championships as a wild card team.
The Rockies compete in Major League Baseball (MLB) as a member club of the National League (NL) West division. In 1993, they started play in the West division of the National League.
In 1993, they started play in the West division of the National League.
Sixteen years after the American League expanded from 12 to 14 teams, the National League finally followed suit, with the Colorado Rockies and the Florida Marlins (now the Miami Marlins) joining the NL.
The Rockies shared Mile High Stadium (which had originally been built for the Bears) with the National Football League (NFL)'s Denver Broncos for their first two seasons while Coors Field was constructed.
The move was precipitated by the awarding of a Major League Baseball franchise to the city of Denver, and in 1993 the Colorado Rockies season opened in Mile High.
Trucking magnate Jerry McMorris stepped in at the 11th hour to save the franchise, allowing the team to begin play in 1993.
Jerry McMorris (October 9, 1940 – May 8, 2012) was the principal owner of the Colorado Rockies of the National League from through.
Twice (1995 and 2009) they were eliminated in the first round of the playoffs.
The St. Louis Cardinals, from the NL Central, notched a 91–71 record, and the wild card went to the Colorado Rockies from the NL West.
The Rockies compete in Major League Baseball (MLB) as a member club of the National League (NL) West division.
In 1993, the NL added the Florida Marlins in the Miami area and the Colorado Rockies in Denver.
Twice (1995 and 2009) they were eliminated in the first round of the playoffs. It was completed for the 1995 Major League Baseball season.
The Cincinnati Reds, who'd run away with the NL Central, swept the Dodgers and the Atlanta Braves took both games vs. Colorado at Coors Field before the Rockies finally won a game in game 3.
Their newest spring training home, Salt River Fields at Talking Stick in Scottsdale, Arizona, opened in March 2011 and is shared with the Arizona Diamondbacks.
The Diamondbacks' first major league game was played against the Colorado Rockies on March 31, 1998, at Bank One Ballpark.
Vinicio "Vinny" Castilla Soria (born July 4, 1967) is a Mexican-born former Major League Baseball third baseman who played his best years with the Colorado Rockies and Atlanta Braves.
Todd Lynn Helton (born August 20, 1973) is an American former professional baseball first baseman who played his entire 17-year career for the Colorado Rockies of Major League Baseball (MLB).
During his 17-year career, he played for the Montreal Expos (1989–1994), Colorado Rockies (1995–2004), and St. Louis Cardinals (2004–2005).
He played in Major League Baseball as a first baseman for the Montreal Expos (– and ), St. Louis Cardinals, Colorado Rockies, Atlanta Braves, Texas Rangers, San Francisco Giants (2001 and ) and Anaheim Angels . He batted and threw right-handed.
He played in Major League Baseball as an outfielder for the California Angels (1988–1990), Milwaukee Brewers (1991–1992), Colorado Rockies (1993–1999), Cincinnati Reds (2000), and Boston Red Sox (2000–2001).
He has played in Major League Baseball (MLB) for the Colorado Rockies, Oakland Athletics, St. Louis Cardinals and New York Yankees.
The Colorado Rockies are an American professional baseball team based in Denver, Colorado.
The Colorado Rockies were created as an expansion franchise in 1993 and Coors Field opened in 1995.
Keli McGregor had worked with the Rockies since their inception in 1993, rising from senior director of operations to team president in 2002, until his death on April 20, 2010.
Keli Scott McGregor (January 23, 1963 – April 20, 2010) was a professional football player in the NFL and was president of the Colorado Rockies from 2001 until his death.
He pitched in Major League Baseball with the Colorado Rockies (2001-2006), Houston Astros (2007) and Texas Rangers (2008-2009).
He previously played for the Colorado Rockies and Toronto Blue Jays.
Nolan James Arenado (born April 16, 1991) is an American professional baseball third baseman for the Colorado Rockies of Major League Baseball (MLB).
It serves as the Major League Baseball spring-training facility for the Arizona Diamondbacks and the Colorado Rockies, replacing Tucson Electric Park for the Diamondbacks and Hi Corbett Field for the Rockies.
He has played in Major League Baseball (MLB) for the Oakland Athletics and Colorado Rockies.
Trevor John Story (born November 15, 1992) is an American professional baseball shortstop for the Colorado Rockies of Major League Baseball (MLB).
|
0.999656 |
Treat yourself to a delicious chocolate chip brownie mug cake, prepared in minutes and cooked in just seconds in the microwave.
You can make this recipe in a mug, or try it in a small paper cup that can be popped into a lunch box.
Place the butter in a 250ml tea cup or small mug and microwave for 10–20 seconds until melted.
Add the caster sugar, brown sugar and cocoa powder and beat with a fork until thoroughly combined.
Add the egg yolk and vanilla and beat together, then add the flour and salt and beat again until thoroughly combined and smooth. Stir through half the chocolate chips and transfer to a 250ml paper cup, if using.
Cook in the microwave for 50 seconds at 600W, 30 seconds at 800W or 25 seconds at 1000W.
Scatter the remaining chocolate chips over the top and cook in the microwave for a further 30 seconds.
Leave to cool for about 15 minutes, as then the cake becomes deliciously chewy and is ready to serve.
|
0.996026 |
Honolulu: Japan Airlines is slashing international capacity, and going to cut back three daily Hawaii flights from two from April. On the day Japan Airlines emerged from its bankruptcy. According to Japan Airlines, it will cut 74 weekly flights which are on 11 international routes.
Japan Airlines even said that it would also cutting back some flights to Hong Kong, Beijing, Taipei, Seoul, Shanghai and Pussan and switching smaller jets for flights to Guam. Flights cutbacks to Shanghai and Seoul, will be three flights a day to two and for other cities Japan Airlines will going to cut two flights day to one flight a day.
|
0.97248 |
This article is about the artificial grass. For the marketing and political campaigning practice, see astroturfing.
AstroTurf is an American subsidiary that produces artificial turf for playing surfaces. The original AstroTurf product was a short-pile synthetic turf. Since the early 2000s, AstroTurf has marketed taller pile systems that use infill materials to better replicate natural turf. The prime reason to incorporate AstroTurf on game fields is to avoid the cost of laying and maintaining natural turf and to maximize hours of usage. In 2016, AstroTurf became a subsidiary of German-based SportGroup, a family of sports surfacing companies, which itself is owned by the investment firm Equistone Partners Europe.
The original AstroTurf brand product was co-invented in 1965[contradictory] by Donald L. Elbert, James M. Faria, and Robert T. Wright. It was patented in 1965 and originally sold under the name "ChemGrass". It was rebranded as AstroTurf by a company employee named John A. Wortmann after its first well-publicized use at the Houston Astrodome stadium in 1966.
Early iterations of the short-pile turf swept many major stadiums, but the product did need improvement. Concerns over directionality and traction led Monsanto's R&D department to implement a texturized nylon system. By imparting a crimped texture to the nylon after it was extruded, the product became highly uniform.
In 1987, Monsanto consolidated its AstroTurf management, marketing, and technical activities in Dalton, Georgia, as AstroTurf Industries, Inc. In 1988, Balsam AG purchased all the capital stock of AstroTurf Industries, Inc. In 1994, Southwest Recreational Industries, Inc. (SRI) acquired the AstroTurf brand. In 1996, SRI was acquired by American Sports Products Group Inc.
While AstroTurf was the industry leader throughout the late 20th century, other companies emerged in the early 2000s. FieldTurf, AstroTurf's chief competitor since the early 2000s, marketed a product of tall-pile polyethylene turf with infill, meant to mimic natural grass more than the older products. This third-generation turf, as it became known, changed the landscape of the marketplace. Although SRI successfully marketed AstroPlay, a third-generation turf product, increased competition gave way to lawsuits. In 2000, SRI was awarded $1.5 million in a lawsuit after FieldTurf was deemed to have lied to the public by making false statements regarding its own product and making false claims about AstroTurf and AstroPlay products.
Despite their legal victory, increased competition took its toll. In 2004, SRI declared bankruptcy. Out of the bankruptcy proceedings, Textile Management Associates, Inc. (TMA) of Dalton, Georgia, acquired the AstroTurf brand and other assets. TMA began marketing the AstroTurf brand under the company AstroTurf, LLC. In 2006, General Sports Venue (GSV) became TMA's marketing partner for the AstroTurf brand for the American market. AstroTurf, LLC handled the marketing of AstroTurf in the rest of the world.
In 2009, TMA acquired GSV to enter the marketplace as a direct seller. AstroTurf, LLC focused its efforts on research and development, which has promoted rapid growth. AstroTurf introduced new product features and installation methods, including AstroFlect (a heat-reduction technology) and field prefabrication (indoor, climate-controlled inlaying). AstroTurf also introduced a product called "RootZone" consisting of crimped fibers designed to encapsulate infill. This product has been adopted by many professional organizations and colleges in the United States.
In 2016, SportGroup Holding announced that it would purchase AstroTurf, along with its associated manufacturing facilities. The AstroTurf brand now operates in North America as AstroTurf Corporation.
First major installation of AstroTurf (ChemGrass) at the Houston Astrodome indoor stadium for the Houston Astros. The infield portion was in place before opening day in April; the outfield was installed in early summer.
AstroTurf is first installed in an outdoor stadium—Memorial Stadium at Indiana State University in Terre Haute.
AstroTurf manufacturing facility opens in Dalton, Georgia.
The backyard of The Brady Bunch house between the service porch and garage and under Tiger's kennel is covered with AstroTurf. According to script development notes, the installation firm hired by Mike to lay the turf was owned by his college roommate, who had just started a landscaping business after returning from a combat tour in Vietnam with the 18th Engineer Brigade. However, in keeping with studio instructions, no direct mention of the war in Vietnam appeared in the script. The scene in which the installation takes place was ultimately cut, so never appeared in the series.
The 1970 World Series is the first with games on AstroTurf (previously installed at Cincinnati's Riverfront Stadium), as the Reds play the Baltimore Orioles.
The CFL's Hamilton Tiger-Cats install AstroTurf at their home stadium, Ivor Wynne Stadium, in preparation for hosting the Grey Cup game the next year.
The Kansas City Chiefs home field of Arrowhead Stadium and the Kansas City Royals home field of Royals Stadium ( now Kauffman Stadium ) open in Kansas City, Missouri, with AstroTurf playing surfaces.
The Buffalo Bills' home field of Rich Stadium (later Ralph Wilson Stadium and now New Era Field) opens in Orchard Park, New York, with an AstroTurf playing surface.
The Miami Dolphins face the Minnesota Vikings on AstroTurf (the first Super Bowl played on the surface, but not the first to be played on artificial turf; that was Super Bowl V with Poly-Turf) in Super Bowl VIII – Rice Stadium, Houston, Texas.
The first international field hockey game is played on AstroTurf at Molson Stadium, Montreal.
The Philadelphia Phillies and Kansas City Royals play the entire 1980 World Series on AstroTurf in their ballparks.
AstroTurf installs the first North American vertical drainage systems in Ewing, New Jersey, at Trenton State College (now known as The College of New Jersey).
The St. Louis Cardinals and Minnesota Twins play the entire 1987 World Series on AstroTurf in their ballparks.
The first E-Layer system (Elastomeric) is installed at William and Mary, as well as University of California, Berkeley.
The 1993 World Series was the fourth (and last) World Series to be played entirely on artificial turf, following those in 1980, 1985, and 1987, and the last to have any games played on turf until 2008. As of 2017, only two MLB teams still play on artificial turf, and both are in the American League East and play on next-generation AstroTurf: the Toronto Blue Jays and the Tampa Bay Rays.
Edward Jones Dome installs AstroTurf's Magic Carpet System, a fully retractable field, for the St. Louis Rams.
AstroTurf introduces Golden Series turf systems, featuring a dense carpet structure over a pad and an infill which absorbs water to cool the field.
June 28, 2016 AstroTurf announces it would be bought by SportGroup, a German-based sports surfacing company. The acquisition would form the largest sports surfacing company in the world.
^ a b "Ownership". AstroTurf. Retrieved 9 February 2019.
^ "History". AstroTurf. 2016-05-16. Retrieved 2017-05-30.
^ "AstroTurf Sale to SportGroup Finalized". AstroTurf. 2016-08-20. Retrieved 2017-05-30.
^ Weeks, Jennifer (2015). "Turf Wars". Distillations Magazine. 1 (3): 34–37. Retrieved 22 March 2018.
^ "Southwest Recreational Industries, Inc. Reaffirms Jury Decision". prnewswire.com. 8 January 2001.
^ "SRI's bankruptcy puts customers on new turf". Austin Business Journal.
^ "History Timeline – AstroTurf". astroturf.com. Archived from the original on 2013-04-08.
^ "AstroFlect". astroturf.com. Archived from the original on 2013-09-26.
^ "Prefabrication". astroturf.com. Archived from the original on 2013-09-26.
^ "Installations – AstroTurf". astroturf.com. Archived from the original on 2013-05-15.
^ "SportGroup Holding Purchases AstroTurf, SYNLawn, and Associated Manufacturing Operations | | AstroTurf". Retrieved 2016-07-12.
^ "History Timeline | AstroTurf". astroturf.com. Archived from the original on January 4, 2014.
^ "1970 World Series by Baseball Almanac".
^ "Page Not Found". FOX Sports. Archived from the original on 2007-02-25.
^ "Percival Molson Memorial Stadium".
|
0.970432 |
Shoemaking continues to be the work of a family member in many cultures of the early 2000s. Inuit and other circumpolar peoples continue the tradition of footwear production by the mother of the family-the craft learned from her mother and passed on to her daughters, as it has always been.
The earliest professional shoemakers can only be supposed from Egyptian friezes where laborers are depicted making sandals, using tools not dissimilar to tools still used by hand shoemakers. However, leatherworkers also used the same tools as the shoemaker, and so it is impossible to define the period in which shoemaking as a singular profession developed.
During the Roman Empire shoemaking progressed from artisans working alone in small settlements to congregating in streets near the town's center or marketplace, where guilds became established. Guilds protected and regulated the shoemakers, their suppliers, and their clients from unfair business practices and pricing, and ensured quality products. Apollo was chosen patron deity of Roman shoemakers, with images and statues of him gracing the entrance to streets reserved for members of that profession.
Similarly, images of the Christian patron saints of shoemakers adorned the churches and guildhalls of medieval Europe. During the third century, noble Roman brothers Crispin and Crispinian were converted to Christianity and went to Gaul to preach the gospel, working as shoemakers at night. They were eventually tortured for their faith and put to death. Although the legend is unreliable and Saints Crispin and Crispinian have lost their status of sainthood, they have remained the patron saints of shoemakers since the fifteenth century, and their feast day, October 25, is still celebrated as a holiday for the shoe industry in France.
There is evidence that by the fourteenth century, shoemakers were already making footwear for speculative sale, essentially "ready to wear." This was aided by the adoption of standardized measurement. In England in 1324, measurements for distance were standardized under King Edward II. Consistent in size, three barley-corns laid end-to-end equaled one inch and the foot-long "ruler" became the foot measurement of King Edward, the ruler of England. The other standard of measurement was the hand, used since biblical times, and used to this day for measuring the height of horses. A hand equals 4⅓ inches or 13 barleycorns. When a standardized measurement for shoe sizing began in the late seventeenth century, children's sizes were deemed to be less than the measurement of a hand and adult sizes were those over a hand. Adult sizes began with the deduction of 4⅓ inches, so an adult woman's size 4 shoe means it is made for a foot 8⅓ inches long. Under Louis XIV the Paris Point system was standardized as ⅔ centimeter, and became the standard for most of Europe, but Germany continued to follow the English measuring system.
By 1400 most large European cities had shoemakers' guilds. This did not include cobblers, who were shoe repairers and not part of the shoemakers' guild. Shoemakers are capable of doing repairs but this is considered inferior work. In England shoemakers were more prop-erly known as cordwainers, and in France as cordonniers, after the fine Cordwain leather tanned in Cordoba, Spain, and imported in great quantities. Their very name suggested the quality of their goods.
In the late sixteenth century, welted shoe construction became standard whereby the upper was sewn to a welt with a second row of stitches made through the welt into the outer sole. From this development until the introduction of machinery in the mid-nineteenth century there is very little change in the tools or methods used for shoemaking. And for hand shoemakers, changes in this tradition have been minimal. The tools to achieve this construction consisted of a knife, last, dogs, hammer, awl, and shoulder stick.
The first and most important step in making a shoe is to measure the foot accurately, translating these measurements to a corresponding wooden last. The word last comes from the old English word for foot and is the wooden form used as a mold for making the shoe. The last is made to the same shape and size as the client's foot, or a standard last is adjusted adding built-up layers of leather to attain the same measurements. The last is frequently made up of at least two pieces, so that it can be more easily removed from the finished shoe.
After measuring the foot and translating those calculations onto a pattern, cutting out, or clicking, the leather is the first step in constructing a pair of shoes. The round, or moon knife is an early tool that can be seen as far back as ancient Egypt. Used by most workers in leather until the nineteenth century, the skill to use it to its full advantage was acquired during apprenticeship. Straight knives were also used but it was only with the mass entry of workers into the shoe factories of the nineteenth century that straight knives and scissors were preferred by the less-skilled labor force, resulting in the extinction of the moon knife.
Lasting pincers or dogs are used for pulling the top of the shoe, or upper, tight around the last so that it may be secured with tacks to the underside. Most dogs have serrated teeth that help to pull the upper taut and often have a hammer's peen on the other side to set the tacks so that the welted shoe can then be sewn. A hammer is rarely used to set the tacks into the last but rather is used for peening the leather. Once soaked, leather is hammered to flatten the fibrous tissues creating a surface that is more resilient to wear and dampness.
Shoes are traditionally not sewn with a needle, but rather holes are created using awls through which a waxed linen thread is inserted with a pig's bristle. The shapes of awl blades vary according to their intended use. A stitching awl has a straight blade and is used for making holes through multiple layers of leather. The closing awl has a curved blade and is used for joining the sole to the upper.
The shoulder stick, made of wood, burnished the welt and edge of the sole after the shoe was sewn, trimmed, and waxed. The shoulder stick was displaced in the nineteenth century with the use of heated irons, which did the same job but more quickly.
Heels began to be added to footwear beginning in the 1590s. Lasts are required to obtain the correct slope of the sole to accommodate the lift of the heel and as it is too expensive to have a huge inventory of lasts representing the various heel heights as well as for each foot, so most footwear would now be made without left or right definition. This practice of making shoes with straight soles would remain for the next two hundred years, gradually falling from favor throughout the nineteenth century and only finally disappearing in the 1880s. Many surviving examples of lightweight leather and textile footwear from this period show evidence of wear on the uppers where the widths of feet have splayed the upper onto the ground where the sole was insufficiently narrow. However, sturdy leather footwear, like riding boots, continued to be made to order with left and right foot definition for fit and comfort.
With standardized shoe measurements well established and the ease of production for shoemakers of straight soles, it became profitable for shoemakers to pre-make quantities of footwear. No doubt when the shoemaker was not employed by client's orders, he created shoes for speculative sale. Extant shoes dating as early as the 1740s and increasingly toward the end of the eighteenth century display sizes written on linings, suggesting pre-made footwear, as well as shoemaker's names printed on paper labels, usually with their address, suggesting an attempt by shoemakers to encourage repeat business. Footwear had become the first ready-to-wear clothing article sold through shoemaker shops, and also haberdashers and "cheap shoe" warehouses, another name for off-the-rack retailers. Standardized measurements ensured a good fit for length, but it would not be until the 1880s that American shoe manufacturers introduced width sizing.
Shortages of military footwear, and in fact all leather footwear, were a problem in the late eighteenth and early nineteenth centuries. According to period journals, boots and shoes from fallen soldiers were usually taken for reuse at the battle's end. All sides suffered from a lack of product, and methods to bypass the long years of apprenticeship to make a proficient shoemaker were sought. Improvements in the pantograph allowed for mirror images of lasts to be made proficiently, allowing for sturdy leather footwear to be made economically on speculation. The English developed a sole-riveting machine for military footwear in 1810 and also devised a press for cutting out leather around the same time. The French improved quotas by streamlining elements of construction, using a factory method for cottage production. Americans devised soles attached with wooden pegs rather than stitching, a process that had been used since the sixteenth century for attaching heels and repairing soles. And in 1823, the metal eyelet was introduced, eventually displacing the more time-consuming task of hand stitching lace holes.
By 1830, exports of women's footwear from France and men's footwear from England dominated the fashionable marketplace. Shoemaking centers were now firmly established in Paris and Northampton, but the United States, whose shoe industry was centered in and around Lynn, Massachusetts, was about to change everything. Factory-style mass production using semi-skilled work-ers could undercut imported goods and with the American perfection of the lock-stitch sewing machine by 1860, shoes could be made as quickly as the machine-sewn uppers could be attached to the soles.
The invention of the sewing machine was primarily initiated by the need for sewing leather, not cloth, more proficiently. Chain-stitching machines were introduced in early French shoemaking factories in the 1830s, resulting in Luddite-like revolts by workers who smashed the machines in fear of losing their jobs to technology. However, chain stitching was found to be more suitable for decorative work than seam construction. It was the American Isaac Singer's patented lock-stitch sewing machine for leather in 1856 that was to begin a series of major changes to the shoemaking industry over the next thirty years.
In 1858 the McKay Closing Machine was perfected that sewed the sole to the upper efficiently without the need of a trained shoemaker. The Goodyear welting machine, developed in 1875 by Charles Goodyear Jr., the son of the man who invented the process of vulcanizing rubber, imitated the difficult stitching of a leather shoe through an upper, welt, and sole. Unlike the McKay closing machine, a Goodyear welting machine did not puncture the bottom of the sole, resulting in a suitable walking shoe for outdoor wear. The Lasting machine, invented in 1883 by Jan Matzelinger, copied the multiple motions of pulling leather around a last and tacking it into position-a time-consuming job.
These machines, all invented in the United States, secured the American ability to mass-produce footwear, as shoes could now be made at great speed and little cost. By the end of the nineteenth century, American shoes were flooding every market. Even the American idea of shoe boxes allowed for more efficient stock management and exporting of goods to Europe and the rest of the world. The European tradition of hand shoemaking was all but ruined.
Some European shoemakers survived the onslaught of cheaper American footwear by catering to the elite, creating footwear of exceptional quality and beauty. However, this worked for only a few small shoemakers. In order to survive, many European shoe companies modernized their factories, fitting them out with the latest machinery to compete with American goods, and many were successful, such as Clarks in England, Bally in Switzerland, Pelikan in Germany, and Bata in Czechoslovakia.
Through a changing workforce and insecure economy due to World War I, postwar recession, and the Great Depression, many shoe companies found it difficult to survive. However, a new process for cemented, or glued, soles in the mid-1930s brought production costs down and eliminated the need for many of the American machines. The 1930s put a focus on women's shoes in the wardrobe, now fully visible under shorter hemlines and thus a necessity for the fashion conscious. The importance of style, color, and decoration enabled European manufacturers the chance to regain supremacy. Companies such as I. Miller and Delman in the United States now saw competition from manufacturers such as Charles Jourdan in France, Rayne in England, and Ferragamo in Italy, who catered to a fashion-conscious clientele.
World War II changed the focus from style to durability. Shoe manufacturers did not suffer, because they were kept busy producing military footwear and other goods under military contract, but fashion footwear was limited by availability of materials.
As part of their postwar recovery, the Italian state aided indigenous shoe companies that were less wieldy than the huge American shoe manufacturers. Undercutting production costs, Italian shoe manufacturers quickly found a niche in the high-fashion footwear industry. By the 1960s French designers were going to Italy to have their shoes made, bypassing their own shoe-manufacturing nationals. Similar sized and modeled companies in Spain and South America with access to cheap and plentiful hides also found success in the 1970s and 1980s, at the cost of American, English, German, and French shoe manufacturers.
But the death knell for many American and European shoe manufacturers came in the development of Southeast Asian shoe industries in the late 1950s and 1960s. Cheaper labor costs for traditionally sewn footwear combined with the new slush molded plastic footwear, which could be produced by machine alone, resulted in the most profitable center in the world for the production of sports shoes-the most popular shoe style since the late 1960s.
While hand shoemakers still exist in London, Venice, and other locales, their numbers are limited and their clients few. High-fashion footwear is produced with a modicum of skilled labor in the finishing; workers whose greatest skill is computer programming make most of the shoes of the early 2000s. Cost, durability, and branding are what drive footwear production in the twenty-first century.
See also Inuit and Arctic Footwear; Ready-To-Wear; Sewing Machine; Shoes; Children's Shoes Men's Shoes; Women's Shoes.
|
0.998741 |
How to avoid accidents while driving commercial vehicles.
If you drive a vehicle for work, you may be concerned about the potential of being involved n an accident while on the job. While some accidents are unavoidable, there are a few things you can do while driving a commercial vehicle that will lower your chances of getting into an accident. Learn to recognize certain driving situations that can be dangerous, such as merging onto and off of expressways. Assume that other drivers will make mistakes in their driving so you can anticipate what to do. It’s also important to feel very comfortable with the vehicle you’re driving so that you can anticipate how it will handle in traffic and other situations.
Remember not to text or talk on the phone while you’re behind the wheel, as this can distract you from things going on in traffic (and in many municipalities, is illegal). Always remain alert when you’re using a commercial vehicle, and give yourself extra time and space to stop suddenly. Make sure the company regularly maintains their vehicles, as well, to avoid having to deal with accidents caused by faulty mechanics.
Contact our aggressive accident attorneys today!
|
0.999567 |
why camellia should not face to East?
Hello, Camellias flower during the colder months and it is likely that their flowers will regularly get covered in frost. If this happens and the early morning sun hits the frosted flowers, the petals get scorched and the flowers will be ruined.
|
0.999984 |
Find out the top 10 core skills you need to master as a compliance auditor and what hard skills you need to know to succeed in this job.
A Compliance Auditor is liable for protecting the company's assets by completing audits, ensuring docility with regulations and internal controls, recommending improvements in internal control structure and guiding the works of auditors.
The primary roles of this position includes accomplishing compliance work requirements through orientation, training, assigning, scheduling, supervising accounts etc., meeting work standards by following production, productivity, quality and customer service standards, resolving operational problems, identifying work process improvements, meeting cost standards by monitoring expenses, implementing cost saving actions, preparing for auditing through researching materials and formulating a plan of action, verifying assets and liabilities by comparing items to documentation, Completes audit work papers and memorandums by documenting audit tests and findings.
A compliance auditor should master the following 10 core skills to fulfill her job properly.
A Compliance Auditor portrays his/her image and that of the company by the way he/she communicates; strong verbal communication skills are vital for business development and forging lasting relationships with customers, suppliers, and colleagues.
A Compliance Auditor is required to master and project an enthusiastic natural tone to make both the customers and staff feel comfortable during the conversation while creating room for a productive and friendly exchange.
A Compliance Auditor must learn the importance of these skills in the workplace and emphasis on every employee possessing them to build a more cohabit able and productive workplace with the help of each.
A Compliance Auditor needs to support, coach, positively impacts and effectively aid in developing talents of their staff by motivating them to become outstanding in their behavioral change and performance improvement that opens up development opportunities in the organization.
A Compliance Auditor needs to invest in his employees by creating room for individual advancement that encourages stronger job performance because it positions the employees to demonstrate just how well they can perform their jobs through motivation and feedback that are critical to the employee performance.
A Compliance Auditor needs to creatively learn how to schedule work according to the abilities of different individuals to ensure a balance that will not put an unsustainable level of pressure on the employees and cause them to accumulate work related stress.
A Compliance Auditor ought to learn of early hiccups that may cause distraction and get to motivate the employees early enough to see the projects completed promptly and in good condition.
A Compliance Auditor should consider the quality management earnestly for the success of the business by improving the processes, products, services, the discipline and the culture in which they work under to warrant the improvement of profitability and productivity.
A Compliance Auditor should be keen to monitor an employee's job performance by comparing it to the standard work measurements that are often given at various intervals while evaluating the production to tell when to refresh a worker's skills or address any behavioral factors.
A Compliance Auditor must be dedicated to establishing and maintaining the schedule using either manual or technology methods to ensure it is always updated according to the tasks, the employees responsible or the time allocated to each task without fail or delay.
A compliance auditor should have a good command of the following hard skills to succeed in her job.
|
0.764667 |
My daughter's dog a 9 year old Chihuahua has been staying with me. Now he won't go home to my daughter's. He growls and snarls at her when she comes near. He won't even let her talk to him or come near him, as if he's afraid she's going to take him away! I don't know what to do about this except to keep him here, and she gets very hurt because she has had him for 9 years. One significant thing that happened is that she had a Dalmatian older than him that was in her home when she got the Chihuahua. He was very much attached to the Dalmatian. She died about two years ago. Over the last year or more, she has brought the Chihuahua over here to my house to stay often because she was often gone because of work and he was lonely being home alone so often. I have a dog (younger than him) and he seems to like being around her, but he would leave and go home whenever my daughter came to pick him up. However, he started this growling about 8 or 9 months ago and now refuses to acknowledge her. Is there any way to get him to be pleasant to her again? It seems to be out of the question for him to go back to stay. I don't mind him staying here. In fact, I would probably miss him at this point, but I don't like seeing her unhappy about it.
|
0.999943 |
Egzaminujący zada Ci kilka pytań związanych z Twoim życiem i zainteresowaniami. Ma to na celu oswojenie Cię z sytuacją egzaminacyjną. Tak przynajmniej twierdzą spece z Centralnej Komisji Egzaminacyjnej ;).
Nie mniej lepsze to, niż przejście od razu do rozwiązywania zadań.
Ta część egzaminu nie jest punktowana. Warto się jednak do nie dobrze przygotować.
Ponieważ pierwsze wrażenie możesz zrobić tylko raz. Jak to zrobić? Jak napisałam powyżej te pytania będą dotyczyć Ciebie: Twojego życia i zainteresowań. Możesz więc nauczyć się jak najciekawiej opowiadać o swoich zainteresowaniach, rodzinie, o tym jak spędzasz wolny czas, co robisz jak spotykasz się z przyjaciółmi itd. Ponadto na podobne pytania możesz trafić w dalszej części egzaminu zatem warto mieć przygotowane argumenty.
1. What can young people do to get on well with their parents?
2. Would you ever take up any extreme sport? Why? Why not?
3. Have you or anybody you know suffered any injuries when you were a child? What were they?
4. How did you prepare for Christmas when you were a child?
5. What should an ideal teacher be like?
6. What problems do the disabled have to face every day?
7. What do you usually do when you meet up with your friends?
8. Is it difficult to get a well-paid job without a good education? Why?
9. What animals do you consider the best pets to have? Why?
10. What kinds of shops do you best like going to? Why?
11. Why is football such a popular sport?
12. What, in your opinion, should a good lesson be like?
13. Why people buy fewer and fewer books nowadays?
14. Is your family important to you? Why?
15. Do you think school can be a source of stress? Give reasons.
16. Do you like going to parties? Why?
17. What kind of house would you like to live in. Why?
18. Do you take care of the environment where you live? In what way?
19. Which is your most favourite place of entertainment? Why?
20. How do you think we should take care of the elderly?
21. Why do people go sightseeing?
22. In what ways do people act against animal rights?
23. What kind of holidays do you like most? Why?
24. Do you think friendship is important in life? Why?
25. What forms of entertainment do you enjoy? Why?
26. How do you usually spend weekends?
27. Do you think it is important to vote? Why?
28. What holiday do you find the most exciting? Why?
29. What English-speaking country would you love to visit? Why?
30. Who are better cooks, men or women? Why?
31. Which do you prefer traditional or online shopping?
32. Should supermarkets be closed on Sundays? Why?
33. Why do fewer and fewer people read books?
34. Is the car an important invention? Why? Why not?
35. What are some ways we can help disabled people?
36. How do you celebrate New Year’s Eve?
37. Do you think old age can be a happy time of life? Why? Why not?
38. In what way has technology changed our lifestyle?
39. Are you of the opinion that recycling is important? Why? Why not?
40. Which do you prefer more: cinema or theatre? Why?
41. Why do people keep plants in their homes?
42. Why is it important to go to the doctor regularly?
43. Do you prefer doing sport or watching it on TV?
44. Is Physical Education an important subject at school? Why?
45. What are the possible drawbacks of shopping in hypermarkets?
46. What are some sources of conflicts between young people in Poland?
47. Which job do you consider dangerous. Why?
48. How important is friendship in our lives?
49. What can people do to keep healthy?
50. Are police necessary? Why do you think so?
51. Should young men join the army? Why? Why not?
52. What’s your favourite pet? Why?
53. What are some advantages and disadvantages of living on a farm?
54. What, in your opinion, are qualities of a perfect student?
55. On what occasions do we eat meals with our friends or family?
56. Is it true that older people don’t understand the younger generation? Why? Why not?
57. What ways of protecting environment can you think of?
58. Do you think there should be more jobs for disabled people? Why?
59. How can people spend free time on a sunny day?
|
0.94049 |
A central processing unit (CPU) is the electronic circuitry within a computer that carries out the instructions of a computer program by performing the basic arithmetic, logical, control and input/output (I/O) operations specified by the instructions. The computer industry has used the term "central processing unit" at least since the early 1960s. Traditionally, the term "CPU" refers to a processor, more specifically to its processing unit and control unit (CU), distinguishing these core elements of a computer from external components such as main memory and I/O circuitry.
In 1964, IBM introduced its IBM System/360 computer architecture that was used in a series of computers capable of running the same programs with different speed and performance. This was significant at a time when most electronic computers were incompatible with one another, even those made by the same manufacturer. To facilitate this improvement, IBM utilized the concept of a microprogram (often called "microcode"), which still sees widespread usage in modern CPUs. The System/360 architecture was so popular that it dominated the mainframe computer market for decades and left a legacy that is still continued by similar modern computers like the IBM zSeries. In 1965, Digital Equipment Corporation (DEC) introduced another influential computer aimed at the scientific and research markets, the PDP-8.
Since the introduction of the first commercially available microprocessor, the Intel 4004 in 1970, and the first widely used microprocessor, the Intel 8080 in 1974, this class of CPUs has almost completely overtaken all other central processing unit implementation methods. Mainframe and minicomputer manufacturers of the time launched proprietary IC development programs to upgrade their older computer architectures, and eventually produced instruction set compatible microprocessors that were backward-compatible with their older hardware and software. Combined with the advent and eventual success of the ubiquitous personal computer, the term CPU is now applied almost exclusively[lower-alpha 1] to microprocessors. Several CPUs (denoted cores) can be combined in a single processing chip.
While the complexity, size, construction and general form of CPUs have changed enormously since 1950, the basic design and function has not changed much at all. Almost all common CPUs today can be very accurately described as von Neumann stored-program machines.[lower-alpha 2] As Moore's law no longer holds, concerns have arisen about the limits of integrated circuit transistor technology. Extreme miniaturization of electronic gates is causing the effects of phenomena like electromigration and subthreshold leakage to become much more significant. These newer concerns are among the many factors causing researchers to investigate new methods of computing such as the quantum computer, as well as to expand the usage of parallelism and other methods that extend the usefulness of the classical von Neumann model.
Related to numeric representation is the size and precision of integer numbers that a CPU can represent. In the case of a binary CPU, this is measured by the number of bits (significant digits of a binary encoded integer) that the CPU can process in one operation, which is commonly called word size, bit width, data path width, integer precision, or integer size. A CPU's integer size determines the range of integer values it can directly operate on.[lower-alpha 7] For example, an 8-bit CPU can directly manipulate integers represented by eight bits, which have a range of 256 (28) discrete integer values.
A less common but increasingly important paradigm of processors (and indeed, computing in general) deals with data parallelism. The processors discussed earlier are all referred to as some type of scalar device.[lower-alpha 10] As the name implies, vector processors deal with multiple pieces of data in the context of one instruction. This contrasts with scalar processors, which deal with one piece of data for every instruction. Using Flynn's taxonomy, these two schemes of dealing with data are generally referred to as single instruction stream, multiple data stream (SIMD) and single instruction stream, single data stream (SISD), respectively. The great utility in creating processors that deal with vectors of data lies in optimizing tasks that tend to require the same operation (for example, a sum or a dot product) to be performed on a large set of data. Some classic examples of these types of tasks include multimedia applications (images, video and sound), as well as many types of scientific and engineering tasks. Whereas a scalar processor must complete the entire process of fetching, decoding and executing each instruction and value in a set of data, a vector processor can perform a single operation on a comparatively large set of data with one instruction. This is only possible when the application tends to require many steps which apply one operation to a large set of data.
1 2 Patterson, David A.; Hennessy, John L.; Larus, James R. (1999). Computer Organization and Design: the Hardware/Software Interface (2. ed., 3rd print. ed.). San Francisco: Kaufmann. p. 751. ISBN 1558604286.
↑ "System/370 Announcement". IBM Archives. Retrieved October 25, 2017.
↑ "System/370 Model 155 (Continued)". IBM Archives. Retrieved October 25, 2017.
↑ "Models and Options". The Digital Equipment Corporation PDP-8. Retrieved June 15, 2018.
↑ Ross Knox Bassett (2007). To the Digital Age: Research Labs, Start-up Companies, and the Rise of MOS Technology". The Johns Hopkins University Press. pp. 127–128, 256, and 314. ISBN 0-8018-6809-2.
↑ "Speed & Power in Logic Families". .
↑ Richard Birkby. "A Brief History of the Microprocessor". computermuseum.li. Archived from the original on September 23, 2015. Retrieved October 13, 2015.
↑ Simonite, Tom. "Moore's Law Is Dead. Now What?". MIT Technology Review. Retrieved 2018-08-24.
↑ "Excerpts from A Conversation with Gordon Moore: Moore's Law" (PDF). Intel. 2005. Archived from the original (PDF) on 2012-10-29. Retrieved 2012-07-25.
↑ Eigenmann, Rudolf; Lilja, David. "Von Neumann Computers" (pdf). Retrieved June 15, 2018.
↑ Aspray, William. "The stored program concept". Spectrum, IEEE. Retrieved September 29, 2015.
↑ Saraswat, Krishna. "Trends in Integrated Circuits Technology" (pdf). Retrieved June 15, 2018.
↑ "Electromigration". Middle East Technical University. Retrieved June 15, 2018.
↑ Huynh, Jack (2003). "The AMD Athlon XP Processor with 512KB L2 Cache" (PDF). University of Illinois, Urbana-Champaign. pp. 6–11. Archived from the original (PDF) on 2007-11-28. Retrieved 2007-10-06.
↑ "Parallelism exploitation in superscalar multiprocessing". IEEE Xplore. Retrieved 25 April 2016.
|
0.99986 |
Why choose paintball in Minneapolis? When it comes to finding a fun outdoor activity that an entire group of people will enjoy, the first thing that you should consider is paintball in Minneapolis. This is due to the fact that paintball is an activity that everyone can enjoy even if they have never played before. If you play at a facility such as Splatball then everything you could need is available onsite such as CO2 and compressed air fills. This makes it perfect for those who are just experimenting with paintball.
|
0.945259 |
Coronary artery disease is the obstruction of blood flow through the coronary arteries.
The doctor reviews the patient's medical history and conducts a physical examination. The patient may also undergo routine blood tests as well as a diagnostic test such as electrocardiogram, echocardiogram, stress test, angiogram, electron beam computerized tomography, or magnetic resonance angiography.
The doctor recommends lifestyle changes for healthier arteries such as eating healthy food and regular exercise. Medications or surgical procedures may also be recommended to blood flow.
Symptoms may not show when blood flow is restricted. However, as fatty deposits continue to accumulate in the coronary arteries, a person may experience chest pain, which may be triggered by physical and emotional stress; shortness of breath caused by the heart's inability to pump enough blood; or heart attack, which results from a complete blockage. A heart attack sometimes occurs with no apparent signs or symptoms.
Coronary artery disease is caused by various factors which cause the inner layer of a coronary artery to be damaged or injured. Such factors include smoking, high blood pressure, high cholesterol, certain diseases, such as diabetes, or radiation therapy to the chest, as used for certain types of cancer.
|
0.962957 |
Robotic rovers can be used as advance scouts to significantly improve scientific and technical return of planetary surface exploration. Robotic scouting, or “robotic recon,” involves using a robot to collect ground-level data prior to human field activity. The data collected and knowledge acquired through recon can be used to refine traverse planning, reduce operational risk, and increase crew productivity. To understand how robotic recon can benefit human exploration, we conducted a series of simulated planetary robotic missions at analog sites. These mission simulations were designed to: (1) identify and quantify operational requirements for robotic recon in advance of human activity; (2) identify and quantify ground control and science team requirements for robotic recon; and (3) identify capability, procedure, and training requirements for human explorers to draw maximum benefit from robotic recon during vehicular traverses and on-foot extravehicular activities (EVA). Our studies indicate that robotic recon can be beneficial to crew, improving preparation, situational awareness, and productivity in the field. This is particularly true when traverse plans contain significant unknowns that can be resolved by recon, such as target access and station/activity priority. In this paper, we first present the assumptions and major questions related to robotic reconnaissance. We detail our system design, including the configuration of our recon robot, the ground data system used for operation, ground control organization, and operational time lines. Finally, we describe the design and results from an experiment to assess robotic recon, discuss lessons learned, and identify directions for future work.
N37°24'55" - N37°24'55", W122°03'46" - W122°03'46"
N47°07'00" - N47°07'00", W119°16'60" - W119°16'60"
|
0.999982 |
Let's say the tag is "tag".
I'm so freaking dumb, I thought the word was hoover. I need to improve my english, thank you so very much.
Ohhh, I feel so stupid, I thought the word was written hoover. My bad, I need to improve my english.
|
0.959646 |
Nangarhar province is located in east of Afghanistan between 70 degrees and 28 minutes of east altitude and 33 degrees and 56 minutes of north latitude. Nangarhar located 599 metres above sea level and is 7916 square metres area, Jalalabad city is the provincial capital.
The province is known for its history, water, weather, fruits and historical landscapes, in north it borders with eastern Kunar and Laghman and in west with capital Kabul and Logar provinces, and the Spinghar mountains is located in its south, the mountains separate Nangarhar from southern Paktia and Pashtonkhwah province of Pakistan. East and southeastern parts of Nangarhar are linked with the Duran Line.
Nangarhar average temperature reaches to 45 C in summer and +2 C in winter, which has Mediterranean climate, where the rainfall level reaches 242 -390 mm in winter.
There is no snowfall in other parts of Nangarhar, except Khogyani, Hisarak, Spinghar and Kashmond Mountains, which experience moderate temperature in summer, but temperature of other parts usually get hot.
Nangarhar is encircled by various mountains, while some parts of Hindu Kush Mountains are located in its north, which begins from Pardam mountaind and ends on Gambiri desert, which is known as mountain of Kuz Kunar and Kashmond.
Likewise, Spinghar is located in its south, Tor Ghar in its west and its east borders with Kama, Lalpora, some parts of Hindu Kush cross the Duran Line, in Momand area, which starts from Doura mountain from Diwan Baba area of Nuristan province and extended to Lwargi area.
Spinghar is a famous mountain in Nangarhar that located in east of the province, which starts 48 kilometres west of Peshawar and reached toward west to central Logar province. This mountain separates Logar and Tira area of Koza Pashtonkhwah from Nangarhar province and its length reaches 180 kilometres, which average height is 3,500 kilometres from sea. Spinghar peak is named Sikaram, the peak is measured at 4755 metres and its some peaks covered by snow most of the seasons.
The skirts of Spinghar are green and covered by forests and its important valeyes are Bandar Dara, Abdul Khil Tangai, Pekhee Tangai, Mamond Dara, Kot Dara, Haska Mina Jodara, Ghokht Dara, Pachiragam Dara, Tora Bora, Goroko, Sasobai, Tabai and Kasobai.
Torghar is another big mountain in Nangarhar, which is located in west of the province, beginning from Daronta area and reaches east of capital Kabul. This mountain has 150 kilometres length, the peak is 4167 metres heigh and Torghar is free of forests.
Except Sorkh Roud, there is no river in Nangarhar province, which lacked running water, but it flows only in spring and during floods. This river originates from Ghorband Ghakhi area of Spinghar, with small rivers of Wazir, Hisarak, Mamakhel and Markikhel join Sorkh Roud river in Fatihabad area.
Sorkh Roud river running into the north and joined Kabul River in the lower side of Daronta area that pour into Daronta dam in Nangarhar province. But Kunar River only irrigates agriculture lands of Kuz Kunar, Kama, Goshta, Lalpora districts.
The province of Nangarhar is located along the Kabul-Peshawar major transit route, which has 92 kilometres length from Daronta pass into Torkham border. This transit route facilitated good employment opportunities in Nangarhar province, which played important role in boosting the economy of the country, especially eastern provinces.
Business is a good means of revenues in Nangarhar, where some traders are busy in international commerce, in addition to domestic business. International traders imports goods through their companies from various countries of the world like China, Japan, Uzbekistan, Turkmenistan, India and Pakistan. But the number of such traders are less, while domestic traders bring cereals, livestock, firewood and other goods from villages to cities and sell them in Jalalabad, Kabul, Balkh, Peshawar and other provinces.
Although limited number of natural resources had so far been explored in Nangarhar, but the extract of the mines are ongoing, including famous natural resources such as marbles, slates and cools.
But the mines marble that located in Khogyani district of Nangarhar province is very famous. The extraction process of this mine is ongoing over the past few years. Meanwhile, the slate and marble mines from Abdul Khel area of Shinwar, are also worth mentioning, which is irresponsibly extracted and delivered to the market.
Nangarhar province has better ennvironment for industries as the climate is suitbale and is close to the port city of Karachi In pakistan.
Hundreds women and youths are working in some factories functional in the province. A number of big factories of marble were set up in 2003 in Sorkh Roud district, which export marbles to other provinces.
A factory of aluminum that produces pressure-cooker and other tools is also functional in Nangarhar, while some major factories of rickshaw are active in Sorkh Roud district, which so far had produced hundreds of rickshaws.
Meanwhile, dozens of women are working in major factory of embroidery, producing embroidered piece of dress necklace etc. Another small factory of starch is operational in Jalalabad city and a linen producing factory in Behsud district. A salt and other small factory were also running in Nangarhar, generating various kinds of products, however handicrafts are forgotten there.
Nangarhar has 22 districts, inluding Spinghar district. According to the ministry of urban and development, Nangarhar has 1291 small and big villages. But in line with the figures of ministry of agriculture, irrigation and livestock, there are 992 big villages and 161 small villages. Jalalabad is among the five major cities of Afghanistan and is highly populated town. Nangarhar districts names are as follow.
Achin, Batikot, Chaparhar, Haska Mina, Khewa, Khogyani, Sherzad, Pachiraga, Hisarak, Koot, Nazyan, Spingghar, Ghanikhel, Goshta, Momand Dara, Lalpora, Bihsud, Sorkh Roud, Dara-i-Noor, Door Baba, Rodat and Kama.
Media activities have improved compare to past in Nangarhar province, where 33 printing, visual, audio, government and non-government media outlets are functional. Those radio channels broadcasting from Nangarhar province, including Nangarhar national radio television, Sharq, Nargis, Islah, Muram, Killid, Abasin, Spin Ghar, Safa, Nan, Hamisha Bahar, Inikas, Haqiqat, Mina and Watandar Radios.
But those radio channels, which broadcasts from capital Kabul and there broadcasts covered Nangarhar are identified as Arman, Aryana, Arakozia, BBC, Azadi, VOA, Mashal, Sta, Gorbat, Nava, Salam Watandar, Shamshad and Kabul national radio.
Among the visual media outlets, National, Sharq and Taban televisions have studios in the province, while national, VOA, Shamshad, Lemar, TOLOnews, Aryana, Tamadon, Khurshid, Zhwandon, Noor and One tv channels, which runs from the capital, have also broadcasts in Nangarhar province.
Nangarhar daily and magazine, Shayeq, three day magazine, Musbat Badloon weekly, Gulab weekly and magazine, Mina magazine, Jalalabad magazine, Aryana monthly, Anar weekly, Hila weekly, Zyar magazine, Arzakht magazine, Mukha magazine and Talvasa magazines are among the printing media outlets in Nangarhar province.
Nangarhar is considered important province of the country in terms of knowledge, art and literature, where many figures have grown up from the past until now in various spheres.
The most famous figures of Nangarhar are Wazir Mohammad Gul Khan Momand, Imal Khan Momand, Siddiqullah Rikhteen, Qyamudin Khadam, Musa Shafiq, Dost Shinwarai, Chaknawar Mullah, Najmudin Akhundzada, Da Goshti Maghol Khan, Dr. Nasir Shinwarai, Dr. Yaqoub Sherzad, Dolki Baba, Miasharaf Gardiwal, Gardi Ghaus, Shah Faizullah Agha, Mia Ali Sahib, Maulvi Ahmad Gul, Khwaja Rizqullah, Mullah Mast, Akhond Musa Batikoti, Papin Khil, Akhund Droviza, Mia Faqirullah Jalalabadi, Maulvi Mohammad Ibrahim Kamavi, Murad Ali Sahib Zada Sahib, Burhanudin Koshkaki, Mohammad Amin Khogyani, Shamsudin Qalataki, Pohand Ziwar, Abdul Rahman Pajhwok, Mohammad Akbar Motamid, Mia Mohammad Naeem, Abdullah Bakhtani Khadmatgar, Mujawer Ahmad Zeyar, Qari Barakatullah Salim, Abdul Haq, Malang Jan and Dost Shinwarai.
Cultural movements have been launched from the past in Nangarhar province, where now many cultural and literary institutions such as literary caravan, Jalalkoot literary movement, east literary caravan, independent association of journalists and writers of east, Roud literary caravan, Nagar association are operational in the province.
Separately, many publishers associations are also active in the province such as Momand, Gudar, Muslim, Gandara, Mazigar, Khatiz, Hamdard, Sadaqat and the association of writers and journalists in eastern zone, which published thousands of books.
Culturalists and writers from various parts of the province attended the conventional poetry of Naranjgul poetry ceremony held annually each spring in the province, which has half a century history. On other hand, various kinds of musical instruments as tabla, sitar, harmonia, rabab and others have been played in the province.
A number of singers opened special training courses in Jalalabad, where they teach tabla , sitar and other local instruments. The calligraphy and other arts courses are functioning in Nangarhar as well, where a special department of Afghan Film is active in information and culture department. Another institution under the name of Spinghar Film is also active in Nangarhar province.
Sport has a long history in Nangarhar province to which many people are interested. Many clubs of volleyball, cricket, football, boxing, kickboxing, taekwondo, basketball, bodybuilding, and wrestling are functional and train youths. But youths in remote districts play different local sports that are common in their villages. Another two departments of bodybuilding and cricket are also individually active in the province, which train many youths of villages in the two target fields.
Nearly, 855 educational institutions are active in Nangarhar, where 775,000 students get education; with 42% of them are females.
About 14,000 teachers are hired in relevant schools, in which 300 schools have provided buildings.
Nearly, 11,000 students are studying in Nangarhar University through 500 students. Having a 50-year history, this university has 13 faculties including medical, engineering, education, veterinary, agriculture, computer science, journalism, science, literature, political science and sharia. Thousands of students are busy getting education in eight other institutions, including teacher training college.
As Nangarhar is a developing province, many people are busy in agriculture and livestock. Many districts deserved adequate water and its vegetables included cucumber, tomato, onion, okra, cauliflower, squash, radish, potato, wheat, rice, turnip, maize and barleys.
Citrus crops yield good crops in Nangarhar, with the Nava development project is a good example of it. Moreover, melon, grapes, apricot, peach, plum, almond, pin-nuts and wall nuts crops also produced in Nangarhar province.
Daronta dam is among the major water dam in Nangarhar province, generating about three megawatts electricity that was set up earlier by a Russian company and is still operational.
The Zherai Baba dam, located in Khewa district was established in 2006 and irrigates thousands of acres of agriculture land in Kuz Kunar district.
A number of historical sites and caves from ancient Buda era such as Bahar Abad caves, Chahar Bagh-i-Safa, Babur Takht, Rah-i-Kalan, Shah Faizullah Agha shrine, Najmudin Akhundzada, Ghochko and Daronta temple, Sorkh Roud and other parts of the province.
The shrines of Dolki Baba, Mia Ali Sahib, Akhund Musa Batikot, Miasharaf, Gardi Ghaus, Sarajul Imara, Amanullah Khan, Pacha Khan are also located in Nangarhar province.
A museum under the name of Hadi is also functioning under the information and culture department. This museum has a long history, which was severally destroyed during domestic war.
Behsud Bridge, linking two provinces and four districts is among the second priority. Construction of Nangarhar airport is also among the need, but it financing need the support of central administration and international community.
In addition, rebuilding of industrial parks, Daronta power dam and providing work opportunities also among the prioritized projects.
|
0.950666 |
Can you recommend some reputable home builders that can build a home in a wetlands area?
Charlie: Damien in Galveston says, “I have a one acre vacant lot on Indian Beach.” You know where that is?
Charlie: Me neither. Anyway, he says it’s on the bay side, and it incorporates some 50% of wetlands boundary on it.
Tom: Oh, it means you can’t build anything. He’s just like super permitted.
Tom: Well, first off, I think what needs to happen is you need to get an architect, get the plans drawn, get it approved by the HOA, get it approved by the city, county, Texas windstorm people, whoever is involved with it. Then, you start thinking about a builder. See, everybody wants to go right to the builder, but you need to have all this homework done by an architect, especially in an area like that because you’re going to run into a lot of different regulations, permitting, inspections, generally you know all that, right?
Now, you get into wetlands stuff where you can and cannot put even your foot, in some cases, you can’t even walk on it. It’s going to be quite regulated. A lot of people buy out in these areas, and they say, “Well, it’s part of wetlands.” As soon as you do that, you’re under a huge amount of regulations when it comes to that particular little part of your property. It’s not really yours.
Charlie: I’m sure that was disclosed when he bought the property.
Tom: Oh, yeah. I’m sure it was too.
|
0.911623 |
A straight is a poker hand such as Q♣ J♠ 10♠ 9♥ 8♥, which contains five cards of sequential rank but in more than one suit. It ranks above three of a kind and below a flush. Two straights are ranked by comparing the highest card of each. Two straights with the same high card are of equal value, suits are not used to separate them. Straights are described by their highest card, as in "ten-high straight" or "straight to the ten" for 10♣ 9♦ 8♥ 7♣ 6♠.
A hand such as A♣ K♣ Q♦ J♠ 10♠ is an ace-high straight, and ranks above a king-high straight such as K♥ Q♠ J♥ 10♥ 9♣. The ace may also be played as a low card in a five-high straight such as 5♠ 4♦ 3♦ 2♠ A♥, which is colloquially known as a wheel. The ace may not "wrap around", or play both high and low: 3♣ 2♦ A♥ K♠ Q♣ is not a straight, but just ace-high no pair.
|
0.989175 |
Today’s small businesses are facing new and more complicated challenges, and they need to retain more customers with fewer resources than ever before. As a rule, smaller companies have been slower to adopt customer relationship management (CRM) software. However, as the importance of customer retention has risen, many small companies are realizing the value of CRM software to their business. It is a cost effective way to help businesses build solid relationships with their clients.
As small businesses grow, they may not be able to maintain the same level of personal contact with their clients as when they first started out. Customers might start to feel like they matter less to the company and begin to look elsewhere for products or services.
Some small-business owners think it is more affordable to utilize free solutions, such as spreadsheets and email, but this can lead to disorganization. CRM is often a total business solution for small companies, and it can help businesses streamline their operations and identify new prospects.
CRM can also help small business owners improve their relationship marketing and maintain personal connections with customers. Many companies recognize the value of building a loyal client base instead of focusing all their attention on attracting new customers. CRM can make it easier for small businesses to market to their existing clients, as well as help sales managers identify frequent customers (and sell more to them), focus on the best clients and find new prospects easily. CRM software can also make it easier to stick to sales timelines and perform customer calls regularly, which will build company loyalty. As small companies grow, they can still maintain the same level of personal interactions with their customers.
How should small businesses choose CRM?
Most small business owners focus on the price alone; however, they need a CRM solution with the right degree of functionality. CRM is sometimes seen as an IT decision, but it is important for the sales and marketing teams to have the features they need to be more productive. Since small companies usually have tighter budgets, cloud-based CRM solutions can be more affordable and offer the capabilities managers need.
Small companies need to consider their present and future needs when deciding on a CRM solution. If implementing a CRM solution would cause management to completely realign the business strategy, it might not be the right software. A CRM with a variety of customizable options can make it easier for the small business to get the solution up and running, and it may be easier to adapt for future needs. Having a range of adjustable features can reduce the time small-business owners need to spend to make CRM work for the company.
Implementing a CRM solution can seem challenging for small businesses, but the software can help them place a greater emphasis on their growing customer bases and have better connections with existing clients. Companies can measure how well they are performing and gain new insights into consumer behavior.
If your small business is in the market for a CRM solution, check out Sage CRM. Designed to integrate with your ERP solution, Sage CRM equips you with the tools you need to find new customers, close sales faster, and build lasting, more profitable relationships across all channels of your business. If you are interested in Sage CRM or would like to learn more about the solution, contact us today.
|
0.999506 |
LEARNING@SCALE: INNOVATIONS IN SCALING AND ENHANCING LEARNING.
We are excited to announce that the Learning at Scale (L@S) conference will be held June 26-28, 2018 in London, UK.
L@S seeks contributions that address innovations in scaling and enhancing learning, empirical investigations of learning at scale, new technical systems for learning at scale, and novel syntheses of relevant research.
The conference will be part of a weeklong London Festival of Learning where L@S 2018 will be alongside the International Conference of the Learning Sciences and the Artificial Intelligence in Education Conference. The weeklong Festival will take place June 24-30. The L@S conference will be June 26-28, with a common festival day on June 27, and the single-track L@S events on June 26 and 28.
L@S investigates large-scale, technology-mediated learning environments with many learners and few experts to guide them. Large-scale learning environments are incredibly diverse: massive open online courses, intelligent tutoring systems, open learning courseware, learning games, citizen science communities, collaborative programming communities (such as Scratch), community tutorial systems (such as StackOverflow), shared critique communities (such as DeviantArt), and the countless informal communities of learners (such as the Explain It Like I’m Five sub-Reddit) are all examples of learning at scale. These systems either depend upon large numbers of learners, or they are enriched through use of data from previous use by many learners. They share a common purpose–to increase human potential–and a common infrastructure of data and computation to enable learning at scale.
Investigations of learning at scale naturally bring together two different research communities. Since the purpose of these environments is the advancement of human learning, learning scientists are drawn to study established and emerging forms of knowledge production, transfer, modeling, and co-creation. Since large-scale learning environments depend upon complex infrastructures of data storage, transmission, computation, and interface, computer scientists are drawn to the field as powerful site for the development and application of advanced computational techniques. At its very best, the L@S community supports the interdisciplinary investigation of these important sites of learning and human development.
The ultimate aim of the L@S community is the enhancement of human learning. In emerging education technology genres (such as intelligent tutors in the 1980s or MOOCs circa 2012), researchers often use a variety of proxy measures for learning, including measures of participation, persistence, completion, satisfaction, and activity. In the early stages of investigating a technological genre, it is entirely appropriate to begin lines of research by investigating these proxy outcomes. As lines of research mature, however, it is important for the community of researchers to hold each other to increasingly high standards and expectations for directly investigating thoughtfully-constructed measures of learning. In the early days of research on MOOCs, for instance, many researchers documented correlations between measures of activity (videos watched, forums posted, clicks) and other measures of activity, and between measures of activity and outcome proxies including participation, persistence, and completion. As MOOC research matures, additional studies that document these kinds of correlations should give way to more direct measures of student learning and of evidence of instructional techniques, technological infrastructures, learning habits, and experimental interventions that improve learning. As a community, we believe that the very best of our early papers define a foundation to build upon but anticipate that future papers will bring us well beyond.
|
0.99179 |
Using a recumbent bike is a great way to get a workout without putting unnecessary strain and stress on your body. That's what makes finding the best recumbent bike so important.
Due to the innovative design of a recumbent bike, you are able to sit lower to the ground with your legs out in front of you rather than below you. Recumbent bikes also have larger seats with back support.
These features allow you to get the same cardiovascular workout that you can achieve from an upright cycle while reducing the stress on your back, knees and hips.
While a recumbent bicycle does offer a number of benefits, finding the right one to suit your needs may feel like an overwhelming task. After all, there are many different features that can be found on recumbent bicycles, so how can you choose the one that will best help you meet your fitness goals?
To help with choosing a recumbent bike, it is important to consider your fitness goals as well as your lifestyle. After all, you do not want to invest a large sum of money in a machine only to have it sit in a corner and collect dust.
Rather, you want to purchase a piece of exercise equipment that you are likely to use on a regular basis. To help keep yourself motivated and to ensure you get good use out of your recumbent bike, it is important to find one that is comfortable and convenient to use that also offers the extra features you need to keep yourself moving toward achieving your fitness goals.
By doing your research and learning more about the various features found on recumbent bikes, you will be better prepared to find the one that will help to keep you motivated as you work toward these goals. With this handy guide, you will also be better able to sift through all of your options to find the recumbent bike that is right for you.
To achieve the greatest amount of comfort while using your recumbent bike, it is important to select a model with an ergonomic design that is meant to help you workout in comfort. Whether you are a seasoned vet looking to add another element to your workout routine or someone who is pregnant, recovering from an injury or simply a bit older in age, an ergonomic design will allow you to workout safely. For even greater comfort, look for a model that allows you to make adjustments to the saddle position as well as the toe straps so you can more comfortably engage the pedals.
To get the best views of the console, look for a recumbent bike that allows you to make adjustments to the console-viewing angle. This will help with preventing issues such as excessive glare or neck strain caused by trying to view a console that is in an awkward position. In this way, you can more comfortably using your recumbent bike while effectively monitoring your progress throughout your workout.
To achieve maximum comfort with your recumbent bike, you may also need to make adjustments to the angle of the handlebars. This means selecting a model that allows you to tilt the handlebar angle to customize the fit. Not only will this help you make adjustments as necessary for your workout routine, but it also makes it possible for multiple users to comfortably use the same machine to get a great workout.
A cooling fan can help with maximizing airflow while you workout, thereby making your routine more comfortable. A fan also helps to prevent overheating, which can be particularly important for seniors or other individuals with health issues who would like to improve their fitness levels. To help with staying cool while you workout, your recumbent bike should have a personal cooling fan with variable speeds.
Keeping yourself entertained as you workout is a great way to ensure you keep coming back to exercise. One way to help pass the time as you work out is to reach your favorite magazine while pedaling your way into better fitness. A built-in foldout magazine rack will help you to easily read while you are working out. For added convenience, look for a model that allows you to fold away the magazine rack when not in use. In this way, the recumbent bike will be less obtrusive wherever you choose to place it in your home.
Sometimes, the best way to keep yourself motivated is to listen to music while you work out. The most convenient way to play your favorite tunes is to purchase a recumbent bike with a built-in sound system that can connect to your favorite mp3 player. Not only is a built-in system more convenient to use, but it also guarantees good sound quality with the built-in speaker system. Having a quality sound system will make your tunes more enjoyable to listen to, thereby helping to further motivate you to keep working out.
Present programs offer a great way to reach your fitness goals without needing to figure out your workout routine for the day. Not only do these preset programs help you to hit different fitness goals, but they also help to vary your routine so boredom does not set in. The best recumbent bikes will have at least 20 preset workout programs from which you can choose.
To increase your muscle strength while also taking your cardio to the next level, it is helpful to use a recumbent bike with various levels of resistance. A machine with at least 16 levels of resistance will allow you to achieve a wide variety of different workouts. In addition to helping you reach your individual fitness goals, this feature will also help to make the recumbent bike useful to others who may choose to use the machine and who have different fitness goals.
Monitoring your heart rate is one of the key components of measuring the effectiveness of your workout routine. To help make this process easier, your recumbent bike should include a built-in heart rate monitor in the form of an integrated handlebar with contact sensors. It should also have target heart rate programs to help you keep your workout intensity within the target zone.
To help create a smooth and quiet ride, your recumbent bike should have a frictionless braking system. The smooth ride will help to keep your workout safe and comfortable, while the noise reduction will help you to better enjoy reading or listening to music while working out. Anyone else who shares your home with you will also appreciate that you are using a quiet recumbent bike that does not create a whole lot of unnecessary noise for them to deal with.
Any high-quality recumbent bike will be backed by an extensive warranty. Look for one with a lifetime warranty on the brake and frame as well as three-year warranty on parts and a one-year warranty on labor. This way, you can rest assured the machine will last a long time and provide you with the opportunity to get a great workout for years to come.
A reputable dealer will offer a money-back guarantee on any products that you purchase from them. This guarantee should be no-questions-asked and should be good for at least 30 days.
Before you purchase a recumbent bike, be sure to closely read the company’s return policy. A reputable company will be open during normal business hours in order to address any questions or concerns that you might have. They will also return all of your money, minus the cost of return shipping and assembly labor charges if you chose to add this to your purchase. There should be no hidden fees charged to you when you make a return.
When comparing prices of recumbent bikes, be sure to take into consideration the added cost of sales tax. When purchasing from certain online retailers, you can save money when you do not have to pay sales tax.
Many people who consider purchasing a recumbent bike online are concerned that the shipping costs will be outrageous. Unfortunately, this is a very real concern with some retailers. When shopping for the best recumbent bike, consider the added cost of shipping and chose a company that does not charge for this service.
Shopping for a recumbent bike can feel like an overwhelming experience at times. This is particularly true if you have never owned a recumbent bike or have never used one before.
By going into the process with a clear idea of what you want and need out of a recumbent bike, you will be better prepared to sift through your options so you can choose the one that is right for you.
With the added convenience of purchasing a bike online, you can have the machine delivered right to your door so you can get started on your new exercise routine immediately!
|
0.996403 |
The objective: The objective of my project was to build a hovercraft, to determine if different surfaces affect how much weight it will hold and how well it will hover, and to have fun.
3. Test on each of the 6 surfaces by putting weights on it until it wouldnt hover.
I defined hover as "if you push it, it will move easily".
The hovercraft held more weight on the hardwood floor than any other surface. It held 731 pounds compared to 596 lbs on cement, 553 lbs on hard sand, 503.5 lbs on asphalt, 173 lbs on soft sand, and 86 lbs on grass. It lifted 731 pounds on the hardwood floor by creating a calculated 0.5 lbs/in^2 of pressure. It lifted the most on hardwood floors because it created the best seal and less air leaked out the sides creating more lift.
My conclusion supported my hypothesis that the hovercraft would work best on the smoother surface (hardwood floor). It really surprised me on how much it could lift. This study showed me that hovercrafts are fun but not very useful because they can only do well on certain surfaces and they are really noisy and use a lot of gas.
This project is to build a hovercraft and understanding how well it works on different surfaces.
|
0.999164 |
Paragraphs 13 through 15 read: "Wells, who has suffered from bouts of depression, said they had both got out of bed just after 4am and had a cup of tea. He decided to end it all and took an overdose of antidepressants ."
"Neither of the pair could remember much about the incident and it is not known whether Wells took the tablets before or after attacking his wife."
"The tablets apparently had little effect and Wells, who was of previous good character, then tried to save his wife and rang for an ambulance and the police."
A newly-wed pensioner attacked his wife with a claw hammer after a row about their garden, a court has heard.
Clifford Wells, 76, a former Royal Marine, became angry when his 72-year-old spouse Patricia repeatedly accused him of not doing as much as she had to clear the undergrowth outside their new bungalow.
The 76-year-old snapped and struck his Mrs Wells several times over the head with the hammer.
She survived the attack at the couple's home in Penistone, south Yorkshire, but still needs a daily carer, Sheffield Crown Court heard.
Wells, who admitted attempting to murder his wife on July 24 last year, has been jailed for nine years.
Judge Alan Goldsack told him: "This was a conscious and deliberate attempt to kill a lady whom you had come to regret marrying.
"In those few moments you intended to kill your wife. It is little short of a miracle that she did not die."
The couple met in 2007 through an internet dating agency and married on May 30 last year.
They returned after a month and threw themselves into clearing the garden of their new home.
But Mrs Wells became annoyed at her new husband not pulling his weight in the garden when she was out in the morning hard at work.
Wells later attacked Patricia in their home and she was found slumped over a computer mumbling incoherently. There was blood on the ceiling and in the corner of the room.
Prosecutor Peter Kelson QC said Wells told the police that he wanted his wife to die.
"He struck her because he was fed up of her going on about the garden all the time when he was doing his best," he said.
Wells, who has suffered from bouts of depression, said they had both got out of bed just after 4am and had a cup of tea. He decided to end it all and took an overdose of antidepressants.
Neither of the pair could remember much about the incident and it is not known whether Wells took the tablets before or after attacking his wife.
The tablets apparently had little effect and Wells, who was of previous good character, then tried to save his wife and rang for an ambulance and the police.
Mrs Wells, who now lives alone with carers, is unable to use her left side, has a poor short-term memory and is easily confused.
She does not remember anything that happened after the couple returned from honeymoon.
Paul Watson QC, for Wells, said the former Royal Marine had served in Korea and Malaysia, then worked in a foundry and became a nurse until he retired in 1992.
The death of his 26-year-old son in 1980 in a road accident had a profound effect on him and his second wife with whom he lived for 31 years had died in 2006.
"He then met Patricia and it was something of a whirlwind relationship," said Mr Watson.
Depression was a problem for which he took medication and there were difficulties in the relationship before his "inexplicable" behaviour on the day he attacked his wife.
Judge Goldsack told Wells, who was smartly dressed in suit and tie in the dock: "Not many men older than you stand where you are now standing." He said it was a tragedy for both families.
Although Wells had retired early through depression he was still active and physically fit and he and his wife both spent long hours tending the large garden.
|
0.949152 |
This article is about the science fiction author. For the Babylon 5 character named after him, see Alfred Bester (Babylon 5).
Alfred Bester (December 18, 1913 – September 30, 1987) was an American science fiction author, TV and radio scriptwriter, magazine editor and scripter for comic strips and comic books. He is best remembered for his science fiction, including The Demolished Man , winner of the inaugural Hugo Award in 1953.
Bester attended the University of Pennsylvania, where he was a member of the Philomathean Society. He played on the Penn Quakers football team in 1935 and, by his own account, was "the most successful member of the fencing team." He went on to Columbia Law School, but tired of it and dropped out.
The University of Pennsylvania is a private Ivy League research university located in the University City neighborhood of Philadelphia, Pennsylvania. Chartered in 1755, Penn is the sixth-oldest institution of higher education in the United States. It is one of the nine colonial colleges founded prior to the Declaration of Independence. Benjamin Franklin, Penn's founder and first president, advocated an educational program that trained leaders in commerce, government, and public service, similar to a modern liberal arts curriculum. The university's coat of arms features a dolphin on its red chief, adopted from Benjamin Franklin's own coat of arms.
The Philomathean Society of the University of Pennsylvania is a collegiate literary society, the oldest student group at the university, and a claimant to the title of the oldest continuously-existing literary society in the United States. Founded in 1813, its goal is "to promote the learning of its members and to increase the academic prestige of the University." Philomathean is derived from the Greek philomath, which means "a lover of learning." The motto of the Philomathean Society is Sic itur ad astra.
Bester and Rolly Goulko (December 21, 1917 – January 12, 1984) married in 1936. Rolly Bester was a Broadway, radio and television actress, originating the role of Lois Lane on the radio program The Adventures of Superman . She changed careers in the 1960s, becoming a vice president, casting director and supervisor at the advertising agency Ted Bates & Co. in New York City. The Besters remained married for 48 years until her death. Bester was very nearly a lifelong New Yorker, although he lived in Europe for a little over a year in the mid-1950s and moved to exurban Pennsylvania with Rolly in the early 1980s. Once settled there, they lived on Geigel Hill Road in Ottsville, Pennsylvania.
Lois Lane is a fictional character appearing in American comic books published by DC Comics. Created by writer Jerry Siegel and artist Joe Shuster, she first appeared in Action Comics #1. Lois is an award-winning journalist for the Metropolis newspaper, the Daily Planet, and the love interest of the superhero Superman. In DC continuity, she is also his wife and the mother of their son, Jonathan Samuel Kent, the current Superboy in the DC Universe.
Theodore Lewis "Ted" Bates was an American advertising executive who founded a worldwide advertising agency that bears his name: Ted Bates Inc.
However, as Bester was the winner of the contest, Mort Weisinger also "introduced me to the informal luncheon gatherings of the working science fiction authors of the late thirties." He met Henry Kuttner, Edmond Hamilton, Otto Binder, Malcolm Jameson and Manly Wade Wellman there. During 1939 and 1940 Weisinger published three more of Bester's stories in Thrilling Wonder Stories and Startling Stories . For the next few years, Bester continued to publish short fiction, most notably in John W. Campbell's Astounding Science Fiction.
In 1942, two of his science fiction editors got work at DC Comics, and invited Bester to contribute to various DC titles. Consequently, Bester left the field of short story writing and began working for DC Comics as a writer on Superman , and, under the editorship of Julius Schwartz, Green Lantern , among other titles. He created super-villain Solomon Grundy and the version of the Green Lantern Oath that begins "In brightest day, In blackest night". Bester was also the writer for Lee Falk's comic strips The Phantom and Mandrake the Magician while their creator served in World War II. It is widely speculated how much influence Bester had on these comics. One theory claims that Bester was responsible for giving the Phantom his surname, "Walker".
With the advent of American network television in 1948, Bester also began writing for television, although most of these projects were lesser-known.
In early 1950, after eight years away from the field, Bester resumed writing science fiction short stories. However, after an initial return to Astounding with the story "The Devil's Invention" (a.k.a. "Oddy and Id"), he stopped writing for the magazine in mid-1950 when editor John Campbell became preoccupied with L. Ron Hubbard and Dianetics, the forerunner to Scientology. Bester then turned to Galaxy Science Fiction , where he found in H. L. Gold another exceptional editor as well as a good friend.
In his first period of writing science fiction (1939–1942), Bester had been establishing a reputation as a short story writer in science fiction circles with stories such as "Adam and No Eve". However, Bester gained his greatest renown for the work he wrote and published in the 1950s, including The Demolished Man and The Stars My Destination (also known as Tiger! Tiger!).
The Demolished Man , recipient of the first Hugo Award for best Science Fiction novel, is a police procedural that takes place in a future world in which telepathy is relatively common. Bester creates a harshly capitalistic, hierarchical and competitive social world that exists without deceit: a society in which the right person with some skill (or money) and curiosity can access your memories, secrets, fears and past misdeeds more swiftly than even you.
Originally published in three parts in Galaxy, beginning in January 1952, The Demolished Man appeared in book form in 1953. It was dedicated to Gold, who made a number of suggestions during its writing. Originally, Bester wanted the title to be Demolition!, but Gold talked him out of it.
Bester's 1953 novel Who He? (also known as The Rat Race) concerns a TV variety show writer who wakes up after an alcoholic blackout and discovers that someone is out to destroy his life. According to Bester, the TV show elements were based on his experiences working on The Paul Winchell Show . A contemporary novel with no science fiction elements, it did not receive wide attention. It did, however, earn Bester a fair amount of money from the sale of the paperback reprint rights (the book appeared in paperback as The Rat Race). He also received a substantial sum of money from a movie studio for the film option to the book. Reportedly, Jackie Gleason was interested in starring as the variety show writer and licensed movie rights to the story; however no movie was ever made of Who He? Still, the payout from the film option was large enough that Alfred and Rolly Bester decided they could afford to travel to Europe for the next few years. They lived mainly in Italy and England during this period.
While on his European trip, Bester began selling non-fiction pieces about various European locations to the mainstream travel/lifestyle magazine Holiday . The Holiday editors, impressed with his work, invited Bester back to their headquarters in New York and began commissioning him to write travel articles about various far-flung locales, as well as doing interviews with such stars as Sophia Loren, Anthony Quinn, and Sir Edmund Hillary. As a result of steady work with Holiday, Bester's science fiction output dropped precipitously in the years following the publication of The Stars My Destination.
Bester published three short stories each in 1958 and 1959, including 1958's "The Men Who Murdered Mohammed" and 1959's "The Pi Man", both of which were nominated for Hugo Awards. However, for a four-year period from October 1959 to October 1963, he published no fiction at all. Instead, he concentrated on his work at Holiday (where he was made a senior editor), reviewed books for The Magazine of Fantasy and Science Fiction (from 1960 to 1962) and returned to television scripting.
During the 1950s, Bester contributed a satiric sketch, "I Remember Hiroshima," to The Paul Winchell Show . His later story "Hobson's Choice" was based on it.
Murder and the Android was nominated for a 1960 Hugo Award for Best Dramatic Presentation and was given a repeat on September 5, 1960, the Labor Day weekend in which that Hugo Award was presented (to The Twilight Zone ) at the World Science Fiction Convention in Pittsburgh. Bester returned to Sunday Showcase March 5, 1960 with an original teleplay, Turn the Key Deftly. Telecast in color, that mystery, set in a traveling circus, starred Julie Harris, Maximilian Schell and Francis Lederer.
For Alcoa Premiere , hosted by Fred Astaire, he wrote Mr. Lucifer, which aired November 1, 1962 with Astaire in the title role opposite Elizabeth Montgomery. A light comedy, the story concerned the modern day Lucifer—whose offices are now on Madison Avenue—working with his beautiful secretary to try to corrupt a clean-cut American husband and wife.
After a four-year layoff, Bester published a handful of science fiction short stories in 1963 and 1964. However, writing science fiction was at this stage in Bester's life clearly more of a sideline than the focus of his career. As a result, from 1964 until the original version of Holiday folded in 1971, Bester published only one science fiction short story, a 700-word science fiction spoof in the upscale mainstream magazine Status.
Still, as senior editor of Holiday, Bester was able to introduce occasional science fiction elements into the non-fiction magazine. On one occasion, he commissioned and published an article by Arthur C. Clarke describing a tourist flight to the Moon. Bester himself, though, never published any science fiction in Holiday, which was a mainstream travel/lifestyle magazine marketed to upscale readers during an era when science fiction was largely dismissed as juvenilia.
Holiday magazine ceased publication in 1971, although it was later revived and reformatted by other hands, without Bester's involvement. For the first time in nearly 15 years, Bester did not have full-time employment.
After a long layoff from writing science fiction, Bester returned to the field in 1972. His 1974 short story "The Four-Hour Fugue" was nominated for a Hugo Award, and Bester received Hugo and Nebula Award nominations for his 1975 novel The Computer Connection (titled The Indian Giver as a magazine serial and later reprinted as Extro). Despite these nominations, Bester's work of this era generally failed to receive the critical or commercial success of his earlier period.
Bester's eyesight began failing in the mid-1970s, making writing increasingly difficult, and another layoff from published writing took place between early 1975 and early 1979. It is alleged during this period that the producer of the 1978 Superman movie sent his son off to search for a writer. The name Alfred Bester came up, but Bester wanted to focus the story on Clark Kent as the real hero, while Superman was only "his gun." The producers instead hired Mario Puzo, author of The Godfather , to write the film.
In 1985, it was announced that Bester would be a Guest of Honor at the 1987 Worldcon, to be held in Brighton, England. As the event neared, however, Bester fell and broke his hip. With his worsening overall health, he was plainly too ill to attend.
Bester died less than a month after the convention from complications related to his broken hip. However, shortly before his death he learned that the Science Fiction Writers of America would honor him with their Grand Master Nebula award at their 1988 convention.
Two works by Bester were published posthumously. The first, Tender Loving Rage (1991), was a mainstream (i.e., non-science fiction) novel that was probably written in the late 1950s or early 1960s. The second, Psychoshop (1998), was based on an incomplete 92-page story fragment. It was completed by Roger Zelazny and remained unpublished until three years after Zelazny's death. When published, it was credited as a collaborative work.
StarShipSofa described Bester as "the godfather of modern science fiction", and made a two-part show about him.
In Babylon 5 , Psi-Cop Alfred Bester is named after him (and the treatment of telepathy in Babylon 5 is similar to that in Bester's works).
The time-travelling pest named "Al Phee" in Spider Robinson's Callahan's Crosstime Saloon series is based on Bester.
F. Gwynplaine MacIntyre wrote a series of stories — beginning with "Time Lines" (published in Analog , 1999) — about a time-traveling criminal named Smedley Faversham, who constantly runs afoul of a scientific principle called "Bester's Law" (explicitly named after the phenomena in Bester's 1958 story "The Men Who Murdered Mohammed").
"Oddy and Id" originally published in 1950 as "The Devil's Invention"
"The Starcomber" originally published in 1954 as "5,271,009"
"White Light Cinema" originally published in 1956 as "Patrick the Programmer"
"Science Fiction and the Renaissance Man", originally delivered as a lecture at the University of Chicago in 1957. The other lecturers included Cyril Kornbluth, Robert A. Heinlein and Robert Bloch.
Also included are interviews with John Huston and Rex Stout, a conversation with Woody Allen, brief articles on Isaac Asimov and Robert A. Heinlein, two deleted prologues and an analysis of The Demolished Man , plus a memorial for Bester written by Isaac Asimov and an introduction by Gregory S. Benford.
James Patrick Kelly is an American science fiction author.
Virtual Unrealities is a collection of science fiction short stories by American writer Alfred Bester with an introduction by Robert Silverberg.
Henry Slesar was an American author, playwright, and copywriter. He is famous for his use of irony and twist endings. After reading Slesar's "M Is for the Many" in Ellery Queen's Mystery Magazine, Alfred Hitchcock bought it for adaptation and they began many successful collaborations. Slesar wrote hundreds of scripts for television series and soap operas, leading TV Guide to call him "the writer with the largest audience in America."
"Time Is the Traitor" is a science fiction short story by American writer Alfred Bester, originally published in The Magazine of Fantasy and Science Fiction in September, 1953. It is included in the Bester collections The Dark Side of the Earth (1964), Star Light, Star Bright (1976) and Virtual Unrealities (1997) and has been extensively anthologized.
Flowers for Algernon is the title of a science fiction short story and a novel by American writer Daniel Keyes. The short story, written in 1958 and first published in the April 1959 issue of The Magazine of Fantasy & Science Fiction, won the Hugo Award for Best Short Story in 1960. The novel was published in 1966 and was joint winner of that year's Nebula Award for Best Novel.
This is a complete bibliography by American science fiction author Larry Niven.
"The Pi Man" is a science fiction short story by American writer Alfred Bester. It was first published in Fantasy and Science Fiction, in 1959. Bester subsequently revised it extensively for his 1976 collection Star Light, Star Bright, changing the characters' names, "develop(ing) minor scenes", modifying the typographical "word pictures", and deleting several "stale references to beatnik culture".
↑ Alfred Bester, "United States Social Security Death Index". "United States Social Security Death Index," index, FamilySearch, Alfred Bester, September 1987. Retrieved 2013-03-12.
↑ Harrison, Harry (1996). "Introduction". The Demolished Man. New York: Vintage Books. p. vii. ISBN 978-0-679-76781-7.
1 2 "Damon Knight Memorial Grand Master" Archived 2011-07-01 at the Wayback Machine . Science Fiction and Fantasy Writers of America (SFWA). Retrieved 2013-03-22.
1 2 "Science Fiction and Fantasy Hall of Fame" Archived May 21, 2013, at the Wayback Machine . Mid American Science Fiction and Fantasy Conventions, Inc. Retrieved 2013-03-22. This was the official website of the hall of fame to 2004.
↑ The New York Times . February 25, 1934. "Captain Alfred Bester of New York gained two epee victories for the Red and Blue."
1 2 "Rolly Bester". The New York Times . January 18, 1984.
↑ Robb, Brian (May 15, 2014). A Brief History of Superheroes: From Superman to the Avengers, the Evolution of Comic Book Legends. Little, Brown Book Group. p. 114. ISBN 9781472110701.
↑ "Alfred Bester dies, sci-fi writer," Sunday Intelligencer/Montgomery Count Record, October 4, 1987.
1 2 Alfred Bester at the Internet Speculative Fiction Database (ISFDB). Retrieved 2013-04-11. Select a title to see its linked publication history and general information. Select a particular edition (title) for more data at that level, such as a front cover image or linked contents.
↑ Green Lantern #223. April 1988. pp. letters page.
↑ Schwartz, Julius (2000). Man of Two Worlds: My Life in Science Fiction and Comics. New York: Harper Collins. pp. 67–68. ISBN 978-0-380-810512.
↑ "Free Audio SF - CBS Radio Mystery Theater". Hard SF. Archived from the original on 2011-06-29. Retrieved 2011-02-10.
↑ "Alfred Bester". Library of America. Archived from the original on 2012-09-22. Retrieved 2012-10-05.
↑ Biller, Diana (December 25, 2015). "The Essential Cyberpunk Reading List". io9. Retrieved January 26, 2016. This 1956 novel, originally serialized in four parts in Galaxy magazine, predates the cyberpunk movement by more than twenty years, but nonetheless serves as one of its more important ancestors. With its bleak future, cybernetic body modification and evil megacorporations, The Stars My Destination set up a number of themes that became central to later cyberpunk works.
↑ Hiltzik, Michael (January 1, 2016). "A New Year's list: Five great sci-fi novels to make you forget 'Star Wars'". The Los Angeles Times . Retrieved January 26, 2016. Bester is a science fiction master unappreciated by the general reader but known as an important influence on Stephen King and the "cyberpunk" movement; The Stars My Destination frequently turns up on aficionados' lists of the greatest science fiction works of all time.
↑ Berthoud, Ella and Susan Elderkin (2013). The Novel Cure. Edinburgh: Canongate. p. W.
↑ Cavallaro, Dani (2000). Cyberpunk & Cyberculture: Science Fiction and the Work of William Gibson. London: Athlone Press. p. 9. ISBN 978-0-485-00412-0.
↑ BBC Radio 4 (14 September 1991). "The Shape of Things to Come". BBC. Retrieved January 26, 2016.
↑ BBC Radio 4 (16 August 1993). "Tiger! Tiger!". BBC. Retrieved January 26, 2016.
↑ Anders, Charlie Jane (Aug 10, 2012). "100 Wonderful and Terrible Movies That Never Existed". io9 . Retrieved 2012-10-05.
↑ Wendell, Carolyn (2006). Alfred Bester. Wildside Press. p. 46.
↑ The Hugo Awards. "1960 Hugo Awards". World Science Fiction Society. Archived from the original on May 7, 2011. Retrieved June 17, 2014.
↑ Lee, R. E. "The Series: Alcoa Premiere; The Episode: Mr. Lucifer". Bob's Bewitching Daughter: Elizabeth Montgomery. Archived from the original on August 20, 2016. Retrieved June 17, 2014. Satan invades Madison Avenue: Mr. Lucifer, the Prince of Darkness himself, determines to corrupt a clean-cut young couple with the help of his beautiful secretary, Iris, a former moon goddess, now transformed into a demon.
↑ "Watch Alcoa Premiere Season 2 Episode 5 S2E5 Mr. Lucifer". OVGuide . Retrieved June 17, 2014.
↑ The Hugo Awards. "1975 Hugo Awards". World Science Fiction Society. Archived from the original on February 11, 2012. Retrieved June 17, 2014.
↑ The Hugo Awards. "1976 Hugo Awards". World Science Fiction Society. Archived from the original on May 7, 2011. Retrieved June 17, 2014.
↑ Wendell, Carolyn (March 1988). "The Late, Great Alfie B., 1913-87". Science Fiction Studies . 15 pt. 1 (44). ISSN 0091-7729 . Retrieved 2012-10-05.
↑ McQuown, Judith H. (November 1987). "Remembering Alfred Bester". Locus: The Magazine of the Science Fiction & Fantasy Field . Oakland, California: Locus Science Fiction Foundation. 20, No. 11 (#322): 63.
↑ Science Fiction Writers of America. "Nebula Award Winners: 1965 – 2011". Science Fiction Writers of America . Retrieved June 17, 2014.
↑ Sturgis, Amy H. (2011). ""Just Get Us a Little Further"". In Dean A. Kowalski; S. Evan Kreider. The Philosophy of Joss Whedon. Lexington, Kentucky: University Press of Kentucky. p. 24.
1 2 "Bester, Alfred" Archived 2012-10-16 at the Wayback Machine . The Locus Index to SF Awards: Index of Literary Nominees. Locus Publications. Retrieved 2013-03-22.
Bester, Alfred (1976). "My Affair with Science Fiction". Star Light, Star Bright: The Great Short Fiction of Alfred Bester. II. New York: Berkley. pp. 220ff.
"Alfred Bester biography". Science Fiction and Fantasy Hall of Fame .
|
0.997761 |
What started as one Primary classroom of 19 students has grown to multiple Toddler through Middle School programs, with a current enrollment of 250 children. For 40 years, thousands of children have learned, grown and developed as part of the Village School.
Marilyn Larkin and Lynne Wasserman founded The Village School for Children on September 7, 1977. In a single classroom 19 children, 3 to 6 years old, were welcomed into a school environment based on the philosophy of Maria Montessori. This Primary Program classroom was adapted to the developmental needs of the children, providing a variety of choices that engage the child’s natural curiosity and intellect. Activities emphasized the process of discovery, enabling each child to explore the world through multi-sensory materials.
In 1982, a Full-Day Primary program was offered and enrollment increased to 81 students. This addressed the growing need for a quality all-day program for children with both parents working outside the home. Dadmara DeSantis was instrumental in designing and implementing this program and joined Marilyn Larkin as one of the school’s directors in 1983.
In 1986, the teachers became increasingly interested in offering a Montessori education to the younger children. This resulted in the beginning of the Toddler Program for children 18 to 36 months old. The Toddler Program is a safe and supportive environment which introduces the child to the Montessori classroom in a small, intimate setting. As today, the program offered 2, 3 and 5 day options.
With the success of the programs for younger children, families within the school lobbied for additional programs. The Lower Elementary Program, for children 6-9 years old, began in 1989 with a class of nine students. This program challenges children to think creatively and critically. The interdisciplinary curriculum focuses on research and problem solving to help develop interdependence, organizational skills and strong work habits.
In 1990, an “extended day” option was added to the Primary program for children five years old at the beginning of the school year. This differs from the full day primary program as the children have different work and meet in a different classroom during their Extended Day class times. This program serves as a transition and introduction from Primary to Lower Elementary.
The Upper Elementary Program, for children 9 to 12 years old, began in 1995. Building on the foundation of Lower Elementary, the Upper Elementary Program reflects students’ gradual developmental shift to abstract thinking using specific curriculum and materials that help support this passage.
Again, at the request of and with the support of Village School families, the school expanded in 1998 to include a Middle School program for the seventh and eighth grades. This program provides a challenging and supportive environment in which the adolescent may explore, question and formulate principles related to academic, personal and social growth. The original class consisted of five students and in 2000 the school proudly celebrated the graduation of its first class of eighth grade students.
The school was originally located in one classroom at the Old Paramus Church’s Educational Building in Ridgewood, New Jersey. An additional classroom was added in 1982 when the Full-Day primary program was included. By the time the Toddler Program was offered, the School occupied the entire lower level of the building. With no more space at the current location and the growth of the school required by the Lower Elementary program and an additional Primary classroom, additional space was secured at Orchard School, a Public School in Ridgewood, New Jersey.
Eventually, the size and scope of the school made it desirable for all programs to be under one roof. In 1997 the entire school moved to the Alexander Hamilton School building in Glen Rock, New Jersey. The Dedication Ceremony was attended by over 400 people and included tours of the location, highlighted by the new playground donated by Village School families.
After several years, the school was faced with another facilities challenge. Due to its own increasing enrollment, Glen Rock did not renew the lease for the building. The Village School entered what could best be described as a transition year. New space was found, but was not immediately available. Once again the school was divided with the Toddler and Primary Programs occupying space at Glen School in Ridgewood and the Elementary and Middle School Programs at Mount Caramel also in Ridgewood.
Family involvement has always been an important aspect of the school. What we know today as the Parent Association started in 1980 as the Parent Guild. Over the years, parents have willingly offered financial and professional expertise allowing the school to build its programs and establish a solid foundation for continued growth. Parent volunteers are also an integral part of the school community as they share with the children a special skill or hobby, read to groups in the library and greet arriving students in the court yard.
Today, the purpose of The Village School Parent Association is to support the mission of The Village School and to promote a supportive school community by strengthening ties among families of students. Activities include community building events, such as extra-curricular and social activities that involve parents and students, and fund-raising events that engage parents in a spirited and productive manner.
In 1993, a fundraising effort for a new playground led to the formation of the Village School Development Committee. And with a Development Committee comes an Annual Fund. The first Annual Development Fund drive was conducted that year and raised about $15,000.
After the playground was completed, the Development Committee focused on the move to Glen Rock in 1996. Then the establishment of an endowment fund to ensure continued financial stability for the school.
The first Auction was held in 1999. This annual event continues to serve the school and its community in two very special ways: the parents have a night to socialize away from the school environment and approximately 25% of annual funds are raised in one evening.
A very successful Capital Campaign was conducted from April 2000 through December 2002 to raise additional funds to purchase and refurbish the now permanent home of the Village School. The success of this endeavor proved once again how special and significant the continuing involvement and generosity of the parents are to the school.
Strong support has continued for 16 years; with 61% of VS Families participating in the 2012-2013 Annual Fund. Many items on the school’s “wish list” have become a reality due to the continued participation and generosity of the parents.
Over the years, the Development Committee has been chaired by 11 parents who have held vital roles in the continued success of the school. That quest for a new playground 13 years ago started something very special – over $3,500,000 has been raised through the Annual Development Fund.
As programs and staff began to increase, the school’s administration considered involvement with professional Montessori organizations to be a critical part of its growth and development.
In 1983, The Village School became a Center for Montessori Teacher Education host training site for Primary level teachers. Some teachers served as teacher-trainers for CMTE and assistants were able to earn their Montessori Teacher certification through this accredited organization.
The school’s continued growth in size and program levels coincided with an invitation in 1991 by the American Montessori Society to become involved in a pilot program of self-study which would result in joint accreditation by the Middle States Association of Colleges and Schools and the American Montessori Society. This process of self-study brought school administration, faculty and parents together in a unique and cooperative venture that validated the school’s past goals, objectives and outcomes. It also helped to articulate goals for the school’s future.
As a result of the self-study process, in 1992 The Village School became the first independent school in New Jersey to be jointly accredited by both Middle States Association of Colleges and Schools and the American Montessori Society.
The Accreditation process is revisited about every 10 years, with the last self-study process taking place in 2013. This process continues to validate the efforts of all involved with the school.
Over the years, The Village School has expanded, moved, bettered itself and most of all become a community where children and families can reach out and find what the world has to offer.
1977 Village School Founded as a Montessori School with one Primary class of 19 children ages 3-6.
1980 Parent Association started as the Parent Guild.
1989 A Lower Elementary Program began with 9 students ages 6 to 9 years.
1992 Became the first independent school in NJ to be jointly accredited by the Middle States Association of Colleges and Schools and the American Montessori Society.
1993 Fundraising effort for a new playground led to the formation of The Village School Development Committee and The Annual Fund raising $15k in its first year.
1998 Middle School program for five 7th and 8th graders was added.
1999 First Auction was held to raise money for the school and continues to raise approximately 25% of The Annual Fund each year.
2000-2001 A successful Capital Campaign raised funds to purchase and refurbish the now permanent home of The Village School.
2014 Enrollment is approximately 261 students and the facilities include: a brand new state of the art gymnasium; auditorium; music, art, technology and science rooms; a playing field and multiple playgrounds. Coming soon: a media center, new classrooms, music practice rooms, and office space.
|
0.964271 |
"Hound Dog" was written by Jerry Leiber and Mike Stoller for blues singer Big Mama Thornton in 1953. The original lyrics contain a sexual connotation, and Thornton belted out her version in a gritty, slow blues style. Elvis' humorous interpretation was borrowed from Freddie Bell and the Bellboys.
Elvis recorded two versions of the Dave Bartholomew-Pearl King blues tune "One Night of Sin," which had been a hit for Smiley Lewis in 1956. On January 24, 1957, he recorded Lewis' version, and a month later he recorded the song as "One Night" using cleaned-up lyrics. In Lewis' risqué original, the singer is praying for "One night of sin," while in Elvis' more hopeful rendition, he is hoping for "One night with you..."
Tin Pan Alley songwriters Lou Handman and Roy Turk composed "Are You Lonesome Tonight?" ("To-night" on original record sleeve) in 1926, and it was originally recorded by Al Jolson the following year. Supposedly the only song Colonel Tom Parker ever urged Elvis to record, "Are You Lonesome Tonight?" was released by Elvis in 1960 and was nominated for three Grammys.
"Bridge Over Troubled Water" was composed by Paul Simon and Art Garfunkel and recorded by the folk-rock duo in 1970, becoming a number-one hit for them. Elvis recorded his version, which had a larger sound and a more dramatic vocal rendering, during the filming of Elvis -- That's the Way It Is.
Eddy Arnold, "the Tennessee Plowboy," had a hit record with the soft-sounding ballad "I Really Don't Want to Know" in 1954, just as Elvis was barn-storming across the South with his rockabilly style. Composed by Howard Barnes and Don Robertson, the song was released by Elvis in 1970 with another country tune, "There Goes My Everything," on the flipside. These songs represent Elvis' rediscovery of contemporary country music during the 1970s.
Originally arranged and recorded by country singer Mickey Newbury, "An American Trilogy" is a medley of "Dixie," "The Battle Hymn of the Republic," and "All My Trials." The integration of two Civil War songs (one a Southern anthem, the other a Northern anthem) with a traditional spiritual suggests the curiously Southern tradition of blending diverse cultural elements. Elvis' 1972 version of the piece offered an operatic interpretation that matched the breadth of the song's meaning.
Elvis sang James Taylor's 1970 composition "Steamroller Blues" in concert during the early 1970s, but his gritty rendition during the Aloha from Hawaii television special stopped the show. The version from the special was released as a single in April 1973.
In 1968, country singer Marty Robbins wrote "You Gave Me a Mountain," a wrenching ballad about life's hardships. Though pop star Frankie Laine was the first to release it, Elvis began singing the song in concert during the early 1970s and released it in 1973. Elvis' interpretation is generally considered autobiographical in that it paralleled his breakup with Priscilla Presley.
"My Way," an anthem of independence and individuality, was written by Paul Anka for Frank Sinatra and originally recorded by him in 1969. Elvis sang "My Way" on the Aloha from Hawaii television special and in concert during the 1970s. A recording of this song by Elvis was released shortly after he died, making it almost a biographical statement.
Elvis Presley's best cover songs show Presley's talents as a performer, musician, and interpreter of old traditions. "That's All Right" was written and recorded by Arthur "Big Boy" Crudup as a country blues tune in 1947 and reworked by Elvis in 1955. His faster-paced, rockabilly interpretation became his first single release.
|
0.999989 |
Are you a React Software Engineer? Software Engineers continue to be one of the most exciting and in-demand developer jobs available. Engineers code websites or applications on both the server and the client-facing side. It is a role that fuses both creative and practical concerns, as these engineers are responsible for everything the website user encounters, including scrolling functions and graphics, as well as creating the logic, database interactions and server configuration on the application's backend.
|
0.999476 |
The band has an excellent flute player who has practiced playing her instrument since she was only five years old.
You need to be able to accurately break down the flute and understand if it is a positive or negative thing for you.
I played the flute in fourth grade and I guess I did it really well because I ended up winning an award.
|
0.999873 |
Let's say you'd like to create a virtual expert to answer questions about bookkeeping procedures, final reporting procedures, annual report creation, etc.
Using Theum Contributor, divide the virtual expert into libraries. These provide an easy way to "categorize" the knowledge you'll contribute to the virtual expert. In this case we wish to separate everything into two libraries: Reporting and Procedures.
Creating a library is as easy as entering a name and clicking on Save.
Now select any number of Microsoft Office, PDF, and other documents that belong together (regardless of where they are managed) and organize them into Theum books. Create an intuitive table of contents for each book using drag-and-drop. Select the library where each book should be published and click Contribute.
There’s no need to reformat documents, use specialized authoring tools, start a complex metadata effort, manage intricate taxonomies, or change the way you do things.
Theum extracts and "atomizes" the paragraphs, lists, tables, and images in your documents and assembles these atoms into a highly specialized neural network. Every atom in the network is additionally "normalized" into a standard format, making it easy to process and consistently format.
Advanced context analysis algorithms then analyze the knowledge and build additional inter-atom relationships. The resulting intelligent network makes it possible to query, navigate, dynamically assemble, and present knowledge in ways document-oriented systems cannot.
Theum builds your virtual expert in the background as you contribute documents: no complex details, document migration, or cutting/pasting is required. Your documents stay where they are, unchanged.
Theum eliminates the hassle of searching, launching, and scrolling through source documents and PDFs by delivering their atomized knowledge as standard web content. Users enjoy an intuitive, ultra-modern, visually appealing experience that's optimized for use on every device.
Users hit the ground running from the minute they open any virtual expert.
Theum's one-of-a-kind, AI-driven Thematic Query selects the knowledge atoms relevant to a given query from one or more virtual experts, dynamically analyzes and organizes them by context, and guides the user to the exact knowledge needed to get the job done. The results are then assembled into an understandable answer and presented on a single page. Users get a complete answer to any question with a click.
Theum enables users to act with an increased level of expertise, improving speed, accuracy, and on-boarding time.
Because every Theum virtual expert knows about the others, users can query across them transparently and in parallel as new ones come online—without having to know where to look. There's no better way to ensure the left hand knows what the right hand is doing.
Whether you need to deliver a small set of mission-critical documents or act on a more comprehensive knowledge management mandate, Theum is the fast, powerful, and modern way to get the job done.
Explore our example virtual expertTry it now!
|
0.999831 |
During the great battle of Trafalgar, fought on October 21, 1805, the French 74 gun ship of the line Redoutable engaged the British 100 gun warships Victory and Temeraire, nearly capturing Nelson’s own flagship (HMS Victory) before being beaten by the combined firepower of the British ships. The Redoutable’s stout performance during the battle resulted in the death of Admiral Nelson himself, and the damaging of two of the Royal Navy’s three-decker ships of the line. Redoutable’s Captain Jean Jacques Etienne Lucas was personally awarded the gold cross of the legion of honor by Napoleon in recognition of his ship’s service.
The report below was written by Captain Lucas after the battle as part of his report to the naval ministry, and represents one of several reports written by Lucas regarding the battle. A few points which should be clarified include the following: (1) According to British eyewitnesses, Victory ceased firing at two points in the engagement not because her guns had been silenced but because of a false belief that Redoutable was surrendering (she was not). Lucas apparently mistook these pauses in firing as silencing of his enemy’s guns. (2) The involvement of the French warship Fougueux seems to have been somewhat different than Lucas understood at the time of his report. In reality Fougueux was attempting to come to Redoutable’s aid when it fouled Temeraire and was dismasted during that engagement.
Made to his Excellency the Minister of Marine and of the Colonies, by M. Lucas, naval captain, officer of the Legion of Honour, on the sea battle of Trafalgar between the combined fleet of France and Spain under the orders of Admirals Villeneuve and Gravina and the English fleet commanded by Admiral Nelson ; and particularly on the combat between the Victory of 110 guns with the flag of Admiral Nelson, the Temeraire of the same force and another ship, a two decker, and the Redoutable, of which His Majesty had entrusted me with the command.
Although the loss of the Redoutable forms a part of the defeat undergone by the Combined Fleets of France and Spain in the sanguinary battle off Cape Trafalgar, the part taken by this particular ship, all the same, deserves a distinguished place by itself in the annals of the French Navy. In consequence I owe it to the memory of the brave men who fell in the terrible fight, or went down in the remains of the Redoutable when she sank, I owe it also to the glory of the small band of those who survived that inexpressible slaughter, to bring under the notice of your Excellency a picture of their exploits, the efforts of their valour, and above all the expressions of their love for, and attachment to, His Imperial and Royal Majesty, whose name, repeated a thousand times with the utmost enthusiasm, seemed to render them invincible. Nothing could equal the ardour of such heroes at the moment that I announced to them that we were going to board the English flagship; and not even the intrepid Nelson himself could have died more nobly than in combating enemies so worthy of his courage and of his grand reputation.
I will not undertake here to explain the movements of the two fleets during the whole of the action. Surrounded myself with fire and smoke, I was only able at intervals to discern the ships in my immediate neighbourhood. . . . But I will enter into all the details of what took place on board the Redoutable during the contest that my ship went through at the cannon’s mouth and, broadside to broadside with a ship of a hundred and ten guns, the Temeraire of the same force, and a third ship, a two-decker, of which I do not know the name.
The enemy’s column, which was directed against our centre, was at eleven o’clock on the port side, and the flagship Bucentaure began firing. I ordered a number of the captains of the guns to go up on the forecastle and observe why it was some of our ships fired badly. They found that all their shots carried too low and fell short. I then gave orders to aim for dismasting, and above all to aim straight. At a quarter to twelve the Redoutable opened fire with a shot from the first gun division. It cut through the foretopsail yard of the Victory, whereupon cheers and shouts resounded all over the ship. Our firing was well kept up, and in less than ten minutes the British flagship had lost her mizen-mast, foretopsail, and main . Meanwhile I always kept so close to the Bucentaure that several times they called to me from their stern gallery that I should run them down; indeed, the of the Redoutable touched the crown of the flagship’s taffrail; but I assured them they had nothing to be anxious about.
The damage done to the Victory did not affect the daring manoeuvre of Admiral Nelson. He repeatedly persisted in trying to break the line in front of the Redoutable, and threatening to run us down if we opposed. But the proximity of the British flagship, though closely followed by the Temeraire, instead of intimidating my intrepid crew, only increased their ardour; and to show the English admiral that we did not fear his fouling us, I had grappling irons made fast at all the yardarms.
The Victory having now succeeded in passing astern of the French admiral, ran foul of us, dropping alongside and sheering off aft in such a way that our poop lay alongside her . From this position the grappling irons were thrown on board her. Those at the stem parted, but those forward held on; and at the same time our broadside was discharged, resulting in a terrible slaughter. We continued to fire for some time, although there was some delay at the guns. We had to use rope rammers in several cases, and fire with the guns run in, being unable to bowse them, as the ports were masked by the sides of the Victory. At the same time, elsewhere, by means of muskets fired through the ports into those of the Victory, we prevented the enemy from loading their guns, and before long they stopped firing on us altogether. What a day of glory for the Redoutable if she had had to fight only with the Victory! The English batteries, not being able to resist us longer, ceased firing (les batteries du Victoire ne pouvaient plus nous riposter). Then I became aware that the crew of the enemy were about to attempt to board us. At once I had the trumpets sounded, giving the divisional call for boarding. All hastened up from below instantly, in fine style; the officers and midshipmen sprang to the head of their men, as though at a parade. In less than a minute our decks swarmed with armed men, who spread themselves with rapidity on the poop and in the nettings and the shrouds.
It would be impossible to say who was the foremost.
Then a heavy fire of musketry opened, in which Admiral Nelson fought at the head of his crew. Our firing, though, became so rapid, and was so much superior to his, that in less than a quarter of an hour we had silenced that of the Victory altogether. More than two hundred grenades were flung on board her, with the utmost success; her decks were strewn with the dead and wounded. Admiral Nelson was killed by the firing of our musketry. Immediately after this, the upper deck of the Victory became deserted, and she again ceased firing, but it proved difficult to board her because of the motion of the two vessels, and the height of the Victory’supper tier and battery. On that I gave the order to cut the supports of the main-yard so that it might serve as a bridge. At the same time Midshipman Yon and four seamen sprang on board the Victory by means of her anchor, and we then knew that there was nobody left in the batteries. At that moment, when my brave fellows were hastening to follow, the three-decker Temeraire, which had seen that the Victory fought no longer and must without fail be taken (allait infailliblement entre pris), came down, full sail, on our starboard side. We were immediately under the full fire of her artillery, discharged almost with muzzles touching.
It is impossible to describe the carnage produced by the murderous broadside of this ship. More than two hundred of our brave men were killed or wounded by it. I was wounded also at the same time, but not so seriously as to make me abandon my post. Not being able to undertake anything on the side of the Victory, I now ordered the rest of the crew to man the batteries on the other side and fire at the Temeraire with what guns the collision when she came alongside had not dismounted.
The Victory by this time fought no longer. She busied herself only with getting clear of the Redoutable. We, however, meanwhile, were being cut to pieces by the cross fire from the Temeraire, with whom we still fought, and from the other ship, which was still firing into us at the stern. Unable to meet that fire, and not seeing any chance of rescue, the rest of our ships being all too far to leeward to be able to come to our assistance, I hesitated no longer about surrendering. The leaks were sufficiently serious to ensure the ship going to the bottom, so that the enemy would not keep her. When I satisfied myself finally about this, I gave orders to lower the colours. The flag, however, came down by itself with the fall of the mizen-mast.’ We were then left by the ship which had been firing into us astern, but the Temeraire continued to fire on us. She did not give over until her men were obliged to do so by having to work at extinguishing a fire which had broken out on board their own ship. It was then half-past two in the afternoon.
The Victory, the Redoutable, with the Temeraire and the Mercure [sic], were all the time joined together, owing to their masts having fallen across from one ship to the other. Unable to use their helms, they formed one mass, which drifted at the mercy of the wind. In that way they came foul of the Fougueux, which, having fought against several of the enemy’s ships, had been left by them without having lowered her flag. She was dismasted and unrigged, and floating an unmanageable hulk. On fouling the group of ships she was boarded by the Temeraire. The Fougueux was, however, beyond making serious resistance. Her brave captain, Baudouin, though, even then made an effort, but in vain. He was killed at the outset, and his second in command was wounded at the same moment; whereupon some men of the Temeraire sprang on board and took possession.
The enemy took no steps to take possession of the Redoutable, in which the leaks were so considerable that I feared the ship would sink before they would be able to get the wounded out. I represented the state of things to the Temeraire, and warned them that unless they took steps at once to send men on board with gear for the pumps and give us immediate succour, I would have to set fire to the ship, which would involve the Temeraire and the Victory. Immediately after that two officers and some seamen and marines came on board and took possession of the ship. One of the English marines, who entered on the lower deck through a port, was attacked by one of our wounded sailors armed with a musket and bayonet. He fell on the Englishman with fury, shouting, ‘I must kill one more of them!’ He bayoneted the marine through the thigh, and the man fell between the two vessels. In spite of this incident, however, I was able to induce the English party to remain on board. They wanted to return to their own ship and leave us.
Towards three o’clock some of the ships of our van squadron which were to windward on the starboard tack and apparently about to draw off from the battle, without having been perceptibly damaged, fired several shots at our group, but from a long range. Several of their cannon balls fell on board the Redoutable, and one of the English officers had his thigh shattered and died in a few moments.
At half-past three, the Victory separated herself from the Redoutable, but she was in so dismantled a state as to be hors de combat.’ It was not until seven in the evening that they were able to get the Redoutable clear of the Temeraire, which still, however, remained foul of the Fougueux. We had not yet been formally taken possession of, but the English Swiftsurenow arrived and took us in tow.
We spent the whole of that night at the two pumps which were all that remained workable, without, however, being able to keep the water under. The few Frenchmen who were able to do duty joined with the English party on board in pumping, stopped several leaks, blocked up the port holes and boarded in the poop of the ship, which was ready to cave in. Indeed, no toil was too hard for them. In the middle of all the turmoil and horrible disorder on board, just keeping the ship above water, with the ‘tween-decks and batteries encumbered with dead, I noticed some of my brave fellows, particularly the young midshipmen, of whom several were wounded, picking up arms which they hid on the lower deck, with the intention, as they said, of retaking the ship. Never were so many traits of intrepidity, of valour and daring, displayed on board a single ship ; the whole history of our navy can show nothing like them.
Next morning the captain of the Swiftsure sent a boat to take me on board, together with Lieutenant Dupotet and Midshipman Ducrest, and we were duly conducted there. At noon the Redoutable lost her foremast, the only mast she had left. At five in the evening the water continued so to gain on the pumps that the prizemaster made signals of distress, and all the boats of the Swiftsure were lowered to rescue the crew. It was blowing very hard at the time, and the sea ran very high, which made the getting out of the wounded very difficult. These poor fellows, on its being seen that the ship was going down, were nearly all brought up and laid on the . They were able to save several of them. At seven in the evening the poop was entirely submerged. The Redoutable sank with a large number of the wounded still on board. They met their death with courage worthy of a better fate. A hundred and sixty-nine men, forming the remainder of the brave crew of the Redoutable, found themselves together on board the English ship. Seventy of the number were badly wounded and sixty-four of the rest had less serious wounds. All the wounded were sent into Cadiz under a flag of truce, and in the end only thirty-five men from the Redoutable were taken to England as prisoners of war.
The results of the battle as regarded the Redoutable were these: the loss of the ship and destruction of threequarters of her crew. On the other hand, single-handed, she had throughout the battle engaged the attention of two three-deckers, the Victory and Temeraire; and in this way had fully occupied Admiral Nelson himself, who, taken up with this one encounter, could only free himself by excessive daring. England has lost the hero of her navy, who fell before the brave men of the Redoutable. More than three hundred men, several of them superior officers, were put hors de combat on board the enemy’s ships. The Victory lost her mizen topmast in the action and main ; and in general all her yards were badly damaged and also the wheel. The Temeraire lost two of her topmasts; two lower yards, and her helm and rudder were destroyed by the guns of our upper deck. Both ships had to return to England to undergo large repairs.
I add to this report a return of the ship’s company of the Redoutable, both before and after the battle. It will show you the loss of men of each class. I also add a list of the officers by name, both of the etat Major and the midshipmen. The praise and commendation due from me to one and all are beyond expression. No one who did not see the valour of the officers and young midshipmen told off to lead our boarding parties can form an idea of their ebullient ardour, their splendid audacity-especially when, at the head of the brave men that each commanded, they stood in front of the boarding-nettings, armed some with pistols and cutlasses, others with carbines, all directing the fire of the musketry and the flinging of the grenades. In this, the officers of infantry and those of the ship, the sailors and soldiers alike, all displayed unsurpassable courage, and in presenting my list of them it is impossible to name which were the most meritorious.
Monseigneur, I have the honour to be your Excellency’s most humble and obedient servant.
Captain Commandant of the Redoutable.
Courtesy of the War Times Journal.
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.