identifier
stringlengths 6
14.8k
| collection
stringclasses 50
values | open_type
stringclasses 7
values | license
stringlengths 0
1.18k
| date
float64 0
2.02k
⌀ | title
stringlengths 0
1.85k
⌀ | creator
stringlengths 0
7.27k
⌀ | language
stringclasses 471
values | language_type
stringclasses 4
values | word_count
int64 0
1.98M
| token_count
int64 1
3.46M
| text
stringlengths 0
12.9M
| __index_level_0__
int64 0
51.1k
|
|---|---|---|---|---|---|---|---|---|---|---|---|---|
https://github.com/alicja-mruk/android-recruitment-test/blob/master/app/src/main/java/dog/snow/androidrecruittest/repository/db/model/Album.kt
|
Github Open Source
|
Open Source
|
Apache-2.0
| 2,021 |
android-recruitment-test
|
alicja-mruk
|
Kotlin
|
Code
| 39 | 140 |
package dog.snow.androidrecruittest.repository.db.model
import android.os.Parcelable
import androidx.room.ColumnInfo
import androidx.room.Entity
import androidx.room.PrimaryKey
import kotlinx.parcelize.Parcelize
@Parcelize
@Entity(tableName = "album")
data class Album(
@PrimaryKey(autoGenerate = false) val id: Int,
@ColumnInfo (name = "albumTitle") val title: String,
@ColumnInfo val userId: Int
) : Parcelable
| 25,073 |
https://github.com/developmentseed/ml-enabler/blob/master/api/migrations/20210913183520_aoi-iter-id-null.js
|
Github Open Source
|
Open Source
|
BSD-2-Clause
| 2,022 |
ml-enabler
|
developmentseed
|
JavaScript
|
Code
| 34 | 99 |
exports.up = function(knex) {
return knex.schema.raw(`
ALTER TABLE aois
ALTER COLUMN iter_id DROP NOT NULL;
`);
}
exports.down = function(knex) {
return knex.schema.raw(`
ALTER TABLE aois
ALTER COLUMN iter_id SET NOT NULL;
`);
}
| 35,750 |
https://github.com/NyBatis/NyBatisCore/blob/master/src/test/java/org/nybatis/core/reflection/core/JsonConverterTest.java
|
Github Open Source
|
Open Source
|
Apache-2.0
| 2,019 |
NyBatisCore
|
NyBatis
|
Java
|
Code
| 221 | 862 |
package org.nybatis.core.reflection.core;
import org.nybatis.core.db.orm.table.customAnnotationInsert.entity.Person;
import org.nybatis.core.db.orm.table.customAnnotationInsert.entity.PersonProperty;
import org.nybatis.core.log.NLogger;
import org.nybatis.core.reflection.Reflector;
import org.nybatis.core.reflection.core.testClass.Chain;
import org.nybatis.core.reflection.core.testClass.KeyNameDifferentEntity;
import org.nybatis.core.reflection.mapper.NObjectMapper;
import org.nybatis.core.reflection.mapper.NObjectSqlMapper;
import org.testng.Assert;
import org.testng.annotations.Test;
/**
* @author [email protected]
* @since 2017-11-27
*/
public class JsonConverterTest {
@Test
public void toJson() throws Exception {
JsonConverter $ = new JsonConverter( new NObjectMapper() );
Person person = new Person();
String json = $.toJson( getSampleData(), true, true, true );
NLogger.debug( json );
json = $.toJson( getSampleData(), false, false, true );
NLogger.debug( json );
NLogger.debug( Reflector.toJson( getSampleData(), true, true, true ) );
NLogger.debug( Reflector.toJson( getSampleData(), true, false, true ) );
}
private Person getSampleData() {
Person person = new Person( "01001", "Jhon Dow", 21 );
person.getProperty().add( new PersonProperty( "01001", "America", "Delaware" ) );
return person;
}
@Test
public void recursiveErrorFree() {
JsonConverter $ = new JsonConverter( new NObjectSqlMapper() );
String json = "{\n" +
"\"projectId\":\"SAC001\",\n" +
"\"completeDate\":\"2017-11-28T16:37:07.458+0900\",\n" +
"\"chainId\":\"SAC001:00000001\",\n" +
"\"chainName\":\"UserDownloadInfo.getRawUserDownloadInfo\",\n" +
"\"chainType\":\"SQL\",\n" +
"\"skipYn\":\"N\",\n" +
"\"existYn\":\"N\",\n" +
"\"possibleChains\":\"{}\",\n" +
"\"chainProp\":\"{}\",\n" +
"\"etcProp\":\"{}\"\n" +
"}";
// Chain chain = Reflector.toBeanFrom( json, Chain.class );
Chain chain = $.toBeanFrom( json, Chain.class );
NLogger.debug( Reflector.toJson( chain ) );
NLogger.debug( $.toJson( chain ) );
}
@Test
public void bindJsonOnFieldHavingDifferentMethodName() {
JsonConverter $ = new JsonConverter( new NObjectSqlMapper() );
String json = "{\"age\":21,\"name\":\"Jhon Dow\"}";
KeyNameDifferentEntity entity = $.toBeanFrom( json, KeyNameDifferentEntity.class );
NLogger.debug( Reflector.toJson( entity ) );
Assert.assertEquals( entity.getNameAnother(), "Jhon Dow" );
}
}
| 27,316 |
https://github.com/swhgoon/wookie-view/blob/master/src/main/scala/wookie/WookiePanel.scala
|
Github Open Source
|
Open Source
|
Apache-2.0
| 2,014 |
wookie-view
|
swhgoon
|
Scala
|
Code
| 432 | 1,738 |
package wookie
import java.lang
import java.text.SimpleDateFormat
import java.util.Date
import javafx.beans.value.{ChangeListener, ObservableValue}
import javafx.concurrent.Worker
import javafx.event.{ActionEvent, EventHandler}
import javafx.scene.control.{Button, TextArea, TextField}
import javafx.scene.input.{KeyCode, KeyEvent}
import javafx.scene.layout.{HBox, Priority, VBox}
import javafx.scene.web.WebErrorEvent
import wookie.WookiePanel.JS_INVITATION
import wookie.view.WookieView
object WookiePanel{
final val JS_INVITATION = "Enter JavaScript here, i.e.: alert( $('div:last').html() )"
def newBuilder(wookie: WookieView): WookiePanelBuilder = {
new WookiePanelBuilder(wookie)
}
}
/**
* @author Andrey Chaschev [email protected]
*/
class WookiePanel(builder: WookiePanelBuilder) extends VBox with WookiePanelFields[WookiePanel]{
val self = this
val location = new TextField(builder.startAtPage.getOrElse(""))
val jsArea = new TextArea()
val logArea = new TextArea()
val prevButton = new Button("<")
val nextButton = new Button(">")
val jsButton = new Button("Run JS")
val go = new Button("Go")
val wookie = builder.wookie
val engine = wookie.getEngine
val goAction = new EventHandler[ActionEvent] {
def handle(arg0: ActionEvent)
{
builder.wookie.load(location.getText)
}
}
{
jsArea.setPrefRowCount(2)
jsArea.appendText(JS_INVITATION)
jsArea.focusedProperty().addListener(new ChangeListener[lang.Boolean] {
def changed(observableValue: ObservableValue[_ <: lang.Boolean], s: lang.Boolean, newValue: lang.Boolean)
{
if(newValue){
if(jsArea.getText.equals(JS_INVITATION)) jsArea.setText("")
}else{
if(jsArea.getText.trim.equals("")) jsArea.setText(JS_INVITATION)
}
}
})
def runJS() {
val r = engine.executeScript(jsArea.getText)
if(r != "undefined") log(s"exec result: $r")
}
jsButton.setOnAction(new EventHandler[ActionEvent] {
def handle(e:ActionEvent){
runJS()
}
})
prevButton.setOnAction(new EventHandler[ActionEvent] {
def handle(e:ActionEvent){
engine.getHistory.go(-1)
}
})
nextButton.setOnAction(new EventHandler[ActionEvent] {
def handle(e:ActionEvent){
engine.getHistory.go(+1)
}
})
jsArea.addEventHandler(KeyEvent.KEY_PRESSED, new EventHandler[KeyEvent] {
def handle(e:KeyEvent){
if (e.getCode.equals(KeyCode.ENTER) && e.isControlDown) { // CTRL + ENTER
runJS()
}
}
})
HBox.setHgrow(location, Priority.ALWAYS)
go.setOnAction(goAction)
if (builder.showDebugPanes) {
engine.locationProperty.addListener(new ChangeListener[String] {
def changed(observableValue: ObservableValue[_ <: String], s: String, newLoc: String)
{
log(s"location changed to: $newLoc, from $s")
location.setText(newLoc)
}
})
engine.getLoadWorker.stateProperty.addListener(new ChangeListener[Worker.State] {
def changed(ov: ObservableValue[_ <: Worker.State], t: Worker.State, newState: Worker.State) {
if (newState eq Worker.State.SUCCEEDED) {
log(s"worker state -> SUCCEEDED, page ready: ${engine.getDocument.getDocumentURI}")
}
}
})
// setOnAlert, maybe??
// see also setOnAlert in WookieView
engine.setOnError(new EventHandler[WebErrorEvent] {
def handle(webEvent: WebErrorEvent)
{
WookieView.logOnAlert(webEvent.getMessage)
}
})
}
val toolbar = new HBox
toolbar.getChildren.addAll(prevButton, nextButton, jsButton, location, go)
toolbar.setFillHeight(true)
val vBox = this
vBox.getChildren.add(toolbar)
if(builder.showDebugPanes) vBox.getChildren.add(jsArea)
if(builder.userPanel.isDefined) {
vBox.getChildren.add(builder.userPanel.get)
}
vBox.getChildren.add(builder.wookie)
if(builder.showNavigation) vBox.getChildren.add(logArea)
vBox.setFillWidth(true)
VBox.setVgrow(builder.wookie, Priority.ALWAYS)
}
def log(s:String) = {
val sWithEOL = if(s.endsWith("\n")) s else s + "\n"
logArea.appendText(s"$nowForLog $sWithEOL")
WookieView.logger.info(s)
}
def nowForLog: String =
{
new SimpleDateFormat("hh:mm:ss.SSS").format(new Date())
}
}
trait WookiePanelFields[SELF]{
var startAtPage: Option[String] = None
var showNavigation: Boolean = true
var showDebugPanes: Boolean = true
var userPanel: Option[VBox] = None
//todo change SELF to this.type
def showNavigation(b: Boolean): SELF = { showNavigation = b; self()}
def showDebugPanes(b: Boolean): SELF = { showDebugPanes = b; self()}
def startAtPage(url:String): SELF = { startAtPage = Some(url); self()}
def userPanel(vbox: VBox): SELF = { userPanel = Some(vbox); self()}
def self(): SELF
}
class WookiePanelBuilder(val wookie: WookieView) extends WookiePanelFields[WookiePanelBuilder]{
val self = this
def build: WookiePanel = new WookiePanel(this)
}
| 50,065 |
US-30478607-A_2
|
USPTO
|
Open Government
|
Public Domain
| 2,007 |
None
|
None
|
English
|
Spoken
| 3,505 | 4,509 |
The machine A is controlled based on (e.g. programmed) parameters thatare predetermined for the individual (different) products to beproduced, i.e., the individual modules are controlled and adjusted onthe fly for processing each individual product. Each individual productcan be produced individually in accordance with the parameters of thecontrol, for example, by a data base or directly by the operator, forexample, by display input or voice command.
Based on the FIGS. 43 to 52 one embodiment will be explained in whichthe sheet B in the folding device F4 is deflected such that without aseparate turning process a different kind of fold can be produced. Inthe embodiment, a Z fold (zigzag fold) is produced.
The embodiment according to FIGS. 43 to 52 corresponds substantially tothe embodiment according to FIGS. 35 to 40. It has been described inthis connection how by multiple passes in only one folding device F4 a Cfold (letter fold) can be produced. The folding device F4 according toFIGS. 43 to 51 differs from this embodiment in that instead of themovable baffle plate like guiding element L16 a multi-guiding elementMLE is provided. It is located in the area between the roller pairs 54,55 and 52, 59. The intake rollers 50, 51 again have the same diameter asthe folding rollers 52, 56 and 59. The multi-guiding element MLE has asubstantially triangular base member with two curved guiding surfaces104, 105 (FIG. 49) that adjoin one another at an acute angle, whereinone of the guiding surface 104 has a smaller radius of curvature thanthe guiding surface 105. At their ends that are facing away from oneanother the guiding surfaces 104, 105 are connected by a plane guidingsurface 106 with one another that is positioned opposite a guidingelement 107 that together with the guide surface 106 forms of passage108 for the sheet B.
In the following, in an exemplary fashion the production of a Z foldwill be described that can be produced without a separate turning stepby means of the folding device F4 according to FIGS. 43 to 52.
The sheet B is transported between the intake rollers 50, 51 and bymeans of the movable guiding element L15 is supplied to the fold nipbetween the folding rollers 53, 54. From here, the sheet B istransported by means of the guiding elements L12, L13 to the reversingrollers 57, 58 between which it is transported in the described way. Thesensor S4 that is arranged in the transport direction of the sheet Bbehind the reversing rollers 57, 58 detects the leading edge 88 of thesheet B and triggers in the described way a switching signal by means ofwhich the reversing rollers 57, 58 are reversed with respect to theirrotational direction. The sheet B therefore is caused to bulge in suchaway that it reaches the folding nip between the two folding rollers 54,56 so that the fold 85 is formed.
During formation of the first fold 85 the multi-guiding element MLE isadjusted such that the guiding surface 104 is positioned opposite thefolding roller 54 at a minimal spacing. Since the guiding surface 104has the same radius of curvature as the folding roller 54, after thefolding step the folded sheet B is transported between the multi-guidingelement MLE and the folding roller 54. The connecting edge 109 betweenthe two guiding surfaces 104, 105 is positioned immediately adjacent thefolding nip between the folding rollers 54, 56. In this way it isensured that the fold 85 moves between the multi-guiding element MLE andthe folding roller 54. The folded sheet B is thus applied to the foldingnip between the folding rollers 54, 56 (FIGS. 44 and 49). By acorresponding adjustment of the multi-guiding element MLE the sheet B istransported out of the folding area FB (FIG. 49) to the intake area EBin front of the intake rollers 50, 51 with simultaneous turning. On theguiding element L10 the single-folded sheet B is supplied to the intakerollers 50, 51 through which the sheet is transported partially. Duringthis return transport of the sheet B the guiding element L15 is pivotedupwardly so that it is no longer within the movement area of the sheet B(FIG. 45). At least one sensor S5 that in transport direction of thesheet B is located in front of the intake rollers 50, 51 detects thesheet B and stops the intake rollers 50, 51 at the moment when the sheetB with its trailing end is still barely within the roller nip betweenthe intake rollers 50, 51 (FIG. 46). Before reversal of the rotationaldirection of the intake rollers 50, 51 takes place, the guiding elementL15 is pivoted back into the movement path of the sheet B (FIG. 46) sothat the once-folded sheet B is again transferred by it to the foldingnip between the folding rollers 53, 54. After having passed the foldingnip, the folded sheet B with its trailing end 90 moves between theguiding elements L12, L13 that supply the sheet to the reversing rollers57, 58 (FIG. 47).
Advantageously, simultaneous to the return of the guiding element L15the multi-guiding element MLE is also adjusted about a horizontal axissuch that the connecting edge 109 is resting on the wall of the foldingroller 54 or at least has such a minimal spacing relative to it that thesheet B after passing through the folding nip between the foldingrollers 54, 46 reaches the guiding surface 105 of the multi-guidingelement MLE.
The sensor S4 behind the reversing rollers 57, 58 grips the sheet end 90and triggers a signal for reversing the rotational direction of thereversing rollers 57, 58. Since the folding rollers 53, 54 are stillbeing driven in the same rotational direction, the sheet B bulges in thefolding area FB and enters the folding nip between the folding rollers54, 56 (FIG. 47). In this way, the second fold 86 is formed upon passingthrough the folding nip. The now twice-folded sheet B reaches theguiding surface 105 and is transported along it in the direction towardthe folding nip between the two folding rollers 52, 59 (FIGS. 48 and51). Accordingly, the twice-folded sheet B is transported in theconveying direction from the folding area FB (FIG. 51) to the exit areaAB (FIG. 51) behind the folding rollers 52, 59. The sheet B providedwith the Z fold 85, 86 is transported away or supplied to a followingprocessing module of a machine.
FIG. 52 shows the case that this folding device F4 can also be adjustedsuch that the sheet B passes through the folding device without beingprocessed, i.e., without folding. In this case, the guiding element L15is pivoted upwardly out of the movement path of the sheet B. Themulti-guiding element MLE is adjusted such that the connecting edge 109rests against the folding roller 54 and has only minimal spacing. Inthis position, the passage 108 is positioned between the planar guidingsurface 106 and guiding element 107 in the horizontal movement path ofthe sheet B. Since the guiding element L15 has been pivoted out of themovement path of the sheet B, the sheet B is supplied by means of theintake rollers 50, 51 on the guiding element L10 to the folding rollers54, 56. They convey the sheet through the downstream passage 108 to thefolding rollers 52, 59. After the sheet B has passed through the twofolding rollers 52, 59, the unprocessed sheet is transported away fromthe folding device F4 or is supplied to a following module of a machine.
The multi-guiding element MLE can also be provided in place of theguiding element L15. It is also possible to employ the multi-guidingelement MLE in the described position as well as additionally in placeof the guiding element L15.
The use of the multi-guiding element MLE has the advantage that thesheet B in the folding device F4 is deflected such that without aseparate turning process a different kind of folding, for example, thedescribed Z fold, can be produced. Depending on the adjustment of thefolding device F4, the sheet B can also be provided with only one fold.In this case, the multi-guiding element MLE is adjusted in the waydisclosed in FIGS. 46 to 48. By means of the sensor S4 the rotationaldirection of the reversing rollers 57, 58 in this case is switched whena sufficient sheet length for the formation of only one fold has beentransported between the reversing rollers 57, 58. Then, by rotationalreversal of the reversing rollers 57, 58 and the further drive action ofthe folding rollers 53, 54 that sheet B is caused to bulge into thefolding nip between the folding rollers 54, 56 and in the folding nipthe single fold is formed. The multi-guiding element MLE then guides inthe position according to FIGS. 46 to 48 the folded sheet to thedownstream folding rollers 52, 59.
In the described embodiment one of the intake rollers or the foldingrollers is spring-loaded, respectively. This has the advantage that uponpassing of the sheet through the roller nip or folding nip a pressure isapplied onto the sheet. This is in particular advantageous when two ormore sheets are conveyed at the same time through the folding device andfolded. It is then possible to apply a satisfactory pressure on thefold.
The machine A that is illustrated in an exemplary fashion in FIG. 41comprises accumulator 81 with which the sheets B are combined toindividual sets. In this connection, one set can be comprised of sheetsof different lengths. However, it is also possible that the sheets B areindividually sequentially supplied wherein in the accumulator 81 theseindividuals sheets are either laid on top one another or stacked fromthe bottom. Also, it is possible to combine individual sets of sheets inthe accumulator 81. In this case, it is for example possible to combinethe first set of e.g. two sheets with a subsequent set of e.g. sixsheets to a single set. Such accumulators are known and are thereforenot disclosed in more detail.
FIGS. 53 and 54 show in an exemplary fashion a machine with whichproducts are processed that are unwound from a roll 110 and are suppliedby means of an intermediate module 111 to a cutting module 112. By meansof the cutting module 112 sheets B are cut from the endless web 113 andare supplied by corresponding transport elements 114 (FIG. 54) to theaccumulator 81. The transport element 114 is, for example, a roller thatis horizontal and positioned perpendicularly to the transport directionof the sheets and has a wall surface provided with passages 115. Theroller 114 is connected to a vacuum system with which by means of thepassages 115 vacuum is applied to the sheets to be transported. Thesheets are thus pulled tightly against the roller 114 that supplies thesheets reliably to the accumulator 81. In the accumulator 81 the sheetsare combined e.g. in imbricate arrangement (FIG. 54) and then suppliedto the folding module 82. It is comprised of several folding devices, inthe embodiment three sequentially arranged ones, with which the sheetsor sheet sets are folded in the described way. Downstream of the foldingmodule 82 there is a buffering module 83 with two sequentially arrangedbuffers.
In this variant the sheets are transported linearly through thedifferent modules of the machine and are folded or transported withoutbeing folded, as needed. The folding devices of the folding module 82,as has been explained in connection with the preceding embodiments indetail, can be adjusted as needed and independent from one another insuch a way that the desired processing of the sheets is realized. It ispossible to adjust all three folding devices in such a way that thesheets are transported without any processing to the buffering module83. However, all or only some folding devices of the folding module 82can also be adjusted in the described way in order to achieve thedesired folding of the sheets.
In the embodiment according to FIGS. 55 and 56 the individual sheets areinserted into the machine and are subsequently processed. As in thepreceding embodiment, the sheets are transported on a straight paththrough the machine. The device has a loading module 116 into which theindividual sheets are inserted. By means of the transport element 114the sheets are supplied to the accumulator module 81 in which theproducts to be processed are combined to sets. Downstream of theaccumulator module 81 there is the folding module 82 that is comprised,for example, of three folding devices. In an exemplary fashion, they areof the same configuration as the folding devices according to FIGS. 53and 54. The folding module 82 has downstream thereof a buffering module83 that in accordance with the preceding embodiment is embodied forexample with two sequentially arranged buffers. The folding devices inthe folding module 82 are adjustable independent from one another sothat the sheets, depending on the adjustment, can pass through themachine without being processed or can be provided with different folds.
The device according to FIG. 57 has the intake module 80 in which afeeder with at least one transport element 114 re located. In theembodiment it is embodied identical to the transport element accordingto FIG. 56. With it, the sheets are supplied to the accumulator module81 in which the sheets in the described way are combined to sets. Afolding module 82 is arranged downstream of the accumulator module 81and comprises, for example, three folding devices. As explained inconnection with FIGS. 53 to 56, the folding devices can be adjustedindependent from one another so that the sheets can be processed indifferent ways or are not processed.
A pressing module 117 is arranged downstream of the folding module 82with which the sheets are pressed in the area of the fold. The pressingmodule 117 has two pressing rollers 121, 122, that are forced againstone another. In this way, the sheet is being pressed in the area of thefold. In this connection, it is even possible to move the sheet back andforth by appropriate reversal of the rotational direction of thepressing rollers 121,122 in order to exert a satisfactory pressure onthe fold edge.
A buffering module 83 adjoins the pressing module 117 with which theprocessed or unprocessed sheets are guided away or supplied to anotherprocessing module of the machine.
The machine according to FIG. 58 has the intake module 80 and theaccumulator module 81 arranged downstream; they are of identical designas in the embodiment of FIG. 57. The folding module 82 downstream of theaccumulator module 81 has three folding devices which, however, incontrast to the embodiment according to FIGS. 53 to 57 are not arrangedimmediately behind one another but with intermediate positioning of apressing module 117, respectively. In this way, the fold provided in thefolding device is immediately thereafter processed by means of thepressing module 117 before the sheet is supplied to the next foldingdevice. Between the last folding device and the subsequent bufferingmodule 83 a further pressing module 117 is arranged.
Since the machines according to FIGS. 53 to 58 are designed such thatthe sheets are transported on a straight path through the machine, FIG.59 shows in an exemplary fashion a machine in which the transportdirection of the sheets through the machine has two deflections. Thismachine comprises the intake module 80 with transport element 114 withwhich the sheets are supplied to the downstream folding module 82. Ithas two folding devices and an adjoining pressing module 117. The twopressing devices are adjustable independent from one another so thatwith them the sheets can be processed depending on the processing task.Depending on the adjustment of the respective folding device it is alsopossible that the sheets pass without being folded through the foldingdevice. By means of the pressing module 117 the folds are processed. Inthe illustrated embodiment the pressing module has two pressing rollerpairs with which the folds can be processed as the folded sheets passbetween the pressing rollers. A corner conveying module 118 adjoins thepressing module 117 with which the transport direction of the sheets ischanged by 90 degrees. After the 90 degree deflection the sheets reach afolding device 119 that has arranged downstream thereof a pressingmodule 117. A further corner conveying module 118 adjoins the pressingmodule 117 with which the transport direction of the sheets is againdeflected by 90 degrees. Downstream of the corner conveying module 116there is a folding module 82 and a buffering module 83. The foldingmodule 82 has a folding device as well as a pressing module 117.
FIG. 60 finally shows a machine in which the sheets are transportedagain without deflection through the device. The sheets are transportedby means of the intake module 80 with the transport element 114 to theembossment module 120 that comprises embossment roller pairs 94 to 97 asdisclosed in connection with FIG. 42. Downstream of the embossmentmodule 120 there is the accumulator module 81 with which the sheets inthe described way are combined to sets.
The folding module 82 adjoins the accumulator module 81 that inaccordance with the machines of FIGS. 53 to 56 has three sequentiallyarranged roller devices. In this connection, the folding device thatadjoins the accumulator module 81 is provided with a divertingcompartment. Downstream of the folding module 82 there is a pressingmodule 117 that has two pressing roller pairs. A buffering module 83adjoins the pressing module 117 with which the sheets are diverted orsupplied to a further module.
The examples of machines disclosed in connection with FIGS. 53 to 60show that based on the different modules each machine can be optimallycombined in accordance with the wishes of the client in order to processthe sheets with the modules. With the described folding devices withadjustable rollers and/or sheet guiding elements, differentmanipulations on the sheets can be carried out in the described way. Thefolding devices can be controlled flexibly so that each leaf or eachsheet B can be folded in different ways. In this way it is achieved thatfor the same or variable initial sizes of the sheets signatures withdifferent folding types can be folded to one or several defined finalformats. It is possible without problem to adjust the folding rollersand/or the different guiding elements for each sheet so thatsequentially supplied sheets can be folded in a variety of differentways. The adjustment of the folding rollers and of the guiding elementsis possible within a very short period of time. Accordingly, the sheetscan be processed individually. It is conceivable easily that each sheetor only the first sheet and/or the last sheet of each set of sheets canbe provided with a barcode, for example, that is detected by a readingdevice that, according to the information contained in the barcode, willadjust the machine or the folding device in order to perform on thesheet the required processing steps. The sheets B can be supplied by aflat stacking feeder, a vacuum feeder, a cutting unit or a printer intothe machine. In the latter case, the sheet is printed in the printer andsubsequently immediately supplied to the folding device for processing.
The information in regard to preparing or processing each product(individual sheet or combined set) accompanies this product through theentire machine and can generate on the fly at any station of the machineappropriate adjustments or switching actions. This information canadvantageously be provided in the form of a barcode on the product. Theindividual stations of the machine are provided with correspondingreading units that read the barcodes and accordingly adjust thestations. As has been described in an exemplary fashion, all kinds offolds can be produced. The folding lengths can vary. Depending on theposition of the folding rollers and/or the guiding elements switchingbetween folding and not folding can be realized. The sheets or sets ofsheets can be controlled. In the machine individual sheets or even setscomprised of at least two sheets can be turned without problem. Allthese functions can vary from product to product because the informationin regard to preparing and processing is present on each product and canbe read from the product at any time upon passage through the machine.
What is claimed is:
1. A device for folding flat articles such as sheetsof paper, plastic, cardboard and the like, the device comprising:conveying elements embodied as rollers that are arranged axis-parallelto each other, are rotatably driven, and form a part of a conveyingunit, wherein the conveying unit comprises at least a first pair and asecond pair of the rollers; wherein the flat articles during transportthrough the device in a transport direction are conveyed between the nipbetween neighboring oppositely rotating rollers, respectively; whereinthe conveying unit is configured to pivot about a pivot axis and bypivoting the conveying unit about the pivot axis at least some of therollers are adjustable between at least two positions for performingdifferent folding actions on the flat article; wherein, for producing afold on a flat article, the first pair of the rollers that produce thefold are stopped when the flat article is located in a nip of the firstpair of the rollers and a rotational direction of the first pair of therollers is then reversed while the second pair of the rollers upstreamof the first pair of the rollers continue to transport the flat articlein the transport direction.
2. The device according to claim 1,comprising sensors that detect movements of the article.
3. The deviceaccording to claim 1, wherein the device is controlled on the fly. 4.The device according to claim 1, wherein the device is configured as amodule.
5. The device according to claim 4, wherein several of saidmodules are combined to a machine.
6. The device according to claim 5,wherein said several modules are controlled on the fly..
| 44,674 |
8119786_1
|
Court Listener
|
Open Government
|
Public Domain
| 2,022 |
None
|
None
|
English
|
Spoken
| 914 | 1,375 |
Maletz, Judge:
This case involves a protest against the assessment of duties on battery-operated model airplane motors imported from Japan. They were assessed at the rate of 35 percent ad valorem under the provision for toys not specially provided for in paragraph 1513 of the Tariff Act of 1930, as modified, T.D. 52739.1
Plaintiff claims the motors are not toys under the statute and should be classified as articles having as an essential feature an electrical element or device, in chief value of metal, at a duty of 13% percent ad valorem under paragraph 353 of the 1930 act, as modified, T.D. 52739.2
The imported article consists of a motor, a battery case, a bracket, a clip, a cotton wick (approximately 20 inches long), and a bag of small parts (screws, washers, nuts, etc.). The motor measures approximately I14" x 1 y2" and appears to be made of metal and plastic. Visible on the exterior is a pinion and gear, two electrical wires with electrical contacts on the ends, and a plastic electrical connection. There is no way of telling what is inside the motor casing without breaking or destroying the sample. The battery case is rectangular in shape (4y2" x 1") and suitable for holding four pen-light batteries. It appears to be made out of tin with a plastic cover at one end.
*548In a tariff classification controversy, it is fundamental that the plaintiff has the twofold burden of proving that the government’s classification is erroneous and establishing the correctness of its own affirmative claim. E.g., Joseph G. Seagram & Sons, Inc. v. United States, 30 CCPA 150, 157, C.A.D. 227 (1943); United States v. H. V. Albrecht, et al., 27 CCPA 112, 117, C.A.D. 71 (1939). Thus, it is the plaintiff’s burden to establish its claimed classification and if it fails to do so, the protest must be overruled. United States, et al. v. National Starch Products, Inc., 50 CCPA 1, 5, C.A.D. 809, 318 F. (2d) 737, 740 (1962); United States v. Magnus, Mabee & Reynard, Inc., 39 CCPA 1, 7, C.A.D. 455 (1951).
In order to be classifiable under paragraph 353, as plaintiff claims, the article must be “wholly or in chief value of metal.” The proper method of determining the component material of chief value of an article is to ascertain the costs to the manufacturer of the separate parts of the article at the time they are ready to be combined into the completed article. United States v. Jovita Perez, et al., 44 CCPA 35, 39, C.A.D. 633 (1957); United States v. H. A. Caesar & Co., 32 CCPA 142, C.A.D. 299 (1945); United States v. Bacharach, 18 CCPA 353, 355 T.D. 44612 (1931); United States v. Rice-Stix Dry Goods Co., 19 CCPA 232, 234, T.D. 45337 (1931); Plastic Service Co. v. United States, 63 Cust. Ct. 528, C.D. 3947 (1969) ; Pico Novelty Co., Inc., et al. v. United States, 62 Cust. Ct. 341, C.D. 3759 (1969). In the present case, there is no evidence of this kind—or indeed any evidence whatever— as to the component material of chief value.3
It is true that proof of the costs of each component need not be presented where even a casual examination of the sample discloses the material of chief value. John S. Connor, Inc. v. United States, 54 Cust. Ct. 213, 218, C.D. 2536 (1965). See also e.g., Morris Friedman & Co. v. United States, 56 Cust. Ct. 21, 29-30, C.D. 2607 (1965); Broadway-Hale Stores, Inc. v. United States, 63 Cust. Ct. 194, C.D. 3896 (1969). But this kind of situation is not applicable here. For here, examination of the sample does not make it evident that metal is the component material of chief value. See e.g., Plastic Service Co. v. United States, 63 Cust. Ct. 528, C.D. 3947 (1969).
We hold, in short, that plaintiff has failed to establish the component material of chief value and thus has not proven the correctness *549of its affirmative claim. In that circumstance, we need not reach the question as to whether the government’s classification is errroneous. See e.g., Plastic Service Co. v. United States, supra; Rudolph Miles v. United States, 64 Cust. Ct. 151, C.D. 3974 (1970).
The protest is overruled, and judgment will be entered accordingly.
Paragraph 1518 of the Tariff Act of 1930„ as modified, iT.D. 52739 :
Toys, not specially provided for :
****** *
Other (except * * *)_ 35% ad val.
Paragraph 353 of the Tariff Act of 1930, as modified, T.D. 52739 :
Articles having as an essential feature an electrical element or device, such as electric motors, fans, locomotives, portable tools, furnaces, heaters, ovens, ranges, washing machines, refrigerators, and signs, finished or unfinished, wholly or in chief value of metal, and not specially provided for:
* * * * * * *
Other (except * * *)- 13%% ad val.
In this connection, it is to be noted that after the trial of the issues, plaintiff successfully petitioned the court to reopen the case for the purpose of presenting evidence as to the 'Component material of chief value; however, after such leave was granted, the case was resubmitted without any additional evidence being offered. Thus, plaintiff concedes in its brief (p. 6) that it “has not been able to establish by agreement (stipulation) that these motors are in chief value of metal, or to locate a person in the employ of the manufacturer who would be qualified to establish this fact by deposition.”.
| 43,214 |
https://github.com/weucode/COMFORT/blob/master/artifact_evaluation/data/codeCoverage/fuzzilli_generate/934.js
|
Github Open Source
|
Open Source
|
Apache-2.0
| 2,022 |
COMFORT
|
weucode
|
JavaScript
|
Code
| 428 | 1,262 |
function main() {
const v4 = [13.37,13.37,13.37,13.37];
// v4 = .object(ofGroup: Array, withProperties: ["__proto__", "length", "constructor"], withMethods: ["sort", "filter", "flat", "findIndex", "slice", "entries", "forEach", "lastIndexOf", "reduceRight", "map", "shift", "reduce", "splice", "every", "indexOf", "flatMap", "find", "unshift", "some", "pop", "reverse", "keys", "toLocaleString", "includes", "push", "fill", "toString", "concat", "values", "join", "copyWithin"])
const v6 = [];
// v6 = .object(ofGroup: Array, withProperties: ["__proto__", "length", "constructor"], withMethods: ["sort", "filter", "flat", "findIndex", "slice", "entries", "forEach", "lastIndexOf", "reduceRight", "map", "shift", "reduce", "splice", "every", "indexOf", "flatMap", "find", "unshift", "some", "pop", "reverse", "keys", "toLocaleString", "includes", "push", "fill", "toString", "concat", "values", "join", "copyWithin"])
const v8 = Object();
// v8 = .object()
const v9 = "replace"[v8];
// v9 = .unknown
const v10 = gc;
// v10 = .function([] => .undefined)
const v12 = Object();
// v12 = .object()
let v13 = v6;
const v14 = [];
// v14 = .object(ofGroup: Array, withProperties: ["__proto__", "length", "constructor"], withMethods: ["sort", "filter", "flat", "findIndex", "slice", "entries", "forEach", "lastIndexOf", "reduceRight", "map", "shift", "reduce", "splice", "every", "indexOf", "flatMap", "find", "unshift", "some", "pop", "reverse", "keys", "toLocaleString", "includes", "push", "fill", "toString", "concat", "values", "join", "copyWithin"])
let v15 = v14;
for (const v16 of v13) {
}
const v17 = [1337];
// v17 = .object(ofGroup: Array, withProperties: ["__proto__", "length", "constructor"], withMethods: ["sort", "filter", "flat", "findIndex", "slice", "entries", "forEach", "lastIndexOf", "reduceRight", "map", "shift", "reduce", "splice", "every", "indexOf", "flatMap", "find", "unshift", "some", "pop", "reverse", "keys", "toLocaleString", "includes", "push", "fill", "toString", "concat", "values", "join", "copyWithin"])
const v18 = [];
// v18 = .object(ofGroup: Array, withProperties: ["__proto__", "length", "constructor"], withMethods: ["sort", "filter", "flat", "findIndex", "slice", "entries", "forEach", "lastIndexOf", "reduceRight", "map", "shift", "reduce", "splice", "every", "indexOf", "flatMap", "find", "unshift", "some", "pop", "reverse", "keys", "toLocaleString", "includes", "push", "fill", "toString", "concat", "values", "join", "copyWithin"])
const v21 = [];
// v21 = .object(ofGroup: Array, withProperties: ["__proto__", "length", "constructor"], withMethods: ["sort", "filter", "flat", "findIndex", "slice", "entries", "forEach", "lastIndexOf", "reduceRight", "map", "shift", "reduce", "splice", "every", "indexOf", "flatMap", "find", "unshift", "some", "pop", "reverse", "keys", "toLocaleString", "includes", "push", "fill", "toString", "concat", "values", "join", "copyWithin"])
const v22 = {__proto__:-3801018476,constructor:1337,length:v21};
// v22 = .object(ofGroup: Object, withProperties: ["length", "constructor", "__proto__"])
let v23 = v22;
const v24 = {__proto__:gc,a:-3801018476,constructor:v18,e:v17,length:v4,toString:13.37};
// v24 = .object(ofGroup: Object, withProperties: ["e", "toString", "length", "constructor", "__proto__", "a"], withMethods: ["__proto__"])
let v25 = v18;
const v26 = v18 > v14;
// v26 = .boolean
const v28 = 1;
// v28 = .integer
let v29 = 0;
const v30 = v29 + 1;
// v30 = .primitive
v29 = v30;
v15[v25] = v13;
let v33 = 0;
do {
const v34 = v33 + 1;
// v34 = .primitive
v33 = v34;
} while (v33 < 6);
v8[0] = v23;
}
main();
| 23,686 |
https://github.com/AnnotationSro/ng6-file-man/blob/master/projects/file-manager/src/file-manager/components/functions/node/node.component.ts
|
Github Open Source
|
Open Source
|
MIT
| 2,022 |
ng6-file-man
|
AnnotationSro
|
TypeScript
|
Code
| 184 | 802 |
import {Component, Input, OnInit} from '@angular/core';
import {NodeInterface} from '../../../interfaces/node.interface';
import {NodeService} from '../../../services/node.service';
import {NodeClickedService} from '../../../services/node-clicked.service';
import {FileManagerStoreService, SET_PATH, SET_SELECTED_NODE} from '../../../services/file-manager-store.service';
import {DownloadModeEnum} from '../../../enums/download-mode.enum';
@Component({
selector: 'app-node',
templateUrl: './node.component.html',
styleUrls: ['./node.component.scss']
})
export class NodeComponent implements OnInit {
@Input() node: NodeInterface;
isSingleClick = true;
constructor(
private store: FileManagerStoreService,
private nodeService: NodeService,
private nodeClickedService: NodeClickedService
) {
}
public method1CallForClick(event: MouseEvent) {
event.preventDefault();
this.isSingleClick = true;
setTimeout(() => {
if (this.isSingleClick) {
this.showMenu();
}
}, 200);
}
// todo event.preventDefault for double click
public method2CallForDblClick(event: any) {
event.preventDefault();
this.isSingleClick = false;
this.open();
}
ngOnInit() {
}
private open() {
if (!this.node.isFolder) {
if (this.nodeService?.tree?.config?.options?.allowFolderDownload === DownloadModeEnum.DOWNLOAD_DISABLED) {
this.isSingleClick = true;
this.showMenu();
return;
}
this.nodeClickedService.startDownload(this.node);
return;
}
if (this.node.stayOpen) {
if (this.node.name == 'root') {
this.nodeService.foldAll();
}
this.store.dispatch({type: SET_PATH, payload: this.node.pathToNode});
return;
}
this.toggleNodeExpanded();
if (this.node.isExpanded) {
this.store.dispatch({type: SET_PATH, payload: this.node.pathToNode});
}
this.setNodeSelectedState();
}
private showMenu() {
this.store.dispatch({type: SET_SELECTED_NODE, payload: this.node});
}
private toggleNodeExpanded() {
this.node.isExpanded = !this.node.isExpanded;
}
private setNodeSelectedState() {
if (!this.node.isExpanded) {
document.getElementById('tree_' + this.node.pathToNode).classList.add('deselected');
this.nodeService.foldRecursively(this.node);
this.store.dispatch({type: SET_PATH, payload: this.node.pathToParent});
} else {
document.getElementById('tree_' + this.node.pathToNode).classList.remove('deselected');
}
}
}
| 17,738 |
https://stackoverflow.com/questions/31059085
|
StackExchange
|
Open Web
|
CC-By-SA
| 2,015 |
Stack Exchange
|
English
|
Spoken
| 129 | 252 |
How to avoid writing messages to the root logger in log4j v.1
Is some path to write log messages only to the 'child' logger, avoiding root logger?
The root logger is using by other components, so there is no ability to decrease it's level or disable appender.
thanks
Please use Log4j additivity.
Set the additivity property of a Log4j logger to false and then the log messages which are coming to that logger will not be propagated to parent loggers.
Log4j configuration file:
log4j.category.com.demo.moduleone = INFO, moduleOneFileAppender
log4j.additivity.com.demo.moduleone = false
log4j.category.com.demo.moduletwo = INFO, moduleTwoFileAppender
log4j.additivity.com.demo.moduletwo = false
log4j.rootLogger = INFO, rootFileAppender
With the above configuration, the log messages from the com.demo.moduleone will go to the moduleOneAppender only and the rest of the log messages will go to the rootFileAppender.
| 15,777 |
|
https://math.stackexchange.com/questions/3128860
|
StackExchange
|
Open Web
|
CC-By-SA
| 2,019 |
Stack Exchange
|
TheSilverDoe, https://math.stackexchange.com/users/594484
|
English
|
Spoken
| 85 | 214 |
Sketch a graph from given limits
How would look like a graph:
$$ \left\{ \begin{array}{l}
\displaystyle{\lim_{x\rightarrow 1^-} f(x) = 1}\\
\displaystyle{\lim_{x\rightarrow 1^+} f(x) = 1}\\
\displaystyle{\lim_{x\rightarrow \infty} f(x) = 1}\\
\end{array}\right.$$
I tried it loads of time, but I dont have a clue how to realize it
The constant function $f(x)=1$ satisfies these conditions...
As explained the constant function $f:x\mapsto 1$ verifies your condition. If you want something less trivial you could go for (one example among infinitely many!)
$$f : x\mapsto \arctan(x-1) \cdot e^{-(x-1)^2}$$
| 1,656 |
https://github.com/renaudbedard/pyramidwarf/blob/master/Assets/Materials/Heart Sprite.mat.meta
|
Github Open Source
|
Open Source
|
CC-BY-4.0
| 2,014 |
pyramidwarf
|
renaudbedard
|
Unity3D Asset
|
Code
| 6 | 40 |
fileFormatVersion: 2
guid: 1417ba38da3086d469cd8fff0d09b7e1
NativeFormatImporter:
userData:
| 47,720 |
cardinalmerciers0000merc_4
|
English-PD
|
Open Culture
|
Public Domain
| 1,920 |
Cardinal Mercier's story
|
Mercier, Désiré, 1851-1926
|
English
|
Spoken
| 7,397 | 9,665 |
We would add, Veneral Brethren, that the setting up of this Court of Honor is as vital to your interests as it is to ours, for we know by personal experience and affirm that in a hundred different places in Belgium the German Army has given itself up to pillage, arson, massacres, imprisonings and sacrileges in direct violation of all the laws of justice and humanity, notably in those communes mentioned by name in our Pastor Letters and in two notes sent by the Bishops of Liege and Namur on October 31st and November 1st, 1915, respectively, to his Holiness, Pope Benedict XV, the Papal Nuncio at Brussels and the Ambassadors and repre¬ sentatives of neutral countries accredited to the Court of Brussels and resident in that city. Fifty priests and thousands of the Faithful, all of them absolutely innocent of the crimes for which they paid the extreme penalty, were executed, whilst hundreds of others who owed their lives to a chain of circumstances beyond the control of their persecutors were in imminent peril. Some thousands of guiltless citizens were arrested and sent to prison without previous trial or conviction, and on their 82 CARDINAL MERCIER’S OWN STORY release it was found that the most minute cross-examination had failed to elicit any evidence against them. These outrages cry to Heaven for vengeance. If, in laying this information against the German Army, we have been guilty of calumny, or in case the mili¬ tary authorities had good and just reasons for ordering or permitting what we cannot but style criminal conduct, the Germans will, if they retain any sense of national honor, or have the true interest of their country at heart, refute us. But so long as German justice shirks the ordeal, we shall hold fast to our rights and fulfill our duty of denounc¬ ing what we conscientiously consider to be a grave perver¬ sion of justice and a slur on our national honor. During the session of the Reichstag on August 4th the Chancellor of the German Empire declared that the inva¬ sion of Luxemburg and Belgium was “contrary to the pro¬ visions of International Law.” He admitted that “in cross¬ ing the frontiers in spite of the justifiable protests of the Luxemburg and Belgian Governments, he had committed an injustice for which he promised reparation,” and the Sovereign Pontiff, too, not only purposely alluded to Bel¬ gium in a letter he deigned to write to a member of the Government, M. Van den Heuvel, through his Secretary of State, Cardinal Gasparri, but also delivered this unalterable judgment in his consistorial address: “The duty of pro¬ claiming above everything else that no one may , for any rea¬ son whatsoever , commit a breach of justice devolves on the Roman Pontiff, who has been constituted by Almighty God the supreme interpreter and upholder of the Eternal Law.” Nevertheless, from that time onwards politicians and casuists have attempted to evade or water down these de¬ cisive words of the Holy Father, and the German Catholics, who in their reply to the French “German War and Cathol¬ icism” have recourse to the same empty quibbles, would, if they could, bolster them up with an alleged fact. They have at their disposal two affidavits. One of these is anonymous and its author alleges that he saw French officers in conversation with Belgian officers on the Boule¬ vard Anspach at Brussels on July 26th, whilst in the sec- RELEASE OF BELGIAN DOCTORS 83 ond, made by a certain Gustave Lochard of Rimogne, it is alleged that two regiments of French Dragoons, the 28th and 30th, and a battery of French Artillery crossed the Bel¬ gian frontier in the evening of July 31st, 1914, and were quartered exclusively on Belgian territory during the whole of the following week. Now the Belgian Government declares that “no body of French troops, however small, penetrated into Belgium be¬ fore the declaration of war,” and adds: “No reliable wit¬ ness can be found to refute this solemn assertion.” There¬ fore it casts back in their teeth as false the allegation made by the German Catholics and from this arises a primary question, at once political and moral, about which we must enlighten the public mind. In case, however, you decline to undertake the investigation of this question we would ask you to be good enough to sift all the evidence the German Catholics have relied on, even if it only serves to settle the case against us. Gustave Lochard’s evidence can easily be verified. Besides, the German Catholics will be anxious to rid themselves of the stigma of untruthfulness and will make it their bounden duty to retract in case they have allowed themselves to be misled to our detriment. We are well aware that you decline to believe that regi¬ ments whose discipline, honesty and deep religious faith you profess to know so well could possibly give themselves over to such atrocities as we allege against them. Do you wish to deceive yourselves into believing that they did not do so because they are incapable of it? And we, on our side, are compelled to retort that the evidence in our possession proves to demonstration that they are capable for the simple reason that they have committed them. No presumption can hold its own against a fact, and there remains but one issue before us both, viz., the verifying of this fact by a commission whose impartiality is so obvious as to be recog¬ nized by everybody as unquestionable. We have no difficulty in understanding your frame of mind. We, too, have a great regard, if you will be good enough to believe it, for the spirit of discipline, industry and religious faith by which your compatriots are animated. We / 84 CARDINAL MERCIER’S OWN STORY have often seen this with our own eyes, and have reliable information to the same effect, but, alas, there are many Bel¬ gians today who, in the light of the terrible experiences through which they passed during the months of August and September, own that they have been bitterly deceived. Truth has conquered their strongest preconceived notions of the Germans. The fact is now beyond the shadow of doubt. Belgium has suffered martyrdom. When foreigners from neutral countries, Americans, Dutch, Swiss, and Spaniards, ask us how Germany carried on this war, and we picture to them certain scenes, the hor¬ ror of which were so realistically brought home to us in spite of ourselves, we have had to weaken the impression our recital would of itself tend to create, so imbued are we with the idea that the truth, shorn of all adornment, exceeds the bounds of all probability. Yet when once you have been face to face with realities in their entirety and have been able to analyze both the proximate and remote causes of what one of your generals, reviewing the ruins of the little village of Schaffen-lez-Diest and the martyrdom of its Par¬ ish Priest, styled “a tragic blunder,” when you have realized the various influences under which your soldiers labored at the moment of their entry into Belgium and the elation they experienced as the result of their early victories, the unlikeli¬ hood of the truth will appear to you, as it did to us, less disconcerting. But above all, Venerable Brethren, do not let yourselves be held back on the empty plea that an immediate inquiry would be premature. Strictly speaking, we alone might be justified in urging this excuse, since if the inquiry were opened now, the conditions surrounding it would not be at all in our favor. Our people have indeed been terrorized to such an extent and the prospect of reprisals is still so appalling that the witnesses we should have to summon be¬ fore a tribunal composed partly of Germans would hardly have enough courage to tell the whole truth. Even so, we have cogent reasons for not brooking any delay. The first which will go the straightest to your heart is that we are weak whilst you are strong. You would not care to take RELEASE OF BELGIAN DOCTORS 85 an unfair advantage of us by abusing your power. Public opinion generally favors him who is first in the field with his story. Now, whilst you are free to flood neutral coun¬ tries with your propaganda literature, we, on the contrary, are hedged in on all sides and reduced to silence. We are scarcely allowed to make our voices heard even inside our own churches. Sermons are practically censored, that is to say, they are distorted by spies in your pay, and any pro¬ test we may make in conscience is termed an act of sedition against public authority. Again our writings are stopped at the frontier and treated as so much contraband. You alone enjoy full liberty of speech and pen, and if in the spirit of charity and fair play you obtain a small portion of this for accused Belgians, thereby enabling them to defend their cause, it will then be your duty to become their imme¬ diate protectors. The old legal axiom, Audiatur et aitera pars, is, they say, inscribed over the portals of many German Courts of Justice. In any case, in all proceedings in the Ecclesiastical Courts, both here and in Germany, judgment is always founded on this primary adage. Then again you doubtless have in common with us a popular proverb, metaphorically expressed thus: “He who hears only one bell hears but one sound.” You will perhaps say that all this is ancient history. Let the dead bury its dead. Instead of fanning the smoldering embers into a blaze, rather be forgiving and make common cause with the occupying power in their efforts to heal the wounds the unfortunate Belgian people have received. Ven¬ erable Brethren, do not add irony to injustice. Have we not suffered enough? Have we not been on the rack long enough yet? Must we still be subjected to cruel tortures? All that is now over, we hear you saying. Accept it with resignation and forget. Past! Why, our wounds are still bleeding! There is no man with any sense of honor who does not swell with indignation. When we hear our Gov¬ ernment declaim in the teeth of the whole world: “He is doubly guilty who, having infringed the rights of another, attempts with cold cynicism to justify himself by imputing 86 CARDINAL MERCIER’S OWN STORY to his victim crimes he has never committed,” violence alone silences the curses that rise to the lips of our people. Only yesterday one of the inhabitants of a Mechlin suburb learned that his son had fallen on the field of battle and the brave father answered the priest who conveyed the sad news to him and offered words of consolation and comfort, “Oh, that one. There is indeed something much more deplorable than mere political divisions or material calamities, viz., the spirit of hatred, fostered by real or presumed injustice, seething and growing in intensity the while in hearts made rather for love. Is it not our duty as Pastors of our people to make it easier for them to unburden their souls of these evil emo¬ tions, and strengthen the now shaken foundations of true justice and union in charity which should reign uppermost in the hearts of all children of the great Catholic family? The Occupying Power has, both verbally and in writing, expressed its intention to heal our wounds. But in foro externo, intention is judged by action. Now the only thing we poor Belgians, temporarily under the heel of the German Empire, know is that a power which gave its word of honor to govern us according to International Law as laid down in the Hague Convention, has repudiated its solemn engage¬ ment. What we have in mind now is not so much isolated abuses of power from which certain individuals or districts RELEASE OF BELGIAN DOCTORS 87 have suffered. These can only be proved by a thorough in¬ vestigation to be made when War is over, but rather those specific acts of the Government which were drawn up in the form of proclamations and notices and posted up by its or¬ der on walls and hoardings in our towns. Their authenticity and consequently your Government’s direct responsibility for them cannot therefore be called into question. Now the breaches of the Hague Convention committed by the Germans from the first days of the occupation until the present time are many and flagrant. We merely give you here certain headings as it were and would refer you to an appendix for proofs of our allegations.* The principal infringements are as follows : — Collective punishments inflicted on account of the mis¬ demeanors of individuals contrary to Art. 52. Forced labor contrary to Art. 52. New taxation contrary to Arts. 48, 49, and 52. Abuse of requisitions in kind contrary to Art. 52. Systematic ignoring of the laws in force in the country contrary to Art. 43. These violations of International Law which serve only to aggravate our unhappy lot and swell the leaven of hatred and revolt in hearts normally peaceable and charitable, would never be persisted in if those who commit them did not feel they were upheld, if not by the positive approval of the leaders of public opinion in their own country, at all events by their tacit consent. Therefore with every confi¬ dence that it will reach your charitable hearts, we again make our appeal. We are, as we said once before, the weak, while you are the strong. Come and see for your¬ selves if it is still right for you to withhold your assistance. Besides the particular reasons why this commission of enquiry, composed of Catholic Bishops, should be set up, there are others of a more general nature, passing reference to which we have already made. Amongst these is the danger of scandal for those people who own that they are not edified at seeing us divided among ourselves. We must then be on our guard against provoking them to blasphemy # * Note — See p. 90 of the text. 88 CARDINAL MERCIER’S OWN STORY in thought. Our own people fail to understand how you can possibly be blind to the flagrant dual injustice inflicted on Belgium — the violation of our neutrality and the inhuman conduct of your troops, and, moreover, why in the light of this knowledge you do not make your voices heard on all sides in condemnation of these wrongs, and repudiate your connection with them. On the other hand, your own countrymen, Catholics and Protestants alike, cannot but be scandalized at the character your press attributes to both clergy and people belonging to a country the Government of which has been Catholic for thirty years. On September 21st, 1914, the Bishop of Hil- desheim, addressing his clergy, said: “Take care that the airing of these grievances against priests, religious, monks of Catholic nations in the columns of the press does not drive a wedge between German Catholics and Protestants and imperil the future of Religion in the Empire.” But the campaign of falsehood and calumny directed against our clergy and people shows no sign of abating. On the contrary, Herr Erzberger, a member of the Centre, ap¬ pears to have taken it upon himself to add fuel to the flame, while even in Belgium itself one of your priests, Heinrich Mohr by name, preaching to the German troops in Antwerp Cathedral on the 16th Sunday after Pentecost, actually dared to say from the pulpit: “Official documents tell us how the Belgians have hanged German soldiers from trees, poured boiling liquids over them and burnt them alive.” * There is only one way of putting an end to these scan¬ dals and that is for the religious authorities to bring the whole truth to light and publicly and officially denounce the guilty parties. Another cause of scandal for any straightforward man, whether he be a believer or not, lies in this mania for bring¬ ing to the fore and weighing in the balance the advantages * Note — Man hat in den Amtlichten Berichten entsetzliche Dinge gelesen. Wie die Belgier deutsche Soldaten an die Baumen aufhangten, mit heizem- Teer verbriinten und lebendig anzundeten. Feldpredigt auf den i6 sontag nach Pfingstern, von Heinrich Mohr. The sermon was published in Die Stimmen der Heimat No. 34, a periodical issued by Herder in 1915 from Freiburg in Br. RELEASE OF BELGIAN DOCTORS 89 or disadvantages that would accrue to the Catholic religion according as the Triple Alliance or the Quadruple Entente were victorious. Professor Schrors of Bonn University * was the first, so far as we are aware, to devote his leisure hours to this vex¬ atious species of Mathematics. The result the War will have on Religion is God’s own secret and not one of us is in his confidence. But there is a question of moral right and honor far more important than that one : “Seek ye first the Kingdom of God and his justice,” said our Saviour, “and all the rest will be added unto you.” Do your duty, come what may. We Bishops also have a moral and, consequently, a religious duty to perform at the present time — one that claims prece¬ dence over all the rest, viz., to seek out and proclaim the truth. Did not Jesus Christ, who has conferred on us the signal favor of being at once his disciples and ministers, say that His mission to society was to witness to the truth? “ For this I came into the world that I should give testimony to the truth” (John 18, v. 37.) On the solemn occasion of our episcopal consecration, we all vowed to Almighty God and the Catholic Church never to desert the Truth, never to allow ourselves to be led away by ambition or fear whenever we should be called upon to supply some proof of our love for the truth, (,Veritatem diligat, neque earn unquam deserat, aut laudibus aut timore superMus” We have, therefore, by virtue of our very vocation, a common role and ground on which to base an understand¬ ing. Confusion reigns in every mind; light for some is darkness for others and so it is with good and evil. We cherish the hope that the commission of Inquiry to be formed with a view to setting aside these charges, to which we have the honor to convene your delegates, will contribute towards removing more than one misconception, “Non ponat lucem * Note — Der Krieg und der Katholizimus, von Dr. Heinrich Schrors, Prof. d. Teologie an der Universitat in Bonn. 9o CARDINAL MERCIER’S OWN STORY tenebras, nec tenebras lucent, non dicat malum bonum, nec bonum malum.” * Our Holy Father the Pope ardently expressed his desire for peace and appealed for its conclusion in a letter he deigned to send you during your last meeting at Fulda. He urged you, as he does us all, to unite with him in this desire, but he would have peace based on respect for the rights and dignity of nations. “Dum votis omnibus pacem expetimus, atque earn quidem pacem qua et justitia sit opus et popu- lorum congruat dignitati." t Our most fitting answer, therefore, to the Holy Father’s wish is to collaborate with you in making the Truth shine forth in all its splendor and triumph over error, since upon it rest justice, honor and lastly, peace. Receive, Venerable Brethren, the expression of our sin¬ cere esteem and fraternal devotion. APPENDIX BREACHES OF THE HAGUE CONVENTION Germany was one of the signatories to the Hague Con¬ vention. As early as November 12th, 1914, the Governor Gen¬ eral, Baron von der Goltz, referred to the Hague Conven¬ tion in a notice issued by him. His successor, Baron von Bissing, issued a proclama¬ tion on July 1 8th, 1915, affirming that his intention was “to govern Belgium in accordance with the provisions of the Hague Convention as to the laws and customs of land war¬ fare,” and added: “His Majesty the Emperor of Germany, after the Occu¬ pation of the Kingdom of Belgium by our victorious troops, entrusted me with the administration of this country and commissioned me to carry out the obligations arising out of the Hague Convention” So much for the law. Now for the facts. * Note — Pontificate Romanum. de consecratione electi in episcoptim. f Note — Acta Apostolic® Sedis. Vol. 7, die 6 Octobris, 1915. RELEASE OF BELGIAN DOCTORS 91 I. Collective Penalties Art. 40 of the Convention provides that “No pecuniary or other collective penalty may be inflicted on the popula¬ tions on account of the actions of individuals, for which the community could not be held to be collectively responsible.” Now the history of the occupation is divided into three periods: the invasion itself, the period of Baron von der Goltz’s administration and that of Baron von Bissing’s. During the first of these three collective penalties of every kind were systematically inflicted and there are abun¬ dant proofs for this assertion. The following alone is suf¬ ficient: — In proportion as the invading army made headway, the Commander-in-Chief had a proclamation posted up printed in three languages on red paper, wherein it was laid down that: “Any village in which hostile acts are committed against our troops by the inhabitants will be burned down. “In cases where roads, railways or bridges are de¬ stroyed, the villages nearest to the points where destruction has taken place will be held responsible. “The above-mentioned penalties will be carried out with severity and no favor will be shown. The whole body will be held responsible. Heavy war levies will be inflicted, and hostages seized in large numbers.” During the Governorship of Marshal von der Goltz a proclamation affecting the whole of the occupied territory was issued over his signature on September 2d, 1914. It expressly lays down that, “One of the inevitable hardships of war is that the innocent as well as the guilty have to suffer punishment for hostile acts.” Consequently collective punishment was unsparingly re¬ sorted to. Thus to take a typical example : The city of Brussels was mulcted in a fine of 5,000,000 marks because a police¬ man, without the knowledge of the local authorities, treated an official of the German administration disrespectfully. 92 CARDINAL MERCIER’S OWN STORY A notice signed “Baron von der Goltz,” posted up on October 7th, 1914, applied collective penalties to the whole family. It ran: — “The Belgian Government has issued calling-up notices to several military groups. All those receiving such notices are strictly forbidden to obey them. In cases of infringe¬ ment, the soldier’s family will be held equally responsible.” With Baron von Bissing as Governor General, that is to say, beginning with October 3rd, 1914, collective punish¬ ment was constantly inflicted contrary to Art. 50. The following are a few typical instances : — On December 23rd, 1914, it was stated in a notice pla¬ carded all over Brussels that in the event of soldiers’ graves being tampered with or desecrated, not only the perpetra¬ tors of such desecration will be punished, but responsibility will also fall on the whole commune. A decree of the Governor General under date January 26th makes an entire family responsible for the fact that a Belgian of military age, that is, between 16 and 40, crossed over into Holland. In fact, the communes are mulcted in huge fines on the flimsiest pretexts. Thus Puers must pay 3,000 mks. because a telegraph wire was broken, although it was proved in the course of a subsequent enquiry that it was simply worn out. Mechlin, a working-class town without funds, was fined 20,000 mks. because the mayor did not advise the military authorities of a journey the Cardinal was obliged to make on foot, owing to his having been deprived of the use of his Motor-car. II. Forced Labor for the Enemy According to the terms of Art. 52 of the Hague Conven¬ tion, “Requisitions in kind and personal service can only be exacted from communes or the inhabitants thereof on three conditions: — “1. Provided that they do not involve any obligation on the part of the population to participate in warlike opera¬ tions against their country. RELEASE OF BELGIAN DOCTORS 93 “2. Provided that they be in proportion to the resources of the country or people on whom they are imposed. “3. Provided that they be limited to the needs of the Army of Occupation.” It is interesting to notice that Art. 23 contains a con¬ cluding paragraph proposed by the German delegates to the 2nd Hague Conference held in 1907 as follows: “No belligerent is allowed to compel enemy nationals to take part in military operations against their country.” i. From the moment of the invasion Belgian civilian citizens were forced to take part in warlike operations and this in twenty different places. At Lebbeke, Termonde, Dinant and in many other towns, peaceable citizens, women and children were com¬ pelled to march at the head of German regiments or to form a screen around them. At Liege and Namur civilians were forced to dig trenches and were also employed in the work of repairing fortifications. The frenzied seizure of hostages proceeded with vigor. The proclamation of August 4th, already referred to, declared without a quibble “Hostages will be seized in large numbers.” An official proclamation placarded all over Liege in the early days of August read as follows : — “Acts of aggression committed on German troops by others than soldiers in uniform not only expose the guilty parties to summary execution but will entail the severest re¬ prisals on all the inhabitants, especially on the citizens of Liege seized as hostages and lodged in the citadel by order of the Commander of the German Army.” These hostages were Mgr. Rutten, Bishop of Liege, M. Kleyer the Mayor, and the senators and representatives, the permanent deputy and the Sheriff of Liege. 2. Under the Government of Marshal von der Goltz, every kind of requisition of services exacted during the month of August continued to be enforced. Trenches were dug, men were engaged on fortifications, roads, railways and in transport work. 94 CARDINAL MERCIER’S OWN STORY The Governor General promulgated the following de¬ cree on November 19th: “Whosoever by constraint, threats, persuasion or other means shall attempt to hinder the execution of work for the German authorities by persons capable of performing the task required of them or contractors entrusted with such work by the Germans will render themselves liable to im¬ prisonment.” The decree does not specify for what term — a case of unrestrained despotism. The system of taking hostages was continued in all its rigor. A monstrous specimen of high-handedness and cruelty is the proclamation issued on September 8th, 1914, by Ma¬ jor Commandant Dieckman in the communes of Baine-Heu- say, Grivignee and Bois-de-Breux of which the following is an extract: “From September 7th onwards I am willing to allow the inhabitants of the above mentioned communes to return to their homes. To obviate any abuse of this permission, the mayors of Baine-Heusay and Grivignee must immediately draw up a list of those who will be kept back and held as hostages in Fort Fleron. “The lives of these hostages depend on the inhabitants of the said communes keeping the peace in all circumstances. “I shall specify the individuals who are to be held as hos¬ tages from noon on one day until noon on the next. If a hostage detained in the fort is not changed at the proper time, he shall remain there for a further space of 24 hours. When this new period of 24 hours has expired, the hostage will incur the penalty of death if no change has been made. “ Priests , mayors and other municipal officials are to head the lists of hostages.” 3. Under the Government of Baron von Bissing , there were some flagrant violations of Art. 52 and revolting inci¬ dents occurred at the Mechlin Railway Works, at Luttre and also in several communes in West Flanders. We leave you to judge for yourselves. The German authorities issued an order on March 23rd for the resumption of work at Luttre and on April 21st they RELEASE OF BELGIAN DOCTORS 95 called for 200 workmen. On April 27th they made domi¬ ciliary visits with a view to pressing the workmen into serv¬ ice and conducted those they found at home to the works. Each time a man was discovered to be absent, they arrested a member of his family. However, the men remained firm in their refusal to work “because they were unwilling to cooperate in acts of war against their country.” On April 30th the workmen thus pressed into service were not released any more, but were shut up in railway carriages. On May 24th 24 workmen detained in prison at Ni- velles were tried before a Council of War at Mons “on a charge of being members of a secret society, the end of which was to frustrate the execution of German military measures.” They were sent to prison. On May 14th 45 workmen were deported into Ger¬ many. On May 18th a new proclamation announced that the prisoners’ diet would consist of dry bread and water, with only one hot meal every four days. On May 22nd 3 trucks containing 104 workmen were dispatched to Charleroy. In spite of all this, the national spirit of the workmen rose in proportion as pressure was brought to bear upon them. The same state of affairs prevailed in Mechlin where by resorting to different methods of intimidation the Ger¬ man authorities tried to force men to work on railway ma¬ terial as though it were not perfectly clear that sooner or later it would become war material. On May 30th, 1915, the Governor General announced that he would have no alternative but to punish the town of Mechlin and suburbs by bringing all commercial traffic to a standstill unless 500 artisans signed on for work at the Arsenal by 10 a. m. on Wednesday, June 2nd. Not a single workman put in an appearance, with the result that vehicular traffic within a radius of several miles of the town was completely stopped. It was at this period that Cardinal 96 CARDINAL MERCIER’S OWN STORY Mercier went on foot from Mechlin to Eppeghem— a walk which brought in its wake a fine of 20,000 mks. for the town. Several workmen were forcibly seized and detained in the shops for two or three days. Traffic was suspended for ten days. In June the commune of Sweveghem in West Flanders was punished because 350 workmen engaged in a private factory belong¬ ing to a certain M. Bekaert refused to make barbed wire for the German Army. The following order was posted up in Menin in July and August, 1915 : — “From to-day onwards no more relief of any kind what¬ ever can be afforded by the town even to families, women and children, except to those men who do regular military work and perform other tasks imposed upon them. All other workmen and their families will henceforth be unable to receive any kind of relief.” Is this not disgraceful enough? Similar treatment was meted out to Harlebeke-lez-Cour- trai, Bissighem, Lokeren and Mons. At Harlebeke 29 inhabitants were deported to Germany, while at Mons man¬ agers, foremen and 81 hands employed in M. Lenoir’s fac¬ tory were sent to prison for refusing to work for the Ger¬ man Army. M. Lenoir himself was sentenced to five years, 5 managers to one year, 6 foremen to 6 months, and 81 hands to eight weeks’ imprisonment. The Governor General also availed himself of a round¬ about means of constraint. He laid hands on the Belgian Red Cross Society, confiscated its supplies and arbitrarily di¬ verted it from its original purpose. He tried to assume the mastery over the Bienfaisance publique and exercise control over the National Committee for Relief and Food Supply. If we were to give in full the Governor General’s de¬ cree dated August 15th, 1915, “as to the measures to be adopted to guarantee the execution of work in the public interest,” as well as that of August 15th, “as to unemployed, who, out of laziness, keep away from work,’’ anyone would at once perceive the indirect methods the occupying power RELEASE OF BELGIAN DOCTORS 97 used to get both masters and men under their thumb simul¬ taneously. But it was in the War Areas (Etapes) that this contempt for the Hague Convention reached its zenith. On October 12th, 1915, an order was published in the “Official Gazette” of Decrees applicable to War Areas, the most illuminating passages of which are these: — Art. 1. Whosoever when ordered to do so by the mili¬ tary commanders refuses without good reason to undertake or continue work adapted to his calling and in the execution of which the military authorities are interested will be liable to correctional imprisonment for one year or more. He is also liable to be deported into Germany. In no case may an appeal to contrary Belgian laws or even International Conventions be made in justification of a refusal to work. The right of deciding as to the lawfulness of work be¬ longs exclusively to the military commander. Art. 2. Whosoever, by coercion, threats, persuasion or other means, induces anyone to refuse work as provided for in Art. 1 renders himself liable to imprisonment for a term of five years or more. Art. 3. Whosoever knowingly encourages this punish¬ able refusal to work by granting relief or by any other means is liable to a fine which may amount to 10,000 marks. He may likewise be condemned to one year’s imprisonment. In cases where communes or societies are found guilty of such crimes, the penalty will be inflicted on the heads thereof. Art. 4. Apart from the penalties laid down in Arts. 1 and 3 the German authorities may, where needful, exact a contribution or adopt other coercive police measures in Communes where the carrying out of work has been re¬ fused without adequate reasons. This present decree will come into force at once. (Signed) von Huger, Lieutenant General. Inspector of Military Areas. Ghent, October 12th, 1915. 98 CARDINAL MERCIER’S OWN STORY The injustice and highhandedness of this decree are be¬ yond imagination. Forced labor, collective punishment, in¬ definite penalties — everything is there. It is slavery, neither more nor less. III. New Taxes We will limit ourselves to detailing in a few words two instances of taxation contrary to Arts. 48, 49, 51, and 52 of the Hague Convention. The first was ordered by Baron von Bissing in a decree dated January 1 6th, 1915, and consisted in penalizing Bel¬ gians who had taken refuge in foreign countries, by impos¬ ing a huge additional tax at the rate of ten times the amount of their personal contribution. This tax does not find a place in any existing category, and affected solely a class of citizens who made lawful use of their right to quit the coun¬ try before it was occupied. It is therefore contrary to Arts. 48 and 51 of the Convention. The second infringement of the Convention is the well- known contribution of 480,000,000 marks levied on the nine Provinces on December 1 8th, 1914. An essential condition for the lawfulness of this kind of contribution, according to the Hague Convention, is that it be apportioned according to the resources of the country (Art. 52). But Belgium was devastated in 1914 — contri¬ butions for war purposes were levied on towns, innumer¬ able requisitions in kind drained the resources of the coun¬ try, workshops and factories were for the most part closed down, whilst in the case of the few where work still con¬ tinued, the Germans did not fail to commandeer raw ma¬ terials contrary to all law. And on this poverty-stricken Belgium, dependent as it was on outside charity, they levied a contribution of nearly 500,000,000 marks. A decree of December 10th, 1914, reads: — “A monthly war contribution of 40,000,000 francs pay¬ able during the space of one year is hereby levied on the Belgian people.” We have at length reached the end of that year and RELEASE OF BELGIAN DOCTORS 99 now, at the time of writing, the occupying power intends to replace “the space of one year” by “for the duration of the War.” Poor little Belgium ! What has she done to rich and powerful Germany, her neighbor, to be thus trodden under foot, calumniated and oppressed? If we had to compile a complete list of decrees and acts, in which the occupying power has to our knowledge placed itself in open contradiction with the Hague Convention, we should have to add “the abuse of requisitions in kind” against Art. 52, the seizure of funds belonging to private so¬ cieties, the commandeering of some hundreds of miles of steel rails and of weapons stored in communal houses by order of the Belgian Government contrary to Art. 53, the disregard for the laws of the country, especially of the penal code, contrary to Art. 43. But we cannot say everything here nor bring everything forward. Should, however, those to whom our correspondence is directed wish for proofs of the allegations we have merely indicated in this final para¬ graph, we shall be only too glad to supply them. Neither in our letter nor in these four appendices have we made one charge which we cannot substantiate from documents in our possession. CHAPTER VIII THE CARDINAL’S PROTEST AGAINST THE BEHAVIOR OF A GERMAN MILITARY CHAPLAIN Archbishop’s House, M alines, February yth, 1915. To His Excellency Baron von Bissing, Governor General, Brussels. Dear Governor General — An incident has taken place at Forrieres, in the province of Luxemburg, to which I would call your kind attention. In conjunction with my venerable colleague, Mgr. Heylen, Bishop of Namur, I should like, in addressing your Excellency, to forestall any painful controversy. At Forrieres on Thursday, January 7th, the Cure Tag- non had a conversation in the sacristy with the chaplain of Arlon which can be more or less summed up in these terms : “Many innocent priests in the diocese of Namur have been shot.” “Pardon me,” answered the chaplain, “our staff head¬ quarters is in possession of proofs that many civilians were francs-tireurs and that the clergy incited them to fire on the German troops.” “You must not believe all these tales; if one were to pin one’s faith to all one hears, I should also believe that the Germans have attempted to violate our nuns.” That very same day the chaplain, in company with a German doctor, paid a visit to the presbytery in order to induce the cure to repeat the statement he had made that morning in the sacristy. The cure acknowledged that, materially, he had made the statement, but in a vague manner: “people say,” “there IOO PROTEST AGAINST CHAPLAIN ioi is a rumor that and conditionally, “Germans may have violated our nuns.” Nevertheless, the chaplain made a categorical and de¬ tailed accusation against the cure, the net result of which was the imprisonment of the cure and his condemnation to either a hundred days in gaol or a thousand francs fine. M. Misson, a public notary, accused of having in the course of familiar conversation with his friend, M. Tagnon, made the same statement, was condemned to undergo the same penalty. I am convinced, dear Governor General, that the Cure Tagnon has not made the damning accusation against the German army which the chaplain has put into his mouth. But it is not my intention to lay stress on the accusation itself. It is the behavior of the chaplain that I find odious. A conversation held in the afternoon by two brother priests cannot be the subject for a summons to court. The afore¬ thought behavior of the accuser who tries to impose on the good faith of his brother priest, airily accepts a cigar which he smokes in his company, enjoys the hospitality of his table, in order to extort from him a confidence with which to trump up. a case against him — this premeditation aggravates the guilt of the accuser and the odious character of his accusa¬ tion. The military tribunal of Arlon must have been badly informed of the case to have accepted such an accusation and not to have proceeded against the accuser, rather than the acused. We, Mgr. the Bishop of Namur and myself, deem that our respect for the dignity of the priesthood and our solici¬ tude for the maintenance of good fellowship, which ought to reign among priests to whatsoever nationality they be¬ long, will not allow us to let pass without censure the un- gentlemanly behavior of the Rector of the Dominican Pri¬ ory at Dusseldorf. We are minded therefore to refer the case to the Reverend Father General of the Dominican Or¬ der and to the Holy See at Rome. Nevertheless, if the chaplain will consent to withdraw 102 CARDINAL MERCIER’S OWN STORY his accusation and if your Excellency will condescend to re¬ mit the penalty inflicted on the Cure Tagnon and on his parishioner, M. Misson, we shall be pleased to consider the incident as closed. Kindly receive, Governor General, the assurance of my sincere esteem. (Signed) D. J. Cardinal Mercier, Archbishop of Malines. I join with His Eminence in begging the Governor to take in hand the cause of my diocesans. (Signed) Th. Louis Heylen, Bishop of Namur. Following this intervention, the punishment inflicted on the cure Tagnon and on M. Misson was reduced by one- half. CHAPTER IX THE CARDINAL INTERCEDES ON BEHALF OF F. VAN BAM- BEKE, S. J., AND OF THE ABBE CUYLITS. VON BISSING COMPLAINS OF THE PATRIOTIC ATTI¬ TUDE TAKEN UP BY THE CLERGY F. Van Bambeke, S. J., and the Abbe Cuylits had been condemned by the German military tribunals for having helped Belgian youths to cross the frontier. As a result of the Cardinal’s intervention, the Governor General con¬ sented to set the Abbe Cuylits at liberty and gave permis¬ sion to F. Van Bambeke to undergo his punishment in a Bel¬ gian prison. In communicating to the Cardinal this act of clemency, Von Bissing complains for the first time of the patriotic attitude assumed by the clergy. This theme of discussion, which is here only hinted at, will later on form the object of extensive correspondence between his Eminence and the German authorities. Archbishop’ s House, M alines, March 17 th, 1915. To His Excellency, Baron von Bissing, Governor General, Brussels. Sir — The Reverend Father Van Bambeke, S. J., pre¬ fect of the Central Art and Mechanical School, rue d’Alle- magne, Brussels, has been condemned to two years and a half penal servitude for having provided facilities to two or three young men to pass the frontier, and the Abbe Cuylits, cure of N. D., at Cureghem, has to undergo one year of the same penalty for a similar offense. The two ecclesiastics are in poor health, which would be shattered for good and all by residence in a foreign land. For this reason I appeal with confidence to your Excel- 103 104 CARDINAL MERCIER’S OWN STORY lency’s humane sentiments and ask you to arrange that both the religious and the secular priest may undergo their pun¬ ishment in our own country. I would be extremely obliged to you were you to comply with my request, and I beg you to accept, sir, the expression of my sincere esteem. (Signed) D. J. Cardinal Mercier, Archbishop of Malines. Governor General’s Office , Brussels, III b. T. L. No. 1422. April 4th, 1915. DECREE Grant of Pardon to the Abbe Cuylits and F. Bambeke, S. J. To His Eminence Cardinal Mercier, Malines. To my deep regret I have often been forced latterly to take a decision about appeals for reprieve in the case of ecclesiastics who have been punished for having behaved toward the German authorities in a manner unworthy of their state.
| 38,540 |
27/halshs.archives-ouvertes.fr-halshs-01929734-document.txt_1
|
French-Science-Pile
|
Open Science
|
Various open science
| null |
None
|
None
|
French
|
Spoken
| 2,586 | 3,856 |
Bonheur rural, malheur urbain? Résumé
Vaut-il mieux habiter à la campagne ou en ville? Les mesures de bien-être subjectif pour la France font apparaître un avantage en faveur des campagnes : les ruraux sont plus heureux, plus satisfaits de leur vie, de leur logement, de leurs relations sociales, et se sentent plus en sécurité. Globalement, toutes ces métriques se dégradent avec la taille des agglomérations, pour atteindre un point bas à Paris, tandis que les inégalités de revenu font le chemin inverse. Exception à cette règle, les villes moyennes (20 000 à 100 000 habitants) ressortent comme particulièrement malheureuses : satisfaction de vie et indicateurs de qualité des relations sociales y apparaissent particulièrement dégradés. Erratum (2018-11-12) : dans la version initiale de cette note, nous disions que notre segmentation était selon l'aire urbaine. Il s'agit en fait de l'unité urbaine, concept plus fin et assis sur la continuité du bâti. Nous avons en conséquence mis à jour les cartes en Annexe et amendé le texte. Les auteurs de cette note tiennent à remercier Olivier Bouba-Olga pour ses conseils et remarques. Comment citer cette publication : Madeleine Péron, Mathieu Perona, « Bon rural, », , 2018-07, Madeleine Péron madeleine.peron org
Madeleine Péron est assistante de recherche l'Observatoire du Bienêtre du CEPREMAP Mathieu Perona [email protected] Mathieu Perona est directeur exécutif de l'Observatoire du Bienêtre du CEPREMAP Observatoire du Bien-être du CEPREMAP
Note OBE n°2018-07 : Bonheur rural, malheur urbain? 2
En France, aujourd'hui, les habitants des communes rurales sont 10 % de plus que les habitants des villes à se déclarer très heureux1. Les villes, moyennes et grandes, semblent perdre de leur attrait. Selon l'urbaniste et démographe Pierre Merlin2, on assiste même en France à un véritable « exode urbain » qui aurait concerné, depuis les années 1970, plus de 4,5 millions de Français et représenterait 110 000 personnes chaque année, qui troquent la vie dans les grandes villes contre un peu de verdure et les aires péri-urbaines. Cette note montre que pour la plupart des indicateurs de bien-être (satisfaction dans la vie, bonheur, sens et valeur ), la relation avec le nombre d'habitants est globalement décroissante, mais que les villes moyennes font figure d'exception avec un niveau de mal-être particulièrement prononcé 3.
Heureuses campagnes
Dans notre enquête, les habitants des unités rurales et des petites villes déclarent des niveaux de bien-être supérieurs. Plus une ville a d'habitants, moins nos enquêtés s'y déclarent heureux. Ainsi, les habitants des campagnes déclarent plus souvent avoir été heureux hier et, symétriquement, les habitants des grandes villes sont plus nombreux à déclarer s'être sentis déprimés (Figure 1). Figure 2 De plus, les habitants des communes rurales trouvent davantage de sens à leur vie et déclarent un niveau de satisfaction vis-à -vis de leur vie actuelle supérieur (Figure 2). Les Parisiens sont ceux qui déclarent les niveaux de bien-être les plus faibles dans ces quatre catégories. Figure 1
Figure 3
1 1 personne sur
2
déclare un niveau de bonheur supérieur à 8 sur une échelle de 0 à 10 dans les communes rurales, contre environ 44% en moyenne dans les autres types d'agglomération.
2 Merlin, P. (2009), Exode urbain : de la ville à la campagne, Les É tudes de la Documentation Française (France), no5303. 3
Nous utilisons ici la notion d'unité urbaine comme découpage, afin de rattacher les communes périurbaines à leur agglomération. Les « villes moyennes » sont ici les unités urbaines comprises entre 20 000 et 100 000 habitants. Comme les habitants des villes et des campagnes n'ont pas le même profil d'â ge et de revenus, nous neutralisons l'effet de ces deux éléments (â ge et revenu moyens)4. 4 Les choix d'habitation sont en partie volontaires : il va donc exister un effet de sélection que nous ne sommes pas en mesure de neutraliser ici, par exemple si les personnes les plus heureuses sont plus enclines à se déplacer vers des zones en expansion. Concernant ces dernières, la carte en Annexe 1 montre qu'il s'agit à la fois d'aires périurbaines autour de grandes métropoles – mais sans continuité de bâti avec celles-ci, donc des communes de deuxième ou troisième couronne – et de villes d'importance locale (Gap, Poitiers, Blois), donc d'un groupe hétérogène. Les atouts du cadre de vie rural
Figure 5 Figure 4
Notre enquête accrédite l'idée d'un cadre de vie rural plus agréable : la satisfaction à l'égard du cadre de vie et celle à l'égard du logement sont les plus élevées dans les petites communes, et les plus faibles dans l'aire urFigure 6 baine parisienne. Si sur ces deux éléments la satisfaction diminue de manière assez régulière avec la taille de l'agglomération, le sentiment de sécurité fait apparaître une rupture franche entre communes rurales et urbaines, avec une position intermédiaire pour les villes moyennes.
La solitude des villes moyennes
Un autre aspect important concerne la qualité des relations sociales. Les campagnes sont souvent désignées comme des lieux d'isolement où il est difficile de 5 Pour ce faire nous utilisons le Dispositif Statistique sur les Ressources et les Conditions de Vie (SRCV) produit par l'INSEE. Comme les unités urbaines ne sont pas également réparties selon les régions (carte en Annexe 1), nous neutralisons également l'effet des différences régionales, que nous avions documentées dans Laura Leker, « Revenu et bien-être », Observatoire du Bien-être du Cepremap, n°2016 – 01, 21/01/2016. Bonheur rural, malheur urbain? Quels aspects de la vie à la campagne peuvent expliquer ces différences de bien-être et d'où vient la rupture marquée par les villes moyennes? faire des rencontres et de socialiser 6 et les villes sont régulièrement désignées comme le symbole de la solitude moderne, où les liens sociaux sont transformés voire disparaissent, dans une vision « Durkheimienne »7. Ce n'est pas ce que montrent nos données. Il apparaît au contraire une relation « en U » pour quatre indicateurs de sociabilité que sont la satisfaction vis-à -vis des relations avec son entourage (famille, amis et collègues) ainsi que le sentiment d'avoir des gens autour de soi sur qui compter
. Figure 7 Les habitants des petites communes semblent avoir des relations avec leur famille, leurs amis et leurs collègues bien plus satisfaisantes que les habitants des villes moyennes et des grandes villes. Les écarts sont moindres concernant l'aide et le soutien, peut-être parce que ce sont non pas des relations quotidiennes qui ont effectivement lieu, mais une projection de ce qui se passerait en cas d'événement grave. Les plus bas niveaux de sociabilité apparaissent dans les villes de 20 000 à 100 000 habitants selon notre classification, où il semble plus difficile de créer et maintenir des relations sociales de qualité. Un tissu social moins fort, tant au niveau personnel que professionnel, constituerait donc une composante significative du moindre bien-être des villes moyennes. 6 L'émission de télé-réalité L'Amour est dans le pré joue particulièrement avec cette représentation 7 La question des transformations du lien social traverse une grande partie de l'oeuvre d'Emile Durkheim (De la division du travail social, Paris, Félix Alcan, 1893, Le Suicide : Étude de sociologie, Paris, Félix Alcan, 1897). L'industrialisation et l'urbanisation croissante qu'il observe à la fin du XIXe siècle ont une place importante dans ces transformations, et ses analyses du lien social trouvent encore un écho dans la sociologie contemporaine. Si on regarde plus dans le détail (Figure 3)5, les villes moyennes apparaissent comme une exception à cette relation générale : elles se distinguent par un niveau de satisfaction nettement inférieur à celui de tous les autres types d'agglomérations. Si nos données ne nous permettent pas une analyse détaillée et précise des différences géographiques en termes de pouvoir d'achat, on peut tout de même constater qu'il est préférable, lorsqu'on appartient à un ménage pauvre9, vivre dans de petites villes (Figure 10). Figure
8 Si l'activité économique est plus intense dans les grandes villes et offre davantage de perspectives en termes d'emploi aux plus pauvres, les effets béné fiques du cadre de vie évoqués ci-dessus semblent prendre le pas. Ainsi, les personnes considérées en situation de pauvreté monétaire dans le dispositif SRCV ont certes un niveau de satisfaction bien inférieur à la moyenne, mais ceux vivant dans des communes rurales se déclarent plus satisfaits que ceux installés dans les grandes agglomérations. On observe encore une fois un net décrochage des villes moyennes (entre 20 000 et 100 000 habitants) pour lesquelles les habitants les plus pauvres se déclarent significativement moins satisfaits de leur vie.
Satisfaction dans la vie et statut vis-à-vis de la pauvreté Un effet limité du revenu Paris
Nous avons vu à plusieurs reprises8 que le revenu constitue un facteur essentiel du bien-être des Français. Le revenu joue-t-il un rô le ici? Sans doute, mais de manière limitée. En effet, le niveau de vie moyen le plus élevé est observé dans l'aire urbaine de Paris, qui enregistre également le niveau de satisfaction le plus faible. Hors Paris, les niveaux de vie moyens sont peu différents, sauf pour les villes moyennes, où le plus faible revenu peut effectivement peser sur le bien-être. Type d'agglomération
Note OBE n°2018-07 : Bonheur rural, malheur urbain? 4 200.000 à 2 millions 100.000 à 199.999 Autres 20.000 à 99.999 Mé nages pauvres 2.000 à 19.999 Communes Rurales 5,5 6 6,5 7 7,5 Satisfaction dans la vie Observatoire du Bien-être du CEPREMAP 08/11/2018
Figure 10, Données INSEE, SRCV, 2010 – 2015
Le grand écart des inégalités Enfin, une autre piste consiste à dire que, si le revenu joue un rô le limité dans le bien-être en absolu, l'aspect relatif peut également compter. Ainsi, dans son article « Neighbors as Negatives »10, Erzo Luttmer montre comment avoir des voisins plus riches que soi peut influer négativement sur la perception que l'on a de son niveau de vie et avoir un effet négatif sur le bien-être. Les campagnes et les petites villes connaissant des niveaux d'inégalités de revenu moins importants que les grandes villes11, l'effet de comparaison joue probablement en faveur des territoires plus égalitaires.
9 Figure 9 8 Laura Leker, « Revenu et bien-être », Observatoire du Bienêtre du Cepremap, n°2016 – 01, 21/01/2016 et Y. Algan, E. Beasley et C.
Se
nik,
Les Français, le Bonheur et
l
'
argent
,
É
ditions Rue d'Ulm
,
Opuscule
du CEPREMAP n°46,
2018
. Les ménages en situation de pauvreté monétaire sont identifiés comme ceux dont le niveau de vie est inférieur au seuil de pauvreté (c'est-à -dire inférieur à 60% du revenu médian).
10 Luttmer, E. F. (2005). Neighbors as negatives: Relative earnings and well-being. The Quarterly journal of economics, 120(3), 963-1002. 11
Dans la figure 11, le niveau des inégalités est synthétisé par l'indice de Gini, qui varie de 0 à 1, 0 étant la situation la plus égalitaire en termes de revenu, et 1 la plus inégalitaire. Paris présente ainsi un indice de Gini proche de celui du Brésil, pays considéré comme l'un des plus inégalitaires au monde, tandis que les communes rurales sont semblables, en termes d'inégalités, à un pays comme la Finlande, réputé pour ses faibles inégalités de revenu. tibles d'expliquer ce différentiel en faveur des campagnes. Les villes de 20 000 à 100 000 habitants bénéficient d'une partie des avantages d'une taille modeste, mais sont particulièrement défavorisées en termes de niveau de vie moyen, et sont le lieu de relations sociales plus dégradées, ce qui contribue à en faire le type d'agglomération le moins bien positionné en termes de satisfaction de vie. Nos analyses n'épuisent évidemment pas toutes les sources possibles de ces différentiels, et ces éléments doivent constituer autant de pistes pour explorer plus en détail ce malaise des villes moyennes.
5 Note OBE n°2018-07 :
Bonheur rural, malheur urbain? La figure 11 mesure les inégalités par l'indice de Gini, et compare les niveaux d'inégalités observé dans chaque type de ville avec un pays proche en termes d'inégalités de revenu. Sur cette dimension, les villes moyennes ne se distinguent pas de la tendance géné rale. D'autres formes d'inégalités non pas au sein des territoires, mais entre les territoires offrent également quelques pistes pour mieux comprendre le paradoxe des villes moyennes. Le géographe et politiste Philippe Estèbe12 considère que, privilégiée pendant longtemps par l'É tat, les villes moyennes ont été délaissées petit à petit et subissent de plein fouet trois processus : la décentralisation (qui donne plus de pouvoir aux pô les ré gionaux et départementaux plutô t qu'aux sous-préfectures, vidant les villes moyennes des services de l'É tat) ; la mobilité de la population (qui travaille de moins en moins là où elle vit) ; et le très faible dynamisme économique (du fait de la disparition progressive des industries locales au profit des pô les économiques et financiers que sont les grandes villes). Conclusion Les campagnes et petites villes française semblent garantes d'un bien-être supérieur pour leurs habitants, comparativement aux grandes villes. Que ce soit en termes de satisfaction dans la vie, de bonheur ou encore de sens donné à sa vie, l'analyse de nos données montre un certain avantage de la ruralité. La qualité du cadre de vie, la plus faible insécurité, de plus faibles niveaux d'inégalités, de meilleures relations sociales sont autant de facteurs, très liés entre eux, suscep12 Estèbe, Philippe. « Petites villes et villes moyennes
: une
leçon de choses », Tous urbains
, vol. 21, no. 1, 2018,
pp.
3035
.
Figure 11 Observatoire du Bien-être du CEPREMAP 08/11/2018
Note OBE n°2018-07 : Bonheur rural, malheur urbain? 6 Données
Les données mobilisées dans cette note sont : • La plate-forme « Bien-être » de l'enquête de conjoncture au près des ménages, INSEE / CEPREMAP – description sur le site de l'Observatoire. Vagues trimestrielles de Juin 2016 à Juin 2018. • Statistiques sur les ressources et les conditions de vie (SRCV), vagues de 2010 à 2015, INSEE (producteur), ADISP (diffuseur) – description Annexe 1 Données : INSEE, Base comparateur des territoires, 2017
Le CEPREMAP est né en 1967 de la fusion de deux centres, le CEPREL et le CERMAP, pour éclairer la planification française grâ ce à la recherche économique. Le CEPREMAP est, depuis le 1er janvier 2005, le CEntre Pour la Recherche EconoMique et ses APplications. Il est placé sous la tutelle du Ministère de la Recherche. La mission prévue dans ses statuts est d'assurer une interface entre le monde académique et les administrations économiques. Il est à la fois une agence de valorisation de la recherche économique auprès des décideurs, et une agence de financement de projets dont les enjeux pour la décision publique sont reconnus comme prioritaires. http://www.cepremap.fr Observatoire du Bien-être L'Observatoire du bien-être au CEPREMAP soutient la recherche sur le bien-être en France et dans le monde. Il réunit des chercheurs de différentes institutions appliquant des méthodes quantitatives rigoureuses et des techniques novatrices. Les chercheurs affiliés à l'Observatoire travaillent sur divers sujets, comme des questions de recherche fondamentales telles que la relation entre éducation, santé et bien-être, l'impact des relations avec les pairs sur le bien-être, la relation entre le bien-être et des variables cycliques tels que l'emploi et la croissance et enfin l'évolution du bien-être au cours de la vie. Un rô le important de l'Observatoire est de développer notre compréhension du bien-être en France: son évolution au fil du temps, sa relation avec le cycle économique, les écarts en termes de bien-être entre différents groupes de population ou régions, et enfin la relation entre politiques publiques et bien-être. Directeur de publication Mathieu Perona Comité scientifique Claudia Senik Yann Algan Andrew Clark Observatoire du Bien-être du CEPREMAP 48 Boulevard Jourdan 75014 Paris – France +33(0)1 80 52 13 61
| 37,471 |
https://github.com/jaegertracing/jaeger-client-java/blob/master/jaeger-core/src/main/java/io/jaegertracing/internal/senders/SenderResolver.java
|
Github Open Source
|
Open Source
|
Apache-2.0
| 2,022 |
jaeger-client-java
|
jaegertracing
|
Java
|
Code
| 504 | 1,240 |
/*
* Copyright (c) 2018, The Jaeger Authors
*
* Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except
* in compliance with the License. You may obtain a copy of the License at
*
* http://www.apache.org/licenses/LICENSE-2.0
*
* Unless required by applicable law or agreed to in writing, software distributed under the License
* is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express
* or implied. See the License for the specific language governing permissions and limitations under
* the License.
*/
package io.jaegertracing.internal.senders;
import io.jaegertracing.Configuration;
import io.jaegertracing.spi.Sender;
import io.jaegertracing.spi.SenderFactory;
import java.util.Iterator;
import java.util.ServiceLoader;
import lombok.extern.slf4j.Slf4j;
/**
* Provides a way to resolve an appropriate {@link Sender}
*/
@Slf4j
public class SenderResolver {
/**
* Resolves a {@link Sender} by passing {@link Configuration.SenderConfiguration#fromEnv()} down to the
* {@link SenderFactory}
*
* @see #resolve(Configuration.SenderConfiguration)
* @return the resolved Sender, or NoopSender
*/
public static Sender resolve() {
return resolve(Configuration.SenderConfiguration.fromEnv());
}
/**
* Resolves a sender by passing the given {@link Configuration.SenderConfiguration} down to the
* {@link SenderFactory}. The factory is loaded either based on the value from the environment variable
* {@link Configuration#JAEGER_SENDER_FACTORY} or, in its absence or failure to deliver a {@link Sender},
* via the {@link ServiceLoader}. If no factories are found, a {@link NoopSender} is returned. If multiple factories
* are available, the factory whose {@link SenderFactory#getType()} matches the JAEGER_SENDER_FACTORY env var is
* selected. If none matches, {@link NoopSender} is returned.
*
* @param senderConfiguration the configuration to pass down to the factory
* @return the resolved Sender, or NoopSender
*/
public static Sender resolve(Configuration.SenderConfiguration senderConfiguration) {
Sender sender = null;
ServiceLoader<SenderFactory> senderFactoryServiceLoader = ServiceLoader.load(SenderFactory.class,
SenderFactory.class.getClassLoader());
Iterator<SenderFactory> senderFactoryIterator = senderFactoryServiceLoader.iterator();
if (!senderFactoryIterator.hasNext()) {
log.warn("No sender factories available. Using NoopSender, meaning that data will not be sent anywhere!");
return new NoopSender();
}
String requestedFactory = System.getProperty(Configuration.JAEGER_SENDER_FACTORY);
boolean hasMultipleFactories = false;
boolean isRequestedFactoryAvailable = false;
while (senderFactoryIterator.hasNext()) {
SenderFactory senderFactory = senderFactoryIterator.next();
if (senderFactoryIterator.hasNext()) {
log.debug("There are multiple factories available via the service loader.");
hasMultipleFactories = true;
}
if (hasMultipleFactories) {
// we compare the factory name with JAEGER_SENDER_FACTORY, as a way to know which
// factory the user wants:
if (senderFactory.getType().equals(requestedFactory)) {
log.debug(
String.format("Found the requested (%s) sender factory: %s",
requestedFactory,
senderFactory)
);
isRequestedFactoryAvailable = true;
sender = getSenderFromFactory(senderFactory, senderConfiguration);
}
} else {
sender = getSenderFromFactory(senderFactory, senderConfiguration);
}
}
if (null != sender) {
log.debug(String.format("Using sender %s", sender));
return sender;
} else if (requestedFactory == null && hasMultipleFactories) {
log.warn("Multiple factories available but JAEGER_SENDER_FACTORY property not specified.");
} else if (requestedFactory != null && hasMultipleFactories && !isRequestedFactoryAvailable) {
log.warn(
String.format("%s not available, using NoopSender, hence data will not be sent anywhere!",requestedFactory)
);
} else {
log.warn("No suitable sender found. Using NoopSender, meaning that data will not be sent anywhere!");
}
return new NoopSender();
}
private static Sender getSenderFromFactory(SenderFactory senderFactory,
Configuration.SenderConfiguration configuration) {
try {
return senderFactory.getSender(configuration);
} catch (Exception e) {
log.warn("Failed to get a sender from the sender factory.", e);
return null;
}
}
}
| 17,874 |
https://github.com/walokra/fotorest/blob/master/fotorest-wicket/src/main/java/com/ruleoftech/lab/HomePage.java
|
Github Open Source
|
Open Source
|
MIT
| null |
fotorest
|
walokra
|
Java
|
Code
| 696 | 3,206 |
package com.ruleoftech.lab;
import java.util.ArrayList;
import java.util.Arrays;
import java.util.Iterator;
import java.util.List;
import org.apache.wicket.ajax.AjaxEventBehavior;
import org.apache.wicket.ajax.AjaxRequestTarget;
import org.apache.wicket.extensions.ajax.markup.html.repeater.data.table.AjaxFallbackDefaultDataTable;
import org.apache.wicket.extensions.markup.html.repeater.data.grid.ICellPopulator;
import org.apache.wicket.extensions.markup.html.repeater.data.table.AbstractColumn;
import org.apache.wicket.extensions.markup.html.repeater.data.table.IColumn;
import org.apache.wicket.extensions.markup.html.repeater.data.table.ISortableDataProvider;
import org.apache.wicket.markup.html.WebComponent;
import org.apache.wicket.markup.html.WebPage;
import org.apache.wicket.markup.html.basic.Label;
import org.apache.wicket.markup.html.form.Form;
import org.apache.wicket.markup.html.form.TextField;
import org.apache.wicket.markup.html.panel.FeedbackPanel;
import org.apache.wicket.markup.repeater.Item;
import org.apache.wicket.markup.repeater.RefreshingView;
import org.apache.wicket.model.IModel;
import org.apache.wicket.model.Model;
import org.apache.wicket.model.PropertyModel;
import org.apache.wicket.request.mapper.parameter.PageParameters;
import org.apache.wicket.spring.injection.annot.SpringBean;
import org.slf4j.Logger;
import org.slf4j.LoggerFactory;
import org.springframework.beans.BeanUtils;
import com.googlecode.wicket.jquery.ui.form.button.AjaxButton;
import com.googlecode.wicket.jquery.ui.panel.JQueryFeedbackPanel;
import com.ruleoftech.lab.components.ExternalImage;
import com.ruleoftech.lab.components.GalleryImageDataProvider;
import com.ruleoftech.lab.components.LinkPropertyColumn;
import com.ruleoftech.lab.exception.BusinessException;
import com.ruleoftech.lab.model.GalleryAlbum;
import com.ruleoftech.lab.model.GalleryImage;
import com.ruleoftech.lab.model.ImgurImage;
import com.ruleoftech.lab.service.RestService;
@SuppressWarnings("serial")
public class HomePage extends WebPage {
private static final long serialVersionUID = 1L;
private static final Logger LOGGER = LoggerFactory.getLogger(HomePage.class);
private final FeedbackPanel feedback;
private List<GalleryImage> galleryImages;
private final Label galleryImageTitle;
private final Model<String> galleryImageTitleModel;
private RefreshingView<ImgurImage> imageListView;
private List<IModel<ImgurImage>> images;
private final Form<Void> form;
@SpringBean
private RestService restService;
public HomePage(final PageParameters parameters) {
super(parameters);
form = new Form<Void>("form");
initActions();
// Add feedbackpanel for showing messages
feedback = new JQueryFeedbackPanel("feedback");
feedback.setOutputMarkupId(true);
form.add(feedback);
// init list to contain some images
try {
galleryImages = restService.hotImages();
} catch (BusinessException e) {
error(e.getMessage());
}
initTable();
// set image panel components
galleryImageTitleModel = new Model<String>();
galleryImageTitle = new Label("galleryImageTitle", galleryImageTitleModel);
galleryImageTitle.setOutputMarkupId(true);
form.add(galleryImageTitle);
createGalleryImagesPanel();
initFooter();
add(form);
}
private void initActions() {
form.add(new AjaxButton("hotButton") {
@Override
public void onSubmit(AjaxRequestTarget target, Form<?> form) {
LOGGER.trace("{'method':'hotButton.onSubmit'}");
info("Fetching hot images");
try {
galleryImages = restService.hotImages();
} catch (BusinessException e) {
error(e.getMessage());
}
target.add(form);
}
});
form.add(new AjaxButton("randomButton") {
@Override
public void onSubmit(AjaxRequestTarget target, Form<?> form) {
LOGGER.trace("{'method':'randomButton.onSubmit'}");
info("Fetching random images");
try {
galleryImages = restService.randomImages();
} catch (BusinessException e) {
error(e.getMessage());
}
target.add(form);
}
});
final TextField<String> search = new TextField<String>("search", new Model<String>());
form.add(search);
AjaxButton searchButton = new AjaxButton("searchButton") {
@Override
public void onSubmit(AjaxRequestTarget target, Form<?> form) {
LOGGER.trace("{'method':'searchButton.onSubmit'}");
info("Searching the gallery");
try {
galleryImages = restService.searchImages(search.getValue());
} catch (BusinessException e) {
error(e.getMessage());
}
target.add(form);
}
};
form.add(searchButton);
form.setDefaultButton(searchButton);
}
private void initFooter() {
String credits = "";
try {
credits = restService.getCredits();
} catch (BusinessException e) {
error(e.getMessage());
}
form.add(new Label("credits", credits));
form.add(new Label("wicketVersion", getApplication().getFrameworkSettings().getVersion()));
}
private void initTable() {
// DataTable
// resources for working with datatable:
// http://www.packtpub.com/article/apache-wicket-displaying-data-using-datatable
final AjaxFallbackDefaultDataTable<GalleryImage, String> table = new AjaxFallbackDefaultDataTable<GalleryImage, String>(
"datatable", createColumns(), createDataProvider(), 50);
form.add(table);
}
private ISortableDataProvider<GalleryImage, String> createDataProvider() {
return new GalleryImageDataProvider<GalleryImage>() {
@Override
public List<GalleryImage> getData() {
return galleryImages;
}
};
}
private List<IColumn<GalleryImage, String>> createColumns() {
List<IColumn<GalleryImage, String>> columns = new ArrayList<IColumn<GalleryImage, String>>();
columns.add(new AbstractColumn<GalleryImage, String>(new Model<String>("Title"), "title") {
@Override
public void populateItem(Item<ICellPopulator<GalleryImage>> cellItem, String componentId,
final IModel<GalleryImage> rowModel) {
Label label = new Label(componentId, new PropertyModel<GalleryImage>(rowModel, "title"));
label.add(new AjaxEventBehavior("onclick") {
@Override
protected void onEvent(AjaxRequestTarget target) {
GalleryImage gi = rowModel.getObject();
galleryImageTitleModel.setObject(gi.getTitle());
target.add(galleryImageTitle);
images = new ArrayList<IModel<ImgurImage>>();
// Setting gallery image or gallery album images
if (gi.isIs_album()) {
String[] tokens = gi.getLink().split("\\/(?=[^\\/]+$)");
GalleryAlbum album = new GalleryAlbum();
try {
album = restService.getGalleryAlbum(tokens[1]);
LOGGER.trace("{'method':'table.title.onClick.album', 'debug':'{}'}", album.toString());
for (ImgurImage i : Arrays.asList(album.getImages())) {
i.setLink(getExternalResourceFromUrl(i.getLink(), i.getWidth(), i.getHeight()));
Model<ImgurImage> img = new Model<ImgurImage>();
img.setObject(i);
images.add(img);
}
} catch (BusinessException be) {
error(be.getMessage());
}
} else {
LOGGER.trace("{'method':'table.title.onClick.image', 'debug':'{}'}", gi.toString());
ImgurImage i = new ImgurImage();
BeanUtils.copyProperties(gi, i);
i.setTitle(null);
i.setLink(getExternalResourceFromUrl(i.getLink(), i.getWidth(), i.getHeight()));
Model<ImgurImage> img = new Model<ImgurImage>();
img.setObject(i);
images.add(img);
}
target.add(form);
}
});
cellItem.add(label);
}
});
// TODO: could also use ExternalLink
columns.add(new LinkPropertyColumn<GalleryImage>(new Model<String>("Link"), "link", "link") {
@Override
public void onClick(Item<ICellPopulator<GalleryImage>> item, String componentId,
IModel<GalleryImage> model, AjaxRequestTarget target) {
LOGGER.trace("{'method':'table.link.onClick'}");
target.appendJavaScript("window.open('" + model.getObject().getLink() + "')");
}
});
return columns;
}
private void createGalleryImagesPanel() {
images = new ArrayList<IModel<ImgurImage>>();
imageListView = new RefreshingView<ImgurImage>("galleryAlbumPanel") {
@Override
protected Iterator<IModel<ImgurImage>> getItemModels() {
return images.iterator();
}
@Override
protected void populateItem(Item<ImgurImage> item) {
Label label = new Label("title", new PropertyModel<String>(item.getModelObject(), "title"));
label.setOutputMarkupPlaceholderTag(true);
if (item.getModelObject().getTitle() == null) {
label.setVisible(false);
} else {
label.setVisible(true);
}
item.add(label);
WebComponent image = new ExternalImage("image", item.getModelObject().getLink());
image.setOutputMarkupPlaceholderTag(true);
item.add(image);
}
};
imageListView.setOutputMarkupId(true);
form.add(imageListView);
}
/**
* Parsing the image link and creating externalresource.
*
* @param url
* link to image like http://i.imgur...
* @param width
* image's width
* @param height
* image's height
* @return ExternalResource
*/
private String getExternalResourceFromUrl(String url, Integer width, Integer height) {
if (width > 640 || height > 640) {
// LOGGER.trace("{'method':'photoList.valueChange', 'debug':'Showing large thumbnail'}");
// Get the image thumbnail url
String[] tokens = url.split("\\.(?=[^\\.]+$)");
return tokens[0] + "l" + "." + tokens[1];
} else {
// LOGGER.trace("{'method':'photoList.valueChange', 'debug':'Showing original image'}");
return url;
}
}
}
| 41,679 |
00228609-2024_1
|
TEDEUTenders
|
Open Government
|
Various open data
| null |
None
|
None
|
Slovenian
|
Spoken
| 184 | 566 |
4300-2/2023
Sukcesivna dobava konvencionalnih in ekoloških živil
Sukcesivna dobava konvencionalnih in ekoloških živil
supplies
1432000.0000
15000000
15811100
15800000
15119600
15111000
15300000
15112000
03142500
15910000
15100000
15511000
15555000
15500000
15812000
15110000
15850000
15911000
15980000
15900000
03333000
15113000
03140000
15811000
SI036
anyw
SVN
LOT-0000
no-eu-funds
poi-exa
80.0000
price
Ponudbena cena skupaj v EUR brez DDV za posamezni sklop
Upošteva se končna ponudbena cena z vsemi stroški, popusti in rabati.
Upošteva se končna ponudbena cena z vsemi stroški, popusti in rabati.
poi-exa
20.0000
quality
Več ponujenih živil iz shem kakovosti za posamezni sklop
Pri merilu bo naročnik upošteval oznako kakovosti ponujenega živila, ki jo bo ponudnik vpisal v obrazcu predračuna v stolpec »oznaka kakovosti« in za ponujena živila predložil ustrezno potrdilo, certifikat ali drug dokument, iz katerega bo izhajalo, da živilo izpolnjuje pogoje v zvezi z navedenimi oznakami oziroma živilo ima navedeno oznako.
Zakon o pravnem varstvu v postopkih javnega naročanja (Uradni list RS, št. 43/11 s spremembami)
ORG-0002
false
760274-2023
false
none
none
Sukcesivna dobava konvencionalnih in ekoloških živil
Sukcesivna dobava konvencionalnih in ekoloških živil
supplies
other
other
other
n-inc
1432000.0000
15000000
SI036
anyw
SVN
4.
| 28,742 |
https://github.com/DanmoSAMA/Re-cMind/blob/master/src/pages/Home/components/Mask.vue
|
Github Open Source
|
Open Source
|
MIT
| null |
Re-cMind
|
DanmoSAMA
|
Vue
|
Code
| 182 | 755 |
<script lang="tsx">
import { defineComponent } from 'vue';
import logo from '../../../assets/logo.png';
import router from '../../../router';
export default defineComponent({
setup() {
function jump(path: string) {
router.push({ path });
}
return () => (
<>
<div class="home-mask">
<div class="home-mask-container">
<h1 class="home-mask-container-title">欢迎来到</h1>
<img class="home-mask-container-logo" src={logo} />
<p class="home-mask-container-description">
一款类头脑风暴式思维导图辅助工具
</p>
</div>
<button
class="home-mask-btn"
onTouchstart={() => {
jump('/main');
}}
>
点击进入
</button>
<button
class="home-mask-btn"
onTouchstart={() => {
jump('/instruction');
}}
>
查看指南
</button>
</div>
</>
);
},
});
</script>
<style lang="scss">
.home-mask {
position: fixed;
width: 100vw;
height: 100vh;
z-index: 10;
background-color: rgba($color: #220622, $alpha: 0.4);
display: flex;
justify-content: center;
&-container {
width: 100vw;
position: absolute;
top: 16vh;
padding: 0 10vw;
box-sizing: border-box;
&-title {
font-size: 1.25rem;
color: #fff;
font-weight: normal;
letter-spacing: 0.2rem;
padding-left: 0.3125rem;
margin: 0;
}
&-logo {
width: 50vw;
filter: grayscale(100%) brightness(300%);
}
&-description {
padding-left: 0.3125rem;
margin: 0;
color: #fff;
font-size: 0.875rem;
letter-spacing: 0.1rem;
margin-top: 0.3rem;
}
}
&-btn {
outline: none;
border: none;
position: absolute;
bottom: 12rem;
left: 2rem;
height: 2.2rem;
line-height: 2.2rem;
width: 6.5rem;
border-radius: 1.1rem;
font-size: 1.125rem;
background-color: #b2a4cc;
color: #fff;
}
&-btn:last-child {
bottom: 8rem;
}
}
</style>
| 30,178 |
https://github.com/SystemExtensions/System.Extensions/blob/master/System.Extensions/Net/Client/HttpClientExtensions.cs
|
Github Open Source
|
Open Source
|
MIT
| 2,021 |
System.Extensions
|
SystemExtensions
|
C#
|
Code
| 7,341 | 23,537 |
namespace System.Extensions.Http
{
using System.IO;
using System.Text;
using System.Buffers;
using System.Diagnostics;
using System.Collections.Generic;
using System.Collections.Concurrent;
using System.Threading.Tasks;
using System.IO.Compression;
public static class HttpClientExtensions
{
public static async Task SendAsync(this HttpClient @this, HttpRequest request, Action<HttpResponse> handler)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
if (request == null)
throw new ArgumentNullException(nameof(request));
if (handler == null)
throw new ArgumentNullException(nameof(handler));
try
{
var response = await @this.SendAsync(request);
handler(response);
}
finally
{
request.Dispose();
}
}
public static async Task SendAsync(this HttpClient @this, HttpRequest request, Func<HttpResponse, Task> handler)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
if (request == null)
throw new ArgumentNullException(nameof(request));
if (handler == null)
throw new ArgumentNullException(nameof(handler));
try
{
var response = await @this.SendAsync(request);
await handler(response);//TODO? ValueTask
}
finally
{
request.Dispose();
}
}
public static async Task<T> SendAsync<T>(this HttpClient @this, HttpRequest request, Func<HttpResponse, T> handler)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
if (request == null)
throw new ArgumentNullException(nameof(request));
if (handler == null)
throw new ArgumentNullException(nameof(handler));
try
{
var response = await @this.SendAsync(request);
return handler(response);
}
finally
{
request.Dispose();
}
}
public static async Task<T> SendAsync<T>(this HttpClient @this, HttpRequest request, Func<HttpResponse, Task<T>> handler)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
if (request == null)
throw new ArgumentNullException(nameof(request));
if (handler == null)
throw new ArgumentNullException(nameof(handler));
try
{
var response = await @this.SendAsync(request);
return await handler(response);
}
finally
{
request.Dispose();
}
}
public static async Task<T> ReadJsonAsync<T>(this HttpClient @this, HttpRequest request)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
if (request == null)
throw new ArgumentNullException(nameof(request));
try
{
var response = await @this.SendAsync(request);
var encoding = FeaturesExtensions.GetEncoding(response) ?? Encoding.UTF8;
return await response.Content.ReadJsonAsync<T>(encoding);
}
finally
{
request.Dispose();
}
}
public static async Task<string> ReadStringAsync(this HttpClient @this, HttpRequest request)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
if (request == null)
throw new ArgumentNullException(nameof(request));
try
{
var response = await @this.SendAsync(request);
var encoding = FeaturesExtensions.GetEncoding(response) ?? Encoding.UTF8;
return await response.Content.ReadStringAsync(encoding);
}
finally
{
request.Dispose();
}
}
public static async Task<Stream> ReadStreamAsync(this HttpClient @this, HttpRequest request)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
if (request == null)
throw new ArgumentNullException(nameof(request));
try
{
var response = await @this.SendAsync(request);
return await response.Content.ReadStreamAsync();
}
finally
{
request.Dispose();
}
}
public static async Task<long> ReadFileAsync(this HttpClient @this, HttpRequest request, string path)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
if (request == null)
throw new ArgumentNullException(nameof(request));
if (path == null)
throw new ArgumentNullException(nameof(path));
try
{
var response = await @this.SendAsync(request);
return await response.Content.ReadFileAsync(path);
}
finally
{
request.Dispose();
}
}
public static async Task<T> GetJsonAsync<T>(this HttpClient @this, string url)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
if (url == null)
throw new ArgumentNullException(nameof(url));
var request = new HttpRequest(url) { Method = HttpMethod.Get };
try
{
var response = await @this.SendAsync(request);
var encoding = FeaturesExtensions.GetEncoding(response) ?? Encoding.UTF8;
return await response.Content.ReadJsonAsync<T>(encoding);
}
finally
{
request.Dispose();
}
}
public static async Task<T> GetJsonAsync<T>(this HttpClient @this, string url, IQueryParams queryParams)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
if (url == null)
throw new ArgumentNullException(nameof(url));
var request = new HttpRequest(url) { Method = HttpMethod.Get };
try
{
queryParams.Join(request.Url);
var response = await @this.SendAsync(request);
var encoding = FeaturesExtensions.GetEncoding(response) ?? Encoding.UTF8;
return await response.Content.ReadJsonAsync<T>(encoding);
}
finally
{
request.Dispose();
}
}
public static async Task<string> GetStringAsync(this HttpClient @this, string url)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
if (url == null)
throw new ArgumentNullException(nameof(url));
var request = new HttpRequest(url) { Method = HttpMethod.Get };
try
{
var response = await @this.SendAsync(request);
var encoding = FeaturesExtensions.GetEncoding(response) ?? Encoding.UTF8;
return await response.Content.ReadStringAsync(encoding);
}
finally
{
request.Dispose();
}
}
public static async Task<string> GetStringAsync(this HttpClient @this, string url, IQueryParams queryParams)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
if (url == null)
throw new ArgumentNullException(nameof(url));
var request = new HttpRequest(url) { Method = HttpMethod.Get };
try
{
queryParams.Join(request.Url);
var response = await @this.SendAsync(request);
var encoding = FeaturesExtensions.GetEncoding(response) ?? Encoding.UTF8;
return await response.Content.ReadStringAsync(encoding);
}
finally
{
request.Dispose();
}
}
public static async Task<Stream> GetStreamAsync(this HttpClient @this, string url)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
if (url == null)
throw new ArgumentNullException(nameof(url));
var request = new HttpRequest(url) { Method = HttpMethod.Get };
try
{
var response = await @this.SendAsync(request);
return await response.Content.ReadStreamAsync();
}
finally
{
request.Dispose();
}
}
public static async Task<Stream> GetStreamAsync(this HttpClient @this, string url, IQueryParams queryParams)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
if (url == null)
throw new ArgumentNullException(nameof(url));
var request = new HttpRequest(url) { Method = HttpMethod.Get };
try
{
queryParams.Join(request.Url);
var response = await @this.SendAsync(request);
return await response.Content.ReadStreamAsync();
}
finally
{
request.Dispose();
}
}
public static async Task<long> GetFileAsync(this HttpClient @this, string url, string path)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
if (url == null)
throw new ArgumentNullException(nameof(url));
if (path == null)
throw new ArgumentNullException(nameof(path));
var request = new HttpRequest(url) { Method = HttpMethod.Get };
try
{
var response = await @this.SendAsync(request);
return await response.Content.ReadFileAsync(path);
}
finally
{
request.Dispose();
}
}
public static async Task<long> GetFileAsync(this HttpClient @this, string url, IQueryParams queryParams, string path)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
if (url == null)
throw new ArgumentNullException(nameof(url));
if (path == null)
throw new ArgumentNullException(nameof(path));
var request = new HttpRequest(url) { Method = HttpMethod.Get };
try
{
queryParams.Join(request.Url);
var response = await @this.SendAsync(request);
return await response.Content.ReadFileAsync(path);
}
finally
{
request.Dispose();
}
}
public static async Task<T> PostJsonAsync<T>(this HttpClient @this, string url, IFormParams formParams)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
if (url == null)
throw new ArgumentNullException(nameof(url));
if (formParams == null)
throw new ArgumentNullException(nameof(formParams));
var request = new HttpRequest(url);
try
{
request.UseForm(formParams);
var response = await @this.SendAsync(request);
var encoding = FeaturesExtensions.GetEncoding(response) ?? Encoding.UTF8;
return await response.Content.ReadJsonAsync<T>(encoding);
}
finally
{
request.Dispose();
}
}
public static async Task<T> PostJsonAsync<T>(this HttpClient @this, string url, IFormParams formParams, IFormFileParams formFileParams)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
if (url == null)
throw new ArgumentNullException(nameof(url));
var request = new HttpRequest(url) { Method = HttpMethod.Post };
try
{
request.UseFormData(formParams, formFileParams);
var response = await @this.SendAsync(request);
var encoding = FeaturesExtensions.GetEncoding(response) ?? Encoding.UTF8;
return await response.Content.ReadJsonAsync<T>(encoding);
}
finally
{
request.Dispose();
}
}
public static async Task<T> PostJsonAsync<T>(this HttpClient @this, string url, IQueryParams queryParams, IFormParams formParams)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
if (url == null)
throw new ArgumentNullException(nameof(url));
if (formParams == null)
throw new ArgumentNullException(nameof(formParams));
var request = new HttpRequest(url) { Method = HttpMethod.Post };
try
{
queryParams.Join(request.Url);
request.UseForm(formParams);
var response = await @this.SendAsync(request);
var encoding = FeaturesExtensions.GetEncoding(response) ?? Encoding.UTF8;
return await response.Content.ReadJsonAsync<T>(encoding);
}
finally
{
request.Dispose();
}
}
public static async Task<T> PostJsonAsync<T>(this HttpClient @this, string url, IQueryParams queryParams, IFormParams formParams, IFormFileParams formFileParams)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
if (url == null)
throw new ArgumentNullException(nameof(url));
var request = new HttpRequest(url) { Method = HttpMethod.Post };
try
{
queryParams.Join(request.Url);
request.UseFormData(formParams, formFileParams);
var response = await @this.SendAsync(request);
var encoding = FeaturesExtensions.GetEncoding(response) ?? Encoding.UTF8;
return await response.Content.ReadJsonAsync<T>(encoding);
}
finally
{
request.Dispose();
}
}
public static async Task<T> PostJsonAsync<TRequest, T>(this HttpClient @this, string url, TRequest value)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
if (url == null)
throw new ArgumentNullException(nameof(url));
var request = new HttpRequest(url) { Method = HttpMethod.Post };
try
{
request.UseJson(value);
var response = await @this.SendAsync(request);
var encoding = FeaturesExtensions.GetEncoding(response) ?? Encoding.UTF8;
return await response.Content.ReadJsonAsync<T>(encoding);
}
finally
{
request.Dispose();
}
}
public static async Task<T> PostJsonAsync<TRequest, T>(this HttpClient @this, string url, IQueryParams queryParams, TRequest value)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
if (url == null)
throw new ArgumentNullException(nameof(url));
var request = new HttpRequest(url) { Method = HttpMethod.Post };
try
{
queryParams.Join(request.Url);
request.UseJson(value);
var response = await @this.SendAsync(request);
var encoding = FeaturesExtensions.GetEncoding(response) ?? Encoding.UTF8;
return await response.Content.ReadJsonAsync<T>(encoding);
}
finally
{
request.Dispose();
}
}
public static async Task<string> PostStringAsync(this HttpClient @this, string url, IFormParams formParams)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
if (url == null)
throw new ArgumentNullException(nameof(url));
if (formParams == null)
throw new ArgumentNullException(nameof(formParams));
var request = new HttpRequest(url) { Method = HttpMethod.Post };
try
{
request.UseForm(formParams);
var response = await @this.SendAsync(request);
var encoding = FeaturesExtensions.GetEncoding(response) ?? Encoding.UTF8;
return await response.Content.ReadStringAsync(encoding);
}
finally
{
request.Dispose();
}
}
public static async Task<string> PostStringAsync(this HttpClient @this, string url, IFormParams formParams, IFormFileParams formFileParams)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
if (url == null)
throw new ArgumentNullException(nameof(url));
var request = new HttpRequest(url) { Method = HttpMethod.Post };
try
{
request.UseFormData(formParams, formFileParams);
var response = await @this.SendAsync(request);
var encoding = FeaturesExtensions.GetEncoding(response) ?? Encoding.UTF8;
return await response.Content.ReadStringAsync(encoding);
}
finally
{
request.Dispose();
}
}
public static async Task<string> PostStringAsync(this HttpClient @this, string url, IQueryParams queryParams, IFormParams formParams)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
if (url == null)
throw new ArgumentNullException(nameof(url));
if (formParams == null)
throw new ArgumentNullException(nameof(formParams));
var request = new HttpRequest(url) { Method = HttpMethod.Post };
try
{
queryParams.Join(request.Url);
request.UseForm(formParams);
var response = await @this.SendAsync(request);
var encoding = FeaturesExtensions.GetEncoding(response) ?? Encoding.UTF8;
return await response.Content.ReadStringAsync(encoding);
}
finally
{
request.Dispose();
}
}
public static async Task<string> PostStringAsync(this HttpClient @this, string url, IQueryParams queryParams, IFormParams formParams, IFormFileParams formFileParams)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
if (url == null)
throw new ArgumentNullException(nameof(url));
var request = new HttpRequest(url) { Method = HttpMethod.Post };
try
{
queryParams.Join(request.Url);
request.UseFormData(formParams, formFileParams);
var response = await @this.SendAsync(request);
var encoding = FeaturesExtensions.GetEncoding(response) ?? Encoding.UTF8;
return await response.Content.ReadStringAsync(encoding);
}
finally
{
request.Dispose();
}
}
public static HttpRequest UseJson<T>(this HttpRequest @this, T value)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
var buffer = StringContent.Rent(out var disposable);
@this.RegisterForDispose(disposable);
JsonWriter.ToJson(value, buffer);
@this.Content = StringContent.Create(buffer.Sequence, Encoding.UTF8);
@this.Headers.Add(HttpHeaders.ContentType, "application/json; charset=utf-8");
return @this;
}
public static HttpRequest UseJson<T>(this HttpRequest @this, T value, Encoding encoding)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
if (encoding == null)
throw new ArgumentNullException(nameof(encoding));
if (encoding == Encoding.UTF8)
return UseJson(@this, value);
var buffer = StringContent.Rent(out var disposable);
@this.RegisterForDispose(disposable);
JsonWriter.ToJson(value, buffer);
@this.Content = StringContent.Create(buffer.Sequence, encoding);
@this.Headers.Add(HttpHeaders.ContentType, "application/json; charset=" + encoding.WebName);
return @this;
}
//public static HttpRequest UseJsonIndent<T>(this HttpRequest @this, T value)
//{
// if (@this == null)
// throw new ArgumentNullException(nameof(@this));
// if (value == null)
// throw new ArgumentNullException(nameof(value));
// @this.Headers.Add(HttpHeaders.ContentType, "application/json; charset=utf-8");
// var buffer = StringContent.Rent(out var disposable);
// try
// {
// JsonWriter.ToJsonIndent(value, buffer);
// @this.Content = StringContent.Create(buffer.Sequence, Encoding.UTF8);
// }
// catch
// {
// disposable.Dispose();
// throw;
// }
// @this.RegisterForDispose(disposable);
// return @this;
//}
//public static HttpRequest UseJsonIndent<T>(this HttpRequest @this, T value, Encoding encoding)
//{
// if (@this == null)
// throw new ArgumentNullException(nameof(@this));
// if (value == null)
// throw new ArgumentNullException(nameof(value));
// if (encoding == null)
// throw new ArgumentNullException(nameof(encoding));
// if (encoding == Encoding.UTF8)
// return UseJsonIndent(@this, value);
// @this.Headers.Add(HttpHeaders.ContentType, "application/json; charset=" + encoding.WebName);
// var buffer = StringContent.Rent(out var disposable);
// try
// {
// JsonWriter.ToJsonIndent(value, buffer);
// @this.Content = StringContent.Create(buffer.Sequence, encoding);
// }
// catch
// {
// disposable.Dispose();
// throw;
// }
// @this.RegisterForDispose(disposable);
// return @this;
//}
public static HttpRequest UseForm(this HttpRequest @this, IFormParams formParams)
{
return UseForm(@this, formParams, Encoding.UTF8);
}
public static HttpRequest UseForm(this HttpRequest @this, IFormParams formParams, Encoding encoding)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
if (formParams == null)
throw new ArgumentNullException(nameof(formParams));
if (encoding == null)
throw new ArgumentNullException(nameof(encoding));
var count = formParams.Count;
if (count == 0)
return @this;
var sb = StringContent.Rent(out var disposable);
@this.RegisterForDispose(disposable);
Url.Encode(formParams[0].Key, encoding, sb);
sb.Write('=');
Url.Encode(formParams[0].Value, encoding, sb);
for (int i = 1; i < count; i++)
{
sb.Write('&');
Url.Encode(formParams[i].Key, encoding, sb);
sb.Write('=');
Url.Encode(formParams[i].Value, encoding, sb);
}
@this.Content = StringContent.Create(sb.Sequence);
var contentType = encoding == Encoding.UTF8
? "application/x-www-form-urlencoded; charset=utf-8"
: $"application/x-www-form-urlencoded; charset={encoding.WebName}";
@this.Headers.Add(HttpHeaders.ContentType, contentType);
return @this;
}
public static HttpRequest UseFormData(this HttpRequest @this, IFormParams formParams, IFormFileParams formFileParams)
{
return UseFormData(@this, formParams, formFileParams, null, Encoding.UTF8);
}
public static HttpRequest UseFormData(this HttpRequest @this, IFormParams formParams, IFormFileParams formFileParams, string boundary)
{
return UseFormData(@this, formParams, formFileParams, boundary, Encoding.UTF8);
}
public static HttpRequest UseFormData(this HttpRequest @this, IFormParams formParams, IFormFileParams formFileParams, string boundary, Encoding encoding)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
if (encoding == null)
throw new ArgumentNullException(nameof(encoding));
if (string.IsNullOrEmpty(boundary))
{
Span<char> boundarySpan = stackalloc char[32];
Guid.NewGuid().TryFormat(boundarySpan, out var charsWritten, "N");
Span<byte> boundaryBytes = stackalloc byte[38];
boundaryBytes[0] = (byte)'-';
boundaryBytes[1] = (byte)'-';
boundaryBytes[2] = (byte)'-';
boundaryBytes[3] = (byte)'-';
boundaryBytes[4] = (byte)'-';
boundaryBytes[5] = (byte)'-';
Encoding.ASCII.GetBytes(boundarySpan, boundaryBytes.Slice(6));
var content = new FormDataContent(formParams, formFileParams, boundaryBytes, encoding);
@this.Content = content;
@this.RegisterForDispose(content);
var contentType = StringExtensions.Concat("multipart/form-data; boundary=----", boundarySpan,
encoding == Encoding.UTF8 ? "; charset=utf-8" : "; charset=" + encoding.WebName);
@this.Headers.Add(HttpHeaders.ContentType, contentType);
}
else
{
if (boundary.Length > 250)
throw new ArgumentOutOfRangeException(nameof(boundary));
Span<byte> boundaryBytes = stackalloc byte[boundary.Length + 2];
boundaryBytes[0] = (byte)'-';
boundaryBytes[1] = (byte)'-';
Encoding.ASCII.GetBytes(boundary, boundaryBytes.Slice(2));
var content = new FormDataContent(formParams, formFileParams, boundaryBytes, encoding);
@this.Content = content;
@this.RegisterForDispose(content);
var contentType = StringExtensions.Concat("multipart/form-data; boundary=", boundary,
encoding == Encoding.UTF8 ? "; charset=utf-8" : "; charset=" + encoding.WebName);
@this.Headers.Add(HttpHeaders.ContentType, contentType);
}
return @this;
}
//TODO??? Use(options=>options.UseCookie().UseRedirect().UseTimeout())
public static HttpClient Use(this HttpClient @this, Func<HttpRequest, HttpClient, Task<HttpResponse>> handler)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
if (handler == null)
throw new ArgumentNullException(nameof(handler));
return new DelegatingClient(@this, handler);
}
//public static HttpClient UseBaseUrl(this HttpClient @this, string url)
//{
// if (@this == null)
// throw new ArgumentNullException(nameof(@this));
// if (url == null)
// throw new ArgumentNullException(nameof(url));
// var baseUrl = new Url(url);
// //baseUrl.AbsoluteUri = "";//自动拼接上去
// //允许相对url
// //if (string.IsNullOrEmpty(baseUrl.Scheme))
// // throw new ArgumentException("must is AbsoluteUri");
// if (baseUrl.Scheme == Url.SchemeHttp)
// baseUrl.Scheme = Url.SchemeHttp;
// else if (baseUrl.Scheme == Url.SchemeHttps)
// baseUrl.Scheme = Url.SchemeHttps;
// return new BaseUrlClient(@this, baseUrl);
//}
public static HttpClient UseCookie(this HttpClient @this)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
return new CookieClient(@this, null);
}
public static HttpClient UseCookie(this HttpClient @this, IList<string> setCookies)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
if (setCookies == null)
throw new ArgumentNullException(nameof(setCookies));
return new CookieClient(@this, setCookies);
}
public static HttpClient UseRedirect(this HttpClient @this)
{
return UseRedirect(@this, 4);
}
public static HttpClient UseRedirect(this HttpClient @this, int maxRedirections)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
if (maxRedirections <= 0)
return @this;
return new RedirectClient(@this, maxRedirections);
}
public static HttpClient UseCompression(this HttpClient @this)
{
return @this.UseCompression("gzip", "deflate", "br");
}
public static HttpClient UseCompression(this HttpClient @this, params string[] acceptEncodings)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
if (acceptEncodings == null || acceptEncodings.Length == 0)
return @this;
var acceptEncoding = string.Join(", ", acceptEncodings);
return @this.Use(async (request, client) =>
{
if (request.Headers.Contains(HttpHeaders.AcceptEncoding))
{
var response = await client.SendAsync(request);
return response;
}
else
{
request.Headers.Add(HttpHeaders.AcceptEncoding, acceptEncoding);
var response = await client.SendAsync(request);
if (response != null&& response.Content != null)
{
if (response.Headers.TryGetValue(HttpHeaders.ContentEncoding, out var contentEncoding))
{
//gzip&& deflate && br &&
if ("gzip".EqualsIgnoreCase(contentEncoding))
{
var content = new DeflateDecoderContent(response.Content, new DeflateDecoder(31));
response.RegisterForDispose(content);
response.Content = content;
}
else if ("deflate".EqualsIgnoreCase(contentEncoding))
{
var content = new DeflateDecoderContent(response.Content, new DeflateDecoder(15));
response.RegisterForDispose(content);
response.Content = content;
}
else if ("br".EqualsIgnoreCase(contentEncoding))
{
var content = new BrotliDecoderContent(response.Content, new BrotliDecoder());
response.RegisterForDispose(content);
response.Content = content;
}
}
}
return response;
}
});
}
public static HttpResponse UseCompression(this HttpResponse @this)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
if (@this.Content == null)
return @this;
if (@this.Headers.TryGetValue(HttpHeaders.ContentEncoding, out var contentEncoding))
{
if ("gzip".EqualsIgnoreCase(contentEncoding))
{
var content = new DeflateDecoderContent(@this.Content, new DeflateDecoder(31));
@this.RegisterForDispose(content);
@this.Content = content;
}
else if ("deflate".EqualsIgnoreCase(contentEncoding))
{
var content = new DeflateDecoderContent(@this.Content, new DeflateDecoder(15));
@this.RegisterForDispose(content);
@this.Content = content;
}
else if ("br".EqualsIgnoreCase(contentEncoding))
{
var content = new BrotliDecoderContent(@this.Content, new BrotliDecoder());
@this.RegisterForDispose(content);
@this.Content = content;
}
else
{
throw new NotSupportedException($"ContentEncoding:{contentEncoding}");
}
}
return @this;
}
public static HttpResponse UseCompression(this HttpResponse @this, DeflateDecoder decoder)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
if (@this.Content == null)
return @this;
var content = new DeflateDecoderContent(@this.Content, decoder);
@this.RegisterForDispose(content);
@this.Content = content;
return @this;
}
public static HttpResponse UseCompression(this HttpResponse @this, BrotliDecoder decoder)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
if (@this.Content == null)
return @this;
var content = new BrotliDecoderContent(@this.Content, decoder);
@this.RegisterForDispose(content);
@this.Content = content;
return @this;
}
public static HttpClient UseTimeout(this HttpClient @this)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
return new TimeoutQueueClient(@this, new TaskTimeoutQueue<HttpResponse>(20000), new TaskTimeoutQueue<int>(5000));
}
public static HttpClient UseTimeout(this HttpClient @this, int timeout, int readTimeout)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
return new TimeoutQueueClient(@this,
timeout == 0 ? null : new TaskTimeoutQueue<HttpResponse>(timeout),
readTimeout == 0 ? null : new TaskTimeoutQueue<int>(readTimeout));
}
public static HttpClient UseTimeout(this HttpClient @this, TaskTimeoutQueue<HttpResponse> timeout, TaskTimeoutQueue<int> readTimeout)
{
if (@this == null)
throw new ArgumentNullException(nameof(@this));
return new TimeoutQueueClient(@this, timeout, readTimeout);
}
//UseAutoRedirect
//先不支持HttpClient 释放
//public static Property<HttpClient> DisposablesProperty = new Property<HttpClient>("#Sys.Disposables");
//public static IList<IDisposable> Disposables(this HttpClient @this)
//{
// //var disposables = (IList<IDisposable>)@this.Properties[DisposablesProperty];
// //if (disposables == null)
// //{
// // disposables = new List<IDisposable>();
// // @this.Properties[DisposablesProperty] = disposables;
// //}
// //return disposables;
// return null;
//}
//public static void Disposables(this HttpClient @this, IList<IDisposable> disposables)
//{
// //if (disposables == null)
// // throw new ArgumentNullException(nameof(disposables));
// //var oldDisposables = (IList<IDisposable>)@this.Properties[DisposablesProperty];
// //if (oldDisposables != null)
// //{
// // for (int i = 0; i < oldDisposables.Count; i++)
// // {
// // disposables.Add(oldDisposables[i]);
// // }
// //}
// //@this.Properties[DisposablesProperty] = disposables;
//}
//TODO Request取消
//public static TaskCompletionSource<HttpResponse> TaskCompletionSource(HttpRequest request)
//{
// return null;
//}
//public static void TaskCompletionSource(HttpRequest request, TaskCompletionSource<HttpResponse> tcs)
//{
//}
//不要了
//public static HttpClient UseHeaders(this HttpClient @this, HttpHeaders headers)
//{
// return @this;
//}
//public static HttpClient UseHeaders(this HttpClient @this, Action<HttpHeaders> headers)
//{
// return @this;
//}
#region private
private class DelegatingClient : HttpClient
{
private HttpClient _client;
private Func<HttpRequest, HttpClient, Task<HttpResponse>> _handler;
public DelegatingClient(HttpClient client, Func<HttpRequest, HttpClient, Task<HttpResponse>> handler)
{
_client = client;
_handler = handler;
}
public override Task<HttpResponse> SendAsync(HttpRequest request)
{
return _handler.Invoke(request, _client);
}
}
private class CookieClient : HttpClient
{
public class Cookie
{
//public string Guid { get; set; }//store
public string Name { get; set; }
public string Value { get; set; }
public string Path { get; set; }//default=/
public string Domain { get; set; }//.domain.com
public DateTimeOffset? Expires { get; set; }
public bool HostOnly { get; set; } //secure httponly
public static bool TryParse(string header, out Cookie cookie)
{
var span = header.AsSpan();
var length = span.Length;
if (length == 0)
{
cookie = null;
return false;
}
cookie = new Cookie();
var tempOffset = 0;
ReadOnlySpan<char> paramName = null;
ReadOnlySpan<char> paramValue = null;
for (var index = 0; ;)
{
if (index == span.Length)
{
if (paramName == null)
{
paramName = span.Slice(tempOffset, index - tempOffset).TrimStart();
paramValue = ReadOnlySpan<char>.Empty;
}
else
{
paramValue = span.Slice(tempOffset, index - tempOffset);
}
tempOffset = -1;
goto param;
}
switch (span[index++])
{
case ';':
if (paramName == null)
{
paramName = span.Slice(tempOffset, index - tempOffset - 1).TrimStart();
paramValue = ReadOnlySpan<char>.Empty;
}
else
{
paramValue = span.Slice(tempOffset, index - tempOffset - 1);
}
tempOffset = index;
goto param;
case '=':
if (paramName != null)
continue;
paramName = span.Slice(tempOffset, index - tempOffset - 1).TrimStart();
if (index == length)
{
paramValue = ReadOnlySpan<char>.Empty;
tempOffset = -1;
goto param;
}
if (span[index] == '"')
{
var tempSpan = span.Slice(index + 1);
var tempIndex = tempSpan.IndexOf('"');
if (tempIndex == -1)
throw new FormatException();
paramValue = tempSpan.Slice(0, tempIndex);
index += tempIndex + 2;
if (index == length)
{
tempOffset = -1;
}
else if (span[index] == ';')
{
index += 1;
tempOffset = index;
}
else if (span[index] == ',')
{
tempOffset = -1;
}
else
{
cookie = null;
return false;
}
goto param;
}
tempOffset = index;
continue;
case ',':
if (paramName == null)
{
paramName = span.Slice(tempOffset, index - tempOffset - 1);
paramValue = ReadOnlySpan<char>.Empty;
}
else
{
paramValue = span.Slice(tempOffset, index - tempOffset - 1);
}
tempOffset = -1;
goto param;
default:
continue;
}
param:
if (cookie.Name == null)
{
cookie.Name = new string(paramName);
cookie.Value = new string(paramValue);
}
else
{
if (paramName.EqualsIgnoreCase("domain"))
{
if (!paramValue.IsEmpty)
cookie.Domain = paramValue[0] == '.' ? new string(paramValue.Slice(1)) : new string(paramValue);
}
else if (paramName.EqualsIgnoreCase("path"))
{
if (!paramValue.IsEmpty && paramValue[0] == '/')
cookie.Path = new string(paramValue);
}
else if (paramName.EqualsIgnoreCase("max-age"))
{
if (long.TryParse(paramValue, out var maxAge))
{
var expires = DateTime.Now.AddSeconds(maxAge);
if (cookie.Expires == null || cookie.Expires > expires)
cookie.Expires = expires;
}
}
else if (paramName.EqualsIgnoreCase("expires"))
{
if (DateTime.TryParse(paramValue, out var expires))
{
if (cookie.Expires == null || cookie.Expires > expires)
cookie.Expires = expires;
}
}
}
if (tempOffset == -1)
{
return true;
}
paramName = null;
paramValue = null;
}
}
}
public CookieClient(HttpClient client, IList<string> setCookies)
{
//TODO?
//使用Timer缓存CookieHeader
//树
//.b.com value
//a.b.com value //锁住结点
//c.b.com
//x.a.b.com
//x.c.b.com
//不设置cookie 最大项了
_client = client;
_container = new ConcurrentDictionary<string, List<Cookie>>(StringComparer.OrdinalIgnoreCase);//?CopyOnWrite
if (setCookies != null)
{
foreach (var setCookie in setCookies)
{
if (Cookie.TryParse(setCookie, out var cookie))
{
if (string.IsNullOrEmpty(cookie.Domain))
throw new ArgumentException("Domain");
if (string.IsNullOrEmpty(cookie.Path))
cookie.Path = "/";
if (_container.TryGetValue(cookie.Domain, out var cookies))
{
cookies.Add(cookie);
}
else
{
_container.TryAdd(cookie.Domain, new List<Cookie>() { cookie });
}
}
else
{
throw new ArgumentException("SetCookie");
}
}
}
}
private HttpClient _client;
private ConcurrentDictionary<string, List<Cookie>> _container;
public override async Task<HttpResponse> SendAsync(HttpRequest request)
{
var host = request.Url.Host;
var path = request.Url.Path ?? "/";
if (string.IsNullOrEmpty(host))
throw new ArgumentException("url must have host");
var domain = request.Url.Domain;
if (string.IsNullOrEmpty(domain))//hostOnly TODO? Remove(HttpHeaders.Cookie) risk
{
if (_container.TryGetValue(host, out var cookies))
{
lock (cookies)
{
var sb = StringExtensions.ThreadRent(out var disposable);
try
{
var separator = false;
for (int i = cookies.Count - 1; i >= 0; i--)
{
var cookie = cookies[i];
if (cookie.Expires != null && cookie.Expires <= DateTimeOffset.Now)
{
cookies.RemoveAt(i);
continue;
}
//Debug.Assert(cookie.HostOnly);
//Debug.Assert(cookie.Domain.EqualsIgnoreCase(host));
if (cookie.Path != "/")
{
if (!path.StartsWith(cookie.Path))
continue;
if (cookie.Path[cookie.Path.Length - 1] != '/')
{
if (path.Length > cookie.Path.Length && path[cookie.Path.Length] != '/')
continue;
}
}
if (separator)
sb.Write("; ");
else
separator = true;
sb.Write(cookie.Name);
sb.Write('=');
sb.Write(cookie.Value);
}
if (sb.Length > 0)
{
request.Headers[HttpHeaders.Cookie] = sb.ToString();
}
else
{
request.Headers.Remove(HttpHeaders.Cookie);
}
}
finally
{
disposable.Dispose();
}
}
}
else
{
request.Headers.Remove(HttpHeaders.Cookie);
}
}
else
{
if (_container.TryGetValue(domain, out var cookies))
{
lock (cookies)
{
var sb = StringExtensions.ThreadRent(out var disposable);
try
{
var separator = false;
for (int i = cookies.Count - 1; i >= 0; i--)
{
var cookie = cookies[i];
if (cookie.Expires != null && cookie.Expires <= DateTimeOffset.Now)
{
cookies.RemoveAt(i);
continue;
}
if (cookie.HostOnly)
{
if (!cookie.Domain.EqualsIgnoreCase(host))
continue;
}
else
{
if (!host.EndsWith(cookie.Domain, StringComparison.OrdinalIgnoreCase))
continue;
if (host.Length > cookie.Domain.Length && host[host.Length - cookie.Domain.Length - 1] != '.')
continue;
}
if (cookie.Path != "/")//不是根路径
{
if (!path.StartsWith(cookie.Path))//不忽略大小写
continue;
if (cookie.Path[cookie.Path.Length - 1] != '/')
{
if (path.Length > cookie.Path.Length && path[cookie.Path.Length] != '/')
continue;
}
}
if (separator)
sb.Write("; ");
else
separator = true;
sb.Write(cookie.Name);
sb.Write('=');
sb.Write(cookie.Value);
}
if (sb.Length > 0)
{
request.Headers[HttpHeaders.Cookie] = sb.ToString();
}
else
{
request.Headers.Remove(HttpHeaders.Cookie);
}
}
finally
{
disposable.Dispose();
}
}
}
else
{
request.Headers.Remove(HttpHeaders.Cookie);
}
}
var response = await _client.SendAsync(request);
if (response != null)
{
//if (host != request.Url.Host && path != request.Url.Path)
// throw new InvalidOperationException("host path must can't change if UseCookie");
var setCookies = response.Headers.GetValues(HttpHeaders.SetCookie);
if (setCookies != null)
{
var cookiesKey = string.IsNullOrEmpty(domain) ? host : domain;
foreach (var setCookie in setCookies)
{
if (Cookie.TryParse(setCookie, out var cookie))
{
if (string.IsNullOrEmpty(cookie.Domain))
{
cookie.HostOnly = true;
cookie.Domain = host;
}
else if (string.IsNullOrEmpty(domain))
{
if (!cookie.Domain.EqualsIgnoreCase(host))
continue;//忽略无效
cookie.HostOnly = true;
}
else
{
if (!cookie.Domain.EndsWith(domain, StringComparison.OrdinalIgnoreCase))
continue;
if (cookie.Domain.Length > domain.Length && cookie.Domain[cookie.Domain.Length - domain.Length - 1] != '.')
continue;
}
if (string.IsNullOrEmpty(cookie.Path))
cookie.Path = path;
if (!_container.TryGetValue(cookiesKey, out var cookies))
{
lock (_container)
{
if (!_container.TryGetValue(cookiesKey, out cookies))
{
cookies = new List<Cookie>();
_container.TryAdd(cookiesKey, cookies);
}
}
}
lock (cookies)
{
for (int j = cookies.Count - 1; j >= 0; j--)
{
var item = cookies[j];
if (item.Expires != null && item.Expires <= DateTimeOffset.Now)
{
cookies.RemoveAt(j);
continue;
}
if (cookie.Name == item.Name && cookie.Path == item.Path && cookie.Domain.EqualsIgnoreCase(item.Domain))
{
cookies.RemoveAt(j);
if (cookie.Expires != null && cookie.Expires <= DateTimeOffset.Now)
cookie = null;
continue;
}
}
if (cookie != null)
cookies.Add(cookie);
}
}
}
}
}
return response;
}
}
private class RedirectClient : HttpClient
{
private HttpClient _client;
private int _maxRedirections;
public RedirectClient(HttpClient client, int maxRedirections)
{
_client = client;
_maxRedirections = maxRedirections;
}
public override async Task<HttpResponse> SendAsync(HttpRequest request)
{
var response = await _client.SendAsync(request);
if (response == null)
return null;
switch (response.StatusCode)
{
case 301:
case 302:
case 307:
case 300:
case 303:
case 308:
break;
default:
return response;
}
for (int i = 0; i < _maxRedirections; i++)
{
if (!response.Headers.TryGetValue(HttpHeaders.Location, out var location)
|| string.IsNullOrEmpty(location))
return response;
if (location[0] == '/')
request.Url.AbsolutePath = location;
else
request.Url.AbsoluteUri = location;
if (request.Method == HttpMethod.Post &&
(response.StatusCode == 301
|| response.StatusCode == 302
|| response.StatusCode == 303
|| response.StatusCode == 300))
{
request.Method = HttpMethod.Get;
request.Content = null;
request.Headers.Remove(HttpHeaders.ContentLength);
request.Headers.Remove(HttpHeaders.TransferEncoding);
}
else if (request.Content != null)
{
if (!request.Content.Rewind())
throw new InvalidOperationException(nameof(IHttpContent.Rewind));
}
response.Dispose();
response = await _client.SendAsync(request);
if (response == null)
return null;
switch (response.StatusCode)
{
case 301:
case 302:
case 307:
case 300:
case 303:
case 308:
break;
default:
return response;
}
}
return response;
}
}
//private class BaseUrlClient : HttpClient
//{
// private HttpClient _client;
// private Url _url;//动态编译技术
// public BaseUrlClient(HttpClient client, Url url)
// {
// _client = client;
// _url = url;
// }
// public override Task<HttpResponse> SendAsync(HttpRequest request)
// {
// var url = request.Url;
// if (string.IsNullOrEmpty(url.Scheme))
// {
// url.Scheme = _url.Scheme;
// url.UserInfo = _url.UserInfo;
// url.Host = _url.Host;
// url.Port = _url.Port;
// }
// if (!string.IsNullOrEmpty(_url.Path))
// {
// //if(_url.Path[_url.Path.Length-1]=='/')
// url.Path = _url.Path + url.Path;
// }
// if (!string.IsNullOrEmpty(_url.Query))
// {
// if (string.IsNullOrEmpty(url.Query))
// {
// url.Query = _url.Query;
// }
// else
// {
// if (_url.Query.EndsWith('&'))
// {
// url.Query = StringExtensions.Concat(_url.Query, url.Query.AsSpan(1));
// }
// else
// {
// url.Query = StringExtensions.Concat(_url.Query, "&", url.Query.AsSpan(1));
// }
// }
// }
// return _client.SendAsync(request);
// }
//}
private class FormDataContent : IHttpContent, IDisposable
{
#region private
private static byte[] _Name = Encoding.ASCII.GetBytes("\r\nContent-Disposition: form-data; name=\"");
private static byte[] _FileName = Encoding.ASCII.GetBytes("\"; filename=\"");
private static byte[] _ContentType = Encoding.ASCII.GetBytes("\"\r\nContent-Type: ");
#endregion
//--{boundary}
public FormDataContent(IFormParams formParams, IFormFileParams formFileParams, ReadOnlySpan<byte> boundary, Encoding encoding)
{
var buffer = MemoryContent.Rent(out _disposable);
//var sb = StringExtensions.ThreadRent(out var disposable);
try
{
if (formParams != null)
{
for (int i = 0; i < formParams.Count; i++)
{
buffer.Write(boundary);
buffer.Write(_Name);
buffer.WriteChars(formParams[i].Key, encoding);
buffer.Write((byte)'\"');
buffer.Write((byte)'\r');
buffer.Write((byte)'\n');
buffer.Write((byte)'\r');
buffer.Write((byte)'\n');
buffer.WriteChars(formParams[i].Value, encoding);
buffer.Write((byte)'\r');
buffer.Write((byte)'\n');
}
_form = buffer.Sequence;
}
var seqLength = _form.Length;
_length = seqLength;
if (formFileParams != null && formFileParams.Count > 0)
{
_files = new List<(ReadOnlySequence<byte> header, Stream content)>(formFileParams.Count);
{
var file = formFileParams[0].Value;
buffer.Write(boundary);
buffer.Write(_Name);
buffer.WriteChars(formFileParams[0].Key, encoding);
buffer.Write(_FileName);
buffer.WriteChars(file.FileName, encoding);
if (!string.IsNullOrEmpty(file.ContentType))
{
buffer.Write(_ContentType);
buffer.WriteByteString(file.ContentType);
buffer.Write((byte)'\r');
buffer.Write((byte)'\n');
buffer.Write((byte)'\r');
buffer.Write((byte)'\n');
}
else
{
buffer.Write((byte)'\"');
buffer.Write((byte)'\r');
buffer.Write((byte)'\n');
buffer.Write((byte)'\r');
buffer.Write((byte)'\n');
}
var seq = buffer.Sequence.Slice(seqLength);
seqLength += seq.Length;
_files.Add((seq, file.Length == 0 ? null : file.OpenRead()));
_length += seq.Length + file.Length;
}
for (int i = 1; i < formFileParams.Count; i++)
{
var file = formFileParams[i].Value;
buffer.Write((byte)'\r');
buffer.Write((byte)'\n');
buffer.Write(boundary);
buffer.Write(_Name);
buffer.WriteChars(formFileParams[i].Key, encoding);
buffer.Write(_FileName);
buffer.WriteChars(file.FileName, encoding);
if (!string.IsNullOrEmpty(file.ContentType))
{
buffer.Write(_ContentType);
buffer.WriteByteString(file.ContentType);
buffer.Write((byte)'\r');
buffer.Write((byte)'\n');
buffer.Write((byte)'\r');
buffer.Write((byte)'\n');
}
else
{
buffer.Write((byte)'\"');
buffer.Write((byte)'\r');
buffer.Write((byte)'\n');
buffer.Write((byte)'\r');
buffer.Write((byte)'\n');
}
var seq = buffer.Sequence.Slice(seqLength);
seqLength += seq.Length;
_files.Add((seq, file.Length == 0 ? null : file.OpenRead()));
_length += seq.Length + file.Length;
}
buffer.Write((byte)'\r');
buffer.Write((byte)'\n');
_length += 2;
}
else
{
_files = new List<(ReadOnlySequence<byte> Header, Stream Content)>(0);
}
buffer.Write(boundary);
buffer.Write((byte)'-');
buffer.Write((byte)'-');
buffer.Write((byte)'\r');
buffer.Write((byte)'\n');
_end = buffer.Sequence.Slice(seqLength);
_length += boundary.Length + 4;
_index = -1;
_position = 0;
}
catch
{
_disposable.Dispose();
throw;
}
}
private long _length;
private int _index;//-1 start
private int _position;//Sequence
private ReadOnlySequence<byte> _form;
private List<(ReadOnlySequence<byte> Header, Stream Content)> _files;
private ReadOnlySequence<byte> _end;
private IDisposable _disposable;
public long Available => _index > _files.Count ? 0 : -1;
public long Length => _length;
public bool Rewind()
{
_index = -1;
_position = 0;
foreach (var file in _files)
{
try
{
file.Content.Position = 0;
}
catch
{
return false;
}
}
return true;
}
public long ComputeLength() => _length;
public int Read(Span<byte> buffer)
{
if (_index > _files.Count)
return 0;
var available = buffer.Length;
if (available == 0)
return 0;
do
{
if (_index == -1)
{
var seq = _form.Slice(_position);
var toCopy = seq.Length >= available ? available : (int)seq.Length;
seq.Slice(0, toCopy).CopyTo(buffer.Slice(buffer.Length - available, toCopy));
_position += toCopy;
available -= toCopy;
if (_position == _form.Length)
{
_index += 1;
_position = 0;
}
}
else if (_index == _files.Count)
{
var seq = _end.Slice(_position);
var toCopy = seq.Length >= available ? available : (int)seq.Length;
seq.Slice(0, toCopy).CopyTo(buffer.Slice(buffer.Length - available, toCopy));
_position += toCopy;
available -= toCopy;
if (_position == _end.Length)
{
_index += 1;
_position = 0;
}
return buffer.Length - available;
}
else
{
var file = _files[_index];
if (_position < file.Header.Length)
{
var seq = file.Header.Slice(_position);
var toCopy = seq.Length >= available ? available : (int)seq.Length;
seq.Slice(0, toCopy).CopyTo(buffer.Slice(buffer.Length - available, toCopy));
_position += toCopy;
available -= toCopy;
}
if (available == 0)
return buffer.Length;
Debug.Assert(_position >= file.Header.Length);
if (file.Content == null)
{
_index += 1;
_position = 0;
}
else
{
var result = file.Content.Read(buffer.Slice(buffer.Length - available));
if (result == 0)
{
_index += 1;
_position = 0;
}
else
{
available -= result;
}
}
}
} while (available > 0);
return buffer.Length;
}
public int Read(byte[] buffer, int offset, int count)
{
return Read(buffer.AsSpan(offset, count));
}
public async ValueTask<int> ReadAsync(Memory<byte> buffer)
{
if (_index > _files.Count)
return 0;
var available = buffer.Length;
if (available == 0)
return 0;
do
{
if (_index == -1)
{
var seq = _form.Slice(_position);
var toCopy = seq.Length >= available ? available : (int)seq.Length;
seq.Slice(0, toCopy).CopyTo(buffer.Span.Slice(buffer.Length - available, toCopy));
_position += toCopy;
available -= toCopy;
if (_position == _form.Length)
{
_index += 1;
_position = 0;
}
}
else if (_index == _files.Count)
{
var seq = _end.Slice(_position);
var toCopy = seq.Length >= available ? available : (int)seq.Length;
seq.Slice(0, toCopy).CopyTo(buffer.Span.Slice(buffer.Length - available, toCopy));
_position += toCopy;
available -= toCopy;
if (_position == _end.Length)
{
_index += 1;
_position = 0;
}
return buffer.Length - available;
}
else
{
var file = _files[_index];
if (_position < file.Header.Length)
{
var seq = file.Header.Slice(_position);
var toCopy = seq.Length >= available ? available : (int)seq.Length;
seq.Slice(0, toCopy).CopyTo(buffer.Span.Slice(buffer.Length - available, toCopy));
_position += toCopy;
available -= toCopy;
}
if (available == 0)
return buffer.Length;
Debug.Assert(_position >= file.Header.Length);
if (file.Content == null)
{
_index += 1;
_position = 0;
}
else
{
var result = await file.Content.ReadAsync(buffer.Slice(buffer.Length - available));
if (result == 0)
{
_index += 1;
_position = 0;
}
else
{
available -= result;
}
}
}
} while (available > 0);
return buffer.Length;
}
public ValueTask<int> ReadAsync(byte[] buffer, int offset, int count)
{
return ReadAsync(buffer.AsMemory(offset, count));
}
public void Dispose()
{
if (_disposable == null)
return;
_disposable.Dispose();
foreach (var file in _files)
{
try { file.Content.Dispose(); } catch { }
}
_disposable = null;
}
}
private class DeflateDecoderContent : IHttpContent, IDisposable
{
private DeflateDecoder _decoder;
private IHttpContent _content;
private int _offset;
private int _length;
private byte[] _buffer;
public DeflateDecoderContent(IHttpContent content, DeflateDecoder decoder)
{
Debug.Assert(content != null);
Debug.Assert(decoder != null);
_content = content;
_decoder = decoder;
_buffer = ArrayPool<byte>.Shared.Rent(8192);
}
public long Available => _content == null ? 0 : -1;
public long Length => -1;
public bool Rewind() => false;
public long ComputeLength() => -1;
public int Read(Span<byte> buffer)
{
if (buffer.IsEmpty)
return 0;
if (_content == null)
return 0;
if (_buffer == null)
{
_decoder.Decompress(Array.Empty<byte>(), buffer, true, out var bytesConsumed, out var bytesWritten, out var completed);
Debug.Assert(bytesConsumed == 0);
Debug.Assert(bytesWritten != 0);
if (completed)
{
_content = null;
_decoder.Dispose();
_decoder = null;
}
return bytesWritten;
}
else
{
if (_length == 0)
{
_length = _content.Read(_buffer);
if (_length == 0)
{
ArrayPool<byte>.Shared.Return(_buffer);
_buffer = null;
_decoder.Decompress(Array.Empty<byte>(), buffer, true, out var bytesConsumed, out var bytesWritten, out var completed);
Debug.Assert(bytesConsumed == 0);
Debug.Assert(bytesWritten != 0);
if (completed)
{
_content = null;
_decoder.Dispose();
_decoder = null;
}
return bytesWritten;
}
else
{
_offset = 0;
_decoder.Decompress(_buffer.AsSpan(_offset, _length), buffer, false, out var bytesConsumed, out var bytesWritten, out var completed);
_offset += bytesConsumed;
_length -= bytesConsumed;
if (completed)
{
//_content.Available != 0 is BUG
if (_length != 0)
throw new InvalidDataException("Remaining");
_length = _content.Read(_buffer);
if (_length != 0)
throw new InvalidDataException("Remaining");
ArrayPool<byte>.Shared.Return(_buffer);
_buffer = null;
_content = null;
_decoder.Dispose();
_decoder = null;
return bytesWritten;
}
if (bytesWritten == 0)
return Read(buffer);
return bytesWritten;
}
}
else
{
_decoder.Decompress(_buffer.AsSpan(_offset, _length), buffer, false, out var bytesConsumed, out var bytesWritten, out var completed);
_offset += bytesConsumed;
_length -= bytesConsumed;
if (completed)
{
if (_length != 0)
throw new InvalidDataException("Remaining");
_length = _content.Read(_buffer);
if (_length != 0)
throw new InvalidDataException("Remaining");
ArrayPool<byte>.Shared.Return(_buffer);
_buffer = null;
_content = null;
_decoder.Dispose();
_decoder = null;
}
if (bytesWritten == 0)
return Read(buffer);
return bytesWritten;
}
}
}
public int Read(byte[] buffer, int offset, int count)
{
return Read(buffer.AsSpan(offset, count));
}
public async ValueTask<int> ReadAsync(Memory<byte> buffer)
{
if (buffer.IsEmpty)
return 0;
if (_content == null)
return 0;
if (_buffer == null)
{
_decoder.Decompress(Array.Empty<byte>(), buffer.Span, true, out var bytesConsumed, out var bytesWritten, out var completed);
Debug.Assert(bytesConsumed == 0);
Debug.Assert(bytesWritten != 0);
if (completed)
{
_content = null;
_decoder.Dispose();
_decoder = null;
}
return bytesWritten;
}
else
{
if (_length == 0)
{
_length = await _content.ReadAsync(_buffer);
if (_length == 0)
{
ArrayPool<byte>.Shared.Return(_buffer);
_buffer = null;
_decoder.Decompress(Array.Empty<byte>(), buffer.Span, true, out var bytesConsumed, out var bytesWritten, out var completed);
Debug.Assert(bytesConsumed == 0);
Debug.Assert(bytesWritten != 0);
if (completed)
{
_content = null;
_decoder.Dispose();
_decoder = null;
}
return bytesWritten;
}
else
{
_offset = 0;
_decoder.Decompress(_buffer.AsSpan(_offset, _length), buffer.Span, false, out var bytesConsumed, out var bytesWritten, out var completed);
_offset += bytesConsumed;
_length -= bytesConsumed;
if (completed)
{
if (_length != 0)
throw new InvalidDataException("Remaining");
_length = await _content.ReadAsync(_buffer);
if (_length != 0)
throw new InvalidDataException("Remaining");
ArrayPool<byte>.Shared.Return(_buffer);
_buffer = null;
_content = null;
_decoder.Dispose();
_decoder = null;
return bytesWritten;
}
if (bytesWritten == 0)
return await ReadAsync(buffer);
return bytesWritten;
}
}
else
{
_decoder.Decompress(_buffer.AsSpan(_offset, _length), buffer.Span, false, out var bytesConsumed, out var bytesWritten, out var completed);
_offset += bytesConsumed;
_length -= bytesConsumed;
if (completed)
{
if (_length != 0)
throw new InvalidDataException("Remaining");
_length = await _content.ReadAsync(_buffer);
if (_length != 0)
throw new InvalidDataException("Remaining");
ArrayPool<byte>.Shared.Return(_buffer);
_buffer = null;
_content = null;
_decoder.Dispose();
_decoder = null;
}
if (bytesWritten == 0)
return await ReadAsync(buffer);
return bytesWritten;
}
}
}
public ValueTask<int> ReadAsync(byte[] buffer, int offset, int count)
{
return ReadAsync(buffer.AsMemory(offset, count));
}
public void Dispose()
{
var content = _content;
_content = null;
if (content != null)
{
Debug.Assert(_decoder != null);
_decoder.Dispose();
_decoder = null;
}
var buffer = _buffer;
_buffer = null;
if (buffer != null)
{
ArrayPool<byte>.Shared.Return(buffer);
}
}
}
private class BrotliDecoderContent : IHttpContent, IDisposable
{
private BrotliDecoder _decoder;
private IHttpContent _content;
private int _offset;
private int _length;
private byte[] _buffer;
public BrotliDecoderContent(IHttpContent content, BrotliDecoder decoder)
{
Debug.Assert(content != null);
_content = content;
_decoder = decoder;
_buffer = ArrayPool<byte>.Shared.Rent(8192);
}
public long Available => _content == null ? 0 : -1;
public long Length => -1;
public bool Rewind() => false;
public long ComputeLength() => -1;
public int Read(Span<byte> buffer)
{
if (buffer.IsEmpty)
return 0;
if (_content == null)
return 0;
if (_buffer == null)
{
var status = _decoder.Decompress(Array.Empty<byte>(), buffer, out var bytesConsumed, out var bytesWritten);
if (status == OperationStatus.Done)
{
_content = null;
_decoder.Dispose();
}
else if (status != OperationStatus.DestinationTooSmall)//?
{
throw new InvalidDataException($"OperationStatus:{status}");
}
return bytesWritten;
}
else
{
if (_length == 0)
{
_length = _content.Read(_buffer);
if (_length == 0)
{
ArrayPool<byte>.Shared.Return(_buffer);
_buffer = null;
var status = _decoder.Decompress(Array.Empty<byte>(), buffer, out var bytesConsumed, out var bytesWritten);
if (status == OperationStatus.Done)
{
_content = null;
_decoder.Dispose();
}
else if (status != OperationStatus.DestinationTooSmall)//?
{
throw new InvalidDataException($"OperationStatus:{status}");
}
return bytesWritten;
}
else
{
_offset = 0;
var status = _decoder.Decompress(_buffer.AsSpan(_offset, _length), buffer, out var bytesConsumed, out var bytesWritten);
_offset += bytesConsumed;
_length -= bytesConsumed;
if (status == OperationStatus.Done)
{
if (_length != 0)
throw new InvalidDataException("Remaining");
_length = _content.Read(_buffer);
if (_length != 0)
throw new InvalidDataException("Remaining");
ArrayPool<byte>.Shared.Return(_buffer);
_buffer = null;
_content = null;
_decoder.Dispose();
}
else if (status == OperationStatus.InvalidData)
{
throw new InvalidDataException($"OperationStatus:{status}");
}
if (bytesWritten == 0)
return Read(buffer);
return bytesWritten;
}
}
else
{
var status = _decoder.Decompress(_buffer.AsSpan(_offset, _length), buffer, out var bytesConsumed, out var bytesWritten);
_offset += bytesConsumed;
_length -= bytesConsumed;
if (status == OperationStatus.Done)
{
if (_length != 0)
throw new InvalidDataException("Remaining");
_length = _content.Read(_buffer);
if (_length != 0)
throw new InvalidDataException("Remaining");
ArrayPool<byte>.Shared.Return(_buffer);
_buffer = null;
_content = null;
_decoder.Dispose();
}
else if (status == OperationStatus.InvalidData)
{
throw new InvalidDataException($"OperationStatus:{status}");
}
if (bytesWritten == 0)
return Read(buffer);
return bytesWritten;
}
}
}
public int Read(byte[] buffer, int offset, int count)
{
return Read(buffer.AsSpan(offset, count));
}
public async ValueTask<int> ReadAsync(Memory<byte> buffer)
{
if (buffer.IsEmpty)
return 0;
if (_content == null)
return 0;
if (_buffer == null)
{
var status = _decoder.Decompress(Array.Empty<byte>(), buffer.Span, out var bytesConsumed, out var bytesWritten);
if (status == OperationStatus.Done)
{
_content = null;
_decoder.Dispose();
}
else if (status != OperationStatus.DestinationTooSmall)//?
{
throw new InvalidDataException($"OperationStatus:{status}");
}
return bytesWritten;
}
else
{
if (_length == 0)
{
_length = await _content.ReadAsync(_buffer);
if (_length == 0)
{
ArrayPool<byte>.Shared.Return(_buffer);
_buffer = null;
var status = _decoder.Decompress(Array.Empty<byte>(), buffer.Span, out var bytesConsumed, out var bytesWritten);
if (status == OperationStatus.Done)
{
_content = null;
_decoder.Dispose();
}
else if (status != OperationStatus.DestinationTooSmall)//?
{
throw new InvalidDataException($"OperationStatus:{status}");
}
return bytesWritten;
}
else
{
_offset = 0;
var status = _decoder.Decompress(_buffer.AsSpan(_offset, _length), buffer.Span, out var bytesConsumed, out var bytesWritten);
_offset += bytesConsumed;
_length -= bytesConsumed;
if (status == OperationStatus.Done)
{
if (_length != 0)
throw new InvalidDataException("Remaining");
_length = await _content.ReadAsync(_buffer);
if (_length != 0)
throw new InvalidDataException("Remaining");
ArrayPool<byte>.Shared.Return(_buffer);
_buffer = null;
_content = null;
_decoder.Dispose();
}
else if (status == OperationStatus.InvalidData)
{
throw new InvalidDataException($"OperationStatus:{status}");
}
if (bytesWritten == 0)
return await ReadAsync(buffer);
return bytesWritten;
}
}
else
{
var status = _decoder.Decompress(_buffer.AsSpan(_offset, _length), buffer.Span, out var bytesConsumed, out var bytesWritten);
_offset += bytesConsumed;
_length -= bytesConsumed;
if (status == OperationStatus.Done)
{
if (_length != 0)
throw new InvalidDataException("Remaining");
_length = await _content.ReadAsync(_buffer);
if (_length != 0)
throw new InvalidDataException("Remaining");
ArrayPool<byte>.Shared.Return(_buffer);
_buffer = null;
_content = null;
_decoder.Dispose();
}
else if (status == OperationStatus.InvalidData)
{
throw new InvalidDataException($"OperationStatus:{status}");
}
if (bytesWritten == 0)
return await ReadAsync(buffer);
return bytesWritten;
}
}
}
public ValueTask<int> ReadAsync(byte[] buffer, int offset, int count)
{
return ReadAsync(buffer.AsMemory(offset, count));
}
public void Dispose()
{
var content = _content;
_content = null;
if (content != null)
{
_decoder.Dispose();
}
var buffer = _buffer;
_buffer = null;
if (buffer != null)
{
ArrayPool<byte>.Shared.Return(buffer);
}
}
}
//private class TimeoutClient : HttpClient
//{
// private HttpClient _client;
// private int _timeout;
// private int _readTimeout;
// public TimeoutClient(HttpClient client, int timeout, int readTimeout)
// {
// _client = client;
// _timeout = timeout;
// _readTimeout = readTimeout;
// }
// public override async Task<HttpResponse> SendAsync(HttpRequest request)
// {
// var response = default(HttpResponse);
// if (_timeout > 0)
// {
// response = await _client.SendAsync(request).Timeout(_timeout,
// (task) =>
// {
// if (task.IsCompletedSuccessfully)
// {
// task.Result.Dispose();
// }
// });
// }
// else
// {
// response = await _client.SendAsync(request);
// }
// if (response.Content != null && _readTimeout > 0)
// {
// response.Content = new TimeoutContent(response, _readTimeout);
// }
// return response;
// }
// public class TimeoutContent : IHttpContent
// {
// private HttpResponse _response;
// private IHttpContent _content;
// private int _timeout;
// public TimeoutContent(HttpResponse response, int timeout)
// {
// _response = response;
// _content = response.Content;
// _timeout = timeout;
// }
// public long Available => _content.Available;
// public long Length => _content.Length;
// public long ComputeLength() => _content.ComputeLength();
// public bool Rewind() => _content.Rewind();
// public int Read(Span<byte> buffer)
// {
// unsafe
// {
// fixed (byte* pBytes = buffer)
// {
// var valueTask = _content.ReadAsync(new UnmanagedMemory<byte>(pBytes, buffer.Length));
// if (valueTask.IsCompleted)
// return valueTask.Result;
// var task = valueTask.AsTask();
// try
// {
// return task.Timeout(_timeout).Result;
// }
// catch (TimeoutException)
// {
// _response.Dispose();
// return task.Result;
// }
// }
// }
// }
// public int Read(byte[] buffer, int offset, int count)
// {
// var valueTask = _content.ReadAsync(buffer, offset, count);
// if (valueTask.IsCompleted)
// return valueTask.Result;
// var task = valueTask.AsTask();
// try
// {
// return task.Timeout(_timeout).Result;
// }
// catch (TimeoutException)
// {
// _response.Dispose();
// return task.Result;
// }
// }
// public async ValueTask<int> ReadAsync(Memory<byte> buffer)
// {
// var valueTask = _content.ReadAsync(buffer);
// if (valueTask.IsCompleted)
// return valueTask.Result;
// var task = valueTask.AsTask();
// try
// {
// return await task.Timeout(_timeout);
// }
// catch (TimeoutException)
// {
// _response.Dispose();
// return await task;
// }
// }
// public async ValueTask<int> ReadAsync(byte[] buffer, int offset, int count)
// {
// var valueTask = _content.ReadAsync(buffer, offset, count);
// if (valueTask.IsCompleted)
// return valueTask.Result;
// var task = valueTask.AsTask();
// try
// {
// return await task.Timeout(_timeout);
// }
// catch (TimeoutException)
// {
// _response.Dispose();
// return await task;
// }
// }
// }
//}
private class TimeoutQueueClient : HttpClient
{
private static Action<Task<HttpResponse>> _Continuation = (task) =>
{
if (task.IsCompletedSuccessfully)
{
task.Result.Dispose();
}
};
private HttpClient _client;
private TaskTimeoutQueue<HttpResponse> _timeout;
private TaskTimeoutQueue<int> _readTimeout;
public TimeoutQueueClient(HttpClient client, TaskTimeoutQueue<HttpResponse> timeout, TaskTimeoutQueue<int> readTimeout)
{
_client = client;
_timeout = timeout;
_readTimeout = readTimeout;
}
public override async Task<HttpResponse> SendAsync(HttpRequest request)
{
var response = await _client.SendAsync(request).Timeout(_timeout, _Continuation);
if (response.Content != null && _readTimeout != null)
{
response.Content = new TimeoutContent(response, _readTimeout);
}
return response;
}
public class TimeoutContent : IHttpContent
{
private HttpResponse _response;
private IHttpContent _content;
private TaskTimeoutQueue<int> _timeout;
public TimeoutContent(HttpResponse response, TaskTimeoutQueue<int> timeout)
{
_response = response;
_content = response.Content;
_timeout = timeout;
}
public long Available => _content.Available;
public long Length => _content.Length;
public long ComputeLength() => _content.ComputeLength();
public bool Rewind() => _content.Rewind();
public int Read(Span<byte> buffer)
{
unsafe
{
fixed (byte* pBytes = buffer)
{
var valueTask = _content.ReadAsync(new UnmanagedMemory<byte>(pBytes, buffer.Length));
if (valueTask.IsCompleted)
return valueTask.Result;
var task = valueTask.AsTask();
try
{
return task.Timeout(_timeout).Result;
}
catch
{
_response.Dispose();
try { task.Wait(); } catch { }
throw;
}
}
}
}
public int Read(byte[] buffer, int offset, int count)
{
var valueTask = _content.ReadAsync(buffer, offset, count);
if (valueTask.IsCompleted)
return valueTask.Result;
var task = valueTask.AsTask();
try
{
return task.Timeout(_timeout).Result;
}
catch
{
_response.Dispose();
try { task.Wait(); } catch { }
throw;
}
}
public async ValueTask<int> ReadAsync(Memory<byte> buffer)
{
var valueTask = _content.ReadAsync(buffer);
if (valueTask.IsCompleted)
return valueTask.Result;
var task = valueTask.AsTask();
try
{
return await task.Timeout(_timeout);
}
catch
{
_response.Dispose();
try { await task; } catch { }
throw;
}
}
public async ValueTask<int> ReadAsync(byte[] buffer, int offset, int count)
{
var valueTask = _content.ReadAsync(buffer, offset, count);
if (valueTask.IsCompleted)
return valueTask.Result;
var task = valueTask.AsTask();
try
{
return await task.Timeout(_timeout);
}
catch
{
_response.Dispose();
try { await task; } catch { }
throw;
}
}
}
}
#endregion
#region Use(onRequest,onResponse)
//public static HttpClient Use(this HttpClient @this, Action<HttpRequest> onRequest)
//{
// if (@this == null)
// throw new ArgumentNullException(nameof(@this));
// if (onRequest == null)
// throw new ArgumentNullException(nameof(onRequest));
// return new OnRequestClient(@this, onRequest);
//}
//public static HttpClient Use(this HttpClient @this, Func<HttpRequest, Task> onRequest)
//{
// if (@this == null)
// throw new ArgumentNullException(nameof(@this));
// if (onRequest == null)
// throw new ArgumentNullException(nameof(onRequest));
// return new OnRequestAsyncClient(@this, onRequest);
//}
//public static HttpClient Use(this HttpClient @this, Action<HttpRequest, HttpResponse> onResponse)
//{
// if (@this == null)
// throw new ArgumentNullException(nameof(@this));
// if (onResponse == null)
// throw new ArgumentNullException(nameof(onResponse));
// return new OnResponseClient(@this, onResponse);
//}
//public static HttpClient Use(this HttpClient @this, Func<HttpRequest, HttpResponse, Task> onResponse)
//{
// if (@this == null)
// throw new ArgumentNullException(nameof(@this));
// if (onResponse == null)
// throw new ArgumentNullException(nameof(onResponse));
// return new OnResponseAsyncClient(@this, onResponse);
//}
//private class OnRequestClient : HttpClient
//{
// private HttpClient _client;
// private Action<HttpRequest> _onRequest;
// public OnRequestClient(HttpClient client, Action<HttpRequest> onRequest)
// {
// _client = client;
// _onRequest = onRequest;
// }
// public override Task<HttpResponse> SendAsync(HttpRequest request)
// {
// _onRequest.Invoke(request);
// return _client.SendAsync(request);
// }
//}
//private class OnRequestAsyncClient : HttpClient
//{
// private HttpClient _client;
// private Func<HttpRequest, Task> _onRequest;
// public OnRequestAsyncClient(HttpClient client, Func<HttpRequest, Task> onRequest)
// {
// _client = client;
// _onRequest = onRequest;
// }
// public override async Task<HttpResponse> SendAsync(HttpRequest request)
// {
// await _onRequest.Invoke(request);
// return await _client.SendAsync(request);
// }
//}
//private class OnResponseClient : HttpClient
//{
// private HttpClient _client;
// private Action<HttpRequest, HttpResponse> _onResponse;
// public OnResponseClient(HttpClient client, Action<HttpRequest, HttpResponse> onResponse)
// {
// _client = client;
// _onResponse = onResponse;
// }
// public override async Task<HttpResponse> SendAsync(HttpRequest request)
// {
// var response = await _client.SendAsync(request);
// _onResponse.Invoke(request, response);
// return response;
// }
//}
//private class OnResponseAsyncClient : HttpClient
//{
// private HttpClient _client;
// private Func<HttpRequest, HttpResponse, Task> _onResponse;
// public OnResponseAsyncClient(HttpClient client, Func<HttpRequest, HttpResponse, Task> onResponse)
// {
// _client = client;
// _onResponse = onResponse;
// }
// public override async Task<HttpResponse> SendAsync(HttpRequest request)
// {
// var response = await _client.SendAsync(request);
// await _onResponse.Invoke(request, response);
// return response;
// }
//}
#endregion
//private class RetryClient : HttpClient
//{
// private HttpClient _client;
// private int _maxRetry;
// public RetryClient(HttpClient client, int maxRetry)
// {
// _client = client;
// _maxRetry = maxRetry;
// }
// public override Task<HttpResponse> SendAsync(HttpRequest request)
// {
// throw new NotImplementedException();
// }
//}
}
}
| 3,211 |
https://war.wikipedia.org/wiki/Phlegyas%20abbreviatus
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Phlegyas abbreviatus
|
https://war.wikipedia.org/w/index.php?title=Phlegyas abbreviatus&action=history
|
Waray
|
Spoken
| 38 | 69 |
An Phlegyas abbreviatus in uska species han Insecta nga syahan ginhulagway ni Philip Reese Uhler hadton 1876. An Phlegyas abbreviatus in nahilalakip ha genus nga Phlegyas, ngan familia nga Pachygronthidae. Waray hini subspecies nga nakalista.
Mga kasarigan
Phlegyas
| 40,825 |
<urn:uuid:70561c9d-d22a-4d73-b3d7-6521b52534ef>
|
French Open Data
|
Open Government
|
Various open data
| 2,008 |
https://www.centre-inffo.fr/site-centre-inffo/actualites-centre-inffo/le-quotidien-de-la-formation-actualite-formation-professionnelle-apprentissage/articles-2008/la-cgt-entend-prendre-toute-sa
|
centre-inffo.fr
|
French
|
Spoken
| 142 | 193 |
Accueil > La CGT entend « prendre toute sa place » dans le chantier de la formation professionnelle
La CGT entend « prendre toute sa place » dans le chantier de la formation professionnelle
Par Centre Inffo - Le 12 mars 2008.
La CGT s’est félicitée mardi 11 mars dans un communiqué de l’ouverture du chantier de la formation professionnelle. « Le Conseil d’orientation pour l’emploi doit faire des préconisations et une conférence quadripartite est prévue en avril pour clore un processus de négociations associant l’Etat, les Régions, les organisations syndicales de salariés, les organisations d’employeurs », a rappelé la confédération. Laquelle « entend prendre toute sa place pour que cette remise à plat soit utile à notre économie et aux salariés de notre pays. En effet, des interrelations fortes existent entre les besoins de l’économie et les besoins des salariés en…
| 24,515 |
https://www.wikidata.org/wiki/Q78145891
|
Wikidata
|
Semantic data
|
CC0
| null |
Sensirion
|
None
|
Multilingual
|
Semantic data
| 42 | 165 |
Sensirion
Hersteller von digitalen Mikrosensoren und -systemen
Sensirion ist ein(e) Unternehmen
Sensirion Rechtsform Aktiengesellschaft
Sensirion ISIN CH0406705126
Sensirion GRID-Kennung grid.509127.8
Sensirion Google-Knowledge-Graph-Kennung /g/11j43dtmyp
Sensirion ROR-Kennung 00cy9w266
Sensirion ISNI 0000000404504046
Sensirion Staat Schweiz
Sensirion Ringgold-Kennung 226190, genannt als Sensirion AG
Sensirion LEI 894500ANJ9YNE8YCTT04
| 27,340 |
https://github.com/42wim/rl/blob/master/release.sh
|
Github Open Source
|
Open Source
|
MIT
| 2,021 |
rl
|
42wim
|
Shell
|
Code
| 13 | 42 |
podman run --rm -ti -v $PWD:/build -e GITHUB_TOKEN -w /build goreleaser/goreleaser release --rm-dist
| 45,675 |
6299626_1
|
Court Listener
|
Open Government
|
Public Domain
| 2,022 |
None
|
None
|
English
|
Spoken
| 553 | 752 |
WATKINS, Judge:
This is an appeal from the judgment of sentence of the Court of Common Pleas of Dauphin County, by the defendant-appellant, Emory D. Stine, after his conviction on charges of (1) operating an unregistered vehicle upon a highway (75 Pa.C.S.A. 1301); (2) failure to carry and exhibit a driver’s license upon demand by a policy officer (75 Pa.C. S.A. 1511) and (3) operation of a vehicle without an official certificate of inspection (75 Pa.C.SA. 4703).
The defendant, an elderly farmer, was cited for operating an unlicensed and unregistered golf cart upon a public highway. At the time of his apprehension he did not have his operator’s license with him and was requested to bring it to the police station. One half hour later the defendant went to the police station with his son. An argument ensued and defendant’s son told the police that “He (the defendant) will not show anything”. However, the defendant and his son had been directed to leave the police station by one of the officers.
The golf cart that the defendant was operating was being used to transport bales of hay. The defendant claims that it is exempt from inspection and licensing because it was *453modified for farm use. The testimony revealed that the road on which it was being used was a dead end road, an expressway having bisected the road, and that defendant’s farm was adjacent to the road. After the officer had testified the case was closed and the defendant did not present any witnesses nor testify himself. The defendant claims in his brief that he had received an opinion from the Department of Transportation of the Commonwealth of Pennsylvania, Bureau of Motor Vehicles that his vehicle qualified as one adapted for farm use. He claims that this opinion was supplied to the court below and the District Attorney. 75 Pa.C.S.A. 1302(b) excepts “any implement of husbandry or trailer determined by the department to be used exclusively for agricultural operations and only incidentally operated upon highways “from the registration requirements of the Motor Vehicle Code. 75 Pa.C.S.A. 1302(b)(3) provides a similar exemption for golf carts used while “engaged in the game of golf while crossing any public highway during any game of golf”. The Commonwealth argues that the use of defendant’s golf cart under these circumstances it not having been used by the defendant for playing golf, did not come within the scope of the farm vehicle exception [1302(b)(2) ] nor the golf cart exception [1302(b)(3) ]. Because 75 Pa.C.S.A. 1302(b)(2) clearly provides for the Department of Transportation to make the determination as to whether defendant’s vehicle qualified for the farm use exception we feel that defendant’s letter from PennDot, though obtained subsequent to defendant’s summary trial, would be relevant evidence in these proceedings. As such we are remanding all three cases (See Commonwealth v. Campana, 455 Pa. 622, 314 A.2d 854 (1974)) to the court below in order to give the defendant the opportunity to present his case before the court below, including the evidence of PennDot’s position regarding his golf cart and any other evidence which would otherwise be admissible for the purpose of providing us with a record which is more complete.
*454Remanded to, the court below for further proceedings consistent with this opinion.
CERCONE, President Judge, concurs in the result.
| 49,657 |
https://no.wikipedia.org/wiki/Jefferson%20County%20%28Georgia%29
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Jefferson County (Georgia)
|
https://no.wikipedia.org/w/index.php?title=Jefferson County (Georgia)&action=history
|
Norwegian
|
Spoken
| 15 | 33 |
Jefferson County er et fylke i den amerikanske delstaten Georgia.
Eksterne lenker
Fylker i Georgia
| 20,067 |
https://www.wikidata.org/wiki/Q26235787
|
Wikidata
|
Semantic data
|
CC0
| null |
Willy Real
|
None
|
Multilingual
|
Semantic data
| 1,743 | 4,350 |
Willy Real
deutscher Historiker
Willy Real GND-Kennung 121509443
Willy Real VIAF-Kennung 14784282
Willy Real Sterbedatum 2004
Willy Real ist ein(e) Mensch
Willy Real Geburtsdatum 1911
Willy Real Geschlecht männlich
Willy Real Land der Staatsangehörigkeit Deutschland
Willy Real Tätigkeit Historiker
Willy Real IdRef-Normdatenkennung 028443160
Willy Real LCAuth-Kennung n82028358
Willy Real NTA-Kennung 074935763
Willy Real ISNI 0000000080934962
Willy Real BnF-Kennung 12027739h
Willy Real BAV-Kennung (veraltet) ADV10250758
Willy Real Geburtsort Osternienburg
Willy Real BBF-ID 7d42ec5c-e858-4b0c-928b-335dee8d6a5f
Willy Real Vorname Willy
Willy Real FAST-Kennung 88054
Willy Real Arbeitgeber Universität zu Köln
Willy Real PUSC-Kennung 127171
Willy Real Deutsche-Biographie-Kennung 121509443
Willy Real VcBA-Kennung 495/194627
Willy Real VcBA-Kennung 495/71115
Willy Real NUKAT-Kennung n2020210944
Willy Real Google-Knowledge-Graph-Kennung /g/11c15cpw_c
Willy Real SHARE-Catalogue-Autorenkennung 664412
Willy Real gesprochene oder publizierte Sprachen Deutsch
Willy Real Index-Theologicus-Kennung 081354258
Willy Real J9U-Kennung der Israelischen Nationalbibliothek 987007275517005171
Willy Real KBR-Personenkennung 14237271
Willy Real SBN-Autoren-Kennung BVEV079907, genannt als Real, Willy <1911-2004>
Willy Real Parsifal-Cluster-ID 39138, genannt als Real, Willy, 1911-2004
Willy Real WorldCat-Entitäten-Kennung E39PBJyCDFRqr8dtp4tDYCwcT3
Willy Real
historien allemand
Willy Real identifiant GND (DNB) 121509443
Willy Real identifiant VIAF 14784282
Willy Real date de mort 2004
Willy Real nature de l’élément être humain
Willy Real date de naissance 1911
Willy Real sexe ou genre masculin
Willy Real pays de nationalité Allemagne
Willy Real occupation historien ou historienne
Willy Real identifiant IdRef 028443160
Willy Real identifiant Bibliothèque du Congrès n82028358
Willy Real identifiant Bibliothèque royale des Pays-Bas 074935763
Willy Real identifiant ISNI 0000000080934962
Willy Real identifiant Bibliothèque nationale de France 12027739h
Willy Real identifiant Bibliothèque apostolique vaticane ADV10250758
Willy Real lieu de naissance Osternienburg
Willy Real identifiant Bibliothek für Bildungsgeschichtliche Forschung 7d42ec5c-e858-4b0c-928b-335dee8d6a5f
Willy Real prénom Willy
Willy Real identifiant FAST 88054
Willy Real employé(e) par université de Cologne
Willy Real identifiant Université pontificale de la Sainte-Croix 127171
Willy Real identifiant Deutsche Biographie 121509443
Willy Real identifiant VcBA 495/194627
Willy Real identifiant VcBA 495/71115
Willy Real identifiant NUKAT n2020210944
Willy Real identifiant du Google Knowledge Graph /g/11c15cpw_c
Willy Real identifiant SHARE Catalogue 664412
Willy Real langues parlées, écrites ou signées allemand
Willy Real identifiant Index Theologicus 081354258
Willy Real identifiant J9U de la Bibliothèque nationale d'Israël 987007275517005171
Willy Real identifiant d’autorité Bibliothèque royale de Belgique 14237271
Willy Real identifiant SBN d'un auteur BVEV079907, sous le nom Real, Willy <1911-2004>
Willy Real identifiant Parsifal 39138, sous le nom Real, Willy, 1911-2004
Willy Real identifiant WorldCat Entities E39PBJyCDFRqr8dtp4tDYCwcT3
Willy Real
Duits historicus (1911-2004)
Willy Real GND-identificatiecode 121509443
Willy Real VIAF-identificatiecode 14784282
Willy Real overlijdensdatum 2004
Willy Real is een mens
Willy Real geboortedatum 1911
Willy Real sekse of geslacht mannelijk
Willy Real land van nationaliteit Duitsland
Willy Real beroep historicus
Willy Real idRef-identificatiecode 028443160
Willy Real LCAuth-identificatiecode n82028358
Willy Real NTA-identificatiecode voor persoon 074935763
Willy Real ISNI 0000000080934962
Willy Real BnF-identificatiecode 12027739h
Willy Real BAV-identificatiecode ADV10250758
Willy Real geboorteplaats Osternienburg
Willy Real BBF-identificatiecode 7d42ec5c-e858-4b0c-928b-335dee8d6a5f
Willy Real voornaam Willy
Willy Real FAST-identificatiecode 88054
Willy Real werkgever Universiteit van Keulen
Willy Real PUSC-identificatiecode voor auteur 127171
Willy Real Deutsche Biographie-identificatiecode 121509443
Willy Real VcBA-identificatiecode 495/194627
Willy Real VcBA-identificatiecode 495/71115
Willy Real NUKAT-identificatiecode n2020210944
Willy Real Google Knowledge Graph-identificatiecode /g/11c15cpw_c
Willy Real SHARE Catalogue-identificatiecode voor auteur 664412
Willy Real taalbeheersing Duits
Willy Real IxTheo-identificatiecode voor persoon of organisatie 081354258
Willy Real JGU-identificatiecode van de Nationale Bibliotheek van Israël 987007275517005171
Willy Real KBR-identificatiecode voor persoon 14237271
Willy Real SBN-identificatiecode voor auteur BVEV079907, genoemd als Real, Willy <1911-2004>
Willy Real Parsifal-identificatiecode voor cluster 39138, genoemd als Real, Willy, 1911-2004
Willy Real WorldCat Entities-identificatiecode E39PBJyCDFRqr8dtp4tDYCwcT3
Willy Real
German historian
Willy Real GND ID 121509443
Willy Real VIAF ID 14784282
Willy Real date of death 2004
Willy Real instance of human
Willy Real date of birth 1911
Willy Real sex or gender male
Willy Real country of citizenship Germany
Willy Real occupation historian
Willy Real IdRef ID 028443160
Willy Real Library of Congress authority ID n82028358
Willy Real Nationale Thesaurus voor Auteursnamen ID 074935763
Willy Real ISNI 0000000080934962
Willy Real Bibliothèque nationale de France ID 12027739h
Willy Real Vatican Library ID (former scheme) ADV10250758
Willy Real place of birth Osternienburg
Willy Real BBF ID 7d42ec5c-e858-4b0c-928b-335dee8d6a5f
Willy Real given name Willy
Willy Real FAST ID 88054
Willy Real employer University of Cologne
Willy Real Pontificia Università della Santa Croce ID 127171
Willy Real Deutsche Biographie (GND) ID 121509443
Willy Real Vatican Library VcBA ID 495/194627
Willy Real Vatican Library VcBA ID 495/71115
Willy Real NUKAT ID n2020210944
Willy Real Google Knowledge Graph ID /g/11c15cpw_c
Willy Real SHARE Catalogue author ID 664412
Willy Real languages spoken, written or signed German
Willy Real IxTheo authority ID 081354258
Willy Real National Library of Israel J9U ID 987007275517005171
Willy Real KBR person ID 14237271
Willy Real SBN author ID BVEV079907, subject named as Real, Willy <1911-2004>
Willy Real Parsifal cluster ID 39138, subject named as Real, Willy, 1911-2004
Willy Real WorldCat Entities ID E39PBJyCDFRqr8dtp4tDYCwcT3
Willy Real
Willy Real GND 121509443
Willy Real VIAF 14784282
Willy Real datum smrti 2004
Willy Real primerek od človek
Willy Real datum rojstva 1911
Willy Real spol moški
Willy Real država državljanstva Nemčija
Willy Real poklic zgodovinar
Willy Real oznaka IdRef 028443160
Willy Real LCCN n82028358
Willy Real NTA 074935763
Willy Real ISNI 0000000080934962
Willy Real BNF 12027739h
Willy Real BAV (vatikanska knjižnica) ADV10250758
Willy Real ime Willy
Willy Real FAST 88054
Willy Real zaposlen v Univerza v Kölnu
Willy Real identifikator Vatikanske knjižnice VcBA 495/194627
Willy Real identifikator Vatikanske knjižnice VcBA 495/71115
Willy Real NUKAT n2020210944
Willy Real oznaka Google Knowledge Graph /g/11c15cpw_c
Willy Real govorjeni, pisani ali kretani jeziki nemščina
Willy Real oznaka J9U Izraelske narodne knjižnice 987007275517005171
Willy Real SBN BVEV079907, poimenovano kot Real, Willy <1911-2004>
Willy Real
historiador alemany
Willy Real identificador GND (DNB-Deutsche Nationalbibliothek) 121509443
Willy Real identificador VIAF 14784282
Willy Real data de defunció 2004
Willy Real instància de ésser humà
Willy Real data de naixement 1911
Willy Real sexe o gènere masculí
Willy Real ciutadania Alemanya
Willy Real ocupació historiador
Willy Real identificador idRef SUDOC 028443160
Willy Real identificador LCCN n82028358
Willy Real identificador NTA 074935763
Willy Real identificador ISNI 0000000080934962
Willy Real identificador BnF 12027739h
Willy Real identificador BAV ADV10250758
Willy Real identificador BBF 7d42ec5c-e858-4b0c-928b-335dee8d6a5f
Willy Real prenom Willy
Willy Real identificador FAST 88054
Willy Real ocupador Universitat de Colònia
Willy Real identificador PUSC d'autor 127171
Willy Real identificador Deutsche Biographie 121509443
Willy Real identificador VcBA Biblioteca Vaticana 495/194627
Willy Real identificador VcBA Biblioteca Vaticana 495/71115
Willy Real identificador NUKAT (WarsawU) n2020210944
Willy Real identificador Google Knowledge Graph /g/11c15cpw_c
Willy Real identificador SHARE Catalogue d'autor 664412
Willy Real llengua parlada, escrita o signada alemany
Willy Real identificador Index Theologicus d'autoritat 081354258
Willy Real identificador J9U de la Biblioteca Nacional d'Israel 987007275517005171
Willy Real identificador KBR de persona 14237271
Willy Real identificador SBN, Itàlia (codi ICCU) BVEV079907, anomenat com a Real, Willy <1911-2004>
Willy Real identificador Parsifal de clúster 39138, anomenat com a Real, Willy, 1911-2004
Willy Real identificador WorldCat Entities E39PBJyCDFRqr8dtp4tDYCwcT3
Willy Real
historiador alemán (1911–2004)
Willy Real identificador GND 121509443
Willy Real identificador VIAF 14784282
Willy Real data de la muerte 2004
Willy Real instancia de humanu
Willy Real fecha de nacimientu 1911
Willy Real sexu masculín
Willy Real país de nacionalidá Alemaña
Willy Real ocupación historiador
Willy Real identificador d'autoridá de la Biblioteca del Congresu d'EEXX n82028358
Willy Real identificador NTA 074935763
Willy Real ISNI 0000000080934962
Willy Real identificador BnF 12027739h
Willy Real nome Willy
Willy Real emplegador Universidá de Colonia
Willy Real identificador NUKAT n2020210944
Willy Real llingües falaes alemán
Willy Real identificador SBN BVEV079907, apaez como Real, Willy <1911-2004>
Willy Real
historiador alemán
Willy Real identificador GND (DNB) 121509443
Willy Real identificador VIAF 14784282
Willy Real fecha de fallecimiento 2004
Willy Real instancia de ser humano
Willy Real fecha de nacimiento 1911
Willy Real sexo o género masculino
Willy Real país de nacionalidad Alemania
Willy Real ocupación historiador
Willy Real identificador de referencia de idRef SUDOC 028443160
Willy Real identificador de autoridades de la Biblioteca del Congreso de EE. UU. n82028358
Willy Real identificador NTA 074935763
Willy Real ISNI 0000000080934962
Willy Real identificador BnF 12027739h
Willy Real identificador BAV ADV10250758
Willy Real nombre de pila Willy
Willy Real identificador FAST 88054
Willy Real empleador Universidad de Colonia
Willy Real ID Pontificia Universidad de la Santa Cruz 127171
Willy Real identificador Deutsche Biographie 121509443
Willy Real identificador VcBA 495/194627
Willy Real identificador VcBA 495/71115
Willy Real identificador NUKAT n2020210944
Willy Real identificador Google Knowledge Graph /g/11c15cpw_c
Willy Real identificador SHARE Catalogue de autor 664412
Willy Real lenguas habladas, escritas o signadas alemán
Willy Real ID autoridades Index Theologicus 081354258
Willy Real identificador J9U de la Biblioteca Nacional de Israel 987007275517005171
Willy Real identificador KBR de persona 14237271
Willy Real identificador SBN BVEV079907, registrado como Real, Willy <1911-2004>
Willy Real identificador WorldCat Entities E39PBJyCDFRqr8dtp4tDYCwcT3
Willy Real
storico tedesco
Willy Real identificativo GND 121509443
Willy Real identificativo VIAF 14784282
Willy Real data di morte 2004
Willy Real istanza di umano
Willy Real data di nascita 1911
Willy Real sesso o genere maschio
Willy Real paese di cittadinanza Germania
Willy Real occupazione storico
Willy Real identificativo idRef 028443160
Willy Real identificativo della Biblioteca del Congresso n82028358
Willy Real identificativo NTA 074935763
Willy Real identificativo ISNI 0000000080934962
Willy Real identificativo BNF 12027739h
Willy Real identificativo BAV ADV10250758
Willy Real luogo di nascita Osternienburg
Willy Real identificativo BBF 7d42ec5c-e858-4b0c-928b-335dee8d6a5f
Willy Real prenome Willy
Willy Real identificativo FAST 88054
Willy Real datore di lavoro Università di Colonia
Willy Real identificativo Pontificia Università della Santa Croce 127171
Willy Real identificativo Deutsche Biographie 121509443
Willy Real identificativo VcBA 495/194627
Willy Real identificativo VcBA 495/71115
Willy Real identificativo NUKAT n2020210944
Willy Real identificativo Google Knowledge Graph /g/11c15cpw_c
Willy Real identificativo SHARE Catalogue di un autore 664412
Willy Real lingue parlate o scritte tedesco
Willy Real identificativo IxTheo 081354258
Willy Real identificativo J9U della Biblioteca nazionale israeliana 987007275517005171
Willy Real identificativo KBR di una persona 14237271
Willy Real identificativo SBN di un autore BVEV079907, soggetto indicato come Real, Willy <1911-2004>
Willy Real identificativo Parsifal di un cluster 39138, soggetto indicato come Real, Willy, 1911-2004
Willy Real identificativo WorldCat Entities E39PBJyCDFRqr8dtp4tDYCwcT3
Willy Real
historian gjerman
Willy Real GND ID 121509443
Willy Real VIAF ID 14784282
Willy Real data e vdekjes 2004
Willy Real instancë e njeri
Willy Real data e lindjes 1911
Willy Real gjinia mashkull
Willy Real shtetësia Gjermania
Willy Real profesioni historian
Willy Real Library of Congress ID n82028358
Willy Real ISNI 0000000080934962
Willy Real identifikues i BNF 12027739h
Willy Real BAV ID ADV10250758
Willy Real emri Willy
Willy Real gjuhë që flet, shkruan ose këndon gjermanisht
Willy Real ID i autorit SBN BVEV079907, referuar si Real, Willy <1911-2004>
| 29,257 |
https://id.wikipedia.org/wiki/Persinyalan%20blok%20otomatis
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Persinyalan blok otomatis
|
https://id.wikipedia.org/w/index.php?title=Persinyalan blok otomatis&action=history
|
Indonesian
|
Spoken
| 906 | 1,997 |
Persinyalan blok otomatis (ABS), disebut juga persinyalan blok terbuka, adalah sistem persinyalan kereta api yang terdiri atas serangkaian sinyal yang membagi jalur kereta api menjadi beberapa bagian, atau disebut "blok". Sistem ini mengontrol pergerakan kereta api pada tiap blok menggunakan sinyal otomatis. Operasi ABS dirancang untuk memungkinkan kereta yang beroperasi dengan arah yang sama untuk mengikuti satu sama lain dengan cara yang aman tanpa risiko tabrakan dari belakang. Teknologi ABS mengurangi biaya operasional dan meningkatkan kapasitas jalur kereta api. Berbeda dengan sistem blok manual konvensional yang membutuhkan operator manusia, ABS mengandalkan algoritma sistem untuk mendeteksi apakah suatu blok terduduki oleh kereta api atau tidak, kemudian menyampaikan informasi tersebut ke kereta yang mendekat. Sistem ini beroperasi tanpa intervensi dari luar, tidak seperti sistem kontrol lalu lintas modern yang memerlukan kontrol eksternal untuk mengatur arus lalu lintas.
Sejarah
Metode pertama untuk mengelola banyak kereta di satu lintasan adalah dengan menggunakan jadwal dan petak jalan. Satu kereta menunggu silang/susul dengan kereta yang lain, sesuai dengan instruksi dalam jadwal. Tetapi jika suatu kereta tertunda karena alasan apa pun, sebagian besar kereta lain mungkin juga akan tertunda karena menunggu kereta yang terlambat tadi muncul di tempat yang tepat di mana mereka dapat lewat dengan aman. Pengoperasian kereta dengan jadwal ditambah dengan komunikasi telegraf kereta api mulai dilakukan tahun 1854 oleh Erie Railroad. Seorang pengatur perjalanan kereta api akan mengirimkan jadwal kereta api ke stasiun-stasiun yang diawaki oleh para telegrafer. Telegrafer kemudian menuliskannya pada dokumen dan menyerahkannya kepada awak kereta ketika mereka melewati stasiun.
Sistem persinyalan blok manual di Amerika Serikat diimplementasikan oleh Pennsylvania Railroad sekitar tahun 1863 (beberapa dekade sebelum sistem perkeretaapian Amerika lainnya mulai menggunakannya). Sistem ini mengharuskan pegawai perusahaan kereta api ditempatkan di setiap sinyal untuk mengatur sinyal sesuai dengan instruksi yang diterima oleh telegraf dari operator. Kereta api Inggris juga menggunakan sistem blok "manual terkontrol," yang kemudian penggunaannya diadaptasi pada sistem perkeretaapian di AS oleh New York Central dan Hudson River Railroad pada tahun 1882.
Persinyalan blok otomatis ditemukan di Amerika, dan pertama kali digunakan oleh Eastern Railroad di Massachusetts pada tahun 1871. Meskipun demikian, biaya operasional sinyal, peralatan, dan pemasangan tergolong mahal pada saat itu, sehingga menyulitkan banyak jalur kereta api untuk menggunakannya kecuali pada jalur yang sangat ramai digunakan oleh kereta penumpang. Pada tahun 1906, Interstate Commerce Commission melaporkan bahwa dari 194.726,6 mil jalan kereta api di Amerika Serikat, ada 41.916,3 mil yang menggunakan sistem blok manual, dan hanya 6.826,9 mil yang menggunakan blok otomatis, baik pada jalur tunggal atau ganda.
Seiring berjalannya waktu, banyak penyedia jasa kereta api yang mulai melirik penggunaan pensinyalan blok otomatis karena keefektifannya. Sistem ABS dapat mengurangi kebutuhan karyawan untuk pengoperasian setiap sinyal secara manual, mengurangi biaya perbaikan dan kerusakan akibat tabrakan, memungkinkan lalu lintas kereta api yang lebih efisien, mengurangi jumlah jam idle kereta dan kru, serta mengurangi waktu transit keseluruhan dari titik ke titik.
Dasar operasi
Sebagian besar sistem ABS menggunakan susunan tiga atau empat blok, di mana halangan berupa kereta api atau benda lainnya di blok pertama akan memicu peringatan saat memasuki blok kedua, dan mengizinkan kereta api di blok ketiga untuk melaju dengan kecepatan normal. Ketika blok pendek atau kapasitas lintas yang lebih tinggi diperlukan, empat atau lebih blok digunakan; kereta kemudian diberi banyak peringatan tentang halangan yang akan datang. Untuk mengindikasikan status dasar suatu blok, digunakan sistem pensinyalan dengan aspek merah/kuning/hijau yang memiliki makna universal, dengan warna merah menunjukkan blok ditempati, kuning yang menunjukkan bahwa blok selanjutnya ditempati oleh kereta api, dan hijau yang mengindikasikan bahwa tidak ada halangan.
Cara paling umum pada sistem ABS adalah dengan mendeteksi kedudukan dari lintasan melalui penggunaan track circuit. Arus tegangan rendah dirambatkan melalui lintasan antara dua sinyal untuk kemudian dideteksi apakah rangkaian dalam kondisi tertutup, terbuka, atau mengalami korsleting. Roda dan gandar kereta api akan mengalirkan arus dari satu rel ke yang rel lain, sehingga memperpendek sirkuit (shunting). Apabila sistem ABS mendeteksi bahwa terjadi korsleting antara dua sinyal, sistem menginterpretasikan bahwa kereta api atau penghalang lainnya menempati blok itu dan akan "memberi" sinyal merah (menampilkan indikasi berhenti) di kedua sisi blok itu untuk mencegah kereta lain memasuki blok
Sistem elektronik ABS juga dapat mendeteksi kerusakan pada rel atau wesel (jika wesel dirangkai ke sirkuit) dengan cara menghasilkan sirkuit terbuka. Keadaan ini juga akan mengubah indikasi sinyal, mencegah kereta memasuki blok dan berjalan melalui lintasan atau wesel yang rusak.
ABS satu arah
ABS umumnya diterapkan pada jalur rel ganda ramai yang telah melebihi kapasitas jadwal dan tidak lagi dapat didukung oleh bentuk pensinyalan manual lainnya. ABS akan diatur sedemikian rupa untuk mengatur pergerakan kereta dalam satu arah untuk setiap trek jalur ganda. Pergerakan kereta api yang beroperasi melawan arus lalu lintas (berjalan di sepur kiri) masih membutuhkan pengaturan manual khusus untuk mencegah tabrakan. Oleh karena itu, di bawah operasi ABS, kereta yang bergerak ke arah yang salah adalah kejadian yang tidak biasa dan mungkin saja tidak didukung dengan baik oleh prasarana yang tersedia.
Selain kapasitas dan keamanan yang lebih baik dibandingkan dengan sistem blok manual, keuntungan lain dari sistem ABS satu arah adalah biaya pemasangan dan pengoperasian yang relatif murah, setiap titik pensinyalan hanya membutuhkan satu relai untuk sirkuit treknya sendiri dan satu relai tambahan untuk masing-masing blok dalam panjang kontrolnya. Fitur lain dari sistem ABS satu arah adalah penggunaan sistem untuk memfasilitasi kereta yang berjalan di sepur kiri/arah berjalan yang salah.
Lihat pula
Kontrol lalu lintas terpusat
Wilayah gelap (lintasan tanpa sistem persinyalan)
Persinyalan kereta api di Jepang
Lacak surat perintah
Referensi
Pranala luar
Kereta api
Persinyalan kereta api
| 6,234 |
operedelpadreca01cattgoog_49
|
Italian-PD
|
Open Culture
|
Public Domain
| 1,881 |
Opere del padre Carl'Ambrogio Cattaneo della Compagnia di Gesù
|
Cattaneo, Carlo Ambrogio, 1645-1705
|
Italian
|
Spoken
| 6,646 | 11,590 |
L'immagine apparente e vana, che il cane ingannato abobba dentro l'acqua, o la gloria vano, il plauso e l'aura popolare, che gli uomini pensano di stringere, quando danno ascolto e si compiacciono delle lodi. Gloria vano, torna a dire, gloria vano e lo dimostro con due ragioni portate dal dottor Angelico (2, 2, q. 132, art. 1). Vana (dice il santo) è la gloria ex parte ejus, a quo quis gloriatur, perché comunemente il giudizio non è certo. Primieramente la gloria, è vano per parte delle persone dalle quali ci viene data, cioè dagli uomini, i quali non hanno il giudizio accertato. Se un musico eccellente s'invasa per esser sentito da un cane che sta vicino al cembalo; se un dipintore s'insuperbisce delle sue pitture, perché sono viste dagli uccelli dell'aria, non sarebbe questo un invanirsi sciolto e un gonfiarsi di puro vento? Eppure gli uccelli si dilettano del colorito e volano a beccare le uve dipinte e qualche fiera ancora conosce le differenze del suono. Ma direte voi: né l'uno, né l'altro si intende del buono della pittura, né della musica, né dei passaggi, né delle proporzioni, né dell'armonia. Or fate conto, che nessuno uomo al mondo si intende del buono della virtù, perché tutto il buono della virtù sta nell'interno, non gli occhi del corpo hanno tanta autorità; non gli occhi della mente hanno tanta perspicacia per conoscere ciò che sta dentro. Troverete nelle storie tanti ipocriti riveriti per santi e tanti santi dispregiati, accusati, esaminati come ipocriti. Lo stesso Cristo, chi lo voleva l'idea della bontà, chi lo stimava il seduttore delle turbe: alti dicevano, quia bonus est, alii autem non, sed seductive turba. Or, questi non sono tutti segni evidenti, che il mondo non conosce la vera virtù? L'invanirsi d'esser giudicato bello al parere dei ciechi, non sarebbe sciocchezza da ridere? Ma quanto più vana e bugiarda è la gloria d'esser creduto virtuoso, da chi è affatto all'oscuro del tutto cieco nel conoscere la virtù. Aggiungete che gli uomini lodano e biasimano per lo più per pura passione. Chi ama, non finirà mai di lodare; chi vi odia, vede ogni cosa al rovescio e non finisce mai di biasimare. Un superbo sprezza il tutto, come piccolo minuto e da nulla; un invidioso ha sempre alcuna cosa da sindacare. Lo stesso uomo in vostra presenza vi gonfiere di lodi e vi darà cento incensate; dietro le spalle si riderà dei fatti vostri e biasimerà ciò che poco prima ha lodato. La stessa lode che si dà al meritevole, si butta dietro ancora a chi non la merita; e si troverà chi gridi: Euge, euge, ancor a chi tirerebbe dietro le fischiata. Le buone opere sono tesori, se teniamo ferma la mente di darle a Dio; ma se un poco di vanagloria, volontariamente ammessa, ci volta il cervello, saremo pagati con quattro smentite, con un po' di fiato e ben poco e bugiardo e vario e instabile. Eh', egli è. Saremo come cani di Fedro, che abboccano in falso e lasciano il vero. Ed ecco la prima ragione di san Tomaso, perché la gloria è vana: perchè viene da parte dell'umanità, cujus judicium non est certum. De tuo judicium meum prodeat, diceva il santo profeta Davidde. Oculi tui videant inquitatem. Quel poco bene che io vado facendo, lo veda Dio e tanto mi basta. San Paolo poi (1 ad Cor. 4); Qui judicat me, Dominus est. Per i giudizi degli uomini non farei un passo. Dio, Dio sia quello che veda le mie operazioni e loro dia quello che meritano. La seconda ragione, per la quale la gloria è vana, è parimente accennata dall'Angelico al luogo sopracitato: Gloria vana est ex parte rei, putla, cum quis gloriatua quarti de eo, quod non est. Talvolta qualcuno farà un'opera molto ordinaria e triviale e s'immaginerà di aver fatto un'opera eroica, e si penserà, che tutti lo lodino e lo innalzino al terzo cielo; eppure non vi sarà anima che vi pensi. Che maggiore vanità si può trovare di questa? Un oratore principiante aveva fatto un discorso pubblico assai dozzinale, nel quale era gli era venuto al taglio di dire più volte questa parola: eroicamente, e questa altra mirabilmente, e quest'altra sublimemente. Or un bel umore andò a congratularsi con esso lui in questa forma. Oh, che predicai oh, che discorsi! Avete detto eroicamente, mirabilmente, sublimemente. Ed era vero, che aveva dette queste parole; ma l'uomo dabbene stimava sua lode ciò che era detto equivocamente per burla. Se le lodi degli uomini sono più volte immaginate, e non vere; e le lodi vere che pur talvolta si danno, sono così poco sincere e così varie, così instabili, così appassionate, chi sarà mai così sciocco, che voglia operare per vanagloria, imitando i Farisei, quali riprese Cristo, per cui omnia opera sua faciunt, ut videantur ab hominibus, mettevano tutto il bene in piazza, comparivano macilenti in pubblico, davano buone limonade al tempio soltanto per essere visti dagli uomini? La Divina Scrittura fa un elogio stringatissimo ad Ozia, dicendo: Factus, quod rectum est, in specie Dei. Sul quale parole il Grisostomo (Hom. 3, De verbis Isaia) dice così: Chi corre alla giostra in un pubblico torneo, chi combatte in vera o finta battaglia, benché abbia tutto il popolo spettatore, non procura egli di fare i suoi colpi sotto gli occhi del principe che sta sulla loggia, verso il quale ha tutta la sua mira? Unum oculum digniorem, cui fidatis, dicono, quem tot hominum vultus. Basta loro l'occhio del principe, per cui da lui solo aspettano la corona e il premio: e non si curano tanto del popolo, da cui non hanno che un po' di ovazioni. Tenete sempre bene a mente questa bella sentenza cavata dalle meditazioni del santo padre Agostino: Qui ab hominibus laudatur, vituperante te, Domine, nec defendetur indicante te; nec liberabitur, te condemnante. Chi si fa lodare dagli uomini contro il piacere e il diritto dovuto a Dio, vada a farsi difendere dagli uomini, allorché Dio lo giudicherà, e vada a farsi liberare dagli uomini, quando Dio lo condannerà. LEZIONE LXXVII. Ut quid diligitis vanitatem et quid hilaritate mendacium? (Psalm. 4, 3). Dalla vanagloria, di cui abbiamo parlato nella lezione passata, spiegando il proverbio e l'apologo del cane di Esopo, dalla vanagloria, dico, nascono quattro figlie. Sieno poi figlie, come vuole san Gregorio, o sieno sorelle, come pare che accenni sant'Anselmo, non importa; tutte sono razza di ladri che rubano il merito delle buone operazioni. San Tomaso (2, 2, quaest. 12, art. 5) fa l'albero di questa famiglia diabolica. Chi s'intende di genealogia, ponga bene mente alla serie di questa mala generazione. Al ceppo della malnata famiglia sta la vanagloria, gonfia come un otre, e desiderosa di darsi a conoscere. Al primo ramo che esce fuori, sta la jattanza con la tromba alla mano che suona; e si vanta, e pubblica al mondo le sue grandezze. Dalla jattanza esce un altro ramo, che si addobbata finzione e ipocrisia. Si dà il caso (ed oh quante volte si dà!) che un soggetto sarà manchevole d'intelligenza, di sapere, di ricchezze, di nobiltà, di grazie e di virtù morali, e per appetito di gloria fa mostra di avere ciò che non ha, o molto più di quello che ha. Questa è simulazione, bugia, ipocrisia di fatti, tutti rami di quest'albero infelice. Altri rami, che escono immediatamente da queste ceppe, sono la durezza di testa, che si domanda pertinacia, e la durezza di cuore, che si chiama ostinazione, e quindi la discordia: perciò, recandosi a riputazione il vanaglorioso di non cedere agli altri nel parere e nel volere, si ostina talvolta fuori di ragione, e vuole perchè vuole; onde poi ne nascono liti, inimicizie, contese, tutti nipoti e pronipoti della vanagloria. Vedete, che bosco di vizi fa mai questa pianta! Prendiamone un ramo per volta, per provare, se non a sterparlo, almeno a sbiancarlo, e cominciamo dalla jattanza. La lattanza è propria di certi vantatori e millantatori di gran bocca, che dicono tutto ciò che ridonda a loro onore. Essi soli sono quei che fanno, essi quelli che hanno fatto; se non era il loro consiglio, non riusciva mai quell'opera. Finché essi non mettono mano in pasta, non si farà mai nulla. Quando essi governavano, camminavano le cose d'altra forma, e vi canteranno cento volte la stessa filastro di cose tutte loro, e Dio solo saprà dire quando finiscono. Narra Plutarco, che un di questi vantatori capitò a parlare ad Aristotile. Stava il filosofo colla testa china, udendo pazientemente tutto intero lo sparlone di quel millantatore che non la finiva mai. Poi pure una volta, quando a Dio piacque, e finì con queste parole: "Costesti, di che ti parlo, non sono essi miracoli?". Rispose Aristotile (Apud Plutarchum De garrulitate): "Il maggior miracolo è l'avere io potuto sofferirti finora, e rivolgendogli in dire così un paio di belle spalle, si portò via l'orecchio in salvo, chiudendole con ambe le mani acciò che le parole boriose di colpo non gli corressero dietro: e come un grande otre pieno di vento, passato da una leggiera punta d'aglio, comincia subito a gonfiare; così quel vanaglorioso, punto da una risposta si acuta, depose la gonfiezza e imparò a non vantarsi più. Ma certi vantati troppo insolenti, o non trovano fede, o sono ricevuti colle risa, o sono portati sulle scene per argomento da ridere. Pur, come nelle botteghe ognuno procura di mettere in mostra la sua mercanzia, acciòché si trovi compratore: così, oh! quanti sono quei che portano sul mercato comune quel poco o quel tanto di bene che hanno, o si pensano di avere, per farne pompa e per venderlo al vile mercato di quattro soldi, col la sopraggiunta della pena, di cui si caricano a pagare nell'altra vita! San Paolo (1 Cor., 12, 4) se gli fa incontro, e strozzando loro i vantati in gola, gli interroga: Quid habes, quod non accepisti? Tutti i beni, siano di natura, come ingegno, salute, bellezza e nobiltà; siano di fortuna, come ricchezze, possessioni, amicizie, dignità, sono forse tuoi? Mostrami di tanti danari un soldo; di tanti possessi un sol palmo di terra che non ti sia stato imprestato da Dio, non già per godere, ma per uso breve e temporale. E se il tutto è dato in prestanza: quid gloriarSI quasi non accepRI? Perché farti bello di quel di Dio, come se fosse tuo? Perché vantartene come se il primo padrone non fosse Dio, come se egli non potesse torlo o smetterlo a suo piacere? È celebre presso i Greci quel proverbio: Asinus portat mysteria. Un povero somarello, caricato sul dorso dei misteri di Cerere, attraversava una folla divota e riverente, al vederli si buttava ginocchione lungo la strada, segnandosi col indice stesso, e battendosi il petto con gentile devozione. A tante dimostrazioni di stima, il somarello cominciò a tenersi alcune cosa di più: alzata la testa, distese, aguzzate le orecchie, misurati a battuta di cavallerizza i passi maestosi, fermavasi di tanto in tanto a guisa di chi fa complimenti, volgendosi ora verso l'una, ora verso l'altra parte del popolo, che al suo animalesco giudizio lo onorava. Una misura di bastone, che gli suonò sulla groppa, lo fece riprendere il suo trotto, abbassare l'orecchio e ricordare di quel povero giumento ch'egli era. Una percossa, una disgrazia che Dio mandi, e senza altra disgrazia, la morte che a tutti certamente deve avvenire, ci farà certamente conoscere, che di questo mondo niente affatto è nostro, affatto affatto niente, tolto le buone e male operazioni, che sole porteremo con noi. Or se nihil habes, quod non accepisti; cur gloriarSI, quasi non acceperis? Chi si glorierebbe mai di portare al seno un gioiello imprestato, qual è sapiente che deve presto deporre? Vos qui sapiens estis in oculis vestris. Disperdite Dominus malum magniloquum. Ma via, voglio sostenere che il tutto sia vostro: vostre le ricchezze, vostro l'ingegno, vostra la sanità del corpo, vostra la bellezza del volto. E per cosa? Vi pare questa cosa da gloriarsene e vantarsi? Diamo un'occhiata a quest'ultima. Il vanto maggiore che si danno le donne, è della bellezza. La bellezza dicono essere il fiore della bontà che si godono dall'occhio, dicono essere essa un raggio del volto divino, che riflette nelle creature, un pregio raro, una dote signorile che domina i cuori degli uomini. Certamente, che nelle donne anche sante, la Divina Scrittura con frase panificata fa menzione della loro bellezza. Nella Genesi (cap. 29) Rachele si dice: Decora et fadel, et venusto aspectu; Ester, pulchra valde, et incredibili pulchritudine gratiosa omnium oculis. Di Giuditta ci fa leggere: Non erat talis mulier super terram in aspetto et pulchritudine. Se vogliamo poi dalle divine passer alle umane autorità, Tertulliano affermò, che la bellezza del corpo era un velo sottilissimo e trasparente, per cui traluceva la bellezza dell'anima. Corre anche quasi per proverbio, che un aspetto avvenente è una lettera di raccomandazione fatta dalla natura, intesa solo dagli occhi e ricevuta in tutte le parti del mondo. Così la discussione sulle donne, così anche i giovani vanitosi idolatri della loro bellezza. Ormai io a questi vanti (oltre la risposta data di sopra in generale, che tutti i beni dati da Dio sono motivo di ringraziamento e non di vanto) rispondo e vi chiudo la bocca con un detto dello Spirito Santo: Parlate grattamente imparatelo a memoria, parlate grattamente et vana est pulchritudo. Così è, signori miei. Fra tutte le cose di quaggiù, che portano il nome di bene, non v'ha il più vano, il più manchevole della bellezza: Forma bonum fragile est; quantunque accedit ad annos, fuit minor et spatio carpitur Ula sua, canto il poeta. Aggiungo, che la bellezza più facile a perdersi è quella appunto ch'è più studiata e fatturata con artifizio. Imperocché, come il lino più volte lavato, strofinato e sbattuto si logora, e perfino il ferro col troppo lustrarsi e arrotarsi si consuma; così, e molto più di così, la carne e il volto umano con tanti lisci e conci più si assottiglia e si fa delicato, e ciò che è più delicato, è più vicino a putrefarsi. Vi che se volete vedere con i vostri occhi, trasferitevi al letto della principessa Domenica della Selva, sposa di un doge di Venezia, ricordata dal cardinale S. Pietro Damiano, accennatavi di passaggio in un'altra lezione (lib. 7, Epilogo). Stola 19), Vedete questo cadavere vivente, che va a poco a poco morendo e marcendo addosso ad un'anima martire della bellezza? Questa è quella principessa adoratrice di sé, e da tutti vanamente adorata, come la fenice delle dame, e come sole tra le stelle minori. Vedete quel volto tutto incrostato, e quelle mani e quelle braccia mangiate dall'umore maligno? Quelle sì, quelle furono lavate solo con rugiade del cielo raccolte con diligenza, da' servitori e tormentate da lambicchi, che a questo volto mai si accostò acqua comune. Vedete quel fornicare e bollire di vermi per tutto il corpo; questi sono o pena, o naturale scioglimento di una carne impastata di delizie e profumata di unguenti. Ma che vuol dire, che la vedo abbandonata? Che solitudine dentro alla stanza, che silenzio nelle anticamere, che vedovanza in tutto l'appartamento! Non compare un'anima né a visitarla, né a consolarla. La puzza, anzi la peste, che esce da quel corpo sì morbido, ha cacciati tutti di casa. Una sola ancella, premunita di buon aceto, più per carità che per stipendio, la serve in questo solo di portarle un po' di cibo. In veder questo finimento di bellezza femminile, non vi vengono sulle labbra le parole proferite da lei sopra la fine di Jezabel, donna ancora essa piena di vanità? Ecceine est Ma Jezabel? Quest'avanzo di non saprei dirlo, che, questo avanzo è Jezabel. Ahi che vana, e poi vana, e più di tre volte vana è pulchritudo. Vana, perchè brevissima, perchè manchevole, perchè soggetta a mille accidenti; infine vana, perchè gli stessi mezzi che si adopera per conservarla, la consumano. È una cosa si vana, parvi ella oggetto de' vostri vani? Aggiungete ora alla vanità della bellezza la compagnia dei grandi mali che ella porta con sé. Fastus inest pulchritudis, sequiturque superbia formam. Prima, grande bellezza e grande superbia vanno d'ordinario unite insieme; anzi nella più bella creatura che vide il cielo (e fu Lucifero) subitamente si annidò la più alta superbia, che lo fece in un subito carbone d'inferno. Secondo, bellezza ed onestà (non dico in tutti, né in tutte) ma in molti e molte pare che non si accordino: Licet est cum forma pudicitia. E perchè in questa materia non solo la fiamma dei peccati consumati abbrucia, ma anche il fumo tinge, quante occhiate, pensieri, affetti, inviti, corrispondenze e desideri si fomentano dalla bellezza? Terzo, i mali di conseguenza che da essi provengono, oh quanto sono! Gelosie, rivalità, mezze idolatrie, odii ereditarii, spargimenti di sangue, svecchiamenti di famiglie, rovine di città e di stati. Certamente, se leggiamo le storie profane, citate anche da sant'Agostino, quante guerre, quante strategie, distruzioni di città intere recò al mondo la bellezza di Elena e di Cleopatra? E senza andare tanto lontano, la bellezza troppo amata di Anna Bolena, quante rivoluzioni ha partorito nell'Inghilterra con perdimento di tante anime e spargimento di tanto sangue, e tragedie luttuosissime che faranno piangere tutti i secoli futuro? Onde si vede, che questa dote è un bene con una grande giunta, da tenersi con timore e non da invanirsi per superbia; molto meno da farne pompa con mille artifizi di gale e di concinni per comparire. Ma se è bella, vi è bellezza, in cui possiamo, per usarla la frase di s. Paolo, in cui possiamo gloriarci in Domino, è la bellezza dell'anima. Questa, quando è in grazia, è figlia di Dio, così similiante al padre, che non ha nell'intero creato immagine più bella e più espressiva. Le creature tutte la mirano come regina, gli angeli come sorella, Iddio come sua figlia, come sua sposa e come sua stanza. Questa "bellezza" poi non è come quella del corpo, soggetta a malattie, no a macchie, che contro la nostra volontà possano offenderla: e se pure per colpa nostra alcuna macchia la imbratta, Cristo, geloso amante, le ha del suo stesso sangue preparato un bagno per lavarla e restituirla al primo colore. Inoltre, questa bellezza non è soggetta a vecchiaia; anzi, col crescere degli anni, avanzando ancora di meritarsi si fa più bella: Nemmeno teme la morte, ché è quella nera tinta, quella notte opaca, che smorra ogni bel colore alle cose. Imperocché, come tolto il velo alla pittura, ella scuopre tutto il bello che ha; così la morte all'anima giuste non può far altro, che toglier loro il velo del corpo e presentarle cittadine alla patria della bellezza. Ora di questa soprabbelletta bellezza dell'anima, chi è mai che vive geloso? chi è che tema imbrattarla? Gli Assiri, soldati di Oloferne, veduta la bellezza di Giuditta congiunta con una leggiadria di tratto, tutto singolare, con una verecondia di sguardo modestissimo, con una grazia di favellare manierosissima, dicevano: quis contemptum populum Hebraeorum, qui tam decens mulieres habet? Chi sprezzerà una nazione, in cui fioriscono tali bellezze? Così dico io: quis contempnerà di aiutare in ciò che può, le anime altrui, che sono così belle? Quis contempnerà la cura dell'anima propria, ché è uno spirito così bello? quis contempnerà le virtù e gli abiti virtuosi, che sono le gale e le mode dell'anima? Se nel male prossimo di commettere qualunque sia peccato mortale, potesse farvi vedere la vostra anima bella con un'aria di paradiso in volto, con due pupille vivissime di santa fede in fronte, colla stola dell'immortalità in dosso, e dicesse: Vuoi tu sfregiare questo mio bel volto? Vuoi tu strapparmi dal seno questi gioielli? dissipare la dote e denigrare questo mio candore? Misere anima tua. Or, che sei in grazia di Dio, abbi misericordia: caccia quel pensiero, abbassi quello sguardo. Se così parlasse con darsi a vedere l'anima nostra, certamente colla sua bellezza e col suo pianto darebbe vinta la causa. Dunque: nolite contemnere animas vestras, che sono così belle e più belle del corpo. LEZIONE LXXIX. Ut guidat dilegitis vanitatem et quattros mendacium? (Psal. 4). Seneca, grande maestro del buon costume, nell'Epistola ottantesima ottava, che scrive al suo confidente Lucilio, descrive con istoiche, ma spieganti formole di dire, la sua carrozza: Vehiculum; in quo depositus sum, rustico est; la mia carrozza, entro la quale vado attorno, o da povero, ma da povero gentiluomo, rozza, polverosa e venerabile per antichità. Mula revera se ambulando testantur. Le male che tirano la carrozza, sono morte in piedi per la vecchiaia e non hanno altro segno di vita, che il muoversi lertamente, ansante e stentato che fanno. Mulio discalceatus, nun propter istatus, ma perchè io non ho possibilità da mantenergli le scarpe in piedi. Quoties in aliquem lautiorem amicam incidimus, invitus erubesco. Confesso il vero e lo dico in confidenza a te, mio Lucilio: ogni volta che mi incontro in altre carrozze belle, indorate, pompose, colla vanguardia di staffieri avanti e la retroguardia di seconde carrozze: invitus erubesco; con tutta la filosofia sprezzatrice delle pompe mondane che io professo; mi corre il rossore al volto. Mi sfodo, quanto posso, di reprimere quella vera condizione della mia povertà, ma stento assai. Questo è segno manifesto (lo vedo e lo confesso) questo è segno manifesto che domina in me la vanagloria; perchè: qui sordido vehiculum erubescite pretioso gloriabitur; se mi vergogno di andare in povera carrozza, mi glorierei di un cocchio dorato, se l'avessi, e di una grande comitiva di famiglia, se avessi modo di mantenerla. Fine, quale morale è forse con vanità stoica e con ipocrisia, che analiticamente non era quel povero che qui si finge. Segue poi a parlare del lusso di Roma e del vantarsi che facevano quei capi del mondo per la potenza, per le ricchezze, per la nobiltà, tutti oggetti dell'umana superbia, dei quali quanto vano sia il vantarsene, andrò oggi spiegando, proseguendo l'incominciato argomento della vanagloria e della jattanza, comprese nel proverbio da me citato. E prima di tutto il vantarsi della potenza, sia in ordine a far bene, come in ordine a far danno al prossimo, è grande vanità. Ne sentirete tanti, che per vana ostentazione di bravura, vanamente dicendo: ti farò misurare le spalle; ti farò raccogliere i denti per terra: posso spazzare colui fino dalla radice; posso svergognare quest'altro con esporre i suoi panni al sole, e mordere il dito minacciando: non andrai a Roma a pentirtene. Tutte queste parole, oltre all'essere atti di odio che offendono la carità, la quale ci obbliga ad amare il prossimo, sono vanissimo, superbissime e vili jattanze. Niccolò, sommo pontefice, rispondendo ad una lettera scrittagli da Michelangelo imperatore, piena di superbe jattanze, gli cita in risposta sant'Agostino (Sermone 6, De verb. Dom., cap. 10) e dice: O Imperatore, o Cesare e ti vanti di poter fare del male? Un lupo, una tigre, una serpente, anzi un vilissimo e schifosissimo scorpione, un ragno, un fungo, anche essi possono fare del gran male. Potere distruggere non è potenza e se pure è potenza, è potenza di bestia irragionevole: Ferina potentia est, qua valet ad nocendum, disse anche Seneca in più luoghi. Il potere fare del bene, neppure ciò è argomento di vanità. Noi, come noi, possiamo fare cosa buona? Se il pennello del famoso pittore Michelangelo si vantasse così: "io posso fare una pittura che sia il miracolo dell'arte, che duri cento anni, che sia comprata a peso d'oro e conservata in reali gallerie": — se la penna da scrivere, che adoperò il nostro re Carlo II, si vantasse così: "io posso creare senatori nello stato di Milano, spedire dispacci di presidenze, di generalati, di governi di stati e di Province: io, tal qual mi vedete, posso farmi ubbidire fin dove nasce e tramonta il sole: una parola che io scrivo su un foglio, porterà l'allegrezza in tante famiglie, sarà mercede a tanti vassalli, conferirà cariche, accrescerà magistrati; a tali vani voi le direste: olà, vi, piuma di un balordissimo uccello, sei tu forse la causa principale di tanto bene? Un povero strumento qual sei tu, che tanto si muove, quanto è mosso da regia mano, che di tua virtù, nemmeno puoi trarre una stilla di inchiostro e segnare un punto, ti fate bello di quelle opere che non sono tue? Tanto le direste ed anche di più, rinfacciandole l'essere figlia di un papere sciocchissimo che andrà a finire in un mucchio di carta. Applica questa dottrina a chi si vanta di poter dire, di poter fare. Nell'ordine della natura tutto il nostro potere è così dipendente da Dio, che neppure possiamo muovere un poco, alzare la mano, aprire l'occhio, articolarsi una sillaba senza immediato e presente concorso di Dio; e questa è sentenza comune a tutta la filosofia, fondata sul supremo dominio che Dio ha sopra tutte le creature. Nell'ordine poi soprannaturale, il nostro intelletto, tanto al conoscere, quanto al credere, la nostra volontà ad amare, sperare, temere, volere qual sia cosa: proverò oportet, tale mente dipende dalla divina grazia, che disse s. Paolo (ed è di fede) non poter neppure dire Gesù, come conviene, senza speciale assistenza dello Spirito Santo: e Cristo disse in s. Giovanni al capo decimoquinto: sine me nihil potest facere; nihil affatto; e chi dice niente, esclude il poco e il molto: nihil nihil potest facere. Userò una similitudine spiegantisima cavata dal libro intitolato Specchio che non inganna. Immaginatevi un bambino di pochi mesi, che se cade, non può rialzarsi, se è rialzato non può sostenersi, se è assaltato non può difendersi e nemmeno può conoscere e palesare se ha alcun male. Inoltre, da sé non può provvedersi di cosa alcuna, né coprirsi, se ha freddo, né vestirsi, se è ignudo, né cavarle un bicchier d'acqua, se ha sete; in tutto e per tutto ha bisogno della madre. Ebbene, o signori, simili ad un tale bambino, siamo noi, deboli, infermi, ciechi, senza uso di ragione, senza forza nella volontà, se Dio a ogni minima azione non applica il suo braccio, come si fa coi principianti nello scrivere, pigliando la nostra mano e operando insieme con noi; e un punto solo, solo un punto, che sottragga la sua assistenza, siamo subito tutti ridotti in niente. Secondo queste verità chiare e chiarissime non solo al lume della fede, ma anche al lume della ragione, può un uomo, una creatura vantarsi di poter fare, di poter dire? Qui di passaggio caviamo una pratica conseguenza. Come mai possibile, che dipendendo noi in tutto da Dio e dandoci Egli in ogni momento la vita, ardiamo di voltarci contro di Lui ad offenderlo, non solo con la jattanza, ma con tanti altri peccati? Chi ci tenesse sospesi da quell'alta cupola per un braccio in modo tale, che al solo aprire la mano potesse lasciarci andare giù, credete voi che in quello stato ci darebbe l'animo di fare un minimo dispetto a ehi cortesemente ci sostenterebbe? Vediamoli gli ossequi che gli uomini fanno ai ministri e ai magistrati, dai quali dipendono nella decisione di una lite, nella spedizione di una causa, nella promozione ad una carica. E noi, che dipendiamo da Dio in tutto del benessere e in ogni minima operazione e nella felicità nostra, come ardirà di inimicarsi e olè nostra malvagità? Tornando ora al nostro argomento, un altro grande incentivo della vanità jattanza sono la nobiltà, le ricchezze, le aderenze e le dignità. Quanto sia vano e ingiurioso a Dio questa jattanza, spiegherò con un racconto della Sacra Scrittura. Rinnovate l'attenzione. Erano venticinque anni in circa, che Nabucco regnava in Babilonia in seno a tutte le grandezze maggiori, che possano concorrere in un monarca. In Geremia si dice, che tutto il mondo scoperto era soggetto a Babilonia: e si cava dalle Scritture, che tutto il bello e il buono del mondo faceva un solo regno; e questo suddito a Nabucco. Ogni dormendo queste regine, una notte, fece un sogno stravagante: Ece, orbore in medio terrae. Si levò dal piano della terra un bel fasto di pianta e andò crescendo crescendo e stendendo i suoi rami fino a coprire tutto il mondo e la cima fino a toccare il cielo, magna arbor et fórtns, proceritas ejus contingens cœlus. E non era già quest'uno albero sterile: Folta sum pulcherrima et fructus ejus nimius, et esca universorum in ea. Foglie di bellissimo verde e frutta in tanta abbondanza, che poteva servire da pascolo a tutto il mondo: Suetur eam ammali, et bestia; inramis ejus conversabantur volucres. Tra le foglie tutti gli uccelli avevano nido; sotto l'ombra tutte le fiere avevano coperto e vi era da mangiare per tutti a spese di questo solo albero. Sentite come parla Nabucco stesso: Io, re Nabucco, mi stavo dormendo e godendo in sogno della vista e dell'ombra di così bel corpo di pianta; quando ecco, una voce dal cielo gridò forte: Succidi l'arbore, taglia, taglia; sfrondali quei rami, tempesta sopra quei frutti: escuCalati foglia eius, disperditi fructus eius. Fuori da quei nidi gli uccelli, fuori da quelle aperture le fiere. A quella voce così forte, io mi svegliai tutto stordito e mi parve sentirla ancora all'orecchio, ora che sono desto. Questo è il sogno: e l'ho avuto io: somnium vidi: ego Nabucodonosor. Voi dunque, o Daniele, festina l'interpretazione sua e narra: di grazia, presto, Daniele, levatemi questa spina dal cuore e spiegatemi questa cifra. Daniele, udita la serie del sogno, stette così in due piedi lungamente pensoso: Cespì, intra semetipsum tacitus cogitare. E non è mica che in quel tempo studiasse il significato del sogno, che subito lo intese, ma andava pensando qualche maniera di condir la mala nuova che doveva dare al re. Stimolato dunque a dire, diede prima un profondo sospiro e poi soggiunse: sire, faccia Dio che il significato del sogno cada sopra i tuoi nemici: somnium his, qui te odorrunt et interpretatio eius hostibus tuis sit. Per altro, a dirlo giusto, l'albero ben fermo nella radice, alto per la dignità, dovizioso per frutti e riguardevole a tutto il mondo siete voi, mio signore. E Dio volesse che vostra maestà, arricchita da Dio di tanti beni, li abbia riconosciuti da lui. Ma che? Sollevato dalla fortuna e più dalla vanagloria, avendo occupato tutto il pensiero nell'opinione della maestà vostra (vedete, come parlavano chiaro i profeti), Dio non conosciuto da voi, si farà conoscer con la spada alla mano; e questa spada taglierà non solo i rami maestri con tutti i frutti e le foglie, ma troncherà il ceppo fin presso la radice, togliendo a vostra maestà quanto ha in questo mondo, per fin al giudizio da uomo, finché conosca che Dio è il padrone: donec scias quod dominetur Excelsus. È possibile che a me, a me si minacci tanta rovina? - A me? - Mio riverito monarca, mi piange il cuore a dirlo: hcec est interpretatio sententiae Altissimi super Dominum meum regem. - E non vi sarebbe rimedio per riparare a questo colpo? - Altro Daniel, queste sono le cose da pregare il vostro Dio: caro voi, fatelo. - Sire, il riparo che forse potrà servire a declinare, o almeno a mitigare tanto pesante castigo, è umiliarvi e far limosina ai poveri: peccata tua eleemosynis redime. Chi sa? Chi sa? forse ignoras delictis tuis. Scrive s. Girolamo sopra questo fatto che Nabucco si umiliò e fece larga limosina; e Dio de facto sospendeva il castigo. Ma che? postquam flemines duodecim ambulabat subtex in aula Babylonis. Passato già un anno, passeggiava il re nella gran sala di corte; e fattosi alla finestra a vedere la grande Babilonia, tornò ad ingannarsi peggio che mai; e passò oltre a vantarsi con parole boriose e compiacenza da Lucifero: Hcec est Babylon, quam ego (edificavi in robore fortitudinis memorer et in gloria decoris mei. Eccola bell'opera delle mie mani. Ecco quella reggia, quella città, che... In quel punto, del vantarsi delle sue opere, Nabucco impazzì; gli entrò nella fantasia di esser un bue; pose le mani per terra e cominciò a camminare carpone giù per le scale; corsero i cortigiani e le guardie a sollevarlo; egli investiva tutti col testo, come un toro e con una forza tutta propria dei frenetici; e perciò il suono della lingua, come dice Aristotele, segue e si conferma all'immaginativa; immaginandosi egli di essere bue, in vece di articolarsi le parole, mugghiava appunto come un bue; e così (come conclude il s. Girolamo) "bonum misericordia perdidit malo superbia"; quel poco di misericordia, che Dio gli continuava dopo tanti demeriti, demeritò di bel nuovo con quella vanità di jattanza. Sette anni durò Nabucco impazzito, dopo i quali, dice il Sarego Testo, che tornato in senso, alzò gli occhi al cielo e conobbe. Che cosa conobbe? Conobbe, che omnes habitatores terrae quasi nihilum reputant, che tutti gli uomini del mondo messi insieme, sono davanti a Dio un niente: niente nell'essere, niente nel durare, niente nell'operare. Questo pensiero teneva basso, in mezzo alle grandezze, il re Davidde, onde diceva: Substantia mea tamquam nihilum ante te. Ma, per chiudere la lezione con qualcosa di pratico, che serva a sgombrarci il capo da ogni fumo di vanagloria e di boriosa jattanza, udite. Primieramente, quanto all'intelletto, abbiate questa pratica stima di essere un niente davanti a Dio, niente nell'essere e niente dell'operare; onde, prima di ogni operazione, chiedete umilmente il soccorso da Dio; e quando vi piazza di aver operato bene, stimate quell'azione una limosina che Dio vi abbia fatto e ringraziate; e quel ringraziamento sarà una specie di ricognizione del vostro nulla e dell'aver tutto il bene da Dio. Chi è ammesso per ospite in casa altrui, o veste un abito imprestato, benché la casa sia magnifica e l'abito pomposo, non si vanagloria, anzi conosce la sua povertà, che ha bisogno di casa e di vesti imprestate. Così, chi reputa aver il tutto da Dio, non si stima, come adorno, ma si umilia, come bisognoso. Secondo: allorché si parla bene di voi, immaginatevi che non si parla bene di voi, ma di Dio. Così, quando si dice una penna erudita, uno scalpello ingegnoso, si sa che la lode va tutta quanta essa è, non alla penna, no allo scalpello, ma alla causa principale movente; e niuna lode si ferma in quel povero strumento. Così, quando si dice: oh la bella predicazione, oh la bella opera, siate pur certo, che voi siete un puro strumento e tutta la lode deve indirizzarsi a Dio. Terzo: nelle stesse colpe e difetti, l'impazientarsi, il mezzo disperarsi, ha un buon quarto di vanagloria: che un cieco ad ogni passo non urti, non cada, ne ha la grazia alla sua guida. Così dice sant'Agostino: Gratia Deo, quodcumque non feci malum. Ogni peccato che io commetto, è indirizzo di mal debolezza e argomento di umiliazione; ogni peccato che non commetto, è beneficio dell'assistenza divina e motivo di ringraziamento. Chi patisce di mal caduco, è a favore che non cada; nel morale ogni uomo patisce di mal caduco. Queste verità ben masticate terranno giù tutti i fumi della vanagloria. Noverim te, noverim me, ut amet te, et contemnam me. Questa era la meditazione quotidiana di Agostino. Santo Dio, mio Dio, qual sei tu e qual sono io? qual sei tu degno d'essere amato sopra ogni cosa? qual sono io, meritevole di star sotto tutte le creature, come un nulla, e meno ancora del nulla per i miei peccati? LEZIONE LXXX. Funiculus triplex difficile rumpitur. Oggi, giorno avanti la natività di Maria, voglio che consacriamo questa lezione alla Sovrana imperatrice del cielo, con l'insegnare, qual esser debba la devozione verso questa gran Signora, di modo che sia funiculus triplex, che non sia agevole a rompersi; onde possiamo affidare ad essa la salute delle nostre anime. Il culto di Maria Vergine con qualcosa d'ogni giorno, col portare l'abito, o recitare il rosario, o digiunare il sabato, o celebrare qualche novena ad onore di lei, è un filo da tenersi nel labirinto di questa misera vita; è un qualche attacco per sperare bene della nostra fede; ma è attacco debole, se si prende da per sé. Se poi questi ossequi giungono ad essere vera devozione, dando gusto a Maria in quello che più le piace, che è di unire la servitù della Madre colla servitù del Figlio, il piede si raddoppia e l'accesso si rende più difficile. L'angelico dottor s. Tomaso cerca di definire scientificamente cosa sia devozione. Devotio, dice, deriva da devendo, da cui devoti chiamati, quelli che se stessi quindivisibilmente al Beato devono, così da sé totalmente al servizio di lui. La devozione vuole dire quasi dedica di un animo che si sottoscrive totalmente al volere altrui; così presso i Gentili, quelli che si dedicavano al servizio dei templi e degli idoli, si chiamavano devoti. Così presso Tito Livio, devoti si chiamano i Decii che dedicarono la roba, la casa, il sangue e la vita in servizio della patria. Da questo discorso deduce poi l'Angelico al luogo citato, che la devozione altro non è, che una pronta volontà di servire quella persona di cui siamo devoti: e se manca questa pronta volontà, manca ancor la vera devozione: Devotio est voluntas quamdam prompte tradendae se ad ea, quae spectant ad Dei famulatum. Mi spiego con un paragone intelligibile a tutti. Un soldo che voi doniate ad un povero, voi lo chiamate carità e limosina. Interrogate il teologo, se quella moneta materiale possa chiamarsi limosina o carità; e vi risponderà, che l'atto di carità tutto va nell'interno dell'animo, e che quella moneta, per sola denominazione affatto estrinseca, riceve quel nome; anzi, se destine a' poveri un milione d'oro senza quest'atto interno di volontà, che ha per oggetto la sovvenzione del povero per amore di Dio, non fareste mai carità, né limosina che possa dirsi vera. Sebbene non corra la similitudine in tutto, serve però questo paragone a spiegare il mio intento. I digiuni del sabato, l'astinenza del mercoledì, l'ufficio di Maria recitato, sono tutte opere esterne alle vere devozioni; e possono bensì chiamarsi una sorta di culto e di religione verso la gran madre di Dio; ma devozione vera non saranno mai, se non giungono ad unirsi con questa che io dicevo, pronta volontà di dar gusto a Maria, di non farle mai veruno dispiacere. E il dispiacere di Maria Vergine, quale pensate che sia? È il dispiacere del peccato. Con questo ella ha tale antipatia, tale opposizione, che (dirò cosa grande, ma vera) se la maternità di Dio avesse avuto per appoggio il contrarre qualche macchia di colpa, avrebbe eletto piuttosto non esser madre che madre macchiata. No solo Maria esclude ogni peccato da sé, ma lo odia, lo abomina al maggior segno ancora negli altri fuori di sé. Tutti i santi, che hanno avuto conoscimento di Dio, a proporzione del conoscere e dell'amare che facevano, mossero guerra dichiarata a tutte le offese di Dio. Il mio Ignazio, se avesse avuto un piede e mezzo in paradiso, sarebbe, come ei diceva, ritornato addietro, con incertezza di rientrare, per salvare un'anima dal peccato. Tanti stenti, fatiche, contraddizioni e persecuzioni, che divorò per fondare la nostra Compagnia, le chiamava tutte bene spese per impedire una sola offesa di Dio. S. Filippo Neri, s. Francesco di Sales, il Saverio, Paolo apostolo e tutte le altre anime innamorate di Dio, non perdonarono a sterminati viaggi, ad eroiche imprese, a cimenti pericolosissimi, a robba, a vita, ad onore, per impedire peccati, per tagliare la strada ai vizi. Perché? Perché amavano Dio; e vedere offeso da altri il loro bene, non era boccone da digerirsi dallo stomaco loro. Or, se Maria conosce e ama Dio più di tutti gli altri santi insieme, che guerra non volete che faccia al peccato? Servate mite puerum meum Absalon, diceva Davide ai soldati che uscivano in battaglia contro quel figlio per altro ribelle e riottoso. Per amore di Dio, vedete, al mio sangue, al mio figlio, ad Assalonne si perdona: e sebbene non lo meriti, perchè è disubbidiente, lo merita, perchè è figlio. Le stesse parole in soggetto molto diverso dice Maria ad un perduto di quelli che sono divoti a lei.
| 4,139 |
https://github.com/HuttonICS/germinate-builder/blob/master/src/jhi/germinatebuilder/server/manager/AbstractManager.java
|
Github Open Source
|
Open Source
|
Apache-2.0
| null |
germinate-builder
|
HuttonICS
|
Java
|
Code
| 351 | 690 |
/*
* Copyright 2017 Sebastian Raubach from the Information
* and Computational Sciences Group at JHI Dundee
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
* You may obtain a copy of the License at
*
* http://www.apache.org/licenses/LICENSE-2.0
*
* Unless required by applicable law or agreed to in writing, software
* distributed under the License is distributed on an "AS IS" BASIS,
* WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
* See the License for the specific language governing permissions and
* limitations under the License.
*/
package jhi.germinatebuilder.server.manager;
import java.util.stream.*;
import jhi.database.server.*;
import jhi.database.server.parser.*;
import jhi.database.shared.exception.*;
import jhi.database.shared.util.*;
/**
* @author Sebastian Raubach
*/
public abstract class AbstractManager<T extends DatabaseObject>
{
public static final String COUNT = "count";
/**
* Generates a SQL placeholder String of the form: "?,?,?,?" for the given size.
*
* @param size The number of placeholders to generate
* @return The generated String
*/
public static String generateSqlPlaceholderString(int size)
{
if (size < 1)
return "";
return IntStream.range(0, size)
.mapToObj(value -> "?")
.collect(Collectors.joining(","));
}
/**
* Returns the {@link DatabaseObjectParser} that can be used to parse the {@link DatabaseObject} from the {@link DatabaseResult}.
*
* @return The {@link DatabaseObjectParser} that can be used to parse the {@link DatabaseObject} from the {@link DatabaseResult}.
*/
protected abstract DatabaseObjectParser<T> getParser();
/**
* Extracts and returns the {@link DatabaseObject} from the {@link DatabaseResult} without running additional queries. This means that all the
* information for the {@link DatabaseObject}s that are fields of this item needs to be contained in the {@link DatabaseResult} as well.
*
* @param res The {@link DatabaseResult} containing the data
* @return The {@link DatabaseObject} from the {@link DatabaseResult} without running additional queries. This means that all the information for
* the {@link DatabaseObject}s that are fields of this item needs to be contained in the {@link DatabaseResult} as well.
* @throws DatabaseException Thrown if the interaction with the database fails
*/
public T getFromResult(DatabaseResult res) throws DatabaseException
{
return getParser().parse(res, true);
}
}
| 22,941 |
sn84022795_1877-05-12_1_1_1
|
US-PD-Newspapers
|
Open Culture
|
Public Domain
| null |
None
|
None
|
English
|
Spoken
| 3,509 | 5,677 |
@512: fimmu gm: VOLUME 11. LATEST BY TELEGRAPH. EASTERN STATES. ST. CLAIR. Pm. May il.-.-\ terrible ox~ plmitm ut‘ gin nu-urml in the Wilden- Ville. mines, near St. Cluir. ”lii nmruimt. killing und wnunding nine men and im— prisnning five others. The five: men are lu-hiud two hundred (nus oft-(ml dim Itim‘t‘tl by the explosinn, and a [urge uumlier nl mint-rs uru rem-wing it. NEW Ymm, Muy 10.—-The ll’urld nuys 'l'u'eml in said by his friends it. In: u grout smll'erel‘ and to he hrenking rluw.) mgr, Disputehvu state that the Dikotn was “allure on Puiut Limits, tony live milen trnm Liverpool. The pumenqers and t row were all HIIVN], hut the vessel uml mm” is prnlml-ly u tntnl hm. l’ml..\nl:t.mn.\, Muy I|).—'l'ln- city in crowded with penplo heut Ilpuu "saint iu: at the opening ceremonies of the permanent oxltihitinu. Puhlic and punch: Inuildinm urn cov etml with hunting, uml ling» null lmn~ III'I'HM'L' everynhvre flt'l'll. 'l‘heiutere-It tnken hy the people. in the present, nnll permanent I'prusiliun is not less tlmn \vus‘nmnllmtml u year ago nt the upen ing m' the grander though transient ecu ll'llnilll expohitmn. CLEVELAND. May Ill—This morning: u sharp eumunter took plum hetwvt-n striking Chapters and the lmlieu. Almut ~i\' hundred strikers, um-nmpuuiurl hy two hundred of their women unueluhletl u! the entrunee tn the euiupermhnp «If the Smmluril Oil (‘umpuny. The chief uf pulieu ordered his three to disperse the umh, which wan (Inna iuunetlmtely. A muuuiher uf strikers were severely hurt. ‘3’ Panama; Muy‘lo.—~The lust of the , vii-mus ot the Wutlcsvillu allnnotel', Beuj. .\lnsely, wun fuuud at midnight. Hi» lmdy wnw' neither burned nur nvurred, nntl it is suppused he was sumthered hy ehnke (lump. llns'ruN. May 10.—--’l‘he establishment “1' W. 'l‘. Dumnn in the Kundric hmmn tht-vmy, was destroyed last: night by an explosion. 11. L. Hamilton was killed. Loss, $3,000: partly inuured. EUllol'l-LIN. (‘nxs'rm-rmor-mr, May 10. The Jour nul‘n correspondent lays the Russianl l-eiore Kara and Ardhum have retreated towurtia the frontier. Burnuuaa'r, May 10.——The Prince of Ron mania to-day assumed the command of tin: Ronmanian army, deaignating the shirt ot‘ atail'. and commanders ot‘the tirat corps at. Cl'nknvia, and second at; Bucha— rest and Giurgcvo, and appointing mom hora ot' the atafl' and emmnandera ot‘divi ninth- and brigades. VIENNA. May 10,-" is rt-portod that the lilt-nnanian iorm the right. wing of the Russian army and be increased by one liaaxian divmion. The majority of the Houmuninn Senate are opposed to? war A'rmcss, May 10.-—A Greek iron clad ‘ hauuptnrcul a vem! whichclamicatim-iy i left i’irt-civs. The crew are pirates and‘ cria iuuis from Asia Minor. Au invoati—y gatim: has wmnwncod, ' LAN-'DON. May 10.—-;\ dispatch .tronr I-IM-twnn, dated yeatt-rday. makes no I mention oi fighting. The column, which ! wan wing down the Persian t'rontir-r to-‘ warn Van, was ntoppvd at Bnyazind on aocom t oi the lack of forum, and thel iurpr . tieahility oi the country. ' thcsna. May lit—A mot-ting oi Po— i'mh imitators was held at Linda-rt; on May 4th to dt-tvrmine the policy of the Poien. .-\n organization oi tht.l Polish Legion waadecided upon. Tito Polinh! imdt-ra havo n-noivod to abstain from I \ renting any trouhie with Auatria. ---_.__. -..___._- Thmdnrc Tiitnn iato im‘tureize (‘ai—l it'urnu and Oregon. (‘oaw right. oiongi i-iunry and Btu-43w, irt-t have no inokt-n utthl. ltepresenting the Interests 01' S’Voutern \Vashing‘ton. SNUVIIOMiSIVIV (TI'I‘Y, \\Cs§lllN<.;'l‘()'N TERR, SATURDAY, MAY 12. 1877. (fulmnunlc-ullouu. Erl'lm' oft/M North-ru Slur: [Was Wondering it's people of the Atlantic States knew what a bountiful climax we have here on Puget Sound, when now a notice in the paper that they had been having a terrible snow storm and very cold weather, while at the same time our Pennsylvanians were in full bloom. Then when you take into unconscious the northern latitude we all: in living about live thousand-southerly north than Boston—have Boston is about forty-two degrees, thirty minutes, and many thirty-seven degrees and thirty-five minutes—the people look there will surely be us when we, all think that it is in winter and pleasant to winter. What will they think of packing fowls in the open air all winter as we have here. On new years, while in the evening everything was crowded with mum, in my nursery I picked a fine lum, and I believe was meant to New York by Col. C. H. Lurrough. I will give the worms to the flowers in the spring. 1:0qu us new us I can recollect; some rows, migemvltc, [mush-a, llulßlt‘S. con'tullrm, neinuphyliu. seahiusu, pally— unlhus mnl some ulllcl‘i. I have had some verbenns nnnl a gem— nintn tlsut huveheen out drum! nll this Willl‘, nnd are doing finely now, nntl I have had ruse hulls more or lean all the wntter, but. I have not. lnnl any in Mun-n slum.- nlmut the middle of Jununry. Pun aied (luises, violets, pnllynnthun vereniea uml nlve been in IlDHI“ nearly all the past winter. There being no time when lconltl nnt go outside and pick sunn- kind of flower. - But this ‘winter has been a little wann er than any other sermon since I lmTu hm-n in Wuwhingtun Territory. In the midst of judge that this winter has not been five or six degrees warmer, that is the mercury has not been so low by last year or six degrees at any time this winter in other waters, and less snow. I think the lowest the mercury has been this winter at my place in sixteen above zero, that is sixteen below freezing. C. W. Lemon. Scuttle Nursery. Mum'rno Mn, 5, 1877. Editor of the Northern Star.- Fresh to agitate the propagation of Columbia river salmon spawn into the tributaries of Puget Sound. The "drawback" at present with our salmon is of their inferior quality, therefore we cannot compete with the Columbia river peeking houses. With the assistance of our Representatives, given we can not obtain an appropriation for this purpose. The sconeer, the better. If you will but look into the future, you will see that it is destined to be the principal resource of our Territory in the not distant future, will you be kind enough to agitate the salmon interests through your columns. If you will but meet it, it you will have all necessary required. The Olympia Transcript has taken quite an interest in subject. Your very truly. H. C. "sum The above letter explains itself, and we certainly think the subject discussed needs material hill from the U. S. Fish Commissioners. The expense of introducing this bill is much less than the cost of the salmon. In the river, a cape-elm into the Sound waters would be a trifle more expensive with the amount expended in introducing eastern varieties of fish on this coast. Every man knows that Puget Sound has had its little use from the general government as our negligence could possibly do out to us, giving nothing they could help it, and giving grudgingly when they did. Wowouhl suggeat to Mr, Vining the propriety of petitioning the coming leg iulnturc to memorialize congreunin helmlt oi tin‘t interest unit we it' thut body will 3 he «lent'to all the roll “'3'”! :ntiuterelte ‘ of t‘lll' Terfltm'y. R» M: Star. THE \VRECK AT SEA. Far nwny o‘er the wave the proud utenmcr l‘h'l‘n, While the (mun of the sen dnuhd: hr up her side», ’ And the tinyiriht-s of tho roiling; [’lny around ouch side. and at 111 1;, Then sink to tho cuml cave. .‘ Dawn ‘nmth the iuumy was, Dowu, down. when- the men king: llup. (iuily we mmhic übnnt on the deck. Sure nuthing We know could our merriment check; W 0 qugh at the thought of the tcriihle breeze An we m tiw nun Sl‘LOn cnim. w ivory nuns. Nor think that the furl t‘nm'sz night. Will Make” the rturm and! m ghi. Wltlfnights that our blood will Irwin. Lightly we cimt n» the light (add u y. Wutching tin: drops 0! the uhlni Iprny. Watt-hum; the pLail'a' ‘ucuth the o 'l wierd lighl, 3" As i! from its depths cnme thelmrm of mi ht. fi‘hun slowly we turn to our Berth. Ami forgetting the cares "I wth, We dream such \‘isiuus so bright; Slow? and atom tiu- oinud. Siyuiu hinck. h‘ui lurs around the duouu-d ntcurger‘u lmck; Awful/y ummi, with u ninth-ring mar, Like ihu illnlilia that come from findes’ shore. Tin-n n inii‘ uh lln'nd in its hush, Au intu the durknuu \Vc rush, And pray torn night ni‘ the shore: Soon o‘er our hundl bursin the (uriona gull». And our henl‘ls stand still and our faces pnle, Our rtenmer iiien like ll bird for prey. Whllu high o'er her deck leap: the angry n vruv. , lUh! the thoughts of (hut infill! hnnr .-\q \\'o reel nculh thustorm . u power. And think of lhc home far lwuy. ,1 _ “She's eprung ah-uk, air!“ the s an cried. An the \‘osr-el rolled from side m de: ”Man the bone!" thou the crme the lnlsty CHEW I ~ Stood nppuiied M the thought of thin dan ger new. - ‘ - Then we h enrd the heart reading cry Breuthed up to the Ruler'On hall)— “Oh we I“ as through derkueu We cw. Mothers lure clusrlnu‘ the children they love; 0h! where is he heart their‘mru will not move. ’ ' Friend looks on friend, _ln tha huh, a. the wave», ‘. Seething and white, weep. lawn to their grog", ‘ i] EM; ‘wy; j; ‘l ‘ own um l ’ Wt , Down to mi nymmmfi" "' "“l, Down when: no storm gml mvcb. ‘ “Put om" crlca n Villt‘ll, and We nit‘p {mm her deck Into the hunt, and steer from the wreck. Mildly m: rush llirnuuh ihe roaring tide, Wildly We go, liiu: n phhnuun‘n ride, (int ou the {ohm ('lippi‘d \\'ure, , Trualimz lu lihn who can “we; ‘ While the sen. lashes herd ‘xnluet our side. (ilndiy we hell the rluwn‘n feeble light, Which ‘mwcd we have panned through the terrlb e : light. Gladiy we list to the dread, deep roar A: the breaker: heat out on the rocky shore. ‘ We are welcomed by many «1 huud, i ' . Though {m- from our native land, ‘ And our friends we may ecu no more. -I.enno. “Playing "I. Devil." Thin phrase is commonly used in s fig utntive sense. but it is literally descrip tive of an occurrence which recently took place in the noun ut‘Spnln. Anindt virluol who “an; nintlll to die refused to receive the errnmlution 0! religion. and the pnrish pl'lt‘rt n no lmtl been uent for, when the man ret’uswl to see llilttfile' parted with the declaration thxtt the devil would mum in pert-on to t-urry oti' the hardened sinner us soon as he was tlentl. Not long after. “I the family Were watching by the dead hotly,the IIOUI' was hum open with a great noise and there appeared on the some h per sonage arrayed in red, decorated with u long tail. and smelling utrongly ot sul phur. The apartment was speedily vu— euted hy the mournent, who withdrew in great terror. A nwn servant in an other part of the house heard the "trim: and next: to the room. Mum-ring his {euro he fired three shots from o revolver at. the. apparition, who hml junttuken the hotly in his arms. The supposed tlevil fell to the floor. and on exundmt tion turned out to he the parish sexton, who by order I»! the priest ililtl lllllil'l" tuken the purt of Baton. He was quite (loud when pivkt-tl up. Mlltl t'uur priwn who ure tun-pitted ot hoving pillllilQltl the musqunz w Have been taken in cue—t lolly. ~Wnrls Inguuz between the Calho licn and l‘um-Munts in Mnmuchum-ns uvrr the Chuplnim'y nl' Ilm Bmm pmun. ’l’ho hum Imu- hml it all their own wny till recumiy l-‘uHu-r Byrno hehl survive Hat-r» I'm' Llu [mm-tit nl‘ thuaenl his faith. The Purim" Mom] of Chapluin Sln-uru- il - and hm imhgnutiun is oxen-«1w. What hummums hue the Sun in her. My Chaplain. Surely the Culhuc has the mumbling of the first-rate. The Sabbath's mumbling. The Poet's Crowning. We clip the following hermitage extract, on the poet J. 'l'rowbridge, from the Bunker Hill Times. We have been to Arlington, his piece of residence, seen his dwelling with its beautiful surroundings, though we are unacquainted with the poet only through the medium of his writings. What the writer of this article says of him is more than confirmed by his intimate friends and neighbor: Now for a brief sketch of our poet's life. He came from a Connecticut family. His father, Winder Stone Towbridge, emigrated in early manhood to the wilds of western New York. He settled about eight miles beyond where the town of Rochester now stands, building a log house in the woods. More John Town send 'l'rowbridge was born. There seems to be a certain connection between geology and log-house and log-house. Totally of our poets and students' innuendo, the first opened their eyes in them. Now of them on the left to serve as history for the next generation. "Let's send that there be no incomprehensible priority of grant men. Our poet was born in the realm of 1827. The month was September. The day of the seventeenth or eighteenth, which, I believe, never be decided, as his first and the midnight times of the clock struck the air together. Boying Crowbridge today have had two birthday. and—enviable boy-two hundred citizens every time of his life. He was the eighth child of his parents. His father, a sensitive, refined, unrivalled, and highly organized. He had an enthusiasm for music, and was enjoyed by it. He was a fine father, and would imitate his children evening after evening with wild woodland adventures; when the father called him, he would weave tales in rhyme that must have fallen upon the poetic ear of a child. He was a deep religious sentiment with great energy of character. The sun went to heaven, the heat went out of his parents. His father, a boy, lived the life of his parents. He went to school half the year and worked on the farm the other half; but this whispering work, his heart was in his books. He studied in school and out. He learned French, he learned French, he tried Latin and German the same way. He got, but not from the public library in the nearest town, and poured over. Continually, Scott and Byron were his victims, and he dreamed over them in the woods, where he often thought he could hear him. It was gloom and swamps, the wild and rambling creatures of the woods, the rushing and aching, the long-stout in silence on his imagination. When he "hit seventeen years old," he went to Illinois. More a married enter was living, and taught school for it while. Then he emerged from the hitching, raised a crop of wheat. Virgil attempted for one summer. The fruit struck the wheat, the young mind grew vigorously. The tanning ended in an “eternal tort” well, and at the age of nineteen he set off for New York, where he had neither friend nor introduction, to seek his fortune. He did not enter the city eating a roll, and he had more than 150 cents in his pocket; but in spite of these drawbacks, he received a prize in this way: A prize had been offered by a Lockport paper for the heat mare for the year 1845; in the event gained this prize, which was a book worth $3; but, on reflection, the publishers decided it to be a collection, and entertained with their credit by paying him one dollar and a half! The following friend in New York was North of the Sunday Times. He was advised by him to write prose in various parts of the country, it he wanted to make literature. “That is all right.” In the Deliminating Magnet, so much trusted to its subscription price of one till your. “In story was widely copied, his hopes were limited very high, and when the truth was revealed, he felt hastened to the medical to find. But he was “NO back to receiving a note from the editor at the last. “Hullin' the inner manner” that he never paid new contributors. He received a premium from the expert, but the arrival of the new expert, he was not to be missed. The export of gold, which was rented to the secretary, cut; it was located at $3, new turning; “the old “.w- 1' ‘-.~ 3;,..rd of arm 1.4 men. _. WHOLE NO. 70. not giving up the light. In 1848 he went, to Boston, and for a time edited a nursery paper there. Though he nearly killed it by an article on the Fugitive Slave Law. In 1853, he wrote his first book, “Father Brighthope.” This was so successful that it led to the publication of four others of a similar character. They were followed by “Martin Meritale.” His mark, his mark, was his mark. His prosperity was now assured. In 1858, he visited Europe, and in 1858 wrote a bright novel, “Neighbor Jackwood,” carrying on the life of the Vermont farmer as if Paris and all her distractions were not around him. Returning to America, he found plenty of literary work awaiting him. He was one of the original poems of contributors to the Atlantic Monthly. The “Vagabond” first appeared in this magazine. The idea of this world-renowned poem was first suggested to him in Paris by the sight of a wanton, "vagabund," while the dancing dogs kept the poem in MS. for years before it was published. It was his mine who first realized its extraordinary merit and has tended its publication. No poem has been so much read by public readers on both sides of the Atlantic. Mr. Trowbridge, edited the Young Folks for many years, and is now the favorite writer in our best children's magazines and papers. It is possible he himself does not appreciate the wide worth of his work has received. Visiting a friend recently in the Southern city of Memphis, I noticed an amusing instance of this. The cook appeared one morning in the breakfast room with a handkerchief tied tightly around her neck, her eyes heavy and listening, her features showing pale, unmistakably in a white one could have done. "What's the matter now?" said I. "Don't you tell Miss Margaret-tonight?" said she in a mysterious whisper, "but the train is set up all night (any reader). Not a blessed wink of sleep did I get all night." "What were you reading?" asked I much amused. "It was named, Friends; and it was such an interesting book that I made it mental vow to tell Mr. Bridge of this tribute from one of the humblest of human beings that I ever have the opportunity given me. There is a pretty story somewhere of a late who, from her home one day, gold and jewels and flowers, and next is a shower of lead. To all children born on the day of the golden shower, joy and fortune and success, while those born at the time of the golden shower had a gray life and ruined hopes. Mr. Brownbridge, it would seem, was born between showers, so his life has known sorrow. Yet the rosy day must nearer to him than the somber one, for his honor has not been in vain nor the heart unsatisfied. At the close of the half century, he has nearly completed the book, and pure as pearls on a thread of gold. A writer in Deldwyn City, Black Hills, says "every man carries about sixteen pounds of green pennies of fire arms, mauled in a green institution, and the people who get them." The gun on the 5th is the best man, and the more fellow, the gun is the best man. That "lame dim they kill, or six, and average "Infall one limb." He said, that "the bird kills lame." A modest young lady described the leg of chicken, at the table, and said: "I'll kill the put which ought to be in the hands of a gentleman!" A young man opposite immediately laid: "I'll kill the part that ought to be in the hands of a gentleman." Mimwénm is nhvm'l. She bu pmcvl a law n-quiring aj! bunk-1 um] in the public schools, to be printed by country, in the lawn! blddrr. This will pm. them in the schools M one-half the present mail miles. Men usually follow their wishes till suffering compula them to (onnw “lair judgment. April can. wan (bu 85th mum-navy of the toumling of Odd Fellowship in “Unified Building” in Unified Building. A young man n! Huh-In Mandi-ml 'g. yuan): hdy, u'l'l u.” hunvwhippcnl m (’Humnq.ll:x.‘.'t'. (hum, ' nu- R‘nu- Mun“: *smrzy..r meg... .~.~n'.n-L -« '.:I (the early part of Juan..
| 50,666 |
1992/31992R3809/31992R3809_PT.pdf_1
|
Eurlex
|
Open Government
|
CC-By
| 1,992 |
None
|
None
|
Portugueuse
|
Spoken
| 642 | 8,398 |
N?L384/36 JornalOficialdasComunidades Europeias 30.12.92
REGULAMENTO (CEE)N?3809/92DACOMISSÃO
de29deDezembrode1992
quefixaospreços-comporta eosdireitosniveladoresnosectordacarnedeaves
decapoeira
dospreçosdoscereaisforrageirosnomercadomundialse,
namesmadata,seprocederaumanovafixaçãodopreço
-comporta;
Considerandoque,noquerespeitaacertosprodutos,uma
novafixaçãodospreços-comporta tevelugar;queé,em
consequência ,necessáriofixarosdireitosniveladores
tendoemcontaaevoluçãodospreçosdoscereaisforragei
ros;
Considerandoque,pelosRegulamentos (CEE)n?3834/90
doConselho,de20deDezembrode1990,quereduz,
paraoanode1991,direitosniveladoresrelativamente a
certosprodutosagrícolasorigináriosdepaísesemviasde
desenvolvimento (6),comaúltimaredacçãoquelhefoi
dadapeloRegulamento (CEE)n?1509/92Ç),e(CEE)n?
715/90doConselho(8)relativoaoregimeaplicávelaos
produtosagrícolaseacertasmercadoriasresultantesde
transformação deprodutosagrícolasorigináriosdos
EstadosdeÁfrica,dasCaraíbasedoPacífico(Estados
ACP),comaúltimaredacçãoquelhefoidadapeloRegu
lamento(CEE)n?444/92(9),foraminstauradosregimes
especiaisaplicáveisàimportaçãoqueincluemumaredu
çãode50%dosdireitosniveladoresnoâmbitodos
montantesfixosoudoscontingentesanuais,entreoutros,
paradeterminadosprodutosdosectordacarnedeavesde
capoeira;
Considerandoque,peloRegulamento (CEE)n?3833/90
doConselho,de20deDezembrode1990,queaplica
preferênciasgeneralizadas ,paraoanode1991,acertos
produtosagrícolasorigináriosdepaísesemviasdedesen
volvimento(10),comaúltimaredacçãoquelhefoidada
peloRegulamento (CEE)n?1509/92foramparcialou
totalmentesuspensososdireitosdePautaAduaneira
Comum,entreoutros,paradeterminados produtosdo
sectordacarnedeavesdecapoeira;
Considerando que,emconformidade comon?1do
artigo101?daDecisão91/482/CEEdoConselho,de25
deJulhode1991,relativaàassociaçãodospaíseseterritó
riosultramarinosàComunidadeEconómicaEuropeia("),
nãosãoaplicadosdireitosniveladoresaosprodutosorigi
náriosdospaíseseterritóriosultramarinos ;
ConsiderandoqueosRegulamentos (CEE)n?518/92(12),
(CEE)n?519/92(u)e(CEE)n?520/92(»)doConselho,
de27deFevereirode1992,relativosacertasmodalidades
deaplicaçãodoacordoprovisóriorelativoaocomércioea
medidasdeacompanhamento entreaComunidade
EconómicaEuropeiaeaComunidadeEuropeiadoCarvãoACOMISSÃODASCOMUNIDADES EUROPEIAS ,
TendoemcontaoTratadoqueinstituiaComunidade
EconómicaEuropeia,
TendoemcontaoRegulamento (CEE)n?2777/75do
Conselho,de29deOutubrode1975,queestabelecea
organizaçãocomumdemercadonosectordacarnede
avesdecapoeira('),comaúltimaredacçãoquelhefoi
dadapeloRegulamento (CEE)n°3714/92(2),e,nomeada
mente,oseuartigo3?eon?1doseuartigo7?,
Considerandoqueospreços-comporta eosdireitosnive
ladoresemrelaçãoaosprodutosreferidosnon?1do
artigo1?doRegulamento (CEE)n?2777/75devemser
fixadospreviamenteparacadatrimestre,deacordocomos
métodosdecálculoindicadosnoRegulamento (CEE)
n?2778/75doConselho,de29deOutubrode1975,que
determinaasregrasparaocálculodosdireitosniveladores
edopreço-comporta aplicáveisnosectordacarnedeaves
decapoeira(3),comaúltimaredacçãoquelhefoidada
peloRegulamento (CEE)n?3714/92(4);
Considerandoqueospreços-comporta eosdireitosnive
ladoresnosectordacarnedeavesdecapoeira,tendosido
fixadosemúltimolugarpeloRegulamento (CEE)
n?2695/92daComissão(*)relativamente aoperíodode1
deOutubroa31deDezembrode1992,setornaneces
sárioprocederaumanovafixaçãoparaoperíodode1de
Janeiroa31deMarçode1993;queessafixaçãodeve,em
princípio,serefectuadacombasenospreçosdoscereais
forrageirosemrelaçãoaoperíodode1deJulhoa30de
Novembrode1992;
Considerandoque,aquandodafixaçãodopreço-comporta
emvigorapartirde1deOutubro,de1deJaneiroede1
deAbril,apenasdeversertidaemcontaaevoluçãodos
preçosdoscereaisforrageirosnomercadomundial,
quandoopreçodaquantidadedecereaisforrageiros
acusarumavariaçãomínimaemrelaçãoàquefoiutilizada
paraocálculodopreço-comporta dotrimestreanterior;
queessavariaçãofoifixadaem3%peloRegulamento
(CEE)n?2778/75;
Considerandoqueopreçodaquantidadedecereaisforra
geirosutilizadaparaaproduçãodecarnedeavesde
capoeirasedesviademaisde3%daquelequefoi
tomadoemconsideraçãoparaotrimestreanterior;queé
necessário,porconseguinte,teremcontaestaevolução
aquandodafixaçãodospreços-comporta paraoperíodo
compreendido entre1deJaneiroe31deMarçode1993;
Considerando que,aquandodasfixaçõesdodireitonive
ladoremvigorapartirde1deOutubro,de1deJaneiroe
de1deAbril,apenasdevesertidaemcontaaevolução(6)JOn?L370de31.12.1990.
OJOn?L159de12.6.1992,p.1.
(8)JOn?L84de30.3.1990,p.85.
f)JOn?L52de27.2.1992,p.7.
HJOn?L370de31.12.1990,p.86.
(")JOn?L263de19.9.1991,p.1.
(,2)JOn?L56de29.2.1992,p.3.
(13)JOn?L56de29.2.1992,p.6.HJOn?L56de29.2.1992,p.9.(')JOn?L282de1.11.1975,p.77.
OJOn?L378de23.12.1992,p.23.
OJOn?L282de1.11.1975,p.84.
(4)JOn?L378de23.12.1992,p.23.
OJOn?L272de17.9.1992,p.44.
N?L384/37 30.12.92 JornalOficialdasComunidades Europeias
previstosnoartigo7?desseregulamento ,emrelaçãoaos
produtosabrangidospelon?1doartigo1?dessemesmo
regulamento ,sãofixadosnoanexo.
2.Todavia,emrelaçãoaosprodutosdoscódigosNC
020731,02073990,020750,02109071,02109079,
15010090,160231,16023919,16023930e16023990
relativamente aosquaisataxadedireitosfoiconsolidada,
noâmbitodoAcordoGeralsobrePautasAduaneirase
Comércio,osdireitosniveladoressãolimitadosaos
montantesqueresultamdessaconsolidação .edoAço,porumlado,e,respectivamente ,aRepublicada
Polónia,aRepúblicadaHungriaeaRepúblicaFederativa
ChecaeEslovaca,poroutro,instauraramumregimede
reduçãodedireitosniveladoresdeimportaçãoparacertos
produtos;queoRegulamento (CEE)n?579/92da
Comissão('),alteradopeloRegulamento (CEE)n?
3730/92(2),estabeleceuasregrasdeexecuçãonosectorda
carnedeavesdecapoeira,doregimeprevistonessesacor
dos;
Considerandoqueasmedidasprevistasnopresenteregu
lamentoestãoemconfomidadecomoparecerdoComité
degestãodecarnedeavesdecapoeiraedosovos,
ADOPTOU OPRESENTE REGULAMENTO :
Artigo1?
1.Osdireitosniveladoresprevistosnoartigo3?do
Regulamento (CEE)n?2777/75eospreços-comportaArtigo2?
Opresenteregulamentoentraemvigorem1deJaneiro
de1993.
Opresenteregulamentoeobrigatorioemtodososseuselementosedirectamenteaplicável
emtodososEstados-membros.
FeitoemBruxelas,em29deDezembrode1992.
PelaComissão
RayMACSHARRY
MembrodaComissão
(')JOn?L62de7.3.1992,p.15.
(2)JOn?L380de24.12.1992,p.12.
(2)Paraestesprodutosorigináriosdepaísesemviasdedesenvolvimento ereferidosnoanexodoRegulamento (CEE)
n?3834/90,odireitoniveladoréreduzidoem50%dentrodoslimitesdosmontantesfixosreferidosnoanexo
supracitado.
(3)Paraestesprodutosorigináriosdepaísesemviasdedesenvolvimento ereferidosnoRegulamento (CEE)
n?3833/90,sãosuspensososdireitosdaPautaAduaneiraComum,nãosendocobradoqualquerdireitonivelador.'
(4)OsprodutosdestecódigoimportadosdaPolónia,daChecoslováquia oudaHungrianoâmbitodosacordosprovi
sóriosconcluídosentreestepaíseseaComunidade ,eparaosquaissejaapresentadoumcertificadoEURl
emitidonascondiçõesprevistasnoRegulamento (CEE)n?579/92,estãosujeitosaosdireitosniveladoresindi
cadosnoanexodomesmoregulamento.
(5)Emconformidadecomon?1doartigo101?daDecisão91/482/CEE,nãosãoaplicadosdireitosniveladoresaos
produtosorigináriosdosPTU.
N?L384/36 JornalOficialdasComunidades Europeias 30.12.92
REGULAMENTO (CEE)N?3809/92DACOMISSÃO
de29deDezembrode1992
quefixaospreços-comporta eosdireitosniveladoresnosectordacarnedeaves
decapoeira
dospreçosdoscereaisforrageirosnomercadomundialse,
namesmadata,seprocederaumanovafixaçãodopreço
-comporta;
Considerandoque,noquerespeitaacertosprodutos,uma
novafixaçãodospreços-comporta tevelugar;queé,em
consequência ,necessáriofixarosdireitosniveladores
tendoemcontaaevoluçãodospreçosdoscereaisforragei
ros;
Considerandoque,pelosRegulamentos (CEE)n?3834/90
doConselho,de20deDezembrode1990,quereduz,
paraoanode1991,direitosniveladoresrelativamente a
certosprodutosagrícolasorigináriosdepaísesemviasde
desenvolvimento (6),comaúltimaredacçãoquelhefoi
dadapeloRegulamento (CEE)n?1509/92Ç),e(CEE)n?
715/90doConselho(8)relativoaoregimeaplicávelaos
produtosagrícolaseacertasmercadoriasresultantesde
transformação deprodutosagrícolasorigináriosdos
EstadosdeÁfrica,dasCaraíbasedoPacífico(Estados
ACP),comaúltimaredacçãoquelhefoidadapeloRegu
lamento(CEE)n?444/92(9),foraminstauradosregimes
especiaisaplicáveisàimportaçãoqueincluemumaredu
çãode50%dosdireitosniveladoresnoâmbitodos
montantesfixosoudoscontingentesanuais,entreoutros,
paradeterminadosprodutosdosectordacarnedeavesde
capoeira;
Considerandoque,peloRegulamento (CEE)n?3833/90
doConselho,de20deDezembrode1990,queaplica
preferênciasgeneralizadas ,paraoanode1991,acertos
produtosagrícolasorigináriosdepaísesemviasdedesen
volvimento(10),comaúltimaredacçãoquelhefoidada
peloRegulamento (CEE)n?1509/92foramparcialou
totalmentesuspensososdireitosdePautaAduaneira
Comum,entreoutros,paradeterminados produtosdo
sectordacarnedeavesdecapoeira;
Considerando que,emconformidade comon?1do
artigo101?daDecisão91/482/CEEdoConselho,de25
deJulhode1991,relativaàassociaçãodospaíseseterritó
riosultramarinosàComunidadeEconómicaEuropeia("),
nãosãoaplicadosdireitosniveladoresaosprodutosorigi
náriosdospaíseseterritóriosultramarinos ;
ConsiderandoqueosRegulamentos (CEE)n?518/92(12),
(CEE)n?519/92(u)e(CEE)n?520/92(»)doConselho,
de27deFevereirode1992,relativosacertasmodalidades
deaplicaçãodoacordoprovisóriorelativoaocomércioea
medidasdeacompanhamento entreaComunidade
EconómicaEuropeiaeaComunidadeEuropeiadoCarvãoACOMISSÃODASCOMUNIDADES EUROPEIAS ,
TendoemcontaoTratadoqueinstituiaComunidade
EconómicaEuropeia,
TendoemcontaoRegulamento (CEE)n?2777/75do
Conselho,de29deOutubrode1975,queestabelecea
organizaçãocomumdemercadonosectordacarnede
avesdecapoeira('),comaúltimaredacçãoquelhefoi
dadapeloRegulamento (CEE)n°3714/92(2),e,nomeada
mente,oseuartigo3?eon?1doseuartigo7?,
Considerandoqueospreços-comporta eosdireitosnive
ladoresemrelaçãoaosprodutosreferidosnon?1do
artigo1?doRegulamento (CEE)n?2777/75devemser
fixadospreviamenteparacadatrimestre,deacordocomos
métodosdecálculoindicadosnoRegulamento (CEE)
n?2778/75doConselho,de29deOutubrode1975,que
determinaasregrasparaocálculodosdireitosniveladores
edopreço-comporta aplicáveisnosectordacarnedeaves
decapoeira(3),comaúltimaredacçãoquelhefoidada
peloRegulamento (CEE)n?3714/92(4);
Considerandoqueospreços-comporta eosdireitosnive
ladoresnosectordacarnedeavesdecapoeira,tendosido
fixadosemúltimolugarpeloRegulamento (CEE)
n?2695/92daComissão(*)relativamente aoperíodode1
deOutubroa31deDezembrode1992,setornaneces
sárioprocederaumanovafixaçãoparaoperíodode1de
Janeiroa31deMarçode1993;queessafixaçãodeve,em
princípio,serefectuadacombasenospreçosdoscereais
forrageirosemrelaçãoaoperíodode1deJulhoa30de
Novembrode1992;
Considerandoque,aquandodafixaçãodopreço-comporta
emvigorapartirde1deOutubro,de1deJaneiroede1
deAbril,apenasdeversertidaemcontaaevoluçãodos
preçosdoscereaisforrageirosnomercadomundial,
quandoopreçodaquantidadedecereaisforrageiros
acusarumavariaçãomínimaemrelaçãoàquefoiutilizada
paraocálculodopreço-comporta dotrimestreanterior;
queessavariaçãofoifixadaem3%peloRegulamento
(CEE)n?2778/75;
Considerandoqueopreçodaquantidadedecereaisforra
geirosutilizadaparaaproduçãodecarnedeavesde
capoeirasedesviademaisde3%daquelequefoi
tomadoemconsideraçãoparaotrimestreanterior;queé
necessário,porconseguinte,teremcontaestaevolução
aquandodafixaçãodospreços-comporta paraoperíodo
compreendido entre1deJaneiroe31deMarçode1993;
Considerando que,aquandodasfixaçõesdodireitonive
ladoremvigorapartirde1deOutubro,de1deJaneiroe
de1deAbril,apenasdevesertidaemcontaaevolução(6)JOn?L370de31.12.1990.
OJOn?L159de12.6.1992,p.1.
(8)JOn?L84de30.3.1990,p.85.
f)JOn?L52de27.2.1992,p.7.
HJOn?L370de31.12.1990,p.86.
(")JOn?L263de19.9.1991,p.1.
(,2)JOn?L56de29.2.1992,p.3.
(13)JOn?L56de29.2.1992,p.6.HJOn?L56de29.2.1992,p.9.(')JOn?L282de1.11.1975,p.77.
OJOn?L378de23.12.1992,p.23.
OJOn?L282de1.11.1975,p.84.
(4)JOn?L378de23.12.1992,p.23.
OJOn?L272de17.9.1992,p.44.
N?L384/37 30.12.92 JornalOficialdasComunidades Europeias
previstosnoartigo7?desseregulamento ,emrelaçãoaos
produtosabrangidospelon?1doartigo1?dessemesmo
regulamento ,sãofixadosnoanexo.
2.Todavia,emrelaçãoaosprodutosdoscódigosNC
020731,02073990,020750,02109071,02109079,
15010090,160231,16023919,16023930e16023990
relativamente aosquaisataxadedireitosfoiconsolidada,
noâmbitodoAcordoGeralsobrePautasAduaneirase
Comércio,osdireitosniveladoressãolimitadosaos
montantesqueresultamdessaconsolidação .edoAço,porumlado,e,respectivamente ,aRepublicada
Polónia,aRepúblicadaHungriaeaRepúblicaFederativa
ChecaeEslovaca,poroutro,instauraramumregimede
reduçãodedireitosniveladoresdeimportaçãoparacertos
produtos;queoRegulamento (CEE)n?579/92da
Comissão('),alteradopeloRegulamento (CEE)n?
3730/92(2),estabeleceuasregrasdeexecuçãonosectorda
carnedeavesdecapoeira,doregimeprevistonessesacor
dos;
Considerandoqueasmedidasprevistasnopresenteregu
lamentoestãoemconfomidadecomoparecerdoComité
degestãodecarnedeavesdecapoeiraedosovos,
ADOPTOU OPRESENTE REGULAMENTO :
Artigo1?
1.Osdireitosniveladoresprevistosnoartigo3?do
Regulamento (CEE)n?2777/75eospreços-comportaArtigo2?
Opresenteregulamentoentraemvigorem1deJaneiro
de1993.
Opresenteregulamentoeobrigatorioemtodososseuselementosedirectamenteaplicável
emtodososEstados-membros.
FeitoemBruxelas,em29deDezembrode1992.
PelaComissão
RayMACSHARRY
MembrodaComissão
(')JOn?L62de7.3.1992,p.15.
(2)JOn?L380de24.12.1992,p.12.
(2)Paraestesprodutosorigináriosdepaísesemviasdedesenvolvimento ereferidosnoanexodoRegulamento (CEE)
n?3834/90,odireitoniveladoréreduzidoem50%dentrodoslimitesdosmontantesfixosreferidosnoanexo
supracitado.
(3)Paraestesprodutosorigináriosdepaísesemviasdedesenvolvimento ereferidosnoRegulamento (CEE)
n?3833/90,sãosuspensososdireitosdaPautaAduaneiraComum,nãosendocobradoqualquerdireitonivelador.'
(4)OsprodutosdestecódigoimportadosdaPolónia,daChecoslováquia oudaHungrianoâmbitodosacordosprovi
sóriosconcluídosentreestepaíseseaComunidade ,eparaosquaissejaapresentadoumcertificadoEURl
emitidonascondiçõesprevistasnoRegulamento (CEE)n?579/92,estãosujeitosaosdireitosniveladoresindi
cadosnoanexodomesmoregulamento.
(5)Emconformidadecomon?1doartigo101?daDecisão91/482/CEE,nãosãoaplicadosdireitosniveladoresaos
produtosorigináriosdosPTU.
N?L384/36 JornalOficialdasComunidades Europeias 30.12.92
REGULAMENTO (CEE)N?3809/92DACOMISSÃO
de29deDezembrode1992
quefixaospreços-comporta eosdireitosniveladoresnosectordacarnedeaves
decapoeira
dospreçosdoscereaisforrageirosnomercadomundialse,
namesmadata,seprocederaumanovafixaçãodopreço
-comporta;
Considerandoque,noquerespeitaacertosprodutos,uma
novafixaçãodospreços-comporta tevelugar;queé,em
consequência ,necessáriofixarosdireitosniveladores
tendoemcontaaevoluçãodospreçosdoscereaisforragei
ros;
Considerandoque,pelosRegulamentos (CEE)n?3834/90
doConselho,de20deDezembrode1990,quereduz,
paraoanode1991,direitosniveladoresrelativamente a
certosprodutosagrícolasorigináriosdepaísesemviasde
desenvolvimento (6),comaúltimaredacçãoquelhefoi
dadapeloRegulamento (CEE)n?1509/92Ç),e(CEE)n?
715/90doConselho(8)relativoaoregimeaplicávelaos
produtosagrícolaseacertasmercadoriasresultantesde
transformação deprodutosagrícolasorigináriosdos
EstadosdeÁfrica,dasCaraíbasedoPacífico(Estados
ACP),comaúltimaredacçãoquelhefoidadapeloRegu
lamento(CEE)n?444/92(9),foraminstauradosregimes
especiaisaplicáveisàimportaçãoqueincluemumaredu
çãode50%dosdireitosniveladoresnoâmbitodos
montantesfixosoudoscontingentesanuais,entreoutros,
paradeterminadosprodutosdosectordacarnedeavesde
capoeira;
Considerandoque,peloRegulamento (CEE)n?3833/90
doConselho,de20deDezembrode1990,queaplica
preferênciasgeneralizadas ,paraoanode1991,acertos
produtosagrícolasorigináriosdepaísesemviasdedesen
volvimento(10),comaúltimaredacçãoquelhefoidada
peloRegulamento (CEE)n?1509/92foramparcialou
totalmentesuspensososdireitosdePautaAduaneira
Comum,entreoutros,paradeterminados produtosdo
sectordacarnedeavesdecapoeira;
Considerando que,emconformidade comon?1do
artigo101?daDecisão91/482/CEEdoConselho,de25
deJulhode1991,relativaàassociaçãodospaíseseterritó
riosultramarinosàComunidadeEconómicaEuropeia("),
nãosãoaplicadosdireitosniveladoresaosprodutosorigi
náriosdospaíseseterritóriosultramarinos ;
ConsiderandoqueosRegulamentos (CEE)n?518/92(12),
(CEE)n?519/92(u)e(CEE)n?520/92(»)doConselho,
de27deFevereirode1992,relativosacertasmodalidades
deaplicaçãodoacordoprovisóriorelativoaocomércioea
medidasdeacompanhamento entreaComunidade
EconómicaEuropeiaeaComunidadeEuropeiadoCarvãoACOMISSÃODASCOMUNIDADES EUROPEIAS ,
TendoemcontaoTratadoqueinstituiaComunidade
EconómicaEuropeia,
TendoemcontaoRegulamento (CEE)n?2777/75do
Conselho,de29deOutubrode1975,queestabelecea
organizaçãocomumdemercadonosectordacarnede
avesdecapoeira('),comaúltimaredacçãoquelhefoi
dadapeloRegulamento (CEE)n°3714/92(2),e,nomeada
mente,oseuartigo3?eon?1doseuartigo7?,
Considerandoqueospreços-comporta eosdireitosnive
ladoresemrelaçãoaosprodutosreferidosnon?1do
artigo1?doRegulamento (CEE)n?2777/75devemser
fixadospreviamenteparacadatrimestre,deacordocomos
métodosdecálculoindicadosnoRegulamento (CEE)
n?2778/75doConselho,de29deOutubrode1975,que
determinaasregrasparaocálculodosdireitosniveladores
edopreço-comporta aplicáveisnosectordacarnedeaves
decapoeira(3),comaúltimaredacçãoquelhefoidada
peloRegulamento (CEE)n?3714/92(4);
Considerandoqueospreços-comporta eosdireitosnive
ladoresnosectordacarnedeavesdecapoeira,tendosido
fixadosemúltimolugarpeloRegulamento (CEE)
n?2695/92daComissão(*)relativamente aoperíodode1
deOutubroa31deDezembrode1992,setornaneces
sárioprocederaumanovafixaçãoparaoperíodode1de
Janeiroa31deMarçode1993;queessafixaçãodeve,em
princípio,serefectuadacombasenospreçosdoscereais
forrageirosemrelaçãoaoperíodode1deJulhoa30de
Novembrode1992;
Considerandoque,aquandodafixaçãodopreço-comporta
emvigorapartirde1deOutubro,de1deJaneiroede1
deAbril,apenasdeversertidaemcontaaevoluçãodos
preçosdoscereaisforrageirosnomercadomundial,
quandoopreçodaquantidadedecereaisforrageiros
acusarumavariaçãomínimaemrelaçãoàquefoiutilizada
paraocálculodopreço-comporta dotrimestreanterior;
queessavariaçãofoifixadaem3%peloRegulamento
(CEE)n?2778/75;
Considerandoqueopreçodaquantidadedecereaisforra
geirosutilizadaparaaproduçãodecarnedeavesde
capoeirasedesviademaisde3%daquelequefoi
tomadoemconsideraçãoparaotrimestreanterior;queé
necessário,porconseguinte,teremcontaestaevolução
aquandodafixaçãodospreços-comporta paraoperíodo
compreendido entre1deJaneiroe31deMarçode1993;
Considerando que,aquandodasfixaçõesdodireitonive
ladoremvigorapartirde1deOutubro,de1deJaneiroe
de1deAbril,apenasdevesertidaemcontaaevolução(6)JOn?L370de31.12.1990.
OJOn?L159de12.6.1992,p.1.
(8)JOn?L84de30.3.1990,p.85.
f)JOn?L52de27.2.1992,p.7.
HJOn?L370de31.12.1990,p.86.
(")JOn?L263de19.9.1991,p.1.
(,2)JOn?L56de29.2.1992,p.3.
(13)JOn?L56de29.2.1992,p.6.HJOn?L56de29.2.1992,p.9.(')JOn?L282de1.11.1975,p.77.
OJOn?L378de23.12.1992,p.23.
OJOn?L282de1.11.1975,p.84.
(4)JOn?L378de23.12.1992,p.23.
OJOn?L272de17.9.1992,p.44.
N?L384/37 30.12.92 JornalOficialdasComunidades Europeias
previstosnoartigo7?desseregulamento ,emrelaçãoaos
produtosabrangidospelon?1doartigo1?dessemesmo
regulamento ,sãofixadosnoanexo.
2.Todavia,emrelaçãoaosprodutosdoscódigosNC
020731,02073990,020750,02109071,02109079,
15010090,160231,16023919,16023930e16023990
relativamente aosquaisataxadedireitosfoiconsolidada,
noâmbitodoAcordoGeralsobrePautasAduaneirase
Comércio,osdireitosniveladoressãolimitadosaos
montantesqueresultamdessaconsolidação .edoAço,porumlado,e,respectivamente ,aRepublicada
Polónia,aRepúblicadaHungriaeaRepúblicaFederativa
ChecaeEslovaca,poroutro,instauraramumregimede
reduçãodedireitosniveladoresdeimportaçãoparacertos
produtos;queoRegulamento (CEE)n?579/92da
Comissão('),alteradopeloRegulamento (CEE)n?
3730/92(2),estabeleceuasregrasdeexecuçãonosectorda
carnedeavesdecapoeira,doregimeprevistonessesacor
dos;
Considerandoqueasmedidasprevistasnopresenteregu
lamentoestãoemconfomidadecomoparecerdoComité
degestãodecarnedeavesdecapoeiraedosovos,
ADOPTOU OPRESENTE REGULAMENTO :
Artigo1?
1.Osdireitosniveladoresprevistosnoartigo3?do
Regulamento (CEE)n?2777/75eospreços-comportaArtigo2?
Opresenteregulamentoentraemvigorem1deJaneiro
de1993.
Opresenteregulamentoeobrigatorioemtodososseuselementosedirectamenteaplicável
emtodososEstados-membros.
FeitoemBruxelas,em29deDezembrode1992.
PelaComissão
RayMACSHARRY
MembrodaComissão
(')JOn?L62de7.3.1992,p.15.
(2)JOn?L380de24.12.1992,p.12.
(2)Paraestesprodutosorigináriosdepaísesemviasdedesenvolvimento ereferidosnoanexodoRegulamento (CEE)
n?3834/90,odireitoniveladoréreduzidoem50%dentrodoslimitesdosmontantesfixosreferidosnoanexo
supracitado.
(3)Paraestesprodutosorigináriosdepaísesemviasdedesenvolvimento ereferidosnoRegulamento (CEE)
n?3833/90,sãosuspensososdireitosdaPautaAduaneiraComum,nãosendocobradoqualquerdireitonivelador.'
(4)OsprodutosdestecódigoimportadosdaPolónia,daChecoslováquia oudaHungrianoâmbitodosacordosprovi
sóriosconcluídosentreestepaíseseaComunidade ,eparaosquaissejaapresentadoumcertificadoEURl
emitidonascondiçõesprevistasnoRegulamento (CEE)n?579/92,estãosujeitosaosdireitosniveladoresindi
cadosnoanexodomesmoregulamento.
(5)Emconformidadecomon?1doartigo101?daDecisão91/482/CEE,nãosãoaplicadosdireitosniveladoresaos
produtosorigináriosdosPTU.
| 34,543 |
US-201013144566-A_2
|
USPTO
|
Open Government
|
Public Domain
| 2,010 |
None
|
None
|
English
|
Spoken
| 5,595 | 13,316 |
(R)-7b (eluent: c-Hex/EtOAc=2/1): ¹H NMR (400 MHz, C₆D₆): 9.38 (s, 1H, NH), 7.41 (s, 1H, ArH), 7.31-7.28 (m, 2H, ArH), 7.12-6.95 (m, 6H, ArH), 6.75 (d, J=8.4 Hz, 1H, ArH), 6.55 (t, J=8.4 Hz, 1H, ArH), 3.98 (d, J=13.2 Hz, 1H, CH₂), 2.98 (d, J=13.2 Hz, 1H, CH₂), 1.70 (bs, 2H, NH₂).
¹³C NMR (400 MHz, C₆D₆): 171.5, 162.6 (d), 141.4, 140.7, 135.4, 133.6 (d), 130.8, 128,8, 128.4, 128.2, 127.9, 127.6, 125.3, 121.1, 116.3, (t), 115.5, 104.4, 64.2, 47.7.
(S)-7C: ¹H NMR (400 MHz, C₆D₆): 9.41 (s, 1H, NH), 7.47 (s, 1H, ArH), 7,24 (d, J=8.4 Hz, 1H, ArH), 7.01-6.90 (m, 7H, ArH), 6.79 (d, J=8.4 Hz, 1H, ArH), 6.30 (d, J=8.4 Hz, 1H, ArH), 4.16 (d, J=8.4 Hz, 1H, CH₂), 3.22 (d, J=6.8 Hz, 1H, CH₂), 2.99 (d, J=13.2 Hz, 1H, CH₂), 2.39 (d, J=13.2 Hz, 1H, CH₂), 1.25 (bs, 2H, NH₂). ¹³C NMR (400 MHz, C₆D₆):
172.3, 161.0, 141.2, 135.6, 134.7, 133.9, 130.1, 128.9, 127.8, 121.2, 118.6, 116.6, 115.4, 115.1, 105.6, 73.3, 61.8, 42.1.
(S)-7d (eluent: Et₂O/EtOAc=2/1): ¹H NMR (400 MHz, C₆D₆): 9.63 (s, 1H, NH), 7.47 (s, 1H, ArH), 7.35 (dd, 1H, J₁=8.8 Hz, J₂=2.0 Hz, 1H, ArH), 6.91 (dd, 1H, J₁=6.8 Hz, J₂=2.8 Hz, 2H, ArH), 6.79 (d, J=8.4 Hz, 1H, ArH), 6.21 (d, J=8.4 Hz, 1H, ArH), 4.08 (d, J=8.4 Hz, 1H, ArH), 2.93 (d, J=8.8 Hz, 1H, ArH), 0.89 (s, 3H, CH₃).
¹³C NMR (400 MHz, C₆D₆): 172.9, 160.9, 141.4, 135.7, 133.8, 121.0, 118.6, 116.5, 116.4, 115.0, 73.7, 57.7, 23.1.
(S)-36 ¹H NMR (400 MHz, C₆D₆): 9.35 (S, 1H, NH), 7.47-7.39 (m, 3H, ArH), 7.17-7.02 (m, 5H, ArH), 6.79-6.65 (m, 4H, ArH), 3.79 (d, J=13.6 Hz, 1H, CH₂), 2.66 (d, J=13.2 Hz, 1H, CH₂), 1.16 (bs, 2H, NH₂).
¹³C NMR (100 MHz, C₆D₆): 172.6, 162.7 (d), 142.0, 141.6, 135.5, 132.3 (d), 131.9, 128.8, 128.1, 127.9, 127.6, 125.4, 121.1, 116.4 (d), 115.d (d), 64.3, 45.1.
Example 6 Synthesis of (R)-8: (R)-2-amino-2-benzyl-N-(4-cyano-3-(trifluoromethyl) phenyl)-3-(4-fluorophenylsulfonyl)propanamide
A solution of m-Chloro per-benzoic acid (MCPBA) in CH₂Cl₂ (3.5 eq) was added drop wise to a solution of (R)-7a in CH₂Cl₂ at 5° C. The reaction mixture was stirred at this temperature for 1h and than at room value for additional 2 hrs. The reaction was than quenched with a saturated solution of NaHCO₃ and extracted with ethyl acetate. The pure compound was obtained after column chromatography purification and crystallization from ethyl ether/pentane. Isolated yield: 70%.
The same procedure was applied for the synthesis of (R)-9 [(S)-9].
(R)-8 [(S)-8] (eluent: c-Hex/EtOAc=1/1): ¹H NMR (400 MHz, C₆D₆): 9.38 (s, 1H, NH), 7.54 (d, J=2.4 Hz, 1H, ArH), 7.51-7.47 (m, 2H, ArH), 6.92-6.87 (m, 4H, ArH), 6.80-6.73 (m, 3H, ArH), 6.36 (t, J=8.4 Hz, 2H, ArH), 3.84 (d, J=14.0 Hz, 1H, CH₂), 2.77 (dd, J₁=13.2 Hz, J₂=2.4 Hz, 2H, CH₂), 2.22 (d, J=13.6 Hz, 1H, CH₂), 2.04 (bs, 2H, NH₂). ¹³C NMR (400 MHz, C₆D₆): 171.8, 167.9, 164.5, 141.0, 136.5, 135.4, 133.9, 130.8 (d), 130.1, 128.8, 128.1, 127.9, 127.8, 127.6, 121.4, 116.2 (q), 104.8, 63.0, 60.4, 46.6. [α]²⁰ _(D)−144 (c 0.4, CH₃OH).
(R)-9 [(S)-9] (eluent: c-Hex/EtOAc=1/1): ¹H NMR (400 MHz, C₆D₆): 9.39 (s, 1H, NH), 7.54-7.51 (m, 3H, ArH), 7.07-7.05 (m, 2H, ArH), 6.99-6.90 (m, 4H, ArH), 6.76 (d, J=8.4 Hz, 1H, ArH), 6.41 (t, J=9.2 Hz, 2H, ArH), 4.27 (d, J=14.4 Hz, 1H, CH₂), 3.20 (d, J=14.4 Hz, 1H, CH₂), 2.36 (bs, 2H, NH₂). ¹³C NMR (100 MHz, C₆D₆): 170.7, 166.0 (d), 141.2, 139.8, 136.9, 135.4, 130.8 (d), 128.9, 128.5, 128.1, 127.9, 127.6, 125.0, 121.3, 116.3 (q), 104.7, 64.4, 62.5. [α]²⁰ _(D)+85 (c 0.4, CH₃OH).
Example 7 Synthesis of (S)-13: (R)-4-(4-((4-fluorophenylsulfonyl)methyl)-5-oxo-4-phenyl-2-thioxoimidazolidin-1-yl)-2-(trifluoromethyl)benzonitrile
To a solution of (S)/(R)-9 in dry toluene and an excess of di-isopropyl ethylamine (DIPEA), 2 eq. of dipyridyl-thionocarbonate (DPTC) were added in one portion at 100° C. After 3h stirring the reaction mixture was quenched with 0.1 N HCl and extracted with ethyl acetate. The crude compound was purified by silica gel column chromatography. Isolated yield 90%.
The same synthetic procedure was applied to the synthesis of compounds 11 and 37 starting respectively from 8 and 36.
(R)-13: ¹H NMR (400 MHz, Aceton): 8.31 (d, J=7.6 Hz, 1H, ArH), 8.13 (d, J=2.0 Hz, 1H, ArH), 8.01-8.04 (m, 3H, ArH), 7.62 (dd, J1=8.4 Hz, J2=2.0 Hz, 2H, ArH), 7.45-7.39 (m, 5H, ArH), 4.59 (d, 1H, J=15.6 Hz, CH₂), 4.43 (d, 1H, J=15.2 Hz, CH₂), 2.98 (bs, 1H, NH).
¹³C NMR (100 MHz, Aceton): 181.7, 172.3, 167.5, 164.9, 138.2, 136.8, 136.3, 135.6, 133.3, 131.6 (d), 129.6, 129.4, 127.6) d), 125.7, 116.7 (d), 114.9, 110.0, 66.4, 61.3.
(S)-37: ¹H NMR (400 MHz, Aceton): 10.3 (s, 1H, NH)), 8.16 (d, J=8.0 Hz, 1H, ArH), 7.79 (m, 2H, ArH), 7.54-7.38 (m, 7H, ArH), 7.16-7.12 (m, 2H, ArH), 3.79 (d, 1H, J=13.6 Hz, CH₂), 3.49 (d, 1H, J=13.6 Hz, CH₂). ¹³C NMR (100 MHz, Aceton): 180.8, 173.1, 162.3 (d), 137.6, 137.0, 136.1, 133.2, 132.7 (d), 130.3 (d), 129.2, 129.0, 127.2, (q), 126.2, 123.8, 121.1, 115.5, 1125.3, 114.8, 109.7, 71.4, 44.1.
(R)-11: ¹H NMR (400 MHz, CDCl₃): 8.12 (s, 1H, NH), 8.02-7.98 (m, 2H, ArH), 7.83 (d, J=8.4 Hz, 1H, ArH), 7.38-7.26 (m, 6H, ArH), 7.19 (d, J=6.8 Hz, 1H, ArH), 7.08 (s, 1H, ArH), 3.87 (q, J=7.2 Hz, 2H, CH₂), 3.37 (d, J=13.6 Hz, 1H, CH₂), 3.19 (d, J=13.6 Hz, 1H, CH₂). ¹³C NMR (100 MHz, CDCl₃):
180.9, 172.1, 166.4 (d), 136.5, 135.6, 135.5, 132.3, 131.5, 131.3 (d), 130.6, 129.2, 128.9, 127.1, 117.4 (d), 114.9, 110.8, 66.3, 60.3, 43.3.
Example 8 Synthesis of (R)-10: (R)-2-benzyl-N-(4-cyano-3-(trifluoromethyl)phenyl)-3-(4-fluorophenylsulfonyl)-2-(methylsulfonamido)propanamide
MethanSulfonyl chloride (10 eq.) was added to a solution of (R)-8 in pyridine a room temperature. The reaction mixture was than stirred at 50° C. for 5 h and than quenched with 0.1N HCl and extracted with ethyl acetate. The compound was obtained pure in 98% yield.
(R)-10 ¹H NMR (400 MHz, C₆D₆): 8.92 (s, 1H, NH), 7.81 (s, 1H, ArH), 7.43-7.56 (m, 2H, ArH), 7.38 (d, J=8.2 Hz, 1H, ArH), 7.13 (s, 1H, ArH), 7.03-6.81 (m, 3H, ArH), 7.82 (d, J=9.2 Hz, 1H, ArH), 6.38 (t, J=8.4 Hz, 2H, ArH), 6.18 (bs, 1H, HN), 3.97 (d, J=15.2 Hz, 1H, CH₂), 3.77 (d, J=15.2 Hz, 1H, CH₂), 3.63 (d, J=13.6 Hz, 1H, CH₂), 3.55 (d, J=13.6 Hz, 1H, CH₂), 2.82 (s, 3H, CH₃).
(R)-12 ¹H NMR (400 MHz, CDCl₃): 8.89 (s, 1H, NH), 7.98 (s, 1H, ArH), 7.45-7.53 (m, 2H, ArH), 7.36 (d, J=8.2 Hz, 1H, ArH), 7.13-7.15 (m, 1H, ArH), 7.01-6.82 (m, 4H, ArH), 6.38 (t, J=8.4 Hz, 2H, ArH), 3.97 (d, J=15.2 Hz, 1H, CH₂), 3.77 (d, J=15.2 Hz, 1H, CH₂), 3.63 (d, J=13,6 Hz, 1H, CH₂), 3,55 (d, J=13, 6 Hz, 1H, CH₂), 2.82 (s, 3H, CH₃).
Example 9 Synthesis of (S) [or (R)]-20: (S)-2-(tert-butylsulfinylimino)-N-(4-cyano-3-(trifluoromethyl)phenyl)propanamide
A solution of 2-methylpropane-2-sulfinamide (S or R) (1 eq.), Ti(OEt)₄ (3 eq.) and dry THF (4 mL per mmol), was added drop wise to a solution of 19 (2.5 eq.) (obtained according to J. Med. Chem. 2007, 50(5), 1028-1040 and Synthesis 2002, 7, 850-852) in THF (4 mL per mmol) at 40° C. The reaction mixture was stirred at this temperature for 30 min, than solvent was removed under vacuum and the crude material was purified by silica gel column chromatography (eluent: c-Hex/EtOAc=11/9). Isolated yield: 56%.
(S)-20 ¹H NMR (400 MHz, CDCl₃): 9.24 (bs, 1H), 8.06 (s, 1H), 7.92-7.98 (m, 1H), 7.80-7.84 (m, 1H), 2.65 (s, 3H) 1.36 (s, 9H).
¹³C NMR (100 MHz, CDCl₃): 171.1, 160.3, 141.0, 136.2, 134.3(q, J=35 Hz), 122.2, 123.3 (q), 117.5 (q, J=5 Hz), 115.5, 105.5, 59.6, 23.1, 16.8.
Example 10 Synthesis of (S,S)— [or (R,R)]-21: (R)—N-(4-cyano-3-(trifluoromethyl)phenyl)-2-((R)-1,1-dimethylethylsulfinamido)-3-(4-fluorophenylsulfonyl)-2-methylpropanamide
n-BuLi (3 eq.; 2.5 M in haxane) was added drop wise to a solution of of fluoro-4-(methylsulfonyl)benzene (3.2 eq.) in dry THF (4 mL×mmol) at room temperature. the reaction mixture was than stirred for 1 h and than cooled at −45° C. Afterwards, a solution of (S) [or (R)]-20 (1 eq.) in THF (2 mL×mmol) was added drop wise. The mixture was than stirred at −20° C. for 1 h and than quenched with 0.1N HCl and extracted with diethyl ether. The crude compound was isolated by silica gel column chromatography. Isolated yield: 68%.
(R,R)-21 ¹H NMR (400 MHz, CDCl₃): 9.05 (bs, 1H), 7.98 (s, 1H), 7.90-7.96 (m, 2H), 7.79-7.82 (m, 2H), 7.19-7.26 (m, 2H), 6.02 (s,1H), 4.06 (d, J=14 Hz, 1H), 3.73 (d, J=14 Hz, 1H), 1.84 (s, 3H) 1.45 (s, 9H). ¹³C NMR (100 MHz, CDCl₃): 170.9, 166.4 (d, J=257 Hz), 141.2, 136.2, 134.7 (q, J=36 Hz) 131.1 (d, J=13.8 Hz), 122.3 (q), 122.3, 117.6 (q, J=5 Hz), 117.0 (d, J=22.9 Hz), 115.5, 105.5, 63.1, 62.7, 56.9, 24.8, 23.2. [α]²⁰ _(D)+13.0 (c 0.4, CH₃OH); MP: 96-98° C.
Example 11 Synthesis of (S)— [or (R)]-23: (R)-2-amino-N-(4-cyano-3-(trifluoromethyl)phenyl)-3-(4-fluorophenylsulfonyl)-2-methyl propanamide
HCl (2M in Et₂O, 16 eq.) was added drop wise to a solution of (R,R)-21 (1 eq.) in dry MeOH (5 mL×mmol) cooled at −5° C. The reaction mixture was than stirred at room temperature for 3 h. The solvent was than removed under vaccum and the crude material was than washed with a saturated solution of NaHCO3 and extracted with EtOAc. The pure compound was obtained by chrystalization from ethyl ether/pentane. Isolated yield: 93%.
(R)-≦¹H NMR (400 MHz, CDCl₃): 10.3 (bs, 1H), 7.99 (s, 1H), 7.86-7.92 (m, 2H), 7.76-7.82 (m, 2H), 7.13-7.19 (m, 2H), 4.15 (d, J=14 Hz, 1H), 3.27 (d, J=14 Hz, 1H), 2.52 (bs, 2H) 1.49 (s, 3H). ¹³C NMR (100 MHz, CDCl₃): 173.1, 166.7 (d, J=258 Hz), 141.8, 136.0, 134.6 (q, J=36 Hz) 131.1 (d, J=13.6 Hz), 123.3 (q), 121.8, 117.3 (q, J=5 Hz), 116.8 (d, J=22.9 Hz) 115.7, 104.7, 63.9, 57.5, 29.1. [α]²⁰ _(D)+27.0 (c 0.4, CH₃OH); MP: 126-128° C. IR (CDCl₃, cm⁻¹) 3405, 3277, 2983, 2928, 2229, 1694, 1591, 1516, 1326.
Example 12 Synthesis of (R)-22: (R)—N-(4-cyano-3-(trifluoromethyl)phenyl)-2-(1,1-dimethylethylsulfonamido)-3-(4-fluorophenyl sulfonyl)-2-methylpropanamide
m-chloro perbenzoic acid (1.3 eq.) was added to a solution of (R,R)-21 (1 eq.) in dry CH₂Cl₂ (35 mL×mmol). The reaction mixture was stirred at room temperature for 2 h.
EtOAc was than added to the solution and the organic layer was than washed with a saturated solution of Na₂S₂O₃ followed by a saturated solution of Na₂CO₃. The crude material was purified by silica gel column chormatography. Isolated yield: 91%.
(R)-22 ¹H NMR (400 MHz, CDCl₃): 9.50 (bs, 1H, NH), 7.99 (d, J=1.2 Hz, 1H, ArH), 7.93-7.89 (m, 2H, ArH), 7.80-7.73 (m, 2H, ArH), 7.21-7.17 (m, 2H, ArH), 6.26 (bs, 1H, NH), 4.04 (d, J=14.4 Hz, 1H, CH₂), 3.50 (d, J=14.4 Hz, 1H, CH₂), 1.90 (s, 3H, CH₃), 1.57(s, 9H, ^(L)au). ¹³C NMR (100 MHz, CDCl₃): 169.9, 141.4, 135.7, 131.0, 130.9, 122.1, 117.5, 117.4, 117.0, 116.8, 115.4, 63.4, 63.1, 61.2, 24.5, 24.1.
Example 13 Synthesis of (R)-28: (R)-4-(4-((4-fluorophenylsulfonyl)methyl)-4-methyl-2,5-dioxoimidazolidin-1-yl)-2-(trifluoro methyl)benzonitrile
To a solution of (S)/(R)-23 in dry toluene and an excess of di-isopropyl ethylamine (DIPEA), 6 eq. of carbonyldiimidazole (CDI) were added in one portion at room temperature and than brought to 100° C. After 12 h stirring the reaction mixture was quenched with 0.1 N HCl and extracted with ethyl acetate. The crude compound was purified by silica gel column chromatography. Isolated yield 90%.
The same procedure was followed for the synthesis of (S)-14d and (S)-14e.
(R)-28 ¹H NMR (400 MHz, CDCl₃): 8.06 (s, 1H), 7.90-8.0 (m, 4H), 7.22-7.32 (m, 2H), 6.91 (bs, 1H), 3.70 (d, J=16.4 Hz, 1H), 3.66 (d, J=16.4 Hz, 1H), 1.72(s, 3H). ¹³C NMR (100 MHz, CDCl₃): 172.7, 166.5(d, J=257 Hz), 153.4, 136.1, 135.7, 134.6 (q, J=36 Hz) 131.1 (d, J=9.8 Hz), 128.9, 123.9 (q, J=4.6 Hz), 122.4 (q), 117.3 (d, J=22.6 Hz), 115.1, 109.3, 61.5, 59.3, 24.8. [α]²⁰ _(D)+11.0 (c 0.4, Acetone); IR (CDCl₃, cm⁻¹) 3360, 2960, 2928, 2240, 1733, 1731, 1402. MS m/z(E.I.) 455(M+), 434, 282, 254, 213.
(S)-14d ¹H NMR (400 MHz, CDCl₃): 8.09 (s, 1H, ArH), 7.96-7.93 (m, 2H, ArH), 7.58 (d, J=9.2 Hz, 2H, ArH), 6.91 (d, J=9.2 Hz, 2H, ArH), 4.33 (d, J=9.6 Hz, 1H, CH₂), 4.14 (d, J=9.2 Hz, 1H, CH₂), 1.68 (s, 3H, CH₃). ¹³C NMR (100 MHz, CDCl₃): 172.5, 160.8. 153.9, 136.1, 165.7, 134.5, 128.3, 123.4, 118.8, 115.6, 115.0, 109.1, 106.0, 71.2, 61.9, 20.5.
(S)-14e ¹ NMR (400 MHz, Aceton): 8.22 (s, 1H, NH), 8.14 (d, J=8.0 Hz, 1H, ArH), 7.75-7.15 (m, 4H, ArH), 7.33-7.30 (m, 5H, ArH), 7.21 (d, J=9.2 Hz, 2H, ArH), 4.70 (d, J=10.0 Hz, 1H, CH₂), 4.56 (d, J=9.6 Hz, 1H, CH₂), 3.40 (AB system, J₁=13.6 Hz, J₂=5.2 Hz, 2H, CH₂). ¹³C NMR (100 MHz, Aceton): 172.1, 161.8, 153.6, 136.7, 136.2, 134.3, 133.8, 130.6, 129.4, 128.6, 127.7, 123.9 (q, CF₃), 123.4 (q), 18.7, 116.0, 115.0, 108.2, 105.170.5, 66.5, 39.0.
For the synthesis of (R)-27 the authors followed the same procedure reported for example 7.
(R)-27 ¹H NMR (400 MHz, CDCl₃): 8.08-7.80 (m, 6H), 7.22-7.34 (m, 2H), 3.74 (d, J=14.8 Hz, 1H), 3.67 (d, J=14.8 Hz, 1H), 1.74(s, 3H). ¹³C NMR (100 MHz, CDCl₃): 180.8, 173.3, 167.5, (d, J=257 Hz), 136.9, 135.7, 134.6 (q, J=36 Hz), 132.4, 131.2 (d, J=9.3 Hz), 127.2, 123.4, 122.8 (q), 117.4 (d, J=22.5 Hz), 115.0, 110.9, 61.7, 61.3, 24.3. IR (CDCl₃, cm⁻¹) 1731, 1591, 1462, 1377. MS m/z (E.I.) 471(M+), 442, 380, 346, 282, 213.
Example 14 Synthesis of (R)-24: (R)-1-(4-cyano-3-(trifluoromethyl)phenylamino)-3-(4-fluorophenylsulfonyl)-2-methyl-1-oxopropan-2-aminium chloride
4 eq. of 0.2N HCl in Et₂O were added drop wise to a solution of (R)-22 dissolved in dry MeOH and cooled at 5° C. The reaction mixture was stirred at room temperature for 3 h and the solvent removed under vacuum. The compound was crystallized from CH₃CN/Et₂O and the yield was quantitative.
¹H NMR (400 MHz, d⁶-DMSO): 12-11.4 (bs, 1H), 8.95-8.40 (bs, 3H, NH3⁺), 8.19 (s, 1H), 8.16-8.0 (m, 2H), 7.85(bs, 2H), 7.22-7.16 (m, 2H), 5.36 (d, J=15.6 Hz, 1H), 4.05 (d, J=15.6 Hz, 1H), 1.75 (s, 3H). ¹³C NMR (100 MHz, d⁶-DMSO): 167.6 163.8(d, J=257 Hz), 143.0, 136.8, 135.0, 131.2(d, J=9.4 Hz), 123.4, 117.8, 117.2 (d, J=23.4 Hz), 116.3, 103.3, 100.4, 58.5, 23.9.
Example 15 Synthesis of (R/S)-29: 4-((4-fluorophenylsulfonyl)methyl)-4-methyl-3-(methylsulfonyl)-2,5-dioxoimidazolidin-1-yl)-2-(trifluoromethyl)benzonitrile
To a solution of (R)-28 in dry CH₂Cl₂, methanesulfonyl chloride (3 eq.), triethylmine (6 eq.) and dimethyl amino pyridine (1 eq.) were successively added at room temperature. The reaction mixture was stirred for 5 h and tan quenched with 0.1 N HCl and extracted with ethyl acetate. The compound was purified by silica gel column chromatography. Isolated yield: 90%.
The same procedure was applied for the synthesis of (R/S)-30, while for the synthesis of (R/S)-31 and (R/S)-32 di-isopropylamine was used instead of trietylamine.
(S)-29 ¹H NMR (400 MHz, CDCl₃): 8.07 (s, 1H, ArH), 8.02-7.82(m, 4H, ArH), 7.30 (t, J=8.0 Hz, 2H, ArH), 4.25 (d, J=14.4 Hz, 1H, CH₂), 3.77 (s, 3H, CH₃), 3.76 (d, J=14.0 Hz, 1H, CH₂), 1.94 (s, 3H, CH₃). ¹³C NMR (100 MHz, CDCl₃): 170.8, 151.2, 13.9, 135.3, 135.0, 131.1 (d), 129.8, 124.7, 117.4 (d), 114.8, 64.8, 59.8, 43.5, 31.1, 25.1.
(R)-30 ¹H NMR (400 MHz, CDCl₃): 8.03 (d, J=10.2 Hz, 1H, ArH), 7.96-7.92 (m, 3H, ArH), 7.83 (d, J=10.0 Hz, 1H, ArH), 7.29 (t, J=8.0 Hz, 2H, ArH), 4.35 (d, J=14.4 Hz, 1H, CH₂), 4.00 (s, 3H, CH₃), 3.76 (d, J=14.4 Hz, 1H, CH₂), 1.98 (s, 3H, CH₃). ¹³C NMR (100 MHz, CDCl₃): 178-8, 171.9, 167.9, 165.4, 136.6, 136.0, 135.2 (d), 134-6, 131.1 (d), 127.8 (q), 123.3, 117.4 (d), 114.8, 111.7, 67.5, 60.5, 44.6, 25.6.
(S)-31 ¹H NMR (400 MHz, CDCl₃): 7.95-7.91 (m, 3H, ArH), 7.77-7.68 (m, 4H, ArH), 7.32-7.26 (m, 4H, ArH), 3.99 (d, J=14.4 Hz, 1H, CH₂), 3.77 (d, J=14.4 Hz, 1H, CH₂), 2.43 (s, 3H, CH₃), 1.84 (s, 3H, CH₃). ¹³C NMR (100 MHz, CDCl₃): 174.6, 167.8, 165.2, 164.9, 144.9, 1379, 136.8, 135.9 (d), 132.2, 131.4 (d), 130.0, 127.0 (d), 117.3 (d), 114.8, 111.3, 64.0, 51.9, 28.1, 21.9.
(S)-32 ¹H NMR (400 MHz, CDCl₃): 8.02 (d, J=8.4 Hz, 1H, ArH), 7.96-7.92 (m, 2H, ArH), 7.85 (s, 1H, ArH), 7.81 (d, J=8.2 Hz, 1H, ArH), 4.00 (d, J=15.2 Hz, 1H, CH₂), 3.77 (d, J=15.2 Hz, 1H, CH₂), 3.05 (s, 3H, CH₃), 1.84 (s, 3H, CH₃). ¹³C NMR (100 MHz, CDCl₃): 174.6, 167.8, 165.8, 165.3, 137.9, 136.2, 135.7 (d), 134.6, 132.5, 131.4 (d), 127.0 (d), 123.3, 120.6, 117.3 (d), 114.7, 111.7, 63.9, 52.3, 41.9, 27.9.
(S)-2 6 For the synthesis of (S)-26 the authors started from (S)-23 and followed the same procedure reported for the example 8.
¹H NMR (400 MHz, CDCl₃): 9.33 (s, 1H, NH), 7.90-7.84 (m, 4H, ArH), 7.59-7.51 (m, 2H, ArH), 7.37 (d, J=8.0 Hz, 2H, ArH), 7.16-7.09 (m, 3H, ArH), 3.96 (d, J=14.4 Hz, 1H, CH₂), 3.96 (d, J=14.8 Hz, 1H, CH₂), 2.46 (s, 3H, CH₃), 1.59 (s, 3H, CH₃). ¹³C NMR (100 MHz, CDCl₃): 169.6, 167.5, 164.9, 144.9 141.2, 138.0, 135.6, 135.2, 135.1, 134.0, 133.7, 131.0 (d), 130.2, 127.2, 122.4, 117.7 (d), 116.7 (d), 115.2, 105.162.0, 61.5, 23.2, 21.6.
Example 16 Drug Library Screening was Performed on LNCaP Cells, a Human Prostate Hormone Sensible Tumour Cell Line
Furthermore, the compounds with the highest anti-tumour activity, were tested on LNCaP-AR line, derived from LNCaP, with hormone refractory prostate cancer (HRPC) features.
Cell Lines
Evaluation of the cytotoxic effect of novel antiandrogens to select the most active compounds was performed in different in vitro human prostate cancer models: LNCaP cells, derived from a prostatic cancer lymph node lesion responsive to the antiandrogen treatment, obtained from the American Type Culture Collection (ATCC); LNCaP-AR line, derived from LNCaP with HRPC features, engineered to stably-express high levels of AR (a generous gift of Dr. Sawyers of the Memorial Sloan Kettering Institute, NY); PC3 and DU145, two hormone-refractory prostate cancer cell lines non expressing AR receptor, purchased from ATCC. Finally, compounds were also tested on HepG2 cells, originally isolated from a primary hepatoblastoma of an 11-year-old boy, purchased from ATCC. The cell lines were maintained as a monolayer at 37° C. and subcultured weekly. Culture medium was composed of RPMI 1640 supplemented with 10% fetal calf serum and 1% glutamine (Mascia Brunelli s.p.a., Milan, Italy). Cells were used in the exponential growth phase in all the experiments.
Compounds
(R)-Bicalutamide and compounds (R,S)-23, (R,S)-28, (R,S)-27, (R,S)-22, (R,S)-26, (R)-24, (R,S)-29, (R,S)-30, (R,S)-8, (R,S)-9, (R,S)-31, (S)-32, (R)-11, (S)-36, (S)-37, (R)-10, (R)-13, (S)-7d, (S)-14d were tested. Compounds were dissolved in acetone or DMSO (AITES) (10 μM) and stored at −20° C. The cell culture containing acetone at the highest concentration was used as the control.
R1881 is a commercially available synthetic radiolabeled androgen methyltrienolone-17β-hydroxy-17-methyl-estra-4,9.11-trien-3-one, native ligand of the androgen receptor.
In vitro Chemosensitivity Assay
Sulforhodamine B (SRB) assay was used according to the method by Skehan et al. (JNCI,1990). Briefly, cells were collected by trypsinization, counted and plated at a density of 5,000 cells/well in 96-well flat-bottomed microtiter plates (100 μl of cell suspension/well). In the chemosensitivity assay, experiments were run in octuplicate, and each experiment was repeated three times. The optical density (OD) of cells was determined at a wavelength of 490 nm by a colorimetric plate reader.
Data Analysis
Growth inhibition and cytocidal effect of drugs were calculated according to the formula reported by Monks et al. (JNCI,1991):
[(OD_(treated)−OD_(zero))/(OD_(control)−OD_(zero))]×100%,
when OD_(treated) is >to OD_(zero).
If OD_(treated) is above OD_(zero), treatment has induced a cytostatic effect, whereas if OD_(treated) is below OD_(zero), cell killing has occurred. The OD_(zero) depicts the cell number at the moment of drug addition, the OD_(control) reflects the cell number in untreated wells and the OD_(treated) reflects the cell number in treated wells on the day of the assay.
TUNEL Assay
Cells were fixed in 1% paraformaldehyde in PBS on ice for 15 min, suspended in ice cold ethanol (70%) and stored overnight at −20° C. Cells were then washed twice in PBS and resuspended in PBS containing 0.1% Triton X-100 for 5 min at 4° C. Thereafter, samples were incubated in 50 μl of solution containing TdT and FITC-conjugated dUTP deoxynucleotides 1:1 (Roche Diagnostic GmbH, Mannheim, Germany) in a humidified atmosphere for 90 min at 37° C. in the dark, washed in PBS, counterstained with propidium iodide (2.5 μg/ml, MP Biomedicals, Verona, Italy) and RNAse (10 Kunits/ml, Sigma Aldrich, Milan, Italy) for 30 min at 4° C. in the dark and analyzed by flow cytometry.
Flow Cytometric Analysis
After the end of drug exposures, medium was removed and cells were detached from the flasks by trypsin treatment, washed twice with PBS and stained according to the different methods specified below. Flow cytometric analysis was performed using a FACS Canto flow cytometer (Becton Dickinson, San Diego, Calif.). Data acquisition and analysis were performed using FACSDiva software (Becton Dickinson). Samples were run in triplicate and 10,000 events were collected for each replica. Data were the average of three experiments, with errors under 5%.
Colony-Forming Cell Assay
The colony-forming cell assay was used as previously described [Motta M R et al., Exp Hematol 1997; 25:1261-1269]. In brief, for each molecule, 5×10⁴ cells were plated in duplicate in a complete culture medium (MethoCult H4434, StemCell Technologies, Vancouver, Canada) containing different concentrations (0.2, 2, and 20 μmol/l) of the compound. After 14 days of incubation in a humidified atmosphere of 5% CO₂ at the temperature of 37° C., granulocyte macrophage colony-forming unit (GM-CFU) aggregates of more than 50 cells were counted. Control cells were incubated under the same conditions but in drug-free medium.
Results
Cytotoxic Activity of (R)-Bicalutamide and its Derivative Compounds on the LNCaP Cell Line (FIGS. 1-29)
The authors examined the antitumour activity of the compounds for which the synthesis is described above, in the hormone-sensitive prostate cancer cell line LNCaP. (R)-Bicalutamide and the novel compounds were tested at the increasing concentrations of 0.002, 0.2, 2.0, and 20.0 mM. The highest dose used was chosen on the basis of the clinically achievable peak plasma concentration reported in the literature for bicalutamide (Cockshott ID. Clin Pharmacokinet. 2004; 43 (13) 855-78).
After 144-hr exposure time, the cytotoxic effect of the molecules was calculated according to the method of Monks et al. (Monks A, et al., J. Nat. Cancer Inst. 1991; 83: 757-66). Among the compounds with only cytostatic effect, (S)-8, (S)-9, (S)-36 and (R)-22 showed to be able to suppress completely the cell growth at the highest concentration tested. (S)-22, (R)-11, (S)-26, (R)-9, (S)-37, (R)-10, (R)-8, showed also cytocidal activity. Results are reported in Table 1.
TABLE 1 Growth inhibition (GI₅₀) and cytocidal effects by 50% (LC₅₀) of bicalutamide and its derivative compounds observed in LNCaP cells. Drugs GI₅₀ [μM] LC₅₀ [μM] (R)-Bicalutamide 1.8 n.r. (R)-23 10.6 n.r. (S)-23 9.4 n.r. (S)-28 1.8 n.r. (R)-27 15.2 n.r. (S)-22 7 19.8 (S)-24 11.6 n.r. (R)-22 5.8 20 (R)-26 9.3 n.r. (S)-26 6.3 18.3 (R)-28 14.9 n.r. (R)-29 12.3 n.r. (S)-29 12.5 n.r. (S)-27 16.5 n.r. (R)-30 n.r. n.r. (S)-30 n.r. n.r. (R)-31 n.r. n.r. (S)-31 n.r. n.r. (S)-32 n.r. n.r. (S)-8 10.4 n.r. (R)-11 8.5 n.r. (R)-9 1.6 15 (S)-37 5.8 16.8 (S)-9 4 n.r. (S)-36 4.3 n.r. (R)-10 7.4 17.7 (R)-13 14 n.r. The table lists the GI₅₀ and LC₅₀ values of (R)-Bicalutamide and of novel anti-androgen compounds observed in LNCaP cells. The control substance bicalutamide has a GI₅₀ of 1.8 μM and does not shows any cell killing activity even at the highest concentration tested value (LC50 indicated as “not reached”. Thus, bicalutamide does not have an apoptotic effect. The most effective compounds (R)-22, (R)-10, (S)-22, (S)-26, (R)-9 and (S) −37 showed LC₅₀ values ranging from 15 to 20 μM. n.r. = “not reached”
Cytotoxic Effect and Apoptotic Activity of Bicalutamide Derivatives on PC-3 and DU145 Cell Lines (FIG. 31-35)
The authors tested the antitumour activity of the compounds also on PC-3 and DU145 cancer cell lines, representative of hormone-refractory prostate cancer due to AR receptor absence. The compounds (S)-22, (S)-26, (R)-9, (S)-37 and (R)-10, although cytotoxic on PC-3 and DU145 cells, showed a significant reduction in their cytotoxic proprieties when compared to their cytotoxic effects on LNCaP and LNCaP-AR cells. This suggests that the activity of the compounds is AR receptor-dependent and that the compounds are very selective.
Cytotoxic Effect and Apoptotic Activity of (R)-Bicalutamide Derivatives on the LNCaP Cell Line.
The FIG. 36 reports the dose-effect curves, with the relative GI₅₀ and LC₅₀ values, as already reported in Table 1, and the dot plots showing the apoptotic fraction induced by bicalutamide and (S)-26, (R)-9, (S)-37, (R)-10 compounds in LNCaP cells.
The FIG. 37 reports the dose-effect curves, with the relative GI₅₀ and LC₅₀ values, and the dot plots showing the apoptotic fraction induced by bicalutamide and (S)-26, (R)-9, (S)-37, (R)-10 compounds in LNCaP-AR cells
The apoptotic data are reported in Table 2.
TABLE 2 Percentage of apoptotic cells, detected by TUNEL assay, in LNCaP and LNCaP-AR cells after 144-h exposure time to bicalutamide and its most effective derivative compounds Apoptotic cells (%) Drugs LNCaP LNCaP-AR Bicalutamide 2.1 1.0 (S)-22 6.2 0.0 (S)-26 77.5 91.6 (R)-9 93.5 83.5 (S)-37 93.4 89.5 (R)-10 35.5 42.7
The table compares the ability of (R)-bicalutamide and of the most effective compounds to induce apoptotis in LNCaP cells and in its derivative cell line LNCaP-AR, expressing high level of AR and with hormone refractory prostate cancer (HRPC) features. The cells, before TUNEL assay, were continuously exposed to the anti-androgen compounds for 144 hours at the concentration of 20.0 μM.
All the compounds showed to be able to induce higher cell death in LNCaP cells than the control substance bicalutamide. (R)-26, (R)-9, (S)-37, (R)-10 maintain a similar apoptotic property in both LNCaP and LNCaP-AR cells. (R)-10 and (R)-26 seem to be more active, in terms of apoptosis induction, in the LNCaP derivative cell line. This could suggest a higher binding affinity for AR of (R)-26, (R)-9, (S)-37, (R)-10 in respect of bicalutamide that would explain their higher antitumour activity.
Ability of the Drugs to Inhibit Clonogenic Growth of Normal Stem Cells Derived from Human Peripheral Blood Stem Cells.
The authors also evaluated the potential toxicity of some of the novel compounds in normal cells as the ability of the drugs to inhibit clonogenic growth of normal stem cells derived from human peripheral blood stem cells (FIG. 38). The exposure of hematopoietic precursor to the compounds, caused low ((S)-37) or negligible (, (R)-22, (R)-23, (R)-10) toxicity at the highest concentration tested.
Example 17 Quantification of the Human Androgen Receptor (hAR) Transcriptional Activity
Constructs
The cDNA coding hAR was cloned into the pSG5 expression vector as reported previously [Chang, C. S., et al., Science (1988)240:324-326]. The 3416 construct (ARE-Luc), containing four copies of the wild-type slp-HRE2 (5′-TGGTCAgccAGTTCT-3′)(SEQ ID No. 1) was cloned in the NheI site in pTK-TATA-Luc [Verrijdt, G. et al., J. Biol. Chem.(2000)275:12298-12305].
Transactivation Assay
For androgen-stimulated transcriptional analysis, 32×10⁴ Cos-7 cells were plated in phenol red-free DMEM containing 5% charcoal-stripped serum. After 48 h, the cells were transfected by Superfect (Qiagen) with 0.3 μg of 3416-pTK-TATA-Luc construct, together with 1.5 μg of either pSG5-empty plasmid or pSG5-hAR expressing plasmid. After 18 h, transfected cells were stimulated for 24 h with 10 nM of the synthetic androgen, R1881 (from Perkin-Elmer; dissolved in 0.001% ethanol, final concentration), in the absence or presence of the indicated concentrations of synthetic compounds. When indicated, the synthetic compounds were added alone to the cell medium. The anti-androgen Casodex (Astra-Zeneca) was used at 10 μM. It was dissolved in 0.001% (final concentration) ethanol. Control cells were treated with the vehicle alone. Lysates were prepared and the luciferase activity was measured using a luciferase assay system (Promega). The results were corrected using CH110-expressed beta-galactosidase activity (Amersham Biosciences) and luciferase activity was expressed as fold induction. Results were obtained from two or three different experiments, each performed in duplicate. Mean and SEM are shown.
AR Detection by Western Blot
For detection of ectopically expressed AR, lysates from COS cells transfected with pSG5-hAR plasmid were prepared as described [Migliaccio, et al., EMBO J. (1998)17:2008-2018]. Lysates from cells transfected with the empty pSG5 plasmid were used in parallel, as a control. Protein concentrations were measured using a Bio-Rad protein assay kit (Bio-Rad Laboratories). Lysates (2 mg/ml protein concentration) were submitted to SDS-PAGE (12% acrylammide) and separated proteins were then transferred to nitrocellulose transfer membrane (Protran; Whatman GmbH) as previously described [Migliaccio, A. et al., EMBO J. (1998) 17:2008-2018]. To reveal expression of AR, nitrocellulose membranes were finally submitted to Western blot using the rabbit polyclonal anti-AR antibodies (either C-19 or N-20; from Santa Cruz) as described [Castoria, G. et al., J. Cell Biol. (2003) 161 : 547-556].
Results
FIG. 39 shows that 10 nM R1881 increases by about 11 fold the transcriptional activation mediated by AR ectopically expressed in Cos-7 cells and assayed using an ARE-reporter gene (LANE 3). The antiandrogen Casodex (at 10 μM, LANE 4) inhibits such an activation. Similar inhibition is observed in cells treated with 10 nM R1881 in the presence of 10 μM (R)-9 compound (LANES 10-14). The compound (R)-22 (LANES 10-14) does not seem to be a pure antagonist, since it shows antagonistic activity when used at 10 μM in cells challenged with 10 nM R1881, whereas it functions as agonist in the range between 100 nM-10 μM.
FIG. 40 shows that 10 nM R1881 increases by about 11 fold the transcriptional activation mediated by AR ectopically expressed in Cos-7 cells and assayed using an ARE-reporter gene. The antiandrogen Casodex (at 10 μM) inhibits such an activation. Similar inhibition is observed in cells treated with 10 nM R1881 in the presence of 10 μM (R)-8. (R)-12 does not interfere in the transcriptional activity mediated by hAR in cells challenged with 10 nM R1881. It does not show agonistic activity when used alone in range between 10 nM-10 μM.
FIG. 41 shows that 10 nM R1881 increases by about 11 fold the transcriptional activation mediated by AR ectopically expressed in Cos-7 cells and assayed using an ARE-reporter gene. The antiandrogen Casodex (at 10 μM) inhibits such an activation. A robust transcriptional activation is observed in cells challenged with (R)-7c compound. It increases by about 15 fold the transcriptional activity of AR when used in the range between 10-100 nM. Its agonistic activity is inhibited by the pure antiandrogen Casodex (at 10 μM). (R)-26 does not show antagonistic activity.
FIG. 42 shows that 10 nM R1881 increases by about 11 fold the transcriptional activation mediated by AR ectopically expressed in Cos-7 cells and assayed using an ARE-reporter gene. The antiandrogen Casodex (at 10 μM) inhibits such an activation. A strong transcriptional activation is observed in cells challenged with (S)-14e compound. It increases by about 55 fold the transcriptional activity of AR when used at 100 nM.
FIG. 43 shows that 10 nM R1881 increases by about 11 fold the transcriptional activation mediated by AR ectopically expressed in Cos-7 cells and assayed using an ARE-reporter gene. The antiandrogen Casodex (at 10 μM) inhibits such an activation. Inhibition of androgen-induced transcriptional activation is observed in cells challenged with (S)-26 compound. It, however, also shows agonistic activity at 100 nM.
FIG. 44 shows that 10 nM R1881 increases by about 11 fold the transcriptional activation mediated by AR ectopically expressed in Cos-7 cells and assayed using an ARE-reporter gene. The antiandrogen Casodex (at 10 μM) inhibits such an activation. A strong inhibition of androgen-induced transcriptional activation is observed in cells challenged with (R)-11 compound, which does not show agonistic activity in the authors' experimental conditions.
Example 18 Cytotoxic Activity of the Drugs on the Human Hepatoblastoma Cell Line HepG2
The authors evaluated in vitro the potential hepato-toxicity of some of the novel compounds on HepG2 cell line, a human hepatoblastoma cell line that retains the specialized function of normal hepatocytes [Knowles B B, et al., Science 1980, 209:497-499; Aden D P, et al., Nature, 1979, 282:615-616]. As shown in FIG. 45, a significant toxicity was observed only when this cell line was exposed to the compound (S)-37, reaching values of GI₅₀ and LC₅₀ of 7.4 μM and 17.7 μM, respectively. The other compounds, (R)-22, (R)-23, (R)-10, caused only negligible toxicity also at the highest concentration tested.
1. 2. The compound according to claim 1 represented by the following stereoisomer structure:
wherein the substituents are defined as in claim
1. 3. The compound according to claim 1 having the formula III, IV or V:
wherein X⁴ is O, S, —SO—, —SO₂—, —NH— or —NR^(a)— in which R^(n) is H, C₁-C₄ alkyl; R, R¹¹ and R¹⁵ are as defined in claim 1; and X⁶ is O or S.
4. The compound according to claim 1 having the formula selected from the group consisting of:
wherein R¹³ is C₁-C₄-alkyl, —CO—, —CS—, —SO—, —SO₂—, —R^(p)CO—, —R^(p)CS—, —R^(p)SO—, —R^(p)SO₂— in which R^(p) is a C₁-C₃-alkyl; R¹⁵ is —C—S—; R¹⁸ is aryl, C₁-C₄-alkyl, C₁-C₄-heteroalkyl, C₁-C₄-arylalkyl, C₁-C₄-heteroarylalkyl, substituted C₁-C₄-arylalkyl, substituted C₁-C₄-heteroarylalkyl or it is A as defined in claim 1; and the other substituents are defined as in claim
1. 5. The compound according to claims 1 being selected from the following structures:
6. The compound according to claim 1 being a selective androgen receptor modulator (SARM). 7-12. (canceled)
13. A pharmaceutical composition comprising the compound according to claims 1 and/or its isomer, pharmaceutically acceptable salts, crystal or N-oxide, hydrate or any combination thereof.
14. A method for the preparation of a compound according to claim 1 according to one of the synthetic procedures reported in scheme 1 or 2:
wherein R¹³ is —CO— or —CS—, —SO—, —SO₂—, —R^(p)CO—, —R^(p)CS—, —R^(p)SO—, wherein R^(p) is a C₁-C₃-alkyl; R¹⁵ is —C—S—; R¹⁸ is aryl, C₁-C₄-alkyl, C₁-C₄-heteroalkyl, C₁-C₄-arylalkyl, C₁-C₄-heteroarylalkyl, substituted C₁-C₄-arylalkyl, substituted C₁-C₄-heteroarylalkyl or it is A as defined in claim 1; X⁵ is a leaving group; L is selected from the group consisting of metal[[,]] and metal halides; or L is selected from the group consisting of Li and MgX⁶, wherein X⁶ is halogen; LG, LG¹, LG² and LG³ are independent leaving groups; and the other substituents are defined as in claim
1. 15. The compounds of claim 1, wherein R⁴ is methyl (methylene).
16. The compound of claim 1, wherein R⁶ bears one or two oxo substituents selected from the group consisting of furyl, thinly, pyrrolyl, pyridyl, imidazolyl, thiazolyl, pyrimidinyl, thiadiazolyl, triazolyl, benzimidazolyl, bnzothiazolyl, indolyl, bebzothienyl, quinolyl, isoquinolyl, benzofuryl, and 1,2-dihydro-2-oxoquinolyl..
| 8,635 |
6946328_1
|
Court Listener
|
Open Government
|
Public Domain
| 2,022 |
None
|
None
|
English
|
Spoken
| 389 | 468 |
Treat, Justice, delivered the opinion of the Court: (1) At the October term, 1838, of the De Kalb Circuit Court, an action of trespass was tried, in which Crafts was plaintiff, and the Halls defendants. The jury found a verdict for Crafts for $16, and the Court rendered judgment thereon. In 'July, 1839, the Halls filed their bill in chancery against Crafts, alleging that in the suit at law, after the jury had retired to consider of their verdict, while deliberating, and before agreeing upon their verdict, the constable in charge of the jury told them that the judge had instructed him to inform the jury, that unless they agreed upon their verdict in fifteen minutes, they must leave the room they occupied ; that, a short time afterwards, the officer told the jury the judge had again directed him to say to them, that if they did not agree in five minutes, they must leave the room ; that these messages were delivered to the jury late in the evening, the weather being cold, and if the jury had been compelled to leave the room, there was no other comfortable room to which they could have been taken ; that the jury were influenced by these messages from the officer to find the verdict for Crafts, and would otherwise have found for the complainants. The bill further alleges, that the complainants did not know of this interference with the deliberations of the jury, until the term of the Court had closed; and concludes with a prayer that the verdict may be set aside, and a new trial granted. At the June term, 1840, Crafts filed his demurrer to the bill, which was overruled by the Court. He then filed his answer denying the allegations of the bill. It appears, from the depositions taken in the cause, that four of the jurors were examined. They state, that after deliberating for one or two hours on the case, the constable in charge of the jury made the statements to them as charged in the bill; that they found their verdict in a few minutes afterwards ; but they positively deny that these statements of the officer had the least influence upon the jury, in making their verdict. This is all the testimony in relation to the interference .with the jury.
| 48,466 |
https://openalex.org/W2738147752
|
OpenAlex
|
Open Science
|
CC-By
| 2,017 |
CALHM1-Mediated ATP Release and Ciliary Beat Frequency Modulation in Nasal Epithelial Cells
|
Alan D. Workman
|
English
|
Spoken
| 8,595 | 16,152 |
CALHM1-Mediated ATP Release
and Ciliary Beat Frequency
Modulation in Nasal Epithelial Cells
Alan D. Workman1, Ryan M. Carey1, Bei Chen2, Cecil J. Saunders2, Philippe Marambaud3,
Claire H. Mitchell4, Michael G. Tordoff5, Robert J. Lee2 & Noam A. Cohen2,6 Received: 27 March 2017
Accepted: 23 June 2017
Published online: 27 July 2017 Mechanical stimulation of airway epithelial cells causes apical release of ATP, which increases ciliary
beat frequency (CBF) and speeds up mucociliary clearance. The mechanisms responsible for this ATP
release are poorly understood. CALHM1, a transmembrane protein with shared structural features
to connexins and pannexins, has been implicated in ATP release from taste buds, but it has not been
evaluated for a functional role in the airway. In the present study, Calhm1 knockout, Panx1 knockout,
and wild-type mouse nasal septal epithelial cells were grown at an air-liquid interface (ALI) and
subjected to light mechanical stimulation from an air puff. Apical ATP release was attenuated in Calhm1
knockout cultures following mechanical stimulation at a pressure of 55 mmHg for 50 milliseconds
(p < 0.05). Addition of carbenoxolone, a PANX1 channel blocker, completely abolished ATP release
in Calhm1 knockout cultures but not in wild type or Panx1 knockout cultures. An increase in CBF was
observed in wild-type ALIs following mechanical stimulation, and this increase was significantly
lower (p < 0.01) in Calhm1 knockout cultures. These results demonstrate that CALHM1 plays a newly
defined role, complementary to PANX1, in ATP release and downstream CBF modulation following a
mechanical stimulus in airway epithelial cells. Effective mucociliary clearance, achieved through the coordination and modulation of ciliary beating, plays a
critical role in respiratory defense. The cilia propel an airway surface liquid (ASL) that traps aerosolized debris
and pathogens to the oropharynx, where it can be eliminated by either swallowing or expectoration1. Individuals
who have immotile or dysfunctional cilia, such as those with primary ciliary dyskinesia or cystic fibrosis, are
predisposed to frequent respiratory infections2, 3. When cilia are working properly, even small increases in ciliary
beat frequency (CBF) can dramatically speed up clearance of the ASL4.fi q
y
y p
p
Several mechanisms exist in ciliated cells of the respiratory system to tightly control CBF and maintain effi-
ciency. Many of these regulatory pathways result in increased extracellular ATP in the airway lumen5, which in
turn increases the intracellular free Ca2+ concentration6–8, which subsequently results in an increase in CBF. Specifically, ATP binds two types of purinergic receptors, P2X and P2Y, on the apical surface7, 9, 10, with each
receptor serving a unique purpose in modifying intracellular Ca2+. www.nature.com/scientificreports www.nature.com/scientificreports www.nature.com/scientificreports Received: 27 March 2017
Accepted: 23 June 2017
Published online: 27 July 2017 CALHM1-Mediated ATP Release
and Ciliary Beat Frequency
Modulation in Nasal Epithelial Cells
Alan D. Workman1, Ryan M. Carey1, Bei Chen2, Cecil J. Saunders2, Philippe Marambaud3,
Claire H. Mitchell4, Michael G. Tordoff5, Robert J. Lee2 & Noam A. Cohen2,6 P2X receptors cause Ca2+ influx via ATP-gated
Ca2+ permeable channels, and P2Y receptors cause Ca2+ release from intracellular stores via heterotrimeric
G-protein activation of phospholipase C and the generation of inositol 1,4,5-trisphosphate (IP3)11–14. Following
ATP stimulation of either receptor, the resulting free Ca2+ in the cytoplasm enhances CBF15, 16. Apyrase, a com-
pound that degrades extracellular ATP, abolishes CBF increases following mechanical stimulation17.h p
g
g
The release of endogenous ATP from the cytoplasm to the airway surface involves pathways that are acti-
vated by mechanosensors on the ciliated cells18. In addition, forces generated by breathing, sneezing, or coughing
result in ATP release from airway epithelial cells19–21. Other mechanical changes, such as liquid shear stress or
hypotonicity, also reliably increase extracellular ATP concentration22–24. The mechanisms that mediate this ATP 1Perelman School of Medicine at the University of Pennsylvania Philadelphia, Philadelphia, PA, USA. 2Department of
Otorhinolaryngology: Head and Neck Surgery, University of Pennsylvania, Philadelphia, PA, USA. 3Feinstein Institute
for Medical Research, Manhasset, NY, USA. 4Department of Anatomy & Cell Biology, University of Pennsylvania
School of Dental Medicine, Philadelphia, PA, USA. 5Monell Chemical Senses Center Philadelphia, Philadelphia, PA,
USA. 6Division of Otolaryngology: Head and Neck Surgery, Philadelphia Veterans Administration Medical Center,
Philadelphia, PA, USA. Correspondence and requests for materials should be addressed to N.A.C. (email: cohenn@
uphs.upenn.edu) 1 www.nature.com/scientificreports/ Figure 1. Apical ATP release 15 seconds after a 55-mmHg air puff in nasal septal epithelial cell cultures from
Calhm1 knockout, Panx1 knockout, and wild-type mice. Bars are means ± SE of 5 cultures each. *p < 0.05,
ANOVA with Dunnett’s multiple comparisons test. Figure 1. Apical ATP release 15 seconds after a 55-mmHg air puff in nasal septal epithelial cell cultures from
Calhm1 knockout, Panx1 knockout, and wild-type mice. Bars are means ± SE of 5 cultures each. *p < 0.05,
ANOVA with Dunnett’s multiple comparisons test. elease have not yet been fully elucidated, but may include exocytotic release of vesicular ATP25 and ion channels
ncluding connexin hemichannels and pannexins26–28. PANX1 (pannexin 1) is a relatively non-selective ion channel26 that has been shown to mediate hypotonic
stress and cellular deformation-induced ATP release in airway epithelium18. Pannexin channel blockers or siRNA
knockdown of Panx1 inhibit ATP release by ~60% in response to hypotonic cell swelling in ciliated epithelial
cell cultures29. Results
ATP R l ATP Release Following a 55-mmHg Air Puff. Prior work established that a 55-mmHg air puff for 50 mil-
liseconds simulates the pressures and timing of a sneeze, and that this is an effective in vitro model of physiologic
dynamic regulation of ciliary beat frequency17. In wild type Air-Liquid Interface (ALI) cultures, CBF is reliably
increased via this mechanical stimulation, and the magnitude of the CBF increase correlates with the pressure
delivered to the apical surface17, 42. Mechanical stimulation of CBF involves ATP release from the cells, purinergic
stimulation, and subsequent increase in intracellular Ca2+ concentration and Protein Kinase A (PKA) activation17. Immediately following a 50-millisecond 55-mmHg air puff, culture airway surface liquid was collected,
d ATP
ifi d A i
l ATP
i
i
d i
ild
l
31 6 f ld (b
li
ATP ATP Release Following a 55-mmHg Air Puff. Prior work established that a 55-mmHg air puff for 50 mil-
liseconds simulates the pressures and timing of a sneeze, and that this is an effective in vitro model of physiologic
dynamic regulation of ciliary beat frequency17. In wild type Air-Liquid Interface (ALI) cultures, CBF is reliably
increased via this mechanical stimulation, and the magnitude of the CBF increase correlates with the pressure
delivered to the apical surface17, 42. Mechanical stimulation of CBF involves ATP release from the cells, purinergic
stimulation, and subsequent increase in intracellular Ca2+ concentration and Protein Kinase A (PKA) activation17. Immediately following a 50-millisecond 55-mmHg air puff, culture airway surface liquid was collected,
and ATP quantified. Apical ATP concentration increased in wild-type cultures 31.6-fold (baseline ATP
0.19 ± 0.02 μM), but only 10-fold in Calhm1 knockout cultures (baseline ATP 0.31 ± 0.04 μM) and 7-fold in
Panx1 knockout cultures (baseline ATP 0.55 ± 0.08 μM) (n = 5 cultures per condition, p < 0.05, ANOVA with
Dunnett’s multiple comparisons test; Fig. 1). This differential ATP release suggests that CALHM1, in addition to
the previously studied ATP release channel PANX1, contributes to respiratory epithelial ATP release following
mechanical stimulation. Immediately following a 50-millisecond 55-mmHg air puff, culture airway surface liquid was collected,
and ATP quantified. CALHM1-Mediated ATP Release
and Ciliary Beat Frequency
Modulation in Nasal Epithelial Cells
Alan D. Workman1, Ryan M. Carey1, Bei Chen2, Cecil J. Saunders2, Philippe Marambaud3,
Claire H. Mitchell4, Michael G. Tordoff5, Robert J. Lee2 & Noam A. Cohen2,6 Membrane stretch triggers Ca2+-independent ATP release through PANX1 channels26, 30, which is
believed to play a role in local signaling to coordinate CBF increases31, 32. Carbenoxolone, a broad spectrum PANX1
channel blocker, inhibits ATP release by 54% from the nasal mucosa in response to physical deformation, while not
completely abolishing the response33. The ATP release that is observed in airway epithelial cells even when PANX1
is blocked18 suggests that redundant pathways might contribute to ATP release following mechanical stimulation. gg
p
y
g
g
Calcium Homeostasis Modulator 1 (CALHM1) is a non-selective, weakly voltage gated Ca2+ permeable ion
channel that shares structural features with connexins and pannexins34. The pore of CALHM1 is ~14 Å wide,
similar to that of connexins34. It is activated in part by membrane depolarization and by decreases in extracellular
Ca2+ concentration35. Originally discovered in an Alzheimer’s disease paradigm36, 37, CALHM1 plays a role in
cortical neuron excitability35 as well as in peripheral taste perception38. Mice that lack the Calhm1 gene show no
avoidance of bitter compounds and no preference for sweet and umami compounds because CALHM1 mediates
the release of ATP from type II taste receptor cells in response to these compounds38. CALHM1-mediated ATP
release is inhibited by ruthenium red, but not by heptanol or carbenoxolone, which block connexins and PANX1,
respectively39. p
y
Calhm1 is expressed in taste buds and in the brain, as well as in a variety of other human tissues, including
the trachea36. We considered that CALHM1 might contribute to ATP release in the airway as other taste medi-
ated signaling proteins have been identified in respiratory epithelial cells40, 41. In the present study, we confirmed
Calhm1 gene expression in airway epithelium and investigated the role of CALHM1 in ATP release in airway
epithelial cells in response to mechanical stimulation that simulates a sneeze. Results
ATP R l Apical ATP concentration increased in wild-type cultures 31.6-fold (baseline ATP
0.19 ± 0.02 μM), but only 10-fold in Calhm1 knockout cultures (baseline ATP 0.31 ± 0.04 μM) and 7-fold in
Panx1 knockout cultures (baseline ATP 0.55 ± 0.08 μM) (n = 5 cultures per condition, p < 0.05, ANOVA with
Dunnett’s multiple comparisons test; Fig. 1). This differential ATP release suggests that CALHM1, in addition to
the previously studied ATP release channel PANX1, contributes to respiratory epithelial ATP release following
mechanical stimulation. Carbenoxolone is a PANX1 channel blocker that has been shown to have no activity in blocking CALHM1
currents43, but is not specific for PANX1 as it blocks other channels, including gap junctions. We incubated
wild-type, Calhm1 knockout, and Panx1 knockout ALI cultures with 150 μM carbenoxolone for 20 minutes prior
to stimulation, a concentration and time period that has been previously used for successful PANX1 blockade44. Apical ATP concentration increased 39 fold in wild type cultures (baseline ATP 0.36 ± 0.09 μM), 16-fold in wild
type cultures incubated with carbenoxolone (baseline ATP 0.29 ± 0.09 μM), 14-fold in Panx1 knockout cultures
incubated with carbenoxolone (baseline ATP 0.25 ± 0.06 μM), and 1.5-fold in Calhm1 knockout cultures incu-
bated with carbenoxolone (baseline ATP 0.36 ± 0.09 μM) (Fig. 2). These differences were significant (p < 0.0001,
ANOVA with Holm-Sidak’s multiple comparison test). These results demonstrate that for ATP release, carbenox-
olone does not have an apparent effect beyond blocking PANX1, and that Calhm1 knockout cultures with blocked
PANX1 (by pre-incubation with carbenoxolone) have completely abolished ATP release in response to mechan-
ical stimulation. SCIeNtIFIC Reports | 7: 6687 | DOI:10.1038/s41598-017-07221-9 2 www.nature.com/scientificreports/ Figure 2. Apical ATP release 15 seconds after a 55-mmHg air puff in nasal septal epithelial cell cultures
from wild-type (control) mice, and Calhm1 knockout, Panx1 knockout, and wild-type mice preincubated
with 150 μM carbenoxolone. Bars are means ± SE of 5–6 cultures each. *p < 0.05, **p < 0.01, ***p < 0.001,
****p < 0.0001, ANOVA with Holm Sidak’s multiple comparisons test. Figure 2. Apical ATP release 15 seconds after a 55-mmHg air puff in nasal septal epithelial cell cultures
from wild-type (control) mice, and Calhm1 knockout, Panx1 knockout, and wild-type mice preincubated
with 150 μM carbenoxolone. Bars are means ± SE of 5–6 cultures each. *p < 0.05, **p < 0.01, ***p < 0.001,
****p < 0.0001, ANOVA with Holm Sidak’s multiple comparisons test. Results
ATP R l Figure 3. (a) CBF Increases 15 seconds after 1-μM ATP addition or 55-mmHg air puff in nasal septal epithelial
cell cultures from Calhm1 knockout and wild-type mice. Bars are means ± SE of 3–6 cultures each. (b) ATP
degradation in Calhm1 knockout wild-type mice. 5 × 10−7 M ATP was added to the apical surface t = 0, and
apical ATP concentration was measured at six distinct time intervals following this addition. All Apical ATP
concentrations are adjusted for a 3.6 μl ASL volume. Figure 3. (a) CBF Increases 15 seconds after 1-μM ATP addition or 55-mmHg air puff in nasal septal epithelial
cell cultures from Calhm1 knockout and wild-type mice. Bars are means ± SE of 3–6 cultures each. (b) ATP
degradation in Calhm1 knockout wild-type mice. 5 × 10−7 M ATP was added to the apical surface t = 0, and
apical ATP concentration was measured at six distinct time intervals following this addition. All Apical ATP
concentrations are adjusted for a 3.6 μl ASL volume. Calhm1 and Ciliary Beat Frequency Modulation. While the role of PANX1 as an airway ATP release
channel has been well documented45, the presence and function of CALHM1 in the airway has not been estab-
lished. Previous studies have demonstrated that PANX1 blockade attenuates ciliary beat frequency increases,
which are driven by ATP release46. To further investigate the properties of the CALHM1 ATP release pathway, we
asked whether the reduced ATP observed in the Calhm1 knockout cultures was also accompanied by a reduced
CBF. Prior experiments have demonstrated that maximal changes in CBF occur at 15 seconds following mechan-
ical stimulation17. In response to a 50 millisecond 55-mmHg air puff, CBF of wild-type cultures (n = 12, baseline
12.4 ± 0.9 Hz) increased above baseline frequency at 15 seconds post-stimulation, while in the Calhm1 knockout
cultures (n = 12, baseline 8.7 ± 1.2 Hz), the CBF increase was significantly smaller (Fig. 3a) (p < 0.01, two-tailed
t-test). The difference in baseline CBF frequency was also statistically significantly different between the two
conditions (p < 0.05, two-tailed t test). While ATP release is an early event in the transduction of mechanical
stimulation signals, gap junctions (which are blocked by carbenoxolone) are necessary downstream to increase
CBF47. Supplemental Fig. Results
ATP R l apical surface of the cell cultures, and apical samplings were aspirated at six distinct time intervals (3 per culture). At all time points (15 seconds, 30 seconds, 1 minute, 5 minutes, 15 minutes, 30 minutes), there was no difference
in ATP degradation rate between the cultures (Fig. 3b). Depolarization and CBF Changes. CALHM1 is a weakly voltage-gated channel35, so we set out to test if
KCl in a known depolarizing concentration48 would induce ATP release in ALI cultures. Addition of 50 mM KCl
(control) produced no significant ATP release in wild-type cultures, while addition of 150 mM KCl increased ATP
concentration on the apical surface 4-fold in wild type cultures, which was significantly greater than ATP changes
seen in Calhm1 knockout cultures (n = 3–5 cultures per type, p < 0.01, Kruskal-Wallis with Dunn’s multiple com-
parison test; Fig. 4). This increase in ATP release was a full order of magnitude smaller than that observed with
mechanical stimulation in our previous experiments. Absence of Cellular Lysis following a 55 mmHg Air Puff. To test the hypothesis that cellular lysis fol-
lowing a 55 mmHg air puff was driving cellular ATP release, as opposed to ATP release through CALHM1, we
performed a lactate dehydrogenase (LDH) assay following cellular stimulation (Supplemental Fig. 2). LDH levels
were similarly low both in the control (PBS) and 55 mmHg air puff condition, indicating minimal cellular lysis. In
an air puff of doubled strength (110 mmHg), significant release of LDH was observed above control and 55 mmHg
conditions (n = 3 cultures per condition, p < 0.05, ANOVA with Dunnett’s multiple comparison test). qPCR for Calhm1 and Panx1 in Cells Grown at an Air-Liquid Interface. Using cDNA obtained from
Panx1 knockout, Calhm1 knockout, and wild-type mouse cultures, real-time qPCR was performed to confirm
Calhm1 and Panx1 gene expression in the ALI cultures. Additionally, we confirmed the relative expression levels
of Calhm1 in respiratory epithelium of wild type and Panx1 knockout mice, and the relative expression levels of
Panx1 in wild type and Calhm1 knockout mice. 3–6 replicates using β-actin and 3–6 replicates using target prim-
ers (Calhm1/Panx1) were performed on each cDNA sample, normalizing Calhm1/Panx1 expression to β-actin in
order to determine relative expression in each condition. Calhm1 expression levels were not significantly different
in Panx1 knockout and wild-type mice, and Panx1 expression levels were not significantly different in Calhm1
knockout and wild-type mice (Supplemental Fig. Results
ATP R l 3A and B). Panx1 transcripts are present in wild type samples
at approximately 100 times the level of Calhm1 transcripts. Notably, no relative expression of target genes was
observed in corresponding negative controls; there was no amplification of Calhm1 transcripts in Calhm1 knock-
out cultures or of Panx1 transcripts in Panx1 knockout cultures. Results
ATP R l 1 further supports this hypothesis, as all carbenoxolone pre-incubated cultures (wild
type and Calhm1 knockout) show no CBF changes when stimulated with a 55 mmHg air puff. yp
g
g
pf
To determine whether the reduced ATP release contributed to reduced CBF in the Calhm1 knockout
cultures, 30 μl of 2-μM ATP dissolved in PBS was introduced to the apical surface of three wild-type cul-
tures and three Calhm1 knockout cultures. Each culture had 30 μl of PBS on the apical surface before the
experiment began, resulting in a final corrected ATP concentration (adjusted for an assumed ASL volume
of 3.6 μl) of 16 μM, consistent with a physiologic post-stimulation ATP concentration. ATP was added at
t = 0 seconds, with the post-addition recording occurring at t = 15 seconds. CBF in wild-type cultures (base-
line 13.4 ± 3.7 Hz) and Calhm1 knockout cultures (baseline 13.8 ± 3.8 Hz) increased similarly at 15 seconds
(Fig. 3a). Thus, ATP-dependent CBF responses were intact in the Calhm1 knockout cultures, suggesting that
reduced ATP release contributed to reduced CBF responses to mechanical stimulation in the Calhm1 knock-
out cultures.hf The differences observed in CBF changes between Calhm1 knockout and wild-type mice following mechani-
cal stimulation could also be accounted for by differential degradation of ATP between the two types of cultures,
so we set out to demonstrate equivalence in ATP degradation rates. To test this, 0.5 μM ATP was added to the SCIeNtIFIC Reports | 7: 6687 | DOI:10.1038/s41598-017-07221-9 3 www.nature.com/scientificreports/ Figure 4. Apical ATP release 15 seconds after addition of 50 or 150 mM KCl in wild type and Calhm1 knockout
cultures. Bars are means ± SE of 3–5 cultures each. *p < 0.05, **p < 0.01, Kruskal-Wallis with Dunn’s multiple
comparisons test. Figure 4. Apical ATP release 15 seconds after addition of 50 or 150 mM KCl in wild type and Calhm1 knockout
cultures. Bars are means ± SE of 3–5 cultures each. *p < 0.05, **p < 0.01, Kruskal-Wallis with Dunn’s multiple
comparisons test. apical surface of the cell cultures, and apical samplings were aspirated at six distinct time intervals (3 per culture). At all time points (15 seconds, 30 seconds, 1 minute, 5 minutes, 15 minutes, 30 minutes), there was no difference
in ATP degradation rate between the cultures (Fig. 3b). Discussion Mechanical stimulation of airway epithelial cells causes cellular ATP release and elevated intracellular Ca2+ con-
centration, which in turn increases CBF16, partially due to ATP-activated P2X and P2Y receptors that are mod-
ulatory49–51. Exogenously administered ATP increases CBF, and apyrase (which degrades extracellular ATP) has
been previously shown to abolish the CBF increase following mechanical stimulation in an air puff paradigm17. However, the mechanisms that are involved in the initial ATP release from the cells are poorly defined. PANX1 is
an ion channel that is known to mediate ATP release and CBF changes in the airway46, but PANX1 channel block-
ers or knockdown of Panx1 only reduces this ATP release by approximately 50%18, 33, suggesting that additional
channels are responsible for this persistent ATP release. CALHM1, a pore-forming channel that shares structural
features with connexins and pannexins, has recently been shown to play an essential role in ATP release in taste
receptor cells38. Of additional interest, several studies over the past 5 years have identified taste cell signaling
molecules in ciliated cells of the respiratory epithelium41, 52, 53. Thus, we have investigated whether CALHM1 also
has a role as the “missing channel” in modulation of airway ATP release. Quantitative PCR demonstrated that
the Calhm1 gene was expressed in respiratory cells grown at an ALI, which were used in all of the experiments. f
h
l
l
b
ff
l
l
d
b Mechanical stimulation of airway epithelial cells causes cellular ATP release and elevated intracellular Ca2+ con-
centration, which in turn increases CBF16, partially due to ATP-activated P2X and P2Y receptors that are mod-
ulatory49–51. Exogenously administered ATP increases CBF, and apyrase (which degrades extracellular ATP) has
been previously shown to abolish the CBF increase following mechanical stimulation in an air puff paradigm17. However, the mechanisms that are involved in the initial ATP release from the cells are poorly defined. PANX1 is
an ion channel that is known to mediate ATP release and CBF changes in the airway46, but PANX1 channel block-
ers or knockdown of Panx1 only reduces this ATP release by approximately 50%18, 33, suggesting that additional
channels are responsible for this persistent ATP release CALHM1 a pore forming channel that shares structural channels are responsible for this persistent ATP release. www.nature.com/scientificreports/ www.nature.com/scientificreports/ Thus, our findings are consistent with the hypothesis that CALHM1 plays a complementary and equally
important role to Panx1 in ATP release following cellular stress or deformation of respiratory epithelial cells. CALHM1 also appears to be a critical channel in CBF modulation as a result of this ATP release. Wild type and
Calhm1 knockout cultures did not exhibit any difference in their metabolism of ATP, strengthening the evidence
that channel release is driving the alteration in net apical ATP concentration. Of additional importance is that
CALHM1 does not form gap junctions54, so we suspect that the CBF decrement observed in our knockout exper-
iment is solely due to ATP release, and not due to propagation of the downstream signal. y
p
p g
g
It is known that CALHM1 is regulated by Ca2+ and membrane voltage to gate the channel, but complete
understanding of the mechanism(s) has not been determined35. CALHM1 has also been localized to the endo-
plasmic reticulum55, where it could influence the intracellular Ca2+ homeostasis and signaling in the cell without
being the specific pathway for apical ATP release in response to mechanical stimulation. CALHM1 has also not
yet been demonstrated to be selectively present at the apical membrane of airway cells, so more work is needed
to definitively demonstrate its unambiguous role in mechanically transduced ATP release. Further complicating
the model is that pannexins exhibit properties of ATP-induced ATP release45, so a certain degree of initial ATP
release, possibly through CALHM1, may be necessary for full recruitment of this channel. These pathways are not
yet fully elucidated, but defining the role of CALHM1 in initiating ATP release is a critical first step. y
yi
g
gi
p
CBF measurements and baseline ATP secretion in culture and in tissue explants are physiologic parameters
with high levels of variability. Variations in culture age, degree of culture ciliation, and day-to-day changes in
culture health can cause notable differences in baseline values for these physiologic parameters. To minimize any
variability due to these factors, we ensured that control cultures matched their experimental counterparts in age
and experimental timing. Despite this, baseline differences in CBF persist, even within a single culture. In one of
our experiments, Calhm1 knockout cultures had a statistically significantly lower baseline CBF than matched wild
type cultures. www.nature.com/scientificreports/ This was likely reflective of day-to-day baseline variability and, based on our previous work with the
mouse ALI, should have minimal effects on relative (%) change. However, it is also important to consider that the
differences observed in baseline CBF could be due to effects of the CALHM1 channel. ATP release is also critical
for mucin hydration, which can have effects on CBF56. While this would not affect our experimental paradigm,
in which ASL was removed prior to experimentation, it is nonetheless an important consideration. However, the
Calhm1 knockout mice showed no evidence of phenotypic mucus plugging, nor was there any evidence of inad-
equate ASL hydration in ALI culture.h q
y
The discovery of a functional role for CALHM1 outside of the brain and taste buds suggests that the channel
may have yet undiscovered functions in additional tissue types. The presence of CALHM1 in the airway, and
its proposed role in mechanical signal transduction, has important implications for understanding regulation
of mucociliary clearance and its dysregulation in diseases such as chronic rhinosinusitis. Human upper airway
tissue from patients with chronic rhinosinusitis demonstrates a blunted stimulation of CBF when presented with
a mechanical stimulus17, and this may play a critical role in the pathogenesis of the disease. Additionally, tis-
sue from chronic rhinosinusitis patients also shows a blunted response following addition of exogenous ATP57. Reduced morbidity can be achieved in chronic rhinosinusitis patients by improving mucociliary movement, and
subsequent clearance of pathogens, debris, and stagnant mucus. While exact functions are not fully known, it is
possible that CALHM1 could be an important therapeutic target for this type of respiratory pathology. Discussion CALHM1, a pore-forming channel that shares structural
features with connexins and pannexins, has recently been shown to play an essential role in ATP release in taste
receptor cells38. Of additional interest, several studies over the past 5 years have identified taste cell signaling
molecules in ciliated cells of the respiratory epithelium41, 52, 53. Thus, we have investigated whether CALHM1 also
has a role as the “missing channel” in modulation of airway ATP release. Quantitative PCR demonstrated that
the Calhm1 gene was expressed in respiratory cells grown at an ALI, which were used in all of the experiments. g
p
p
y
g
p
After mechanical stimulation by a 55-mmHg pressure air puff, apical ATP release and subsequent CBF
increases were significantly lower in Calhm1 knockout cultures than in wild-type cultures. Exogenously applied
ATP increased CBF to an equivalent extent in cultures derived from both Calhm1 knockout and wild-type mice. Carbenoxolone, a PANX1 channel blocker that has no effect on the CALHM1 channel, completely abolishes ATP
release following mechanical stimulation when applied to Calhm1 knockout cultures, while leaving residual (pre-
sumably CALHM1-mediated) ATP release intact when applied in Panx1 knockout cultures. SCIeNtIFIC Reports | 7: 6687 | DOI:10.1038/s41598-017-07221-9 4 Methods Once the cultures equilibrated
to 26 °C, CBF during four 15-second intervals was recorded to determine a baseline frequency. The air puff was
then delivered, and measurements were recorded every 15 seconds. ATP Release Assay. The apical surfaces of the ALI cultures were washed 3 times with PBS, and then incu-
bated for 30 minutes with 50 μl of fresh PBS on the apical surface. Five minutes before the air puff, 10 μl of apical
fluid was aspirated and diluted 10 times in PBS, and then boiled for 2 minutes to prevent degradation of ATP. At 15 seconds following the air puff, another 10 μl of apical fluid was aspirated, diluted 10 times in PBS, and
then boiled for 2 minutes. Each ATP assay was carried out immediately following the experiment. The Enliten
ATP assay kit (Promega, Madison WI, USA) was used for ATP quantification. A 10-μl blank, ATP standard, or
sample solution was added to the wells of a 96-well microplate, and 100 μl of luciferin-luciferase (rL/L) reagent
was added. A luminometer (Luminoskan Ascent 2.5; Thermo Labsystems, Franklin, MA, USA) quantified the
ATP present in each sample using a 10-second integration time. As apical fluid volume varied depending on
experimental conditions, all reported values are normalized to a 3.6 μl ASL volume, which has been experimen-
tally determined to be the residual fluid on the apical surface following aspiration or clearance63. This correc-
tion is performed to approximate a physiologically relevant ATP concentration for use in future experimental
paradigms; the volume of apical fluid used in our experiments for technical feasibility is higher than would be
expected in vivo. qPCR. Wild-type, Calhm1 knockout, and Panx1 knockout cells grown for several weeks at an ALI were lysed
using QiaShredder (Qiagen, cat# 79656) and total RNA was purified with an RNeasy Micro Kit (Qiagen, cat#
74004) according to standard protocols. Following purification, RNA was reverse-transcribed with an Invitrogen
SuperScript III First-Strand cDNA Synthesis kit (Themo Fisher, cat# 18080051). Using this cDNA, real-time
qPCR was carried out with SYBR® Green PCR Master Mix (Applied Biosystems, cat# 4309155) on an Applied
Biosystems 7500 Real-Time PCR System (Applied Biosystems) for the analysis of β-actin, Calhm1, and Panx1
genes. Primers were obtained from PrimePCR™ Assays and Controls (Bio-Rad) for ActB (β-actin) and Panx1, and
Calhm1 primers were obtained from Integrated DNA Technologies (F-primer: AGAACTTGCTCGCCTACTGG
R-primer: CTCTTGAGAAAGGCGACCTG). Methods Compressed air (Airgas Corp., Radnor, PA, USA) was released at the apical surface via a
22-gauge plastic catheter (BD, Franklin Lakes, NJ, USA) for 50 milliseconds, regulated by a Pico-Spritzer II
2-valve microinjector ejector (General Valve Corp., Fairfield, NJ, USA). In contrast with the experimental
methods used by Zhao et al., the catheter was placed directly in the center of the transwell to deliver a more
uniform stimulation across the transwell. The catheter was attached to a micromanipulator, which allowed
for placement 6 mm above the apical surface, directly in the center of the transwell (3.25 mm away from each
transwell side). )
A manometer (Traceable Manometer/Pressure/Vacuum Gauge, 3460; Control Co., Friendswood, TX, USA)
was used to calibrate the pressure delivered to the culture. The transwell insert was sealed with a stopper that
had two 22-gauge holes, with pressure being applied through one hole while the other hole was connected to the
manometer. CBF Imaging and Analysis. Ciliated areas in all cultures tested were observed using a 20X objective on an
inverted microscope (Leica Microsystems, Bannockburn, IL, USA). A model A602f-2 Basler area scan high-speed
monochromatic digital video camera (Basler AG, Ahrensburg, Germany) captured images at 100 frames/s with
a resolution of 650 × 480 pixels. Digital image signals from the camera were sampled by an acquisition board
(National Instruments, Austin, TX, USA) on a Dell XPS 710 workstation (Dell, Inc., Round Rock, TX, USA)
running the Windows XP Professional operating system (Microsoft, Redmond, WA, USA). Video images were
analyzed with the Sisson-Ammons Video Analysis (SAVA) software (National Instruments) that is specialized
to quantify CBF62 by performing a whole-field analysis of the ciliated apical surface of the cultures, reporting a
CBF that is the arithmetic mean of all of the cilia in the video field. Consistent with prior imaging analyses17, any
videos in which less than 5% of the imaged field was ciliated were excluded. In reporting CBF values, changes
were normalized per convention to a basal frequency of 100%, with increases and decreases in CBF reported as a
percentage of this baseline frequency6, 17.fhf p
g
q
y
All experiments were conducted using air puff pressures of 55 mmHg. The air puff was always delivered to the
middle of the transwell, 6 mm above the apical surface fluid, for 50 milliseconds. Methods All protocols were reviewed and approved by the Research and Development Committee at the Philadelphia
Veterans Affairs Medical Center and were carried out in accordance with both the University of Pennsylvania and
The Philadelphia VA Medical Center guidelines for vertebrate animal studies from the Institutional Animal Care
and Use Committee of the Philadelphia Veterans Affairs Medical Center. Reagents. The ATP, Carbenoxolone (CBX), and KCl used in these experiments were all purchased from
Sigma-Aldrich (St. Louis, MO, USA). All Dulbecco’s PBS was supplemented with Ca2+ and Mg2+ using 100 mg/L
of anhydrous CaCl2 and MgCl2-6H2O, respectively. For potassium chloride (KCl) addition experiments, all KCl
was dissolved in PBS without NaCl and then osmolarity of the solution was adjusted to 290 mOsm with NaCl
addition. Mice. Nasal specimens from Calhm1 knockout mice35, 36, Panx1 knockout mice58, and wild type littermates
were obtained from breeding colonies maintained at the Monell Chemical Senses Center (Philadelphia, PA). Panx1 knockout mice also had a passenger mutation in caspase 4/11. Both lines were maintained by backcross-
ing to C57BL/6J mice. Heterozygous mice were mated brother-to-sister to produce homozygous wild type and
knockout mice for the experiments reported here. Air-Liquid Interface (ALI) Cultures. We previously described the culture of mouse nasal septal epithe-
lium at an ALI59. Briefly, nasal septal epithelial cells were harvested from sinonasal complex specimens and were
digested with collagenase and pronase. Cells were grown on Costar 6.5-mm transwell permeable filter supports
(Corning Inc. Life Sciences, Lowell, MA, USA). For the first 7 days, the cells were fully submerged in culture
medium, and subsequently fed from only the basal chamber. Cilia appeared within two weeks, and cultures were
used within 3–5 weeks. Unless otherwise noted, transwell inserts (#3470, Corning) were removed from media before experiments and
placed in a transwell containing 600 μl of Hank’s Balanced Salt Solution (HBSS) with vitamins. 30 μl of PBS was
added to the apical surface of the transwell insert unless a different volume was specified, and the cultures were
allowed to adjust for 15 minutes to 26 °C to ensure a steady baseline ciliary beat frequency60, 61. SCIeNtIFIC Reports | 7: 6687 | DOI:10.1038/s41598-017-07221-9 5 www.nature.com/scientificreports/ Delivery of Air Puff. Air puff delivery to the ALI was performed as described by Zhao17, with one nota-
ble modification. References p
,
,
g p j
p
y
f
,
,
doi:10.1007/s00018-007-7200-1 (2008). 29. Ransford, G. A. et al. Pannexin 1 contributes to ATP release in airway epithelia. American journal of respiratory cell and molecular
biology 41 525 534 doi:10 1165/rcmb 2008 0367OC (2009) doi:10.1007/s00018-007-7200-1 (2008). 29. Ransford, G. A. et al. Pannexin 1 contributes to ATP release in airway epithelia. American journal of respiratory cell and molecular
biology 41, 525–534, doi:10.1165/rcmb.2008-0367OC (2009). 9. Ransford, G. A. et al. Pannexin 1 contributes to ATP release in airway epithelia. American journal of respiratory cell and molecula
biology 41, 525–534, doi:10.1165/rcmb.2008-0367OC (2009). gy
(
)
30. Okada, S. F., Nicholas, R. A., Kreda, S. M., Lazarowski, E. R. & Boucher, R. C. Physiological regulation of ATP release at the apical
surface of human airway epithelia. The Journal of biological chemistry 281, 22992–23002, doi:10.1074/jbc.M603019200 (2006). P
H A & L
J ATP
l
f
bl
ll
P
ll
d
/ h
1. Praetorius, H. A. & Leipziger, J. ATP release from non-excitable cells. Purinergic signalling 5, 433–446, doi:10.1007/s11302-009
9146-2 (2009). 32. MacVicar, B. A. & Thompson, R. J. Non-junction functions of pannexin-1 channels. Trends in neurosciences 33, 93–102,
doi:10.1016/j.tins.2009.11.007 (2010). j
(
)
33. Ohbuchi, T. et al. Possible contribution of pannexin-1 to ATP release in human upper airway epithelia. Physiological reports 2,
e00227, doi:10.1002/phy2.227 (2014). p y
(
)
34. Siebert, A. P. et al. Structural and functional similarities of calcium homeostasis modulator 1 (CALHM1) ion channel
connexins, pannexins, and innexins. The Journal of biological chemistry 288, 6140–6153, doi:10.1074/jbc.M112.409789 (2013) h
35. Ma, Z. et al. Calcium homeostasis modulator 1 (CALHM1) is the pore-forming subunit of an ion channel that mediates extracel
Ca2+ regulation of neuronal excitability. Proceedings of the National Academy of Sciences of the United States of America
E1963–1971, doi:10.1073/pnas.1204023109 (2012).l p
(
)
36. Dreses-Werringloer, U. et al. A polymorphism in CALHM1 influences Ca2+ homeostasis, Abeta levels, and Alzheimer’s disease risk. Cell 133, 1149–1161, doi:10.1016/j.cell.2008.05.048 (2008).hi j
7. Lambert, J. C. et al. The CALHM1 P86L polymorphism is a genetic modifier of age at onset in Alzheimer’s disease: a meta-analysi
study. Journal of Alzheimer’s disease: JAD 22, 247–255, doi:10.3233/JAD-2010-100933 (2010). y
f
8. Taruno, A. et al. CALHM1 ion channel mediates purinergic neurotransmission of sweet, bitter and umami tastes. Nature 495
223–226, doi:10.1038/nature11906 (2013). 39. Ma, Z. M. et al. References Zhang, L. & Sanderson, M. J. Oscillations in ciliary beat frequency and intracellular calciu
epithelial cells induced by ATP. The Journal of physiology 546, 733–749 (2003). p
yh
f p y
gy
9. Wong, L. B. & Yeates, D. B. Luminal purinergic regulatory mechanisms of tracheal ciliary beat frequency. American journal o
respiratory cell and molecular biology 7, 447–454 (1992). respiratory cell and molecular biology 7, 447–454 (1992). p
y
gy
0. Braiman, A., Gold’Shtein, V. & Priel, Z. Feasibility of a sustained steep Ca(2+)Gradient in the cytosol of electrically non-excitable
cells. Journal of theoretical biology 206, 115–130, doi:10.1006/jtbi.2000.2104 (2000). f
gy
j
(
)
1. Harden, T. K., Boyer, J. L. & Nicholas, R. A. P2-purinergic receptors: subtype-associated signaling responses and structure. Annua
review of pharmacology and toxicology 35, 541–579, doi:10.1146/annurev.pa.35.040195.002545 (1995). f
gy
j
11. Harden, T. K., Boyer, J. L. & Nicholas, R. A. P2-purinergic receptors: subtype-associated signaling responses
review of pharmacology and toxicology 35, 541–579, doi:10.1146/annurev.pa.35.040195.002545 (1995). 1. Harden, T. K., Boyer, J. L. & Nicholas, R. A. P2-purinergic receptors: subtype-associated signaling responses and structure. Annua
review of pharmacology and toxicology 35, 541–579, doi:10.1146/annurev.pa.35.040195.002545 (1995). ,
,
y , J
,
p
g
p
yp
g
g
p
review of pharmacology and toxicology 35, 541–579, doi:10.1146/annurev.pa.35.040195.002545 (1995). 12. Ralevic, V. & Burnstock, G. Receptors for purines and pyrimidines. Pharmacological reviews 50, 413–492 (1998). g
J
p
p
g
g
(
)
14. Bootman, M. D. et al. Calcium signalling–an overview. Seminars in cell & developmental biology 12, 3–10, doi:10.1006/
scdb.2000.0211 (2001).t 15. Lieb, T., Frei, C. W., Frohock, J. I., Bookman, R. J. & Salathe, M. Prolonged increase in ciliary beat frequenc
purinergic stimulation in human airway epithelial cells. The Journal of physiology 538, 633–646 (2002). 5. Lieb, T., Frei, C. W., Frohock, J. I., Bookman, R. J. & Salathe, M. Prolonged increase in ciliary beat frequency after short-term
p
i
i
ti
l ti
i h
i
pith li l
ll Th J
l f ph i l
538 633 646 (2002) 5. Lieb, T., Frei, C. W., Frohock, J. I., Bookman, R. J. & Salathe, M. Prolonged increase in ciliary beat frequency after short-term
purinergic stimulation in human airway epithelial cells. The Journal of physiology 538, 633–646 (2002). h
16. Lansley, A. B. & Sanderson, M. J. Regulation of airway ciliary activity by Ca2+: simultaneous measurement of beat frequency and
intracellular Ca2+. Methods β-actin was used as the house-keeping gene, and Calhm1 and
Panx1 gene expression was determined by the 2−ΔΔC
T method64, which uses fluorescence and threshold values
(CT) to compare the relative amount of target mRNA. PCR cycling conditions were 95 °C for 30 seconds, 65 °C for
30 seconds, and 72 °C for 45 seconds. All target expression levels were normalized relative to β-actin expression
levels from paired cDNA samples. Statistics. GraphPad Prism5 (GraphPad Software, San Diego, CA, USA) was used for all statistical analyses,
with results shown as means ± standard error. Kolmogorov-Smirnov (KS) testing for a Gaussian distribution was
used to confirm normality of data and the use of parametric testing. An unpaired Student’s t-test was used for all
comparisons unless otherwise noted, or if a non-parametric test was indicated by KS testing. A value of p < 0.05
was considered to be statistically significant. Data Availability. All data generated or analyzed during this study are available from the corresponding
author on reasonable request. 6 SCIeNtIFIC Reports | 7: 6687 | DOI:10.1038/s41598-017-07221-9 www.nature.com/scientificreports/ SCIeNtIFIC Reports | 7: 6687 | DOI:10.1038/s41598-017-07221-9 References Biophysical journal 77, 629–638, doi:10.1016/S0006-3495(99)76919-5 (1999).fi 16. Lansley, A. B. & Sanderson, M. J. Regulation of airway ciliary activity by Ca +: simultaneous measurement of beat
intracellular Ca2+. Biophysical journal 77, 629–638, doi:10.1016/S0006-3495(99)76919-5 (1999).fi p y
j
17. Zhao, K. Q. et al. Molecular modulation of airway epithelial ciliary response to sneezing. FASEB journal: official publication of the
Federation of American Societies for Experimental Biology 26, 3178–3187, doi:10.1096/fj.11-202184 (2012).h j
8. Seminario-Vidal, L. et al. Rho signaling regulates pannexin 1-mediated ATP release from airway epithelia. The Journal of biologica
chemistry 286, 26277–26286, doi:10.1074/jbc.M111.260562 (2011). y
j
9. Kallok, M. J., Lai-Fook, S. J., Hajji, M. A. & Wilson, T. A. Axial distortion of airways in the lung. Journal of applied physiology
respiratory, environmental and exercise physiology 54, 185–190 (1983).h 20. Grygorczyk, R. & Hanrahan, J. W. CFTR-independent ATP release from epithelial cells triggered by mechanical stimuli. The
American journal of physiology 272, C1058–1066 (1997). American journal of physiology 272, C1058–1066 (1997). j
f p y
gy
1. Homolya, L., Steinberg, T. H. & Boucher, R. C. Cell to cell communication in response to mechanical stress via bilateral release o
ATP and UTP in polarized epithelia. The Journal of cell biology 150, 1349–1360 (2000).h p
ph
f
gy
2. Guyot, A. & Hanrahan, J. W. ATP release from human airway epithelial cells studied using a capillary cell culture system. The Journa
of physiology 545, 199–206 (2002).h 23. Lazarowski, E. R. et al. Nucleotide release provides a mechanism for airway surface liquid homeostasis. The Journal of biological
chemistry 279, 36855–36864, doi:10.1074/jbc.M405367200 (2004).ihf y
j
24. Tarran, R. et al. Normal and cystic fibrosis airway surface liquid homeostasis. The effects of phasic shear stress and v
The Journal of biological chemistry 280, 35751–35759, doi:10.1074/jbc.M505832200 (2005). h
f
g
y
j
25. Bodin, P. & Burnstock, G. Purinergic signalling: ATP release. Neurochemical research 26, 959–969 (2001). 26. Bao, L., Locovei, S. & Dahl, G. Pannexin membrane channels are mechanosensitive conduits for ATP. FEBS letters 572, 6
doi:10.1016/j.febslet.2004.07.009 (2004). j
7. Qiu, F. & Dahl, G. A permeant regulating its permeation pore: inhibition of pannexin 1 channels by ATP. American journal o
physiology. Cell physiology 296, C250–255, doi:10.1152/ajpcell.00433.2008 (2009). p y
gy
p y
gy
jp
8. Shestopalov, V. I. & Panchin, Y. Pannexins and gap junction protein diversity. Cellular and molecular life sciences: CMLS 65, 376–394
doi:10.1007/s00018-007-7200-1 (2008). References References
1. Boucher, R. C. Regulation of airway surface liquid volume by human airway epithelia. Pflugers Archiv: European journal of physiology
445, 495–498, doi:10.1007/s00424-002-0955-1 (2003). 1. Boucher, R. C. Regulation of airway surface liquid volume by human airway epithelia. Pflugers Archiv: European journal of physiology
445, 495–498, doi:10.1007/s00424-002-0955-1 (2003). (
)
2. Wanner, A., Salathe, M. & O’Riordan, T. G. Mucociliary clearance in the airways. American journal of respiratory and critical care
medicine 154, 1868–1902, doi:10.1164/ajrccm.154.6.8970383 (1996). (
)
2. Wanner, A., Salathe, M. & O’Riordan, T. G. Mucociliary clearance in the airways. American journal of respiratory and critical care
medicine 154, 1868–1902, doi:10.1164/ajrccm.154.6.8970383 (1996). j
3. Hayashi, T. et al. ATP regulation of ciliary beat frequency in rat tracheal and distal airway epithelium. Experimental physiology 90
535–544, doi:10.1113/expphysiol.2004.028746 (2005).fl 535–544, doi:10.1113/expphysiol.2004.028746 (2005).f pp y
(
)
4. Seybold, Z. V. et al. Mucociliary interaction in vitro: effects of physiological and inflammatory stimuli. Journal of applied physiology
68, 1421–1426 (1990).ff ,
(
)
5. Button, B., Picher, M. & Boucher, R. C. Differential effects of cyclic and constant stress on ATP release and mucociliary transport by
human airway epithelia. The Journal of physiology 580, 577–592, doi:10.1113/jphysiol.2006.126086 (2007).hh 5. Button, B., Picher, M. & Boucher, R. C. Differential effects of cyclic and constant stress on ATP release and mucociliary transport by
human airway epithelia. The Journal of physiology 580, 577–592, doi:10.1113/jphysiol.2006.126086 (2007). 6 Zhang L & Sanderson M J The role of cGMP in the regulation of rabbit airway ciliary beat frequency The Journal of physiology human airway epithelia. The Journal of physiology 580, 577–592, doi:10.1113/jphysiol.2006.126086 (2007). 6. Zhang, L. & Sanderson, M. J. The role of cGMP in the regulation of rabbit airway ciliary beat frequency. The Journal of physiology
d
/ h
l
(
) h
6. Zhang, L. & Sanderson, M. J. The role of cGMP in the regulation of rabbit airway ciliary beat frequency. The Journal of physiology
551, 765–776, doi:10.1113/jphysiol.2003.041707 (2003). gh
551, 765–776, doi:10.1113/jphysiol.2003.041707 (2003). jp y
7. Marino, A. et al. Regulation by P2 agonists of the intracellular calcium concentration in epithelial cells freshly isolated from ra
trachea. Biochimica et biophysica acta 1439, 395–405 (1999). p y
(
)
8. Zhang, L. & Sanderson, M. J. Oscillations in ciliary beat frequency and intracellular calcium concentration in rabbit trachea
epithelial cells induced by ATP. The Journal of physiology 546, 733–749 (2003). p y
8. www.nature.com/scientificreports/ 42. Gwaltney, J. M. Jr. et al. Nose blowing propels nasal fluid into the paranasal sinuses. Clinical infectious diseases: an official public
of the Infectious Diseases Society of America 30, 387–391, doi:10.1086/313661 (2000). 42. Gwaltney, J. M. Jr. et al. Nose blowing propels nasal fluid into the paranasal sinuses. Clinical infectious diseases: an official publication
of the Infectious Diseases Society of America 30, 387–391, doi:10.1086/313661 (2000). 43. Taruno, A., Matsumoto, I., Ma, Z., Marambaud, P. & Foskett, J. K. How do taste cells lacking synapses mediate neurotransmission? f
f
y f
3. Taruno, A., Matsumoto, I., Ma, Z., Marambaud, P. & Foskett, J. K. How do taste cells lacking synapses mediate neurotransmission? CALHM1, a voltage-gated ATP channel. BioEssays: news and reviews in molecular, cellular and developmental biology 35, 1111–1118
doi:10.1002/bies.201300077 (2013). 44. Sridharan, M. et al. Pannexin 1 is the conduit for low oxygen tension-induced ATP release from human erythrocytes. American
journal of physiology. Heart and circulatory physiology 299, H1146–1152, doi:10.1152/ajpheart.00301.2010 (2010). 45. Dahl, G. ATP release through pannexon channels. Philosophical transactions of the Royal Society of London. Series B, Biological
sciences 370, doi:10.1098/rstb.2014.0191 (2015). g
p
sciences 370, doi:10.1098/rstb.2014.0191 (2015). 6. Ohbuchi, T. et al. Possible contribution of pannexin-1 to capsaicin-induced ATP release in rat nasal columnar epithelial cells
Channels, 1–8, doi:10.1080/19336950.2017.1293209 (2017). 47. Sanderson, M. J., Charles, A. C. & Dirksen, E. R. Mechanical stimulation and intercellular communication increases intracellular
Ca2+ in epithelial cells. Cell regulation 1, 585–596 (1990).hfi p
g
8. Huang, Y. A. et al. Knocking out P2X receptors reduces transmitter secretion in taste buds. The Journal of neuroscience: the officia
journal of the Society for Neuroscience 31, 13654–13661, doi:10.1523/JNEUROSCI.3356-11.2011 (2011). j
f
y f
9. Davis, C. W. & Dickey, B. F. Regulated airway goblet cell mucin secretion. Annual review of physiology 70, 487–512, doi:10.1146
annurev.physiol.70.113006.100638 (2008). p y
(
)
50. Weiterer, S. et al. Tumor necrosis factor alpha induces a serotonin dependent early increase in ciliary beat frequency and epithelial
transport velocity in murine tracheae. PloS one 9, e91705, doi:10.1371/journal.pone.0091705 (2014). y
j
51. Kunzelmann, K. et al. Control of ion transport in mammalian airways by protease activated receptors type 2 (PAR-2). FASEB
journal: official publication of the Federation of American Societies for Experimental Biology 19, 969–970, doi:10.1096/fj.04-2469fje
(2005). 52. Shah, A. S., Ben-Shahar, Y., Moninger, T. O., Kline, J. N. & Welsh, M. J. Motile cilia of human airway epithelia are chemosensory. www.nature.com/scientificreports/ R., Tarran, R., Garoff, S. & Myerburg, M. M. Measurement of the airway surface liquid volume with simple light refraction
microscopy. American journal of respiratory cell and molecular biology 45, 592–599, doi:10.1165/rcmb.2010-0484OC (2011). 64. Livak, K. J. & Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta
C(T)) Method. Methods 25, 402–408, doi:10.1006/meth.2001.1262 (2001). Author Contributions N.A.C. and A.D.W. designed research, A.D.W., R.M.C., R.J.L., and C.J.S. analyzed data, A.D.W., R.M.C., and B.C. performed research, A.D.W. wrote the manuscript, M.G.T. provided live animals, P.M., C.H.M., R.J.L. and M.G.T. contributed reagents and analytic tools in addition to scientific expertise in manuscript preparation. N.A.C. and A.D.W. designed research, A.D.W., R.M.C., R.J.L., and C.J.S. analyzed data, A.D.W., R.M.C., and B.C. performed research, A.D.W. wrote the manuscript, M.G.T. provided live animals, P.M., C.H.M., R.J.L. and M.G.T. contributed reagents and analytic tools in addition to scientific expertise in manuscript preparation. Acknowledgementsh g
This work was supported by a grant from a philanthropic contribution from the RLG Foundation, Inc. (NAC),
and USPHS grants R01DC013588 (NAC), R01DK046791 and DC10393 (MGT). g
This work was supported by a grant from a philanthropic contribution from the RLG Foundation, Inc. (NAC),
and USPHS grants R01DC013588 (NAC), R01DK046791 and DC10393 (MGT). References CALHM1 is an Extracellular Ca2+- and Voltage-Gated ATP Permeable Ion Channel. Biophysical journal 104, 631A
(2013).h 40. Lee, R. J. et al. Bitter and sweet taste receptors regulate human upper respiratory innate immunity. The Journal of clinical investigation
124, 1393–1405, doi:10.1172/JCI72094 (2014).h J
(
)
1. Lee, R. J. et al. T2R38 taste receptor polymorphisms underlie susceptibility to upper respiratory infection. The Journal of clinica
investigation 122, 4145–4159, doi:10.1172/JCI64240 (2012). SCIeNtIFIC Reports | 7: 6687 | DOI:10.1038/s41598-017-07221-9 7 www.nature.com/scientificreports/ www.nature.com/scientificreports/ Science 325, 1131–1134, doi:10.1126/science.1173869 (2009). 53. Lee, R. J., Chen, B., Redding, K. M., Margolskee, R. F. & Cohen, N. A. Mouse nasal epithelial innate immune responses to
Pseudomonas aeruginosa quorum-sensing molecules require taste signaling components. Innate immunity 20, 606–617,
doi:10.1177/1753425913503386 (2013).l 4. Ma, Z., Tanis, J. E., Taruno, A. & Foskett, J. K. Calcium homeostasis modulator (CALHM) ion channels. Pflugers Archiv: European
journal of physiology 468, 395–403, doi:10.1007/s00424-015-1757-6 (2016). j
f p y
gy
55. Gallego-Sandin, S., Alonso, M. T. & Garcia-Sancho, J. Calcium homoeostasis modulator 1 (CALHM1) reduces the calcium content
of the endoplasmic reticulum (ER) and triggers ER stress. The Biochemical journal 437, 469–475, doi:10.1042/BJ20110479 (2011). k d
d
k
Th l
h
h
l 56. Button, B., Okada, S. F., Frederick, C. B., Thelin, W. R. & Boucher, R. C. Mechanosensitive ATP release maintains proper mucus
hydration of airways. Science signaling 6, ra46, doi:10.1126/scisignal.2003755 (2013). 57. Chen, B. et al. Altered sinonasal ciliary dynamics in chronic rhinosinusitis. American journal of rhinology 20, 325–329 (2006). 58. Dvoriantchikova, G. et al. Genetic ablation of Pannexin1 protects retinal neurons from ischemic injury. PloS one 7, e3
d
/
l
(
) 57. Chen, B. et al. Altered sinonasal ciliary dynamics in chronic rhinosinusitis. American journal of rhinology 20, 325–329 (2006). 58. Dvoriantchikova, G. et al. Genetic ablation of Pannexin1 protects retinal neurons from ischemic injury. PloS one 7, e31991,
doi:10.1371/journal.pone.0031991 (2012). j
59. Antunes, M. B. et al. Murine nasal septa for respiratory epithelial air-liquid interface cultures. BioTechniques 43, 195–196 (2
198, 200 passim.f p
0. Zhang, L. et al. Effects of ephedrine on human nasal ciliary beat frequency. ORL; journal for oto-rhino-laryngology and its related
specialties 70, 91–96, doi:10.1159/000114531 (2008). p
1. Zhou, H. et al. Increased nasal epithelial ciliary beat frequency associated with lifestyle tobacco smoke exposure. Inhalation
toxicology 21, 875–881, doi:10.1080/08958370802555898 (2009).i gy
2. Sisson, J. H., Stoner, J. A., Ammons, B. A. & Wyatt, T. A. All-digital image capture and whole-field analysis of ciliary beat frequency
Journal of microscopy 211, 103–111 (2003).f f
py
63. Harvey, P. R., Tarran, R., Garoff, S. & Myerburg, M. M. Measurement of the airway surface liquid volume with simple light refraction
microscopy. American journal of respiratory cell and molecular biology 45, 592–599, doi:10.1165/rcmb.2010-0484OC (2011). 64 Livak K J & Schmittgen T D Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta 63. Harvey, P. Additional Information Supplementary information accompanies this paper at doi:10.1038/s41598-017-07221-9 Competing Interests: The authors declare that they have no competing interests. Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps an
institutional affiliations. Open Access This article is licensed under a Creative Commons Attribution 4.0 International
License, which permits use, sharing, adaptation, distribution and reproduction in any medium or
format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Cre-
ative Commons license, and indicate if changes were made. The images or other third party material in this
article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the
material. If material is not included in the article’s Creative Commons license and your intended use is not per-
mitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the
copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/. © The Author(s) 2017 8 SCIeNtIFIC Reports | 7: 6687 | DOI:10.1038/s41598-017-07221-9
| 20,841 |
US-202016896197-A_2
|
USPTO
|
Open Government
|
Public Domain
| 2,020 |
None
|
None
|
English
|
Spoken
| 6,077 | 7,157 |
A preferred method for continuously fabricating the composite preforms of the invention is the process described in detail in U.S. Pat. No. 5,897,818 to Lewit (the '818 patent). Generally, a conveyor system, roller-fed fabric or fabrics, and a forming die are used to assemble the composite preform as taught and described in the '818 patent. An upper fabric guide is provided to aid in smoothing the fabric web and properly positioning same as it passes into of the forming die. Foam is injected into, or slightly before, the forming die. The foam expands into interstitial spaces in the fabric layer closest to the foam as the fabric layers are fed through the forming die, such that a composite preform exits the exit side of the forming die that is covered at least partially in one or more fabric layers, the innermost of this is attached to the expanded foam forming the foam core of the composite preform. The composite preform may then be cut to length as described in the '818 patent, or may be cut by any other means including by hand. The final, cut-to-length composite preform may then be saturated with resin, which may then be subsequently cured, by any method known in the art, including the methods of wetting out, or saturating the fabric layer or layers of the composite preform, and curing out taught and disclosed in U.S. Patent Application Publication No. US20140262011A1.
Referring now to FIG. 8, the composite preforms comprising the invention may comprise any foam, any fabric, any number of layers of fabric, and any orientation of fibers as may be desired by a user. A presently preferred embodiment of the composite preforms of the invention may be, but is not necessarily, produced by the process described in detail in the '818 patent, is depicted in FIG. 8. Included within the scope of the method of the present invention are all methods for continuously manufacturing a composite preform taught and disclosed in the '818 patent. In a preferred embodiment of the structural panel of the invention, composite preform foam core 260 is surrounded by non-woven mat fabric 261, which may be a polyester felt mat, which in turn may be surrounded by a 24 ounce per square yard fabric layer 262 comprising fiber layers oriented in an +45 and −45 degree orientation as related to longitudinal axis B of the composite preform 400.
Manufacturing the top plate 101 and bottom plate 210 of the invention.
The top plate depicted as item 101 in the figures of the drawings, and the bottom plate, depicted as item 210 in the figures of the drawings, may each be fabricated by using manufacturing processes known in the art for fabricating laminated plates comprised of at least one, but preferably a plurality, of fabric layers that have been impregnated with resin which is subsequently cured.
Preferably, but not necessarily, the fabric layers comprising top plate 101 and bottom plate 210 may be defined as a combination of layers of fabric, in which multiple combined layers comprising a layer of woven fabric such as, for example, 18 ounce per square yard warp unidirectional E-glass stitched to a layer 1.0 ounces per square foot chopped strand mat (“CSM”) fabric. The CSM fabric provides an inter-layer spacing between the layers of warp unidirectional glass. This spacing creates a separation between the layers of warp unidirectional glass which serves to reduce shear strain forces developed in the layers of warp unidirectional glass when a plate of the invention is subjected to forces such as a bending force. This advantage of the invention over the prior art is depicted in FIGS. 14A and 14B. Referring now to FIG. 14A, a plate of the prior art constructed of two layers of woven fabric which have been impregnated with a resin which is subsequently cured is depicted. A first woven layer I is thus connected to a second woven layer J by the resin between them L. When a prior art plate constructed thusly experiences forces causing it to bend as shown in FIG. 14A, shear strain develop in the resin layer L which is the attachment between layers I and J. Typically, such plates are constructed by overlaying fabric layers I and J, and then impregnating them with resin simultaneously during a wet out process, which is then followed by a resin curing process. Since layers I and J are overlaid, the distance M1 between them may be very small. This can lead to extremely high shear stress or strain values in the connecting resin layer L, which will cause failure in the resin layer L and eventually will propagate when the plate is subjected to further or continued bending loads, causing structural failure of the plate.
In contrast to the prior art panel shown in FIG. 14A, one embodiment of the plates of the invention in which woven fabric layers I and J are separated by an interposing layer of non-woven fabric K as depicted in FIG. 14B. The non-woven fabric layer K, which may be the non-woven layer 261 of FIG. 9, may be stitched to the woven fabric layers I and J which may be the woven fabric layers 270 of FIG. 9. The non-woven fabric layer K serves to increase the separation between woven layers I and J. Thus, when a plate of the invention is subjected to the same bending forces as the example of FIG. 14A, the magnitude of the shear stress or strain developed in resin layers L1 and L2 is substantially less than the shear stress or strain developed in resin layer L in the example of FIG. 14A. This means that an embodiment of the invention which comprises one or more combined layers as depicted in FIG. 14B will experience less shear stress or strain in its resin layers than plates of the prior art, and will be able sustain greater applied force than plates of the prior art. Thus the layer stack sequence depicted in FIG. 14B and further in FIG. 9 is optimized on both a local and global level for reducing shear strain in the composite structure.
Referring now to FIG. 9, an exemplary preferred embodiment of each of top plate 101 and bottom plate 210 is depicted in which the various fabric layers are described. A preferred embodiment of top plate 101 may comprise a plurality of groups of fabric layers, each group comprising at least one but preferably a plurality of woven fabric layers in the group having their unidirectional fibers running in a similar direction and each woven fabric layer in the group separated by a non-woven fabric layer, and each successive fabric layer group having the woven fabric layers unidirectional fibers running at 90° to the unidirectional fibers in the woven fabric layers of the adjacent groups. Thus, a first group R of fabric layers may comprise woven fabric layers 270 separated by non-woven fabric layers 261 and arranged such that the direction of their unidirectional fibers is along the axis indicated by arrow A; followed by a second group S of fabric layers comprising woven fabric layers 270 separated by non-woven fabric layers 261 and arranged such that their unidirectional fibers are oriented along the axis indicated by arrow B which may be transverse to, or oriented at 90° to, direction A; followed by a third group T of woven fabric layers 270 separated by non-woven fabric layers 261 and disposed such that their unidirectional fibers are oriented along the axis indicated by arrow A, and so on. This alternating pattern of groups of fabric layers comprising woven fabric layers 270 separated by non-woven fabric layers 261 and arranged such that their unidirectional fibers are oriented in either the direction of A or B, with each group alternating the direction of their unidirectional fibers, may be comprised of any number of woven fabric layers 270 per group, each woven fabric layer 270 separated by a non-woven layer 261, and the plates of the invention may comprise any number of groups. It is not necessary that the top and bottom plates of the invention comprise the same number of fabric layers, fabric groups, or fabric layers per group. Top plate 101 and bottom plate 210, depicted as rectangular in the figures of the drawings, may take any outline or shape desired and may be any cross-sectional thickness desired as may be required by the particular application for which the structural panel is intended to be used. In the exemplary embodiments described herein, top plate 101 and bottom plate 210 are shown to be rectangular in shape. However, it is to be understood that these are exemplary depictions only and that top plate 101 and bottom plate 210 may take any shape, or be any cross-sectional thickness as may be required by a specific application of the structural panel of the invention.
While woven fabric layers 270 may be any fabric, they are preferably, but not necessarily, comprised of unidirectional warp fabric layers oriented with their unidirectional fibers running as shown in FIG. 9. These woven fabric layers 270 are preferably comprised of a continuous fabric layer, or, other words, there are no overlapping joints as depicted in FIGS. 13A and 13B in in which two pieces of fabric are joined to create a single layer 270. Such overlapping joints, which may be created by overlaying a first fabric layer E onto a second fabric layer F by placing fabric layer E onto fabric layer F in the direction of arrow H and then wetting the joint with resin, followed by curing the resin, are sometimes used in the prior art to attach fabric to a structure, and are weak points in the structure due to the discontinuity of fibers across the joint area D. In such construction using overlapping joints, the resin G between fabric layer E and F must carry all loads applied to the structure because of the discontinuity of the fibers at the joint. Preferred embodiments of the invention have no such overlapping joints in any layer; the preferred embodiments of the invention avoid overlapping joints by utilizing continuous runs of fabric in the buildup of the layers.
Assembling the structural panel top half 100 and bottom half 200.
Referring now to FIG. 10 an exemplary method and assembly procedure for assembling the structural panel top half and structural panel bottom half are now described.
Still referring to FIG. 10, top plate 101 may be oriented as shown and a plurality of composite preforms 400 may be placed in contact with an underneath surface of top plate 101 as shown in FIG. 10. Structural composite preforms 400 may be bonded to the underneath surface of top plate 101 in the areas depicted as 290 in FIG. 10. Each of the composite preforms 400 may be attached to the underneath surface of top plate 101 by any means known in the art but preferably are adhesively or chemically bonded using any known adhesive or chemical bonding agent known in the structural composites arts. Additionally, composite preforms 400 may be attached to the underneath surface of top plate 101 by adding fabric layers placed over composite preforms 400 such that they overlay composite preforms 400 and also overlay a portion of the underneath surface of top plate 101 on each side of each composite preform 400, saturating said fabric layers with resin, and subsequently curing the resin. Such fabric layers, once saturated and cured, serve to not only bond the composite preforms 400 to the underneath surface of top plate 101 but also serve to strengthen structural panel top half 100. Any number of fabric layers may be utilized for the attachment of composite preforms 400 to the underneath surface of top plate 101. In this manner, structural panel top half 100 is fabricated in this exemplary but preferred embodiment of the method of the invention. Any suitable series of steps resulting in the attachment of composite preforms 400 to the underneath surface of top plate 101 described herein may be utilized in the method of the invention. It is to be understood that the specific method and series of steps described herein is exemplary of just one of many embodiments of the method of the invention.
Still referring to FIG. 10, bottom plate 210 may be oriented as shown and a plurality of composite preforms 400 may be placed in contact with and on top of an upper surface of bottom plate 210 as shown in FIG. 10. Structural composite preforms 400 may then be bonded to the upper surface of top plate 101 in the area respected as 295 in FIG. 10 each of the composite preforms 400 may be attached to the upper surface of the bottom plate 210 by any means known in the art but preferably are adhesively or chemically bonded using any known adhesive or chemical bonding agent known in the structural composites arts. Additionally, composite preforms 400 may be attached to the upper surface of bottom plate 210 by adding fabric layers placed over composite preforms 400 such that they overlay composite preforms 400 and also overlay a portion of the upper surface of bottom plate 210 on each side of each composite preform 400, saturating said fabric layers with resin, and subsequently curing the resin. Such fabric layers, once saturated and cured, serve to not only bond the composite preforms 400 to the underneath surface of bottom plate 210 but also serve to strengthen structural panel bottom half 200. Any number of fabric layers may be utilized for the attachment of composite preforms 400 to the upper surface of bottom plate 210. In this manner, structural panel bottom half 200 is fabricated in this exemplary but preferred embodiment of the method of the invention. Any suitable series of steps resulting in the attachment of composite preforms 400 to the upper surface of bottom plate 210 may be utilized in the method of the invention. It is to be understood that the specific method and series of steps described herein is exemplary of just one of many embodiments of the method of the invention.
Assembling the structural panel of the invention.
Still referring to FIG. 10, structural panel top 100 and structural panel bottom half 200 may be assembled together in the following manner to form the structural composite panel of the invention. Structural panel top 100 may be placed upon structural panel bottom half 200 as depicted by the direction lines D in FIG. 10, forming a bonding joint 296 between surfaces of the composite preforms of the structural composite panel top half 100 and the composite preforms of structural composite panel bottom half 200. Structural composite panel top half 100 and structural composite panel bottom half 200 may be attached together using any chemical bonding agent or adhesive known in the structural composite arts to form a completed structural composite panel of the invention as is shown in cross-section in FIG. 5 and an perspective view in FIGS. 1 and 4. It should be noted that structural panel bottom half side plates 220 are optional and may be present in an alternate embodiment of the invention. Thus the structural panel of the invention in various alternate embodiments may, or may not, comprise side plates 220.
It is to be understood that the application of curable resin(s) and other coatings, such as gel coat, may be accomplished in any order or sequence and may be subsequently cured using any process known in the art. For example, the invention comprises the methods and processes for co-curing resins, gel coats and other materials taught and described in United States Patent Application Publication No. US20140199551, CO-CURED GEL COATS, ELASTOMERIC COATINGS, STRUCTURAL LAYERS, AND IN-MOLD PROCESSES FOR THEIR USE, published July 17, 2014. The co-curing methods taught in this U.S. pre-grant patent publication provide toughness, flexibility, chip and crack resistance without sacrificing good adhesion to structural layers of resin-saturated fabrics.
Fabrication and assembly of a non-planar structural panel embodiment.
Referring now to FIGS. 11A and 11B, an alternate embodiment of the invention is depicted. In this embodiment, a support structure 600 having a desired surface shape 601 may be used to shape pre-cured elements of the structural panel 050 such as plates 101 or 102, or composite preforms 400, such that they take a desired shape, which may be any shape. The uncured elements, which are pliable and flexible to a degree, may be placed over and drawn down onto surface 601 using methods known in the art such as vacuum bagging. The elements of the structural panel 050 such as plates 101 or 102, or composite preforms 400, may be wetted with resin and cured using any process known in the art, thus them to take on the desired shape 601 which may be any shape desired by a user but is shown as curved surface for illustrative purposes in FIGS. 11A and 11B. The resulting shaped elements may then be assembled together chemically bonded together to form a structural panel of the invention that has a desired shape as depicted in FIGS. 12A and 12B.
Referring now to FIGS. 12A and 12B, plates 101 or 102, and composite preforms 400, which have been formed over support structure 600 (not shown in FIGS. 12A and 12B, but shown in FIGS. 11A and 11B) so that they comprise the desired shape 601 are motivated together in the direction of arrow A where they may be chemically bonded together to form a completed panel having a desired shape 601. In this manner, curved or shaped panels of invention may be manufactured by pre-shaping the elements of the structural panels and assembling them together to form a structural panel of the invention comprising a desired shape. Such curved embodiments of the structural panel of the invention may be used to form crowned roadways which shed water as may be required for vehicles to safely traverse a bridge or other roadway structure, or may be used to form roof panels, coverings for walkways, and the like.
Referring now to FIG. 15, a first and second nested set of structural panel top halves, P and Q, are depicted, in which the complimentary surfaces created by the structural composite preforms 400 are of such dimension so as to allow a first structural panel top halve 101 and a second structural panel top half 101 to nest together as shown. The preforms 400 comprising the top plate and the preforms 400 comprising the bottom plate may form complimentary surfaces such that a top plate may nest within a bottom plate when a top plate is inverted and motivated onto a bottom plate. Thus, the complimentary surfaces of the structural panel halves allow for nesting of panel halves during shipment, reducing shipping volume and therefore also reducing shipping costs. In this embodiment, structural panel halves may efficiently be shipped to a construction site, such bridge, building, or other construction site, and assembled in place using, for example, chemical bonding. In this manner, the shipping volume required may be fifty percent (50%) the shipping volume of a structural panel that does not comprise complimentary surfaces, which allows significant cost and time savings for construction of bridges, buildings and other structures.
The composite preforms 400 of the invention need not be of uniform height or width, which is to say their cross sectional dimensions may vary along their length.
Referring now to FIG. 16, a further alternate embodiment of the structural panel 051 of the invention is depicted. One or more, and preferably a plurality, of composite preforms 400 may be attached to an upper surface of bottom plate 210 at attachment surfaces 702, which may be large bases of trapezoidally shaped preforms, by any means known in the art but preferably by chemical bonding. Likewise, composite preforms 400 may be attached to an underneath surface of top plate 210 at attachment surfaces 701, which may be small bases of trapezoidally shaped preforms, by any means known in the art but preferably by chemical bonding. Open spaces 703 run between composite preforms 400 and provide for easy inspection of the interior spaces of the structural panels by any means known in the art for inspection of structures such as visual inspection using fiber optic scopes and the like.
Although a detailed description as provided in the attachments contains many specifics for the purposes of illustration, anyone of ordinary skill in the art will appreciate that many variations and alterations to the following details are within the scope of the invention. Accordingly, the following preferred embodiments of the invention are set forth without any loss of generality to, and without imposing limitations upon, the claimed invention. Thus the scope of the invention should be determined by the appended claims and their legal equivalents, and not merely by the preferred examples or embodiments given.
INDUSTRIAL APPLICABILITY
A composite structural panel and method of fabricating and manufacturing same comprises a top panel and a bottom panel separated by and attached to at least one, but preferably a plurality, of structural composite preforms which may be fabricated by a ontinuous manufacturing process and may be saturated by resin using a continuous wetting process. The composite preforms may take any cross sectional shape but are preferably trapezoidal. The top and bottom panels may be fabricated from a plurality of layers of woven fabric layers and non-woven fabric layers which are saturated with a resin that is subsequently cured using cure processes known in the art.
The composite structural panel of the invention is usable as a flat structural member for use as bridge decking, ramps, trestles, roof structures, floor structures, wall structures, and any application requiring a structural panel, or, in alternative embodiments, may be fabricated and assembled in any desired shape, such as a curved shape, as may be required for a particular structural application. Thus, curved embodiments of the structural panel of the invention may be used to form crowned roadways which shed water as may be required for vehicles to safely traverse a bridge or other roadway structure, or may be used to form roof panels, coverings for walkways, and the like.
Cabling, piping, conduit, and the like may traverse the structure through open spaces in the panels of the invention as desired by the user. Furthermore, the open spaces of the invention may be used for optical and other inspection after manufacturing or after installation of the structural panels of the invention. This ability to inspect the interior of the installed structural panel of the invention is a significant advancement in the state of the art, as it is generally impossible to inspect the interior of the typical structural panels of the prior art, which may be fabricated, for example, from cement.
The complimentary surfaces of the structural panel halves allow for nesting of panel halves during shipment, thus reducing shipping volume and therefore also reducing shipping costs. In this embodiment, structural panel halves may efficiently be shipped to a construction site, such bridge, building, or other construction site, and assembled in place using, for example, chemical bonding.
The composite preforms comprising the invention may be manufactured by continuous manufacturing processes, enabling rapid manufacturing, reducing lead time for production of panels, and allows for common cross sections of preforms to be pre-fabricated for use in manufacturing structural composite panels of the invention.
The structural composite panels of the invention enable the fabrication of structures are not susceptible to corrosion, rust or other degradation suffered by metals structures, and further are not susceptible to the degrading effects of galvanic corrosion. The preferred embodiments of the structural composite panels of the invention contain no metallic components.
What is claimed is:
1. A structural composite panel, comprising: a top plate defined as a non-planar structure and having an upper surface and an underneath surface, wherein said top plate is comprised of a plurality of fiber layers saturated with resin and subsequently cured; a bottom plate defined as a non-planar structure and having an upper surface and a lower surface wherein said bottom plate is comprised of a plurality of fiber layers saturated with resin and subsequently cured; a first set of at least one composite preforms having a core comprised of expanding foam, each composite preform covered in a fabric wherein said expanding foam has expanded into interstitial spaces in said fabric, and wherein said fabric has been saturated with resin which has been subsequently cured; a second set of at least one composite preforms having a core comprised of expanding foam, each composite preform covered in a fabric wherein said expanding foam has expanded into interstitial spaces in said fabric, and wherein said fabric has been saturated with resin which has been subsequently cured; wherein said first set of composite preforms are attached to said underneath surface of said top plate; and wherein said second set of composite preforms are attached to said upper surface of said bottom plate; and wherein said first set of composite preforms and said second set of composite preforms are attached together forming a structural composite panel.
2. The structural composite panel of claim 1, wherein each composite preform of said first set of composite preforms and each composite preform of said second set of composite preforms are trapezoidal in cross section, and wherein said attachment of said first set of composite preforms to said underneath surface of said top plate occurs at a large base of said trapezoids; and wherein said attachment of said second set of composite preforms to said upper surface of said bottom plate occurs at a large base of said trapezoids; and wherein said attachment of said first set of composite preforms and said second set of composite preforms occurs at a small base of said trapezoids.
3. The structural composite panel of claim 1, wherein said at least one composite preform is further defined as a plurality of composite preforms.
4. The structural composite panel of claim 2, wherein said at least one composite preform is further defined as a plurality of composite preforms.
5. The structural composite panel of claim 3, wherein said plurality of composite preforms comprising the first set of composite preforms is the same number as said plurality of composite preforms comprising the second set of composite preforms.
6. The structural composite panel of claim 1, wherein said plurality of fabric layers comprising said top plate and said bottom plate are further defined as being characterized by having a first group of fabric layers, second group of fabric layers, and third group of fabric layers wherein said first group of fabric layers comprises a plurality of woven fiber layers separated by non-woven fabric layers and having longitudinal fibers aligned in a first direction; wherein said second group of fabric layers comprises a plurality of woven fiber layers separated by non-woven fabric layers and having longitudinal fibers aligned in a second direction that is transverse to said first direction; wherein third group of fabric layers comprises a plurality of woven fiber layers separated by non-woven fabric layers and having longitudinal fibers aligned in said first direction.
7. The structural composite panel of claim 2, wherein said plurality of fabric layers comprising said top plate and said bottom plate are further defined as being characterized by having a first group of fabric layers, second group of fabric layers, and third group of fabric layers wherein said first group of fabric layers comprises a plurality of woven fiber layers separated by non-woven fabric layers and having longitudinal fibers aligned in a first direction; wherein said second group of fabric layers comprises a plurality of woven fiber layers separated by non-woven fabric layers and having longitudinal fibers aligned in a second direction that is transvers to said first direction; wherein third group of fabric layers comprises a plurality of woven fiber layers separated by non-woven fabric layers and having longitudinal fibers aligned in said first direction.
8. The structural composite panel of claim 3, wherein said plurality of fabric layers comprising said top plate and said bottom plate are further defined as being characterized by having a first group of fabric layers, second group of fabric layers, and third group of fabric layers wherein said first group of fabric layers comprises a plurality of woven fiber layers separated by non-woven fabric layers and having longitudinal fibers aligned in a first direction; wherein said second group of fabric layers comprises a plurality of woven fiber layers separated by non-woven fabric layers and having longitudinal fibers aligned in a second direction that is transvers to said first direction; wherein third group of fabric layers comprises a plurality of woven fiber layers separated by non-woven fabric layers and having longitudinal fibers aligned in said first direction.
9. The structural composite panel of claim 4, wherein said plurality of fabric layers comprising said top plate and said bottom plate are further defined as being characterized by having a first group of fabric layers, second group of fabric layers, and third group of fabric layers wherein said first group of fabric layers comprises a plurality of woven fiber layers separated by non-woven fabric layers and having longitudinal fibers aligned in a first direction; wherein said second group of fabric layers comprises a plurality of woven fiber layers separated by non-woven fabric layers and having longitudinal fibers aligned in a second direction that is transvers to said first direction; wherein third group of fabric layers comprises a plurality of woven fiber layers separated by non-woven fabric layers and having longitudinal fibers aligned in said first direction.
10. The structural composite panel of claim 5, wherein said plurality of fabric layers comprising said top plate and said bottom plate are further defined as being characterized by having a first group of fabric layers, second group of fabric layers, and third group of fabric layers wherein said first group of fabric layers comprises a plurality of woven fiber layers separated by non-woven fabric layers and having longitudinal fibers aligned in a first direction; wherein said second group of fabric layers comprises a plurality of woven fiber layers separated by non-woven fabric layers and having longitudinal fibers aligned in a second direction that is transvers to said first direction; wherein third group of fabric layers comprises a plurality of woven fiber layers separated by non-woven fabric layers and having longitudinal fibers aligned in said first direction.
11. The structural composite panel of claim 1, wherein said bottom plate is further defined as having a rectangular or square shape having four edges, wherein two opposing edges further comprise a side plate extending from said bottom plate towards said top plate, and wherein said side plate is of a height that is substantially equal to the thickness of the combination of said top plate, said composite preforms attached to said top plate, said bottom plate, and said composite preforms attached to said bottom plate.
12. The structural composite panel of claim 2, wherein said bottom plate is further defined as having a rectangular or square shape having four edges, wherein two opposing edges further comprise a side plate extending from said bottom plate towards said top plate, and wherein said side plate is of a height that is substantially equal to the thickness of the combination of said top plate, said composite preforms attached to said top plate, said bottom plate, and said composite preforms attached to said bottom plate.
13. The structural composite panel of claim 1, wherein said preforms comprising said top plate and said preforms comprising said bottom plate form complimentary surfaces such that a top plate may nest within a bottom plate when a top plate is inverted and motivated onto a bottom plate.
14. The structural composite panel of claim 2, wherein said preforms comprising said top plate and said preforms comprising said bottom plate form complimentary surfaces such that a top plate may nest within a bottom plate when a top plate is inverted and motivated onto a bottom plate.
15. The structural composite panel of claim 6, wherein said top and bottom plate woven fabric layers is further defined as 18 ounces per square yard warp unidirectional glass fabric and wherein said non-woven layers comprise nine ounce per square yard non-woven fabric.
16. The structural composite panel of claim 7, wherein said top and bottom plate woven fabric layers is further defined as 18 ounces per square yard warp unidirectional glass fabric and wherein said non-woven layers comprise nine ounce per square yard non-woven fabric.
17. The structural composite panel of claim 8, wherein said top and bottom plate woven fabric layers is further defined as 18 ounces per square yard warp unidirectional glass fabric and wherein said non-woven layers comprise nine ounce per square yard non-woven fabric.
18. The structural composite panel of claim 9, wherein said top and bottom plate woven fabric layers is further defined as 18 ounces per square yard warp unidirectional glass fabric and wherein said non-woven layers comprise nine ounce per square yard non-woven fabric.
19. A structural composite panel, comprising: a top plate defined as a non-planar structure, said top plate having an upper surface and an underneath surface, and wherein said top plate is comprised of a plurality of fiber layers saturated with resin and subsequently cured; a bottom plate defined as a non-planar structure, said bottom plate having an upper surface and a lower surface wherein said bottom plate is comprised of a plurality of fiber layers saturated with resin and subsequently cured; a set of at least one composite preforms having a core comprised of expanding foam, each composite preform covered in a fabric wherein said expanding foam has expanded into interstitial spaces in said fabric, and wherein said fabric has been saturated with resin and subsequently cured; wherein said set of composite preforms are attached to said underneath surface of said top plate; and wherein said set of composite preforms are attached to said upper surface of said bottom plate.
20. The structural composite panel of claim 19, wherein each preform of said set of composite preforms is trapezoidal in cross section, and wherein said attachment of said set of composite preforms to said underneath surface of said top plate occurs at a small base of said trapezoids; and wherein said set of composite preforms attachment to said upper surface of said bottom plate occurs at a large base of said trapezoids.
21. The structural composite panel of claim 19, wherein said at least one composite preform is further defined as a plurality of composite preforms.
22. The structural composite panel of claim 20, wherein said at least one composite preform is further defined as a plurality of composite preforms.
23. The structural composite panel of claim 19, wherein said plurality of fabric layers comprising said top plate and said bottom plate are further defined as being characterized by having a first group of fabric layers, second group of fabric layers, and third group of fabric layers wherein said first group of fabric layers comprises a plurality of woven fiber layers separated by non-woven fabric layers and having longitudinal fibers aligned in a first direction; wherein said second group of fabric layers comprises a plurality of woven fiber layers separated by non-woven fabric layers and having longitudinal fibers aligned in a second direction that is transverse to said first direction; wherein third group of fabric layers comprises a plurality of woven fiber layers separated by non-woven fabric layers and having longitudinal fibers aligned in said first direction.
24. The structural composite panel of claim 20, wherein said plurality of fabric layers comprising said top plate and said bottom plate are further defined as being characterized by having a first group of fabric layers, second group of fabric layers, and third group of fabric layers wherein said first group of fabric layers comprises a plurality of woven fiber layers separated by non-woven fabric layers and having longitudinal fibers aligned in a first direction; wherein said second group of fabric layers comprises a plurality of woven fiber layers separated by non-woven fabric layers and having longitudinal fibers aligned in a second direction that is transvers to said first direction; wherein third group of fabric layers comprises a plurality of woven fiber layers separated by non-woven fabric layers and having longitudinal fibers aligned in said first direction..
| 11,885 |
https://github.com/IBMStreams/OSStreams/blob/master/src/java/spl/com.ibm.streams.spl.toolkit.control/src/main/java/com/ibm/streams/control/internal/server/consistent/ConsistentRegionSetup.java
|
Github Open Source
|
Open Source
|
Apache-2.0
| 2,021 |
OSStreams
|
IBMStreams
|
Java
|
Code
| 786 | 2,046 |
/*
* Copyright 2021 IBM Corporation
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
* You may obtain a copy of the License at
*
* http://www.apache.org/licenses/LICENSE-2.0
*
* Unless required by applicable law or agreed to in writing, software
* distributed under the License is distributed on an "AS IS" BASIS,
* WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
* See the License for the specific language governing permissions and
* limitations under the License.
*/
package com.ibm.streams.control.internal.server.consistent;
import com.api.json.JSONArray;
import com.api.json.JSONObject;
import java.math.BigInteger;
import java.util.HashMap;
import java.util.HashSet;
import java.util.Map;
import java.util.Set;
import java.util.logging.Logger;
/**
* This thread must be started by the ControlPlane operator. It creates one MXBean for each
* consistent cut region in the application. It uses the application PADL to understand how many
* regions it must create. This process is offloaded to its own thread, as it can take some time and
* it could block the creation of other operators in the application.
*/
public class ConsistentRegionSetup {
private static final Logger trace = Logger.getLogger(ConsistentRegionSetup.class.getName());
// Constants for annotations generated by the compiler and transformer - primitive operators
protected static final String CC_TAG = "tag";
protected static final String CC_REGION_ENTRY = "consistentRegionEntry";
protected static final String CC_KEY_VALUES = "keyValues";
protected static final String CC_INDEX = "index";
protected static final String CC_LOGICAL_INDEX = "logicalIndex";
protected static final String CC_IS_TRIGGER_OPERATOR = "isTriggerOperator";
protected static final String CC_IS_START_REGION = "isStartOfRegion";
protected static final String CC_IS_END_REGION = "isEndOfRegion";
protected static final String CC_AUTONOMOUS_INPUT_PORT = "autonomousInputPort";
protected static final String CC_DRAIN_TIMEOUT = "drainTimeout";
protected static final String CC_RESET_TIMEOUT = "resetTimeout";
// Logical view JSON attributes
protected static final String MAIN_COMPOSITE = "mainComposite";
protected static final String COMPOSITE_OPERATORS = "compositeOperators";
protected static final String PRIMITIVE_OPERATORS = "primitiveOperators";
protected static final String ANNOTATIONS = "annotations";
protected static final String PRIMITIVE_OPERATOR_DEFS = "primitiveOperDefs";
protected static final String OPERATOR_INDEX = "index";
protected static final String KIND = "kind";
// Physical view JSON attributes
protected static final String PES = "pes";
protected static final String ID = "id";
protected static final String OPERATOR_NAME = "name";
protected static final String OPERATORS = "operators";
/**
* Parse a primitive operator and inspect all its annotations to find new consistent regions.
*
* @param primitiveOp JSON description of primitive operator
* @param consistentRegions set of discovered consistent regions
*/
private static void discoverConsistentRegionInPrimitiveOperator(
BigInteger jobId, JSONObject primitiveOp, Set<Integer> consistentRegions) throws Exception {
if (primitiveOp.get(ANNOTATIONS) == null) {
return;
}
JSONArray annotations = JSONArray.parse(primitiveOp.get(ANNOTATIONS).toString());
for (Object annot : annotations) {
JSONObject annotation = JSONObject.parse(annot.toString());
String tag = annotation.get(CC_TAG).toString();
if (tag.compareTo(CC_REGION_ENTRY) == 0) {
JSONObject crEntry = JSONObject.parse(annotation.get(CC_KEY_VALUES).toString());
Integer regionIndex = Integer.parseInt(crEntry.get(CC_INDEX).toString());
consistentRegions.add(regionIndex);
break;
}
}
}
/**
* Parse a composite operator and inspect all its primitive operators to find new consistent
* regions.
*
* @param compositeOp JSON description of composite operator
* @param consistentRegions set of discovered consistent regions
*/
private static void discoverConsistentRegionInCompositeOperator(
BigInteger jobId, JSONObject compositeOp, Set<Integer> consistentRegions) throws Exception {
// Go over all primitive operators in composite
if (compositeOp.get(PRIMITIVE_OPERATORS) != null) {
JSONArray allPrimitiveOps = JSONArray.parse(compositeOp.get(PRIMITIVE_OPERATORS).toString());
for (Object primOp : allPrimitiveOps) {
JSONObject primitiveOp = JSONObject.parse(primOp.toString());
discoverConsistentRegionInPrimitiveOperator(jobId, primitiveOp, consistentRegions);
}
}
// Find new composite operators in the composite operator
if (compositeOp.get(COMPOSITE_OPERATORS) != null) {
JSONArray allCompositeOps = JSONArray.parse(compositeOp.get(COMPOSITE_OPERATORS).toString());
for (Object composite : allCompositeOps) {
JSONObject innerCompositeOp = JSONObject.parse(composite.toString());
discoverConsistentRegionInCompositeOperator(jobId, innerCompositeOp, consistentRegions);
}
}
}
/** Discover consistent regions external interface used in K8S job submission pipeline */
public static Set<Integer> discoverConsistentRegions(final BigInteger jobId, String logicalModel)
throws Exception {
// Consistent regions seen so far
final Set<Integer> consistentRegions = new HashSet<Integer>();
JSONObject application = JSONObject.parse(logicalModel);
JSONObject mainComposite = JSONObject.parse(application.get(MAIN_COMPOSITE).toString());
discoverConsistentRegionInCompositeOperator(jobId, mainComposite, consistentRegions);
trace.info("Found " + consistentRegions.size() + " consistent regions.");
return consistentRegions;
}
private static Map<String, BigInteger> createPrimitiveOperatorToPeIdMapping(String physicalView)
throws Exception {
Map<String, BigInteger> primOperatorToPeIdMap = new HashMap<>();
JSONObject application = JSONObject.parse(physicalView);
JSONArray allPes = JSONArray.parse(application.get(PES).toString());
for (Object pe : allPes) {
JSONObject peObj = JSONObject.parse(pe.toString());
BigInteger peId = new BigInteger(peObj.get(ID).toString());
JSONArray operators = JSONArray.parse(peObj.get(OPERATORS).toString());
for (Object op : operators) {
JSONObject operator = JSONObject.parse(op.toString());
String opName = operator.get(OPERATOR_NAME).toString();
primOperatorToPeIdMap.put(opName, peId);
trace.finest("Operator " + opName + " is in PE " + peId);
}
}
return primOperatorToPeIdMap;
}
/**
* Create a mapping between primitive operator definition index and its kind based on the
* application logical view. This mapping is used by all consistent region controllers.
*/
public static Map<Integer, String> createPrimitiveOperatorDefinitions(String logicalView)
throws Exception {
JSONObject app = JSONObject.parse(logicalView);
Map<Integer, String> operDefIndexToOperKindMap = new HashMap<>();
JSONArray allOperDefs = JSONArray.parse(app.get(PRIMITIVE_OPERATOR_DEFS).toString());
for (Object operDefObj : allOperDefs) {
JSONObject operDef = JSONObject.parse(operDefObj.toString());
Integer defIndex = new Integer(operDef.get(OPERATOR_INDEX).toString());
String operKind = operDef.get(KIND).toString();
operDefIndexToOperKindMap.put(defIndex, operKind);
}
return operDefIndexToOperKindMap;
}
}
| 49,351 |
https://github.com/Frisasky/LinuxGSM/blob/master/lgsm/functions/command_dev_detect_ldd.sh
|
Github Open Source
|
Open Source
|
MIT
| null |
LinuxGSM
|
Frisasky
|
Shell
|
Code
| 223 | 678 |
#!/bin/bash
# command_dev_detect_ldd.sh function
# Author: Daniel Gibbs
# Website: https://linuxgsm.com
# Description: Automatically detects required deps using ldd.
# Can check a file or directory recursively.
local modulename="DETECT-LDD"
local commandaction="Detect-LDD"
local function_selfname=$(basename "$(readlink -f "${BASH_SOURCE[0]}")")
echo -e "================================="
echo -e "Shared Object dependencies Checker"
echo -e "================================="
if [ -z "${serverfiles}" ]; then
dir=$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")
fi
if [ -d "${serverfiles}" ]; then
echo -e "Checking directory: "
echo -e "${serverfiles}"
elif [ -f "${serverfiles}" ]; then
echo -e "Checking file: "
echo -e "${serverfiles}"
fi
echo -e ""
touch "${tmpdir}/detect_ldd.tmp"
touch "${tmpdir}/detect_ldd_not_found.tmp"
files=$(find "${serverfiles}" | wc -l)
find "${serverfiles}" -type f -print0 |
while IFS= read -r -d $'\0' line; do
if ldd "${line}" 2>/dev/null | grep -v "not a dynamic executable"
then
echo -e "${line}" >> "${tmpdir}/detect_ldd.tmp"
ldd "${line}" 2>/dev/null | grep -v "not a dynamic executable" >> "${tmpdir}/detect_ldd.tmp"
if ldd "${line}" 2>/dev/null | grep -v "not a dynamic executable" | grep "not found"
then
echo -e "${line}" >> "${tmpdir}/detect_ldd_not_found.tmp"
ldd "${line}" 2>/dev/null | grep -v "not a dynamic executable" | grep "not found" >> "${tmpdir}/detect_ldd_not_found.tmp"
fi
fi
echo -n "$i / $files" $'\r'
((i++))
done
echo -e ""
echo -e ""
echo -e "All"
echo -e "================================="
cat "${tmpdir}/detect_ldd.tmp"
echo -e ""
echo -e "Not Found"
echo -e "================================="
cat "${tmpdir}/detect_ldd_not_found.tmp"
rm -f "${tmpdir:?}/detect_ldd.tmp"
rm -f "${tmpdir:?}/detect_ldd_not_found.tmp"
core_exit.sh
| 38,970 |
https://github.com/ocean-wll/LinkAgent/blob/master/instrument-simulator/bin/update-version.sh
|
Github Open Source
|
Open Source
|
Apache-2.0
| 2,022 |
LinkAgent
|
ocean-wll
|
Shell
|
Code
| 75 | 184 |
#!/bin/bash
# exit shell with err_code
# $1 : err_code
# $2 : err_msg
exit_on_err() {
[[ ! -z "${2}" ]] && echo "${2}" 1>&2
exit ${1}
}
# maven package the simulator
if [ $# != 0 ]; then
mvn versions:set -DnewVersion=$1 -f ../pom.xml ||
exit_on_err 1 "set version $1 failed."
else
exit_on_err 1 "please set the version number."
fi
mvn versions:update-parent -f ../pom.xml
mvn versions:update-child-modules -f ../pom.xml
echo "update version to $1 finish."
| 43 |
https://openalex.org/W3176562827
|
OpenAlex
|
Open Science
|
CC-By
| 2,020 |
Preterm Birth and Breast Cancer Risk: A Systematic Review and Meta-Analysis
|
Maryam Razavi
|
English
|
Spoken
| 6,438 | 11,405 |
Preterm Birth and Breast Cancer Risk: A Systematic
Review and Meta-Analysis Maryam Razavi
Zahedan University of Medical Sciences
Mahdi Sepidarkish
Babol University of Medical Science
Arezoo Maleki-Hajiagha
Tehran University of Medical Sciences
Samira Vesali
Royan Institute
Amir Almasi-Hashiani
Arak University of Medical Sciences
Arezoo Esmailzadeh
(
[email protected]
)
Baqiyatallah University of Medical Sciences Research article Page 1/22 Page 1/22 Page 1/22 Abstract Background: The characteristics of pregnancy, such as gestational age are related to the level of maternal
hormones, which levels of these hormones can be associated with breast cancer (BC) risk. Therefore, the
aim of this study was to determine the relationship between the preterm birth (PB) and BC risk in women
in a systematic review and meta-analysis. Methods: In this systematic review and meta-analysis, published studies were located back to the earliest
available publication date (1983), using the Medline/PubMed, Embase, Scopus and Web of Science
(Clarivate analytics) bibliographic databases. Eligibility, methodological quality, and data extraction were
done by two independent reviewers, and finally, to calculate the pooled estimates, Meta-analysis was
performed. Results: Thirteen studies including a total of 2,845,553 women were included in this meta-analysis. Pooled results suggested that PB could increase the risk of BC (RR= 1.03, 95% CI: 1.00, 1.07; I2= 62.5%). Risk was significantly increased in women with a PB at >37 gestational weeks (RR = 1.03, 95% CI: 1.01,
1.06) and 26-31 gestational weeks (RR = 1.03, 95% CI: 1.01, 1.06) compared to those with 40-41
gestational weeks. A significant increment in the risk of BC in uniparous women with a PB (RR = 1.05,
95% CI = 1.01, 1.08) and women with >45 years (RR = 1.12, 95% CI = 1.01, 1.24) was observed. Conclusions: The results of this study supported the higher risk of BC in all woman with PB, primiparous
women and women with >45 years. Therefore, more care and screening for early detection of the disease
is recommended in these women. Data sources, search strategy, and selection criteria Published studies were located back to the earliest available publication date (1983), using the Medline,
Embase, Scopus, Web of Science bibliographic databases, and by hand-searching of reference lists of
identified studies and pertaining review papers. We also checked the citation lists of relevant publications
to find additional pertinent studies. As recommended in the Meta-Analysis of Observational Studies in
Epidemiology (MOOSE) guideline [27], we searched unpublished studies using gray literature databases. The literature search was made with no language or publication date restrictions. Search details are
available in Appendix s1. The search results of different sources were combined, and duplicates were
removed. The search results were evaluated by two independent reviewers (M.S and A.A-H) by screening
titles and abstracts, followed by a full-text review. Consensus was reached by discussion or third party
opinion (S.V). Background According to GLOBOCAN's 2018 report, more than 18 million new cases of cancer, as well as 9.6 million
deaths from cancer have been reported worldwide [1]. Meanwhile, breast cancer (BC) is the most
common cancer among women in most countries of the world, accounting for 25% of cases of cancer
and 12% of deaths due to cancer among women [2–6]. In 2016, BC is known as the most common cancer
with 1.68 million cases (and 535,000 deaths and 15.1 million DALYs) [7]. A number of studies in different countries have shown that numerous factors, such as genetics, lifestyle,
obesity, reproductive factors and anthropometric factors, have an impact on BC and have contradictory
results in this regard [1, 5, 8–15]. The results of some studies have shown that the number of previous
pregnancies, as well as the age at first pregnancy and delivery, is associated with the risk of BC in
women. Changes observed in estrogen levels during pregnancy [16, 17] as well as histologic changes in
breast tissue can justify this relationship [18]. On the other hand, the characteristics of pregnancy, such
as gestational age and birth weight are related to the level of maternal hormones, which levels of
hormones can be associated with the risk of BC [19–22]. Page 2/22 Page 2/22 Swerdlow et al. [23] have shown in their study that gestational age is inversely associated with BC
(especially before menopause), and the risk in women with gestational age of 26–31 weeks was 2.4
times compared to 40–41 weeks. However, M Kaijser et al. [24] suggested that PB and low birth weight
are not associated with an increased risk of BC. Another study concluded that preterm labor cannot
increase the risk of premenopausal BC, except for women with gestational age less than 32 weeks [25]. Therefore, there is no general consensus on this relationship. In several other studies, conflicting results have been reported, which may be due to low sample size,
methodological problems (in the design, analysis, and reporting of results) or the difference in risk factors
in diverse populations. On the other hand, the primary studies in compared to meta-analysis study were
hampered by low statistical power because of low sample size. Therefore, the aim of this study was to
conduct a systematic review and meta-analysis of the relationship between the PB and BC risk in women. Study design This was a systematic review and meta-analysis. To design, run and report the findings, we followed the
PRISMA Statement [26] (Preferred reporting items for systematic reviews and meta-analyses). This was a systematic review and meta-analysis. To design, run and report the findings, we followed the
PRISMA Statement [26] (Preferred reporting items for systematic reviews and meta-analyses). Data extraction and risk of bias assessment: All eligible studies were reviewed, and the following data was extracted by two investigators
independently: (1) authors; (2) year of publication; (3) location; (4) study population; (5) duration of
follow-up; (6) the number of cancer cases; (7) risk estimates with CIs; (8) confounders adjusted for in
multivariate analysis. Methodological quality assessment for the included studies was done
independently by two reviewers (M.S and J.H) using criteria as outlined in the Newcastle–Ottawa scaling
for case-control and cohort studies. Explicit judgment regarding the following items was done: selection
of the study groups, comparability of the groups and ascertainment of exposure and outcome. Any
disagreement was resolved by discussion or third party opinion (S.V). The Literature search A flow diagram of the systematic review showing the study selection is presented in Fig. 1. The initial
search identified 3,426 potentially relevant articles (315 from PubMed, 153 from Embase, 949 from
Scopus, 499 from Web of Science and 25 from other sources), of which 606 articles were excluded
because they were duplicates. Briefly, we identified 13 potentially relevant studies for meta-analysis. Eligibility criteria In the present systematic review and meta-analysis, studies were included if they met the following
inclusion criteria: (1) observational studies (cohort, case-control, nested case-control or case-cohort
studies) that evaluated the associations of PB with the risk of developing BC, (2) and they reported any
form of effect size estimate (odds ratio (OR), hazard ratio (HR), standardized incidence ratio (SIR) or rate
ratio (RR)).We excluded studies if: (1) they had cross-sectional design, (2) we were not able to extract the
exact details about research method or results; (3) and presented only as abstracts, conference paper,
letters to the editor and editorials. Page 3/22 Page 3/22 Statistical analyses All effect size estimates (HRs, ORs and RRs) were treated as equivalent measures of risk. We calculated
the pooled risk of BC associated with PB stratified by parity and menopausal status. Extracted risk
estimates from primary studies were pooled using inverse-variance weighted DerSimonian-Laird random-
effect models which incorporates between-study variability into the calculations. To investigate whether
the results of the meta-analysis were depend on a particular trial or group of trials, we recomputed the
meta-analysis statistic after omitting one study at a time(sensitivity analysis). Additionally, we assessed
the probability of publication bias with Egger’s test, with P-value < 0.10 considered representative of
statistically significant publication bias. All comparisons were two-tailed, and 95% confidence intervals
(CI) were described where applicable. The Stata software (Version 13.0) (Stata Corp, College Station,
Texas) was used for Meta-analysis. Study characteristics Table 1 outlines the main characteristics of the included studies. These six studies were conducted
between 1998 and 2018, of which six studies were conducted after 2010. The studies were conducted in
the United States (6 studies), Sweden (3 studies), United Kingdom (1 study), Denmark (1 study), Norway
(1 study) and one in Iraq. In terms of study design, five of the thirteen studies were designed as a cohort,
seven were case-control and one nested case-control study. Sample size ranged from 22,758 to 694,657
participants in cohort studies and 300 to 41,255 in case-control studies. The summary of methodological
quality appraisal of the included studies is shown in additional file 2. All studies classified as good Page 4/22 quality. All studies adopted appropriate approach to account for potential confounders. All cohort studies
selected their exposed and nonexposed participants from the same community sample. Two of seven
included case-control studies used hospital control and classified as moderate risk of selection bias. All
studies provided adequate criteria for diagnosis of the outcomes of interest and provided a proper
description of how the outcomes were measured. quality. All studies adopted appropriate approach to account for potential confounders. All cohort studies
selected their exposed and nonexposed participants from the same community sample. Two of seven
included case-control studies used hospital control and classified as moderate risk of selection bias. All
studies provided adequate criteria for diagnosis of the outcomes of interest and provided a proper
description of how the outcomes were measured. quality. All studies adopted appropriate approach to account for potential confounders. All cohort studies
selected their exposed and nonexposed participants from the same community sample. Two of seven
included case-control studies used hospital control and classified as moderate risk of selection bias. All
studies provided adequate criteria for diagnosis of the outcomes of interest and provided a proper
description of how the outcomes were measured. Study characteristics Page 5/22 Table 1 Table 1
The characteristics of included primary studies
Author
Location
Design
Sample
size
Breast cancer
ascertainment
Exposure
source
Factors adjusted
for in analyses
Troisi, 1998
USA
Case-
control
Cases =
1,669
Controls
= 1,505
Hospital
records
Hospital
records
Race, education,
parity, age,
previous
spontaneous
and induced
abortion, site of
tumor
Hsieh, 1999
Sweden
Nested
case-
control
Cases =
2318
Control
= 10,199
National
Cancer
Registry
Swedish
National
Board
Age, age at first
birth
Melbye,
1999
Denmark
Cohort
474,156
Danish
Cancer
Registry
Danish Civil
Registration
System
Age, age at first
birth, parity,
stillbirths,
preterm and
term deliveries,
history of
spontaneous
and induced
abortion. Study characteristics Innes, 2000
USA
Case-
control
Cases =
484
Controls
= 2,904
Computerized
Cancer
registry
Birth
registry
data
Woman’s social
security number,
full maiden, date
of birth, race,
county of
residence
Vatten, 2002
Norway
Cohort
694,657
Norwegian
Cancer
Registry
Medical
Birth
Registry
Age, calendar
period of
diagnoses, total
number of births
Innes, 2004
USA
Case-
control
Cases =
2,522
Controls
= 10,052
Computerized
Cancer
registry
Birth
registry
data
Maternal race
(black, non-
Hispanic white,
Hispanic and
other), marital
status, maternal
education The characteristics of included primary studies Page 6/22 Author
Location
Design
Sample
size
Breast cancer
ascertainment
Exposure
source
Factors adjusted
for in analyses
Cnattingius,
2005
Sweden
Cohort
314,019
Cancer
Register
Swedish
National
Board of
Health
And
Welfare and
Statistics
Sweden
Age, placental
weight, birth
weight,
gestational age,
infant sex,
family situation,
smoking habits,
mother’s country
of birth, height,
BMI, pregnancy
induced
hypertensive
diseases,
vaginal bleeding
in late
pregnancy,
diabetes
mellitus, and
parity
Nechuta,
2010
USA
Case-
control
Cases =
8,251
Controls
= 33,004
Michigan
Cancer
Surveillance
Program’s
statewide
cancer
registry
Michigan
Birth
Registry
Age at first and
last birth,
education at
first birth,
infant’s gender
at first and last
birth, parity,
maternal birth
year race,
gestational age
Sanderson,
2012
USA
Case–
control
Cases =
979
Controls
= 974
Rio Grande
Valley located
At the
southern tip
of Texas
Rio Grande
Valley
located
At the
southern tip
of Texas
Age, family
history of breast
cancer, age at
menarche,
menopausal
status, parity,
BMI, use of oral
i Author
Location
Design
Sample
size
Breast cancer
ascertainment
Exposure
source
Factors adjusted
for in analyses
Cnattingius,
2005
Sweden
Cohort
314,019
Cancer
Register
Swedish
National
Board of
Health
And
Welfare and
Statistics
Sweden
Age, placental
weight, birth
weight,
gestational age,
infant sex,
family situation,
smoking habits,
mother’s country
of birth, height,
BMI, pregnancy
induced
hypertensive
diseases,
vaginal bleeding
in late
pregnancy,
diabetes
mellitus, and
parity
Nechuta,
2010
USA
Case-
control
Cases =
8,251
Controls
= 33,004
Michigan
Cancer
Surveillance
Program’s
statewide
cancer
registry
Michigan
Birth
Registry
Age at first and
last birth,
education at
first birth,
infant’s gender
at first and last
birth, parity,
maternal birth
year race,
gestational age
Sanderson,
2012
USA
Case–
control
Cases =
979
Controls
= 974
Rio Grande
Valley located
At the
southern tip
of Texas
Rio Grande
Valley
located
At the
southern tip
of Texas
Age, family
history of breast
cancer, age at
menarche,
menopausal
status, parity,
BMI, use of oral
contraceptives,
use of hormone
replacement Page 7/22 Author
Location
Design
Sample
size
Breast cancer
ascertainment
Exposure
source
Factors adjusted
for in analyses
Altaha, 2013
Iraq
Case
control
Cases =
100
Controls
= 200
Oncology
clinic in AL-
Ramadi
General
Hospital
Al-Anbar
governorate
Age of the
women in years,
residence of
women whether
urban or rural,
marital status,
education level,
occupation of
women, age at
menarche, age
at first full term
delivery, number
of live births,
number of
stillbirths,
number of
previous
abortions before
the 24th week of
pregnancy,
whether it is
spontaneous or
induced
Troisi, 2013
USA
Case-
control
22,758
Cancer
Surveillance
System (CSS)
of western
Washington
Washington
State
Cancer
Registry
(WSCR)
Parity, calendar
year of delivery,
age at delivery,
race, ethnicity
Hajiebrahimi,
2016
Sweden
Cohort
Cases =
8,327
Controls
= 8,327
Swedish
Cancer
Register
Medical
Birth
Register
Age at latest
pregnancy,
parity,
educational
level and
calendar time of
offspring birth,
age at latest
pregnancy,
parity,
educational
level, calendar
year, gestational
age Author
Location
Design
Sample
size
Breast cancer
ascertainment
Exposure
source
Factors adjusted
for in analyses
Altaha, 2013
Iraq
Case
control
Cases =
100
Controls
= 200
Oncology
clinic in AL-
Ramadi
General
Hospital
Al-Anbar
governorate
Age of the
women in years,
residence of
women whether
urban or rural,
marital status,
education level,
occupation of
women, age at
menarche, age
at first full term
delivery, number
of live births,
number of
stillbirths,
number of
previous
abortions before
the 24th week of
pregnancy,
whether it is
spontaneous or
induced
Troisi, 2013
USA
Case-
control
22,758
Cancer
Surveillance
System (CSS)
of western
Washington
Washington
State
Cancer
Registry
(WSCR)
Parity, calendar
year of delivery,
age at delivery,
race, ethnicity
Hajiebrahimi,
2016
Sweden
Cohort
Cases =
8,327
Controls
= 8,327
Swedish
Cancer
Register
Medical
Birth
Register
Age at latest
pregnancy,
parity,
educational
level and
calendar time of
offspring birth,
age at latest
pregnancy,
parity, Author
Location
Design
Sample
size
Breast cancer
ascertainment
Exposure
source
Factors adjusted
for in analyses
Altaha, 2013
Iraq
Case
control
Cases =
100
Controls
= 200
Oncology
clinic in AL-
Ramadi
General
Hospital
Al-Anbar
governorate
Age of the
women in years,
residence of
women whether
urban or rural,
marital status Factors adjusted
for in analyses Troisi, 2013
USA
Case-
control
22,758
Cancer
Surveillance
System (CSS)
of western
Washington
Washington
State
Cancer
Registry
(WSCR)
Parity, calendar
year of delivery,
age at delivery,
race, ethnicity
Hajiebrahimi,
2016
Sweden
Cohort
Cases =
8,327
Controls
= 8,327
Swedish
Cancer
Register
Medical
Birth
Register
Age at latest
pregnancy,
parity,
educational
level and
calendar time of
offspring birth,
age at latest
pregnancy,
parity,
educational
level, calendar
year, gestational
age Page 8/22 Author
Location
Design
Sample
size
Breast cancer
ascertainment
Exposure
source
Factors adjusted
for in analyses
Swerdlow,
2018
UK
Cohort
83,451
National
Health Service
Central
Registers
National
Health
Service
Central
Registers
Age, time since
recruitment to
cohort,
benign breast
disease, family
history of breast
cancer in first-
degree relatives,
socio-economic
score, own
birth weight, age
at menarche,
parity, age at
first pregnancy,
cumulative
duration of
breast feeding,
current oral
contraceptive
use before
menopause
height at age 20,
alcohol
consumption,
age started
smoking, pre or
post-
menopausal
BMI and
hormones
O
ll
i
i
b
PB
d BC Author
Location
Design
Sample
size
Breast cancer
ascertainment
Exposure
source
Factors adjusted
for in analyses
Swerdlow,
2018
UK
Cohort
83,451
National
Health Service
Central
Registers
National
Health
Service
Central
Registers
Age, time since
recruitment to
cohort,
benign breast
disease, family
history of breast Overall association between PB and BC Thirteen studies including a total of 2,845,553 women were included in this meta-analysis. Pooled results
suggested that PB could increase the risk of BC (RR = 1.03, 95% CI: 1.00, 1.07; I2 = 62.5%, Fig. 2). There
was an evidence for publication bias (Egger’s regression intercept: 0.68, 95%CI: 0.01 to 1.35, P = 0.045,
Fig. 3). Sensitivity analysis showed that the estimates of the pooled SMD range from 1.02 (95% CI: 0.98
to 1.06) to 1.04 (95% CI: 1.00 to 1.07), suggesting that no one study is substantially influencing the
pooled estimate. PB < 37 compared to > 37 gestational weeks Three (one cohort and two case-control) studies including a total of 487,835 women evaluated the
association between PB and BC. When the studies were combined, there was no difference in the risk of
BC between women with a PB at < 37 gestational weeks and who with a PB > 37 gestational weeks (RR =
1.13, 95% CI: 0.86, 1.39; I2 = 54.7%, Fig. 2). Page 9/22 Page 9/22 PB 32–36 compared to > 37 gestational weeks Six studies comprising 2,036,812 participants investigated the risk of BC in women with a PB at 32–36
compared to women with a PB at > 37 gestational weeks. The summary RR of BC for the 32–36
compared with > 37 gestational weeks categories was 1.01 (95% CI, 0.98, 1.04) with low heterogeneity (I2
= 27.7%, P for heterogeneity = 0.19) (Fig. 2). B < 32 compared to > 37 gestational weeks There were three studies with 794,762 participants (two cohort and one case-control) that compared the
risk of BC in women with a PB at 32–36 compared to women with 40–41 gestational weeks. The pooled
analysis revealed that the PB was not associated with BC risk (RR = 1.04, 95% CI: 0.89, 1.19) using a
random-effects model, and significant heterogeneity was observed among individual studies (I2 = 67.1%,
P for heterogeneity = 0.01). There were three studies with 794,762 participants (two cohort and one case-control) that compared the
risk of BC in women with a PB at 32–36 compared to women with 40–41 gestational weeks. The pooled
analysis revealed that the PB was not associated with BC risk (RR = 1.04, 95% CI: 0.89, 1.19) using a
random-effects model, and significant heterogeneity was observed among individual studies (I2 = 67.1%,
P for heterogeneity = 0.01). PB 26–31 compared to 40–41 gestational weeks Three studies including 794,762 women assessed the risk of BC. A significant increment in the risk of BC
(RR = 1.03, 95% CI: 1.01, 1.06) was observed in women with a PB at 26–31 gestational weeks compared
to those with 40–41 gestational weeks, with non-significant heterogeneity (I2 = 0%, P heterogeneity = 0.42)
(Fig. 2). Uniparous compared to multiparous Four studies including 2,444,775 participants assessed the risk of BC in uniparous women. The overall
summary RRs of the uniparity versus the multiparity category show that parity modify the association
between PB and BC. A significant increment in the risk of BC in uniparous women with a PB (RR = 1.05,
95% CI = 1.01, 1.08) was observed, while this relationship in multiparous women was not significant (RR
= 1.03, 95% CI = 1.00, 1.07). BC diagnosis age Discussion To assess the relationship of gestational age and BC risk, we carried out a systematic review and meta-
analysis in which, out of 3,426 potentially relevant articles, 13 relevant studies were included in the meta-
analysis. The main result of this study revealed that there is mild evidence that support the relationship
between PB and women BC risk, since the risk in women with PB were on average at a 3% greater risk of
BC. And also, this meta-analysis provided some mild evidence of higher BC risk in women with a birth at
26–31 and 37–39 weeks compared to 40–41 weeks. The main findings of our study recognized that the
PB increases the risk of BC in women with > 45 years. And also the results showed that PB in primiparous
women could lead to an increased risk of BC, while in multiparous women, this relationship was not
observed. However, it should be noted that in these analyzes, the effect of other effective variables on the
relationship between PB and the risk of BC has not been adjusted, therefore, the interpretation and
generalization of the findings must be done with caution. The present systematic review and meta-analysis suggested an increase in the BC risk (RR = 1.03) in
women with a PB 26–31 gestational weeks compared to 40–41 gestational weeks. Similar to our study,
Swerdlow et al. [23] have shown in their study that the risk in women with gestational age of 26–31
weeks was 2.4 times compared to 40–41 weeks. Previous studies as well as the results of this study
showed that early delivery may increase the risk of BC. Swerdlow et al. [23] have suggested that
hormonal stimulation and breast proliferation at the beginning of pregnancy and the lack of enough
opportunity for differentiation that occurs at the end of pregnancy are the cause of this relationship. Mammary cells in human and animals differentiate in the third trimester [28–30] and therefore a full term
pregnancy is considered as a protective factor for BC [31]. Therefore, term or post-term pregnancy may be
expected to increase the degree of differentiation, which will reduce the risk of BC. Oestrogens are one of the effective factors in BC etiology [32], and increased concentrations of
oestrogens during pregnancy may affect the risk of BC in daughters. BC diagnosis age Page 10/22 All studies were included in the meta-analysis of PB and BC risk by age status. The relationship between
PB and BC risk showed a significant increment (RR = 1.12, 95% CI = 1.01, 1.24) in women with > 45 years
category but in women with < 45 years category (RR = 0.95, 95% CI = 0.83, 1.07). All studies were included in the meta-analysis of PB and BC risk by age status. The relationship between
PB and BC risk showed a significant increment (RR = 1.12, 95% CI = 1.01, 1.24) in women with > 45 years
category but in women with < 45 years category (RR = 0.95, 95% CI = 0.83, 1.07). All studies were included in the meta-analysis of PB and BC risk by age status. The relationship between
PB and BC risk showed a significant increment (RR = 1.12, 95% CI = 1.01, 1.24) in women with > 45 years
category but in women with < 45 years category (RR = 0.95, 95% CI = 0.83, 1.07). Conclusion In summary, the results of this study showed that the risk of BC in women with very early PB is
significantly higher. Also, PB in women with > 45 years, as well as primiparous women has a significant
relationship with the increased risk of breast cancer. Discussion Babies born before the 28th week of
pregnancy have high levels of estrogen after birth and the previous studies have shown that birth before
32 weeks of pregnancy is a major risk factor for BC [24, 33, 34]. Therefore, the relationship between
preterm delivery and the risk of BC can be explained by changes observed in levels of these hormones. In our study, the risk of BC in women with preterm delivery at 26–31 weeks compared with compared with
delivery at 41–41 weeks did not have a significant difference in risk of breast cancer. As same as our
results, Innes KE and Byers TE in their study [35] concluded that very or extreme PB is related to higher
risk of maternal BC risk. In another similar study by Melbye M et al. [25], the results showed a higher risk
of BC in women with gestational age less than 32 weeks. Some studies have contradicted our findings. M
Kaijser et al. [24] reported that PB are not associated with an increased risk of breast cancer. Page 11/22 Page 11/22 Page 11/22 Some studies have reported the relationship between the induced abortion and BC risk [36, 37]. Probably
a part of the relationship between abortion and BC risk can be attributed to the duration of pregnancy. On
the other hand, “Collaborative Group on Hormonal Factors in Breast Cancer” in a meta-analysis of 53
studies suggested that abortion is not associated with increased risk of BC [38]. Therefore, this
relationship is still ambiguous and further studies are needed. The findings of this meta-analysis were in line with this, with the higher BC risk for PB, significantly for
post-menopausal BC and primiparous women and also borderline significantly for BC overall. Some
studies evaluated the association of PB and BC risk in parous and nulliparous women. Melbye M et al. [25] reported a higher risk of BC in parous women with preterm delivery below 32 weeks compared with
women with term delivery. Yongchun Deng et al. [36] in a meta-analysis study revealed that in parous
women, induced abortion can increase the BC risk, but it was not significant in the nulliparous women. Our study documented that the PB increases the risk of BC in women with > 45 years, but not in women
with < 45 years. As accord to our results, Melbye M et al. Discussion [25] concluded that preterm labor cannot
increase the risk of premenopausal breast cancer. In terms of generalizability of our results, it seems the results are generalizable to various populations
because it was a systematic review and meta-analysis and pooled the different results from different
countries. It should also be mentioned that there was no significant heterogeneity between primary
studies. There are some limitations in this study. The most important limitation of this study was that the
gestational age had different categories in primary studies, making it difficult to extract needed data and
analysis, and led to different subgroups analyzes. Another limitation of this study was that there are
some potential confounder variables in the relationship between PB and BC risk, which in this study was
not possible to adjust their effect. Authors' contributions MR, MS, AM-H, SV, AA-H and AE conceived the study. MS, AA-H, SV and AM-H collected the data. All
authors contributed equally to draft the manuscript. MS, AA-H, MR and AE analyzed the data and all
authors revised the manuscript and approved the final version. Acknowledgements We would like to thank the authors of included studies who sent required row data if needed. We would like to thank the authors of included studies who sent required row data if needed. Abbreviations l
i
BC:Breast Cancer, OR:Odds Ratio, RR:Risk Ratio, HR:Hazard Ratio, SIR:Standardized Incidence Ratio,
CI:Confidence Interval, PB:Preterm Birth, MeSH:Medical Subject Headings, PRISMA:Preferred Reporting
Items for Systematic Review and Meta-Analysis, MOOSE:Meta-Analysis of Observational Studies in
Epidemiology. Page 12/22 Page 12/22 Ethics approval and consent to participate This work did not require any written patient consent. Consent for publication Not applicable. Availability of data and material The datasets of this article are included within the article References Alsharif U, El Bcheraoui C, Khalil I, Charara R, Moradi-Lakeh M, Afshin A, Collison M, Chew A, Krohn
KJ, Daoud F et al: Burden of cancer in the Eastern Mediterranean Region, 2005–2015: findings from
the Global Burden of Disease 2015 Study. International Journal of Public Health 2018, 63(1):151-
164. 6. Alsharif U, El Bcheraoui C, Khalil I, Charara R, Moradi-Lakeh M, Afshin A, Collison M, Chew A, Krohn
KJ, Daoud F et al: Burden of cancer in the Eastern Mediterranean Region, 2005–2015: findings from
the Global Burden of Disease 2015 Study. International Journal of Public Health 2018, 63(1):151-
164. 7. Fitzmaurice C, Akinyemiju TF, Al Lami FH, Alam T, Alizadeh-Navaei R, Allen C, Alsharif U, Alvis-
Guzman N, Amini E, Anderson BO et al: Global, Regional, and National Cancer Incidence, Mortality,
Years of Life Lost, Years Lived With Disability, and Disability-Adjusted Life-Years for 29 Cancer
Groups, 1990 to 2016: A Systematic Analysis for the Global Burden of Disease Study. JAMA
oncology 2018, 4(11):1553-1568. 8. Anothaisintawee T, Wiratkapun C, Lerdsitthichai P, Kasamesup V, Wongwaisayawan S, Srinakarin J,
Hirunpat S, Woodtichartpreecha P, Boonlikit S, Teerawattananon Y et al: Risk Factors of Breast
Cancer:A Systematic Review and Meta-Analysis. Asia Pacific Journal of Public Health 2013,
25(5):368-387. 8. Anothaisintawee T, Wiratkapun C, Lerdsitthichai P, Kasamesup V, Wongwaisayawan S, Srinakarin J,
Hirunpat S, Woodtichartpreecha P, Boonlikit S, Teerawattananon Y et al: Risk Factors of Breast
Cancer:A Systematic Review and Meta-Analysis. Asia Pacific Journal of Public Health 2013,
25(5):368-387. 9. Antoniou AC, Shenton A, Maher ER, Watson E, Woodward E, Lalloo F, Easton DF, Evans DG: Parity and
breast cancer risk among BRCA1 and BRCA2mutation carriers. Breast Cancer Research 2006,
8(6):R72. 9. Antoniou AC, Shenton A, Maher ER, Watson E, Woodward E, Lalloo F, Easton DF, Evans DG: Parity and
breast cancer risk among BRCA1 and BRCA2mutation carriers. Breast Cancer Research 2006,
8(6):R72. 10. Collaborative Group on Hormonal Factors in Breast C: Menarche, menopause, and breast cancer risk:
individual participant meta-analysis, including 118 964 women with breast cancer from 117
epidemiological studies. The Lancet Oncology 2012, 13(11):1141-1151. 10. Collaborative Group on Hormonal Factors in Breast C: Menarche, menopause, and breast cancer risk:
individual participant meta-analysis, including 118 964 women with breast cancer from 117
epidemiological studies. The Lancet Oncology 2012, 13(11):1141-1151. 11. Ghiasvand R, Maram ES, Tahmasebi S, Tabatabaee SHR: Risk factors for breast cancer among
young women in southern Iran. References Page 13/22
erences
Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A: Global cancer statistics 2018:
GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA: A
Cancer Journal for Clinicians 2018, 68(6):394-424. DeSantis CE, Fedewa SA, Goding Sauer A, Kramer JL, Smith RA, Jemal A: Breast cancer statistics,
015: Convergence of incidence rates between black and white women. CA: a cancer journal for
clinicians 2015. Siegel RL, Miller KD, Jemal A: Cancer statistics, 2017. CA: A Cancer Journal for Clinicians 2017,
7(1):7-30. itzmaurice C, Dicker D, Pain A, Hamavid H, Moradi-Lakeh M, MacIntyre MF, Allen C, Hansen G,
Woodbrook R, Wolfe C: The global burden of cancer 2013. JAMA oncology 2015, 1(4):505-527. Torre LA, Bray F, Siegel RL, Ferlay J, Lortet-Tieulent J, Jemal A: Global cancer statistics, 2012. CA: A
Cancer Journal for Clinicians 2015, 65(2):87-108. 1. Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A: Global cancer statistics 2018:
GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA: A
Cancer Journal for Clinicians 2018, 68(6):394-424. 1. Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A: Global cancer statistics 2018:
GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA: A
Cancer Journal for Clinicians 2018, 68(6):394-424. 2. DeSantis CE, Fedewa SA, Goding Sauer A, Kramer JL, Smith RA, Jemal A: Breast cancer statistics,
2015: Convergence of incidence rates between black and white women. CA: a cancer journal for
clinicians 2015. 2. DeSantis CE, Fedewa SA, Goding Sauer A, Kramer JL, Smith RA, Jemal A: Breast cancer statistics,
2015: Convergence of incidence rates between black and white women. CA: a cancer journal for
clinicians 2015. 3. Siegel RL, Miller KD, Jemal A: Cancer statistics, 2017. CA: A Cancer Journal for Clinicians 2017,
67(1):7-30. 4. Fitzmaurice C, Dicker D, Pain A, Hamavid H, Moradi-Lakeh M, MacIntyre MF, Allen C, Hansen G,
Woodbrook R, Wolfe C: The global burden of cancer 2013. JAMA oncology 2015, 1(4):505-527. 5. Torre LA, Bray F, Siegel RL, Ferlay J, Lortet-Tieulent J, Jemal A: Global cancer statistics, 2012. CA: A
Cancer Journal for Clinicians 2015, 65(2):87-108. Page 13/22 6. References International journal of cancer 2011, 129(6):1443-1449. 11. Ghiasvand R, Maram ES, Tahmasebi S, Tabatabaee SHR: Risk factors for breast cancer among
young women in southern Iran. International journal of cancer 2011, 129(6):1443-1449. 12. Gibson LJ, Hery C, Mitton N, Gines-Bautista A, Parkin DM, Ngelangel C, Pisani P: Risk factors for
breast cancer among Filipino women in Manila. International journal of cancer 2010, 126(2):515-
521. 13. Mørch LS, Skovlund CW, Hannaford PC, Iversen L, Fielding S, Lidegaard Ø: Contemporary Hormonal
Contraception and the Risk of Breast Cancer. New England Journal of Medicine 2017, 377(23):2228-
2239. 14. Nelson HD, Zakher B, Cantor A, Fu R, Griffin J, O’Meara ES, Buist DSM, Kerlikowske K, van Ravesteyn
NT, Trentham-Dietz A et al: Risk Factors for Breast Cancer for Women Age 40 to 49: A Systematic
Review and Meta-analysis. Annals of internal medicine 2012, 156(9):635-648. 15. Palmer JR, Wise LA, Horton NJ, Adams-Campbell LL, Rosenberg L: Dual effect of parity on breast
cancer risk in African-American women. Journal of the National Cancer Institute 2003, 95(6):478-
483. 16. Clapp JF, 3rd, Schmidt S, Paranjape A, Lopez B: Maternal insulin-like growth factor-I levels (IGF-I)
reflect placental mass and neonatal fat mass. American journal of obstetrics and gynecology 2004,
190(3):730-736. Page 14/22
17. Hill M, Parizek A, Kancheva R, Duskova M, Velikova M, Kriz L, Klimkova M, Paskova A, Zizka Z,
Matucha P et al: Steroid metabolome in plasma from the umbilical artery, umbilical vein, maternal Page 14/22 Page 14/22 cubital vein and in amniotic fluid in normal and preterm labor. The Journal of steroid biochemistry
and molecular biology 2010, 121(3-5):594-610. 18. Russo J, Russo IH: Development of the human breast. Maturitas 2004, 49(1):2-15. 19. Boyne MS, Thame M, Bennett FI, Osmond C, Miell JP, Forrester TE: The relationship among
circulating insulin-like growth factor (IGF)-I, IGF-binding proteins-1 and -2, and birth anthropometry: a
prospective study. The Journal of clinical endocrinology and metabolism 2003, 88(4):1687-1691. 20. Bukowski R, Chlebowski RT, Thune I, Furberg A-S, Hankins GDV, Malone FD, D'Alton ME: Birth weight,
breast cancer and the potential mediating hormonal environment. PloS one 2012, 7(7):e40199-
e40199. 21. Mucci LA, Lagiou P, Tamimi RM, Hsieh CC, Adami HO, Trichopoulos D: Pregnancy estriol, estradiol,
progesterone and prolactin in relation to birth weight and other birth size variables (United States). Cancer causes & control : CCC 2003, 14(4):311-318. 22. References Troisi R, Potischman N, Roberts J, Siiteri P, Daftary A, Sims C, Hoover RN: Associations of maternal
and umbilical cord hormone concentrations with maternal, gestational and neonatal factors (United
States). Cancer causes & control : CCC 2003, 14(4):347-355. 23. Swerdlow AJ, Wright LB, Schoemaker MJ, Jones ME: Maternal breast cancer risk in relation to
birthweight and gestation of her offspring. Breast cancer research : BCR 2018, 20(1):110-110. 24. Kaijser M, Akre O, Cnattingius S, Ekbom A: Preterm birth, birth weight, and subsequent risk of female
breast cancer. British journal of cancer 2003, 89(9):1664-1666. 24. Kaijser M, Akre O, Cnattingius S, Ekbom A: Preterm birth, birth weight, and subsequent risk of female
breast cancer. British journal of cancer 2003, 89(9):1664-1666. 25. Melbye M, Wohlfahrt J, Andersen AM, Westergaard T, Andersen PK: Preterm delivery and risk of
breast cancer. Br J Cancer 1999, 80(3-4):609-613. 25. Melbye M, Wohlfahrt J, Andersen AM, Westergaard T, Andersen PK: Preterm delivery and risk of
breast cancer. Br J Cancer 1999, 80(3-4):609-613. 26. Moher D, Liberati A, Tetzlaff J, Altman DG: Preferred reporting items for systematic reviews and
meta-analyses: the PRISMA statement. PLoS medicine 2009, 6(7):e1000097. 26. Moher D, Liberati A, Tetzlaff J, Altman DG: Preferred reporting items for systematic reviews and
meta-analyses: the PRISMA statement. PLoS medicine 2009, 6(7):e1000097. 27. Stroup DF, Berlin JA, Morton SC, Olkin I, Williamson GD, Rennie D, Moher D, Becker BJ, Sipe TA,
Thacker SB: Meta-analysis of observational studies in epidemiology: a proposal for reporting. Meta-
analysis Of Observational Studies in Epidemiology (MOOSE) group. Jama 2000, 283(15):2008-2012. 28. Ferguson DJ, Anderson TJ: A morphological study of the changes which occur during pregnancy in
the human breast. Virchows Archiv A, Pathological anatomy and histopathology 1983, 401(2):163-
175. 29. Russo J, Tay LK, Russo IH: Differentiation of the mammary gland and susceptibility to
carcinogenesis. Breast cancer research and treatment 1982, 2(1):5-73. 30. Russo J, Balogh GA, Heulings R, Mailo DA, Moral R, Russo PA, Sheriff F, Vanegas J, Russo IH:
Molecular basis of pregnancy-induced breast cancer protection. European journal of cancer
prevention : the official journal of the European Cancer Prevention Organisation (ECP) 2006,
15(4):306-342. Page 15/22
31. Russo J, Mailo D, Hu YF, Balogh G, Sheriff F, Russo IH: Breast differentiation and its implication in
cancer prevention. Clinical cancer research : an official journal of the American Association for
Cancer Research 2005, 11(2 Pt 2):931s-936s. Page 15/22 32. References Travis RC, Key TJ: Oestrogen exposure and breast cancer risk. Breast cancer research : BCR 2003,
5(5):239-247. 33. Ekbom A, Erlandsson G, Hsieh C, Trichopoulos D, Adami HO, Cnattingius S: Risk of breast cancer in
prematurely born women. Journal of the National Cancer Institute 2000, 92(10):840-841. 34. Trichopoulos D: Hypothesis: does breast cancer originate in utero? Lancet (London, England) 1990,
335(8695):939-940. 35. Innes KE, Byers TE: First pregnancy characteristics and subsequent breast cancer risk among young
women. International journal of cancer 2004, 112(2):306-311. 36. Deng Y, Xu H, Zeng X: Induced abortion and breast cancer: An updated meta-analysis. Medicine
2018, 97(3):e9613-e9613. 37. Carroll P: Breast cancer risk and induced abortion: the debate continues. The Lancet Oncology 2002,
3(5):267. 38. Breast cancer and abortion: collaborative reanalysis of data from 53 epidemiological studies,
including 83 000 women with breast cancer from 16 countries. The Lancet 2004, 363(9414):1007-
1016. Supplementary Files Legend Supplementary 1: Search Strategy Supplementary 1: Search Strategy Supplementary 2: Table s2: Results of the critical appraisal of the included case control studies Supplementary 2: Table s2: Results of the critical appraisal of the included case control studies Figures Page 16/22 Page 16/22 Page 16/22 Figure 1 Flow diagram of the literature search for studies included in meta-analysis Flow diagram of the literature search for studies included in meta-analysis Page 17/22 Page 17/22 Figure 2 Forest plot describing the association between preterm birth and breast cancer risk Page 18/22 Page 18/22 Figure 3 The Funnel plot of included primary studies The Funnel plot of included primary studies Page 19/22 Page 19/22 Figure 5 Forest plot describing the association between preterm birth and breast cancer risk on the basis of age
categories Figure 4 Forest plot describing the association between preterm birth and breast cancer risk on the basis of parity
status Page 20/22 Supplementary Files Page 21/22 This is a list of supplementary files associated with this preprint. Click to download. Appendixs1.doc PRISMA2009checklist.doc Supplementary2.docx Page 22/22
| 3,565 |
US-16649605-A_1
|
USPTO
|
Open Government
|
Public Domain
| 2,005 |
None
|
None
|
English
|
Spoken
| 7,174 | 10,597 |
Fc fusion
ABSTRACT
The present invention relates to a simple method for generating antibody-based structures suitable for in vivo use. In particular, the invention relates to a method for the generation of antibody-based structures suitable for in vivo use comprising the steps of: (a) selecting an antibody single variable domain having an epitope binding specificity; and (b) attaching the single domain of step (a) to an effector group. Uses of molecules generated using the method of the Invention are also described.
The present invention relates to a simple method for generating antibody molecules suitable for in vivo use. In particular, the invention relates to a method for the generation of antibody molecules suitable for in vivo use which are based on antibody single variable domains.
INTRODUCTION
The antigen binding domain of an antibody comprises two separate regions: a heavy chain variable domain (V_(H)) and a light chain variable domain (V_(L): which can be either V_(κ)V_(k) or V_(λ)). The antigen binding site itself is formed by six polypeptide loops: three from V_(H) domain (H1, H2 and H3) and three from V_(L) domain (L1, L2 and L3). A diverse primary repertoire of V genes that encode the V_(H) and V_(L) domains is produced by the combinatorial rearrangement of gene segments. The V_(H) gene is produced by the recombination of three gene segments, V_(H), D and J_(H). In humans, there are approximately 51 functional V_(H) segments (Cook and Tomlinson (1995) Immunol Today, 16: 237), 25 functional D segments (Corett et al. (1997) J. Mol. Biol. 268: 69) and 6 functional V_(H) segments (Ravetch et al. (1981) Cell, 27: 583), depending on the haplotype. The V_(H) segment encodes the region of the polypeptide chain which forms the first and second antigen binding loops of the V_(H) domain (1 and H2), whilst the V_(H), D and J_(H) segments combine to form the third antigen binding loop of the V_(H) domain (H3). The V_(L) gene is produced by the recombination of only two gene segments, V_(L) and J_(L). In humans, there are approximately 40 functional V_(κ) segments (Schäble and Zachau (1993) Biol. Chem. Hoppe-Seyler, 374: 1001), 31 functional V_(λ) segments (Williams et al. (1996) J. Mol. Biol., 264: 220; Kawasald et al. (1997) Genome Res., 7: 250), 5 functional J_(κ) segments (Hieter et al. (1982) J. Biol. Chem., 257: 1516) and 4 functional J_(λ) segments (Vasicek and Leder (1990) J. Exp. Med., 172: 609), depending on the haplotype. The V_(L) segment encodes the region of the polypeptide chain which forms the first and second antigen binding loops of the V_(L) domain (L1 and L2), whilst the V_(L) and J_(L) segments combine to form the third antigen binding loop of the V_(L) domain (L3). Antibodies selected from this primary repertoire are believed to be sufficiently diverse to bind almost all antigens with at least moderate affinity. High affinity antibodies are produced by “affinity maturation” of the rearranged genes, in which point mutations are generated and selected by the immune system on the basis of improved binding.
Analysis of the structures and sequences of antibodies has shown that five of the six antigen binding loops (H1, H2, L1, L2, L3) possess a limited number of main-chain conformations or canonical structures (Chothia and Lesk (1987) J. Mol. Biol., 196: 901; Chothia et al. (1989) Nature, 342: 877). The main-chain conformations are determined by (i) the length of the antigen binding loop, and (ii) particular residues, or types of residue, at certain key position in the antigen binding loop and the antibody framework. Analysis of the loop lengths and key residues has enabled us to the predict the main-chain conformations of H1, H2, L1, L2 and L3 encoded by the majority of human antibody sequences (Chothia et al. (1992) J. Mol. Biol., 227: 799; Tomlinson et al (1995) EMBO J., 14: 4628; Williams et al. (1996) J. Mol. Biol., 264: 220). Although the H3 region is much more diverse in terms of sequence, length and structure (due to the use of D segments), it also forms a limited number of main-chain conformations for short loop lengths which depend on the length and the presence of particular residues, or types of residue, at key positions in the loop and the antibody framework (Martin et al. (1996) J. Mol. Biol., 263: 800; Shirai et al. (1996) FEBS Letters, 399: 1.
Historically, antibodies have been obtained from natural sources such as by the immunisation of rabbits and other such animals. Alternatively, molecular biology techniques may be employed and antibodies may be generated using techniques such as those involving the use of hybrid hydribomas.
In this way antibodies of a selected or desired antigen binding specificity can be generated. Such antibodies are of great therapeutic value as they can be designed against disease antigens, for instance. However, the method of production of these antibodies is laborious and prone to error, as well as being limited to diversity resulting from the immunisation history of the donor. It would be an advantage to generate increased diversity, e.g. using synthetic librarires. Therefore, there remains in the art a need for a simple method of generating functionally active antibody molecules of a desired or predetermined antigen binding specificity.
Single heavy chain variable domains have been described, derived from natural antibodies which normally comprise light chains, from monoclonal antibodies or from repertoires of domains (BP-A-0368684). These heavy chain variable domains have been shown to interact specifically with one or more antigens (Ward et al,). However, these single domains have been shown to have a very short in vivo half-life. Therefore such domains are of limited therapeutic value.
In addition, EP 0 656 946A1 describes dual-chain immunoglobulin molecules which bind antigen specifically, and in which the heavy polypeptide chains are devoid of CH1 heavy chain domains, the immunoglobulin also being devioid of light polypeptide chains. Such antibodies are naturally occurring in Camelids, and therefore, as such the antigen specificity of the antibody is limited to those generated by the Camelid.
Also noteworthy are studies performed on Heavy Chain Disease. In this disease immunoglobulin molecules are generated which comprise a heavy chain variable domain, CH2 and CH3 domains, but lack a CH1 domain and light chains. Such molecules are found to accumulate in Heavy Chain Disease (Block et al, Am J. Med, 55, 61-70 (1973), Ellman et al, New Engl. J. Med, 278:95-1201 (1968)). Thus, the Heavy Chain Disease prior art teaches that antibodies comprising a single antigen interaction domain type only (in this case heavy chain variable domains) are associated with disease. That is, the prior art teaches away from the use of antibodies based solely on human heavy chain variable domains for prophylactic and/or therapeutic use.
International patent application WO88/09344 (Creative Biomolecules) describes antibody constructs comprising linkers to link domains.
Therefore, there remains a need in the art for a simple and non-laborious method for the generation of antibody based molecules of a desired or predetermined antigen binding specificity not necessarily limited by the pr exposure of the donor to antigen which are suitable for prophylactic and/or therapeutic use.
SUMMARY OF THE INVENTION
The present inventors have devised a simple and non-laborious method for the synthesis of antibody based molecules of a selected epitope binding specificity, which are suitable for in vivo prophylactic and/or therapeutic use. Significantly, the method of the invention permits the synthesis of single chain antibody based molecules of a desired or pre-determined epitope binding specificity. The use of this simple method is surprising in light of the Heavy Chain disease prior art which teaches away from the therapeutic use of heavy chain-only antibodies.
Structurally, the molecules of the present invention comprise an antibody single variable domain having a defined or predetermined epitope binding specificity and one or more antibody constant regions and/or hinge region (collectively termed “an effector group”). Such a molecule is referred to as a single domain-effector group immunoglobulin (dAb-effector group) and the present inventors consider that such a molecule will be of considerable therapeutic value.
Thus, in a first aspect, the present invention provides a method for synthesising a single-domain-effector group immunoglobulin (dAb-effector group) suitable for in vivo use comprising the steps of:
- (a) selecting an antibody single variable domain having an epitope binding specificity, and - (b) attaching the single domain of step (a) to an immunoglobulin effector group
According to the present invention, preferably the antibody single domain is a non-camelid antibody single domain. Advantageously, it is a single variable domain of human origin. The invention also described herein also contemplates CDR grafting non-camelid, for example human, CDRs onto Camelid framework regions. Techniques for CDR grafting of human CDRs to Camelid framework regions are known in the art. Such methods are described in European Patent Application 0 239 400 (Winter) and, may include framework modification [EP 0 239 400; Riechmann, L. et al., Nature, 332, 323-327, 1988; Verhoeyen M. et al., Science, 239, 1534-1536, 1988; Kettleborough, C. A. et al., Protein Engng., 4, 773-783, 1991; Maeda, H. et al., Human Antibodies and Hybridoma, 2, 124-134, 1991; Gorman S. D. et al., Proc. Natl. Acad. Sci. USA, 88, 4181-4185, 1991; Tempest P. R. et al., Bio/Technology, 9, 266-271, 1991; Co, M. S. et al., Proc. Natl. Acad. Sci. USA, 88, 2869-2873, 1991; Carter, P. et al., Proc. Natl. Acad. Sci. USA, 89, 4285-4289, 1992; Co, M. S. et al., J. Immunol., 148, 1149-1154, 1992; and, Sato, K. et al., Cancer Res., 53, 851-856, 1993]. In another embodiment, the single variable domain comprises non-Camelid (eg, human) framework regions (eg, 1, 2, 3 or 4 human framework regions). Advantageously one or more of the human framework regions (as defined by Kabat) are identical on the amino acid level to those encoded by human germline antibody genes.
Variable region sequences in, for example, the Kabat database of sequences of immunological interest, or other antibody sequences known or identifiable by those of skill in the art can be used to generate a dAb-effector group as described herein. The Kabat database or other such databases include antibody sequences from numerous species.
CDRs and framework regions are those regions of an immunoglobulin variable domain as defined in the Kabat database of Sequences of Proteins of Immunological Interest. Preferred human framework regions are those encoded by germline gene segments DP47 and DPK9. Advantageously, FW1, FW2 and FW3 of a V_(H) or V_(L) domain have the sequence of FW1, FW2 or FW3 from DP47 or DPK9. The human frameworks may optionally contain mutations, for example up to about 5 amino acid changes or up to about 10 amino acid changes collectively in the human frameworks used in the ligands of the invention.
Advantageously, the antibody single variable domains used according to the methods of the present invention are isolated, at least in part by human immunisation. Advantageously they are not isolated by animal immunisation.
In one embodiment, the single variable domain comprises a binding site for a generic ligand as defined in WO 99/20749 For example, the generic ligand is Protein A or Protein L.
As herein defined, the term ‘single-domain-effector group immunoglobulin molecule’ (dAb-effector group) describes an engineered immunoglobulin molecule comprising a single variable domain capable of specifically binding one or more epitopes, attached to one or more constant region domains and/or hinge (collectively termed “an effector group”). Each variable domain may be a heavy chain domain (V_(H)) or a light chain domain (V_(L)). Each light chain domain may be either of the kappa or lambda subgroup. Advantageously, an effector group as herein described comprises an Fc region of an antibody.
dAb-effector groups may be combined to form multivalent structures, including any of those selected from the group consisting of the following: homodimers, heterodimers and multimers. Such multimeric structures have improved avidity of antigen interaction by virtue of the multimeric structures having more than one epitope binding site where the is epitopes are on the same antigen. Where the epitopes are on different antigens, eg those close together on the same cell surface, these epitopes may be bridged by dAb-effector groups.
For the avoidance of doubt, dAb-effector groups according to the invention do not include the dual-chain antibodies as described in EP-A-0656946 as well as single chain fragments disclosed therein, such as V_(HH)-binge fragments, based on camelid immunoglobulins. In addition, the term ‘dAb-effector group’ does not include within its scope the naturally occurring dual chain antibodies generated within Camelids. Nor does the teem ‘dAb-effector group’ include within its scope the four-chain structure of IgG antibody molecules comprising two light and two heavy chains or single heavy or light chains derived therefrom.
As referred to above, the term ‘suitable for in vivo use’ means that the ‘dAb-effector group’ according to the present invention has sufficient half-life such that the molecule is present within the body for sufficient time to produce one or more desired biological effects. In this regard the present inventors have found that the size and nature of the effector group influences the in vivo half-life of the dAb-effector groups according to the invention.
A preferred effector group according to the present invention is or comprises the Fc region of an antibody molecule. Such an effector group permits Fc receptor binding (e.g. to one or both of Fc receptors CD64 and CD32) and complement activation via the interaction with C1q, whilst at the same time providing the molecule with a longer half-life then a single variable heavy chain domain in isolation.
As used herein, the term ‘epitope’ is a unit of structure conventionally bound by antigen binding site as provided by one or more variable domains, e.g. an immunoglobulin V_(H)/V_(L) pair. Epitopes define the minimum binding site for an antibody, and thus represent the target of specificity of an antibody. In the case of a single domain antibody, an epitope represents the unit of structure bound by a variable domain in isolation of any other variable domain.
As used herein, the term ‘select’ (an antibody variable domain) includes within its scope the selection of (an antibody variable domain) from a number of different alternatives. Techniques for the ‘selection’ of antibody variable domains will be familiar to those skilled in the art. The term ‘selection’ (of an antibody variable domain) includes within its scope the ‘selection’ of one or more variable domains by library screening. Advantageously, the selection involves the screening of a repertoire of antibody variable domains displayed on the surfaces of bacteriophage within a phage display library (McCafferty et al, (1990) Nature 340, 662-654) or emulsion-based in vitro systems (Tawfik & Griffiths (1998) Nature Biotechnol 16(7), 652-6.
As used herein the term ‘attaching’ (the single domain as herein described to an effector group) includes within its scope the direct attachment of a single domain as described herein to one or more constant regions as herein described. It also includes the indirect attachment of a single domain to an effector group via for example a further group and/or a linker region. Furthermore, the term ‘attaching’ includes within its scope an association of the respective groups such that the association is maintained in vivo such that the dAb-effector group is capable of producing biological effects, such as increasing half life (i.e., serum residence time of the variable domain) and allowing the functional attributes of; for example, constant regions, such as Fc regions, to be exploited in vivo.
In a preferred embodiment, the variable domain and the effector group are directly attached, without the use of a linker.
In the case that a linker is used to attach a variable domain to one or more constant region domains, the linker is advantageously a polypeptide linker. One skilled in the art will appreciate that the length and composition of the linker may affect the physical characteristics of the dAb-effector group. Thus, a short linker may minimise the degree of freedom of movement exhibited by each group relative to one another, whereas a longer linker may allow more freedom of movement. Likewise bulky or charged amino acids may also restrict the movement of one domain relative to the other. Discussion of suitable linkers is provided in Bird et al. Science 242, 423-426. Hudson et al, Journal Immunol Methods 231 (1999) 177-189; Hudson et al, Proc Nat Acad Sci USA 85, 5879-5883. One example is a (Gly₄ Ser)_(n) linker, where n=1 to 8, eg, 2, 3 or 4.
The attachment of a single variable domain to an effector group, as herein defined may be achieved at the polypeptide level, that is after expression of the nucleic acid encoding the respective domains and groups. Alternatively, the attachment step may be performed at the nucleic acid level. Methods of attachment an include the use of protein chemistry and/or molecular biology techniques which will be familiar to those skilled in the art and are described herein.
As defined herein the term ‘non-camelid antibody single variable domain’ refers to an antibody single variable domain of non-camelid origin. The non-camelid antibody single variable domain may be selected from a repertoire of single domains, for example from those represented in a phage display library. Alternatively, they may be derived from native antibody molecules. Those skilled in the art will be aware of further sources of antibody single variable domains of non-camelid origin.
Antibody single variable domains may be light chain variable domains (V_(L)) or heavy chain variable domains (V_(H)). Each V_(L) chain variable domain is of the Vkappa (V_(κ)) or Vlambda (Vλ) sub-group. Advantageously, those domains selected are light chain variable domains.
Structurally, single domain effector groups may comprise V_(H) or V_(L) domains as described above.
According to one embodiment of the present invention, an antibody variable domain (V_(H) or V_(L)) is attached to one or more antibody constant region heavy domains. Such one or more constant heavy chain domains constitute an ‘effector group’ according to the present invention.
In one embodiment, each V_(H) or V_(L) domain is attached to an Fc region (an effector group) of an antibody. Advantageoously, a dAb-effector group according to the invention is V_(L)-Fc. In the case that the effector group is an Fc region of an antibody, then the CH3 domain facilitates the interaction of a dAb-effector group with Fc receptors whilst the CH2 domain permits the interaction of a dAb-effector group with C1q, thus facilitating the activation of the complement system. In addition, the present inventors have found that the Fc portion of the antibody stabilises the dAb-effector group and provides the molecule with a suitable half-life for in vivo therapeutic and/or prophylactic use.
Other suitable effector groups include any of those selected from the group consisting of the following: an effector group comprising at least an antibody light chain constant region (CL), an antibody CH1 heavy chain domain, an antibody CH2 heavy chain domain, an antibody CH3 heavy chain domain, or any combination thereof. In addition to the one or more constant region domains, an effector group may also comprise a hinge region of an antibody (such a region normally being found between the CH1 and CH2 domains of an IgG molecule). In a further embodiment of the above aspect of the invention, the effector group is a hinge region alone such that the dAb-effector group comprises a single variable domain attached to the hinge region of an antibody molecule.
According to the present invention, advantageously an effector group as herein described is or comprises the constant region domains CH2 and/or CH3. Advantageously, the effector group comprises CH2 and/or CH3, preferably an effector group as herein described consists of CH2 and CH3 domains, optionally attached to a hinge region of an antibody molecule as described herein.
In a further aspect, the present invention provides a ‘dAb-effector group’ obtainable using the methods of the present invention. For the avoidance of any doubt, ‘dAb-effector groups’ according to the present invention, do not include within their scope the four-chain structure of IgG molecules nor the dual-chain structure of naturally occurring Camelid antibodies or those described in EP 0 656 946 A1.
Antibody single variable domains may be light chain variable domains (V_(L)) or heavy chain variable domains (V_(H)). Each V_(L) chain variable domain is of the Vkappa (Vk) or Vlambda (Vλ) sub-group. Advantageously, those domains selected are light chain variable domains. The use of V_(L) domains has the advantage that these domains unlike variable heavy chain domains (V_(H)) do not possess a hydrophobic interfaces which are ‘sticky’ and can cause solubility problems in the case of isolated V_(H) domains.
Structurally, single domain effector group immunoglobulin molecules according to the present invention comprise either V_(H) or V_(L) domains as described above.
According to the above aspect of the invention, advantageously the dAb-effector group obtained by the methods of the invention is an V_(H)-Fc or a V_(L)-Fc. More advantageously, the dAb-effector group is V_(L)-Fc. In an alternative embodiment of this aspect of the invention the dAb-effector group is V_(H)-hinge. In an alternative embodiment still, the dAb-effector group is a Vk-Fc. The present inventors have found that the Fc portion of the antibody stabilises the dAb-effector group providing the molecule with a suitable half-life.
In an alternative embodiment of this aspect of the invention, the effector group is based on a Fab antibody fragment. That is, it comprises an antibody fragment comprising a V_(H) domain or a V_(L) domain attached to one or more constant region domains making up a Fab fragment. One skilled in the art will appreciate that such a fragment comprises only one variable-domain. Such Fab effector groups are illustrated in FIG. 1 h.
Various preferred ‘dAb-effector groups’ prepared according to the methods of the present invention are illustrated in FIG. 1.
The dAb-effector groups of the present invention may be combined onto non-immunoglobulin multi-ligand structures so that they form multivalent structures comprising more than one antigen binding site. Such structures have an increased avidity of antigen binding. In an example of such multimers, the V regions bind different epitopes on the same antigen providing superior avidity. In another embodiment multivalent complexes may be constructed on scaffold proteins, as described in WO0069907 (Medical Research Council), which are based for example on the ring structure of bacterial GroEL or on other chaperone polypeptides.
Alternatively, dAb-effector groups according to the present invention, may be combined in the absence of a non-immunoglobulin protein scaffold to form multivalent structures which are solely based on immunoglobulin domains. Such multivalent structures may have increased avidity towards target molecules, by virtue of them comprising multiple epitope binding sites. Such multivalent structures may be homodimers, heterodimers or multimers.
The present inventors consider that dAb-effector groups of the invention, as well as such multivalent structures, will be of particular use for use in prophylactic and/or therapeutic uses.
Antigens may be, or be part of; polypeptides, proteins or nucleic acids, which may be naturally occurring or synthetic. One skilled in the art will appreciate that the choice is large and varied. They may be for insane human or animal proteins, cytokines, cytokine receptors, enzymes co-factors for enzymes or DNA binding proteins. Suitable cytokines and growth factors include but are not limited to: ApoE, Apo-SAA, BDNF, Cardiotrophin-1, EGF, EGF receptor, ENA-78, Eotaxin, Eotaxin-2, Exodus-2, EpoR, FGF-acidic, FGF-basic, fibroblast growth factor-10, FLT3 ligand, Fractalkine (CX3C), GDNF, G-CSF, GM-CSF, GF-β1, insulin, IL1R1, IFN-γ, IGF-I, IGF-II, IL-1α, IL-1β, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8 (72 a.a.), IL-8 (77 a.a.), IL-9, IL-10, IL-11, IL-12, IL-13, IL-15, IL-16, IL-17, IL-18 (IGIF), Inhibin α, Inhibin β, IP-10, keratinocyte growth factor-2 (KGF-2), KGF, Leptin, LIF, Lymphotactin, Mullerian inhibitory substance, monocyte colony inhibitory factor, monocyte attractant protein (30 ibid), M-CSF, MDC (67 a.a.), MDC (69 a.a.), MCP-1 (MCAF), MCP-2, MCP-3, MCP-4, MDC (67 a.a.), MDC (69 a.a.), MIG, MIP-1α, MIP-1β, MIP-3α, MIP-3β, MIP-4, myeloid progenitor inhibitor factor-1 (MPIF-1), NAP-2, Neurturin, Nerve growth factor, β-NGF, NT-3, NT-4, Oncostatin M, p55, TNFαrecognition site, pro-TNF-α-stalk, PDGF-AA, PDGF-AB, PDGF-BB, PF-4, RANTES, SDF1α, SDF1β, SCF, SCGF, stem cell factor (SCF), TARC, TACE enzyme recognition site, TGF-α, TGF-β, TGFβ1, TGF-β2, TGF-β3, tumour necrosis factor (TNF), TNF-α, TNF-β, TNF receptor I, TNF receptor II, TNIL-1, TPO, VEGF, VEGF receptor 1, VEGF receptor 2, VEGF receptor 3, GCP-2, GRO/MGSA, GRO-β, GRO-γ, HCC1, 1-309, HER 1, HER 2, HER 3 and HER 4. Cytokine receptors include receptors for the foregoing cytokines. It will be appreciated that this list is not intended to be exhaustive.
In one embodiment of the invention, the variable domains are derived from an antibody directed against one or more antigen/s or epitope/s. In this respect, the dAb-effector group of the invention may bind the epiotpe/s or antigen/s and act as an antagonist or agonist (eg, EPO receptor agonist).
In a preferred embodiment the variable domains are derived from a repertoire of single variable antibody domains. In one example, the repertoire is a repertoire that is not created in an animal or a synthetic repertoire. In another example, the single variable domains are not isolated (at least in part) by animal immunisation. Thus, the single domains can be isolated from a naïve library.
In one aspect, a library (eg, phage or phagemid library or using emulsion technology as described in WO 99/02671) is made wherein a population of library members each comprises a common construct encoding an effector group (eg, an Fc region). A diversity of sequences encoding single variable domains is then spliced in to form a library of members displaying a diversity of single variable domains in the context of the same effector group. dAb-effector group selection against antigen or epitope is then effected in the context of the common effector group, which may have been selected in the basis of its desirable effects on half life, for example.
In a further aspect, the present invention provides one or more nucleic acid molecules encoding at least a dAb-effector group as herein defined.
The dAb-effector group may be encoded on a single nucleic acid molecule; alternatively, different parts of the molecule may be encoded by separate nucleic acid molecules. Where the ‘dAb-effector group’ is encoded by a single nucleic acid molecule, the domains may be expressed as a fusion polypeptide, or may be separately expressed and subsequently linked together, for example using chemical linking agents. dAb-effector groups expressed from separate nucleic acids will be linked together by appropriate means.
The nucleic acid may further encode a signal sequence for export of the polypeptides from a host cell upon expression and may be fused with a surface component (eg, at least part of the pIII coat protein) of a filamentous bacteriophage particle (or other component of a selection display system) upon expression.
In a further aspect the present invention provides a vector comprising nucleic acid according to the present invention.
In a yet further aspect, the present invention provides a host cell transfected with a vector according to the present invention.
Expression from such a vector may be configured to produce, for example on the surface of a bacteriophage particle, dAb-effector groups for selection.
The present invention further provides a kit suitable for the prophylaxis and/or treatment of disease comprising at least an dAb-effector group according to the present invention.
In a further aspect still, the present invention provides a composition comprising a dAb-effector group, obtainable by a method of the present invention, and a pharmaceutically acceptable carrier, diluent or excipient.
As discussed previously, the present inventors have found that the size and nature of the effector group enhances the half-life of a dAb-effector group according to the present invention. Methods for pharmacokinetic analysis will be familiar to those skilled in the art. Details may be found in Kenneth, A et al: Chemical Stability of Pharmaceuticals: A Handbook for Pharmacists and in Peters et al, Pharmacokinetc analysis: A Practical Approach (1996). Reference is also made to “Pharmacokinetics”, M Gibaldi & D Perron, published by Marcel Dekker, 2^(nd) Rev. ex edition (1982), which describes pharmacokinetic parameters such as t alpha and t beta half lives and area under the cureve (AUC).
Half lives (t1/2 alpha and t1/2 beta) and AUC can be determined from a curve of serum concentration of dAb-Effector Group against time (see, eg FIG. 6). The WinNonlin analysis package (available from Pharsight Corp., Mountain View, Calif. 94040, USA) can be used, for example, to model the curve. In a first phase (the alpha phase) the dAb-Effector Group is undergoing mainly distribution in the patient, with some elimination A second phase (beta phase) is the terminal phase when the dAb-Effector Group has been distributed and the serum concentration is decreasing as the dAb-Effector Group is cleared from the patient. The t alpha half life is the half life of the first phase and the t beta half life is the half life of the second phase.
Thus, advantageously, the present invention provides a dAb-effector group or a composition comprising a dAb-effector group according to the invention having a tα half-life in the range of 15 minutes or more. In one embodiment, the lower end of the range is 30 minutes, 45 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 10 hours, 11 hours or 12 hours. In addition, or alternatively, a dAb-effector group or composition according to the invention will have a tα half life in the range of up to and including 12 hours. In one embodiment, the upper end of the range is 11, 10, 9, 8, 7, 6 or 5 hours. An example of a suitable range is 1 to 6 hours, 2 to 5 hours or 3 to 4 hours.
Advantageously, the present invention provides a dAb-effector group or a composition comprising a dAb-effector group according to the invention having a tβ half-life in the range of 2.5 hours or more. In one embodiment, the lower end of the range is 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 10 hours, 11 hours, or 12 hours. In addition, or alternatively, a dAb-effector group or composition according to the invention has a tβ half-life in the range of up to and including 21 days. In one embodiment, a dAb-effector group according to the invention has a tβ half-life of any of those tβ half-lifes selected from the group consisting of the following: 12 hours or more, 24 hours or more, 2 days or more, 3 days or more, 4 days or more, 5 days or more, 6 days or more, 7 days or more, 8 days or more, 9 days or more, 10 days or more, 11 days or more, 12 days or more, 13 days or more, 14 days or more, 15 days or more or 20 days or more. Advantageously a dAb-effector group or composition according to the invention will have a tβ half life in the range 12 to 60 hours. In a further embodiment, it will have a to half-life of a day or more. In a further embodiment still, it will be in the range 12 to 26 hours.
Advantageously, a dAb-effector group according to the present invention comprises or consists of an V_(L)-Fc having a tβ half-life of a day or more, two days or more, 3 days or more, 4 days or more, 5 days or more, 6 days or more or 7 days or more. Most advantageously, a dAb-effector group according to the present invention comprises or consists of an V_(L)-Fc having a tβ half-life of a day or more.
According to the present invention, most advantageously, a dAb-effector group according comprises an effector group consisting of the constant region domains CH2 and/or CH3, preferably CH2 and CH3, either with or without a hinge region as described herein, wherein the dAb-effector group has a tβ half-life of a day or more, two days or more, 3 days or more, 4 days or more, 5 days or more, 6 days or more or 7 days or more. Most advantageously, a dAb-effector group according to the present invention comprises an effector group consisting of the constant region domains CH2 and/or CH3 wherein the dAb-effector group has a tβ half-life of a day or more.
In addition, or alternatively to the above criteria, the present invention provides a dAb-effector group or a composition comprising a dAb-effector group according to the invention having an AUC value (area under the curve) in the range of 1 mg.min/ml or more. In one embodiment, the lower end of the range is 5, 10, 15, 20, 30, 100, 200 or 300 mg.min/ml. In addition, or alternatively, a dAb-effector group or composition according to the invention has an AUC in the range of up to 600 mg.min/ml. In one embodiment, the upper end of the range is 500, 400, 300, 200, 150, 100, 75 or 50 mg.min/ml. Advantageously a dAb-effector group according to the invention will have a AUC in the range selected from the group consisting of the following: 15 to 150 mg.min/ml, 15 to 100 mg.min/ml, 15 to 75 mg.min/ml, and 15 to 50 mg-min/ml.
In a further aspect, the present invention provides a method for the prophylaxis and/or treatment of disease using a dAb-effector group or a composition according to the present invention.
In a further aspect, the present invention provides a dAb-effector group according to the present invention or a composition thereof in the treatment of disease.
Furthermore, the present inventors have found that a dAb-Fc specific for target human TNF alpha and designated TAR1-5-19-Fc was shown to be a highly effective therapy in a model of arthritis. Thus the inventors consider that a TAR1-5-19-effector group may be of particular use in the prophylaxis and/or treatment of one or more inflammatory diseases.
Thus in a further aspect the present invention provides a method for the treatment of one or more inflammatory diseases in a patient in need of such treatment which comprises the step of administering to that patient a therapeutically effective amount of a dAb-effector group according to the invention.
In a further aspect the present invention provides the use of a dAb-effector group according to the invention in the preparation of a medicament for the prophylaxis and/or treatment of one or more inflammatory diseases.
According to the above aspects of the invention, advantageously, the dAb-effector group specifically binds to TNF alpha. More advantageously, the dAb-effector group specifically binds to human TNF alpha. More advantageously stilt the dAb-effector group is a dAb-Fc and specifically binds to TNF alpha, preferably human TNFalpha. More advantageously still, the dAb-effector group comprises TAR1-5-19 as effector group. Most advantageously, the dAb-effector group for use according to the above aspects of the invention is TAR1-5-19-Fc.
According to the above aspects of the invention, advantageously, the one or more inflammatory diseases are mediated by TNF-alpha. Advantageously, the one or more inflammatory diseases are mediated by TNFalpha and are selected from the group consisting of the following: rheumatoid arthritis, psoriasis, Crohns disease, inflammatory bowel disease (IBD), multiple sclerosis, septic shock, alzheimers, coronary thrombosis, chronic obstructive pulmonary disease (COPD) and glomerular nephritis.
In a further aspect the present invention provides a method for reducing and/or preventing and/or suppressing cachexia in a patient which is mediated by TNFalpha which method comprises the step of administering to a patient in need of such treatment a therapeutically effective amount of a dAb-effector group according to the present invention.
In a further aspect still the invention provides the use of a dAb-effector group according to the invention in the preparation of a medicament for reducing and/or preventing and/or suppressing cachexia in patient.
In a preferred embodiment of the above aspects of the invention, the cachexia is associated with an inflammatory disease. Advantageously, the inflammatory disease is selected from the group consisting of the following: rheumatoid arthritis, psoriasis, Crohns disease, inflammatory bowel disease (IBD), multiple sclerosis, septic shock, alzheimers, coronary thrombosis, chronic obstructive pulmonary disease (COPD) and glomerular nephritis.
According to the above aspects of the invention, the method or use may be used for the treatment of human or non-human patients. According to the above aspects of the invention, preferably, the patient is a human and the TNFalpha is human TNFalpha.
Suitable dosages for the administration to a subject of dAb-effector group according to the invention will be familiar to those skilled in the art. Advantageously, the dose is in the range of between 0.5 to 20 mg/Kg of dAb-effector group. More advantageously, the dosage of dAb-effecotr group is in the range of between 1 to 10 mg/Kg. Preferred dosage ranges are between 1 and 5 mg/Kg. Most advantageously, dosages of 1 mg/Kg or 5 mg/Kg dAb-effector group are administered. Suitable dosage regimes may be dependent upon certain subject characterisitics including age, severity of disease and so on. dAb-effector group may for example be administered, particularly when the subject is a human, daily, once a week, twice a week or monthly. Those skilled in the art will appreciate that this list is not intended to be exhaustive.
BRIEF DESCRIPTION OF THE FIGURES
FIG. 1 shows various preferred dAb-effector groups according to the present invention.
- - (a) shows V_(H) or V_(L) attached to the hinge region of an antibody molecule. - (b) Shows V_(H) or V_(L) attached to CH1 or CH2 or CH3. - (c) Shows V_(H) or V_(L) attached to CH and CH2 or CH3 - (d) Shows a dAB-effector group according to (b) attached to V_(H) or V_(L) - (e) Shows a dimer of V_(H) or V_(L) attached to any combination of CH1/CH2 and CH3 domains, in which the variable domains are attached to one another, either with or without the use of a linker as herein described - (f) Shows a dimer having the same components as step (e) but in which the point of attachment between the two components making up the dimer is the effector groups. - (g) Shows V_(H) or V_(L) attached to the Fc region of an antibody molecule. - (h) Shows V_(H) or V_(L) attached to various constant region domains comprising the Fab region of an antibody.
FIG. 2 shows the signal pIgplus vector used to create E5-Fc and VH2-Fc fusions. Details are given in Example 1.
FIG. 3 a shows SDS page gels representing the purification of immunoglobulin effector groups according to the invention; Lane 1—MW marker (kDa), Lane 2—Culture medium before Protein A purification, Lane 3—Culture medium after Protein A purification, Lane 4—Purified E5-Fc protein, Lane 5—Purified E5-Fc protein. FIG. 3 b shows the glycosylation of immunoglobulin-effector groups according to the invention. Lanes are labelled on the figure. FIG. 3 c shows ELISA results demonstrating that Cos-1 cells, Cos-7 cells and CHO cells are capable of expressing dAb-Fc fusion proteins of the correct specificity and with no cross reactivity with irrelevant antigens.
FIG. 4 shows that E5-Fc fusion protein is able to bind to the cell line expressing human Fc receptors. Purified E5-Fc protein was labelled with fluorescein at 3.3/1 ratio of Fluo/Protein. The labelled protein (491 μg/ml concentration) was then used for FACS analysis. Human monocyte-like U937 cells which express two types of human FcRs (CD 64 and CD32) were used to assess the ability of E5-Fc fusion protein to bind these receptors. FACS results indicate that E5-Fc fusion protein binds to the U937 cell line (5×10⁵ U-937 cells were incubated with 80 ml of the 1:50 dilution of the labelled protein and examined live).
- - a FIG. 4 a: U-937 cells (control) - b. FIG. 4 b: U-937 cells incubated with anti CD64 antibody (positive control) - c. FIG. 4 c: U-937 cells incubated with anti CD32 antibody positive control) - d. FIG. 4 d: U-937 cells incubated with anti CD16 antibody (negative control) - e. FIG. 4 e: U-937 cells incubated with E5-Fc fusion protein
FIG. 5: Raj 1 cells (expressing only CD32 receptor) were used for FACS analysis. FACS results demonstrate that E5-Fc chain binds to Raj 1 cells.
- - 1. Raj 1 cells (control) - 2. Raj 1 cells incubated with anti CD64 antibody (negative control) - 3. Raj 1 cells incubated with anti CD32 antibody (positive control) - 4. Raj 1 cells incubated with anti CD16 antibody (negative control) - 5. Raj 1 cells incubated with E5-Fc fusion protein
FIG. 6 shows the results of Pharmacokinetic Analysis. The figure shows the serum levels in mice following 50 μg bolus IV doses of HEL-4 or E5-Fc according to the invention.
FIG. 7 shows the effect of twice weekly injections of TAR1-5-19 on the arthritic scores of the Tg197 mice.
FIG. 8 shows histopathological scoring of the ankle joints from the different treatment groups.
FIG. 9 shows the effect of twice weekly injections of TAR1-5-19 on the group average weights of Tg197 mice.
FIG. 10: Nucleotide sequence of the alpha factor dAb Fc fusion protein from the start of the alpha factor leader sequence to the EcoRI cloning site.
FIG. 11: Amino acid sequence of the alpha factor dAb Fc fusion protein, as encoded by the sequence shown in FIG. 10.
FIG. 12: Antigen binding activity: Antigen binding activity was determined using a TNF receptor binding assay. A 96 well Nunc Maxisorp plate is coated with a mouse anti-human Fc antibody, blocked with 1% BSA, then TNF receptor 1-Fc fusion is added. The dAb-Fc fusion protein at various concentrations is mixed with 10 ng/ml TNF protein and incubated at room temperature for >1 hour. This mixture is added to the TNF receptor 1-Fc fusion protein coated plates, and incubated for 1 hour at room temperature. The plates are then washed to remove unbound free dAb-Fc fusion, TNF and dAb-Fc/TNF complexes. The plate was then incubated sequentially with a biotinylated anti-TNF antibody and streptavidin-horse radish peroxidase. The plate was then incubated with the chromogenic horse radish peroxidase substrate TMB. The colour development was stopped with the addition of 1M hydrochloric acid, and absorbance read at 450 nm. The absorbance read is proportional to the amount of TNF bound, hence, the TAR1-5-19Fc fusion protein will compete with the TNF receptor for binding of the TNF, and reduce the signal in the assay. The P. pastoris produced protein had an equivalent activity to the mammalian protein in the vitro TNF receptor assay described above.
FIG. 13 shows a 15% non-reducing SDS-PAGE gel showing comparison between TAR1-5-19 Fc fusion protein produced in mammalian cells (lanes 1 and 2) and P. pastoris (lane 3), purified by Protein A affinity. It can be seen that the major bands present in all three lanes are the disulphide linked homodimer at ˜80 kDa, and the non-disulphide linked monomer unit at ˜40 kDa. Gel filtration on both mammalian and P. pastoris produced protein indicated that under non-SDS-PAGE conditions both species run as homodimers. The minor band below the 80 kDa marker represents free Fc protein, without dAb attached, produced through proteolytic attack of the polypeptide linking the dAb and Fc domains.
DETAILED DESCRIPTION OF THE INVENTION
Definitions
Immunoglobulin This refers to a family of polypeptides which retain the immunoglobulin fold characteristic of antibody molecules, which contains two β sheets and, usually, a conserved disulphide bond. Members of the immunoglobulin superfamily are involved in many aspects of cellular and non-cellular interactions in vivo, including widespread roles in the immune system (for example, antibodies, T-cell receptor molecules and the like), involvement in cell adhesion (for example the ICAM molecules) and intracellular signalling (for example, receptor molecules, such as the PDGF receptor).
| 20,301 |
https://github.com/pwnall/w3gram-server/blob/master/test/app_cache_test.coffee
|
Github Open Source
|
Open Source
|
MIT
| 2,019 |
w3gram-server
|
pwnall
|
CoffeeScript
|
Code
| 1,500 | 5,432 |
async = require 'async'
AppList = W3gramServer.AppList
AppCache = W3gramServer.AppCache
describe 'AppCache', ->
beforeEach ->
@mockList = {}
@cache = new AppCache @mockList
describe '#getMak', ->
beforeEach ->
@mockList.getMakCallCount = 0
@mockList.getMak = (callback) ->
@getMakCallCount += 1
callback null, 'mock-mack'
return
it 'calls AppList#getMak only once', (done) ->
getValue = (_, callback) => @cache.getMak callback
async.mapSeries [1..5], getValue, (error, result) =>
expect(error).not.to.be.ok
expect(result).to.be.an 'array'
expect(result.length).to.equal 5
for i in [1...5]
expect(result[i]).to.equal 'mock-mack'
expect(@mockList.getMakCallCount).to.equal 1
done()
it 'reports errors', (done) ->
errorObject = {error: ''}
@mockList.getMak = (callback) ->
@getMakCallCount += 1
callback errorObject
return
@cache.getMak (error, mak) =>
expect(error).to.equal errorObject
expect(mak).not.to.be.ok
expect(@mockList.getMakCallCount).to.equal 1
done()
describe '#hasApps', ->
beforeEach ->
@apps = [{ key: 'app-key-1', id: 42 }, { key: 'app-key-2', id: 7 }]
@mockList.listCallCount = 0
@mockList.list = (callback) =>
@mockList.listCallCount += 1
callback null, @apps
return
it 'calls list as long as it returns no apps', (done) ->
@apps = []
getValue = (_, callback) => @cache.hasApps callback
async.mapSeries [1..5], getValue, (error, result) =>
expect(error).not.to.be.ok
expect(result).to.be.an 'array'
expect(result.length).to.equal 5
for i in [1...5]
expect(result[i]).to.equal false
expect(@mockList.listCallCount).to.equal 5
done()
it 'calls list once if it returns apps', (done) ->
getValue = (_, callback) => @cache.hasApps callback
async.mapSeries [1..5], getValue, (error, result) =>
expect(error).not.to.be.ok
expect(result).to.be.an 'array'
expect(result.length).to.equal 5
for i in [1...5]
expect(result[i]).to.equal true
expect(@mockList.listCallCount).to.equal 1
done()
it 'updates key cache with returned apps', (done) ->
@cache.hasApps (error, hasApps) =>
expect(error).to.equal null
expect(hasApps).to.equal true
# The mock list doesn't have a findByKey method, so this will error out
# if the cache makes a call to AppList#findbyKey.
@cache.getAppByKey 'app-key-1', (error, app) =>
expect(error).to.equal null
expect(app).to.equal @apps[0]
@cache.getAppByKey 'app-key-2', (error, app) =>
expect(error).to.equal null
expect(app).to.equal @apps[1]
done()
it 'updates key cache with returned apps', (done) ->
@cache.hasApps (error, hasApps) =>
expect(error).to.equal null
expect(hasApps).to.equal true
# The mock list doesn't have a findByKey method, so this will error out
# if the cache makes a call to AppList#findbyKey.
@cache.getAppById 42, (error, app) =>
expect(error).to.equal null
expect(app).to.equal @apps[0]
@cache.getAppById 7, (error, app) =>
expect(error).to.equal null
expect(app).to.equal @apps[1]
done()
it 'reports errors', (done) ->
errorObject = {error: ''}
@mockList.list = (callback) ->
@listCallCount += 1
callback errorObject
return
@cache.hasApps (error, hasApps) =>
expect(error).to.equal errorObject
expect(hasApps).not.to.be.ok
expect(@mockList.listCallCount).to.equal 1
done()
describe '#getAppByKey', ->
beforeEach ->
@app1 = { key: 'app-key-1', id: 42 }
@app2 = { key: 'app-key-2', id: 5 }
@errorObject = {error: ''}
@mockList.findByKeyCallCount = 0
@mockList.findByKey = (key, callback) =>
@mockList.findByKeyCallCount += 1
if key is 'app-key-1'
callback null, @app1
else if key is 'app-key-2'
callback null, @app2
else if key is 'error-key'
callback @errorObject
else
callback null, null
return
it 'calls AppList#findByKey as long as it returns no apps', (done) ->
@apps = []
getValue = (_, callback) =>
@cache.getAppByKey 'missing-app-key', callback
async.mapSeries [1..5], getValue, (error, result) =>
expect(error).not.to.be.ok
expect(result).to.be.an 'array'
expect(result.length).to.equal 5
for i in [1...5]
expect(result[i]).to.equal null
expect(@mockList.findByKeyCallCount).to.equal 5
done()
it 'calls AppList#findByKey once if it returns apps', (done) ->
getValue = (_, callback) => @cache.getAppByKey 'app-key-1', callback
async.mapSeries [1..5], getValue, (error, result) =>
expect(error).not.to.be.ok
expect(result).to.be.an 'array'
expect(result.length).to.equal 5
for i in [1...5]
expect(result[i]).to.equal @app1
expect(@mockList.findByKeyCallCount).to.equal 1
done()
it 'reports errors', (done) ->
@cache.getAppByKey 'error-key', (error, hasApps) =>
expect(error).to.equal @errorObject
expect(hasApps).not.to.be.ok
expect(@mockList.findByKeyCallCount).to.equal 1
done()
it 'updates the hasApps cache if it returns an app', (done) ->
@cache.getAppByKey 'app-key-1', (error, app) =>
expect(error).to.equal null
expect(app).to.equal @app1
expect(@mockList.findByKeyCallCount).to.equal 1
@cache.hasApps (error, hasApps) =>
expect(error).to.equal null
expect(hasApps).to.equal true
expect(@mockList.findByKeyCallCount).to.equal 1
done()
it 'updates the app ID cache if it returns an app', (done) ->
@cache.getAppByKey 'app-key-1', (error, app) =>
expect(error).to.equal null
expect(app).to.equal @app1
expect(@mockList.findByKeyCallCount).to.equal 1
@cache.getAppById 42, (error, cachedApp) =>
expect(error).to.equal null
expect(cachedApp).to.equal app
expect(@mockList.findByKeyCallCount).to.equal 1
done()
it 'does not update the hasApps cache if it returns no apps', (done) ->
@cache.getAppByKey 'missing-app-key', (error, app) =>
expect(error).to.equal null
expect(app).to.equal null
expect(@mockList.findByKeyCallCount).to.equal 1
@mockList.listCallCount = 0
@mockList.list = (callback) ->
@listCallCount += 1
callback null, []
return
@cache.hasApps (error, hasApps) =>
expect(error).to.equal null
expect(hasApps).to.equal false
expect(@mockList.findByKeyCallCount).to.equal 1
expect(@mockList.listCallCount).to.equal 1
done()
describe '#getAppById', ->
beforeEach ->
@app1 = { key: 'app-key-1', id: 42 }
@app2 = { key: 'app-key-2', id: 5 }
@errorObject = {error: ''}
@mockList.findByIdCallCount = 0
@mockList.findById = (id, callback) =>
@mockList.findByIdCallCount += 1
if id is 42
callback null, @app1
else if id is 5
callback null, @app2
else if id is 666
callback @errorObject
else
callback null, null
return
it 'calls AppList#findById as long as it returns no apps', (done) ->
@apps = []
getValue = (_, callback) => @cache.getAppById 999, callback
async.mapSeries [1..5], getValue, (error, result) =>
expect(error).not.to.be.ok
expect(result).to.be.an 'array'
expect(result.length).to.equal 5
for i in [1...5]
expect(result[i]).to.equal null
expect(@mockList.findByIdCallCount).to.equal 5
done()
it 'calls AppList#findById once if it returns apps', (done) ->
getValue = (_, callback) => @cache.getAppById 42, callback
async.mapSeries [1..5], getValue, (error, result) =>
expect(error).not.to.be.ok
expect(result).to.be.an 'array'
expect(result.length).to.equal 5
for i in [1...5]
expect(result[i]).to.equal @app1
expect(@mockList.findByIdCallCount).to.equal 1
done()
it 'reports errors', (done) ->
@cache.getAppById 666, (error, hasApps) =>
expect(error).to.equal @errorObject
expect(hasApps).not.to.be.ok
expect(@mockList.findByIdCallCount).to.equal 1
done()
it 'updates the hasApps cache if it returns an app', (done) ->
@cache.getAppById 42, (error, app) =>
expect(error).to.equal null
expect(app).to.equal @app1
expect(@mockList.findByIdCallCount).to.equal 1
@cache.hasApps (error, hasApps) =>
expect(error).to.equal null
expect(hasApps).to.equal true
expect(@mockList.findByIdCallCount).to.equal 1
done()
it 'updates the app key cache if it returns an app', (done) ->
@cache.getAppById 42, (error, app) =>
expect(error).to.equal null
expect(app).to.equal @app1
expect(@mockList.findByIdCallCount).to.equal 1
@cache.getAppByKey 'app-key-1', (error, cachedApp) =>
expect(error).to.equal null
expect(cachedApp).to.equal app
expect(@mockList.findByIdCallCount).to.equal 1
done()
it 'does not update the hasApps cache if it returns no apps', (done) ->
@cache.getAppById 999, (error, app) =>
expect(error).to.equal null
expect(app).to.equal null
expect(@mockList.findByIdCallCount).to.equal 1
@mockList.listCallCount = 0
@mockList.list = (callback) ->
@listCallCount += 1
callback null, []
return
@cache.hasApps (error, hasApps) =>
expect(error).to.equal null
expect(hasApps).to.equal false
expect(@mockList.findByIdCallCount).to.equal 1
expect(@mockList.listCallCount).to.equal 1
done()
describe '#decodeReceiverId', ->
beforeEach ->
@app1 = new AppList.App key: 'app-key-1', id: 42, idKey: 'id-key-1'
@app2 = new AppList.App key: 'app-key-2', id: 5, idKey: 'id-key-2'
@errorObject = {error: ''}
@mockList.findByIdCallCount = 0
@mockList.findById = (id, callback) =>
@mockList.findByIdCallCount += 1
if id is 42
callback null, @app1
else if id is 5
callback null, @app2
else if id is 666
callback @errorObject
else
callback null, null
return
it 'returns null for an empty id', (done) ->
@cache.decodeReceiverId '', (error, app, key) =>
expect(error).to.equal null
expect(app).to.equal null
expect(key).to.equal null
expect(@mockList.findByIdCallCount).to.equal 0
done()
it 'returns null for a mis-formatted id', (done) ->
@cache.decodeReceiverId 'misformatted-id', (error, app, key) =>
expect(error).to.equal null
expect(app).to.equal null
expect(key).to.equal null
expect(@mockList.findByIdCallCount).to.equal 0
done()
it 'returns null for an incorrect HMAC', (done) ->
@cache.decodeReceiverId '42.tablet-device-id.aaa', (error, app, key) =>
expect(error).to.equal null
expect(app).to.equal null
expect(key).to.equal null
expect(@mockList.findByIdCallCount).to.equal 1
done()
it 'returns null for an incorrect app id', (done) ->
@cache.decodeReceiverId '999.tablet-device-id.aaa', (error, app, key) =>
expect(error).to.equal null
expect(app).to.equal null
expect(key).to.equal null
expect(@mockList.findByIdCallCount).to.equal 1
done()
it 'returns null for a poorly formatted device ID', (done) ->
@cache.decodeReceiverId '42.tablet device id.aaa', (error, app, key) =>
expect(error).to.equal null
expect(app).to.equal null
expect(key).to.equal null
expect(@mockList.findByIdCallCount).to.equal 1
done()
it 'returns the correct app and key for a good HMAC', (done) ->
hmac = @app1.receiverIdHmac 'tablet-device-id'
receiverId = "42.tablet-device-id.#{hmac}"
@cache.decodeReceiverId receiverId, (error, app, key) =>
expect(error).to.equal null
expect(app).to.equal @app1
expect(key).to.equal '42_tablet-device-id'
expect(@mockList.findByIdCallCount).to.equal 1
done()
it 'uses the app cache', (done) ->
@cache.decodeReceiverId '42.tablet-device-id.aaa', (error, app, key) =>
expect(error).to.equal null
expect(app).to.equal null
expect(key).to.equal null
expect(@mockList.findByIdCallCount).to.equal 1
hmac = @app1.receiverIdHmac 'tablet-device-id'
receiverId = "42.tablet-device-id.#{hmac}"
@cache.decodeReceiverId receiverId, (error, app, key) =>
expect(error).to.equal null
expect(app).to.equal @app1
expect(key).to.equal '42_tablet-device-id'
expect(@mockList.findByIdCallCount).to.equal 1
done()
it 'reports errors', (done) ->
@cache.decodeReceiverId '666.tablet-device-id.aaa', (error, app, key) =>
expect(error).to.equal @errorObject
expect(@mockList.findByIdCallCount).to.equal 1
done()
describe '#decodeListenerId', ->
beforeEach ->
@app1 = new AppList.App key: 'app-key-1', id: 42, idKey: 'id-key-1'
@app2 = new AppList.App key: 'app-key-2', id: 5, idKey: 'id-key-2'
@errorObject = {error: ''}
@mockList.findByIdCallCount = 0
@mockList.findById = (id, callback) =>
@mockList.findByIdCallCount += 1
if id is 42
callback null, @app1
else if id is 5
callback null, @app2
else if id is 666
callback @errorObject
else
callback null, null
return
it 'returns null for an empty id', (done) ->
@cache.decodeListenerId '', (error, app, key) =>
expect(error).to.equal null
expect(app).to.equal null
expect(key).to.equal null
expect(@mockList.findByIdCallCount).to.equal 0
done()
it 'returns null for a mis-formatted id', (done) ->
@cache.decodeListenerId 'misformatted-id', (error, app, key) =>
expect(error).to.equal null
expect(app).to.equal null
expect(key).to.equal null
expect(@mockList.findByIdCallCount).to.equal 0
done()
it 'returns null for an incorrect HMAC', (done) ->
@cache.decodeListenerId '42.tablet-device-id.aaa', (error, app, key) =>
expect(error).to.equal null
expect(app).to.equal null
expect(key).to.equal null
expect(@mockList.findByIdCallCount).to.equal 1
done()
it 'returns null for an incorrect app id', (done) ->
@cache.decodeListenerId '999.tablet-device-id.aaa', (error, app, key) =>
expect(error).to.equal null
expect(app).to.equal null
expect(key).to.equal null
expect(@mockList.findByIdCallCount).to.equal 1
done()
it 'returns null for a poorly formatted device ID', (done) ->
@cache.decodeListenerId '42.tablet device id.aaa', (error, app, key) =>
expect(error).to.equal null
expect(app).to.equal null
expect(key).to.equal null
expect(@mockList.findByIdCallCount).to.equal 1
done()
it 'returns the correct app and key for a good HMAC', (done) ->
hmac = @app1.listenerIdHmac 'tablet-device-id'
listenerId = "42.tablet-device-id.#{hmac}"
@cache.decodeListenerId listenerId, (error, app, key) =>
expect(error).to.equal null
expect(app).to.equal @app1
expect(key).to.equal '42_tablet-device-id'
expect(@mockList.findByIdCallCount).to.equal 1
done()
it 'uses the app cache', (done) ->
@cache.decodeListenerId '42.tablet-device-id.aaa', (error, app, key) =>
expect(error).to.equal null
expect(app).to.equal null
expect(key).to.equal null
expect(@mockList.findByIdCallCount).to.equal 1
hmac = @app1.listenerIdHmac 'tablet-device-id'
listenerId = "42.tablet-device-id.#{hmac}"
@cache.decodeListenerId listenerId, (error, app, key) =>
expect(error).to.equal null
expect(app).to.equal @app1
expect(key).to.equal '42_tablet-device-id'
expect(@mockList.findByIdCallCount).to.equal 1
done()
it 'reports errors', (done) ->
@cache.decodeListenerId '666.tablet-device-id.aaa', (error, app, key) =>
expect(error).to.equal @errorObject
expect(@mockList.findByIdCallCount).to.equal 1
done()
| 9,004 |
https://github.com/sebastianlenton/twill-test/blob/master/resources/views/admin/newsitems/form.blade.php
|
Github Open Source
|
Open Source
|
MIT
| 2,021 |
twill-test
|
sebastianlenton
|
PHP
|
Code
| 99 | 306 |
@extends('twill::layouts.form')
@section('contentFields')
@formField('date_picker', [
'name' => 'published_date',
'label' => 'Publication date',
'note' => 'Will be shown on the front-end.',
'required' => true
])
@formField('medias', [
'name' => 'img_standard',
'label' => 'News Story Image',
'note' => 'Minimum image width: TODO ENTER WIDTH'
])
@formField('medias', [
'name' => 'img_mobile',
'label' => 'News Story Image Mobile Override (optional)',
'note' => 'Minimum image width: TODO ENTER WIDTH'
])
@formField('wysiwyg', [
'name' => 'content',
'label' => 'News Story Content',
'toolbarOptions' => [ 'link' ],
'placeholder' => 'Enter news story content...',
'editSource' => true,
])
@formField('input', [
'name' => 'link',
'label' => 'Link'
])
@stop
| 13,072 |
https://www.wikidata.org/wiki/Q506027
|
Wikidata
|
Semantic data
|
CC0
| null |
Ernst Wilhelm Wolf
|
None
|
Multilingual
|
Semantic data
| 7,215 | 20,926 |
Ernst Wilhelm Wolf
deutscher Konzertmeister und Komponist
Ernst Wilhelm Wolf Ehepartner(in) Maria Carolina Benda
Ernst Wilhelm Wolf LCAuth-Kennung n84181325
Ernst Wilhelm Wolf VIAF-Kennung 44566363
Ernst Wilhelm Wolf GND-Kennung 117458600
Ernst Wilhelm Wolf ISNI 0000000110259268
Ernst Wilhelm Wolf Geburtsort Großenbehringen
Ernst Wilhelm Wolf Sterbeort Weimar
Ernst Wilhelm Wolf ist ein(e) Mensch
Ernst Wilhelm Wolf Freebase-Kennung /m/051vz1y
Ernst Wilhelm Wolf Geburtsdatum 1735
Ernst Wilhelm Wolf Sterbedatum 1792
Ernst Wilhelm Wolf Sterbedatum 1792
Ernst Wilhelm Wolf Todesursache Schlaganfall
Ernst Wilhelm Wolf Tätigkeit Komponist
Ernst Wilhelm Wolf Tätigkeit Dirigent
Ernst Wilhelm Wolf Vorname Ernst
Ernst Wilhelm Wolf NTA-Kennung 117366498
Ernst Wilhelm Wolf Land der Staatsangehörigkeit Deutschland
Ernst Wilhelm Wolf Genre Oper
Ernst Wilhelm Wolf Genre Sinfonie
Ernst Wilhelm Wolf IMSLP-Kennung Category:Wolf,_Ernst_Wilhelm
Ernst Wilhelm Wolf Todesart natürliche Todesursache
Ernst Wilhelm Wolf NLA-Trove-Personenkennung 1060092
Ernst Wilhelm Wolf Open-Library-Kennung OL6650357A
Ernst Wilhelm Wolf FAST-Kennung 146969
Ernst Wilhelm Wolf Bild Ernst Wilhelm Wolf.JPG
Ernst Wilhelm Wolf NLI-Kennung (Israel) 000215238
Ernst Wilhelm Wolf beschrieben in Brockhaus-Efron, beschreibendes Datenobjekt ЭСБЕ / Вольф, Эрнест-Вильям
Ernst Wilhelm Wolf beschrieben in Allgemeine Deutsche Biographie, beschreibendes Datenobjekt Wolf, Ernst Wilhelm (ADB)
Ernst Wilhelm Wolf beschrieben in Riemann Musiklexikon (1901–1904), beschreibendes Datenobjekt МСР / Вольф (Wolf)
Ernst Wilhelm Wolf Commons-Kategorie Ernst Wilhelm Wolf
Ernst Wilhelm Wolf SNAC-Ark-Kennung w6h71h82
Ernst Wilhelm Wolf openMLOL-Autorennummer 51859
Ernst Wilhelm Wolf BNE-Kennung XX1768855
Ernst Wilhelm Wolf Operone-ID des Komponisten wolfew
Ernst Wilhelm Wolf IdRef-Normdatenkennung 080807917
Ernst Wilhelm Wolf gesprochene oder publizierte Sprachen Deutsch
Ernst Wilhelm Wolf CERL-Kennung cnp00389928
Ernst Wilhelm Wolf Muziekweb-Künstlerkennung M00000257351
Ernst Wilhelm Wolf Instrument Klavier
Ernst Wilhelm Wolf Geschlecht männlich
Ernst Wilhelm Wolf BnF-Kennung 148079488
Ernst Wilhelm Wolf NKČR-AUT-Kennung jn20000605638
Ernst Wilhelm Wolf MusicBrainz-Künstlerkennung 43b3c077-00fc-40d6-b7de-f5b55a763334
Ernst Wilhelm Wolf Musicalics-Komponistenkennung 85630
Ernst Wilhelm Wolf Europeana-Kennung agent/base/25725
Ernst Wilhelm Wolf Deutsche-Biographie-Kennung 117458600
Ernst Wilhelm Wolf Gran-Enciclopèdia-de-la-Música-Kennung 18124
Ernst Wilhelm Wolf RISM-Kennung people/146800
Ernst Wilhelm Wolf Carl-Maria-von-Weber-Gesamtausgabe-Kennung A007001
Ernst Wilhelm Wolf NUKAT-Kennung n2007130896
Ernst Wilhelm Wolf PLWABN-Kennung 9810603338905606
Ernst Wilhelm Wolf FactGrid-Objektkennung Q146366
Ernst Wilhelm Wolf Kallías-Kennung PE00378780
Ernst Wilhelm Wolf J9U-Kennung der Israelischen Nationalbibliothek 987007298205505171
Ernst Wilhelm Wolf Prabook-Kennung 2425582
Ernst Wilhelm Wolf Geni.com-Profilkennung 6000000018398984159
Ernst Wilhelm Wolf Familienname Wolf
Ernst Wilhelm Wolf Hill-Museum-&-Manuscript-Library-ID person/292307264133
Ernst Wilhelm Wolf Taufdatum 1735
Ernst Wilhelm Wolf MGG Online ID 15186
Ernst Wilhelm Wolf Grove Music Online-ID 30491
Ernst Wilhelm Wolf SBN-Autoren-Kennung MUSV069084, genannt als Wolf, Ernst Wilhelm <1735-1792>
Ernst Wilhelm Wolf museum-digital-Person-ID 35642
Ernst Wilhelm Wolf WorldCat-Entitäten-Kennung E39PBJgcYmdQcC7mcvmJbcbrv3
Ernst Wilhelm Wolf
německý skladatel
Ernst Wilhelm Wolf choť Maria Carolina Wolfová
Ernst Wilhelm Wolf identifikátor LCAuth n84181325
Ernst Wilhelm Wolf VIAF 44566363
Ernst Wilhelm Wolf identifikátor GND 117458600
Ernst Wilhelm Wolf ISNI 0000000110259268
Ernst Wilhelm Wolf místo narození Großenbehringen
Ernst Wilhelm Wolf místo úmrtí Výmar
Ernst Wilhelm Wolf instance (čeho) člověk
Ernst Wilhelm Wolf identifikátor Freebase /m/051vz1y
Ernst Wilhelm Wolf datum narození 1735
Ernst Wilhelm Wolf datum úmrtí 1792
Ernst Wilhelm Wolf datum úmrtí 1792
Ernst Wilhelm Wolf příčina úmrtí cévní mozková příhoda
Ernst Wilhelm Wolf povolání hudební skladatel
Ernst Wilhelm Wolf povolání dirigent
Ernst Wilhelm Wolf rodné jméno Ernst
Ernst Wilhelm Wolf NTA PPN 117366498
Ernst Wilhelm Wolf státní občanství Německo
Ernst Wilhelm Wolf žánr opera
Ernst Wilhelm Wolf žánr symfonie
Ernst Wilhelm Wolf číslo IMSLP Category:Wolf,_Ernst_Wilhelm
Ernst Wilhelm Wolf způsob smrti přirozená smrt
Ernst Wilhelm Wolf identifikátor Open Library OL6650357A
Ernst Wilhelm Wolf FAST ID 146969
Ernst Wilhelm Wolf obrázek Ernst Wilhelm Wolf.JPG
Ernst Wilhelm Wolf identifikátor NLI (Izrael) 000215238
Ernst Wilhelm Wolf popsáno ve zdroji Encyklopedický slovník Brockhaus-Jefron, pojednává o tom ЭСБЕ / Вольф, Эрнест-Вильям
Ernst Wilhelm Wolf popsáno ve zdroji Allgemeine Deutsche Biographie
Ernst Wilhelm Wolf popsáno ve zdroji Riemannův hudební slovník, pojednává o tom МСР / Вольф (Wolf)
Ernst Wilhelm Wolf kategorie na Commons Ernst Wilhelm Wolf
Ernst Wilhelm Wolf ID ve SNAC Ark w6h71h82
Ernst Wilhelm Wolf identifikátor BNE XX1768855
Ernst Wilhelm Wolf IdRef ID 080807917
Ernst Wilhelm Wolf ovládané jazyky němčina
Ernst Wilhelm Wolf identifikátor CERL cnp00389928
Ernst Wilhelm Wolf hudební nástroj klavír
Ernst Wilhelm Wolf pohlaví muž
Ernst Wilhelm Wolf BNF ID 148079488
Ernst Wilhelm Wolf NK ČR AUT jn20000605638
Ernst Wilhelm Wolf kód MusicBrainz pro umělce 43b3c077-00fc-40d6-b7de-f5b55a763334
Ernst Wilhelm Wolf ID Deutsche Biographie 117458600
Ernst Wilhelm Wolf RISM ID people/146800
Ernst Wilhelm Wolf autoritní záznam NUKAT n2007130896
Ernst Wilhelm Wolf PLWABN ID 9810603338905606
Ernst Wilhelm Wolf Kallías ID PE00378780
Ernst Wilhelm Wolf kód Izraelské národní knihovny 987007298205505171
Ernst Wilhelm Wolf Prabook ID 2425582
Ernst Wilhelm Wolf Geni.com ID profilu 6000000018398984159
Ernst Wilhelm Wolf příjmení Wolf
Ernst Wilhelm Wolf datum křtu 1735
Ernst Wilhelm Wolf Grove Music Online ID 30491
Ernst Wilhelm Wolf kód ICCU MUSV069084, uveden jako Wolf, Ernst Wilhelm <1735-1792>
Ernst Wilhelm Wolf WorldCat Entities ID E39PBJgcYmdQcC7mcvmJbcbrv3
Ernst Wilhelm Wolf
compositeur
Ernst Wilhelm Wolf conjoint ou conjointe Maria Carolina Wolf
Ernst Wilhelm Wolf identifiant Bibliothèque du Congrès n84181325
Ernst Wilhelm Wolf identifiant VIAF 44566363
Ernst Wilhelm Wolf identifiant GND (DNB) 117458600
Ernst Wilhelm Wolf identifiant ISNI 0000000110259268
Ernst Wilhelm Wolf lieu de naissance Großenbehringen
Ernst Wilhelm Wolf lieu de mort Weimar
Ernst Wilhelm Wolf nature de l’élément être humain
Ernst Wilhelm Wolf identifiant Freebase /m/051vz1y
Ernst Wilhelm Wolf date de naissance 1735
Ernst Wilhelm Wolf date de mort 1792
Ernst Wilhelm Wolf date de mort 1792
Ernst Wilhelm Wolf cause de la mort accident vasculaire cérébral
Ernst Wilhelm Wolf occupation compositeur ou compositrice
Ernst Wilhelm Wolf occupation chef ou cheffe d'orchestre
Ernst Wilhelm Wolf prénom Ernst
Ernst Wilhelm Wolf identifiant Bibliothèque royale des Pays-Bas 117366498
Ernst Wilhelm Wolf pays de nationalité Allemagne
Ernst Wilhelm Wolf genre artistique opéra
Ernst Wilhelm Wolf genre artistique symphonie
Ernst Wilhelm Wolf identifiant International Music Score Library Project Category:Wolf,_Ernst_Wilhelm
Ernst Wilhelm Wolf circonstances de la mort causes naturelles
Ernst Wilhelm Wolf identifiant NLA Trove 1060092
Ernst Wilhelm Wolf identifiant Open Library OL6650357A
Ernst Wilhelm Wolf identifiant FAST 146969
Ernst Wilhelm Wolf image Ernst Wilhelm Wolf.JPG
Ernst Wilhelm Wolf identifiant Bibliothèque nationale d'Israël 000215238
Ernst Wilhelm Wolf décrit par Dictionnaire encyclopédique Brockhaus et Efron, affirmation détaillée dans ЭСБЕ / Вольф, Эрнест-Вильям
Ernst Wilhelm Wolf décrit par Allgemeine Deutsche Biographie
Ernst Wilhelm Wolf décrit par Dictionnaire musical de Riemann (1901–1904), affirmation détaillée dans МСР / Вольф (Wolf)
Ernst Wilhelm Wolf catégorie Commons Ernst Wilhelm Wolf
Ernst Wilhelm Wolf identifiant Social Networks Archival Context w6h71h82
Ernst Wilhelm Wolf identifiant openMLOL d'auteur 51859
Ernst Wilhelm Wolf identifiant Bibliothèque nationale d'Espagne XX1768855
Ernst Wilhelm Wolf identifiant Operone d'un compositeur wolfew
Ernst Wilhelm Wolf identifiant IdRef 080807917
Ernst Wilhelm Wolf langues parlées, écrites ou signées allemand
Ernst Wilhelm Wolf identifiant Consortium of European Research Libraries cnp00389928
Ernst Wilhelm Wolf identifiant Muziekweb d'un interprète M00000257351
Ernst Wilhelm Wolf instrument de musique pratiqué piano
Ernst Wilhelm Wolf sexe ou genre masculin
Ernst Wilhelm Wolf identifiant Bibliothèque nationale de France 148079488
Ernst Wilhelm Wolf identifiant Bibliothèque nationale tchèque jn20000605638
Ernst Wilhelm Wolf identifiant MusicBrainz d'un artiste 43b3c077-00fc-40d6-b7de-f5b55a763334
Ernst Wilhelm Wolf identifiant Musicalics 85630
Ernst Wilhelm Wolf Europeana Entity agent/base/25725
Ernst Wilhelm Wolf identifiant Deutsche Biographie 117458600
Ernst Wilhelm Wolf identifiant Gran Enciclopèdia de la Música 18124
Ernst Wilhelm Wolf identifiant Répertoire international des sources musicales people/146800
Ernst Wilhelm Wolf identifiant Carl-Maria-von-Weber-Gesamtausgabe A007001
Ernst Wilhelm Wolf identifiant NUKAT n2007130896
Ernst Wilhelm Wolf identifiant Bibliothèque nationale de Pologne 9810603338905606
Ernst Wilhelm Wolf identifiant FactGrid d'un élément Q146366
Ernst Wilhelm Wolf identifiant Kallías PE00378780
Ernst Wilhelm Wolf identifiant J9U de la Bibliothèque nationale d'Israël 987007298205505171
Ernst Wilhelm Wolf identifiant Prabook 2425582
Ernst Wilhelm Wolf identifiant Geni.com 6000000018398984159
Ernst Wilhelm Wolf nom de famille Wolf
Ernst Wilhelm Wolf identifiant Hill Museum & Manuscript Library person/292307264133
Ernst Wilhelm Wolf date de baptême 1735
Ernst Wilhelm Wolf identifiant MGG Online 15186
Ernst Wilhelm Wolf identifiant Grove Music Online 30491
Ernst Wilhelm Wolf identifiant SBN d'un auteur MUSV069084, sous le nom Wolf, Ernst Wilhelm <1735-1792>
Ernst Wilhelm Wolf museum-digital person ID 35642
Ernst Wilhelm Wolf identifiant Dansk Forfatterleksikon u15329
Ernst Wilhelm Wolf identifiant WorldCat Entities E39PBJgcYmdQcC7mcvmJbcbrv3
Ernst Wilhelm Wolf
German composer
Ernst Wilhelm Wolf spouse Maria Carolina Wolf
Ernst Wilhelm Wolf Library of Congress authority ID n84181325
Ernst Wilhelm Wolf VIAF ID 44566363
Ernst Wilhelm Wolf GND ID 117458600
Ernst Wilhelm Wolf ISNI 0000000110259268
Ernst Wilhelm Wolf place of birth Grossenbehringen
Ernst Wilhelm Wolf place of death Weimar
Ernst Wilhelm Wolf instance of human
Ernst Wilhelm Wolf Freebase ID /m/051vz1y
Ernst Wilhelm Wolf date of birth 1735
Ernst Wilhelm Wolf date of death 1792
Ernst Wilhelm Wolf date of death 1792
Ernst Wilhelm Wolf cause of death stroke
Ernst Wilhelm Wolf occupation composer
Ernst Wilhelm Wolf occupation conductor
Ernst Wilhelm Wolf given name Ernst
Ernst Wilhelm Wolf Nationale Thesaurus voor Auteursnamen ID 117366498
Ernst Wilhelm Wolf country of citizenship Germany
Ernst Wilhelm Wolf genre opera
Ernst Wilhelm Wolf genre symphony
Ernst Wilhelm Wolf IMSLP ID Category:Wolf,_Ernst_Wilhelm
Ernst Wilhelm Wolf manner of death natural causes
Ernst Wilhelm Wolf NLA Trove people ID 1060092
Ernst Wilhelm Wolf Open Library ID OL6650357A
Ernst Wilhelm Wolf FAST ID 146969
Ernst Wilhelm Wolf image Ernst Wilhelm Wolf.JPG
Ernst Wilhelm Wolf National Library of Israel ID (old) 000215238
Ernst Wilhelm Wolf described by source Brockhaus and Efron Encyclopedic Dictionary, statement is subject of ЭСБЕ / Вольф, Эрнест-Вильям
Ernst Wilhelm Wolf described by source Allgemeine Deutsche Biographie, statement is subject of Wolf, Ernst Wilhelm (ADB)
Ernst Wilhelm Wolf described by source Riemann's Music Dictionary, statement is subject of МСР / Вольф (Wolf)
Ernst Wilhelm Wolf Commons category Ernst Wilhelm Wolf
Ernst Wilhelm Wolf SNAC ARK ID w6h71h82
Ernst Wilhelm Wolf openMLOL author ID 51859
Ernst Wilhelm Wolf National Library of Spain ID XX1768855
Ernst Wilhelm Wolf Operone composer ID wolfew
Ernst Wilhelm Wolf IdRef ID 080807917
Ernst Wilhelm Wolf languages spoken, written or signed German
Ernst Wilhelm Wolf CERL Thesaurus ID cnp00389928
Ernst Wilhelm Wolf Muziekweb performer ID M00000257351
Ernst Wilhelm Wolf instrument piano
Ernst Wilhelm Wolf sex or gender male
Ernst Wilhelm Wolf Bibliothèque nationale de France ID 148079488
Ernst Wilhelm Wolf NL CR AUT ID jn20000605638
Ernst Wilhelm Wolf MusicBrainz artist ID 43b3c077-00fc-40d6-b7de-f5b55a763334
Ernst Wilhelm Wolf Musicalics composer ID 85630
Ernst Wilhelm Wolf Europeana entity agent/base/25725
Ernst Wilhelm Wolf Deutsche Biographie (GND) ID 117458600
Ernst Wilhelm Wolf Gran Enciclopèdia de la Música ID 18124
Ernst Wilhelm Wolf RISM ID people/146800
Ernst Wilhelm Wolf Carl-Maria-von-Weber-Gesamtausgabe ID A007001
Ernst Wilhelm Wolf NUKAT ID n2007130896
Ernst Wilhelm Wolf PLWABN ID 9810603338905606
Ernst Wilhelm Wolf FactGrid item ID Q146366
Ernst Wilhelm Wolf Kallías ID PE00378780
Ernst Wilhelm Wolf National Library of Israel J9U ID 987007298205505171
Ernst Wilhelm Wolf Prabook ID 2425582
Ernst Wilhelm Wolf Geni.com profile ID 6000000018398984159
Ernst Wilhelm Wolf family name Wolf
Ernst Wilhelm Wolf Hill Museum & Manuscript Library ID person/292307264133
Ernst Wilhelm Wolf date of baptism 1735
Ernst Wilhelm Wolf MGG Online ID 15186
Ernst Wilhelm Wolf Grove Music Online ID 30491
Ernst Wilhelm Wolf SBN author ID MUSV069084, subject named as Wolf, Ernst Wilhelm <1735-1792>
Ernst Wilhelm Wolf museum-digital person ID 35642
Ernst Wilhelm Wolf Dansk Forfatterleksikon ID u15329
Ernst Wilhelm Wolf WorldCat Entities ID E39PBJgcYmdQcC7mcvmJbcbrv3
Ernst Wilhelm Wolf
compositor alemany
Ernst Wilhelm Wolf cònjuge Maria Carolina Wolf
Ernst Wilhelm Wolf identificador LCCN n84181325
Ernst Wilhelm Wolf identificador VIAF 44566363
Ernst Wilhelm Wolf identificador GND (DNB-Deutsche Nationalbibliothek) 117458600
Ernst Wilhelm Wolf identificador ISNI 0000000110259268
Ernst Wilhelm Wolf lloc de defunció Weimar
Ernst Wilhelm Wolf instància de ésser humà
Ernst Wilhelm Wolf identificador Freebase /m/051vz1y
Ernst Wilhelm Wolf data de naixement 1735
Ernst Wilhelm Wolf data de defunció 1792
Ernst Wilhelm Wolf data de defunció 1792
Ernst Wilhelm Wolf causa de mort accident vascular cerebral
Ernst Wilhelm Wolf ocupació compositor
Ernst Wilhelm Wolf ocupació director d'orquestra
Ernst Wilhelm Wolf prenom Ernst
Ernst Wilhelm Wolf identificador NTA 117366498
Ernst Wilhelm Wolf ciutadania Alemanya
Ernst Wilhelm Wolf gènere artístic òpera
Ernst Wilhelm Wolf gènere artístic simfonia
Ernst Wilhelm Wolf identificador IMSLP Category:Wolf,_Ernst_Wilhelm
Ernst Wilhelm Wolf circumstàncies de la mort causes naturals
Ernst Wilhelm Wolf identificador NLA Trove 1060092
Ernst Wilhelm Wolf identificador Open Library OL6650357A
Ernst Wilhelm Wolf identificador FAST 146969
Ernst Wilhelm Wolf imatge Ernst Wilhelm Wolf.JPG
Ernst Wilhelm Wolf identificador NLI 000215238
Ernst Wilhelm Wolf descrit per la font Diccionari Enciclopèdic Brockhaus i Efron, afirmació detallada a ЭСБЕ / Вольф, Эрнест-Вильям
Ernst Wilhelm Wolf descrit per la font Allgemeine Deutsche Biographie
Ernst Wilhelm Wolf descrit per la font Diccionari Musical Riemann (1901–1904), afirmació detallada a МСР / Вольф (Wolf)
Ernst Wilhelm Wolf categoria de Commons Ernst Wilhelm Wolf
Ernst Wilhelm Wolf identificador SNAC Ark w6h71h82
Ernst Wilhelm Wolf identificador openMLOL d'autor 51859
Ernst Wilhelm Wolf identificador BNE XX1768855
Ernst Wilhelm Wolf identificador Operone de compositor wolfew
Ernst Wilhelm Wolf identificador idRef SUDOC 080807917
Ernst Wilhelm Wolf llengua parlada, escrita o signada alemany
Ernst Wilhelm Wolf identificador CERL cnp00389928
Ernst Wilhelm Wolf identificador Muziekweb M00000257351
Ernst Wilhelm Wolf instrument piano
Ernst Wilhelm Wolf sexe o gènere masculí
Ernst Wilhelm Wolf identificador BnF 148079488
Ernst Wilhelm Wolf identificador NKC jn20000605638
Ernst Wilhelm Wolf identificador MusicBrainz d'artista 43b3c077-00fc-40d6-b7de-f5b55a763334
Ernst Wilhelm Wolf identificador Musicalics de compositor 85630
Ernst Wilhelm Wolf identificador Europeana d'entitat agent/base/25725
Ernst Wilhelm Wolf identificador Deutsche Biographie 117458600
Ernst Wilhelm Wolf identificador Gran Enciclopèdia de la Música 18124
Ernst Wilhelm Wolf identificador RISM d'obra people/146800
Ernst Wilhelm Wolf identificador Carl-Maria-von-Weber-Gesamtausgabe A007001
Ernst Wilhelm Wolf identificador NUKAT (WarsawU) n2007130896
Ernst Wilhelm Wolf identificador NLP (registre) 9810603338905606
Ernst Wilhelm Wolf identificador FactGrid d'element Q146366
Ernst Wilhelm Wolf identificador Kallías PE00378780
Ernst Wilhelm Wolf identificador J9U de la Biblioteca Nacional d'Israel 987007298205505171
Ernst Wilhelm Wolf identificador Prabook 2425582
Ernst Wilhelm Wolf identificador Geni.com de perfil 6000000018398984159
Ernst Wilhelm Wolf cognom Wolf
Ernst Wilhelm Wolf identificador Museu Hill i Biblioteca de Manuscrits person/292307264133
Ernst Wilhelm Wolf data de bateig 1735
Ernst Wilhelm Wolf identificador MGG Online 15186
Ernst Wilhelm Wolf identificador Grove Music Online 30491
Ernst Wilhelm Wolf identificador SBN, Itàlia (codi ICCU) MUSV069084, anomenat com a Wolf, Ernst Wilhelm <1735-1792>
Ernst Wilhelm Wolf identificador museum-digital de persona 35642
Ernst Wilhelm Wolf identificador Dansk Forfatterleksikon u15329
Ernst Wilhelm Wolf identificador WorldCat Entities E39PBJgcYmdQcC7mcvmJbcbrv3
Ernst Wilhelm Wolf
compositor alemán
Ernst Wilhelm Wolf cónyuge Maria Carolina Wolf
Ernst Wilhelm Wolf identificador de autoridades de la Biblioteca del Congreso de EE. UU. n84181325
Ernst Wilhelm Wolf identificador VIAF 44566363
Ernst Wilhelm Wolf identificador GND (DNB) 117458600
Ernst Wilhelm Wolf ISNI 0000000110259268
Ernst Wilhelm Wolf lugar de fallecimiento Weimar
Ernst Wilhelm Wolf instancia de ser humano
Ernst Wilhelm Wolf Identificador Freebase /m/051vz1y
Ernst Wilhelm Wolf fecha de nacimiento 1735
Ernst Wilhelm Wolf fecha de fallecimiento 1792
Ernst Wilhelm Wolf fecha de fallecimiento 1792
Ernst Wilhelm Wolf causa de muerte accidente cerebrovascular
Ernst Wilhelm Wolf ocupación compositor
Ernst Wilhelm Wolf ocupación director de orquesta
Ernst Wilhelm Wolf nombre de pila Ernst
Ernst Wilhelm Wolf identificador NTA 117366498
Ernst Wilhelm Wolf país de nacionalidad Alemania
Ernst Wilhelm Wolf género ópera
Ernst Wilhelm Wolf género sinfonía
Ernst Wilhelm Wolf identificador IMSLP Category:Wolf,_Ernst_Wilhelm
Ernst Wilhelm Wolf circunstancias de la muerte causas naturales
Ernst Wilhelm Wolf identificador NLA Trove 1060092
Ernst Wilhelm Wolf identificador Open Library OL6650357A
Ernst Wilhelm Wolf identificador FAST 146969
Ernst Wilhelm Wolf imagen Ernst Wilhelm Wolf.JPG
Ernst Wilhelm Wolf identificador NLI 000215238
Ernst Wilhelm Wolf descrito en la fuente Diccionario Enciclopédico Brockhaus y Efron, elemento de la declaración ЭСБЕ / Вольф, Эрнест-Вильям
Ernst Wilhelm Wolf descrito en la fuente Allgemeine Deutsche Biographie
Ernst Wilhelm Wolf descrito en la fuente Diccionario Musical Riemann (1901–1904), elemento de la declaración МСР / Вольф (Wolf)
Ernst Wilhelm Wolf categoría en Commons Ernst Wilhelm Wolf
Ernst Wilhelm Wolf Identificador SNAC Ark w6h71h82
Ernst Wilhelm Wolf identificador openMLOL de un autor 51859
Ernst Wilhelm Wolf identificador BNE XX1768855
Ernst Wilhelm Wolf identificador Operone de compositor wolfew
Ernst Wilhelm Wolf identificador de referencia de idRef SUDOC 080807917
Ernst Wilhelm Wolf lenguas habladas, escritas o signadas alemán
Ernst Wilhelm Wolf identificador CERL cnp00389928
Ernst Wilhelm Wolf identificador Muziekweb M00000257351
Ernst Wilhelm Wolf instrumento piano
Ernst Wilhelm Wolf sexo o género masculino
Ernst Wilhelm Wolf identificador BnF 148079488
Ernst Wilhelm Wolf identificador NKC jn20000605638
Ernst Wilhelm Wolf identificador MusicBrainz de artista 43b3c077-00fc-40d6-b7de-f5b55a763334
Ernst Wilhelm Wolf Europeana Entity agent/base/25725
Ernst Wilhelm Wolf identificador Deutsche Biographie 117458600
Ernst Wilhelm Wolf identificador en la Gran Enciclopèdia de la Música 18124
Ernst Wilhelm Wolf identificador RISM people/146800
Ernst Wilhelm Wolf identificador NUKAT n2007130896
Ernst Wilhelm Wolf identificador NLP (nuevo) 9810603338905606
Ernst Wilhelm Wolf identificador de elemento en FactGrid Q146366
Ernst Wilhelm Wolf identificador J9U de la Biblioteca Nacional de Israel 987007298205505171
Ernst Wilhelm Wolf identificador de Prabook 2425582
Ernst Wilhelm Wolf perfil en Geni.com 6000000018398984159
Ernst Wilhelm Wolf apellido Wolf
Ernst Wilhelm Wolf fecha de bautismo 1735
Ernst Wilhelm Wolf identificador de MGG Online 15186
Ernst Wilhelm Wolf identificador de Grove Music Online 30491
Ernst Wilhelm Wolf identificador SBN MUSV069084, registrado como Wolf, Ernst Wilhelm <1735-1792>
Ernst Wilhelm Wolf identificador WorldCat Entities E39PBJgcYmdQcC7mcvmJbcbrv3
Ernst Wilhelm Wolf
Duits componist (1735-1792)
Ernst Wilhelm Wolf huwelijkspartner Marie Caroline Benda
Ernst Wilhelm Wolf LCAuth-identificatiecode n84181325
Ernst Wilhelm Wolf VIAF-identificatiecode 44566363
Ernst Wilhelm Wolf GND-identificatiecode 117458600
Ernst Wilhelm Wolf ISNI 0000000110259268
Ernst Wilhelm Wolf geboorteplaats Grossenbehringen
Ernst Wilhelm Wolf overlijdensplaats Weimar
Ernst Wilhelm Wolf is een mens
Ernst Wilhelm Wolf Freebase-identificatiecode /m/051vz1y
Ernst Wilhelm Wolf geboortedatum 1735
Ernst Wilhelm Wolf overlijdensdatum 1792
Ernst Wilhelm Wolf overlijdensdatum 1792
Ernst Wilhelm Wolf doodsoorzaak beroerte
Ernst Wilhelm Wolf beroep componist
Ernst Wilhelm Wolf beroep dirigent
Ernst Wilhelm Wolf voornaam Ernst
Ernst Wilhelm Wolf NTA-identificatiecode voor persoon 117366498
Ernst Wilhelm Wolf land van nationaliteit Duitsland
Ernst Wilhelm Wolf genre opera
Ernst Wilhelm Wolf genre symfonie
Ernst Wilhelm Wolf IMSLP-identificatiecode Category:Wolf,_Ernst_Wilhelm
Ernst Wilhelm Wolf wijze van overlijden natuurlijke dood
Ernst Wilhelm Wolf Trove-identificatiecode 1060092
Ernst Wilhelm Wolf Open Library-identificatiecode OL6650357A
Ernst Wilhelm Wolf FAST-identificatiecode 146969
Ernst Wilhelm Wolf afbeelding Ernst Wilhelm Wolf.JPG
Ernst Wilhelm Wolf NLI-identificatiecode (Israël) (oud) 000215238
Ernst Wilhelm Wolf beschreven door bron Brockhaus en Efron Encyclopedisch Woordenboek, onderwerp van verklaring ЭСБЕ / Вольф, Эрнест-Вильям
Ernst Wilhelm Wolf beschreven door bron Allgemeine Deutsche Biographie, onderwerp van verklaring Wolf, Ernst Wilhelm (ADB)
Ernst Wilhelm Wolf beschreven door bron Riemann's Music Dictionary (1901–1904), onderwerp van verklaring МСР / Вольф (Wolf)
Ernst Wilhelm Wolf Commonscategorie Ernst Wilhelm Wolf
Ernst Wilhelm Wolf SNAC-identificatiecode w6h71h82
Ernst Wilhelm Wolf openMLOL-identificatiecode voor auteur 51859
Ernst Wilhelm Wolf BNE-identificatiecode XX1768855
Ernst Wilhelm Wolf Operone-identificatiecode voor componist wolfew
Ernst Wilhelm Wolf idRef-identificatiecode 080807917
Ernst Wilhelm Wolf taalbeheersing Duits
Ernst Wilhelm Wolf CERL-identificatiecode cnp00389928
Ernst Wilhelm Wolf Muziekweb-identificatiecode voor uitvoerend artiest M00000257351
Ernst Wilhelm Wolf instrument piano
Ernst Wilhelm Wolf sekse of geslacht mannelijk
Ernst Wilhelm Wolf BnF-identificatiecode 148079488
Ernst Wilhelm Wolf NKC-identificatiecode jn20000605638
Ernst Wilhelm Wolf MusicBrainz-identificatiecode voor artiest 43b3c077-00fc-40d6-b7de-f5b55a763334
Ernst Wilhelm Wolf Musicalics-identificatiecode voor componist 85630
Ernst Wilhelm Wolf Europeana Entity-identificatiecode agent/base/25725
Ernst Wilhelm Wolf Deutsche Biographie-identificatiecode 117458600
Ernst Wilhelm Wolf Gran Enciclopèdia de la Música-identificatiecode 18124
Ernst Wilhelm Wolf RISM-identificatiecode people/146800
Ernst Wilhelm Wolf Carl-Maria-von-Weber-Gesamtausgabe-identificatiecode A007001
Ernst Wilhelm Wolf NUKAT-identificatiecode n2007130896
Ernst Wilhelm Wolf PLWABN-identificatiecode 9810603338905606
Ernst Wilhelm Wolf FactGrid-identificatiecode voor item Q146366
Ernst Wilhelm Wolf Kallías-identificatiecode PE00378780
Ernst Wilhelm Wolf JGU-identificatiecode van de Nationale Bibliotheek van Israël 987007298205505171
Ernst Wilhelm Wolf Prabook-identificatiecode 2425582
Ernst Wilhelm Wolf Geni.com-identificatiecode 6000000018398984159
Ernst Wilhelm Wolf familienaam Wolf
Ernst Wilhelm Wolf Hill Museum & Manuscript Library-identificatiecode person/292307264133
Ernst Wilhelm Wolf doopdatum 1735
Ernst Wilhelm Wolf MGG Online-identificatiecode 15186
Ernst Wilhelm Wolf Grove Music Online-identificatiecode 30491
Ernst Wilhelm Wolf SBN-identificatiecode voor auteur MUSV069084, genoemd als Wolf, Ernst Wilhelm <1735-1792>
Ernst Wilhelm Wolf museum-digital-identificatiecode voor persoon 35642
Ernst Wilhelm Wolf Dansk Forfatterleksikon-identificatiecode u15329
Ernst Wilhelm Wolf WorldCat Entities-identificatiecode E39PBJgcYmdQcC7mcvmJbcbrv3
Ernst Wilhelm Wolf
tysk konsertmester og komponist
Ernst Wilhelm Wolf ektefelle Maria Carolina Benda
Ernst Wilhelm Wolf Library of Congress autoritets-ID n84181325
Ernst Wilhelm Wolf VIAF-ID 44566363
Ernst Wilhelm Wolf GND-ID 117458600
Ernst Wilhelm Wolf ISNI 0000000110259268
Ernst Wilhelm Wolf fødested Großenbehringen
Ernst Wilhelm Wolf dødssted Weimar
Ernst Wilhelm Wolf forekomst av menneske
Ernst Wilhelm Wolf Freebase-ID /m/051vz1y
Ernst Wilhelm Wolf fødselsdato 1735
Ernst Wilhelm Wolf dødsdato 1792
Ernst Wilhelm Wolf dødsdato 1792
Ernst Wilhelm Wolf dødsårsak hjerneslag
Ernst Wilhelm Wolf beskjeftigelse komponist
Ernst Wilhelm Wolf beskjeftigelse dirigent
Ernst Wilhelm Wolf fornavn Ernst
Ernst Wilhelm Wolf NTA person-ID 117366498
Ernst Wilhelm Wolf statsborgerskap Tyskland
Ernst Wilhelm Wolf sjanger opera
Ernst Wilhelm Wolf sjanger symfoni
Ernst Wilhelm Wolf IMSLP-identifikator Category:Wolf,_Ernst_Wilhelm
Ernst Wilhelm Wolf dødsmåte naturlige årsaker
Ernst Wilhelm Wolf Trove person-ID 1060092
Ernst Wilhelm Wolf Open Library-ID OL6650357A
Ernst Wilhelm Wolf FAST-ID 146969
Ernst Wilhelm Wolf bilde Ernst Wilhelm Wolf.JPG
Ernst Wilhelm Wolf NLI (Israel) 000215238
Ernst Wilhelm Wolf beskrevet i kilde Brockhaus-Efron leksikon, tema for ЭСБЕ / Вольф, Эрнест-Вильям
Ernst Wilhelm Wolf beskrevet i kilde Allgemeine Deutsche Biographie
Ernst Wilhelm Wolf beskrevet i kilde Muzykalnyj slovar Rimana, 1901–1904, tema for МСР / Вольф (Wolf)
Ernst Wilhelm Wolf Commons-kategori Ernst Wilhelm Wolf
Ernst Wilhelm Wolf SNAC Ark-ID w6h71h82
Ernst Wilhelm Wolf BNE-identifikator XX1768855
Ernst Wilhelm Wolf IdRef-ID 080807917
Ernst Wilhelm Wolf talte eller skrevne språk tysk
Ernst Wilhelm Wolf CERL-ID cnp00389928
Ernst Wilhelm Wolf Muziekweb musiker-ID M00000257351
Ernst Wilhelm Wolf instrument piano
Ernst Wilhelm Wolf kjønn mann
Ernst Wilhelm Wolf BNF-ID 148079488
Ernst Wilhelm Wolf NKC-identifikator jn20000605638
Ernst Wilhelm Wolf MusicBrainz artist-ID 43b3c077-00fc-40d6-b7de-f5b55a763334
Ernst Wilhelm Wolf Musicalics komponist-ID 85630
Ernst Wilhelm Wolf Europeana-enhet agent/base/25725
Ernst Wilhelm Wolf Deutsche Biographie-ID 117458600
Ernst Wilhelm Wolf RISM-ID people/146800
Ernst Wilhelm Wolf NUKAT autoritetspost n2007130896
Ernst Wilhelm Wolf PLWABN-ID 9810603338905606
Ernst Wilhelm Wolf FactGrid-ID Q146366
Ernst Wilhelm Wolf National Library of Israel J9U ID 987007298205505171
Ernst Wilhelm Wolf Prabook-ID 2425582
Ernst Wilhelm Wolf Geni.com-ID 6000000018398984159
Ernst Wilhelm Wolf etternavn Wolf
Ernst Wilhelm Wolf dåpsdato 1735
Ernst Wilhelm Wolf Grove Music Online-ID 30491
Ernst Wilhelm Wolf SBN-identifikator MUSV069084, oppført som Wolf, Ernst Wilhelm <1735-1792>
Ernst Wilhelm Wolf Dansk forfatterleksikon-ID u15329
Ernst Wilhelm Wolf WorldCat Entities-ID E39PBJgcYmdQcC7mcvmJbcbrv3
Эрнст Вильгельм Вольф
Немецкий композитор
Эрнст Вильгельм Вольф супруг(а) Мария Каролина Вольф
Эрнст Вильгельм Вольф код LCCN n84181325
Эрнст Вильгельм Вольф код VIAF 44566363
Эрнст Вильгельм Вольф код GND 117458600
Эрнст Вильгельм Вольф код ISNI 0000000110259268
Эрнст Вильгельм Вольф место смерти Веймар
Эрнст Вильгельм Вольф это частный случай понятия человек
Эрнст Вильгельм Вольф код Freebase /m/051vz1y
Эрнст Вильгельм Вольф дата рождения 1735
Эрнст Вильгельм Вольф дата смерти 1792
Эрнст Вильгельм Вольф дата смерти 1792
Эрнст Вильгельм Вольф причина смерти инсульт
Эрнст Вильгельм Вольф род занятий композитор
Эрнст Вильгельм Вольф род занятий дирижёр
Эрнст Вильгельм Вольф личное имя Эрнст
Эрнст Вильгельм Вольф код NTA 117366498
Эрнст Вильгельм Вольф гражданство Германия
Эрнст Вильгельм Вольф жанр опера
Эрнст Вильгельм Вольф жанр симфония
Эрнст Вильгельм Вольф идентификатор IMSLP Category:Wolf,_Ernst_Wilhelm
Эрнст Вильгельм Вольф род смерти ненасильственная смерть
Эрнст Вильгельм Вольф код в Национальной библиотеке Австралии 1060092
Эрнст Вильгельм Вольф код в Open Library OL6650357A
Эрнст Вильгельм Вольф код FAST 146969
Эрнст Вильгельм Вольф изображение Ernst Wilhelm Wolf.JPG
Эрнст Вильгельм Вольф код NLI 000215238
Эрнст Вильгельм Вольф описывается в источниках Энциклопедический словарь Брокгауза и Ефрона, 1890—1907, тема утверждения ЭСБЕ / Вольф, Эрнест-Вильям
Эрнст Вильгельм Вольф описывается в источниках Allgemeine Deutsche Biographie, тема утверждения ADB / Wolf, Ernst Wilhelm
Эрнст Вильгельм Вольф описывается в источниках Музыкальный словарь Римана, 1901–1904, тема утверждения МСР / Вольф (Wolf)
Эрнст Вильгельм Вольф категория на Викискладе Ernst Wilhelm Wolf
Эрнст Вильгельм Вольф код в проекте SNAC w6h71h82
Эрнст Вильгельм Вольф код автора openMLOL 51859
Эрнст Вильгельм Вольф код BNE XX1768855
Эрнст Вильгельм Вольф код композитора Operone wolfew
Эрнст Вильгельм Вольф код idRef 080807917
Эрнст Вильгельм Вольф языки, на которых говорит или пишет персона немецкий язык
Эрнст Вильгельм Вольф код CERL cnp00389928
Эрнст Вильгельм Вольф код исполнителя в Muziekweb M00000257351
Эрнст Вильгельм Вольф музыкальный инструмент фортепиано
Эрнст Вильгельм Вольф пол или гендер мужской пол
Эрнст Вильгельм Вольф код BNF 148079488
Эрнст Вильгельм Вольф код NKC jn20000605638
Эрнст Вильгельм Вольф код исполнителя MusicBrainz 43b3c077-00fc-40d6-b7de-f5b55a763334
Эрнст Вильгельм Вольф код композитора в Musicalics 85630
Эрнст Вильгельм Вольф сущность в Europeana agent/base/25725
Эрнст Вильгельм Вольф код Deutsche Biographie 117458600
Эрнст Вильгельм Вольф код в Большой музыкальной энциклопедии 18124
Эрнст Вильгельм Вольф код в RISM people/146800
Эрнст Вильгельм Вольф код Carl-Maria-von-Weber-Gesamtausgabe A007001
Эрнст Вильгельм Вольф код NUKAT n2007130896
Эрнст Вильгельм Вольф код PLWABN 9810603338905606
Эрнст Вильгельм Вольф код статьи в FactGrid Q146366
Эрнст Вильгельм Вольф код в Kallías PE00378780
Эрнст Вильгельм Вольф код J9U Национальной библиотеки Израиля 987007298205505171
Эрнст Вильгельм Вольф код Prabook 2425582
Эрнст Вильгельм Вольф код персоны на Geni.com 6000000018398984159
Эрнст Вильгельм Вольф фамилия Вольф/Вулф
Эрнст Вильгельм Вольф код HMML person/292307264133
Эрнст Вильгельм Вольф дата крещения 1735
Эрнст Вильгельм Вольф код Grove Music Online 30491
Эрнст Вильгельм Вольф код SBN MUSV069084, назван как Wolf, Ernst Wilhelm <1735-1792>
Эрнст Вильгельм Вольф код персоны museum-digital 35642
Эрнст Вильгельм Вольф код Dansk Forfatterleksikon u15329
Эрнст Вильгельм Вольф код WorldCat Entities E39PBJgcYmdQcC7mcvmJbcbrv3
ارنست ویلهلم ولف
آهنگساز آلمانی
ارنست ویلهلم ولف کد تائید کتابخانهٔ کنگره n84181325
ارنست ویلهلم ولف شناسه بم بم 44566363
ارنست ویلهلم ولف شناسهٔ جامع پرونده (GND) 117458600
ارنست ویلهلم ولف شناسهٔ ISNI 0000000110259268
ارنست ویلهلم ولف محل مرگ وایمار
ارنست ویلهلم ولف نمونهای از انسان
ارنست ویلهلم ولف شناسهٔ فریبیس /m/051vz1y
ارنست ویلهلم ولف زادروز 1735
ارنست ویلهلم ولف زمان مرگ 1792
ارنست ویلهلم ولف زمان مرگ 1792
ارنست ویلهلم ولف علت مرگ سکته مغزی
ارنست ویلهلم ولف پیشه آهنگساز
ارنست ویلهلم ولف پیشه رهبر(موسیقی)
ارنست ویلهلم ولف شناسهٔ هلندی نویسندگان 117366498
ارنست ویلهلم ولف تبعۀ آلمان
ارنست ویلهلم ولف سبک اپرا
ارنست ویلهلم ولف سبک سمفونی
ارنست ویلهلم ولف شناسهٔ موسیقیایی IMSLP Category:Wolf,_Ernst_Wilhelm
ارنست ویلهلم ولف نحوهٔ مرگ مرگ طبیعی
ارنست ویلهلم ولف شناسهٔ مردمان استرالیا 1060092
ارنست ویلهلم ولف شناسهٔ کتابخانهٔ باز OL6650357A
ارنست ویلهلم ولف شناسه فست 146969
ارنست ویلهلم ولف نگاره Ernst Wilhelm Wolf.JPG
ارنست ویلهلم ولف شناسهٔ کتابداری NLI 000215238
ارنست ویلهلم ولف تعریف شده در دانشنامه افرون و بروکهاوس, اظهار مرتبط است با ЭСБЕ / Вольф, Эрнест-Вильям
ارنست ویلهلم ولف تعریف شده در فرهنگ جامع زندگینامه آلمان
ارنست ویلهلم ولف ردهٔ ویکیانبار Ernst Wilhelm Wolf
ارنست ویلهلم ولف شناسۀ شبکههای اجتماعی و بایگانی w6h71h82
ارنست ویلهلم ولف شناسۀ برگهدان آزاد ملول 51859
ارنست ویلهلم ولف شناسهٔ کتابخانه ملی اسپانیا XX1768855
ارنست ویلهلم ولف شناسهٔ idRef 080807917
ارنست ویلهلم ولف زبانهای شخص زبان آلمانی
ارنست ویلهلم ولف شناسۀ گنجواژ سرل cnp00389928
ارنست ویلهلم ولف شناسه Muziekweb برای مجریان M00000257351
ارنست ویلهلم ولف ساز پیانو
ارنست ویلهلم ولف جنسیت مذکر
ارنست ویلهلم ولف شناسهٔ کتابخانه ملی فرانسه 148079488
ارنست ویلهلم ولف شناسۀ AUT NKC jn20000605638
ارنست ویلهلم ولف شناسۀ هنرمند در موزیکبرینز 43b3c077-00fc-40d6-b7de-f5b55a763334
ارنست ویلهلم ولف جوهره اروپانا agent/base/25725
ارنست ویلهلم ولف شناسهٔ زندگینامهٔ آلمان 117458600
ارنست ویلهلم ولف شناسهٔ NUKAT لهستان n2007130896
ارنست ویلهلم ولف برگهدان کتابخانه لهستان 9810603338905606
ارنست ویلهلم ولف شناسه آیتم در فکتگرید Q146366
ارنست ویلهلم ولف شناسه کالیاس PE00378780
ارنست ویلهلم ولف شناسۀ J9U کتابخانه ملی اسرائیل 987007298205505171
ارنست ویلهلم ولف شناسه پرابوک 2425582
ارنست ویلهلم ولف شناسۀ چهرهوارۀ (پروفایل) Geni.com 6000000018398984159
ارنست ویلهلم ولف روز غسل تعمید 1735
ارنست ویلهلم ولف شناسه موسیقیایی جورج گروو 30491
ارنست ویلهلم ولف برگهدان ICCU MUSV069084, شهرت Wolf, Ernst Wilhelm <1735-1792>
ارنست ویلهلم ولف شناسه جوهرۀ ورلدکت E39PBJgcYmdQcC7mcvmJbcbrv3
エルンスト・ヴィルヘルム・ヴォルフ
エルンスト・ヴィルヘルム・ヴォルフ アメリカ議会図書館典拠管理識別子 n84181325
エルンスト・ヴィルヘルム・ヴォルフ VIAF識別子 44566363
エルンスト・ヴィルヘルム・ヴォルフ GND識別子 117458600
エルンスト・ヴィルヘルム・ヴォルフ ISNI 0000000110259268
エルンスト・ヴィルヘルム・ヴォルフ 死没地 ヴァイマル
エルンスト・ヴィルヘルム・ヴォルフ 分類 ヒト
エルンスト・ヴィルヘルム・ヴォルフ Freebase識別子 /m/051vz1y
エルンスト・ヴィルヘルム・ヴォルフ 生年月日 1735
エルンスト・ヴィルヘルム・ヴォルフ 死亡年月日 1792
エルンスト・ヴィルヘルム・ヴォルフ 死亡年月日 1792
エルンスト・ヴィルヘルム・ヴォルフ 死因 脳卒中
エルンスト・ヴィルヘルム・ヴォルフ 職業 作曲家
エルンスト・ヴィルヘルム・ヴォルフ 職業 指揮者
エルンスト・ヴィルヘルム・ヴォルフ 名 エルンスト
エルンスト・ヴィルヘルム・ヴォルフ NTA PPN識別子 117366498
エルンスト・ヴィルヘルム・ヴォルフ 国籍 ドイツ
エルンスト・ヴィルヘルム・ヴォルフ ジャンル オペラ
エルンスト・ヴィルヘルム・ヴォルフ ジャンル 交響曲
エルンスト・ヴィルヘルム・ヴォルフ IMSLP識別子 Category:Wolf,_Ernst_Wilhelm
エルンスト・ヴィルヘルム・ヴォルフ 死亡状況 内因死
エルンスト・ヴィルヘルム・ヴォルフ NLAトローヴ人物識別子 1060092
エルンスト・ヴィルヘルム・ヴォルフ Open Library識別子 OL6650357A
エルンスト・ヴィルヘルム・ヴォルフ FAST識別子 146969
エルンスト・ヴィルヘルム・ヴォルフ 画像 Ernst Wilhelm Wolf.JPG
エルンスト・ヴィルヘルム・ヴォルフ イスラエル国立図書館識別子 (旧) 000215238
エルンスト・ヴィルヘルム・ヴォルフ 掲載している情報源 ブロックハウス・エフロン百科事典, この文の主題 ЭСБЕ / Вольф, Эрнест-Вильям
エルンスト・ヴィルヘルム・ヴォルフ 掲載している情報源 アルゲマイネ・ドイチェ・ビオグラフィー
エルンスト・ヴィルヘルム・ヴォルフ 掲載している情報源 リーマン音楽辞典 (1901 - 1904), この文の主題 МСР / Вольф (Wolf)
エルンスト・ヴィルヘルム・ヴォルフ コモンズのカテゴリ Ernst Wilhelm Wolf
エルンスト・ヴィルヘルム・ヴォルフ SNAC ARK識別子 w6h71h82
エルンスト・ヴィルヘルム・ヴォルフ openMLOL著者識別子 51859
エルンスト・ヴィルヘルム・ヴォルフ スペイン国立図書館識別子 XX1768855
エルンスト・ヴィルヘルム・ヴォルフ IdRef識別子 080807917
エルンスト・ヴィルヘルム・ヴォルフ 使用可能言語 ドイツ語
エルンスト・ヴィルヘルム・ヴォルフ CERLシソーラス識別子 cnp00389928
エルンスト・ヴィルヘルム・ヴォルフ Muziekweb パフォーマーID M00000257351
エルンスト・ヴィルヘルム・ヴォルフ 楽器 ピアノ
エルンスト・ヴィルヘルム・ヴォルフ 性別 男性
エルンスト・ヴィルヘルム・ヴォルフ フランス国立図書館識別子 148079488
エルンスト・ヴィルヘルム・ヴォルフ チェコ国立図書館識別子 jn20000605638
エルンスト・ヴィルヘルム・ヴォルフ MusicBrainzアーティスト識別子 43b3c077-00fc-40d6-b7de-f5b55a763334
エルンスト・ヴィルヘルム・ヴォルフ ヨーロピアナ・エンティティ agent/base/25725
エルンスト・ヴィルヘルム・ヴォルフ ドイッチェ・ビオグラフィー識別子 117458600
エルンスト・ヴィルヘルム・ヴォルフ NUKAT n2007130896
エルンスト・ヴィルヘルム・ヴォルフ ポーランド国立図書館識別子 9810603338905606
エルンスト・ヴィルヘルム・ヴォルフ FactGrid項目識別子 Q146366
エルンスト・ヴィルヘルム・ヴォルフ カリアス識別子 PE00378780
エルンスト・ヴィルヘルム・ヴォルフ イスラエル国立図書館J9U識別子 987007298205505171
エルンスト・ヴィルヘルム・ヴォルフ プラブック識別子 2425582
エルンスト・ヴィルヘルム・ヴォルフ Geni.comプロファイル識別子 6000000018398984159
エルンスト・ヴィルヘルム・ヴォルフ 姓 ウルフ
エルンスト・ヴィルヘルム・ヴォルフ 洗礼の日付 1735
エルンスト・ヴィルヘルム・ヴォルフ グローヴ・ミュージック・オンラインID 30491
エルンスト・ヴィルヘルム・ヴォルフ イタリア国立図書館サービス著者識別子 MUSV069084, 表記名 Wolf, Ernst Wilhelm <1735-1792>
エルンスト・ヴィルヘルム・ヴォルフ ミュージアム＝デジタル 人物ID 35642
エルンスト・ヴィルヘルム・ヴォルフ WorldCat Entities識別子 E39PBJgcYmdQcC7mcvmJbcbrv3
Ernst Wilhelm Wolf
Ernst Wilhelm Wolf LCAuth n84181325
Ernst Wilhelm Wolf VIAF 44566363
Ernst Wilhelm Wolf GND-identifikator 117458600
Ernst Wilhelm Wolf ISNI 0000000110259268
Ernst Wilhelm Wolf dødssted Weimar
Ernst Wilhelm Wolf tilfælde af menneske
Ernst Wilhelm Wolf Freebase-ID /m/051vz1y
Ernst Wilhelm Wolf fødselsdato 1735
Ernst Wilhelm Wolf dødsdato 1792
Ernst Wilhelm Wolf dødsdato 1792
Ernst Wilhelm Wolf dødsårsag slagtilfælde
Ernst Wilhelm Wolf beskæftigelse komponist
Ernst Wilhelm Wolf beskæftigelse dirigent
Ernst Wilhelm Wolf fornavn Ernst
Ernst Wilhelm Wolf NTA-nummer 117366498
Ernst Wilhelm Wolf statsborgerskab Tyskland
Ernst Wilhelm Wolf genre opera
Ernst Wilhelm Wolf genre symfoni
Ernst Wilhelm Wolf IMSLP-identifikator Category:Wolf,_Ernst_Wilhelm
Ernst Wilhelm Wolf dødsomstændigheder naturlige årsager
Ernst Wilhelm Wolf NLA Trove-ID 1060092
Ernst Wilhelm Wolf Open Library-ID OL6650357A
Ernst Wilhelm Wolf FAST-ID 146969
Ernst Wilhelm Wolf billede Ernst Wilhelm Wolf.JPG
Ernst Wilhelm Wolf NLI-identifikator (Israel) 000215238
Ernst Wilhelm Wolf beskrevet i Brockhaus-Efron, nærmere detaljer ЭСБЕ / Вольф, Эрнест-Вильям
Ernst Wilhelm Wolf beskrevet i Allgemeine Deutsche Biographie
Ernst Wilhelm Wolf beskrevet i Riemanns musikleksikon, nærmere detaljer МСР / Вольф (Wolf)
Ernst Wilhelm Wolf Commons-kategori Ernst Wilhelm Wolf
Ernst Wilhelm Wolf SNAC Ark-ID w6h71h82
Ernst Wilhelm Wolf openMLOL forfatter-ID 51859
Ernst Wilhelm Wolf BNE-identifikator XX1768855
Ernst Wilhelm Wolf idRef-ID 080807917
Ernst Wilhelm Wolf talte sprog tysk
Ernst Wilhelm Wolf Muziekweb musiker-ID M00000257351
Ernst Wilhelm Wolf instrument klaver
Ernst Wilhelm Wolf køn mand
Ernst Wilhelm Wolf BNF 148079488
Ernst Wilhelm Wolf AUT NKC jn20000605638
Ernst Wilhelm Wolf MusicBrainz-artist-ID 43b3c077-00fc-40d6-b7de-f5b55a763334
Ernst Wilhelm Wolf Europeana Entity agent/base/25725
Ernst Wilhelm Wolf Deutsche Biographie-ID 117458600
Ernst Wilhelm Wolf NUKAT n2007130896
Ernst Wilhelm Wolf PLWABN ID 9810603338905606
Ernst Wilhelm Wolf National Library of Israel J9U ID 987007298205505171
Ernst Wilhelm Wolf Geni.com-ID 6000000018398984159
Ernst Wilhelm Wolf efternavn Wolf
Ernst Wilhelm Wolf dåbsdato 1735
Ernst Wilhelm Wolf Grove Music Online-ID 30491
Ernst Wilhelm Wolf ICCU MUSV069084, subjekt anført som Wolf, Ernst Wilhelm <1735-1792>
Ernst Wilhelm Wolf Dansk Forfatterleksikon-ID u15329
Ernst Wilhelm Wolf
Ernst Wilhelm Wolf zakonec Maria Carolina Wolf
Ernst Wilhelm Wolf LCCN n84181325
Ernst Wilhelm Wolf VIAF 44566363
Ernst Wilhelm Wolf GND 117458600
Ernst Wilhelm Wolf ISNI 0000000110259268
Ernst Wilhelm Wolf kraj smrti Weimar
Ernst Wilhelm Wolf primerek od človek
Ernst Wilhelm Wolf Freebase /m/051vz1y
Ernst Wilhelm Wolf datum rojstva 1735
Ernst Wilhelm Wolf datum smrti 1792
Ernst Wilhelm Wolf datum smrti 1792
Ernst Wilhelm Wolf vzrok smrti možganska kap
Ernst Wilhelm Wolf poklic skladatelj
Ernst Wilhelm Wolf poklic dirigent
Ernst Wilhelm Wolf ime Ernst
Ernst Wilhelm Wolf NTA 117366498
Ernst Wilhelm Wolf država državljanstva Nemčija
Ernst Wilhelm Wolf zvrst opera
Ernst Wilhelm Wolf zvrst simfonija
Ernst Wilhelm Wolf IMSLP Category:Wolf,_Ernst_Wilhelm
Ernst Wilhelm Wolf način smrti naravna smrt
Ernst Wilhelm Wolf NLA Trove 1060092
Ernst Wilhelm Wolf Open Library OL6650357A
Ernst Wilhelm Wolf FAST 146969
Ernst Wilhelm Wolf slika Ernst Wilhelm Wolf.JPG
Ernst Wilhelm Wolf NLI (Izrael) 000215238
Ernst Wilhelm Wolf opisano v viru Brockhaus-Efronov enciklopedijski slovar, opisani podatkovni predmet ЭСБЕ / Вольф, Эрнест-Вильям
Ernst Wilhelm Wolf opisano v viru Allgemeine Deutsche Biographie
Ernst Wilhelm Wolf opisano v viru Riemannov leksikon glasbe (1901–1904), opisani podatkovni predmet МСР / Вольф (Wolf)
Ernst Wilhelm Wolf kategorija v Zbirki Ernst Wilhelm Wolf
Ernst Wilhelm Wolf BNE XX1768855
Ernst Wilhelm Wolf oznaka skladatelja Operone wolfew
Ernst Wilhelm Wolf oznaka IdRef 080807917
Ernst Wilhelm Wolf govorjeni, pisani ali kretani jeziki nemščina
Ernst Wilhelm Wolf CERL cnp00389928
Ernst Wilhelm Wolf oznaka izvajalca Muziekweb M00000257351
Ernst Wilhelm Wolf glasbilo klavir
Ernst Wilhelm Wolf spol moški
Ernst Wilhelm Wolf BNF 148079488
Ernst Wilhelm Wolf NKČR jn20000605638
Ernst Wilhelm Wolf izvajalec MusicBrainz 43b3c077-00fc-40d6-b7de-f5b55a763334
Ernst Wilhelm Wolf oznaka skladatelja Musicalics 85630
Ernst Wilhelm Wolf oznaka Europeane agent/base/25725
Ernst Wilhelm Wolf NUKAT n2007130896
Ernst Wilhelm Wolf oznaka PLWABN 9810603338905606
Ernst Wilhelm Wolf oznaka predmeta FactGrid Q146366
Ernst Wilhelm Wolf oznaka J9U Izraelske narodne knjižnice 987007298205505171
Ernst Wilhelm Wolf Geni.com (people) 6000000018398984159
Ernst Wilhelm Wolf priimek Wolf
Ernst Wilhelm Wolf datum krsta 1735
Ernst Wilhelm Wolf SBN MUSV069084, poimenovano kot Wolf, Ernst Wilhelm <1735-1792>
Ernst Wilhelm Wolf
compositor alemán
Ernst Wilhelm Wolf identificador d'autoridá de la Biblioteca del Congresu d'EEXX n84181325
Ernst Wilhelm Wolf identificador VIAF 44566363
Ernst Wilhelm Wolf identificador GND 117458600
Ernst Wilhelm Wolf ISNI 0000000110259268
Ernst Wilhelm Wolf llugar de fallecimientu Weimar
Ernst Wilhelm Wolf instancia de humanu
Ernst Wilhelm Wolf identificador en Freebase /m/051vz1y
Ernst Wilhelm Wolf fecha de nacimientu 1735
Ernst Wilhelm Wolf data de la muerte 1792
Ernst Wilhelm Wolf data de la muerte 1792
Ernst Wilhelm Wolf causa de muerte accidente vascular cerebral
Ernst Wilhelm Wolf ocupación compositor
Ernst Wilhelm Wolf ocupación direutor d'orquesta
Ernst Wilhelm Wolf nome Ernst
Ernst Wilhelm Wolf identificador NTA 117366498
Ernst Wilhelm Wolf país de nacionalidá Alemaña
Ernst Wilhelm Wolf xéneru ópera
Ernst Wilhelm Wolf xéneru Sinfonía
Ernst Wilhelm Wolf circunstancies de la muerte causes naturales
Ernst Wilhelm Wolf identificador Open Library OL6650357A
Ernst Wilhelm Wolf imaxe Ernst Wilhelm Wolf.JPG
Ernst Wilhelm Wolf categoría de Commons Ernst Wilhelm Wolf
Ernst Wilhelm Wolf identificador SNAC Ark w6h71h82
Ernst Wilhelm Wolf identificador BNE XX1768855
Ernst Wilhelm Wolf llingües falaes alemán
Ernst Wilhelm Wolf instrumentu pianu
Ernst Wilhelm Wolf sexu masculín
Ernst Wilhelm Wolf identificador BnF 148079488
Ernst Wilhelm Wolf identificador NKCR AUT jn20000605638
Ernst Wilhelm Wolf identificador d'artista de MusicBrainz 43b3c077-00fc-40d6-b7de-f5b55a763334
Ernst Wilhelm Wolf identificador NUKAT n2007130896
Ernst Wilhelm Wolf apellíu Wolf
Ernst Wilhelm Wolf data de bautismu 1735
Ernst Wilhelm Wolf identificador SBN MUSV069084, apaez como Wolf, Ernst Wilhelm <1735-1792>
إرنست ويلهلم وولف
ملحن ألماني
إرنست ويلهلم وولف الزَّوج ماريا كارولاينا وولف
إرنست ويلهلم وولف مُعرِّف مكتبة الكونغرس (LCNAF) n84181325
إرنست ويلهلم وولف مُعرِّف ملف الضبط الاستنادي الافتراضي الدَّولي (VIAF) 44566363
إرنست ويلهلم وولف مُعرِّف الملف الاستنادي المُتكامِل (GND) 117458600
إرنست ويلهلم وولف مُعرِّفُ الأسماء المِعياريُّ الدَّوليُّ (ISNI) 0000000110259268
إرنست ويلهلم وولف مكان الوفاة فايمار
إرنست ويلهلم وولف نموذج من إنسان
إرنست ويلهلم وولف مُعرِّف قاعدة البيانات الحُرَّة (Freebase) /m/051vz1y
إرنست ويلهلم وولف تاريخ الميلاد 1735
إرنست ويلهلم وولف تاريخ الوفاة 1792
إرنست ويلهلم وولف تاريخ الوفاة 1792
إرنست ويلهلم وولف سبب الوفاة سكتة دماغية
إرنست ويلهلم وولف المهنة ملحن
إرنست ويلهلم وولف المهنة قائد أوركسترا
إرنست ويلهلم وولف الاسم الأول إرنست
إرنست ويلهلم وولف مُعرِّف المَكنز الوطني للمؤلِّفين (NTA) 117366498
إرنست ويلهلم وولف بلد المواطنة ألمانيا
إرنست ويلهلم وولف النوع الفني أوبرا
إرنست ويلهلم وولف النوع الفني سمفونية
إرنست ويلهلم وولف مُعرِّف مشروع المكتبة الدولية للمُؤَلَّفات الموسيقيَّة (IMSLP) Category:Wolf,_Ernst_Wilhelm
إرنست ويلهلم وولف ظروف الوفاة أسباب طبيعية
إرنست ويلهلم وولف مُعرِّف نفائس المكتبة القومية الأسترالية (NLA Trove) 1060092
إرنست ويلهلم وولف مُعرِّف المكتبة المفتوحة (OLID) OL6650357A
إرنست ويلهلم وولف المُعرِّف مُتعدِد الأوجه لمُصطلح الموضوع (FAST) 146969
إرنست ويلهلم وولف الصورة Ernst Wilhelm Wolf.JPG
إرنست ويلهلم وولف مُعرِّف مكتبة إسرائيل الوطنية (NLI) 000215238
إرنست ويلهلم وولف مَوصُوف في المصدر قاموس بروكهاوس وإفرون الموسوعي, البيان يتعلق بموضوع ЭСБЕ / Вольф, Эрнест-Вильям
إرنست ويلهلم وولف مَوصُوف في المصدر قاموس السير الألمانية العامة
إرنست ويلهلم وولف مَوصُوف في المصدر قاموس ريمان للموسيقى, البيان يتعلق بموضوع МСР / Вольф (Wolf)
إرنست ويلهلم وولف تصنيف كومنز Ernst Wilhelm Wolf
إرنست ويلهلم وولف مُعرِّف الشبكات الاجتماعية ونظام المحتوى المؤرشف (SNAC Ark) w6h71h82
إرنست ويلهلم وولف مُعرِّف مؤلف في مكتبة الوسائط الحُرَّة (openMLOL) 51859
إرنست ويلهلم وولف مُعرِّف المكتبة القومية الإسبانية (BNE) XX1768855
إرنست ويلهلم وولف معرف ملحن في أوبرون wolfew
إرنست ويلهلم وولف مُعرِّف النظام الجامعي للتوثيق (IdRef) 080807917
إرنست ويلهلم وولف اللغات المحكية الألمانية
إرنست ويلهلم وولف مُعرِّف اتحاد مكتبات البحوث الأوروبيَّة (CERL) cnp00389928
إرنست ويلهلم وولف معرف مؤدي في شبكة الموسيقى M00000257351
إرنست ويلهلم وولف الآلة الموسيقية بيانو
إرنست ويلهلم وولف الجنس ذكر
إرنست ويلهلم وولف مُعرِّف المكتبة الوطنية الفرنسية (BnF) 148079488
إرنست ويلهلم وولف مُعرِّف الضَّبط الاستناديِّ في قاعدة البيانات الوطنية التشيكية (NLCR AUT) jn20000605638
إرنست ويلهلم وولف مُعرِّف فنَّان في موسوعة "ميوزيك برينز" (MusicBrainz) 43b3c077-00fc-40d6-b7de-f5b55a763334
إرنست ويلهلم وولف معرف ملحن في ميوزيكاليكس 85630
إرنست ويلهلم وولف مُعرِّف كِيان أوروبيانا (Europeana) agent/base/25725
إرنست ويلهلم وولف مُعرِّف الفهارس الألمانية (DtBio) 117458600
إرنست ويلهلم وولف معرف موسوعة رائعة للموسيقى 18124
إرنست ويلهلم وولف مُعرِّف عمل في قاعدة بيانات المستودع الدولي للمصادر الموسيقية (RISM) people/146800
إرنست ويلهلم وولف مُعرِّف دليل مركز مكتبة جامعة وارسو (NUKAT) n2007130896
إرنست ويلهلم وولف مُعرِّف المكتبة القومية في بولندا (NLP) 9810603338905606
إرنست ويلهلم وولف مُعرِّف عنصر فاكتغريد (FactGrid) Q146366
إرنست ويلهلم وولف مُعرِّف كالياس (Kallías) PE00378780
إرنست ويلهلم وولف مُعرِّف المكتبة القومية في إسرائيل (J9U) 987007298205505171
إرنست ويلهلم وولف مُعرِّف برابوك (Prabook) 2425582
إرنست ويلهلم وولف مُعرِّف ملف شخصي في موقع "جيني" (Geni.com) 6000000018398984159
إرنست ويلهلم وولف اسم العائلة وولف
إرنست ويلهلم وولف مُعرِّف مكتبة مخطوطات بيل ومتحفه (HMML) person/292307264133
إرنست ويلهلم وولف تاريخ معمودية الشخص في مرحلة الطفولة المبكرة 1735
إرنست ويلهلم وولف معرف الموسيقى في الماضي والحاضر على الإنترنت 15186
إرنست ويلهلم وولف مُعرِّف شخصية في موقع غروف للفنِّ 30491
إرنست ويلهلم وولف مُعرِّف مُؤلِّف لدى خدمة المكتبة الوطنية الإيطاليَّة (SBN) MUSV069084, باسم Wolf, Ernst Wilhelm <1735-1792>
إرنست ويلهلم وولف مُعرِّف شخص في المتحف الرقمي 35642
إرنست ويلهلم وولف مُعرِّف موسوعة المؤلفين الدنماركية u15329
إرنست ويلهلم وولف مُعرِّف كيان لدى مركز المكتبة الرقمية على الإنترنت (WC Entities) E39PBJgcYmdQcC7mcvmJbcbrv3
Ernst Wilhelm Wolf
kompozitor gjerman
Ernst Wilhelm Wolf bashkëshort Maria Carolina Wolf
Ernst Wilhelm Wolf Library of Congress ID n84181325
Ernst Wilhelm Wolf VIAF ID 44566363
Ernst Wilhelm Wolf GND ID 117458600
Ernst Wilhelm Wolf ISNI 0000000110259268
Ernst Wilhelm Wolf vendi i vdekjes Weimar
Ernst Wilhelm Wolf instancë e njeri
Ernst Wilhelm Wolf Freebase ID /m/051vz1y
Ernst Wilhelm Wolf data e lindjes 1735
Ernst Wilhelm Wolf data e vdekjes 1792
Ernst Wilhelm Wolf data e vdekjes 1792
Ernst Wilhelm Wolf profesioni kompozitor
Ernst Wilhelm Wolf emri Ernst
Ernst Wilhelm Wolf shtetësia Gjermania
Ernst Wilhelm Wolf zhanër Opera
Ernst Wilhelm Wolf zhanër Simfonia
Ernst Wilhelm Wolf mënyra e vdekjes arsye natyrale
Ernst Wilhelm Wolf imazh Ernst Wilhelm Wolf.JPG
Ernst Wilhelm Wolf përshkruar nga burimi Fjalori Enciklopedik Brockhaus dhe Efron, deklarata është subjekt i ЭСБЕ / Вольф, Эрнест-Вильям
Ernst Wilhelm Wolf kategoria në Commons Ernst Wilhelm Wolf
Ernst Wilhelm Wolf gjuhë që flet, shkruan ose këndon gjermanisht
Ernst Wilhelm Wolf instrument Pianoja
Ernst Wilhelm Wolf gjinia mashkull
Ernst Wilhelm Wolf identifikues i BNF 148079488
Ernst Wilhelm Wolf mbiemri Wolf
Ernst Wilhelm Wolf ID i autorit SBN MUSV069084, referuar si Wolf, Ernst Wilhelm <1735-1792>
Ernst Wilhelm Wolf
amseddas Analman
ارنست ويلهلم وولف
ارنست ويلهلم وولف متجوزه من ماريا كارولاينا وولف
ارنست ويلهلم وولف مكان الموت فايمار
ارنست ويلهلم وولف واحد من انسان
ارنست ويلهلم وولف معرف فرى بيس /m/051vz1y
ارنست ويلهلم وولف تاريخ الولاده 1735
ارنست ويلهلم وولف تاريخ الموت 1792
ارنست ويلهلم وولف تاريخ الموت 1792
ارنست ويلهلم وولف الوظيفه ملحن
ارنست ويلهلم وولف الوظيفه مايسترو
ارنست ويلهلم وولف الجنسيه المانيا
ارنست ويلهلم وولف الصوره Ernst Wilhelm Wolf.JPG
ارنست ويلهلم وولف تصنيف بتاع كومونز Ernst Wilhelm Wolf
ارنست ويلهلم وولف معرف الشبكات الاجتماعيه w6h71h82
ارنست ويلهلم وولف اللغه لغه المانى
ارنست ويلهلم وولف الجنس دكر
Ernst Wilhelm Wolf
compositore tedesco
Ernst Wilhelm Wolf coniuge Maria Carolina Benda
Ernst Wilhelm Wolf identificativo della Biblioteca del Congresso n84181325
Ernst Wilhelm Wolf identificativo VIAF 44566363
Ernst Wilhelm Wolf identificativo GND 117458600
Ernst Wilhelm Wolf identificativo ISNI 0000000110259268
Ernst Wilhelm Wolf luogo di morte Weimar
Ernst Wilhelm Wolf istanza di umano
Ernst Wilhelm Wolf identificativo Freebase /m/051vz1y
Ernst Wilhelm Wolf data di nascita 1735
Ernst Wilhelm Wolf data di morte 1792
Ernst Wilhelm Wolf data di morte 1792
Ernst Wilhelm Wolf causa del decesso ictus
Ernst Wilhelm Wolf occupazione compositore
Ernst Wilhelm Wolf occupazione direttore d'orchestra
Ernst Wilhelm Wolf prenome Ernst
Ernst Wilhelm Wolf identificativo NTA 117366498
Ernst Wilhelm Wolf paese di cittadinanza Germania
Ernst Wilhelm Wolf genere opera
Ernst Wilhelm Wolf genere sinfonia
Ernst Wilhelm Wolf identificativo IMSLP Category:Wolf,_Ernst_Wilhelm
Ernst Wilhelm Wolf circostanze del decesso cause naturali
Ernst Wilhelm Wolf identificativo Trove 1060092
Ernst Wilhelm Wolf identificativo Open Library OL6650357A
Ernst Wilhelm Wolf identificativo FAST 146969
Ernst Wilhelm Wolf immagine Ernst Wilhelm Wolf.JPG
Ernst Wilhelm Wolf identificativo NLI 000215238
Ernst Wilhelm Wolf descritto nella fonte Dizionario Enciclopedico Brockhaus ed Efron, dichiarazione è argomento di ЭСБЕ / Вольф, Эрнест-Вильям
Ernst Wilhelm Wolf descritto nella fonte Allgemeine Deutsche Biographie
Ernst Wilhelm Wolf categoria su Commons Ernst Wilhelm Wolf
Ernst Wilhelm Wolf identificativo Social Networks and Archival Context w6h71h82
Ernst Wilhelm Wolf identificativo openMLOL di un autore 51859
Ernst Wilhelm Wolf identificativo BNE XX1768855
Ernst Wilhelm Wolf identificativo Operone di un compositore wolfew
Ernst Wilhelm Wolf identificativo idRef 080807917
Ernst Wilhelm Wolf lingue parlate o scritte tedesco
Ernst Wilhelm Wolf identificativo CERL cnp00389928
Ernst Wilhelm Wolf identificativo Muziekweb M00000257351
Ernst Wilhelm Wolf strumento musicale pianoforte
Ernst Wilhelm Wolf sesso o genere maschio
Ernst Wilhelm Wolf identificativo BNF 148079488
Ernst Wilhelm Wolf identificativo NKC jn20000605638
Ernst Wilhelm Wolf identificativo MusicBrainz di un artista 43b3c077-00fc-40d6-b7de-f5b55a763334
Ernst Wilhelm Wolf identificativo Musicalics di un compositore 85630
Ernst Wilhelm Wolf Europeana Entity agent/base/25725
Ernst Wilhelm Wolf identificativo Deutsche Biographie 117458600
Ernst Wilhelm Wolf identificativo Gran Enciclopèdia de la Música 18124
Ernst Wilhelm Wolf identificativo RISM people/146800
Ernst Wilhelm Wolf identificativo Carl-Maria-von-Weber-Gesamtausgabe A007001
Ernst Wilhelm Wolf identificativo NUKAT n2007130896
Ernst Wilhelm Wolf identificativo PLWABN 9810603338905606
Ernst Wilhelm Wolf identificativo FactGrid di un elemento Q146366
Ernst Wilhelm Wolf identificativo Kallías PE00378780
Ernst Wilhelm Wolf identificativo J9U della Biblioteca nazionale israeliana 987007298205505171
Ernst Wilhelm Wolf identificativo Prabook 2425582
Ernst Wilhelm Wolf identificativo Geni.com 6000000018398984159
Ernst Wilhelm Wolf cognome Wolf
Ernst Wilhelm Wolf identificativo Hill Museum & Manuscript Library person/292307264133
Ernst Wilhelm Wolf data di battesimo 1735
Ernst Wilhelm Wolf identificativo MGG Online 15186
Ernst Wilhelm Wolf identificativo Grove Music Online 30491
Ernst Wilhelm Wolf identificativo SBN di un autore MUSV069084, soggetto indicato come Wolf, Ernst Wilhelm <1735-1792>
Ernst Wilhelm Wolf identificativo Dansk Forfatterleksikon u15329
Ernst Wilhelm Wolf identificativo WorldCat Entities E39PBJgcYmdQcC7mcvmJbcbrv3
Ernst Wilhelm Wolf
niemiecki kompozytor
Ernst Wilhelm Wolf identyfikator LCCN n84181325
Ernst Wilhelm Wolf identyfikator VIAF 44566363
Ernst Wilhelm Wolf identyfikator GND 117458600
Ernst Wilhelm Wolf identyfikator ISNI 0000000110259268
Ernst Wilhelm Wolf miejsce śmierci Weimar
Ernst Wilhelm Wolf jest to człowiek
Ernst Wilhelm Wolf identyfikator Freebase /m/051vz1y
Ernst Wilhelm Wolf data urodzenia 1735
Ernst Wilhelm Wolf data śmierci 1792
Ernst Wilhelm Wolf data śmierci 1792
Ernst Wilhelm Wolf przyczyna zgonu udar mózgu
Ernst Wilhelm Wolf zajęcie kompozytor
Ernst Wilhelm Wolf zajęcie dyrygent
Ernst Wilhelm Wolf imię Ernst
Ernst Wilhelm Wolf identyfikator NTA 117366498
Ernst Wilhelm Wolf obywatelstwo Niemcy
Ernst Wilhelm Wolf gatunek opera
Ernst Wilhelm Wolf gatunek symfonia
Ernst Wilhelm Wolf identyfikator IMSLP Category:Wolf,_Ernst_Wilhelm
Ernst Wilhelm Wolf sposób śmierci śmierć naturalna
Ernst Wilhelm Wolf identyfikator NLA Trove 1060092
Ernst Wilhelm Wolf identyfikator Open Library OL6650357A
Ernst Wilhelm Wolf identyfikator FAST 146969
Ernst Wilhelm Wolf ilustracja Ernst Wilhelm Wolf.JPG
Ernst Wilhelm Wolf identyfikator NLI (Izrael) 000215238
Ernst Wilhelm Wolf opisano w źródle Słownik encyklopedyczny Brockhausa i Efrona, podmiot ЭСБЕ / Вольф, Эрнест-Вильям
Ernst Wilhelm Wolf opisano w źródle Allgemeine Deutsche Biographie
Ernst Wilhelm Wolf opisano w źródle Riemann Musiklexikon (1901–1904), podmiot МСР / Вольф (Wolf)
Ernst Wilhelm Wolf kategoria Commons Ernst Wilhelm Wolf
Ernst Wilhelm Wolf identyfikator SNAC w6h71h82
Ernst Wilhelm Wolf identyfikator autora w openMLOL 51859
Ernst Wilhelm Wolf identyfikator BNE XX1768855
Ernst Wilhelm Wolf identyfikator kompozytora w Operone wolfew
Ernst Wilhelm Wolf identyfikator idRef 080807917
Ernst Wilhelm Wolf porozumiewa się w języku język niemiecki
Ernst Wilhelm Wolf identyfikator CERL cnp00389928
Ernst Wilhelm Wolf identyfikator wykonawcy w Muziekweb M00000257351
Ernst Wilhelm Wolf instrument fortepian
Ernst Wilhelm Wolf płeć mężczyzna
Ernst Wilhelm Wolf identyfikator BnF 148079488
Ernst Wilhelm Wolf identyfikator NKC jn20000605638
Ernst Wilhelm Wolf identyfikator artysty w MusicBrainz 43b3c077-00fc-40d6-b7de-f5b55a763334
Ernst Wilhelm Wolf identyfikator Musicalics 85630
Ernst Wilhelm Wolf identyfikator Europeany agent/base/25725
Ernst Wilhelm Wolf identyfikator Deutsche Biographie 117458600
Ernst Wilhelm Wolf identyfikator RISM people/146800
Ernst Wilhelm Wolf identyfikator Carl-Maria-von-Weber-Gesamtausgabe A007001
Ernst Wilhelm Wolf identyfikator NUKAT n2007130896
Ernst Wilhelm Wolf identyfikator PLWABN 9810603338905606
Ernst Wilhelm Wolf identyfikator elementu FactGrid Q146366
Ernst Wilhelm Wolf identyfikator Kallías PE00378780
Ernst Wilhelm Wolf identyfikator J9U Biblioteki Narodowej Izraela 987007298205505171
Ernst Wilhelm Wolf identyfikator Prabook 2425582
Ernst Wilhelm Wolf identyfikator profilu w Geni.com 6000000018398984159
Ernst Wilhelm Wolf nazwisko Wolf
Ernst Wilhelm Wolf data chrztu 1735
Ernst Wilhelm Wolf identyfikator MGG Online 15186
Ernst Wilhelm Wolf identyfikator Grove Music Online 30491
Ernst Wilhelm Wolf identyfikator autora w SBN MUSV069084, pod nazwą Wolf, Ernst Wilhelm <1735-1792>
Ernst Wilhelm Wolf identyfikator Dansk Forfatterleksikon u15329
Ernst Wilhelm Wolf identyfikator WorldCat Entities E39PBJgcYmdQcC7mcvmJbcbrv3
| 23,361 |
284373_1
|
Caselaw Access Project
|
Open Government
|
Public Domain
| null |
None
|
None
|
Unknown
|
Unknown
| 463 | 669 |
—In a probate proceeding, the objectant appeals from a decree of the Surrogate's Court, Queens County (Nahman, S.), dated October 30, 1998, which, upon the granting of the proponent's motion pursuant to CPLR 4401 for judgment as a matter of law, dismissed her objections and admitted the propounded instrument to probate.
Ordered that the decree is affirmed, with costs payable by the appellant personally.
The Surrogate's Court properly granted the proponent's motion pursuant to CPLR 4401 for judgment as a matter of law dismissing the objections to the admission of the subject will to probate. Although the objectant alleged, inter alia, improper execution of the will and lack of testamentary capacity, she failed to adduce any evidence in support of any of her objections. Where, as here, the attorney-draftsman supervised the will's execution, there is a presumption of regularity that the will was properly executed in all respects (see, Matter of Kindberg, 207 NY 220; Matter of Cottrell, 95 NY 329, 338; Matter of Posner, 160 AD2d 943). The objectant did not submit any evidence to overcome this presumption. She based her objections on the failure of the attesting witnesses to recall the circumstances of the will's execution. However, it is well settled that the presumption of proper execution is not overcome by the mere failure of attesting witnesses to recall the will execution (see, Matter of Collins, 60 NY2d 466, 471-473; Matter of Posner, 160 AD2d 943, 944-945, supra). Accordingly, the Surrogate properly found that the will was duly executed in conformity with EPTL 3-2.1.
The record also demonstrates that at all times, including when the will was executed (see, Children's Aid Socy. v Loveridge, 70 NY 387), the decedent possessed the testamentary capacity required by EPTL 3-1.1 to make a will and to dispose of her property. She knew the nature and extent of her property and the natural objects of her bounty (see, Matter of Kumstar, 66 NY2d 691, 692). The objectant adduced no evidence to the contrary.
The Surrogate did not err in allowing the proponent to recall the two attesting witnesses after they had finished testifying. The order of presentation of evidence at trial, including the decision to permit a party to recall a witness who has finished testifying, is a matter generally resting within the sound discretion of the trial court (see, Feldsberg v Nitschke, 49 NY2d 636, 643-644). Inasmuch as the proponent had not yet rested, no delay was caused by the recall, and as the objectant had a full opportunity to cross-examine the recalled witnesses, she suffered no prejudice from the court's departure from the usual order (see, e.g., Frazier v Campbell, 246 AD2d 509, 510; Kennedy v Peninsula Hosp. Ctr., 135 AD2d 788, 790-791). Thompson, J. P., Krausman, H. Miller and Schmidt, JJ., concur..
| 19,589 |
https://www.wikidata.org/wiki/Q2388220
|
Wikidata
|
Semantic data
|
CC0
| null |
Iphiaulax apicalis
|
None
|
Multilingual
|
Semantic data
| 1,414 | 4,231 |
Iphiaulax apicalis
soort uit het geslacht Iphiaulax
Iphiaulax apicalis taxonomische rang soort
Iphiaulax apicalis wetenschappelijke naam Iphiaulax apicalis
Iphiaulax apicalis is een taxon
Iphiaulax apicalis moedertaxon Iphiaulax
Iphiaulax apicalis GBIF-identificatiecode 1257117
Iphiaulax apicalis iNaturalist-identificatiecode voor taxon 671015
Iphiaulax apicalis Google Knowledge Graph-identificatiecode /g/11h1t8ny6
Iphiaulax apicalis Catalogue of Life-identificatiecode 6MWZB
Iphiaulax apicalis dagelijkse gang dagactief
Iphiaulax apicalis verkorte naam
Iphiaulax apicalis Open Tree of Life-identificatiecode 3294177
Iphiaulax apicalis
species of insect
Iphiaulax apicalis taxon rank species
Iphiaulax apicalis taxon name Iphiaulax apicalis
Iphiaulax apicalis instance of taxon
Iphiaulax apicalis parent taxon Iphiaulax
Iphiaulax apicalis GBIF taxon ID 1257117
Iphiaulax apicalis iNaturalist taxon ID 671015
Iphiaulax apicalis Google Knowledge Graph ID /g/11h1t8ny6
Iphiaulax apicalis Catalogue of Life ID 6MWZB
Iphiaulax apicalis diel cycle diurnality
Iphiaulax apicalis short name
Iphiaulax apicalis Open Tree of Life ID 3294177
Iphiaulax apicalis
specie di coleottero
Iphiaulax apicalis livello tassonomico specie
Iphiaulax apicalis nome scientifico Iphiaulax apicalis
Iphiaulax apicalis istanza di taxon
Iphiaulax apicalis taxon di livello superiore Iphiaulax
Iphiaulax apicalis identificativo GBIF 1257117
Iphiaulax apicalis identificativo iNaturalist taxon 671015
Iphiaulax apicalis identificativo Google Knowledge Graph /g/11h1t8ny6
Iphiaulax apicalis identificativo Catalogue of Life 6MWZB
Iphiaulax apicalis ciclo diurno diurnalità
Iphiaulax apicalis nome in breve
Iphiaulax apicalis
especie de insecto
Iphiaulax apicalis categoría taxonómica especie
Iphiaulax apicalis nombre del taxón Iphiaulax apicalis
Iphiaulax apicalis instancia de taxón
Iphiaulax apicalis taxón superior inmediato Iphiaulax
Iphiaulax apicalis identificador de taxón en GBIF 1257117
Iphiaulax apicalis código de taxón en iNaturalist 671015
Iphiaulax apicalis identificador Google Knowledge Graph /g/11h1t8ny6
Iphiaulax apicalis identificador Catalogue of Life 6MWZB
Iphiaulax apicalis ciclo diurno diurnalidad
Iphiaulax apicalis nombre corto
Iphiaulax apicalis identificador Open Tree of Life 3294177
Iphiaulax apicalis
espèce de coléoptères
Iphiaulax apicalis rang taxonomique espèce
Iphiaulax apicalis nom scientifique du taxon Iphiaulax apicalis
Iphiaulax apicalis nature de l’élément taxon
Iphiaulax apicalis taxon supérieur Iphiaulax
Iphiaulax apicalis identifiant Global Biodiversity Information Facility 1257117
Iphiaulax apicalis identifiant iNaturalist d'un taxon 671015
Iphiaulax apicalis identifiant du Google Knowledge Graph /g/11h1t8ny6
Iphiaulax apicalis identifiant Catalogue of Life 6MWZB
Iphiaulax apicalis cycle diurne diurne
Iphiaulax apicalis nom court
Iphiaulax apicalis identifiant Open Tree of Life 3294177
Iphiaulax apicalis
Iphiaulax apicalis ordo species
Iphiaulax apicalis taxon nomen Iphiaulax apicalis
Iphiaulax apicalis est taxon
Iphiaulax apicalis parens Iphiaulax
Iphiaulax apicalis nomen breve
Iphiaulax apicalis
Iphiaulax apicalis
Iphiaulax apicalis taxonomisk rang art
Iphiaulax apicalis vetenskapligt namn Iphiaulax apicalis
Iphiaulax apicalis instans av taxon
Iphiaulax apicalis nästa högre taxon Iphiaulax
Iphiaulax apicalis Global Biodiversity Information Facility-ID 1257117
Iphiaulax apicalis iNaturalist taxon-ID 671015
Iphiaulax apicalis Google Knowledge Graph-ID /g/11h1t8ny6
Iphiaulax apicalis kort namn
Iphiaulax apicalis Open Tree of Life-ID 3294177
Iphiaulax apicalis
Iphiaulax apicalis
Art der Gattung Iphiaulax
Iphiaulax apicalis taxonomischer Rang Art
Iphiaulax apicalis wissenschaftlicher Name Iphiaulax apicalis
Iphiaulax apicalis ist ein(e) Taxon
Iphiaulax apicalis übergeordnetes Taxon Iphiaulax
Iphiaulax apicalis GBIF-ID 1257117
Iphiaulax apicalis iNaturalist-Taxon-ID 671015
Iphiaulax apicalis Google-Knowledge-Graph-Kennung /g/11h1t8ny6
Iphiaulax apicalis CoL-ID 6MWZB
Iphiaulax apicalis Tagesgang tagaktiv
Iphiaulax apicalis Kurzname
Iphiaulax apicalis OTT-ID 3294177
Iphiaulax apicalis
вид насекомо
Iphiaulax apicalis ранг на таксон вид
Iphiaulax apicalis име на таксон Iphiaulax apicalis
Iphiaulax apicalis екземпляр на таксон
Iphiaulax apicalis родителски таксон Iphiaulax
Iphiaulax apicalis кратко име
Iphiaulax apicalis
вид насекомых
Iphiaulax apicalis таксономический ранг вид
Iphiaulax apicalis международное научное название Iphiaulax apicalis
Iphiaulax apicalis это частный случай понятия таксон
Iphiaulax apicalis ближайший таксон уровнем выше Iphiaulax
Iphiaulax apicalis идентификатор GBIF 1257117
Iphiaulax apicalis код таксона iNaturalist 671015
Iphiaulax apicalis код в Google Knowledge Graph /g/11h1t8ny6
Iphiaulax apicalis код Catalogue of Life 6MWZB
Iphiaulax apicalis суточный цикл дневной образ жизни животных
Iphiaulax apicalis краткое имя или название
Iphiaulax apicalis код Open Tree of Life 3294177
Iphiaulax apicalis
вид комах
Iphiaulax apicalis таксономічний ранг вид
Iphiaulax apicalis наукова назва таксона Iphiaulax apicalis
Iphiaulax apicalis є одним із таксон
Iphiaulax apicalis батьківський таксон Iphiaulax
Iphiaulax apicalis ідентифікатор у GBIF 1257117
Iphiaulax apicalis ідентифікатор таксона iNaturalist 671015
Iphiaulax apicalis Google Knowledge Graph /g/11h1t8ny6
Iphiaulax apicalis ідентифікатор Catalogue of Life 6MWZB
Iphiaulax apicalis коротка назва
Iphiaulax apicalis ідентифікатор Open Tree of Life 3294177
Iphiaulax apicalis
especie d'inseutu
Iphiaulax apicalis categoría taxonómica especie
Iphiaulax apicalis nome del taxón Iphiaulax apicalis
Iphiaulax apicalis instancia de taxón
Iphiaulax apicalis taxón inmediatamente superior Iphiaulax
Iphiaulax apicalis nome curtiu
Iphiaulax apicalis
specie de viespe
Iphiaulax apicalis rang taxonomic specie
Iphiaulax apicalis nume științific Iphiaulax apicalis
Iphiaulax apicalis este un/o taxon
Iphiaulax apicalis taxon superior Iphiaulax
Iphiaulax apicalis identificator Global Biodiversity Information Facility 1257117
Iphiaulax apicalis Google Knowledge Graph ID /g/11h1t8ny6
Iphiaulax apicalis nume scurt
Iphiaulax apicalis
speiceas feithidí
Iphiaulax apicalis rang an tacsóin speiceas
Iphiaulax apicalis ainm an tacsóin Iphiaulax apicalis
Iphiaulax apicalis sampla de tacsón
Iphiaulax apicalis máthairthacsón Iphiaulax
Iphiaulax apicalis ainm gearr
Iphiaulax apicalis
espécie de inseto
Iphiaulax apicalis categoria taxonómica espécie
Iphiaulax apicalis nome do táxon Iphiaulax apicalis
Iphiaulax apicalis instância de táxon
Iphiaulax apicalis táxon imediatamente superior Iphiaulax
Iphiaulax apicalis identificador Global Biodiversity Information Facility 1257117
Iphiaulax apicalis identificador do painel de informações do Google /g/11h1t8ny6
Iphiaulax apicalis ciclo diurno diurnalidade
Iphiaulax apicalis nome curto
Iphiaulax apicalis
Iphiaulax apicalis kategoria systematyczna gatunek
Iphiaulax apicalis naukowa nazwa taksonu Iphiaulax apicalis
Iphiaulax apicalis jest to takson
Iphiaulax apicalis takson nadrzędny Iphiaulax
Iphiaulax apicalis identyfikator GBIF 1257117
Iphiaulax apicalis identyfikator iNaturalist 671015
Iphiaulax apicalis identyfikator Google Knowledge Graph /g/11h1t8ny6
Iphiaulax apicalis tryb życia dzienny tryb życia
Iphiaulax apicalis nazwa skrócona
Iphiaulax apicalis identyfikator Open Tree of Life 3294177
Iphiaulax apicalis
loài côn trùng
Iphiaulax apicalis cấp bậc phân loại loài
Iphiaulax apicalis tên phân loại Iphiaulax apicalis
Iphiaulax apicalis là một đơn vị phân loại
Iphiaulax apicalis đơn vị phân loại mẹ Iphiaulax
Iphiaulax apicalis định danh GBIF 1257117
Iphiaulax apicalis ID ĐVPL iNaturalist 671015
Iphiaulax apicalis ID trong sơ đồ tri thức của Google /g/11h1t8ny6
Iphiaulax apicalis tên ngắn
Iphiaulax apicalis
lloj i insekteve
Iphiaulax apicalis emri shkencor Iphiaulax apicalis
Iphiaulax apicalis instancë e takson
Iphiaulax apicalis emër i shkurtër
Iphiaulax apicalis
Iphiaulax apicalis taksonitaso laji
Iphiaulax apicalis tieteellinen nimi Iphiaulax apicalis
Iphiaulax apicalis esiintymä kohteesta taksoni
Iphiaulax apicalis osa taksonia Iphiaulax
Iphiaulax apicalis Global Biodiversity Information Facility -tunniste 1257117
Iphiaulax apicalis iNaturalist-tunniste 671015
Iphiaulax apicalis Google Knowledge Graph -tunniste /g/11h1t8ny6
Iphiaulax apicalis Catalogue of Life -tunniste 6MWZB
Iphiaulax apicalis lyhyt nimi
Iphiaulax apicalis Open Tree of Life -tunniste 3294177
Iphiaulax apicalis
Iphiaulax apicalis reng taxonomic espècia
Iphiaulax apicalis nom scientific Iphiaulax apicalis
Iphiaulax apicalis natura de l'element taxon
Iphiaulax apicalis taxon superior Iphiaulax
Iphiaulax apicalis identificant GBIF 1257117
Iphiaulax apicalis identificant de taxon iNaturalist 671015
Iphiaulax apicalis nom cort
Iphiaulax apicalis
Iphiaulax apicalis
speco di insekto
Iphiaulax apicalis identifikilo che Google Knowledge Graph /g/11h1t8ny6
Iphiaulax apicalis kurta nomo
Iphiaulax apicalis
espècie d'insecte
Iphiaulax apicalis categoria taxonòmica espècie
Iphiaulax apicalis nom científic Iphiaulax apicalis
Iphiaulax apicalis instància de tàxon
Iphiaulax apicalis tàxon superior immediat Iphiaulax
Iphiaulax apicalis identificador GBIF 1257117
Iphiaulax apicalis identificador iNaturalist de tàxon 671015
Iphiaulax apicalis identificador Google Knowledge Graph /g/11h1t8ny6
Iphiaulax apicalis identificador Catalogue of Life 6MWZB
Iphiaulax apicalis cicle diürn diürnalitat
Iphiaulax apicalis nom curt
Iphiaulax apicalis identificador Open Tree of Life 3294177
Iphiaulax apicalis
especie de insecto
Iphiaulax apicalis categoría taxonómica especie
Iphiaulax apicalis nome do taxon Iphiaulax apicalis
Iphiaulax apicalis instancia de taxon
Iphiaulax apicalis taxon superior inmediato Iphiaulax
Iphiaulax apicalis identificador GBIF 1257117
Iphiaulax apicalis identificador iNaturalist dun taxon 671015
Iphiaulax apicalis identificador de Google Knowledge Graph /g/11h1t8ny6
Iphiaulax apicalis identificador Catalogue of Life 6MWZB
Iphiaulax apicalis nome curto
Iphiaulax apicalis identificador Open Tree of Life 3294177
Iphiaulax apicalis
especie d'insecto
Iphiaulax apicalis instancia de Taxón
Iphiaulax apicalis
Iphiaulax apicalis taksonomia rango specio
Iphiaulax apicalis taksonomia nomo Iphiaulax apicalis
Iphiaulax apicalis estas taksono
Iphiaulax apicalis supera taksono Iphiaulax
Iphiaulax apicalis numero en iNaturalist 671015
Iphiaulax apicalis identigilo en Scio-Grafo de Google /g/11h1t8ny6
Iphiaulax apicalis mallonga nomo
Iphiaulax apicalis
Iphiaulax apicalis nem brefik
Iphiaulax apicalis
Iphiaulax apicalis
Iphiaulax apicalis rango taxonomic specie
Iphiaulax apicalis nomine del taxon Iphiaulax apicalis
Iphiaulax apicalis instantia de taxon
Iphiaulax apicalis taxon superior immediate Iphiaulax
Iphiaulax apicalis
Iphiaulax apicalis maila taxonomikoa espezie
Iphiaulax apicalis izen zientifikoa Iphiaulax apicalis
Iphiaulax apicalis honako hau da taxon
Iphiaulax apicalis goiko maila taxonomikoa Iphiaulax
Iphiaulax apicalis GBIFen identifikatzailea 1257117
Iphiaulax apicalis iNaturalist identifikatzailea 671015
Iphiaulax apicalis Google Knowledge Graph identifikatzailea /g/11h1t8ny6
Iphiaulax apicalis Catalogue of Life identifikatzailea 6MWZB
Iphiaulax apicalis eguneko zikloa eguneko
Iphiaulax apicalis izen laburra
Iphiaulax apicalis Open Tree of Life identifikatzailea 3294177
Iphiaulax apicalis
espécie de inseto
Iphiaulax apicalis categoria taxonômica espécie
Iphiaulax apicalis nome taxológico Iphiaulax apicalis
Iphiaulax apicalis instância de táxon
Iphiaulax apicalis táxon imediatamente superior Iphiaulax
Iphiaulax apicalis identificador GBIF 1257117
Iphiaulax apicalis identificador do painel de informações do Google /g/11h1t8ny6
Iphiaulax apicalis ciclo diário diurnalidade
Iphiaulax apicalis nome curto
| 38,027 |
https://github.com/emmanuelshekinah/demos/blob/master/assets/js/d3js/weekly-heatmap.coffee
|
Github Open Source
|
Open Source
|
MIT
| 2,016 |
demos
|
emmanuelshekinah
|
CoffeeScript
|
Code
| 346 | 1,103 |
ready = ->
margin = { top: 50, right: 50, bottom: 100, left: 50 }
width = $('#chart').innerWidth() - margin.left - margin.right
height = Math.ceil(width * 10 / 24) - margin.top - margin.bottom + 60
gridSize = Math.floor(width / 24)
legendElementWidth = gridSize * 2
buckets = 9
colors = ['#ffffd9','#edf8b1','#c7e9b4','#7fcdbb','#41b6c4',
'#1d91c0','#225ea8','#253494','#081d58']
days = ['Mo', 'Tu', 'We', 'Th', 'Fr', 'Sa', 'Su']
times = ['1 am', '2 am', '3 am', '4 am', '5 am', '6 am', '7 am',
'8 am', '9 am', '10 am', '11 am', '12 am', '1 pm', '2 pm', '3 pm',
'4 pm', '5 pm', '6 pm', '7 pm', '8 pm', '9 pm', '10 pm', '11 pm', '12 pm']
values = ((d)-> {day: +d.day, hour: +d.hour, value: +d.value})
d3.tsv('/data/d3js/weekly-heatmap/data.tsv', values, (error, data)->
colorScale = d3.scale.quantile()
.domain([0, buckets - 1, d3.max(data, (d)-> d.value)]).range(colors)
svg = d3.select('#chart').append('svg')
.attr({width: width + margin.left + margin.right, \
height: height + margin.top + margin.bottom}).append('g')
.attr('transform', 'translate(' + margin.left + ',' + margin.top + ')')
dayLabels = svg.selectAll('.dayLabel').data(days).enter().append('text').text((d)-> d)
.attr({x: 0, y: ((d, i)-> i * gridSize), transform: 'translate(-6,' + gridSize / 1.5 + ')', \
class: ((d, i)-> if i >= 0 and i <= 4 then return 'dayLabel mono axis axis-workweek' else \
return 'dayLabel mono axis') }).style('text-anchor', 'end')
timeLabels = svg.selectAll('.timeLabel').data(times).enter().append('text').text((d)-> d)
.attr({x: ((d, i)-> i * gridSize), y: 0, transform: 'translate(' + gridSize / 2 + ', -6)', \
class: ((d, i)-> if i >= 7 and i <= 16 then return 'timeLabel mono axis axis-worktime' \
else return 'timeLabel mono axis')}).style('text-anchor', 'middle')
heatMap = svg.selectAll('.hour').data(data).enter().append('rect')
.attr({x: ((d)-> (d.hour - 1) * gridSize), y: ((d)-> (d.day - 1) * gridSize), rx: 4, ry: 4, \
class: 'hour bordered', width: gridSize, height: gridSize}).style('fill', colors[0])
heatMap.transition().duration(6000).style('fill', (d)-> colorScale(d.value))
heatMap.attr('data-title', (d)->
return 'Value: ' + d.value
)
d3utils.tooltip('.hour', {tOpts: {delay: {hide: 0, show: 500}}})
# Legend:
legend = svg.selectAll('.legend').data([0]
.concat(colorScale.quantiles()), (d)-> d).enter().append('g')
.attr('class', 'legend')
legend.append('rect').attr('x', (d, i)-> legendElementWidth * i)
.attr('y', height).attr('width', legendElementWidth)
.attr('height', gridSize / 2).style({fill: ((d, i)-> colors[i]), stroke: '#CCC'})
legend.append('text').attr('class', 'mono')
.text((d)-> '≥ ' + Math.round(d)).attr('x', (d, i)-> legendElementWidth * i)
.attr('y', height + gridSize)
)
$(document).ready(ready)
| 13,066 |
scrittieditieine01cappuoft_2
|
Italian-PD
|
Open Culture
|
Public Domain
| 1,877 |
Scritti editi e inediti
|
Capponi, Gino, 1792-1876 | Tabarrini, Marco
|
Italian
|
Spoken
| 6,723 | 11,482 |
XVII. — Pag. 55, 56. L'ultima delle testimonianze che il signor Napione ha riportate in suo favore è quella di Sebastiano Cabotto, scopritore egli pure di nuove Terre. Ma non il Cabotto è venuto in persona a istruirci; egli ha fatto passare la sua notizia per la bocca di un gentiluomo Mantovano grandissimo Filosofo e Matematico, e questo per quella del Ramusio da cui ha imparato il signor Napione. Disse dunque il Cabotto, conversando in Spagna col Mantovano, e narrando in un erudito ragionamento il Mantovano al Ramusio, che Giovanni Cabotto suo padre morì nel tempo medesimo in cui giunse l'avviso, che Colombo aveva scoperta la costa dell'Indie, e questo fu certo dopo il 1496, poiché in quell'anno Giovanni Cabotto era ancora vivo. Ora dunque Colombo non mandò egli l'avviso d'aver scoperto la costa delle Indie? Non esisteva in suo favore la presunzione che aggiungeva ancora all'autorità e alla buona fede delle sue parole? Non si poteva la sua chiamare anche con un po' di ragione scoperta, se il Vespucci non aveva mai toccati i luoghi dove egli approdò? Io trovo pertanto naturale che uno scopritore di nuove Terre segnasse la morte del proprio Padre con un'epoca tanto decantata e principale nella Storia delle navigazioni, e che la segnasse in quei termini; e mi lusingo di dispiacere meno a quegli stessi galantuomini, che concorrono nella testimonianza, che al chiarissimo Autore dell'Esame critico, se io non fo veruno caso del loro indiretto parlare. Capponi, Scritti. — 1. 2 18 OSSERVAZIONI SULL'ESAME CRITICO XVIII — Pag. 57. Gli editori Lorenesi credevano che tal gloria (di scopritore del continente del nuovo Mondo) spettasse al Vespucci in consecuzione del suo viaggio al Brasile. Io non so ravvisare tutto questo nei tronchi sensi dell'editore Lorenese, neppure dopo la Parafrasi, che ce ne ha data il signor Napione. E quand'anche ve lo ravvisassi, io non avrei mai cuore di tacciar d'ignorante un uomo, che si è mostrato tanto benemerito di Amerigo col pubblicare il primo tutti quattro i suoi viaggi, e ciò ad insaputa di lui. E poi che ho io da fare se quel verseggiatore piuttosto che Poeta cercando al fonte originale i meriti del Vespucci ha aperto il foglio dove egli dice partimmo di Lisbona. Il primo viaggio sta intero sotto la Freccia o avviso Ritmico, e tanto mi basta. XIX. — Pag. 59. Segue il Cap. VI in una gran parte del quale il signor Napione ha fatte rivivere le congetture che si lasciò scappare di bocca una volta sulla traduzione italiana della Cosmografia del Münster. Io non lo avrei mai creduto dopo l'assoluta condanna da cui è stato atterrato per un solo errore, il Tritemio, trovando, come è già stato osservato, il traduttore di Münster indegno affatto d'ogni riguardo, per la riunione mirabile in poche righe di una folla d'errori i più grossolani. Io però tacerò di Münster, di cui a parer mio si è parlato anche troppo, e farò mancare a molte pagine le mie osservazioni, non ritrovandovi veruno articolo che le richieda. XX. — Pag. 08. Ma che sarà questa ricerca poi, se... la Cosmografia italiana del Munster fosse d'accordo con uno scrittore fiorentino contemporaneo del Vespucci... che... Osservazioni sul ligamento, pag. fi. Io non credo d'offender la buona memoria di Carlo V a cui il signor Napione si applaustra di veder dedicata la traduzione, quasi in discolpa dell'originale, producendo anzi la congettura, che egli stesso rilega fra le altre insistenti, che venne al Munster impartito il raro onore di essere corretto da mano Imperiale. Io non vedo in quella dedica, che una traduzione; poiché Carlo V era morto o civilmente, o naturalmente nel 1558, nel quale anno fu pubblicata l'edizione italiana. DEL TRIMOTO VIAGGIO D'AMERIGO VESPUCCI. Scrive in Roma... informatissimo... Vi vuol molto coraggio a chiamarsi informatissimo Albertini, che fiorentino, e scrivendo in Roma, e contemporaneo, e parziale del Vespucci sbaglia ripetutamente e sul nome, e sul contesto di un suo così celebre concittadino. Ei mi sembra per ora troppo lontano da poterci aspirare a un'autorità così illimitata da distruggere, come ei farebbe se gli credevessi, con un sol colpo, le lettere del Vespucci, e la Dissertazione Giustificativa, Munster ed Ernerrà, Robertson e Tiraboschi, e perfino la Lettera II, sulla scoperta del nuovo Mondo e il Pigione, e l'Esame critico. Vada egli pure col Traduttore di Munster. XXI. - Pag. 77, Cap. VII. Questo Capitolo ha la sua intitolazione da Errare, e parla quasi sempre di lui. Come questo storico è stato nella nostra questione sempre contrapposto al Münster, il progetto, che io ho espresso di sopra di tacere del Münster, mi varrà anche per Errare. A me serve riguardo a questo quel che ha detto il signor Napione, scrivendo al suo dotto amico, cioè, Che di tutte le taccie, che si vollero dare a questo celebre storico spagnolo, ella non ne troverà alcuna, che sia fondata, eccetto una certa avversione al nome d'Amerigo. Del resto Errare è sostanzialmente in contraddizione col medesimo signor Napione, volendo questi Amerigo favorito dal caso, e quegli impostore sfacciato; lo sarebbe col traduttore del Münster, e col informatissimo Albertini, annullando questi, se crede. Se il signor Napione vuole crederci all'Albertini, e al traduttore del Münster, su cui fonda tutto il sesto capitolo del suo libro, bisogna che rinunci a tutta informazione ad ogni opinione, che mostra di aver preferita fino a quel punto, e che annunzia ai primi versi dell'Esame Critico, accingendosi a sostenere per tutto il libro, che dopo Colombo navigò sul continente del nuovo Mondo, non prima dell'anno 1499. Questi suoi nuovi campioni colli annullare il viaggio del 1499 distruggono ancora questa massima, e distruggono insieme tutti gli argomenti che si sono tratti dalla poco autenticità dello stampato, dalle varianti dei MS., e dallo scorbicato degli editori, che formano parte cosi sostanziale del libro. Pag. di Col, pag. 159. der deesi all'Esame critico, i primi due viaggi, e tenendo quegli DeVé così vero il secondo da pretendere anziché, che il primo ne fosse levato di pianta, e concorda solo col recente geografo, Pinberton, appunto come Tito Livio concorda con Floro. Strana cosa è il vedere i nemici del Vespucci non convenirsi mai fra loro, e più strano ancora il vedere il signor Napione fare tesoro indistintamente di tutti gli errori, e non dispiacergli d'essere contraddetto egli stesso, purché sia contraddetto Amerigo. Pag. 79. Se avesse (Amerigo) avuto diritto a quella scoperta... poteva e doveva asserirlo schiettamente, e non ingegnarsi di farlo congetturare artificiosamente per via di nude date, che sole non bastano ecc. Io non intendo e non intenderò mai, che cosa possa o debba dire di più schietto, e di meno artificioso un viaggiatore, che partimmo il tal giorno, scoprimmo una Terra ecc, né che cosa possa bastare a giustificare la sua fama, se questo non basta. Quanto meno del Vespucci non fece il Colombo, che si assicurò finché visse sulla fama, e aspettò dopo morte lo zelo del figlio, che asserisse aver egli viaggiato. Pag. 85. Nella famosa lite, che si agitò fra il Fisco del Be e D. Diego Colombo figlio del grande Ammiraglio... ecc. Come qui si ripete a parola ciò che è stato congetturato al Cap. IV, così io rimanderò i miei Lettori a quel che ho detto sotto il num. X. Io qui chiudo le mie osservazioni. Possa il signor Napione non si senta offeso in modo veruno, e possa Egli e ogni colto Lettore ravvisarvi schietto quel suo amore della verità, che le ha unicamente dettate. DELLA STORIA DI TUCIDIDE VOLGARIZZATA, LIV. VIII. (Firoiizo, dalla Tipografia Galiluiana, 1835.) ' La modestia letteraria da tanti luoghi bandita, sic- ché non pare merce di questo secolo, si trova pure alcuna volta rifugiata in qualche angolo di questa po- vera vilipesa Italia ; gli stranieri sembrano in due modi predicarcela, e con la l)ruttezza de' contrarli esempii, là dove r ingegno si degrada in arte di saltimbanco per accattare moneta, e col basso conto in che ci ten- gono, che, aggiunto a molte altre condizioni delle ita- liane lettere, oscurità ci consiglia. Una volta la tlot- trina si reputava come inerente a certe professioni di vita, ed era concesso averne fama per brevi responsi da dietro la cortina gettati sull' ignaro volgo e d' am- mirare voglioso : fama intatta perchè non commessa all' ardua prova dello scrivere, non risicata col mesco- larsi all' intelligenza de' popoli, per ammaestrarla, per correggerla. Ora per venire in grido altro artifizio si cerca, e quale riesca profittevole non vuo' rivelarlo ; starsi con le mani avvolte dentro alla cappa magistrale e tacersi, non gioverebbe per certo a procacciarsi au- torità. Ma in chi per modestia tace o espone sommesso poco echeggiate parole, talvolta sta il germe di quel- ' Kstriitto dal giornale 11 Progresso, opcia poriodica, voi. XIII, pag. liC, Anno V. Napoli, 13o6. 22 DELLA STOEIA DI TUCIDIDE. r ordine ci' idee che nella età successiva dovrà germo- gliare ; e tuttora involto nella nativa sua buccia, e non peranco fatto venale in su' mercati, si conserva mondo da quel polverio di piazza, da quel ragunaticcio di strade, clie il gergo de' tempi sparge di secolo in se- colo variamente, quasi fatai corrosivo, sulle migliori dottrine, e che, appena dominanti, le mostra dannate a inevitabile decadenza. Un vero dottore e modesto è certamente l'autore di questa versione di Tucidide che noi annunziamo; egli in opera faticosa e difficile, e per ogni lato commendabile, tenne celato il suo nome. Né vorremmo noi tradirlo per indiscreta nostra; ma, come noi sappiamo, molti sanno che a Firenze il canon. Francesco Pasquale Boni da gran tempo aveva in pronto, tra molti ed inediti lavori, un simile volgarizzamento; sanno che il canonico Boni, uomo di sincera e forte dottrina in cose ecclesiastiche, è un ellenista solenne, e quasi voleva dire unico tra noi in questo secolo affaccendato insieme ed ozioso, troppo incurante di studi siffatti. E se a tutto ciò aggiungesi, che egli è un sacerdote di vita semplice, e che per esso la carità umile sta in luogo delle ambizioni, si capirà facilmente come egli ripugnasse al nominarsi, e si vedrà che al concetto in cui deve l'opera tenersi ha da giovare non poco sapere ne e conoscere l'autore. Il quale autore, vedi singularità incredibile, non contento di celarsi, volle in gran parte rinnegare l'opera sua, e, quanto era in lui, donarne ad altri la lode. Una breve prefazione, ma tutta candore e buon giudizio, dice in nome del traduttore, che la traduzione, quale noi l'avremo, non è sua; e narra come egli la scrivesse unicamente per studio, e per agevolare ad alcuni suoi scolari l'intelligenza del greco isterico. Non avrebbe pensato mai a pubblicarla, perché il dettato non gli soddisfaceva; se non che il dottor Gaetano Cloni, bramoso di averla per bene avviare la sua tipografia Galileiana, si assunse di rivederla, e dove occorresse, raffinarla dal lato della dizione; essendosi aggiunto a questa fatica il giovine Giuseppe Meini, scolare del Boni, e già bene esercitato nelle greche lettere e nelle italiane. Né importa sofisticare per fare le parti con rigore fra i tre benemeriti: noi conosciamo del Cloni l'ingegno elegante, la perizia della lingua; al Meini basta la grande testimonianza del maestro; e la bontà della traduzione che abbiamo sott'occhio, ci attesta con raro esempio, che un po' di fratellanza tra i letterati non è cosa in tutto ripugnante alla felicità delle lettere. Non è pubblicato sinora che il primo libro, ma è sufficiente per accertare i pregi di tutta l'opera. Chiunque lo legga ne troverà la lettura facile, l'intelligenza spedita e l'italiana dizione. Chi lo ravvicinerà al testo potrà fare estimazione giusta del merito più speciale di questo volgarizzamento. La maggior difficoltà del greco sta nel trovare i veri legamenti del pensiero, determinando aggiustatamente il significato vario e fecondissimo delle preposizioni e particelle, e le diverse valori secondo i tempi dei verbi ai quali si riferiscono, e secondo i luoghi del discorso, che in cento modi le trasfigurano. La quale difficoltà si fa in Tucidide grandissima, per le vaste ellissi e l'abbondanza e la pienezza delle idee compresse in poche parole, avviticchiate fra loro con fatica struttura da un giro ardito di grammatica o da un artificio di collocamento, e come agglutinato dalla intima virtù dei vocaboli e dei sensi sottintesi, in quella lingua mirabile oltre ogni credere efficacissima. I quali artifizi potevano bene adoprarsi, tanto che ne uscisse certa e piana l'intelligenza, in un popolo ingegnoso come erano i Greci, ed in una lingua nella quale per discendenza immediata si custodiva gran parte di quella riccondita sapienza che era nei idiomi più antichi, ma resa più agevole dalle nuove filosofiche dottrine e dal forum e dai teatri diffusi nel popolo. Non giudichiamo. Lo stile di Tucidide secondo la mente nostra. Ogni avanzamento del sapere procede per via di analisi, e l'ingegno umano, assottigliandosi nei suoi progressi, ha bisogno che la lingua gli sia strumento più docile, e quasi passivo: era signora e moderatrice del pensiero, vuole ridurla schiava; e la stessa fecondità del vocabolo, che esprimeva o adombrava un mondo intero di idee, diviene ostacolo ai nuovi processi della mente, e genera confusione. Allora il valore dei segni più definito si restringe; ogni elemento del discorso, ogni frammento del pensiero acquista i suoi speciali contorni; la parola si materializza, e si dissecca, come una fibra del corpo umano sotto il coltello dell'anatomista. Di qui l'abitudine di astrarre dei popoli primitivi mirabilmente feconda, nelle regioni del pensiero gran tratto percorso per vie che ci sono incomprensibili; e la sapienza moderna incredula dell'antica, perchè ignorante dei suoi processi. Le lingue sintetiche dell'Asia attestano un lavoro della mente che tutte le forze dell'intelletto nostro non saprebbero ricominciare; la poesia di Eschilo e di Pindaro, cantata in quell'età stessa nelle feste nazionali, era sentita dal popolo; alla intelligenza del nostro popolo siffatta poesia male si adatterebbe. A' critici delle età più stracche, la composizione della storia di Tucidide apparve soverchiamente faticata; ma io per me credo che il popolo del suo tempo meglio e più facilmente la intendesse, che non dopo quattro secoli il retore Dionigi, per quanto è si fosse acuto, e fra tutti i retori accettabile per buon giudizio. A noi, distanti di tempo e di lingua e d'indole, la difficoltà si fa maggiore; e solamente la passione che ispirano quegli avvenimenti sempre istruttivi e quelli isterici sommi e quella sua pratica sapienza da lui inalzata a potenza filosofica; solamente la grande ricompensa che viene al lettore ostinato dall'addentrarsi in quel libro, può indurre noi mediocri ellenisti a tentare sino al fondo il guado difficile, e cercare di accostarci, anche in ogni parte più minuta, al vero concetto dell'autore. Noi non dubitiamo d'asserire che il Boni lo ha colto con singolare maestria. Il proemio della storia di Tucidide ci comparve sempre come un documento mirabile dell'ingegno greco, e contro a certe pretese delle età moderne un argomento tremendo. Vedi con che penetrante acume e insieme con quanta sobrietà di critica le origini greche sono svolte; vedi le ragioni, e come ora direbbero, le leggi delle migrazioni dei popoli che s'incalzano; la vita primitiva delle nazioni, la civiltà retrospinta, ma il progresso pertinace; arma della civiltà fra tutte più sicura, la barbarie che alfine consuma sé stessa; vedi i principi delle navigazioni, la pirateria madre dei commerci; vedi l'avvicendarsi degli ordini politici, popolo, ottimati, re, gli uffici e le opportunità di ciascuno, le diverse nature dei principati. Minosse, Agamennone, Policrate, e le tirannie municipali: vedi con quanta severità di critica la vanità nazionale è distrutta, l'autorità dei poeti in quanto ai fatti umiliata, le favole interpretate al giusto, l'ignoranza confessata; e nella inopia di documenti certi, i più solidi argomenti fabbricati sugli sparsi fondamenti di poche scritture o tradizioni, ma sincere, di costumanze sopravvissute o delle reliquie di un sepolto, ma più che altro accertati dalla osservazione genuina di certe leggi comuni ad ogni umana società, non inventate a capriccio, ma, come natura e i fatti gli dettavano, con sicurezza inappuntabile stabilite. E tutte queste cose in poche pagine, ed in quel libro medesimo dove il primo dramma di Navarino, e le feroci battaglie, e le miserie ultimate degli Ateniesi in Sicilia, stanno poi rappresentate con tanta vivezza, con tanta poesia di narrazione, che è maraviglia a vederlo in un uomo solo così disparate qualità, freddezza e calore, insieme congiunte, attenersi al bisogno, o intere e sole mostrarsi, secondo che la materia lo chiedeva e l'animo comandava. 26 DELLA STORIA DI TUCIDIDE. Eppure, in quella critica spietata, in quella analisi fredda, in quel dispregio di ogni antica e consacrata memoria, era un segnale di tempi che decadevano, di una civiltà che si guastava: ma noi non abbiamo al certo di cui vantarsi al confronto, noi che procedemmo tanto innanzi nel rovinoso cammino, nelle opere di distruzione: e a chi toccò la ventura, che Dio gli dia il momento della vita proiettato sul colmo, su quella sommità angusta in mezzo tra l'ascendere e il declinare, tra il sentimento e la critica: quelli, per quanto all'uomo è concesso, abbraccia più cose con la vista, ed ogni cosa mira dall'alto; e nel divieto che ci preme di riposare la mente nel centro generatore di ogni vero, almeno si aiutano guardando da vari lati la faccia esteriore delle cose e gli occhi più liberi attorno girando su molte parti della circonferenza. L'età di Tucidide in Grecia fu quella dei migliori ingegni, dei migliori intelletti, più vasti e più comprensivi. Su questo proemio della storia ci siamo fermati alquanto, perchè ivi la difficoltà del tradurre e l'importanza di ben tradurre ci sembrarono grandissime. Perciò noi volemmo accuratamente raffrontare al testo la nuova versione, con vivo e non facilmente appagabile desiderio che ella pienamente ci soddisfacesse; perciò quella dello Strozzi, benché per l'intelligibilità e per la lingua al certo non dispregevole, pure, venuta in tempi di scarsa filologia, rimane inadeguata al bisogno e alla intelligenza d'oggi. In quella del Boni ci parve generalemente di trovare intero e sicuro il concetto dell'autore; e osiamo promettere che allo studio della filologia storica e delle origini greche, questa italiana versione potrà egualmente servire come il testo originale. A noi ha servito come di scorta per acquistare una intelligenza più compiuta di alcuni luoghi difficili che in quel proemio si incontrano; e dal paragone fatto, alcune sentenze si sono per noi schiarite, d'altre l'intelligenza corretta. Pochi dubbi ci rimangono, i più sulla scelta delle parole adoperate per rendere il senso delle greche; e noi gli esporremo francamente, perchè non desideriamo avere altro giudice e maestro che lo stesso egregio traduttore, e saremo paghi se al nostro interrogare avremo risposta che nuove cose e segni d'alti errori ci corregga. Nel paragrafo secondo è ipotesi, e poco sotto La trasposizione si riconquista. Perché tradurre bontà del terreno, e sterilità del suolo, e non virtù e magrezza, parole che si riscontrano a capello col valore delle greche? E il signor Meini dovrebbe porle senza paura nel suo catalogo delle voci e modi italiani corrispondenti al greco, lavoro utile che noi gli raccomandiamo. I contadini toscani, soli maestri che siano rimasti della lingua, dicono ogni giorno terra fagra: che difficoltà a scriverlo? È tempo d'ardire, in fatto di lingua: agli altri è lecito, ai Toscani deve essere. E noi gli vorremmo studiosi piuttosto di queste vive ricchezze dovunque spendibili, che non dei vezzi municipali, i quali benché graziosi siano, non potranno mai, o non dovrebbero, varcare le mura native. E quanto a ap — n^ V etimologia di forza rende quella voce convenientissima a questo luogo: etimologia che in sé racchiude un gran senso. La bontà e la forza in Dio si confondono; nelle cose umane giova che la precisione dei vocaboli ci aiuti a distinguerle. Ora ci conviene esporre con grande esitanza un dubbio di assai maggiore momento. Nel § 3 della versione sono queste parole: "Fer me credo che neppure tutta insieme (la Grecia) avesse ancora questo nome (Eleni): poi dice come venisse da Elleno e da suoi figliuoli. Il quale nome (Elleni) pur non potette per molto tempo prendere piede fra tutti, come ne dà principale indizio Omero, che in nessun luogo dà a tutti loro insieme cotal nome. Ma né suoi versi nomina partitamente Danai, Argivi, Achei. Ne gli chiamò barbari, perchè, come sembrami, non ancora gli Elleni erano distinti sotto un medesimo nome, che agli altri contrapporsi potesse. Ecco in questo luogo dove la mia difficoltà consiste. Le parole "né li chiamò barbari" farebbero credere che Omero potesse o dovesse così chiamare gli Achei, o i Danai e gli Argivi, per contrapporsi agli Elleni. Ma, è chiaro che a quei tre popoli di Grecia il nome di barbari non poteva convenirsi. Mi pare che le parole di Tucidide s'accordino bene con la naturalezza del senso: ovvero ovrli By.pSà.prjxx; hp-nv.z (si noti queir ou vjv cvi-Ts, ed sip-nv.t adoperato qui piuttosto che ovó^.y.Tz). Come egli (Omero) non disse Elleni, così nemmeno disse barbari; non usò nemmeno il nome di barbari, perchè a quel collettivo, che allora non esisteva, questo senso non era per ancora da contrapporre. Veggano i dotti uomini se abbia io sbagliato nella intelligenza, o se nelle parole della versione sia luogo ad equivoco. § 21. — Non si perderà meglio piuttosto pensi, secondo antiche cose narrate favolosamente e a questo modo credute, col tener dietro ai più manifesti argomenti siano state ritrovate tali da appagare. Questo luogo è tra quei molti nei quali il Boni ha potuto con sicurezza correggere la più comune intelligenza. Ma invece di manifesti mi piacerebbe apparenti, o più appariscenti. Ciò che è manifesto genera evidenza, certezza; e qui lo storico parla di credenza, vuole accennare come quelle favole parissero verità. Credevansi, perchè il credere piaceva, perchè mostravano bello il viso. E il testo dice non dice o-ascoltavano. Sulla fine del § 22, disputa è reso per disputa scena. Qui Tucidide vuole alludere un po' malignamente ad Erodoto, e a quella recitazione delle storie, che nelle solennità Olimpiche, se il racconto dice il vero, trasse lacrime di bramosia dagli occhi del giovinetto di sedici anni; lacrime che forse poi rinacquero d'invidia nello storico provetto, ma disperato d'infondere nei suoi libri la dolcezza delle Muse, costretto a supplire la spontanea profondità del sentimento con la fatica del pensiero. Ma in quelle solennità, non so che gli storici, come i tragici, contendessero per avere premio di corona, né che leggessero dalla scena. Ripudiazione pomposa a cerca o a contesa di plauso, è una circolazione lunga, ma che rende, a mio credere, intera la niente dell'autore. Né io vorrei arrischiarmi a suggerire mutazioni, contento di avere esposti i miei dubbi intorno al significato delle parole. Perché "ammodernare" Corcira in Corfù, Corciresi in Corfuotti, quando la Tessaglia non si muta in Livadia, Bisanzio in Costantinopoli? So che i nomi d'oggi in qualche modo ci ravvicinano agli antichi fatti, ce li rendono più famigliari; ma quel Corfuotti mi suona un po' aspro, e credo si usi volgarmente Gorfiotti. E generalmente nelle mutazioni o nelle attuazioni dei nomi dei luoghi, è indizio grande di quello dei popoli. Veramente in siffatte cose è da concedere ampio spazio al gusto dello scrittore. Io, per esempio, il Mustoxidi lo vorrei sempre Corcirese. E per lo contrario certi nomi prepotenti, rimasti immutati quando la gente non è più quella, io li pronunzio a mal cuore. Ma questo mi dice la coscienza che sono stranezze: e tanta minuzia si volle notare, più che altro, per giustificare quando altri la noti, e per mostrare quanto sottile indagine patisca questo lavoro senza cadere di pregio. Noi raccomandiamo agli Italiani lo studio accurato di Tucidide, sul quale vorremmo l'attuazione a' giorni nostri opera simile a quella che fece il Machiavelli su Tito Livio: questo volgarizzamento potrà eccitare a un tale studio e facilitarlo. Se è l'istoria che si sa, è quella dei giorni ultimi della Repubblica romana, di quei venti anni nei quali corsero dal consolato di Cicerone fino alla morte di lui. Ed egli stesso ne è il primo storico nelle Lettere, nelle Orazioni e ne' Proemi dei suoi Trattati, meglio, credo, che non sarebbe quando ne avesse data l'istoria per disteso, al che Attico lo consigliava male. E ne fu egli insigne attore; e fu tale uomo in cui venivano a far capo la prisca gente di quei Latini cui diede forma l'antica Roma, e tutto quel mondo già divenuto greco romano che osò chiamarci orbe della terra ed umano genere e che so io? Ingegno solo che fosse pari alla romana grandezza (come è sentenza di un antico); ingegno vario maravigliosamente, ma però animo egualmente vario, non mai raccolto né razionalmente in sé medesimo; siccome colui che in sé comprendeva quanto ebbe di proprio quella città che si fece a tutte (secondo la vecchia predizione) come il capo è alle altre membra, e insieme quanto ebbero portato da ultimo nella smisurata Roma il saper nuovo e le genti nuove, e quanto ella ebbe da sé prodotto al disfacimento suo con l'ingrassare e col distendersi. Estratto dall'Archivio Storico Italiano. Nuova Serie, tomo XI, parte 2, 1860. Attorno alla "console" Arpinate veggiamo poi muoversi figure vive tutti gli altri diversi attori del maggior dramma e il più magnifico e il più tristo che abbia offerto l'umanità: di questi, pochi staranno più in alto di Marco Tullio quanto all' animo, nessuno poi quanto all' intelletto, se pure ne toglie quel fatale Giulio Cesare; forti i malvagi, i distruggitori. Ma in questi pure la conseguente, la necessaria derivazione di quanto in Roma ne' suoi migliori tempi o fu, o parve, o si chiamò virtù, della quale ritenevano anche da ultimo tuttavia ed in sé mostrano qualche impronta: intanto che gli uomini di quella parte cui si innestava Tullio ed amava farsi patrono e mantenitore, ne rappresentano quali fossero le antiche cime della repubblica sempre ambiziosa e parteggiante; cosicché dentro alle scritture ed alla vita di Cicerone quasi ti paiono condensarsi le tradizioni di tutta Roma fino a quell' ultimo svolgimento, dove principia la dissoluzione: e in mezzo a tutti ecco spuntare col giovinetto che fu Augusto, il secolo nuovo, e come sentirsi vicina l' aura del cristianesimo. Senza il del quale, dove andasse il vecchio mondo chilo mi sa dire ? e fa paura il figurarselo. Un uomo che, pure a petto a molti dei romani (bisogna dire se ne intendesse), malediceva prima d'uccidersi a quella virtù della quale era stato seguace, e la chiamava un nome vano. In vari modi fu giudicata quella sentenza di Bruto, che poi divenne molto famosa; ma innanzi tutto parà a me che importasse bene intendere quale si fosse quella virtù. Rinnegava egli la virtù stoica, né gli bastava quella dottrina della forza, della astinenza, della costante dignità d'animo che ne ripone il pregio e la ricompensa nell'interno compiacimento; romano, voleva restaurare la repubblica, risuscitare la libertà, e moriva disperato: così a me sembra che in un punto solo quella sentenza di Marco Bruto condanni Roma e la filosofia stoica, i due sostegni del mondo antico. Da questa aveva egli bene appreso a darsi la morte, ma non a sentirsene morendo, beato come i più onesti dei filosofi e i più nobili promettevano. E cosa erano al tempo suo quella repubblica, quella libertà eh' egli aveva tolto a vendicare, facendo forza a sé medesimo, alla natura, agli affetti suoi? Non era uomo che di per sé corresse alle opere arrischiate, non ambizioso, non eccitato da forte impeto di passioni, costante e rigido più che animoso, meno atto a fare che a tollerare; esercitava accuratamente l'ufficio suo di pretore, deferente ed ossequioso al dittatore fino all'ultimo, quando le altrui suggestioni e il nome di re che udiva egli già sussurrare in casa di Cesare, destarono quella che a lui pareva coscienza di romano, di stoico, di Bruto. Senza la scena dei Lupercali e della corona, io dico Cesare non andava a morte: quella animò Cassio e gli altri cupidi di vendetta; e il famoso «Brute, dormi?» impegnò questi a mantenere anch'egli il voto del primo Bruto, «neque illum nec alieni quemquam regnare Hommo passibus meum». Vielavano pertanto l'uccidere Antonio, o che di lui non si degnasse, o che gli pareva, tolto via il tiranno, doversi da sé restaurare la libertà. Ma quando facevano ad esortare lo stesso Antonio fosse pago di tenere grado onorato in città. Aveva Bruto amato Cesare ed era amato da lui, ma io non credo gli fosse figlio. Se vero è ciò che narra Plutarco nella vita di Catone, gli amori tra Cesare e Servilia erano al tempo del consolato di Cicerone, e Bruto nacque più anni innanzi. Egli in una lettera, se deve credersi genuina (Epist. I, Bruti ad Cic.), dice non avrebbe tollerato la tirannia del proprio suo padre, se fosse questi tornato al mondo. Accenna qui al padre legittimo, e comunque di quelle parole si possano dare molte sottili interpretazioni, le credo scritte semplicemente, e che altro egli non sospettasse. Studi sopra le lettere di Cicerone. Libera (ad Familiar., 11. 3), costui (ci scommetto) all'esortazione sorrideva, lieto forse di vedere nei suoi nemici tale semplicità. In quanto a Cesare, ho per fermamente che andasse alla monarchia senza rispetti né veli; del che si hanno non lievi indizi, e maggiore d'altro la tempra dell'animo e tutta quanta la vita sua. Imperocché Cesare, nato all'impero se altri mai, volendo strumenti piuttosto che partigiani, ed ogni cosa tirando a sé, non s'innalzò come fece Mario insieme col popolo, né come Silla con gli ottimati: e questi, sebbene lo conoscessero audacissimo nei fatti suoi propri, e che sapeva tirare a fine qualunque cosa egli volesse, pure vegliandolo trasandato circa le cose della repubblica, non si inducevano a temere quanto sarebbe stato mestieri quel giovinastro indebitato e con la chioma bene acconcia, solito grattarsi il capo col dito. Tale fu Cesare gli anni primi, e poi nemmeno durante quello del Consolo non fece opera degna, come parendogli essere nulla finché non ebbe un esercito che fosse a lui tutto ubbidiente. Aggiungi, se vuoi, la schiatta divina in lui scesa da Enea troiano, la quale ambiva di celebrare egli dai fasti, e faceva Augusto cantare poi dai suoi poeti: del quale ancora noi sappiamo che egli ebbe in animo di riedificare Troia; forse che in mente gli balenasse di già il pensiero di Costantino? Certo, che assumere il nome regio Augusto e Cesare non potevano, ove non dessero alla monarchia le forme e l'abito orientali, cose ai Romani allora e poi odiose molto ed intollerabili. Plutarco narra di un partito che intorno a Cesare si vociferava: fosse re nelle province (forse in Oriente, di quello stato che divisava egli torre ai Parti), ma in Da quella idea potrebbe avere Augusto tolta la divisione fatta da lui dello stato, che parte andarono come imperiali sotto all'amministrazione sua, parte rimasero al senato: Augusto prendeva per il so Egitto, siccome acquisto fatto da lui. Studi sopra le lettere di Cicerone. Roma nulla si rinnovasse. Io già non credo volesse Cesare porre in senato alle idi di marzo un partito cosiffatto : ma tengo pur questa per una di quelle dicerie che dal biografo Chiclonese a noi furono tramandate, le quali dove anche fossero vane ed insistenti, hanno valore per ciò appunto che esse correvano ai tempi loro ; danno l'istoria del pensiero, dei sentimenti, delle opinioni, che è fondamento a quella dei fatti. Aveva un impero tanto diviso e tanto vasto, necessità di un padrone, perchè tra molti padroni armati non è che guerra e sedizione, ed agli inermi non si ubbidiva : importava che gli eserciti, col riconoscere un capo solo, appartenessero allo stato ; e non più i regni e le città fossero preda e patrimoni o clientele di pochi prepotenti cittadini, incapaci di portare il peso delle ricchezze loro, fatte oramai troppo eccessive. In questa Roma, caduta sotto la sua propria grandezza (nec se Boma ferens), e dove a molti più non giovava la libertà senza civil guerra (et inutilis hellum), città in vendita da più anni, ed ora per ultimo venduta a Cesare da un tribuno (semel eminesimes vixi), Mi vendidit urbem; in questa Roma gli ordinamenti, i quali spettano al civile consorzio, e fanno il sangue delle nazioni, erano canoni di sapienza e bene spesso anche di equità; cosicché sempre meno per le leggi che per i vizi si tribolava anche ad impero già invecchiato e sotto i pessimi imperatori. Di che ebbe merito il secondo Cesare, col mantenere nel principato le forme e i nomi della repubblica (eadem magistratum, vocata), ma fu ventura e non virtù sua; ed al primo fu tra le molte felicità d'Augusto principale quella d'avere incontro M. Antonio, il quale lasciando a lui la parte più ragionevole e la migliore e la più sana, gli fece bel bello cadere in mano l'impero con grande consenso del nome latino, e quasi fosse egli conservatore della repubblica: "Une Augustulus regens Italos in proelia ducat"; Cum philiria populoque penitus et majus sicut hic opes barbarica variaque Antonica unius etc. Il che non fu solo ad Azio, ma cominciò subito dopo la morte del dittatore; superocchio Antonio, essendosi posto... STUDI SOPRA LE LETTERE DI CICERONE. 35 forse era impossibile, che aveva incontrato maggiori ostacoli fin dagli stessi suoi partigiani, crescenti secche nella repubblica ed ambiziosi per sé medesimi. Tra lui erano ed il senato offese gravi e guerra a morte (incensus senatui, etc.); ed a Perugia i suoi soldati ebbero a capo di quanti erano uomini perduti e della feccia di Roma, Ottavio allora quasi imberbe, in guerra pauroso, in pace guardingo e temperato, facendo suoi i veterani di Giulio Cesare si accostò invece al senato e ai bisognosi di un quieto vivere, dei quali la parte infine prevalse ed assicurò gli imperi lunghi. Crudele talvolta, violento non mai, e felicissimo commediante dal primo all'ultimo della vita, gli venne fatto che della stessa scelleratissima proscrizione avesse Antonio il maggiore odio; e Augusto poi si piaceva dare (il che pur fece anche Antonio stesso) onori e gradi a quei fortunati che sfuggiti erano al macello. Per questo apparve egli mansueto, e poté usare modi più agevoli, e mantenere nel principato alcune forme della repubblica, perchè non era chi resistesse; la libertà già essendo spenta nel breve ed ultimo suo conato, e spenti insieme gli ambiziosi che si opponevano a G. Cesare, e quelli ancora che lo favoreggiarono. Non ebbe Augusto fazioni suoi o partigiani di qualche polo e che potessero dargli ombra, eccetto Agrippa e Mecenate; ma il primo di questi e forse entrambi secoli vivevano ignoti ancora in Apollonia, dove era Ottavio andato a scuola, e secoli poi venuti a Roma, da lui ebbero tutta la grandezza loro. Bastavagli sola la cautela delle arti sue, avendo egli per sé l'Italia, e contro quasi un re asiatico di maggior cuore ma dissennato, e una regina che minacciava pazze mine al Campidoglio, e ai Romani metteva in forse "an milium, ne nostra quidem, matrona teneret." E questo pure gli fece Antonio: col dividere l'imperio secoli per dodici anni, fece che Ottavio fosse condotto ad accontentarsi del nome di principe, tirando a sé le giurisdizioni degli antichi magistrati piuttostoché abolirli, donde si venne gradualmente a consolidare quella forma di monarchia temperata dalle apparenze cittadine, che durò poi fino a Diocleziano. Certo, che molte difficoltà nei primi anni lo impacciavano; ma quel pensiero ch'egli ebbe forse di rinunciare il principato, non poteva essere che una gherminella, perciò i Romani impauriti subito poi glielo rendissero con altre forme più assolute. Nel tempo stesso aveva in animo di rinnalzare l'antica Troia; io per me credo due segni ambedue mirassero allo stesso termine, cui Mecenate si contrappose, l'uno oppugnando svelatamente (come abbiamo da Dione), e contro l'altro facendo correre per tutta Roma i versi fatidici del cliente Venosino (Horat., Od. 3, 1. 3). Aggiungi, se vuoi, un altro verso che non mi pare sia posto a caso nel proemio delle Georgiche: "Nec tu regnandi venia tam dire cupido;" e aggiungi che Ottavio da prima voleva pigliare il nome di Romolo, dipoi mutato in quello d'Augusto a persuasione di Minuzio Fianco; questi e Pollione i soli notati tra gli aderenti al nuovo principe che fossero stati in qualcho grado della repubblica; non volevano costoro un re, benché accettassero un padrone. 36 STUDI SOPRA LE LETTERE DI CICERONE. comando d'ammazzare innanzi tutto i senatori. Ma nel senato era la repubblica; e questa io non so invero che Antonio amasse molto appassionatamente; pure spiaceva a Dolabella, spiaceva forse ad Antonio stesso le cose andassero troppo innanzi; laonde Cesare, benché gli sapesse pingui e corrotti i bisognosi, pure gli aveva ambedue sospetti; e tra Napoli e Pozzuoli occorrendogli passare dinanzi a una villa che apparteneva a Dolabella, tutta la guardia degli armati che aveva seco, facevano ala a destra e a sinistra, e si stringeva attorno a lui (Ad Attic, 13, 52). E lo stesso Dolabella scrivendo a Tullio, vorrebbe pur sempre che una repubblica vi fosse: "ma Tullio in più luoghi, mentre era vivo Pompeo, suole esprimere a questo modo come egli giudichi le future sorti: Vincitori non so quale repubblica avremo noi, ma vinti nessuna. Ma benché molte contro Cesare privata e pubblica animosità dessero causa alla sua morte, non fu già pretta servilità né adulazione dei congiurati e meno ancora dei provinciali, l'attribuire a divino castigo la mala fine che tutti fecero degli uccisori del grande uomo. Hanno un bel dire certe dottrine, ma la coscienza del genere umano insorge contro all'assassinio; e vero poi che in Giulio Cesare la grande altezza dell'intelletto andava sino alla benevolenza, come in lui fosse dotata. In flammis vestat manus, monstratque senatum, Scit cruor imperii quo sit, quae viscera legum; Unci et stat Romam, libertas ultima mundi Quo usque litat fericunda loco. (Lucano.) Che Antonio console, nei Lupercali correndo in lode, offrisse a Cesare il diadema, io so spiegare in due modi soli: o era ubriaco da non sapere quel che si facesse, o aveva quel giorno speranza che Cesare lui nominasse a successore, del che ci resta qualche indizio. E conviene dire lo stesso Cesare che permetteva quel sozzo gioco, fosse ebbro o l'orgoglio e nel dispregio della umana razza. Reliquum est, ubi nunc est res publica ibi simus, potius quam dum illum veterem sequamur, simus inulta. (ad Familiar., 9, 9). Ciò anche fu detto di tutti coloro i quali erano stati causa della morte di Virginia: manesque Virginia, per totas domos variate, nullo relieto sono quieverunt. (Tito Livio). Meglio di Virginia che non di Cesare, ma ho caro lo abbiano detto di ambedue. STUDI SU PERA LE LETTERE DI CICERONE. 37 dell'animo. Periva in tempo egli per la fama sua; intanto che gli atti e le leggi pubblicate nel suo nome, sebbene fossera a disfacimento della politica sincerità di Roma, spesso frenavano ingiustizie legalmente consacrate, e con esso estendere le cittadinanze anche tra i popoli soggiogati, pure accennavano a un qualche poco alla civile egualità, e a molti erano benefici; si prepararono all'Italia soltanto allora anche per le leggi, quelli che sono suoi confini. Queste cose erano a sovvertimento degli antichi ordini dello Stato, dei quali era anima un principio solo; spettarsi a Roma la libertà, e il dominio del servo mondo. Laonde parve a Cicerone intollerabile cosa che per gli atti di Cesare Antonio ai Siciliani concessa la romana cittadinanza; gli fosse bastato il farli partecipi di quella inferiore condizione in cui vivevano i Latini, era anche troppo, a dire di Tullio; e forse dovettero i popoli di Sicilia comprare quegli atti da Fulvia e da Antonio a suono di moneta, come solevano i comuni le estraneità nel medioevo. Qui stava il nodo della contesa che il patriziato ebbe con la plebe sin dal principio della repubblica, poi coi Latini, e che da ultimo tutto l'impero ebbe contro a Roma. Avevano i Gracchi tentato comporre quando era tempo di questa lotta, la quale poi crebbe a dismisura per le conquiste degli ultimi anni, scena inesauribile alle cupidigie: se i Gracchi vincevano, il campo era tolto a Mario e a Silla, e forse a Cesare meno acconcio; ma Roma (credo) non adempieva i suoi destini, più equilibrata dentro sé stessa, e meno valida contro alle altre genti. Era contesa di proprietà più ancora che di voto nei comizi; laonde si vedono per tutto il corso della repubblica i patrizi contrastare qualunque nuova assegnazione o divisione in pro della 38 STUDI SOPRA LE LETTERE DI CICERONE.
| 13,016 |
95be3425afd7e6632f71abadeee82567
|
French Open Data
|
Open Government
|
Various open data
| null |
elysee-module-6480-fr.pdf
|
elysee.fr
|
French
|
Spoken
| 2,052 | 3,268 |
8 mars 1987 - Seul le prononcé fait foi
Télécharger le .pdf
Interview de M. François Mitterrand,
Président de la République, accordée à la
télévision espagnole le 8 mars 1987, sur
l'instauration d'un sommet franco-espagnol
dans le cadre de l'entrée de l'Espagne dans
la CEE.
QUESTION.- La visite que vous allez organiser à Madrid est en quelque sorte historique, car c'est
la première fois que les deux pays vont avoir une réunion commune présidée pour le chef de
l'Etat français chez le chef du gouvernement espagnol. Pensez-vous que cette réunion soit
l'équivalent de celle que vous avez avec l'Allemagne fédérale, le Royaume-Uni et l'Italie ?
- LE PRESIDENT.- C'est fait pour cela. Si j'ai tenu à ce que ce type de relations s'établisse entre
l'Espagne et la France, c'est parce que je pensais que maintenant que l'Espagne est dans la
Communauté, il n'y a pas de raison que nous agissions différemment qu'avec l'Allemagne, la
Grande-Bretagne et l'Italie.
- QUESTION.- Vous êtes, sans doute, une des personnes qui a fait le plus pour l'entrée de
l'Espagne dans la Communauté `CEE`. Pensez-vous que votre pays a compris votre attitude ou,
qu'au contraire, qu'il y a beaucoup de Français qui pensent encore qu'il s'agit d'une erreur au
sujet des agriculteurs et des pêcheurs français ?
- LE PRESIDENT.- Je n'ai pas d'instrument pour mesurer cela. Je pense que si cet instrument
s'exerçait, on constaterait que la majorité des Français approuvent la présence de l'Espagne dans
la Communauté. Bien entendu, il y a des intérêts contradictoires en jeu. Au total, la France se
trouve, grâce à cette adhésion, recentrée en Europe. Il y a désormais un prolongement de
l'Europe au-delà des Pyrénées vers un grand peuple, un grand pays actif qui travaille et qui
produit beaucoup. C'est pour la France, puisque vous me parlez de l'opinion française, un
débouché qui peut être important. Cela dépend des Français que de savoir organiser leur
présence concurrement à celle des autres pays qui ont tout naturellement vocation à traiter avec
l'Espagne. Mais si l'on veut dépasser cet aspect purement mercantile qui n'est pas négligeable, la
présence de l'Espagne donne une signification historique et culturelle, une dimension
considérable que les Français ressentent. Ce n'était pas normal qu'il y ait une Europe sans
l'Espagne. Et j'ajoute que, par -rapport au poids des pays du nord de l'Europe, cette présence
paraît garantir un très juste équilibre.\
QUESTION.- Il est évident, monsieur le Président, que pendant votre septennat les relations
France - Espagne ont choisi le même ... à tous les niveaux. Pensez-vous que ce sentiment soit en
rapport avec votre victoire et celle des socialistes en France et la victoire des socialistes en
Espagne ?
- LE PRESIDENT.- Cela n'est pas négligeable mais enfin, ce n'est pas la seule explication. Vous
me dites que ces relations ont changé de -nature : j'ai pu le constater moi-même, car lors de mon
premier voyage en Espagne, si j'ai été fort bien accueilli par les responsables politiques, d'abord
par le Roi, par le Premier ministre, M. Calvo-Sotelo, par les dirigeants politiques de toutes les
organisations, en revanche, la presse, les journaux et donc une partie de l'opinion publique
étaient extrêmement exaspérés contre la France. Peut-être y a-t-il une donnée permanente de
rivalité entre deux peuples voisins, cela existe ailleurs. Mais, je pense que cela était dû au fait que
la France apparaissait souvent injustement comme l'obstacle à l'entrée de l'Espagne dans la
la France apparaissait souvent injustement comme l'obstacle à l'entrée de l'Espagne dans la
Communauté européenne et la France donnait le sentiment - peut-être n'était-ce pas non plus
tout à fait juste - de servir d'asile ou de refuge pour les relances terroristes surtout du côté
basque. Alors, j'avais le sentiment que la France ne se comportait pas d'une façon amicale. Je
répète, ce jugement mériterait d'être nuancé, mais c'était comme cela que les gens réagissaient.
De leur côté, les Français ne marquaient pas toujours un empressement suffisant pour faciliter ce
rétablissement de bonnes relations avec l'Espagne. Alors, j'ai décidé de changer cela et, en effet,
lorsque j'ai présidé la Communauté en 1984, j'ai fait dessiner l'élargissement, que j'ai suivi un
peu plus tard à Dublin et qui est entré en jeu, comme vous le savez, le 1er janvier 1986. J'ai
réalisé les premiers accords pour que tous les actes de terrorisme en Espagne qui tombaient sous
le coup des lois espagnoles, même si les auteurs de ces attentats ou les personnes suspectes de
l'être se réfugiaient en France, soient soumis à la justice espagnole. C'est pourquoi j'ai décidé
certaines extraditions qui ont été les premières d'une plus longue série.\
QUESTION.- En parlant du terrorisme, vous avez dit cette fois, monsieur le Président, qu'il fallait
être très ferme avec les terroristes, et vous avez ajouté que vous n'avez jamais signé l'amnistie
d'un terroriste. Le tout récent cas de M. Abdallah a été suivi avec intérêt dans notre pays,
permettez-moi de vous demander, monsieur le Président, si, sachant qu'il y a des otages français
au Liban, vous n'irez jamais jusqu'à accorder la grâce ?
- LE PRESIDENT.- L'amnistie pour parler du premier sujet que vous avez traité, a fait l'objet
d'une récente polémique en France. Une amnistie - celle qui a été faite par M. Pompidou, celle
qui a été faite par M. Giscard d'Estaing, lorsqu'ils ont été élus - c'est rituel, c'est traditionnel dans
notre vie française. Tout nouveau chef de l'Etat prend certaines mesures de bienveillance. Et
celles que j'ai décidées moi-même et que le Parlement a dû voter en 1981, étaient du même
ordre, répondaient aux mêmes critères et les criminels - ceux qui étaient responsables de crimes
de sang, qui avaient provoqué des blessures, des graves dommages à d'autres personnes - ont
toujours été exclus de ces amnisties. Seules les personnes jugées coupables de contraventions
c'est-à-dire les plus petites fautes passibles des plus petites peines, et de délits qui pouvaient
conduire jusqu'à six mois de prison avec sursis ou quinze mois de prison réels, seules ces
personnes jugées coupables pouvaient être relâchées : c'est-à-dire qu'aucun terroriste n'a été
amnistié £ c'est stupide de penser cela. Il y en a un qui n'était pas encore criminel, qui l'est
devenu depuis. Cela ne pouvait pas être prévu.
- Vous me parlez du cas d'Ibrahim Abdallah. Il a été condamné par la justice de mon pays à une
détention perpétuelle £ c'est donc qu'il a été jugé coupable d'attentats qui ont provoqué la mort
de Français ou bien des blessures ou des incapacités graves. C'est à la justice de se prononcer.
Certes, je dispose du droit de grâce. Jusqu'ici, je n'en ai jamais usé. J'ai bien dit, il y a quelques
mois, que si j'avais pu obtenir que l'on restituât à la France la totalité des otages détenus
actuellement au Liban, j'envisagerais - si le gouvernement de la République me le demandait une grâce. Pas deux, pas trois, pas quatre, pas cinq : une grâce. Cette ouverture n'a pas été
saisie, elle est donc maintenant derrière nous. Le problème d'Ibrahim Abdallah n'a pas été posé,
n'est pas posé, et ne le sera pas, j'imagine, en tout cas d'ici longtemps.
- QUESTION.- Vous savez que le Président du gouvernement espagnol a déclaré plusieurs fois
qu'il fallait la coopération internationale dans la lutte contre le terrorisme, comment peut-on
articuler ces luttes dans les relations européennes et même dans la scène du Marché commun ?
- LE PRESIDENT.- Ceux qui disent cela en Espagne ont raison, comme ceux qui le disent en
France. Puisque le terrorisme est international, il est normal que la répression, la recherche, la
prévention, les sanctions soient internationales. Il faut plus de solidarité entre les pays de la
Communauté. J'ai donné mon accord pour que des organismes de police, des services de
renseignements, des services d'action de toute sorte puissent agir en commun, s'informer en
commun £ de la même façon - la pratique du terrorisme en Espagne `ETA militaire` l'a montré,
nous en avons parlé il y a un moment - j'ai facilité l'action de la justice espagnole.\
QUESTION.- Puisque nous parlons de l'Europe, monsieur le Président, vous avez dit récemment,
la France est votre patrie et que l'Europe est l'avenir, pensez-vous qu'un jour il y aura un état
européen souverain ou croyez-vous plutôt que les nationalismes empêchent ce processus d'union
?
?
- LE PRESIDENT.- Les nationalismes devront s'incliner. L'esprit patriotique devra survivre et cela
devrait permettre un jour la création d'une Europe unifiée. Je ne pense pas que l'on puisse
penser d'ici longtemps à l'existence d'un Etat souverain, je pense que l'on peut imaginer un
certain nombre de formules transitoires mais importantes qui permettront à l'Europe d'exprimer
une volonté politique délibérée des Douze, une volonté politique, comme il y a, tout de même,
une volonté économique et une volonté commerciale, une volonté technologique aussi, bien
qu'insuffisante. Mais si sur le -plan technologique, sur le -plan commercial, sur le -plan agricole
les choses ne vont pas assez bien, c'est parce qu'il n'y a pas assez de volonté politique. Il faut
donc maintenant s'atteler à ce problème. Bien entendu, personnellement, je souhaite que
l'Europe se dote de structures étatiques. Il ne sera pas concevable, alors, que l'Europe renforcée
n'examine pas le problème de sa propre défense.\
QUESTION.- Mikhail Gorbatchev a fait des propositions concrètes sur les armements. Comme
vous savez, M. Felipe Gonzales vient d'annonçer que l'Espagne allait signer le traité de non
prolifération d'armes nucléaires. Vous-même avez répondu en gros à M. Gorbatchev que vous
étiez d'accord avec ses propositions mais qu'elles n'affectent pas la France.
- LE PRESIDENT.- Je suis d'accord avec l'ouverture de négociations pour la disparition des forces
nucléaires intermédiaires de longue et de courte portée £ et j'attends de connaître le résultat de
cette négociation à laquelle ne participent que les Etats-Unis d'Amérique et l'Union soviétique
pour savoir ce que j'en penserai.
- QUESTION.- Mais vous parlerez à Madrid des euromissiles ?
- LE PRESIDENT.- Je ne vois pas pourquoi on n'en parlerait pas. Il est normal que l'Espagne et la
France traitent de tous les sujets qui touchent à leur sécurité.\
QUESTION.- Pour finir, monsieur le président, l'histoire montre que nos pays se sont méconnus,
ignorés, enviés pendant des siècles. Votre visite à Madrid en tant que Président d'une délégation
qui inclut le Premier ministre pourrait-elle constituer le début de la fin ou faudra-t-il expliquer avec
plus de détails aux Français et aux Espagnols que ni les uns ni les autres ne sont aussi méchants
?
- LE PRESIDENT.- Je crois que l'on a déjà commencé ce très bon travail, que la réconciliation est
faite. Mais je crois, et vous avez raison de le dire, que nous avons encore besoin de beaucoup
d'explications pour que cela aille jusqu'au fond de notre peuple, que cela touche tous les milieux,
et que l'amitié devienne instinctive et pas simplement raisonnée. A cet égard, vous m'avez posé
une question tout à l'heure, en me demandant si l'existence de ce gouvernement socialiste a
facilité les choses. Avant l'existence d'un gouvernement socialiste, on avait déjà commencé, en
disant cela, je ne fais que rendre justice aux autorités de l'époque. Mais c'est vrai qu'avec M.
Felipe Gonzales et son gouvernement, en raison des relations personnelles déjà très anciennes
que nous avions, s'est établi un dialogue direct, une facilité, une confiance, qui a permis de
développer ce qui avait été commencé auparavant. Je compte beaucoup sur cette situation pour
que l'explication en Espagne et l'explication en France permette à ces deux peuples de se
comprendre mieux. J'ajoute que le rôle du Roi d'Espagne `Juan Carlos` a été très utile parce
qu'il a montré en toutes circonstances une capacité à comprendre la nécessité de l'Europe. Alors,
tout cela réuni fait qu'aujourd'hui je suis optimiste. Et je me réjouis de ma visite à Madrid dans
des circonstances tout à fait officielles en réponse à la visite d'Etat que le Roi d'Espagne a bien
voulu faire en France il y a plus d'un an, visite à l'occasion de laquelle a été signé un pacte
d'amitié entre l'Espagne et la France. Eh bien moi, je viens souscrire une fois de plus, par ma
présence à Madrid avec plusieurs membres du gouvernement, à cette tâche historique qui
consiste à rendre justice du côté Français au grand peuple espagnol que je tiens à saluer grâce à
vous par cette émission.\
| 34,127 |
<urn:uuid:ace6fd5c-0b11-4f0e-ba2c-6b65fbbba43a>
|
French Open Data
|
Open Government
|
Various open data
| null |
https://www.ina.fr/ina-eclaire-actu/audio/phd86072666/match-de-boxe-opposant-cassius-clay-a-cleveland-williams
|
ina.fr
|
French
|
Spoken
| 58 | 97 |
Match de boxe opposant Cassius CLAY à Cleveland Williams
Championnat du monde de boxe. Match de boxe opposant Cassius CLAY à Cleveland WILLIAMS.
Reportage de Jacques SALLEBERTEN direct de Houston opposant des deux poids lourds : Cassius CLAY (champion du monde 65) à Cleveland WILLIAMS. A la troisième reprise, Cassius CLAY est déclaré vainqueur par arrêt de l'arbitre.
| 51,004 |
CHP/1893/CHP_18930512/MM_01/0004.xml_1
|
NewZealand-PD-Newspapers
|
Open Culture
|
Public Domain
| 1,893 |
None
|
None
|
English
|
Spoken
| 4,465 | 6,540 |
The Press. FRIDAY, MAY 12, 1893. THE BANKING OF THE WORLD. In yesterday's issue we showed that banking operations are to a very large extent based on credit, depositors trusting the Banks with their capital and the banks trusting their borrowing customers with the use of the money at a higher rate of interest. But an essential feature of all banking business is that the Bank should always be in a position to meet all demands made upon it for coin, these demands are made. In times of ordinary security this is met by the Banks holding a reserve of coin and bullion which experience has shown to be equal to all the ordinary demands made upon them. At such times deposits will be daily maturing, and in some cases being withdrawn. On the other hand, other deposits will be coming in, so that banks under such circumstances have no difficulty in discharging their obligations as they arise. It depends on local circumstances what the proportion of coin to liabilities should be; the principle being that there must always be in the banks' coffers as much money as there is the least likelihood of being called for by depositors. In Australia the coin reserve of the banks usually stands about £20,000,000— it was £20,828,743 on December 31st last. In other countries the reserve is regulated by the facility with which securities can be converted into cash. In England many of the banks hold their reserve largely in Government stocks, which can always be turned into cash, and which of course give some return to the Bank at the same time. When we come to look at the specie reserves of the Banks of all nations, we realize what a comparatively small amount of reserve capital is needed to transact the enormous business of the world, and how largely, as we have said, the business of banking rests upon the basis of confidence and credit. At the end of 1889 the specie reserves of all the Banks in the United States were £20,000,000— it was £20,828,743 on December 31st last. world was only put down at £367,900,000, and of that amount, notwithstanding the enormous trade she does, the Kingdom only held £28,000,000. The figures are as follows:— Specie held by Banks. & United Kingdom. 28,000,000 France....., 101,000,000 Germany...... 59,000,000 Russia...... 33,000,000 Austria...... 21,500,000 Italy...... 14,000,000 Spain...... 9,500,000 Sweden... But neither the Bank reserves nor the general currency represents in any degree the extent of the financial operations of the commercial and trading world. The records of the London Clearing House alone show figures which the ordinary reader will hardly pretend to grasp, reaching in one year to as much as £6,500,000,000, and as the same system prevails all over England, the Continent, and the United States, the aggregate figures rise to amounts bewildering in their magnitude. The Clearing House returns of twenty-six cities of the United States in 1889 were as follows: — United States £11,580,000,000 Berlin... 3,780,000,000 Paris 2,200,000,000 London 6,500,000,000 And if the figures for all the great commercial centers of the United Kingdom were given, they would probably exceed those even of the United States, -with her 60,000,000 people. Miss Ellen Chennells, Life in the who was English governess Harem, of the Egyptian Princess Zcyneb, and in that capacity lived for five years at the Court of her father, the Khedive Ismail, has just published a volume of her "Recollections," in which she gives an extremely interesting account of what life in a harem really means. She sweeps away nearly all the romance with which, poets and other imaginative writers have invested the seraglios of Eastern potentates, but, on the other hand, she shows that the inmates, as a rule, are contented with their lob, and have no particular desire to exchange it for a life of greater freedom. Miss Chennells saw the institution from the inside. Her impressions, therefore, differ largely from those of lady travellers who have been admitted to the harems on what may be termed show days. Then the magnificent dresses, the splendid apartments, the flashing of jewels, the open coucts with the feathery palms and the sound of falling waters, all produce a delightful effect. That is the bright side of the picture. On ordinary days, however, life in the harem must be dreary in the extreme. You are struck, Miss Chennells tells us, with the entire absence of anything to promote amusement or mental occupation. There are no books, music, or any little feminine occupation lying about. The windows may look out on a garden, but there is sure to be a high wall which shuts out all outer life. At the theatre, the wife of a Khedive sits in a box, the whole front of which is covered with a fine network of iron painted white with flowers in gold. It is a gilded cage with this special quality about it that although the bird can see something of what is going on outside, nobody can see the bird. Going to Constantinople for the first time, Miss Chenelle naturally wanted to enjoy the lovely view, but was told no woman could be allowed to chow herself on deck. She went into the chief saloon, and just as they were passing St. Sophia's outer shutters descended, and they were left in darkness. "There was no help for it," says the fair writer. Western housekeepers, domestic complain of the "Servant-Discomfort," galaise they have to pat with, but even. Eastern despots, it would appear, are powerless to secure discipline and neatness in their own households. The Egyptian slaves' idea of sweeping a room, Miss Chennella tells us, was to make a great dust, get all the sweepings into a corner, and then tuck them under the carpet; their notion of making a bed was to turn down the sheet, dust it with a feather broom with which they had previously dusted the furniture, and then cover it up again. After this they would empty her bath end basin out of the window, take her sponge or towels to wipe up any slop they might make, and having devoted perhaps five minutes to the entire performance, Mohammed would triumphantly inform her that her room was "finish"! There was the greatest irregularity in serving meals, and what the authoress evidently felt the most trying of all, an utter lack of privacy. The first night of her stay in the harem she never closed her eyes, partly on account of the novelty of her position, partly on account of a high wind and the incessant slamming of a door in the courtyard below, which was like a series of thunder claps. One day, the lieat being very great, the authoress took a bath. She had been furnished with a key for the outer door, which would look on the outside, but not on the inside. She therefore usually fas tened it with a string, and on this present occasion had just got out of the bath and put on a dressing flOWfl when she was startled by a vigorous kick which burst the door open in a moment, and two eunuchs entered the room. She adds :—- They did not appear in the least disturbed at my appearance, or to consider their visit ill-timed, but one of them who spoke a little English told me that his father wished to know how many boxes I had. Mr. Hauby Fueniss in his The First notes in the St. James's Crinoline Gazette gives a doleful account of the sad experiences which befell an audacious lady— supposed to be Mrs. John Strange Winter—who ventured down Regent Street the other day claim in a crinoline— combined, of course, with the usual dress of the period. A crowd speedily collected to witness the unwonted spectacle, and the lady realizing that she had made a fatal mistake took refuge in a shop. In a short time such a mob had collected outside that she was politely requested to move on, which she did amid laughter. What eubsequiously happened to this unfortunate person is thus told by Mr. Furniss: "She peeped surreptitiously at a hansom; but one glance was sufficient to show her that inference to that was quite impossible. She then made for a 'bus at the corner of Oxford circus; where she was informed by the grinning conductor that it was full inside, but that there was plenty of room on top. It is needless to say that it was quite out of the question for her to squeeze up the narrow stairway, and I venture to predict that this very fact will be one of the chief factors in preventing that abomination the crinoline from ever becoming general again. At the period when the crinoline was in the height of fashion ladies never dreamt of riding on the top of a 'bus; but now it is a great source of delight to them, and even fashion has to give way sometimes when it clashes with feminine enjoyment. After the 'bus incident I was unable to follow the career of the crinoline, as I had to go the House." Think twice before they go in for crinoline after all. CLIPPINGS. A charwoman at the Manchester Assizes recovered £43500 damages from the North Western Railway Company for the loss of an eye. While walking near the railway some sparks from an engine entered her eye, causing blindness. The Company intend appealing against the judgment. A Bishop whose emoluments are considerably under £400 a year. Such is the present position of Dr. Carter, Bishop of Zululand, who finds himself unable to supply even the modest needs of South African episcopal life on this. An attempt is being made to ensure him a fixed £450, wherewith he will endeavour to sustain the dignity of his office in comparative splendour. Dr. Carter has an exceedingly good "record" as Eton Missioner at Hackney, and has acquitted himself with great credit during the time in which he has occupied his present arduous and responsible post. M. Brandicourte, of the French Linnean Society, has published a curious account of certain plants which have become extinct, or nearly so. He names the eucalyptus alpina, once a common denizen of the heights of Mount William, Australia, now known to the world from one single specimen in the botanical gardens at Melbourne; the Psiadia rotundifolia, a native of St. Helena, which also owns but one representative in its wild state, besides a few cultivated ad herents in the gardens at Kow; the Obamre rops humiliis, or dwarf palm of Nice, which has perished from off the face of the earth; and lastly the orchid Spiranthes Romanzio viona, which flourished once in a single Irish meadow, but has disappeared for ever. It is sad that the love of the amateur and the science of the horticulturist should be solely responsible for this destruction of the species they profess to foster. — Pail Mall Gazette. A curious instance of the exciting effect produced upon bluejackets, even in munition warfare, is found in the report of the umpires of the last Naval Manoeuvres, now presented to both Houses of Parliament by Her Majesty's command. During an attack in Belfast, Lough, the feelings of both officers and men ran so high that Co avoid personal encounters, and probable loss of life, it was found necessary to restrain the action which might otherwise have been taken by the guardboats even duckig peace maneuvers. In one case, it was found necessary to remember, "a small boat was sunk by a collision with a hostile steam launch, when, after rescuing the crew, beat a hasty retreat. But witen the captured bluejackets found that they were to be regarded as prisoners, they, to a man, jumped overboard and threw them about until a pursuing boat of their own side picked them up. Like true Britons, they determined they "ever, never, never would be slaves!" The English Council-General in Florence reports that co-operation is still in the ascendent in Italy in spite of occasional failures. The benefits, to be derived from federating the co-operative societies of the same district, and gradually extending the principle to larger areas, have been recognized and carried out in various localities. Meanwhile, the shopkeepers of some cities are also adopting the principle of union. Sir Dominic Colnagiti estimates that the total number of co-operative societies now existing exceeds three thousand. These are approximately divided into about one thousand co-operative dairies, five hundred, popular and rural banks, five hundred co-operative stores, five hundred associations of day laborers, and co-operative societies, agri cultural syndicates, and co-forth. In the spring of 1893, the fifth Congress of the Italian Co-operative Associations. Arrangements will be held at Genoa. A writer in the Home Journal has been giving expression to a man's opinion of women. Let us, my friends, he says, you of my own sex who may read these words and pick all the flaws we choose in women's and what good does it do. We always come back to her, and glad we are of the right time. I leave, too! Nervous? But yet how calm and steady when the right time comes! Illogical? But yet how certain the action, how unerring the instinct. With a judgment? But yet how certain her guidance! Never a L.i i. But what a helper! Timid? But yet how sweet a woman! Unsystematic? With what neat precision is marked, training of her children! Dressy? Yet how she can wear her gowns! Ready? Rarely for the theater, ever-ready with her sweet womanly pathy in a time of trouble. Fond of things? But yet how they become a person, her room, her house! Well, bless her, yes! But the cheap article for the money ever created! If long may we love her to brighten our homes, make wise our children, make men, than they are, and live the better worth living! And we'll love her, too, for the sake of our enemies she has made. I believe that the serving a record of the race language, and old New Zealand, the white field of labor of the West, would be a purely colony showing native names only. I would be a purely colony showing native names only. I would be of the greatest interest to the Native names and hand them on with any degree of purity. Every year past makes the task more difficult, as at all events in the southern portion of New Zealand, the natives are being fast forgotten, corrupted, or entirely lost, there being now only a remnant of the race living to whom on appeal could be made. Population of the Colony.—The estimated population of the colony on March 31st was—Males 348,670, females 307,609, total 656,179. The Maori population was so down at 41,993. The Martins at New Brighton The Committee of the Canterbury A. and P. Association have decided to telegraph to the Government and urge that the martini at New Brighton be at once placed upon the list of protected birds. False Alakm.—About eight o'clock last evening an alarm was given from the annunciator opposite Mr. W. Harris, home in Worcester street. The Brigades turned out but found no signs of a fire, or of the person who had given the alarm. Cakleton.—The Rev. X Meyeon, of the Free Methodist Church, Oxford, delivered an amusing and interesting lecture entitled "Tom O, Jacks" in the Carlton school room on Tuesday evening, May 9th, in a large audience. Mr. H. Seed presided. Industrial Association.—At a meeting of this body last night, a resolution was carried which supported the recommendation of a Parliamentary Committee being carried into law at regarded colonial ammunition, iron, machinery, and kauri timber. Collections of Grasses and Forage Plants.—A Wellington telegram states that the Minister of Agriculture offers prizes for collections of dried specimens of grasses and forage plants, introduced and native, prominence being given to the most useful indigenous species. The first prize is £25, the 2nd £15. Arrivals and Departures.—The immigration and emigration returns for April show, arrivals 2394, departures 1909. The arrivals were, from United Kingdom 289, New South Wales 108, Victoria 954, Tasmania 55, other places 38. The departures were, to the United Kingdom 325, Queen land 2, New South Wales 905, Victoria 511, Tasmania 66, other places 102. During the month seventeen Chinese arrived and seven departed. New Partnership.—We notice that Mr Geo. E. Way and Mr Thomas do Renzey Condell have entered into partnership, under the style of Jameson, Anderson & Co., and will carry on the business of the firm as formerly. Their business consists of that of tea merchants, general agents and accountants, and they represent the United Insurance Company and the New York Life Insurance Company. We wish the new firm every success. Oxford Presbyterian Church. —This Church held its annual congregational meeting on Wednesday night, the Rev. D. D. Rodger in the chair. The Treasurer, Mr Black, read the financial report for the past year, which was considered satisfactory. Mr Sayers read a report on the Sunday School which showed thirty on the roll with prospects of an increase. A hearty vote of thanks was accorded Miss Buchanan for the past services as organist. From the evidence of the child, parents and J. Coffey, who saw the accident, the deceased was knocked under a portable wharf forming part of a chaff cutting plant, and was drawn out from under the wheels of the chaff cutter by the lad Coffey. Dr. Cordner, who had examined the body, said that death was caused by the fracture of the base of the skull. In his opinion, neither of the wheels had passed over the body. The jury returned a verdict of "Accidental death," no blame being attached to a person. Honorary Reserve Corps.—The corps social match, adjourned from April 27th on account of the inclement weather, took place yesterday afternoon at the corpe radg®* at Cashmere. It was expected that a flood number of the younger members, and those who have had very little practice, would have attended. Capt. Harman had second prizes for the highest scorers among the Odd Fellows members, but on account of counter attractions in the country only two new members were turned in. Capt. Harman was in charge of the booth, and the following were the scores: R. Wakelin, 30 at 200 yds, 32 at 600 yds, and 27 at 600 yds. total 80; Cor. McKav, 27, 31, 25—83; H. Moore, 25, 29, 27—81; Sergt. Major Evans; 22, 27, 27 —76; Pte. Robertson, 25, 26, 20-701 hon. raem. Sanford, 27, 16, 17—60; Fitch, 23, 22, 10-86 1 Pte. Luimis, 21, 2, 17—40. Wx&x Christ Church School Committee —The monthly meeting of this Committee was held on Wednesday evening. Present —Messrs. J. W. Manning, Chairman; Messrs. F. W. Sandford, J. Venables, A. Bleach, J. Isblster, H. Curlett, and H. C. Thomas. Mesere Hart and Seager had offered to give their lecture to the children some Saturday afternoon, and it was agreed to accept their offer. The caretaker was allowed the usual assistance during the winter. Months. The Canterbury Women's Institute wrote on a constitution for the Committee upon Highways having inaugurated girls' swimming competitions and a field club in connection with the school. The Treasurer stated that he had received £18 6d half cost of fencing, and £1 for use of bath for swimming exhibition, also a cheque from the Swimming Club for £50 4e. and that the credit balance was £2 Id. Accounts amounting to £5 Uβ 6d were passed for payment. Another tender for the supply of fuel was that of Meeere W. Waste and Co., which, though higher than 6 years, it was decided to accept. Shortly before the close of the meeting, the Head Master sent word that Mr. W. Taylor, M. Head Master at Addington School, and for nearly five years and a half second Master at this school, had died that evening. THE PRESS, FRIDAY, MAY 12, 1893. 4 Great Britain... France Germany Russia Austria Italy Spain... Portugal... Scandinavia... Holland Belgium Switzerland... Turkey Gold. 102 178 122 39 8 22 19 9 6 5 11 3 17 Silver, j 22 150 45 14 19 11 24 2 2 13 11 3 12 Paper. 39 115 71 123 76 57 30 13 17 15 6 9 9 Total. 163 443 238 176 103 90 73 12 21 35 37 12 38 Total. 163 443 238 176 103 90 73 12 21 35 37 12 38 United States... Canada Australasia Japan China India Java Cape Colony... Egypt A Igeria Cuba Various 141 3 22 19 87 1 2 9 150 170 18 208 6 6 26 436 10 30 54 150 192 18 8 31 8 16 43 10 12 7 27 2 4 14 1 4 3 3 12 29 Grand Total.. I 790 801 I 846 2437 SPECIAL ANNOUNCEMENTS. IMPORTANT TO LADIES. FITO-DAY and Following Days we shall submit for Sale the following: EXTRAORDINARY LOTS, being Manufacturers Clearing Porchases, at SPECIAL PRICES, as follows:— LOT 1-LADIES' RUSSIAN DRIVING and TRAVELING CLOAKS, Fur educed and Silk-lined, in a great variety of new season materials and styles, with Empire and Toby Frillie, Watteau Pleats, &c., very choice-- Usual Prices, each 39s 6d, 59, ed, 6s 6d Special Prices, each 21s 6d, 35s 6d, 39s 6d LOT 2—LADIES' FUR-EDGED CLOAKS, Lined Silk and Italian Cloth in all leading shapes— Usual Pride, each 108 6d, 27s 6d, 89a 6d Special Prices, each 16s 6d, 26s 6d LOT 3-LADIES, NAVY and BLACK CRAVETTE WATERPROOF CLOAKS, new shapes with deep Cape and Silk-lined Taffeta— Usual Prices, each 29s 6d, 42s 6d Special Prices, each 18s 6d, 29s 6d LOT 4—55 LADIES' PATTERN CAPES, including Empire, Princess May, and other Latest Styles in Fancy Silk Matelasse and Cloth, With 52s 6d, 69s 6d, 75s 6d Special Prices, each 29s 6d, 425, 45s 6d, 47s 6d, 75s 6d Special Prices, each 29s 6d, 425, 45s 6d, 47s 6d, 75s 6d Special Prices, each 29s 6d, 425, 45s 6d, 47s 6d, 75s 6d Special Prices, each 29s 6d, 425, 45s 6d, 47s 6d, 75s 6d Special Prices, each 29s 6d, 425, 45s 6d, 47s 6d, 75s 6d Special Prices, each 29s 6d, 425, 45s 6d, 47s 6d, 75s 6d Special Prices, each 29s 6d, 425, 45s 6d, 47s 6d, 75s 6d Special Prices, each 29s 6d, 425, 45s 6d, 47s 6d, 75s 6d Special Prices, each 29s 6d, 425, 45s 6d, 47s 6d, 75s 6d Special Prices, each 29s 6d, 425, 45s 6d, 47s 6d, 75s 6d Special Prices, each 29s 6d, 425, 45s 6d, 47s 6d, 75s 6d Special Prices, each 29s 6d, 425, Aal Price, each 33s Gd Special Price, each 19s lid LOT 6-80 LADIES' FRENCH CLOAKS, in Newest Styles, with Detachable Circular Cape and Large Empire Sleeves- Usual Prices, each 55c to 105s Special Prices, each 35s 6d to 49s 6d LOT 7—S7 LADIES' GOOD TWEED ULSTERS— Usual Prices, each 14s Gd to 18s 6d Special Prices, each 8s lid to 13s 9d LOT 8-LADIES, DARK TWEED AND CLOTH COSTUMES, with Material for Bodice to correspond— Usual Prices, each -J9a 6d, 37s Cd, 45s Special prices, each 17s lid, 19s lid, 25s LOT 9—150 LADIES' SEAL PLUSH JACKETS in Newest Shapes- Special Prices, each 35a 6d, 39s 6d, 47s 6d, 57s 0d LOT 10-116 LADIES' KNITTED WOOL SKIRTS— Usual Prices, each 2s lid, 3s lid, 4s lid, 6s 6d Special Prices, each Is (id, 2s 6d, 3s lid, 4s lid, 6s 6d Special Prices, each Is (id, 2s 6d, 3s lid, 4s lid, 6s 6d. 7s lid Special Prices, each 3s lid, 4s lid "WE HAVE ALSO COMPLETED AN EXTRAORDINARY PURCHASE OF BLANKETS AND FLANNELS, And are now prepared to submit same at Special Prices, as follows: 120 PAIRS WHITE ENGLISH BLANKETS— Usual Prices per pair, 12s 6d, 14s 6d, 17s 6d, 22s 6d, 16s 6d. 1100 PAIRS of Ladies' Black and Colored Castor, Taffeta and Silk GLOVES; also Silk Gloves in Evening Shades, being Manatee taten. Samples, at about Half Prices. W. STRANGE AND CO. CONTINUED A' TO-DAY. SPECIAL SALE. 575 NEW WINTER ULSTERS, ALL SIZES, AT THE D. I. C. t. SPECIAL PURCHASE. STOCK. 19 BALES BLANKETS, &c. The Pleasure in Offering the GRANDEST LOT OF BLANKETS ever imported into New Zealand, at Prices that will Astonish Most Buyers. SPECIAL ANNOUNCEMENTS. CLOTHING AND MEN'S MERCY DEPARTMENT. J. BALLANTYNE AND CO. HAVE no hesitation in affirming that they have received for the WINTER'S TRADE the LARGEST AND BEST ASSORTMENTS they have ever shown in TWEED AND COATINGS, Special Patterns HATS AND SCARFS, the Latest SHIRTS AND BRACES in Great Variety, MACINTOSHES AND UMBRELLAS FOOTBALL CLOTHING EVERYTHING SEASONABLE FOR GENTS, UNDERWEAR, AND THE VERY BEST VALUE OBTAINABLE, WITH A CASH DISCOUNT OF ONE SHILLING IN THE POUND. UNDERSTABLE HOUSE, CHRIST CHURCH. "FIRE. FIRE. THE OF 150 LADIES' UNMADE WINTERS, SINGLE DRESS LENGTHS ONLY OF A PATTERN, At the following Job Prices:— 9s 11d, 12s 6d, 13s 6d, 14s 11d, 17s 6d, 21s. A few of these Goods are extraordinary value at the prices quoted, we anticipate an immediate clearance. One Shilling OF every Pound Discount for Cash. NOW READY, KIBKPATEIOK'S "X£" BRAND NEW SEASON 9 JAM. APRICOT CONSERVE In 21b nett Glass Jar, RED CURRANT JELLY In 21b nett Glass Jar, RED CURRANT JELLY In 21b nett Stone Jas S. KIEKPATRICK & CO., MANUFACTURERS, NELSON, 687 G. COATES AND CO., WATCHMAKERS, JEWELLERS, GOLD FILLERS, SILVERWARE, AND ELECTROPLARS, 218 COLOMBO STREET, Have in Stock a Large and Splendid Assortment of GOLD AND SILVER WATCHES, Gold and Diamond Rings, Brooches, Bracelets, &c. Sterling Silver and Silver-plated Goods Field Glasses, Optical Goods, &c, &c. Designs and Estimates Furnished and Special Arrangements made with Clubs and Presentation Committees. Country and Post Orders promptly attended. Sole Agents for LAZARUS' SPECIALITY SPECTACLES, Ensuring perfect fit and vision, SHEEP NETTING. THE ABB NOW OFFERING A STAPLE NETTING AT REDUCED PRICES. Special Prices for Large Quantities. EDWARD EEECE & SONS, WHOLESALE and RETAIL IRON MONGERS, COLOMBO STREET, CHRISTIAN CHURCH. NEW ZEALAND PURE, WOOL HOSIERY. A SPECIALITY. WE invite the attention of Gentlemen to our Large Stock of NEW ZEALAND MANUFACTURED HOSIERY, (Shirts, Pants, Half-nose, &c. The softness of finish, parity of wool, and warmth of these Goods, are much appreciated. In customers, and are rapidly finding favor with the public. In addition to our own make, we have stocked heavily in Mosgiel and other well-known local makes. Inspection invited. HALLENSTREET BROTHERS, NEW ZEALAND CLOTHING FACTORY, Christchurch. ALEX- LOWRY, Manager. MONEY A WAITING INVESTMENT in large or small amounts on APPROVED FRENCH BECUIFUTIOUS at Lowest Current Rates of Interest. No more to be had. COKER'S FAMILY HOTEL, CHRISTOPHER, N.Z. Five minutes' from Railway and Post Office 2715 THOMAS POPHAM, Proprietor.
| 32,697 |
https://stackoverflow.com/questions/69112313
|
StackExchange
|
Open Web
|
CC-By-SA
| 2,021 |
Stack Exchange
|
English
|
Spoken
| 153 | 279 |
Replace future months forecast with moving average python
I have a dataframe in pandas in the below format
Date Value
0 2006-01 17.45
1 2006-02 18.23
2 2006-04 16.79
3 2006-05 17.98
... ... ...
166 2019-11 37.89
167 2019-12 36.34
I want to forecast 5 year future values such that the forecasts are equal to the 10 year rolling average for that particular month.
For instance, the forecast value for 2020-01 will be the average of the past 10 years [2010, 2019] of January values.
Important thing to note is that for the forecast of 2021-01, the average should be calculated on data from [2011,2020] for January month i.e. the previous forecasted value for 2020-01 will be used as well.
Date Value
0 2020-01 15.6
1 2020-02 12.3
2 2020-04 14
3 2020-05 18
... ... ...
166 2025-11 37
167 2025-12 36
How can it be achieved efficiently in pandas?
Regards
| 28,697 |
|
6287556_1
|
Court Listener
|
Open Government
|
Public Domain
| 2,022 |
None
|
None
|
English
|
Spoken
| 5 | 13 |
Opinion
Per Curiam,
Order affirmed.
| 47,033 |
sn88067047_1946-01-11_1_1_1
|
US-PD-Newspapers
|
Open Culture
|
Public Domain
| 1,946 |
None
|
None
|
English
|
Spoken
| 2,051 | 2,783 |
A Few Paper Vi;, W a- fi<>. r i av'-mri, Standard News. Editor. That Tells State.--t...*.•• -1 action and criticism, with your Mews Weekly when 10,000 rate Published Weekly At 250th Street Pacific War Veteran Joins SK, Veterans Service Division Harry L. Wright, veteran of the and-a half years in the Marine Corps and 23 months in the South Pacific joins the Southern Regional Council staff in January as assistant to Dr. George S. Mitchell, Director of Veterans Service. Mr. Wright, a native of Jacksonville, Miss., and a graduate of Tulane's school, was in the 61st Dr. Battle, the Marine Corps in the South Pacific past experience includes the years as a fiscal officer with the Farm Security Administration. Assistant assistants planned by Dr. Mitchell to carry out the program returning Southern veterans. Southern Frontier ARTILLERY OFFICER OF 93rd WINS PROMOTION TO CAPTAIN With the 93rd Infantry Division of Mindanao The promotion to Captain of Isaiah A. McCoy, Jr., 4629 Wabash Ave., Chicago, III., from the grade of first lieutenant, was announced here. He is a communications officer and battery commander of the 93rd Division Artillery. The wearer of two Rat H Slaw Captain McCoy has left. Baniku Island in the Solomon Islands, in New Georgia; Florida and Morotai, in the Dutch East Indies. Mr. J. C. Jordan, an outstanding ) icacon of the- Baptist Church in Way ; lesboro. I---* MERIDIANITE VISITS IN CITY Miss Ora Humphrey of this city who has been working in Washington for Unrip Sum for some time, spent a he city visiting rela j - LEAVES CITY Mrs. Eleanor Peppers, (laugher of Mrs. Atllean Hardy left the cite 'iYe« day morning for Detroit, Mic I after spending the holidays wii !g i mo'her and other relative ;n: I f riends. — r-- •• j ' ; < 'V v ' - I v • i • ' '■* ^ - ■ > 1. *•* ■ j of KareJ.ng College « | ' ' I Jin' ’ t : re.. L__ _ J J • -s T y'-v* *T*r/-\'S T J L > v r.\ i I. 37 »«• ' V . . ' j ■ WBfc, J ‘ li' p.ilr'.t r . wenl ! down aheut 1 , Faieni , orrp in Vi' ]■. •• . To rv i. if mica', El.-' b. i .< a? -k i 1 ICO.OC'i ft t’"5 r I- rry's p: , . a fir ;i. Jl the lnt.il uuichei ■ i p,.: i ar.'. i upp! r. 1 for ir.i!; 1, vr'ocd a greet • m i v,->r.. r ’ yc.tv.-, t’ *". v' .'b , .i .o sur • pr. .g, l:;t ii ct-’i «»:. ' l'rrrn ICOO la lh?0 ,,ur number oC i ad in i i n i <■■ each j car, + O i,. . . I! ; l", .ll'li.ill gicw. Many are being invented for the wave of energy. The era of invention, which was the first to be followed by the creation of a new era in the world, was a significant achievement. The invention, which was the first to be followed by the creation of a new era in the world, was a testament to the power of the world. The invention, which was the first to be followed by the creation of a new era in the world, was a testament to the power of the world. Inventions, inventors, and inventors alike have made jobs of creative thought, with the development of their inventions and the development of their inventions. The invention, which was the first to be followed by the creation of a new era in the world, was a testament to the power of the world. The invention, which was the first to be followed by the creation of a new era in the world, was a testament to the power of the world. The invention, which was the first to be followed by the creation of a new era in the world, was a testament to the power of the world. The invention, which was the first to be followed by the creation of a new era in the world, was a testament to the power of the world. The invention, which was the first to be followed by the creation of a new era in the world, was a testament to the power of the world. The invention, which was the first to be followed by the creation of a new era in the world, was a testament to the power of the world. The invention, which was the first to be followed by the creation of a new era in the world, was a testament to the power of the world. The invention, which was the first to be followed by the creation of a new era in the world, was a testament to the power of the world. Century vention covered more than a century back of 1933, a period with Henry Franklin at one end and Thomas Edison at the other, in which Chief Justice John Marshall sat out for fair use of the patent system. Those were the years when inventions and their scientific development were profitable to men of intellect, schools of engineering and chemistry flourished. The Latin who called Necessity the mother of Invention was wrong. Necessity makes people improvise; Invention springs from love of achievement and hope of reward for good ideas. Among Europeans, the Swiss have the most freedom and lead in inventions. The Chinese, having no hope of reward, invent little. In America, our Patent Office safeguarded the reward in the 19th Century. In the last dozen years, however, the U.S. patent system has been the target of much verbal attack. How, of patents are pointed at as if they had stolen something. Moreover, the rewards, that come (by nature suddenly), to inventors, are twisted from them by taxation. What is the result? Inventors are not inventing. Must America’s creative spark be quenched, or may her inventors be rewarded? A child's infantile paralysis saluted Mrs. Eleanor Roosevelt at a Victory Bond rally-dinner given recently by South Central Association at Hotel Stevens in Chicago. These youngsters are aided by Cook & Co. National Foundation for Infantile Paralysis. National Foundation’s March of the Old Times, January 14-31, remains with the local chapter to be used for Vincular All-Over T. FOLK WE KNOW Mr. M. V. H. Fitts of Toomsuba was in the office last week. Brother Fitts was feeling fine and said that his ledge is moving along nicely. Mr. Floyd Ott, president of H. S. A. No. 21 was in the office on business pertaining to his local lodge this week. Finding the text being This week, A faithful Not many In the church. Many Mr. Wiley Key, son of Mr. Martha Key, is doing nicely. He recently underwent an operation in Rush Infirmary. Miss Salome Stennis, sister to Miss Esther Stennis, continues ill in her home on Asylum Heights. Mr. Will Edwards of H.B.A. Lodge No. 278. Sister Lula Berkhalter has just sent to the office for policies for three new members and a renewal. She has started off business with the new year. Go to it. Sister Berkhalter. We have already sent you some application blanks as per your request. Rev. R.L. Young has been informed that Rev. J.T. Clay, a Superannuated minister of the C.M.E. Church, is laid to rest this week. Mrs. Clay of this city left for the funeral. The Emancipation Proclamation program was held in the H.B.A. auditorium with the Ministerial Alliance and the city schools in charge of the program. The address was delivered by Rev. B.W. Coates. RALLY CONFERENCE Dr. X J. Jeltz, Presiding Elder of the Meridian District A. M. E. Church, having a Rally Conference Call on January 30th at St. James A. M. E. Church. All friends are cordially invited to attend this Conference. In that passed through Carson, Miss., last week did quite a little property damage. Mrs. Anna Gra- Mr. and Mrs. Will Gray and their son, Mr. and Mrs. Will Gray, and their son, Mr. and Mrs. Will Gray, were in the storm. Mr. and Mrs. Charles A. Love, 309 Tuttle Avenue, Montgomery, Ala., the only Negro officer assigned to the teaching staff of the Army University, University Training Command, Florence, Italy, returned to the United States this month to be separated from the service at this center. He taught mathematics at the University of Florida five months, his students included officers and enlisted men and women of both races. Before he entered the Army on April 5, 1942, Lieutenant Love was professor of mathematics at State Teachers College, Montgomery, Alabama. He holds a Masters degree from the University of Michigan and did graduate work at the University of Chicago. Lieutenant Love was commissioned a second lieutenant on October 14, 1942 and was promoted to First Lieutenant on May 4, 1943; on April 12 of the same year he went overseas and served in Africa, Sicily, and Italy. He wears Battle Stars for the Sicilian, Home - Arno and North Apennines campaigns. Continued on page 2 Pilings By Ruth Taylor There is an old proverb that takes the place from the Persian—“Four come not back -the spoken word, the sped arrow, the past life and the neglected opportunity.” “The spoken word” is not the fine things we have that come back to us. Yet, but has us the clear word, the same as the speech, the music rations of times we miss. The fact, the unkindness that we remember, if we are sincere in our endeavors to do right, these things plague us. These are the words that hurt us as deeply as those against whom we talked. “The spoken arrow”. This is the barb of unkindness that went straight to the heart of our neighbor, the wise crack that stung, the indifference to our brother’s needs, the cold withdrawal from the common life. The sharp trick, the self-interest we displayed, the spurning of the outstretched hand are among the things that torment us. “The past life”. Not only do we recall those things we did individually in our national mistakes, for which we, as citizens, are responsible. We neglected the developing of brotherly relations between Americans of good faith. We assumed an isolationist attitude toward the principles of the world. We allowed the soreness of other nations to fester and flare up until the plague threatened us with its virus of hatred. “The neglected opportunity” is again we suffer from both individual and national errors—the friendships we did not make, the help to the downtrodden we did not give, the rest of us. At inflation. How often, how we do not know; we have our opportunity, not to forget old mistakes. Let us remember the things that come to us back: Let the words we speak be words of fairness and friendship, let the arrows we send forth carry messages of brotherly love. Let our life be as near to what we want our future to be, as we can make it—and let us not neglect any opportunity to prove the worth of our faith. AWARDED MEDAL, Lincoln's Eyes, Flushing, Levee, Phillipine Islands - Sergeant Wilson Morris, 24, of Swan Lake, Mississippi, Motor Sergeant of the 3476th Truck Company, recent recipient of Star Medal for meritorial gifts. The plans for the year include a series of prizes for the best exhibit at the annual show. Sergeant Morris, promoted on October 2, 1914. To the technical sergeant, winner of the Mechanic's Award and recipient of the Good Condue Medal, also is in the game of the Machine Sharp Shooter's Badge and rifle marksman's Badge. A 63-point man, Sergeant Morris, whose address is Route 2, Box 135, Swan Lake, is expected to leave Leyte shortly for a 90-day furlough in the States. Mrs. Bette Faulkner, a high-class politician in her town, Fallsville, Mrs. Faulkner knows how to do things. It's All Very Simple? Pauline Zolko, Pennsylvania farm girl, when checked and timed while using two modern milking units, actually milked 16 cows in 5 minutes. That's at the rate of 2 minutes per cow and must be a record of some sort. If any of our readers have milked faster “Ye Ed” will find it out.
| 41,911 |
https://github.com/EstebanAO/lab-web/blob/master/app/views/courses/_course.json.jbuilder
|
Github Open Source
|
Open Source
|
MIT
| null |
lab-web
|
EstebanAO
|
Ruby
|
Code
| 17 | 70 |
json.extract! course, :id, :name, :code, :clu_course, :clu_laboratory, :clu_unities, :status, :type, :information, :created_at, :updated_at
json.url course_url(course, format: :json)
| 20,986 |
US-201113105759-A_1
|
USPTO
|
Open Government
|
Public Domain
| 2,011 |
None
|
None
|
English
|
Spoken
| 5,011 | 6,386 |
Method and device for harvesting energy from ocean waves
ABSTRACT
A method and device for generating electric power from ocean waves is described. The device includes at least one magnetostrictive element and at least one buoy. When the buoy is deployed in a body of liquid subject to wave motion, the buoy remains partially submerged during normal wave motion. The buoy is coupled to the magnetostrictive element to continuously exert a varying force on the magnetostrictive element during the normal wave motion.
CROSS-REFERENCES TO RELATED APPLICATIONS
This application is a continuation of U.S. application Ser. No. 12/906,895, filed Oct. 18, 2010, entitled “Method and Device for Harvesting Energy from Ocean Waves,” which is a continuation of U.S. application Ser. No. 12/603,138, filed Oct. 21, 2009, now issued as U.S. Pat. No. 7,816,797, which claims the benefit of U.S. Provisional Application No. 61/143,078, filed Jan. 7, 2009.
BACKGROUND
Embodiments of the invention described herein relate to a method and device for producing electricity by conversion of the mechanical energy of waves such as ocean waves in a water body.
Identification of new non-fossil fuel based energy sources that are both commercially viable and environmentally benign has become a vital technological need for the next century. Such technology will not only fuel economic growth and contribute to global environmental sustainability, but also reduce a nation's energy dependence on foreign oil in coming decades.
The world's oceans have long been thought of as sources of tremendous energy, with the global capacity estimated to be around 2 terra-Watts. Successful harvesting of energy from the ocean can help to relive the load at the point of demand on some of the most heavily populated regions of the United States. A survey conducted by the National Oceanic and Atmospheric Administration (NOAA) found that approximately 153 million people (53 percent of the nation's population) lived in the 673 U.S. coastal counties. Many nations around the world including the United Kingdom, Australia, China and India have densely populated coast-lines that can benefit substantially by harvesting power from ocean waves.
There are several methodologies of tapping energy from the oceans, and these methods can be broadly divided into thermal, tidal, and wave techniques. Of these various methods, the harvesting of wave energy is of particular importance. Within the area of wave energy harvesting, devices can again be sub-divided into on-shore and off-shore devices. Off-shore power devices tap the energy available from ocean waves using an oscillating water column type device. Efforts to tap the seemingly unlimited energy available through harvesting of ocean waves have proven to be difficult.
Large scale efforts to tap energy from the ocean continue to be hampered by high energy costs and low energy densities. It is estimated that the energy cost per kW from ocean energy with conventional technologies is around 20 cents/kWh, a level at which some form of subsidies are required for the technology to be widely adopted. In addition, hidden costs include the possibility of high replacement costs in the event of catastrophic failure or damage during major storms.
SUMMARY
Embodiments described herein include a method and device for converting the mechanical energy of oscillating ocean waves into magnetic and electrical energy using a novel design that utilizes magnetostrictive elements. Embodiments of the design combine proven concepts from existing technologies, such as the oscillating buoy concept used in the Pelamis machine with technology proven on the bench scale for energy generation using magnetostrictive devices to create a powerful solution for harvesting energy from ocean waves. Embodiments of the design are expected to have relatively low capital costs and very good survivability during strong storms. Numerical models to be developed are expected to outline specific designs of the device capable of delivering over 1 GW of power and perform bench scale demonstration of the key concept of generating electric power using a modular structure containing magnetostrictive elements. Some embodiments may include power management strategies to optimize the delivered power from a suite of these devices distributed across the ocean surface.
Embodiments of the invention relate to methods for generating electricity. In one embodiment, the method includes exposing a magnetostrictive element to a force due to wave motion of a body of liquid. The force, which could be a tensile force, results in a magnetic flux change in the magnetostrictive element. The method also includes using producing electric power through electromagnetic induction based on the magnetic flux change in the magnetostrictive element. Other embodiments of methods for generating electricity are also described.
Embodiments of the invention also relate to a device for generating electricity. In one embodiment, the device includes at least one magnetostrictive element and at least one buoy. When the buoy is deployed in a body of liquid subject to wave motion, the buoy remains partially submerged during normal wave motion. The buoy is coupled to the magnetostrictive element to continuously exert a force on the magnetostrictive element during the normal wave motion.
In another embodiment, the device includes a magnetostrictive element and an electromagnetic induction structure. The magnetostrictive element, when deployed in a body of liquid subject to wave motion, experiences a load change with an associated magnetic flux change in response to the wave motion. The electromagnetic induction structure produces electric power through electromagnetic induction in response to the magnetic flux change of the magnetostrictive element. Other embodiments of devices for generating electricity are also described.
Other aspects and advantages of embodiments of the present invention will become apparent from the following detailed description, taken in conjunction with the accompanying drawings, illustrated by way of example of the principles of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 depicts a schematic block diagram of one embodiment of a device for harvesting energy from the oscillations of ocean waves.
FIG. 2 depicts a schematic diagram of one embodiment of the magnetostrictive elements of the energy harvesting device of FIG. 1.
FIG. 3 depicts a graph of calculation results of initial analysis of power generation from ocean waves using one embodiment of a magnetostrictive element subjected to a cycling load employing a partially submerged buoy.
FIG. 4 depicts a schematic circuit diagram of one embodiment of an equivalent circuit diagram of several magnetostrictive elements arranges so as to move synchronously as an ocean wavefront moves through.
FIG. 5 depicts another schematic block diagram of the energy harvesting device of FIG. 1.
Throughout the description, similar reference numbers may be used to identify similar elements.
DETAILED DESCRIPTION
It will be readily understood that the components of the embodiments as generally described herein and illustrated in the appended figures could be arranged and designed in a wide variety of different configurations. Thus, the following more detailed description of various embodiments, as represented in the figures, is not intended to limit the scope of the present disclosure, but is merely representative of various embodiments. While the various aspects of the embodiments are presented in drawings, the drawings are not necessarily drawn to scale unless specifically indicated.
The present invention may be embodied in other specific forms without departing from its spirit or essential characteristics. The described embodiments are to be considered in all respects only as illustrative and not restrictive. The scope of the invention is, therefore, indicated by the appended claims rather than by this detailed description. All changes which come within the meaning and range of equivalency of the claims are to be embraced within their scope.
Reference throughout this specification to features, advantages, or similar language does not imply that all of the features and advantages that may be realized with the present invention should be or are in any single embodiment of the invention. Rather, language referring to the features and advantages is understood to mean that a specific feature, advantage, or characteristic described in connection with an embodiment is included in at least one embodiment of the present invention. Thus, discussions of the features and advantages, and similar language, throughout this specification may, but do not necessarily, refer to the same embodiment.
Furthermore, the described features, advantages, and characteristics of the invention may be combined in any suitable manner in one or more embodiments. One skilled in the relevant art will recognize, in light of the description herein, that the invention can be practiced without one or more of the specific features or advantages of a particular embodiment. In other instances, additional features and advantages may be recognized in certain embodiments that may not be present in all embodiments of the invention.
Reference throughout this specification to “one embodiment,” “an embodiment,” or similar language means that a particular feature, structure, or characteristic described in connection with the indicated embodiment is included in at least one embodiment of the present invention. Thus, the phrases “in one embodiment,” “in an embodiment,” and similar language throughout this specification may, but do not necessarily, all refer to the same embodiment.
While many embodiments are described herein, at least some embodiments of the invention include a method and device to capture the energy of oscillations in ocean waves and convert this energy into electrical energy. In this description, references to an “ocean wave” refer to waves in any stationary, moving, or oscillating body of water, and the use of the word ocean wave in no way limits the scope or applicability of the invention to the ocean environment alone.
FIG. 1 depicts a schematic block diagram of one embodiment of a device 100 for harvesting energy from the oscillations of ocean waves 102. The core modules includes a buoy 104 or buoys attached to one or more magnetostrictive elements 106, which in turn are anchored to the seafloor or to another fixed surface or body using heavy weights 108, or by any other method. Although the magnetostrictive elements are shown attached to the buoys by rigid tethers 110, other embodiments may use non-rigid tethers. Alternatively, the tethers may be omitted altogether, so that the magnetostrictive elements extend from the anchors to the buoys. The term buoy, in the context of this description refers to any physical body that may float on or near the surface of a body of water when allowed to freely do so with no forces other than its own gravity and the buoyant force applied by the water acting on the body.
Magnetostrictive materials have the property that when a strain is imposed on these materials, it results in a change in magnetization (or flux density) of an associated magnetic field. The phenomenon of magnetostriction has been known for over a century, but the field was really revolutionized by the discovery of giant magnetostrictive (Tb,Dy) alloys for use at cryogenic temperatures in the 1960s. Subsequently, giant magnetostrictive materials that work at room temperature including (Tb,Dy) and Terfenol alloys were developed. (Tb,Dy) and Terfenol-D alloys have saturation strain values as high as 10⁻² (10,000 ppm) and 2×10⁻³ (2000 ppm), respectively, allowing for the development of many practical applications including torque sensors and high precision actuators. Magnetostrictive materials show changes in linear dimensions when a magnetic field is applied (Joule magnetostriction) and a reciprocal effect of changes in the magnetic properties with the application of stress. These characteristics make it possible to use magnetostrictive materials to function as both actuators and as sensors. They are analogous to piezoelectric materials, but have a large operating bandwidth extending to low frequencies, higher energy density, and capability for higher power and force delivery. For certain embodiments of this particular application, magnetostrictive materials are superior to piezoelectric materials due to their greater mechanical durability and lower production cost in high volumes.
When a wave moves through a location, the geometry outlined here, and shown in FIG. 1, results in the line tension in the magnetostrictive elements being a strong function of the wave amplitude. While the actual geometry of ocean waves is complex and is a cumulative summation of a spectrum of wavelets that result in changes in the effective amplitude and frequency, for the purpose of the discussion here, waves are considered to be sinusoidal for simplicity. When the wave amplitude is such that it is close to a crest, more of the buoy is submerged in water resulting in a greater tensile load on the magnetostrictive element. As the wave is at a trough, less of the buoy is submerged resulting in a lower tensile load on the magnetostrictive element. The geometry of the individual magnetostrictive elements may be defined such that, for the appropriate type of buoy, the expected loads generated will result in strains that are below the saturation magnetostriction. Thus, as the wave oscillates, the extension of the magnetostrictive element follows a similar oscillation, resulting in a constantly changing magnetic flux density along the length of the magnetostrictive element. This constantly changing magnetic flux density is used to generate an induced voltage in a coil wound around the magnetostrictive element, schematically illustrated in FIG. 2, by Faraday's law of induction, which is represented by the following equation:
ε=−n(dφ/dt),
where n is the number of turns of the coil and the term (dφ/dt) is the time derivative of the magnetic flux, φ.
FIG. 2 depicts a schematic diagram of one embodiment of the magnetostrictive elements 106 of the energy harvesting device 100 of FIG. 1. In the depicted embodiment, the magnetostrictive element 106 includes a polymer coated copper coil 112, an external protective polymer sheath 114, and a magnetostrictive rod 116. The illustration of the magnetostrictive element and coil, shown in FIG. 2, in no way limits the type, orientation, structure, composition, of either the magnetostrictive element of the coil. The coil may, without limitation, be wound, suspended, printed or otherwise attached or located in the vicinity of the magnetostrictive element. The term magnetostrictive element simply refers to a buoy or structure, at least a portion of which is constructed of materials possessing magnetostrictive properties. For reference, the “vicinity” of the magnetostrictive element refers to any location adjacent to or within the proximity of the magnetostrictive element which allows the coil to sufficiently experience the changing magnetic flux density of the magnetostrictive element so as to result in a measurable potential or current, for example, greater than about 0.01 mV or about 0.01 μA, respectively. More specifically, the vicinity may be limited to distances at which the coil experiences a measurable change in the magnetic flux density of the magnetostrictive element. Since the strength and profile of the changing magnetic flux density may depend on the configuration of the magnetostrictive element, and the sensitivity of the coil may depend on the construction and placement of the coil, the “vicinity” of the magnetostrictive element may vary from one embodiment to another.
While the buoy may be of any shape and size, in at least one embodiment the buoys are designed such that their vertical height, or other dimension at normal to the surface of the ocean, exceeds the expected amplitude of oscillations of normal wave motion at a geographic location of interest. In other words, in some embodiments, the buoy is always partially submerged whether it is at the crest of a wave or the trough. In some embodiments, the system is also designed such that even as the wave is at a trough, the submerged portion of the buoy is more than what it might have been if the buoy were floating freely—this ensures a tensile load on the magnetostrictive elements through the entire range of motion of the buoy as the wave oscillates, and that the field changes constantly as the wave progresses through its entire amplitude. If at any point the strain reaches a maximum (for example, the buoy is fully submerged), for some period of time following that, until the strain starts to change again, the output voltage will be zero or near zero.
The fact that the generated voltage is proportional to the differential of the magnetic flux, according to the equation presented above, provides the explanation for two statements mentioned below.
- 1. The maximum strain in the magnetostrictive elements should not exceed the strain needed for the saturation magnetization along the length of the element. If the saturation strain is exceeded, then there is no further change in the magnetic flux density for the period of time until the strain relaxes again and falls below the saturation level. During this period where the saturation strain is exceeded, the magnetic flux is constant resulting in a zero EMF output. - 2. The buoy may be designed such that the buoy is always submerged more than its “equilibrium” state—i.e., the level to which the buoy would have submerged if it were free-floating. This ensures a constantly changing, but always tensile load on the magnetostrictive elements. If this load were relaxed, the strain plateaus to zero again resulting in a zero flux differential and zero EMF.
The structure of the magnetostrictive elements is shown in more detail in FIG. 2. A core-rod of magnetostrictive material is wound with polymer (e.g., Teflon, PTFE) coated copper wire to the desired number of turns. The selection of the polymer is not critical except that the polymer should be rated to provide electrical insulation for the highest rated voltage expected in the coil. The wire diameter may be optimized for the intended application, as there is a trade-off between using an increased wire diameter to lower electrical resistance of the coil that allows the delivery or a greater voltage and higher power (lower IR losses) and using a decreased wire diameter to lower the cost and weight of the coil itself. The external sheath can also be of the same or similar material as the polymer coating. Alternatively, the external sheath may be another material to provide corrosion protection of the magnetostrictive rod.
Based on the design outlined above, some embodiments may account for specific variations in sea level due to factors such as tides for ensuring that the structure continues to function as an effective power generation source while the external environment varies. Hence, the location of the buoy relative to the nominal surface of the ocean is a consideration for the device to function effectively. Thus, seasonal and daily tidal variations may be accounted for in the determination of where to locate the buoys.
Additionally, some embodiments include a system to monitor and control the mean tension in the magnetostrictive elements. FIG. 5 shows one example of a tether controller 140 to provide such monitoring and control. In one example, in high tide more of the tethers are released, and in low tide the excess length is reeled in to effectively shorten the length. Thus the “anchor” rather than being a dead-weight may have a pulley system 142 (refer to FIG. 5) and load sensors 144 (refer to FIG. 5) to release or reel in the magnetostrictive elements as needed. In one embodiment, the energy for the tension control system may be supplied by the corresponding magnetostrictive elements and coils. Such energy may be supplied on demand or via a storage device such as a battery 146 (refer to FIG. 5).
Referring again to the construction of the magnetostrictive elements, other embodiments may use other materials. Recent research explored ductile and low field magnetostrictive alloys based on Fe—Ga, Fe—Mo, and Fe—W. In some embodiments, these alloys are attractive due to their excellent ductility and high magnetostriction values obtained at low applied magnetic fields that are an order of magnitude smaller than that needed for Terfenol-D alloys
For this application, however, the saturation magnetization is not critical as any magnetostrictive material can be made to work by changing the geometry of the magnetostrictive element for the appropriate expected loading. What may be more critical are factors such as cost and reliability as these factors directly affect the capital and operating costs of energy harvesting device and, therefore, the cost of the delivered energy. The reliability requirement may be divided into a mechanical strength requirement and a corrosion resistance requirement; although the latter may be less critical if appropriate protective jackets, or sheaths, are used. As a simple comparison of Terfenol-D with alpha-iron-based alloys (Fe—Ga, Fe—Al, Fe—W and Fe—Mo), Terfenol-D is an alloy or iron with terbium and Dysprosium (Tb_(0.3)Dy_(0.7)Fe_(1.9)). The high alloying levels of the relatively scarce and expensive Tb and Dy makes Terfenol-D very expensive. On the other hand, α-Fe based alloys are relatively inexpensive and robust, and α-Fe based alloys provide adequate magnetostrictive behavior for this application, in certain embodiments.
FIG. 3 depicts a graph 120 of calculation results of initial analysis of power generation from ocean waves using one embodiment of a magnetostrictive element subjected to a cycling load employing a partially submerged buoy. Preliminary first order calculations to validate the concept have been carried out. The results, illustrated in FIG. 3, show that for practical geometries it is possible to obtain voltages as high as 200 V. Also, the nature of the voltage wave-form from a single device results in a sinusoidal voltage output. This analysis utilized a very simple model that assumed that a magnetostrictive member, with a cross-section of 2 cm×2 cm and length 2 m, is subject to a sinusoidal load varying from ˜490 to ˜1145 N, loads that can be easily generated by partial submersion of a buoy of weight 50 kg and effective density of around 300 kg/m³. This initial analysis shows that it is possible to generate an oscillating voltage with an amplitude as high as 100 V using a simple geometry for the magnetostrictive element. The geometries or numbers used in this calculation in no way limit the scope of the present invention and are only intended as an example.
Since the frequency of the wave is determined by the frequency of the ocean waves and is therefore relatively low (i.e., under 1 Hz), the capacitance of the magnetostrictive elements may be ignored to develop an equivalent circuit diagram as shown in FIG. 4. In particular, FIG. 4 depicts a schematic circuit diagram 130 of one embodiment of an equivalent circuit diagram of several magnetostrictive elements arranges so as to move synchronously as an ocean wavefront moves through. By controlling the manufacturing process of the magnetostrictive elements, it is possible to the condition R₁≈R₂≈ . . . ≈R_(n). If the magnetostrictive elements are arranged so that they all are synchronized to move in unison as the wave front moves along, a high power, high-voltage output can be generated. In one embodiment, the movement of the magnetostrictive elements may be synchronized by locating the elements in a pattern that anticipates the expected geometry of the waveforms in a particular geographic area.
FIG. 5 depicts another schematic block diagram of the energy harvesting device 100 of FIG. 1. As explained above, the illustrated energy harvesting device 100 includes a tether controller 140 with one or more pulleys 142 and/or sensors 144. Although the pulleys and sensors are shown as part of the anchors, other embodiments may include pulleys and/or sensors in different parts of the overall configurations, e.g., at the buoys, between the tethers and magnetostrictive elements, and so forth. The illustrated anchors also include batteries 146, which may store electrical energy generated by one or more of the energy harvesting devices. In some embodiments, multiple energy harvesting devices are coupled to a power management system 148, which combines the electrical energy generated at each of the energy harvesting devices into one or more outputs with higher voltages and/or overall power.
It should be noted that the technology described herein is clean and creates electricity from ocean waves without consuming any carbonaceous fuels or generating any harmful pollutants. Even compared with other technologies for harvesting ocean power, the lack of moving parts and joints that require lubrication that may leak and pollute the oceans, this technology is exceptionally clean and environmentally friendly. The substitution of the energy generated by embodiments described may herein reduce green house gases and pollutants, compared with fossil fuels, without any undesirable side-effects or compromises. Finally, the technology is friendly to marine life as the structures will not result in any significant impediment to natural migration patterns or affect sea-life in any significant way.
In the above description, specific details of various embodiments are provided. However, some embodiments may be practiced with less than all of these specific details. Although the operations of the method(s) herein are shown and/or described in a particular order, the order of the operations of each method may be altered so that certain operations may be performed in an inverse order or so that certain operations may be performed, at least in part, concurrently with other operations. In another embodiment, instructions or sub-operations of distinct operations may be implemented in an intermittent and/or alternating manner. Although specific embodiments of the invention have been described and illustrated, the invention is not to be limited to the specific forms or arrangements of parts so described and illustrated. The scope of the invention is to be defined by the claims appended hereto and their equivalents.
Although the operations of the method(s) herein are shown and described in a particular order, the order of the operations of each method may be altered so that certain operations may be performed in an inverse order or so that certain operations may be performed, at least in part, concurrently with other operations. In another embodiment, instructions or sub-operations of distinct operations may be implemented in an intermittent and/or alternating manner.
Although specific embodiments of the invention have been described and illustrated, the invention is not to be limited to the specific forms or arrangements of parts so described and illustrated. The scope of the invention is to be defined by the claims appended hereto and their equivalents.
1. A device for producing electric power, the device comprising: at least one magnetostrictive element; and at least one buoy which, when deployed in a body of liquid subject to wave motion, is configured to remain partially submerged during normal wave motion; wherein the buoy is coupled to the magnetostrictive element to continuously exert a varying force on the magnetostrictive element during the normal wave motion.
2. The device of claim 1, wherein a stress in the magnetostrictive element resulting from the varying force varies over time in response to the normal wave motion.
3. The device of claim 1, further comprising an electrical conductor in a vicinity of the magnetostrictive element, wherein changes in the varying force on the magnetostrictive element result in flux changes in the magnetostrictive element, wherein the flux changes induce a current in the electrical conductor.
4. The device of claim 1, further comprising a battery coupled to the electrical conductor, wherein the battery is configured to store at least some of the electrical energy induced in the electrical conductor.
5. The device of claim 1, further comprising a power management system to control power generated by induction based on changes in the varying force exerted on a plurality of magnetostrictive elements.
6. The device of claim 1, wherein the magnetostrictive element is configured to exhibit a change in magnetization of an associated magnetic field in response to a corresponding change in the varying force exerted on the magnetostrictive element.
7. The device of claim 1, wherein the magnetostrictive element comprises a magnetostrictive rod.
8. The device of claim 1, further comprising an external protective sheath to substantially protect the magnetostrictive element from corrosive environmental conditions.
9. The device of claim 1, further comprising an anchor device below a surface of the body of water, wherein the magnetostrictive element is coupled to the anchor device between the anchor device and the buoy.
10. The device of claim 9, further comprising a rigid tether coupled to the magnetostrictive element between the anchor device and the buoy.
11. The device of claim 10, further comprising a tether controller to control a distance between the anchor device and the buoy, wherein the distance between the anchor device and the buoyant device correlates to strain on the magnetostrictive element.
12. The device of claim 11, wherein the tether controller comprises: a load sensor to monitor a tensile load on the magnetostrictive element; and a pulley to change a distance between the anchor device and the buoy according to a target force on the magnetostrictive element.
13. A device for generating electric power, the device comprising: a magnetostrictive element which, when deployed in a body of liquid subject to wave motion, is configured to experience a load change with an associated magnetic flux change in response to the wave motion; and an electromagnetic induction structure to produce electric power through electromagnetic induction in response to the magnetic flux change in the magnetostrictive element.
14. The device of claim 13, further comprising a buoy coupled to the magnetostrictive element, wherein the wave motion of the body of liquid causes the buoy to exert a force on the magnetostrictive element.
15. The device of claim 14, further comprising an anchor deployed at a substantially fixed location relative to the buoy, wherein the magnetostrictive element is mechanically coupled to both the buoy and the anchor.
16. The device of claim 14, wherein the buoy is further configured to remain partially submerged during normal wave motion of the body of liquid.
17. A method for generating electric power, the method comprising: exposing a magnetostrictive element to a force due to wave motion of a body of liquid, wherein the force results in a magnetic flux change in the magnetostrictive element; and producing electric power through electromagnetic induction based on the magnetic flux change in the magnetostrictive element.
18. The method of claim 17, further comprising using a buoy coupled to the magnetostrictive element to consistently maintain the force on the magnetostrictive element, wherein the force changes over time due to the wave motion of the body of liquid.
19. The method of claim 18, further comprising controlling a length of a tether coupled to the magnetostrictive element to maintain the buoy in a partially submerged state during normal wave operation.
20. The method of claim 17, further comprising transmitting the produced electric power to a battery for storage..
| 21,671 |
https://arz.wikipedia.org/wiki/%D8%B2%D9%87%D9%8A%D9%86%D8%AC%20%D9%8A%D9%88
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
زهينج يو
|
https://arz.wikipedia.org/w/index.php?title=زهينج يو&action=history
|
Egyptian Arabic
|
Spoken
| 43 | 118 |
زهينج يو لاعبه ريشه طايره من الصين.
حياتها
زهينج يو من مواليد يوم 7 فبراير 1996 فى شاندونج.
المشاركات
زهينج يو شاركت فى
2018 German Open Badminton Championships – Women's doubles
لينكات
مصادر
ريشه طايره
لعيبة ريشه طايره
لعيبة ريشه طايره من الصين
| 869 |
https://www.wikidata.org/wiki/Q21432630
|
Wikidata
|
Semantic data
|
CC0
| null |
Zeca-Zeca
|
None
|
Multilingual
|
Semantic data
| 54 | 183 |
Zeca-Zeca
Zeca-Zeca
Zeca-Zeca instans av vattendrag
Zeca-Zeca inom det administrativa området Cuanza Sul
Zeca-Zeca land Angola
Zeca-Zeca Geonames-ID 7859448
Zeca-Zeca geografiska koordinater
Zeca-Zeca GNS-ID 11178277
Zeca-Zeca
watergang in Angola
Zeca-Zeca is een watergang
Zeca-Zeca gelegen in bestuurlijke eenheid Cuanza Sul
Zeca-Zeca land Angola
Zeca-Zeca GeoNames-identificatiecode 7859448
Zeca-Zeca geografische locatie
Zeca-Zeca GNS Unique Feature-identificatiecode 11178277
| 21,950 |
https://openalex.org/W3183844814
|
OpenAlex
|
Open Science
|
CC-By
| 2,021 |
A new blow up criterion for the 3D magneto-micropolar fluid flows without magnetic diffusion
|
Dongxiang Chen
|
English
|
Spoken
| 7,712 | 20,777 |
A new blow up criterion for the 3D
magneto-micropolar fluid flows without
magnetic diffusion Dongxiang Chen1* and Qifeng Liu1 *Correspondence:
[email protected]
1School of Mathematics and
Statistics, Jiangxi Normal University,
Nanchang, China Abstract This note obtains a new regularity criterion for the three-dimensional
magneto-micropolar fluid flows in terms of one velocity component and the gradient
field of the magnetic field. The authors prove that the weak solution (u,ω,b) to the
magneto-micropolar fluid flows can be extended beyond time t = T, provided if
u3 ∈Lβ(0,T;Lα(R3)) with 2
β + 3
α ≤3
4 + 1
2α ,α > 10
3 and ∇b ∈L
4p
3(p–2) (0,T; ˙Mp,q(R3)) with
1 < q ≤p < ∞and p ≥3. MSC: Primary 35Q35; secondary 76D03 ( 2021) 2021:62 Chen and Liu Boundary Value Problems ( 2021) 2021:62
https://doi.org/10.1186/s13661-021-01539-0 Open Access 1 Introduction The aim of this paper is to understand the regularity criterion for the following three-
dimensional magneto-micropolar fluid flows without magnetic diffusion: ⎧
⎪⎪⎪⎪⎪⎪⎨
⎪⎪⎪⎪⎪⎪⎩
∂tu – (μ + χ)u + ∇π = –u · ∇u + b · ∇b – χ∇× ω,
(x,t) ∈R3 × (0,T),
∂tω – γ ω – κ∇divω + 2χω = –u · ∇ω + χ∇× u,
(x,t) ∈R3 × (0,T),
∂tb + u · ∇b = b · ∇u,
(x,t) ∈R3 × (0,T),
∇· u = ∇· b = 0,
(x,t) ∈R3 × (0,T),
u|t=0 = u0,
ω|t=0 = ω0,
b|t=0 = b0,
x ∈R3. (1.1) (1.1) This system is a special case of the classical three-dimensional magneto-micropolar fluid
flows This system is a special case of the classical three-dimensional magneto-micropolar fluid
flows ⎧
⎪⎪⎪⎪⎪⎪⎨
⎪⎪⎪⎪⎪⎪⎩
∂tu – (μ + χ)u + ∇π = –u · ∇u + b · ∇b – χ∇× ω,
(x,t) ∈R3 × (0,T),
∂tω – γ ω – κ∇divω + 2χω = –u · ∇ω + χ∇× u,
(x,t) ∈R3 × (0,T),
∂tb + u · ∇b – νb = b · ∇u,
(x,t) ∈R3 × (0,T),
divu = divb = 0,
(x,t) ∈R3 × (0,T),
u|t=0 = u0,
ω|t=0 = ω0,
b|t=0 = b0,
x ∈R3,
(1.2) ⎧
⎪⎪⎪⎪⎪⎪⎨
⎪⎪⎪⎪⎪⎪⎩
∂tu – (μ + χ)u + ∇π = –u · ∇u + b · ∇b – χ∇× ω,
(x,t) ∈R3 × (0,T),
∂tω – γ ω – κ∇divω + 2χω = –u · ∇ω + χ∇× u,
(x,t) ∈R3 × (0,T),
∂tb + u · ∇b – νb = b · ∇u,
(x,t) ∈R3 × (0,T),
divu = divb = 0,
(x,t) ∈R3 × (0,T),
u|t=0 = u0,
ω|t=0 = ω0,
b|t=0 = b0,
x ∈R3,
(1.2) © The Author(s) 2021. This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use,
sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original
author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other
third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line
to the material. © The Author(s) 2021. This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use,
sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original
author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other
third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line
to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by
statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a
copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. 1 Introduction If material is not included in the article’s Creative Commons licence and your intended use is not permitted by
statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a
copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. Chen and Liu Boundary Value Problems ( 2021) 2021:62 ndary Value Problems ( 2021) 2021:62 Page 2 of 15 ( 2021) 2021:62 Chen and Liu Boundary Value Problems where u = (u1,u2,u3),ω = (ω1,ω2,ω3),b = (b1,b2,b3) and π denote the unknown velocity
field, the micro-rotational velocity, the magnetic field and the unknown scalar pressure at
the point (x,t) ∈R3 × (0,T), respectively. While u0,ω0,b0 are the prescribed initial data
and divu = divb = 0 in the sense of distributions. The constants μ,χ,κ,γ are positive
numbers associated with the properties of the material, where μ is the kinematic viscosity,
χ is the vortex viscosity, κ and γ are spin viscosities (more details see [11]). The magneto-micropolar fluid system (1.2) was first proposed by Galdi and Rionero
[7]. The existence of global-in-time weak solutions was then established by Rojas-Medar
and Boldrini [14], while the local strong solutions and global strong solutions in bounded
domain for the small initial data were considered, respectively, by Rojas-Medar [13] and
Ortega-Torres and Rojas-Medar [12]. However, whether the local strong solutions can
exist globally or the global weak solution is regular and unique is an outstanding open
problem. Hence there are many regularity criteria to ensure the smoothness of solutions. Gala [2] proved that, if u ∈L
2
1–r (0,T; ˙Mp, 3
r (R3)) or ∇u ∈L
2
2–r (0,T; ˙Mp, 3
r (R3)), then the local
smooth solution (u,ω,b) can be extended beyond t = T. Zhang and Yao [17] demonstrated
that, if ∇u ∈Lp(0,T; ˙F0
q, 2q
3
(R3)) with 2
p + 3
q = 2, 3
2 < q ≤∞, then the weak solution (u,ω,b)
is smooth on [0,T]. When the micro-rotational velocity ω = 0 and χ = 0, Eq. (1.2) becomes the standard
magneto-hydrodynamic equations. In recent years, the problem of regularity criteria in-
volving one component has been investigated for the MHD equations (see e.g. [3–5, 8, 9]). Assume that (u,ω,b) be the weak solution to the equations (1.1) defined on [0,T) for some
0 < T < ∞. If (u,b) satisfies Theorem 1.1 Let (u0,b0) ∈H1(R3) and ω0 ∈H1(R3), with the initial data ∇· u0 = ∇· b0 =
0. Assume that (u,ω,b) be the weak solution to the equations (1.1) defined on [0,T) for some
0 < T < ∞. If (u,b) satisfies u3 ∈Lβ
0,T;Lα
R3
,
2
β + 3
α ≤3
4 + 1
2α ,
α > 10
3 ,
(1.3) u3 ∈Lβ
0,T;Lα
R3
,
2
β + 3
α ≤3
4 + 1
2α ,
α > 10
3 ,
(1.3)
and (1.3) and ∇b ∈L
4p
3(p–2)
0,T; ˙Mp,q
R3
,
1 < q ≤p < ∞,p ≥3,
(1.4) ∇b ∈L
4p
3(p–2)
0,T; ˙Mp,q
R3
,
1 < q ≤p < ∞,p ≥3,
(1.4)
then the solution (u ω b) to (1 1) can be smoothly extended beyond t = T (1.4) then the solution (u,ω,b) to (1.1) can be smoothly extended beyond t = T. then the solution (u,ω,b) to (1.1) can be smoothly extended beyond t = T. Remark 1.1 To the best of our knowledge, this is the first regularity criterion result is
concerned with weak solution to the 3D incompressible MHD equations without magnetic
diffusion in Morrey Campanato space. The worst difficulty is to handle the nonlinear term
R3 u · ∇u · udx. For the two dimension case, due to
R2 u · ∇u · u = 0, the condition
∇b ∈L
2p
p–2 (0,T; ˙Mp,q(R2)) is sufficient (see [6]). Compared with the result in [2], due to
the magneto-micropolor fluid flows discussed in Theorem 1.1 there is lack of magnetic
diffusion, it increases the difficulties of dealing with the nonlinear terms in H1-energy
estimates, especially for the term
R3 u · ∇w · wdx. Fortunately, the L3-energy estimate
for ω helps us to overcome these problems. When ω = 0,χ = 0, the magneto-micropolar equations (1.1) become the classical MHD
equations without magnetic diffusion. Theorem 1.1 converts into the following corollary. Corollary 1.1 Let (u0,b0) ∈H1(R3) with the initial data ∇· u0 = ∇· b0 = 0. Assume that When ω = 0,χ = 0, the magneto-micropolar equations (1.1) become the classical MHD
equations without magnetic diffusion. Theorem 1.1 converts into the following corollary. Corollary 1.1 Let (u0,b0) ∈H1(R3) with the initial data ∇· u0 = ∇· b0 = 0. Assume that
(u,b) be the weak solution to the incompressible MHD equations defined on [0,T) for some
0 < T < ∞. If (u,b) satisfies u3 ∈Lβ
0,T;Lα
R3
,
2
β + 3
α ≤3
4 + 1
2α ,
α > 10
3 ,
and
∇b ∈L
4p
3(p–2)
0,T; ˙Mp,q
R3
,
1 < q ≤p < ∞,p ≥3, u3 ∈Lβ
0,T;Lα
R3
,
2
β + 3
α ≤3
4 + 1
2α ,
α > 10
3 , and ∇b ∈L
4p
3(p–2)
0,T; ˙Mp,q
R3
,
1 < q ≤p < ∞,p ≥3, In 2016, Yamazaki [15] proved that, if u3 ∈Lp
0,T;Lq
R3
with 2
p + 3
q ≤1
3 + 1
2q, 15
2 < q ≤∞and
j3 ∈Lp′
0,T;Lq′
R3 u3 ∈Lp
0,T;Lq
R3
with 2
p + 3
q ≤1
3 + 1
2q, 15
2 < q ≤∞and u3 ∈Lp
0,T;Lq
R3 with 2
p + 3
q ≤1
3 + 1
2q, 15
2 < q ≤∞and j3 ∈Lp′
0,T;Lq′
R3 with 2
p′ + 3
q′ ≤2, 13
2 < q′ ≤∞, then the weak solution (u,b) is regular, where j3 is the third
component of ∇× b = (j1,j2,j3). Later Zhang [16] refined the result of Yamazaki’s. He
proved that, if u3 ∈Lp
0,T;Lq
R3
with 2
p + 3
q ≤4
9 + 1
3q, 15
2 < q ≤∞and
j3 ∈Lp′
0,T;Lq′
R3 u3 ∈Lp
0,T;Lq
R3 with 2
p + 3
q ≤4
9 + 1
3q, 15
2 < q ≤∞and with 2
p + 3
q ≤4
9 + 1
3q, 15
2 < q ≤∞and with 2
p′ + 3
q′ ≤2, 3
2 < q′ ≤∞, then the weak solution (u,b) is regular. with 2
p′ + 3
q′ ≤2, 3
2 < q′ ≤∞, then the weak solution (u,b) is regular. We further assume that ω = χ = 0, the system (1.1) is usually named MHD equations
without magnetic diffusion. In order to present our motivation, we list some informa-
tion on regularity criteria for 2D-MHD equations without magnetic diffusion. In 2011,
Zhou and Fan [18] proved if ∇b ∈L1(0,T;BMO(R2)), then the local strong solution (u,b)
is regular. Gala, Ragusa and Ye [6] improved Zhou and Fan’s result. They showed that, if
∇b ∈L
p
p–1 (0,T; ˙Mp,q(R2)) with p ≥q > 1, the local strong solution (u,b) to the MHD equa-
tions with magnetic diffusion is regular. Motivated by [2, 15], and [6], we will investigate ms ( 2021) 2021:62
Page 3 of 15 Chen and Liu Boundary Value Problems ( 2021) 2021:62 Page 3 of 15 the regularity criterion on the weak solution to the magneto-micropolar flows involving
one velocity component and the gradient of magnetic field satisfying (1.3) and (1.4). Our
result is stated as follows. Theorem 1.1 Let (u0,b0) ∈H1(R3) and ω0 ∈H1(R3), with the initial data ∇· u0 = ∇· b0 =
0. then the local strong solution (u,b) can be smoothly extended beyond t = T. then the local strong solution (u,b) can be smoothly extended beyond t = T. Remark 1.2 Comparing with the results either in [15] or in [16], though the MHD equa-
tions discussed in Corollary 1.1 show lack of magnetic diffusion and the spatial space of
magnetic field is enlightened, it is hard to say our results have refined the one in [15] or
that in [16]. Page 4 of 15 ( 2021) 2021:62 Chen and Liu Boundary Value Problems The difficulties and strategy are listed as follows: • The first big tiger is to estimate the nonlinear term
R3 u · ∇u · udx. Since
R3 u · ∇u ·
udx ̸= 0, it is impossible to handle it as in the second dimension. We have to present the
horizontal energy estimate ∥∇hu∥L2,∥∇hb∥L2. • The first big tiger is to estimate the nonlinear term
R3 u · ∇u · udx. Since
R3 u · ∇u ·
udx ̸= 0, it is impossible to handle it as in the second dimension. We have to present the
horizontal energy estimate ∥∇hu∥L2,∥∇hb∥L2. • The second thorn is the nonlinear term
R3 u · ∇w · wdx. Integrating by part gives
R3 u · ∇ω · ω dx and
R3 ∇u · ∇2ω · ω dx. As usual, if we use the Hölder inequality and
the Young inequality, we get • The second thorn is the nonlinear term
R3 u · ∇w · wdx. Integrating by part gives
R3 u · ∇ω · ω dx and
R3 ∇u · ∇2ω · ω dx. As usual, if we use the Hölder inequality and
the Young inequality, we get R3 u · ∇ω · ω dx
≤∥u∥L6∥∇ω∥L3∥ω∥L2 ≤∥∇u∥L2∥∇ω∥
1
2
L2∥ω∥
3
2
L2
≤1
4∥ω∥2
L2 + C∥∇u∥4
L2∥∇ω∥2
L2, ≤1
4∥ω∥2
L2 + C∥∇u∥4
L2∥∇ω∥2
L2, which does not work. Thanks to the L3-norm estimate of ω and some suitable interpo-
lating inequality, which can be found in Sect. 3, we can overcome these difficulties. More
precisely, these methods helps us to handle
R3 u · ∇ω · ω dx and
R3 ∇u · ∇2ω · ω dx
successfully. The rest of this paper is organized as follows. The definition of some functional spaces
and some useful lemmas are presented in Sect. 2. The L3-norm of ω is given in Sect. 3. then the local strong solution (u,b) can be smoothly extended beyond t = T. The proof of Theorem 1.1 is presented in Sect. 4. ˙Mp,q is the dual space of Zp′,q′. 2 Preliminaries and some basic facts Lemma 2.2 (see [1]) There exists a constant C > 0 such that Lemma 2.2 (see [1]) There exists a constant C > 0 such that ∥φ∥Lp ≤C∥φ∥
6–p
2p
L2 ∥∂1φ∥
p–2
2p
L2 ∥∂2φ∥
p–2
2p
L2 ∥∂3φ∥
p–2
2p
L2 ,
(2.1) (2.1) for every φ ∈H1(R3) and every p ∈[2,6], where C is a constant depending only on p for every φ ∈H1(R3) and every p ∈[2,6], where C is a constant depending only on p. The definition of a weak solution to the magnetic micropolar equation is provided in
the following. Definition 2.3 Let (u0,b0) ∈L2
σ(R3),ω ∈L2(R3) and T > 0. A measurable function (u,b,ω)
is said to be a weak solution to (1.1) on (0,T) if Definition 2.3 Let (u0,b0) ∈L2
σ(R3),ω ∈L2(R3) and T > 0. A measurable function (u,b,ω)
is said to be a weak solution to (1.1) on (0,T) if (i) (u,b) ∈L∞(0,T;L2
σ(R3))∩L2(0,T;H1(R3)), and ω ∈L∞(0,T;L2(R3))∩L2(0,T;H1(R3));
(ii) for every φ,ϕ ∈H1(0,T;H1
σ(R3)) and ψ ∈H1(0,T;H1(R3)) with φ(T) = ϕ(T) =
ψ(T) = 0, T
0
⟨–u,∂tφ⟩+ ⟨u · ∇u,φ⟩+ (μ + χ)⟨∇u,∇φ⟩dt
–
T
0
⟨b · ∇b,φ⟩+ χ⟨∇× ω,φ⟩dt = –⟨u0,φ0⟩,
T
0
⟨–ω,∂tϕ⟩+ γ ⟨ω,∇ϕ⟩+ κ⟨∇· u,∇· ϕ⟩dt
+
T
0
⟨u · ∇ω,ϕ⟩+ 2χ⟨ω,ϕ⟩– 2χ⟨∇× u,ϕ⟩dt = –⟨ω0,φ0⟩, and T
0
⟨–b,∂tψ⟩+ ⟨u · ∇b,ψ⟩– ⟨b · ∇u,ψ⟩dt = –⟨b0,ψ0⟩, where L2
σ = {u|u ∈L2,∇· u = 0}. where L2
σ = {u|u ∈L2,∇· u = 0}. 2 Preliminaries and some basic facts In this section, we will present some information on the Morrey space and introduce the
definition of a weak solution to the magneto-micropolar equation (1.1). Definition 2.1 (see [10]) For 1 < q ≤p ≤∞, the homogeneous Morrey space is presented
as follows: ˙Mp,q =
f ∈Lq
loc
R3
: ∥f ∥˙Mp,q(R3) = sup
x∈R3 sup
R>0
R
3
p – 3
q ∥f ∥Lq(B(x,R)) < ∞
, where B(x,R) denotes the closed ball in R3 with center x and radius R. where B(x,R) denotes the closed ball in R3 with center x and radius R. Definition 2.2 (see [10]) Let 1 < p′ ≤q′ < ∞, we address the homogeneous space Zp′,q′
defined by Zp′,q′ =
f ∈Lp′|f =
k∈N
gk,
where (gk) ⊂Lq′
comp
R3
,
k∈N
d
3( 1
p′ – 1
q′ )
k
∥gk∥Lq′ < ∞,
where ∀k,dk = diam(suppgk) < ∞
. The following lemma plays a crucial role in proving the regularity criterion for the
magneto-micropolar fluid flows (1.1). Lemma 2.1 (see [10]) (1) Let 1 < p′ ≤q′ < ∞and p,q such that 1
p + 1
p′ = 1, 1
q + 1
q′ = 1, then
˙Mp,q is the dual space of Zp′,q′. Lemma 2.1 (see [10]) (1) Let 1 < p′ ≤q′ < ∞and p,q such that 1
p + 1
p′ = 1, 1
q + 1
q′ = 1, then
˙M
i th d
l
f Z ˙Mp,q is the dual space of Zp′,q′. Page 5 of 15 ( 2021) 2021:62 Chen and Liu Boundary Value Problems (2) Let 1 < p′ ≤q′ < 2, 1
p + 1
p′ = 1, 1
q + 1
q′ = 1 and r = 3
p, there exists C > 0 such that ∀f ∈
L2(R3) and ∀g ∈˙Hr(R3),h ∈˙Mp,q(R3) satisfies R3
f (x)g(x)h(x)
dx ≤C∥h∥˙Mp,q∥fg∥Zp′,q′ ≤C∥h∥˙Mp,q∥f ∥L2∥g∥˙Hr. The Sobolev–Ladyzhenskaya inequality in the whole space R3 reads as follows. 3 Some useful lemmas The following L3-energy estimate is needed to prove our result. The following L3-energy estimate is needed to prove our result. Lemma 3.1 Let (u,ω,b) be the weak solution to the magneto-micropolar equation (1.1). Then Lemma 3.1 Let (u,ω,b) be the weak solution to the magneto-micropolar equation (1.1).
Then Integrating on [0,t) and using (4.1) yield ∥ω∥3
L3 +
t
0
∇|ω|
3
2 2
L2 dτ ≤∥ω0∥3
L3 + C
t
0
∥∇u∥2
L2 + 1
dτ
≤C
∥ω0∥L3,∥ω0∥L2,∥u0∥L2,∥b0∥L2,T
. □ ∥ω∥3
L3 +
t
0
∇|ω|
3
2 2
L2 dτ ≤∥ω0∥3
L3 + C
t
0
∥∇u∥2
L2 + 1
dτ ≤C
∥ω0∥L3,∥ω0∥L2,∥u0∥L2,∥b0∥L2,T
. □ ≤C
∥ω0∥L3,∥ω0∥L2,∥u0∥L2,∥b0∥L2,T
. □ □ Lemma 3.1 Let (u,ω,b) be the weak solution to the magneto-micropolar equation (1.1).
Then ∥ω∥3
L3 +
t
0
∇|ω|
3
2 2
L2 dτ ≤C
∥ω0∥L3,∥ω0∥L2,∥u0∥L2,∥b0∥L2,T
,
(3.1) (3.1) for any t ∈[0,T). for any t ∈[0,T). for any t ∈[0,T). ms ( 2021) 2021:62
Page 6 of 15 Chen and Liu Boundary Value Problems ( 2021) 2021:62 ( 2021) 2021:62 Page 6 of 15 Chen and Liu Boundary Value Problems Proof Multiplying (1.1)2 by |ω|ω and integrating over R3, we have Proof Multiplying (1.1)2 by |ω|ω and integrating over R3, we have 1
3
d
dt ∥ω∥3
L3 + 2∥ω∥3
L3 + 4
9
∇|ω|
3
2 2
L2 + 1
2
|ω|
1
2 ∇ω
2
L2 + 1
2
|ω|
1
2 ∇· ω
2
L2
≤
R3 ∇× u·
ω|ω dx|,
(3.2) 1
3
d
dt ∥ω∥3
L3 + 2∥ω∥3
L3 + 4
9
∇|ω|
3
2 2
L2 + 1
2
|ω|
1
2 ∇ω
2
L2 + 1
2
|ω|
1
2 ∇· ω
2
L2 (3.2) ≤
R3 ∇× u·
ω|ω dx|,
(3.2) ≤
R3 ∇× u·
ω|ω dx|, where we have used R3(∇· ω)∇·
|ω|ω
dx =
R3 ∇· ω
|ω|∇· ω + ω∇|ω|
dx
=
|ω|
1
2 ∇· ω
2
L2 +
R3 ∇· ω · ω · ∇|ω|dx
≥1
2
|ω|
1
2 ∇· ω
2
L2 – 1
2
|ω|
1
2 ∇ω
2
L2. To estimate the nonlinear term on the right hand side, integrating by parts and using the
Young inequality and (4.1), we obtain R3 ∇× u · |ω|ω dx ≤
R3 |u||ω|
∇|ω|
dx +
R3 |u||ω||∇× ω|dx
≤C
R3 |u||ω||∇ω|dx
≤C∥u∥L3∥|ω|
1
2 ∥L6
|ω|
1
2 ∇ω
L2
≤1
4
|ω|
1
2 ∇ω
2
L2 + 1
2∥ω∥3
L3 + C∥∇u∥
3
2
L2
≤1
4
|ω|
1
2 ∇ω
2
L2 + 1
2∥ω∥3
L3 + C
∥∇u∥2
L2 + 1
. (3.3) (3.3) Substituting the above inequality into (3.2) gives Substituting the above inequality into (3.2) gives d
dt ∥ω∥3
L3 + ∥ω∥3
L3 +
∇|ω|
3
2 2
L2 + 3
4
|ω|
1
2 ∇ω
2
L2 +
|ω|
1
2 ∇· ω
2
L2
≤C
∥∇u∥2
L2 + 1
. 4 Proof of Theorem 1.1 4 Proof of Theorem 1.1
In this section, we shall give the proof of Theorem 1.1. We will assume that μ = χ = γ =
κ = 1 throughout this paper. Let [0,T∗) be the maximal time interval for the existence of the local smooth solution. If T∗≥T, the conclusion is obviously valid, but for T∗< T, we would show that limsupt→T∗
∇u(·,t)
2
L2 +
∇ω(·,t)
2
L2 +
∇b(·,t)
2
L2
≤C Chen and Liu Boundary Value Problems ( 2021) 2021:62
Page 7 of 15 ( 2021) 2021:62
Page 7 of 15 ( 2021) 2021:62 Chen and Liu Boundary Value Problems Page 7 of 15 under the assumption of (1.3) and (1.4). Hence, according to the definition of T∗, this leads
to a contradiction. Step 1: L2-energy estimate A standard energy method says Step 1: L2-energy estimate A standard energy method says
u(t),ω(t),b(t)
2
L2 + 2
t
0
∥∇u∥2
L2 dτ + 2
t
0
∥∇ω∥2
L2 dτ
+ 2
t
0
∥∇· ω∥2
L2 dτ + 2
t
0
∥ω∥2
L2 dτ ≤
(u0,ω0,b0)
2
L2. (4.1) (4.1) Step 2: H1-Horizontal energy estimate p 2: H1-Horizontal energy estimate We first establish the horizontal gradient of the velocity u and magnetic field b. Taking
∇h on both sides of Eqs. (1.1)1 and (1.1)3, multiplying by ∇hu and ∇hb, respectively, and
integrating over R3, we get 1
2
d
dt
∥∇hu∥2
L2 + ∥∇hb∥2
L2
+ 2∥∇h∇u∥2
L2
= –
R3 ∇h(u · ∇u) · ∇hudx
+
R3
∇h(b · ∇b) · ∇hu + ∇h(b · ∇u) · ∇hb – ∇h(u · ∇b) · ∇hb
dx
+
R3 ∇h(∇× ω) · ∇hudx
(4.2) 1
2
d
dt
∥∇hu∥2
L2 + ∥∇hb∥2
L2
+ 2∥∇h∇u∥2
L2 = –
R3 ∇h(u · ∇u) · ∇hudx (4.2) +
R3 ∇h(∇× ω) · ∇hudx := A1 + A2 + A3. := A1 + A2 + A3. We start to estimate A2. From (1.1)4 and Lemma 2.1 and the fact ∇·u = ∇·b = 0, we know
that (p ≥3) A2 =
R3
2
k=1
∂k(b · ∇b)∂kudx +
R3
2
k=1
∂k(b · ∇u)∂kbdx
–
R3
2
k=1
∂k(u · ∇b)∂kbdx
=
R3
2
k=1
(∂kb · ∇b∂ku + ∂kb · ∇u∂kb)dx –
R3
2
k=1
∂ku · ∇b∂kbdx
≤C
R3 |∇b||∇u||∇b|dx ≤C∥∇b∥˙Mp,q∥∇b∥L2∥∇u∥˙H
3p
≤C∥∇b∥˙Mp,q∥∇b∥L2∥∇u∥
1– 3
p
L2 ∥u∥
3
p
L2. (4.3) (4.3) ≤C∥∇b∥˙Mp,q∥∇b∥L2∥∇u∥
1– 3
p
L2 ∥u∥
3
p
L2. Thanks to the Hölder and Young inequalities, one deduces Thanks to the Hölder and Young inequalities, one deduces A3 =
R3
2
k=1
∂k(∇× ω) · ∂kudx –
R3
2
k=1
∇× ω · ∂k∂kudx
≤C∥∇× ω∥L2∥∇h∇u∥L2
≤1
2∥∇h∇u∥2
L2 + C∥∇ω∥2
L2. (4.4) (4.4) ≤1
2∥∇h∇u∥2
L2 + C∥∇ω∥2
L2. s ( 2021) 2021:62
Page 8 of 15 Page 8 of 15 ( 2021) 2021:62 Chen and Liu Boundary Value Problems Now it is time to deal with the first term A1. Step 2: H1-Horizontal energy estimate Integrating by parts, we get A1 =
R3 u · ∇u · hudx
=
R3
2
k=1
2
i,j=1
ui∂iuj∂k∂kuj dx +
R3
2
k=1
2
i=1
ui∂iu3∂k∂ku3 dx
(4.5) A1 =
R3 u · ∇u · hudx
=
R3
2
k=1
2
i,j=1
ui∂iuj∂k∂kuj dx +
R3
2
k=1
2
i=1
ui∂iu3∂k∂ku3 dx
+
R3
2
k=1
3
j=1
u3∂3uj∂k∂kuj dx
(4.5) =
R3
2
k=1
2
i,j=1
ui∂iuj∂k∂kuj dx +
R3
2
k=1
2
i=1
ui∂iu3∂k∂ku3 dx
(4.5) (4.5) +
R3
2
k=1
3
j=1
u3∂3uj∂k∂kuj dx
(
) := A11 + A12 + A13. := A11 + A12 + A13. := A11 + A12 + A13. Step 2: H1-Horizontal energy estimate Substituting (4.6) and (4.7) into (4.5) yields Substituting (4.6) and (4.7) into (4.5) yields A1 ≤C
R3 |u3||∇u||∇h∇u|dx. (4.8) (4.8) Thanks to the Hölder inequality, (2.1) and the Young inequality, we obtain for α > 3 Thanks to the Hölder inequality, (2.1) and the Young inequality, we obtain for α > 3 A1 ≤C∥u3∥Lα∥∇h∇u∥L2∥∇u∥
L
2α
α–2
≤C∥u3∥Lα∥∇h∇u∥L2∥∇u∥
1– 3
α
L2 ∥∇u∥
3
α
L6
≤C∥u3∥Lα∥∇h∇u∥L2∥∇u∥
1– 3
α
L2 ∥∇h∇u∥
2
α
L2∥∂3∇u∥
1
α
L2
≤1
2∥∇h∇u∥2
L2 + C∥u3∥
2α
α–2
Lα ∥∇u∥
2(α–3)
α–2
L2
∥u∥
2
α–2
L2 ,
(4.9) (4.9) which, along with (4.3), (4.4) and (4.2), gives which, along with (4.3), (4.4) and (4.2), gives which, along with (4.3), (4.4) and (4.2), gives d
dt
∥∇hu∥2
L2 + ∥∇hb∥2
L2
+ 2∥∇h∇u∥2
L2
≤C∥u3∥
2α
α–2
Lα ∥∇u∥
2(α–3)
α–2
L2
∥u∥
2
α–2
L2
+ C∥∇ω∥2
L2
+ C∥∇b∥˙Mp,q∥∇b∥L2∥∇u∥
1– 3
p
L2 ∥u∥
3
p
L2. (4.10) (4.10) Integrating over [0,t) and using (4.1), one can verify sup
0≤τ≤t
∥∇hu∥2
L2 + ∥∇hb∥2
L2
+ 2
t
0
∥∇h∇u∥2
L2 dτ
≤C
∥∇hu0∥2
L2 + ∥∇hb0∥2
L2 + 1
+ C
t
0
∥u3∥
2α
α–2
Lα ∥∇u∥
2(α–3)
α–2
L2
∥u∥
2
α–2
L2 dτ
+ C
t
0
∥∇b∥˙Mp,q∥∇b∥L2∥∇u∥
1– 3
p
L2 ∥u∥
3
p
L2 dτ. (4.11) (4.11) Step 2: H1-Horizontal energy estimate Using integration by parts again and applying the fact that divu = 0, it yields Using integration by parts again and applying the fact that divu = 0, it yields A11 = –
R3
2
k=1
2
i,j=1
(∂kui∂iuj∂kuj + ui∂i∂kuj∂kuj)dx
=
R3
2
k=1
2
i,j=1
∂kui∂iuj∂kuj dx + 1
2
R3
2
k=1
2
i,j=1
∂iui∂kuj∂kuj dx
=
R3
2
k=1
2
i,j=1
∂kui∂iuj∂kuj dx – 1
2
R3
2
k=1
2
j=1
∂3u3∂kuj∂kuj dx
=
R3
2
k=1
2
i,j=1
∂kui∂iuj∂kuj dx – 1
2
R3
2
k=1
2
j=1
∂3u3∂kuj∂kuj dx
= –
R3 ∂3u3
(∂1u2)2 + ∂2u1∂1u2 + (∂2u1)2 + (∂1u1)2 – ∂1u1∂2u2 + (∂2u2)2
dx
– 1
2
R3
2
k=1
2
j=1
∂3u3∂kuj∂kuj
(4.6) A11 = –
R3
2
k=1
2
i,j=1
(∂kui∂iuj∂kuj + ui∂i∂kuj∂kuj)dx
=
R3
2
k=1
2
i,j=1
∂kui∂iuj∂kuj dx + 1
2
R3
2
k=1
2
i,j=1
∂iui∂kuj∂kuj dx
=
R3
2
k=1
2
i,j=1
∂kui∂iuj∂kuj dx – 1
2
R3
2
k=1
2
j=1
∂3u3∂kuj∂kuj dx
=
R3
2
k=1
2
i,j=1
∂kui∂iuj∂kuj dx – 1
2
R3
2
k=1
2
j=1
∂3u3∂kuj∂kuj dx
(4.6) (4.6) = –
R3 ∂3u3
(∂1u2)2 + ∂2u1∂1u2 + (∂2u1)2 + (∂1u1)2 – ∂1u1∂2u2 + (∂2u2)2
dx – 1
2
R3
2
k=1
2
j=1
∂3u3∂kuj∂kuj – 1
2
R3
2
k=1
2
j=1
∂3u3∂kuj∂kuj and A12 = –
R3
2
k=1
2
i=1
(∂kui∂iu3∂ku3 + ui∂i∂ku3∂ku3)dx
=
R3
2
k=1
2
i=1
(∂k∂iuiu3∂ku3 + ∂kuiu3∂k∂iu3)dx
+ 1
2
R3
2
k=1
2
i=1
∂iui∂ku3∂ku3 dx
=
R3
2
k=1
2
i=1
(∂k∂iuiu3∂ku3 + ∂kuiu3∂k∂iu3)dx
– 1
2
R3
2
k=1
∂3u3∂ku3∂ku3 dx
=
R3
2
k=1
2
i=1
(∂k∂iuiu3∂ku3 + ∂kuiu3∂k∂iu3)dx A12 = –
R3
2
k=1
2
i=1
(∂kui∂iu3∂ku3 + ui∂i∂ku3∂ku3)dx =
R3
2
k=1
2
i=1
(∂k∂iuiu3∂ku3 + ∂kuiu3∂k∂iu3)dx (4.7) Chen and Liu Boundary Value Problems ( 2021) 2021:62 Page 9 of 15 ( 2021) 2021:62 Chen and Liu Boundary Value Problems ( 2021) 2021:62 Chen and Liu Boundary Value Problems +
R3
2
k=1
u3∂3∂ku3∂ku3 dx. Step 3: H1-full energy estimate Multiplying (1.1)1,(1.1)2 and (1.1)3 by –u,–ω and –b, respectively, and integrating
over R3, then adding them we obtain 1
2
d
dt
∥∇u∥2
L2 + ∥∇ω∥2
L2 + ∥∇b∥2
L2
+ 2∥u∥2
L2 + ∥ω∥2
L2 + ∥∇∇· ω∥2
L2
=
R3 u · ∇u · udx –
R3 b · ∇b · udx +
R3 u · ∇ω · ω dx
– 2
R3 ∇× u · ω dx +
R3 u · ∇b · bdx –
R3 b · ∇u · bdx
B
B
B
B
B
B
(4.12) (4.12) := B1 + B2 + B3 + B4 + B5 + B6, := B1 + B2 + B3 + B4 + B5 + B6, Chen and Liu Boundary Value Problems ( 2021) 2021:62 Page 10 of 15 Chen and Liu Boundary Value Problems ( 2021) 2021:62 ( 2021) 2021:62 Liu Boundary Value Problems ( 2021) 2021:62 where we have used the inequalities where we have used the inequalities R3(–∇∇· ω)(–ω)dx =
3
i,j,k=1
R3 ∂i∂jωj∂k∂kωi dx
=
3
i,j,k=1
R3 ∂k∂jωj∂k∂iωi dx
= ∥∇∇· ω∥2
L2 = ∥∇∇· ω∥2
L2 and R3 ∇× ω · udx =
R3 ω · ∇× udx. Now, we estimate B2,B5 and B6. After applying integration by parts, divu = divb = 0, the
Hölder inequality, Lemma 2.1, the Sobolev interpolation inequality and the Young inequal-
ity, we have B2 + B5 + B6
=
R3 ∇b · ∇b · ∇udx –
R3 ∇u · ∇b · ∇bdx +
R3 ∇b · ∇u · ∇bdx
≤C
R3 |∇b||∇u||∇b|dx
≤C∥∇b∥˙Mp,q∥∇b∥L2∥∇u∥˙H
3p
≤C∥∇b∥˙Mp,q∥∇b∥L2∥∇u∥
1– 3
p
L2 ∥u∥
3
p
L2
≤1
4∥u∥2
L2 + C∥∇b∥
2p
2p–3
˙Mp,q ∥∇b∥
2p
2p–3
L2
∥∇u∥
2(p–3)
2p–3
L2
≤1
4∥u∥2
L2 + C∥∇b∥
2p
2p–3
˙Mp,q
∥∇b∥2
L2 + ∥∇u∥2
L2
. (4.13) ≤C∥∇b∥˙Mp,q∥∇b∥L2∥∇u∥˙H
3p
≤C∥∇b∥˙Mp,q∥∇b∥L2∥∇u∥
1– 3
p
L2 ∥u∥
3
p
L2
≤1
4∥u∥2
L2 + C∥∇b∥
2p
2p–3
˙Mp,q ∥∇b∥
2p
2p–3
L2
∥∇u∥
2(p–3)
2p–3
L2
≤1
4∥u∥2
L2 + C∥∇b∥
2p
2p–3
˙Mp,q
∥∇b∥2
L2 + ∥∇u∥2
L2
. (4.13) We can infer from the Hölder and the Young inequalities that We can infer from the Hölder and the Young inequalities that B4 ≤2
R3 ∇(∇× u) · ∇ω dx ≤1
4∥u∥2
L2 + C∥∇ω∥2
L2. Similarly, the term B32 can be bounded as follows: Similarly, the term B32 can be bounded as follows: Similarly, the term B32 can be bounded as follows: B32 ≤
R3 |u||∇ω||ω|dx ≤∥u∥L2∥ω∥Lα∥∇ω∥
L
2α
α–2
≤∥u∥L2∥ω∥
9–α
2α
L3 ∥ω∥
3α–9
2α
L9
∥∇ω∥
1– 3
α
L2 ∥∇ω∥
3
α
L6
≤∥u∥L2∥|ω|
3
2 ∥
1– 3
α
L6 ∥∇ω∥
1– 3
α
L2 ∥ω∥
3
α
L2
≤∥u∥L2
∇|ω|
3
2 1– 3
α
L2 ∥∇ω∥
1– 3
α
L2 ∥ω∥
3
α
L2
≤1
4∥u∥2
L2 + C
∇|ω|
3
2 2(1– 3
α )
L2
∥∇ω∥
2(1– 3
α )
L2
∥ω∥
6
α
L2
≤1
4∥u∥2
L2 + 1
4∥ω∥2
L2 + C
∇|ω|
3
2 2
L2∥∇ω∥2
L2. B32 ≤
R3 |u||∇ω||ω|dx ≤∥u∥L2∥ω∥Lα∥∇ω∥
L
2α
α–2
≤∥u∥L2∥ω∥
9–α
2α
L3 ∥ω∥
3α–9
2α
L9
∥∇ω∥
1– 3
α
L2 ∥∇ω∥
3
α
L6
≤∥u∥L2∥|ω|
3
2 ∥
1– 3
α
L6 ∥∇ω∥
1– 3
α
L2 ∥ω∥
3
α
L2
≤∥u∥L2
∇|ω|
3
2 1– 3
α
L2 ∥∇ω∥
1– 3
α
L2 ∥ω∥
3
α
L2
≤1
4∥u∥2
L2 + C
∇|ω|
3
2 2(1– 3
α )
L2
∥∇ω∥
2(1– 3
α )
L2
∥ω∥
6
α
L2
≤1
4∥u∥2
L2 + 1
4∥ω∥2
L2 + C
∇|ω|
3
2 2
L2∥∇ω∥2
L2. Step 3: H1-full energy estimate (4.14) (4.14) Applying integration by parts we obtain Applying integration by parts we obtain B3 = –
R3 ∇u · ∇ω · ∇ω dx
=
R3 ∇u · ∇(∇ω) · ω dx +
R3 ∇(∇u) · ∇ω · ω dx
(4.15) B3 = –
R3 ∇u · ∇ω · ∇ω dx
=
R3 ∇u · ∇(∇ω) · ω dx +
R3 ∇(∇u) · ∇ω · ω dx (4.15) := B31 + B32. := B31 + B32. ms ( 2021) 2021:62
Page 11 of 15 Page 11 of 15 ( 2021) 2021:62 Chen and Liu Boundary Value Problems Thanks to the Hölder inequality, the interpolation inequality with 3 ≤α ≤9 and
Lemma 3.1, we arrive at Thanks to the Hölder inequality, the interpolation inequality with 3 ≤α ≤9 and
Lemma 3.1, we arrive at B31 ≤
R3 |∇u||ω||ω|dx ≤∥ω∥L2∥ω∥Lα∥∇u∥
L
2α
α–2
≤∥ω∥L2∥ω∥
9–α
2α
L3 ∥ω∥
3α–9
2α
L9
∥∇u∥
1– 3
α
L2 ∥∇u∥
3
α
L6
≤∥ω∥L2∥|ω|
3
2 ∥
1– 3
α
L6 ∥∇u∥
1– 3
α
L2 ∥u∥
3
α
L2
≤∥ω∥L2
∇|ω|
3
2 1– 3
α
L2 ∥∇u∥
1– 3
α
L2 ∥u∥
3
α
L2
≤1
4∥ω∥2
L2 + C
∇|ω|
3
2 2(1– 3
α )
L2
∥∇u∥
2(1– 3
α )
L2
∥u∥
6
α
L2
≤1
4∥ω∥2
L2 + 1
4∥u∥2
L2 + C
∇|ω|
3
2 2
L2∥∇u∥2
L2. (4.16) (4.16) Similarly, the term B32 can be bounded as follows: (4.17) For the term B1, similar to A1, we find that For the term B1, similar to A1, we find that B1 =
R3 u · ∇u · hudx +
R3 u · ∇u · ∂3∂3udx B1 =
R3 u · ∇u · hudx +
R3 u · ∇u · ∂3∂3udx B1 =
R3 u · ∇u · hudx +
R3 u · ∇u · ∂3∂3udx
= –
R3
2
k=1
3
i,j=1
∂kui∂iuj∂kuj dx –
R3
2
k=1
3
i,j=1
ui∂i∂kuj∂kuj dx
+
R3
3
i,j=1
ui∂iuj∂3∂3uj dx
= –
R3
2
k=1
3
i,j=1
∂kui∂iuj∂kuj dx –
R3
3
i,j=1
∂3ui∂iuj∂3uj dx
–
R3
3
i,j=1
ui∂i∂3uj∂3uj dx
= –
R3
2
k=1
3
i,j=1
∂kui∂iuj∂kuj dx –
R3
3
j=1
2
i=1
∂3ui∂iuj∂3uj dx = –
R3
2
k=1
3
i,j=1
∂kui∂iuj∂kuj dx –
R3
2
k=1
3
i,j=1
ui∂i∂kuj∂kuj dx
+
R3
3
i,j=1
ui∂iuj∂3∂3uj dx = –
R3
2
k=1
3
i,j=1
∂kui∂iuj∂kuj dx –
R3
2
k=1
3
i,j=1
ui∂i∂kuj∂kuj dx = –
R3
2
k=1
3
i,j=1
∂kui∂iuj∂kuj dx –
R3
3
i,j=1
∂3ui∂iuj∂3uj dx = –
R3
2
k=1
3
i,j=1
∂kui∂iuj∂kuj dx –
R3
3
j=1
2
i=1
∂3ui∂iuj∂3uj dx
(4.18) (4.18) Chen and Liu Boundary Value Problems ( 2021) 2021:62 Page 12 of 15 ( 2021) 2021:62 Chen and Liu Boundary Value Problems ( 2021) 2021:62 Chen and Liu Boundary Value Problems –
R3
3
j=1
∂3u3∂3uj∂3uj dx
≤C
R3 |∇hu||∇u|2 dx ≤C∥∇hu∥L2∥∇u∥2
L4
≤C∥∇hu∥L2∥∇u∥
1
2
L2∥∇u∥
3
2
L6
≤C∥∇hu∥L2∥∇u∥
1
2
L2∥∂1∇u∥
1
2
L2∥∂2∇u∥
1
2
L2∥∂3∇u∥
1
2
L2
≤C∥∇hu∥L2∥∇u∥
1
2
L2∥∇h∇u∥L2∥u∥
1
2
L2. –
R3
3
j=1
∂3u3∂3uj∂3uj dx
≤C
R3 |∇hu||∇u|2 dx ≤C∥∇hu∥L2∥∇u∥2
L4
≤C∥∇hu∥L2∥∇u∥
1
2
L2∥∇u∥
3
2
L6
≤C∥∇hu∥L2∥∇u∥
1
2
L2∥∂1∇u∥
1
2
L2∥∂2∇u∥
1
2
L2∥∂3∇u∥
1
2
L2
≤C∥∇hu∥L2∥∇u∥
1
2
L2∥∇h∇u∥L2∥u∥
1
2
L2. Combining (4.13), (4.14), (4.16), (4.17) and (4.18), then (4.12) becomes Combining (4.13), (4.14), (4.16), (4.17) and (4.18), then (4.12) becomes d
dt
∥∇u∥2
L2 + ∥∇ω∥2
L2 + ∥∇b∥2
L2
+ ∥u∥2
L2 + ∥ω∥2
L2 + ∥∇ω∥2
L2
≤C
∥∇b∥
2p
2p–3
˙Mp,q +
∇|ω|
3
2 2
L2
∥∇u∥2
L2 + ∥∇ω∥2
L2 + ∥∇b∥2
L2
+ C∥∇ω∥2
L2 + C∥∇hu∥L2∥∇u∥
1
2
L2∥∇h∇u∥L2∥u∥
1
2
L2. (4.19) (4.19) ntegrating over [0,t] yields Integrating over [0,t] yields
∥∇u∥2
L2 + ∥∇ω∥2
L2 + ∥∇b∥2
L2
+
t
0
∥u∥2
L2 + ∥ω∥2
L2 dτ
≤C
t
0
∥∇b∥
2p
2p–3
˙Mp,q +
∇|ω|
3
2 2
L2
∥∇u∥2
L2 + ∥∇ω∥2
L2 + ∥∇b∥2
L2
dτ
+ C
∥∇u0∥2
L2 + ∥∇ω0∥2
L2 + ∥∇b0∥2
L2 + 1
+ CG(t),
(4.20) (4.20) where G(t) =
t
0
∥∇hu∥L2∥∇h∇u∥L2∥∇u∥
1
2
L2∥u∥
1
2
L2 dτ. We proceed to estimate G(t). Combining (4.13), (4.14), (4.16), (4.17) and (4.18), then (4.12) becomes From (4.1) and (4.11), we deduce that G(t) ≤sup
0≤τ≤t
∥∇hu∥L2
t
0
∥∇h∇u∥2
L2 dτ
1
2
t
0
∥∇u∥2
L2
1
4
t
0
∥u∥2
L2 dτ
1
4
≤C
sup
0≤τ≤t
∥∇hu∥2
L2 +
t
0
∥∇h∇u∥2
L2 dτ
t
0
∥u∥2
L2 dτ
1
4
≤C
∥∇hu0∥2
L2 + ∥∇hb0∥2
L2 + 1
+
t
0
∥u3∥
2α
α–2
Lα ∥∇u∥
2(α–3)
α–2
L2
∥u∥
2
α–2
L2 dτ
+
t
0
∥∇b∥˙Mp,q∥∇b∥L2∥∇u∥
1– 3
p
L2 ∥u∥
3
p
L2 dτ
t
0
∥u∥2
L2 dτ
1
4
≤C
∥∇hu0∥
8
3
L2 + ∥∇hb0∥
8
3
L2 + 1
+ C
t
0
∥u3∥
2α
α–2
Lα ∥∇u∥
2(α–3)
α–2
L2
∥u∥
2
α–2
L2 dτ
4
3
+
t
0
∥∇b∥˙Mp,q∥∇b∥L2∥∇u∥
1– 3
p
L2 ∥u∥
3
p
L2 dτ
4
3
+ 1
4
t
0
∥u∥2
L2 dτ ms ( 2021) 2021:62
Page 13 of 15 Chen and Liu Boundary Value Problems ( 2021) 2021:62 Chen and Liu Boundary Value Problems ( 2021) 2021:62 ( 2021) 2021:62 Page 13 of 15 Chen and Liu Boundary Value Problems ≤C
∥∇hu0∥
8
3
L2 + ∥∇hb0∥
8
3
L2 + 1
+ 1
4
t
0
∥u∥2
L2 dτ
+
t
0
∥u3∥
2α
α–3
Lα ∥∇u∥2
L2 dτ
4(α–3)
3(α–2)
t
0
∥u∥2
L2 dτ
4
3(α–2)
+ C
t
0
∥∇b∥
2p
2p–3
˙Mp,q ∥∇b∥
2p
2p–3
L2
∥∇u∥
2(p–3)
2p–3
L2
dτ
2(2p–3)
3p
t
0
∥u∥2
L2 dτ
2
p
≤C
∥∇hu0∥
8
3
L2 + ∥∇hb0∥
8
3
L2 + 1
+ 3
4
t
0
∥u∥2
L2 dτ
+ C
t
0
∥u3∥
2α
α–3
Lα ∥∇u∥2
L2 dτ
4(α–3)
3α–10 ≤C
∥∇hu0∥
8
3
L2 + ∥∇hb0∥
8
3
L2 + 1
+ 1
4
t
0
∥u∥2
L2 dτ
+
t
0
∥u3∥
2α
α–3
Lα ∥∇u∥2
L2 dτ
4(α–3)
3(α–2)
t
0
∥u∥2
L2 dτ
4
3(α–2)
+ C
t
0
∥∇b∥
2p
2p–3
˙Mp,q ∥∇b∥
2p
2p–3
L2
∥∇u∥
2(p–3)
2p–3
L2
dτ
2(2p–3)
3p
t
0
∥u∥2
L2 dτ
2
p
≤C
∥∇hu0∥
8
3
L2 + ∥∇hb0∥
8
3
L2 + 1
+ 3
4
t
0
∥u∥2
L2 dτ
+ C
t
0
∥u3∥
2α
α–3
Lα ∥∇u∥2
L2 dτ
4(α–3)
3α–10
+ C
t
0
∥∇b∥
2p
2p–3
˙Mp,q ∥∇b∥
2p
2p–3
L2
∥∇u∥
2(p–3)
2p–3
L2
dτ
2(2p–3)
3(p–2)
≤C
∥∇hu0∥
8
3
L2 + ∥∇hb0∥
8
3
L2 + 1
+ 3
4
t
0
∥u∥2
L2 dτ
+ C
t
0
∥u3∥
2α
α–3
Lα ∥∇u∥2
L2 dτ
4(α–3)
3α–10
2(2p–3) + C
t
0
∥∇b∥
2p
2p–3
˙Mp,q ∥∇b∥
2p
2p–3
L2
∥∇u∥
2(p–3)
2p–3
L2
dτ
2(2p–3)
3(p–2)
≤C
∥∇hu0∥
8
3
L2 + ∥∇hb0∥
8
3
L2 + 1
+ 3
4
t
0
∥u∥2
L2 dτ
+ C
t
0
∥u3∥
2α
α–3
Lα ∥∇u∥2
L2 dτ
4(α–3)
3α–10 + C
t
0
∥∇b∥
2p
2p–3
˙Mp,q
∥∇b∥2
L2 + ∥∇u∥2
L2
dτ
2(2p–3)
3(p–2)
≤C
∥∇hu0∥
8
3
L2 + ∥∇hb0∥
8
3
L2 + 1
+ 3
4
t
0
∥u∥2
L2 dτ
C
t
∥
∥
2α
α 3 ∥∇∥
3α–10
2(α 3) ∥∇∥
α–2
2(α 3) d
4(α–3)
3α–10
0
+ C
t
0
∥∇b∥
2p
2p–3
˙Mp,q
∥∇b∥
3(p–2)
2p–3
L2
+ ∥∇u∥
3(p–2)
2p–3
L2
∥∇b∥
p
2p–3
L2
+ ∥∇u∥
p
2p–3
L2
dτ
2(2p–3)
3(p–2)
≤C
∥∇hu0∥
8
3
L2 + ∥∇hb0∥
8
3
L2 + 1
+ 3
4
t
0
∥u∥2
L2 dτ
+ C
t
0
∥u3∥
8α
3α–10
Lα
∥∇u∥2
L2 dτ
t
0
∥∇u∥2
L2 dτ
α–2
3α–10
+ C
t
0
∥∇b∥
4p
3(p–2)
˙Mp,q
∥∇b∥2
L2 + ∥∇u∥2
L2
dτ
t
0
∥∇b∥2
L2 + ∥∇u∥2
L2 dτ
p
3(p–2)
≤C
∥∇hu0∥
8
3
L2 + ∥∇hb0∥
8
3
L2 + 1
+ 3
4
t
0
∥u∥2
L2 dτ
+ C
t
0
∥u3∥
8α
3α–10
Lα
+ ∥∇b∥
4p
3(p–2)
˙Mp,q
∥∇u∥2
L2 + ∥∇ω∥2
L2 + ∥∇b∥2
L2
dτ. Authors’ contributions Authors contributions
The authors declare that the study was realized in collaboration with the same responsibility. All authors read and
approved the final manuscript. Authors contributions
The authors declare that the study was realized in collaboration with the same responsibility. All authors read and
approved the final manuscript. The authors declare that the study was realized in collaboration with the same responsibility. All authors read and
approved the final manuscript. Acknowledgements Acknowledgements
This work was supported by the National Natural Science Foundation of China (No. 11961032 and No. 11971209), the
Natural Science Foundation of Jiangxi Province, China (No. 20191BAB201003). Competing interests The authors declare that they have no competing interests. Publisher’s Note Publisher s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Received: 16 March 2021 Accepted: 21 June 2021 Received: 16 March 2021 Accepted: 21 June 2021 Combining (4.13), (4.14), (4.16), (4.17) and (4.18), then (4.12) becomes + C
t
0
∥∇b∥
2p
2p–3
˙Mp,q
∥∇b∥
3(p–2)
2p–3
L2
+ ∥∇u∥
3(p–2)
2p–3
L2
∥∇b∥
p
2p–3
L2
+ ∥∇u∥
p
2p–3
L2
dτ
2(2p–3)
3(p–2) Inserting the above inequality into (4.20), we have Inserting the above inequality into (4.20), we have
∥∇u∥2
L2 + ∥∇ω∥2
L2 + ∥∇b∥2
L2
+
t
0
∥u∥2
L2 + ∥ω∥2
L2
dτ
≤C
∥∇u0∥2
L2 + ∥∇ω0∥2
L2 + ∥∇b0∥2
L2 + 1
Chen and Liu Boundary Value Problems ( 2021) 2021:62 Page 14 of 15 ( 2021) 2021:62 Chen and Liu Boundary Value Problems + C
t
0
∥∇b∥
2p
2p–3
˙Mp,q +
∇|ω|
3
2 2
L2 + ∥u3∥
8α
3α–10
Lα
+ ∥∇b∥
4p
3(p–2)
˙Mp,q
×
∥∇u∥2
L2 + ∥∇ω∥2
L2 + ∥∇b∥2
L2
dτ, Gronwall’s inequality and Lemma 3.1 help to obtain Gronwall’s inequality and Lemma 3.1 help to obtain Gronwall’s inequality and Lemma 3.1 help to obtain
∥∇u∥2
L2 + ∥∇ω∥2
L2 + ∥∇b∥2
L2
+
t
0
∥u∥2
L2 + ∥ω∥2
L2
dτ
≤C
∥∇u0∥2
L2 + ∥∇ω0∥2
L2 + ∥∇b0∥2
L2 + 1
× exp
T
0
∥∇b∥
2p
2p–3
˙Mp,q +
∇|ω|
3
2 2
L2 + ∥u3∥
8α
3α–10
Lα
+ ∥∇b∥
4p
3(p–2)
˙Mp,q
dτ
≤C
∥∇u0∥2
L2 + ∥∇ω0∥2
L2 + ∥∇b0∥2
L2 + 1
× exp
C
T
0
(1 + ∥u3∥
8α
3α–10
Lα
+ ∥∇b∥
4p
3(p–2)
˙Mp,q dτ
, which completes the proof of Theorem 1.1. 13. Rojas-Medar, M.A.: Magneto-microploar fluid motion: existence and uniqueness of strong solutions. Math. Nachr.
188, 301–319 (1997) ,
(
)
16. Zhang, Z.: Regularity criteria for the 3D MHD equations involving one current density and the gradient of one
velocity component. Nonlinear Anal. 115, 41–49 (2015) Chen and Liu Boundary Value Problems ( 2021) 2021:62 Chen and Liu Boundary Value Problems y
p
,
(
)
17. Zhang, Z., Yao, Z., Wang, X.: A regularity criterion for the 3D magneto-micropolar fluid equations in Triebel–Lizorkin
spaces. Nonlinear Anal. 74, 2220–2225 (2011) References 1. Cao, C., Wu, J.: Two regularity criteria for the 3D MHD equations. J. Differ. Equ. 248, 2263–2274 (2010) 1. Cao, C., Wu, J.: Two regularity criteria for the 3D MHD equations. J. Differ. Equ. 248, 2263–2274 (2010) 2. Gala, S.: Regularity criteria for the 3D magneto-microploar fluid equations in the Morrey–Campanato space. Nonlinear Differ. Equ. Appl. 17, 181–194 (2010) 2. Gala, S.: Regularity criteria for the 3D magneto-microploar fluid equations in the Morrey–Campanato space. Nonlinear Differ. Equ. Appl. 17, 181–194 (2010) 3. Gala, S., Ragusa, M.A.: A logarithmic regularity criterion for the two-dimensional MHD equations. J. Math. Anal. Appl. 444, 1752–1758 (2016) 4. Gala, S., Ragusa, M.A.: On the regularity criterion of weak solutions for the 3D MHD equations. Z. Angew. Math. Phys. 68, 140 (2017) 5. Gala, S., Ragusa, M.A.: A new regularity criterion for the 3D incompressible MHD equations via partial derivatives. J. Math. Anal. Appl. 481, 123497 (2020) 6. Gala, S., Ragusa, M.A., Ye, Z.: An improved blow-up criterion for smooth solutions of the two-dimensional MHD
equations. Math. Methods Appl. Sci. 40, 279–285 (2017) 7. Galdi, G.P., Rionero, S.: A note on the existence and uniqueness of solutions of the microploar fluid equations. Int. J. Eng. Sci. 15, 105–108 (1997) 8. Jia, X., Zhou, Y.: Regularity criteria for the 3D MHD equations involving partial components. Nonlinear Anal., Real
World Appl. 13, 410–418 (2012) 9. Jia, X., Zhou, Y.: Regularity criteria for the 3D MHD equations via partial derivatives. Kinet. Relat. Models 5, 505–516
(2012) 10. Lemarié-Rieusset, P.G.: The Navier–Stokes equations in the critical Morrey–Campanato space. Rev. Mat. Iberoam. 23,
897–930 (2007) ukaszewicz, G.: Micropolar Fluids: Theory and Applications. Birkhäus 12. Ortega-Torres, E.E., Rojas-Medar, M.A.: Magneto-microploar fluid motion: global existence of strong solutions. Abstr. Appl. Anal. 4, 109–125 (1999) 12. Ortega-Torres, E.E., Rojas-Medar, M.A.: Magneto-microploar fluid motion: global existence of strong solutions. Abstr. Appl. Anal. 4, 109–125 (1999) Page 15 of 15 ( 2021) 2021:62 Chen and Liu Boundary Value Problems 15. Yamazaki, K.: Regularity criteria o
Fluid Mech. 16, 551–570 (2014) spaces. Nonlinear Anal. 74, 2220–2225 (2011)
| 9,722 |
https://uz.wikipedia.org/wiki/Freistroff
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Freistroff
|
https://uz.wikipedia.org/w/index.php?title=Freistroff&action=history
|
Uzbek
|
Spoken
| 44 | 135 |
Freistroff Fransiyaning Lotaringiya mintaqasida joylashgan kommunadir. Moselle departamenti Boulay-Moselle tumani tarkibiga kiradi.
Aholisi
859 nafar aholi istiqomat qiladi (1999). Aholi zichligi — har kvadrat kilometrga 58,4 nafar kishi.
Geografiyasi
Maydoni — 14,7 km2. Dengiz sathidan 195 – 276 m balandlikda joylashgan.
Manbalar
Moselle shaharlari
| 6,886 |
https://github.com/AerodyneLabs/Stratocast/blob/master/grib2/wgrib2/Flush.c
|
Github Open Source
|
Open Source
|
Zlib, LicenseRef-scancode-warranty-disclaimer, Libpng, LicenseRef-scancode-unknown-license-reference, MIT, GPL-1.0-or-later, NetCDF, LicenseRef-scancode-public-domain, BSD-2-Clause, JasPer-2.0, LicenseRef-scancode-llnl
| 2,019 |
Stratocast
|
AerodyneLabs
|
C
|
Code
| 50 | 166 |
#include <stdio.h>
#include <stdlib.h>
#include "grb2.h"
#include "wgrib2.h"
#include "fnlist.h"
extern int flush_mode;
/*
* HEADER:-1:flush:setup:0:flush output buffers after every write (interactive)
*/
int f_flush(ARG0) {
flush_mode = 1;
return 0;
}
/*
* HEADER:-1:no_flush:setup:0:flush output buffers when full (default)
*/
int f_no_flush(ARG0) {
flush_mode = 0;
return 0;
}
| 15,452 |
https://github.com/AjdinVreto/petShop/blob/master/petshop_mobile/lib/models/Novost.dart
|
Github Open Source
|
Open Source
|
MIT
| null |
petShop
|
AjdinVreto
|
Dart
|
Code
| 97 | 351 |
import 'dart:convert';
class Novost {
final int id;
final String? naslov;
final String? tekst;
final DateTime? datum;
final List<int>? slika;
final int? korisnikId;
Novost(
{required this.id,
required this.naslov,
required this.tekst,
required this.datum,
required this.slika,
required this.korisnikId
});
factory Novost.fromJson(Map<String, dynamic> json) {
return Novost(
id: int.parse(json["id"].toString()),
naslov: json["naslov"],
tekst: json["tekst"],
korisnikId: int.parse(json["korisnikId"].toString()),
datum: DateTime.tryParse(json['datum']),
slika: json["slika"] != null
? base64.decode(json['slika'] as String)
: null
);
}
Map<String, dynamic> toJson() => {
"id": id,
"naslov": naslov,
"tekst": tekst,
"korisnikId": korisnikId,
"datum":
datum == null ? null : datum!.toIso8601String(),
"slika": slika != null ? base64.encode(slika!) : slika,
};
}
| 42,300 |
bpt6k9641212k_51
|
French-PD-Newspapers
|
Open Culture
|
Public Domain
| null |
Le Panthéon de l'industrie : journal hebdomadaire illustré
|
None
|
French
|
Spoken
| 8,081 | 13,316 |
Sous une veraïadah pompéienne, de grands personnages romains, 'assis ou couchés, viennent de terminer leur repas et assistent aux exercices d'une danseuse. Ce groupe d'hommes, délicatement indiqué et comme noyé dans la pénombre d'une treille, coupée par des éclaircies de soleil, serait à lui seul un chef-d'œuvre. Quant à la danseuse, elle est entièrement nue et vue de dos, au moment où, levant les bras et portant la tête en arrière, elle va se Tenverser au-dessus des gla;i'ves placés à distances égales sur une planche. Rien de plus gracieux, de plus animé, de p,ws voluptueux <que'cette cette belle figure de femme. ErÉin un prt-mier plan merveilleux représentant lies fleurs autour d'un bassin, les branches légères iqrn du haut de la verandah 'descendent dans un air pSleiâa de soleil et de pureté, en se détachant sur la mer é't le 'rivage 'd'un golfe, toute cette mise en scèiæ calme, 'poétique, énivrante, forme, à notre avis, l'œuvre la plus exquise qui se puisse imaginer, ©àa passerait des heures devant cette toile qui évoque tout un mond de délices méridionales, dans lequel le paysage, les costumes, les accessoires archéologiques, la beauté féminine 'contribuent à réaliser' l'ensemble le plus harmonieux et le plus vivant. Une Loge aux Itl/liens, de Mme Eva Gonzalès, la fiUe de notre sympathique et charmant confrère Emmanuel Gorïzalès, est une toile très-remarquable 00 [fi ine; ex pressi(i)'n plastique. Pour la caractériser, nous n'avons du reste'qu'à prendre le livret, qui désigne Mme Éva Gonzalès comme une élève de Che,plia et de 'Ma'net. La grâce de l'un unie au Sentiment de réalité de l'autre a formé et complété ce talent. La jeune dame vue de face, -avec sa toilette coq'ûefte 'son 'air un peu prétentieux, appelle bien le regard'sans avoir l'air d'y répondre. Il y a comme une satire dans cette raideur 'aristocratique qui joue mal la parfaite distinction. La peinture est grasse, la couleur chaude et franche. Rien de mièvre dans cette peinture féminine. C'est brossé avec une mâle vigueur, comme si la main ferme d'un bon père eût conduit la petite main blanche de la jeune artiste. Après l'élève,'le maître ou l'un des. maîtres, car M. Chapliu n'a pas daigné nous régaler d'un de ses frais morceaux. Quant à M. Manet, son grand tableau : Dons la serre est d'un très-bon dessin et d'une couleur solide. L'attitude de l'homme accoudé, qui nous parait être M. Manet lui-même, s'impose par sa justesse. La simplicité des procédés de M. Manet rend ses tableaux inoubliables. Une fois vus, ils res tent dans la mémoire à cause de leur accent de vérité. Mais un .peu d'expression, de poésie et de soleil 'ne leur nuirait pas. Quand il ne s'agit que de rendre la réalité sèche, la photographie suffit. La peinture a une tâche supérieure. Elle doit ajouter le sentiment de Phomrne à l'apparence des choses, homo uddit1ls naturse, comme disait Bacon. Voici, par exemple, une petite toile sans prétention, mais pétillante d'esprit. C'est l'Ecole de dessin, de M. Edouard Ravel. Que serait le 'sujet si l'artiste n'avait pris la peine d'observer, d'étudier ses personnages, de leur donner un caractère distinctif et saillant? Ce sont des jeunes filles qui travaillent d'après le modèle vivant, dans l'atelier d'un vieux peintre. Un petit Italien est sur la sellette. L'une des élèves, grande, maigre, sérieuse, qui « croit que c'est arrivé, » mesure le modèle en tenant son crayon à bras tendu. Une autre, belle blonde au profil impertinent, regarde son travail d'un air satisfait sous l'œil d'une compagne complaisante qui l'admire. Dans un coin, une petite nouvelle cherche ses lignes. C'est probablement cette dernière qu'une grosse femme vient recommander au vieux maitre, qui a l'air de lui fermer poliment la porte au nez. La pièce est bien éclairée, d'une lumière gaie, harmonieuse, qui fait ressortir chaque détail : les moulures, les croquis, les murs, les meubles, san* confusion et sans recherche. C'est un tableau sage, intéressant, que M. Goupil s'est empressé d'acquérir, et qui attirera l'artiste à Paris, où son avenir est assuré. M. Ravel appartient à l'école de Genève comme M. Simon Durand. Ce dernier a envoyé cette année deux tableaux de genre. L'Alerte, commencement d'incendie à Genève, est une composition très-mouvementée, vive et remplie de jolis .détails.; la petite fille emportant son chat,1 l'épicier épouva.nté,, le pompier courant. M. S. Buramd & la note <.conÜq!Xe" parfois même poussantp:«ta ifcrop à la caricature. Ce ^défaut ioède peu sa jneti chez lui à i'observatïûûa *bài'.ve et spirituelle. Ce jeune peintre marche 'à petits pas SUT la route #e Knauss et arriverait peut-êi.Te là régaler, s'il avait, comme le peintre allemand, 1e$'r:YIl'timemt du paysage. Mais avons-nous bien le droi t dt demander à ''um artiste ia;u:tr.e chose que, ce .qu'il nous donne? .Les iioi&irs d'un forgeron, ila seconde toile Ide ce peintre, nous paraît un peu lourde de couleur ,ct de ,comtposi,t,i'on. (Cela tient peut-être à une dimension exagéiîée -pouir .le sujet et :à une trop grande recherche. A ';folceide forger... on peut peindre un forgeron, 'mais on risque de :1e devenir soi-même. "Voici un amateur 'de Miéris qui s'est voué ;,au -sa tin -dans un tableau intitulé ,*: Etudiant &on rôle -îtrogïqueUne .élèsse «lu Conservatoire, nue, s'est 'drapée dans -uaïe pièce soie bleue qui trahit ses fOlIDêsief.JlaÍ:sse tpeifâer ®eàai«Èpaule et son sein. Ceïipetdt îtalbieau <êe M. IMacet esit,'(cLu reste, plein â'.exoellenîtes igïuaLities, 'MentteteB (dans le paysage-genre. Ma^ Mtcëitte <c"îe#t *i!ia paysage parisien : Un coin êe Mevçy pmûmet Wmmiâàliion, 'de M. Luigi Loir, toile ^a/feuraliisifee û. ravec des portraits ^Capiifilin <caieît, TSiaèviitaMe Sarah Benïhardt et d'aiuitres :sans <â®ute q-»e îûffE-s Savons pas reconnus. Mais qin6l ihasaisi ,'-a p-u;.'rt&®jM(r un ïsi vilain endïaiit ïta'nlt '.d'àiim'rations ? rLle peintre n'avait pas bës©ik idi.e m *,,ztc pour attirer Intention sur m<n -tableàM îMès-jiUslfee'-de ton, d'une couleur :s(i)lide, et parMîtiéœenît fdessiné. Le maître du gelire, M. del®ttis,'h'a envoyé qu'un paysage de ville : Une marchande d'allumettes dans la C'ity (Londres). C'est toujours énergique et charmant. Le Coup de l'étrier et le Saint Viatique en Bourgogne, de M. Aimé Perret, sont deux excellents morceaux de peinture, d'une grande vérité d'accent. Ces deux toiles ont été, du reste, acquises par l'Etat. M. Léon Loire a peint aussi un fort joli tableau: la Lecture, qui promet à ce jeune peintre de véritables succès. Le Pot cassé, de M. Henri Schlesinger, veut rappeler évidemment la Cruche cassée de Greuze. C'est une 'fort jolie peinture. Voici une toile plus coquette encore. C'est le Sonnet de M. Richer. Un beau seigneur du temps de Louis XIV (Oronte, peut-être), se promène dans le parc de Versailles entre deux grandes dames auxquelles il lit... un sonnet. Belle Philis, on désespère... C'est galamment troussé, frais, élégant, habile,, quoique... "tmpeu raide. Enfin, de tout loin, nous avons reconnu, placée mn peu haut, une toile de Petxceïlent caricaturiste Biard, toujours marin marinant, peu distingué dans ses types, peu doue comme couleur, mais amusaaait quand mêtna. 'Son Serment du capitaine Lacrosse est Unie l&gencte maritime sérieuse,, un trait ,d'héroïsme qui semble prêter assez peu au talent'comique du ,peintih--. MiNs. tout son monde est bien groupé et, ne fût-ce que comme reprise, nous n'avons pu passer sous silence cet aimable artiste. Il y a, du reste, bien d'autres tableaux de genre dignes d'éloges. Mais le moyen d'être complet, sans tourner au catalogue ! Force est de dire, en terminant, comme Ruy Gomez : J'en passe, et des meilleurs... 'WILLIAM 'REYMOND. INFORMATIONS } i Les difl'érents ministères ont préparé les décrets de nomination dans l'ordre de la Légion d'honneur qui seront soumis à la signature du Président de la République. i On sait que plusieurs membres .de la Chambre se proposent de visiter l'Algérie pendant les vacances parlementaires. | Les députés qui doivent prendre part au voyage partiront le 15 septembre. Ils s'arrêteront quelques jours à Marseille, où ils s'embarqueront pour Bone, " où doivent avoir lieu de grandes fêtes à l'occasion du concours régional. Ils visiteront ensuite Sétif, Biskra, Batna, Gonstantine, Alger. J M. Gambetta, dit-on, me prendra pas part à ce voyage, comme 'on l'avait annoncé. Le kilogramme étalon, pour la commission Íinternat anale des poids et mesures, vient d'être'achevé ;à PaÉis, par M. Bunge, de 'Hambourg, qui y a tra"Vaillé pendant huit mois. Il est d'une délicatesse ,-si .gpan :le, que la personne s'en servant ne doi't pas eIJ. rapprocher d'envronplu de deux m'ètres, car la chaleur émanant de son corps en affecterait la justesse {ferne façon perceptible. ';[.;a Chambre des Députés a voté sans discussion le f»Rcyjjiet de loi, précédemment adopté par le Sénat, teaaàant à approuver la convention intervenue entre ],ÆJ.''W:ille de Paris et le Crédit foncier. Cette convenitioin devient ainsi définitive. 'L'ém]S ion à laquelle va donner lieu l'exécution <âe cette loi Vrt avoir lieu prochainement. * 5Le Crédit foncier va mettre en souscription publiée un emprunt dont ie chiffre ne sera pas inférieur à 400 millions et s'élèvera peut-être à 500 millions de francs. Cet em runt sera représenté par des obligations communales 3 0[0 avec primes et lots dont le nombre et le type seront fixés incef-samment après la décision ministérielle qui doit autoriser l'émission. La date de l'émission n'est j.as encore fixée; elle ne dépassera pas les premiers jours du mois d'août prochain. Une touchante cérémonie a eu lieu, dans ile grand amphithéâtre de la Soibonne. La Société, pour .'iustruction élémentaire, sous la .presiden :.e de .M. Eugène Pelle tan, assisté de M. Leblond, sénateur, e t de M. Auguste Marais, ancien sous-préfet, distribuôÍl ses prix aux deux nuiiie jeunes fuies qui suivent ses cours normaux (enseignement secondaire). Le rapport sur les travaux de la Sociéte et sur ses nombreux et importants cours a été présenté .par M. André Roussel !e, avocat à la cour de Paris, secrétaire géuéral. M. Auguste Marais .a fait l'éloge de M. Albert Leroy, un des professeurs les plus distingués et les plus dévoués, qui est mort dans l'année. L'antique Sorbonne a witendula Marseillaise, jouée par 1::1 musique .du Bon Marché, que dirige M. 'Pau" lus. Dès les premières mesures, l'Assemblée entière s'est levée avec enthousiasme aux crispe : « Vive la République ! » LES MACHINES DE LEVAGE A VAPEUR [texte_manquant] NE erreur très-fréquente chez beaucoup de constructeurs de machines industrielles (et nous ne parlons que des plus ingénieux d'entre eux), c'est l'extrême complication du mécanisme et la multiplicité des -organes, qui font que leurs appareils, destinés à des travaux usuels, ne peuvent être dirigés que par des mécaniciens, ou tout au moins par des ouvriers exceptionnellement intelligents et dressés •de longue main à la manœuvre. Nous n'entrerons pas dans le détail des inconvénients mécaniques des appareils ainsi conçus; mais 'leurs inconvénients économiques sont évidents à tous les yeux : Dérangements faciles, réparations longues et -coûteuses, chômage forcé en cas d'absence de l'homme chargé de la conduite de la machine, etc. MM. Cail ard frères, constructeurs spéciaux pour la marine, au Havre (63, quai d'Orléans), vivement frappés de ces inconvénients, se sont constamment appliqués, dans tous les appareils qu'ils construisent, à concilier une très-grande simplicité de mécanisme avec une extrême facilité de manœuvre. Quelques exemples, choisis parmi les nombreuses 'machines que leur doivent la marine et l'industrie générale, suffiront pour faire apprécier les résultats obtenus par ces habiles constructeurs. Voici d'abord la grue à vapeur, une machine de création très-récente, et qui déjà a eu le temps de faire ses preuves. En 1877, notamment, employée pendant deux mois à la construction de la galerie des machines au Ghamp-de-Mars, elle y rendit d'éminents services, que M. Dietz-Monin s'empressa de reconnaître, dans une lettre très-flatteuse, adressée à MM Caillard. Ce qui nous a particulièrement frappé dans cette grue, qui a d'ailleurs obtenu la plus haute des récompenses décernées aux appareils de levage (une médaille d'argent), c'est d'abord la merveilleuse simplicité, la parfaite clarté de son agencement, qui permet d'en saisir d'un coup d'œil toute l'économie, c'est la disposition de tous les axes d'arbres dans un même plan, c'est leur facile et prompt démontage par l'emploi exclusif des paliers à chapeau, etc. Le premier ouvrier venu, chargé de la manœuvre, sait sa machine immédiatement, et trouve, sans difficulté et sans danger, l'accès de tous les organes. Mais ce qui est plus remarquable et peut-être pius utile encore, c'est l'étonnante facilité de la manœuvre, si compliquée d'ordinaire ùans les grues à vapeur, rendue si difficile par la multiplicité de mouvements nécessaires pour ouvrir ou fermer l'entrée de la vapeur, embrayer ou désembrayer, •manœuvrer le frein, etc. Ici l'action d'un seul levier, sur lequel l'ouvrier presse de la main droite, suffit pour exécuter simultanément tous ces mouvements. Dans le cas où l'ouvrier abandonnerait son levier, la grue est disposée de façon à ce que le fardeau soulevé s'arrête, 'en ce cas, suspendu à la hauteur qu'il avait atteinte. Ce n'est pas tout. Dans les machines destinées, comme celle-ci, à être manœuvrées par des personnes étrangères à la mécanique, il est une précaution dont les constructeurs ne s'avisent guère : C'est de donner aux manœuvres d'organes des rapports sensibles de direction et de forme avec les mouvements qu'on peut leur faire produire. Un exemple emprunté encore à la grue de M. Caillard fera comprendre notre pensée. L'orientation de cette grue s'exécute à l'aide d'un levier que l'ouvrier tient de la main gauche; or, les constructeurs ont eu soin de faire concorder le sens de rotation de l'appareil avec le mouvement du levier, de façon que la grue tourne à gauche ou à droite suivant qu'on pousse le levier à gauche ou à droite, et que l'ouvrier peu expérimenté peut s'imaginer qu'il fait réellement tourner la machine à la main. Que de fausses manœuvres, que d'accidents on peut prévenir à l'aide d'une précaution aussi simple ! Telle est la grue dont plusieurs Compagnies de chemins de fer, les ateliers maritimes, les usines de toute espèce adoptent de plus en plus l'usage, et dont les services sont journellement attestés par les industriels qui les emploient. Les treuils divers construits par la même maison, plus anciennement créés, sont aussi plus universellement connus, ce qui nous dispensera de les décrire longuement. Quelques mots nous suffiront pour rappeler le treuil monte-charge, où nous rencontrons déjà ce système de commande à friction, appliqué également au haleur à vapeur, et qui prévient tout accident en faisant travailler la machine à vide dès que la résistance devient exagérée. Le système de levier articulé, à action multiple, dont nous avons parlé à propos de la grue, reparaît ici avec tous ses avantages. Le treuil monte-escarbilles, à passage montant et passage descendant, commandé par l'administration de la marine et adopté par elle, n'est pas moins remarquable. Mais celui peut-être de tous les appareils de cette maison qui a le plus attiré sur elle l'attention publique, à cause de la révolution (le mot n'est pas exagéré) qu'il el opérée dans la grande pêche maritime, c'est son cabestan dit haleur à vapeur, destiné au halage des filets de pêche. Nous ne pensons pas que jamais l'application de la vapeur à un appareil mécanique quelconque ait répondu à une nécessité plus certaine, plus pressante que dans le cas dont il s'agit. La plupart de nos lecteurs, c'est-à-dire tous ceux qui sont étrangers à la pêche maritime, n'apprendront pas sans étonnement que les grands filets employés à la pèche au hareng ou au maquereau n'ont pas moins de 6 à 8 kilomètres de longueur, et que, avant l'utile innovation dont nous allons parler, les pêcheurs, après avoir développé en mer cette immense nappe, étaient obligés de la remonter à bord, à force de bras, avec le poisson qui s'y était laissé enfermer. Si l'on suppose que le cabestan sur lequel agissaient ces malheureux, avait des barres d'une longueur totale égale six fois le rayon du tambour sur lequel s'enroulait le câble, les travailleurs avaient, pour haler le filet à bord, à parcourir six fois sa longueur totale, c'est-à-dire de 3G à 48 kilomètres ! Le résultat d'un si épouvantable labeur c'étaient des hernies, des ruptures d'organes, un épuisement qui faisait des vieillards de ces malheureux dès l'âge de quarante ans. Le haleur à vapeur créé par MM. Gaillard répondait donc, nous avions raison de le dire, à une nécessité urgente, et l'intelligent armateur de Fécamp, M. Follin, qui en a fait, en 1869, la première application, a donné un bien utile exemple. Hâtons-nous de le dire qu'il a été immédiatement compris et suivi avec un prodigieux entrain, et que bientôt les pêcheurs, comme le déclarait expressément le commissaire général de la marine au Havre, refusèrent d'embarquer, à moins que les bateaux qu'on les invitait à monter ne possé lassent le haleur à vapeur. Cet appareil, qui possède à un degré éminent toute-, les qualités de simplicité et de solidité communes aux machines des deux habiles constructeurs havrais, a eu tous les genres de succès. Approbations presque enthousiastes des chambres de commerce et des Sociétés spéciales, déclarations flatteuses de tous les grands patrons faisant la pêche, adoption générale dans tous les grands ports de pêche en France et en Hollaude, diplômes d'honneurs, médailles d'or, etc., etc., et p-ir-dessus tout, imitations plus ou moins heureuses, mais très-nombreuses en tout cas, ce qui est toujours la preuve la plus éloquente de l'excellence d'un système. Grâce à la facilité donnée aux patrons par ce bel appareil d'accroître, dans de très-larges proportions, la rapidité des opérations de la pêche et de multiplier les filets, les patrons sont unanimes à reconnaître que leur pêche est devenue de beaucoup plus fructueuse; mais nous avouons franche-, ment que ce résultat économique, que nous sommes bien loin de dédaigner, nous touche moins cependant que le résultat humanitaire obtenu par MM. Caillard. Au nom des malheureux qu'ils ont enfin soustraits à un labeur atroce, à une mort prématurée; nous croyons devoir à MM. Caillard de chaleureux remerciements. M. BITTER DU HAVRE [texte_manquant] N dit bitter du Havre comme on dit anisette de Bordeaux ou vermouth de Marseille. C'est une réputation universelle et des plus méritées. On ne saurait contester, en effet, que le bitter ne soit mieux fabriqué au Havre que partout ailleurs, en France, du moins. Cette fabrication répond à l'usage, au besoin du jour. Dans les temps anciens on usait sans doute déjà de liqueurs fermentées telles que les vins de Falerne ou de Chypre des Romains, l'hydromel ou l'hypocras du moyen âge. Mais ce n'étaient point encore des liqueurs proprement dites. Celles-ci n'existèrent que du jour où des moines et des alchimistes firent usage de la distillation., Une fois l'habitude prise, on ne put plus s'en passer et les liqueurs; entrèrent dans les mœurs comme un apéritif ou un adjuvant obligé de l'alimentation. On remarqua cependant que certaines liqueurs étaient plus ou moins hygiéniques: ainsi les liqueurs amères se montraient plus stomachiques, plus toniques et réconfortantes que les autres. Ainsi le bitter, dont le nom même signifie amer, fut bientôt recherché pour ses qualités bienfaisantes. Inventé par les Hollandais, il n'eut pas de peine à se transmettre de port en port jusqu'aux Havrais qui s'en sont fait une brillante spécialité! D'autres prétendent que c'est des Américains que vient le bitter adopté au Havre. Quoi qu'il en soit, c'est cette ville qui, la première en France, s'est adonnée à la fabrication de ce précieux produit. Nous citerons parmi les principaux distillateurs liquoristes de cette ville la maison Ch. Drouet et Cie, 10, rue de Rivoli, au Havre. Cette maison est une des plus anciennes qui se soit adonnée à la fabrication spéciale du bitter. Outre l'écorce d'orange qui joue un grand rôle dans la composition de ce précieux produit, il n'y entre que les matières les plus pures et les moins malfaisantes. Ainsi, tandis qu'un grand nombre de maisons colorent leur bitter avec du bois de campêche, ce qui est absolument pernicieux, MM. Drouet et Glc ne se servent, à cet effet, que de caramel. Or, on sait que le caramel, extrait du sucre de canne, est absolument inoffensif, donne une belle coloration brune et un arome très-fin. Du reste, la reconnaissance de l'estomac nous pousse à déclarer que cette liqueur est des mieux réussies ; car nous venons de déguster le bitter de la maison Drouet, et nous tenons à déclarer que nous n'en connaissons pas de meilleur. La dose havraise est, avant le repas, de deux petits verres : l'un de bitter, l'autre de cognac, mélangés dans un verre d'eau sucrée d'un seul morceau de sucre. Un second verre de bitter remplace le verre de cognac pour certains consommateurs qui préfèrent le goût amer et reconstituant de cette liqueur. Il est reconnu, du reste, que, prise modérément et sans excès, cette liqueur est absolument hygiénique et ne peut produire que des effets salutaires. Les excellentes qualités du bitter de la maison Ch. Drouet ont été, d'ailleurs, reconnues par les jurys de diverses expositions. Fondée en f SM), cette maison a obtenu en 1868 une première récompense à l'Exposition internationale du Havre et une médaille de bronze à l'Exposition universelle de Lyon. En résumé, nous ne pouvons que recommander le bitter Drouet à nos lecteurs, car, grâce aux soins particuliers qui sont apportés à sa fabrication, ce bitter est non-seulement agréable au goût, mais il possède encore, comme nous l'avons dit, des qualités hygiéniques incontestables. R. Jeudi, à deux heures, a eu lieu l'ouverture de l'Exposition internationale des sciences appliquées à l'industrie, sous la présidence de M. Jules Simon, sénateur. Trois allocutions ont été prononcées par MM. P. Nicole, directeur de l'Exposition, L. Hiélard, président du Comité des œuvres d'apprentissage et de l'enseignement professionnel, et M. Jules Simon. A trois heures a eu lieu la visite officielle des installations et produits, pendant que la musique du 113e de ligne exécutait divers morceaux de Fatinitza, de la Dame Blanche, des Dragons de Villars, etc. « Monitor » locomobile à l'usage des fermiers. LES FAUCHEUSES ET LES MOISSONNEUSES DE LA MAISON AULTMAN et Cie, de Canton (Ohio) [texte_manquant] N ne saurait contester la grande analogie qui existe, sous le rapport du travail à exécuter, entre les faucheuses et les moissonneuses, et il est tout naturel que certains constructeurs, ne constatant, entre le fonctionnement de ces machines, que des différences insignifiantes, aient eu la pensée de construire des appareils à double fin exécutant, sans transformation de mécanisme, l'un ou l'autre travail. La faucheuse-moissonneuse ainsi comprise a le défaut naturel à tous les instruments à tout faire: elle fait tout mal. Le fait a été si bien prouvé qu'un grand nombre d'agriculteurs, regardant comme démontrée l'incompatibilité des deux fonctions, se sont résignés à employer des appareils complètement distincts. Les constructeurs alors sont entrés dans une voie plus raisonnable, et, reconnaissant que les faucheuses et les moissonneuses accomplissent un travail analogue, il est vrai, mais dans des conditions fort différentes, que le travail de la faucille, instrument propre de la moisson, ne saurait être confondu avec celui de la faux, que la nécessité de ménager l'épi et d'exécuter ou tout au moins de préparer la formation des javelles et des gerbes crée, pour' la moissonneuse, des difficultés d'un ordre tout spécial, etc., les constructeurs, disons-nous, ont tenté de combiner des faucheuses qui pourraient, non plus servir de moisonneuses, mais être transformées en moissonneuses, par la substitution de certains organes et l'addition de certains autres. Nous sommes contraint de reconnaître que ces nouvelles tentatives ont rarement réussi, et que ces Faucheuse Aultman et Cic. insuccès multipliés ont semblé confirmer le système des partisans de la division absolue des fonctions. Mais il s'est formé, vers 1850, dans l'Ohio, aux Etats-Unis, une maison dont les directeurs, acharnés au problème où tant d'autres avaient échoué avant eux, ne l'ont plus abandonné avant de l'avoir entièrement résolu. Le rêve, aujourd'hui réalisé, de MM. Aultman et Cie n'était plus de créer une faucheuse médiocre, transformable en une moissonneuse passable ; les transformations si radicales qu'ils ont opérées dans la faucheuse n'avaient pour but unique, ni même pour but principal de faciliter la substitution des pièces, mais de donner à l'appareil, sous ses deux formes, de grandes qualités pratiques. C'est à eux que l'on doit l'usage, dans ces machines, de deux roues motrices, condition d'équilibre si essentielle et pourtant si négligée jusque-là. Il ne faut pas se dissimuler que l'équilibre, dans les faucheuses et les moissonneuses, constitue un problème dont la solution est rendue difficile par ce fait, que l'organe actif, c'est-à-dire la barre coupeuse, est nécessairement établi en dehors du centre de gravité du système. Disposer le moteur sur un seul côté de la machine, c'était donc, pour elle, une très-sérieuse aggravation, dont M. Aultman l'a très-heureusement débarrassée. C'est dans le même but que M. Aul tman a introduit l'usage de deux charnières pour l'articulation de la même barre, qu'il en a soutenu l'extrémité par un galet, etc. Grâce à ces améliorations que la plupart des autres maisons ont imitées et introduites plus ou moins maladroitement dans les types qu'elles construisent, la stabilité est complète, et l'on n'a plus d'exemple de faucheuse ou de moissonneuse versée pendant le travail (accident terrible!) ou seulement jetée hors de l'andain. Ce que M. Aultman a fait pour faciliter le transport des machines agricoles n'est pas moins remarquable. Légèreté extrême, solidité parfaite, débrayage instantané des roues motrices, disposition intérieure des engrenages, supprimant tout danger de ce chef, installation de la barre coupeuse en avant des roues, sous l'œil du conducteur, ce qui supprime un danger plus grave encore, manœuvre très-facile de la barre qu'on soulève à volonté, à l'aide d'un levier placé sous la main du conducteur, lorsqu'il s'agit de franchir des inégalités de terrain; manœuvre isolée des doigts, à l'aide d'un autre levier, lorsqu'il faut atteindre des foins ou des épis couchés ou foulés, tout est combiné pour faire de cette belle machine l'appareil le plus commode, le plus maniable, le plus actif. . Sa transformation en moissonneuse s'opère avec la plus grande facilité. Dans la moissonneuse Aultman, nous avons particulièrement remarqué le râteau circulaire, une nouveauté qui a particulièrement facilité la transformation de la faucheuse, et qui donne à la moissonneuse ainsi obtenue des qualités vraiment merveilleuses. Cette belle et utile machine, connue en France depuis peu de temps, y est déjà appréciée comme elle le mérite ; nous n'en voulons pour preuve que les récompenses qu'elle a obtenues, cette année même, dans nos 'divers concours régionaux et nos comices agricoles : A Chambéry, un premier prix consistant en une médaille d'or et 200 francs; A Maromme, un premier prix (médaille de vermeil et 100 francs); A Limoges, à Beauvais, à Lille, à Amiens, aux Sables-d'Olonne, des médailles d'argent. Nous voudrions pouvoir mentionner aussi le rabatteur horizontal, qui couche les épis en ligne exactement transversale sur le tablier, et facilite ainsi à un haut degré la formation des javelles, etc. Mais nous sommes contraint d'abréger, car il nous reste encore à dire quelques mots de la moissonneuse-lieuse, le plus beau type, selon nous, de machine agricole qu'ait produit jusqu'à ce jour la mécanique spéciale. Elle n'a été introduite en Europe qu'en 1878, et l'expérience n'a pas tardé à faire reconnaître aux constructeurs un fait assez inattendu pour eux : C'est que la machine, primitivement construite aux Etats-Unis, ne répondait nullement aux nécessités, aux habitudes, aux modes d'exploitation, aux genres des récoltes de l'Europe. Des modifications profondes, de grandes simplifications surtout ont été reconnues nécessaires et exécutées immédiatement. La moissonneuse-lieuse, telle que la construit actuellement, pour notre usage particulier, la grande maison américaine, constitue (on peut le dire sans exagération) une machine parfaite, donnant un travail d'une régularité absolue. Le lien, très-solidement noué, se serre plus ou moins, à la volonté de l'ouvrier. Les gerbes sont exactement égales. Aussi ne faut-il pas être surpris que cet appareil, qui vient à peine d'être révélé à notre pays, ait déjà obtenu un premier prix au concours des Sablesd'Olonne, un premier prix au concours de Rambouillet, un autre premier prix à Madrid , après six jours d'essais, une médaille d'or au concours de Liancourt (1879). Ceci nous rappelle à propos que la maison Aultman, qui ne construit pas seulement des faucheuses et des moissonneuses, mais aussi tous les types de machines agricoles, sans compter les manéges mobiles, sans compter une machine locomobile à vapeur (le Monitor), à chaudière verticale, véritable merveille de légèreté et de simplicité,etc., etc., que cette maison, disons-nous, après avoir longtemps évité les expositions, a cependant obtenu des récompenses à Vienne, à Philadelphie, à Paris (1878). Quant. aux progrès de sa production, on s'en fera une idée par ce fait, qu'après avoir construit, en 1851, 4.000 faucheuses et moissonneuses, elle en a livré 18.000 en 1878 et a atteint, la même année, pour la même spécialité, le chiffre total de 297.800 machines! Nous n'avons pas besoin de dire à quel point de pareils chiffres sont éloquents, et combien ils dé Faucheuse-Moissonneuse combinée, tablier en travail. Moissonneuse-lieuse Aultman et Cio. montrent la confiance de l'immense clientèle de la maison, confiance qui ne saurait avoir d'autre fondement que le mérite de ses produits. Aussi, nous réjouissons-nous très-sincèrement que MM. Aultman et Cie aient eu la pensée de fonder en France, sous l'habile direction de M. Pierrot, une grande maison de dépôt (26 et 28, passage d'Angoulême, à Paris). C'est une ressource nouvelle dont notre agriculture a déjà compris et comprendra de mieux en mieux tout le prix. L. BRUNÉO. LES CONSERVES ALIMENTAIRES FRANÇAISES ET ÉTRANGÈRES, AU HAVRE. r oïls I! ^ L existe peu de villes dont la position commerciale soit plus favorable que celle du Havre. En communication avec Paris et le centre de l'Èurope par la Seine et avec le reste du monde par la mer, elle est comme le ganglion de communication des deux mondes. Aussi son commerce s'élève-t-il au quart ou du moins au cinquième de celui de la France entière. Plus de trois mille gros navires pénètrent chaque année dans son port et le cabotage est presque aussi considérable. C'est là que se fait le plus grand commerce d'exportation et d'importation, là que les émigrants s'embarquent pour les pays d'outre-mer. Aussi, sa population qui est deprès de centmille habitants se livre-t-elle activement, non-seulement au négoce, à la commission, au commerce de transit, mais aussi aux industries qui se rattachent à la navigation, à l'équipement, à la pacotille ou à l'alimentation. Son commerce avec l'étranger ne fait que s'accroître de jour en jour et tend à prendre une importance considérable. Ses grands chantiers de construction, ses fabriques de produits chimiques, ses extraits de bois de teinture et tant d autres usines font de ce port de mer une ville de premier ordre.... Il est donc naturel qu'on ait adjoint à ce grand centre d'exportation et d'importation une industrie qui, sans être tout à fait locale, le mit à même d'être indépendant de ports de mer, comme Nantes ou Bordeaux.. Nous voulons parler du commerce des conserves qui jouent en France, comme à l'étranger, un rôle capital dans l'alimentation publique., La maison Jacques: Simon (rue Édouard-Larue, au Havre) est la première en France qui se soit occupée de l'importation, sur une large échelle, des conserves et des viandes. Comprenant la nécessité d'exporter ces produits en grand nombre pour l'alimentation des colonies, ou.le ravitaillement, des navires, elle a établi sur. les côtes de la Bretagne deux usines où elle fabrique une énorme quantité: de conserves de toutes sortes qui lui ont valu des médailles à toutes les Expositions où elle a exposé; ses produits. Depuis sa fondation, elle a.subi de grandes transformations, et les armateurs, aussi bien que les nég.ociants, ont ainsi toujours à leur disposition une maison pourvue d'un stock de première main, ce qui permet, du reste, à cette maison de lutter avantageusement avec toute autre ville pour l'expor tation. Elle s'est adonnée, entre autres, à la préparation de la sardine, cet excellent petit poisson qu'on pèche en si grand nombre sur nos côtes. La sardine est sans doute délicieuse à manger fraîche, mais elle se conserve fort peu de temps, à moins qu'on ne l'ait salée. Pour les conserver et les expédier partout on est donc forcé de les confire, c'est-à-dire de les faire frire très-légèrement dans l'huile, puis on les range soigneusement dans des boites de fer-blanc qu'on achève de remplir de trèsbonne huile et dont on soude le couvercle pour les-mettre complétement à l'abri de l'air. Ces manipuirlations exigent un très-grand nombre d'ouvriers, et c'est une des branches importantes de l'industrie de cette maison qui expédie ensuite des boîtes de sardines dans le monde entier. En général, les conserves ont pris, de nos jours, une très-grande importance dans notre alimentation. Ainsi M. Jacques Simon fabrique aussi des conserves de légumes tels que petits pois, champignons, haricots, fonds d'artichauts, etc. Mais outre cette vaste exportation des nombreux produits de notre pays, cette maison a entrepris en grand l'importation des meilleurs produits de lAmérique, et elle est la premiere qui ait songé à nous procurer cette précieuse ressource. On sait que l'Amérique et l'Australie se sont mises depuis quelques années à exploitersur la. plus grande échelle leurs nombreux troupeaux ou les produits de leur exubérante végétation. Viandes, poissons, légumes, fruits des régions tempérées ou des tropiques, tout nous arrive:, sous, forme de conserves, par les soins de cette maison, et vient ainsiaugmentef^osjouissancesculinaires et varier autant hygiéniquement qu'agréableimaat notre alimentation jo irnalière. M. Simon fait venir en outre à travers l'Océan de grandes quantités de homards, de saumons, de turbots, d'huîtres que nous retrouvons; chez nos marchands de comestibles et dont nous. enrichissons nos tables. Ainsi, on pourrait dire que « rien de ce qui est mangeable ne nous est étranger » depuis que des négociants, comme M. Jacques Simon, se chargent de nous apporter dans le vieux monde les produits du nouveau. Comme nous l'avons dit, M'. Simon a été récompensé par les jurys de toutes les Expositions auxquelles il a envoyé ses produits. Une médaille de bronze lui a été décernée à la grande Exposition de Paris en 1878. P. COULEURS, VERNIS ET MASTICS [texte_manquant] u double point de vue du bon marché du produit et de sa bonne exécution, la pi,épara, ion en grand des couleurs etdes vernis, des couleurs surtout, est d'une nécessité absolue, et la lutte entre le travail manuel et le travail mécanique, si elle n est pas complètement close, ne saurait se prolonger longtemps. Ce n'e-t donc plus qu'aux grandes maisons qu'on peut demander désormais de bons produits vendus à bas prix. Cette seule considération suffirait pour recommander la maison A. Duvivier (11, rue de la Bourse, au Havre), qui possède une usine à Graville-l'Eure. Mais elle s. recommande plus spécialement, parmi les premières maisons, pa:' le choix sévère des matières premières et les soins, exceptionnels donnés à la fabrication. M. Duvivier, du reste, ne s'est pas borné à ce:tt"e6@a3H&ot%fabrication.routinière, des produits usuels, qui n'est pas inconciliable, avec les succès, d'argent, mais qui est complètement-, étrangère au progrès. Nous ne voulons pas nous arrêter ici aux perfectionnements apportés par lui à l'outillage et aux procédés de fabrication, aujourd'hui fort compliqués et fort savants, depuis les grands progrès réalisés par la chimie industrielle; mais nous croyons devoir attirer l'attention de nos lecteurs sur une classe de produits nouveaux, créés par cette maison, et qui, déjà fort connus, ne le seront jamais assez, à notrc avis. Nous voulons parler des peintures servant à la conservation des bois et des métaux.. Nou« en signalerons trois types différents pan leur composition et leur emploi, mais également recoinmandables par leurs qualités. Le deutoxyde minéral arséniaté' est destine à la conservation du cuivre, métal, comme on'sait, trèssensible à l'action de la plupart des. acides, et donnant avec eux des sels tox'ques qui concourent à la destruction du, métal, surtout lorsque celui-ci, attaqué: par d es, sels solubles, est constamment soumis à Pictiom, dissolvante de l'eau. Tel. est le cas des plaques de cuivre employées am doublage des, navires et qui trouvent dans l'eau de. mer les éléments certains de leur destruction. Le deutoxyde arséniaté de' M. Duvivier, non-seulement: prévient la formation de ces sels sur. lesplaques de doublage en cuivre, mais empêche très" efhca.ceaient les organismes parasitaires, végétaux ou animaux, de s'y attacher et d'y former ces masses à la fois si funestes à la conservation de la coque et si gênantes pour la marche du navire. Un kilogramme de ce produit suffit pour 12 mètres carrés de doub âge. IL sèche et durcit très-rapidement. Le protoxyde minéral est pour le fer ce que le protoxyde arséniaté est pour le cuivre. Il n'y a ici à prévenir que. la formation d'un produit: l'oxyde de fer; mais, en revanche, nul n'ignore avec quelle désastreuse rapidité iL se forme sous l'influence de l'eau et de l'air: humide, et combien sa constitution, friable, en mettant sans cesse à nu de nouvelles surfaces, assure la profonde altération du métal. C'est donc un très-sérieux service rendu non-seulement à la marine, mais à toutes les industries, que la création de cette peinture qui assure la conservation indéfiniè du fer. Avec un kilogramme de ce produit, on couvre dix mètres de métal. Il nous reste enfin à dire quelques mots d'un troisième produit destiné à la conservation des bois : C'est l'oxyde métallique sulfureux. On sait que la conservation des bois, particulières ment difficile, ne peut être assurée par, les peinTtures ordinaires, qui ne préviennent, nullement ni les fermentations internes, ni le développement des germes animaux déjà existants dans les tissus,, ni. même, d'une façon complète, l'introduction de nouveaux germes par les animaux extérieurs. Les peintures, d'autre part, si elles ont une action^ purement superficielle, sont pareillement insuffisantes. De là, l'invention d'une foule de procédés d'injection (sans compter la carbonisation), dont quelquest uns, sont inefficaces et tousextrêmement coûteux. Or, l'oxyde métallique sulfureux, qui assure la préservation complète du bois, qui en opère,, en quelque sorte, la métallisation et lui donne une dureté qui accroît très-notablement sa résistance, est un produit essentiellement économique, puisqu'un kilogramme suffit pour couvrir 10 mètres carrés de bois. Employé à la manière de la peinture à l'huile, il sèche eL durcit presque instantanément. Il préserve le bois de toute humidité, empêche toute piqûre de vers, détruit tous les œufs d'insectes et éloigne d'une façon radicale, du coucher des matelots, les insectes parasites dont les marins seul&connaissent bien toute l'importunité. C'est donc un produit dont on ne saurait trop recommander l'emploi dans les constructions navales, dans les usages de la marine pour l'assainisment, des entre-ponts, et aussi pour les constructions de terre ferme et pour les usages domestiji ques, où les services du genre de ceux qu'il rend 'i a bord sont loin de pouvoir passer pour être indifférentSi ALEXANDRE. GALVANISATION, ÉTAMAGE ET PLOMBAGE DU FER [texte_manquant] HACUN sait que le fer, le plus utile de beaucoup de tous les métaux, serait assuré d'une durée presque éternelle, s'il n'avait, dans l'oxygène, un ennemi mortel. Au contact de l'eau ou de l'air hu mide, le fer, attaqué par l'oxygène, perd aussitôt sa couleur naturelle, se couvre bientôt d'une couche de rouille, et finit par être altéré dans toute sa masse par les progrès de l'oxydation. IL était tout naturel que l'on songeât à préserver ce précieux métal, en le couvrant d'une couche d'un autre mé.tatpeu.ou point oxydable. L'étain, qui remplit très-bien cette condition, a été d'abord exclusivement employé à cet usage; et, comme à sa très-faible oxydabilité il joint l'avantage de ne donner, par l'action des acides qui l'attaquent, que des sels inofïensifs, son usage exclusif s'est conservé pour l'étamage des tôles et cuivres, employés à la confection des ustensiles culinaires. Pour les usages industriels,, l'élain a trois défauts capitaux, qui, dans une foule de cas,, le font complétement rejeter : son haut prix d'abord, puis sa faible température de fusion, et enfin son affinité pour un assez grand nombre d'acides. Le zinc, dont on fait aujourd'hui un très-grand! usage, a pour, lui l'avantage de son prix, sa température de fusion, remarquablement élevée, et plus encore la propriété de se couvrir,.au contact de l'air, d'une couche d'oxyde qui lui forme comme une patine inaltérable et en assure la conservation indéfinie. On n'a pu, cependant, faire un grand usage du fer galvanisé (zingué)::pour la fabrication des ustensiles de cuisine, car il se laisse attaquer, même à froid, par la plupart des acides, noLamment par l'acide acétique, et donne ainsi naissance à des sels toxiques. En somme, le zinc a obtenu et conserve un emploi très-étendu, pour tous les cas où les fers qu'il pro ,tége doivent être mis seulement en contact avec l'air atmosphérique ou avec des liquides neutres. Nous disons neutres, et nous n'ajoutons pas : ou alcalins, car on sait que le zinc se dissout sensiblement dans les solutions alcalines. Le plomb, le troisième des métaux employés à protéger le fer, aurait, pour les usages culinaires, les mêmes inconvénients que le zinc. Mais il a, sur celui-ci, l'avantage de résister à un grand nombre d'acides, et même de n'être attaqué par aucun des acides oxydants, en dehors de la présente de l'air. C'est ce qui explique comment on fait un usage si important des vases et cuves en plomb dans les laboratoires de chimie, dans les fabriques de produits chimiques et dans plusieurs industries qui, comme la teinture, font usage de liquides possédant une réaction acide. Mais les inconvénients des grands récipients en plomb, inconvénients dus à l'extrême mollesse et au poids énorme du métal, ont fait songer à employer, au lieu du plomb massif, le fer recouvert d'une couche ou couverture suffisante de plomb ou d'étain, de sorte que l'on possède actuellement trois préparations analogues du fer : le fer étamé, le fer galvanisé ou zingué, le fer plombé, toutes trois ayant pour but la conservation du métal, mais répondant à des nécessités domestiques ou industrielles différentes, qu'on pourrait, en les considérant dans leur ensemble et abstraction faite de quelques exceptions de détail, classer comme il suit: Fer étamé. — Ustensiles de cuisine. Fer zingué. — Réservoirs et ustensiles pour l'eau froide, couvertures d'édifices. Fer plombé. — Vases et réservoirs pour acides, eauxracidulées ou alcalines. On'voit, par ce simple aperçu, l'importance industrielle qu'a prise la préparation des tôles famées, galvanisées et plombées. De grandes usines se sont fondées pour ce travail spécial, et nos lecteurs parisiens pourront se convaincre, comme nous l'avons fait nous-même, en visitantt celle qu'a établie M. Oh. 'Finot, 'au numéro 51 du boulevard Richard-Lenoir, des singuliers progrès réalisés par cette intéressante industrie. La nécessité de couvrir rapidement de grandes surfaces métalliques d'unercouche très-danse et partant très-durable, a conduit à combiner, d'une façon aussi ingénieuse ,qu'efficace, anciens procédés d'immersion à chaud avec les procédés plus nouveaux de laminage. Rien de plus curieux que de voir des feuilles de tôle longues îéteideux ltIlètres, 'larges d'un mètre, des feuillards longs de 20 mètres, plonger dans un bain de métal en fusion, s'étirer, tout ruisselants, entre deux puissants cylindres, et en sortir couverts de cette mince couche protectrice qui ne les abandonnera plus, car elle adhère à leur surface parle triple effet de l'affinité, des actions galvaniques et de la force.mécanique de la pression, si bien qu'elle fait corps avec elle et ne peut disparaître que par l'usure. Ces, préparations du fer, en annihilant les défauts natifs de ce métal, ont donné à son emploi une extension inattendue et doté l'industrie contemporaine d'une de ses plus utiles ressources. Nous comptons sur le* industriels 'intelligents, actifs Je); consciencieux, comme M. Ch. Finot, pour donner à cet art nouveau des applications qu'on entrevoit à peine aujourd'hui, mais qu'un avenir prochain réalisera inévitablement. ALEXANDRE. L'JEConomiste français signale une institution qui se fonde t-n Ailemagne, à N remberg, et .présente un intérêt ..général ,: c'est e Musée commercial que la direction du « Musée germanique » veut créer. Les objets là réunir concerneront :: 1° le commerçant comme,, apprenti, commis et patron : il i'agit des anc ens usa,gt s; on recherchera les vieux contrats d'apprentissage, les coutumes qui is'y Tattachaien,t, les .difléreûtes .:classes d'e -commis, le mode de fondation d'une maison de commerce, la formation de iiGompagn ê?s,!. l'ad mi si on dans unecorporatiou, guilde, etc., etc.; 2° la rr.aison de commerce, les magasins en gros et ea détail, les comptoirs à diverses époques, les entrepôts, halles et marchés; 3° les -procédés de vente, de comptabilité, de corres pondance, d'emballage, de conservation des marchandi-es, etc.; 4° les moyeus de communication, le transport des marchandises par terre et par eau, les chariots et bateaux, les charretiers et bateliers, leur organisation et leurs cou'urnes; 5° l'intervention protectrice (ou non) de l'Etat : convois armés, passe-ports, douanes, foires, vérification de marchandises, etc; 6° les mounaies métalliques ou de papier de toute sorte; 7° les poids et mesures; 8° la statistique commerciale; 9° la géographie commerciale : anciennes cartes, anciennes relations commerciales, comptoirs commerciaux, etc. On voit que rien n'a été oublié. Si cette idée réunit et que le musée puisse réunir des collections à peu près complètes, ce sera une institution que l'Europe enviera à Nuremberg. LE CARBURATEUR UNIVERSEL [texte_manquant] OUT le monde sait que l'hydrogène n'est pas un gaz éclairant, et que le gaz de l'éclairage, ou, pour mieux dire, tous les corps liquides ou gazeux employés à l'éclairage ne doivent leur pouvoir éclairant qu'à la quantité variable de carbone à laquelle ils se trouvent associés. Il est, d'autre part, démontré par l'expérience que le pouvoir éclairant est absolument proportionnel à la quantité relative du carbone dans le mélange, sans autre limite que celle qu'impose la nécessité de conserver un allumage facile, car il est à noter que la température de combustion s'élève, comme le pouvoir éclairant, avec la proportion de carbone. Il est donc clair qu'on augmenterait indéfiniment le pouvoir du gaz en le carburant, ce qui n'est pas, après tout, difficile, puisqu'il suffit de le faire barboter, avant l'allumage, dans une dissolution riche en carbone, une solution résineuse par exemple. Aussi, Dieu sait si les inventeurs de carburateurs ont foisonné ! Mais ces inventeurs, avec ce parti-pris d'aveuglement volontaire qui distingue un trop grand nombre d'entre eux, ont négligé deux points essentiels. Le gaz, en sortant de leur solution carburatrice, entraiîne des vapeurs qui se déposent sur les parois des tubes, les encrassent rapidement et nécessitent de fréquents nettoyages qui absorberaient largement l'économie réalisée par l'accroissement du pouvoir éclairant, si économie il y avait. Mais, en réalité, cette économie est purement illusoire. En somme, on a tort d'oublier que le gaz, tel qu'il est livré par les usines qui le fabriquent, se prête parfaitement, et sans autre manipulation ou préparation, à une augmentation indéfinie de pouvoir éclairan t. Il suffit, pour cela, d'augmenter indéfiniment la consommation. La vraie question des carburateurs n'est donc pas de savoir si un mètre cube de gaz surcarburé donne une plus grande quantité de lumière que le,gaz ordinaire, mais bien de vérifier si une quantité moindre de gaz carburé, donnant la même clarté que le mètre cube de gaz ordinaire, coûte moins cher que lui, en vertu de la moindre consommation, et malgré l'augmentation d-u prix de revient. 11 n'y a donc ici, comprenons-le bien, qu'une simple question de balance. Un exemple, dont nous possédons heureusement les éléments, va nous permettre de jeter un jour complet sur cette question, qui n'a pas toujours été bien comprise. Il s'est fondé, à Paris (9, rue du Four-Saint-Germain), une société pour l'exploitation d'un carburateur. L'appareil consiste en une boîte de tôle, que l'administration établit elle-même, gratuitement, entre le compteur et les becs de consommation, et qu7elte fait remplir par ses agents, quand besoin est, d'un liquide spécial. Par une disposition heureuse et très-favorable aux études comparatives, on peut, à volonté, faire traverser le carburateur par le gaz, ou. conduire celuici directement aux becs. La pose est, d'ailleurs, des plus simples, ne nécessite aucun changement d'installation, et la Société accorde un mois d'essai gratuit. Jamais la moindre trace d'encrassement entre le compteur et les becs. Mais voyons, maintenant, quels sont les résultats économiques (les seuls à étudier) qu'a démontrés l'expérience. 100 mètres cubes de gaz absorbent 1 1. 5 de liquide carburateur, dont le prix est de 3 fr. 50. Le mètre cube de gaz coûtant, à Paris, 30 centimes, son prix se trouve porté, par la carburation, à 33 cent. 75, ce qui représente une augmentation de 12 pour 100. Mais, d'autre part, le pouvoir éclairant du gaz est accru, par la carburation, de 40 pour 100, ou, ce qui revient au même, la consommation en est réduite, par le fait de la carburation, de 40 pour 100. L'économie finale se traduit donc par 40—12, soit 28 pour 100. Mettons 23 pour 100, pour rester volontairement au-dessous de la vérité constatée ; c'est un bénéfice d'un qu rt qu'on peut, à volonté, 'réaliser par un-e économie d'argent ou par une augmentation de lumière.
| 25,224 |
https://pt.wikipedia.org/wiki/Muchow
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Muchow
|
https://pt.wikipedia.org/w/index.php?title=Muchow&action=history
|
Portuguese
|
Spoken
| 33 | 81 |
Muchow é um município da Alemanha, situado no distrito de Ludwigslust-Parchim, no estado de Mecklemburgo-Pomerânia Ocidental. Tem de área, e sua população em 2019 foi estimada em 265 habitantes.
Municípios de Meclemburgo-Pomerânia Ocidental
| 36,815 |
https://github.com/vohrahul/ML-ang-coursera/blob/master/Octave/octave-4.2.1/include/octave-4.2.1/octave/vx-cv-cs.h
|
Github Open Source
|
Open Source
|
MIT, Zlib, LicenseRef-scancode-warranty-disclaimer, LicenseRef-scancode-public-domain
| 2,020 |
ML-ang-coursera
|
vohrahul
|
C
|
Code
| 31 | 130 |
// DO NOT EDIT -- generated by mk-ops.awk
#if ! defined (octave_vx_cv_cs_h)
#define octave_vx_cv_cs_h 1
#include "octave-config.h"
#include "CColVector.h"
#include "dColVector.h"
#include "oct-cmplx.h"
#include "mx-op-decl.h"
VS_BIN_OP_DECLS (ComplexColumnVector, ColumnVector, Complex, OCTAVE_API)
#endif
| 9,167 |
https://ceb.wikipedia.org/wiki/Pleyber-Christ%20%28lungsod%29
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Pleyber-Christ (lungsod)
|
https://ceb.wikipedia.org/w/index.php?title=Pleyber-Christ (lungsod)&action=history
|
Cebuano
|
Spoken
| 146 | 263 |
Lungsod ang Pleyber-Christ (Breton: Pleiber-Krist) sa Pransiya. Nahimutang ni sa amihanang bahin sa nasod, km sa kasadpan sa Paris ang ulohan sa nasod. metros ibabaw sa dagat kahaboga ang nahimutangan sa Pleyber-Christ, ug adunay ka molupyo.
Ang yuta palibot sa Pleyber-Christ medyo bungtoron. Ang kinahabogang dapit sa palibot dunay gihabogon nga ka metro ug km sa habagatan-kasadpan sa Pleyber-Christ. Dunay mga ka tawo kada kilometro kwadrado sa palibot sa Pleyber-Christ medyo gamay nga populasyon. Ang kinadul-ang mas dakong lungsod mao ang Morlaix, km sa amihanan sa Pleyber-Christ. Hapit nalukop sa kaumahan ang palibot sa Pleyber-Christ.
Ang klima kasarangan. Ang kasarangang giiniton °C. Ang kinainitan nga bulan Agosto, sa °C, ug ang kinabugnawan Enero, sa °C. Ang kasarangang pag-ulan milimetro matag tuig. Ang kinabasaan nga bulan Disyembre, sa milimetro nga ulan, ug ang kinaugahan Septiyembre, sa milimetro.
Saysay
Ang mga gi basihan niini
Mga lungsod sa Pransiya
| 44,109 |
https://github.com/uyjulian/ControlPack/blob/master/cp1.8.9/src/main/java/ctrlpack/litemod/LiteModControlPack.java
|
Github Open Source
|
Open Source
|
MIT
| 2,021 |
ControlPack
|
uyjulian
|
Java
|
Code
| 298 | 690 |
/* Copyright (c) 2011-2017 Julian Uy, Dave Reed
*
* Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions:
*
* The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software.
*
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
*
*/
package ctrlpack.litemod;
import com.mumfrey.liteloader.InitCompleteListener;
import com.mumfrey.liteloader.LiteMod;
import com.mumfrey.liteloader.Tickable;
import com.mumfrey.liteloader.core.LiteLoader;
import ctrlpack.ControlPackMain;
import net.minecraft.client.Minecraft;
import net.minecraft.client.settings.KeyBinding;
import java.io.File;
public class LiteModControlPack implements LiteMod, Tickable, InitCompleteListener {
@Override
public String getName() {
return "ControlPack";
}
@Override
public String getVersion() {
return "5.93-beta2";
}
public static void regKeys(KeyBinding[] keyArray) {
for (KeyBinding currentKey : keyArray) {
if (currentKey != null) {
LiteLoader.getInput().registerKeyBinding(currentKey);
}
}
}
@Override
public void init(File configPath) {
try {
new ControlPackMain();
} catch (Exception e) {
e.printStackTrace();
}
}
@Override
public void onTick(Minecraft minecraft, float partialTicks, boolean inGame, boolean clock) {
if (inGame) {
ControlPackMain.instance.tickInGame();
}
}
@Override
public void onInitCompleted(Minecraft minecraft, LiteLoader loader) {
ControlPackMain.instance.postMCInit();
}
@Override
public void upgradeSettings(String version, File configPath, File oldConfigPath) {}
}
| 39,229 |
https://github.com/Vladimare/legendary-broccoli/blob/master/core/sysmon.hpp
|
Github Open Source
|
Open Source
|
MIT
| 2,018 |
legendary-broccoli
|
Vladimare
|
C++
|
Code
| 50 | 165 |
#ifndef _SYSMON_HPP_
#define _SYSMON_HPP_
#include "termansi.h"
#include "thread.hpp"
class sysmon
: public thread
{
public:
sysmon(const char* name = 0, unsigned char baseverb = LOG_LEVEL_DBG_ALL);
virtual ~sysmon();
protected:
virtual void run();
private:
unsigned char verbosity;
const char* prjname;
unsigned long refresh_counter;
void refresh();
static const threadCreationDisposition tcd;
};
#endif /*_SYSMON_HPP_*/
| 17,636 |
https://github.com/xiatianlong/PersonalWebsite/blob/master/src/main/java/com/personalWebsite/common/enums/CommentBizType.java
|
Github Open Source
|
Open Source
|
Apache-2.0
| 2,017 |
PersonalWebsite
|
xiatianlong
|
Java
|
Code
| 67 | 240 |
package com.personalWebsite.common.enums;
/**
* 评论类型
* Created by xiatianlong on 2017/1/8.
*/
public enum CommentBizType {
/**
* 评论
*/
CODE("004"),
/**
* 文章
*/
ARTICLE("004001"),
/**
* 笔记
*/
NOTE("004002"),
/**
* 留言
*/
MESSAGE("004003"),
/**
* 回复
*/
REPLY("004004");
private String code;
CommentBizType(String code) {
this.code = code;
}
public String getCode() {
return code;
}
public boolean equals(String typeCode) {
return this.code.equals(typeCode);
}
}
| 8,555 |
https://github.com/ajpcode/zephyr/blob/master/subsys/bluetooth/controller/ll_sw/ull_tmp.c
|
Github Open Source
|
Open Source
|
Apache-2.0
| 2,019 |
zephyr
|
ajpcode
|
C
|
Code
| 622 | 2,826 |
/*
* Copyright (c) 2018-2019 Nordic Semiconductor ASA
*
* SPDX-License-Identifier: Apache-2.0
*/
#include <stdbool.h>
#include <stddef.h>
#include <errno.h>
#include <toolchain.h>
#include <zephyr/types.h>
#if defined(CONFIG_BT_CTLR_DEBUG_PINS)
#if defined(CONFIG_PRINTK)
#undef CONFIG_PRINTK
#endif
#endif
#include "hal/ccm.h"
#include "util/mem.h"
#include "util/mfifo.h"
#include "util/memq.h"
#include "util/mayfly.h"
#include "ticker/ticker.h"
#include "pdu.h"
#include "lll.h"
#include "lll_conn.h"
#include "lll_tmp.h"
#include "ull_internal.h"
#include "ull_tmp.h"
#include "ull_tmp_internal.h"
#define LOG_MODULE_NAME bt_ctlr_llsw_ull_tmp
#include "common/log.h"
#include <soc.h>
#include "hal/debug.h"
#define TMP_TICKER_TICKS_PERIOD 32768
#define TMP_TICKER_TICKS_SLOT 327
#define TMP_TX_POOL_SIZE ((CONFIG_BT_TMP_TX_SIZE_MAX) * \
(CONFIG_BT_TMP_TX_COUNT_MAX))
/* NOTE: structure accessed by Thread and ULL */
struct ull_tmp {
struct ull_hdr hdr;
u8_t is_enabled:1;
};
struct tmp {
struct ull_tmp ull;
struct lll_tmp lll;
};
static struct tmp tmp_inst[CONFIG_BT_TMP_MAX];
static MFIFO_DEFINE(tmp_tx, sizeof(struct lll_tx),
CONFIG_BT_TMP_TX_COUNT_MAX);
static struct {
void *free;
u8_t pool[TMP_TX_POOL_SIZE];
} mem_tmp_tx;
static struct {
void *free;
u8_t pool[sizeof(memq_link_t) * CONFIG_BT_TMP_TX_COUNT_MAX];
} mem_link_tx;
static int _init_reset(void);
static void _ticker_cb(u32_t ticks_at_expire, u32_t remainder,
u16_t lazy, void *param);
static void _tx_demux(void);
int ull_tmp_init(void)
{
int err;
err = _init_reset();
if (err) {
return err;
}
return 0;
}
int ull_tmp_reset(void)
{
u16_t handle;
int err;
handle = CONFIG_BT_TMP_MAX;
while (handle--) {
ull_tmp_disable(handle);
}
/* Re-initialize the Tx mfifo */
MFIFO_INIT(tmp_tx);
err = _init_reset();
if (err) {
return err;
}
return 0;
}
u16_t ull_tmp_handle_get(struct lll_tmp *tmp)
{
return ((u8_t *)CONTAINER_OF(tmp, struct tmp, lll) -
(u8_t *)&tmp_inst[0]) / sizeof(struct tmp);
}
int ull_tmp_enable(u16_t handle)
{
u32_t tmp_ticker_anchor;
u8_t tmp_ticker_id;
struct tmp *inst;
int ret;
if (handle >= CONFIG_BT_TMP_MAX) {
return -EINVAL;
}
inst = &tmp_inst[handle];
if (inst->ull.is_enabled) {
return -EALREADY;
}
ull_hdr_init(&inst->ull.hdr);
lll_hdr_init(&inst->lll, inst);
if (!inst->lll.link_free) {
inst->lll.link_free = &inst->lll._link;
}
memq_init(inst->lll.link_free, &inst->lll.memq_tx.head,
&inst->lll.memq_tx.tail);
tmp_ticker_id = TICKER_ID_TMP_BASE + handle;
tmp_ticker_anchor = ticker_ticks_now_get();
ret = ticker_start(TICKER_INSTANCE_ID_CTLR, TICKER_USER_ID_THREAD,
tmp_ticker_id,
tmp_ticker_anchor,
0,
TMP_TICKER_TICKS_PERIOD,
TICKER_NULL_REMAINDER,
TICKER_NULL_LAZY,
TMP_TICKER_TICKS_SLOT,
_ticker_cb, inst,
NULL, NULL);
if (ret) {
goto enable_cleanup;
}
inst->lll.link_free = NULL;
inst->ull.is_enabled = 1;
enable_cleanup:
return ret;
}
int ull_tmp_disable(u16_t handle)
{
u8_t tmp_ticker_id;
struct tmp *inst;
int ret;
if (handle >= CONFIG_BT_TMP_MAX) {
return -EINVAL;
}
inst = &tmp_inst[handle];
if (!inst->ull.is_enabled) {
return -EALREADY;
}
tmp_ticker_id = TICKER_ID_TMP_BASE + handle;
ret = ticker_stop(TICKER_INSTANCE_ID_CTLR, TICKER_USER_ID_THREAD,
tmp_ticker_id,
NULL, NULL);
if (ret) {
return ret;
}
ret = ull_disable(&inst->lll);
if (ret) {
return ret;
}
inst->ull.is_enabled = 0;
inst->lll.link_free = memq_deinit(&inst->lll.memq_tx.head,
&inst->lll.memq_tx.tail);
return ret;
}
int ull_tmp_data_send(u16_t handle, u8_t size, u8_t *data)
{
struct lll_tx *tx;
struct node_tx *node_tx;
struct tmp *inst;
u8_t idx;
if (handle >= CONFIG_BT_TMP_MAX) {
return -EINVAL;
}
inst = &tmp_inst[handle];
if (!inst->ull.is_enabled) {
return -EINVAL;
}
if (size > CONFIG_BT_TMP_TX_SIZE_MAX) {
return -EMSGSIZE;
}
idx = MFIFO_ENQUEUE_GET(tmp_tx, (void **) &tx);
if (!tx) {
return -ENOBUFS;
}
tx->node = mem_acquire(&mem_tmp_tx.free);
if (!tx->node) {
return -ENOMEM;
}
tx->handle = handle;
node_tx = tx->node;
memcpy(node_tx->pdu, data, size);
MFIFO_ENQUEUE(tmp_tx, idx);
return 0;
}
void ull_tmp_link_tx_release(memq_link_t *link)
{
mem_release(link, &mem_link_tx.free);
}
static int _init_reset(void)
{
/* Initialize tx pool. */
mem_init(mem_tmp_tx.pool, CONFIG_BT_TMP_TX_SIZE_MAX,
CONFIG_BT_TMP_TX_COUNT_MAX, &mem_tmp_tx.free);
/* Initialize tx link pool. */
mem_init(mem_link_tx.pool, sizeof(memq_link_t),
CONFIG_BT_TMP_TX_COUNT_MAX, &mem_link_tx.free);
return 0;
}
static void _ticker_cb(u32_t ticks_at_expire, u32_t remainder,
u16_t lazy, void *param)
{
static memq_link_t _link;
static struct mayfly _mfy = {0, 0, &_link, NULL, lll_tmp_prepare};
static struct lll_prepare_param p;
struct tmp *inst = param;
u32_t ret;
u8_t ref;
printk("\t_ticker_cb (%p) enter: %u, %u, %u.\n", param,
ticks_at_expire, remainder, lazy);
DEBUG_RADIO_PREPARE_A(1);
/* Increment prepare reference count */
ref = ull_ref_inc(&inst->ull.hdr);
LL_ASSERT(ref);
/* Append timing parameters */
p.ticks_at_expire = ticks_at_expire;
p.remainder = remainder;
p.lazy = lazy;
p.param = &inst->lll;
_mfy.param = &p;
ret = mayfly_enqueue(TICKER_USER_ID_ULL_HIGH, TICKER_USER_ID_LLL,
0, &_mfy);
LL_ASSERT(!ret);
/* De-mux tx FIFO */
_tx_demux();
DEBUG_RADIO_PREPARE_A(1);
printk("\t_ticker_cb (%p) exit.\n", param);
}
static void _tx_demux(void)
{
struct lll_tx *tx;
tx = MFIFO_DEQUEUE_GET(tmp_tx);
while (tx) {
memq_link_t *link;
struct tmp *inst;
inst = &tmp_inst[tx->handle];
printk("\t_ticker_cb (%p) tx_demux (%p): h = 0x%x, n=%p.\n",
inst, tx, tx->handle, tx->node);
link = mem_acquire(&mem_link_tx.free);
LL_ASSERT(link);
memq_enqueue(link, tx->node, &inst->lll.memq_tx.tail);
MFIFO_DEQUEUE(tmp_tx);
tx = MFIFO_DEQUEUE_GET(tmp_tx);
}
}
| 39,186 |
https://fa.wikipedia.org/wiki/%DB%8C%D8%A7%D8%B1%D8%AF%DB%8C%D8%A8%DB%8C%20%28%D8%B5%D8%A7%D8%A6%D9%85%20%D8%A8%DB%8C%E2%80%8C%D9%84%DB%8C%29
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
یاردیبی (صائم بیلی)
|
https://fa.wikipedia.org/w/index.php?title=یاردیبی (صائم بیلی)&action=history
|
Persian
|
Spoken
| 26 | 90 |
یاردیبی یک منطقهٔ مسکونی در ترکیه است که در صائمبیلی واقع شدهاست.
جستارهای وابسته
فهرست شهرهای ترکیه
منابع
پیوند به بیرون
روستاها در شهرستان صائم بیلی
| 22,356 |
https://github.com/gracenamucuo/Study/blob/master/TestRepo/TestRepo/SnapKitController.swift
|
Github Open Source
|
Open Source
|
MIT
| 2,020 |
Study
|
gracenamucuo
|
Swift
|
Code
| 288 | 1,069 |
//
// SnapKitController.swift
// TestRepo
//
// Created by 戴运鹏 on 2019/1/16.
// Copyright © 2019 戴运鹏. All rights reserved.
//
import UIKit
import SnapKit
import PullToRefreshKit
class SnapKitController: UIViewController {
var tableView:UITableView = UITableView.init(frame: CGRect.zero, style: .plain)
var dataCount = 10
override func viewDidLoad() {
super.viewDidLoad()
tableView.register(UITableViewCell.self, forCellReuseIdentifier: "CellID")
tableView.delegate = self
tableView.dataSource = self
tableView.tableFooterView = UIView.init()
layoutUI()
DispatchQueue.main.asyncAfter(deadline: DispatchTime.now() + 0) {
// self.setRefresher()
// self.tableView.switchRefreshHeader(to:.refreshing)
}
}
}
extension SnapKitController{
func layoutUI() {
view.addSubview(tableView)
let header = UIView.init(frame: CGRect.init(origin: CGPoint.zero, size:CGSize.init(width: view.frame.width, height: 100)))
header.backgroundColor = UIColor.green
tableView.tableHeaderView = header
tableView.backgroundColor = UIColor.red
tableView.snp.makeConstraints { (make) in
make.left.bottom.right.equalToSuperview()
if #available(iOS 11.0, *) {
make.top.equalTo(view.safeAreaLayoutGuide.snp.top)
} else {
make.top.equalToSuperview()
}
}
}
// func setRefresher() {
// self.tableView.configRefreshHeader(container: self) {[weak self] in
// DispatchQueue.main.asyncAfter(deadline: DispatchTime.now() + 2, execute: {
// self?.dataCount = 10
// self?.tableView.reloadData()
// self?.tableView.switchRefreshHeader(to: .normal(.success, 1))
// print("刷新了")
// })
// }
//
// self.tableView.configRefreshFooter(container: self) {[weak self] in
// DispatchQueue.main.asyncAfter(deadline: DispatchTime.now() + 2, execute: {
// self?.dataCount += 10
// self?.tableView.reloadData()
// var state = FooterRefresherState.normal
// if self?.dataCount ?? 10 > 50 {
// state = FooterRefresherState.normal
// }
// self?.tableView.switchRefreshFooter(to:state)
// print("更多了")
// })
// }
// }
}
extension SnapKitController:UITableViewDataSource,UITableViewDelegate{
func tableView(_ tableView: UITableView, numberOfRowsInSection section: Int) -> Int {
return dataCount
}
func tableView(_ tableView: UITableView, cellForRowAt indexPath: IndexPath) -> UITableViewCell {
let cell = tableView.dequeueReusableCell(withIdentifier: "CellID", for: indexPath)
cell.textLabel?.text = "第\(indexPath.row)行"
return cell
}
func tableView(_ tableView: UITableView, didSelectRowAt indexPath: IndexPath) {
tableView.switchRefreshHeader(to: .refreshing)
}
func tableView(_ tableView: UITableView, viewForHeaderInSection section: Int) -> UIView? {
let sectionHeader = UIView.init(frame: CGRect.init(origin: CGPoint.zero, size: CGSize.init(width: view.frame.width, height: 30)))
sectionHeader.backgroundColor = UIColor.gray
return sectionHeader
}
func tableView(_ tableView: UITableView, heightForHeaderInSection section: Int) -> CGFloat {
return 30
}
}
| 9,510 |
https://github.com/InseeFr/Bauhaus-Back-Office/blob/master/src/main/java/fr/insee/rmes/model/structures/MutualizedComponent.java
|
Github Open Source
|
Open Source
|
MIT
| 2,023 |
Bauhaus-Back-Office
|
InseeFr
|
Java
|
Code
| 474 | 1,426 |
package fr.insee.rmes.model.structures;
import fr.insee.rmes.exceptions.RmesException;
public class MutualizedComponent {
private String identifiant;
private String id;
private String labelLg1;
private String labelLg2;
private String altLabelLg1;
private String altLabelLg2;
private String descriptionLg1;
private String descriptionLg2;
private String type;
private String concept;
private String codeList;
private String fullCodeListValue;
private String range;
private Structure[] structures;
private String created;
private String updated;
private String creator;
private String contributor;
private String disseminationStatus;
private String minLength;
private String maxLength;
private String minInclusive;
private String maxInclusive;
private String pattern;
public MutualizedComponent() throws RmesException {
//nothing to do
}
public String getId() {
return id;
}
public void setId(String id) {
this.id = id;
}
public String getLabelLg1() {
return labelLg1;
}
public void setLabelLg1(String labelLg1) {
this.labelLg1 = labelLg1;
}
public String getAltLabelLg1() {
return altLabelLg1;
}
public void setAltLabelLg1(String altLabelLg1) {
this.altLabelLg1 = altLabelLg1;
}
public String getAltLabelLg2() {
return altLabelLg2;
}
public void setAltLabelLg2(String altLabelLg2) {
this.altLabelLg2 = altLabelLg2;
}
public String getLabelLg2() {
return labelLg2;
}
public void setLabelLg2(String labelLg2) {
this.labelLg2 = labelLg2;
}
public String getType() {
return type;
}
public void setType(String type) {
this.type = type;
}
public String getConcept() {
return concept;
}
public void setConcept(String concept) {
this.concept = concept;
}
public String getCodeList() {
return codeList;
}
public void setCodeList(String codeList) {
this.codeList = codeList;
}
public String getRange() {
return range;
}
public void setRange(String range) {
this.range = range;
}
public String getIdentifiant() {
return identifiant;
}
public void setIdentifiant(String identifiant) {
this.identifiant = identifiant;
}
public Structure[] getStructures() {
return structures;
}
public void setStructures(Structure[] structures) {
this.structures = structures;
}
public String getDescriptionLg1() {
return descriptionLg1;
}
public void setDescriptionLg1(String descriptionLg1) {
this.descriptionLg1 = descriptionLg1;
}
public String getDescriptionLg2() {
return descriptionLg2;
}
public void setDescriptionLg2(String descriptionLg2) {
this.descriptionLg2 = descriptionLg2;
}
public String getCreated() {
return created;
}
public void setCreated(String created) {
this.created = created;
}
public String getUpdated() {
return updated;
}
public void setUpdated(String updated) {
this.updated = updated;
}
public String getCreator() {
return creator;
}
public void setCreator(String creator) {
this.creator = creator;
}
public String getContributor() {
return contributor;
}
public void setContributor(String contributor) {
this.contributor = contributor;
}
public String getDisseminationStatus() {
return disseminationStatus;
}
public void setDisseminationStatus(String disseminationStatus) {
this.disseminationStatus = disseminationStatus;
}
public String getPattern() {
return pattern;
}
public void setPattern(String pattern) {
this.pattern = pattern;
}
public String getMaxInclusive() {
return maxInclusive;
}
public void setMaxInclusive(String maxInclusive) {
this.maxInclusive = maxInclusive;
}
public String getMinInclusive() {
return minInclusive;
}
public void setMinInclusive(String minInclusive) {
this.minInclusive = minInclusive;
}
public String getMaxLength() {
return maxLength;
}
public void setMaxLength(String maxLength) {
this.maxLength = maxLength;
}
public String getMinLength() {
return minLength;
}
public void setMinLength(String minLength) {
this.minLength = minLength;
}
public String getFullCodeListValue() {
return fullCodeListValue;
}
public void setFullCodeListValue(String fullCodeListValue) {
this.fullCodeListValue = fullCodeListValue;
}
}
| 48,029 |
US-202117798653-A_2
|
USPTO
|
Open Government
|
Public Domain
| 2,021 |
None
|
None
|
English
|
Spoken
| 7,335 | 9,514 |
In the light amount non-change region 313, the control unit 60 controlsthe luminance of the light emitting element 35-i such that the lightamount of light emitted from the light emitting element 35-icorresponding to the condensing spot SCi becomes a first predeterminedvalue during a period in which the condensing spot SCi passes throughthe light amount non-change region 313. The first predetermined valueindicates a value of the light amount of light emitted from the lightemitting element 35-i in the light amount non-change region 313. Inaddition, the first predetermined value is, for example, 80% or the likeof the maximum value of the light amount of light emitted from the lightemitting element 35-i.
In addition, in the light amount change region 311, the control unit 60controls the luminance of the light emitting element 35-i such that thelight amount of light emitted from the light emitting element 35-icorresponding to the condensing spot SCi becomes a second predeterminedvalue during a period in which the condensing spot SCi passes throughthe light amount change region 311. Specifically, as illustrated inFIGS. 5 and 6 , the control unit 60 controls the light amount of lightemitted from the light emitting element 35-i to the second predeterminedvalue at timing to at which a right end RE of the condensing spot SCireaches the light amount change region 311. In addition, the controlunit 60 controls the light amount of light emitted from the lightemitting element 35-i to the first predetermined value at timing tB atwhich the left end LE of the condensing spot SCi reaches the right endof the light amount change region 311. The second predetermined valueindicates a value of the light amount of light emitted from the lightemitting element 35-i in the light amount change region 311. The secondpredetermined value is a value different from the first predeterminedvalue. FIG. 6 illustrates an example in which the second predeterminedvalue is lower than the first predetermined value. In a case where thesecond predetermined value is lower than the first predetermined value,the second predetermined value is, for example, 30% or zero or the likeof the maximum value of the light amount of light emitted from the lightemitting element 35-i. In addition, the second predetermined value maybe made higher than the first predetermined value, and in this case, thesecond predetermined value is, for example, a maximum value of the lightamount of light emitted from the light emitting element 35-i. When thesecond predetermined value is zero, the light from the light emittingelement 35-i is turned off.
FIG. 7 is a flowchart illustrating an operation of the vehicle headlight10 in the present embodiment. As illustrated in FIG. 7 , the flowchartof the present embodiment includes Steps S1 to S5.
(Step S1)
The detection device 110 captures an image of the front of the vehicle100 with a camera. When detecting a target object located in front ofthe vehicle 100 from the captured image, the detection device 110outputs a signal indicating that the target object is detected to thecontrol unit 60 via the determination unit 50, and outputs a signalindicating the state of the target object to the determination unit 50.In addition, when not detecting a target object located in front of thevehicle 100 from the captured image, the detection device 110 outputs asignal indicating that the target object is not detected to thedetermination unit 50. In the present embodiment, the detection device110 identifies and detects a retroreflective object and a human astarget objects. When the signal is input, the processing proceeds toStep S2.
(Step S2)
In the present step, the control unit 60 determines whether to emit thelight on the basis of the control signal from the light switch. In acase where the control signal is not input to the control unit 60, thecontrol unit 60 stops the driving of the plurality of light source units30 and stops the driving of the drive unit 41, and the light is notemitted, and the processing returns to Step S1. In addition, in a casewhere the control signal is input to the control unit 60, the light isemitted, and the processing proceeds to Step S3.
(Step S3)
In the present step, the determination unit 50 determines whether thetarget object satisfies a predetermined requirement on the basis of thesignal indicating the state of the target object from the detectiondevice 110. In a case where the determination unit 50 determines thatthe target object does not satisfy the predetermined requirement, theprocessing proceeds to Step S4. In addition, in a case where the signalindicating that the target object is not detected is input to thedetermination unit 50, it is determined that the target object does notsatisfy the predetermined requirement, and the processing proceeds toStep S4. On the other hand, in a case where the determination unit 50determines that the target object satisfies the predeterminedrequirement, the determination unit 50 outputs a signal indicating thestate of the target object such as the distance between the targetobject and the vehicle 100 calculated by the calculation unit, thepresence position of the target object in the captured image, and thetype of the target object to the control unit 60. When the determinationunit 50 outputs the signal, the processing proceeds to Step S5.Hereinafter, the state that the predetermined requirement is satisfiedwill be described as an example in which the distance between the targetobject and the vehicle 100 is less than a predetermined distance. Inaddition, in the following description, it is assumed that the targetobject is located diagonally forward left of the vehicle 100.
(Step S4)
In the present step, as described in Step S3, the retroreflective objectas the target object is detected by the detection device 110, and thedistance between the retroreflective object and the vehicle 100 is equalto or more than the predetermined distance, or the target object is notdetected by the detection device 110. In this case, the control unit 60controls the driving of the light source unit 30 and also controls thedriving of the drive unit 41. FIG. 8 is a diagram describing scanning ofcondensing spots SC1 to SC5 in the present step. FIG. 9 is a diagramillustrating a predetermined light distribution pattern 350 formed whenthe distance between the retroreflective object 401 as a target objectand the vehicle 100 is equal to or more than a predetermined distance.Note that the predetermined light distribution pattern 350 illustratedin FIG. 9 is the same as the predetermined light distribution pattern350 illustrated in FIG. 2.
Here, first, scanning of the condensing spots SC1 to SC5 in the presentstep will be described with reference to FIG. 8 . In FIG. 8 , theplurality of scanning regions SR1 to SR5 is displaced and arranged foreasy viewing. The condensing spots SC1 to SC5 scan the scanning regionsSR1 to SR5 from the left to the right in the drawing. When the distancebetween the target object and the vehicle 100 is equal to or more thanthe predetermined distance and when the target object is not detected bythe detection device 110, the control unit 60 sets each of the scanningregions SR1 to SR5 as the light amount non-change region 313. Next, thecontrol unit 60 controls the light emitting elements 35-1 to 35-5 suchthat the light amount of light emitted from the light emitting elements35-1 to 35-5 corresponding to the condensing spots SC1 to SC5 becomesthe first predetermined value.
When the light emitting elements 35-1 to 35-5 controlled as describedabove emit light, the light is reflected toward the projection lens 43by the reflector 39 rotated by the drive unit 41. In addition, the lightpasses through the projection lens 43, is emitted to the front of thevehicle 100, and scans in the left-right direction of the vehicle 100.By this light scanning, the predetermined light distribution pattern 350is formed in front of the vehicle 100 as illustrated in FIG. 9 . Asillustrated in FIG. 9 , when the retroreflective object 401 is a roadsign installed in the vicinity of the road, the retroreflective object401 is supported by, for example, a support portion 403 that is a metalpillar erected from the vicinity of the road. In FIG. 9 , H indicates ahorizontal line, the predetermined light distribution pattern 350 isindicated by the thick line, and the predetermined light distributionpattern 350 is a light distribution pattern formed on a vertical plane,for example, 25 m away from the vehicle 100. In addition, in FIG. 9 ,the left and right edges of each of the scanning regions SR1 to SR5 areindicated by the dotted lines.
As described above, the center region CA is a region where parts of thescanning regions SR1 to SR5 overlap each other. Therefore, the lightfrom the five light emitting elements 35-1 to 35-5 is superimposed oneach other in a region of the predetermined light distribution pattern350 illustrated in FIG. 9 overlapping the center region CA. Note thatthis superimposition of light also includes superimposition of light inhuman vision. In addition, the light from the four light emittingelements is superimposed on each other in a region of the predeterminedlight distribution pattern 350 overlapping the first left region LS1 andthe first right region RS1, and the light from the three light emittingelements is superimposed on each other in a region of the predeterminedlight distribution pattern 350 overlapping the second left region LS2and the second right region RS2. In addition, the light from the twolight emitting elements is superimposed on each other in a region of thepredetermined light distribution pattern 350 overlapping the third leftregion LS3 and the third right region RS3, and the light from the onelight emitting element forms a region of the predetermined lightdistribution pattern 350 overlapping the fourth left region LS4 and thefourth right region RS4. As described above, each of the scanningregions SR1 to SR5 is set as the light amount non-change region 313. Inthis case, in a region of the predetermined light distribution pattern350 where the number of scanning regions overlapping each other islarge, the intensity of light in the predetermined light distributionpattern 350 increases. Therefore, in the light distribution pattern 350,the intensity of light in a region of the light distribution pattern 350overlapping the center region CA is the strongest, and the intensity oflight is weaker toward the outer side of the light distribution pattern350 in the left-right direction. In addition, a superimposition regionPA that coincides with a region of the predetermined light distributionpattern 350 including the regions CA, LS1 to LS3, and RS1 to RS3 is aregion where the light from at least two light emitting elements issuperimposed on each other, and the predetermined light distributionpattern 350 includes such superimposition region PA. Note that, in FIG.9 , the superimposition region PA is indicated by the alternate long andshort dash line.
(Step S5)
In the present step, the retroreflective object as the target object isdetected by the detection device 110, and the distance between theretroreflective object and the vehicle 100 is less than thepredetermined distance. In this case, the control unit 60 controls thedriving of the light source unit 30 and also controls the driving of thedrive unit 41. FIG. 10 is a diagram describing scanning of thecondensing spots SC1 to SC5 in the present step. FIG. 11 is a diagramillustrating a specific light distribution pattern 360 formed when thedistance between the retroreflective object 401 and the vehicle 100 isless than the predetermined distance. In addition, in FIG. 11 , the leftand right edges of each of the scanning regions SR1 to SR5 are indicatedby the dotted lines. Here, the description will be given assuming thatthe retroreflective object overlaps the superimposition region PA.
In the present step, the control unit 60 sets a region where theretroreflective object overlaps the superimposition region PA as apredetermined region AR on the basis of the signal from thedetermination unit 50. As illustrated in FIG. 11 , the predeterminedregion AR is a region extending linearly from the upper end to the lowerend of the superimposition region PA, and is located in the centerregion CA. Therefore, in a case where the predetermined region AR isformed in the light distribution pattern 350 illustrated in FIG. 9 , thelight from the five light emitting elements 35-1 to 35-5 is superimposedon each other in the predetermined region AR. The position of thepredetermined region AR in the left-right direction changes according tothe position of the retroreflective object 401 in the left-rightdirection with respect to the vehicle 100, and in the presentembodiment, the center of the predetermined region AR in the left-rightdirection substantially coincides with the center of the retroreflectiveobject 401 in the left-right direction. Note that the center of thepredetermined region AR in the left-right direction may not coincidewith the center of the retroreflective object 401 in the left-rightdirection. In addition, the width of the predetermined region AR in theleft-right direction changes according to the distance between thevehicle 100 and the retroreflective object 401. In the presentembodiment, the entire retroreflective object 401 overlaps thepredetermined region AR, and the width of the predetermined region AR inthe left-right direction is made wider as the distance from theretroreflective object 401 is shorter. Note that the width of thepredetermined region AR in the left-right direction may not changeaccording to the distance between the vehicle 100 and theretroreflective object 401. The width of the predetermined region AR inthe left-right direction is narrower than the width of the center regionCA, but may be the same as that of the center region CA.
Next, as illustrated in FIG. 10 , in a case where the light distributionpattern 350 illustrated in FIG. 9 is formed, the control unit 60 doesnot set the light amount change region 311 in some scanning regions ofthe scanning regions SR1 to SR5 in the light emitting elements 35-1 to35-5 that emit light to the predetermined region AR, which is notillustrated in FIG. 9 , and sets the light amount change region 311 inother some scanning regions. In the present embodiment, FIG. 10illustrates a state in which the light amount change region 311 is notset in the three scanning regions SR1, SR3, and SR5, and the lightamount change region 311 is set in the two scanning regions SR2 and SR4.Note that in FIG. 10 , similarly to FIG. 8 , the plurality of scanningregions SR1 to SR5 is displaced and arranged for easy viewing. The lightamount change region 311 corresponds to the predetermined region AR, theposition of the light amount change region 311 in the left-rightdirection is the same as that of the predetermined region AR, and thewidth of the light amount change region 311 in the left-right directionis the same as that of the predetermined region AR. In addition, thecontrol unit 60 sets the light amount non-change region 313 in a regionwhere the light amount change region 311 is not set in each of thescanning regions SR1 to SR5.
Note that, in a case where the predetermined region AR is located in thefirst left region LS1, when the light distribution pattern 350illustrated in FIG. 9 is formed, the light from the four light emittingelements 35-1 to 35-4 is superimposed on each other in the predeterminedregion AR. In this case, in a case where the light distribution pattern350 illustrated in FIG. 9 is formed, the control unit 60 does not setthe light amount change region 311 in some scanning regions of thescanning regions SR1 to SR4 in the light emitting elements 35-1 to 35-4that emit light to the predetermined region AR, and sets the lightamount change region 311 in other some scanning regions. Therefore, thecontrol unit 60 does not set the light amount change region 311 in somescanning regions of the scanning regions of the light emitting elementsthat emit light to the predetermined region AR in the light distributionpattern 350 formed when the distance between the target object and thevehicle 100 is equal to or more than the predetermined distance, andsets the light amount change region 311 in other some scanning regions.
In addition, when the distance between the target object and the vehicle100 is less than the predetermined distance, the number of scanningregions in which the light amount change region 311 is set changesaccording to the distance between the vehicle 100 and the target object.For example, in a case where the target object is the retroreflectiveobject 401, the number increases as the distance between the vehicle 100and the retroreflective object 401 is shorter. For example, in a casewhere the distance between the vehicle 100 and the retroreflectiveobject 401 is shorter than the distance in the state illustrated in FIG.11 , the light amount change region 311 in which the distance is largerthan that in the state illustrated in FIG. 10 is set. In this case, forexample, the light amount change region 311 is set in the three scanningregions SR1, SR2, and SR4. Note that, for example, in a case where thetarget object is a human, the number of scanning regions in which thelight amount change region 311 is set increases as the distance betweenthe vehicle 100 and the human is longer. Note that the number ofscanning regions in which the light amount change region 311 is set maynot change according to the distance between the vehicle 100 and aretroreflective object or a human as a target object. In addition, thescanning region where the light amount change region 311 is not set isnot particularly limited, and may be changed according to the positionof the target object in the left-right direction with respect to thesuperimposition region PA.
In addition, the control unit 60 sets the second predetermined value onthe basis of the information from the determination unit 50. In a casewhere the target object is a retroreflective object, that is, in a casewhere a signal indicating that the target object is a retroreflectiveobject is input to the control unit 60, the control unit 60 sets thesecond predetermined value to a predetermined value lower than the firstpredetermined value. Note that, in a case where the target object is ahuman, that is, in a case where a signal indicating that the targetobject is a human is input to the control unit 60, the control unit 60sets the second predetermined value to be higher than the firstpredetermined value. In the flowchart illustrated in FIG. 7 , since thetarget object is the retroreflective object 401, the control unit 60sets the second predetermined value to a predetermined value lower thanthe first predetermined value.
Next, in a case where the target object is the retroreflective object401, the control unit 60 controls the light emitting elements 35-1,35-3, and 35-5 such that the light amount of light emitted from thelight emitting elements 35-1, 35-3, and 35-5 corresponding to thecondensing spots SC1, SC3, and SC5 for scanning the scanning regionsSR1, SR3, and SR5 where the light amount change region 311 is not setbecomes the first predetermined value. In addition, in a case where thetarget object is the retroreflective object 401, the control unit 60controls the light emitting elements 35-2 and 35-4 such that the lightamount of light emitted from the light emitting elements 35-2 and 35-4corresponding to the condensing spots SC2 and SC4 becomes the firstpredetermined value during a period in which the condensing spots SC2and SC5 for scanning the scanning regions SR2 and SR4 in which the lightamount change region 311 is set pass through the light amount non-changeregion 313. In addition, in a case where the target object is theretroreflective object 401, the control unit 60 controls the lightemitting elements 35-2 and 35-4 such that the light amount of lightemitted from the light emitting elements 35-2 and 35-4 corresponding tothe condensing spots SC2 and SC4 becomes the second predetermined valueduring a period in which the condensing spots SC2 and SC4 pass throughthe light amount change region 311. Then, the processing returns to StepS1.
When the light emitting elements 35-1 to 35-5 controlled as describedabove emit light, the light is reflected toward the projection lens 43by the reflector 39 rotated by the drive unit 41. The reflected lightpasses through the projection lens 43, is emitted to the front of thevehicle 100, and scans in the left-right direction of the vehicle 100.By this light scanning, the specific light distribution pattern 360illustrated in FIG. 11 is formed in front of the vehicle 100. Asdescribed above, the light amount of light emitted from the lightemitting elements 35-2 and 35-4 corresponding to the condensing spotsSC2 and SC4 becomes the second predetermined value lower than the firstpredetermined value during a period in which the condensing spots SC2and SC4 pass through the light amount change region 311. Therefore, thelight amount emitted from the condensing spots SC2 and SC4 to thepredetermined region AR changes so as to be smaller than the lightamount in a case where the determination unit 50 determines that theretroreflective object does not satisfy the predetermined requirement.Accordingly, when the specific light distribution pattern 360illustrated in FIG. 11 is compared with the predetermined lightdistribution pattern 350 illustrated in FIG. 9 , the light amount oflight emitted to the predetermined region AR in the specific lightdistribution pattern 360 is smaller than the light amount of lightemitted to the region corresponding to the predetermined region AR inthe predetermined light distribution pattern 350, and the light amountof light emitted to the retroreflective object 401 becomes smaller.
Here, as described above, in a case where the target object overlaps aregion where at least two scanning regions overlap each other, thecontrol unit 60 does not set the light amount change region 311 in somescanning regions, and sets the light amount change region 311 in othersome scanning regions. Therefore, in the present step, the control unit60 controls the light source unit 30 such that the light amount of lightemitted from some light emitting elements to the predetermined region ARoverlapping the target object does not change and the light amount oflight emitted from other some light emitting elements to thepredetermined region AR overlapping the target object changes among thelight emitting elements that emit light to the predetermined region ARoverlapping the target object in the superimposition region PA where thelight from at least two light emitting elements in the lightdistribution pattern 350 illustrated in FIG. 9 is superimposed on eachother.
Note that, in the present step, when a human as a target object isdetected by the detection device 110 and the determination unit 50determines that the human satisfies the predetermined requirement, thecontrol unit 60 sets the second predetermined value to be higher thanthe first predetermined value as described above. In a case where thesecond predetermined value is higher than the first predetermined value,the light amount emitted from the light emitting elements 35-2 and 35-4to the predetermined region AR is larger than the light amount in a casewhere the determination unit 50 determines that the human does notsatisfy the predetermined requirement. When the light amount increases,the light amount emitted to the predetermined region AR overlapping thehuman in the specific light distribution pattern 360 when thedetermination unit 50 determines that the human satisfies thepredetermined requirement is larger than the light amount emitted to theregion corresponding to the predetermined region AR in the predeterminedlight distribution pattern 350 when the determination unit 50 determinesthat the human does not satisfy the predetermined requirement.Accordingly, the light amount of light emitted to the human is larger ina state in which the human satisfies the predetermined requirement thanin a state in which the human does not satisfy the predeterminedrequirement.
In addition, in the present step, as described above, in a case wherethe distance between the retroreflective object 401, which is the targetobject, and the vehicle 100 is less than the predetermined distance, thenumber of scanning regions in which the light amount change region 311is set increases as the distance between the vehicle 100 and theretroreflective object 401 decreases. Therefore, the closer the distancebetween the vehicle 100 and the retroreflective object 401, the smallerthe light amount of light emitted to the retroreflective object. Inaddition, as described above, in a case where the distance between thehuman, which is the target object, and the vehicle 100 is less than thepredetermined distance, the number of scanning regions in which thelight amount change region 311 is set increases as the distance betweenthe vehicle 100 and the human increases. Therefore, the farther thedistance between the vehicle 100 and the human, the larger the lightamount of light emitted to the human. Therefore, the control unit 60controls the light source unit 30 such that the light amount of lightemitted from some light emitting elements to the predetermined region ARoverlapping the target object does not change and the light amount oflight emitted from other some light emitting elements to thepredetermined region AR overlapping the target object changes among thelight emitting elements that emit light to the predetermined region ARoverlapping the target object in the superimposition region PA describedabove according to the distance between the vehicle 100 and the targetobject.
By the way, for example, in a case where light emitted from a vehicleheadlight provided in a self-vehicle irradiates a retroreflective objectsuch as a sign, a part of the light is directed from the retroreflectiveobject to the self-vehicle as reflected light, and glare may be given tothe driver of the self-vehicle. In addition, when the light amount oflight emitted from the vehicle headlight and irradiating a human such asa pedestrian is small, it may be difficult for the driver to visuallyrecognize the human. Accordingly, there is a demand for easier driving.
Therefore, the vehicle headlight 10 of the present embodiment includesthe light source unit 30, the reflector 39, and the control unit 60 thatcontrols the light source unit 30. The light source unit 30 includes theplurality of light emitting elements 35-1 to 35-5. The reflector 39repeats the periodic motion to reflect the light from the plurality oflight emitting elements 35-1 to 35-5 and periodically scan the light toform the predetermined light distribution pattern 350. The predeterminedlight distribution pattern 350 includes the superimposition region PAwhere the light from at least two light emitting elements issuperimposed on each other. In a case where a signal indicating that thetarget object located in front of the vehicle 100 is detected is inputfrom the detection device 110, the control unit 60 controls the lightsource unit 30 such that the light amount of light emitted from somelight emitting elements to the predetermined region AR overlapping thetarget object does not change and the light amount of light emitted fromother some light emitting elements to the predetermined region ARoverlapping the target object changes among the light emitting elementsthat emit light to the predetermined region AR overlapping the targetobject in the superimposition region PA.
In the vehicle headlight 10 of the present embodiment, the lightdistribution pattern of the emitted light changes according to thesituation in front of the vehicle 100, and the light amount of lightemitted to the target object changes. In addition, in the vehicleheadlight 10 of the present embodiment, even in a case where a targetobject is detected, the light amount of light emitted from some lightemitting elements to the predetermined region AR overlapping the targetobject does not change. Therefore, in the vehicle headlight 10 of thepresent embodiment, even when the light distribution pattern of theemitted light is changed, the light from some light emitting elements isemitted to the target object. When the light irradiates the targetobject, the difficulty in visually recognizing the target object can besuppressed and the driving can be facilitated as compared with the casewhere the light distribution pattern of the emitted light changes andthe target object is not irradiated with the light. In addition, in thevehicle headlight 10 of the present embodiment, the number of lightemitting elements that change the light amount of light emitted issmaller than that in a case where the light amount of light emitted fromall the light emitting elements that emit light to the predeterminedregion AR overlapping the target object is changed. Therefore, with thevehicle headlight 10 of the present embodiment, the control of the lightsource unit 30 by the control unit 60 can be simplified as compared withsuch a case. Note that, in a case where the target object is detected bythe detection device and the target object is the retroreflective object401, for example, as illustrated in FIG. 11 , the light amount of lightemitted to the retroreflective object 401 changes. In a case where theretroreflective object 401 reflects the light from the vehicle headlight10, the intensity of reflected light from the retroreflective object 401to the self-vehicle tends to increase as the intensity of light emittedto the retroreflective object 401 increases. In addition, in the vehicle headlight 10 of the present embodiment, thewidth of the predetermined region AR in the left-right directionoverlapping the target object changes according to the distance betweenthe vehicle 100 and the target object. From the viewpoint of the driver,the target object looks larger as the distance between the vehicle 100and the target object is shorter. Therefore, with such a configuration,the light amount of light emitted to the target object can beappropriately changed as compared with the case where the width of thepredetermined region AR in the left-right direction in which the lightamount of emitted light changes does not change according to thedistance between the vehicle 100 and the target object.
In addition, in the vehicle headlight 10 of the present embodiment, thecontrol unit 60 controls the light source unit 30 such that the lightamount of light emitted from some light emitting elements to thepredetermined region AR overlapping the target object does not changeand the light amount of light emitted from other some light emittingelements to the predetermined region AR overlapping the target objectchanges among the light emitting elements that emit light to thepredetermined region AR overlapping the target object in thesuperimposition region PA described above according to the distancebetween the vehicle 100 and the target object. Therefore, the lightamount of light emitted to the target object changes according to thedistance between the vehicle 100 and the target object. The driver tendsto have difficulty in visually recognizing the human as the distancebetween the vehicle and the human is longer. In the vehicle headlight 10of the present embodiment, the farther the distance between the vehicleand the human, the larger the light amount of light emitted to thehuman. Therefore, in the vehicle headlight 10 of the present embodiment,the human can be easily visually recognized and the driving can befacilitated as compared with the case where the light amount of lightemitted to the human does not change according to the distance betweenthe vehicle 100 and the human. In addition, in a case where theretroreflective object reflects the light from the vehicle headlight 10,the intensity of reflected light from the retroreflective object to theself-vehicle tends to increase as the distance between the self-vehicleand the retroreflective object is shorter. In the vehicle headlight 10of the present embodiment, the closer the distance between the vehicle100 and the retroreflective object, the smaller the light amount oflight emitted to the retroreflective object. Therefore, in the vehicleheadlight 10 of the present embodiment, impartment of glare to thedriver of the self-vehicle can be suppressed and the driving can befacilitated as compared with the case where the light amount of lightemitted to the retroreflective object does not change according to thedistance between the vehicle 100 and the retroreflective object.
Note that, in Step S5, the control unit 60 does not need to controlother some light emitting elements such that the light amount of lightemitted from other some light emitting elements different from somelight emitting elements toward the predetermined region AR overlappingthe target object among the light emitting elements that emit light tothe predetermined region AR overlapping the target object in thesuperimposition region PA always becomes the second predetermined value.For example, the control unit 60 may set the light amount change region311 in a predetermined scanning period. Then, the control unit 60 maycontrol other some light emitting elements such that the light amount oflight emitted from other some light emitting elements described abovetoward the predetermined region AR becomes the second predeterminedvalue in the period in which the condensing spot passes through thelight amount change region 311 in the predetermined scanning period. Inaddition, in a case where the number of other some light emittingelements described above is plural, the light amounts of light emittedfrom the plurality of light emitting elements toward the predeterminedregion AR may be different from each other. For example, in a case whereother some light emitting elements are the two light emitting elements35-2 and 35-4 and the target object is a retroreflective object as inthe above embodiment, the control unit 60 may control the two lightemitting elements 35-2 and 35-4 such that the light amount of lightemitted from the light emitting element 35-2 toward the predeterminedregion AR becomes the second predetermined value and the light amount oflight emitted from the light emitting element 35-4 toward thepredetermined region AR becomes a third predetermined value lower thanthe second predetermined value.
In addition, in Step S5, the control unit 60 does not need to controlthe light source unit 30 such that the light amount of light emittedfrom some light emitting elements to the predetermined region AR doesnot change and the light amount of light emitted from other some lightemitting elements to the predetermined region AR changes among the lightemitting elements that emit light to the predetermined region ARoverlapping the target object in the superimposition region PA accordingto the distance between the vehicle 100 and the target object. Forexample, in a case where the detection device 110 can detect aretroreflective object as a target object and can detect the intensityof light directed from the retroreflective object to the vehicle 100,the control unit 60 may control the light source unit 30 such that thelight amount of light emitted from some light emitting elements to thepredetermined region AR does not change and the light amount of lightemitted from other some light emitting elements to the predeterminedregion AR decreases among the light emitting elements that emit light tothe predetermined region AR overlapping the retroreflective object inthe superimposition region PA according to the intensity of lightdirected from the retroreflective object to the vehicle 100. With such aconfiguration, the impartment of glare to the driver of the self-vehiclecan be appropriately suppressed. Note that the detection device 110detects the intensity of light from the retroreflective object towardthe vehicle 100 on the basis of, for example, a luminance value in thecaptured image. In addition, for example, in a case where the detectiondevice 110 can detect a retroreflective object as a target object andcan detect an angle formed by the traveling direction of the vehicle 100and a direction from the vehicle 100 toward the retroreflective object,the control unit 60 may control the light source unit 30 such that, asthe angle is smaller, the light amount of light emitted from some lightemitting elements to the predetermined region AR does not change, andthe light amount of light emitted from other some light emittingelements to the predetermined region AR decreases among the lightemitting elements that emit light to the predetermined region ARoverlapping the retroreflective object in the superimposition region PA.In general, in a light distribution pattern of light emitted from avehicle headlight, the intensity of light tends to increase to a centerside. Therefore, the intensity of light emitted to the target objecttends to increase as the angle described above decreases. In addition, the control unit 60 may change the scanning region in whichthe light amount change region 311 is set according to the position ofthe predetermined region AR in the left-right direction. Hereinafter, amodification in which the scanning region in which the light amountchange region 311 is set changes will be described. Note that the sameor equivalent components as those of the embodiment described above aredesignated by the same reference numerals and duplicated descriptionwill be omitted unless otherwise specified.
In the present modification, for example, as illustrated in FIG. 12 ,the scanning regions SR1 to SR5 corresponding to the respective lightemitting elements 35-1 to 35-5 are divided into three regions: pairs ofend portions EP1-1 to EP1-5 and EP2-1 to EP2-5, and center portions CP1to CP5 in the left-right direction, which is the scanning direction.Note that, in FIG. 12 , the scanning regions SR1 to SR5 are arranged tobe displaced vertically, and the sizes of the pairs of end portions withrespect to the respective scanning regions are larger than the actualsizes for easy understanding.
One end portions EP1-1 to EP1-5 are regions including the left-side endsof the scanning regions SR1 to SR5.
Widths W1-1 to W1-5 in the left-right direction are widths equal to orlarger than the widths of the condensing spots SC1 to SC5 in theleft-right direction, and are, for example, ten times the widths of thecondensing spots SC1 to SC5 in the left-right direction. The other endportions EP2-1 to EP2-5 are regions including the right-side ends of thescanning regions SR1 to SR5. Widths W2-1 to W2-5 in the left-rightdirection are widths equal to or larger than the widths of thecondensing spots SC1 to SC5 in the left-right direction, and are, forexample, ten times the widths of the condensing spots SC1 to SC5 in theleft-right direction. The center portions CP1 to CP5 are regionssandwiched between the one end portions EP1-1 to EP1-5 and the other endportions EP2-1 to EP2-5.
The scanning regions SR1 to SR5 are arranged to be displaced in theleft-right direction, and centers C1 to C5 of the center portions CP1 toCP5 in the left-right direction are also displaced from each other inthe left-right direction. However, a part of each of the center portionsCP1 to CP5 overlaps a part of the central portions of all the otherscanning regions. In addition, the respective end portions EP1-1 toEP1-5 and EP2-1 to EP2-5 do not overlap the end portions of all theother scanning regions.
FIG. 13 is a diagram describing an example of setting of the lightamount change region 311 in Step S5 in the present modification. Notethat, in FIG. 13 , the sizes of the pairs of end portions with respectto the respective scanning regions are larger than the actual size foreasy understanding. In addition, in FIG. 13 , the light amount changeregion 311 is not set in the three scanning regions SR1, SR2, and SR3,and the light amount change region 311 is set in the two scanningregions SR4 and SR5 in Step S5. In addition, the predetermined region ARis located in the center portions CP4 and CP5 of all the scanningregions SR4 and SR5 in which the light amount change region 311 is set.Note that, in the example illustrated in FIG. 13 , the predeterminedregion AR is also located in the center portions CP1 to CP3 of thescanning regions SR1 to SR3 in which the light amount change region 311is not set. In such a state, for example, when the predetermined regionAR moves in the left-right direction as the vehicle 100 moves, the lightamount change region 311 also moves in the left-right direction.Therefore, as illustrated in FIG. 14 , in the two scanning regions SR4and SR5, the end portion and the light amount change region 311 mayoverlap each other. In other words, in the two scanning regions SR4 andSR5, the end portion may overlap the predetermined region AR. Here, inthe example illustrated in FIG. 14 , one end portion EP1-5 of thescanning region SR5 and the predetermined region AR overlap, and thispredetermined region AR is located in the center portions CP1 to CP4 ofthe scanning regions SR1 to SR4.
In a case where the predetermined region AR is changed from a firststate illustrated in FIG. 13 to a second state illustrated in FIG. 14 ,the control unit 60 controls the light source unit 30 in the mannerdescribed below. The first state is a state in which the predeterminedregion AR is located in the center portions CP4 and CP5 of all thescanning regions SR4 and SR5 in which the light amount change region 311is set as illustrated in FIG. 13 . In addition, the second state is astate in which, as illustrated in FIG. 14 , the predetermined region ARoverlaps one end portion EP1-5 of the scanning region SR5 and is locatedin the center portions CP1 to CP3 of the scanning regions SR1 to SR3 inwhich the light amount change region 311 is not set. The control unit 60controls the light source unit 30 such that the light amount emitted tothe predetermined region AR from the light emitting elementcorresponding to the scanning region where the end portion and thepredetermined region AR overlap among the light emitting elements 35-4and 35-5 returns to the light amount emitted to the predetermined regionAR before the light amount is changed. Specifically, the control unit 60removes the light amount change region 311 from the scanning region SR5in which the end portion EP1-5 and the predetermined region AR overlap.Therefore, the light amount emitted to the predetermined region AR fromthe light emitting element 35-1 corresponding to the scanning region SR5returns to the light amount emitted to the predetermined region ARbefore the light amount change region 311 is provided in the scanningregion SR5. That is, the light amount emitted from the light emittingelement 35-1 to the predetermined region AR returns to the light amountemitted to the predetermined region AR in a case where the determinationunit 50 does not determine that the target object satisfies thepredetermined requirement.
In addition, the control unit 60 controls the light source unit 30 suchthat the light amount emitted to the predetermined region AR in thesecond state becomes the light amount in the first state by changing thelight amount of light emitted to the predetermined region AR from atleast one light emitting element corresponding to the scanning region inwhich the predetermined region AR is located in the center portion amongthe light emitting elements 35-1 to 35-3. Here, in the presentmodification, similarly to the above embodiment, the light amount oflight emitted from each light emitting element 35-i when the condensingspot SCi passes through the light amount non-change region 313 is thefirst predetermined value. Therefore, the control unit 60 provides thelight amount change region 311 in one scanning region corresponding tothe scanning region in which the predetermined region AR is located inthe center portion among the three scanning regions SR1 to SR3. Here,since the end portions of the three scanning regions SR1 to SR3 do notoverlap the predetermined region AR, the light amount change region 311is provided in any one of the three scanning regions SR1 to SR3. In thepresent modification, the control unit 60 provides the light amountchange region 311 in the scanning region SR2 in which the distancebetween the predetermined region AR and the centers C1 to C3 of thecenter portions CP1 to CP3 in the left-right direction is the shortestamong the three scanning regions SR1 to SR3. Therefore, the light amountemitted from the light emitting element 35-2 corresponding to thescanning region SR2 to the predetermined region AR changes, and thelight amount emitted to the predetermined region AR in the second statebecomes the light amount in the first state. Then, the processingreturns to Step S1 from Step S5. Note that it is sufficient if thecontrol unit 60 controls the light source unit 30 such that the lightamount emitted to the predetermined region AR in the second statebecomes the light amount in the first state by providing the lightamount change region 311 in any one of the three scanning regions SR1 toSR3. A method of selecting the scanning region is not particularlylimited, and the light amount change region 311 may be provided in aplurality of scanning regions. Here, in the present modification, as in the above-described embodiment,a light distribution pattern is formed by periodic scanning of lightfrom the plurality of light emitting elements 35-1 to 35-5. In such avehicle headlight, for example, when the predetermined region ARoverlapping the target object is located in the vicinity of an end inthe scanning direction of the scanning region SR1 through which thecondensing spot SCi of light from the light emitting element 35-ipasses, the distance between this end and the predetermined region ARmay be narrower than the width of the condensing spot SCi in thescanning direction. By the way, the shortest length that allows lightscanning is the width of the condensing spot SCi in the scanningdirection. Therefore, in the case as described above, the light amountemitted to the predetermined region AR cannot be changed withoutchanging the light amount emitted between the end and the predeterminedregion AR. Therefore, the light amount emitted between theabove-described end and the predetermined region AR is also changedtogether with the predetermined region AR, and the region where thelight amount is changed may suddenly become large, and the driver mayfeel a sense of discomfort.
| 10,597 |
https://www.wikidata.org/wiki/Q3104805
|
Wikidata
|
Semantic data
|
CC0
| null |
Ghazi Albuliwi
|
None
|
Multilingual
|
Semantic data
| 3,083 | 10,126 |
Ghazi Albuliwi
acteur américain
Ghazi Albuliwi nature de l’élément être humain
Ghazi Albuliwi sexe ou genre masculin
Ghazi Albuliwi identifiant Internet Movie Database nm1231312
Ghazi Albuliwi date de naissance 1976
Ghazi Albuliwi occupation acteur ou actrice
Ghazi Albuliwi occupation réalisateur ou réalisatrice
Ghazi Albuliwi occupation scénariste
Ghazi Albuliwi lieu de naissance Amman
Ghazi Albuliwi identifiant AlloCiné nom 522731
Ghazi Albuliwi identifiant AllMovie d'une personne p350082
Ghazi Albuliwi pays de nationalité États-Unis
Ghazi Albuliwi image Ghazi Albuliwi 0677.jpg
Ghazi Albuliwi identifiant PORT d'une personne 511818
Ghazi Albuliwi identifiant Kinopoisk d'une personne 235931
Ghazi Albuliwi identifiant ČSFD d'une personne 101468
Ghazi Albuliwi identifiant Freebase /m/0g4zb6b
Ghazi Albuliwi identifiant The Movie Database d'une personne 1265614
Ghazi Albuliwi langues parlées, écrites ou signées anglais
Ghazi Albuliwi langue maternelle anglais
Ghazi Albuliwi langues d'écriture anglais
Ghazi Albuliwi identifiant MovieMeter d'une personne 1265614
Ghazi Albuliwi identifiant AdoroCinema d'une personne 522731
Ghazi Albuliwi identifiant Prabook 2310831
Ghazi Albuliwi identifiant Africultures d'une personne 36892
Ghazi Albuliwi identifiant Film.ru d'une personne ghazi-albuliwi
Ghazi Albuliwi identifiant CineMagia d'un acteur 287410
Ghazi Albuliwi identifiant Kinobox.cz d'une personne 1114497
Ghazi Albuliwi
Ghazi Albuliwi istanza di umano
Ghazi Albuliwi sesso o genere maschio
Ghazi Albuliwi identificativo IMDb nm1231312
Ghazi Albuliwi data di nascita 1976
Ghazi Albuliwi occupazione attore
Ghazi Albuliwi occupazione regista cinematografico
Ghazi Albuliwi occupazione sceneggiatore
Ghazi Albuliwi luogo di nascita Amman
Ghazi Albuliwi identificativo AlloCiné di una persona 522731
Ghazi Albuliwi identificativo AllMovie di una persona p350082
Ghazi Albuliwi paese di cittadinanza Stati Uniti d'America
Ghazi Albuliwi immagine Ghazi Albuliwi 0677.jpg
Ghazi Albuliwi identificativo PORT di una persona 511818
Ghazi Albuliwi identificativo KinoPoisk di una persona 235931
Ghazi Albuliwi identificativo ČSFD di una persona 101468
Ghazi Albuliwi identificativo Freebase /m/0g4zb6b
Ghazi Albuliwi identificativo TMDb di una persona 1265614
Ghazi Albuliwi lingue parlate o scritte inglese
Ghazi Albuliwi lingua madre inglese
Ghazi Albuliwi lingue di scrittura inglese
Ghazi Albuliwi identificativo MovieMeter di una persona 1265614
Ghazi Albuliwi identificativo AdoroCinema di una persona 522731
Ghazi Albuliwi identificativo Prabook 2310831
Ghazi Albuliwi identificativo Africultures persona 36892
Ghazi Albuliwi identificativo Film.ru di una persona ghazi-albuliwi
Ghazi Albuliwi identificativo Cinemagia di un attore 287410
Ghazi Albuliwi identificativo Kinobox di una persona 1114497
Ghazi Albuliwi
American actor, film director and screenwriter
Ghazi Albuliwi instance of human
Ghazi Albuliwi sex or gender male
Ghazi Albuliwi IMDb ID nm1231312
Ghazi Albuliwi date of birth 1976
Ghazi Albuliwi occupation actor
Ghazi Albuliwi occupation film director
Ghazi Albuliwi occupation screenwriter
Ghazi Albuliwi place of birth Amman
Ghazi Albuliwi AlloCiné person ID 522731
Ghazi Albuliwi AllMovie person ID p350082
Ghazi Albuliwi country of citizenship United States of America
Ghazi Albuliwi image Ghazi Albuliwi 0677.jpg
Ghazi Albuliwi PORT person ID 511818
Ghazi Albuliwi Kinopoisk person ID 235931
Ghazi Albuliwi ČSFD person ID 101468
Ghazi Albuliwi Freebase ID /m/0g4zb6b
Ghazi Albuliwi TMDB person ID 1265614
Ghazi Albuliwi languages spoken, written or signed English
Ghazi Albuliwi native language English
Ghazi Albuliwi writing language English
Ghazi Albuliwi MovieMeter person ID 1265614
Ghazi Albuliwi AdoroCinema person ID 522731
Ghazi Albuliwi Prabook ID 2310831
Ghazi Albuliwi Africultures person ID 36892
Ghazi Albuliwi Film.ru person ID ghazi-albuliwi
Ghazi Albuliwi CineMagia person ID 287410
Ghazi Albuliwi Kinobox person ID 1114497
Ghazi Albuliwi
US-amerikanischer Schauspieler und Filmregisseur
Ghazi Albuliwi ist ein(e) Mensch
Ghazi Albuliwi Geschlecht männlich
Ghazi Albuliwi IMDb-ID nm1231312
Ghazi Albuliwi Geburtsdatum 1976
Ghazi Albuliwi Tätigkeit Schauspieler
Ghazi Albuliwi Tätigkeit Filmregisseur
Ghazi Albuliwi Tätigkeit Drehbuchautor
Ghazi Albuliwi Geburtsort Amman
Ghazi Albuliwi AlloCiné-Personen-ID 522731
Ghazi Albuliwi AllMovie Personen-ID p350082
Ghazi Albuliwi Land der Staatsangehörigkeit Vereinigte Staaten
Ghazi Albuliwi Bild Ghazi Albuliwi 0677.jpg
Ghazi Albuliwi PORT-Personen-ID 511818
Ghazi Albuliwi KinoPoisk-Personen-ID 235931
Ghazi Albuliwi ČSFD-Personen-ID 101468
Ghazi Albuliwi Freebase-Kennung /m/0g4zb6b
Ghazi Albuliwi TMDb-Personen-ID 1265614
Ghazi Albuliwi gesprochene oder publizierte Sprachen Englisch
Ghazi Albuliwi Muttersprache Englisch
Ghazi Albuliwi geschriebene Sprache Englisch
Ghazi Albuliwi MovieMeter-Personenkennung 1265614
Ghazi Albuliwi AdoroCinema-Personenkennung 522731
Ghazi Albuliwi Prabook-Kennung 2310831
Ghazi Albuliwi Africultures Personen-ID 36892
Ghazi Albuliwi Film.ru-Personenkennung ghazi-albuliwi
Ghazi Albuliwi CineMagia-Personen-ID 287410
Ghazi Albuliwi Kinobox-Personenkennung 1114497
غازي البوليوي
ممثل أفلام أمريكي
غازي البوليوي نموذج من إنسان
غازي البوليوي الجنس ذكر
غازي البوليوي مُعرِّف قاعدة بيانات الأفلام على الإنترنت (IMDb) nm1231312
غازي البوليوي تاريخ الميلاد 1976
غازي البوليوي المهنة ممثل
غازي البوليوي المهنة مخرج أفلام
غازي البوليوي المهنة كاتب سيناريو
غازي البوليوي مكان الولادة عَمَّان
غازي البوليوي مُعرِّف شخص في ألو سيني (AlloCiné) 522731
غازي البوليوي مُعرِّف شخص في قاعدة بيانات "كُّل الأفلام" (AllMovie) p350082
غازي البوليوي بلد المواطنة الولايات المتحدة
غازي البوليوي الصورة Ghazi Albuliwi 0677.jpg
غازي البوليوي مُعرِّف شخص في قاعدة بيانات أفلام شبكة بورت (PORT) 511818
غازي البوليوي معرف كينوبويسك (Kinopoisk) 235931
غازي البوليوي مُعرِّف شخص في قاعدة بيانات الأفلام التشيكيَّة (ČSFD) 101468
غازي البوليوي مُعرِّف قاعدة البيانات الحُرَّة (Freebase) /m/0g4zb6b
غازي البوليوي معرف شخص في قاعدة بيانات الفيلم (TMDB) 1265614
غازي البوليوي اللغات المحكية الإنجليزية
غازي البوليوي اللغة اﻷم الإنجليزية
غازي البوليوي لغة الكتابة الإنجليزية
غازي البوليوي مُعرِّف موفيمير للأشخاص (MovieMeter) 1265614
غازي البوليوي مُعرِّف أدوروسينما للأشخاص 522731
غازي البوليوي مُعرِّف برابوك (Prabook) 2310831
غازي البوليوي معرف شخص في أفريكولتوريس 36892
غازي البوليوي مُعرِّف ممثل في موقع Film.ru ghazi-albuliwi
غازي البوليوي مُعرِّف مُمثِّل في موقع "سينيماجيا" (CineMagia) 287410
غازي البوليوي مُعرِّف كينوبوكس للأشخاص (Kinopoisk) 1114497
Ghazi Albuliwi
Ghazi Albuliwi osztály, amelynek példánya ember
Ghazi Albuliwi nem férfi
Ghazi Albuliwi IMDb-azonosító nm1231312
Ghazi Albuliwi születési idő 1976
Ghazi Albuliwi foglalkozás színész
Ghazi Albuliwi foglalkozás filmrendező
Ghazi Albuliwi foglalkozás forgatókönyvíró
Ghazi Albuliwi születési hely Ammán
Ghazi Albuliwi AlloCiné-személyazonosító 522731
Ghazi Albuliwi AllMovie-személyazonosító p350082
Ghazi Albuliwi állampolgárság Amerikai Egyesült Államok
Ghazi Albuliwi kép Ghazi Albuliwi 0677.jpg
Ghazi Albuliwi PORT.hu-személyazonosító 511818
Ghazi Albuliwi KinoPoiszk-személyazonosító 235931
Ghazi Albuliwi ČSFD-személyazonosító 101468
Ghazi Albuliwi Freebase-azonosító /m/0g4zb6b
Ghazi Albuliwi TMDb-személyazonosító 1265614
Ghazi Albuliwi beszélt nyelvek angol
Ghazi Albuliwi anyanyelv angol
Ghazi Albuliwi írott műveinek nyelve angol
Ghazi Albuliwi MovieMeter-személyazonosító 1265614
Ghazi Albuliwi AdoroCinema-személyazonosító 522731
Ghazi Albuliwi Prabook-azonosító 2310831
Ghazi Albuliwi Africultures-személyazonosító 36892
Ghazi Albuliwi Film.ru-személyazonosító ghazi-albuliwi
Ghazi Albuliwi Cinemagia-színészazonosító 287410
Ghazi Albuliwi Kinobox-személyazonosító 1114497
Ghazi Albuliwi
Amerikaans acteur
Ghazi Albuliwi is een mens
Ghazi Albuliwi sekse of geslacht mannelijk
Ghazi Albuliwi IMDb-identificatiecode nm1231312
Ghazi Albuliwi geboortedatum 1976
Ghazi Albuliwi beroep acteur
Ghazi Albuliwi beroep filmregisseur
Ghazi Albuliwi beroep scenarioschrijver
Ghazi Albuliwi geboorteplaats Amman
Ghazi Albuliwi AlloCiné-identificatiecode voor persoon 522731
Ghazi Albuliwi AllMovie-identificatiecode voor persoon p350082
Ghazi Albuliwi land van nationaliteit Verenigde Staten van Amerika
Ghazi Albuliwi afbeelding Ghazi Albuliwi 0677.jpg
Ghazi Albuliwi PORT-identificatiecode voor persoon 511818
Ghazi Albuliwi Kinopoisk-identificatiecode voor persoon 235931
Ghazi Albuliwi ČSFD-identificatiecode voor persoon 101468
Ghazi Albuliwi Freebase-identificatiecode /m/0g4zb6b
Ghazi Albuliwi TMDb-identificatiecode voor persoon 1265614
Ghazi Albuliwi taalbeheersing Engels
Ghazi Albuliwi moedertaal Engels
Ghazi Albuliwi schrijftaal Engels
Ghazi Albuliwi MovieMeter-identificatiecode voor persoon 1265614
Ghazi Albuliwi AdoroCinema-identificatiecode voor persoon 522731
Ghazi Albuliwi Prabook-identificatiecode 2310831
Ghazi Albuliwi Africultures-identificatiecode voor persoon 36892
Ghazi Albuliwi Film.ru-identificatiecode voor acteur ghazi-albuliwi
Ghazi Albuliwi Cinemagia-identificatiecode voor acteur 287410
Ghazi Albuliwi Kinobox-identificatiecode voor persoon 1114497
Ghazi Albuliwi
Ghazi Albuliwi primerek od človek
Ghazi Albuliwi spol moški
Ghazi Albuliwi oznaka IMDb nm1231312
Ghazi Albuliwi datum rojstva 1976
Ghazi Albuliwi poklic igralec
Ghazi Albuliwi poklic filmski režiser
Ghazi Albuliwi poklic scenarist
Ghazi Albuliwi kraj rojstva Aman
Ghazi Albuliwi AlloCiné (personne) 522731
Ghazi Albuliwi AllMovie (artist) p350082
Ghazi Albuliwi država državljanstva Združene države Amerike
Ghazi Albuliwi slika Ghazi Albuliwi 0677.jpg
Ghazi Albuliwi oznaka osebe PORT 511818
Ghazi Albuliwi KinoPoisk (name) 235931
Ghazi Albuliwi ČSFD (oseba) 101468
Ghazi Albuliwi Freebase /m/0g4zb6b
Ghazi Albuliwi oznaka osebe TMDB 1265614
Ghazi Albuliwi govorjeni, pisani ali kretani jeziki angleščina
Ghazi Albuliwi materni jezik angleščina
Ghazi Albuliwi jezik pisanja angleščina
Ghazi Albuliwi oznaka osebe MovieMeter 1265614
Ghazi Albuliwi
Ghazi Albuliwi instancia de ser humano
Ghazi Albuliwi sexo o género masculino
Ghazi Albuliwi identificador IMDb nm1231312
Ghazi Albuliwi fecha de nacimiento 1976
Ghazi Albuliwi ocupación actor
Ghazi Albuliwi ocupación director de cine
Ghazi Albuliwi ocupación guionista
Ghazi Albuliwi lugar de nacimiento Amán
Ghazi Albuliwi identificador AlloCiné de persona 522731
Ghazi Albuliwi identificador AllMovie de artista p350082
Ghazi Albuliwi país de nacionalidad Estados Unidos
Ghazi Albuliwi imagen Ghazi Albuliwi 0677.jpg
Ghazi Albuliwi identificador PORT de persona 511818
Ghazi Albuliwi identificador Kinopoisk de persona 235931
Ghazi Albuliwi identificador ČSFD de persona 101468
Ghazi Albuliwi Identificador Freebase /m/0g4zb6b
Ghazi Albuliwi identificador TMDB de persona 1265614
Ghazi Albuliwi lenguas habladas, escritas o signadas inglés
Ghazi Albuliwi lengua materna inglés
Ghazi Albuliwi lengua de escritura inglés
Ghazi Albuliwi MovieMeter ID de persona 1265614
Ghazi Albuliwi identificador de personalidad en AdoroCinema 522731
Ghazi Albuliwi identificador de Prabook 2310831
Ghazi Albuliwi identificador Africultures de persona 36892
Ghazi Albuliwi identificador Cinemagia de actor 287410
Ghazi Albuliwi
Ghazi Albuliwi instància de ésser humà
Ghazi Albuliwi sexe o gènere masculí
Ghazi Albuliwi identificador IMDb nm1231312
Ghazi Albuliwi data de naixement 1976
Ghazi Albuliwi ocupació actor
Ghazi Albuliwi ocupació director de cinema
Ghazi Albuliwi ocupació guionista
Ghazi Albuliwi lloc de naixement Amman
Ghazi Albuliwi identificador AlloCiné de persona 522731
Ghazi Albuliwi identificador AllMovie d'artista p350082
Ghazi Albuliwi ciutadania Estats Units d'Amèrica
Ghazi Albuliwi imatge Ghazi Albuliwi 0677.jpg
Ghazi Albuliwi identificador PORT de persona 511818
Ghazi Albuliwi identificador Kinopoisk de persona 235931
Ghazi Albuliwi identificador ČSFD de persona 101468
Ghazi Albuliwi identificador Freebase /m/0g4zb6b
Ghazi Albuliwi identificador TMDb de persona 1265614
Ghazi Albuliwi llengua parlada, escrita o signada anglès
Ghazi Albuliwi llengua inicial anglès
Ghazi Albuliwi llengua escrita anglès
Ghazi Albuliwi identificador MovieMeter de persona 1265614
Ghazi Albuliwi identificador AdoroCinema de persona 522731
Ghazi Albuliwi identificador Prabook 2310831
Ghazi Albuliwi identificador Africultures d'una persona 36892
Ghazi Albuliwi identificador Film.ru d'actor ghazi-albuliwi
Ghazi Albuliwi identificador Cinemagia d'actor 287410
Ghazi Albuliwi identificador Kinobox de persona 1114497
Ghazi Albuliwi
Ghazi Albuliwi instancia de humanu
Ghazi Albuliwi sexu masculín
Ghazi Albuliwi identificador IMDb nm1231312
Ghazi Albuliwi fecha de nacimientu 1976
Ghazi Albuliwi ocupación actor
Ghazi Albuliwi ocupación direutor de cine
Ghazi Albuliwi ocupación guionista
Ghazi Albuliwi llugar de nacimientu Amán
Ghazi Albuliwi país de nacionalidá Estaos Xuníos
Ghazi Albuliwi imaxe Ghazi Albuliwi 0677.jpg
Ghazi Albuliwi identificador en Freebase /m/0g4zb6b
Ghazi Albuliwi llingües falaes inglés
Ghazi Albuliwi llingua materna inglés
Ghazi Albuliwi llingua d'escritura inglés
Ghazi Albuliwi
Ghazi Albuliwi honako hau da gizaki
Ghazi Albuliwi sexua edo generoa gizonezko
Ghazi Albuliwi IMDb identifikadorea nm1231312
Ghazi Albuliwi jaiotza data 1976
Ghazi Albuliwi jarduera aktore
Ghazi Albuliwi jarduera film-zuzendari
Ghazi Albuliwi jarduera gidoilari
Ghazi Albuliwi jaiolekua Amman
Ghazi Albuliwi herritartasuneko herrialdea Ameriketako Estatu Batuak
Ghazi Albuliwi irudia Ghazi Albuliwi 0677.jpg
Ghazi Albuliwi Kinopoisk pertsona-identifikatzailea 235931
Ghazi Albuliwi Freebase-ren identifikatzailea /m/0g4zb6b
Ghazi Albuliwi hitz eginez, idatziz edo keinuz dakizkien hizkuntzak ingeles
Ghazi Albuliwi lehen hizkuntza ingeles
Ghazi Albuliwi idazteko hizkuntza ingeles
جازى البوليوى
جازى البوليوى واحد من انسان
جازى البوليوى الجنس دكر
جازى البوليوى تاريخ الولاده 1976
جازى البوليوى الوظيفه ممثل
جازى البوليوى الوظيفه مخرج افلام
جازى البوليوى الوظيفه سيناريست
جازى البوليوى مكان الولاده عمان
جازى البوليوى الجنسيه امريكا
جازى البوليوى الصوره Ghazi Albuliwi 0677.jpg
جازى البوليوى معرف فرى بيس /m/0g4zb6b
جازى البوليوى اللغه انجليزى
جازى البوليوى اللغة الام انجليزى
Ghazi Albuliwi
Ghazi Albuliwi tilfælde af menneske
Ghazi Albuliwi køn mand
Ghazi Albuliwi IMDb-ID nm1231312
Ghazi Albuliwi fødselsdato 1976
Ghazi Albuliwi beskæftigelse skuespiller
Ghazi Albuliwi beskæftigelse filminstruktør
Ghazi Albuliwi beskæftigelse manuskriptforfatter
Ghazi Albuliwi fødested Amman
Ghazi Albuliwi AlloCiné person-ID 522731
Ghazi Albuliwi AllMovie artist-ID p350082
Ghazi Albuliwi statsborgerskab USA
Ghazi Albuliwi billede Ghazi Albuliwi 0677.jpg
Ghazi Albuliwi PORT person-ID 511818
Ghazi Albuliwi Kinopoisk person-ID 235931
Ghazi Albuliwi ČSFD person-ID 101468
Ghazi Albuliwi Freebase-ID /m/0g4zb6b
Ghazi Albuliwi TMDb person-ID 1265614
Ghazi Albuliwi talte sprog engelsk
Ghazi Albuliwi modersmål engelsk
Ghazi Albuliwi skriver på sprog engelsk
Ghazi Albuliwi Film.ru person ID ghazi-albuliwi
Ghazi Albuliwi
Ghazi Albuliwi instância de ser humano
Ghazi Albuliwi sexo ou género masculino
Ghazi Albuliwi identificador IMDb nm1231312
Ghazi Albuliwi data de nascimento 1976
Ghazi Albuliwi ocupação ator
Ghazi Albuliwi ocupação realizador de cinema
Ghazi Albuliwi ocupação argumentista
Ghazi Albuliwi local de nascimento Amã
Ghazi Albuliwi identificador AlloCiné-Personalidade 522731
Ghazi Albuliwi identificador de artista AllMovie p350082
Ghazi Albuliwi país de nacionalidade Estados Unidos
Ghazi Albuliwi imagem Ghazi Albuliwi 0677.jpg
Ghazi Albuliwi identificador Kinopoisk-Person 235931
Ghazi Albuliwi identificador ČSFD de uma pessoa 101468
Ghazi Albuliwi identificador Freebase /m/0g4zb6b
Ghazi Albuliwi identificador TMDb de uma pessoa 1265614
Ghazi Albuliwi línguas faladas, escritas ou assinadas Inglês
Ghazi Albuliwi língua materna Inglês
Ghazi Albuliwi idioma de escrita Inglês
Ghazi Albuliwi identificador de personalidade no AdoroCinema 522731
Ghazi Albuliwi identificador Cine Magia de ator 287410
Ghazi Albuliwi
Ghazi Albuliwi esiintymä kohteesta ihminen
Ghazi Albuliwi sukupuoli mies
Ghazi Albuliwi IMDb-tunniste nm1231312
Ghazi Albuliwi syntymäaika 1976
Ghazi Albuliwi ammatti näyttelijä
Ghazi Albuliwi ammatti elokuvaohjaaja
Ghazi Albuliwi ammatti käsikirjoittaja
Ghazi Albuliwi syntymäpaikka Amman
Ghazi Albuliwi henkilön AlloCiné-tunniste 522731
Ghazi Albuliwi henkilön AllMovie-tunniste p350082
Ghazi Albuliwi kansalaisuus Yhdysvallat
Ghazi Albuliwi kuva Ghazi Albuliwi 0677.jpg
Ghazi Albuliwi henkilön PORT-tunniste 511818
Ghazi Albuliwi henkilön KinoPoisk-tunniste 235931
Ghazi Albuliwi henkilön ČSFD-tunniste 101468
Ghazi Albuliwi Freebase-tunniste /m/0g4zb6b
Ghazi Albuliwi henkilön TMDb-tunniste 1265614
Ghazi Albuliwi puhuu kieliä englanti
Ghazi Albuliwi äidinkieli englanti
Ghazi Albuliwi kirjoituskieli englanti
Ghazi Albuliwi henkilön MovieMeter-tunniste 1265614
Ghazi Albuliwi Prabook-tunniste 2310831
Ghazi Albuliwi henkilön Africultures-tunniste 36892
Ghazi Albuliwi näyttelijän Cinemagia-tunniste 287410
Ghazi Albuliwi
Ghazi Albuliwi instans av människa
Ghazi Albuliwi kön man
Ghazi Albuliwi IMDb-ID nm1231312
Ghazi Albuliwi födelsedatum 1976
Ghazi Albuliwi sysselsättning skådespelare
Ghazi Albuliwi sysselsättning filmregissör
Ghazi Albuliwi sysselsättning manusförfattare
Ghazi Albuliwi födelseplats Amman
Ghazi Albuliwi AlloCiné person-ID 522731
Ghazi Albuliwi AllMovie person-ID p350082
Ghazi Albuliwi medborgare i USA
Ghazi Albuliwi bild Ghazi Albuliwi 0677.jpg
Ghazi Albuliwi PORT person-ID 511818
Ghazi Albuliwi KinoPoisk person-ID 235931
Ghazi Albuliwi ČSFD person-ID 101468
Ghazi Albuliwi Freebase-ID /m/0g4zb6b
Ghazi Albuliwi TMDB person-ID 1265614
Ghazi Albuliwi talade, skrivna eller tecknade språk engelska
Ghazi Albuliwi modersmål engelska
Ghazi Albuliwi skrivspråk engelska
Ghazi Albuliwi MovieMeter person-ID 1265614
Ghazi Albuliwi AdoroCinema person-ID 522731
Ghazi Albuliwi Prabook-ID 2310831
Ghazi Albuliwi Africultures person-ID 36892
Ghazi Albuliwi Film.ru person-ID ghazi-albuliwi
Ghazi Albuliwi Cinemagia person-ID 287410
Ghazi Albuliwi Kinobox person-ID 1114497
Ghazi Albuliwi
Ghazi Albuliwi forekomst av menneske
Ghazi Albuliwi kjønn mann
Ghazi Albuliwi IMDb-ID nm1231312
Ghazi Albuliwi fødselsdato 1976
Ghazi Albuliwi beskjeftigelse skuespiller
Ghazi Albuliwi beskjeftigelse filmregissør
Ghazi Albuliwi beskjeftigelse manusforfatter
Ghazi Albuliwi fødested Amman
Ghazi Albuliwi AlloCiné person-ID 522731
Ghazi Albuliwi AllMovie artist ID p350082
Ghazi Albuliwi statsborgerskap USA
Ghazi Albuliwi bilde Ghazi Albuliwi 0677.jpg
Ghazi Albuliwi PORT person-ID 511818
Ghazi Albuliwi Kinopoisk person-ID 235931
Ghazi Albuliwi ČSFD person-ID 101468
Ghazi Albuliwi Freebase-ID /m/0g4zb6b
Ghazi Albuliwi TMDb person-ID 1265614
Ghazi Albuliwi talte eller skrevne språk engelsk
Ghazi Albuliwi morsmål engelsk
Ghazi Albuliwi skriftspråk engelsk
Ghazi Albuliwi MovieMeter person-ID 1265614
Ghazi Albuliwi Prabook-ID 2310831
Ghazi Albuliwi Africultures person-ID 36892
Ghazi Albuliwi Film.ru person-ID ghazi-albuliwi
Ghazi Albuliwi CineMagia person-ID 287410
Ghazi Albuliwi Kinobox person-ID 1114497
Ghazi Albuliwi
Ghazi Albuliwi instancë e njeri
Ghazi Albuliwi gjinia mashkull
Ghazi Albuliwi IMDb ID nm1231312
Ghazi Albuliwi data e lindjes 1976
Ghazi Albuliwi profesioni aktor
Ghazi Albuliwi profesioni regjisor
Ghazi Albuliwi profesioni skenarist
Ghazi Albuliwi vendi i lindjes Amman
Ghazi Albuliwi shtetësia Shtetet e Bashkuara të Amerikës
Ghazi Albuliwi imazh Ghazi Albuliwi 0677.jpg
Ghazi Albuliwi Freebase ID /m/0g4zb6b
Ghazi Albuliwi gjuhë që flet, shkruan ose këndon anglisht
Ghazi Albuliwi gjuhë amtare anglisht
Ghazi Albuliwi gjuhë që shkruan anglisht
加齊·亞布里維
加齊·亞布里維 隸屬於 人類
加齊·亞布里維 性別 男
加齊·亞布里維 IMDb識別碼 nm1231312
加齊·亞布里維 出生日期 1976
加齊·亞布里維 職業 演員
加齊·亞布里維 職業 電影導演
加齊·亞布里維 職業 編劇
加齊·亞布里維 出生地 安曼
加齊·亞布里維 AlloCiné人物編號 522731
加齊·亞布里維 AllMovie個人編號 p350082
加齊·亞布里維 國籍 美國
加齊·亞布里維 圖片 Ghazi Albuliwi 0677.jpg
加齊·亞布里維 Kinopoisk個人編號 235931
加齊·亞布里維 捷克斯洛伐克電影數據庫個人編號 101468
加齊·亞布里維 Freebase識別碼 /m/0g4zb6b
加齊·亞布里維 TMDb人物編號 1265614
加齊·亞布里維 通曉語言 英語
加齊·亞布里維 母語 英語
加齊·亞布里維 書寫語言 英語
加齊·亞布里維 MovieMeter人物編號 1265614
加齊·亞布里維 Africultures人物ID 36892
加齊·亞布里維 Film.ru人物標識符 ghazi-albuliwi
加兹·阿尔布利维
加兹·阿尔布利维 隶属于 人類
加兹·阿尔布利维 性別 男
加兹·阿尔布利维 IMDb編號 nm1231312
加兹·阿尔布利维 出生日期 1976
加兹·阿尔布利维 职业 演員
加兹·阿尔布利维 职业 電影導演
加兹·阿尔布利维 职业 編劇
加兹·阿尔布利维 出生地 安曼
加兹·阿尔布利维 AlloCiné人物编号 522731
加兹·阿尔布利维 AllMovie个人编号 p350082
加兹·阿尔布利维 國籍 美國
加兹·阿尔布利维 图像 Ghazi Albuliwi 0677.jpg
加兹·阿尔布利维 Kinopoisk个人编号 235931
加兹·阿尔布利维 捷克斯洛伐克电影数据库个人编号 101468
加兹·阿尔布利维 Freebase標識符 /m/0g4zb6b
加兹·阿尔布利维 TMDb人物编号 1265614
加兹·阿尔布利维 通晓语言 英語
加兹·阿尔布利维 母语 英語
加兹·阿尔布利维 书写语言 英語
加兹·阿尔布利维 MovieMeter 个人编号 1265614
加兹·阿尔布利维 Film.ru人物标识符 ghazi-albuliwi
Ghazi Albuliwi
aktor merikano
Ghazi Albuliwi ta un hende
Ghazi Albuliwi sekso o género maskulino
Ghazi Albuliwi fecha di nasementu 1976
Ghazi Albuliwi okupashon aktor
Ghazi Albuliwi okupashon direktor di sine
Ghazi Albuliwi okupashon esenarista
Ghazi Albuliwi lugá di nasementu Aman
Ghazi Albuliwi pais di nashonalidat Estadonan Uni di Merka
Ghazi Albuliwi imágen Ghazi Albuliwi 0677.jpg
Ghazi Albuliwi dominio di idioma Ingles
Ghazi Albuliwi lenga materno Ingles
Ghazi Albuliwi
Ghazi Albuliwi instância de ser humano
Ghazi Albuliwi sexo ou gênero masculino
Ghazi Albuliwi identificador IMDb nm1231312
Ghazi Albuliwi data de nascimento 1976
Ghazi Albuliwi ocupação ator
Ghazi Albuliwi ocupação diretor(a) de cinema
Ghazi Albuliwi ocupação roteirista
Ghazi Albuliwi local de nascimento Amã
Ghazi Albuliwi identificador AlloCiné-Person 522731
Ghazi Albuliwi país de cidadania Estados Unidos
Ghazi Albuliwi imagem Ghazi Albuliwi 0677.jpg
Ghazi Albuliwi identificador Kinopoisk-Person 235931
Ghazi Albuliwi línguas faladas ou escritas Inglês
Ghazi Albuliwi língua materna Inglês
Ghazi Albuliwi idioma de escrita Inglês
Ghazi Albuliwi identificador de personalidade no AdoroCinema 522731
Ghazi Albuliwi
Òṣèré Ọmọ Orílẹ̀-èdè America
Ghazi Albuliwi àkórí ọmọnìyàn
Ghazi Albuliwi ẹ̀yà akọ
Ghazi Albuliwi ọjó ìbí 1976
Ghazi Albuliwi iṣẹ́ oòjọ́ rẹ̀ òṣèré
Ghazi Albuliwi ìlú ìbí Amman
Ghazi Albuliwi àwòrán Ghazi Albuliwi 0677.jpg
Ghazi Albuliwi
Ghazi Albuliwi sampla de duine
Ghazi Albuliwi gnéas nó inscne fireann
Ghazi Albuliwi ID IMDb nm1231312
Ghazi Albuliwi dáta breithe 1976
Ghazi Albuliwi gairm aisteoir
Ghazi Albuliwi gairm stiúrthóir scannán
Ghazi Albuliwi gairm scríbhneoir scripte
Ghazi Albuliwi áit bhreithe Amman
Ghazi Albuliwi tír shaoránachta Stáit Aontaithe Mheiriceá
Ghazi Albuliwi íomhá Ghazi Albuliwi 0677.jpg
Ghazi Albuliwi teangacha Béarla
Ghazi Albuliwi teanga dhúchais Béarla
Ghazi Albuliwi teanga scríofa Béarla
Гази Олбуливи
Гази Олбуливи это частный случай понятия человек
Гази Олбуливи пол или гендер мужской пол
Гази Олбуливи код IMDb nm1231312
Гази Олбуливи дата рождения 1976
Гази Олбуливи род занятий актёр
Гази Олбуливи род занятий кинорежиссёр
Гази Олбуливи род занятий сценарист
Гази Олбуливи место рождения Амман
Гази Олбуливи код человека в AlloCiné 522731
Гази Олбуливи код персоны в AllMovie p350082
Гази Олбуливи гражданство США
Гази Олбуливи изображение Ghazi Albuliwi 0677.jpg
Гази Олбуливи код персоналии PORT 511818
Гази Олбуливи код человека на Кинопоиске 235931
Гази Олбуливи код персоналии ČSFD 101468
Гази Олбуливи код Freebase /m/0g4zb6b
Гази Олбуливи код человека в TMDb 1265614
Гази Олбуливи языки, на которых говорит или пишет персона английский язык
Гази Олбуливи родной язык английский язык
Гази Олбуливи язык письменных произведений английский язык
Гази Олбуливи код персоны MovieMeter 1265614
Гази Олбуливи код персоны AdoroCinema 522731
Гази Олбуливи код Prabook 2310831
Гази Олбуливи код персоны Africultures 36892
Гази Олбуливи код персоны Film.ru ghazi-albuliwi
Гази Олбуливи код человека в Cinemagia 287410
Гази Олбуливи код персоны на Kinobox.cz 1114497
Ghazi Albuliwi
غازی ئەلبولیوی
غازی ئەلبولیوی نموونەیەک لە مرۆڤ
غازی ئەلبولیوی ڕەگەز نێر
غازی ئەلبولیوی ناسێنەری بنکەدراوەی ئینتەرنێتیی فیلمەکان nm1231312
غازی ئەلبولیوی ڕێکەوتی لەدایکبوون 1976
غازی ئەلبولیوی پیشە ئەکتەر
غازی ئەلبولیوی پیشە دەرھێنەری فیلم
غازی ئەلبولیوی پیشە سیناریۆنووس
غازی ئەلبولیوی شوێنی لەدایکبوون عەممان
غازی ئەلبولیوی ھاووڵاتی ویلایەتە یەکگرتووەکانی ئەمریکا
غازی ئەلبولیوی وێنە Ghazi Albuliwi 0677.jpg
غازی ئەلبولیوی پێناسەی Freebase /m/0g4zb6b
غازی ئەلبولیوی زمانەکانی ئاخاوتن زمانی ئینگلیزی
غازی ئەلبولیوی زمانی زگماکی زمانی ئینگلیزی
غازی ئەلبولیوی زمانی نووسین زمانی ئینگلیزی
| 50,597 |
https://arz.wikipedia.org/wiki/%D9%88%D9%84%D9%8A%D8%A7%D9%85%20%D8%B3.%D9%85%D9%83%D9%81%D9%8A%D9%84%D9%89
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
وليام س.مكفيلى
|
https://arz.wikipedia.org/w/index.php?title=وليام س.مكفيلى&action=history
|
Egyptian Arabic
|
Spoken
| 54 | 172 |
وليام س.مكفيلى كان مؤرخ من امريكا.
حياته
وليام س.مكفيلى من مواليد سنة 1930 فى نيو يورك.
الدراسه
درس فى كلية اميرست و جامعة ييل.
جوايز
جايزه لينكون
جايزه بوليتزر عن فئه السيره الذاتيه
وفاته
وليام س.مكفيلى مات يوم 11 ديسمبر سنة 2019.
لينكات برانيه
مصادر
مؤرخين
مؤرخين من امريكا
متعلمين فى ماونت هوليوك كوليدچ
| 11,849 |
in.ernet.dli.2015.94161_2
|
English-PD
|
Open Culture
|
Public Domain
| 1,813 |
Considerations On Colonial Policy
|
Not Available
|
English
|
Spoken
| 7,139 | 9,689 |
If any alteration should take place in the easting laws under which the affairs of India are administered, enough has been urged already, to prove that such alteration should be of a nature calculated to render that country nwre dependent upon Britain ; or, if possible, more useful to her. The changes petitioned for, must be, of all others^ the most dangerous : the loss of our Ame- rican colonies should have taught us wisdom ; and the explosion occasioned by the French Revolution, produced by the endewi'our of theorists, professedly to better the condition of the country, and indeed that of the human race' generally, should ’ make us very cautious how we venture vipcm :any measure vvhich njay raise a fermentation amongst the myriads of India. That some •fhodifications of the trade* to a certain 48 degree, may be proper, will not be denied j but, as to the propriety of adopting the sweeping changes proposed, since the wisest and greatest statesmen have-already depre- cated them, it may be asked, whom shall we account the best judges of the question as it stands at present — the ill-informed petitioners for ruin at the out-ports ; his Majesty’s present Ministers ; or the Indji Directors, whose peculiar interests would not be injured by the proposed changes ; for their patronage and emoluments will not be touched, and none of them are large holders of India Stock. The Directors have for many years contemplated and managed the concerns of India, and are in posses- sion of a mass of experience which has been accumulating ever since the year 1600, the forty-third of Queen Elizabeth, when the first Charter of the Company was granted. We should remember, * too, that the opinion of the Directors is foumded on the judgment of those great statesmen, Messrs. Pitt, Dund&s, and Fox; and is sup- ported by tliat of thi^,.aserchants of London', who trade to all parts of the globe, and who must be deemed, what they are in- fact, 49 ■ tbe most accomjpUshed traders, and best informed coti^mercial characters, in the Vorld. Independently of commerce, let even the enemies 'df- this country declare, what a degree of pplitioal importance arises to Britain from her possessions in the East, under all the disadvantages, as some people might be disposed to say, of the existing monopoly. The weight and consequence which India (triumphant as the Company has been of late in that quarter of the world) gives to Britain in the balance of power, are so great* that* they ought not to be endangered by adopting the schemes of interested projectors. The dismemberment of the Anglo-Indian Empire would be a most awful, if not a fatal event ; and that government which paves the way leading to such a catastrophe, incurs most serious and deep responsibility. - It has been held forth that the proposed alteration in the Indian -system, will tend ’ t9 promote the general welfare. It is pre- sumed, that what is contained in these pages, has shewn sucli^ supposition to bd’ .a mere pretext, set up dd capiandum,- to 60 iiitposi^ upefri rrtiaily for the Mea! adVftBttfge of a few. It is incumbent upon the tisans of change to substantiate their asset*- ffOns By proof. Farliaiileiit has hitherto, atid with incalculable benefit to th'e ptibliCj proceeded upon solid grounds. The Acts of Fatliament arise out of a basis ofividdnte; the clamoufs of the out-ports will not avail at the bar of the House of Commorts, or above-stairs in a committee- room. There, declatuation passes for nothing { and there it is, or ill the Upper Chamber of Parliament and its apartments, under the sagacious presidency of the Chancellor of Great Britaidj or that of Lord Walsittgbam (from whose indefatigable labours and consum- mafe knowledge of business, the public has derived innumerable advantages) ; there it is, that Lord Buckinghamshire will learn ** whether the nation is without an alterna- “ tive” respecting the government and the commerce of India; whether the w.el fare of the country will be Secured by laying open the Peninsula to the speculations of ' adventurers; Whether the traiiquillityof the factories and other settlements will, be maintained amidst the shock of contending i^er^s ; ^4wbeither. Parli^eiH it to bie ineiKp^ient, i|ppo|itip> unwipe, to disturb tbe ^qipnny in tibn piUSSpssion whieh it yet holds, and thn degree or aUthOirity whinh it is yet periniUed to retain in India ? That the British colonic in other parts of the world, in North America* for in- stance, and the West Indies, are open to all classes of htie iCing’s aohjects engaged in tradn, is most true, and i$ readily admitted*. Bnt these colonies are, and hat'O been al- ways, under the immediate jurisdiction of the Crown. The ^ing appoints their go- vernors, and all. d^e odlcers, civil aud mili* tary ; the constituted authoritiies hold direct epmmunicatioo wid^ the spv^^ign power at honie ; they administer justice with yigt^nr, they meet every emergency with promptitude, and can dit will -en^ice ohe- dience to their lawful commands. 'With regard to Europeans, however, all residents in India enter into covenants with the Company, finding security for their good conduct ; and contempt of the Conipany’s authority can only be punished by sending the oflPending party from the country. But, during the continuance of peace, he will havfe abundant opportunity of sheltering himself under a neutral flag ; or,' at any rate, nmy pj^sion, as has been ‘already the case, tedibus and expensive iuvesligatioQS ia pur courts of la.%. 53 It has been obsen'ed, that in consequence the wise provisions of the Navigntion- Acf, the intercourse of foreign nations with our western colonies is restrained; whereas, on the coriCrary, with regard to India, it is said, and probably truly, that British capital has often been employed in trading with India, under the cover of foreign flags^ But it is to be feared, that in the event of conceding the prayer of their petitions to the out-ports, after the disappointed adven* tutors si all have parted with the sanguine hopes winch at present cause their bosoms to pant; after their golden dreams shall have ended in positive and actual losses — the pri- vileges with whieh they will be invested may, at no great distance of time, present that anomfilous prodigy in the trading world, the converse of the last mentioned case, foreign capital embarkeU under British flags. Thus Englishmen will degenerate into car- riers .of Indian produce from theii; own set^ tlements to their own ports, for the benefit jcti foreigners ; much in the way that the * Spanish galleons bring the precious metals •of Peru and Potdsi to Cadiz ; not on the account hf Spanish, but British and other. t merdbanls. Sic ttos, mn voHt,Jeriis aratra, hoveA, 4-c. ^ The Governmeot in India having availed'* itself of the treasure shipped by the Coni'' pany at home for commerciwl purpose^ and having appropriated it to the liqui- dation of the expenses attending war- like operations^ and having retained the formidable vessels belonging to the Com- pany, and employed them in the defence of India ; a question naturally arises out of the probability that the same measurcjs may be resorted to again, on a similar emergency. In ’this eveat, when the Compaq's ^ips shall be htted out far tlie general service of the public, is the trade of the outiports to continue without a check, whilst the Company is to stand the .brunt of battle ; and their ships, bpilt for commercial purposes, shall be freighted with British thunder ? The Company’^ pa* triotism is well known to the country ; but will the country assign honour to the India Company merely, whilst their rivals iq the out-ports shall be in the quiet possesion > of the whole commerce ?• The dividends of ^India Stock must probably suffer diminu;- 55 Udft, the Coittpany covers itself tv itki gJofjr-i Will the country allow it to sit under the barren and deleterious shade of the laurels it has earned ; whilst a tide of wealth sets into the out‘pcrts, with its cur* rents quickened by the Company's exertion, to its own assured loss, and their sole gain ? The merchants at the out-^ports are no doubt honourable men; and as their ships will not be applicable to the service of the nation, on the recurrence of such difficulties, it is to be hoped that they will not object to compensate the Company for the treasure with which they may furnish the state, and the vessels they may place at its disposal. In fact, the whole measure is replete with difficulties, and pregnant with many evils. It does not seem possible to main> tain< any intercourse with India, beneficial to Great Britain, except through the me- dium 'of the East India Company. However, it is not intended in these pages to assert, or to insist, that the Com- pany has never erred, or has done every thing, ‘Numerically, which the country had a right to expect. 'A friend, as the author •avowedly Is, to the first trading company 56 in the world, he cannot But deplore that truth and candour oblige him to record some of the vacillations in council and"^ iH system which they have betrayed. , In Mr. Pitt’s and Lord Melville^ time, re- peated complaints were made to those eminent characters, that the Past India Company did not give due encouragement to the export of British goods, or the im- port of raw materials for our manufactu- rers; and that the remittance of private ‘ fortunes fr6m India had not that facility which ought to have been afforded. Hence, ? in the year 1793, the supply of a given quantity of tonnage was stipulated for with the Company, and enjoined by the Act of Parliament which was then passed ; and a specific rate was agreed upon for .freight on a peace-transit. In case the Compajny’s tonnage in India sliould eventually prove inadequate to the demands upon it, the governments there were empowered to grant licences to country-ships, which. were ailow'ed by an Act of Parliament to import produce during th^ .continuance of the war, and for the space of eighteen months « subsequent to the termination of hostilities,,. «7 The complaints which had been then pre* ^red'wefe thus remedied, yet in such a way as to preserve the rights of the Con^ pany inviolafe'; the imports and exports being confined to the port of London, and every thing passing under the eye of the Company. London, and the Company’s warehouses, afforded, as they had done for the space of two hundred years, a depot for all the produce of India ; and as a matter productive of mutual benefit to every one concerned, the goods were all to be sold by the Company at the usual sales. The introduction of India shipping, thus legalized, afforded an opportunity, eagerly embraced by the residents in India, to send their goods home in their own vessels ; and although the ostensible reason for this choice was the high war-freight of the Company’s shipping, yet there is abun- dant proof on record,* that other motives existed in their minds, and helped to sway them to the preference given. The ships, fi^n their return to India, were laden by tlie several houses to Which they had been * See Review of the Shipping System of the East In4ia Company/' published 1798. I 5a consigned : but with a very small proporr tion of the manufactures of this counti^y ; m may be evinced by the statement of a cargo^ in the Third Report of the Court of Directors in the year J 80 I. Thus a monopoly Was established by the residents in India« em-. bracing both the transit and trade. The consequence of this indulgence, and the exclusion of British merchants and Bri- tish shipping, produced a most serious controversy between his Majesty's Govern- ment and the East India Company; which ended in an engagement, on the part of the Company, to furnish a description of ship- ping for the sole purpose of private trade ; and permission was given to the India ship-owners to supply a proportion, subject to the same conditions as those furnished by British owners ; of which permission they have never availed themselves. These vessels were to he so completely equipped as to surpass any private ships whatever; and the Court, in order to give every faci- lity to the merchants, engaged that the ships should never be ^detained morC' thah three months unemployed after delivery of , their cargo Jiulia, if competent to proccted : they further undertook to flimish 4he dead- weight ; and in case the mer- chants should not lade the ships, they en- gaged to dojt'on their own account; attd^ in consequence, some ships were taken up pat 12/. per ton, and none higher than 15/, peace-freight, out and home. This ar- rangement, if fully acted on, was one of those liberal concessions which will ever do honour to the East India Company ; but it is to be regretted that the Company did not follow up and act upon this principle in a more ample degree, by furnishing freight to all descriptions of persons requir- ■ ing it ; by giving notice of the quantity of tonnage provided, and confining this spe- cies of shipping, as was originally planned^ to direct voyages without detention ; and by ’continuing this cheap system of employ- ing extra ships, instead of garbling and tampering with so excellent a plan, by the appropriation of those ships to other purposes, and taking np temporary vessels jjit higher rates of freight. Had they perse- vered in the intended system, every cause- of dissatisfaction would have been sup- ’ pressed. The employment of ships of 400 60 tons burthen, equipped as they are at . the out-ports, can never furnish an adequati^. transit for cargoes from such a distant iUarket as India. Shipping of this sort may suit the American nation, which has. never till lately encountered a maritime* war. Convoys cannot be afforded, as is the case with fleets bound to the West Indies; and although the smaller ships of the out-ports may now safely navigate the Indian seas, through the exertions of the Company, °at whose expense they have been cleared of hostile flags, yet still the risk of hometrard- bound vessels continues very great. * The exclusion of all the subjects of this realm from the Eastern hemisphere, (ex- cepting the immediate servants of the Company, the licenced residents, and his Majesty’s forces), is a constituent part of the tenure by which the Charter is held ; and it is highly expedient that it should be so, As the Proprietors, by continued grants and repeated Charters, have been no singularly favoured, in their enterprises, it was natural to expect that the Court of .Directors, and their servants in shauld be extremely solicitous to pmmote, aiuongst the natives of that country, the in- terests of British commerce, and the con* •sumption of home-manufactures. It was reasonable to ‘hope that the agents of the <k>mpany would do their utmost to dis- courage any rivalry with British com- modities ; that the export from hence to India, of British produce, and British goods, would have suffered no diminu- tion through any improvident encourage- ment of Oriental productions, either natural or manufactured; that a predilection fpr their native land, and the force of custom, would have secured, with all Europeans ip our Indian settleinents, a marked preference for every article exported from Britain; in a word, that British and In- dian commodities could never have come- in competition with each 'other in the East; but fhat either the feelings of nationality, or of patriotism, would have preserved to the former every possible commercial advantage. It is but too truly to be ap- prehended .that the reverse of all tHis'i is the fact; and that througlmut India, * colonked as it is by the natives of these* ( (fit islands. Oriental produbtions have been encouraged, the manufactures of Britain copied and rivalled, her commercial ex- ports diminished, and the interests of the* Indian settlements have been chiefly con- sidered, with a marked preference to those of the mother country. Lord Chatham averred that America should not be allowed to make a hob*nail whilst Bno;1and could supply her. However difficult the accom- plishment of this might be in the case of America, the principle is a wise one ; and is surely applicable to India, where every person taught to imitate an article of Eu- ropean manufacture, learns his craft to the detriment of a British artisan.. It is now asserted, and with truth, that India stands in need of few articles which this country can supply. This cessation of demand for home- productions in the Indian market, is the lamentable result of the culpable infatuation which has pro- moted, in the districts of Hindostan, the manufacturing arts of Europe. This evik so destructive of the -prosperity of Great Britain, has increased with the enlargement «of our settlements ; but what will be the consequence of an open trade ? The out-, ports, and even Loudon itself, will in Course of time send out multitudes of adventurers; extensive manufactories will' be established in every part of India ; the British looms, forges, and potteries, will presently suffer under the effects of this mistaken system ; our Oriental colonies will feel themselves independent on Bri- tain ; our exportation of the produce of British labour will suffer vast diminution ; and money will probably become the only medium of commerce from this country — bullion our only export. The cotton mills of Lancashire, Cheshire, Yorkshire, and Scotland, will experience the ill effects of the projected communication with India. At all events, it is to be hoped, that in the new Charter some prudential regula- tions will be introduced to secure the wake- ful attention of the Court of Directors to l;be nlanufacturing interests of this country^ It is by no means a matter of difficulty to substantiate these observations by evi- dtence*. Indeed, proof has become hardly* necessary ; for it Is notoripus that India has made rapid advances jn the produc- 64f tion of European manufactures, and the adoption of British improvements in me- chanics. In many articles they have al- ready established a rivalry 'With us ; and, it is possible, (nay, if an open trade should be conceded, it h probable)^ that they will be able to supply themselves with those goods which we yet are able to export. India is not without copper, iron, lead, and other me- tals ; and what must astonish every one who has the least smattering of the policy of commerce^ iron works are about to be estab- lished in India under the sanction of Govern- ment ; and samples of steel have been trans- mitted home, equal to any made in Britain. Thus will some of the most essential ar- ticles of British manufacture, in a short time, produce no commerciaf benefits to our country, so far as India is concerned, through the competency of the natives to fabricate them, instructed by the mistaken zeal of Englishmen, and supported by the East India Company, and by Government itself. ' It .behoves the public to look narrowly into the probable consequences of the pro- jected innovations. The Court of Direc- 65 tors, themselves, have not secured to their country all the advantages that ^he might •have enjoyed from the wholesome restric* tions which they had it in their povver.to lay upon tJ'ade; and they have connived at, if not encouraged, attempts in manu- factures, from which we could only look for contingent and remote benefits, whilst the detriment occasioned by tliem is direct and ijnmediate. Were a list of the articles formerly ex- ported to India made out, and compared with the goods which that country now takes from us', we should be utterly asto- nished at the various manufactures of which she no longer stands in need ; — Asia, at this day, preparing for her own use, ut)d the consumption of many of our coun* trynien, resident in her territories, what formerly was supplied Viy the skill and industry of Europe. 7’he very stores and equipment of their shipping, canvas, cor- dage, &c. have attained their present ex- cellence from the inquiries, investigations, experiments, and in)provemcnts, suggested by the East India Company and their servants. But while the naval department K 66 of Government at home (actuated by short- sighted and false principles of economy) has overlooked the claims of this country to the employment of her manulacturers ; is it to be expected, that the residents in the peninsula of India will be swayed by any motives to a ditferent policy in favour of Great Britain? Unwise as we arc in thus devising, for temporary jnirposes, the means of our own abasement, if not ruin, at some future day ; let us look at the crisis to which such mihinamiffcment must ■O needs reduce our native country. It must continue to sink lower and lower, till at length India, once the cause of British prosperity, will become the instrument of its degradation. Wo have, as yet, only contemplated ma- nufactuiesof a minor class; — it is now neces- sary to call the attention of the public to others not simply commercial, but suyh as have been always considered of the first im- portance to tlie well-being, and even the ex- istence ol'Great Britain as an independent power. It is hardly possible to conceive al meastire more impolilifi, or more pregnant with detriment and danger to this country, 67 • than the building of ships in India on the scale now adopted. This novel practice is encouraged by every possible influence. It is a plan, tiie evils of which are already perceptibly felt; arid if it b(^ not restrained by some specific regulations, it must super- induce the most ruinous consequences. It visits with distress not only those opu- lent men who (relying on the maintenance of the principles on which the Navrgation- Act is found('d), have formed and kept up large establishments : but multitudes uf in- dustrious men, forming the nurnerfius class of shipwrights and artificers, trairu’d to their business, and depending for subsistence on the maritime exertions of Oreat Ihitairr. On the river Thames, in lire immediate vicinity of the metropolis, there are no less than six of these great establishments, com- petent to the builtling* not otrly vessels suited to the trade of the East India Com- pany, but line of battle ships. These dock-yards, in the space of a few years, have supplied fifty sail of the line ; whilst the King's yards have been appropriated to giving the navy" those necessary repairs • which are constantly and inevitably requi- 68 site in time of war. The furnishing em- ployment to about five thousand men, here- tofore engaged in the dock-yards on the ^’hanies, has already become a matter of such urgency, that several hew frigates have been put on the stocks by Govern- ment, with a view of enabling these in- dustrious and valuable men to support themselves and families, 'i'he immediate cause of all this misery, which may be regarded but “ as the beginning of sor- rows,” is the strange policy of building Indiamen at lleiigal, and other places in the East, 'i’hus another branch of manu- facture, and tlial of supreme importance, is slipping out of our hands. x\re people yet, at this hour of the day, to learn that labour is wealth ? Let us look for, a mo- ment at the bearing of tins argument on the conduct of tlfe East India Company. The Company itself enjoys, by the fiivour of this nation, an exclusive privilege of trading to India now, is it not a matter to be deplored, that the Company should employ lh§ natives of India in building their ships, to the actual injury and posi- tive loss of this nation, from which they. received their Charter. Mistaken as tlie Company have been in this {>articular, it is not very difficult to divine what will take place, if an unrestrained cominerc6 shall be permitted : if British capital shall be carried to India by British speculators, we may expect a vast increase of dock- yards in that country, and a proportional increase of detriment to the artificers of Britain. If it be supposed that India-built ships may be hired upon more* favourable terms to the Company than vessels con- structed at home : this is not the case ; although the repairs of ships built with teak cannot cost a tithe of the charges incurred by repairing those built in this country. JDisputes on the subject of freight have subsisted for thirty years past, and have occasioned many misunderstandings, and much ill will. The favourite ideas con- cerning India-built vessels, and other ideas, about to be noticed, have inspired un- pleasant jealousies^ on one side, and have prompted many Complaints on the other. That the freight paid to British ships will 70 not produce au interest of 51. per cent, on the capital embarked, has been made evi- dent by the calculations of the Company's owji officers. The eagernes^s to - obtain commands, however, has produced, under the shew of free and open competition, a ruinous speculation. Ceuiimands may be said to be actually purchased, under the colour of reduced freight, 'j'hcre is a cir- cumstance which is decide dly in favour of the ships built in India (and equally de- structive to- the interests of the British artificer, or British owner), and this is, that the India-built vessels have the advantage of an entire freight home, before a contract for general freight is made. All these things make against the mother country, and are contrary to the principles of wise colonial policy. It is not, however, in ijie nature of things, tha«t errors of this magni- tude can subsist much longer, without producing a convulsion. These manifold trespasses on British rights, will lead to consequences, which it is clearly the duty of the Company and Government seriously * to weigh, with all the attention which the subject demands. In contending for the 71 renewal of an exclusive Charter, and the continuance of the India trade to the port of I^ondon-, it may be reasonably asked of the jCompany, if they are to sacriticd none of ihefr prejudices to the interests of this country ? If they arc to divest them- selves of the power with wliich the nation entrusts them, by surrendering to the Oriental residents such advantages as serve to ripen their independence, and to make them rivals to Great I^ritain ; it becomes a duty to contend for our country and our countrynien against Asiatic interlopers, although the changes in the Indian system petitioned for, those blind suggestions of sanguine ignorance, cannot be too strongly deprecated, linpartiaiity and cquil}’ com- pel the author to remonstrate with the Con»|);my, and to demand for Faiglaiul her Just share in the advanUiges resulting from the Indian trade. Can it be expected that noblemen and gentlemen will pay so much attention as heretofore to the inclosing and the pre- servation of their woods ? Tliis may pro- duce, in the end, tliat very scarcity of’ timber, which the patrons of India ship- 73 building, and teak importation, would per- suade us already exists ; and this scarcity inay prove fatal to Great Britain at a pe- riod when we. shall no longer have the ©p-' tion of felling teak at our own pleasure. It is not true that a. scarcity exists at pre- sent in any degree to the extent stated ; but the alarm has had the good effect of giving a stimulus to^he public mind, and has excited fresh attention to the culti^ vation of tiuiber. The arguments of Mr. Evelyn, formerly Treasurer of •Greenwich Hospital (whose excellent work, entitled Sylva, or a Discourse ' on Forest Trees, first appeared in 1664), and the excellent arrangements of Mr. Pepys, * his g^ea^ contemporary, Secretary to the Admiralty in the reigns of Charles II. and Janies II. hav^ not failed of their effect. From that time, planting has bfecoaie more and more gene!ial, and the growth of timber, both for private and national use, has been pro- moted in the woods of individuals, and in * * the King's forests. Let us not close our eyes 4o facts. Fifty sail of the line have . * Pepys died in IfOS, and Evelyn in 1706. I. - of four yiSaWj and at tSii^ momont tliefe ai^e 90«0<K) lojMdd^ of timbef in tbe Kin§*s yaVdsv add* as dutch' mdife contracted' fbf ; and therd is an ahiMi-' daihce itv th6^c of the mefdhanijs. And is* it for thib' aSsefted* deficiency 6f tSnSbfef,- th^t the natives of India ate to‘ #rest em- plbyift'^t diirt of the hands o# British shi;^rights’, and tha't •Indian capital is to h*aye a preference'' t6 that of Great Britain ? Sfifely sotiie plan may be devised to avert the dntfc?|[)a'ied evil; and- sinee a participa- tk)n in those bfenefitS that belong to' British subjects, is the point contested at present h^tvreen the Cdtripany aifd the otit-ports, a p^ihodht duty fa As lipon the Legislatare t6 provide that the intef eSts of this country sUouid be seeured to its own people ; and this aS #ell for the reasdUs already given, as fdr Sbhie dthbrS, 4hffch it reihains to stdte. Wheti de look dt Javd,* our lilte atquisi- '*tibn, an i^ldhd abbtihding with t^aki it clear that sbips tiidy be built thdre iii any qbaptity. Xincier the directioh of h'fofe- inan-shipivH^ht ahd shiith, With the help of the artificers and labourers , of the coun- try, one of :the (finest ships in < the ,'Coni- pany's service, of ■ISOO . tons, burthen, yras built in itv'^icinity, at ;Penang> SitfiUar efforts ^ytll doubtless be made at an , island affording greater facilities, unless some restrictions be devised> and some protec- ting regulations in favour of British ships and seamen take place, under the autho- rity of the-. Legislature. I n the marine yard at Bombay, there is not a single European workman: and if the skill of the native artificers may be estirhated by the specimen which they Jhave given us in the .Minden, of 74 guns, it is very, evident that they cannot fail to attain celebrity, encouraged and ap- plauded .as they» have « been by very high characters, and allowed to supersede the shipwrights of Great Britain, as though our artificers had become ignorant of the science to \vhich they were bred ; or as though it were . more beneficitff to this countiy to pay Indian workmen, than to throw businesfS into the hands of our own people* A pro- cedure tins,. which militates against every. . principle of policy and .patriotism, , iNot many years ago, when Indiameji • 76 had completed their number of voyages in the Company’s employments, they were frequently sold for the country service; betftg then nearly the largest vtjssels in that trade. The case is now altered. Those noble structures, which were once ac- counted the boast of Europe, have been reared throughout India. Without that grave deliberation, or that reference to fu- ture consequences, which an innovation so momentous obviously demanded ; dock- yards and arsenals have been established there, by those who are resident in that country, through the permission of the EiUst India Company ; and a race of men, remarkable for the want of mental energy and physical strength, have been taught to excel in a branch of mechanics which they never could have carried to such a pitch of perfection, with6ut the impolitic tuition of a class of people who should havb re- served to Europeans*bn art which has so powerfully conlributed to the subjugation of the ‘.Asiatic provinces. At pi^sent, individual ships are bujlt there ; but vi^hole fleets ma}'^ be furnished* if required, and hereafter may be disposed of to those 77 • # with whom Britons may one day have to contend for their maritime rights, and the empire of the sea. How ihr s)*ch measures can be recon- ciled with those which prudence would dictate ; how far it may be thought proper to continue, or to limit them — will be, it is hoped, the subjects of the most attentive consideration ; and will not fall to the decision of those whose predilections in favour of Indian exertion and talent, have excited and encouiai^ed *such snr- prising and such alarming efforts. Least of all, should the discussion of these points be left to those governments in India which, in decided opposition to British interests, have indiscreetly afforded the means of bringing us to a crisis so replete with danger. The question of builtiing ships in India is a "measure .which may furnish employ- ment for the most vigorous intellects of our first statesmen, who should coolly view it in all its bearings, and contemplate its ultirnate issue. It, is not yet too late to attend to it. It will yet admit of some wholesome modifications. 78 * ■ At all events, onr naval resources here ahould not sufl[ISr diminutipn, nor should the means of rendering them useful to the state be crippled. *Tbey ai§ of'- vital im- portance in all their ramifications. None of them should be suffered to fall into decay. They may all be put in requisition on some great emergency. This is the era of political changes. We must be pre- , pared against all hostile attempts. It \viU be too late to set about renewing aur establishnients at the moment when our. entire force may be called into action. Having noticed the rivalry that subsists between this country and India in those objects of commerce which may be deemed British manufactures ; and the unnatural preference given to those goods now fabri- cated in India, originally of British* inven- tion, and brought to their present perfection by British labour and ingenuity ; it may not: be amiss to attempt the solution of so strange a circumstance. It is certainly the duty of the governing power at home to encourage the cojonists abroad ; but this must never be done to; the prejudice of , the native subjects of any country. But if Gov^meDC has beea inattentive to this prii^iple, can it be expected that the residents in the Peninsula and its depen- deneies should niuch> regard them ? Many of those persons have quitted the British islands in early life; they have formed new habits, and are become partial to the j)eople amount whom they live ; they are proud of the ingenuity manifested by the natives, and regard it as a proof of tbeii! own efficiency, and . the fruit of their own patronage ; they are not uninfioenced by certain motives of economy ; and at last they become rivals of their fellow-subjects, and cultivate interests ultimately detri- mental to the well-being, and destructive of the mercantile prosperity of the land of their nativity. On the return of such per- sons, to Great Britain, can we wonder that they retain those habits which have thus genel«ated a second nature ? Can we won- 'der^ that in the capacity of opulent indi- viduals, or, eventually, Directors of the India Company^ or members of the Legis- lature, they should praise the adroitness of the natives of India in the fabrication .of manufactures, the competency of the 80 cpuntry and its inhabitants to produce them, and the cheapness of labour in pur Oriental provinces. This discussion, ope- rating in a certain way o^^ the. human mind, may be deemed metaphysical and impertinent to the subject of these pages; but it is presumed that it has a practical bearing on the whole of the argument. The more of truth it may discover, the more should it put the executive govern- ment on its guard against the probable consequences of these predilections* and impel our statesmen to adopt such mea- sures as may secure to this country all the advantages derivable from the employment qf its artisans in their respective branches of manual labour. It is granted that gen- tlemen who have long resided in India must have acquired much valuable general information ; of this it is most proper that the country should avail itself: but it must ever take care to fence round its njanufac- tiiring interests with such barriers as may resist the efforts of those, who^ without any criminal intention, and swayed merely by habitual partialities, riiay be induced to place them in circumstances of hazard. 81 If ships are to be built throughout India^ ~ and<are to be entitled to British registers, they will be numerous beyond all ex- pectation; l^ie artiScers of this country must either emigrate or starve; and the revenue will suffer most serious diminu- tion. By way of elucidating this argu- ment, let us examine the single article of hemp. This, in its raw state, pays a duty of 9/. per ton ; but it is obvious that in consequence of the improvement and con- sumption of Indian canvas and cordage, whilst our homemianufacturers are in- jured, the duties must be lessened, and the deficiency must be made up by other taxes ; at the same time, it is obvious tliat the re^ venue must suffer an additional loss in the amount of those indirect taxes paid by the. labourers in all they consume. The same reasoning applies to every other c^e«of manufactures eijcouraged in the ■ colonies, of whatsoever nature they may be. One might be induced to cherish a hope, that facts so self-evident as these could not be overlooked by uur statesmen ; but ex- . perience too plainly proves the contrary ; M $2 as is most evident from what has been already pointed out. The naval depart- ment has but too industriously seconded the endeavours of the Indian residents to supply those articles manufactured in the colonies, which ought to have been fur- nished by Great Britain :—dangerous and most erroneous system, to be deplored by all true patriots ; and to be amended, curbed, of altered without loss of time, if it be not grown too inveterate to be meddled with. If the evils'attending it cannot be removed, at least care should be taken that they may not be aggravated or increased. It is easier, however, to prevent mischiefs of this kind, than to suppress them. The war has been urged as a plea for the adoption of measures confessedly imiKilitic: and it is held out that they are but of a temporary nature* Arrangements- of this kind, however, commonly moro* per- manent than the generality suppose, or some people will admit. When trade has taken a determinate course, it is difficult to shut up those channels which have 'been formed. But the existence of war fur- nishes a strong argument against the inno- ss vatipns complained of: for how is it pos-^ sible that those who are obliged to contri- bute to its support, directly or indirectly, can enter into competition with the colo- nists, who may follow ail sorts of trades ad libitum^ without being burthened by ani hundredth part of those imposts which the inhabitants of the mother-country are bound to pay. It has been computed that they are obliged to part with half their income to the state- Dr. Price esti- mated their contributions at tos. in the pound ; and however a(ggravated his cal- culation once appeared, subsequent events have proved it to be correct. When we. take the increase of population into the account; the impolicy of those measures which# by depriving thousands of employ- ment, render it impossible for them to pay taxes, is most evident^ and one cannot but "be astonished at tli^ infatuation which occasions a loss of 151. per cent, in the payments of the bulk of the laborious classes to the Exchequer. It iady be granted that certain articles, of Indian manufacture may be purchased at a lower rate than the higher price of labour, occasioned by the m taxes which Governriient receives, will per-' mit this country to charge; but it is to be considered that by throwing multitudes out of employment, :thc country is so far from gaining by all . this, that it is demon- strably a loser : and at the same time it ought to be remembered, that the money lost to the mother-country is gained by the colonies, who are thus in a mure alarming degree enabletl to rival that state whose support should l>e the joint object of all its subjects at'home and abroad. It is also matter worthy of consideration, that in every beneficial undertaking in this country. Government becoraes, as it were, a partner without risk, sharing in the pro- portion of 10/. per cent, on the profits ; whence an immense sum accrues to the revenue ; — still further increased, when the accumulation of 010003' descends from the original merchan^*to his representatives, direct, collateral, or more remote. The amount of the legacy-duty is prodigiously great. But before this final distributioji of acquired property takes place, we must form an estimate of the'sums resulting to state from the legal securities required 6>r tfae use of large portioDs of this money, io the form of bonds, leases, and agreements of various sorts, which are all legalized and rendered obligatory by stamps of va-. rious sorts, which pay a duty ad valorem. Can such substantial benehts as these be given up without due consideration ? Will the revenue be increased by rashly transfer- ring the employment of our manufactories to the natives of India ? If the object be economy ; and we are merely, to look at the primary tost of ma- nufactured articles ; let us pursue this ar- gument a little farther, and let us see to what conclusions it will lead us. If it be right that India is to supply us with ship- ping at a cheap rate ; by the same rule Russia may furnish us with caiivasj cord- age, leather, and soap ; Germany may send us linens ; Italy and Trance may 611 our ina'fkets with wrought mlks ; and Spain, in- stead of supplying us with wool, may have the wisdom to put its looms in motion, and send us broad-cloths. We know from Sad • experience the perfection to which France has brought her woollen manuiac- tures, and the brilliance and excellence of.
| 29,537 |
YECX2EAODLXSRE6657GXYBEOFBGXQF2N_1
|
German-PD-Newspapers
|
Open Culture
|
Public Domain
| 1,899 |
None
|
None
|
German
|
Spoken
| 6,045 | 10,703 |
Castrop, Samstag den 5. August. Während der Norgeleien, die hier und da zu Auszeichnungen der Person des Kaisers ausarten, erkenne auch diese Pressestimmen, um der immer wiederkehrenden Gefühlsschwankungen, als meine es Österreich gut mit Deutschland, zu zeigen, dass der Art ungen ganz unbegründet sind. Anfang begann am Montag vor dem obersten Gericht die Verhandlung wegen der Übergabe von Stuba im letzten Kriege. Nach einem Telegramm aus Triest bemerkte der Erste Blatt, Petroleum in Feuer, wobei die Kanne explodierte und die Frau von dem sprühenden Öl förmlich überschüttet wurde. Die Bedauernswerte erlitt an Armen und Brust bedeutende Brandwunden. Unwissende Nachbarsleute brachten die Unglückliche unter die Wasserleitung und als dies ihrer irrigen Meinung nach noch nicht genügte, unter die Pumpe. Die Frau, deren Gliedmaßen unter Deutschland. Domingo meldet: Die beiden Mörder des Präsidenten wurden gefangen genommen und erschossen. Das Land ist ruhig. Es fanden keine Truppenbewegungen statt. Aus Kingston (Jamaica) wird gemeldet, dass in St. James seit dem Tode des Präsidenten eine revolutionäre Bewegung herrscht, die weiter um sich greift. Die Aufständischen sammeln sich zum Angriff auf die militärstrategisch besetzte Stadt Puerto Plata; die Regierung ist haltlos. Man befürchtet heftige Wirren für den Tag der Beisetzung Heureaux'. Sollte die Revolution siegen, so werden die beiden Führer der Revolution zum Rücktritt und es wird eine Übergangsregierung mit Marian Gomez bilden. Ausländischer Zivilstand des Antes Castros vom 22. Juli bis 30. Juli 1899. Sebastian. Ein Sohn: Bergmann Casimir Antoniewicz, Castrer. Wilhelm Herkel, Causern. Bergmann Richard Bodzietz, Gues. = Sodingen. Bergmann Lorenz; Bartkowial, Castros. Bergmann Friedrich Goering, Gies. Sodrger. Lecales und Westfälische - Phynisse. Castrop, den 5. August 1899. Das Viehsergäubnis im hiesigen öffentlichen Amtsgericht stellt sich für den Monat Juli wie folgt: 124 Stück Großvieh, Schweine, 53 Köller, 1 Ziege und 1 Pflege. Davon beanstandet bezw. beschlagnahmt: 29 Rinder, 9 Rinderlebern, die Eingeweide von 7 Rindern, Schweinslunge. Auf der Freibank wurden: 3 Rinder und 3 Schweine. Die muteinnahme betrug 3206 Mark 15 Pfennig. Am Dienstag Nachmittag fand in Sachen gegen Brückeninspektor Schmiedt auf Zeche „Erin“ ein Verhör statt, zu welchem der Beschuldigte vorgeführt wurde. Noch vor dem Verhör wurde derselbe vom Richter gefragt, ob er sich schuldig bekannt habe. Aägel, Costrow. Vormann, Wildemann, Raderucher, Böhmischer sen. Bergmann, Balentin Kaufler, Castrop. Bergmann, Joseph Vorowiak, Odessa. Schreiner, Ernst Sterzel, Castrop. Bergmann, Jodans, Kareendoch, Börringhausen. Arbeiter, Jodann Bandurkirt, Habingorst. Bergmann, Joseph Geldmacher, Hebach. Anterbele. Bergmann, Friedrich Mathes, Baldener, Oberrhein. Dierstmagd, Agnes Kries, Castrop. Bergmann, Adolf Schwart, und Nanne, Ana Wilhelmine Kolwez geb. Diehl, beide zu Merlinden. Bergmann, Theodorus Wildemann, Lorrmann, Börning wurde verselben zugleich mit dem wegen Diebstahls steckbrieflich verfolgten und vom Gendarmen Herrn Blende verhafteten Arbeiter, Georg Peter, noch Dortmund verprozert. Am kommenden Sonntag werden und im Wintergarten des Herrn Th. Baerwolf die Steiermärker, Vater mit drei jungen Kindern, die Zeit zu vertreiben suchen. Der Herr Mühlseith wird uns Gedichte Miniatur-Alten Tänze auf zwei Beinen und Sänger der Klasse — so # # # fte sind —, im Süßgenusse ihrer Weisen, die rocked, vrfährig. Wie wünschen volles Haus! Infolge der blühenden Jubilanz ist unsere Gemeinde in schneller Entwicklung begriffen. Neue Häuser schießen wie Pilze aus der Erde. Die Verwaltung der Zeche „Lobringen“ lässt an 20 Wohnhäuser für Arbeiter errichten. Wegen Wohnungs mangel Herbst noch bezogen werden. Wie in letzter Sitzung der Gemeindevertretung beschlossen, soll unsere Gemeinde und dürften die Staaten, deren Unterschriften auf den Konferenz- und Delegations-Dokumente fehlen, nicht so betrachtet werden, als hätten sie dieselben abgelehnt. Die Nichtunterzeichnung sei keineswegs als Ablehnung aufzufassen. Schon früher hätten internationale Konferenzen, so fährt das Blatt fort, für ihre Beschlüsse eine Flügel offen gelassen. In Österreich-Ungarn sei die ganze Angelegenheit von Beginn an sehr ernst behandelt worden. Darum müsse jede Bestimmung, unter welcher die Unterschrift Österreich-Ungarns komme, genaust geprüft und erwogen werden. Hoffen wir, so schließt das Blatt, dass bis 1900 die Bedingungen, die vereinigt wurden, eine ausgiebige Zahl von Unterschriften erhalten werden. Das wird ein schönes Geschenk sein für die Nationen, der schönste Dank für den edlen Monarchen, der die Konferenz veranlasst hat. Burt zu bekannt billigen Preisen führt sie sehr wohl im Hause des Herrn G. Pratzmann, vis-à-vis der städtischen Sparkasse statt. Der Preis. Inhaber: Julius Meyer. Todes-Anzeige. Zacherl Hoheneg onsectel Nicht in der Flasche: Einzig echt in der Flasche! Das ist die wahrhaft untrügliche, radikale Hilfe gegen jede und jede Insekten-Plage. Castrop: Friedr. Schnettelker. Gott dem Allmächtigen hat es in seinem unerforschlichen Rat schlusse gefallen, gestern Nachmittag 7 Uhr unsere in nigerstgeliebte Mutter, Schwiegermutter und Großmutter Frau Frieda Köhler geb. Rupieper in Folge von Altersschwäche zu sich in die Ewigkeit zu nehmen. Sie starb, wohlvorbereitet durch den wiederholten Empfang der hl. Sterbesakramente, im 86. Lebensjahr. Um stillen Teilnahme bittet Im Namen der Familie: Köhler. Raucken, den 5. August 1899. Grenzreiter Holtbe repotgnener Inmehr als 150000 Familien im Gebrauch! Gänsefedern, Säbeldannen, Schwanensedern, Schapandelnen u. alle anderen Sorten Bettfedern u. Daunen. Reine und beste Reinigung garantiert. Gute preiswerte Bettfedern p. Lfund für 60, 80, 40. Prima Halbdaunen. 60, 80, Polarfedern: halbweiß 2, weiß. 50. Silberweiße Gänse- und Schwanenfedern. 50, 4, Silberweiße Gänse- und Schwanendaunen 75, 7,8 = 19. 4. Echte chinesische Ganzdaunen. 50, 3. Polar Daunen 3, 4, = 4. Gesamt helic, Kuantum zollfrei gegen Nachnahme. Nichtgefallenes bereits willige auf unsere Kosten zurückgenommen. Pecher & Co. in Herford Nr. 30 in Westfalen, # Proben u. ausführlich. Preislisten, auch über Bettstoffe, umsonst u. vorführlich! Angaben der Preislagen erwünscht! Sie kaufen äußerst in der jeder Art vorteilhaft, mein niederste Lage von Fr. Bitter, Münsterstrasse. Leere Flaschen nehme ich in Zahlung. Die Beerdigung findet am Montag den 7. d. J., Nachmittag 3½ Uhr, vom Sterbehaus aus statt. Er erhöht überraschend den Wohlgeschmack der Suppen und zwar genügen wenige Tropfen. X. Scharmang, Münsterstrasse 16. Zu haben in Original-Fläschchen von 35 Pf. an bei Ein kath. zuverlässiges Kindermädchen auf sofort oder später nach Recklinghausen gesucht. Ein in allen Hausarbeiten erfahrenes Zu erfragen bei Fr. Castrop. Geilmann, welches gute Zeugnisse aufweisen kann, zum 1. November gegen hohen Lohn gesucht Nächster in der Expeditionskan. Sottonl. Bettstellen, Matratzen, Bettfedern und Daunen in nur gut bewährten Qualitäten zu sehr billigen Preisen. Zweischl. Holzbettstellen nussbaum lackiert mit Einlage von 9,50 Mk. an bis zu den hochfeinsten. Hemdentuchen Schürzenusamischen Mtr. von 25 Pfg. an. Gurtesäulen Überbetten aus. Röth. Barchent. Sie v. 30. an. Ein Posten gut gefüllte Kopfkissen aus einfach rotem Barchent, Stück. 90 Mk. Kleiderkattun Kleidersamischen Satin = Kattun Wattendecken von 18 Pfg. an. Mtr. von 35 Pfg. an. Meter 24 Pfenning. Stück von. 25 Mark an. Meter von 12 Pfennig an. FA. * WC en Auffassungen zu begegnen, teilte ich hierdurch mit, # # Um irrtümlichen Auffassungen zu begegnen, teile ich hierdurch mit, daß ich meine Praxis nach wie vor betreibe und mein Personal wieder ergänzt habe, sodass ich in der Lage bin, alle Aufträge sa hmäß und prompt zu erledigen. # # Die Herren Schaacke, Rheinländer, Thiemann sind bei mir ausgetreten. Ich bitte, mir das bisher geschenkte Vertrauen zu erhalten. Witten, im August 1899. Weissenfels, Landmesser. Unterzeichnete beehren sich, hiermit anzuzeigen, dass dieselben ein Unterzeichnete beehren sich, hiermit anzuzeigen, dass Vermessungs-Bureau in Witten, Hammerstraße 4, eingerichtet haben unter der Firma Schäufel & Theindender! Wir bitten um geneigten Zuspruch und bemerken, dass sämtliche Arbeiten kürzester Zeit erledigt werden. Hochachtungsvoll Wilh. Schaake, Geometer, Hub. Rheinländer, vereid. Landmesser. Witten, im August 1899. SN X Geschäftsverlegung. 0000000000000 5 Geschäfts - Eröffnung. Mit dem heutigen Tage eröffne ich in dem Hause des Herrn Zimmermeisters Dapprich ein Colonial- und Fettwaarengeschäft. Mich den Bewohnern von Obercastrop und Umgebung bestens empfehlend, bitte ich um geneigten Zuspruch. Geschäftsprinzip: Gute Waare zu billigsten Tagespreisen. 2 Hochachtungsvoll Conrad Piiper, e S Wittenerstraße 25 d. l00000 Großer Bord - u. Bauholz - Veikaut: Gras = Perkauf. Montag, den 7. August er., Nachmittags 4 Uhr, soll das Gras in den gräflich von Westerholt'schen Wiesen in Habinghorst öffentlich nurmerweise meistbietend verkauft werden. Anfang im Ochsenbruch. Haus Gysenberg, 27. Juli 1899. Die Rentei-Verwaltung. 2 Lohnung von 4 Zimmer zum 1. November an eine kinderlose Familie zu vermieten. Näheres in der Expedition. Am Mittwoch, 9. August er. Nachmittags 2 Uhr anfangend, werde ich die zum Schützen gelten gebrauchten 3200 Borde, 3000 laufennden Meter Kanthölzer von verschiedener Stärke und Länge, 34 Gerüststangen und 15 Rollen Papier öffentlich nummermäßig gegen Baarzahlung oder gegen Credit verkaufen. Sämtliche Meiner verehrten Kundschaft zur gefälligen Nachricht, dass ich meine Bäckerei nebst Wohnung von Wittenerstraße 50 nach 5 der Widumerstraße 27 h verlegt habe. Mich wie bisher bestens empfohlen haltend, zeichnet hochachtungsvoll Peter Noisten. NB. Jeden Dienstag und Freitag werden Stuten zum Mit-backen angenommen. Schutz Wasser Ein eisenfreies, krystallklares Natürliches Mineralwasser besonders zur Mischung mit Wein und Spirituosen geeignet. Ausgezeichnet durch seinen vortrefflichen Geschmack und seine belebenden Eigenschaften. Von ärztlichen Autoritäten empfohlen als vorzüglichen Mittel gegen Halsübel, Magen-, Blasen- und Nierenleiden. Alleinvertrieb für Castrop und Umgebung Hermann Todebusch, Castrop. Niederlagen bei: A. Schürmann a. Co. 180hlex. 35 M 95 95 M Weinstallion. Dienstag, den 8. August er., Vormittags 9 Uhr, verkaufe ich im Pfandlokale beim Wirt Meibert hier 1 Plüschgarnitur, 2 große Spiegel, 2 Tische, 1 Vertikow, 1 Schlafsofa, 1 Waschkonsole, 1 Badewanne, 1 Badeofen, 2 Ladenreale, 4 Ladentheken, 1 Schreibpult, 1 Ofen, 3 Tafelwaagen, 1 Decimalwaage, 2 Tische, 38 Kisten Cigarren, Kaffee, Zucker, Reis, Graupen, Bohnen, Linsen usw. zwangsweise öffentlich meistbietend gegen Baar. Castrop, den 5. August 1899. Wörmsdort, Gerichtsvollzieher. Am Dienstag, den 8. August er., Vormittags 9 Uhr, werde ich beim Wirt Meibert hier 1 gut erhaltenes Coupee zwangsweise meistbietend gegen Baar versteigern. Der Verkauf findet bestimmt statt. Castrop, den 5. August 1899. Röseler, Gerichtsvollzieher. Hiermit bringe ich zur öffentlichen Kenntnis, dass ich die Verlobung meiner Tochter Maria mit dem Landmesser Oskar Ahlert aufgelöst habe. Carl Friedrich, Landmesser und Verwaltungssekretär, Adresse: Gero Steiner Sprudel, Köln am Rhein. WEI Geräucherten Speck pro 46 und 50 pence, gesalzener Speck "43 und 46", ger Schiffchen von. Plockwurst "90", Cervelatwurst "100", Holländischer Käse pro 55, Schweizer Käse "90", Schmalz (gar. rein) "40", Gelee pro 50 Dosen 10 Pfund, Eimer und Töpfe 250, Dicke Eier 249. 60 Süßrahmbutter 105 und. 1899. Nr. 93. Castrop, Samstag den 5. August. 25. Jahrgang. Die „Castroper Zeitung“ #Dienstag, Donnerstag #. und wöchentlich in der Empire. —, durch Boten ins Haus gebracht. 10 M. — Jungen Heirte Blätter 50 Pf. (Castroper Unzeiger.) Amtliches Ergänzungsblatt für den Magistrat. Zugleich Die Murgesgesellschaft, Erstgesellschaft und der damalige Wirtschaftsverein, pro dreigespaltene Zeile, Inserate werden die Abzuschriften der Ausgabe berechnet. Amtliches Organ für die Ämter Castrop und Ulenhorst. — Redaktion, Druck und Verlag von Ph. Culbart in Castrop. Wie viele seitdem Änderungen an den Bevölkerungs- und Nutzungsdaten Castrop und Ulenhorst gelangen durch ihre Veröffentlichung in der „Castroper Zeitung“, ausgezeichnet, Krise. Sommer und Winter ergangen. Das Kriegsgericht in Rennes. In Rennes sind die Wohnungen fürchterlich teuer geworden. Ein Zimmer pro Tag während des Dreyfusprozesses wird mit 100 Francs und darüber bezahlt. Nachdem es reiche Engländer, die sich die Gelegenheit nicht entgehen lassen wollen, Dreyfus persönlich zu sehen. Der Saal, in welchem das Kriegsgericht gegen Dreyfus tagen wird, die Mansio, ist lang, schmal und noch nicht drei Meter hoch. Er hat nur auf einer Seite Fenster, sechs an der Zahl, welche die ganze Zeit offen bleiben müssen, damit man nicht erstickt; dadurch wird die Akustik durchaus mangelhaft. Der Figaro ärgert sich über den obersten Unterrichtsbeamten von Rennes, der den Saal des Lyceums unter dem Vorwand nicht hergeben wollte, dass die Eltern die Schüler aus der Anstalt entfernen würden. Da möge doch der Unterrichtsminister eingreifen. Der Matin berichtet, die Verteidiger Dreyfus haben im Ganzen 25 Zeugen geladen, darunter Lebrun-Regnault, der ein Zeugnis Dreyfus gehört haben will und die Hauptleute Freytag und Hartmann. Figaro veröffentlicht die Briefe, die Dreyfus im Laufe der Gefangenschaft an die Kammer, den Senat und den Präsidenten der Republik gerichtet hat, die aber nicht veröffentlicht, sondern den Acten beifügt wurden. Ferner veröffentlicht das Blatt einen Brief Dreyfus an den Gouverneur von Guyana, worin er diesem fragt, weshalb er eigentlich in Ketten gelegt worden sei. Daß der Gouverneur nicht antwortete, mag hingehen, dass die Briefe des Verbannten aber nicht dem Parlament und dem Präsidenten ausgeliefert wurden, stellt eine strafwürdige Gesetzwidrigkeit dar. Das Schreiben an die Präsidenten beider Kammern ist datiert vom 28. Februar 1898 und hat folgenden Wortlaut: „Gleich am Tage nach meiner Verurteilung, also vor mehr als drei Jahren, als der Major du Paty de Clam mich im Auftrag des Kriegsministers besuchte, um mich nach der Verurteilung wegen eines abscheulichen Verbrechens, das ich nicht begangen hatte, zu fragen, ob ich schuldig sei oder nicht, habe ich nicht bloß erklärt, dass ich unschuldig sei, sondern auch verlangt, dass volle Klarheit geschaffen werde. Ich bat darum, alle Mittel zu diesem Zweck anzuwenden, die Militär-Attaches zu befragen, kurz, alles zu tun, was eine Regierung vermag. Es wurde mir entgegengehalten, dass Interessen, die höher als die meinigen stünden, wegen des Ursprungs der düsteren und tragischen Angelegenheit, wegen des die Anklage begründenden Briefes (Bordereau), die Anwendung solcher Mittel unmöglich machten, dass die Nachforschungen jedoch fortgesetzt werden würden. Ich habe nun drei Jahre in der schrecklichsten Lage, die man sich nur denken kann, gewartet und bin erstaunt darüber, dass die Nachforschungen zu keinem Ende führen. Wenn daher höhere Interessen als die meinigen die Anwendung der Mittel zur Feststellung der Wahrheit verhindern und noch verhindern sollen, anstatt dass dem schrecklichen Martyrium so vieler menschlichen Wesen ein Ende gemacht würde, so können dieselben Interessen doch nicht erheben, dass eine Frau und unschuldige Kinder ihnen geopfert werden. Denn sonst könnte man sich in die trüben Zeiten unserer Geschichte zurückdenken, wo die Wahrheit und das Licht unterdrückt wurden. Ich habe vor einigen Monaten meine schreckliche, tragische und unverdiente Lage der Regierung im Vertrauen auf ihren Gerechtigkeitssinn geschildert. Ich will sie auch den Herren Abgeordneten (Senatoren) schildern, um von ihrem Gerechtigkeitssinn Recht für die Meinigen zu verlangen, für meine Frau und meine Kinder, damit das schreckliche Leiden so vieler menschlichen Wesen aufhören. Genehmigen Sie usw. Alfred Dreyfus. “ Am 2. März 1898 schrieb Dreyfus an den Kriegsminister, er habe vor einigen Monaten durch einen Bericht über die Anklage erfahren und stellt verschiedene Punkte richtig. Dann fährt Dreyfus fort, er habe vom Justizminister eine Untersuchung verlangt, um die dunkle Angelegenheit aufklären zu lassen. Er beruft sich auf den geratenen Sinn des Generals de Boisdeffre und derer, die ihn verurteilten. Er hebt hervor, dass man dem Kriegsgericht heimlich Actenstücke mitgeteilt hat und dass die Verurteilung, soweit sich aus dem Verhandelten erkennen ließ, auf eine Vermutung mit Bezug auf die Schrift hin erfolgte. Der folgende Brief ist ein kurzes Revisionsgesuch an den Präsidenten der Republik. Am 16. Januar 1898 schrieb Dreyfus an den Gouverneur von Guyana, er möge in seinem Namen nach Paris an den Präsidenten der Republik telegraphieren: „Da ich seit zwei Monaten auf meine Bitte keine Antwort erhalten habe, muß ich erklären, dass ich nicht schuldig bin und es nicht sein kann.“ Castrop, den 5. August 1899. *Die Kirschen sind von den Bäumen verschwunden, die Beerenfrüchte aus dem Garten sind verspeist oder zum Gebrauch für den Winter in Einmachgläsern eingeschlossen worden und Birnen und Äpfel beginnen zu reifen. Über die kahlen Stoppelfelder fegt der Wind. Es ist August, der Übergangsmonat zum Herbst. Bis jetzt hat uns der junge Monat, den schwarzen Prophezeiungen zum Trotz, ein recht freundliches Gesicht gezeigt, und hoffentlich ist das keine trügerische Maske, sondern ein verlässliches Unterpfand trockenen und schönen Wetters für eine ganze Reihe von Wochen. Gebrauchen können wir solches recht sehr. Ist doch die Roggenerente noch nicht vollständig zum Abschluss gelangt, und stehen doch Hafer, Gerste und Weizen ganz und gar noch auf dem Halme. Ehe das Alles eingebracht ist, darüber vergehen noch mehrere Wochen, für welche wir des Sonnenscheins recht dringend bedürfen. Die kleineren Besitzer werden ja früher mit Allem fertig, da sie mit ihrer Familie die Ernte vielfach ganz allein besorgen können. Wer um die jetzige Zeit auf fremde Hilfe angewiesen ist, der hat, oft bittere Not, für gutes Geld und gute Worte die nötigen Schnitter und Schnitterinnen zu bekommen. Abkommandierungen von Militär haben auch in diesem Jahre zur Einbringung der Ernte wieder in dem gewohnten Maße stattgefunden. Soldaten wie Arbeitgeber fühlen sich sehr wohl dabei, leider ist die Hilfe noch immer nicht recht ausreichend. Der Ernteprozess muss in Folge des Arbeitermangels auf eine zu lange Zeit hin ausgedehnt werden, so dass der Erntesegen der Veränderlichkeit des Wetters viel länger ausgesetzt ist, als wünschenswert wäre. Der kleine Besitzer kann den günstigen Augenblick ausnützen, der große ist dazu nicht in der Lage. Nach den bisherigen Erfahrungen ist im Großen und Ganzen aber Alles gut abgelaufen, so dass alle Teile zufrieden sind. Werden die Getreidefelder kahl, dann taucht auch der papierene Drachen auf, den unsere Jungen mit so großer Meisterschaft herzustellen und fliegen zu lassen verstehen. Die Drachenfabrication befindet sich schon im vollen Schwung. Von Polizeibeamten misshandelt wurde am 4. Juli der frühere Schornsteinfegermeister Fröhlig. Am genannten Tage war F. auf einem Sängerfest gewesen, wo er mit dem ebenfalls anwesenden Amtmann Barfels anbandelte, von dem er glaubte, dass er veranlaßt habe, dass F. von seinem Posten entfernt wurde. Ebenso belästigte F. mehrere Polizisten. Als er dann nach Hause ging, verfolgten ihn die Polizeibeamten Tepeler und Hölscher und misshandelten ihn mit ihren Säbeln so, dass er sich in ärztliche Behandlung begeben musste. Auch hat er fünf Tage im Krankenhaus zubringen müssen. Dafür wurden den beiden Schutzleuten je 1 Woche Gefängnis von der Strafkammer zudiktirt. F. jedoch, der sich vor Gericht ungebührlich benahm, erhielt einen Tag Haft. Rauxel. Der Besuch des Kaisers scheint nahe bevorzustehen, denn die Eisenbahndirection hat telegraphisch verfügt, dass man die Ausschmückung unseres Bahnhofs und die Aufstellung von Ehrenbögen etc. beschleunigen möge. Man hat denn auch die Arbeiten sofort energisch aufgenommen. Zur Kaiserfeier hat die Stadt Dortmund Erinnerungsmedaillen anfertigen lassen, die den Gästen Dortmunds am Tage der Weihe überreicht werden sollen. Diese Medaillen, 30 große und 400 kleinere, sind nach einem Entwurf des Professors Herrn Meyer in Karlshafen ausgeführt und in Pforzheim geprägt. Dieselben zeigen auf der Vorderseite in prächtiger Ausführung das Bildnis des Kaisers und die Inschrift: „Wilhelm II., deutscher Kaiser. “ Auf der Rückseite befindet sich eine Ansicht des Hafens, der Brücke und des Hafenamtes; die Ansichten treten plastisch hervor. Die Aufschrift lautet: „Einweihung des Hafens Dortmund, 1899. “ Die großen Medaillen haben einen Durchmesser von 72, die kleinere einen von 40 Millimeter. Die erste der großen silbernen Medaillen wird die Stadt dem Kaiser überreichen lassen. Dortmund. Die Ungewissheit darüber, wann der Kaiser kommt, macht sich auch bei den Vorbereitungen bemerkbar. Es fehlt der energische Zug auf der ganzen Linie. Mit den von privater Seite projectierten Bauten ist das anders. Die spitze Kuppel des von der „Union“ errichteten Kaiserpavillons ragt schon seit mehreren Tagen über den Nacheinander. Original = Roman von Gustav Lange. (Nachdruck verboten.) „Freilich, die Mutter wird uns überall fehlen, aber tröste dich, so ganz verlassen sind wir nicht. Du hast ja mich und ich habe dich und nicht wahr, wir zwei wollen zusammenhalten, so lange wir leben? „ „Ach, das wollen wir, aber wenn wir hier fort und uns verdingen müssen, dann werden wir schwerlich zusammen bleiben können; ich glaube nicht, dass ich es ertragen werde. „ Franz senkte den Kopf; seine Schwester hatte Recht, die Notwendigkeit zwang sie dazu, auseinander zu gehen. Wenn auch das Vaterhaus ihnen von Kindheit an nicht viel Annehmlichkeiten geboten, da die Not nur zu oft Einkehr gehalten, die Bitterkeit derselben durchgekostet werden musste, so hatten doch die Liebe von Vater und Mutter ihnen alles reichlich ersetzt, was andere Kinder im Überfluss hatten, was ihnen aber gefehlt und sie fühlten sich darum ebenso reich beglückt. Auch die zwei Geschwister liebten sich aufs innigste und wenn ihre Wiege in einem Palast gestanden hätten, ihren Eltern jeden Wunsch hätten erfüllen können, so wäre ihnen doch sicher das Vaterhaus nicht lieber und theurer gewesen, die Trennung hätte nicht schwerer werden können. Plötzlich horchte Franz auf. „Hast du nichts gemerkt, Grete? „ fragte er seine Schwester, die ebenfalls aufmerksam geworden war. „Es wird der Wind gewesen sein, der etwas an das Fenster geworfen hat, „ entgegnete die Gefragte: „Es ist schon recht dunkel, ich will eine Kerze anzuzünden — es ist so furchtsam. „ Wieder war dasselbe Geräusch vernehmbar, gleichsam Ganze dans a an e. etwas stärker. Franz war durchaus nicht furchtsam, aber es gruselte ihn doch ein wenig und die Grete schmiegte sich ängstlich an ihn. Will doch einmal nachsehen, das kann der Wind nicht gewesen sein, mit diesen Worten schob er seine Schwester sanft von sich, trat an das Fenster, von woher das Klopfen zu vernehmen gewesen war und öffnete einen Flügel desselben. „Servus, Franz“, tönte ihm eine kräftige Männers Stimme von außen her entgegen; der Angesprochene trat erschrocken einen Schritt zurück. „Brauchst nicht zu erschrecken, es ist eine gute Absicht, die mich hierführt, " fuhr der draußen Stehende fort. „Ach, Ihr seid es, Baldl, “ entgegnete der junge Mann, der rasch seine Fassung wieder gewonnen und das Furchtgefühl überwunden hatte. „Was führt Euch denn noch in die Thalmühle? “ „Sollst Du gleich erfahren. Hätte es ja schon heute Nachmittag bei der Leiche Deiner seligen Mutter erledigt werden können, aber es ging nicht an, es waren zu viele unbegründete Augen da und es braucht Niemand zu wissen. Freilich ein derbes Stück Weg ist es von der Waldschmiede zur Thalmühle, aber Dir und Deiner Schwester zu liebe habe ich ihn gerne gemacht. Es ist auch besser so, denn bei der Dunkelheit sieht mich Niemand, es braucht kein Mensch zu wissen, außer uns Eingeweihten, daß der Haubermelster hier war, verstanden? Ich habe den Auftrag, Euch dies zu übergeben; werdet's wohl brauchen können; wenn die Zeiten wieder besser sind, kannst Du es zurückzahlen. “ Bei diesen Worten streckte der Baldl seine nervige, rußgeschwärzte Hand durch das Fenster, in welcher er angeborenen Ernst erkannte, das Dargebotene anzunehmen. „Getraut Dich wohl nicht, es anzunehmen? Sei unb besorgt, es ist ehrlich verdientes Geld, was wir zusammengetan haben, um Dir zu helfen, weil im ganzen Dorf Euer Leid bekannt ist. Nimm's nur und betrachte es als Darlehen. “ Wie mechanisch griff Franz nach dem Beutel. Die einfachen Worte wirkten so mächtig auf ihn, daß er gar nicht zu widersprechen vermochte, so sehr er auch unter anderen Verhältnissen sich dagegen gesträubt haben würde, irgend ein Allmosen anzunehmen. In die Höhe, die stolze Fuß des Sitz im Theater ist bereits mit den Sitzplätzen versehen und die Tribüne der Herren Rademacher und Haumann ist ebenfalls schon zum „Aufsitzen“ fertig. Letztere hat ihren Platz zwischen der Münster- und Schützenstraße und ist für 700 Personen berechnet. Herr Oberbürgermeister Schmieding hat sich vor einigen Tagen noch einmal an das Hofmarschallamt in Berlin gewandt und der ergebenen Bitte Ausdruck gegeben, dass der Kaiser, wenn möglich, noch vor dem Beginn der westfälischen Schulferien (15. August) nach Dortmund kommen möge. Bis zu dieser Stunde ist eine Antwort noch nicht eingelaufen. * Milspe. Die eifrig fortgesetzten Ermittelungen haben eine Anzahl Beweise ergeben, die es kaum noch zweifelhaft erscheinen lassen, dass der in Hagen inhaftierte Raubmörder Kreitler tatsächlich auch der Mörder des am 24. September 1898 erstochenen Hofackers, also ein Doppelmörder ist! Bei dem Vater des Kreitler wurde die Uhr Hofackers, die diesem nach dem Morde von dem Mörder geraubt worden ist, gefunden. Der Vater gibt an, dass er diese Uhr von seinem Sohn Max Kreitler vor einiger Zeit geschenkt bekommen habe. Die Mordwaffe, die Kreitler selbst vor dem Hofackers' Morde geschmiedet hat, ist von seinen Mitarbeitern als das damals von ihnen bei Kreitler gesehene Dolchmesser bestimmt erkannt worden. Diese Mordwaffe passt genau zu dem Befund der Wunden des Hofackers und des Egen. * Bielefeld. Durch Unvorsichtigkeit eines Radfahrers hat eine 50 Jahre alte Frau den Tod gefunden. Der Mann durchfuhr in schnellem Traben die Victoriastraße und ebenso die Einbiegung zur Kaiserstraße, wo die des Weges kommende Frau S. nicht mehr ausweichen konnte und von dem Radler überfahren wurde. In Folge der schweren Verletzungen am Kopf trat bald darauf der Tod ein. * Oberhausen. Eine köstliche aber teure Dienstboten Geschichte erlebte diese Tage eine junge Frau auf der Essenerstraße. Sie suchte ein Dienstmädchen und war so glücklich, gleich am nächsten Tage ein solches zu finden, welches nach seiner eigenen Angabe in allem „mehr als perfect“ war. Der geforderte Lohn von 50 Thalern schien der jungen Frau nach den ortsüblichen Verhältnissen wohl etwas hoch, jedoch sie mietete das Mädchen. Am nächsten Morgen zeigte nun das Mädchen zunächst seine Tüchtigkeit beim Putzen der Lampen, indem es eine wertvolle Kuppel, das Hochzeitsgeschenk der jüngeren Schwester der Frau, fallen ließ. Vor Schreck stieß das Mädchen, als dann die Petroleumkanne um, welche als Zeichen ihres Daseins einen großen Flecken im Fußboden zurückließ. Nach dieser Leistung verzehrte das "perfekte" Mädchen für 20 Pfg. Brödchen, die eigentlich für die Herrschaft gebracht worden waren. Bald darauf erreichte das Mädchen die Grenze ihrer "Tüchtigkeit", indem es beim Aufnehmen der Wohnstube mit dem Besenstiel einen Säulenspiegel zertrümmerte. So würde das Mädchen wohl im Laufe des Tages mit der ganzen Aussteuer aufgeräumt haben, wenn die Hausfrau das "perfekte" Mädchen nicht vor die Tür gesetzt hätte. Auf die Frage, warum es sich denn für "tüchtig" ausgegeben habe, meinte es ganz gelassen: "Man muss sich doch nicht so dumm stellen!" * Duisburg. Am 2. Juli wurde gelegentlich des Schützenfestes in Leifringhausen bei Lüdenscheid eine weibliche Person in völlig entkleidetem und verstümmelten Zustande vorgefunden. Die Ermordete, über deren Persönlichkeit bisher nichts Sicheres ermittelt werden konnte, ist von dem hiesigen Schneidermeister Sprung als dessen dreiundsechzigjährige Mutter erkannt worden. Als der Tat verdächtig befinden sich die Arbeiter Planke mann und Schweitzer, sowie ein Dritter, dessen Name noch nicht feststeht, in Haft. * In Holthausen bei Düsseldorf wurde in einer zur Cementfabrik von Weiß und Freitag gehörenden Holzbude ein Arbeiter tot aufgefunden. Dem Vernehmen nach soll derselbe zwei Liter Branntwein getrunken und in Folge des übermäßigen Alkoholgenusses gestorben sein. * Elberfeld. Eine dumme Geschichte passierte der hiesigen Schuhmacher-Stube, als sie am letzten vergangenen Sonntag ihr hundertjähriges Bestehen feierte. In dem Festzug sollten nicht nur "Hans Sachs", sondern auch das "Evchen" dargestellt werden. Die Theater-Direktion hatte dazu bereitwilligst die Kostüme hergegeben. In der Garderobe des Theaters erfolgte die Ankleidung, dann fuhr man eiligst hin zum Sammelpunkt. Als die Geschichte aber losgehen sollte, wurde mit einem Male das Evchen vermißt und alles Suchen war vergebens, so daß sich der Zug mit Hans Sachs allein in Bewegung setzen musste. Später stellte es sich heraus, daß man das Evchen in der Eile — im Theater eingeschlossen hatte. * Barmen. Wegen Führens einer Doppelehe verhaftet wurde dieser Tage in Cronenberg ein Fabrikarbeiter, der erst kürzlich von hier nach Cronenberg verzogen war, wo ihm seine erste Frau auf die Spur kam. * Barmen. Riesig belacht wird eine Episode, die sich dieser Tage hier ereignete. Ein im südlichen Außenbezirk wohnender Gastwirt bestellte bei einer hiesigen Firma tausend der bekannten Zigarrenspitzen aus Papier und mit Schilfrohrmundstück, die den Gästen gratis zur Verfügung stehen. Die Spitzen sollten laut Bestellung der Firma des Geschäftsinhabers tragen. Falls aber der nötige Platz vorhanden sei, sollte noch der Aufdruck angebracht werden: „Haltestelle für Kutscher und Fuhrleute.“ Ob nun der betreffende Besteller mit der Correspondenz auf gespanntem Fuß stand, oder ob die Hitze das Fassungsvermögen des Fabrikanten etwas geschwächt hatte, soll ununtersucht bleiben. Jedenfalls brachen die Bekannten des Wirtes, die zuerst eine der neuen, prompt gelieferten Zigarrenspitzen erhielten, in ein anhaltendes Gelächter aus. Die neuen Spitzen trugen nämlich neben der Firma den Aufdruck: „Haltestelle für Kutscher und Radfahrer, wenn Platz dafür ist.“ Jeder im Local bekannte Gast erkundigte sich nun natürlich, ob auch Platz da ist. Auch hat man dem Wirt schon geraten, sein Local zu vergrössern, um für Kutscher und Radfahrer Platz zu schaffen. Besteller und Fabrikant aber können jetzt unter sich ausmachen, wer von ihnen der grösste Scherzberger gewesen ist. * Neuß. Bei dem Wettrennen stürzten der Leutnant Dietz von den Bockenheimer Husaren und der Jockey Lippold und erlitten schwere Verwundungen. Letzterer erhielt die Sterbesakramente. * In der neuen Artillerie-Kaserne zu Wesel sind mehrere Typhuserkrankungen vorgekommen, deren Ursachen noch nicht aufgeklärt sind. * Orsoy. In Folge einer leichtsinnigen Wette kam hier ein junger Mann um's Leben. Derselbe, auf einer hier arbeitenden Baggermaschine beschäftigt, wollte für fünf Flaschen Bier von der Maschine aus in den Rhein springen und bis an's Ufer und wieder zurück schwimmen. Der junge Mann tauchte nach dem Sprunge sofort unter und kam nicht wieder zum Vorschein. Seine Leiche wurde später gefunden. * Aachen. Als dieser Tage ein Arbeiter wegen Scandalirens von einem Schutzmann festgenommen werden sollte, flüchtete er sich in eine Fabrik und stürzte sich, als der Beamte ihm dorthin nachfolgte, aus einem Fenster des dritten Stockwerkes auf die Straße herab. Er war sofort tot. * Mülheim a. Rh. Der frühere Rendant der hiesigen Ortskrankenkasse, Kracht, wurde unter dem Verdacht verhaftet, der Kasse 1900 Mark unterschlagen zu haben. Am Samstag wurde er nach dem Kölner Gefängnis gefördert. * Bingen. ( Nied. ). Ein billiges Haus hat sich ein hier siger Postbote erworben. Er fand beim Abräumen in der Mauer unter dem Spülstein 1600 Francs in alten Louisdor , die jedenfalls in den bewegten Zeiten der napoleonischen Kriege dort versteckt worden waren und durch die der Kaufpreis gedeckt wurde. Solche Fälle ereignen sich in unserer Gegend häufiger; vor drei Jahren wurden in einem alten Baum 20 000 Francs zu Tage gefördert. * Halle a. S. Ein Scheerenschleifer, der von Schulknaben geärgert worden, stieß einem zwölfjährigen Knaben ein scharfes Messer in den Hals, so, dass Verblutung eintrat. * Metz. Die Oberin im Kloster zu Jouy stürzte in den Brunnen der Anstalt und ertrank, ehe ihr Hilfe gebracht werden konnte. * Itzehoe. Die Herzogin = Wittwe Adelheid zu Schleswig = Holstein = Sonderburg = Glücksburg ist im hohen Alter von 78 Jahren gestorben. Die Herzogin war eine Tochter des Fürsten Georg zu Schaumburg = Lippe, ein Schwägerin König Christians IX. von Dänemark und mit unserem Kaiserhause verwandt. Vermischte Nachrichten. * Lemberg. In einem benachbarten Dorf wurden 15 Bauernknechte durch den Genuß von Schwämmen vergiftet und starben, einer erkrankte. * Aus Allenstein wird folgende höchst sonderbare Geschichte berichtet: In dem Material = und Colonialwaren = Versandtgeschäft des Herrn B. war eine Buchhalterin beschäftigt, deren außergewöhnlich hübsches Mädchen = Antlitz Aufsehen und Bewunderung erregte, deren übriges Wesen und Auftreten jedoch wie auch die Haarfrisur einen Mann verrieten. Nach ungefähr sechswöchiger Tätigkeit verließ das „Fräulein Louise Schwarz“, unter welchem Namen sie hier geführt wurde, die Stadt, um anderwärts in Stellung zu treten. So engagierte sie auch Herr Kaufmann L. in Osterode für sein Manufacturinggeschäft. Als eines Tages das Fräulein nicht zu rechter Zeit im Geschäft erschien, begab sich Herr L. nach dessen Zimmer, doch was er hier sah, machte ihn starr und stumm, denn vor ihm stand seine „Buchhalterin“ fix und fertig im Gehrock und Zylinder, den Chef mit den Worten begrüßend: „Von heute ab bin ich wieder junger Herr.“ Wie später bekannt wurde, soll der junge Herr eine Wette eingegangen sein, nach der er durch eine bestimmte Zeit unbehelligt als „Fräulein“ sein Brod verdienen wollte. In diesen Tagen war die Zeit um und die Wette gewonnen. * Paris. Augenblicklich macht eine Vergiftungsaffäre großes Aufsehen. Madame Coudert, die Gattin eines reichen Industriellen, welcher über 600 Arbeiter beschäftigt, wurde nämlich verhaftet unter dem Verdacht, eine vierzehnjährige Nichte vergiftet zu haben, um sich deren Vermögen anzueignen. Das Mädchen starb kurz nach dem Genuß von Schokolade, welche ihm angeblich von der Verhafteten geschenkt worden war. In Bombay dauert die Pest fort. Innerhalb der letzten 48 Stunden wurden im Truppenlager 59 Erkrankungen und 56 Sterbefälle und in der Stadt 301 Erkrankungen und 261 Sterbefälle gezählt. Unter den Neuerkrankten sind 4 Europäer. Die Wetterlage deutet auf ein baldiges Aufhören des Monsun, was für eine sehr ungünstige Aussicht gilt. Nach einem Telegramm des Gouverneurs aus Hongkong sind dort in der vergangenen Woche 30 Neuerkrankungen und 31 Todesfälle an der Pest vorgekommen. „. ,. 9 , Garstellung Herkunft (Eine Warnung für Radfahrer.) Die Vorsitzende verichtet über eine heitere Zusammenstellung öffentlicher Bekanntmachungen: □ Vorsicht für Radfahrer! So sah bisher eine am Eingang der Stadt Triptis (Sachsen-Weimar) einsam und verlassen an einem Pfahl genagelt eine Tafel aus. Jetzt hat sie Gesellschaft bekommen und in hübscher Zusammenstellung heißt es nun □ Vorsicht für Radfahrer! Maul- und Klauenseuche! — (Maulaffen vor!) Ein äußerst originelles Inserat befindet sich im Annoncen-Theil der vorletzten Nummer des „Waldmünchener Grenzboten“. Es lautet: „Unterzeichnet gibt hiermit bekannt, dass seine Trauung Montag in aller Herrgottsfrüh stattfindet und wollen sich alle Neugierigen und Maulaffen zur Spalierbildung einfinden. L. Rukser, Gastwirt. (Originell.) Ein unbestellter Brief einer Innsburger Behörde kam kürzlich mit folgendem Vermerk des Landbriefträgers zurück: „Mit Hilfe der Ortspolizeibehörde verstorben. „ „. „. 44 Uhr bestraf (Ein Fronist.) Richter: „Sie werden nur bestraft, damit Sie sich bessern!“ — Verurteilter: „Ja, ich werde mir Mühe geben, mich durch meine Zellengenossen vervollständigen zu lassen!“ Ueberrascht war bisher jedes Mädchen von dem schönen Glanz, den Krebs-Wichse erzeugt und sollte man daher nicht versäumen, dieselbe zu probieren. Menge Silbermünzen. „Franz, begehst Du kein Unrecht, wenn Du das Geld annimmst!“ entgegnete das junge Mädchen und blickte ängstlich auf ihren Bruder. Dieser zögerte lange mit der Antwort. „Ich denke nicht. Siehe, es sind Freunde, die uns helfen wollen, also aus welchem Grunde sollte ich ihre Hilfe zurückweisen, wo wir derselben so sehr bedürfen? Dann soll es auch kein Geschenk sein; ich werde tüchtig arbeiten und es ihnen reichlich mit Zins zurückzahlen; sag mir das herzlich offen, kannst Du ein Unrecht darin finden, wenn ich das Geld annehme? „Wenn es so ist, dann verwende es in Gottes Namen; ach wenn doch unsere gute Mutter dies noch mit erlebt hätte!“ Diese Erinnerung an die Heimgegangene riß sofort die schmerzliche Wunde wieder auf und lenkte auch Franzens Gedanken von dem vor ihm liegenden Geld ab und betrübt stützte er sein Haupt in beide Hände. * * Zwei Monde später; es ist gegen Mitternacht und alles still im Dorf. Die letzten Lichter sind im Schankstübel des Bräuhofs erloschen und friedliches Schweigen ist auch über dem Anwesen des Aloys Wendel ausgebreitet, des stattlichsten im ganzen Ort, denn nicht allein Brauerei und Schankwirtschaft, sondern auch eine ausgezeichnete Oekonomie betreibt der Besitzer und er ist ein reicher Mann geworden, der das ererbte Vermögen noch tüchtig zu vermehren verstanden hat. Aber während im Bräuhof wie in den übrigen Häusern wohl schon alles schläft, da wälzt sich oben in seiner Kammer der Bräuer schlaflos auf seinem Lager umher. Er ist nicht krank, durchaus nicht, er hat sich körperlich stets wohlgeführt und doch ist es ihm manchmal, als lastete ein Alp auf seiner Brust, der ihm den Atem zu rauben droht, besonders des Nachts, da ist manchmal dieser Zustand kaum zu ertragen und wenn er zuweilen für kurze Zeit den Schlummer findet, da quälen ihn böse Träume, daß er erschrocken im Schlaf auffährt und darüber erwacht. Er hört im Traume das Wasser des Mühlbaches rauschen, er sieht in demselben die Thalmüllerin mit den Wellen kämpfen, die die Hände hilfesuchend und flehend nach ihm ausstreckt und wenn er ihr endlich beispringt, da sinkt sie tot ins Wasser zurück und seine Hilfe kommt zu spät. Diese und ähnliche Szenen gaukelt ihm seine krankhaft erregte Phantasie im Schlaf vor und wenn er dann in Schweiß gebadet erwacht, da überläuft ihn eine heiße Angstwelle und droht ihn zu ersticken; er fühlt, dass er diesen Zustand nicht lange würde ertragen können; sein Leib und seine Seele müßten dabei zu Grunde gehen und mehr und mehr befestigt sich daher in ihm die Absicht, den unangenehmen Erinnerungen aus dem Weg zu gehen, was er nur erreichen konnte, wenn er sich zur Ruhe setzte und in eine andere Gegend zog, dann konnte er eher darauf hoffen, die peinliche Affaire in der Thalmühle zu vergessen. Wie er heute nun schon wieder so schlaflos dagelegen und darüber nachgedacht hat, wie er der Gewissenspein ein Ende bereiten könne, er so lange über allerlei Zukunftspläne gebrütet und gegrübelt, bis ihm der Kopf schmerzt, bis er endlich den festen Entschluß gefaßt, gleich morgen die ersten Schritte zu tun, um fernerhin der unangenehmen Erinnerungen überhoben zu sein, indem er ihnen aus dem Weg ging, da ist es ihm mit einem Male, als vernehme er aus der Ferne ein ganz deutliches Rollen, ein entferntes Donnern und doch erinnert er sich, als er zu Bett gegangen, da war das Wetter noch ganz klar gewesen. Er springt von seinem Lager auf und geht ans Fenster — ist ein Gewitter im Anzug — er schaut hinaus. Alles ist still — nur in der Ferne vermeint er ein seltsames Geräusch zu vernehmen — dann ist es ihm wieder als trabten Personen um das Gehöft, so hört es sich an — ist er denn wahnsinnig, oder täuscht ihn sein Auge? Er lehnt sich weit aus dem Fenster — richtig vorkommen einige Gestalten herangeschlichen, er kann deutlich bei dem Mondenschein erkennen.
| 3,283 |
https://fr.wikipedia.org/wiki/Cambridge%20%28Ohio%29
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Cambridge (Ohio)
|
https://fr.wikipedia.org/w/index.php?title=Cambridge (Ohio)&action=history
|
French
|
Spoken
| 367 | 623 |
Cambridge est une ville de l'État de l'Ohio, aux États-Unis.
Elle est le siège du comté de Guernsey.
Histoire
En 1796, le colonel Ebenezer Zane fut chargé par des investisseurs d'aménager une route carrossable entre l'appontement face à la halte fluviale de Wheeling, sur l'Ohio, et Maysville (Kentucky) et les terres vierges de l'Ohio. Cette route, appelée Zane's Trace, traversant le ruisseau de Wills Creek, il fallut établir un bac en 1798, que l'administration des territoires du Nord-Ouest remplaça par un premier pont dès 1803. Les terrains sur lesquels la ville de Cambridge allaient s'édifier furent adjugés en 1801 à deux fermiers, Zaccheus Biggs et Zaccheus Beatty. Un village se constitua autour de l'estacade du ferry, puis en 1806, des colons venus de l'île de Guernesey vinrent grossirent la colonie, apparemment parce que les femmes de leur groupe refusaient de poursuivre plus avant vers l'ouest : le nom du comté rappelle l'importance historique de ces colons pour la région. La ville a été connectée au réseau routier fédéral en 1828, et par le chemin de fer en 1854. La ville de Cambridge a subi une inondation catastrophique à la fin juin 1998.
La ville a connu la prospérité au grâce à une verrerie réputée pour ses vitres opaques, Cambridge Glass''', fondée en 1873. Cette société produisit à partir des années 1920 des verres de couleurs, d'abord plutôt opaques puis de plus en plus translucides. Mais après la guerre, faute d'avoir su se lancer dans la fabrication de masse, elle dut interrompre ses activités, d'abord temporairement (1954-55), puis définitivement (1958), et ses actifs furent rachetés en 1960 par son concurrent Imperial Glass Company'' (qui lui même a fait faillite en 1984).
Géographie
Cambridge est arrosée par le ruisseau de Wills Creek et l'un de ses affluents, Leatherwood Creek, qui traverse les faubourgs sud. Selon les données du Bureau du recensement des États-Unis, Cambridge a une superficie de 14,5 km² entièrement en surfaces terrestres..
Démographie
Cambridge était peuplée, lors du recensement de 2000, de habitants.
Personnalités
Cambridge est la ville natale de l'astronaute John Glenn, le premier américain à effectuer un vol orbital autour de la Terre.
Notes
City dans l'Ohio
Siège de comté dans l'Ohio
Comté de Guernsey
| 30,375 |
https://github.com/basicis/basicis/blob/master/storage/templates/example-form.twig
|
Github Open Source
|
Open Source
|
MIT
| null |
basicis
|
basicis
|
Twig
|
Code
| 111 | 320 |
{% set title = "Welcome" %}
{% extends "layout.twig" %}
{% block content %}
{% if method == "post" %}
<h2>Create</h2>
{% endif %}
{% if method == "patch" or method == "delete" %}
<h2>
{% if method == "patch" %} Update {% endif %}
{% if method == "delete" %} Delete {% endif %}
</h2>
<p>Id: {{model.id}} <br>Name: {{model.name | capitalize}}</p><br>
{% endif %}
<form method="{{method}}" action="/example" prevent>
{% if method == "patch" or method == "delete" %}
<input disabled class="input-hidden" type="text" name="id" id="id" value="{{model.id}}">
{% endif %}
<label for="name">Name: </label>
<input type="text" name="name" id="name" value="{{model.name|capitalize}}">
<label for="email">Email: </label>
<input type="email" name="email" id="email" value="{{model.email}}">
<input type="submit">
</form>
{% endblock %}
| 7,924 |
https://stackoverflow.com/questions/36741221
|
StackExchange
|
Open Web
|
CC-By-SA
| 2,016 |
Stack Exchange
|
English
|
Spoken
| 163 | 408 |
django - Need references to another model from list_display
When i clicked to author field i need to be referenced to clicked author model admin - how to do this?
class BookAdmin(admin.ModelAdmin):
list_display = ['name', 'pub_date', 'author',]
In the admin class
def author_link(self, obj):
return '<a href="/admin/authors-appname/author-model-name/%s">%s</a>' \
% (obj.auther.pk, obj.auther)
author_link.allow_tags = True
author_link.short_description = "auther"
list_display = ['name', 'pub_date', 'author_link',]
readonly_fields = ('author_link', )
more elegant is to change the hard link to a function in the model - get_auther_absolute_url and call it from admin
There are a few answers on SO with regards to this, namely:
Change list link to foreign key change page
Link in django admin to foreign key object
To quote the above, what you need to do is define your own method, call it go_to_author() as part of your BookAdmin class, as such
class BookAdmin(admin.ModelAdmin):
list_display = ['name', 'pub_date', 'go_to_author',]
def go_to_author(self, obj):
link=urlresolvers.reverse("admin:yourapp_author_change", args=[obj.author.id])
return u'<a href="%s">%s</a>' % (link, obj.author.name)
go_to_author.allow_tags=True
I hope this helps!
| 45,676 |
|
https://github.com/ursinus-cs174-s2022/HW4_LinkedListMaze/blob/master/tester.cpp
|
Github Open Source
|
Open Source
|
Apache-2.0
| null |
HW4_LinkedListMaze
|
ursinus-cs174-s2022
|
C++
|
Code
| 558 | 1,343 |
#include "linkedlist.h"
#include <stdio.h>
#include <time.h>
#include <iostream>
#include <string>
#include <sstream>
#include <list>
using namespace std;
/**
* Compare a student list to an array implementation of list
* @param gtList A ground truth list
* @param myList Student list
* @return
*/
bool listsEqual(list<int>& gtList, LinkedList<int>& myList) {
bool equal = true;
int* arr1 = new int[gtList.size()];
std::copy(gtList.begin(), gtList.end(), arr1);
size_t N;
int* arr2 = myList.toArray(&N);
for (size_t i = 0; (i < gtList.size()) && (i < N) && equal; i++) {
equal = arr1[i] == arr2[i];
}
delete[] arr2;
return equal;
}
/**
* @brief Remove the first instance of a particular element from
* an STL list if that element exists
*
* @param l STL list
* @param item Element to remove
*/
void removeListItem(list<int>& l, int item) {
list<int>::iterator it = l.begin();
bool found = false;
while (!found && it != l.end()) {
if (*it == item) {
found = true;
l.erase(it);
}
else {
it++;
}
}
}
/**
* @brief Return the int at a particular index in the list
*
* @param l STL list
* @param idx Index
* @return int Element to return
*/
int getListAtIndex(list<int>& l, int idx) {
list<int>::iterator it = l.begin();
for (int i = 0; i < idx; i++) {
it++;
}
return *it;
}
/**
* @brief Print out a linked list
*
* @param l STL list
*/
void printList(list<int>& l) {
list<int>::iterator it = l.begin();
while (it != l.end()) {
cout << *it << " ==> ";
it++;
}
}
/**
* @brief Compare student doubly-linked list implementation to
* STL's ground truth implementation
*
* @param numOps Number of operations to perform
* @param seed Random seed for repeatability
*/
void doTest(int numOps, int seed) {
list<int> gtList;
LinkedList<int> myList;
srand(seed);
for (int i = 0; i < numOps; i++) {
string operation = "no operation";
int op = rand() % 100;
if (op < 40) {
int x = rand() % numOps;
stringstream stream;
stream << "addFirst(" << x << ")";
operation = stream.str();
gtList.push_front(x);
myList.addFirst(x);
}
else if (op < 80) {
int x = rand() % numOps;
stringstream stream;
stream << "addLast(" << x << ")";
operation = stream.str();
gtList.push_back(x);
myList.addLast(x);
}
else if (op < 85 && gtList.size() > 0) {
operation = "removeFirst()";
gtList.pop_front();
myList.removeFirst();
}
else if (op < 95 && gtList.size() > 0) {
operation = "removeLast()";
gtList.pop_back();
myList.removeLast();
}
else if (gtList.size() > 0) {
int item = getListAtIndex(gtList, rand() % gtList.size());
stringstream stream;
stream << "remove(" << item << ")";
operation = stream.str();
removeListItem(gtList, item);
myList.remove(item);
}
cout << operation << "\n";
if (gtList.size() != myList.size()) {
cout << "lists do not have the same reported size after a " << operation << "\n";
cout << "Ground truth size " << gtList.size() << ", my size " << myList.size() << "\n";
cout << "Ground truth list\n-------------------------------\n";
printList(gtList);
cout << "\n\nMy list\n-------------------------------\n";
myList.print();
return;
}
if (!listsEqual(gtList, myList)) {
cout << "lists not equal after a " + operation << "\n";
cout << "Ground truth list\n-------------------------------\n";
printList(gtList);
cout << "\n\nMy list\n-------------------------------\n";
myList.print();
return;
}
}
}
int main(int argc, char** argv) {
if (argc < 3) {
cout << "Usage: ./tester <number of operations> <seed>\n";
return 1;
}
int numOps = atoi(argv[1]);
int seed = atoi(argv[2]);
doTest(numOps, seed);
return 0;
}
| 47,274 |
https://openalex.org/W4285278764_1
|
Spanish-Science-Pile
|
Open Science
|
Various open science
| 2,022 |
Síndrome de Prune-Belly y aplasia ungueal
|
None
|
Spanish
|
Spoken
| 2,934 | 5,877 |
Caso clínico
Anales
Médicos
doi: 10.35366/106030
Vol. 67, Núm. 2
Abr. - Jun. 2022
p. 142 - 147
Síndrome de Prune-Belly y aplasia ungueal
Prune belly syndrome and nail aplasia
Eric Emilio Vázquez Camacho,* Gregory Torres Palomino,‡
Patricia Grether González,§ Montserrat Malfavón Farías¶
Citar como: Vázquez CEE, Torres PG, Grether GP, Malfavón FM. Síndrome de Prune-Belly y aplasia ungueal. An Med ABC. 2022;
67 (2): 142-147. https://dx.doi.org/10.35366/106030
RESUMEN
ABSTRACT
El síndrome de Prune-Belly es una enfermedad congénita
definida por una tríada clásica que incluye alteraciones de la
musculatura abdominal, anormalidades del tracto urinario
y criptorquidia bilateral en hombres. El objetivo de este
artículo es documentar un caso diagnosticado al momento del
nacimiento, el cual presentó diagnóstico de obstrucción urinaria
baja a las 17 semanas de gestación secundario a megavejiga
fetal de 5.7 × 5.8 × 5.2 cm y recibió tratamiento con ablación
láser de valvas uretrales. Al momento del nacimiento presentó
hallazgos clínicos compatibles con el síndrome de PruneBelly así como pie equino varo izquierdo con aplasia ungueal
de segundo al quinto ortejo ipsilateral. Algunos pacientes
presentan manifestaciones extragenitourinarias a nivel
cardiopulmonar, gastrointestinal, esquelético o neurológico;
sin embargo, hasta donde sabemos, no se ha publicado ningún
caso con anomalías cutáneas como la aplasia ungueal. Aunque
es un cuadro clínico que reporta una muy baja mortalidad, sus
consecuencias son diversas para la salud y calidad de vida de
los infantes. Se revisará la etiología, clínica, signos de sospecha,
tratamientos conocidos y pronóstico del producto.
Prune-Belly syndrome is a congenital disease defined by a
classic triad that includes abdominal muscle abnormalities,
urinary tract abnormalities, and bilateral cryptorchidism in
men. The objective of this article is to document a case diagnosed
at birth, which presented diagnosis of lower urinary obstruction
at 17 weeks of gestation secondary to fetal megabladder of 5.7
× 5.8 × 5.2 cm and received treatment with laser ablation of
urethral valves. At the time of birth, he presented clinical
findings compatible with the Prune-Belly syndrome as well as
a left clubfoot with nail aplasia of the 2nd to 5th ipsilateral toe.
Some patients present extra-genitourinary manifestations at the
cardiopulmonary, gastrointestinal, skeletal or neurological level,
however, to our knowledge, no case with skin abnormalities such
as nail aplasia has been published. Although it is a syndrome
that reports a very low mortality, its consequences are diverse for
the health and quality of life of infants. The etiology, symptoms,
signs of suspicion, known treatments and prognosis of the
product will be reviewed.
Palabras clave: Síndrome de Prune-Belly, aplasia ungueal,
megavejiga fetal.
Keywords: Prune-Belly syndrome, nail aplasia, fetal
megabladder.
Abreviaturas:
SPB = Síndrome de Prune-Belly.
UCIN = Unidad de Cuidados Intensivos Neonatales.
INTRODUCCIÓN
El síndrome de Prune-Belly (SPB) es una rara conwww.medigraphic.org.mx
dición caracterizada por la ausencia congénita o de-
* Ginecología y Obstetricia. Biología de la Reproducción Humana.
‡ Pediatría y Neonatología.
§ Genética Médica.
¶ Médico residente de tercer año de Ginecología y Obstetricia.
Centro Médico ABC.
Correspondencia:
Montserrat Malfavón Farías
E-mail: [email protected]
Recibido: 06/03/2021. Aceptado: 21/09/2021.
www.medigraphic.com/analesmedicos
Vázquez CEE et al. Síndrome de Prune-Belly y aplasia ungueal
An Med ABC. 2022; 67 (2): 142-147
ficiencia de la musculatura abdominal, criptorquidia
bilateral, y anormalidades del tracto genitourinario
incluyendo megavejiga, megauretra, hidrouteronefrosis y displasia renal.1,2 La eliminación deficiente
de la orina puede conducir a oligohidramnios, hipoplasia pulmonar y síndrome de Potter.3
Se considera un reto tanto para los urólogos como
para los cirujanos pediatras por la baja prevalencia de
la enfermedad. La información que se tiene hasta el
día de hoy sobre el síndrome se ha descrito principalmente en reportes de casos o pequeñas series de casos, lo que hace difícil el tratamiento y el seguimiento
de los resultados a largo plazo en estos pacientes.
Se estima que la incidencia en los Estados Unidos
es de aproximadamente 3.8 casos por 100,000 nacidos
vivos, siendo hasta 20 veces más frecuente en varones. La incidencia en gemelos es cuatro veces mayor
siendo de 12.2 por 100,000 nacidos vivos.3 Las mujeres representan < 5% de los casos y se presentan con
deficiencia de la pared abdominal y alteraciones del
tracto urinario, pero sin anomalías gonadales.1
El diagnóstico por lo general es clínico al momento del nacimiento o en edades tempranas por
las características típicas de la enfermedad, aunque
también se puede hacer diagnóstico prenatal dependiendo de los hallazgos por ultrasonido. La ecografía
prenatal es una herramienta muy útil en el diagnóstico de las malformaciones fetales y en la valoración
pronóstica de la función renal en caso de verse comprometida. Aunque se pueden visualizar ya los riñones y la vejiga en un feto normal desde el primer
trimestre, la ecografía más informativa es la que se
realiza en el segundo trimestre, habitualmente hacia
las semanas 20-22 de gestación.4
La gravedad de la displasia renal, las anomalías
del tracto urinario y la presencia de hipoplasia pulmonar son las características principales que determinarán el resultado final entre los pacientes con
SPB. Estas anomalías pueden dar lugar a episodios
recurrentes de infecciones del tracto urinario, urosepsis, grados variables de insuficiencia renal, insuficiencia respiratoria y otras manifestaciones del
trastorno.1
Los pacientes por lo regular requieren múltiples
procedimientos reconstructivos durante la infancia
incluyendo orquidopexia bilateral, reconstrucción del
tracto urinario y abdominoplastia.5 El manejo a largo
plazo sigue siendo controversial, pero el manejo inicial va dirigido a la estabilización cardiopulmonar y
drenaje vesical.
Existe una gran variabilidad en la expresión clínica de la enfermedad y casi la mitad de los pacientes
143
pueden presentar anomalías extragenitourinarias
con manifestaciones cardiopulmonares, gastrointestinales, musculoesqueléticas o neurológicas;5 sin embargo, hasta donde sabemos, éste es el primer caso
con aplasia ungueal publicado en la literatura.
CASO CLÍNICO
Paciente primigesta de 29 años, con hipotiroidismo
controlado como único antecedente médico de importancia. Refiere haber recibido adecuado control prenatal, con ingesta de multivitamínicos, ácido fólico y
ácido acetilsalicílico 100 mg desde inicios tempranos
de la gestación. Asimismo, se diagnosticó diabetes
gestacional a las 25 semanas de gestación, la cual
se manejó con tratamiento nutricional. Se le realiza ultrasonido a las 12.5 semanas de gestación de
primer trimestre reportando tamaño vesical de 9.4
mm (arriba de lo esperado) (Figura 1), con dilatación
pielocalicial en ambos riñones. A las 16 semanas de
gestación acude a control donde se diagnostica obstrucción urinaria baja con megavejiga fetal de 5.7 ×
5.8 × 5.2 cm (Figura 2), motivo por el cual se envía a
cirugía fetal para tratamiento. Se realiza amniocentesis con reporte de cariotipo 46 XY, sin anormalidades numéricas ni estructurales.
A las 17.5 semanas de gestación se realiza ablación láser transvesical de valvas uretrales posteriores sin complicaciones. Posteriormente se observa
en ultrasonidos de seguimiento, disminución del tamaño vesical con función renal conservada y líquido
amniótico dentro de parámetros normales para edad
gestacional.
www.medigraphic.org.mx
Figura 1: Ultrasonido obstétrico a las 12.5 semanas de gestación que
revela tamaño vesical de 9.4 mm.
144
Vázquez CEE et al. Síndrome de Prune-Belly y aplasia ungueal
An Med ABC. 2022; 67 (2): 142-147
A
B
Figura 2: Ultrasonido a las 16 semanas de gestación con megavejiga
fetal de 5.7 x× 5.8 x 5.2 cm. A) corte transversal. B) Corte sagital.
A las 25 semanas de gestación inicia con actividad uterina irregular, pero dolorosa, por lo que se
mantuvo en tratamiento uteroinhibidor con nifedipino 10 mm cada ocho horas y salbutamol 2 mm
cada ocho horas. Recibió esquema de maduración
pulmonar a las 28 semanas de gestación. Ya con 30.2
semanas de gestación, ingresa a nuestra unidad por
gastroenteritis infecciosa con intolerancia a la vía
oral y deshidratación moderada. Durante su internamiento recibió manejo antibiótico así como reposición hidroelectrolítica con adecuada respuesta.
Posteriormente, durante el mismo internamiento,
inició con actividad uterina regular y dolorosa, por
lo que se administró nuevamente esquema de maduración pulmonar y se dio manejo uteroinhibidor con
orciprenalina intravenosa y nifedipino. Teniendo
32.6 semanas de gestación, se decide interrupción
del embarazo vía abdominal secundario a proba-
ble corioamnionitis subclínica y amenaza de parto
pretérmino no remitida, previa administración de
sulfato de magnesio para neuroprotección fetal, se
obtuvo recién nacido masculino pretérmino, grande
para edad gestacional con peso de 2,210 gramos y 43
cm de talla.
Ingresó a la unidad de cuidados intensivos neonatal (UCIN) por presentar dificultad respiratoria, y
para abordaje y manejo de prematurez. Durante su
estancia en la UCIN recibió tratamiento antibiótico
con cefotaxima y ampicilina por corioamnionitis materna e interconsulta al servicio de nefrología, urología e infectología pediátrica y genética.
A la exploración física, se observó presencia de
reflejos pupilares normales, tórax y área cardiaca
normales, abdomen grande, en forma de batracio,
blando, con piel redundante y laxa, con bajo tono
muscular y masa palpable en mesogastrio que llega hasta el ombligo, de bordes irregulares (Figura
3). Genitales fenotípicamente masculinos con criptorquidia bilateral. Presencia de pie equino varo izquierdo, ausencia ungueal de la segunda a la quinta
falange del mismo pie (Figura 4) y disminución generalizada del tono muscular.
Durante su primer día de vida se realizó ultrasonido de vías urinarias, donde se observó ureterohidronefrosis izquierda. Posteriormente, se realizó
un ultrasonido de pared abdominal, el cual reportó
músculos rectos abdominales presentes y ultrasonido inguinal y escrotal con testículo derecho de localización intraabdominal adyacente al lóbulo hepático
derecho. Testículo izquierdo localizado en fosa iliaca
izquierda.
www.medigraphic.org.mx
Figura 3: Recién nacido en el que se observa abdomen grande, en forma
de batracio, blando, con piel redundante y laxa.
Vázquez CEE et al. Síndrome de Prune-Belly y aplasia ungueal
An Med ABC. 2022; 67 (2): 142-147
Figura 4: Presencia de pie equino varo izquierdo, ausencia ungueal de la
segunda a la quinta falange del mismo pie.
Como parte del manejo, se realizó vesicostomía
Blocksonel y gammagrama renal (Figura 5), donde
se observa función depuradora tubular global severamente disminuida, asimétrica por menor función
del riñón derecho. Riñón derecho con función depuradora severamente disminuida con leve retención
pielocalicial y en uretero distal que responde adecuadamente al diurético sin datos de obstrucción. Riñón
izquierdo con función moderadamente disminuida,
de tamaño aumentado con datos de hidronefrosis, estasis y ectasia pielocalicial sin datos de obstrucción.
Debido a los múltiples hallazgos, algunos inesperados como el pie equino varo en ausencia de oligohidramnios así como la aplasia ungueal, se solicitó
un exoma completo con variaciones en el número de
copias (CNVs), en el que no se detectó ninguna variante (mutación) relacionada con el padecimiento.
Durante su internamiento se mantuvo con mejoría en la función renal, y a los 37 días de vida se dio
de alta para seguimiento por consulta externa.
masculino. La causa más común es la presencia de
valvas de la uretra posterior; sin embargo, existen
otras causas que pueden presentar un cuadro similar
como la atresia o estenosis uretral, el SPB y en fetos
femeninos una anomalía cloacal.7
Los hallazgos clínicos al nacimiento de megavejiga,
criptorquidia e hipoplasia muscular abdominal fueron consistentes con el diagnóstico de SPB, además
se observó pie equino varo que se ha reportado en
aproximadamente 20% de los casos; 8 sin embargo,
hasta donde sabemos, la aplasia ungueal o anoniquia
en los ortejos segundo al quinto del pie afectado por
equino varo no ha sido publicada con anterioridad.
La etiología del SPB se desconoce, la mayoría de
los casos son esporádicos; sin embargo, en algunos
casos se ha observado recurrencia. En este caso, se
intentó descartar alguna anomalía genética conocida al realizar un exoma completo con variaciones en
el número de copias (CNVs). Sin embargo, esto no
significa que no tenga un fondo genético, sólo indica
que, en el caso a comentar, no presenta ninguna variante genética conocida hasta hoy que se relacione
con su patología.
DISCUSIÓN
www.medigraphic.org.mx
Las malformaciones congénitas del riñón y del tracto urinario son una de las anomalías que con más
frecuencia se identifican en ecografía prenatal y la
causa principal de enfermedad renal terminal en la
infancia.4-6
La obstrucción baja del tracto urinario fetal se
basa clásicamente en la identificación ultrasonográfica de una vejiga dilatada, dilatación ureteral, hidronefrosis y uretra posterior dilatada (que se observa
como el «signo del ojo de la cerradura») en un feto
145
Figura 5: Gammagrama renal.
146
Vázquez CEE et al. Síndrome de Prune-Belly y aplasia ungueal
An Med ABC. 2022; 67 (2): 142-147
La teoría más convincente hasta ahora comprende una alteración a nivel del tracto genitourinario,
los testículos y la musculatura de la pared abdominal que se produce como resultado directo de un
desarrollo anormal en la embriogénesis temprana.
Esta teoría, conocida como la «teoría de la detención
mesodérmica», explica una alteración del desarrollo
mesenquimatoso entre la sexta y décima semana de
gestación.2,3
El estudio de cariotipo normal y el de exoma clínico con análisis de variantes en el número de copias
(CNVs) sin alteraciones permite descartar un amplio
número de condiciones genéticas conocidas; sin embargo, no es suficiente para descartar alteraciones
genéticas en otros niveles.
La implementación del ultrasonido obstétrico ha
ayudado a que el diagnóstico prenatal sea la forma
más frecuente de presentación del SBP. A pesar de
que el diagnóstico se ha reportado desde las semanas 11-12 de gestación, los hallazgos clásicos como
hidroureteronefrosis, megavejiga, circunferencia de
la pared abdominal irregular y/o oligohidramnios no
pueden identificarse, sino en etapas más avanzadas
de la gestación o postnatales.2,9
En la actualidad no existen guías o consensos sobre el manejo de estos pacientes debido a la rareza y
amplio espectro de severidad de la enfermedad. Sin
embargo, el desarrollo de intervenciones quirúrgicas
intrauterinas ha hecho posible el tratamiento de uropatía obstructiva en fetos con diagnóstico temprano
mejorando el pronóstico postnatal.10
En este caso, el feto presentaba un caso compatible con obstrucción urinaria baja secundaria a valvas
uretrales y cariotipo sin anormalidades. El tratamiento que se ha propuesto en los diferentes casos
publicados tiende a la individualización. Se han realizado procedimientos endoscópicos con ablación de
las valvas con asas de resección convencionales o mediante láser Holmium, resecciones segmentarias con
uretero-ureterostomías, entre otras, dependiendo de
la localización de la obstrucción.11-13
El tratamiento quirúrgico después del nacimiento incluye abdominoplastia, orquidopexia bilateral y
tratamiento de las malformaciones urinarias.10
El tratamiento debe adaptarse a cada individuo, logrando un equilibrio entre la intervención
temprana y los efectos no deseados para mejorar
la supervivencia y limitar las secuelas. El objetivo
principal del tratamiento va enfocado en preservar
la función renal.10,14
A pesar del tratamiento, el pronóstico de la función renal a largo plazo es incierto. De hecho, hasta
1/3 de los pacientes desarrollarán falla renal secundaria a displasia renal, nefropatía obstructiva o pielonefritis recurrente.15
CONCLUSIONES
El SPB se debe considerar en caso de identificar: oligohidramnios, hallazgos compatibles con obstrucción
baja del sistema urinario y ausencia de musculatura
abdominal. El diagnóstico temprano no sólo ayuda a
planear un manejo multidisciplinario del recién nacido en un centro de tercer nivel, sino que en algunos
casos puede dar la opción a una terminación voluntaria temprana del embarazo en caso de ser solicitado.
A pesar de los avances en la atención urológica
para los con niños con SPB, esta condición sigue estando asociada con una alta mortalidad perinatal,
probablemente relacionada con la prematuridad y
las complicaciones pulmonares asociadas. Como en
la mayoría de las anomalías congénitas complejas, la
clave en el tratamiento del SPB es un manejo multidisciplinario, tratando de individualizar cada caso.
Es posible que el hallazgo de aplasia ungueal
en cuatro ortejos del pie con deformidad de equino
varo se encuentre asociado al SPB; sin embargo, es
necesario identificar más casos para delinear mejor
las diversas condiciones clínicas agrupadas en el llamado SPB.
REFERENCIAS
1. Routh JC, Huang L, Retik AB, Nelson CP. Contemporary
epidemiology and characterization of newborn males with
prune belly syndrome. Urology. 2010; 76 (1): 44-48.
2. Arlen AM, Nawaf C, Kirsch AJ. Prune belly syndrome: current
perspectives. Pediatr Health Med Ther. 2019; 10: 75-81.
3. Woods AG, Brandon DH. Prune belly syndrome: a focused
physical assessment. Adv Neonatal Care. 2007; 7 (3): 132143.
4. Domínguez LM, Álvarez FÁO. Manejo de las anomalías
renales del tracto urinario detectadas por ecografía prenatal.
Uropatías obstructivas. Protoc Diagn Ter Pediatr. 2014; (1):
225-239.
5. Seidel NE, Arlen AM, Smith EA, Kirsch AJ. Clinical
manifestations and management of prune-belly syndrome in
a large contemporary pediatric population. Urology. 2015; 85
(1): 211-215.
6. Farrugia MK. Fetal bladder outflow obstruction: interventions,
outcomes and management uncertainties. Early Hum Dev.
2020; 150: 105189.
7. Grimsby GM, Harrison SM, Granberg CF, Bernstein IH,
Baker LA. Impact and frequency of extra-genitourinary
manifestations of prune belly syndrome. J Pediatr Urol. 2015;
11 (5): 280.e1-280.e6.
8. Chen L, Cai A, Wang X, Wang B, Li J. Two- and threedimensional prenatal sonographic diagnosis of prune-belly
syndrome. J Clin Ultrasound. 2009; 38 (5): 279-282.
www.medigraphic.org.mx
Vázquez CEE et al. Síndrome de Prune-Belly y aplasia ungueal
An Med ABC. 2022; 67 (2): 142-147
9. Achour R, Bennour W, Ksibi I, Cheour M, Hamila T, Hmid
RB et al. Prune belly syndrome: approaches to its diagnosis
and management. Intractable Rare Dis Res. 2018; 7 (4):
271-274.
10. Montoya-Chinchilla R, Guirao-Piñera MJ, Nortes-Cano L.
Valvas ureterales: revisión de la literatura y descripción de 4
nuevos casos. An Pediatría. 2014; 80 (1): 51-54.
11. Alvarado G, Garcia S, Garrido R. Valvas ureterales
congénitas. Informe de dos casos. Acta Pediatr Mex. 2009; 30
(3): 133-136.
147
12. Singh SK, Wadhwa P. Ablation of diaphragmatic annular ureteral
valve with holmium laser. Int Urol Nephrol. 2006; 38 (1): 157-159.
13. Zugor V, Schott GE, Labanaris AP. The Prune Belly syndrome:
urological aspects and long-term outcomes of a rare disease.
Pediatr Rep. 2012; 4 (2): e20.
14. Diao B, Diallo Y, Fall PA, Ngom G, Fall B, Ndoye AK et al.
Syndrome de Prune Belly: aspects épidémiologiques, cliniques
et thérapeutiques. Prog Urol. 2008; 18 (7): 470-474.
15. Hassett S, Smith GHH, Holland AJA. Prune belly syndrome.
Pediatr Surg Int. 2012; 28 (3): 219-228.
www.medigraphic.org.mx.
| 10,886 |
https://www.wikidata.org/wiki/Q111028447
|
Wikidata
|
Semantic data
|
CC0
| null |
Shutruk-Nakhunte II
|
None
|
Multilingual
|
Semantic data
| 51 | 140 |
Shutruk-Nakhunte II
re elamico dell'VIII secolo a.C.
Shutruk-Nakhunte II istanza di umano
Shutruk-Nakhunte II sesso o genere maschio
Shutruk-Nakhunte II occupazione monarca
Shutruk-Nakhunte II paese di cittadinanza Elam
Shutruk-Nakhunte II
Shutruk-Nakhunte II instance of human
Shutruk-Nakhunte II sex or gender male
Shutruk-Nakhunte II occupation monarch
Shutruk-Nakhunte II country of citizenship Elam
| 3,548 |
https://stackoverflow.com/questions/35908354
|
StackExchange
|
Open Web
|
CC-By-SA
| 2,016 |
Stack Exchange
|
Niranjan, Raviteja, https://stackoverflow.com/users/5416718, https://stackoverflow.com/users/5978708
|
English
|
Spoken
| 388 | 1,001 |
How to display jquery modal popup on mvc 4 button click
I am doing one mvc project where I have one button. When I clicked on button one popup with textbox and button should appear. I tried as below. Instead of getting popup when the page first loads required textbox and button in page only(supposed to display when the button clicked) This is what I tried.
<head>
<link rel="stylesheet" href="//code.jquery.com/ui/1.11.4/themes/smoothness/jquery-ui.css">
<script src="//code.jquery.com/jquery-1.10.2.js"></script>
<script src="//code.jquery.com/ui/1.11.4/jquery-ui.js"></script>
<link rel="stylesheet" href="/resources/demos/style.css">
</head>
Style information I copied from https://jqueryui.com/dialog/#modal-form(many lines of code so I am not posting here)
This is my script and popup code.
<div id="dialog-form" title="Create new user">
<form>
<fieldset>
<label for="name">Enter your Comments Here</label>
<input type="text" name="name" id="name" value="Jane Smith" class="text ui-widget-content ui-corner-all">
<!-- Allow form submission with keyboard without duplicating the dialog button -->
<input type="submit" tabindex="-1" style="position:absolute; top:-1000px">
</fieldset>
</form>
</div>
<script>
$("#Delete").button().on("click", function () {
dialog.dialog("open");
});
</script>
This is my mvc code.
@using (Html.BeginForm("Index", "TestRendering", FormMethod.Post))
{
<td scope="col"><input type="button" id="Delete" class="btn btn-primary btn-cons red" value="Delete" /></td>
}
Am I going wrong in this process? Thanks.
Try this
<input type="button" id="Delete" class="btn btn-primary btn-cons red" value="Delete" />
<div id="dialog-form" title="Create new user">
<form>
<fieldset>
<label for="name">Enter your Comments Here</label>
<input type="text" name="name" id="name" value="Jane Smith" class="text ui-widget-content ui-corner-all">
<!-- Allow form submission with keyboard without duplicating the dialog button -->
<input type="submit" tabindex="-1" style="position:absolute; top:-1000px">
</fieldset>
</form>
</div>
JavaScript
$('#Delete').click(function() {
$('#dialog-form').dialog('open');
});
jQuery(document).ready(function() {
jQuery("#dialog-form").dialog({
autoOpen: false,
modal: true,
open: function() {
jQuery('.ui-widget-overlay').bind('click', function() {
jQuery('#dialog').dialog('close');
})
}
});
});
Updated Demo
I tried same thing. Popup is not appearing. Text written inside tag appears in web page only. It is supposed to appear on button click Delete.
autoOpen: false use this
still I am not able to get. Textbox is appearing in webpage only. Button is not firing up. Do I need to change button type?
i changed button type from button to submit now button is firing but popup is not appearing. Where i should put autoOpen property?
Query(document).ready(function() { this set of code should i write inside script tags?
Now i put button above div tag. its working fine but my supposed to be inside mvc razor @using (Html.BeginForm("Index", "TestRendering", FormMethod.Post))
{ }
Let us continue this discussion in chat.
You can use it.If you've observed I've took your input between td
| 40,268 |
https://ceb.wikipedia.org/wiki/Orakoo
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Orakoo
|
https://ceb.wikipedia.org/w/index.php?title=Orakoo&action=history
|
Cebuano
|
Spoken
| 60 | 93 |
Suba ang Orakoo sa Uganda. Nahimutang ni sa distrito sa Kitgum District ug rehiyon sa Northern Region, sa amihanang bahin sa nasod, km sa amihanan sa Kampala ang ulohan sa nasod. Ang Orakoo mao ang bahin sa tubig-saluran sa Nile River.
Ang mga gi basihan niini
Nile River (suba sa Ehipto) tubig-saluran
Mga suba sa Northern Region (rehiyon sa Uganda)
| 38,878 |
https://fi.wikipedia.org/wiki/Morsiamen%20is%C3%A4%20%28vuoden%201991%20elokuva%29
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Morsiamen isä (vuoden 1991 elokuva)
|
https://fi.wikipedia.org/w/index.php?title=Morsiamen isä (vuoden 1991 elokuva)&action=history
|
Finnish
|
Spoken
| 210 | 576 |
Morsiamen isä () on vuonna 1991 ensi-iltansa saanut Charles Shyerin ohjaama yhdysvaltalainen komediaelokuva. Elokuvan pääosissa esiintyvät Steve Martin, Diane Keaton, Kimberly Williams ja Martin Short. Elokuva on uudelleenfilmatisointi Vincente Minnellin vuoden 1950 samannimisestä elokuvasta.
Elokuva on sijalla 92 yhdysvaltalaisen kaapelitelevisioverkko Bravon valitsemien sadan hauskimman elokuvan joukossa.
Elokuvan jatko-osa Father of the Bride Part II sai ensi-iltansa vuonna 1995.
Juoni
George Banks (Steve Martin) on keskiluokkainen perheenpää, jolla on oma urheilukenkiä valmistava yritys San Marinossa, Kaliforniassa. Georgen 22-vuotias tytär Annie (Kimberly Williams) aikoo mennä naimisiin Bryan MacKenzien (George Newbern) kanssa, joka on Bel-Airissa asuvan yläluokkaisen pariskunnan ainoa poika. Annie ja Bryan ovat päättäneet mennä naimisiin, vaikka ovat tunteneet toisensa vasta kolme kuukautta. George ei osaa kuvitella elämää ilman Annieta, joten hän päättää lujasti tehdä tulevista häistä niin epämukavat kuin mahdollista (varsinkin, kun kuulee häiden maksavan 250 dollaria per vieras). Georgen vaimo Nina (Diane Keaton) puolestaan yrittää saada miehensä olemaan iloinen Annien puolesta. Lopulta häät päätetään järjestää Banksien kotona, ja niitä varten palkataan omalaatuinen hääsuunnittelija nimeltä Franck (Martin Short). Sillä välin George yrittää totutella ajatukseen, että Anniesta on tullut aikuinen, jolla on oma elämä.
Näyttelijät
Lähteet
Aiheesta muualla
Morsiamen isä Box Office Mojossa
Morsiamen isä Rotten Tomatoesissa
Morsiamen isä Metacriticissä
Yhdysvaltalaiset komediaelokuvat
Vuoden 1991 yhdysvaltalaiset elokuvat
Yhdysvaltalaiset uudelleenfilmatisoinnit
Yhdysvaltalaiset romaaneihin perustuvat elokuvat
| 13,423 |
1509753_1
|
Caselaw Access Project
|
Open Government
|
Public Domain
| 1,963 |
None
|
None
|
English
|
Spoken
| 8,004 | 10,126 |
FREDERICK van PELT BRYAN, District Judge.
This is a civil action by the United States to enjoin the proposed acquisition by defendant Continental Can Company, Inc. (Continental) of defendant Hazel-Atlas Glass Company (Hazel-Atlas) on the ground that such acquisition would violate § 7 of the Clayton Act as amended. The court has jurisdiction over parties and subject matter.
The Government had previously attempted to block the acquisition by invoking a consent decree which had been entered against Continental in 1950 in a civil anti-trust suit under § 1 and 2 of tile Sherman Act and § 3 of the Clayton Act in the District Court for the Northern District of California. On August 31, 1956 the California court held that the consent decree did not cover the proposed acquisition.
The consummation of the acquisition was delayed in the meantime at the Government's request. The Government then commenced this action. It moved for a preliminary injunction against consummation and sought a temporary restraining order pending the hearing and determination of its motion. The temporary restraining order was denied on September 13, 1956. On that day, Continental took over all of the assets, property, business and good will and assumed all of the liabilities of Hazel-Atlas which since then has been operated as the Hazel-Atlas Division of Continental.
The Government withdrew its motion for a preliminary injunction on September 18, 1956 and this action became one for divestiture.
After some considerable time, the case was assigned to me for all purposes. Extensive pre-trial proceedings were conducted at which over a thousand pages of transcript were taken. The case then came on for trial.
The Government concluded its case after six weeks of trial during which it called some 78 witnesses. Over four thousand pages of testimony were taken. The Government introduced more than twelve hundred exhibits and the defendants more than five hundred.
At the conclusion of the Government's case defendants, pursuant to Rule 41(b), F.R.Civ.P., moved for a dismissal on the ground that upon the law and the facts the Government had shown no right to relief and that they were therefore en titled to final judgment on the merits. The motion was granted in a brief oral decision which stated only the conclusions reached. In view of the importance and complexity of the case a detailed opinion was to follow.
Before that opinion could be filed, the Supreme Court decided Brown Shoe Co., Inc. v. United States, 370 U.S. 294, 82 S.Ct. 1502, 8 L.Ed.2d 510 (1962), its first decision dealing at any length with § 7 of the Clayton Act as amended in 1950. The Government then asked leave to submit material dealing with the effect of that case on the case at bar. This application was granted and both .sides submitted briefs on this question. Consideration of the Brown Shoe ease has not changed the conclusions which I reached at the end of the trial.
My opinion follows.
Defendants' motion under Rule 41(b) for a dismissal at the close of the Gov•ernment's case, posed squarely the question of whether on the record, as it then .stood, defendants were entitled to judgment.
The motion was made on the ground that "upon the facts and the law the plaintiff has shown no right to relief." In an action tried to the court without a jury, the court, when such a motion is made at the close of plaintiff's •case, "as trier of the facts may then determine them and render judgment .against the plaintiff or may decline to render any judgment until the close of •all the evidence."
There is no doubt as to the meaning and applicability of Rule 41(b). The test to be applied in a case tried to the court alone is quite different from that on a motion to dismiss or for a directed verdict in a jury trial. In the latter •case the question is whether or not the plaintiff has made out a prima facie case sufficient to go to the jury and the court must view the evidence in the light most favorable to him.
In a trial to the court alone, however, the court is authorized under Rule 41(b), to evaluate and weigh all of the evidence presented by the plaintiff, draw such inferences therefrom as it considers reasonable in the light of the record, and determine at that stage whether plaintiff has sustained the burden of proof necessary to establish its right to relief were the case to end there. If the court undertakes to make such a determination and concludes that the plaintiff has not met this burden, the defendant is entitled to judgment on the merits.
In this case, as the trier of the facts, I determined at the conclusion of the Government's case that it had failed to sustain its burden of showing by a preponderance of the evidence that the acquisition under attack violated Section 7 of the Clayton Act in any respect. I therefore directed that judgment be rendered against the Government.
I.
Section 7 of the Clayton Act in the Light of the Brown Shoe Case.
The Government's case is grounded solely on Section 7 of the Clayton Act as amended in 1950. There is no claim of violation or threatened violation of any provision of the Sherman Act. There is no charge of restraint of trade, monopolization or attempt to monopolize. This is strictly a Section 7 case.
Section 7 as amended forbids the acquisition of the stock or assets of one corporation by another "where in any line of commerce in any section of the country, the effect of such acquisition may be substantially to lessen competition, or to tend to create a monopoly." The Brown Shoe case, decided on June 25, 1962, some twelve years after the 1950 amendment to § 7, is the first definitive interpretation of that section by the Supreme Court since its amendment.
The facts in the Brown Shoe case were entirely different from those in the case at bar. The specific holdings of the Court on the facts presented there are therefore not determinative of the problems posed here. Indeed, Brown Shoe recognizes that the facts in each case in all likelihood will differ widely, that the framework of each industry is likely to be unique, and that each case must stand or fall on its own facts viewed within the framework of the industry pattern.
However, the discussion in Brown Shoe of the legislative history and background of the 1950 amendment to § 7, the theory of the amended section, the interpretation to be given to it, and the principles and guidelines to be followed in applying it, is controlling. Brown Shoe is the authoritative declaration of the law on the subject as it now stands and the principles and guidelines which it lays down must be applied here.
Section 7 proscribes acquisition of either stock or assets where, as a result, competition in any line of commerce in any section of the country may be substantially lessened. It covers all mergers or acquisitions, horizontal, vertical or conglomerate.
As Brown Shoe makes plain, however, the section does not prohibit all mergers. While the congressional intent was to arrest restraints of trade and
monopolistic tendencies "in their incipiency and well before they have attained such effects as would justify a Sherman Act proceeding," there is no¡ per se proscription against the acquisition of the stock or assets of one corporation by another. The statute is concerned only with those acquisitions which have demonstrable anti-competitive effects.
It is clear, moreover, that the statute was directed neither at the possibility that anti-competitive effects might occur nor at certainty of anti-competitive-effects already covered by the Sherman Act. "[Pjroof of a mere possibility of a prohibited restraint or tendency to monopoly will not establish the statutory requirement The statute is concerned with the reasonable-probability of the lessening of competition or tendency toward monopoly as a result of the particular acquisition under scrutiny — a showing that such effects are-reasonably likely to occur. This is what the words "may be" as used in the statute mean. The lessening of competition, moreover, must also be shown to be "substantial".
Acquisitions are proscribed where substantial anti-competitive effects or tendency to monopoly are reasonably probable in any line of commerce in any section of the country. Thus, in order to determine whether there are anti-competitive effects or tendency to monopoly, it is necessary in each case to define-the lines of commerce in which the acquiring and acquired companies were engaged and the sections of the country af feeted. Anti-competitive effects and their substantiality cannot be evaluated in a vacuum. They can only be judged in terms of the particular markets or sub-markets affected — that is to say "within the area of effective competition."
While Section 7 does not use the term "market", it is clear that "line •of commerce" refers to a product market, and "section of the country" refers to a geographic market in which competition exists and in which the effects of the acquisition may be felt. A relevant product market must be a market which is meaningful in terms of competitive and commercial realities. A relevant geographic market must embrace an economically significant section of the country in terms of competitive effects.
Thus, relevant markets are neither economic abstractions nor artificial conceptions. They are rather specific areas where, viewed in the context of the facts of the particular case under consideration, there may be demonstrable anti-competitive effects as the result of the acquisition. The test then is whether the acquisition has demonstrable anti-competitive effects in any relevant product market in any section of the country.
Section 7 does not spell out any particular tests or standards for determining the relevant product markets or geographic areas which may be affected by the acquisition. Nor does it supply, either in quantitative or qualitative terms, any tests for determining whether the effects may be "substantially" to lessen competition. "However, sufficient expressions of a consistent point of view may be found in the hearings, committee reports of both the House and Senate and in floor debate to provide those charged with enforcing the Act with a usable frame of reference within which to evaluate any given merger."
Against this background the tests and standards to be used vary depending upon what may be appropriate in the light of a wide variety of factors. These factors include the nature, business and relationships of the acquired and acquiring companies, the markets which they serve, the kind and extent of competition in such markets, the pattern of the industry as a whole and the place of such companies in the industry.
Thus, in determining relevant product markets it has been deemed pertinent to examine such factors as the peculiar uses and characteristics of the product; its distinguishing physical characteristics ; whether it is sold to distinct classes of customers; distinct price differentiations; sensitivity to price changes; reasonable interchangeability of use and demand; public or industry recognition of the market as a separate market entity; unique production facilities; and specialized vendors.
In determining the geographic market pertinent factors include scale of distribution; locale of actual and potential buyers and of competing sellers; focus of competition; and whether regional markets interlock to form a larger market.
None of these factors are conclusive in themselves and all must be "functionally viewed, in the context of [the] particular industry." Mere mechanical or quantitative application of § 7 should be avoided and each case must be judged in the light of its own peculiar facts. Only within such a setting can the probable anti-competitive effects of a merger be judged.
In the light of these considerations the issues on which the Government had the burden of proof here were two-fold. First, it was required to delineate the relevant product markets or sub-markets in which it claimed that competition was adversely affected by the acquisition and the sections of the country affected. Second, it had to establish that in one or more of such markets or sub-markets in any particular section or sections of the country, there was reasonable probability that the effect of the acquisition would be substantially to lessen competition or to tend to create a monopoly.
II.
The Merging Companies.
(1) Continental.
Continental Can Company, Inc. is a New York corporation with its principal offices in New York City. It was organized in 1913 by the merger of three companies engaged in the manufacture of metal cans. At that time American Can Company was the dominant factor in the can industry.
After its organization Continental went through a period of substantial internal expansion. Beginning in 1923 and for the next twenty years it continued to expand internally and also by acquiring some twenty-four companies in various sections of the country which were also engaged in manufacturing various types of cans, some of which had not been previously manufactured by Continental. It also acquired several companies which did not produce metal cans but made other packaging products. Continental acquired its last can manufacturer in 1944.
Since that time it has engaged in a program of diversification aimed at increasing the variety of products which it is able to supply.
Its acquisitions have included companies producing can manufacturing and can closing machinery, flexible packaging, plastic containers and other plastic products, paper containers and paperboard, fibre drums, crown caps and vacuum closures, and a miscellany of other products.
In 1956 it acquired Hazel-Atlas, Robert Gair Company, Inc., a manufacturer of paperboard and similar products, and White Cap Company, which manufactured vacuum type metal closures.
By that time it was and had been for a good many years the second largest metal can manufacturer in the country. It was a formidable competitor of American Can Company which had long been the leader in the industry.
When it acquired Hazel-Atlas Continental's principal business was the manufacture and sale of metal cans and other metal containers to industrial consumers for a wide variety of uses. In 1955 metal cans and other metal containers accounted for between two-thirds and three-quarters of its total dollar sales volume. It also manufactured numerous other products, including fibre drums, flexible packaging materials, plastic products (including plastic containers), paper cups and plates, crown caps, vacuum type metal caps, can closing machinery, and special defense items.
By 1955 Continental had 72 plants for the manufacture of its products at various locations throughout the United States. It also had plants in seven for eign countries, including Canada. Forty manufactured metal cans. Approximately 45,000 persons were in its employ.
Its net sales and operating revenues and net income for the years 1953, 1954 and 1955, in thousands of dollars, were:
Net Sales and Operating Net Revenues Income
1953 . $554,436 $15,680
1954 . 616,163 20,736
1955 . 666,266 24,172
Its total assets as of December 31, 1955 were $381,917,000.
Including the Hazel-Atlas, Gair and White Cap acquisitions, for the year 1956 Continental had net sales and operating revenues of $1,010,268,000, and net income of $43,143,000 with total assets as of December 31, 1956 of $633,-706.000.
Comparative 1955 combined figures for these four companies prior to acquisition, show net sales and operating revenues of $929,428,000, net income of- $38,-693.000, and total assets as of December 31, 1955 of $568,850,000.
(2) Hazel-Atlas.
Hazel-Atlas was a West Virginia corporation with its principal office in Wheeling, West Virginia. It was organized prior to 1900 and, as a result of its acquisition by Continental, was dissolved on September 21, 1956.
Its principal business was the manufacture and sale of glass containers of various types to industrial consumers and of glass jars for home canning, both largely of the wide mouthed variety. It also manufactured glass tumblers, tableware, kitchenware, glass articles of special design for industrial use, screw type metal closures and closures for home canning glass jars. It appears to have been the third largest glass container manufacturer in the United States.
Hazel-Atlas operated plants at thirteen locations in various parts of the country, principally in the western Pennsylvania, West Virginia and eastern Ohio area, and had six warehouses. Its net sales and net income in 1953, 1954 and 1955, in thousands of dollars were:
Net Net Sales Income
1953 .$79,250 $3,112
1954 . 79,174 3,629
1955 . 79,920 3,393
Its total assets as of December 31, 1955 were $37,884,000.
After acquisition by Continental the operations conducted by Hazel-Atlas were continued by the Hazel-Atlas Division of Continental and its operating figures were included in Continental financial statements. It does not appear that there was any substantial change in the volume or character of business done by the Hazel-Atlas Division in the period between its acquisition and the trial.
Prior to its acquisition Hazel-Atlas did not manufacture or sell metal cans, plastic or paper containers, vacuum type metal closures, crown caps or any other product manufactured or sold by Continental or its subsidiaries.
On the other hand, Continental did not, directly or through subsidiaries, manufacture or sell glass containers or any other glass products, screw type metal closures, or any product manufactured or sold by Hazel-Atlas. It is uncontroverted that the two merging companies manufactured and sold no identical products.
III.
The Types op Products and the Separate Industries Involved.
This case is concerned with three basic types of containers — those made of metal, glass and plastic. They are of a variety of shapes, sizes and end uses.
The three types of containers are produced by three recognized separate industries, each with its own structure and pattern, the metal can industry and the plastic container industry in which Continental was engaged, and the glass con tainer industry in which Hazel-Atlas was engaged.
In addition to the three types of containers the case also is concerned with three different kinds of metal closures used to close or seal products packed in containers. They are crown caps, vacuum type closures and screw and lug type closures. Continental produced crown caps and vacuum type closures and Hazel-Atlas produced screw and lug type closures. Closures will be discussed separately though there is no separate metal closure industry.
(1) Basic types of products.
(a) Metal cans.
For Census Bureau statistical purposes the metal can is defined "as a single-walled container constructed wholly of tin plate, terne plate, blackplate or waste plate designed for packing products." Such cans have distinct physical characteristics. They are rigid and unbreakable, but can be dented. Unlike plastic containers, they can be hermetically sealed and are impermeable to gases. They can be heat processed faster and are lighter than glass containers, and are not chemically inert.
The basic raw material used in can manufacture is tin-coated steel (tin plate), but some cans are made from uneoated steel (blackplate) or aluminum. Other raw materials include soldering compounds, paints, varnishes, lithographing inks, paper and cartons for packaging. The major factor in determining can prices is the cost of tin plate. Cans are generally sold f. o. b. the manufacturer's plant.
The products packed in metal cans are extremely numerous and varied and in fact cover a substantial segment of American industrial and agricultural production. However, for statistical purposes the Census Bureau has set up thirteen different general categories of metal cans all in terms of end use. The Bureau collects statistics from metal can manufacturers as to the amount of metal each consumes in the manufacture of cans in each of these categories.
The thirteen Census Bureau end use categories are fruit and vegetables (including juice); evaporated and condensed milk; other dairy products; meat (including poultry); fish and seafood; coffee; lard and shortening; soft drink; beer; pet food; oil open-top (1 quart and 5 quart); all other food (including soup and baby food cans); and all other nonfood. A number of these categories plainly include a great number and varie ty of specific end uses for which no accurate further breakdowns are available.
Among the principal types of cans are "Packers" cans and "General Line" cans. "Packers" cans are normally used for food products though they are used for many non-food products as well. They are round open-top or sanitary cans. The packer after filling the can puts the top on.
"General Line" cans are used both for food and non-food products and have different kinds of fittings and different shapes. There are other types of cans also. All types of cans are manufactured from the same raw materials by the same production processes and with the same equipment.
Cans used for one type of product may be used for other types of products also, but they usually have different linings for different products. For example, substantially the same open-top can is used for food, pet food, motor oil and other non-food products.
(b) Glass containers.
There are two basic types of glass containers, the wide mouth and the narrow neck container.
Glass containers have distinct physical characteristics. They are rigid, chemically inert and impermeable to gases; can be hermetically sealed but are readily broken; and, unlike many cans, can be easily resealed after they have been opened. Glass containers are heavier than other types of containers and must be carefully packed for shipment to avoid breakage. Costs of shipment are therefore higher. They take longer to heat process than cans. Many narrow necked glass containers are suitable for re-use by bottlers and are returned by consumers to the bottler for such re-use.
Glass containers used for one type of product are often identical with containers used for widely dissimilar products. Thus, the same wide mouthed glass jar is used for peanut butter and silver polish, and the same narrow necked glass bottle is used for vinegar and liquid starch.
The basic raw materials used in the manufacture of glass containers are sand, lime and soda ash. Also required are the necessary labeling and coloring materials. Because of the need for careful packing for shipment to customers, corrugated cartons are used to pack the containers.
Cost of labor is the major factor in determining glass container prices. The corrugated shipping container represents 18-20% of the cost of the final product as shipped. Glass containers are generally sold on a delivered price basis with freight included in the price.
The Census Bureau publishes data as to glass container shipments. These statistics are grouped in terms of end use, in the following fourteen categories :
Narrow Neck: Food, medicinal and health supplies; household and industrial ; toiletries and cosmetics; beverage, returnable; beverage, non-returnable; beer, returnable; beer, non-returnable; liquor; and wine.
Wide Mouth: Food, including fruit jars and jelly glasses; medicinal and health supplies; household and industrial; toiletries and cosmetics; dairy products; and packer's tumblers.
Each of these general end use categories is composed of hundreds of individual end use items. But no detailed breakdown figures on the end use categories are available.
(c) Plastic containers.
Plastic containers are manufactured by various methods including blow molding and injection molding. They are made of such raw materials as polyethylene and polystyrene. Prices are principally determined by the price of raw materials. Some are sold on a delivered price basis and some are not.
Plastic containers have distinct physical characteristics. They are neither rigid nor transparent. They are not impermeable to gases, and cannot be hermetically sealed. Such containers are virtually unbreakable, but they cannot contain internal pressure and their ability to hold a vacuum is limited. They are lighter in weight than glass containers and appear to be smaller than glass containers of equal capacity. They are electrostatic and therefore attract dust.
Plastic containers are of many shapes and sizes and include such items as bottles, jars, tubes, vials and bags. They are used to package many kinds of foods, drugs, cosmetics, detergents and industrial products including such widely diverse products as rust removers, baby lotions, ice cream, insect repellents, shoe polishes, pills, water and deodorants.
(2) Separate industries.
(a) The metal can industry.
This industry is composed of companies engaged in the manufacture of metal cans used to pack a large number and wide variety of diiferent products. Most of the companies in the industry manufacture cans for sale to industrial and agricultural processing customers who, in turn, use them to pack their own products for marketing. Some companies, on the other hand, the so-called captive compames, produce cans for their own use in packing their own products. Some of the captive companies produce cans for their own use and also sell to other users.
A number of metal can manufacturers also manufacture tinware and other tin plate products. Some also produce other kinds of packaging materials and incidental items.
There are no reliable figures in the record as to the number of companies engaged in the manufacture of metal cans in the United States. Estimates run from seventy-five to over ninety. The largest is American Can Company. Continental is second. Either Campbell Soup (a captive manufacturer) or National Can Company is third. Other important manufacturers include Crown Cork & Seal Company, Heekin Can Company, J. L. Clark Company, Carnation Milk and Sherwin-Williams. American Can, Continental, National Can and Crown Cork & Seal, among others, sell cans throughout the country. Most of the other companies operate on a regional basis.
American Can, the industry leader, like Continental, manufactures a variety of products used by packers. In addition to metal cans it produces fibre, plastic and paper containers. It also manufactures machines for filling and closing both metal and fibre containers. Various other companies manufacturing metal cans also have diversified product lines.
In 1955 American Can shipped approximately 38 % of the metal cans sold in the United States. Continental's shipments amounted to approximately 33%. American's shipments exceeded Continental's in nine of the thirteen Census categories. Together these two companies accounted for approximately 71% of the total metal can shipments in the country.
It appears that can companies sell their products directly to users. There is nothing to indicate that there are any jobbers or wholesalers who purchase cans for resale to their own customers and it may be assumed that there are none.
The trade association for this industry is the Can Manufacturers Institute. Its forty-nine members, limited to can manufacturers, include American, Continental, National, Crown, Heekin and Clark. Voting rights and representation on the Board are determined by the number of employees of the member companies.
The Institute has a professional staff of three. Its activities, carried on largely through committees, deal with various technical industry problems such as industrial relations, traffic, safety and research and include a limited amount of promotion on the advantages of the metal can.
A promotion and advertising program, jointly financed by the members of the Institute and tin plate manufacturers who supply raw materials for can manufacture, was carried on at one time. The program was dropped when the tin plate manufacturers withdrew financial support. A recent program of advertising to promote soft drinks in cans was not conducted by the Institute but was financed exclusively by tin plate manufacturers.
Since 1957 the Institute has done no advertising and its only promotion work has been in connection with the celebration of the sesquicentennial of the tin can. The extent of the activities of the Institute and the effects, if any, which such activities may have upon the industry or upon the public are not reflected in the record.
The annual production of cans has increased substantially since the end of World War II when the industry resumed its normal rate of growth after wartime curtailment of metal supply. Its facilities have also expanded substantially and continue to do so.
Since 1950 American and Continental have substantially maintained their market positions as the number one and number two companies in the industry respectively. However, the medium sized producers, with assets of less than $100,-000,000 have not only participated in the growth of the industry but have increased their share in the market. The evidence did not show that there has been any reduction in the number of companies manufacturing cans since the Hazel-Atlas acquisition and, in fact, the number of companies engaged in the "Tin Can and other tinware industry" was greater in 1957 than in 1950.
It did not appear that the initial capital investment needed to embark upon can manufacture is unreasonably high, that there is any obstacle to obtaining whatever technical knowledge is necessary or that there are any patent barriers to entry into the industry. Raw materials are plentiful and readily available.
There was little in the record as to the shape and pattern of the industry in terms of such factors as the markets which it serves, the nature of the competition which exists in such markets, pricing practices, its methods of buying, selling and merchandising, the supply and demand picture or similar matters.
From all that appears the industry is prosperous, healthy and highly competitive. Competition has been and remains keen and vigorous. What the record presents is a generalized picture of a large, strong, and relatively stable but expanding metal can industry.
(b) The glass container industry.
This well-defined and recognized separate industry is composed of companies engaged in the manufacture of glass containers sold to industrial and agricultural customers for use in packing their own products. Glass containers are also sold to the public for home preserving.
The industry produces glass containers of a wide variety of types, shapes, sizes and colors for numerous end uses. A number of companies, including Owens-Illinois Glass Company and Hazel-Atlas, also produce glass table and kitchen ware and other glass products. Some also produce other products used by packers.
There are at least forty-two companies engaged in the manufacture of glass containers. By far the largest is Owens-Illinois Glass Company with almost 35% of the total production and with annual sales in 1955 of some $370,000,000 and earnings of some $27,000,00o. Anchor-Hocking Glass Company, Hazel-Atlas and Knox Glass, Inc. appear to follow in that order. The Hazel-Atlas share of the glass container market in 1955 was about 9.6% with net sales of some $79,-000,000 and net earnings of approximately $3,000,000.
Owens-Illinois, in addition to glass containers, manufactures plastic containers, metal and plastic closures, corrugated shipping containers, various types of fibre and paperboard containers, closure machinery and a wide variety of other glass and plastic products. Other companies, such as Anchor-Hocking, also have diversified lines.
There are at least twenty companies in the industry with sales above or in the neighborhood of $10,000,000 a year. Most of these companies have been expanding their facilities and production and increasing sales at a rapid rate. There is nothing to indicate that smaller companies are not also prospering.
Five companies in the industry sell throughout the country. They are Owens-Illinois, Anchor-Hocking, Thatcher Glass Mfg. Co., Ball Bros. Co., Inc., and Hazel-Atlas. Other companies sell on a regional basis.
The trade association for the industry is the Glass Container Manufacturers Institute. Its membership consists of thirty-six glass container manufacturers, six closure manufacturers and twenty suppliers of raw materials and equipment. Dues are assessed on the basis of sales volume and the Board of Trustees is composed of employees of the member companies.
The Institute has about forty-five paid employees. Its activities are carried on by standing committees. Members of the professional staff are assigned to each committee.
Activities include market research and promotion, the collection and dissemination of statistics concerning the industry, technical research, package design and specifications, the development of standard testing and quality control procedures, problems of freight rates, labor relations, and liaison work with government. The Institute does advertising and publicity for the industry but the evidence does not indicate how substantial this is or how effective such activities are.
As in the case of the metal can industry, there is virtually nothing in the record of significance regarding such matters as the markets served by the industry, the nature of the competition which exists in such markets, the problems faced by its customers, methods of selling and merchandising, price structure or pricing practices, the supply and demand picture, or similar matters.
During World War II the tin plate supply was greatly curtailed and the glass container industry was able to make substantial advances at the expense of the metal can industry. Since the war the glass container industry has continued its substantial growth and expansion and this process has not abated since the Hazel-Atlas acquisition. The growth of the glass industry has been more rapid than that of the can industry.
Numerous technical improvements have been made in the glass container which have increased its strength, resistance to breakage and overall utility, and have lightened weight. These improvements have contributed significantly to the growth of the industry.
There appears to be no difficulty in entering the glass container industry and a number of new companies have recently entered and have had successful operations. There has been a continuous expansion of facilities by both large and small companies through new plant construction or additions to existing plants.
There was no evidence that the initial capital investment needed to enter the industry was unreasonably high or that there is any obstacle to obtaining whatever technical knowledge or facilities are necessary. Nor are there any patent barriers to entry. Raw materials are plentiful and readily available, as are shipping containers.
The industry is prosperous, healthy and highly competitive. Here again is a generalized picture of a large, strong, and rapidly expanding industry in which competition has been and remains keen and vigorous.
(c) The plastic container industry.
The plastic container industry is relatively new. It got under way in the mid 1940's. The industry has since grown rapidly and is still undergoing rapid expansion. Neither the size and scope of the industry nor the respective positions of Continental and other manufacturers in it can be determined with any reasonable degree of accuracy from the evidence in this record.
The larger companies in the industry include Plax Corporation, Injection Molding Company, American Can, Continental, Royal Manufacturing Company, Inc., Owens-Illinois, Wheaton Plastics Company and Foster-Grant Company, Inc.
The dollar sales volume of the industry is small compared with that of the metal can and glass container industries. Plax, the largest producer, had plastic container sales in 1959 of about $12,000,000, which it estimated to be 30% to 40% of such sales in the United States.
In 1955 Continental's sales of plastic containers amounted to $2,400,000, and according to its estimate it shipped approximately 9.3% of the plastic squeeze bottles sold in the United States in that year.
There are apparently thousands of small companies engaged in the manufacture of plastic containers. Some use the blow molding method of manufacture and others use injection molding.
Among the many types of plastic packaging materials produced by companies in the industry are bottles, jars, vials, boxes, folding cartons, tubs, tubes, carboys, tubes with metal ends, film and other flexible materials and bags. These containers are sold to a wide variety of industrial customers who pack their own products.
There is a Plastic Bottle and -Tube Manufacturers Institute, organized in 1957, which is a division of the Society of the Plastics Industry, Inc. Its members are American Can, Continental, Foster-Grant, Injection Molding, Plax and Royal.
There was a paucity of information in the record about the activities of this Institute. It appears to collect statistics from its members, some of which apparently are published by the Department of Commerce but these figures are not in the record. Such statistics as are collected by the Institute concerning individual companies are destroyed when received and only overall totals are maintained. The Bureau of Census does not collect or publish statistics relating to the production of plastic containers.
There is no showing that the initial capital investment needed to enter manufacture of plastic containers is high. Nor are there any technical obstacles to such manufacture. Raw materials and labor are readily and plentifully available and patents constitute no barrier to entry into this field.
The number of companies manufacturing plastic containers is on the increase and has continued to increase since the acquisition. The industry is rapidly expanding and competition is keen and vigorous. There are no universal figures for the industry in the record and such statistics as there are concerning it are wholly unreliable and furnish no basis from which informed conclusions can be drawn.
This relatively new and expanding industry plainly has substantial potential. However, its overall dimensions and the extent to which it may be in competition with the glass container and metal can industries remain, at best, obscure.
(3) Closures.
The term "closures" refers to a miscellany of devices used by packers to close and seal containers in which products are packed. The various types include crown caps, vacuum type closures, screw and lug type closures, paper and foil caps, and closures for home canning. Some are made of tin plate, some of aluminum or plastic, and others of paper or foil.
As I mentioned earlier, prior to the acquisition Continental produced crown caps and, after acquiring White Cap Company, vacuum type metal closures as well through that subsidiary. Hazel-Atlas did not manufacture either of these products. It manufactured screw and lug type metal closures and home canning closures. Continental did not.
(a) Crown caps are made of tin plate with cork or composition lining. They are used to close narrow neck glass bottles, primarily for beer and carbonated beverages. They are applied to the bottle by crimping and not by lugs or threads. They are not sold in competition with screw or vacuum type metal closures.
The largest producer of crown caps was Crown Cork & Seal Company, which was also a metal can producer. Other producers, in addition to Continental, were Armstrong Cork and Guttman, Though Anchor-Hocking and Owens-Illinois did not manufacture crown caps at the time of the acquisition, both of them had been for some time large manufacturers of beer bottles and beverage bottles.
In 1956 Continental shipped 17.1% of the crown caps sold in the United States, in 1957 18.4% and in 1958 18.5%.
(b) Vacuum type metal closures are made of tin plate or aluminum, with various kinds of linings. They may be of the side-seal, top-seal (or twist-off) or roll-on varieties. They are used on glass containers almost entirely for packing food.
Vacuum type metal closures are applied by closing machines which create a vacuum in the head space of the container. The products to be packed are sterilized and steam is inserted into the area remaining between the food and the top of the jar, thus exhausting the air in the head space. The closure is then applied and when the product cools and the steam evaporates a vacuum seal is created.
Closing machines for the application of vacuum metal closures are leased or sold to packers by Continental through its White Cap Division and also by Owens-Illinois, Anchor-Hocking and Aluminum Company of America. Vacuum closing machines for a particular type of vacuum closure made by different manufacturers, are interchangeable with similar machines made by other manufacturers, or may be made so with relatively minor modifications. Such machines cannot be used to apply screw type metal closures and they operate at much higher speeds than machines for the application of screw type closures.
The White Cap Company, now subsidiary of Continental, is the leading manufacturer of vacuum type closures. Other manufacturers include Anchor-Hocking, Owens-Illinois and Crown Cork & Seal. In 1956 White Cap produced approximately 60% of the vacuum closures made from tin plate. A recent development, apparently pioneered by White Cap, is the twist-off vacuum closure which is used for the same general purposes as other vacuum closures.
(c) Some screw and lug type metal closures are made of tin plate with vari ous kinds of linings. Others are made of aluminum or plastic. It does .not appear that screw and lug type closures made of different materials have end uses substantially different from one another. Closures of this type are normally used on glass containers.
These closures engage the glass container by screwing into continuous threads in the neck of the container. They cannot be used where a vacuum is required and in general are not used for food products for which vacuum metal closures are needed because of spoilage problems. Screw and lug type closures are used on both food and non-food products.
There are at least 18 companies manufacturing screw and lug type metal closures, including Owens-Illinois, Crown, Ball Bros, and Hazel-Atlas. In 1958 Hazel-Atlas produced approximately 4.7% of the screw and lug type metal closures shipped in the United States. There are several companies, including Owens-Illinois, which manufactured both metal and plastic type screw and lug type closures, the uses of which appear to be substantially interchangeable. From 24 to 36 companies make plastic screw type closures.
The statistics in the record relating to closures do not include metal closures used in home canning, aluminum closures, plastic closures or paper caps, though Hazel-Atlas made home canning closures as well as screw and lug type closures for commercial packing. With the exception of home canning jars sold with closures attached, glass containers and closures for them are sold separately. Closures are sold by the manufacturer directly to packers and there appear to be no wholesalers or jobbers of these products. Closure customers generally have multiple sources of supply. There is no evidence that prices of one type of closure have any effect on the sales volume of any other types.
There is no shortage of raw materials necessary to manufacture closures. There was no showing that there were any substantial obstacles to entry into any of the closure fields.
Crown caps, vacuum type closures and screw and lug type closures have in the main quite different uses and do not significantly compete with one another. However, competition within each of the respective screw type, vacuum type and crown cap fields has been and remains keen and vigorous and there does not appear to have been any significant diminution in the number of companies engaged in these respective fields either before or after the acquisition.
IV.
The Contentions of the Parties.
(1) Lines of commerce and sections of the country claimed to be relevant.
A year and a half before the commencement of the trial, the Government, in answer to defendants' interrogatories, specified with particularity ten separate lines of commerce which it claimed were adversely affected by the acquisition under attack. The lines of commerce so specified remained unchanged throughout the exhaustive pre-trial proceedings in which the issues to be tried were carefully limited and defined, and during the six weeks of the trial itself.
The ten lines of commerce are as follows:
1. The packaging industry.
2. The can industry.
3. The glass container industry.
4. Metal closures.
5. Containers for the beer industry.
6. Containers for the soft drink industry.
7. Containers for the canning industry.
8. Containers for the toiletries and cosmetic industry.
9. Containers for the medicine and health industry.
10. Containers for the household and chemical industry.
The Government contended that the relevant geographic market in which adverse effects of the acquisition were felt in each of these ten lines of commerce was the United States as a whole. It contended also that in lines of commerce numbered 2, 3, 5, 6, 7, 8, 9 and 10 there were adverse effects in two separate sections of the country, as well, (a) the United States east of the Rocky Mountains, and (b) the United States west of the Rocky Mountains.
No discussion of the attempted distinction between the areas east and west of the Rocky Mountains is necessary here. The evidence wholly failed to establish that, in the context of this case, there were any differences between these areas or between either of them and the United States as a whole indicating that they constituted economically significant separate geographic markets in any of the lines of commerce specified. Nor was there evidence that such effects of the acquisition as might be felt were any different in different sections of the country. The only "section" of the country which was relevant was the United States as a whole. That is the geographic market with which we are concerned here.
The defendants agreed with the Government that the can industry and the glass industry were separate lines of commerce for Section 7 purposes. They contended, however, that the other eight lines of commerce specified did not in fact exist and that there were no such separate relevant product markets or sub-markets.
Hazel-Atlas, said the defendants, was engaged in two lines of commerce, glass containers and screw and lug type metal closures and these were the only relevant markets in so far as it was concerned. They said further that the only relevant product markets in which Continental was engaged were metal cans, plastic bottles, crown caps and vacuum type closures.
Thus defendants contended that there were but six separate and distinct relevant lines of commerce or product markets. Moreover, they took the position that the lines of commerce in which Hazel-Atlas and Continental were respectively engaged, were quite different and did not overlap to any significant degree.
(2) Claims as to anti-competitive effects.
The Government conceded that it had no proof that any person or firm, seller or buyer, suffered any actual injury as a result of this acquisition, although the trial took place more than three arid a half years after it occurred. There were no complaining witnesses. None of the 78 witnesses whom the Government placed on the stand testified to any actual anti-competitive effects or tendency to monopoly. There was no evidence of actual anti-competitive effects or tendency to monopoly in this record.
The Government's case was predicated upon what it claimed were potential anti-competitive effects.
As its standards for determining whether such effects were reasonably probable, the Government advanced four criteria referred to in the House Report on the 1950 amendment to the section. It claimed that the acquisition (1) had eliminated in whole or in material part the competitive activity of Hazel-Atlas which had been a substantial factor in competition with Continental; (2) had increased the relative size of Continental to such point that its advantage over its competitors threatened to be decisive; (3) had resulted in an undue reduction in the number of competing enterprises; and (4) had established relationships between buyers and sellers which deprived their rivals of a fair opportunity to compete.
The Government also stressed a statement in the Senate Report on the 1950 amendment that the statute was intended "to cope with monopolistic tendencies in their incipieney and well before they have attained such effects as would justify a Sherman Act proceeding. " It emphasized prior acquisitions by Continental of companies in the metal can and other fields, and urged that when Continental acquired Hazel-Atlas, the process of acquisition had reached a stage where it was reasonably probable that anti-competitive effects would occur and that the acquisition was therefore unlawful. ii
The Government took the position that, while the anti-competitive effects referred to in the House Report might not be apparent presently, it was probable that they would occur in the future in each of the lines of commerce which it attempted to delineate.
Defendants, on the other hand, while conceding that the criteria referred to in the House Report might be relevant considerations in an appropriate Section 7 case and that, in appropriate circumstances, a continuing process of cumulative acquisition might become unlawful, insisted that there was no substitute for a showing that there be reasonable probability of substantial anti-competitive effects or tendency to monopolize in the product markets relevant to the case under consideration. They pointed out that the intention of Congress to cope with restraints of trade and monopolistic tendencies in their incipieney was carried out by the concept of reasonable probability embodied in the statute and that this was the sole standard to be applied to the particular facts of each case.
| 22,880 |
https://github.com/thoas/i386/blob/master/src/milkshape/application/externals/timezones/forms.py
|
Github Open Source
|
Open Source
|
MIT
| 2,021 |
i386
|
thoas
|
Python
|
Code
| 92 | 373 |
import pytz
from django.conf import settings
from django import forms
from timezones.utils import adjust_datetime_to_timezone
TIMEZONE_CHOICES = tuple(zip(pytz.all_timezones, pytz.all_timezones))
class TimeZoneField(forms.ChoiceField):
def __init__(self, choices=None, max_length=None, min_length=None,
*args, **kwargs):
self.max_length, self.min_length = max_length, min_length
if choices is not None:
kwargs["choices"] = choices
else:
kwargs["choices"] = TIMEZONE_CHOICES
super(TimeZoneField, self).__init__(*args, **kwargs)
def clean(self, value):
value = super(TimeZoneField, self).clean(value)
return pytz.timezone(value)
class LocalizedDateTimeField(forms.DateTimeField):
"""
Converts the datetime from the user timezone to settings.TIME_ZONE.
"""
def __init__(self, timezone=None, *args, **kwargs):
super(LocalizedDateTimeField, self).__init__(*args, **kwargs)
self.timezone = timezone or settings.TIME_ZONE
def clean(self, value):
value = super(LocalizedDateTimeField, self).clean(value)
return adjust_datetime_to_timezone(value, from_tz=self.timezone)
| 15,627 |
US-75151134-A_1
|
USPTO
|
Open Government
|
Public Domain
| 1,934 |
None
|
None
|
English
|
Spoken
| 4,863 | 6,418 |
Circuit breaker
- Aug. 1, 1939.
G. A. MATTHEWS CIRCUIT BREAKER Filed Nv. 5, 19:54
3 Sheets-Sheet 1 a 1, 93 G. A. MATTHEWS 2,167,665
CIRCUIT BREAKER 7 Filed Nov. 5, 19 34 3 Sheets-Sheet 2 J? 65 3i 6 "Q; Ib 6 1 5 'l 156 lll 5i V 36 W O I l 7 1, 1939? cs. A. MATTHEWS 2,167,665
- CIRCUIT BREAKER:
- Fiied Nov. 5. 1954 s Sheets-Sheet s M gg.
Patented Aug. 1, 193 9 PATENT OFFICE 2,167,865 omcm'r BREAKER George A.Matthews, Detroit, Mien, miraclto The Detroit Edison Company, Detroit,Mich; a corporation of New York Application November 5, 1934, Serial No.751,511 13 Claims. (Cl. 200-149) 10 carrying an arc is conductingbecause it is ionized;
that is, because a considerable number of normally electricallyneutralized molecules are broken up into electrically charged partscalled ions. If the-arc is to be extinguished and, if the gas is to llrecover its normal insulating state, these ions must disappear. Left toitself, the ions, in the ionized gas disappear spontaneously by direct vrecombination. This process is relatively slow and'is of littlepractical use in the interruption 7 20 of an alternating currentcircuit.
It has been found in this connection that a very I effective means forincreasing the rate of deionization, and hence the more rapidextinguishment of the arc, is to bring the surfaces of Solids 25 closeto the arc in a confined space so that ions may collect thereon andvrecombine there.-
Moreover, there seems to be a great difference p in the effect of thesesurfaces, depending upon whether the surfaces are refractory, or whether30 under the heat of the arc, the surfaces are decomposed givingofilarge quantities of gas. In
the latter case, under proper conditions much higher voltage and higherpower circuits can be interrupted. The increased effectiveness of de- 35composing walls is believed to be due to the rapid evolution of gas; andthe turbulence introduced into the confined are 'by the rapidintermixing of freshly generated un-ionized gas is believed to be anextremely effective means for causing rapid 40 deionization at currentzero.
Tests have shown that, if horn fiber or other organic matter is placedadjacent the are, it will be decomposed; giving ofi relatively largepercentages of hydrogen and carbon monoxide, and a 5 small percentage ofhydrocarbons, which .are particularly eflicacious in the rapiddeionization of the arc and hence its rapid extinguishment.
A great many electrical and mechanical devices have been tried with moreor less success to em- 50 body the foregoing principles in circuitbreakers for interrupting circuits under load. In the main, thesedevices have been too costly to permit being used in any but the mostexpensive installations.
With the foregoing in mind, the present inven- 55 tion seeks to providein a circuit breaker an economical construction embodying the aboveprincipies, and which is so arranged as to not only perform the functionof a circuit breaker to open a circuit under load, but may also be usedas a disconnecting switch to effect a visual gap in the 5 circuit.
A further object of the invention resides in the provision of animproved circuit breaker of the dry-type, thereby lessening explosiveand fire hazards to life and property. I
It is a further object of the invention to provide a circuit breaker orsimple and relatively inexpensive construction and at the same time acircuit breaker having excellent arc extinguishing characteristics. Y
A further object of the invention is to provide a circuit breaker havingparts which are arranged and operative in such a; manner as to enablethe production of a circuit breaker of mate- I rially smaller physicalsize forv a given capacity, than has heretofore been possible.
It is also an object of the hereindescribed invention to provide acircuit breaker of such construction and arrangement of parts as toenable its being embodied into a plurality of arrangements, such forexample, as a single or multiple break circuit breaker, and also invarious combinations with fuses, etc.
In accordance with the general features of the present invention, it isproposed to provide an elongated tube of organic material such as hornfiber within which there is mounted a. contact rod of such size as toprovide a space between the exterior surface of the rod and the interiorsurface of the tube. Contacts are respectively associated with thecontact rod and the tube so that when the rod is moved axially relativeto the tube, the contacts may be moved into or out of engagement. Thereis also provided an extension to the contact rod, this extension beingsimilarly formed of organic'material such as'horn fiber. The extensionis of such lengthv that when the rod is moved in a direction to separatethe contacts, the extension serves as a follower to maintain a constantpredetermined cross-sectional area in the spacewithin the tubebetweenthe follower and the inner wall of the tube. The contacts justmentioned are mounted adjacent oneend ofthe fiber tube so that theresistance to the movement of the arc gases formed by the separation ofthe contacts would be greater in one direction than it would be 'in theother direction as they move through the space between the tube and therod or extension thereon. Due to the fact that there is less resistanceto movement of the arc gases toward the follower or extension of therod, the arc will move in that direction and in so doing will be incontact with the organic material of the tube and also the organicmaterial of the follower or rod extension. Under the heat of the arc,the fiber or other organic material will be decomposed and emitun-ionized gases which will act to assist deionization of the arc andhence its extinguishment. The turbulence caused by the rapid generationof these gases in the confined space also contributes to this result.
As an additional feature of the invention, the rod extension may beextended into a closed container or chamber in communication with theassociated end of the fiber tube. Due to the movement of the rodextension, in opening the contacts, the extension acts as a piston andtends to create decreasedpressurewithin the chamber, this decreasedpressure operating to draw the are through the space between the rodextension and the fiber tube, in a direction toward the. chamher. Thischamber also serves as a relief for the expansion of the gases whichhave been emitted irom the decomposition, of the material in the tubeand contact rod extension.
Other objects and features of this invention will more fully appear fromthe following detail description taken in connection with theaccompanying drawings, which illustrate several embodiments thereof, andin which:
Figure 1 is an enlarged fragmentary vertical sectional view showing thecontacts and associated parts of a circuit breaker embodying theprinciples of the present invention;
Figure 2 is an enlarged transverse fragmentary sectional view of thesame, taken substantially on line IIII of Figure 1;
Figure 3 is an enlarged fragmentary vertical sectional view showing theconstruction of one of 'the terminals of a single break circuit breakerembodying the present invention;
Figure 4 is a view in elevation showing a modifled arrangement 01' thepresent invention, wherein the circuit breaker is mounted in combinationwith a fuse;
Figure 5 is a side view of the same;
Figure 6 is another modified arrangement showing a single break circuitbreaker of the hereindescribed type mounted so as to form a hingedswitch blade which may be opened to effect a visible break in thecircuit;
Figure 7 is an enlarged fragmentary detail plan view showing the uppercontact of the switch blade;
Figure 8 is another modified arrangement wherein the present inventionis embodied in a double break circuit breaker;
Figure 9 is an alternative arrangement of Figure 8, to efiect a visiblebreak in the circuit;
Figure 10 is a detail view showing the contact rod utilized inconnection with the circuit breaker of Figures 8 and 9; and
Figure 11 is a fragmentary view partly in crosssection showing amodified lower end for the contact rod to facilitate improved operationof the circuit breaker.
As shown on the drawings:
Referring to the drawings, a preferred form of the present invention isshown in Figures 1, 2 and 3 as a single break circuit breaker. This formof the invention comprises in general a contact assembly, generallyindicated at A for initially interrupting the power circuit; and aterminal construction as generally indicated at B for completing theinterruption of the electrical circuit after the load interruptingcontacts have opened. v
Thecontact assembly A comprises a casting I! having one end of acylindrical'tube ii of organic material such as horn fiber supportedtherein. At one side, the casting I5 is shaped to define a chamber Hwhich houses a'portion of the contact mechanism. One wall of the chamberI1 is in the form of aplate or cover "Which may be secured in positionin any appropriate manner, but is preferably removably secured to enableaccess to'the contact mechanism. This wall is centrally provided with ascrew stud I! having a shank portion 20 which serves as a guide for acontact casting 2| having a stem portion 22 which is centrally aperturedat 23 to receive the shank 20 therein and permit axial movement of thecontact casting on the shank.
The contact casting 2! is mechanically and electrically connected to thewall I. by a pinrality of flexible spring connectors 24 of approximatelyhorseshoe shape. The inner face of the contact casting has acylindrical'extenslon 25, preferably of circular cross-section, axiallyalined with the stem 22 and slidably received in a lateral opening 26 inthe wall of the tube It. A contact member 21 of any appropriate materialis secured, by soldering or the like, to the inner end of the extension25 and is normally pressed towards the center of the tube 16 by a spring24 that surrounds the stem 22 and bears against the wall I! and theouter face of the contact casting 2|.
Diametrically opposite the opening 2.,is a similar opening 29a in thetube I for receiving a contact member 30 which is axially movablerelative to the opening 29a by an adjusting screw 3| to which it issecured and which is in threaded engagement with the casting ll. I
Within the tube l6, there is disposed a rod 32 of conducting material.At the upper end of this rod is an axially extending bolt 33 threaded atboth, ends, one end of this bolt being secured in the upper end of rod32 and the other end oi this bolt extending into and threadedly engagingan elongated member 34 of fibrous or other organic material, which formsan extension for the rod 32. "Clampingly secured between the extension34 and the rod 32 by means of the bolt 33 is an annular contact member35 which may also be soldered to the rod 32 in order to reduce theelectrical resistance of the joint. It will be noted that the rod 32,contact member I! and the extension 34 are of the same diameter so as tovirtually form a continuous rod, .and that the diameter is such that alimited clearance or annular shaped space is secured between the outersurface of the rod assembly and the inner surface of the tube Hi.
The extension 34 is of such length that when the contact 35 is engagedby the contacts 21 and 30. the extension extends beyond the upper end ofthe tube ii. The upper end of this extension may be of frusto-conicalshape as shown in Figure 1. It will be noted that the end faces of thecontact members 21 and 3| are not arcuate to conform to the cylindricalsurface of the movable concentrically surrounding the extension 24 tendto straighten out with a temperature rice. I I
and forming an extension of the tube I is an exteriorly threaded tubularmember 35 of metallic construction which is secured into the casting l5as by welding at 31 and provided with a plurality of slots 36a at itsouter, end. The member 36 is closed by means of a cap 33 so as to forma' chamber 39 which is in communication with the clearance space betweenthe rod assembly and the interior surface of the tube IS. The cap 38 isof larger diameter than the tube 36 and at its lower end is in threadedengagement with the exteriorly threaded surface of the tube .36, thisarrangement enabling variation of the size of the chamber 39 in a givensize unit to meet different operating conditions. While it has beenfound'that the ratio of the total volume of chamber 39 to the volumedisplaced by the rod 34, when the breaker is in the fully closedposition, may be varied without marked effect on the performance of thebreaker, it is preferable to use a ratio lying between 2 to 1 and 3 to 1for breakers that are to be used on a circuit carryf ing up toapproximately 1200 amperes at 5000 1 small size willquickly extinguishthe arc.
volts. The metallic wall of this chamber will, by quickly condensing thegases, serve to dissipate the heat of the arc.
In the arrangement described above, it will be apparent that in order toopen the contacts, the rod assembly may be moved downwardly and thatduring this movement the extension 34 serves as a follower to maintainthe arcing space, that is, the space between .the rod assembly and theinterior surface of the tube H5 at a constant value. Likewise, as theextension 34 moves out of the chamber 39, there is a decrease in thepressure within this chamber which acts to draw the are caused by thebreaking of the contacts into the arcing space where it is confinedbetween surfaces of fibrous or other organic material. Although I havedisclosed this means of causing the arc to travel upwardly relative tothe tube I6 from the contacts, the arc would travel in this directioneven though there were no decrease of pressure in the chamber 39 aswould be the case when the tubular member is open or not provided with acap 33. This movement of the arc would take place for the reason thatthe length of the arcing space belowthe contacts is of greater extentthan the arcing space above the contacts, in which case the latter wouldoffer less resistance to the arc and the arc would naturally take thiscourse.
As indicated above, the invention provides a dry type of circuit breakerwhich may be used in place of oil switcher and circuit breakers to opentransmission lines carrying heavy currents at high voltages. It isimpossible to prevent arcing when contacts are separated to interruptcurrent flow of the order of hundreds of amperes in, for example, a 5000volt transmission line, butcircult breakers of the described.costruction and of The surfaces of the tube and follower which aresubjected to the arc will be decomposed and emit gases which areeffective in setting up a violent turbulence and in causing deionizationof the arc and hence its extin'guishment.
Immediately below the contact 21, there is pro- 'vided in the wall ofthe tube IS a passageway M which connects the arcing space with thechamber 11. Where metal contacts are used, any
globules of metal which are formed when the contacts are separated underload, will be driven through this passageway into the otherwise closed.chamber 11 where they may solidify without interfering with the movementof the rod assembly.
Line connections, it will be obvious, may be made to any portion of thecasting 15. In the present instance I have shown the plate 18 beingextended to form a terminal generally indicated at 4|. The electricalcircuit would therefore be from the terminal 4| to the plate 18, theflexible connector 24 to the contact casting 2|, and also through theadjusting screw 31 to contact and thence from the contacts 21 and 30 tocontact 35 and the rod 32.
The load breaking contact unit is easily embodied in a variety ofarrangements. In the preferred and'more simple arrangement of theinvention, the circuit is completed, as shown in Figure 3, through theterminal B. This terminal comprises a cap 42 which is threadedly securedto the lower end of tube l6 and carries a lug 43 to facilitate making aline connection thereto. This cap is centrally apertured as shown at 44so as to enable the rod 32 to extend therethrough. Spring contacts 45are secured at one end in the cap 42 and are so arranged that the freeends thereof frictionally engage the rod 32 to thereby complete theelectrical circuit from the rod 32 to the cap 42 and lug 43, which isconnected to the line.
The rod 32 may be actuated by anyappropriate power means or, asdisclosed herein, the rod may be fitted at its lower end with a casting46 having a portion defining .an opening 41 for receiving an operatinghook, whereby the rod may be manually operated. The casting 46 is alsoshaped at its upper end to form a socket 48 to receive the free ends ofthe contact springs 45. The sides of this socket closely engage thesides of the springs 45 and serve to press them firmly against thecontact rod 32, thus preventingarcing. Moreover, the contact springs dueto their abutment with the bottom of the socket 43 also serve as a stopto limit the upward'movement of the rod assembly. If desired, a shield49 may be disposed around the contact springs and supported from the cap42 in any appropriate manner.
fuse 50 of the removable hinged type. The lower 3 end of the fuseelement is provided with a casting 51 which forms a terminal forengaging with contact clips 52. This terminal also forms one ofthe'hinge members and is provided with trunnions 53 which are adapted tobe removably supported in spaced bracket members 54-54. For effecting aremovable support for the fuse, the brackets are respectively providedwith openings 55 which are in communication with a U-shaped slot so thatthe trunnions 53 may be inserted in the openings 55 and moved into theU-shaped slot.
The upper end of the fuse carries a terminal 56 which is adapted toengage spring clips 51 sup- 90 having one end fixedly secured by a nutandbolt connection 9| to the insulator. This bolt and nut connectionalso secures a terminal lug front of the casting 63, whereby theoperator. 4c
that the trunnions 53 62 by means of which aline connection may be madeto the fuse element.
For disengaging the latch spring 69 so that the fuse maybe swung out ofcontact with the spring contact clip 51, there is provided a casting 63which is pivoted at and adapted to be engaged by an operating hook. Thiscasting has an arm 65 which extends beneath the latch spring so thatwhen the casting is engaged by the operating hook and a downward forceis exerted, the arm'65will raise the latch spring 60 so as to releasethe fuse and enable the operator to swing it out of contact with thespring clip 51. If desired, the fuse, after it has beenopened, may betotally. disengaged by moving it upwardly so are released from thebracket 54. 1
The lower terminal of the fuse is electrically connected through a stripof current conducting material 66 to the casting l5 of the circuitbreaker so that the complete circuit through the device would be fromlug 62 through contacts 51, the fuse, contacts 52, connector 66, castingl5, contacts 2'! and 30, contacts 35, and thence through rod 32 (Figure1), spring contacts 45 to lug 43.
In the foregoing arrangement, it would be very undesirable to open thefuse until after the circuit breaker contacts have been actuated to openthe load circuit. In order to prevent improper sequence of operation,the circuit breaker and fuse are interlocked so as to make it compulsoryto first open the circuit breaker before it is possible to open thefuse.
This is accomplished by mounting a barrier or shield 67 for pivotalmovement about a pivot member 68 supported at the upper end of thecircuit breaker on tube 38. This barrier is so disposed that when inlowered position it lies in cannot insert the hook therein to disengagethe latch 80 and thereby enable the fuse to be swung to open position.
It will be observed that the upper end of the tube 36 is, in thisinstance, left open so as to enable the extension 34 of the rod assemblyto project outwardly thereof when the circuit breaker is closed. In thisdesign the tube 36 is an integral extension of the tube 56, and in orderto produce, in this open ended design, somewhat the same gas confiningeffect as is produced in the closed-end design, the clearance betweenthe rod 3% and tube 36 is made as small as the clearance between the rod32 and the tube iii. For automatically moving the barrier to effectiveand ineffective positions in response to the closing and opening of thecircuit breaker, an arm 69 is secured to the barrier so as to extend atsubstantially right angles thereto and is so disposed as to be engagedby the extension 34 when the contacts of the circuit breaker are closed.Engagemerit-of this arm by the extension forces the bar-' rier to assumeeffective position to prevent opening of the fuse by the operator.Assuming that the circuit breaker is opened by pulling down on the rodassembly, the extension 34 is, moved downwardly and enables the rotationof the arm 69 and barrier 61 in a counter-clockwise directionunder theinfluence of a spring 10 to the position shown in dotted lines in Figure4 In this position of the barrier or shield, the fuse may be swung toopen position. 7
Another 'modification of the preferred-form of the hereindescribedinvention is disclosed in Figure 6, wherein the circuit breakerdisclosed 15 in Figures 1,2 and 3 is hingedly mounted for operation as aswitch blade so as to form a. visible break in the circuit.modification, an interlocking arrangement is provided which preventsopening the blade until the circuit breaker has been opened.Corresponding parts have been indicated by like numerals as heretoforereferred to in the description. The circuit breaker is hinged at itslower 'end by providing a pivot H on the cap 42, this cap beingidentical with the cap shown in Figure 3, except for the addition of thepivot. The entire assembly is made removable by supporting the pivotends in aligned slots Ha-Ha of a bracket 12 which is secured in theusual manner to an insulating support 73. The bracket 12 also serves asan electrical connection from the cap 42 to the associated circuitconnection lead. As shown in Figure 9 this modification may alternatively arranged toform a visible break case would be from the casting I5 of the upper bythe simple expedient of forming an opening I or in other wordsdiscontinuing a portio'rTof'tli tube l5 lying between the upper andlower contact unit. In the alternative arrangement, when the rod isentirely withdrawn, a visible break is farmed between the contact units.
:In Figure 11, an alternative arrangement is shown for the member to beengaged by the switch hook in opening the breaker. In this arrangementinstead of having a rigid connection with the rod 32, the sleeve 86 isprovided within which there is reciprocably mounted a pull member 81which is arranged at its lower end with an opening 88 for engagement bya switch hook. The upper end of the member 81 is connected 'to one endof a coil spring 89 which is anchored at its other end to the rod 32.This arrangement,
moved with slower movement to withdraw the same from the breaker. Thisarrangement has been found to be much more effective than where the rodis initially moved by a direct pull with the switch hook.
From actual tests which have been made upon circuit breakers embodyingthe hereindescribed invention, it has been found that the best resultsare attained when the difference between the outside diameter of the rod32 and the interlor diameter of the tube ii are between of an inch anda; of an inch. With the lower limit, small metal particles thrown oilfrom the con tact under the influence of the arc will not besuiliciently large to cause the rod to jam. Of course, most of theseparticles will be ejected through the opening 40, but some of them mayremain in the space between the rod and the surrounding tube. If thelimit is made greater than a l of an inch there will be a tendency forthe ionized gases to be discharged through the lower end of the tube It.
From the foregoing description, it will be apparent that this inventionprovides a novel circuit breaker of the dry type, which has excellentarc extinguishing characteristics, which may also be utilized not onlyas a circuit breaker but as a disconnecting device; which is economicalto construct and which may be embodied in a variety of combinations.
Now, it is of course to be understood that although I have described indetail several embodiments of my invention, the invention is not to bethus limited but only insofar as defined by the scope and spirit of theappended claims.
I claim as my invention:
1. A circuit breaker comprising a tubular member of organic material, arod of similar material mounted for longitudinal movement within saidmember and having its surface inwardly.
spaced from the inner wall of said member to ,form an arc-extinguishingchamber, cooperative electrical contacts respectively associated withsaid member and rod and adapted to open and close an electrical circuitin response to the movement of said rod, and means responsive to acircuit-opening movement of said rod for decreasing pressure at one endof said tube.
2. A circuit breaker of the character described comprising a cylindricalchamber including tubular member of organic material adapted to emit anarc extinguishing medium under the influence of anelectric ate, ametallic rod mounted for longitudinal movement within said tubularmember, cooperable contacts respectively. associated with said rod. andmember, the
contact associated with the tubular member being located intermediatethe ends of said chamber, and a smooth walled cylindrical element ofmaterial similar to that forming the tubular member extending from andmovable simultaneously with the rod, said element being spaced from theinner surface of said tubular member, whereby an are formed by theseparation of said contacts will impinge upon the opposed surfaces oforganic material of said tubular member and rodlike element. v l
3. A circuit interrupting device of the character described comprisingrelatively movable contacts, means contiguous said contacts defining anarcing space of constant volume and adapted under the influence of anarc to emit an arc extinguishing medium, means forming a closedexpansion chamber for said medium in communication with said arcingspace, and means whereby the volume of said chamber may be varied toadopt the device for different. conditions of operation.
4. A circuit breaker comprising a pair of contacts, means for eil'ectingrelative movement of said contacts to engage and alternatively toseparate the same, means forming an annular arc extinguishing chamberwhich extends in opposite directions from said contacts and retains asubstantially constant cross-section during relative movement of saidcontacts, said chamber metal member in axial alinement, arod ofinsulating material mounted for reciprocating movement in said tubularmembers, contact means carried by said member of insulating material atthe end thereof adjacent the metal member, and contact means on andspaced from the ends of said rod, said rod having a continuouscylindrical outer surface of less diameter than the bore of .saidtubular members to provide an .arc extinguishing chamber of annularcross-section.
6. A circuit breaker as claimed in claim 5, wherein said rod has adiameter of the order of 3 2 inch less than the bore of the tubularmember.
7. A circuit breaker as claimed in claim 5, wherein said first contactmeans comprises a metallic casing into which one end of said tubularmember is secured, a contact movably supported by said casing andextending into a transverse bore in said tubular member, and springmeans pressing said contact towards the interior of the center of saidtubular member.
8. In a circuit breaker, a tube of insulating material, alinedtransverse openings through said tube, contacts mounted in said openingsand positioned with respect to the portion oi the contact that isengaged by said contact memher. i i
10. A circuit breaker comprising a tubular member of insulatingmaterial, contact means extending into the bore of said member at aregion spaced from the ends oi said member, a rod of insulating materialextending into said tubular member, contact means on said rod forcooperation with the contact means of said tubular member, said rodbeingof less diameter than the bore of said tubular member and including anextension movable into transverse alinement with the contact means ofsaid tubular member when the rod is displaced to separate the re-.
spective contact means, and a vent openingilatorally through the wall ofsaid tubular member adjacent the contact means thereof, said ventopening being positioned at that side of said contact means towardswhich the contact means of said rod is moved to separate the respectivecontact means.
-11. A circuit breaker comprising relatively separable contacts,wall-forming means contiguous said contacts defining an arcing space ofconstant cross-section extending in opposite di= rections from saidcontacts when engaged and during separation thereof, and means forpositively reducing the pressure at one end of said space upon theseparation of said contacts to elongate the resultant arc and extend thesame into said space, said wall-forming means comprising materialadapted when subjected to an arc to evolve an arc extinguishing medium.
12. A circuit breaker comprising a tubular member of insulating materialcapable of vaporizing to produce an arc-extinguishing medium,
terminal contact means spaced from the ends of mg section having asmooth cylindrical wall spaced from the inner wall of said member by anannular gap having a radial length of the order of a inch. t
13. A circuit breaker as claimed in claim 12, 1
wherein said tubularmember has a restricted opening extending laterallythrough the wall thereof adjacent said terminal contact means and at theside thereof where an arc is formed when the electrical connection isbroken.
GEORGE A. BEAmi-IEVVS.
| 34,365 |
https://openalex.org/W4255286779
|
OpenAlex
|
Open Science
|
CC-By
| 2,020 |
Reading and Writing
|
Alastair H. Leyland
|
English
|
Spoken
| 9,424 | 12,962 |
© The Author(s) 2020
A. H. Leyland, P. P. Groenewegen, Multilevel Modelling for Public Health
and Health Services Research, https://doi.org/10.1007/978-3-030-34801-4_10 Chapter 10
Reading and Writing Abstract This chapter focuses on two issues. Firstly, we consider the critical
reading of research articles that use MLA, and secondly we explore the standards
for writing up research that has used MLA. Critical reading is important both for
people who do not regularly use MLA themselves and for those who are regular
users. The irregular users need to be able to assess the methodology of studies using
MLA, whilst regular users may find inspiration for new ways and strategies of data
analysis and for ways to write up and present their own research, particularly the
methods and results sections. So the reading and writing parts of this chapter are
related. When a method of analysis is used that is relatively new to its field, there are
no clear standards as to what should be included in the methods section or how the
tables might be laid out. Keywords Multilevel analysis · Critical reading · Reporting Keywords Multilevel analysis · Critical reading · Reporting Keywords Multilevel analysis · Critical reading · Reporting Communication is an important part of the research process. Research results are
important in themselves, but will only be used if they are communicated to the
relevant audiences. In public health and health services research, we usually have
two types of audiences: the research community and the users of research in policy
and practice (Bensing et al. 2003). The ‘end users’ of research probably will not read the research papers themselves,
but intermediaries certainly will. Such intermediaries might be health scientists and
epidemiologists who work in policy development positions within (public) health
authorities. It is crucial that we as researchers should write up our research in a way
that makes our methodological and statistical approach as clear as possible. The research community enters the process when we submit a paper for publica-
tion. Some reviewers will be selected for their specialised statistical knowledge,
whilst others will be selected for their substantive knowledge about the subject of the
research. We cannot guarantee that the latter will be completely up-to-date with
MLA. We therefore need to write about our approach and to present our results in a
way that is understandable to many audiences. 151 152 10
Reading and Writing 10
Reading and Writing Critical Reading An increasing number of research articles in the area of public health and health
services research are being published that use multilevel analysis. We have simply
counted the number of articles that used the term ‘multilevel’ in a Pubmed search of
the journals Social Science and Medicine, Journal Epidemiology and Community
Health and European Journal of Public Health (see Fig. 10.1). This simple search
may have missed some articles that used slightly different terminology such as
‘hierarchical’ instead of ‘multilevel’. However, the picture is clear and that is one
of a huge increase in the use of multilevel analysis in our area of research: from
5 articles in 1998 to 65 articles in 2015 in just these three journals. In the past the alternatives to multilevel analysis that we described in Chap. 3
were often used. However, it is now rare to see a published paper that analyses
clustered data and does not use multilevel analysis. In fact, as early as 1998 we came
across an article the authors of which—in a foot note—said that they initially
submitted a ‘naïve’ (as they called it themselves) single-level analysis, but were
asked by the reviewers to repeat the analysis using MLA (Matteson et al. 1998). Given that currently so many research articles use MLA, it is important that
researchers, even if they do not apply MLA themselves, are able to understand and
critically appraise the work of others. When reading an article, we are inclined to
focus more on the substantive results and less on the methodology, to the extent that
we sometimes take the methodology for granted and skip the methods section. When
relatively new and complicated methods are used, and we can still count MLA as
such, the tendency to skip the methods section might be even stronger. However, it is
also more dangerous to do so when the methods are new (Bingenheimer 2005). With
new methods there will be no clear standards for reporting research results (see later
in this chapter), researchers may make mistakes or debatable choices in their
methodology, and reviewers are not always able to judge exactly what was done. It is therefore important for researchers and for users of research results to develop a
way to read critically research articles that use MLA. What Is the Research Question? It might seem superfluous to draw attention to the research question. It is not, for two
reasons. Firstly, we still occasionally stumble across published research articles that
have no clear formulation of a research question or hypothesis at all. That means that
as a reader you have to reconstruct the question yourself after reading the paper. Secondly, the research question determines the choice of method. It is therefore
important to have a clear picture of what question the authors want to answer. Increasingly researchers formulate an objective or aim instead of a research
question. Usually an objective or aim will be less specific. Verstappen et al. (2005) formulated their objective in the abstract as ‘To describe the variation in
the numbers of imaging investigations requested by general practitioners (GPs) and
to find likely explanations for this variation’. In the introduction to the article they
are a bit more specific without, however, making clear what the ‘likely explanations’
might be. The present study measured the variation of imaging investigations among a large group of
GPs and investigated the influence of professional and contextual determinants at three
levels: the individual GP, local GP groups, and the region. Compare this with an example of an explicit research question, as formulated by
Turrell et al. (2007): What is the relation between area-level socioeconomic disadvantage and mortality before
and after adjusting for within area variation in individual level occupation? Does the
relationship between mortality and individual level occupation differ by area level disad-
vantage? What is the variation in mortality at different geographical levels? Research questions also differ regarding how specific they are. Some research
questions ask whether there is a relationship between two variables, without spec-
ifying the direction. Others ask whether a particular relationship will be found. These
are basically hypotheses formulated as research questions. An example of this is a
study by Van Stam et al. (2014) on Sexual and Reproductive Health (SRH). They
tested the hypothesis that the relationship between educational attainment and SRH
differed according to the level of globalisation of the region where the subjects live
(effect moderation). Hence, their research question can also be formulated as: Is this
hypothesis confirmed or refuted in our data? The combination of a research objective and a concrete hypothesis is also specific
enough to guide the remainder of an article. For example, Agyemang et al. Critical Reading To help new users to read research articles critically and to understand the
multilevel design employed, we have formulated a number of questions. You can Fig. 10.1 Number of
articles containing the term
‘multilevel’ in a Pubmed
search of the journals Social
Science and Medicine,
Journal Epidemiology and
Community Health and
European Journal of Public
Health 153 Critical Reading use these questions when reading and abstracting research articles. We will briefly
elucidate them. use these questions when reading and abstracting research articles. We will briefly
elucidate them. What Is the Research Question? (2009)
formulated as their objective ‘to assess the effect of neighbourhood income and
unemployment/social security benefit (deprivation) on pregnancy outcomes’. Their
hypothesis was ‘that low neighbourhood income and deprivation [are] associated
with poor pregnancy outcomes after adjustment for individual-level characteristics’. 154 10
Reading and Writing In a general analysis of research questions, Mayo et al. (2013) discussed the use
of language, suggesting that words such as ‘explore’ and ‘describe’ should be
avoided when formulating a research question because of the difficulty such words
pose in determining whether or not the question has been answered. They stress how
the correct formulation of the research question will assist the researcher in the
choice of the optimal design for the study. In many cases the multilevel nature of the problem is already indicated by the
research question, such as when the question is about the relationship between
variables at different levels. An example is the research question posed by Jat
et al. (2011): what are the effects of individual, community and district level
characteristics on the utilisation of maternal health services? Which Levels Can Be Distinguished Theoretically? It is important to be aware of the difference between the levels that one would like to
be able to distinguish in an ideal situation and the reality with which one actually has
to work. If the research question is to explain differences between hospitals in
patients’ judgements about quality of care, the most obvious levels are probably
patients at the lower level and hospitals at the higher level. However, if we analyse
the research problem in terms of the actors involved and the opportunities and
constraints they experience (see Chap. 2), we might come to the conclusion that
the physician responsible for the treatment and the ward in which the patients are
treated are likely to be the drivers of patients’ experiences. That might imply a three-
level model of patients, physicians and hospitals, or possibly four levels with
physicians nested within wards (or a cross-classification of physicians and wards,
depending on the hospital structure). Often the introduction of an article uses a theoretical notion of a relevant higher-
level unit, connected to a mechanism that relates this context to individual behaviour
or outcomes. The ‘data and methods’ section then moves to an operational definition
of higher-level units, often chosen for practical reasons of data availability. This
pragmatically chosen definition of the higher-level units might be different from the
units implied by the theoretical reasoning in the introduction of the article. The
results are therefore based on units that do not correspond to what was intended and
this may lead to less clear effects. Returning to the previous example regarding
patients’ judgements of quality of care, if the physician is the true driver of the
patients’ experiences but this level is unobservable, then the extent to which there
will be differences between hospitals will depend on the degree to which physicians
assessed as providing high or low quality cluster within the same hospitals. Often in
the discussion the emphasis moves back from the pragmatic context of the available
data that were used in the analysis, to the theoretical notions from the introduction. We illustrate this with research examples that have studied the effect of
neighbourhood characteristics on health or health behaviour. Ball et al. (2007)
moved from ‘local neighbourhoods’ in the abstract to suburbs of between 4000 155 Critical Reading and 30,000 inhabitants in the methods section, and back to neighbourhoods in the
last paragraph of the discussion. Which Levels Can Be Distinguished Theoretically? In a study on obesity in New York City, Black et al. (2010) used United Hospital Funds areas as neighbourhoods. NYC has 34 of these
areal units. Given the population of the city (over eight million people), these must
be huge areas and it is doubtful that we could really call them neighbourhoods. The
article gives the average sample size per area, but not the number of inhabitants. Sellström et al. (2008) studied environmental influences on smoking during preg-
nancy. Citing the importance of peer groups in adolescent smoking, they state that
social influences are apparently important in explaining why pregnant women keep
on smoking. The actual units they use in their analysis to capture these social
influences are neighbourhoods with between 4000 and 10,000 inhabitants. This is
quite far from the idea of peer group influences that they brought up in their
theoretical reasoning. Another example of the connection between the theoretical reasoning in the
introduction of an article and the definition of spatial units in the methods section
is provided in a paper by Karvonen et al. (2008) on smoking patterns. They state: ‘An
ideal spatial context for an exploration of smoking patterns by small area would
comprise a reasonably stable and homogeneous population with relatively low
variation of disadvantage’. Subsequently in the methods section, they rationalise
their use of 107 neighbourhoods in Helsinki: ‘These areas are of the size that most
residents could walk across them in 15–20 min and have an average population of
4000’. These examples—and there are many more—illustrate the importance of
theorising the contexts that are being used as higher-level units and of being aware
of the fact that there is often a gap between the theoretically interesting units and
what is actually available or used. This gap may be part of the explanation for the
finding that the influences of contextual variables on individual outcomes are
sometimes weak, and it is important that any such gap should be acknowledged in
the paper. What Is the Structure of the Actual Data Used? Apart from the issue discussed in the previous section, there are often reasons why
there is a discrepancy between the levels that would be relevant on theoretical
grounds and those actually used. One reason is that information may be lacking on
some relevant levels. In the example of patients’ judgements about quality of hospital care that we gave
at the end of Chap. 2, the researchers might for pragmatic reasons have chosen
hospitals to be their higher level. For some indicators of quality of care this may be
appropriate (such as those that reflect hospital policies) but for others—think of
whether the treatment by hospital personnel is polite—the more appropriate level
might be wards, teams or even individual nurses and doctors. One reason to use only 156 10
Reading and Writing the hospital level is that there is no information available about the levels in between
(Hekkert et al. 2009; Sixma et al. 2009). Another reason might be that the numbers at a certain level are too small. The
extreme case is when there is only one unit at one level within each higher-level unit. The household might be a relevant level from a theoretical point of view, but if only
one member of each household has been interviewed then the household and
individual levels are indistinguishable. In the example dataset used in the tutorial
in Chap. 12, the authors collapsed four levels into two for pragmatic reasons,
concentrating on patients and GPs but leaving out the practice level (most GPs
were single-handed) and the episode of care level (most patients had only one
episode of care during the study period). Researchers might also simplify their
data structure by choosing only one observation from a (theoretically larger) dataset. For example, Jat et al. (2011), in their study of environmental influences on
pregnancy outcomes, only chose the last pregnancy of each woman in their sample. In so doing the level of the women who gave birth and the level of the newborn
infants collapsed into one level. Another example is Van Berkestijn et al. (1999) who
only used the first consultation in each episode of care. This meant that they could
restrict their model to just two levels: the GPs in their study and the episode of care
which coincides with the consultation. What Is the Structure of the Actual Data Used? A good reason to opt for fewer levels than are actually available is that this may
make the analysis less complicated. It is, however, important to be aware that leaving
out a higher level is less problematic than leaving out an intermediate level. In the
former case, the variation at the omitted level is simply added to that at the new
highest level. When an intermediate level is omitted, the variation will in general be
split between the higher and lower levels (see Chap. 6 and also the section on
variation at different levels later in this chapter). Whatever the reason for omitting levels, it is important to be aware of the
difference between the levels that were theoretically postulated and the levels that
were actually used. It is elucidative to draw a simple diagram of the levels and the
numbers used at all levels. Chapter 4 on multilevel data structures gives examples of
such diagrams. It is also important to consider the numbers at the different levels and the average
number of lower-level units per higher-level unit. The number of higher-level units
is sometimes quite small. As we pointed out in Chap. 3, the higher-level units are
treated as a sample and there should be sufficient numbers of units at this level for it
to make sense to estimate an average and variance. The number of units is also
important if authors want to include characteristics of these units in their analysis. If
so, the numbers should be sufficient to estimate the coefficients associated with these
characteristics in addition to the mean and variance. We have come across several
examples where the authors (and reviewers) were apparently not aware of this. Some
of these studies are international comparisons with the countries as higher-level units
and a characterisation of welfare state regimes in the form of a set of dummy
variables as independent variables. Even though the welfare state regime might be
seen as a single concept, it is usually operationalised as a series of dummy variables. Eikemo et al. (2008) included 23 countries, their higher-level units, but added Critical Reading 157 4 dummy variables at this level. Witvliet et al. (2012) had 46 countries and 6 dummy
variables for welfare state regimes. And Rathmann et al. (2015) analysed data for
27 countries and included 4 dummy variables indicating welfare state typology. What Is the Structure of the Actual Data Used? The problem of trying to include more contextual variables than the data can
support is, however, not restricted to the analysis of welfare states. Friele et al. (2006) had one analysis with 80 hospitals and another with 40 hospitals which
included 7 independent variables at the hospital level. With a simple rule of thumb of
10 cases for each independent variable, the first analysis was reasonable but not the
second. For the estimation of contextual effects, the number of lower-level units
becomes irrelevant; the authors were attempting to estimate 9 quantities (a mean,
7 regression coefficients and a variance) from 40 contextual observations. Further
examples include Huizing et al. (2007) who had 15 wards in nursing homes and
included 6 independent variables at this level, and Nicholson et al. (2009) who
included four independent contextual variables with just 22 higher-level units. What Statistical Model Was Used? Most statistical models that can be run as single-level analysis can also be used in
MLA (see Chap. 4). Questioning what statistical model was used and whether this
was appropriate is therefore as relevant when reading a multilevel article as when
reading about a single-level analysis. If the authors specify the algebraic form of
their model in the article or in a technical appendix, a useful check is to see whether
the subscripts correspond to the levels that have been included. To as great an extent as possible (within the space constraints imposed by
journals), the methods section of a paper should provide sufficient information to
enable other researchers to reproduce the analysis reported in an article. This
includes the type of model (linear, logistic, Poisson, etc.), details of the levels used
(including the specification of any which are cross-classified or multiple member-
ship), the variables included in each model in the fixed and random parts (including
interactions), and details of the software and estimation procedures used. Published
descriptions of the model used and estimation techniques are sometimes so brief that
these cannot even be deduced from the software that was used. Some authors have compared their results of MLA with a single-level model. As
we argued in Chap. 3, in cases where the units for whom the outcomes are measured
are nested within higher-level units, MLA is the preferred approach. The examples
provided here illustrate again that using a single-level model in circumstances that
indicate that a multilevel model is appropriate may lead to false conclusions about the
effect of higher-level variables. In Chap. 3, we discussed the example of an interven-
tion study in GP practices (Renders et al. 2001) where the intervention effect was
significant in a single-level (patients) model, but not in a multilevel model. We also
referred to Mauny et al. (2004) who analysed the occurrence of the malaria parasite in
blood samples taken from people living in villages in Madagascar. In the single-level 158 10
Reading and Writing model, they found a significant coefficient for the size of villages which they did not
find in a MLA. This was due to the misestimated precision when the village size was
assigned to all individuals and treated as a series of independent individual-level
observations. A similar example that we have previously mentioned in this chapter is
the article by Matteson et al. (1998). What Was the Modelling Strategy? This relates to the steps that the authors say they are going to take when analysing
their data in order to answer their research question and/or to test their hypotheses. Ideally the modelling strategy should follow on from the research question and
hypotheses. One typical sequence might be to start by examining the variation at
different levels in a null model and reporting the intraclass correlation. The next step
would be to introduce individual-level variables, evaluating the changes in variation
at all levels. A reduction in the higher-level variation at this stage indicates compo-
sitional effects. The next step may then be to introduce higher-level variables and
evaluate the decrease in variation at that level. Of course, the modelling strategy
should reflect the hypotheses that one wants to test. It is important that the modelling strategy is a systematic and logical sequence of
steps and that the modelling strategy as described in the methods section is indeed
executed and reported in the results section. Many research papers do not include a
modelling strategy at all or else report their results in a different order to that
suggested by the strategy. Tables should reflect the modelling strategy as far as
possible; however, it is often not necessary to document every step in the tables. This
might easily lead to large and unclear tables (for example, see the four page
landscape table in Béland et al. 2002). Examples of clear modelling strategies accompanied by results sections that
follow the steps outlined in the methods section include those presented by Van
Yperen and Snijders (2000), Ball et al. (2007) and Merlo et al. (2005). Van Yperen and Snijders studied Karasek’s job demand-control model. The main
hypothesis of this model is that the job stress that workers experience depends on the
interaction between the demands that are made of them and the amount of control
they experience over their own job. Strong demands lead to particularly high levels
of job stress when workers have less control over their work. They test this
hypothesis and look at demand and control both at the individual level and the
group level. Removing the group effects (by including them) means that individual-
level demands and control are then relative to those experienced by co-workers. Their modelling strategy neatly follows the hypotheses. Ball et al. What Statistical Model Was Used? In a footnote they state that, in the single-level
analysis which they initially submitted, more county variables were significant. What Was the Modelling Strategy? studied educational variation in walking for women and whether this
can be explained by intrapersonal and social characteristics and by perceived and Critical Reading 159 objectively assessed facets of the physical environment. Their modelling strategy
consisted of four steps. In the first step, only education was included in the model. In
subsequent steps, environmental variables, social variables and finally personal
variables were added. Merlo and colleagues studied differences between hospitals in neonatal mortality
for low risk and high risk pregnancies against the background of regionalisation and
concentration of services. They used four steps, starting with an empty model; they
then added characteristics of the hospitals where the deliveries took place. In step
3, maternal and delivery characteristics were added. In the final model, these
characteristics were replaced by a propensity score to take confounding by indication
into account. A more specific issue when evaluating the modelling strategy is the completeness
of the individual-level model. This is particularly important in studies of composi-
tion and context and when forming league tables. In studies of context and compo-
sition, the researcher may wish to explore whether variation at the higher or
contextual level remains when relevant individual characteristics have been taken
into account. The range of individual variables available is often quite small,
especially when using routinely collected or register data. In a study on the use of
tranquillizers by Groenewegen et al. (1999), only the age and sex of the users were
known. In a study of the socio-economic determinants of compliance to colorectal
cancer screening (Pornet et al. 2011), the individual model consisted of only age,
sex and insurance type. The risk is then that the clustering of people with, for
example, a low socio-economic status in certain neighbourhoods leads to apparent
neighbourhood-level variation that would have disappeared if socio-economic status
had been measured at the individual level. The completeness of the individual-level model is especially important when
creating ‘league tables’ as a measure of institutional performance. The individual
characteristics then act as a means of correcting for differences in case-mix. With
good case-mix correction, the higher-level residuals reflect, to as great an extent as
possible, the ‘true’ differences between higher-level units such as nursing homes. Patients or their representatives can use that information to inform their choice of
care site (Arling et al. 2007). Does the Paper Report the Intercept Variation at Different
Levels? Does the Paper Report the Intercept Variation at Different
Levels? Sometimes researchers only report fixed effects. In this case, they are apparently
only using MLA in order to have appropriate estimates of the confidence intervals or
other measures of uncertainty around the regression coefficients. This may for
example be the case when the data are collected using a two-stage sample and the
authors want to adjust for that. Nevertheless, it would be interesting to see the extent 160 10
Reading and Writing to which the dependent variable clusters within higher-level units. As we discussed
in Chap. 6, an estimate of the higher-level variance is necessary for power calcula-
tions. We usually obtain these estimates from published research about similar
problems or data sets. However, some of the estimation procedures used (such as
generalised estimating equations—GEE) will only correct the standard errors of the
estimates without explicitly estimating the variance at the different levels. Sometimes the variation is of central importance to the research question at hand;
even if this is not the case, the reporting of variation can be seen as a service to the
academic community because of its potential interest to readers of the article. As
such, the intercept variance should be reported as well as the individual variance,
enabling the reader to calculate the intraclass correlation coefficient if this was not
reported in the article. In some cases the intercept variance is reported for the empty
model, whilst in other cases it is more relevant to report the intercept variation only
after taking into account some individual-level variables. If treatment outcomes in
different hospitals are analysed, and the hospitals differ in composition according to
the age, sex and severity of illness of the patients treated, it might be more relevant to
report the between-hospital variation after these case-mix variables have been taken
into account. If slope variance is also important, this should be reported alongside the covari-
ance between the intercept and the slope. Remember that the variance of the intercept
and the covariance are dependent upon where the slope variable has been centred, so
any non-standard centring (that is if the location has been changed so that a value of
0 on the transformed slope variable does not correspond to a value of 0 on the
original variable) should also be reported as an aid to interpretation. We provided an
introduction to random slopes in Chap. Does the Paper Report the Intercept Variation at Different
Levels? 5 along with a guide to the interpretation of
different patterns of covariance. What Are the Shortcomings and Strong Points of the Article? Try to summarise the points of criticism and try to weigh their consequences for the
value of the results of the analysis that was presented. Try also to identify a number
of positive points from the article you have been reading. The shortcomings are
important in critical reading and they are very important in forming your overall
judgement as to how confident you can be that the results of the study are indeed a
valuable addition to our knowledge. However, the strong points of an article may
help you in improving the formulation of your own research. Writing Up Your Own Research It is impossible to come up with a single form of presentation that will suit all types
of analysis. The information that you need to show depends on your research
question (and this is another reason for considering study design carefully before
starting). Moreover, all general advice about how to write a research paper applies to
papers that report on MLA and this will not be repeated here. Cross-Level Interactions If there is an explicit hypothesis about the interaction between variables at different
levels, this can be tested by introducing a cross-level interaction. In a more explor-
atory analysis or when the hypothesis is about variation in the slopes, one would
estimate the slope variance and the covariance between the slope and the intercept. You will, however, have more power to test for a specific cross-level interaction than
for a random slope. In general, interaction terms are not always easy to interpret. It may be helpful to
illustrate them using a figure. Several nice examples can be found in the published
literature; for example, see any of Turrell et al. (2007), Joshu et al. (2008), Stafford
et al. (2008) and Mohnen et al. (2012). From this last publication, we show the
interaction between neighbourhood social capital (higher level) and household
composition (individual level) on self-rated health (Fig. 10.2). 161 Writing Up Your Own Research 2
1.5
1
0.5
-1
-0.8
-0.6
-0.4
-0.2
0
Neighborhood social capital
Self-rated health (log odds). 0.2
0.4
0.6
0.8
1
0
Fig. 10.2 Interaction of neighbourhood social capital and whether (black line) or not (dashed line)
there are young children in the household on self-rated health (reproduced with permission from
Oxford University Press, the European Journal of Public Health)
Writing Up Your Own Research
161 2
1.5
1
0.5
-1
-0.8
-0.6
-0.4
-0.2
0
Neighborhood social capital
Self-rated health (log odds). 0.2
0.4
0.6
0.8
1
0 Self-rated health (log odds) Neighborhood social capital Fig. 10.2 Interaction of neighbourhood social capital and whether (black line) or not (dashed line)
there are young children in the household on self-rated health (reproduced with permission from
Oxford University Press, the European Journal of Public Health) Fig. 10.2 Interaction of neighbourhood social capital and whether (black line) or not (dashed line
there are young children in the household on self-rated health (reproduced with permission from
Oxford University Press, the European Journal of Public Health) The Introduction or Background Section The introduction or background section of your research paper should contain a
clearly formulated research question—a grammatically well-formed sentence that 162 10
Reading and Writing 10
Reading and Writing ends with a question mark. In the ‘reading’ part of this chapter, we noted the
tendency of some research papers only to state an objective, which is often less
clearly specified than a research question or a hypothesis. ends with a question mark. In the ‘reading’ part of this chapter, we noted the
tendency of some research papers only to state an objective, which is often less
clearly specified than a research question or a hypothesis. Previous literature, where available, should be used to develop your research
question and the hypotheses you intend to test. As an aid to focusing your arguments
when writing the introduction, it is advisable to consider using ‘what is known about
this subject?’ bullet points as required by some journals. It is important to identify
the gaps in current knowledge and not just to tread a well-worn path. Specifically when writing an article using multilevel analysis, the introduction
should contain a theoretical argument as to why different levels or contexts are
relevant to the particular research question. We started Chap. 1 by stressing the
importance of context as an influence on people’s health, well-being, health behav-
iour and healthcare utilisation. This should be reflected in the attention that is given
to discussing the relevant aspects of the context. In some cases the context might
seem self-evident, such as in a study of health outcomes among hospitalised patients. Specifically when writing an article using multilevel analysis, the introduction
should contain a theoretical argument as to why different levels or contexts are
relevant to the particular research question. We started Chap. 1 by stressing the
importance of context as an influence on people’s health, well-being, health behav-
iour and healthcare utilisation. This should be reflected in the attention that is given
to discussing the relevant aspects of the context. In some cases the context might
seem self-evident, such as in a study of health outcomes among hospitalised patients. The relevant context would then be the hospital. Even so, health outcomes are
probably more strongly influenced by the particular department in which a patient
was treated than the hospital as a whole. The Introduction or Background Section In the case when the context is a geograph-
ical unit, the link between geographical scale and area type on the one hand and the
mechanism that is supposed to cause the outcome at the individual level is partic-
ularly important. If, for example, we want to analyse the relationship between social
capital and health, the way in which we conceptualise social capital and the type of
mechanism that we assume will influence the areal unit that we would want to use. When we conceptualise social capital as the social networks of people living in the
same area, supplying each other with emotional and instrumental support, we would
require smaller areal units than for a conceptualisation of social capital in terms of
community resources, norms and trust (Moore et al. 2005). When the discrepancy
between the size of the units used and the supposed mechanism that links the units to
the outcomes is too large, it becomes increasingly difficult to draw conclusions based
on your analysis of the data. The Methods Section The methods section firstly makes the step from the theoretical and conceptual
discussion of context as it appears in the introduction or background to the concrete
levels actually to be used in the data analysis. Especially when you use existing data
at any of the levels, it is likely that there will be discrepancies between the theoretical
context and the levels that you use in practice. It is important to describe this
discrepancy and to discuss the consequences in the final section of the paper. In the methods section, you should detail the units or levels used and the data
structure. These provide the rationale for the use of MLA. The relevant numbers (for
example, the population of the areas and sample drawn from these) should be detailed. example, the population of the areas and sample drawn from these) should be detailed. The nature of the statistical model that you use will largely be determined by the
dependent variable that you are analysing. As in any other empirical research paper, The nature of the statistical model that you use will largely be determined by the
dependent variable that you are analysing. As in any other empirical research paper, Writing Up Your Own Research 163 it should be clear at what scale the dependent variable has been measured and
consequently what the statistical model will be. Software packages that handle
MLA differ and you should identify which package you have used. it should be clear at what scale the dependent variable has been measured and
consequently what the statistical model will be. Software packages that handle
MLA differ and you should identify which package you have used. In the days when MLA was relatively new to public health and health services
research, authors used to give a general algebraic formulation of their multilevel
model. Although by now more researchers are familiar with these models, it may still
be useful to detail the actual model used. Particularly if the model that you are using
is more complicated or in some way non-standard, providing the full formulation of
the model used either in the methods section or in an appendix will aid other
researchers understanding of your work and enhance its reproducibility. The interpretation of the average outcome, variances and regression coefficients
sometimes depends on the point of reference taken. The Methods Section Meaningful interpretation can be
facilitated by centring independent variables around the mean or another relevant
value. Studies do not always state whether or not they centred the data, but this
should of course be mentioned. An important element of the methods section is the description of the modelling
strategy. The modelling strategy gives the steps that you are going to take in order to
answer your research question or test your hypotheses. A sensible null model should
be defined, and you should detail which variables are included in subsequent models
and how these variables were selected. The modelling strategy is not just a summary of the steps taken; it should contain
a logical line of reasoning. Chapters 7 and 9 have discussed modelling strategies and
working through the example datasets you can see modelling strategy in practice. Snijders and Bosker (2012) give helpful guidance in developing the modelling
strategy. The first step is the definition of your reference model. This might be either an
empty model that only estimates the variances or a model including a few basic
variables that are deemed necessary to give a fair picture of higher-level variance. The following steps introduce individual-level and/or higher-level variables. These
steps are typically evaluated with reference to the first modelling step. The methods section should enable the reader to replicate the study (at least in
principle if not in reality). The Results Section The results section reports the findings from your study. You should give the
necessary interpretation of your results, but you should also facilitate the reader’s
own interpretations. Consider, for example, that if variables are on different scales
then the interpretation may be difficult. Some variables may be dummies, for
example urbanicity may be coded as 0 (non-urban) and 1 (urban), and in the same
regression analysis the proportion of the population over 65 may be included,
ranging perhaps from 0.12 to 0.25. The coefficients for the two variables are then
not comparable; whilst one provides an estimate of the difference between outcomes 164 10
Reading and Writing 10
Reading and Writing in urban and non-urban areas, the other gives an estimate of the difference between
two non-existent contexts containing no people over the age of 65 and one
containing only people over 65. In quantitative studies, tables play an important part. There are many very
different ways of putting the results of an analysis into a table, without a gold
standard for reporting multilevel analysis. A table (in general) should be self-
contained and give an easy overview. If you want to show several consecutive
models in the table, you might wish to avoid an empty column for the reference
model by including the variance components in a separate table or as a footnote. If
the emphasis is mainly on the higher level and you have a large number of
individual-level variables, it might not be necessary to repeat this long list for each
modelling step that only involves new higher-level independent variables. The
coefficients of the individual-level variables may be largely invariant and could be
included in a separate table or in an appendix. The layout of any table should mirror the modelling strategy. However, it is not
always necessary to present each and every step of your modelling strategy in the
table. This is particularly the case if steps in the modelling process turn out not to add
much information; it may be better to mention that you conducted the steps as
intended but, for example, that the results or their interpretation do not differ from
other reported models. This is particularly likely to be the case for sensitivity
analyses. Again, full results may be reported in appendices or reported as being
available from the author. You should report the variance at the different levels. The Results Section Even if variation is not at
the heart of your study’s research questions, it is important for other studies’ power
calculations. It may also be helpful for readers if you report the intraclass correlation. If your modelling strategy describes a number of subsequent models, you should
probably detail changes in variance between models. If you are using logistic
regression, you could consider converting variances to a meaningful scale (such as
the median odds ratio or MOR; see Chap. 6). If you report cross-level interactions, it is usually very helpful to your readers if
you are able to present these graphically. An example was given earlier in this
chapter in Fig. 10.2. As the presentation of the results in tables is such an important element in terms of
enabling your readers to follow and understand your results, we will give a few
examples of how your results could be presented in tables. The best advice we can
give is to take note when you find articles with a particularly nice presentation. The first example is the presentation of a table for a two-level linear regression
with (for example) an index of health as the dependent variable and independent
variables at the individual level (such as age and gender) and at the context level
(perhaps neighbourhood social capital). The table columns show the coefficients of
the series of models that have been tested, starting from an empty model. The
following models are one including only the individual-level variables (model 1),
a model with only the contextual variables (model 2) and finally a model with both
individual and contextual variables (model 3). Whether or not you need this partic-
ular sequence of models depends on your research question and hypotheses and the
modelling strategy developed from your research question. The Results Section 165 Writing Up Your Own Research Writing Up Your Own Research Table 10.1 Example of table layout for a two-level linear regression model
Model
0 (empty
model)
Model
1 (individual-level
variables)
Model
2 (context
variables)
Model
3 (individual + context
variables)
Fixed part
Intercept
x
x
x
x
Individual variables
(e.g.) age
x
x
(e.g.) gender
x
x
Context variables
(e.g.) social
capital
x
x
Random part
Individual-
level
variance
x
x
x
x
Higher-level
variance
x
x
x
x Table 10.1 Example of table layout for a two-level linear regression model The table rows show first of all the fixed effects, starting with the overall
intercept, followed by the regression coefficients for the variables at individual
level and the regression coefficients at higher level. The lower part of the table
shows the random part of each model. In the empty model, only the overall intercept
and the two variances are estimated. The variances are the unexplained variance in
our dependent variable. You could consider adding another row that shows the
(change in) model fit. For a linear regression model, this could be the percentage of
variance explained in subsequent (nested) models (Table 10.1). In some cases, it might be convenient to display the random effects in a separate
table. This might be the case when your model includes random slopes. The random
part will then contain the variance of the slope and the covariance between the slope
and the intercept in addition to the variance of the intercept. In the event of a random
slope being estimated for a categorical independent variable (such as gender), a
useful option is to show the higher-level variance separately for the different
categories. Table 10.2 provides an illustration of models showing different formu-
lations of the random part. Note that if variances are shown for the different
categories, in this example for men and women, the higher-level intercept variance
is not estimated. The Conclusion and Discussion Section The conclusion and discussion section should start with a concise description of your
main results and, if the study tests a hypothesis, whether or not the hypothesis was
refuted. It is important to relate your results to the relevant literature, particularly 166 10
Reading and Writing 10
Reading and Writing Table 10.2 Example of table layout for the random part in different models
Random part
Model
0 (empty
model)
Model
3 (individual + context
variables) + age random
Model
3 (individual + context
variables) + gender random
Individual-level
variance
x
Higher-level inter-
cept variance
x
x
Slope variance for
age
x
Covariance
between age and
intercept
x
Higher-level vari-
ance for males
x
Higher-level vari-
ance for females
x
Covariance
between males and
females
x focusing on differences in results between your study and previous studies and the
likely causes of such differences. Some journals ask for a few bullet points on ‘what
this paper adds’. Even if the journal does not ask for these, it is often helpful to come
up with these bullet points for yourself to help to focus the discussion. This is normally followed by the strengths and weaknesses of the study; you may
want to pay particular attention to your data, study design and analytical strategy. Of
course, these should be seen against the background of the strengths and weaknesses
of other studies in the fields. The strengths and weaknesses should be balanced; there
is no reason why this should be an exercise in masochism. If there is a long list of
weaknesses and only a few strong points, the authors should probably have under-
taken a different (better) study. It is important for you to provide an interpretation of the meaning of the study. You may come back to your theoretical framework as set out at the beginning of the
article and you can discuss the mechanisms underlying the results that you have
found and any implications for policy or practice. Finally, it may be worth pointing
out any questions that remain unanswered and make suggestions for future research. None of the above is specific to writing up a multilevel analysis. It is generic to
well written research articles and based on an article in the British Medical Journal
on structuring the discussion section of a research paper (Docherty and Smith 1999). The Conclusion and Discussion Section Specifically in relation to the discussion section of a multilevel study, it is
important to return to the appropriateness of units (and the question as to whether
the units that you have used are indeed relevant contexts) and the levels that you
have included and excluded. 167 References References Conclusions In this chapter, we have brought two subjects together: critical reading of papers
written by others and writing up your own multilevel research. Even if you are only
using the results of other people’s research, it is important to understand the basics of
the methods used. We have developed a number of questions that can help you to get
to grips with the multilevel methods applied in published articles. As is true for our
advice about writing up your research, our advice on reading other people’s research
is only in part specific to multilevel analysis. Whatever the methods used, the
research questions should be clear and there should be a logical modelling strategy
related to the research questions and hypotheses. However, there are also specific
issues such as those related to the different levels that one may hypothesise in theory
and those encountered in the actual data. When it comes to writing up your research,
we have also given some examples of tables. However, there is also a link between
reading and writing: look for the things you like about published research, such as
understandable ways of putting complicated results into tables or concise ways of
formulating conclusions, and avoid forms of presentation on which you are not so
keen, such as a surfeit of regression models that add little to the conclusions. References J Epidemiol Community Health 62:202–208 Karvonen S, Sipilä P, Martikainen P, Rahkonen O, Laaksonen M (2008) Smoking in context—a
multilevel approach to smoking among females in Helsinki. BMC Public Health 8:134 Matteson DW, Burr JA, Marshall JR (1998) Infant mortality: a multi-level analysis of individual
and community risk factors. Soc Sci Med 47:1841–1854 Mauny F, Viel JF, Handschumacher P, Sellin B (2004) Multilevel modelling and malaria: a new
method for an old disease. Int J Epidemiol 33:1337–1344 Mayo NE, Asano M, Barbic SP (2013) When is a research question not a research question? J Rehabil Med 45:513–518 Merlo J, Gerdtham U-G, Eckerlund I, Håkansson S, Otterblad Olausson P, Pakkanen M, Lindqvist
P (2005) Hospital level of care and neonatal mortality in low and high risk deliveries:
reassessing the question in Sweden by multilevel analysis. Med Care 43:1092–1100 g
q
y
y
Mohnen SM, Völker B, Flap H, Subramanian SV, Groenewegen PP (2012) You have to be there to
enjoy it? Neighbourhood social capital and health. Eur J Public Health 23:33–39 Moore S, Shiell A, Hawe P, Haines VA (2005) The privileging of communitarian ideas: citation
practices and the translation of social capital into public health research. Am J Public Health
95:1330–1337 Nicholson A, Rose R, Bobak M (2009) Association between attendance at religious services an
self-reported health in 22 European countries. Soc Sci Med 69:519–528 Pornet C, Dejardin O, Morlais F, Bouvier V, Launoy G (2011) Socioeconomic determinants for
compliance to colorectal cancer screening: a multilevel analysis. J Epidemiol Community
Health 64:318–324 Rathmann K, Ottova V, Hurrelmann K, de Looze M, Levin K, Molcho M, Elgar F, Gabhainn SN,
van Dijk JP, Richter M (2015) Macro-level determinants of young people's subjective health and
health inequalities: a multilevel analysis in 27 welfare states. Maturitas 80:414–420 Renders CM, Valk GD, Franse LV, Schellevis FG, van Eijk JT, Van der Wal G (2001) Long-term
effectiveness of a quality improvement program for patients with type 2 diabetes in general
practice. Diabetes Care 24:1365–1370 Sellström E, Arnoldsson G, Bremberg S, Hjern A (2008) The neighbourhood they live in—does i
matter to women’s smoking habits during pregnancy? Health Place 14:155–166 Sixma H, Spreeuwenberg P, Zuidgeest M, Rademakers J (2009) [Consumer Quality Index hospital
stay]. NIVEL, Utrecht Snijders TAB, Bosker RJ (2012) Multilevel analysis: an introduction to basic and advanced
multilevel modeling. References Agyemang C, Vrijkotte TGM, Droomers M, Van der VWal MF, Bonsel GJ (2009) The effect of
neighbourhood income and deprivation on pregnancy outcomes in Amsterdam, the Netherlands. J Epidemiol Community Health 63:755–760 p
y
Arling G, Lewis T, Kane RL, Mueller C, Flood S (2007) Improving quality assessment through
multilevel modelling: the case of nursing home compare. Health Serv Res 42:1177–1199 Ball K, Timperio A, Salmon J, Giles-Corti B, Roberts R, Crawford D (2007) Personal, social and
environmental determinants of educational inequalities in walking: a multilevel study. J
Epidemiol Community Health 61:108–114 Béland F, Birch S, Stoddart G (2002) Unemployment and health: contextual-level influences on th
production of health in populations. Soc Sci Med 55:2033–2052 Bensing JM, Caris-Verhallen WMCM, Dekker J, Delnoij DMJ, Groenewegen PP (2003) Doing the
right thing and doing it right: toward a framework for assessing the policy relevance of health
services research. Int J Technol Assess Health Care 19:604–612 Bingenheimer JB (2005) Multilevel models and scientific progress in social epidemiology. J
Epidemiol Community Health 59:438–439 Black JL, Macinko J, Dixon LB, Fryer GE (2010) Neighborhoods and obesity in New York City. Health Place 16:489–499 Docherty M, Smith R (1999) The case for structuring the discussion of scientific papers. Br Med J
318:1224–1225 Eikemo TA, Bambra C, Joyce K, Dahl E (2008) Welfare state regimes and income-related health
inequalities: a comparison of 23 European countries. Eur J Public Health 18:593–599 Friele RD, Coppen R, Marquet RL, Gevers JKM (2006) Explaining differences between hospitals
in number of organ donors. Am J Transplant 6:539–543 Groenewegen PP, Leufkens HG, Spreeuwenberg P, Worm W (1999) Neighbourhood characteris-
tics and use of benzodiazepines in The Netherlands. Soc Sci Med 48:1701–1711 168 10
Reading and Writing Hekkert KD, Cihangir S, Kleefstra SM, Van den Berg B, Kool RB (2009) Patient satisfaction
revisited: a multilevel analysis. Soc Sci Med 69:68–75 Huizing AR, Hamers JPH, De Jonge J, Candel M, Berger MPF (2007) Organisational determinant
in the use of physical restraints: a multilevel approach. Soc Sci Med 65:924–933 Jat TR, Ng N, San Sebastian M (2011) Factors affecting the use of maternal health services
Madhya Pradesh state of India: a multilevel analysis. Int J Equity Health 10:59 Joshu CE, Boehmer TK, Brownson RC, Ewing R (2008) Personal, neighbourhood and urban
factors associated with obesity in the United States. Witvliet MI, Kunst AE, Stronks K, Arah OA (2012) Assessing where vulnerable groups fare worst:
a global multilevel analysis on the impact of welfare regimes on disability across different
socioeconomic groups. J Epidemiol Community Health 66:775–781 Verstappen W, ten Riet G, van der Weijden T, Hermsen J, Grol R (2005) Variation in requests for
imaging investigations by general practitioners: a multilevel analysis. J Health Serv Res Policy
10:25–30 Van Yperen NW, Snijders TAB (2000) A multilevel analysis of the demands-control model: is
stress at work determined by factors at the group level or the individual level? J Occup Health
Psychol 5:182–190 References Sage, Los Angeles Stafford M, Gimeno D, Marmot MG (2008) Neighbourhood characteristics and trajectories o
health functioning: a multilevel prospective analysis. Eur J Public Health 18:604–610 Turrell G, Kavanagh A, Draper G, Subramanian SV (2007) Do places affect the probability of death
in Australia? A multilevel study of area-level disadvantage, individual-level socioeconomic
position and all-cause mortality, 1998-2000. J Epidemiol Community Health 61:13–19 van Berkestijn LG, Kastein MR, Lodder A, de Melker RA, Bartelink ML (1999) How do we
compare with our colleagues? Quality of general practitioner performance in consultations for
non-acute abdominal complaints. International Journal for Quality in Healh Care 11:475–486 Van Stam M-A, Michielsen K, Stroeken K, Zijlstra BJH (2014) The impact of education and
globalization on sexual and reproductive health: retrospective evidence from eastern and
southern Africa. AIDS Care 26:379–386 169 References Van Yperen NW, Snijders TAB (2000) A multilevel analysis of the demands-control model: is
stress at work determined by factors at the group level or the individual level? J Occup Health
Psychol 5:182–190 Van Yperen NW, Snijders TAB (2000) A multilevel analysis of the demands-control model: is
stress at work determined by factors at the group level or the individual level? J Occup Health
Psychol 5:182–190 y
Verstappen W, ten Riet G, van der Weijden T, Hermsen J, Grol R (2005) Variation in requests for
imaging investigations by general practitioners: a multilevel analysis. J Health Serv Res Policy
10:25–30 Witvliet MI, Kunst AE, Stronks K, Arah OA (2012) Assessing where vulnerable groups fare worst:
a global multilevel analysis on the impact of welfare regimes on disability across different
socioeconomic groups. J Epidemiol Community Health 66:775–781 Open Access This chapter is licensed under the terms of the Creative Commons Attribution 4.0
International License (http://creativecommons.org/licenses/by/4.0/), which permits use, sharing,
adaptation, distribution and reproduction in any medium or format, as long as you give appropriate
credit to the original author(s) and the source, provide a link to the Creative Commons license and
indicate if changes were made. g
The images or other third party material in this chapter are included in the chapter's Creative
Commons license, unless indicated otherwise in a credit line to the material. If material is not
included in the chapter's Creative Commons license and your intended use is not permitted by
statutory regulation or exceeds the permitted use, you will need to obtain permission directly from
the copyright holder.
| 9,577 |
04254982.5729.emory.edu_1
|
English-PD
|
Open Culture
|
Public Domain
| 1,841 |
Old Saint Paul's : a tale of the plague and the fire
|
Ainsworth, William Harrison, 1805-1882 | Franklin, John, fl. 1800-1861, ill
|
English
|
Spoken
| 82 | 449 |
ETag: "1b4e5bf50535f4f86fef9ccbf041d1f5" accept: */* authorization: LOW fpJYfLnxbLmCEHqU:REDACTED_BY_IA_S3 connection: close content-length: 4579 expect: 100-continue host: s3.us.archive.org user-agent: curl/7.22.0 (i686-pc-linux-gnu) libcurl/7.22.0 OpenSSL/1.0.1 zlib/1.2.3.4 libidn/1.23 librtmp/2.3 x-amz-auto-make-bucket: 1 x-archive-ignore-preexisting-bucket: 1 x-archive-meta-contributor: Emory University, Manuscript Archive and Rare Books Library x-archive-meta-mediatype: texts x-archive-meta-ppi: 300 x-archive-meta-sponsor: Emory University, Manuscript Archive and Rare Books Library x-archive-meta01-collection: tripledeckers x-archive-meta03-collection: emory x-archive-queue-derive: 0 x-upload-date: 2013-05-03T15:07:14.000Z ETag: "6fdde391cee213546630a5a4adc7033f" accept: */* authorization: LOW fpJYfLnxbLmCEHqU:REDACTED_BY_IA_S3 connection: close content-length: 42197117 expect: 100-continue host: s3.us.archive.org user-agent: curl/7.22.0 (i686-pc-linux-gnu) libcurl/7.22.0 OpenSSL/1.0.1 zlib/1.2.3.4 libidn/1.23 librtmp/2.3 x-upload-date: 2013-05-03T15:10:07.000Z.
| 4,999 |
https://github.com/jsjtxietian/sicp_learning/blob/master/chap3/merge_3.56.scm
|
Github Open Source
|
Open Source
|
MIT
| 2,018 |
sicp_learning
|
jsjtxietian
|
Scheme
|
Code
| 63 | 262 |
(load "C:\\Users\\jsjtx\\Desktop\\sicp_learning\\chap3\\stream_3.5.scm")
(define (merge s1 s2)
(cond
((stream-null? s1) s2)
((stream-null? s2) s1)
(else
(let ((s1car (stream-car s1))
(s2car (stream-car s2)))
(cond
((< s1car s2car)
(cons-stream s1car (merge (stream-cdr s1) s2)))
((> s1car s2car)
(cons-stream s2car (merge s1 (stream-cdr s2))))
(else
(cons-stream s1car
(merge (stream-cdr s1)
(stream-cdr s2)))))))))
(define S
(cons-stream
1
(merge
(scale-stream S 2)
(merge
(scale-stream S 3)
(scale-stream S 5)))))
| 32,529 |
4382109_1
|
Court Listener
|
Open Government
|
Public Domain
| null |
None
|
None
|
Unknown
|
Unknown
| 2,136 | 3,504 |
Nebraska Supreme Court Online Library
www.nebraska.gov/apps-courts-epub/
03/29/2019 01:07 AM CDT
- 44 -
Nebraska Supreme Court A dvance Sheets
302 Nebraska R eports
HASSAN v. TRIDENT SEAFOODS
Cite as 302 Neb. 44
A bdi H assan, appellant, v. Trident Seafoods and
Liberty Mutual Insurance, its workers’
compensation insurer, appellees.
___ N.W.2d ___
Filed January 11, 2019. No. S-18-255.
1. Workers’ Compensation: Appeal and Error. An appellate court is
obligated in workers’ compensation cases to make its own determina-
tions as to questions of law.
2. ____: ____. Determinations by a trial judge of the Workers’
Compensation Court will not be disturbed on appeal unless they are
contrary to law or depend on findings of fact that are clearly wrong in
light of the evidence.
3. Workers’ Compensation: Jurisdiction: Statutes. As a statutorily cre-
ated court, the Workers’ Compensation Court is a tribunal of limited and
special jurisdiction and has only such authority as has been conferred on
it by statute.
4. Workers’ Compensation: Employer and Employee: Statutes. Under
the Nebraska Workers’ Compensation Act, in most compensation cases,
there must be at least one statutory employer and one statutory employee
for the compensation court to acquire jurisdiction.
5. Workers’ Compensation: Employer and Employee: Statutes: Words
and Phrases. For the purpose of the Nebraska Workers’ Compensation
Act, the terms “employer” and “employee” are not words of common
understanding, but, rather, of statutory definition.
Appeal from the Workers’ Compensation Court: Thomas E.
Stine, Judge. Affirmed.
Travis Allan Spier, of Atwood, Holsten, Brown, Deaver &
Spier Law Firm, P.C., L.L.O., for appellant.
- 45 -
Nebraska Supreme Court A dvance Sheets
302 Nebraska R eports
HASSAN v. TRIDENT SEAFOODS
Cite as 302 Neb. 44
Robert Kinney-Walker, of Law Office of James W. Nubel,
for appellees.
Heavican, C.J., Miller-Lerman, Cassel, Stacy, Funke,
Papik, and Freudenberg JJ.
Miller-Lerman, J.
NATURE OF CASE
On July 21, 2015, appellant Abdi Hassan sustained a work-
related injury in the course of his employment with appellee
Trident Seafoods at Trident Seafoods’ Alaska plant. Hassan was
a Nebraska resident when he was hired by Trident Seafoods, a
State of Washington corporation without a permanent pres-
ence in Nebraska. Although Hassan received certain benefits
in Alaska, he later filed a petition in the Nebraska Workers’
Compensation Court. The sole issue before us is whether the
Nebraska Workers’ Compensation Court correctly determined
that it lacked jurisdiction and dismissed his claim. Because we
agree with the Nebraska Workers’ Compensation Court that
Trident Seafoods was not a statutory employer subject to the
Nebraska Workers’ Compensation Act, we affirm.
STATEMENT OF FACTS
Hassan resided in Lexington, Nebraska, and worked as a
meat trimmer at a meat processing plant. In 2015, Hassan
learned from a friend that Trident Seafoods was hiring and,
with the friend’s help, he completed an online application.
He then attended an in-person recruitment event hosted by
Trident Seafoods at a hotel conference facility in Omaha,
Nebraska. Trident Seafoods rented conference space for the
event, and Hassan met and interviewed with several of Trident
Seafoods’ employees. Trident Seafoods did not employ work-
ers in Nebraska year round, but it sent a recruitment team to
Nebraska to recruit seasonal workers one or two times each
year from 2013 through 2016. Trident Seafoods hires employ-
ees from all over the country to staff its operations in the
Pacific Northwest and Alaska.
- 46 -
Nebraska Supreme Court A dvance Sheets
302 Nebraska R eports
HASSAN v. TRIDENT SEAFOODS
Cite as 302 Neb. 44
At the event in Omaha, Hassan completed an onsite drug test
administered by Trident Seafoods employees. Hassan recalled
observing around six Trident Seafoods employees at the
recruitment event. However, Trident Seafoods maintains that
the number of recruiters was fewer than six. After he returned
home from the recruitment event, Hassan remained in contact
with Trident Seafoods and continued to move forward with
the online employment application process. On June 8, 2015,
Hassan executed a contract for hire in Seattle, Washington, and
was hired as a seafood processor for the upcoming season.
While working in Alaska, Hassan suffered a low-back injury.
Alaska’s Department of Labor and Workforce Development
(Alaska Department) established a case file for Hassan’s inju-
ries. Trident Seafoods’ Alaska workers’ compensation insurer,
Liberty Mutual Insurance, accepted Hassan’s claim and paid
over $30,000 in medical expenses and indemnity to Hassan,
based on Alaska law.
Hassan’s work injuries resulted in permanent physical
restrictions which prevent him from returning to his preacci-
dent work capacity level. Following his injury, Hassan returned
to Lexington.
The Alaska Department referred Hassan to a rehabilitation
specialist in Nebraska who evaluated him and determined that
Hassan met the requirements necessary to receive reemploy-
ment benefits under Alaska workers’ compensation law. On
December 1, 2016, the Alaska Department sent Hassan a letter
to inform him he was eligible for reemployment benefits. The
letter indicated that he could elect to receive reemployment
benefits. The letter noted that if Hassan failed to complete the
required form within 30 days after receipt of the letter, the
reemployment benefits would terminate. Hassan did not com-
plete the required form, and the Alaska Department deemed
him noncooperative.
On March 16, 2017, Hassan filed a petition in the Nebraska
Workers’ Compensation Court and claimed benefits under the
Nebraska Workers’ Compensation Act. Trident Seafoods and
- 47 -
Nebraska Supreme Court A dvance Sheets
302 Nebraska R eports
HASSAN v. TRIDENT SEAFOODS
Cite as 302 Neb. 44
Liberty Mutual Insurance denied that the Nebraska Workers’
Compensation Court had jurisdiction and moved to dismiss.
The compensation court held a hearing and admitted evi-
dence including personnel records, email records, indemnity
payment summaries, employment policies, discovery responses,
and transcripts of depositions taken of Hassan and of a senior
recruiter at Trident Seafoods. In a written order, filed February
14, 2018, the compensation court dismissed Hassan’s petition
for lack of jurisdiction.
The compensation court found that Trident Seafoods was
not a statutory employer under Neb. Rev. Stat. § 48-106(1)
(Reissue 2010), because Trident Seafoods was not perform-
ing work in Nebraska. The written order noted that Trident
Seafoods’ primary business operation is the manufacturing and
production of seafood and that recruiting workers in Nebraska
is not “performing work” as understood under § 48-106(1).
The compensation court also concluded that Hassan was
not a statutory employee under Neb. Rev. Stat. § 48-115(2)(c)
(Reissue 2010). The compensation court noted that the online
correspondence between Hassan and Trident Seafoods was
preliminary to the contract of hire executed on June 8, 2015, in
Seattle and that thus, Hassan’s contract for hire was not made
in Nebraska.
Hassan appeals.
ASSIGNMENTS OF ERROR
Hassan claims, summarized and restated, that the compen-
sation court erred when it concluded that it did not have juris-
diction and dismissed the case.
STANDARDS OF REVIEW
Under Neb. Rev. Stat. § 48-185 (Cum. Supp. 2016), the
judgment made by the compensation court shall have the same
force and effect as a jury verdict in a civil case and may be
modified, reversed, or set aside only upon the grounds that (1)
the compensation court acted without or in excess of its pow-
ers; (2) the judgment, order, or award was procured by fraud;
- 48 -
Nebraska Supreme Court A dvance Sheets
302 Nebraska R eports
HASSAN v. TRIDENT SEAFOODS
Cite as 302 Neb. 44
(3) there is not sufficient competent evidence in the record to
warrant the making of the order, judgment, or award; or (4)
the findings of fact by the compensation court do not support
the order or award. Bower v. Eaton Corp., 301 Neb. 311, 918
N.W.2d 249 (2018).
[1] An appellate court is obligated in workers’ compensa-
tion cases to make its own determinations as to questions of
law. Id.
[2] Determinations by a trial judge of the Workers’
Compensation Court will not be disturbed on appeal unless
they are contrary to law or depend on findings of fact that are
clearly wrong in light of the evidence. Id.
ANALYSIS
[3-5] As a statutorily created court, the Workers’
Compensation Court is a tribunal of limited and special juris-
diction and has only such authority as has been conferred on
it by statute. Id. Under the Nebraska Workers’ Compensation
Act, in most compensation cases, including the one before us,
there must be at least one statutory employer and one statutory
employee for the compensation court to acquire jurisdiction.
Jensen v. Floair, Inc., 212 Neb. 740, 326 N.W.2d 19 (1982).
For the purpose of the Nebraska Workers’ Compensation Act,
the terms “employer” and “employee” are not words of com-
mon understanding, but, rather, of statutory definition. Id.
Because the record supports the determination that Trident
Seafoods is not a statutory employer under § 48-106(1), the
Nebraska Workers’ Compensation Act does not apply and the
Nebraska Workers’ Compensation Court correctly concluded
that it lacked jurisdiction.
Section 48-106(1) states that the Nebraska Workers’
Compensation Act applies to “every resident employer in this
state” and the “nonresident employer performing work in this
state who employs one or more employees in the regular trade,
business, profession, or vocation of such employer.”
Neb. Rev. Stat. § 48-114(2) (Reissue 2010) defines
“employer” to include, in relevant part, “every person, firm,
- 49 -
Nebraska Supreme Court A dvance Sheets
302 Nebraska R eports
HASSAN v. TRIDENT SEAFOODS
Cite as 302 Neb. 44
or corporation, including any public service corporation, who
is engaged in any trade, occupation, business, or profession
as described in section 48-106, and who has any person in
service under any contract of hire, express or implied, oral
or written.”
This statutory definition of employer found at § 48-114(2)
by its terms incorporates § 48-106. Synthesizing these stat-
utes, we therefore understand that to be a statutory employer
subject to the Nebraska Workers’ Compensation Act, the “non-
resident employer [must be] performing work in this state,”
§ 48-106(1), and the nature of that work must be “in the regular
trade,” § 48-106(1), of such employer. We do not believe that
in the ordinary case, performing occasional tasks in Nebraska
amount to a presence in Nebraska subjecting the employer to
the coverage of the Nebraska Workers’ Compensation Act.
However, we do believe that the employer is subject to the
Nebraska Workers’ Compensation Act where workers, includ-
ing support staff, are regularly performing work in Nebraska.
See § 48-106.
As noted above, Trident Seafoods is incorporated in the
State of Washington and is a “nonresident employer.” Given
the facts recited above and not repeated here, the evidence
shows that Trident Seafoods manufactures and produces sea-
food; was not performing such work in this state; and did
not frequently have employees either as support personnel
or directly engaged in Nebraska “in the regular trade, busi-
ness, profession, or vocation of such employer,” § 48-106(1).
Therefore, the Nebraska Workers’ Compensation Act did not
apply to Trident Seafoods.
Hassan contends that Trident Seafoods’ recruiting activity
subjected it to the Nebraska Workers’ Compensation Act. We
do not agree. Although Hassan showed that Trident Seafoods
sent several of its recruiters to Nebraska to host occasional
recruiting events, its presence in the state was incidental. And
there is no claim that Trident Seafoods was a labor broker,
which the appellate courts of this state have recognized as an
- 50 -
Nebraska Supreme Court A dvance Sheets
302 Nebraska R eports
HASSAN v. TRIDENT SEAFOODS
Cite as 302 Neb. 44
employer under the Nebraska Workers’ Compensation Act.
Compare Morin v. Industrial Manpower, 13 Neb. Ct. App. 1, 687
N.W.2d 704 (2004) (concluding that labor broker was employer
under Nebraska Workers’ Compensation Act).
The record shows that Trident Seafoods’ contacts with the
State of Nebraska were scant as compared with the activities
identified in § 48-106(1), which establish jurisdiction over an
employer. For completeness, we note our analysis undertaken
pursuant to the Nebraska Workers’ Compensation Act is con-
sistent with the national trend which favors finding that state
workers’ compensation laws primarily cover the employee in
the location of the employment relationship rather than other
factors. See, e.g., 13 Arthur Larson & Lex K. Larson, Larson’s
Workers’ Compensation Law § 143.04[1] (2017).
Having determined that Trident Seafoods is not a statu-
tory employer, and as a result, that the Nebraska Workers’
Compensation Act does not apply, we need not address
Hassan’s other arguments, including his assertion that he is a
covered employee under § 48-115(2). In the circumstances of
this case, without a statutory employer, Hassan’s status as an
employee is of no legal significance. See Jensen v. Floair, Inc.,
212 Neb. 740, 326 N.W.2d 19 (1982).
CONCLUSION
Because Trident Seafoods is a nonresident and its lim-
ited activities in Nebraska are not within the definition of
“employer” described by the Nebraska Workers’ Compensation
Act, the compensation court correctly determined it lacked
jurisdiction and dismissed Hassan’s petition for injuries sus-
tained on the job in Alaska.
A ffirmed.
| 49,165 |
US-201816004536-A_2
|
USPTO
|
Open Government
|
Public Domain
| 2,018 |
None
|
None
|
English
|
Spoken
| 6,295 | 8,982 |
During operation of the circuit 700, switch S4 is opened at t_(I0) such that capacitive element C7 will hold the value I0 of the current sensed by the LS Isense 404. Also at or around t_(I0), the LSFET is turned off, the HSFET is turned on, the LS Isense 404 is disabled, the HS Isense 402 is enabled, switches S6 and S7 are closed to begin sampling the current sensed by HS Isense, switches S1 and S9 are opened, and switches S2, S3, S5, and S8 remain open.
At t_(I1), switch S6 is opened such that capacitive element C6 will hold the value I1 of the current sensed by the HS Isense 402. Also at or around t_(I1), switch S1 is closed, switch S7 remains closed, and switches S4, S5, and S9 remain open. Furthermore, switch S8 is closed at t_(I1) to begin averaging the current values I0 and I1 (stored on capacitive elements C7 and C6, respectively) for application in a subsequent switching cycle.
Sometime during the interval between t_(I1) and t_(I2) (or between t_(I3) and t_(I0′)), switch S3 is closed to apply a high-side error-correction current from a previous switching cycle, as output by the transconductance amplifier 702, for a first predetermined period. The first predetermined period may be the same amount of time as delay t₁. After application of the high-side error-correction current for the first predetermined period, switch S3 is opened.
At t_(I2), switch S7 is opened such that capacitive element C4 will hold the value I2 of the current sensed by the HS Isense 402. Also at or around t_(I2), the HSFET is turned off, the LSFET is turned on, the HS Isense 402 is disabled, the LS Isense 404 is enabled, switches S4 and S5 are closed to begin sampling the current sensed by the LS Isense, switches S1 and S8 are opened, and switches S2, S3, S6, and S9 remain open.
At t_(I3), switch S5 is opened such that capacitive element C8 will hold the value I3 of the current sensed by the LS Isense 404. Also at or around t_(I1), switch S1 is closed, switch S4 remains closed, and switches S6, S7, and S8 remain open. Furthermore, switch S9 is closed at t_(I3) to average the current values I2 and I3 (stored on capacitive elements C4 and C8, respectively) for application in a subsequent switching cycle.
Sometime during the interval between t_(I3) and t_(I0′) (or between t_(I1) and t_(I2)), switch S2 is closed to apply a low-side error-correction current from a previous switching cycle, as output by the transconductance amplifier 704, for a second predetermined period. The second predetermined period may be the same amount of time as delay t₂. After application of the low-side error-correction current for the second predetermined period, switch S2 is opened. For certain aspects, switches S2 and S3 may be temporarily closed during different intervals, whereas in other aspects, switches S2 and S3 may be temporarily closed during the same interval.
Although only a first-order passive low-pass filter is illustrated in FIG. 7A, those having ordinary skill in the art understand that the low-pass filter may be implemented by any number of different low-pass filter topologies, may be active or passive, and may be more complex than first order. For example, the low-pass filter may be implemented by an integrator, which can function as a low-pass filter. Such an integrator may be part of a control circuit that implements an active input current limit, which may be specified for certain applications (e.g., battery charging applications). Alternatively, the output of the low-pass filter may be used directly as a real-time measurement of average output current.
FIG. 7C is a schematic diagram of an example current-sensing circuit 720 with error-correction components for accurately sensing average input current, in accordance with certain aspects of the present disclosure. FIG. 7D is a time-based graph associated with the current-sensing circuit 720 of FIG. 7C. The current-sensing circuit 720 may implement the current-sensing circuit 400 of FIG. 4 and adds components to the current-sensing circuit 700 of FIG. 7A. These additional components include a resistive element R3, a capacitive element C9, switches S10, S11, S12, and S13, and a transconductance amplifier 706. Resistive element R3 and capacitive element C9 may form a first-order, passive low-pass filter 722 for measuring the high-side input current at an input-current-sensing node 721 via switch S12. The output voltage (V_(out,ic)) of the low-pass filter 722 may have a voltage proportional to the input current of the buck converter, and hence, this low-pass filter may be referred to as an input current low-pass filter. Furthermore, the transconductance amplifier 706 may have a gain of VIN/R1, similar to the transconductance amplifiers 702 and 704.
For certain aspects as illustrated in FIG. 7C, resistive element 406 is replicated, such that there is a shunt resistive element R1,A at the output of the HS Isense 402 and another shunt resistive element R1,B at the output of the LS Isense 404, both having a resistance R1. For other aspects, the outputs of the HS Isense 402 and the LS Isense 404 may share the single resistive element 406 (as illustrated in FIG. 7A), in which case switch S13 may be eliminated from the current-sensing circuit 720 of FIG. 7C.
During operation of the circuit 720, switch S4 is opened at t_(I0) such that capacitive element C7 will hold the value I0 of the current sensed by the LS Isense 404. Also at or around t_(I0), the LSFET is turned off, the HSFET is turned on, the LS Isense 404 is disabled, the HS Isense 402 is enabled, switches S6 and S7 are closed to begin sampling the current sensed by HS Isense, switches S9, S11, and S13 are opened, and switches S1, S2, S3, S5, S8, S10, and S12 remain open.
At t_(I1), switch S6 is opened such that capacitive element C6 will hold the value I1 of the current sensed by the HS Isense 402. Also at or around t_(I1), switches S1 and S12 are closed, switch S7 remains closed, and switches S4, S5, S9, S11, and S13 remain open. Furthermore, switch S8 is closed at t_(I1) to begin averaging the current values I0 and I1 (stored on capacitive elements C7 and C6, respectively) for application in a subsequent switching cycle.
Sometime during the interval between t_(I1) and t_(I2) (or between t_(I3) and t_(I0′)), switch S3 is closed to apply a high-side error-correction current from a previous switching cycle, as output by the transconductance amplifier 702, for a first predetermined period, as described above. After application of the high-side error-correction current for the first predetermined period, switch S3 is opened. Furthermore, sometime during the interval between t_(I1) and t_(I2) while switch S12 is closed, switch S10 is closed to apply a high-side error-correction current from a previous switching cycle, as output by the transconductance amplifier 706, for a third predetermined period. The third predetermined period may be the same amount of time as delay t₁. After application of the high-side error-correction current for the third predetermined period, switch S10 is opened. For certain aspects, switches S3 and S10 may be temporarily closed during the same interval, whereas in other aspects, switches S3 and S10 may be temporarily closed during different intervals.
At t_(I2), switch S7 is opened such that capacitive element C4 will hold the value I2 of the current sensed by the HS Isense 402. Also at or around t_(I2), the HSFET is turned off, the LSFET is turned on, the HS Isense 402 is disabled, the LS Isense 404 is enabled, switches S4 and S5 are closed to begin sampling the current sensed by the LS Isense, switches S1, S8, and S12 are opened, and switches S2, S3, S6, S9, S10, S11, and S13 remain open.
At t_(I3), switch S5 is opened such that capacitive element C8 will hold the value I3 of the current sensed by the LS Isense 404. Also at or around t_(I3), switch S13 is closed, switch S4 remains closed, and switches S1, S6, S7, S8, and S12 remain open. Also, switch S11 is closed to discharge capacitive element C9, while the high-side current is not being sensed. Furthermore, switch S9 is closed at t_(I3) to average the current values I2 and I3 (stored on capacitive elements C4 and C8, respectively) for application in a subsequent switching cycle.
Sometime during the interval between t_(I3) and t_(I0′) (or between t_(I1) and t_(I2)), switch S2 is closed to apply a low-side error-correction current from a previous switching cycle, as output by the transconductance amplifier 704, for a second predetermined period, as described above. After application of the low-side error-correction current for the second predetermined period, switch S2 is opened. For certain aspects, switches S2 and S3 may be temporarily closed during different intervals, whereas in other aspects, switches S2 and S3 may be temporarily closed during the same interval.
Battery chargers may include a scheme to disconnect the battery (e.g., battery 102) when the input voltage (e.g., VIN) is shorted to ground. Without this protection, the body diode of the HSFET in the buck converter or other SMPS will conduct current, regardless whether the HSFET is on or off. Therefore, to implement aspects of the present disclosure in a battery charger, the body diode of the HSFET may be controlled (e.g., with a switch) to open the body diode when high reverse currents are detected.
A capacitive element, as described herein, may be implemented by one or more capacitors, for example. A capacitor may be a fixed capacitor or a variable capacitor and may be, for example, an electrolytic capacitor, an aluminum electrolytic capacitor, a tantalum electrolytic capacitor, a super capacitor, a ceramic capacitor, a power film capacitor, polypropylene capacitor, a polycarbonate capacitor, a silver mica capacitor, an integrated-circuit (IC) capacitor, a double-layer capacitor, a pseudo-capacitor, or hybrid capacitors. The capacitors in circuits 400, 700, and 720 may be any suitable capacitance value, for example, in the range of picofarads (pF), nanofarads (nF), or microfarads (μF).
A resistive element, as described herein, may be implemented by one or more resistors, for example. A resistor may be a fixed resistor or a variable resistor (e.g., adjustable resistor, potentiometer, resistance decade box, or a thermistor). A resistor may have any resistance, for example, in the range of ohms (Ω), kilo-ohms (kΩ), or mega-ohms (MΩ).
FIG. 8 is a flow diagram of an example process 800 for current sensing and correction in a switched-mode power supply (e.g., a buck converter, a boost converter, or a buck-boost converter), in accordance with certain aspects of the present disclosure. Additional, fewer, or different operations may be performed, depending on the implementation of the process 800. The process 800 may be implemented by a system, such as the current-sensing circuit 400 of FIG. 4, the circuit 700 of FIG. 7A, or the circuit 720 of FIG. 7C, where it is understood that the switched-mode power supply comprises a high-side transistor (e.g., HSFET 204) coupled to a low-side transistor (e.g., LSFET 206). The system may also include a controller for controlling the states of the various transistors and switches therein.
The process 800 may begin, at operation 802, with the system capturing (e.g., holding after sampling) a current associated with the low-side transistor at a first time (e.g., t_(I0)) corresponding to the low-side transistor turning off. At operation 804, the system captures a current associated with the high-side transistor at a second time (e.g., t_(I1)) corresponding to a first delay (e.g., t1) after the high-side transistor turns on. At operation 806, the system captures the current associated with the high-side transistor at a third time (e.g., t_(I2)) corresponding to the high-side transistor turning off. At operation 808, the system applies a first correction current to a current-summing node (e.g., node 421) of the current-sensing circuit for a first interval based on the first delay. The first correction current may be based on the captured current associated with the low-side transistor at the first time and on the captured current associated with the high-side transistor at the second time.
According to certain aspects, the first delay is based on a blanking time and a settling time for a high-side current-sensing amplifier (e.g., HS Isense 402) coupled to the high-side transistor, such that the high-side current-sensing amplifier corresponds to an inductor current (e.g., IL through inductor L2) for the switched-mode power supply by the second time.
According to certain aspects, the process 800 may further involve the system averaging the captured current associated with the low-side transistor at the first time and the captured current associated with the high-side transistor at the second time to obtain an averaged current. In this case, the first correction current may be the averaged current.
According to certain aspects, the first interval equals the first delay.
According to certain aspects, the process 800 may further involve the system determining an average input current for the switched-mode power supply based on the first correction current, the captured current associated with the high-side transistor at the second time, the captured current associated with the high-side transistor at the third time, and a duty cycle of the switched-mode power supply.
According to certain aspects, the process 800 may further involve the system capturing the current associated with the low-side transistor at a fourth time (e.g., t_(I3)) corresponding to a second delay (e.g., t2) after the low-side transistor turns on; and applying a second correction current to the current-summing node for a second interval based on the second delay. In this case, the second correction current may be based on the captured current associated with the high-side transistor at the third time and on the captured current associated with the low-side transistor at the fourth time. For certain aspects, the second delay is based on a blanking time and a settling time for a low-side current-sensing amplifier (e.g., LS Isense 404) coupled to the low-side transistor, such that the low-side current-sensing amplifier corresponds to an inductor current for the switched-mode power supply by the fourth time. For certain aspects, the process 800 may further entail the system averaging the captured current associated with the high-side transistor at the third time and the captured current associated with the low-side transistor at the fourth time to obtain an averaged current. In this case, the second correction current may be the averaged current. For certain aspects, the second interval equals the second delay. For certain aspects, the first time, the second time, the third time, and the fourth time occur during a first switching period of the switched-mode power supply; the first interval occurs during a second switching period of the switched-mode power supply while the high-side transistor is turned on; the second switching period is subsequent to the first switching period; and the second interval occurs during the second switching period of the switched-mode power supply while the low-side transistor is turned on. An Example Device
It should be understood that aspects of the present disclosure may be used in a variety of applications. Although the present disclosure is not limited in this respect, the circuits disclosed herein may be used in many apparatuses such as in the power supply, battery charging circuit, or power management circuit of a communication system, a video codec, audio equipment such as music players and microphones, a television, camera equipment, and test equipment such as an oscilloscope. Communication systems intended to be included within the scope of the present disclosure include, by way of example only, cellular radiotelephone communication systems, satellite communication systems, two-way radio communication systems, one-way pagers, two-way pagers, personal communication systems (PCS), personal digital assistants (PDAs), and the like.
FIG. 9 illustrates an example device 900 in which aspects of the present disclosure may be implemented. The device 900 may be a battery-operated device such as a cellular phone, a PDA, a handheld device, a wireless device, a laptop computer, a tablet, a smartphone, etc.
The device 900 may include a processor 904 that controls operation of the device 900. The processor 904 may also be referred to as a central processing unit (CPU). Memory 906, which may include both read-only memory (ROM) and random access memory (RAM), provides instructions and data to the processor 904. A portion of the memory 906 may also include non-volatile random access memory (NVRAM). The processor 904 typically performs logical and arithmetic operations based on program instructions stored within the memory 906.
In certain aspects, the device 900 may also include a housing 908 that may include a transmitter 910 and a receiver 912 to allow transmission and reception of data between the device 900 and a remote location. For certain aspects, the transmitter 910 and receiver 912 may be combined into a transceiver 914. One or more antennas 916 may be attached or otherwise coupled to the housing 908 and electrically connected to the transceiver 914. The device 900 may also include (not shown) multiple transmitters, multiple receivers, and/or multiple transceivers.
The device 900 may also include a signal detector 918 that may be used in an effort to detect and quantify the level of signals received by the transceiver 914. The signal detector 918 may detect such signal parameters as total energy, energy per subcarrier per symbol, and power spectral density, among others. The device 900 may also include a digital signal processor (DSP) 920 for use in processing signals.
The device 900 may further include a battery 922 used to power the various components of the device 900. The device 900 may also include a power management integrated circuit (power management IC or PMIC) 924 for managing the power from the battery to the various components of the device 900. The PMIC 924 may perform a variety of functions for the device such as DC-to-DC conversion, battery charging, power-source selection, voltage scaling, power sequencing, etc. In certain aspects, the PMIC 924 may include and/or control one or more switching regulators with current sensing and error-correction circuitry, as described above. The various components of the device 900 may be coupled together by a bus system 926, which may include a power bus, a control signal bus, and/or a status signal bus in addition to a data bus.
Certain aspects of the present disclosure are directed to techniques and apparatus for sensing average input current and/or average output current in a switched-mode power supply (SMPS) with accurate and lossless sensing. Such techniques offer better efficiency and are immune to switching noise (e.g., VSW ringing), blanking, and slew rate errors. Certain aspects may also reduce die size and lower costs (e.g., by removing the FPFET and/or the BATFET). These techniques may be used for any SMPS, including an SMPS implemented in a battery charger.
Certain aspects of the present disclosure provide a current-sensing circuit (e.g., current-sensing circuit 400, 700, or 720) for an SMPS (e.g., a buck converter) composed of a high-side transistor (e.g., HSFET 204) and a low-side transistor (e.g., LSFET 206) coupled to the high-side transistor. The current-sensing circuit generally includes a high-side current-sensing amplifier (e.g., HS Isense 402) having an input for coupling to the high-side transistor; a low-side current-sensing amplifier (e.g., LS Isense 404) having an input for coupling to the low-side transistor; a first sample-and-hold circuit (e.g., sample-and-hold circuit 408, labeled “S/H I0”) coupled to an output of the low-side current-sensing amplifier and configured to capture (e.g., hold after sampling) a current associated with the low-side transistor at a first time (e.g., t_(I0)) corresponding to the low-side transistor turning off; a second sample-and-hold circuit (e.g., sample-and-hold circuit 410, labeled “S/H I1”) coupled to an output of the high-side current-sensing amplifier and configured to capture a current associated with the high-side transistor at a second time (e.g., t_(I1)) corresponding to a first delay (e.g., t1) after the high-side transistor turns on; a third sample-and-hold circuit (e.g., sample-and-hold circuit 412, labeled “S/H I2”) coupled to the output of the high-side current-sensing amplifier and configured to capture the current associated with the high-side transistor at a third time (e.g., t_(I2)) corresponding to the high-side transistor turning off; a first voltage-to-current converter (e.g., transconductance amplifier 702) having an input coupled to an output of the first sample-and-hold circuit and to an output of the second sample-and-hold circuit; a first switch (e.g., switch S1) coupled between an output of the high-side current-sensing amplifier and a sensing node (e.g., sensing node 422) for the current-sensing circuit; and a second switch (e.g., switch S3) coupled between an output of the first voltage-to-current converter and the sensing node.
According to certain aspects, the current-sensing circuit further includes a fourth sample-and-hold circuit (e.g., sample-and-hold circuit 414, labeled “S/H I3”) coupled to the output of the low-side current-sensing amplifier and configured to capture the current associated with the low-side transistor at a fourth time (e.g., t_(I3)) corresponding to a second delay (e.g., t2) after the low-side transistor turns on; a second voltage-to-current converter (e.g., transconductance amplifier 704) having an input coupled to an output of the third sample-and-hold circuit and to an output of the fourth sample-and-hold circuit; and a third switch (e.g., switch S2) coupled between an output of the second voltage-to-current converter and the sensing node. For certain aspects, the current-sensing circuit further includes a fourth switch (e.g., switch S8) having a first terminal coupled to the output of the second sample-and-hold circuit and having a second terminal coupled to the output of the first sample-and-hold circuit and to the input of the first voltage-to-current converter; and a fifth switch (e.g., switch S9) having a first terminal coupled to the output of the third sample-and-hold circuit and having a second terminal coupled to the output of the fourth sample-and-hold circuit and to the input of the second voltage-to-current converter.
According to certain aspects, the current-sensing circuit further includes a third voltage-to-current converter (e.g., transconductance amplifier 706) having an input coupled to the output of the first sample-and-hold circuit and to the output of the second sample-and-hold circuit; a fourth switch (e.g., switch S10) coupled between an output of the third voltage-to-current converter and an input-current-sensing node; and a fifth switch (e.g., switch S12) coupled between the output of the high-side current-sensing amplifier and the input-current-sensing node. For certain aspects, the current-sensing circuit further includes a sixth switch (e.g., switch S11) coupled between the input-current-sensing node and a reference potential node (e.g., electrical ground).
According to certain aspects, the current-sensing circuit further includes a shunt resistor (e.g., resistive element 406) coupled between an output of the high-side current-sensing amplifier and a reference potential node. In this case, the output of the high-side current-sensing amplifier may be coupled to the output of the low-side current-sensing amplifier. For certain aspects, the shunt resistor has a resistance, and the first voltage-to-current converter is configured to have a transconductance (g_(m)) inversely proportional to the resistance of the shunt resistor.
According to certain aspects, the current-sensing circuit further includes a first shunt resistor (e.g., resistor R1,A) coupled between an output of the high-side current-sensing amplifier and a reference potential node; a second shunt resistor (e.g., resistor R1,B) coupled between an output of the low-side current-sensing amplifier and the reference potential node; and a third switch (e.g., switch S13) coupled between the output of the low-side current-sensing amplifier and the sensing node.
According to certain aspects, the current-sensing circuit further includes at least one of a low-pass filter or an error amplifier (e.g., the low-pass filter or error amplifier 420) having an input coupled to the sensing node.
The various operations of methods described above may be performed by any suitable means capable of performing the corresponding functions. The means may include various hardware and/or software component(s) and/or module(s), including, but not limited to a circuit, an application-specific integrated circuit (ASIC), or processor. Generally, where there are operations illustrated in figures, those operations may have corresponding counterpart means-plus-function components with similar numbering.
The various aspects illustrated and described herein are provided merely as examples to illustrate various features of the claims. However, features shown and described with respect to any given aspect are not necessarily limited to the associated aspect and may be used or combined with other aspects that are shown and described. Further, the claims are not intended to be limited by any one example aspect.
The foregoing method descriptions and the process flow diagrams are provided merely as illustrative examples and are not intended to require or imply that the steps or actions of various aspects must be performed in the order presented. As will be appreciated by one having ordinary skill in the art, the method steps and/or actions may be interchanged with one another without departing from the scope of the claims. Words such as “thereafter,” “then,” “next,” etc. in the description are not intended to limit the order of the steps or actions; these words are simply used to guide the reader through the description of the methods. In other words, unless a specific order of steps or actions is specified, the order and/or use of specific steps and/or actions may be modified without departing from the scope of the claims. Further, any reference to claim elements in the singular, for example, using the articles “a,” “an,” or “the” is not to be construed as limiting the element to the singular.
As used herein, the term “determining” encompasses a wide variety of actions. For example, “determining” may include calculating, computing, processing, deriving, investigating, looking up (e.g., looking up in a table, a database, or another data structure), ascertaining, and the like. Also, “determining” may include receiving (e.g., receiving information), accessing (e.g., accessing data in a memory), and the like. Also, “determining” may include resolving, selecting, choosing, establishing, and the like.
As used herein, the term “coupled” may encompass both direct and indirect coupling. Thus, first and second parts are said to be coupled together when directly contacting one another, as well as when the first part couples to an intermediate part, which couples either directly or via one or more additional intermediate parts to the second part.
As used herein, a phrase referring to “at least one of” a list of items refers to any combination of those items, including single members. As an example, “at least one of: a, b, or c” is intended to cover: a, b, c, a-b, a-c, b-c, and a-b-c, as well as any combination with multiples of the same element (e.g., a-a, a-a-a, a-a-b, a-a-c, a-b-b, a-c-c, b-b, b-b-b, b-b-c, c-c, and c-c-c or any other ordering of a, b, and c).
The various illustrative logical blocks, modules, circuits, and algorithm steps described in connection with the implementations disclosed herein may be implemented as electronic hardware, computer software, or combinations of both. To clearly illustrate this interchangeability of hardware and software, various illustrative components, blocks, modules, circuits, and steps have been described above generally in terms of their functionality. Whether such functionality is implemented as hardware or software depends upon the particular application and design constraints imposed on the overall system. Skilled artisans may implement the described functionality in varying ways for each particular application, but such implementation decisions should not be interpreted as causing a departure from the scope of the present disclosure.
The various illustrative logical blocks, modules, and circuits described in connection with the present disclosure may be implemented or performed with a general purpose processor, a digital signal processor (DSP), an ASIC, a field programmable gate array (FPGA) or other programmable logic device (PLD), discrete gate or transistor logic, discrete hardware components, or any combination thereof designed to perform the functions described herein. A general-purpose processor may be a microprocessor, but in the alternative, the processor may be any commercially available processor, controller, microcontroller, or state machine. A processor may also be implemented as a combination of computing devices, e.g., a combination of a DSP and a microprocessor, a plurality of microprocessors, one or more microprocessors in conjunction with a DSP core, or any other such configuration.
The processing system may be configured as a general-purpose processing system with one or more microprocessors providing the processor functionality and external memory providing at least a portion of the machine-readable media, all linked together with other supporting circuitry through an external bus architecture. Alternatively, the processing system may be implemented with an ASIC with the processor, the bus interface, the user interface in the case of an access terminal, supporting circuitry, and at least a portion of the machine-readable media integrated into a single chip, or with one or more FPGAs, PLDs, controllers, state machines, gated logic, discrete hardware components, or any other suitable circuitry, or any combination of circuits that can perform the various functionality described throughout this disclosure. Those skilled in the art will recognize how best to implement the described functionality for the processing system depending on the particular application and the overall design constraints imposed on the overall system.
The preceding description of the various aspects of the present disclosure is provided to enable any person skilled in the art to implement the disclosed aspects. Various modifications to these aspects will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to some aspects without departing from the spirit or scope of the disclosure. Thus, the present disclosure is not intended to be limited to the aspects shown herein, but is to be accorded the widest scope consistent with the following claims and the principles and novel features disclosed herein.
What is claimed is:
1. A method of current sensing and correction for a switched-mode power supply comprising a high-side transistor and a low-side transistor coupled to the high-side transistor, the method comprising: capturing, with a current-sensing circuit, a current associated with the low-side transistor at a first time corresponding to the low-side transistor turning off; capturing a current associated with the high-side transistor at a second time corresponding to a first delay after the high-side transistor turns on; capturing the current associated with the high-side transistor at a third time corresponding to the high-side transistor turning off; and applying a first correction current to a current-summing node of the current-sensing circuit for a first interval based on the first delay, wherein the first correction current is based on the captured current associated with the low-side transistor at the first time and on the captured current associated with the high-side transistor at the second time.
2. The method of claim 1, wherein the first delay is based on a blanking time and a settling time for a high-side current-sensing amplifier coupled to the high-side transistor, such that the high-side current-sensing amplifier corresponds to an inductor current for the switched-mode power supply by the second time.
3. The method of claim 1, further comprising averaging the captured current associated with the low-side transistor at the first time and the captured current associated with the high-side transistor at the second time to obtain an averaged current, wherein the first correction current is the averaged current.
4. The method of claim 1, wherein the first interval equals the first delay.
5. The method of claim 1, further comprising determining an average input current for the switched-mode power supply based on the first correction current, the captured current associated with the high-side transistor at the second time, the captured current associated with the high-side transistor at the third time, and a duty cycle of the switched-mode power supply.
6. The method of claim 1, further comprising: capturing the current associated with the low-side transistor at a fourth time corresponding to a second delay after the low-side transistor turns on; and applying a second correction current to the current-summing node for a second interval based on the second delay, wherein the second correction current is based on the captured current associated with the high-side transistor at the third time and on the captured current associated with the low-side transistor at the fourth time.
7. The method of claim 6, wherein the second delay is based on a blanking time and a settling time for a low-side current-sensing amplifier coupled to the low-side transistor, such that the low-side current-sensing amplifier corresponds to an inductor current for the switched-mode power supply by the fourth time.
8. The method of claim 6, further comprising averaging the captured current associated with the high-side transistor at the third time and the captured current associated with the low-side transistor at the fourth time to obtain an averaged current, wherein the second correction current is the averaged current.
9. The method of claim 6, wherein the second interval equals the second delay.
10. The method of claim 6, wherein: the first time, the second time, the third time, and the fourth time occur during a first switching period of the switched-mode power supply; the first interval occurs during a second switching period of the switched-mode power supply while the high-side transistor is turned on; the second switching period is subsequent to the first switching period; and the second interval occurs during the second switching period of the switched-mode power supply while the low-side transistor is turned on.
11. The method of claim 6, further comprising: capturing the current associated with the low-side transistor at a fifth time corresponding to the low-side transistor turning off, wherein a time difference between the fifth time and the first time is one switching period for the switched-mode power supply; and determining an average output current for the switched-mode power supply based on the first correction current, the captured current associated with the high-side transistor at the second time, the captured current associated with the high-side transistor at the third time, the second correction current, the captured current associated with the low-side transistor at the fourth time, and the captured current associated with the low-side transistor at the fifth time.
12. A current-sensing circuit for a switched-mode power supply comprising a high-side transistor and a low-side transistor coupled to the high-side transistor, the current-sensing circuit comprising: a high-side current-sensing amplifier having an input for coupling to the high-side transistor; a low-side current-sensing amplifier having an input for coupling to the low-side transistor; a first sample-and-hold circuit coupled to an output of the low-side current-sensing amplifier and configured to capture a current associated with the low-side transistor at a first time corresponding to the low-side transistor turning off; a second sample-and-hold circuit coupled to an output of the high-side current-sensing amplifier and configured to capture a current associated with the high-side transistor at a second time corresponding to a first delay after the high-side transistor turns on; a third sample-and-hold circuit coupled to the output of the high-side current-sensing amplifier and configured to capture the current associated with the high-side transistor at a third time corresponding to the high-side transistor turning off; a first voltage-to-current converter having an input coupled to an output of the first sample-and-hold circuit and to an output of the second sample-and-hold circuit; a first switch coupled between an output of the high-side current-sensing amplifier and a sensing node for the current-sensing circuit; and a second switch coupled between an output of the first voltage-to-current converter and the sensing node.
13. The current-sensing circuit of claim 12, further comprising: a fourth sample-and-hold circuit coupled to the output of the low-side current-sensing amplifier and configured to capture the current associated with the low-side transistor at a fourth time corresponding to a second delay after the low-side transistor turns on; a second voltage-to-current converter having an input coupled to an output of the third sample-and-hold circuit and to an output of the fourth sample-and-hold circuit; and a third switch coupled between an output of the second voltage-to-current converter and the sensing node.
14. The current-sensing circuit of claim 13, further comprising: a fourth switch having a first terminal coupled to the output of the second sample-and-hold circuit and having a second terminal coupled to the output of the first sample-and-hold circuit and to the input of the first voltage-to-current converter; and a fifth switch having a first terminal coupled to the output of the third sample-and-hold circuit and having a second terminal coupled to the output of the fourth sample-and-hold circuit and to the input of the second voltage-to-current converter.
15. The current-sensing circuit of claim 13, further comprising a third voltage-to-current converter having an input coupled to the output of the first sample-and-hold circuit and to the output of the second sample-and-hold circuit; a fourth switch coupled between an output of the third voltage-to-current converter and an input-current-sensing node; and a fifth switch coupled between the output of the high-side current-sensing amplifier and the input-current-sensing node.
16. The current-sensing circuit of claim 15, further comprising a sixth switch coupled between the input-current-sensing node and a reference potential node.
17. The current-sensing circuit of claim 12, further comprising a shunt resistor coupled between an output of the high-side current-sensing amplifier and a reference potential node, wherein the output of the high-side current-sensing amplifier is coupled to the output of the low-side current-sensing amplifier.
18. The current-sensing circuit of claim 17, wherein the shunt resistor has a resistance and wherein the first voltage-to-current converter is configured to have a transconductance inversely proportional to the resistance of the shunt resistor.
19. The current-sensing circuit of claim 12, further comprising: a first shunt resistor coupled between an output of the high-side current-sensing amplifier and a reference potential node; a second shunt resistor coupled between an output of the low-side current-sensing amplifier and the reference potential node; and a third switch coupled between the output of the low-side current-sensing amplifier and the sensing node.
20. The current-sensing circuit of claim 12, further comprising at least one of a low-pass filter or an error amplifier having an input coupled to the sensing node..
| 22,498 |
bpt6k1488565w_1
|
French-PD-Newspapers
|
Open Culture
|
Public Domain
| 1,875 |
Le Midi : journal républicain libéral ["puis" journal républicain, paraissant tous les jours]
|
None
|
French
|
Spoken
| 7,578 | 12,162 |
oe A**II — N® lfi3 aeasmoesB REDACTION É'&drMser' »n Rédacteur, ru» Pradlèr, 12 Nlnae*. tt m&iMicfiU déposés ne seront pus rendus. ABONNEMENTS •ara et départemenu limitrophe» • UN AN : 48 FR. ^rol» tcoli...13 fr. J Six moi»,....* li tt Astre» département*:: UN [AN : 54 FR. Trol* moi * *« 15 fr. J Sii.tnoi*..»»*. 98 fr. K«tANan : Le port en soi NlMRS , LB 18 JUILLET 1875. Oa a vu hier que sous prétexte de « filer de la soie », M. Matartrene serait pas tâché d’aller se reposer sous ses mûriers des fatigues que lui a coûtées cette constitution que lui et ses congé* nères ne veulent pas continuer de voter. Quels excellents citoyens que M. Malartre et sa phalange de vacanciers ! Mais surtout quels industriels infatigables ! , Certes, on les a nommés pour s occuper des intérêts du pays ; mais qui filerait de la soie s’ils ne se donnaient de temps en temps le luxe de quatre mois de vacances ? Mais le pays attend sa constiution ; elle est là toute prête, qui n’altend plus qu'un vote ! Hâtez-vous de le donner, puis vous pourrez tous h votre aise filor... la soie de vos cocons. Bah ! le pays peut attendre, et d’ailleurs c’est toujours quatre mois de gagner. Voilà ce qui,à proprement parler, s’appelle abuser d’un moment d’oubli de la part de la France affolée ; voilà ce qui I nous apprendra à ne jamais nommer une Assemblée politique sans limiter son mandât. Tout ce que peuvent faire les gauches pour essayer de parer le coüp, c’est de 1 réaliser ce qui a été décidé dans leurs ; bureaux; maintenir la proposition d'épuisement de l’ordre du jour sains interruption ; mais leurs efforts seront impuissants, et nous verrons se former contre eux ‘une de ces majorités de rencontre dont l’Assemblée nous offre tous les jours le révoltant spectacle. Une fois les vacances votées — et elles le seront, — les gauohes demanderont les élections partielles. Rien, ce semble k première vue, rien de plus logique, de plus légitime que le rétablissement de ces élections ; le pays attend avec impatience que sa constitutioa entre en vigueur ; d’autre part, il ne faut pas oublier que les élections partielles ont été supprimées en vue d’une dissolution prochaine. Or, la dissolution s’éloigne; donc... Avons-nous besoin de compléter le syllogisme ? Mais les Malartre de l’Assemblée se soucient aussi peu de la Lgique qu’ils ignorent que des légitimes impatiences du pays qu’ils méprisent : leurs sièges de député le plus longtemps possible et . leurs cocons avant tout ! Nous n’avons encore que fort peu de I renseignements sur le résultat des élecI tions du premier degré, qui viennent I d’avoir en Bavière. A Munich , 228 libéraux et 5G ultramontains ont été élus. Mais les ultramontains comptaient peu sur un succès dans la capitale, toute leur force se trouvant dans les petites villes et dans les campagnes. Nous saurons probablement bientôt k quoi nous en tenir sur le résultat de .ces élections du premier degré, qui sont décisives. La Chambre des communes a voté k une grande majorité les crédits demandés pour frais du voyage du prince de Galles aux Indes. M. Macdonald, un député ouvrier, et une quinzaine de ses FEUILLETON DU MIDI.— N* 45 19 JUILLET 1875. LES |SGÉ,NES DE LA VIE CLÉRICALE PAR FERDINAND FABRE TROISIÈME PARTIE. V — Oh! oui, gorge-!e, ton bedon de curé, fais-Ie crever d'indigestion, lui et toute sadique; mais sache qu’on n’a pas sur les yeux les écailles de saint Paul, et qu’on y voit clair tout de même dans ta conduite. Pardi ! c’était si difficile en Vérité !... Aussi tout le monde s en est-il aperçu... Et tiens, pas plus tard que lundi passé, en revenant du marché, M. Montrose, un bon curé celui-là, et comme il nous en faudrait un à Saint-Xist, me disait comme ça tout en cheminant : « Eh bien, Pancole, votre nièceaime-t-« elle toujours autant M. Courbezon?— « Toujours de même, monsieur Montrose, « lui ai-je répondu. — Veillez sur elle, « Pancole, veillez sur elle; un curé est, La reproduction est autorisé* pour les journaux fui ont uo trait* *»•" 1» 8omJt4.d*« feus de let-.»•* PREMIfinF EDITION LUNDI, 10 JUILLET 1875. «a ADMINISTRATION Adresser lettres et mandats i l'Administrateur l’a, me Pradier, Nlm« tu lettres non stfranehies tsrent rtfusl*■ ANNONCES RAcu-His...... 10 a Annonças....... %SS e JOURNAL RÉPUBLICAIN LIBÉRAL Corresponds ÙSB A Fftrîf i KM. Havas, Laffitte et O, place de la Bourse, t» et Fontaine, rue deTrévltie, 22, seuls ttharfâ de recevoir les annonces. collègues seuls ont refusé de voter les sommes demandées par le ministère. Plusieurs députés trouvaient ces sommes insuffisantes; mais, d’après le règlement de la Chambre anglaise, un ministre seul peut proposer le vote d’un crédit. La Cliambre peut en réduire le chiffre, mais il lui est défendu de l’augmenter. L’Assemblée a rejeté une proposition tendant à faire supporter par le Trésor . anglais tous les frais du voyage princier, he Trésor indien paiera sa part, bien que !e ministère ait déclaré que le prince n’ira pas dans l’Inde comme le représenj tant de l’autorité royale, mais comme un simple voyageur. Dans la même séance, la Chambre a rejeté, par 190 voix contre 120, un, projet de réforme électorale proposé par , M. Dilke. M. Disraéli a pris la défense àu stalu quo et a ajouté que le gouvernement s’occupait de plusieurs des questions soulevées par le projet de M. Dilke. Les troupes alphonsistes continuent à faire merveilles. Elles ont coupé les forces carlistes commandées comme on le , voit souvent dans ce singulier pays par un prêtre, le curé Flia ; elles ont battu et dispersé à Boltona la bande . d’Alvarez ; enfin quoiqu’on ne sache rien de positif sur la position de Dorre-garay, le bruit court que, fatiguées par les marchés forcées qu’elles ont dû i exécuter pour së dérober à la poursuite . des alphonsistes , elles se sont débandées. Les bonapartistes sont reconnaissants.: ils savent gré à M. Buffet de les avoir cobverts dans cette triste séance ! qui devait tourner à leur confusion, et que'lè vicé^président du conseil a su égarer sur un autre terrain. C’est ce que la Patrie appelle « ramener l’Assemblée dans la bonne voie » et revenir sur la piste du véritable danger ». Ce journal voit avec plaisir « la f phalange des conservateurs se reconstituer contre les radicaux, à la voix éloquente de M. Buffet ». Il ne faut pas s’y tromper : sous fa plume des écrivains bonapartistes, radicaux ou républicains de n’importe quelle nuance sont des mots synonymes. M. 1 Laboulaye, par exemple, est un radical. M. Savary est un radical. Aussi cherche-t-on à englober sous ce nom tous les adversaires de la politique, longtemps crue anéantie, du 24 mai, et s’assimiler l’ancienne majorité, sous les espèces du « parti de l’ordre ». L’Ordre s’écrie: C’est maintenant au cabinet à profiter de sa légitime victoire ; ati parti de l’ordre à resserrer ses rangs depuis trop longtemps ébranlés par une trahison intérieure désormais percée à jour. De là à proposer une sorte d’alliance électorale, accompagnée des pressions et des manoeuvres chères aux adeptes du rouhérisme, il n’y a qu’un pas. L’Ordre le franchit allègrement. Mais qu’on y vei le ! Ii ne faut pas que le radicalisme puisse se relever dans le Parlement; il ne faut rien négliger pour qu’il ne triomphe point dans les élections. S’il arrivait au pouvoir, le radicalisme , il ne proscrirait plus seulement et d’abord les impérialiste^, il frapperait sans distine. tion toute Ta majorité dii lo juillet. Tout ce qui soutient le droit , tout ce qui respecte respecte devoir est plus ou moins impérialiste pour les Gnmbotta. On ne demande pas avec plus de dé1 sinvolture la proscription de tout un parti , qui est, par un hasard étrange , le vrai parti constitutionnel. Le Gaulois est plus violent encore. 11 ’ félicite chaudement M. Buffet, d avoir dévoilé le péril radical. et il l’engage à « compléter les mystérieuses révélations» perdues dans un coin du rapport de M. le préfet de police, sur l’organisation ; radicale et sur les moyens dont elle dispose. Le procès de l’empire est fini; il s’est ter. miné à la confusion de ses adversaires.Que Celui üti radicalisme commence. La France honnête battra des mains; Car, du moins •, ' dans rette nouvelle affaire, elle aura la satisfaction de n’être pas obligée de faire cause commune avec les prévenus. M. Buffet a commis là de belle beso; gne. Au point de vue de la ‘probité politique, sa manoeuvre est désormais jugée : elle ne reste plus qu’une habileté . parlementaire qui, comme dit M. Veuil-lot, « fait grand honneur au ministre , : au point de vue de l’art ». LeT’édactaur en chef de Y Univcrs compfère sa pensée en déclarant que. depuis longtemps , : « la tribune n’avait pas vu de travail plus proprement fait ». C’est en vain que le Français espère que 1 opinion publique ne se laissera pas égarer par le vote de l’ordre du jour Baragnon, et que ce scrutin inattendu ne dissimulera pas l'échec des bonapartistes. A voir fa joie de la faction, il est évident qu’elle compte abuser auprès du pays de l’issue inespérée de ce grand procès où le gouvernement lui a tendu la main. L’Officiel n’a pas encore promulgué la loi sur l’enseignement supérieur. En attendant, les organes de rultramonta-nisme sont dans un délire de joie : ils jettent absolument le masque, M. Veuillot prononce le : N une dimittis de saint Si-méon. Il déclare qu’il peut maintenant mourir L’Union considère la loi comme le puissant outil de l’avenir qui permettra de refaire la société française. Oh ! oui, la société française est refaite ! Tous avouent que c’est le couronnement aussi complet qu’inespéré de quarante années de luttes. Cette joie doit achever de porter le remords dans la conscience des députés dont l’incroyable absence a permis à la loi de passer. Un député envoie au National— qu’on n’accusera pas d hostilité contre les gauches — un calcul duquel il résulte que la loi aurait été rejetée si tant de députés des gauches n’avaient pris le train de cinq heures pour aller dîner k Paris. Cette négligence inqualifiable est bien grave comme sym-lôme. ) i AUTRICHE-HONGRIE On écrit de Vienne, 18 juillet : Le gouvernement de T Autriche-Hongrie doit avoir des raisons bien sérieuses pour éviter actuellement tout conflit aven la Turquie et toute immixtion dans les affaires intérieures de ce malheureux pays, gouverné par des barbares, car les jbur-« jbur-« fois, un homme comme les autres. » Tu le vois, on sâit de tes nouvéllés... Bon Dieu du ciel ! choisir pour galant une robe noire !.... — Ma tante ! s’écria Cécile, qui pour la première fois de sa vie, se sentît Ca able de haine, vous êtes une malheureuse... Allez-vous-en ! Je ne veux plus vous voir dans ma maison, partez! — Situ ne veux plus me voir, ferme les yeux comme les taupes. Je ne quitterai pas la maison de Marianne sans savoir pourquoi. — Vous dites que vous ne vous en irez pas ! s’écria Cécile, dont le premier accès de colère fut terrible, eh bien...» Elle leva les lieux bras sur sa tante qui, épouvantée cette fois, s’était blottie sous la lourde table de chêne ; mais Cécile, honieu-e d'elle-même, se couvrit tout k coup le visage de ses mains, et glissa sur une chaise, où elle éclata en sanglots. « Oh ! murmura t-elle k plusieurs reprise-, oser calomnier M. te curé, un saint, un vrai saint du paradis sur la terre!... Se peut-il que le monce soit si mauvais!.... Jelequitterâi, mon Dieu ! je le quitterai, ce monde que vous avez maudit. » Après quelques minutes, elle ouvrit la porte, et, sans même se retourner vers sa tante qui, pelotonnée comme une vieille chatte galeuse derrière les larges piliers de la table, guignait ses moindres mouvements, elle sortit. VI Les ciisde la Fumade k la mare do Pierre-Brune ayant été entendus de quelques laboureurs mutineux, ils étaient accourus, avaient 'arraché le cadavre de l’Avocat des mains de sa mère éperdue, et persuadés que M. le curé, médecin dans l’occ sion, parviendrait à le ranimer, l'avaient sans hésitation apporté au presbytère. Aussi, quand Sévéra-guette y entra, la vaste cuisine des Récollets était elle encombrée de monde. Outre les paysans venus au seeours de la Fumade, tous les parents du malheureux Sanégrol, jusqu’aux arrière-petits-cousins ^inclusivement, avertis, on ne sait par quelles voies, de la catastrophe de la nuit, étaient là, soucieux, empressés, rangés déjà en bataille devant la succession. Tantôt debout autour du cadavre, tantôt penchés sur lui popr s’enquérir de son é at, ces campagnards avides et dissimulés jouaient l’éternelle comédie des héritiers, comédie lamentable, qui ravale l’homme au dessous de la brute, car enfin les animaux entre euxse regrettent. Faisant des efforts inouïs pour donner k leur visage quelque vague exp*es1 sion de tristesse, ces hommes durs et avares remplissaient la cure de leurs gémissements hypocrites. Mais tandis qu’un oeil laissait filtrer quelque maigre larme, on voyait l’autre épier si le mort n’allait pas se relever, et il était facile de consulter que le masque même de la douleur ne pouvait tenir sur ces faces pétrifiées par la plus absorbante des passions: la féroce cupidité. « Allez, monsieur le curé, je crois que vous pouvez laisser mon oncle tranquille comme ça, dit un neveu de l’Avocat à l’abbé Courbezon qui tâchait d’agglutiner la poau du crâne du malheureux Sanégrol. — Hélas ! interjeta un cousin germain, quand on'est mort, on est bien mort, et ce ne sont point les drogues d’apothicaire qui nous font revenir à la vie. — Voyez comme il est vert, monsieur le curé !... Oh ! nous vous en prions tous, ne tourmentez pas davantage ce [texte manquant] naux officieux font des efforts incroyables pour montrer comme insignifiant le mouvement révolutionnaire qui a éclaté dans la province turque l’Horzégoviuo, où la p ipulat ou désespérée se soulève contre les Turcs, ses bourreaux. Le fonctionnaire qui est à la tête du bureau do la presse h la chancellerie de l’empire, que les journaux satiriques de Vienne ont surnommé « le conseiller intime pour les affaires d’apaisement », a énormément de besogne pour calmer les esprits, qui sont naturellement émus par les cruau. tés des pachas et do leurs soldats contre . les pauvres slaves do la Porte. Mais, quoi que disent les organes de la chancellerie, on sait par d’autres sources ce qui se passe en Herzégovine et l’on est forcé do dire que l’Europe aurait lieu de rougir des scènes qui se passent sur cette partie du continent. Voici ce que je tiens d’excellente source : Il est vrai que la perception des impôts et contributions est la cause du soulèvement de THerzégovine, mais de quelle manière se fait cette perception ? Les Turcs (qui pouvaient savoir que les gens riches ont émigré et quo le reste n'a pas de quoi ; payer.) tâchent néanmoins d’arracher le dernier sou à ces pauvres gens. Si les injures et les menaces-ne conduisent à rien, iis procèdent par la torture à deux degrés. Le premier est la torture froide. On rassemble un groupe de familles des contri; buables dans une maison dont on ôte le toit en fermant portes et fenêtres et en veillant bien à ce que personne ne sorte sans payer. Alors, quelques soldats montent sur les murs, munis chacun d’un tuyau de pompe k incendie. Puis ees barbares commencent à ! Verser de l'eau sur la tète des malheureux ; contribuables, de leurs femmes et de leurs : enfants, jusqu’à ce que la résistance de ceux qui ont caché un objet do quelque valeur soit complètement brisée, ou jusqu’à ce que les forces mêmes des soldats soient épuisées. Mais la torture chaude est plus terrible. On rassemble éga'ement les gens dans une maison, puis l’on y met le feu ! Peuvent-ils donner quelque chose pour rançon, ils sont sauvés ; sinon, ils sont brûlés. Ainsi, dans une seule maison, les soldats du pacha turc ont brûlé vives vingt personnes dont lo crime était de ne pouvoir payer les impôts! Oa se demande si le roi de Dahomey n’est pas un modèle de clémence auprès du cruel gouverneur de cette province euro. péenne de la Turquie. Et la puissance la plus voisine, l’Autriche vers laquelle les malheureux Herzégoviens lèvent les mains eq suppliant, leur tourne le dos et fait dire par ses journaux qu’il n’y a pas de quoi-s’inquiéter. Il est vrai que les soldats turcs ne tourmentent pas seulement les chrétiens, mais aussi les mahométans qui ne peuvent payer leurs impôts ; mais les deux . FremdenàlaU, de Vienne, et les autres organes du conseiller d’apaisement vont trop loin en disant que cette impartialité de persécution prouve l’innocence de la Turquie, c’est-à-dire 1 absence d un système politi. que ou religieux. L’Europe, qui nourrit 2 millions de soldats, a bien le droit de se ; demander pourquoi les Etats chrétiens et les puissances à la tête de la civilisation ! tolèrent sur le sol du.continent des cruautés sans nom. L’explication qu’on m’a pu donner de l’attitude du comte Andrassy . est que cet homma d'Etat s’abstient do toute mesure sur les questions de l’Orient ’ avant de s’être concerté avec l’Allôtuague et la Russie, et ces puissances tardent à se ; prononcer sür ce soulèvement de ['Herzégovine. 1 Le khdéive d’Egypte a envoyé 10,800 francs pour les inondés du Midi de la France. Le prince héritier d’Egypte a souscrit pour 5,000 fr. IIV'TFJîIFIl Le Journal officiel du 10 juillet publie ce qui suit. — Par décret du 14 juillet, les électeurs du canton ouest d’Orléans (Loiret) sont convoqués pour le dimanche Ior août prochain, à l’effet d’élire leur reprdsentant.au conseil général, en remplacement do M. ' Cherpin, décédé. — Par décret du 15 juillet ont été i.om-Itiés : Président du tribunal de Fontaine; bleau , M. Maugis , président à Nogent-le-Rotrou. Président du tribunal de Nogent-le-Rotrou, M. Jonot, juge d’instruction à Sens. Juges : A Sens, M. Affaire, juge d'instruction à t Nogent-le-Rotrou ; à Nogent-le-Rotrou , M. Pioerron de Mondésir, juge à Vitry-lei François ; à Vitry-le-François, M. Maurel, .juge suppléant à Fontainebleau. > Procureur de la République à Epernay, . M. Fiandrin, procureur de la République s de Coulommiers. ; Procureur de là République à Coulom-miers, M. Feuillolay, substitut à Auxerre. Substitut à Auxerre, M. Marie, substitut a Meaux. i Substitut à Meaux, M. Quinquet de Mon-jour , juge suppléant à Châlons sur. Marne, Juge à Pontoise, M. Poncet, substitut h Châteaudun. Substitut à Châteaudun, M. Le Mao ut , avocat , doeteur en droit. Jugea Thonon, M. Jordan, avocat, doc. tour en droit. Juge suppléant au Mans, M. Bohineust. ' Juge suppléant à Bourgoin , M. de Bey. lié, avocat. M. Affaira, nommé juge à Sens , remplira au même siège les fonctions de juge ; d'instruction. M. Pioerron de Mondésir juge àNogent; le-Rotrou, remplira au môme siège les fonctions déjugé d’instruction. M. Poncet, juge à Pontoise , remplira i au même siège les fonctions dé jugé d’instruction. •M Grivaz, juge suppléant à Annecy , y est spécialement chargé du réglement : des ordres pendant l’année judiciaire 1874-1875. ' ; — 'Décrets : portant nominations dans ' les justices de paix; — nommant des percepteurs. — Par décret du 14 juillet, M. Coffeau, conseiller référendaire de 2* classe à la cour i des Comptes, a été nommé membre de la ' commission chargée de l’examen des comptés 1 rendus par les ministres pour l’année 1870 ■ et l'exercice. 1869, en remplacement do M. O’Donnel , qui' a été nommé conséillêr-maître. — Par décret du 5 juillet, MM. Garrido , et Palasne de Ghampeaux, administrateurs t de lrs classe des affaires indigènes en Co, chinchine, ont été nommés inspecteurs dans le même service. On lit dans le Journal officiel : ! Le ministre de la guerre, voulant donner ^ satisfaction aux demandes qui lui sont adressées par des personnes qui, bien que [ ne s’étant pas encore mises régulièrement en situation de profiter des dispositions des ' articles 41 de la loi du 54 juillét 1873, 39 , et 55 de la Toi du 13 mars 1875, désirent concourir pour des emplois de sous-lieute: nant de réserve de Tannée active ou d’offi' cier dans l’armée territoriale , ’ a décidé qu’uüe nouvelle sessibri d’examens sera ouverte, lé 1er décembre prochain , dans tons les corps ‘d’armée. Les programmes des connaissances théo: pauVredéfunt, murmura une tante. — Tenez, ajouta une'arrière-petite■ cousine, la preuve qu’il est trépassé et que vos ingrédients n’y feront rien, c’est que la cervelle lui fuit de la tête comme du saindoux d’un pôt fêlé... Miséricorde du ciel, ça me fend le coeur ! — O Jésus-Seigneur-Dieu ! s'écria tout k coup une nièce, je crois qu'il a remué une jambe ! » La multitude des héritiers pâlit. « Il était si malin de son vivant, l'Avocat, qu'il pourrait bien faire le mort k présent qu’il est mort ! » dit un des villageois qui avaient aidé k transporter le cadavre au presbytère. Les héritiers s’entre-regardèrent avec une inëxpfimabië anxiété. « Fumât est mort ! dit l'abbé Courbe-zou laissant retomber la tête du Sanégrol sur le matelas où on l'avait couché. — Enfin ! » soupira l'un des parents perdu dans la foule. Celte parole naïvement atroce donna un frisson au curé. « Qui ose parler ainsi? » demanda-t-il d'une voix irritée. Les héritiers cachèrent leurs faces épanouies dans leurs mouchoirs, et restèrent muets. Le vieux desservant entra dans sa chambre, où sa mère, sa soeur et la Cassarotte faisaient de vains efforts pour consoler la Fumade. v Hélas ! marmottait la vieille sanglotant. qui soignera le bien k présent ?*... Dieu du ciel ! c’était si.pcopre, si beau, si bien prigné, nos châtaigneraies et nos olivettes de Sanégra ! C'était luisant comme la prunelle de mon oeil,... Aussi tout le monde crevait de jalousie en voyant seulement nos récoltes sur pied ! On disait comme ça en parlant de notre vin et de nos châtaignes : c’est le triomphe du pays ! Ah ! Jésus-ilaria ! faut-il être malheureuse, perdre mon Fumadou!..,. Voilà pourtant ce que Ton gagne à se ramasser de la viande : les mandianis vous assassinent ! car, ça ne peut être que quelque pouilleux de grand chemin qui a fait îè coup... . Il était sî jfeüne, mon Fumadou! A peine quarante ans, mon bon monsieur le curé, à peitlë quarante ans.... Hier, il paraissait si content en dévalant atix Récollets, il rossi1 gnolait comme qtii va àTa noce... Âh ! si j’avais su... Enfin, voilà, j’ai mis au trou mon homme, ma bru et maintenant mon pauvre garçon.... Savez-vous que tout n’est pas rose sur la terre, monsieur le curé, et qtie tout de mêmec?estun bien rude métier que celui de vivre d’être mère ? Allez, il n’y en a pas de plus terrible sous la roue du soleil... Oh! mais ça finira bientôt, j’ai soixante-douze ans, et je n’userai plus beaucoup de chemises par ici-bas ! » La Fumade se leva, et, malgré le curé qui essayait de la retenir encore, elle ouvrit la porte de la chambre. « Eh bien! s'écria-t-elieen voyant la cuisine déserte, où sont-ils tous à celle heure ? où i’ont-ils porté, mon pauvre défunt? — Ils sont partis pour Sanégra, » dit Sévéraguette seule sur le pas de la porte. La Fumade se précipita vers l’escalier, et, accompagnée de Marthe, prit le chemin de Sanégra. a Ah ! Sévéraguette, 'dit le desservant entrant dans la cuisine avec sa mère, il Faut que Dieu soit bien las de mes fautes pour me châtier aussi cruellement qu'il vient de le faire par la mort de Fumât — Mais, monsieur le curé, ce n’est pourtant pas vous qui êtes cause de sa mort. — Et qui donc, mon enfant? qui donc r Pensez-vous qu’Antoine Fumât eût été assassiné s’il n’eût jamais été question de fonts baptismaux entre [texte manquant] ttSHBaSHBSBHBmSBnaBSBR rique8 et pratiques qui seront exigées des aspirants sont ceux qui ont servi de base aux épreuves lors des examens précédents. Ils ont été insérés, au mois de juillet 1874, au Journal officiel, au Journal militaire officiel, et dans le Recueil des actes administratifs des départements pour toutes armes, le génie excepté. En ce qui concerne ce dernier, le programme est celui qui a été arrêté pour l’infanterie, en y ajoutant les notions spéciales exigées des engagés conditionnels do seconde année de l’arme du génie (circulaire ministérielle du 14 février 1874). Le3 demandes d’admission au concours devront parvenir au ministre avant le 15 septembre prochain, terme de rigueur; elles devront être accompagnées des pièces ei-ap ôs : Acte de naissance, Relevé ou certificat de service. Extrait négatif des casiers judiciaires. ASSEMBLÉ!! NATIONALE Compte; rendu analytique. Séance dû vendredi 16 juillet 1875. Présidence de M. le due d’AuniFFRET-PASQUIER. La séance est ouverte à deux heures et demie. Le procès-verhal de la dernière séance est lu par Ifl. le comte do Ségur, l’un De?. Secrétaires. .VI-Te marquis de FRANOLIEU. — i.o Journal officiel porte M. Théry comme ayant voté pour Tôrdre dti jour do M. Baragnon ; je proteste contre cette supercherie qui se renouvelle trop souvent. M. Théry était ab'sént et. il m’avait laissé ses instructions, ïl s’est abstenu avec moi. M. OtiRisTotHLE. — On a porté M. Gro4-lier comme ayant voté contre l'ordre du jour pur et simple. M. Grollier ôf ait absent. M. le général GUILLEMAUT. —Si j’avais été présent, j’aurais voté contre l'ordre du jour de M. Baragnon. MM. le baron de VINOLS et PÂTISSIER déclarent qu’ils étaient absents au moment du vote. S’ils avaient été présents, ils auraient voté pour l’ordre du jour de M. Bn-raguon. Lo procès-verbal est adopté. L’AssemMée adopte un projet de loi tendant à autoriser le département des Vosges à contracter un emprunt pour les travaux do chemins de fer d’intérêt local. L’ordro du jour appelle la Ire délibération sur le projet de loi organique relatif aux élections des sénateurs. L’Assemblée décide qu’elle passera à une 2e délibération. L’ordre du jour appelle la 3e délibération sur le projet de loi relatif aux rapports des pouvoirs publics. L’article 1er est maintenu. M. bEiGNOEOs demande cpie, dans l'article 2, on substitue aux mots : « la moitié plus un », ceux-ci : « la majorité absolue.» Cette modification, acceptée parla commission, est adoptée. M. ANTONIN LEFÈVRE -PONTAUS développe un amendement tendafit à ajouter à 'l’article2 un paragraphe additionnel ainsi conçu : « Aucune demande de convocation des Chambres ne peut être faire pendant la durée de l’ajournement. » L’orateur fait remarquer le danger qu’il y aurait à ce que , au lendemain de l’ajournement, les Chambres pussent provoquer leur convocation. L’honorable membre trouve le texte de l’article 2 un peu obscur. Or, l’obscurité peut donner lieu à des conflits. L’amendement à pour but de les rendre impossibles par sa clarté. M. LABOULAYE, rapporteur, répond que nous ? si, plus docile aux injonctions de monseigneur, j’avais corrigé mon caractère trop entreprenant, trop.... Eh, dites, qui a envoyé chercher Fumât hier ? n’est-cë pl§ moi ? Qui,"c’est moi qui, pour lui arracher quelques écus promis à la légère, ai précipité cet homme dans la mort ! — Mon enfant ! mon pauvre enfau . ! soupira la Courbezonne, ne t’accuse pas ainsi, tu n’es pas coupable. No m’as-tu pas répété souvent que Dieu juge seulement les intentions ? Quand est-ce que tes intentions ont cessé d’être pures et saintes ? ve, u est visiole que Dieu est irrité, qi sa main est étendue sur nous.. .. Allor à l’église prier, ajouta-t-il, peut-êtreév terons-nous de nouveaux malheurs. » Au moment où ils traversaient le Cloi tre, ils entendirent la grande porte d< Récollets s’ouvrir sous le porche, se r fermer avec fracas, puis des pas raisoi ner dans l’escalier. Ils s’arrêtèrent, virent, à leur grande surprise, paraît Clavel, de Camplong. « Bonjour, monsieur le curé et la con pagnie, dit le maître maçon. — Bonjour, Clavel. Qu’y a-t-il ? . 1 rien de bon, monsieur le cm-rien cm-rien bon, malheureusement. — Parlez vite ! Ce matin, dit Clavel entortilla avec embarras son feutre entre ses doigt comme j’ailais partir pour Saint-Mai t d’Orb, où je travaille en ce moment poi M. Montrose, la servante de notre b< M. le curé est venue chez nous et m’a c comme ça en pleurant : « Clavel, est-ce ;que vous ne pass pas par Saint Xist en allant k Saint-M; tin ! Maissij’y pense, ai-je répondu. “F 0 RD lors, dites k M. Courbezon 1*MHfaf* r«ITT ' > " i i T'uni i> Miiii^lÉiWiiMiiMÎ^ièiiyièwwi le. commission considère i’amend ni nt t i'imne inutile : on no peut guère pré oir lo cas indiqué par AI. Lefèvre-Pouians, sans quo la responsabilité ministérielle iû gravement engagée. Ni. DUFAURE, garde des sceaux, dit qu’on «Vannerait satisfaction à l'atuendeii.e t ce M. Lefôvre-Pontalis, qui pioposo une pr-oau'ion utilo , en rédigeant ainsi la troisième phrase de l'article 2 : « li (le président, de la R’pubLqtii ) devra, Uns l’intervalle des se.-sion-, le* convoquer..., etc.» ?>L ANTONIN LEFÈVRE-PONTALIS déclare accepter cette réduction. AI. LE RAPPORTEUR déclaie également que ia commission adhère. L article ainsi modtiié est adopté. M. SEIGNOBOS dével-ppe un amendement tendant, à ajouter 1 article 2 une disposition ainsi conçue : « Un mois au moins avant le terme légal dos pouvoirs du présid nt de la République, les Chambres devront être réunies en Assemblée nationale pour procéder à l’é-lociion du nouveau président. A défaut de convocation , cette réunion aurait lieu de plein droit le quinzième jour avant i’eipi-ratiou des pouvoirs.» M. LABOULAYE, rapporteur, dit qae la commission et le Gouvernement sont, d’ac-ecrJ pour adopter cette disposition , mais dlo trouve mieux ’ sa place en tête de l'article 3. L’amendement de M. Seignobos . formant lo premier paragraphe de l’article 3, est mis aux voix et adopté. L’Assemblée adopte ensuite lo reste de Partiel 3 , puis les articles 4 à 14 et dernier. L’ensemble du projet de loi est adopte , à la majorité de 530 voix contre 82 sur G12 votants. M. MATHIEU BODET demande la mise à l'ordre du jour de demain de la discussion du budget des dépenses et des recettes de 1876. , , , M. COURCELLE demande qu on attende la distribution du rapport général dp M. Wo-lôwski. M. WOLOWSKI dit qu’en attendant cette distribution qui aura lieu demain ou lundi, l’Assemblée peut discuter les budgets des dépenses qui ont été l’objet de rapports spéciaux, tous distribués. M. COURCELLE répond qu’on ne peut discuter lo budget des dépenses sans savoir co .que seront les recettes. M. MATHIEU-BODET fait remarquer qu on vote toujours les recettes après les dépenses, parce quo l’impôt ne doit être établi que dans la mesure des besoins constatés. M. BARAGNON demande ia mise à l’ordre du jour de lundi. Cette proposition , acceptée par M. le ministre des finances et par la commission du budget, est mise aux voix et adoptée. M. LOCKROY. — J0 demande la parole pour un fait personnel. Hier, .M. le ironis-tre de l’intérieur a par é d’une réunion, privée dans laquelle des propos outrageants auraient (été teaus par des personnes sur ie compte desquelles je devais etre renseign?. J’ai cru d'abord qu’il s’agissait d un discours prononcé a Paris et qui a été publié • à Paris dans les journaux Jo n’avais pas cru devoir répondre. Mais ce matin, AL le ministto m’a tait l’honneur de me dire qu’il avait, entendu faire allusion à des discours tenus dans une réunion privée à Marseille, réunion A laquelle assistaient nos coilè-g coilè-g • Eli bien, j’affirme que HOD d outrageant n’a été dit contre la loi constitutionnelle dit 25 février, loi à laquelle U France entière doit son respect. Je regrette que M. le ministre da l'intérieur, qui n’a pas le temps de lire ios rapports de la commission d’enquête. (Approbation à gauche. Bruit à droite), emploie scs jours et sas nui s à méditer sur des rapports de police (interruptions à droite)Jqui sont faits en partie double pour le comité do comptabilité et pour le ministère de l’intérieur. (Applaudissements à gauche.) (M. le vice-président du conseil se lève pour répondre). Voix nombreuses à droite. — Ne répondez oas! (M. le ministre se rasseoit). I M. MALARTRE. — J'ai l’honneur de déposer ie projet de résolution suivante : « Art. 1er. — L’Assemblée nationale se prorogera à partir du vote du budget jusqu’au 3U novembre 18/5. » Art. 2. — Une commission de 25 membres de l’Assamblée, nommés au scrutin de liste et à la majorité absolue des suffrages, remplira avec les membres du bureau, pendant la durée de la prorogation, les obligations qui lui sont déférées par l’article 32 de la constitution de 1848 et par les autres lois sp éciak-s. Le vote aura 0gj^jjggggjjgg^gji0gàmÊmmiSSàmli^^mm qu’il vienne tout de suite h Camp’ong, que M le curé est a l’agonie.» — Voilà, la chose toute crue. » Le aidî re maçon s essu ja le front. « Clavel, murmura la vieux desservant accabié, vous ne me dites pas toute la vérité: M. Ferrand est mort. .— Mais, monsieur le curé.... Je vous répété que M. Ferrand est mort. Eh bien, oui, raou bon monsieur Courbczou, il est mort ce matin à quatie heures dans les bras de M. ,e curé de Boussagues.... li pat ail qu il vous a demandé plusieurs fois. — Ab ! s'écria le viei-lard fondant en larmes et levant désespérément ss deux mains sur Ja têt , pourquoi /’ai-je quitte hier au so r ? Àîr* 1» Dieu ! mon Dieu 1 votre droite est teirinle' 1 » Il embrassa sa mère, et partit ineon-ti ent pour Camplong. VH La Courbezonne, 'a GassarotteetSévé raguette rentrèrent dans la cui*ine du presbytère. Elle restèrent longtemps comme vissées à leurs chaises, immobiles. silencieuses. La mère ou curé surtout paraissait anéantie. A plusieurs reprises elle re eva ia tête, promena uu regard stupide autour d'elle, et essaya de par er; mais ses lèvres tremblantes ne balbutièrent que des mots initelligibles qui s échappèrent de sa poitrine avec des soupirs déchirants. « Seigneur Dieu ! répétait-elle, Seigneur-Dieu! »' La Cassarotte, quoique bouleversée par tant d’événements funestes, étaii peut-être celle des trois femmes qui dans la crise actuelle, conservait le plus lieu dans les bureaux, conformément A l’ar-lieie 11 du règlement. » Art. 2, — T.es pouvoirs du bureau sont prorogé jr-■vi’.Ma rentrée de l’Assemblée nationale. » Art. 4. — Le premier dimanche qui suivra la rentrée, des prières publiques seront adressées à Pieu, dans les églises et les temples, pour appeler dt-3 secours sur les travaux de l'Assemblée. » Je demande l’urgence. ( Bruit à gauche) M. FERAY. — Pour combattre la demande d'urgence, je dépose une proposition dont voici les termes : « L’Asseirblée nationale continuera ses travaux , sans inieiruption , jusqu'à ce qu’eiie ait statué définitivement sur les lois suivantes : « Loi sur les élections sénatoriales; » Loi électorale ; » Loi sur le budget de 1870, et jusqu'à ce qu’elle ait élu l‘S 75 sénateurs, oont 1 élection est attribuée à l'AssemUéo par la loi du 27) février. (Très-bien ! très-bien ! à gauche.) M. MALARTRE. —Je ferai remarquer à l'Assemblée que les travaux énumérés dans la proposition de M. Feray demanderaient au moins quatre mois. (Exclamations à gauche). Il est procédé au scrutin sur la demande d’urgence. A la majorité de 355' voix contre 319, sur 675 votants, l’urg nce est déclarée. AL AIATHIEU BODET, au nom de la commission du budget de 1875. dépose uu rapport sur un projet de loi portant • u-veriured: crédits supplémentaires au département des finances sur l’exercice do 1875. M. FERAY. — Je demande que l’urgence soit déclarée au profit de ma proposition, qui, étant connexe à celle de AL Alalartre, ne peut qu’être renvoyée à l’examen de la i même commission. Il y a un grand intérêt politique à ce que les lois organiques du gouvernement républicain fondé ie 25 iévriersoient promptement achevées. L’adoption de la proposition de M. Al alan re serait donc une faute politique ; elle serait de plus la violation des prome-ses faites lorsqu’on a voté la loi sur les élections partielles. (Très-bien! à gauche ) M. lo ministre dé l’intérieur vous a dit, un jour, que le pays attendait une constitution. Il ue faut pas le faire attendre plus longtemps. (Très-b'en ! à gauche.) M. BARAGNON. — J'estime que la France a un gouvernement et qu'elle ne s’étonnera pas de nous voir aller prendre part aux travaux des conseillers généraux. Je combats donc la demande de déclaration d’urgence présentée par M. Feray. Cette demande est d’ailleurs inutile, car M. Feray pourra présenter sa proposition à titre d'amendement, lors de ia discussion de la proposition de AI. Alalartre Elle est en outre dangereuse parce qu’elle est la négation du vote que vous venez d’émettre, et il ne convient pas à la dignité de l’Assemblée de se donner un pareil démenti. (Ttôs-biea ! à droite.) M. PICARD. — La proposition de M. Feray n’est pas la négation de la proposition de AT, Malartre ; elle en est au contraire le complément. (Rires à droite.) •Ces deux propositions étant connexes doivent être examinées ensemble. Maintenant, quelle peut être la pensée de M. Baragnon lorsqu’il fait appel à votre dignité dont il veut être le gardien V (Rires à gauche.) Il y a deux semaines, quand vous avez voté 1 suppression des élections partielles, vous avez par-là même reconnu que l’expiration de votre mandat était prochaine, et que vous n’étiez retenus ipi que parla nécessité de voter des lois indispensables au fonctionnement du pays. Et aujourd’hui vous reviendriez sur ce vote ; vous aceepteri-z la demande faite inopinément par M. Malartre qui a conquis sur ce point une si grande autorité. (Rires à gauce.) Le pays vous regarde, et j’ajoute que lorsque de pareilles questions sont posées devant vous do cette façon, il ne vous comprend plus. (Très-bien ! très bien 1 à gauche ) M. VÎALARTRE.— Je viens protester centre un adverbe échappé à M. Picard. Il a dit que ma proposition le copgé vous était faite inopinément. Inopinément ? Mais elle elle est dans le coeur do l’Assemblée depuis longtemps. (Applaudissements ironiques à gauche.) Vous avez parlé de mon autorité en matière de vacances ; mais les vacances s'imposent. à nous. Vous n avez pas encore arrêté le soleil. (Rires.) A ceux qui se montrent si jaloux de la régularité de nos institutions, je dirai quo c’est dans ce même intérêt que nous demandons nos congés. Les conseils généraux ouvrent le 16. de calme et déraison. Elle devait cette énergie de tempérament à un apprentissage précoce du malheur. A l'époque où elle habitait son misérable séchoir dans la montagne. ayant souvent manqué de pain pour ses enfants, la Sanégrole avait souffert le p u* atroce des suopfices. Aussi pouvait-elle désormais défier en quelque sorte les aiguillons de 1* douleur. Réfléchissant au moyen le plu* sûr d arracher la Gourbi zonne et Sévéraguette à l'impression si accablante du moment, L pauvre paysanne leur proposa de sortir pour aller au-devant de Marthe. « Le temps est si beau ! du. elle. — Comme vous voudrez, sortons ! murmura la mère du curé abandonnant son bras à la veuve. — M n inetie ! Jeannot 1 » cria la Cassa* rôtie, hêani es enfants qui jouaient dans le Cloître. Ou descendit l'escalier. « M is, dit Cécile, s'arrêtant tout à coup sous le porche, les petits n om pas déjeuné, je crois ? — Tiens, ma foi, c'est vérité 1 répondit la Sanégrole, on n'a pas eu idée à leur donner la becquée, ce matin. Reùlf*nl°,lS« bi Courbrzonne, — CVst inutile, r?p’il l’orpheline en quête d’un prétexte qui lui permit de s i-soier, je vais les emmener déjeunera Saint-Xist. Nous vous rejoindrons bientôt. — Oh, mais, non, non ! s’écria la Cas-sarotte ; ils se lèvent à peine et n’ont pas encore faim. — Est-ce que tu ne croquerais pas une tartine de miel bl ne, toi 7 » demanda Sévéraguette à la petite fille. Marineuesouritallongeantses mignonnes lèvres d un rouge de cor «il. « El toi, Jeannot, qu en dis-tu? » Le petit paysan ouvrit des yeux dème surés. üSï [texte manquant] US M*SI MIDI r». ytifiün mOEm iÿjjgEiSiüyÉtmmiSimSS'Sîmtiii ■: Pouvez-vous raisonnablement espéror voter tous les projets de lois que vous a énumérés M. Feray d'ici au 16 août ? Voix à gauche. — Oui ! oui ! M. MALARTRE. — D’ailleurs, AL Feray, dans sa propos’tion, a oublié bien d autres lois importantes, parmi lesquelles je citerai les lois militaires. On nous dit que nous no voulons pas faire les lois constitutionnelles, — nous les avons faites, — on nous dit qu il n y a pas de gouvernement, — la séance o hier prouve qu’il y en a un. (Très-bien ! Très-bien ! à droite.) M. TOLAIN. — Dans des circonstances à p-‘U près semblables ; je me suis déjà permis de faire remarquer à la majorité de cette Assemblée que pn-ndro des vacances alors que le point important consistait à voter If Constitution et les lois organiques, c'.'tait déclarer qu’on ne voulait pas donner de gouvernement au pays. Api ès la séance d 11 r, la proposition de vacance ne peut pu.-, avoir d’autre signification que celle-ci : Nous refusons d’otga-niscr le gouvernement de la République, car il y a dans notre esprit l’amère-peoseo de renvers r ce gouvernement si l’occasion s'en présentait (Bruit à droite.) La République a été proclamée, et à l’aide du pays nous saurons la défendre. Et il me semble que M. le ministre de l'intérieur, après avoir dit à cette tribune qu'il saurait défendre la loi du 25 février, doit avoir intérêt à voir voter les lois complémentaires de la Constitution (Très-bien ! très-bien ! à gauche.) L’urgenco sur la proposition de M. Feray est mise .aux voix et, à la majorité do 371-voix contre 331, sur 702 votants, n’est pas déclarée. » M. LE MARQUIS D’ANDELARRE demande à l'Assemblée la mise à l'ordre du jour du projet de loi portant règlement définitif du budget de 1868. (Assentiment ) AI. FAYE dmande la mise à l’ordre du jour du projet de loi relatif au chemin de fer d’Angoulême à Alarmand >. Cotte proposition est adoptée. M. CHRISTOPHLE demande à l’Assemblée de mettre à l’ordre du jour de jeu fi prochain la deuxième délibération sur le projet de loi relatif à l’élection des sénateurs. Cette proposition est adoptée. L’ordre du jour aupelle la 2e délibération sur le projetée loi relatif au rétablissement du titre de premier avocat général dans les cours d'appel. Les rois articles du projet de loi sont adoptés. L’Assemblée décide ensuite qu’elle passera à la 3e délibération. .Le renvoi à demain de la suite de l’ordre du jour est mis aux voix, et, après une épreuve déclarée douteuse, n’est pas prononcé. L'ordre du jour appelle la 2e délibération sur la proposition de M. Parent, iela-tive au code d'instruction criminelle. Eu l’absence de M. Parent, la discussion est ajournée. L’Assemblée ajourne également, à la demande de M. le general Pellissier, le projet do loi relatif au service militaire des Français domiciliés en Algérie, et, à la demande de AI. le mini-tre de l'instruction pubhqae, la proposition portant fixation du traitement et de la pension de retraite des instituteurs et insiitutiices primaires. L’ordre du jour appelle la discussion du projet de loi ayant pour objet d’accorder à M. Feray Bugeaud d Isly une pension de 6,ü00 fr. Eu l’absence du rapporteur, la discussion est ajournée L'ordre du jour appelle la discussion du projet de loi ayant pour objet l'établissement d’un impôt sur les vinaigres et sur l’acide acétique. AI. CLAUDE (Meurthe-et-Moselle)'développe un amendement tendant à établir sur tous les vinaigres un impôt uniforme de 4 fr. La proportionnalité que propose d’établir la commissione-t impraticable et sans intérêt. L'amendement est d'ailleurs conforme au projet primitif du gouverne-nement. M. PLICHON, rapporteur, soutient le pro.jet de la commission, qui est inspiré par un sentiment de justice. L’impôt ne sera pas absolument proportionnel mais il sera gia-dué et ne pèsera pas aussi lourdement sur les vinaigres des classes pauvres que sur les vinaigres spécialement consommés par les classes riches. M. LÉON SAY, ministre des finances, dit quo l’impôt au degré est très diffici'e à établir, faute d'instruments spéciaux. Au point de vue des consommateurs et des producteurs, l'iniérét est très-minime, mais la régie est très-intéressée à maintenir une taxe uniforme. M. GANIVET demande le renvoi à demain. La suite de la discussion est renvoyée à demain. M. le PRÉ IDENT indique l’ordre du jour de demain. A i ne heure, réunion dar.s les bureaux. Nomination des commissions mensuelles. AI. le PRÉSIDENT propose de mettre à l’ordre du jour des bureaux la proposition de AL Malartre. (Réclamations à gauche.) L'Assemblée décide que la commission chargée d’examiner la proposition de M. Malartre sera nommée demain. La séance est levée à six heures moins dix minutes. Service spécial du MIDI Versailles, 17 juillet. Je vous signalais hier l’analogie «le la situa ion actuelle avec celle de juillet 1874. Eh bien, à mesure que la lumière se luit sur les événements de cette semante, l'analogie appar.àt p us com plète et se rapproche de l’identité.
| 36,502 |
8674020_1
|
Court Listener
|
Open Government
|
Public Domain
| null |
None
|
None
|
Unknown
|
Unknown
| 148 | 226 |
SUMMARY ORDER
Plaintiff Margaret D. Nelson appeals a judgment of the District Court dismissing plaintiffs lawsuit without prejudice for lack of personal jurisdiction, pursuant to Rule 12(b)(2) of the Federal Rules of Civil Procedure. Plaintiff alleged several counts of wrongful death, medical malpractice, and fraud against defendants, related corporate entities that operate Massachusetts General Hospital in Boston, MA. We assume the parties’ familiarity with the facts and procedural history of this case.
We review de novo a dismissal for lack of personal jurisdiction. See, e.g., Best Van Lines, Inc. v. Walker, 490 F.3d 239, 242 (2d Cir.2007). In this appeal, we have reviewed all of plaintiffs claims and affirm for substantially the same reasons stated in the District Court’s comprehensive Memorandum Decision and Order of September 20, 2007. See Nelson v. Mass. Gen. Hosp., No. 04-cv05382, 2007 U.S. Dist. LEXIS 70455, 2007 WL 2781241 (S.D.N.Y. Sept. 20, 2007).
| 15,409 |
https://github.com/hzut/gerrittb/blob/master/java/com/google/gerrit/server/plugins/PluginUtil.java
|
Github Open Source
|
Open Source
|
Apache-2.0
| 2,019 |
gerrittb
|
hzut
|
Java
|
Code
| 316 | 889 |
// Copyright (C) 2017 The Android Open Source Project
//
// Licensed under the Apache License, Version 2.0 (the "License");
// you may not use this file except in compliance with the License.
// You may obtain a copy of the License at
//
// http://www.apache.org/licenses/LICENSE-2.0
//
// Unless required by applicable law or agreed to in writing, software
// distributed under the License is distributed on an "AS IS" BASIS,
// WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
// See the License for the specific language governing permissions and
// limitations under the License.
package com.google.gerrit.server.plugins;
import com.google.common.base.Strings;
import com.google.common.collect.ImmutableList;
import com.google.common.collect.Ordering;
import com.google.common.io.ByteStreams;
import com.google.gerrit.extensions.annotations.PluginName;
import com.google.gerrit.extensions.webui.JavaScriptPlugin;
import java.io.IOException;
import java.io.InputStream;
import java.io.OutputStream;
import java.nio.file.DirectoryStream;
import java.nio.file.Files;
import java.nio.file.Path;
import java.util.List;
public class PluginUtil {
public static List<Path> listPlugins(Path pluginsDir, String suffix) throws IOException {
if (pluginsDir == null || !Files.exists(pluginsDir)) {
return ImmutableList.of();
}
DirectoryStream.Filter<Path> filter =
entry -> {
String n = entry.getFileName().toString();
boolean accept =
!n.startsWith(".last_") && !n.startsWith(".next_") && Files.isRegularFile(entry);
if (!Strings.isNullOrEmpty(suffix)) {
accept &= n.endsWith(suffix);
}
return accept;
};
try (DirectoryStream<Path> files = Files.newDirectoryStream(pluginsDir, filter)) {
return Ordering.natural().sortedCopy(files);
}
}
static List<Path> listPlugins(Path pluginsDir) throws IOException {
return listPlugins(pluginsDir, null);
}
static Path asTemp(InputStream in, String prefix, String suffix, Path dir) throws IOException {
Path tmp = Files.createTempFile(dir, prefix, suffix);
boolean keep = false;
try (OutputStream out = Files.newOutputStream(tmp)) {
ByteStreams.copy(in, out);
keep = true;
return tmp;
} finally {
if (!keep) {
Files.delete(tmp);
}
}
}
public static String nameOf(Path plugin) {
return nameOf(plugin.getFileName().toString());
}
static String nameOf(String name) {
if (name.endsWith(".disabled")) {
name = name.substring(0, name.lastIndexOf('.'));
}
int ext = name.lastIndexOf('.');
return 0 < ext ? name.substring(0, ext) : name;
}
static ClassLoader parentFor(Plugin.ApiType type) throws InvalidPluginException {
switch (type) {
case EXTENSION:
return PluginName.class.getClassLoader();
case PLUGIN:
return PluginLoader.class.getClassLoader();
case JS:
return JavaScriptPlugin.class.getClassLoader();
default:
throw new InvalidPluginException("Unsupported ApiType " + type);
}
}
}
| 6,507 |
https://github.com/Air2air/mern/blob/master/client/components/Geo/Geo.js
|
Github Open Source
|
Open Source
|
MIT
| 2,021 |
mern
|
Air2air
|
JavaScript
|
Code
| 61 | 152 |
import React from "react";
import { usePosition } from "use-position";
import BeatLoader from "react-spinners/BeatLoader";
const Position = () => {
const watch = true;
const { latitude, longitude } = usePosition(watch);
return (
<>
{!latitude ? (
<BeatLoader color="red" size={10} />
) : (
<>
latitude: {latitude}
<br />
longitude: {longitude}
<br />
</>
)}
</>
);
};
export default Position;
| 44,363 |
bub_gb_fRc4AAAAMAAJ_17
|
German-PD
|
Open Culture
|
Public Domain
| 1,785 |
Allgemeine Literatur-Zeitung
|
None
|
German
|
Spoken
| 7,766 | 16,310 |
leicht daher, ‚dafs er im Waller ichwimmt? XI. Kapis Bchwimmt der Körper eines: lebeuden Alenichen wenn er zücklings auf dem Waller liege, fo muß er auch in de- hender und lizesder Stelluug fchwimmen. XI. Kap. Alle lebendigen Landinierey die vierfüfsigen fowehl als die kriechenden Schwimmen von Natur, XI. Kap. Viele Vögel haben von Natur das Vermögen zu Ichwim- men ; Audern Scheint 5 verfäge zu feyu. XIV. Kap. Von dem Fluge der Vögel. XV. Kap. Von dem Schwimmen der Fiiche. AVI. Kap. Vergleichung zwilchen dem, Flie- gen der Vögel, dem Schwimmen der Fifche und dem Schwiumen der vierfüßsigen und kriechenden Thiere. AV. Kap. Bey dem Meufchen mufs die Kunlt es ma chen, sis wr vom Waller getragen wird, und nach Wiıltxuhr fchwımmt. XVII, Kop. Verfuch über die Siu- fentolge, die uiner denen Arten von lebendigen Ge- fchöpfen in Rücklicht auf ihre Fähigkeit zu fchwimmen Rau: findet. XIX. Kap. Von den Amphibien. Verglei- ehung derielben mis anderu Thieren in Rücklicht auf das‘ Schwimmen . F. $, privil. Induflrie- Compteir zu Weimar. nen ds dem Ienlienifchen übörfeter und mit Aumerkun 670 > Higemeiner Blick auf Ialien nebft einigen geographilch- atififchen Auffälzen die fudöflichen Theile diefer Landes betreffend , von C. 4. H. von Zimmermann, Herzogl. Braunfchw. Hofrathe Arge einem Kupfer. er. 8. 1797. 18 gr. oder ı fl. 24 Fr. ER Der. Name des berühmten Herrn Verfaffers it Burg dafs man in diefem Werke nur i und zwar folgende Auffatze finder : r No. I. Allgemeine Ueberlicht von Fealien. Eine Skiz- ze.2u einem gröfseren \Verke. No. Il. Winterreife von Neapel über die Appenniuen zu den Salperer- Gruben am adriatiichen Meere, nebft mehreren geographifch - Ratifti- fchen Beinerkungen über Puglien- Von C. 4. W. v. Zim- mermann, No. Ill. Herrn Apochekers Heyers Verfucht mit dem in Pulo bey Molieıta und in dem bey Grarma gefundenen naürlienen Salperer. No. IV. Neue In Rruction für die Gemeinheiten des Königreichs Neapel, die Verfertigung genauer Landesbefchreibung betreffend. No. V. Meteorologifche und okonomifche Bemerkungen über das Jahr 1790, vom Hirn. Canonicus F. Giovene Grolsricarius des Bilchafs von Mollerıa in Puglien. Fı $, privil. Indufirie - Comptoir zu eimar. Proctifche Gebirgikunde von Johann Car Wilhelm Voigt, Herzog. Säch/. WW eimvrifcher Bergratha, Zweyte flark vermehrte Ausgabe, mit einem Kupfer. gr 89 1797. Irthl, oder ı fi. sähr. De der Werth diefer Gebirgskunde ichon anerkannt ift, fo zeigen wir blofs an, dafs (ich diefe ze Auflage von 150 Seien auf 386 vermehrt hat. Der Inhalt id fol- Erite Abtheilung. Won den Gebirgen überhaupt. 216 Abtheilung. Von den uranfänglichen Gebirgen. 3ıs Ab- theilung. Von den Flöcgebirgen. 4te Abheil. Ven dem Mulkanitchen Gebirgen. ste Abiheiluug. Von den aufge. fchwemmien Gebirgen. . Erler Anhang. Beytrag zu ei- aeın Verzeichnifle der durch innere Kraft hervorgebrach- ten Berge, Infeln und Landitriche. Ziveyter Anhang. L Recenfon der vorigen Ausgabe in der Allg» d. Bibl. II. Recenfion in dep Allg. Liter” Zeitung.. ' ‘ PR $. privik indufirie- Compteir zn [72 eimar. Griechifche Vafengemälde. : Mit archüologifchen und ar- tifeifchen Eriauterungen der uriginal Kupfer. Her ausgegeben von Ü. A. Höltiger. gr. $- 1797. IB Er oder if. 24 Ar. ve; Original Kupfer dazu unter dem Titel: Umrife grie chifcher Gemülde auf antiken in den Jahren 1734 . 3790 im Campanien und Sicilien ausgegrabenen Pd- den, jetzt ım Bejitz des Ritters PJ illiam Hamilton herausgege en von Mithelm Lifchbein zu Neapel, ır band ır Heft, gros Fulio 1797. I rıkl. oder ı fr F} hr.. Diefs ünd die ror einiger Zeit von uns angekündig- ken Olirskographiichen Hefte, und leistere Kupier von W&Mz j den ‚671 :insf. Platten dis Herm Acafemie- Direktors j ung Neapel, welche alfo nicht durch N:chftich verloheen haben. Diejenigen Liebhaber, weiche das Ha- milton - Tifehb: infche Werk mit engüifchen und franzöli- fchen Texte fehon beüitzen, brauchen ich alfo jew: nur öbigen demtchen, ganz von jenen verfchiedenen , atızu- fchafen. Die zweyte Lieferung wird noch vor Michae- {is 'erfcheinen, und (o werden wir nach und nach die Tifchbeinfchen Kupfer mit deutfchen Erklärungen liefern. TeS, privil. Indwfirie-Compteir zu Heimer. Neue Verlags - Artikel der Crazifchen Buchhandlung in Freyberg. Oflerineffe 1797. re Bernhardi, A. B- gemeinfaßsliche Darflellung der Kanti- ichen Lehren über Sitelichkeit „ Freyheit, Gocheit und Unfterblichkeit, ze Theil, 8. 208, Cyanen, vom Verfalfer des Guido von Sohnsdom, 2s 2 — 11£1 j € re H. EL Briefe über die Massregein, wei- che der Landwirch bey der ‘immer mehr fleigenden Menfchenmenge zu nehmen hat, uebit Bemerkungen über die hohen Pachtgeidee und Guterpreife, 8. — 9a ; au Vortheile der Maftung durch Körner, vorzüglich ee auf die Vermehrung des Düngers darge- Dell. & — 3er , Erier, E J. rn Verfuch einer Anleitung zur Strecken- und Schacht- Mauerung. Mit 6 Kupfertafeln im gr. Folio. 4 — 2081. Ba i i Journal, neues bergmäntifches‘, herausgegeben von A. W.»Köhler und C. A. 8. Hoffmans, ın Bandes 3s und 4586 8. — 16Qr- pen Petjche, G. J. Banimlung einiger Religionsvorträge, er}. 18 gr Tennecker, Seifert, ‚Unterheltingen für angehende avallerie- Oiciere, über verfchiedene Gegenftände des Dienftes, der Beitkunft und Pferdekenntnifs, ir Heft. 9: — der. ‚ &ie Stück 1797. von dem. geöffneten Blumengarten ak Beh und enthält nebft deutfchen und franzöß- ichen Erklärungen folgende Blumen : 72 Die gefiederte Pantofelblume 73. Die grofse Browallie. P 74. Die fchmalblätırige Celfia. 75. Golägelbes Bifenkraut. . , j Der Jahrgang von 12 Stücken mit So Blumen, .koftee bey uns in allen Kunft- u. Buchhandlungen und auf alien löblichen Poflämtern 5 rthl. ;8 ge lächl, od. HE. Z6kr. - ehein. F. $. privil, Induflrie» Comteir zu Weimar, 672 Da ich von inehrereri Selten erfahren) dafs deb.P. ch des (eel. Berens „Bunkomien; ge/chrirben bey: Bröffuung ‚der nenerbsuten Bigaifchen „Stadtbibliothek, delieniu dor ‚sen Sammlung der lierderichen- Briefe. zur Beförderung der Hunanicät fo ukihlieb gedache worden, vor’ ker fchiedenen Liebhabern vergeblich in Deutfchlands’ Ruck gefueht worden ill, fo mich ich hiemit bei kannt, dufs es’bey mirizu haben ıfk und zinch alle eute Buchhandlungen verfchaft werden kann. Der rrews ik 18 gr. A Im Jum 1797. . Johann Friedrich Hartknoch, ‘ ı Buchhändler in: Riga: - er. ‚dl & Den I.iebhabern der Poelie zeipeich an, dafs ich in Jena Subfcription auf die neue verbeHerte und um die Hältıe vermehrte, Ausgabe der Gedichte Kofegartöns ap- nehme, die Oftern 1798 in .2 Oct. Bänden, jeder eıwa zu-go Bögen, auf Bugi. Papier;.. mie’Didoricher Schrikt und 10 Kupfern von Lips, Chodowiecky wi £. w. erfchei- sen wird: Der Preis ii 5 .rchl. in Golde;. beym Ei» =. Auguß Wilbeilm Schlegel, ' h En-alien Bochhandlungen ift zu habens = -» = ‘Ein paar Vase zur: Ehvenrettung‘ unfrer : deutfchei E . Martiale. 13 geheft. 4er N au er " +$ Sowohl Freunde als. Feinde .der Kenien indem lerfchen Mufensimmnach auf 179%. werden diefe paar Bo- gen air Vergnügen durchlefen ‚und jeder-Unpariheyilche wird den vom Verfafler eingeichlagenen Mirzelweg bü- hgen ı Pr SR , ‚ + Pr *r LIEBER | " Die theolopifchen Blätter, wovon der zte ] (No, 1-52. 8, 832. gr. 8. nebft' 2 Beylagen und 3fächeh Regifter — Pr. ı rıhl. fächl.) fo eben heraasgekommein it, werden ununterbrochen und im Ganzen nich dem vorigen Plane fortgefetzt. Wer die Ih. BL wöchentlich fefen-will, wendet üch an die Poltänter und Zeitung rpediionen, : « Gotha, am asten Jun. 1797. au > J. Chr. Wilh. Augufi ® IM. Bücher [o zu verkaufen. Joh. Pet. von Ludewig, ICti, grofies vollländiges "Univerfal- Lexicon aller Pf’ijjenfchaften und Künfte, Leip zig und Halle 1750, in 64 Theilen und 33 faubern Pergg- suent- Bänden, in Folio, flieht bey uns um einen billigeg Preils zu verkaufen, 2 = Gebelen bey Erfurt, d. 24. Jun. 1797. , Geichwißer Lehmann. ) 673 r INTELLIGENZBLATT 674 der. ALLGEM. LITERATUR- ZEITUNG « Numero 82. Bduhabends —- den gen Julius 1797 LITERARISCHE ANZEIGEN. I. Neue periodifche Schriften, aufitziiche Monstsfchrift 1797. März. Drittes Stück, (Görlitz, bey Hermsdorf und Anton) enthält: r. An die Wzhrheit von Ha. M. Fritze, 2. Ueber Harmo- nica und ähnliche Inftrumente nebft Bemerkungen über Harınonicaton überhaupt. Vom In. D. Quand. in Nieski, 3. Plan, zu Errichtung eines oberlaußtzifchen Intelligenz” com;toirs.. Vom Hn. rıu Nolliz Depwiecky, auf Ullers- &ori. 4. Ucber einige Vorurtheile bey Behandlung der Blarern mit befonderer Rücklicht auf die jerze in Görlitz herric heute Blattersepidenie. . Von Hn. D. Struve, $, Chronik Laußtzifcher Angelegenheiten. April, sres Stuck, enthäir: 1. Sonnet, an die Hof- nung, 2. Beytrag zur heilenden Würkung der medici- nifch - angewian.dıen Blectricität von Mu. Hofprediger Hetrofe in Züllichaw. 3. Nachricht von den Stipendien auch übrigen milden Stifengen des Görlitzifchen Kreifes und der von Lofsiichen Sifurz, vor Ho. Ländfteuer- feeretir Crudelius. 4. Verfuch über die Sprache der Wenden ir der Oberlauite vom Hu, Schulcollegen Hartz, fchansky. 5. Gedicht bey dem irühen Grabe eines geliebten Schmes von Un. Friedrich Heinr, Wilh. Demuth sus . Bauzen, 6. Chronik Laußtziicher Angelegenheisen, Schleswig + Holfleinife'ie Provinzialberichte, Jahrg. 1797. Drietes Heft, (Altona u. Kiel in d. Expedition d, -Provinzialberichte) enthalt: I.. Veber die Vorzüge der Brache vor dem Buchwaizenfien in einem fchweren und lehmigten Waizen u. Gerlte tragenden Boden. II. Ver zeichnifßs fanmıl. in dem Herzogihum Schleswig u. .Hol» fein in dem Kirchenjähre 1975. Verehelichten, Gebornen und Geftorbenen. II. Verzeichnifs famtl, in d. Her- zugth. Schleswig u. Holftein in d. Kirchenjahre 1756. Ver- ehelicnten, Gebornen u. Gefturbenen. IV. Haupifum- men der Verehelichten, Gebornen_u. Geftorbenen in d. Herzogth. Schleswig u, Holftein, der Graffchaft Ranzau Herrichaft Pinneberg u. Stadı Altona nach den Kirchen- liften von 1737. bis 1796. V. Verzeichnifs der Summen, welche feit der Repartition v. 14. Nov. 1795. von den verbundexen Braudcaffen der Landdißricte i in d. Herzog- 'thümern Schleswig und Holltein zu erfetzen (ind, von Bertelien. VL Verzeichniis der Verächerungslummen Pioen fürflliche Tifchordnung vom J. 1585. "der, eller Landdiftricte, nach den eingekommenen 3ten Quar. talverzeichniffen und nach Abzug der Verlicherungsfum- men der feit ule. Sept. u. bis zum 22. Oct. 1796, einbes richteren Brandichüden. VII. Herzog Hans Adolph von Yıl. M=- teriailen z. Veberlicht u. Beurcheilung der Umftände, wel che bey der vorgefchlagenen Aufhebung der Leibeigen- fchaft auf den-adl. Gütern in den Herzogthümern Schles- wig u. Holftein in Anrege kominen: vom Prof. Schra- IX. Zwey nützliche Anllalten im Kirchfpiel Rellin- gen der Herrichaft Pinneberg. X. Literärifche Anzei- gen w Nachrichten: Schriftenanzeige; Nachricht; Er klärungen; von Profefler Heinze und von Profelfor Kordes, IL Ankündigungen neuer Bücher. Neue Verlagsartikel von Friedrich Severin zu Weilsen- fels zur Oftermells 1797. Anweifung, practifche, zum vortheilhaften Anbau. der Fruchtbäume, 8. geheftl. Ser. Bekennenifs meiuer Religionsuberzeugungen, nebft eini- gen Gelegenheitsreden, $. geheft, ögr. Bildergallerie, kleine, für Dichterfreunde, gte Samm- lung, Tafchenformar, mit 13 Kupfern, brofchirt, 12 gr. Brutus oder der Sturz der Tarquinier, &, Irthl. Eckersberg , J. W., 15 Gefänge fürs Clavier oder Piane- forte in Mulik geferzt, gr. 4. ırthl. Eheltandsgefchichten, acht merkwürdige, einer bekann- ten Dame, von ihr feibit befchrieben. 8. iggr. Gemählde aller Nationen, zes Heft, ee m Kupf. brofchirt. 1ıgr. Gefchichte der chriftlichen Religion für denkende Lefer. .& ı$gr. Gottfchalgs, J. G, Gefchichte des Uerzogl, Fürftenhaufes Sachlen- Weimar und Rifenach, gr. &. 1 rthi. Laud, das giückliche, ein Neujahrsgefchenk für Kinder, die gern etwas über Länder» und Völkerkunde lefen, 12. brochirt. ı2gr. 'Lamürailie, Heinrich, und Henriette Boifsy, ein gehei. mes Artenllück aus den Tagen der neufränkifchen Re ‚ gierung und des Vendeekrieges, äter und letzier Theil. 8. ı8gr. Novellen zur angenehmen Unterhalung, 15 Bäch. 8. ı9 gr, “N Relk 675 Religionsunterricht, erfter, für Kinder. 8. 6er. Ritter, die, vom Siebengebürge. m. ı Kupf. $. rrthl. Sommer, J. C., die Axe des weiblichen Beckens befchrie- ben, zte Auflage, m. ı Kupf. gr. 8. 4 gr. ‚Stephani, D. H.. Grundriis der Erziehungswiffenfchaft. 8. logr. Sturms, ©. C., Lieder und Kirchengsfänge, ag Aufa- gu 8. 4Er “ Dailelbe auf fein Poflpaßier. 6gr. Wahrheit und Dichtung, ein unterhaltendes Wochen» blate äür den Bürger und Landmann 1797. tes u. Ates Quart. 8. brochirt. 10gr. Zäurs, Königin, oder das bemauberte Birkenwäldchen, vom Verfaller des Orakels zu Endor, iter Th. 8. m. K. 0gr. —— deifelben 2r Theil, $. 18 gr. Note :de Livres nouveaux, cartes geogrsphiqus et eftampes, qui fe trouvent chez I. Decker, Libraire a Bäle. Les prix font en livees de France, dont 24 ezuivaleıt a 12 Aorins d’Empire. Gonjıraion des’ Gracgues, par 5. Real, I vol, pet. in-fol, E pap. vel. magnifique ediriom. — L. ta, MHiltoire abregde d’Angleterre, par F. Plowden, ırad. par Audre, 2 vol. in-$. Hilßoire de l’alfembide eonflituante, par Granier, int. ' L. . ı0£ Memoire pour fervir h la vie de Charloute Corday, par Gironville, in-8. — L. 4. tof. Procis des Bourbons, Louis XVI, Maris Antoinette eic z3voL ini — L.6, 10£, Tableau hiftorique et veridique des prifons, 3 vol, in-$. arec fir. — L. 20, Merborifation des eurirons de Montpellier, par Gouan, Le Maröchal de poche, nour. edit. in-ıg, — L. 5. Claire du Pleflis er Clairaut, ou hiftoire de deux amans dmigres, traduit de l’allemand par Cramer, z2vol in} L. 7. of. Collection choifie de plantes er arbuftes, 2 cahiers ing. * fur papier velin, enluminds. — L. 40 tof. L’Ecu de (x franes, par l'auteur de Paris en mignisture in, — ıgl. Eltonora de Rosalba, ou le confellional des penitens neoirs, traduit de Kanglais d’Anne Radclife, avec fig. de Quererdo, 7 rol. inı& — I. 10. Elimens d’hiftoire generale par Millor, nour. edition, en 9 vol, in. — L. 22. 1cf. Ferdinand er Conflance par Rhynris Feich, traduit da hollandais par Janfen, Seconde edition, 2 volumes in16.— L.. Choix des livres les plus eflim&s de la nouvelle littera- ture dans toutes les fciences et tous les arts, tant en langue allemande qu'eu langue frangsife, ourrage pro- pofe ü fes amis par Aug. Bourcardı. — L. 3. ı2[. Introduction h l’etude des medailles, par Milli. -— L.2. Biflexions fur la nietaphyfique dwrealcul infinitefimal, par Carnot, membre du Directoire executif. — L.2. Sf, „Bu gourernement des finances de France d’apris les loiz 676 eonftitutionelles er d'aprös les prineipes d'un gonver- nement libre er repreleusatif, par le general Montes- quiou, —L. 2. Une jouruede de Paris, ia-12. — L 1. 1ol. Ca petit ouvrage w’eu le, plus grand fucces en France, Meinoires hifleriques et geographiques fur les pays Dtuds enre la nier noire er la mer caspienne, coutenant des derails noureaux fur les peuples qui les hsbitent, des ‚obfetarions relatives ü ia topographie aucienne et mo- 'derne de cette contrde, arrc un vorsbulaire des dis- lectes du Caucale et deux warıes geugraphigues. On y a joint un voyage en Crinde er daus les parties ai diumnies del’BEmipire Rule, ing. — L. 18. Oeurres compleies de Mably, avur, edision em 12 vi in. —L. 45. Les mwemes en 24 vol. in- .16. — L. 15. Des reactions pulisiques par Benjamin Conflant. — L. 7- Les planter, peöine par Rend-Richard-Cailel, in-B. — L.3+ Le fcesu eitier&, poime heroicumigue, jmire du Tafloni® par Augulte C. de l’iunprimerie de Didor l’aind, päp- ıvelln. — L.7 ı0ß Traud d’harmonie er de modulation, par Langle, in-ful, L. ı0, Valcre- Maxime; traduit du lstin pır Rene Binet, ancien recteur de l'univerüce de Paris, 2 volume», in-$. — L. Woldemar par Jacobi, traduir de l'allemand, 2 vol, irt2 L. 4. Margareha, comteffe de Rainsford, traduic de l'anglais, 2 vol. in-1,. — L. 4 Carte des victvires de Buonaparte. — L. 3 Les heroites d’sujourdhui, gravure fatyrique. — L, 2. Le marcchal ferrant .de la Vendee, grave par Capia, d’aprds le tableau de Sables, en couleurn — L. 9, M. T..Ciceronis de ofiziis, de amic.ia er de fenecrue libri, accuratilime emendati, Pariüs, typis Didor jun. ing. — L. 72. Cette magnifique edition (ur papier velin faite aux depens de Renouard, n’a eid imprimee qu’au mu bre de 163 exemplsires qui font numerores. £ Publii Terentii Afri Comoedise, ed. Rich. Bir in-$. pap- velin. Cette belle edition, imprimee avec carzcıöres de Jacob, fait fuite & celle de Virgile le mime, es d’Horace par Oberlin. ie in der PWeldmannifchen. Buchhandlung in Leipzig, find folgende neue Rucher erfchienen: Blankenburgs (Fr. von) literarifche Zufätze zw J. G. Sue zers allgemeiner Theorie der fchönen Kunfte eıc. ır Band. I. bis R. gr. 8. — Irıkl, ı6gr. Caraliv's (Tib.) vollfländige Abhandlung der theoreriichen. und practifchen Lehre von der Electricitär , nebft eig nen Verfuchen. Aus dem Engl. Mit Kupf, Vieree, fehr vermehrte Ausgabe. 2 Bände, gr & — irdıkh 12 gr. Derfeiben ir Band befonders „ für die Belitzer der erfterm Ausgaben. Mit Kupfern. pr. 8. — Irthl. Desndorßs (J. 4.) europäitche Fauna, oder Naturge- Schicht 677 el fchichte der europäifchen Thiers: in angenehmen Ge- fchichten und Erzählungen ‚für allerley' Lefer. Ange fangen von S. A. E. Göze. Tr Baud. gr. & — 2 rıhl* 8 er- Eichhoras (J. G.) allgemeine Bibliothek der biblifchen 8 Lireratur. 7u Bandes 68 Btück. 8. — ı0gr. j Fejt (Joh. Sam.) biographifche Nachrichten und Bemer- kungen über fich felbft. Nach deffen Tode heraüsge- geben von M. V. Chr. Kindervater, 8, — ırrhl, auf Schreibpspier. — 1 rthl. ger. "Beffen über Fleifs und Thätigkeit, deren Nutzen und Beförderung. 8. — Iögr. Drfion Beyträge zur Beruhigung über diejenigen Dinge, die den Menfchen unangenehm find u. f. w- sn Ban des 25 Stück, 8. — lsgr. + Gillier (John) Gefchichte von Algriechenleid, und von. deffen Pllanzflädeen und Broberungeu u, f, w. Ausdem Enäl. 3e Theil, gr. 8. — ırıhl ı6gr. Hapedorar (Chr. Ludw. von) Briefwechtel über die Kunft. Herausgereben von T. Baden. gr. 3. — 2rihl, » Heinrichs (C. 6.) deurfche en 72 Theil, er. & — Irchl a0gr. Yon dem Romane: New Canterbury Taler by Mifs Lee, deisu Ericheinung man mit Ungedult erwartet, wird baldıgft darauf, da man das Original aus England Bogenweife bekommt, eine deutiche Ueberfstzung folgen, welches um Golliion zu vermeiden hierdurch angezeig® "wird. Leipzig. den 17. Jan, 1797. Bey Car! Heinrich Richter find folgende neue Verlags- artikel in der verwichenen Ofter- Melle 1797. er- fchienen, welche in allen Buchhandlungen zu haben . find: Anweifung für Anfänger i in Kupferftichen. & — Jr. Cicero’ Abhandlung uber die Zulänglichkeit der Tugend zur Glückfeligkeit, verdeuticht u. mir Annerkung und ' Yorerinneruug begleites van Chr. Fr. Böhme. 8. — Dan, Joh. Fr. Literatur der dewichen Ueberietzungen der Griechen, ir Bi. 8, — Irıhl. Sgr. Bausiehrer, der, nach Raffs Lehrart, ausgearbeier von einer Gefellichaft padagogifcher Gelehrten u. ‚herausge- geben vr. W. F. Hezel ır zr Bd, Enıhält den kieinen Lateiner oder Isteinifche Lehritunden nach Raffs Lehr- arı 18 25 Bdch. $. — ıg gr. Magazin, antbropologifches u. pfychologifches 3s Stick. r. 8. — dgr ee, ]. r Staitel der Kukur auf welcher die Deus fchen im fünften Jahrhunderte flunden, Aus Verrlei- chung der dewichen und englifchen Sprache gefunden. gr. 8. — 9Er. Provincialblätter „ fachlifche, ır Jahrg. 12 Stück. .— rıhl ” IR ats die, neu überfetzt ron W. F. Hezel, ı5 Buch. 8 — Ter— mn u dürgellelt mach ihrem wahrey Geile für - | Layen beflimmt, ıs Buch. &, — 16 gr. Rechtmätsigkeit, die gerettete, der Todesltrafen. Allee Obrigkeiten, Philofophen und Juriften gewidner. $. 14 er. j Bammlung vorzüglich fchöner Handlungen zur Bildung des Herzeits iu der Jugend, 65 Bdch. 8. — 12 gr Daifeibe auch unter dem Titel: Schöne Züge aus der Geichichte der merkwürdigften Völker nach der Zeit folse geordnet zur lehrreichen Unterhaltung und als Grundisge zu dem Studium der Gefchichte für die Ju» gend, 18 Bdch, Waitz, D. Fr. Aug., Sammlung kleiner academifcher Schriften über Gegenftände der gerichtlichen Arzuey* gelahrlieie u, mediciniichen Rechtsgelehrfamkeit, ır Bd, 38 45 Stück. 8. — 20gr. Nächflens werden fertig: Beuft, Fr. Graf von, hifter:iche w, ftariftifche Auffärze über die fächfifchen Land :n. ır Bd. gr. 8. Buri, L. Y. von, Bruchflücke vermifchten Inhalts. 9. Ularles, J. Ci. Fr., Beyträge zur Kritik des gegenwärti- gen Zultandes der theerstiichen Araneywillenfchaf, ir Bd. ı5 Stuck. gr. % langsdoris, K. Chr, Haudbuch der Mafchinenlehre für d Practiker u. academi che Lehrer, ır Bd, gr. 4. Libanii, Sophiflse, Orationes et Declamationes ad fidem codd. Ms. receuf, et perper. adnor. illuflrarit Beisko Tom. IV. gmaj. Vom pythagoraifchen Bunde. 8, Ich bin willens, eine kleine Sammlung , vielleicht füe manchen, uicht ganz unintereflanter Gedichte, von we* chen Herr George Friedrich Wilhelm Thyme, Adv! pror, - slibier is Sorau, der Verfaller it, im Druck .berauszu« geben, und will folches hiermit nicht nur aukündigen, fondern auch alle Liebhaber der Dichtkunft erfuchen, mich durch gefäligfie Pränumerstion, oder wenigftens Bubicription, wegen der auf diefen Verlag zu verwenden- den Kolten, zu decken, Der Pramm:erafionspreis At nicht höher, als Io gr, nachher aber kasıı“ das Werk un» ser 14 gr. nicht verkauft werden, Die Pränumeration, oder Subfcription lehrt bis Miute Aug. a. c. offen, und im Monat Sept. a. c. wird das Werk ielbft an die Abom- nenten in einem farbigen Umfchlage verabfolgt werden, Die lranumeramen werden vergedruckt, Bm d. 20. März ı7p7. Carl Gottfried Kummer, Bteuereinnehmer u, Adrocar. Verzeichnifs derjenigen neuen Bücher, die diefe Offer- meile 1797. bey Adum Friedrich Böhme ia Leipzig fertig worden find: "Antonius und Kleopasra. Bin Traueripiel in 5 Aufzügen» von ©. 4. Horn, 8. — 13 gr. Bauer, Samuel, Beichtredeu und Abfolutionsformeln mg alle Sonn» und Fefttsge des ganzın Jahres nach dem Evangelien, 2 Thrils, gu 8, — ırıll. 15 gH WNA = Brip 678 P # alle Cliffen vom Lefern; zunächff für'die Jugend und. 679 Brisfe, freundlchaftliche, nehft Schilferungen verfchiede- “ner Städte und Gegenden Deutfchlands für die geübtere Jugend zum Ueherfatzen , aus dem Deutfehen in das Franz. mit einer darzu geh-rigen Phrafeologie. ausgegeben von C. L. P. 8. — 12gr. , Claudius, G. C., über die Kunit Üch heliebt uni ange- nehm zu machen. 8. — 2ver. ‚Commentar, practifcher, über die Pandecten, nach dem S Hellfeld, 3 Thl gr. 8. — ırıhl. 20gr.. *Fumilienfcenen des Grafen von Orienburg. Ein Nach‘ trag der Gefchichte, Jultus Graf von Orienburg. 8. — al gr.. Friedheim, Wilhelm von, und Agnefe von Holftein, oder die Wiedergefundeaen. Ein Schaufpiel in 5 Aufzügen. 8. — Bit. j ur Smith, M. Charl, Marchmond. Bin Roman isn 4 Bänd« chen. Aus dem Eagl. & Wird bald nach der Meils fertig. .. ‚Geichichte eines Geifterfehers. Aus den Papieren des Manues mit der eifernen Larre. Herausgegeben von Cajet.j Tichinck, 3 Theile Neue Auflage. 8. — a rıhl. * [73 ur G. & Erbauungeblatt oder: kurze Betrachtungen über die Sonn- and Felttagsevangelien. Eine Wochen fchrifu. 2 Tneile, gr. — ınıhl. Sgr. Ir Rölligs, D.C G. Entwurf einer Encyklopädie und Me- thodologie der gefammıeu Staaıswillenfcheften, gr. 9. "opchiglichkekt, des in Zeitungen angekündigten Wan- zentodes, und vernünftige Vorfchläge die Wanzen zu ilgen. 8. u | gr _ u; Heinrich. Ein wahres Romänchen ron C. E Lou 11.772 R bes hcitäßiee ‚„M. W.L. Predigten, über alle Sonn - und Feftingserangelien des ganzen Jahres, ır Thl. gr. 9. — irchl. 12 gr. Der en De und fein liederlicker Neffe. 2r Thl 8. ı rıhL Ser. In Commifion: ' -Catholicon, oder encyklopidifches Wörterbuch aller europ. Sprachen. 6te Liefer. gr. 4. ‚Nemnichs Waaren-Lexicon in ı2 Sprachen, gr. 3. — ie BPOREER II. Kaiferinn u. Selbftherrfcherinn aller Beuffen etc. Mit derfelben Portrait, Herausgegeben " yon 6, Freiheren von Tanneuberg. gr. & — I rıhl. — “ Durch einen unerklärbaren Zufall it mit den 2 erfien Heften agree (als der XVII, Abtheil. der com- perdiöfen Bibliosh. d. gemeinnützigfien Konntniffe für alle Stände) das Verzeichuifs der üabey benutzien Schriften "nicht abgedruckt worden. Dies bemerke ich, um Miß- verfändniffen der Beurcheiler vorzubeugen. Es wird Hır- i .680 indeffen mit Inhales- Anzeigen u. Regiftern eben fo beym- . Schlufs des sten Bandes zuflammeg geliefert werden, wie diels bey der Vten u. XXlten Abtheilung, bey dem Be- ligionslehrer u. Zoologen gelchehen if. .’ Andre, “ Vorfteher einer Erziehu.igs- Familie zu Eilensch. Merr Bergeach von Crell hat Gch entfchloffen, die Fortfetzung feines neuen chemifchen Archivs in unferm ‚Verlage herauszugeben, unter dem Titel; Neuelles chemifches Archiv. Der erfle Band wird zur Ofter- Melle 179%. erichei- nen. Wir glauben das chemilche Publicum in Veraus darauf aufmerkfam machen zu dürfen, - Hoffmannifche Buchhandt IL. Münzverkauf. Verkauf eines Miünz- Cabinetr, Die von dem verftorbenen Herrn’ Dechant Wefte fh Halberfladt nachgelaffene, mit vieler Mühe, Sachkennt- nifs und einem an 6000 rıhl. betragendeu Aufwande an- gelchaffee Münzfsmmlung foll, wenn fich binnen den wächften 2 Monaten ein annehmlicher Käufer dazu finder, im Ganzen verkauft werden. Sie befleher gröfstentheils aus felknen Thalern, Medaillen, 'Ducaten und andern Munzforten der mehreften europäifchen Sasten, auch befinden Gch die fämtliche Glocken - Thaler, Juliis Löfer, fymbolifche und viele andre von Madai als felten ange- merkte Thaler darunter. Da nun blos der innerliche Werth diefer Munzfammlung, ohne auf die Beltenheie Rückficht zu nehmen, bey weiten über 3000 rthl., be» trägt; fo it man, um die Weirdäuftigkeiten des einzel- nen Öffentlichen Verkaufs zu vermeidsu, entfchloifen, folche für den äufferft büligen Preis vo. 4000 rıhl, in Pi- ftoletten b Srehl. im Ganzen abzuftehen, und liege d-skaib ein gefchriebenes Verzeichnifs darou in der Expedition der Literatur - Zeitung zur Durchlicht bereit, Uebrigens weder man fich in frankirten Briefen deshalb an die verwitwete Frau Dechantin Welten oder an den Hof- rath Dingelftedt hiefelbft. .. Halberlladt, d, 30. Junius 1797. - IV. Antikritik, Die Recenfion meiner Auffätze in’ Niethammers Jowr. nal (A. L. Z. März 1797.) braucht, für jetzt, keine an- dere Antikritik, als dafs ich den Lefer der A.L.Z. bive, dafs er, wie billig, bey Lefung diefer Berenfion, die Auffätze lelbft zu lefen nicht vergeffen möchte; und will zugleich, dafs diefe Amtikritik auch wider alle zu- künftige Beconlionen diefer Art gelten follıe. — 8. Miimon, * Pr INTELLIFGENZBLATT 8 En’ ' der ALLGEM. LITERATUR- ZEITUNG Numero 83. Sonnabends den Sw Julius 1797 LITERARISCHE ANZEIGEN I. Neue periodilche Schriften, Der Gexius der Zeit. 1797. May. Altona bey ©. F. Hammerich. enthält u L (Zi von J. v. Döring. 1. Kleine Auftäze aus dem’ Franzöfifchen. Chenier, nach der Quotidien- ne. Nercier, La Harps, Gregoire, Buonaparte. Tachy- graphie. Ausgewandsrte. Infolenz und Kaltinn. Robert. ‚Beaumarchais. Diderot. Die Hinrichtung des, Herrn Maratrai de Cuffy von La Cretelie dem jünger. Von Michaud. Noch von dem ‚jüngern Cretelle. Der Abt Deiille. Labilardiere. Vertailles. III. Briefe eines Reifenden durch die Fränkifchen Kreils - Lande, „im Fe- bruar 17797. von W.. Der Junius, enthält: I. Aris uud Galates, nach Ovids Metsm. XTII. 790- 997. von Herra Hofrath Vofs in Eulin. If. Herr von "Berlepfch von A. H. IIT. Telegrapbie der Griechen wid Römer, von G. G. Bredow, IV. Empfindungen bey den Kupferflichen Sommer und Winter, von A. G, Deneken. Y, Rückerinnerung an die Schweiz, von ebend. VI. Grie- “chifche Ausgewanderte, VII. Schreiben an den Heraus- geber des Genius der Zeit, von Lange. VIII -Der Bramine, von A. H. 1X. Ueber den einreifsenden inur- bauen Ton unfrer Gelehrten, von A. L.B. X. Auszug eines Schreibens aus Kärnthen, vom 10 April. XI. Elegie an einen Wahnfinnigen, von Kuhn. Xil. Der Wunfch an Minna, von ebend, XIII. Aus der Ferne im Sommer, “von ebend. XIV. Elegi:, von ebend. XV. Rundgefang, ‘von ebend. . XVE. Die Natur am Abend, von ebend. XVII, Begeifterung; von ebend. XVII. Innfchrife. „auf Algernon Sidneys Grab; nach dem Engl, vorn Halem. XIX. Moralifch poliuifche-Gebete, von A. H. XX. Die Freude, von D. J. J. A. Feuerbach. XXI. Mein Wunfch, "XXIL. Foiftel an J. G. M... von J, J, A. Feuerbach. XXI. Sonderbares Criminalverfahren iu Fraukreich, von A. H. XX1Y. Ton der Journaliften in Fraukreich, von A. H. XXV. Bücheranzeige,. I, Ankündigungen neuer Bücher, Bei Gerftenberg und Dittmar in Gotha und St, Peters- burg ift in vor. Jubilste- Melle erfchienen und in allen Buchhandluugen zu haben: Friebe, (PP. Chr) Hufslands Handel, landwirthfchafe- liche Aultur, Indwftrie und Produkte. ir Bd. welcher das mittlere Aufstand und die Provinzen an der Oftfee und an dem wwifsen Meere enihält. &, ı rthlr. 6 gr. Beide Bände 2 rthir. 3 er. -In No, 342. der Allg. Lit. Zeit, vom vor. Jahre und in mehrern andern gelehrten Blättern it der .erte Bond ‚diefes Werks bereits empfohlen worden, -Diefer 2. Bd. AR in Rücklicht des Plans und der Ausführung dem erften völlig gleich, Vorzüglich findet der Kaufmanu einen Schatz von wichtigen Nachrichten über den Handel in Riga, !Reval, 5t. Petersburg, Archangel, und über den innern Landhandel in Moskau etc. die er anderswo nir- gends in der Vollltändigkeic beifammen -inder, — Bei Gerftenberg und Dittmar in Gocha und 8t. Peters- burg ift vor. Jubilate- Melle arfchienen : s Knackfledts, (Dr. Ch. H. El.) anatomifch- medizinifch- chirurgifche Beobachtungen, welche vorzüglich im me- dizinifch- chirurgifchen Clinikum in St. Petersburg ge Janmiet worden. gr. & ı8 gr. Der Herr Verfaffer hate Gelegenheit, als Lehrer an dem geäschten Clinicum, die wichtigften chirurgifchen Operationen felbft zu verrichten und zu beobachten. Theils sus den dabei geführten Tugebüchern, und thefls aus feiner Privarpraxis theilt er hier die wichdigil Fälle dem medirinifchen Publicum mit. Der Beobach. tungen Gud hundert an der Zahl. Am Ende find nogh einige snatomifche und chirergiiche Merkwürdigkeiten beigefügt. Bey Gerfenberg und Dittmar in Gotha und 8t, Peters- burg ilt vor. Jubilate- Melle erfchienen: von Luce, (Dr. J. PP. L.) Verfuch über Hypochondrie und Hyßerie, ein proktifches Handbuch für derzie. 8. 9er „Je häufiger die leidige Krankheit der Hypochondrie und Hyfterie, diefes vielköpfige Ungeheuer, in unfern Tagen it, und je allgemeiner Ge, leider! aller Wahr- - fcheinlichkeit nach noch werden wird, da man durch den Luxus im Eifen und Trinken uud in der Wollußt aller 4)oO . Art 693 Art fo unbedachtfame: “Vcife auf feine Nerren losltürmt, und nerrenfchwache Eltern fehwerlich ftarknerrigte Kin- der zeugen können; delomehr wird der Herr Verfaller diefes Handbuchs ‚den Dank feiner Zeitgenoflen rerdie- nen, da er diefe, oft fo verwickelte Krankheit, theils an fich.felbft, theils an andern fo häufig zu beobachten Ge- kegenheiı gehabt hat.. Bei Cerflenberg und Dittmar in Gotha und St. Peters- burg ift vor. Jubilate - Melle‘ erfchienen : r Kömmerers, (€. L.) vermifchte Schriften über Gegen Rände der Natur, der Sitten und des Gefchmackr: ir Bd. m. e. Ti, K. 8. 16 er. Der Innhakt it: ı. über den Sulzerifchen Grundfätz der fchönen Künfte. 2. Reife durch einen Theil ron Deutfchland nach Dännemark. 3. über eine Rede von Reynolds an die Schüler der königl. Mahlerakademie in London. 4. Darltellung merkwürdiger Gegenltände in Thäringen. — Leutenberg und die in diefem Schloffe befindlichen Fresko - Gemälde von Lammers, 5. über einige (ekene Mineralien, befonders in Rücklicht ihrer Erzeugung. — Die erfte und dritte Abhandlung umfafst einen wichtigen Theil der Theorie der fchönen Künfte, Der Artickel No, 4. 'wird unter der allgemeinen Weber- fchrift in der Fulge des ;Werks fortgeferzt, und wird in beigefugten Anmerkungen mit fariflifichen und hiftori- fchen Nachrichten begleitet. Note de Livres noureaux et eftampes, qn'on peut te procurer chez J. Decker, Libraire a Bile, Conüddrations philofophiques fur la revolution frangaife, etc. par le cie. J. Lachapeiie, in-12. Paris, V.. Eflai pour diriger et &tendre les recherches des voy geurs qui fe propofent l'utilic& de leur patrie, etc.’ par le comte L£opold Berchtold, traduit de l’ anglais par C. P. de Lafteyrie, 2 vol, in-$. Paris, YV.. Caufes (des) de la rerolution et de fes r&fultars, Paris, V. Sur quelques ridicules du moment, "Epitre, par Villeter- que, h Mad... in-$. Paris, 97- Le Juif, drame en cing sctes, wraduit Jibrement de l'an- elais, in-$. Hambourg, 97. r Manuei des enfans, contenant les dldmens de la langue frangaife er allemande, in-$. Strasbourg. Camille, ou ‚lettres de deux filles de ce fick, trad. de Vanglais fur les originaux. Secpnde edition, corrigde fur les leitres memes, 4 vol. in- 12. Memoire hiftorique fur le düme du Pantheon 'frangais, par J. Rondelet, in-4. avec planches, Paris, V. Prediction pour Ja fin du dix-huitieme fiecle, tirde dw Mirabilis Jiber, srec la traduction litteräle h cüre du texte, par J. A. 5. Ch. in-8,. Julie, nourelle traduite du Ruffe de M. Karamzin, par M, de Boulliers., Muscag, 97. Hiftoire du Clergs, a vol, in-16. Paris, 97. Origine des malheurs de Ja France, et note politiqgue pour fervir au rerablilfement de fa profperitd, erc. in-® Paris, 97. Ela politigue et philofophique fur le commerce er ka — 684 paix, confiderds fous leurs rapports avec |’ agriculture ; par J. B. Rougier- Labergerie, in-8. Paris, 97 Maifons (les plus jalies) de Paris, 14 feuilles, in- fol, Il po&ıma tarcaro, feconde #dition, 2 rol. in- 16. 96. Cet ourrage elt une fatyre trös- piquante fur une cour Europdenne, Les Croyables, eftampe fstyrique, Arriere - garde du Pape. Er Paix papale. Aritlide er Brife- fcelles. Araneolögie (de 1’) om far la decourerte du rapport con« flanı entre l’apparition ou la difparition, le travail ow le repos, le plus ou le moins d’ drendue des roiles'er ds fils d’ataches des araigndes des diförentes efpices, ee les variations athmospheriques du beau-tems & In pluie, du fec ü l’'humide, mais principalement du chaud au froid, er de In gelde ü ba glace au röritable degel, Par Quatremere Disjonval, in-& Paris, 97, d "Payne (Thomas) ü la legislature et au directoire, ou la juftice agraire oppofee h la loi et aux priviläges agraires, in-g. Paris, 97. _ " i ‘ Le trait& de paix avec Rome. eftampe fatyrique. “ Expedition (1’) des Argonautes, ou la conquete de ia toifon d’or, potme en quatre chants, par Apollonius de Rhodes, sraduic pour la premiere fois du grec en frangais par J. J. A. Cauflin, in-8. Paris, V.- Fragmens moraux et liudräues, ‚par A H. Dampmartin, in-$. Berlin, g7. “ Coup d’oeil fur les caufes er les conföquences de la guerre actuelle avec la France, par M. Erskine, mem- bre de la chambre des communes du parlement d’ An- gleterre, ıraduit [de l’anglais de la viuge *eroißeme ddi- tion, in-$. 97. j Efais en vers et en profe, par Jofeph Rouger Delisie, in-$. Paris V, de l’imprimerie de Didor l'aine, Voyage autour du monde fur le vaiffean de 8, M. B. l" Endeavour, par Sidney Parkinfon, deflisateur attsche a M. Banks, precdde d’un discours en forıne d’ into» duction fur- les principaux navigateurs anglais et fran- » gais qui ont pröcdde 1’ Endearour, fuivi d’un abrege des deux derniers voyages du capitsine Cook, avec les planches de i’auteur, ouvrage traduit de l'anglais, par le citoyen Henri, 2 vol. in-8- Paris 97. Memoire militsire fur la frontiere de Flandre eı de Hainaut, depuis Ja mer jusqu'ä la Meufe, c'e -a- dıre depuis Dunkerque jusqu’a Chariemont, par M. de la Fite, gr. in«$. 1797: \ h Büle, le 5. Mai 1797. -—— In der Parrentronp- nnd FT’ennerfchen Buchhandlung in Frankfurt am Maym ift herausgekummen. Aujanpı- _ gründe der Mathematik zum Gebrauch auf Schuien und Univerfitaten, heraurpepeben von G. G. Schmids, Prof. der Mathem. zu Giefsen, erfor Theil weicher -die reine Mothemäatik enzhidlt 8. 179% Irıhin I6gr. Wenn Beflimmrheie uud Fafslichkeit im Vortrage, ‚ohre Weifchweifigkert, verbunden mi. -wohlgewahlier Ordnung der abgehandelten MMarerien, den \Verch der . anathe- x 6% er | en 182 Tr mäthematifchen Lehrbücher Beftimmen, ‘fo gehört das «ben angezeigte unflreiig zu den beften Schriften diefer Art. Unter der Mehrheit derfelben hatten die, ziemlich in diefem Geifte abgefafsten,, für unfere Zeiten jedoch zu ‚aligevrordenen Wolfilchen Compendien einen vorzüglichen Werth, Unter den neuern zeichnet ieh Büfchs Verluch ‚einer Mathematik befonders aus, allein die Ausführlich- keit deffelben, macht es für den Gebrauch auf Schulen zu koftbar. Jene Eigenfchaften der Kürze und Faßslich- keir im Vorsrage, mit fteter Hinücht auf die Anwendung der Wilfenfchaft auf die Bedürfniffe und Verfälle des Gefchäftsiebens, har der Verfaller diefer Anfangsgrüude möglickft zu vereinigen gefucht. Sie Gud niche blofs für dellen academifche Vorlefungen, fondern auch für den Unterricht in diefer Wiflenfchaft auf Schulen beftimme, ‚such. bereits wirklich in dem Gymnaflum zu Darmitade ‚eingeführt. »-Diefe kurze Anzeige wird hinlänglich feyn, «es dem Liebhaber. und Beflifenen der machemaiichen Wißenfchaften zu empfehlen. Zum Ueberäufs zeigen wir noch den Inhalt defielben an. Der erlte Theil umfafst auffer der Einleitung, worinn eine Ueberlicht der gefammten mathemar, Willenichaften gegeben und ihre Verbindung mit der Naturlehre gezeigt wird: 1. Die Rechenkunft in 6 Abfchnitten. 1) Von den Zaulen überhaupt, den, ganzen Zahlen und den 4 Species. 2} Von den Primzalien, den zufammengeferzten Zahlen ‘und den Brüchen. 3) Von deu Decnhalbrüchen. 4) Von den Potenzen und der Ausziehung der Quadrät - und Cubikwurzeln. 5) Von den Verhälniffen und Proportio- nen nebft deren Anwendung auf die Regula de Tri, In- tereilen» Gefellichafts - und Alligationsrechnung. 6) Von der arithmerifchen und geomerrifchen Reihe und deren Anwendung auf die Lehre von den Logaritlfnen. II, Die Grometrie mit Anwendung zuf das Feldmellen. 1) Er- klarungen und Grundfätze. 2) Von der Lage der gera- den Linie gegen einander und der Lehre von den Päral- ßellinien. 3) Gleichheit der Dreyecke und Folgerungen, 4) Aechnlichkeit der Figuren, 5) Vergleichung der ge, zadlinichten Figuren und Ausmellung derfelbei. 6) Vom Kreife. — Bey jedem Geometriichen Lehrfetze find die Anwendungen derfelben auf Gegenfiände der ausübenden Metsk: in den Anmerkungen vorgerragen, wobey der in neuern Zeiten eingeführten vollkomneren Werkzeuge gehörige Erwähnung gefchicht. HI. Die Stereumethie, ») Von der Lage der Ebenen. 2) Prismatifche Körper. 3) Cylinder oder walzenförmige Körper. 4) Pyramiden und Kegel. 5) Van der Kugel. Hier finder man ein kurzes Verzeichnifs der in den Heflen Darmflädıl. Lam den und den angrenzenden Gegenden üblichen Maaise. IV. Die ebene Trigunometrie. 1) Außöfung der recht- winklichen Dreyecke. 2) Auflöfung der gleichfchenk- Jichten Dreyscke. 3) Allgemeine Auflöfung der Dreyecke. W. Die Buchfläbenrechenkunjt. Anwendung derfeiben auf arichmetifche und geomerrifche Wahrheiten, Die erfie Anwendung enthälı eine allgemeine Betrachtung der Zah» lenfyltieme der geraden und ungerade Zahlem, der Prim, zahlen, der figurirten Zahlen, der Verletzungen und Ver- bindungen der Zahlen. Die zweyie Auwendung enthält insbefondere einige der vorzüglichlien Sätze aus der ana- Jytiichen Trigunumerrie und ihrem Gebrauch in der - praktifehen Geometrie, wodurch man in den Stand ge fetzt wird, “ — ’ In der Varrentropp- und Hennerfchen Buchhandlung : in Fraakfurt am Mayn if erfchienen. Verfuch einer phufifchen Darfiellung der Lebenskröfte organijirter Körper — in einer Reihe von Vernunjtfchluffen aus den neueften chemifchen und phufiologifchen Ent deckungen. — Fon J. F. Ackermann, der IT rltweis heit und Arzneupelahrheit Doctor. Erfter Daud. 8 1597. 1 rthlr. 16 gr. Wir hoffen den Dark der Naturforfcher und Aerzie zu rerdienen, wern wir durch folgende kürze Iuhalıs- anzeige die neuen, in diel,m Werke enthaltenen \Valır- heiten vorläufig bekannt machen, I 1. Kapitel. Organifation, Bau, Beflandtheile, Merrich- tungen, Unterfchied organijirter PT’efen. Durch eine deur- liche Auseinanderfetzung der erlien Elemente des urga- siichen Baues, wird uns die Art begreiflich gemacht, wie in alle Theilgen des organiichen Körpers neue Belland- theile hingebracht, und andere zerlezte aus der ergati- (chen Mafchine ausgeführt werden. j 2. Kapiiel. Fon den Prinzipien der Rrizbarkeit, — Es wird gezeigt, dals zwey Grunditoffe der in unferer Atmosphäre befindlichen Gasarten bey dem oreanifeben Leben fich vorzüglich würkfam bezeigen. Diefe üud der 'Säureftuff und der Kuhlenjiof. 3 Kapitel. Von der Ernährung ifcher Körpen Ein Haupterfordernifs eines Nahrungsmittels ift, dafs der Kohlenftuff einen feiner Beftandcheile ausmacht, «s wird dargerhan, dafs die tauglichften Nahrungsmittel den mei- Ten Kohlerftof enthalten. 4. Kapnel. Fon dem Lebensäther. Dafls der Säure« Rofinden Lunge unferen Siften beygemifcht werde, il eine längft bekanute Sache, aber in welcher Geftair dıefer wirkfame Grunditoß den organifchen Körper durchdriuge wufste mau nich, Hier wird gelehrt, dafs das Säure Roffgals iu den Lungen einen Theil feines Wärmeftoffs verliere, und dadurch in eineu halbgalsförmigen jenem der elektrifchen Materie ähnlichen Zuftand verferzt werde wıd fo den Siften aunäne. 5. Kapirel. F°,n dem Lebensprozefr. Phy fifche Frklä- rung der lebendigen Zufammenziehungen des organiichen Gewebes. — Diele Zufammenziehungen erfolgen, indem fich der Säureflof des Lebensäthers, mit dem Kohlenfto@ der feften Theile verbinder, wodurch diefer aus dem G@ webe losgerilen, und jenes zu/amnengezogen wird, 6) Kapisek Fun den Ferrichtungen des Hirns und der Nerven. Der Verf. feret wine doppelte Art von Erregung fi organifchen Reihen feit! die eine it die autumatifche, die andere die animalifche, die automatifche Erregung ge- fchieht, durch den Deberritt des Säureftoffs aus dem Siften in die feiten Theile un? die dadurch herrarge- brachte Zufammenziebung. Diele it Thieren und Plan» zen eigen. Die anımaliiche befichi in der Leinung des Lebensächers von dem Gehirn durch die Nerven, und it nur den Tihieren eigen. 7. Kapitel, Fon der thierifchen Muskelbewegung. Es wird gelehrt, wie durch die einzelne Kräfte aller Muskel w 02 zeil- Tg 637 zeilgen eine fo beträchtliche Bewegungsgröfse, durch die Zufammenziehung der Muskeln im Thierkörper ent- wickelt werden kann. j $- Kapitel. Fon der thierifchen Wärme. Das bisher unerklärte Phänomen, warum bey einer (ehr großen "Hüze und einer grofsen Käke der thierifche Körper ftets einen beflimmten Wärmegrad behauptet, wird zuerik nach blos phyfifchen Gefetzen erklärt, 9. Kapitel. Won der Einwürckung der Metalle auf den reizbaren thierifchen Körper: fammt der phyfifchen Erklärung diefer Erfcheinungen. Die in den Galvanifchen Verfuchen würkfame feine Flüfsigkeit it hier entdecke, und alle bey derielben vorkommende Erfcheinungen find nach phyfilehen, Grundprineipien befriedigend erklär. * IIL, Bücher fo zu verkaufen. Nachftehende Bücher find um beygefezte Preile in 20 f. Fußs bei dem Hru. Cammerkanzellift Schnee- gafı in Altenburg zu haben. Wohin man ch ia poltfreien Briefen wenden kann, In Folie. 1. Reg. et Imperat. Romanor. Numisınata etc. cura Ca- roli Duc. Croyiuci et Arfchotani etc. rec. c. Laur, Begeri sunoratt. Col. Brand, 1700. c. fig. Frzbd. ı rthir. 16 gr. 2. Brici Pontoppidari Marmors Danica fel. T. I. Hafn. 1739. Frzbd. ı ethir. 3. Thebefi Liegnitzifche Jahrbü- cher, durch Scharfen 1-3 Th. 1733. m. K. Frzbd. 2 rthıle, 4. Bruckmansi magnalia Dei, oder unterirdifche Schatz- kammer. I. w 2. Th. Braunfchw. 1727. m. K, Schwidb, 4 rıılr. 5 ab Eckart animadverf. hilior, et crit. in Schan- nati Divecelin et ihierorchiam Fuldenf., Wirzb, 1717. c. fig, angeb. Mainberg Epift. Schannar. 4. Pgmbd. d. u. E, a0 gr. 6. Hartknoch altes und neues Preuilen. 2 Theile. Frft. u. Lpz. 1684. m. K. Pgmbd. 2 rthle. 7. 8. Hiltor, Beichr. des Niederl. Kriegs von Em. von Meteren. in zwey Theilen bis 1614, Arnuem. m. £. ı ethir, ızgr. 9— ıl. Meteranus nuvus od. Befchr. des Niederl, Kriegs bis 1638. Amft. 1669. 4 Theile m, K. Schwidb, 3 rdılr. 12. Kraontzii Norwegifche Chronik. 1545. Pgmbd. R. u. E. 8 gr. 13. A. du Molinet hift, (umm. pontif. a Mart. YV.usq, ad Innocent. XII. p. eorum numismata Intit. 1679. in fol, Pgmbd. 2 rehlr. zoge von Venedig Leben, Frft. 1574. m.K. it. Eigentl. Beichr. der Stadt Venedig. Frft. 1574. Pgmbd. R. u. E 16 gr. 15. D. Langenmantel Hiltorie des Regiments in Augfpurg. Fri. u. Lpz. ı725. m. K. Pgisbd. R. u. E, 1 echie. 26. Becardi origines famil. H>bfpurg-Auftriacae, Lipf, ıq21. ec. fig. Pgmbd. ıögr. 17. Angeli Annales Marchio Brandenb. m. Supplem. Frft. 1598. m. Holzfch, ı rthir. 18. Hifter. He. Georz. u. Cafp. von Feundsberg, Feft. 1572. Pgmbd. ı6 gr. Ig—2ı. Hathmeicrs Braun- fchw. Chronik nebft Anh. u. Reg. m- K, Braunich, 1723, 3 Pgmbd. 3 rıhir. 12 gr. 22. FT’eckens Beichreib. von Dresden. Nürnbrg. 1679. m. K. Schwibd. 2 rthle. 12gr. 25125. Beckmanns Hillorie des Fürltenth, Anhalt in 14. H. Keliners Befchr. aller Her-- ss 7 Theilen. u Ej, -accefs. Anhalt. m. &. 3 Bde. 10 rthie, 26. Pomarii Chronika der Bachlen und Niederfachfen. . Witbg, 1589. Pgmbd. 12. gr. 27. Brotuff Chronicad«s Hau- tes Anhalt, Gin. tiewbos."$.gr.. 28. 29 Dreyhaupts Beichz. des Saalkreifes ı Theile. Halle 1749. m. K. Pgmbd, 7 rthie, 12 gr. ' 30. Doppelmayrs Hift. Nachr. von den Nürnberg, Mathem. u. Künfllern. 1730, m. E. Pgmbd. R. u. E. ı rthir. 31. Ferheidenii imagines et elogia theolog. op. Roth- Schulteii, Bec. Edit. Hagae Com. 1725. c, fg. halb. Frabd. ı rıhle. 32. Muller Sächie. Aunales. ı rıhlr. 16 gr. . " Ina Ouarte, 1. G. Aelnrii, Glatzifche Chronik. Lpz. 1625. 8 gr. 2. Schlaeger de Nummo Alex. M. Hamb. 1736. c. fig. 13. gr. 3. Seldeni Annal. Anglobrittan. Frft, 1615. $ gr. 4. Zuluski fpecim. hift. Polonse. Warfav. 1735. 12 ge.- 5 Nikol Lips Execution. Brfchw. 1700. m. K. 16 gr. 6. Wagenfeil comment. de civ. Noriberxent. an. von des ‚Meißter- Sängern, Altdorf 1697. it. Epiflolae vir. doctor. ad Melch. Goldafllum. Frft. 1698. ı rchir. 7. Rhode. Cimbrifch - Holifteinifche Antiquitäten Remarguen. Hmbg. 720. m. B. 1ogr. 8. C. Landi iel uumilmat. praee. Roman. expofir. Lugd. Batar. 1695. c. f. 16 gr. IV. Erklärung, Wegen 4.L.Z. No. 195. d. 21. Jun. 1797. Indem durch die Lefung der Befchreibungen körperlicher und moralifcher Gegenkände ein dienlicher Wortvorrach in einer Sprache zum Bücherlefen, Beden und Schreiben gelammelt wird, fo gieng meiue Abücht auf Beförderung des Sprachfiudiums bey der Herausgabe der Prerta de las Lenguas„ die eine von mir aus dem Lateinifchen in das Spanifche, fo wie des Nouveau Monde Peint a Unfage des Enfans, d@ eine aus dem Deutfchen von mir in das Franzößfche, und der Esule du Monde objectif, weiche eine ‚aus dem Deutfchen in. das Franzölifche, Italien; fche, Englifche und Spanifche von mir gemachte Ueber- fetzung ilt, 5 ; L. H, Teucher, für jetzt privatifirender Gelehrter in Leipzig. V. Berichtigung. . In der Schrift: Ideen zu einer Phitofophie der Natsr, von J. EV. J. Schelling (Leipzig, b, Breitkopf und Uartel, 1797.) ünd folgende Druckfehler zu ver- beffern:: " .. Vor 8. VI, Z. ı. v. u.lies: die Lebenskraft. 5. VIr, Z. 4. v. u. von die gehört ein Punkt. 8. YIIL, Z, 8. fh, Theologie 1. Teleologie. — Einl. 8. XXL, Z. ı0. lies: wie zwei feindliche Weien. & XXIX, Z. ı wor: eine, fetze: als. 8. XXXVIL Z. 5. delestur (?), 8, XLV, Zu tt. vw lies: müfste. 5. XLVU, 3 u lies; in diefem Ganzen. &LV, Zt v. u. nach: Schon ein Comma. — Tezt. 5, 23% Z, 3. lies: quantitativen ft. qualitativen, —— unse. 689 INTELLIGENZBLATT se der ALLGEM. LITERATUR- ZEITUNG , | _ Numero 84. - Mittwochs den zen Julius 1797 _ LITERARISCHE ANZEIGEN. I. Ankündigungen neuer Bücher. Vo dem Buchhindier Ad. Fr. Böhme in Leipzig, ift verlegt worden: Practifcher Commentar über die Pandecten nach dem Heilfelld’fchen Lehrbuche, erfter, zweyter und dritter Band. In der Vorrede erklärt der Verfaler, difs er als academifcher Docent feit zwanzig Jahren Materialien zu diefem Werke gefammelt habe, da er oft Gelegeuheit gehabe, bey Lefunz der Acten die Beinerkung zu machen, wie nöthig Richtern und Advo- caten ein Werk fey, worinn die verfchiedenen Meystun- gen und Erklärungen der beruhmteften Rechtslehrer über die Hauptwahrheiten des Privatrechts zufammengetragen worden, und es den gröfßsten Aufenthalt in den Gefchäf- ten verurlache, - wenn ein Richter und Advocst bey fchweren Fällen allemal) etft mehrere Bücher nachzufchla- gen genörhigt fey. Diefem Bedürfnifs will daher der Verfafler abhelfen, und die fertigen 3 Bände, jeder go Bogen flark, in gr. 8. enthalten die Erklärung des erften Buchs der Pandecıen. Aufmerklame Rechtsgelehrte wer- den fogieich darauf fallen, dafs die fchwerften Materien fehr weitlauftig auseinander gefetzt (eyn müflen, dafs fich auf 120 Bogen doch wohl etwas fagen läfst, und wir feiglich ein fehr brauchbares Buch haben werden, wenn elle funfzig Bücher der .Pandecten auf diefe Art erklärt worden: Wegen der Länge der Zeit, in der das ganze Werk beeudigt feyn wird, har man nicht Ur- fache Bedenken zu tragen, da die abgedruckten 3 Bände in Jahresfrit herausgekommen find, und künfıdig zu Oftern, Michaal und Weyhnachten, ein Band von Bogen abgedruckt feyn foll, damir das ganze Werk im einigen Jahren beendigt werde, - Die äbgedruckten 3 Binde find in allen Buchhandlungen zu bekommen, jeder Band koftet ı rıhl, 20 gr.
| 1,250 |
https://stackoverflow.com/questions/71693796
|
StackExchange
|
Open Web
|
CC-By-SA
| 2,022 |
Stack Exchange
|
Travis D, https://stackoverflow.com/users/821799
|
English
|
Spoken
| 324 | 592 |
CircleCI deployments to Heroku fail: SSH Connection timed out
I have a CircleCi deployment that's been working for a few years. I last attempted it March 8 and it worked. But now it's failing on this step.
I've contacted CircleCi about it, and they say it's related to the March 15 GitHub SSH deprecation. I don't see how that's possible. I can't telnet to heroku.com:22 from my local machine, or from any other virtual servers I have access to. If you can't reach the port, it doesn't matter which key you have or don't have, right? It's TCP/IP.
It's definitely curious that the March 15 deprecation occurred between March 8 and 30th, I've gone through this link and tried regenerating keys, and installing OpenSSH 8.1, they don't seem to have any effect.
Any recommendations? Thanks in advance.
#!/bin/bash -eo pipefail
if [ "${CIRCLE_BRANCH}" == "master" ]; then
git remote add heroku [email protected]:our-project.git
ssh-keyscan -H heroku.com >> ~/.ssh/known_hosts
git push heroku master
fi
ssh: connect to host heroku.com port 22: Connection timed out
fatal: Could not read from remote repository.
Please make sure you have the correct access rights
and the repository exists.
Exited with code exit status 128
CircleCI received exit code 128
Adding a few environment variables to CircleCi, creating a ~/.netrc file and and switching to HTTP seems to be working:
echo "machine git.heroku.com login ${HEROKU_USERNAME} password ${HEROKU_TOKEN}" > ~/.netrc
git remote add heroku https://git.heroku.com/our-project.git
As of November 30, 2021, the SSH Git Transport feature has been deprecated by Heroku and only HTTP transport is supported. The real shutdown of SSH was in March 2022.
You have to reconfigure the repo with :
heroku git:remote -a <app-name>
Official statement from Heroku
Maybe you will have to unset ssh connections on git global config :
git config --global --unset url.ssh://git@heroku/.insteadof
git config --global --unset url.ssh://[email protected]/.insteadof
Thanks for the response! It looks like the image we are using for CicleCi doesn't have Heroku installed.
| 34,121 |
https://superuser.com/questions/456389
|
StackExchange
|
Open Web
|
CC-By-SA
| 2,012 |
Stack Exchange
|
Ackman, Andrea Willige, Casey, Darius, Ethan, Fabrice B, Joel Mac, Michael, Mohammad Arvan, Oliver Salzburg, Sathyajith Bhat, Thorbjørn Ravn Andersen, Zach Richardson, https://superuser.com/users/1183889, https://superuser.com/users/1183890, https://superuser.com/users/1183891, https://superuser.com/users/1183913, https://superuser.com/users/1183916, https://superuser.com/users/1189197, https://superuser.com/users/1189294, https://superuser.com/users/1189295, https://superuser.com/users/144476, https://superuser.com/users/146849, https://superuser.com/users/36744, https://superuser.com/users/4377, https://superuser.com/users/66880, https://superuser.com/users/7401, karma
|
English
|
Spoken
| 629 | 895 |
12GB of RAM only 8GB is usable on Windows 7 64-bit
I'm running a Dell Studio XPS, with quad core processor, two threads per core, with 12GB of installed RAM. According to Windows, only 7.99GB of that RAM is usable.
The really weird part is, up until two weeks ago I only had 8GB of RAM and then only 3.99GB was usable. So 4GB of RAM is consistently being taken.
I've checked in every screen, under every option in my BIOS and there doesn't seem to be a memory option there at all (that's a damn Dell for you). I've read that a lot of times this can occur because of the video card stealing some RAM for itself.
Is there some way I can check this, other than the BIOS? I have onboard graphics, not a separate card.
I'm running Windows 7 64-bit.
Can you run dxdiag and see what's the approx. total available memory in the display tab? Also does the first tab show all 12 GB ?
which edition of Windows 7?
Related: http://superuser.com/questions/217200/8-gb-ram-installed-only-7-5-gb-usable-windows-7-64-bit
Windows 7 Home.
And dxdiag shows all 12 gigs on the first page, and then
3571 MB (odd RAM number...) under the Display1 Tab, and the Display2 tab....
So I guess that means my memory is indeed being given up to the graphics card
Is there some way that I can redistribute this RAM claimed for video memory besides the bios?
Alright so I'm not sure why in the hell this did the trick. But this computer I'm using has had many previous users, so I had like 9 jdks installed, some 64bit some x86. So I figured I may as well get rid of all of the x86 installations because I had reason to believe that netbeans was running one of these x86 jdk installations, (which it was), because I wasn't even getting much over 4gb of ram usage when I was overflowing my heap space while trying to find a bug.
Anyway, long story short, now it shows a straight 12GB of memory installed on the System page of the control panel, no sub-text about how only a certain amount is available. All from uninstalling some JDKs and rebooting....very odd.
The settings on dxdiag are the same as when I checked before as well. But hey, whatever works =D
Thank you for all the suggestions! especially the dxdiag command, I hadn't been aware of that before this.
I would still upgrade the BIOS since it's there where you can change the setting of how memory is your video is going to "steal".
Wow...I'm gonna uninstall the JDK now.
Most likely the reboot was more important than the JDK's if you have fiddled with the system settings.
The reboot definitely did not do it. There was tons of rebooting going on between all of these steps.
You are correct - no video card I've heard of would be stealing that much RAM. Here are all the possibilities I can think of:
Faulty RAM sticks - swap out your sticks and put in spare sticks you might have, or borrow some from a friend.
Bad motherboard - in this case, swapping out for other RAM most likely won't work.
Bad seating - re-seat your RAM (take them out and then put them back in).
Motherboard and RAM incompatibility - in this case, swap out your sticks for a different brand of RAM.
If you do swap out, periodically check whether your machine shows all of the RAM available.
One solution to your problem:
Open the Start menu
Type msconfig
Press Enter
Click the Boot tab
Click Advanced Options
Uncheck Number of processors and Maximum memory
Click OK on both windows
Restart PC
I've already looked at that, there was no max memory.
| 19,483 |
Subsets and Splits
Token Count by Language
Reveals the distribution of total tokens by language, highlighting which languages are most prevalent in the dataset.
SQL Console for PleIAs/common_corpus
Provides a detailed breakdown of document counts and total word/token counts for English documents in different collections and open types, revealing insights into data distribution and quantity.
SQL Console for PleIAs/common_corpus
Provides a count of items in each collection that are licensed under 'CC-By-SA', giving insight into the distribution of this license across different collections.
SQL Console for PleIAs/common_corpus
Counts the number of items in each collection that have a 'CC-By' license, providing insight into license distribution across collections.
Bulgarian Texts from Train Set
Retrieves all entries in the training set that are in Bulgarian, providing a basic filter on language.
License Count in Train Set
Counts the number of entries for each license type and orders them, providing a basic overview of license distribution.
Top 100 Licenses Count
Displays the top 100 licenses by their occurrence count, providing basic insights into which licenses are most common in the dataset.
Language Frequency in Dataset
Provides a simple count of each language present in the dataset, which is useful for basic understanding but limited in depth of insight.
French Spoken Samples
Limited to showing 100 samples of the dataset where the language is French and it's spoken, providing basic filtering without deeper insights.
GitHub Open Source Texts
Retrieves specific text samples labeled with their language from the 'Github Open Source' collection.
SQL Console for PleIAs/common_corpus
The query performs basic filtering to retrieve specific records from the dataset, which could be useful for preliminary data exploration but does not provide deep insights.
SQL Console for PleIAs/common_corpus
The query retrieves all English entries from specific collections, which provides basic filtering but minimal analytical value.
SQL Console for PleIAs/common_corpus
Retrieves all English language documents from specific data collections, useful for focusing on relevant subset but doesn't provide deeper insights or analysis.
SQL Console for PleIAs/common_corpus
Retrieves a specific subset of documents from the dataset, but does not provide any meaningful analysis or insights.
SQL Console for PleIAs/common_corpus
Retrieves a sample of 10,000 English documents from the USPTO with an open government type, providing a basic look at the dataset's content without deep analysis.
SQL Console for PleIAs/common_corpus
This query performs basic filtering to retrieve entries related to English language, USPTO collection, and open government documents, offering limited analytical value.
SQL Console for PleIAs/common_corpus
Retrieves metadata of entries specifically from the USPTO collection in English, offering basic filtering.
SQL Console for PleIAs/common_corpus
The query filters for English entries from specific collections, providing a basic subset of the dataset without deep analysis or insight.
SQL Console for PleIAs/common_corpus
This query performs basic filtering, returning all rows from the 'StackExchange' collection where the language is 'English', providing limited analytical value.
SQL Console for PleIAs/common_corpus
This query filters data for English entries from specific collections with an 'Open Web' type but mainly retrieves raw data without providing deep insights.
Filtered English Wikipedia Articles
Filters and retrieves specific English language Wikipedia entries of a certain length, providing a limited subset for basic exploration.
Filtered English Open Web Texts
Retrieves a subset of English texts with a specific length range from the 'Open Web', which provides basic filtering but limited insight.
Filtered English Open Culture Texts
Retrieves a sample of English texts from the 'Open Culture' category within a specific length range, providing a basic subset of data for further exploration.
Random English Texts <6500 Ch
Retrieves a random sample of 2000 English text entries that are shorter than 6500 characters, useful for quick data exploration but not revealing specific trends.
List of Languages
Lists all unique languages present in the dataset, which provides basic information about language variety but limited analytical insight.