identifier
stringlengths 6
14.8k
| collection
stringclasses 50
values | open_type
stringclasses 7
values | license
stringlengths 0
1.18k
| date
float64 0
2.02k
⌀ | title
stringlengths 0
1.85k
⌀ | creator
stringlengths 0
7.27k
⌀ | language
stringclasses 471
values | language_type
stringclasses 4
values | word_count
int64 0
1.98M
| token_count
int64 1
3.46M
| text
stringlengths 0
12.9M
| __index_level_0__
int64 0
51.1k
|
|---|---|---|---|---|---|---|---|---|---|---|---|---|
https://ar.wikipedia.org/wiki/%D8%A2%D9%8A%D8%AA%D9%8A%D8%B3
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
آيتيس
|
https://ar.wikipedia.org/w/index.php?title=آيتيس&action=history
|
Arabic
|
Spoken
| 74 | 249 |
آيتيس و هو شخصية ذكرت في الميثولوجيا الاغريقية أنه كان ملك كولخيس الموجودة حالياً في جورجيا، وهو ابن إله الشمس هيليوس وبيرسي وهو شقيق كيركي وباسيفاي وهو والد ميديا وكالكيوبي وأبسيرتوس، وزوجاته هن إيديا وأستيروديا وأوقيانيد ونيريد، معنى إسمه هو النسر، أصل آيتيس من كورنثوس وكان له علاقة قرابة مع هيكاته إلهة السحر في الميثولوجيا الإغريقية.
المراجع
أبناء هيليوس
جورجيون خياليون
شخصيات أسطورية إغريقية
ملوك في الأساطير الإغريقية
أساطير في آرغونوتيكا
ملوك أسطوريون كولخيس
| 35,154 |
https://github.com/aklivity/zilla/blob/master/runtime/binding-http/src/test/java/io/aklivity/zilla/runtime/binding/http/internal/streams/rfc7230/server/AccessControlIT.java
|
Github Open Source
|
Open Source
|
Apache-2.0, LicenseRef-scancode-unknown-license-reference
| 2,023 |
zilla
|
aklivity
|
Java
|
Code
| 553 | 3,090 |
/*
* Copyright 2021-2023 Aklivity Inc.
*
* Aklivity licenses this file to you under the Apache License,
* version 2.0 (the "License"); you may not use this file except in compliance
* with the License. You may obtain a copy of the License at:
*
* http://www.apache.org/licenses/LICENSE-2.0
*
* Unless required by applicable law or agreed to in writing, software
* distributed under the License is distributed on an "AS IS" BASIS, WITHOUT
* WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the
* License for the specific language governing permissions and limitations
* under the License.
*/
package io.aklivity.zilla.runtime.binding.http.internal.streams.rfc7230.server;
import static io.aklivity.zilla.runtime.binding.http.internal.HttpConfiguration.HTTP_SERVER_HEADER;
import static java.util.concurrent.TimeUnit.SECONDS;
import static org.junit.rules.RuleChain.outerRule;
import org.junit.Rule;
import org.junit.Test;
import org.junit.rules.DisableOnDebug;
import org.junit.rules.TestRule;
import org.junit.rules.Timeout;
import org.kaazing.k3po.junit.annotation.Specification;
import org.kaazing.k3po.junit.rules.K3poRule;
import io.aklivity.zilla.runtime.engine.test.EngineRule;
import io.aklivity.zilla.runtime.engine.test.annotation.Configuration;
public class AccessControlIT
{
private final K3poRule k3po = new K3poRule()
.addScriptRoot("net", "io/aklivity/zilla/specs/binding/http/streams/network/rfc7230/access.control")
.addScriptRoot("app", "io/aklivity/zilla/specs/binding/http/streams/application/rfc7230/access.control");
private final TestRule timeout = new DisableOnDebug(new Timeout(10, SECONDS));
private final EngineRule engine = new EngineRule()
.directory("target/zilla-itests")
.commandBufferCapacity(1024)
.responseBufferCapacity(1024)
.counterValuesBufferCapacity(8192)
.configurationRoot("io/aklivity/zilla/specs/binding/http/config/v1.1")
.configure(HTTP_SERVER_HEADER, "Zilla")
.external("app0")
.clean();
@Rule
public final TestRule chain = outerRule(engine).around(k3po).around(timeout);
@Test
@Configuration("server.access.control.cross.origin.yaml")
@Specification({
"${net}/allow.origin.wildcard/client",
"${app}/allow.origin/server",
})
public void shouldAllowOriginWildcard() throws Exception
{
k3po.finish();
}
@Test
@Configuration("server.access.control.cross.origin.allow.explicit.yaml")
@Specification({
"${net}/allow.origin.explicit/client",
"${app}/allow.origin/server",
})
public void shouldAllowOriginExplicit() throws Exception
{
k3po.finish();
}
@Test
@Configuration("server.access.control.cross.origin.allow.credentials.yaml")
@Specification({
"${net}/allow.origin.credentials/client",
"${app}/allow.origin/server",
})
public void shouldAllowOriginWithCredentials() throws Exception
{
k3po.finish();
}
@Test
@Configuration("server.access.control.same.origin.yaml")
@Specification({
"${net}/allow.origin.same.origin/client",
"${app}/allow.origin.same.origin/server",
})
public void shouldAllowOriginWhenSameOrigin() throws Exception
{
k3po.finish();
}
@Test
@Configuration("server.access.control.cross.origin.yaml")
@Specification({
"${net}/allow.origin.same.origin/client",
"${app}/allow.origin.same.origin/server",
})
public void shouldAllowOriginWhenCrossOriginWithSameOrigin() throws Exception
{
k3po.finish();
}
@Test
@Configuration("server.access.control.same.origin.yaml")
@Specification({
"${net}/allow.origin.omitted.same.origin/client",
"${app}/allow.origin.omitted/server",
})
public void shouldAllowOriginOmittedWhenSameOrigin() throws Exception
{
k3po.finish();
}
@Test
@Configuration("server.access.control.cross.origin.yaml")
@Specification({
"${net}/allow.origin.omitted.cross.origin/client",
"${app}/allow.origin.omitted/server",
})
public void shouldAllowOriginOmittedWhenCrossOrigin() throws Exception
{
k3po.finish();
}
@Test
@Configuration("server.access.control.cross.origin.allow.explicit.yaml")
@Specification({
"${net}/reject.origin.not.allowed/client",
})
public void shouldRejectOriginNotAllowed() throws Exception
{
k3po.finish();
}
@Test
@Configuration("server.access.control.same.origin.yaml")
@Specification({
"${net}/reject.origin.not.allowed/client",
})
public void shouldRejectOriginNotSameOrigin() throws Exception
{
k3po.finish();
}
@Test
@Configuration("server.access.control.cross.origin.yaml")
@Specification({
"${net}/allow.methods.wildcard/client",
"${app}/allow.methods/server",
})
public void shouldAllowMethodsWildcard() throws Exception
{
k3po.finish();
}
@Test
@Configuration("server.access.control.cross.origin.cached.yaml")
@Specification({
"${net}/allow.methods.wildcard.cached/client",
"${app}/allow.methods/server",
})
public void shouldAllowMethodsWildcardCached() throws Exception
{
k3po.finish();
}
@Test
@Configuration("server.access.control.cross.origin.allow.explicit.yaml")
@Specification({
"${net}/allow.methods.explicit/client",
"${app}/allow.methods/server",
})
public void shouldAllowMethodsExplicit() throws Exception
{
k3po.finish();
}
@Test
@Configuration("server.access.control.cross.origin.allow.explicit.cached.yaml")
@Specification({
"${net}/allow.methods.explicit.cached/client",
"${app}/allow.methods/server",
})
public void shouldAllowMethodsExplicitCached() throws Exception
{
k3po.finish();
}
@Test
@Configuration("server.access.control.cross.origin.allow.credentials.yaml")
@Specification({
"${net}/allow.methods.credentials/client",
"${app}/allow.methods/server",
})
public void shouldAllowMethodsWithCredentials() throws Exception
{
k3po.finish();
}
@Test
@Configuration("server.access.control.cross.origin.allow.credentials.cached.yaml")
@Specification({
"${net}/allow.methods.credentials.cached/client",
"${app}/allow.methods/server",
})
public void shouldAllowMethodsWithCredentialsCached() throws Exception
{
k3po.finish();
}
@Test
@Configuration("server.access.control.cross.origin.allow.explicit.yaml")
@Specification({
"${net}/reject.method.not.allowed/client",
})
public void shouldRejectMethodNotAllowed() throws Exception
{
k3po.finish();
}
@Test
@Configuration("server.access.control.cross.origin.yaml")
@Specification({
"${net}/allow.headers.wildcard/client",
"${app}/allow.headers/server",
})
public void shouldAllowHeadersWildcard() throws Exception
{
k3po.finish();
}
@Test
@Configuration("server.access.control.cross.origin.allow.explicit.yaml")
@Specification({
"${net}/allow.headers.explicit/client",
"${app}/allow.headers/server",
})
public void shouldAllowHeadersExplicit() throws Exception
{
k3po.finish();
}
@Test
@Configuration("server.access.control.cross.origin.allow.credentials.yaml")
@Specification({
"${net}/allow.headers.credentials/client",
"${app}/allow.headers/server",
})
public void shouldAllowHeadersWithCredentials() throws Exception
{
k3po.finish();
}
@Test
@Configuration("server.access.control.cross.origin.allow.explicit.cached.yaml")
@Specification({
"${net}/allow.headers.explicit.cached/client",
"${app}/allow.headers/server",
})
public void shouldAllowHeadersExplicitCached() throws Exception
{
k3po.finish();
}
@Test
@Configuration("server.access.control.cross.origin.allow.credentials.cached.yaml")
@Specification({
"${net}/allow.headers.credentials.cached/client",
"${app}/allow.headers/server",
})
public void shouldAllowHeadersWithCredentialsCached() throws Exception
{
k3po.finish();
}
@Test
@Configuration("server.access.control.cross.origin.cached.yaml")
@Specification({
"${net}/allow.headers.wildcard.cached/client",
"${app}/allow.headers/server",
})
public void shouldAllowHeadersWildcardCached() throws Exception
{
k3po.finish();
}
@Test
@Configuration("server.access.control.cross.origin.allow.explicit.yaml")
@Specification({
"${net}/reject.header.not.allowed/client",
})
public void shouldRejectHeaderNotAllowed() throws Exception
{
k3po.finish();
}
@Test
@Configuration("server.access.control.cross.origin.yaml")
@Specification({
"${net}/expose.headers.wildcard/client",
"${app}/expose.headers/server",
})
public void shouldExposeHeadersWildcard() throws Exception
{
k3po.finish();
}
@Test
@Configuration("server.access.control.cross.origin.expose.yaml")
@Specification({
"${net}/expose.headers.explicit/client",
"${app}/expose.headers/server",
})
public void shouldExposeHeadersExplicit() throws Exception
{
k3po.finish();
}
@Test
@Configuration("server.access.control.cross.origin.allow.credentials.yaml")
@Specification({
"${net}/expose.headers.credentials/client",
"${app}/expose.headers/server",
})
public void shouldExposeHeadersWithCredentials() throws Exception
{
k3po.finish();
}
@Test
@Configuration("server.access.control.cross.origin.allow.credentials.yaml")
@Specification({
"${net}/allow.credentials.cookie/client",
"${app}/allow.credentials.cookie/server" })
public void shouldAllowCredentialsCookie() throws Exception
{
k3po.finish();
}
}
| 13,927 |
oeuvrespublies11conduoft_1
|
French-PD-diverse
|
Open Culture
|
Public Domain
| 1,847 |
Oeuvres. Publiées par A. Condorcet O'Connor et F. Arago
|
Condorcet, Jean-Antoine-Nicolas de Caritat, marquis de, 1743-1794 | O'Connor, Arthur, 1763-1852 | Arago, F. (François), 1786-1853
|
English
|
Spoken
| 7,413 | 11,332 |
'^pm. zcn ■Ln ERSIIV OF TORO 1 00395 1— ^Cû n ''^i _c<?^igë CCC& "entre <: SE^ik:: -£î'«« X&MS^Sj jC* i-C c ..<C C§:<«« <c Cg^-rft s < c< ^1.^ ' c m^zi:L<z.* «saai^À'cciiÉaicI fc-^^ff -cil I^fc*^ Sc®:<MCL«j ^^^^^^^^^«^^ ŒUVRES DE CONDORCET. PiPis. _Tvrof:Rpiiir w. firmin didot FKKnr^, «UE ir.m<, 5fi. «rP ŒIJVRES DE CONDORCET publiées par A COiXDORCET OTOiNIVOR, Lieutenant -General ET M. F ARAGO, Secrctain* perpétuel de l'Aradeniic des Sciences. TOME ONZlRMi;. Hh-O-ê PARIS. FIRMIN niDOT FRÈRES, LIBRAIRES IMI'RIMFAIRS DE l'iNSTITUT , tilF. J(;0B, jB. 1847. B -tJl POLITIQUE. TOME 1. LETTRE D'UN LABOUREUR DE PICARDIE, A M. ^•*•(l). AITECH PROIlIBtTlF, * PARIS. 1775. (l) Cette initiale désigne M. Necker. XI. LETTRE D'UN LABOUREUR DE PICARDIE, A M. N*". Monsieur , Il y a environ un mois que le général des troupes delà ferme, qui commande dans noire canton, m'a apporté un gros livre, qu'il m'a dit être de vous. «Tenez, ajoutait-il, voilà ce qu'on appelle un bon livre : vous y trouverez des secrets infaillibles et fa ciles pour que le blé soit toujours à bon marclié. » Après avoir travaillé pendant six jours de la se maine , j'emploie ordinairement le septième à faire avec mes enfants des lectures qui puissent leur donner des connaissances utiles dans leur état, ou le leur faire aimer. Autant il me paraît nuisible d'enlever tant de jours à la culture, pour les abandonner à l'oisi veté et à la débauche , autant je désirerais qu'il y eût un jour de chaque semaine consacré à des instruc tions utiles, et terminé par une fête champêtre. J'ai lu quelque part , qu'il y avait un pays où les habi 1. 4 LETTRE lants cievaieni les yeux de leurs esclaves, pour qu'ils battissent leur lait sans distraction. Non-seulement ces hommes étaient cruels, mais ils entendaient mal leuis intérêts. Le travail n'en va que mieux quand il est fait gaiement et par des gens qui voient clair. En parcourant la table de votre livre, je ne me sentais pas de joie. Tout ce que nous avons jamais désiré de savoir se trouve réuni dans cet ouvrage : mais je fus bien trompé, lorsqu'en le lisant à mes enfents , je vis que ni eux ni moi , nous ne pouvions en entendre une page. Cela paraît pourtant écrit en français, nous disions-nous. Cependant , j'ai un peu compris ce que vous dites sur le peuple, et votre nouvelle législation des blés. Je vous remercie de l'intérêt tendre que vous prenez à ce pauvre peuple : mais, en vérité, il n'est ni si heureux ni si malheureux que vous le dites (i). Tant qu'il a de la jeunesse , de la santé et du tra vail, son sort est supportable; peut-être même est -il meilleur que celui du riche : car on dit que tout homme qui a plus de cent pistoles de rente, ou qui est exempt de taille, est pendant toute sa vie tourmenté d'une maladie qu'on appelle vanité, et dont l'effet infaillible est d'empoisonner ses jouis sances, et de rendre ses peines plus amères. Mais lorsqu'une famille est chargée de faiie sub sister des vieillards; lorsque la mort lui enlève son chef, ou que, né avec une constitution faible, il est souvent exposé à manquer d'ouvrage; lorsque de (i) Pages 32 et iSï. U UN LABOUREUR VE l'ICAUUIE. *) longues maladies l'ont épuisée , elle tombe dans un état d'angoisse et de détiesse, où il ne lui reste , contre une destruction lente et cruelle, que des ressources humiliantes ou criminelles. Vous dites (|ue «pour soulager le peuple, le gou vernement n'a pres(jue d'autre moyen que d'ordon ner de ne vendre le blé qu'au marché, lorsqu'il passera un certain prix ; de défendre aux marchands d'en acheter, à moins qu'ils ne promettent de ne pas le revendre dans le pays ; de forcer les boulangers à avoir chez eux des provisions; de fournir des fonds à des marchands de blé privilégiés; de ne laisser sortir que des farines , et seulement lorsque le blé sera à bon marché ; enfin, de n'ordonner tout cela que pour dix ans. » Hélas! Monsieur, j'avais espéré, depuis quelque temps, que la destruction des corvées, la suppres sion des gabelles, et celle de la taille arbitraire, of friraient bientôt au peuple des ressources assuiées contre les accidents qui l'exposent à la misère. Je voyais, dans la suppression de la taille arbi traire, une diminution d'impôt pour le pauvre, la liberté rendue à l'industrie, que tenait captive la crainte d'une augmentation de taille. Dans la suppression des gabelles, je voyais l'exemp tion d'un droit énorme, levé sur une denrée de consommation journalière, droit dont le peuple fait tous les jours les avances : j'y voyais la facilité d'avoir ])lus de bestiaux, et des bestiaux plus sains; d'aug menter par là les ressources du peuple et la masse de ses subsistances. 6 LKTTRt: Dans la destruction des corvées, enfin, je voyais que mes malheureux voisins ne seraient plus forcés de travailler sans salaire pendant quinze jours : qu'au contraire, ce changement, en assurant à chacjue homme environ quinze journées de plus par année, suffirait pour piévenir, dans les campagnes, le manque d'ouvrage. Je ne parle point de tout ce que ces sages opé rations épargneraient au peuple de vexaticns, de concussions, d'inquiétudes, d'humiliations, de traite ments cruels . etc. J'ai peine à croire que votre législation fasse de plus grands biens. Premièrement , quand le blé sera cher, le peuple des campagnes sera obligé d'aller à trois lieues de chez lui, et à des moments marqués, acheter, argent comptant, au marché le blé qu'il aurait pu acheter chez son voisin à toute heure, à meilleur marché et souvent à crédil. A la vérité, vous assurez que celle loi ne serait jamais exécutée, mais qu'il faut toujours la faire, afin de s'en servir contre qui l'on jugera à propos : et un des grands défauts que vous trouvez au système de la liberté, c'est qu'il ne fournit aucun prétexte pour punir les marchands de blé trop avides. J'avais toujours cru que des lois dont l'exécution n'était pas générale, dégénéraient en oppression ; qu'on ne les faisait valoir que contre ceux qui ne pourraient acheter le droit de s'y soustraire. Mais quoi qu'il en soit, si la loi est exécutée, il y a perte de temps et augmentation de prix pour le paysan ; si elle ne l'est pas, il y aina quelques avanies faites au ha d'un laboureur de PICARDIE. 7 sard à quelques marchands de blé : cela pourra diver tir le i)euple , mais je ne vois point encore de sou lagement réel. Secondement, vous ne voulez pas qu'on achète au marché pour revendre sans destination. D'abord la nécessité de déclarer au greffe quelle est la desti nation du blé qu'on a acheté, suffira pour dégoûter de ce commerce. D'ailleurs, faudra-t-il que la destina tion soit pour vingt, pour dix, pour deux lieues seulement de l'endroit du marché? Sera-t-on tenu de revendre ou de faire sortir le blé dans la huitaine ou dans la quinzaine? S'il vient à augmenter au lieu de l'achat, ne rendra-t-on pas à ceux qui ont acheté , avec une destination éloignée, le droit de revendre sur le même lieu? Cette partie de votre loi ne serait elle pas alors absolument illusoire? Dans le temps de cherté , presque tout le blé est entre les mains des marchands et des propriétaires riches : presque tout est dans les villes. Les habitants des campagnes ne peuvent commodément l'y aller chercher : les meuniers, lesblatiers viennent en apporter chez eux. L'entière liberté de vendre à qui et partout où l'on veut, est donc alors de la plus grande nécesssité. "Vous voulez qu'il y ait une provision chez les boulangers, c'est-à-dire, que vous voulez les forcer, pendant une partie de l'année, à avoir chez eux une certaine quantité de blé. Mais qui payera le sur croît de dépense, que celte contrainte occasion nera aux boulangers? Ceux qui achèteront leur pain. Et vos agents secrets, employés par le gouverne 8 LETTRE ment au commerce de blé. . . Ah! Monsieur, ce sont les plus habiles gens du monde pour remédier aux disettes qu'ils ont fait naître. La permission de ne faire sortir que des farines, aura l'avantage immense de conserver en France plus de son , sans compter celui de donner aux propriétaires de moulins le privilège exclusif du commerce étranger, et d'introduire une exportation de grains, qui ne sera pas un encouragement pour l'agriculture. Enfin, Monsieur, je ne vois rien dans tout cela qui tende à soulager le peuple. Vous proposez de ne faire celte loi que pour dix ans, je trouve que c'est beaucoup trop encore : mais laissez nous d'abord essayer de la liberté aussi pendant dix ans. Oh! cela est fort différent , direz-vous, parce que le peuple est une espèce d'animal très-patient , mais qui au moindre bruit de cheité devient furieux: le seul mot de prohibition, de loi contre les mar chands de blé , lui rend la raison et le calme. Voilà le véritable fondement des lois piohibitives : car, après tout, on doit respecter la faiblesse de ce pau vre peuple, qui est disposé à tout souffrir, pourvu qu'on songe à lui donner du pain. S'il n'avait pas de préjugé contre la liberté, ce système en vaudrait bien un autre : mais les préjugés du peuple sur cet objet sont absolument incurables. !N'esl-ce pas à jjeu près. Monsieur, ce que vous avez voulu dire, dans ce que j'ai pu entendre de votre livre, sur les motifs des lois prohibitives? Le peuple est stupide, sans doute; mais ce n'est D rjN LABOUItliUli Di. l'ICARDlE. g pas sa faute. Avant le i3 septembre i']']l, on n'a vait point encore daigné traiter le peuple comme une société d'elles raisonnables : abandonné à des charlatans de toute espèce, jamais on n'avait songé à lui donner sur rien des idées justes, des notions précises. Est-il étonnant, après cela, qu'il se laisse entraîner aux plus grossières apparences, qu'il soit la dupe de l'artifice? Mais les cireurs de l'ignorance sont plus aisées à détruire que celles de l'intérêt et de l'orgueil; et voilà pourquoi je crois que le peuple sera guéri de ses fausses opinions sur le conniierce des blés, longtemps avant les hommes les plus éclairés qui partagent ses préjugés. S'il n'est pas en étal de saisir des preuves compliquées, (pielques années d'expérience, la confiance dans le gouver nement, fortifiée chaque année par des opérations bienfaisantes, le spectacle des fourbes qui l'égarent, démasqués et punis, suffiront poui afiaiblir ses pié jugés, en attendant qu'une éducation plus raison nable , qu'il serait si aisé et si utile de procurer à ce peuple, vienne préserver la génération naissante de toute erreur funeste. J'ai vu quelquefois ce pauvre peuple s'échauffer pour le blé! Eh bien, dans nos villages où tout le monde se connaît, j'ai remarqué que ce n'étaient pas les plus malheureux, mais les plus déshonorés, qu'on voyait à la tète des séditions : ceux qui les sui vaient étaient entraînés, non par la faim, mais par une fureur qu'on leur avait suggérée. Un homme qui aurait faim enlèverait du pain, de la farine, du blé même; il le porterait dans sa chaumière, il se hâte I O LEl'TRE lait d'en piéparer la nourriture nécessaire au sou tien de sa vie. Au lieu de cela, tantôt ils pillaient les meubles d'un marchand de blé, parce qu'on leur avait dit que ce marchand ne vendrait du blé que lorsqu'il vaudrait 60 francs le selier. Tantôt ils détruisaient un moulin économique, dont le propriétaire leur vendait du pain à meilleur marché, parce que les boulangers les avaient assurés que cet homme met tait de la craie avec sa farine. D'autres jnenaient le blé des gens d'église, parce que, disaient-ils, le bien de l'Église est le bien des pauvres, et que c'est pour cela qu'il ne paye point de vingtièmes. Quel ques-uns enlevaient du blé de force, le payaient le prix qu'ils voulaient, et croyaient leur expédition légitime , parce qu'ils avaient droit de vivre. Or, Monsieur, croyez-vous qu'il soit impossible de persuader au peuple, que si un homme a tenu un propos dur cl barbare, cela ne donne pas le droit de le piller; que les meuniers économiques ne mettent pas de craie dans le pain; que les biens des moines leur appartiennent, tant que le gouverne ment voudra bien les leur laisser, et que payer le setier 12 livres quand il en vaut 3o, c'est précisé ment comme si on prenait 18 francs dans la poche du possesseur de ce blé ? Croyez-vous qu'on ne puisse pas faire entendre au peuple que le besoin ne lui donne pas plus le droit de voler du blé que de l'argent; que ces deux vols ne peuvent être excusés (|ue dans les mêmes cir constances; que celui qui achète i5 francs un se DON LABOUREUR UE PiCARUIF. lier de blé qui en vaut 3o , ne peut alléguei la né cessité poiu" excuse, parce qu'il pouvait aclielei un demi-selier pour i5 francs, et travailler pour eu gagner i5 autres? Nous venons de voir une troupe de brigands dé molir des moulins, jeter à la rivière les farines et les blés, en disant qu'ils manquaient de pain, et crier qu'ils avaient faim en répandant l'or à pleines mains. Nous les avons vus traîner à leur suite un peuple trompé, à (pii ils peisuadaient que l'intention du gouvernement était que le blé fût à bon marché; fabriquer de fausses lois pour le tromper. Nous avons vu des gens du peuple, riches en terres et en effets, se joindre aux pillards, et soudoyer des hom mes qui pillaient pour eux. Nous avons vu celti' fu reur se commuiii(]uer de proche en prt)che, et celte opinion qu'il est permis de piendre du blé où il y en a, et de le payer ce que l'on veut, prête à devenir l'opinion générale. Cela prouve, sans doute, qu'il est facile de sé duire et d'égarer le peuple. Mais croyez-vous qu'il soit impossible de lui faire sentir que des scélérats ont abusé de sa facilité pour le rendre criminel; que c'est un mauvais moyen, pour procurer du pain au peuple, que de jeter les faiines à la rivière; que le cultivateur qui a fait venii le blé à force de travaux et de sueurs, le marchand qui l'a payé de son ar gent, doivent avoir la libre disposition de leur blé, comme l'homme du peuple a la libre disposition de ses habits, de ses meubles; que toute taxe d'une denrée qui n'est pas l'objet d'un privilège exclusif, 13 LETTRE est un véritable vol ; que le gouvernement enfin n'a point le droit de gêner, entre les concitoyens d'un même État, la liberté d'acheter et de vendre une denrée nécessaire? Lorsque ces réflexions très-sim ples sur Xinjustice des lois prohibitives, et la fermeté du gouvernement à maintenir la liberté comme juste et comme utile, auront disposé les gens du peuple à regarder cet état de liberté comme l'état le plus naturel, pourquoi ne leur ferait-on pas entendre qu'il est de leur avantage que le cultivateur soit maître absolu du grain qu'il recueille, afin qu'il soit plus intéressé à augmenter la repioduclion ; qu'il est de leur intérêt que le commerce soit libre, afin qu'on leur apporte du blé quand ils en manqueront; qu'il est de leur intérêt que les magasins de blé soient sacrés , afin qu'on leur prépare une ressource dans les années stériles? Ces simples réflexions ne suffisent pas, sans doute, pour résoudre toutes les difficultés qu'on élève contie la liberté du commerce des grains; mais elles suffisent pour rassurer le peuple, pour lui fdiire sentir que les partisans de cette liberté ne sont pas des monstres qui enipninteiit sa voix pour le dévorer. Vous dites que le peuple haïra toujours les mar chands de blé, qu'il appelle monopoleurs, et qu'ainsi cet état, flétri par l'opinion, ne sera ja mais un état honnête. Mais, Monsieur, le peuple hait les financiers, qu'il appelle maltôliers, et les marchands d'argent , qu'il appelle usuriers : direz vous cpie ces états sont mallionnétes? Tous ces pié jugés ont une source commune; ces différents d'un laboureur DR PICARDIE. l3 fatals (i) n'ont été remplis longtemps que par des liomraes déshonorés : tous trois protégés, employés en secret par le gouvernement, étaient flétris par des lois; longtemps leurs opérations n'ont été qu'un tissu de manœuvres coupables. Mais ces préjugés, fondés autrefois sur la raison , et maintenant désa voués par elle, se dissiperont, et le peuple deviendra moins injuste, en devenant moins nialheureux. Paimi les causes qui entretiennent la haine du peuple contre les marchands de blé, il en .est une à laquelle on n'a pas daigné faire attention, parce qu'elle est absurde, mais qui n'en est pas moins puissante: chaque année, des chanteurs parcourent les campagnes avec des complaintes : tantôt, c'est un pauvre qui a proposé à un fermier de lui vendre du blé à bon marché , quoiqu'il soit cher; le charitable fermier va remplir le sac, et en revenant il trouve son pauvre, transmué en un grand crucifi.v qui fait force miracles. Une autre fois, c'est un fermier qui a dit, en reniant Dieu, qu'il aimait mieux être mangé des rats, que de vendre son blé à une pauvre femme; et voilà soudainement que les rats viennent le manger jusqu'aux os, comme Popiel , duc de Li ihuanie, et je ne sais quel archevéqjLie de Mayence, (i) Notre agriculteur, qui ne connaît pas les finesses de la lan gue, avait mis métier. En français, ou dit le métier de laboureur, le métier de poète , de philosophe , le métier de la guerre ; mais il serait de la plus grande impolitesse de parler du métier de fer mier d'impôts, de ban(iuier, d'agent de change; ce serait manquer au respect que, dans toute nation bien policée, on doit à l'or et au talent d'en amasser. l4 LKTTRF. à ce i|ue disent les historiens les plus respectables. Enfin, un coquin de fermier a osé dire qu'il devien drait tambour, si le blé ne montait pas à 60 francs le sac; et sur-le-champ voilà son ventre changé en tambour, et ses bras en baguettes : les voisins accou rent charitablement pour le tuer; mais, comme de raison, les balles s'aplatissent sur son ventre. .. Quant aux marchands de blé emportés par le dia ble, aux sorciers qui escamotent le blé pour produire la famine, il n'y a rien de plus commun; et pour quoi voudriez-vous que le peuple ne crût pas tout cela , et cent autres sottises qu'on lui insinue par la même voie, que la jeunesse apprend par cœui', et qui sont la seule éducation qu'elle reçoive après être sortie des écoles? Ne lisent-ils pas au bas : vu et a/j proiH'é? et ces mots, suivis des signatures les plus respectables, comment le peuple devinerait-il que signer qu'on approuve, signifie le plus souvent qu'on n'approuve pas? J'ai ouï dire qu'à Paris on prenait les plus grands soins pour empêcher les illustres habitants de cette ville, de se gâter l'esprit par la lecture des livres de certaines gens qu'on appelle philosophes, c'est-à dire, amis de la sagesse. Je crois qu'on rendrait un grand seivice au peuple des campagnes, si on met tait ces marchands de mensonges ( quoiqu'ils ne soient pas amis de la sagesse) au pilori avec cet écriteau : Colporteurs d'histoires inventées, pour ren dre les hommes imbéciles et méchants. Je suis per suadé que cette correction serait très-instructive et très-exemplaire. D UN LABOl RKLK I>1 PIC11DIF. i5 Je reviens aux préjugés du peuple sur le blé. 11 y a dans ce canton des gens bien intentionnés, qui ont l'honnêteté de répandre que si le blé est cher, c'est parce que le gouvernement en a fait passer aux élrangeis : le peuple croit cette absuide calomnie, et il a raison. Il voyait, il n'y a pas longtemps, l'ex portalion défendue par une loi publique, et permise à des personnes privilégiées, par des ordres secrets; pourquoi ne croirait-il pas que l'on suit aujourd'hui le même régime ? Il n'y a encore que le peuple du Limousin quisachepourquoicequi sefaisaiten 1771, ne se fait pas en 1773; mais, dans quelques années, le peuple de toute la France le saura. Vousexagérez la stupidité du peuple. Nous sommes ignorants, parce qu'on n'a point daigné nous don ner les moyens de nous instruire; parce qu'il est tout simple qu'une jurisprudence, une législation de (inances, qu'aucun jurisconsulte, aucun financier ne peuvent se vanter d'avoir eutendues en entier, n'of frent qu'un brouillard à des hommes qui n'ont ni le temps ni l'habitude de la réflexion; mais nous sa vons saisir les idées simples qu'on nous présente clairement, et raisonner avec justesse sur ces idées; nous savons souffrir avec patience les outrages c{ue nous ne pouvons repousser; mais nous ne sommes pas'abrutis au point de ne les plus sentir. Nous délestons les lois, en vertu desquelles un pauvre père de famille, qui n'a point cent écus d'ar gent comptant, est envoyé aux galères , et marqué d'un fer chaud, pour avoir acheté à bon marché du sel qui n'est souillé d'aucune ordure; nous sommes iG I.KTTKE indignés (ju'on ose faire si peu de cas de noire liberté et de notie honneur. Nous savons que ceux qui nous traitent ainsi, n'ont d'autre avantage au-dessus de nous, que de s'être enrichis de nos dépouilles, et cela redouble notre indignation. Vous dites que nous sommes tentés de regarder les riches comme des êtres dune nature différente, que leur giandeur est une magie qui nous en impose. Ah! Monsieur, que nous sommes éloignés de ces idées! Nous voyons passer quelquefois de ces riches fastueux, et ce n'est point du respect qu'ils nous ins pirent; nous savons combien les métiers qui les ont enrichis, sont moins nobles que les métiers utiles qui nous donnent à peine de quoi vivre. Nous sen tons que si leur argent leur donne la facilité d'ache ter des jouissances dont nous sommes privés, il ne leur donne aucun droit d'obtenir sur nous des dis tinctions ou des préférences; et l'homme en place, le grand seigneur qui leur accorde ces distinctions, se dégr-ade à nos yeux; nous le regardons comme un vil esclave de l'or. Nous payons avec joie la dîme destinée à l'entre tien des pasteurs, chargés de nous instruire et de nous consoler. Mais nous savons trouver très-injuste (|ue nos pasteurs soient réduits à partager notre pauvreté , tandis que nos dîmes sont consommées par des abbés et des moines qui, heureusement poirr nos mœurs, ont renoncé au soin de nous rien ap prendr-e. Lorsqu'un malheureux, qui manquait de pain, n'a pu aller travailler quinze jours , sans salaire, à U'UN LABOUREUR DE PICARDIE. ] '] plusieurs lieues de sa maison; lorsqu'il a mieux aimé désobéir à un piqueur, que de laisser sa famille ex posée à mourir de faim, on le condamne à une amende qu'il ne peut payer; et pour le punir d'être pauvre, on le traine en prison : croyez-vous que nous n'ayons pas l'esprit de trouver ce traitement barbare, quoique ce malheureux ait t/u pain dans son ca chot? Croyez-vous que nous ne sentions pas que, grâce aux épices , au privilège exclusif des procureurs et des avocats, et aux subtilités de la chicane , il n'y a point de piaticien de la ville voisine, qui ne puisse nous ruiner de fond en comble, sans qu'il soit pos sible de nous défendre, sans que jamais il risque d'être puni? Que lorsqu'un riche injuste attaque notre pro priété , tout ce que nous avons sera consommé en frais de justice, avant de l'avoir obtenue; et que si nous préférons l'orgueil de nous défendre, au parti humiliant d'acheter la paix, nous risquons notre ruine totale? Qu'il n'est pas absolument juste que le blé que nous avons semé, soit mangé par les lièvres ou par les sangliers de notre seigneur? Que si nous souffrons des violences de la part d'un riche, des vexations de celle d'un subalterne, qu'il nous sera impossible d'obtenir une réparation , et qu'en osant la solliciter, nous nous exposons à une vengeance dont les lois ne nous préserveront pas ? Voilà l'origine de cette patience apparente, que vous avez prise pour de la stupidité. Mais un roi XI. ' 2 i8 LETTRE juste et qui veut le bien de son peuple, nous a rendu l'espérance et la voix. Nous osons attendre de lui des lois de propriété, qui nous garantissent le peu que nous avons, contre les ruses de la chicane et les entreprises de l'homme accrédité; des lois de liberté qui défendent nos per sonnes de la violence des exacteurs, qui nous dé livrent de l'esclavage des corvées; des lois de Jus lice qui protègent notre personne et notre Iionneur contre le crédit du riche, contre la tyrannie des pouvoirs subalternes. Car c'est dans ces abus que consiste la force , vraiment funeste au peuple, que donne au riche contre le pauvre la corruption de la so ciété, et non pas le droit de propriété; c'est contre cette force qu'il invoque le secours de son roi. Voilà, Monsieur, ce que nous espérons , et ce que nous osons hautement préférer à votre législation des farines, à cette précaution de garder tout le son poumons, que vous semblez regarder comme une découverte lumineuse. Pardonnez, si je vous parle avec quelque vivacité; mais votre pitié nous humilie, en même temps qu'elle cherche à nous soulager. Vous voulez qu'on nous fasse l'aumône, parce que nous sommes des êtres misérables, incapables d'en tendre raison , incapables de sentir le prix de la li berté et des bonnes lois (pag. 170.) Nous mériterions ces reproches, si nous pouvions les souffrir sans in dignation. Vous avertissez les propriétaires, que si le peuple perdait ses préjugés sur le commerce de blés, il pour rait s'éclairer en même temps sur d'autres objets. d'un laboureur de PICARDIE. I9 Croyez-vous, Monsieur, (|u'il serait dangereux de souffrir que le peuple sortît de son ignorance? Croyez-vous que l'iiomnie devienne niédianl en s'éclairant? Croyez-vous que les voleurs de grand chemin soien I d'iiabiles raisonneurs, et qu'il leur ait fallu de gran des lumières pour trouver les raisons, sur lesquelles ils fondent leurs réclamations contre la pi opriété et les lois? Ou seulement avez-vous prétendu avertir charita blement les riches, que si le peuple s'éclaire, il saura mieux se soutenir contre l'oppression et contre la ruse? Et qu'ainsi il vaul mieux pour lesiiches, lais ser le peuple piller les marchands de blé , que de risquer qu'en apprenant à respecter la propriété des autres , il n'apprenne en même temps à se défendre ? Oserais-je vous représenter. Monsieur, qu'un homme qui fait un gros livre sur la législation et le commerce des blés, aurait dû s'instruire avec plus de soin des détails de nos campagnes? Vous voulez prouver que l'exportation n'est pas nécessaire pour encourager à défricher; et vous di tes que l'on cultive aussi bien les terres qui rappor tent cinq pour un, que celles qui rapportent six. Il n'est pas question de savoir combien de fois la leire rapporte la semence qu'on lui a confiée, mais de savoir ce qu'elle rapportera au-dessus des frais de culture , de semence , de récolte. Dans les terres à défricher, il y en a qui rapportent très-peu au delà de ces frais: il y en a qui peuvent rapporter beaucoup au delà des avances, mais qui demandent des avan 2. OO LETTRE ces considérables. Or, comme le laboureur risque, si l'année est mauvaise, de ne pas retirer ses avan ces sur ces terres nouvelles; que les frais de culture, le loyer du fonds, la dîme, et la dépense nécessaire à sa subsistance, peuvent alors absorber au delà du ])roduit de ses terres anciennes, il faut, pour le dé terminer à risquer une entreprise, qu'il soit sûr que, dans une année d'abondance, son blé ne tombera pas à vil prix. Dans les mauvaises années, le cultiva teur ne vend presque point de blé, et il a tout vendu avant le rebaussement : il n'a donc d'encouragement que dans le bon prix des années fertiles. D'ailleurs, il ne s'agit pas seulement de défricher, il faut faire rapporter six à la terre qui ne rapportait que cinq; et pour cela il faut employer de nouvelles ressources, faire des avances dont l'intérêt diminue à mesure que la cultuie plus parfaite rend les amé liorations plus difficiles. Ce n'est pas tout encore : nous faisons porter du blé à des terres qui ne por taient que du seigle; les terres à blé se sont couver tes de lin, de chanvres, de colzas: l'aurions-nous fait si le surplus de blé produit, par uneculture per fectionnée,ou parles terres nouvelles, n'eût dédom magé, par le bon prix des années fertiles, de ce qu'il a coûté pour le produire? Enfin, Monsieur, croyez-vous que nous ne soyons conduits que par l'espérance du gain , comme les né gociants des grandes villes, comme si nous n'avions que cele^'ier dans le cœur?l^C)% gagnons à l'heureuse nécessité qui nous attache aux campagnes, d'aimer par-dessus tout la liberté et la paix. Nous retirons IJ UN LABOLIRKUR Ui: l'ICAHUIli. at ordinairement de nos terres de (iiiui paver le pro priétaire, le déciinaleur et nos ouvriers, la itiitrée des autres frais decultuie,une subsistance honnête, quelques épargnes pour notre vieillesse et pour nia riei' nos filles. Pensez-vous que nous irons risquer ces épargnes, nous livrer à des cultures nouvelles, à des procédés qui exigent une attention plus l'oite, nous condamner à une augmentation de peines, de soins et d'inquiétudes, et cela pour être exposés à avoir des querelles avec les préposés de votre légis lation, pour être rançonnés par vos agents secrets? Vous dites que nous payons en argent le salaire de nos ouvriers de labourage , que vous appelez la boureurs et cultivateurs : ce fait n'est point exact, ce qui suffit pour faire tomber tout le raisonnement par lequel vous prouvez, dans cet endroit, que les économistes sont de terribles animaux. Vous dites qu'il y a des marchés dans presque tous les villages : cela n'est pas vrai dans ce pays , où il y a souvent cinq à six lieues d'un marché à l'autre. J'ai ouï dire qu'il en était de même de plusieurs autres cantons. Vous supposez que les habitants des villages (pii n'ont point de marché, font quatre ou cin(| fois l'an née leur provision de blé; et vous ignorez que le peuple des villages achète à très-petite mesure, et que c'était quarante ou cinquante qu'il fallait dire ; vous ajoutez qu'il ne sera nullement gêné de rap porter cette quantité de blé avec les autres provisions. Ainsi, Monsieur, selon vous, leconsoumiateur de vil lage ne sera point gêné d'avoir à rapporter eiiiron 2 2 LETTRE 5oo livres de plus que ses provisions, qui peut-être lie pèsent point 20 livres : selon la vérité, c'est 5o à 60 livres qu'il faudra qu'il rapporte de plus sur son dos , et qui , selon vous , ne le gêneront nullement. Vous croyez que si l'on n'est pas forcé de ne vendre qu'au marché, les gens des villes seront obligés d'aller chercher leur blé de campagne en campagne. Vous ignorez que dans presque toutes les villes on est nourri par les boulangers : que les magasins des marchands de blé, les greniers des propriétaires sont presque tous dans les villes, et que dans le temps de cherté, ce sont elles qui doivent nourrir les campagnes. Vous ignorez qu'il a été permis cette année, par un arrêt du conseil, de porter du blé par mer dune province à l'autre. J'avais jusqu'ici regardé l'art de conserver les grains, comme un art bienfaiteur, et je pratiquais avec suc cès les moyens proposés par M. Duhamel. Mais cet art est propre à augmenter la puissance naturelle du vendeur sur le consuininateur, et il serait par consé quent très-sage de le proscrire. De quoi s'est avisée l'A cadémie de Limoges de donner un prix à celui qui en seignerait les meilleurs moyens de préserver les blés des charançons, et de détruire ces insectes? Voilà ce que c'est que de n'avoir que de petites vues; si jamais les vôtres font fortune, nous verrons les so ciétés littéraires proposer des prix pour le meilleur moyen de multiplier les charançons , les vers, les pa pill()ns et autres insectes qui mangent les blés. D UN LABOUKEUU DE IMCARDIK. a3 Comme je raisonnais sur ce sujet avec mon curé , qui lit liiusles livres nouveaux, il m'a appris ([ue M. T,... qu'il legarde comme le plus conséquent des auteurs pioliibitiCs, voulait (|ue le peuple ne se nourrit ([ue de poisson pourri, parce que les marchands ne peu vent le garder, et que cette nourriture soulève le cœur des gens un peu délicats. Il faut avouer que la tendresse des auteurs prohi bitifs pour le peuple, leur a inspiré de bien heureuses découvertes. Vous assurez, Monsieur, que la France est dans le plus haut point de prospérité : et vous en concluez qu'il n'y faut pas faire de lois nouvelles sur ses sub sistances,/;rt/f« qu'on ne doil pas faire d'expériences d'anatomie sur un corps vivant. Si c'est en 177^^, temps où a paru votre livre, c[u'il ne faut point faire de loi nouvelle, à la bonne heure; nous devons suivre la loi du i3 septembre, et ne pas essayer de votre nouvelle législation. Si c'est avant le mois de sep tembre 1774, que vous placez la grande prospé rité, alors on eut tort de faire la loi du i3. Mais aussi vous avez tort de proposer, en mai r775, une nouvelle expérience d'anatomie : car s'il ne faut pas faire d'expérience d'anatomie sur les corps vivants, il faut encore moins les répéter; donc, etc. Vous faites j7i;7/(?7' votre requête par l'utile laboureur et le pauvre cultivateur. Permettez-moi de vous dire, que moi qui suis du métier, j'ai pris la liberté d'en présenter une toute contraire. Voici la copie de la mienne : /i LKTTRE 24 « MoNSErGNEUR , «Vous nous avez délivrés d'une loi tyran nique, «qui nous forçait à ne vendre, à n'acheter des «subsistances que dans les marchés, où il nous «fallait ensuite payer au seigneur la permission « d'obéir aux ordres du roi. «Tandis que, par une loi générale, il nous était «ordonné de n'acheter qu'aux marchés , il était dé « fendu aux fermiers, par une loi de police par «ticulière, d'acheter à ces mêmes marchés du grain «pour eux ou pour leurs chevaux. Vous nous avez « délivrés de l'oppression de ces règlements conlra «dictoires, et arbitrairement exécutés. ic II nous était défendu , dans le temps de cherté, « d'acheter du pain aux marchés des villes où nous « étions contraints de porter nos blés, où ce blé, que «nos travaux avaient fait naître, était déposé dans «les greniers des chapitres et des moines : et c'est «encore une vexation dont vous nous avez délivrés. « La défense de faire sortir d'une ville le blé qui y « était une fois entré, était une autre chaîne que vous « avez brisée. « Daignez achevei votre ouvrage. «On n'ose plus nous vexer par des règlements; «mais faites que les blatiers qui vont aux marchés « des villes chercher le blé dont les campagnes ont «besoin , ne soient plus exposés à des menaces, à des «abus de pouvoir, à des ruses de chicane. Ne souffrez «pas que les partisans du régime prohibitif donnent D KN LABOUKEUR DE l'ICARDllî. aS « des atleiiites sourdes à la loi paternelle de la liberté. «Délivrez cette liberté des entraves qui Uii restent. « Qu'une denrée nécessaire à la vie, comme l'air «qu'on respire, ait une circulation aussi libre. Affrau «cliissez les blés des droits de péage. « Détruisez ces droits de minage, de stellage, de «hallage, de mesurage, restes honteux de notre an « titpie servitude. Ils s'opposent à la distribution natu « relie des subsistances ; ils soumettent le commerce «à l'inspection, aux procédures d'une nuée de com « mis, citoyens inutiles, qu'il faut encore que le com « merce soudoie. «Détruisez les banalités : tant qu'elles subsiste « ront, le commerce des farines ne sera point viai « ment libre. L'adresse avec laquelle les meuniers «peuvent, à leur gré, diminuer ou augmenter la n quantité ou le poids de farine que rend une même « mesure, est une source de voleries si variées, si « difficiles à constater, que la liberté en est l'unique « remède. Comme le meunier est marchand de blé, « il a soin de donner moins de farine à ceux qui « achètent ailleurs que chez lui. Il est dur que le « pauvre, à qui un travail opiniâtre procure à peine «de quoi acheter sa subsistance, ne soit pas libre « d'acheter celle qu'il croit ou la meilleure ou la « moins coûteuse : qu'il ne puisse la faire moudre « par celui dont il espère obtenir le plus de farine; « et ces soupçons fussent-ils mal fondés, il est cruel « qu'il soit forcé de porter un blé acheté par tant de « sueurs, à un homme qui croit devoir lui en voler « une partie. i6 LETTRE « Nous ne nous arrêterons ni aux fours banaux, rt genre de servitude plus barbare encore et plus « nuisible, ni aux communautés de boulangers, et « aux taxations pour le prix du pain qui en sont la « suite. Ces fléaux sont réservés aux villes, ils sont « l'ouvrage de la pédanterie, qui y a succédé à la « barbarie de nos ancêtres. « Toutes les institutions qui gênent la liberté, doi « vent toutes être également proscrites; et leur pros « cription, en montrant que la loi de la liberté en « tière est regardée par le gouvernement comme une « loi perpétuelle et inviolable, mettra le sceau aux « biens que la liberté doit procurer; l'opinion que « cette loi sera durable, peut seule établir, entre le « prix des subsistances et celui des journées, la pro « portion qu'ils doivent avoir. « Tels sont , Monseigneur, les vœux et les espé « rances de ceux à qui vous avez rendu la douceur « de pouvoir espérer. » J'étais au désespoir de ne pas entendre votre livre tout entier .-je priai mon curé, qui est un très-bon homme, et qui a une jolie bibliothèque, de me le traduire en langage ordinaire. Au bout de deux jours, il est revenu avec un livre à la main : « Tenez, me dit-il, voilà une traduction du livre de M. iN., très fidèle, très-claire, et faite d'avance. » J'ai ouvert ce volume, il a pour titre : Dialogue sur le Commerce des blés, entre M. de Roquemaure et le chevalier Za nobi, 1770. J'ai rapporté votre ouvrage à M. le capitaine qui demeure à la ville : il était avec le vicaire de sa pa JDUN LABOURUUU DE PICARDIE. 27 loisse et un échevin. « Messieurs, leur dis-je, je vou drais savoir pourquoi vous, cl les gens qui sont de même état que vous, vous êtes en général si déchaî nés contre la liberté du commerce des blés? » a Mon ami, dit le capitaine, je n'entends rien à toutes ces questions : maisj'ai peur que, de la liberté du commerce des blés, on ne passe à la liberté du commerce du sel et du tabac; et si cela arrivait, mes troupes et moi , nous deviendrions inutiles; nos seigneurs les fermiers n'auraient plus de quoi nous paver de retraites. Autrefois il y avait, aimée com mune, cinquante arrêts du conseil pour étendre les droits de !a ferme au delà des conventions du bail : depuis que cet homme à systèmes est en place, il n'en a pas fait rendre un seul. Aussi. » «Ma foi, dit l'échevin , s'il s'avisait d'étendre la liberté des blés sui tous les objets qui se vendent aux marchés, nous n'aurions plus ni règlements à faire, ni amendes à prononcer; autant vaudrait-il être de simples particuliers : et puis il serait dur, pour nos bourgeois, que les étrangers, que des paysans vinssent librement acheter des denrées sur nos marchés, et les faire renchérir. » « Il serait à craindre, dit alors le vicaire, que la liberté de vendre du blé n'amenât celle de vendre du papier noir et blanc; et vous sentez qu'alors l'E tal serait perdu sans ressource. » « Du pain et une religion, oa ce qu'il faut au peu ple, dit notre auteur. » C'est dommage qu'il ne puisse entrer ni dans le paradis ni au conseil. Du pain et une religion! voilà précisément ce que les jésuites 2 8 LETTRE avaient fait au Paraguay : ils distribuaient à chaque habitant un peu de maïs et beaucoup de reUques, et ils donnaient le fouet à quiconque aurait osé faire un pas, dire un mot, sans la permission du père su périeur. Voilà ce que nous aurions fait en Europe, si on nous eût laissés faire. Fort peu de pain et beau coup de religion, voilà ce qui vous resterait tout au plus sans Henri IV, Gustave-Adolphe et les Nassau : aussi comment sont-ils morts? C'est l'abus des mots de liberté et de propriété, comme l'a encore très-bien observé notre auteur (et il tenait votre livre entre ses mains avec complai sance) : c'est l'abus de ces mots, qui a causé les maux les plus affreux. César, le meilleur des humains, n'aurait pas été réduit à faire égorger un million d'hommes pour persuader aux Romains de lui obéir, s'ils n'avaient pas eu la bêtise de croire qu'ils étaient plus libres sous leurs consuls. Si les bourgeois de Genève n'avaient pas raisonné si subtilement sur la liberté politique, ils se seraient soumis au petit con seil , ou ils n'auraient pas traité les natifs comme leurs sujets, et il n'y eût pas eu deux hommes de tués dans leur dernière guerre civile. Si les Mani chéens, les Albigeois, les Hussites, les Vaudois, les Protestants, n'avaient pas eu l'opiniâtreté de vouloir conserver la liberté de penser, nous n'aurions pas été obligés de faire égorger plus de deux millions de ces hérétiques, pour la plus grande gloire de Dieu, sans compter environ un pareil nombre de Catho liques qui ont péri dans ces saintes expéditions. Si les Mahomélans n'avaient point eu la fantaisie de U UN LABOUREUR DE PICARDIE. 29 prétendre que des infidèles pouvaient être légitimes propiiélaires d'un pays où notre Dieu avait été autre fois enterré pendant trois jours, il n'y aurait point péri trois millions de Musulmans et de Chrétiens dans nos pieuses croisades. Si les Américains avaient eu l'esprit de comprendre que la terre où ils étaient nés n'était point à eux, mais aux Espagnols, à qui le Pape en avait transporté la propriété, il n'aurait point fallu en égorger cinq ou six millions pour faire entendre raison au reste. Si on ne s'était pas avisé, dans le seizième siècle, d'imaginer que le bien de l'Eglise appartenait à l'Etat qui pouvait le repren dre, pour en faire un usage plus utile, il n'y aurait pas eu de guerres de religion. 3o LETTRE J'ai donc laissé le vicaire continuer sa déclamation contre l'abus de la propriété et delà liberté, et je suis retourné chez moi, bien convaincu que sans la liberté on ne respire jamais qu'à demi. Oserais-je vous demander, Monsieur, ce que vous pensez de l'exportation des haricots, qu'on défend toujours avec celle du blé ; de l'exportation des châtai gnes, qu'on a interdite dans quelques provinces, et de celle des œufs frais et du petit salé, contre laquelle on a dernièrement voulu faire une belle loi ? Ne pou vait-on pas permettre seulement l'exportation des châtaignes bouillies et des omelettes, afin de rendre, comme celui de la farine, ce commerce plus difficile, et de garder le bénéfice de la main-d'œuvre? J'ai l'honneur d'être, avec le plus profond res pect, etc. M. N. a été un peu surpris de recevoir cette lettre d'un laboureur de Picardie; il s'est adressé à un de ses correspondants, dont il a reçu la réponse sui vante : « Je connais beaucoup le laboureur dont vous me parlez, c'est un homme bizaire : il a pu être riche, il est pauvre; il a une femme et six enfants; il ne lui est arrivé que des événements fâcheux , et je n'ai jamais vu personne avoir l'air plus content de son sort.
| 7,458 |
https://github.com/Nexowned/Freud2.0/blob/master/Freud/Modules/Administration/Common/Filter.cs
|
Github Open Source
|
Open Source
|
MIT
| null |
Freud2.0
|
Nexowned
|
C#
|
Code
| 43 | 132 |
using Freud.Extensions;
using System.Text.RegularExpressions;
namespace Freud.Modules.Administration.Common
{
public class Filter
{
public int Id { get; }
public Regex Trigger { get; }
public Filter(int id, string trigger)
{
this.Id = id;
this.Trigger = trigger.CreateWordBoundaryRegex();
}
public string BaseRegexString
=> this.Trigger.ToString().RemoveWordBoundaryEscapes();
}
}
| 34,405 |
https://github.com/mfkiwl/verible/blob/master/common/lsp/message-stream-splitter.cc
|
Github Open Source
|
Open Source
|
Apache-2.0
| 2,021 |
verible
|
mfkiwl
|
C++
|
Code
| 605 | 1,646 |
// Copyright 2021 The Verible Authors.
//
// Licensed under the Apache License, Version 2.0 (the "License");
// you may not use this file except in compliance with the License.
// You may obtain a copy of the License at
//
// http://www.apache.org/licenses/LICENSE-2.0
//
// Unless required by applicable law or agreed to in writing, software
// distributed under the License is distributed on an "AS IS" BASIS,
// WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
// See the License for the specific language governing permissions and
// limitations under the License.
#include "common/lsp/message-stream-splitter.h"
namespace verible {
namespace lsp {
absl::Status MessageStreamSplitter::PullFrom(const ReadFun &read_fun) {
if (!message_processor_) {
return absl::FailedPreconditionError(
"MessageStreamSplitter: Message processor not yet set, needed "
"before PullFrom() called");
}
return ReadInput(read_fun);
}
// Return -1 if header is incomplete (not enough data yet).
// Return -2 if header complete, but does not contain a valid
// Content-Length header (i.e. an actual problem)
// On success, returns the offset to the body and its size in "body_size"
static constexpr int kIncompleteHeader = -1;
static constexpr int kGarbledHeader = -2;
int MessageStreamSplitter::ParseHeaderGetBodyOffset(absl::string_view data,
int *body_size) {
static constexpr absl::string_view kEndHeaderMarker = "\r\n\r\n";
static constexpr absl::string_view kLenientEndHeaderMarker = "\n\n";
static constexpr absl::string_view kContentLengthHeader = "Content-Length: ";
int header_marker_len = kEndHeaderMarker.length();
auto end_of_header = data.find(kEndHeaderMarker);
if (end_of_header == absl::string_view::npos && lenient_lf_separation_) {
end_of_header = data.find(kLenientEndHeaderMarker);
header_marker_len = kLenientEndHeaderMarker.length();
}
if (end_of_header == absl::string_view::npos) return kIncompleteHeader;
// Very dirty search for header - we don't check if starts with line.
const absl::string_view header_content(data.data(), end_of_header);
auto found_ContentLength_header = header_content.find(kContentLengthHeader);
if (found_ContentLength_header == absl::string_view::npos) {
return kGarbledHeader;
}
size_t end_key = found_ContentLength_header + kContentLengthHeader.size();
if (!absl::SimpleAtoi(header_content.substr(end_key), body_size)) {
return kGarbledHeader;
}
return end_of_header + header_marker_len;
}
// Read from data and process all fully available messages found in data.
// Updates "data" to return the remaining unprocessed data.
// Returns ok() status encountered a corrupted header.
absl::Status MessageStreamSplitter::ProcessContainedMessages(
absl::string_view *data) {
while (!data->empty()) {
int body_size = 0;
const int body_offset = ParseHeaderGetBodyOffset(*data, &body_size);
if (body_offset == kGarbledHeader) {
absl::string_view limited_view(
data->data(), std::min(data->size(), static_cast<size_t>(256)));
return absl::InvalidArgumentError(
absl::StrCat("No `Content-Length:` header. '", limited_view, "...'"));
}
const int message_size = body_offset + body_size;
if (body_offset == kIncompleteHeader ||
message_size > static_cast<int>(data->size())) {
return absl::OkStatus(); // Only insufficient partial buffer available.
}
absl::string_view header(data->data(), body_offset);
absl::string_view body(data->data() + body_offset, body_size);
message_processor_(header, body);
stats_largest_body_ = std::max(stats_largest_body_, body.size());
*data = {data->data() + message_size, data->size() - message_size};
}
return absl::OkStatus();
}
// Read from "read_fun", fill internal buffer and call all available
// complete messages in it.
absl::Status MessageStreamSplitter::ReadInput(const ReadFun &read_fun) {
size_t write_offset = 0;
// Move all we had left from last time to the beginning of the buffer.
// This is in the same buffer, so we need to memmove()
if (!pending_data_.empty()) {
memmove(read_buffer_.data(), pending_data_.data(), pending_data_.size());
write_offset = pending_data_.size();
}
if (write_offset == read_buffer_.size()) {
read_buffer_.resize(2 * read_buffer_.size());
}
const int free_space = read_buffer_.size() - write_offset;
int bytes_read = read_fun(read_buffer_.data() + write_offset, free_space);
if (bytes_read <= 0) {
// Got EOF.
// If we still have data pending, regard this as data loss situation, as
// we were never able to fully read the last message and send to process.
// Otherwise, report 'Unavailable' to indicate EOF (meh, this should
// be a better message).
if (!pending_data_.empty()) {
return absl::DataLossError(
absl::StrCat("Got EOF, but still have incomplete message with ",
pending_data_.size(), " bytes read so far."));
}
return absl::UnavailableError(absl::StrCat("read() returned ", bytes_read));
}
stats_total_bytes_read_ += bytes_read;
absl::string_view data(read_buffer_.data(), write_offset + bytes_read);
if (auto status = ProcessContainedMessages(&data); !status.ok()) {
return status;
}
pending_data_ = data; // Remember for next round.
return absl::OkStatus();
}
} // namespace lsp
} // namespace verible
| 190 |
https://zh-min-nan.wikipedia.org/wiki/Moores%20Mill%20%28Alabama%29
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Moores Mill (Alabama)
|
https://zh-min-nan.wikipedia.org/w/index.php?title=Moores Mill (Alabama)&action=history
|
Min Nan Chinese
|
Spoken
| 27 | 77 |
Moores Mill sī Bí-kok Alabama chiu Madison kūn ê chi̍t ê chng-thâu (CDP).
Jîn-kháu
Chit ūi tī 2010 nî ê jîn-kháu-sò͘ sī 5,682 lâng.
Alabama ê chng-thâu
| 15,646 |
https://github.com/ganlanshugod/wechat-client/blob/master/wechat-client/src/main/java/org/bana/wechat/pay/order/param/OrderQueryParam.java
|
Github Open Source
|
Open Source
|
Apache-2.0
| null |
wechat-client
|
ganlanshugod
|
Java
|
Code
| 188 | 715 |
/**
* @Company 青鸟软通
* @Title: OrderQueryParam.java
* @Package org.bana.wechat.pay.orderquery.param
* @author Liu Wenjie
* @date 2015-9-22 下午8:36:31
* @version V1.0
*/
package org.bana.wechat.pay.order.param;
import javax.xml.bind.annotation.XmlRootElement;
import org.bana.wechat.pay.common.WechatPayParam;
/**
* @ClassName: OrderQueryParam
* @Description: 查询订单的参数
*
*/
@XmlRootElement(name="xml")
public class OrderQueryParam extends WechatPayParam {
private String transaction_id;//微信订单号 transaction_id 二选一 String(32) 1009660380201506130728806387 微信的订单号，优先使用
private String out_trade_no;//商户订单号 out_trade_no String(32) 20150806125346 商户系统内部的订单号，当没提供transaction_id时需要传这个。
/**
* @Description: 属性 transaction_id 的get方法
* @return transaction_id
*/
public String getTransaction_id() {
return transaction_id;
}
/**
* @Description: 属性 transaction_id 的set方法
* @param transaction_id
*/
public void setTransaction_id(String transaction_id) {
this.transaction_id = transaction_id;
}
/**
* @Description: 属性 out_trade_no 的get方法
* @return out_trade_no
*/
public String getOut_trade_no() {
return out_trade_no;
}
/**
* @Description: 属性 out_trade_no 的set方法
* @param out_trade_no
*/
public void setOut_trade_no(String out_trade_no) {
this.out_trade_no = out_trade_no;
}
/**
* <p>Description: </p>
* @author Liu Wenjie
* @date 2015-9-22 下午8:37:53
* @return
* @see java.lang.Object#toString()
*/
@Override
public String toString() {
return "OrderQueryParam [appid=" + appid + ", mch_id=" + mch_id + ", transaction_id=" + transaction_id + ", out_trade_no=" + out_trade_no + ", nonce_str=" + nonce_str
+ ", sign=" + sign + "]";
}
}
| 44,381 |
https://github.com/AY2122S1-CS2103T-THUNDERCATS/tp/blob/master/src/test/java/seedu/address/model/person/PersonTest.java
|
Github Open Source
|
Open Source
|
MIT
| 2,021 |
tp
|
AY2122S1-CS2103T-THUNDERCATS
|
Java
|
Code
| 619 | 2,616 |
package seedu.address.model.person;
import static org.junit.jupiter.api.Assertions.assertEquals;
import static org.junit.jupiter.api.Assertions.assertFalse;
import static org.junit.jupiter.api.Assertions.assertNotEquals;
import static org.junit.jupiter.api.Assertions.assertTrue;
import static seedu.address.logic.commands.CommandTestUtil.VALID_ADDRESS_AMY;
import static seedu.address.logic.commands.CommandTestUtil.VALID_ADDRESS_BOB;
import static seedu.address.logic.commands.CommandTestUtil.VALID_EMAIL_AMY;
import static seedu.address.logic.commands.CommandTestUtil.VALID_EMAIL_BOB;
import static seedu.address.logic.commands.CommandTestUtil.VALID_NAME_AMY;
import static seedu.address.logic.commands.CommandTestUtil.VALID_NAME_BOB;
import static seedu.address.logic.commands.CommandTestUtil.VALID_PHONE_AMY;
import static seedu.address.logic.commands.CommandTestUtil.VALID_PHONE_BOB;
import static seedu.address.logic.commands.CommandTestUtil.VALID_TAG_FRIEND;
import static seedu.address.logic.commands.CommandTestUtil.VALID_TAG_HUSBAND;
import static seedu.address.testutil.Assert.assertThrows;
import static seedu.address.testutil.TypicalPersons.ALICE;
import static seedu.address.testutil.TypicalPersons.BOB;
import java.util.HashSet;
import java.util.Set;
import org.junit.jupiter.api.Test;
import seedu.address.model.common.Name;
import seedu.address.model.tag.Tag;
import seedu.address.testutil.PersonBuilder;
public class PersonTest {
private static final Name AMY_NAME = new Name(VALID_NAME_AMY);
private static final Phone AMY_PHONE = new Phone(VALID_PHONE_AMY);
private static final Email AMY_EMAIL = new Email(VALID_EMAIL_AMY);
private static final Address AMY_ADDRESS = new Address(VALID_ADDRESS_AMY);
private static final Set<Tag> AMY_TAGS = new HashSet<>();
static {
AMY_TAGS.add(new Tag(VALID_TAG_FRIEND));
}
@Test
public void withAddress_nonNullAddress_successfullyProducesEqualAddress() {
// Equivalence Partition {address}: Non-null address
Person person = new Person.Builder(AMY_NAME, AMY_PHONE, AMY_EMAIL)
.withAddress(AMY_ADDRESS)
.withTags(AMY_TAGS)
.build();
Address addressAfterBuild = person.getAddress();
assertNotEquals(null, addressAfterBuild);
assertEquals(AMY_ADDRESS, addressAfterBuild);
}
@Test
public void withAddress_nullAddress_successfullyStoresNull() {
// Equivalence Partition {address}: Null address
Person person = new Person.Builder(AMY_NAME, AMY_PHONE, AMY_EMAIL)
.withAddress(null)
.withTags(AMY_TAGS)
.build();
Address addressAfterBuild = person.getAddress();
assertEquals(null, addressAfterBuild);
}
@Test
public void withAddress_notCalled_successfullyStoresNull() {
// Equivalence Partition {address}: Method not called
Person person = new Person.Builder(AMY_NAME, AMY_PHONE, AMY_EMAIL)
.withTags(AMY_TAGS)
.build();
Address addressAfterBuild = person.getAddress();
assertEquals(null, addressAfterBuild);
}
@Test
public void withTags_nonNullTags_successfullyProducesEqualTags() {
// Equivalence Partition {tags}: Non-null tags
Person person = new Person.Builder(AMY_NAME, AMY_PHONE, AMY_EMAIL)
.withAddress(AMY_ADDRESS)
.withTags(AMY_TAGS)
.build();
Set<Tag> tagsAfterBuild = person.getTags();
assertNotEquals(null, tagsAfterBuild);
assertEquals(AMY_TAGS, tagsAfterBuild);
}
@Test
public void withTags_nullTags_successfullyCreatesEmptySet() {
// Equivalence Partition {tags}: Null tags
Person person = new Person.Builder(AMY_NAME, AMY_PHONE, AMY_EMAIL)
.withAddress(AMY_ADDRESS)
.withTags(null)
.build();
Set<Tag> tagsAfterBuild = person.getTags();
assertEquals(new HashSet<>(), tagsAfterBuild);
}
@Test
public void withTags_notCalled_successfullyCreatesEmptySet() {
// Equivalence Partition {address}: Method not called
Person person = new Person.Builder(AMY_NAME, AMY_PHONE, AMY_EMAIL)
.withAddress(AMY_ADDRESS)
.build();
Set<Tag> tagsAfterBuild = person.getTags();
assertEquals(new HashSet<>(), tagsAfterBuild);
}
@Test
public void build_validCompulsoryFields_successfullyProducesEqualFields() {
// Equivalence Partition {name, phone, email}: Valid non-null fields for builder constructor
Person person = new Person.Builder(AMY_NAME, AMY_PHONE, AMY_EMAIL)
.withAddress(AMY_ADDRESS)
.withTags(AMY_TAGS)
.build();
Name nameAfterBuild = person.getName();
assertEquals(AMY_NAME, nameAfterBuild);
Phone phoneAfterBuild = person.getPhone();
assertEquals(AMY_PHONE, phoneAfterBuild);
Email emailAfterBuild = person.getEmail();
assertEquals(AMY_EMAIL, emailAfterBuild);
}
@Test
public void build_nullName_throwsNullPointerException() {
// Equivalence Partition {name}: Null name
Person.Builder personBuilder = new Person.Builder(null, AMY_PHONE, AMY_EMAIL)
.withAddress(AMY_ADDRESS)
.withTags(AMY_TAGS);
assertThrows(NullPointerException.class, () -> personBuilder.build());
}
@Test
public void build_nullPhone_throwsNullPointerException() {
// Equivalence Partition {phone}: Null phone
Person.Builder personBuilder = new Person.Builder(AMY_NAME, null, AMY_EMAIL)
.withAddress(AMY_ADDRESS)
.withTags(AMY_TAGS);
assertThrows(NullPointerException.class, () -> personBuilder.build());
}
@Test
public void build_nullEmail_throwsNullPointerException() {
// Equivalence Partition {email}: Null email
Person.Builder personBuilder = new Person.Builder(AMY_NAME, AMY_PHONE, null)
.withAddress(AMY_ADDRESS)
.withTags(AMY_TAGS);
assertThrows(NullPointerException.class, () -> personBuilder.build());
}
@Test
public void asObservableList_modifyList_throwsUnsupportedOperationException() {
Person person = new PersonBuilder().build();
assertThrows(UnsupportedOperationException.class, () -> person.getTags().remove(0));
}
@Test
public void isSamePerson() {
// same object -> returns true
assertTrue(ALICE.isSamePerson(ALICE));
// null -> returns false
assertFalse(ALICE.isSamePerson(null));
// same name, all other attributes different -> returns true
Person editedAlice = new PersonBuilder(ALICE).withPhone(VALID_PHONE_BOB).withEmail(VALID_EMAIL_BOB)
.withAddress(VALID_ADDRESS_BOB).withTags(VALID_TAG_HUSBAND).build();
assertTrue(ALICE.isSamePerson(editedAlice));
// different name, all other attributes same -> returns false
editedAlice = new PersonBuilder(ALICE).withName(VALID_NAME_BOB).build();
assertFalse(ALICE.isSamePerson(editedAlice));
// name differs in case, all other attributes same -> returns false
Person editedBob = new PersonBuilder(BOB).withName(VALID_NAME_BOB.toLowerCase()).build();
assertFalse(BOB.isSamePerson(editedBob));
// name has trailing spaces, all other attributes same -> returns false
String nameWithTrailingSpaces = VALID_NAME_BOB + " ";
editedBob = new PersonBuilder(BOB).withName(nameWithTrailingSpaces).build();
assertFalse(BOB.isSamePerson(editedBob));
}
@Test
public void equals() {
// same values -> returns true
Person aliceCopy = new PersonBuilder(ALICE).build();
assertTrue(ALICE.equals(aliceCopy));
// same object -> returns true
assertTrue(ALICE.equals(ALICE));
// null -> returns false
assertFalse(ALICE.equals(null));
// different type -> returns false
assertFalse(ALICE.equals(5));
// different person -> returns false
assertFalse(ALICE.equals(BOB));
// different name -> returns false
Person editedAlice = new PersonBuilder(ALICE).withName(VALID_NAME_BOB).build();
assertFalse(ALICE.equals(editedAlice));
// different phone -> returns false
editedAlice = new PersonBuilder(ALICE).withPhone(VALID_PHONE_BOB).build();
assertFalse(ALICE.equals(editedAlice));
// different email -> returns false
editedAlice = new PersonBuilder(ALICE).withEmail(VALID_EMAIL_BOB).build();
assertFalse(ALICE.equals(editedAlice));
// different address -> returns false
editedAlice = new PersonBuilder(ALICE).withAddress(VALID_ADDRESS_BOB).build();
assertFalse(ALICE.equals(editedAlice));
// different tags -> returns false
editedAlice = new PersonBuilder(ALICE).withTags(VALID_TAG_HUSBAND).build();
assertFalse(ALICE.equals(editedAlice));
}
}
| 21,477 |
organizationcons00ochsuoft_10
|
US-PD-Books
|
Open Culture
|
Public Domain
| null |
None
|
None
|
English
|
Spoken
| 7,553 | 9,446 |
STORAGE TANK SYSTEMS. — In the use of storage tank systems two methods are usually employed. The first applies to localities where through the excessive use of water during the day, the pressure is so reduced in the street mains that water cannot be drawn conveniently or at all in the higher stories. In such in- stances the night pressure is usually sufficient to fill the tank, which is put in the attic or in a pent house on the roof, thus giv- ing sufficient water during the entire twenty-four hours. In such systems it is the custom to arrange the water supply, except for the hot water, so that the lower stories are supplied by the -direct pressure, and the upper stories from the tank. In this system it is absolutely necessary to supply the heater for the hot water supply from the tank at all times, for obvious reasons — viz., first, that were this not done there would be no hot water supply for the upper stories during the period of low pressure; and, second, that there would be great danger of mishap to the water heating apparatus should the supply of water at any time be shut off. It is necessary in hospitals when the lower floors are supplied dii-ect that provision be made so that in case the water from the street main becomes insufficient, the supply from the tank will automatically give a supply of water to such lower floors. In larger hospitals, where the water consumption is relatively great, the system of supply is shown in Fig. 120. In this system a pump forces the water to the storage tank in the attic, which tank may be supplemented by as many overflow tanks as are required to give a full quantity of water for at least twenty-four hours. PUMPS. — Pump for this work can be one of the many types employed, but an automatic, motor-driven, triplex pump is the most economical and the most positive in operation. The triplex pump will sustain the column of water to the tank to better ad- vantage than any other form. In the use of pumps for water supply it is always well to take the water from a tank placed close to the pump. TANKS. — If steam pumps are used surge tanks or suction tanks must be employed. This is done so as to prevent the reduc- ing of the pressure in the mains, and to prevent damage to the water supply system. These surge tanks should be made large 228 PLUMBING. FTG. 120. PLUMBING. 229 enough to hold at least one day 's supply, if possible, large enough for two or three days' supply. The house tanks should be located well above the highest fixture in the building. The minimum distance between such fix- tures and the lowest tank should be at least ten feet. These tanks, and as much of the apparatus as can be conveniently placed, should be in a separate room or pent house, built in such manner as to prevent freezing of the water. This makes it possible to systematize the water supply. Owing to the amount of water that is used, it is often neces- sary to supply auxiliary or overflow tanks. These should all be connected below the main tank with the main house supply. All tanks should be supplied with an overflow pipe, which is equal in size in its discharge to the greatest quantity of water which is brought to the tank by the supply. House tanks should also be provided with a vent pipe on the house supply, and an emptying pipe from the bottom of the tank connected to the overflow with a valve so placed that the entire tank can be drained. The supply pipe to the house should extend a short distance above the bottom of the tank inside of same, so as to prevent the sediment from entering the supply. These over- flow pipes should be run to the roof, or preferably to the nearest sink. They should never be connected with the drainage system direct. The size of tanks can be safely figured in their capacity in hospitals at one hundred gallons of water per day per capita. As shown, the auxiliary tank as well as the distilled water tank are equipped with overflow and emptying pipes. If all of these dis- charge into one pipe (see figure), this pipe must be increased relatively for each tank as the latter discharges into this pipe. As shown in the illustration, for a system of water supply, the apparatus for which is herein described, the water is brought into a storage tank, which is made of steel, and from this is raised to the house storage tank by the direct connected triplex pump. A check valve should be placed in the riser so as to take as much load off the pump as possible. In this system an auxiliary tank appears which is equipped similarly to the main house tank, is supplied with water by the overflow of the latter, and is cross- connected to the main house supply. A branch from the main riser to the storage tank, as also a branch from the main house supply properly cross-connected, is run to the filter. The filtered water is taken from this filter to a storage tank. From the main house supply is run a branch at least two inches in diameter, which is connected to the garbage crematory or to a suitable heater. From this main house supply are also taken the branches 230 PLUATBING. for the cold water supply for the slop sinks, kitchen sinks, water closets, slop hoppers, bath tubs, and lavatories. From the gar- bage crematory for the house supply is taken the hot water for the above fixtures, except the water closets, with proper return to the heater for complete circulation. From the filtered water tank is taken a supply to a manifold as in the case of the cold water and hot water house supply, and from this manifold are taken the pipes to supply the sinks in the operating rooms, dressing rooms, sterilizing rooms and anesthetiz- ing rooms, with cold filtered water. The filtered water supply is run to the garbage crematory through a separate coil, and the above fixtures are supplied with hot water in this manner. There must be a return or circulating pipe on all hot water feed pipes, so as to give a continuous supply of hot water at any fixture immediately upon the opening of a faucet. This can be accomplished to better advantage by running the pipes up to supply one set of fixtures, and returning the pipes to supply an- other set, and then return to the heater as shown. From the filtered water supply a branch is taken to a distill- ing apparatus, a pipe leading from this to a condenser. This con- denser is operated by a flow of cold water from the main house supply, and the discharge of this water can be either into the dis- charging pipe, or it can be directly connected to the hot water supply as an auxiliary to the hot water house supply, the water being heated in the process of condensation. The condensed water flows into a distilled water tank, which has an overflow and dis- charge pipe as for other tanks. The distilled water in the tank is hot and is piped directly to the distilled water fixtures in the operating and dressing rooms, etc., as described; There is also a pipe from this tank to cooling coils, which are so placed that the water in them is cooled by air or by water from the main house supply running over these coils. In this manner the sinks in the operating department are supplied with cold distilled water. From this supply is taken a branch which is run through coils placed in the refrigerator to supply the drinking fountains, and such other fixtures where drinking water is used. It will be necessary in order to have no waste of the iced dis- tilled water that a circulating pipe be run to the farthest fixture, and all intermediate fixtures connected with return stubs to the main return pipes. By so doing there is a continuous circulation which makes it possible to draw cold water immediately instead of emptying the entire supply pipe wherein the water has become warm by standing. PLUMBING. 231 FILTEBS. — The filter should consist of two cylinders connected by one operating valve or manipulator. The construction is shown in Fig. 121. In each cylinder there are two diaphragms about two inches apart, made of brass wire cloth backed up by a grating. The space between the diaphragms is closely packed with sea gravel, which confines the filtering bed in the cylinders. Animal charcoal, or bone black made by calcination in inclosed vessels, is the material used for filtering. This is a purifying as well as a BO4SS DIAPHSJCM Section of Cylinder Showing Construction FIG. 121. clarifying agent, and, owing to its buoyancy, is easily cleaned. Owing to the fact that fully two-thirds of the mass of this material is occupied by interstices and pores, as against only one-third in sand, such as is found in sand filters, it is possible to do the filtration without the use of coagulants. Alum is necessary in sand filters as a coagulant to gather this sediment in such coarse particles that it will not pass through the interstices. The quan- tity of alum necessary to clarify water varies from day to day with the changing conditions of the water supply. It can only be 232 PLUMBING. determined by chemical analysis, which, of course, is not prac- ticable under ordinary circumstances. Any excess of alum in water used for drinking is prejudicial to health, and as there would certainly be an excess almost constantly, its use in niters is condemned by all medical authorities. Filters in which alum is used are all the more dangerous because they deliver water that is brilliant and sparkling, and there is a popular tendency to regard clear water as pure. That is one reason why too much stress cannot be laid upon the danger of alum clarified water. Neither does the alum process render water suitable for bathing, laundry or manufacturing purposes. It makes the water ';hard," releases free sulphuric acid in large quantities and greatly in- creases the incrustation when the water is used for steam boilers, causing diminished efficiency and higher fuel cost. All filters should be constructed with a deep filtering bed, so that the water will remain longer in contact therewith and thus become clearer and purer. Sand filters are impaired in their usefulness by severe changes in temperature. In using the double cylinder filter the cleansing process can be made automatic, and does not require the turning of the crank or other manual labor to clean the filtering bed. This is an ad- vantage also over the stone filter, in which the filtering medium must be scraped by the turning of the stone and the consequent wearing thereof, and causing in time the replacing of the filtering stone. The cleaning process is as follows: The filtered water from one tank is run through the opposite tank by turning the manipu- lator in a position where this result is obtained. The water fil- tered in the first cylinder washes all of the impurities from the filtering bed of the second by reversing the flow, the water from the second cylinder being carried into the waste. In using bone black filters no chemicals are required; each cylinder is washed with filtered water only; the supply of filtered water is not cut off during the washing process. The water can be singly or doubly filtered ; the bacterial efficiency is not reduced after washing. Bone black also removes sulphuric acid and iron, and in consequence pipes and fixtures are not affected by these. GAEBAGE CREMATOEIKS AND ABATER HEATERS.- — The object of the garbage crematory is to supply a cheap and effectual method of disposing of refuse. Where there is a large amount of such refuse the consumption of coal for the raising of water to the re- quired temperature for use in a hospital is small. None of these crematories, however, will operate on refuse consumption alone, PLUMBING. 233 and it is necessary to supplement this by coal. In large plants the water from these crematories is used for feed water. Dr. McCullom says : ' ' Twenty-five years ago the destruction of garbage by fire commenced to receive the attention of physi- cians and sanitary engineers, and, like every advance in science, this method was bitterly opposed on economical principles, as well as on account of the offensive odors resulting from combus- tion. In the refuse from wards, we have only to deal with rub- bish and garbage, such as paper, soiled dressings and mattresses. Much has been said regarding the expense of the disposal of refuse by cremation, and an important factor in increasing the expense is the cost of collection, but this does not apply to hos- pital refuse, as it is not transported any distance. "The object to be sought is a cheap, effectual, and not too complicated method of disposing of the refuse from the wards. Where a large amount of refuse is to be destroyed, the heat gen- erated by its combustion can be utilized to a certain extent in the production of steam or hot water." In commenting upon the necessity of cremation of garbage and refuse from hospitals for treating infectious diseases, Dr. McCullom further states that "No case occurred within an eighth of a mile of the hospital. Sixty-eight cases occurred within a quarter of a mile; within a half mile seventy-one cases; seventy- five cases within three-quarters of a mile, and seventy-two cases within a mile. Without going into this subject too much in detail, it is sufficient to say that, during the past ten years, in which time more than 24,000 cases of infectious diseases were treated, in no instance can the infection be traced to the hospital. The result is due, without doubt, in a great measure, to the fact that all the refuse matter from the wards is burned on the premises ; for there can be no doubt that where hospitals for infectious diseases have apparently been spreaders of contagion, there has been lack of care in the disposal of the refuse." The subject of garbage cremation for the supply of feed water to power plants, commonly known as thermal storage, is too comprehensive to explain in this volume. There are books on this subject which give the entire detail of the ways and means of obtaining results. Such furnaces are too large for the ordi- nary hospital, and are used only where high pressure plants are installed and forced drafts can be obtained readily. Crematories installed for the sole purpose of destroying refuse without ref- erence to the economic principles of conserving the heat are not recommended. Crematories will serve the purpose of refuse de- struction as well when the products of combustion are utilized 234 PLUMBING. to heat the water supply, as they will when all of this heat is wasted. All. crematories constructed for the utilization of the heat have the same primary principles as those which are made for destruction alone — namely, the converting of refuse into fuel ; that is, first drying the garbage and refuse and then burning it. In the types ordinary to hospitals, crematories are built with two chambers, the upper being divided from the lower by garbage grates. These crematories come in all sizes, from those used in the smallest to the large double crematories for the largest in- stitutions. They are built in several ways, either of steel with an inner and outer shell, or brick, set in the same manner as are furnaces for boilers. The steel double shell type has a water space around the entire crematory between the shells. The brick set type is made with water tubes in the lower or combustion chamber, which extend along both sides and rear. Of the latter there are also varieties in which there is a garbage pan fixed in a slanting posi- tion, upon which the garbage and refuse is placed through a side door. The coils are carried along both sides of the pan and are crossed underneath in the rear, in order to absorb the heat from refuse and garbage, as well as the heat from the coal, as it travels through and over the garbage pan. The principle is to gradually burn or consume the refuse at the same time that the products of combustion are absorbed on their travel. In the ordinary type the garbage and refuse is placed upon the bars, and the heat from the fire in the lower chamber dries this until it is converted into fuel. Crematories are .built with continuous circulating coils, or with coils connected to the inner shell, if they are built entirely of steel. The upper or garbage grate should be hollow tubing, the lower grates of the ordinary rocking kind. There should be sum- r-ient cleanout doors in all crematories, and these and all othe* uoors in the apparatus should close tightly. A good sized chim- ney or flue must be provided so as to give sufficient draft to make the combustion complete, and to carry off the surplus gases. Where there are two sets of coils necessary, as in heating water for house supply and the filtered water, the crematory must be of sufficient size to do this work properly. In this type the coils are laid alternately. The furnace for the double system could be of the all-steel pattern, in which the space between shells could be utilized for one system with the garbage grate as auxiliary to this, and sep- arate coils put into the furnace for the second system. It will bo I'M'MlilNG. 235 found possible in some cases that after the fires in crematories are started the refuse will supply sufficient heat for all purposes, but such cases are so rare that they are not to he taken into con- sideration. Coal or wood consumption is necessary, the advan- tage in crematories lying in the fact that the saving in such fuel is considerable. WATER SUPPLY FOR SMALL HOSPITALS. — Water supply for small hospitals may be obtained as described for larger hospitals in sim- plified form. A storage tank can be placed in the attic to be filled by the municipal supply, by small electric pumps, or by wind pumps. Gas and gasoline engines are not recommended for hos- pitals, as they are noisy in operation and are not wholly depend- able. 9 J A f^=> — — FIG. 122. In the installation of systems for smaller hospitals the first requisite is a plan for the general layout and distribution which is economical and direct. What has been said of such systems for larger hospitals applies as well to the smaller institutions. OUTSIDE TANKS. — Storage tanks of the ordinary type placed over a wind pump are not recommended, as there is always a lia- bility of freezing in winter, and moreover in summer the water from such tanks is warm. Provision should be made in such a system for placing the tank in the attic of the building. TANK SYSTEM. — The best method for obtaining water Avhere there is no municipal supply is by the pneumatic tank system. This consists of a tank into which is forced water under pressure, 236 PLUMBING. either by wind, electric pumps or gasoline engine and pump. The general operation of these systems is sure and direct, and they are besides very simple in installation and maintenance, as shown in Fig. 122. This outfit should be connected as shown in the above illustration. Air may be admitted to the tank by opening the pet cock Q. This will allow the air to pass through the air pipe E into the suction pipe S. From here it is pumped into the tank by the pump cylinder C and pump B. The air pump E must join the suction pipe S above the water level in the well, and the cylin- der must not be under water. When the system is first installed enough water must be pumped to seal the openings on the bottom of the tank. The valve Q is then opened and air pumped until the gauge shows a pressure of ten pounds. This may take some time, but unless air is allowed to escape from the tank it need not be done again. The air valve should then be closed and water pumped into the tank. When the tank is half full of water the pressure will be 30 pounds. This is the correct proportion. Any time that the tank may be half full of water, the pressure gauge should register thirty pounds, and if it is less, the pet cock should be opened and air pumped until the gauge shows 30 pounds pressure. Either a regulating cylinder or a relief valve should be used upon the system to prevent ex- cessive pressure upon the pumping fixtures. When a pressure of 50 pounds is attained the regulating cylinder E will pull the wind- mill out of gear, thus limiting the pressure. The weight P will pull the mill into gear again when the pressure has decreased. FIXTURES. LOCATION. — In selecting fixtures for hospitals, it is highly essential that only those be installed that have been found to be specially fitted for their ultimate purpose, and which may be ac- complished without sacrificing their artistic effect. While in no way disparaging the effort toward sightly and artistic installa- tions of fixtures, showy fixtures put in with these objects in view are to be discouraged. There are two tendencies which are equally bad — the one results in show without utility, greatly increasing the cost of keeping clean; while the other tendency is to secure only utility, and to make every detail absolutely plain, giving the institution a prison-like appearance that repels the very class of people that should be attracted and that can be most benefited if attracted. The main object to be attained is the placing of inex- pensive, thoroughly practical, handsome and efficient fixtures, which can be easily cleaned and controlled. Fixtures may be grouped as follows : PLUMBING. 237 1. Bathroom. 2. Toilet room. 3. Operating room. 4. Kitchen department. 5. Laundry. 6. Domestic supplies. 7. Laboratory. 8. Hydro-therapeutic. In the classification of bathroom fixtures would be water closets, bath tubs, slop sinks, slop hoppers, individual laundry tubs and shower baths not therapeutic. FIG. 123. Toilet rooms — Lavatories and individual water closets. Operating rooms — Sinks for these, dressing rooms, anesthetiz- ing rooms, sterilizing rooms. Kitchen department — Kitchen sinks, butler's pantry sinks, and vegetable sinks. Laundry- — Laundry tubs. Hydro-therapeutic — The entire equipment for such rooms. Domestic supplies — DrinMng fountains. While it is possible and often preferable to divide the fixtures — namely, to place them in separate rooms, as, for example, slop sinks and slop hoppers — they are here classified as stated because 238 PLUMBING. they are more generally placed in the' bathroom, as shown in Fig. 125. Private bathrooms in connection with suites or single rooms would come partly under the classification for toilet rooms, as lavatories are placed in these instead of sinks. FIG. 124. In operating rooms, dressing rooms, etc., as classified, as also in general bathrooms, lavatories should never be used. In bathrooms the fixtures can be arranged as shown in the illustra- tion. BATH TUBS. — The bath tubs should always stand free so that they are accessible from all sides. Such tubs can be of porcelain PLUMBING. 23!) or enameled iron. In either case they should be tubs with sojid bases, extending below the finished floor, as shown in Fig. 123, with an enameled iron tub, and Fig. 124, a solid porcelain tub. PIG. 125. These illustrations merely show the method of setting; for loca- tion of such tubs, see Fig. 125. Porcelain tubs are in no way superior to good enameled iron tubs, and are considerably more expensive. The fitting for tubs should consist of bell supply fixture and standing waste, as shown. This leaves the entire inside of the tub free and gives easy access to all working parts. Moreover, the standing waste can be easily removed and cleaned. All fittings for these tubs should be made of nickel-plated heavy brass tubing and brass castings, or of white metal tubing and castings. The tubs should be trapped, as should also each fixture throughout the 240 PLUMBING. hospital. Bath tub traps are of two kinds, the drum trap of lead or brass, which is set below the floor level with a trap screw on a level with the finished floor ; and the nickel-plated brass trap, which sets above the finished floor, as shown in Fig. 126. WATER CLOSETS. — Water closets are of two types — those with an individual tank for each closet, and those which operate by FIG. 126. pressure from a main roof tank, or by direct pressure, if this is sufficient. All water closets without exception in hospitals should be siphon jet closets. For sanitary reasons all closets should be of the wall type, as ehowi in Fig. 127. This Hoset sets completely FIG. 127. free from the floor and close to the wall and should be set into the tile or marble wainscot. In setting closets of the floor typo, they should be secured to the floor and to the soil pipe, as shown in Fig. 128, or in Fig. 129. The former consists of a conical shaped asbestos gasket, which assumes an inclined position between the connecting parts, becoming a powerful compressive lever during the tightening process, forcing it against the closet outlet, and against the wall of the floor flange, making a positive gas and water tight joint, without the use of rubber, putty or cemein". PLUMBING 241 Fig. 129 shows a closet screw connection in two parts, the lower portion of which is fastened to the floor by means of screws and soldered to the soil pipe. The upper half is connected to the bowl, and a specially prepared asbestos washer is forced between the FIG. 128. earthenware and brass connection. The two sections of the con- nection are then screwed together until the closet is flush on the floor surface. While enameled iron seats are the most sanitary to use on hospital water closets, they are objectionable, owing to the fact that they are exceedingly cold! In using the wall form of closet, provision must be made for FIG. 129. bolting the fixture to the wall, the connection being the same as described for floor closets, shown in Fig. 129. The individual tank closet needs no special mention, except that the flush pipe from the tank to the closet should be at least one and one-half inches inside diameter. Either the tank or push button closet can be operated automatically. Where the water supply is sufficient at all times the push button or lever type flushing valves are recommended. The flush- ing valve is the most economical form of all devices in its con- sumption or water. Supplies to these valves should never be less than one and one-half inches in diameter, and two-inch pipes are preferable. The water closet should invariably be made of 242 PLUMBING vitreous ware. The old style enameled iron closet is neither sani- tary nor practicable. SLOP SIXKS — Slop sinks should be sufficient!}' large to con- veniently admit a large pail. These can be of porcelain or enam- eled iron, but owing to their rough usage the latter is preferable. FIG. 130. These sinks should be equipped with a strap standard, as shown in Fig. 130. They can be made with a brass ring to protect the enamel, but with ordinary care this would not be necessary. The water supply to these sinks should consist of a combination faucet of heavy brass, with a long spout with a bucket hook, and the PLUMBING 243 entire fixture firmly braced by a wall support. The sink should have a plug strainer, which will admit of its being filled. SLOP HOPPERS. — These fixtures in their improved form have but recently been introduced for hospital use. The old type had not a water seal and it was impossible to dilute the contents of bed pans which were poured into them, and in consequence they were extremely malodorous until they were flushed, which could not be done quickly. In their present form, as .shown in Figs. 131 and 132, the entire contents of the bed pan is diluted at once, and the flush being exceedingly strong carries away all the diluted material practically without odor. They should be so arranged as to have a long, continuous flush. Besides the strong siphon jet and consequent rapid discharge, there is a heavy flushing rim supply- ing a long and copious flow over the entire inside of the bowl. These fixtures should always be made of vitreous ware, as is the case with water closets, for they are essentially an enlarged type of the latter, and should also be siphon jet in all cases. These FIG. 131. hoppers should be supplied with a long spouted faucet as de- scribed under slop sinks ; the bucket hook may be omitted. These hoppers are secured to the floor in the same manner as described for water closets. WASH TRAYS. — It is necessary in most instances to have at least one wash tray or tub on each floor. These can be made of porcelain, enameled iron or soapstone. They should be, as far as possible, in one piece. SHOWER BATHS. — The latitude in the selection of shower baths is so great that no attempt is made to describe fixtures, but gen- 244 PLUMBING eral conditions are such that they must be carefully observed. It is recommended that showers of the simple and inexpensive forms be used in all bath rooms. These may consist of merely supplies with a head spray and an overhead ring with a curtain, the whole apparatus being placed over the tub. For special showers, such as are used in doctors' dress- i -^ i ing and toilet rooms, it is cus- tomary to install a full shower apparatus. The stall contain- ing the shower can be built with sides of marble, slate or glass. The floors of such stalls can be built of any of these materials, or of tile or cement, but they must be properly countersunk and sloped to the central drain. It will be neces- sary in all instances to put un- der the floor of whatever ma- terial, except cement, a lead safing. The drain in these floors should be flush with the top surface, and of sufficient size to carry off the water as quickly as it flows to it. The shower to be used depends en- tirely upon the amount avail- able for the apparatus. It is customary to equip all showers with mixing chambers. These are in the form of cylin- ders, into which the hot and cold water are introduced from opposite directions for the purpose of thoroughly mixing and producing a uniform de- gree of heat. If it were pos- sible to control the flow of both the hot and cold water, the desired results could be obtained, but this is not possible, and therefore these chambers are practically useless. Several forms of these chambers have been invented to overcome the objection- able features, the governmer, fc having adopted a non-scalding valve, which consists of a single valve, so arranged that the cold water FIG. 132. PLUMBING 245 must be turned on before the hot water can flow. This makes it impossible to turn on the full head of hot water before the cold water is introduced into the shower, and so prevents accident through the introduction of scalding water. The valve is not co to wholly successful, however, in the absolute control of temperature, and while the safety feature is admirable, it lacks the requisites of a uniform temperature control. There has been introduced a system for the absolute control of water for showers, which con- sists of automatic controlling valves, arranged in such a manner 246 PLUMBING that the pressure is always uniform at the shower head. Aside from the automatic valves, the apparatus has a cylinder so ar- ranged that the proper temperature of water is produced in this •• - FIG, 134. cylinder, the whole being controlled by oue valve, which makes it practically impossible for the temperature to vary, and also makes it a non-scalding valve, as the water first introduced into it is cold. PLUMBING 247 LAVATORIES. — Lavatories should be used, in hospitals, only in toilet rooms and private bath rooms in connection with other rooms. Fig. 133 shows the general arrangement of a private bath. FIG. 135. Toilet rooms are placed in connection with administration rooms and rooms for staff officers. They all follow the same general rules for fixtures. Tubs in private bath rooms should be the same as those in general bath rooms, following the same rules for the installation of fixtures. Water closets in these rooms should be 248 PLUMBING of the type best suited, but preferably the wall pattern as de- scribed, with lever or button valve supply, where sufficient water is available to operate these. Lavatories for private baths and in other places in the hos- pital where these are used should be either enamel ware or vitre- ous ware. The latter are probably the best, as they are absolutely non-absorbent, and exceedingly durable. These fixtures should be of the integral type, in which the back, slab and bowl are cast in FIG. 135A. one piece, if they are to be placed against the wall, as shown in Fig. 134. If they are to stand free where the walls of the room are tiled, they can be of the type shown in Fig. 135. These lavatories should be equipped with faucets as described, and traps of the non-siphon pattern, if these are necessary. OPERATING DEPARTMENT FIXTURES. — For a number of years PLUMBING 249 there has been operating room fact, stationary a growing tendency to exclude from the all plumbing and lighting fixtures; in fixtures for any purpose that could pos- sibly be dispensed with. This precaution came from the fear of having objects in the operating room which could not be easily no. 136. and perfectly disinfected. There was also the fear of contaminat- ing the operating room air by sewer gas, through the sewer con- nections. These theories resulted in much inconvenience to the surgeon, his assistants and nurses, in the performance of their work during operations. The protection which modern plumbing affords against sewer gas infection is so perfect that this danger is now completely eliminated, and it is perfectly safe to have run- ning water in the operating rooms. Aside from these fixtures, it is probably best to have no stationary fixtures except those 250 PLUMBING required for artificial lighting, which detail is discussed under sep- arate heading. In the operating and dressing rooms sinks should be of good size, made of enameled iron, vitreous ware or porcelain. These sinks should be deep so that the wash bowls can be placed into them conveniently. In operating rooms they can be arranged for hot and cold, filtered and distilled water, respectively. The supplies should be con- trolled by either pedal valves, as shown in Pig.l35A,or knee action PLUMBING 251 valves as shown in Fig. 136, and the water either distilled or fil- tered, both hot and cold, should be supplied to the sink through a single spout for each kind of water. The waste should also be operated by a pedal or knee action fitting. There is a distinct advantage in using free basins in a sink instead of having stationary basins, because these loose basins FIG. 138. can be easily sterilized by boiling and can be kept on hand in quantities. It is really better to have the water come through one spout so that it can be mixed to make the proper temperature for wash- ing under running water. In the sterilizing room should be placed a sink for washing instruments, constructed like an ordinary sink, but which has instrument trays at either end, which are an integral part of the sink. The faucets should be placed high enough over this fixture 252 PLUMBING so that they do not interfere with the work. The traps for these sinks should be of the same variety as used for other sinks, as described under traps. KITCHEN FIXTURES. — In Fig. 137 are shown model kitchen departments with all necessary fixtures and equipment for such rooms. The plumbing fixtures should consist of sinks for washing pots and pans, sinks for washing vegetables, and butler's pantry sinks. A sink should be placed in the baking room, also one in the special diet kitchen. In the illustration the ordinary diet kitchen is shown, and the only fixture in this is a sink with ample drain board space (Fig. 137). The ordinary diet kitchen is shown in Fig. 138. V FIG. 139. SINKS. — The kitchen sink is probably the fixture which re- ceives the hardest wear of all those in a hospital. The washing of pots and pans is exceedingly hard on the surface of these sinks. They can be made of enameled iron, porcelain or vitreous ware, but the enameled is best adapted for this rough usage. All kitchen sinks should be connected to a grease trap, as described under traps, and should be supplied with hot and cold water through extension faucets. These faucets should extend over the sink to about eight inches from the back edge. Drain boards for kitchen sinks should be made of either enameled iron or slate, which can be covered by rubber mats, or they should be made of well-seasoned ash with an enameled joint. These boards should be bolted and made especially for this pur- pose. PLUMBING 253 VEGETABLE SINKS. — Vegetable sinks should be of the pattern as shown in Fig. 139, having three compartments, tTie central one FIG. 140. of which is very deep and used for washing the vegetables. At the right of this is a shallow compartment in which are placed the cleaned vegetables, from which the water drains to the center 254 PLUMBING portion through the grates. To the left, divided from the center by a partition somewhat lower than the edge of the sink, is another compartment. The water from the center portion flows over this partition and drains out through a standing Avaste. The water from the center portion is drained out through a plug strainer after parings have been removed. The left-hand section is also used for the washing of vege- tables. These sinks are made of porcelain. BUTLEK'S PANTRY SINKS. — Butler's pantry sinks are ordinarily made of planished copper, but are also made in all porcelain, as shown in Fig. 140. In the latter rubber mats should be used on the FIG. 141. drain boards, and a wooden mat in the bottom to prevent break- age. In the copper sink the bowl is either spun in oval shape or in square shape, in which the copper is blocked. In the latter pattern the copper is placed in a wooden box to give it a backing. The drain boards are also of copper, grooved as shown in Fig. 141. The tops can also be made of marble when the sinks are copper. A full countersinking of the entire slab, with proper slope to drain, is preferable to the grooved top. Supplies for pantry sinks are ordinarily Fuller pantry faucets as shown. The waste is trapped as described for other fixtures and connected to the waste stack. It is not necessary to equip pantry sinks with grease traps, as only glassware and silver are ordinarily washed in these sinks. If, however, the dishes are all PLUMBING 255 washed in one of these sinks, it must be equipped with a grease trap. The square pattern is fitted with a standing waste, and the sink itself holds the body of water for washing the dishes. In the oval pattern a plug and chain are used instead of standing waste. The porcelain sink has Fuller faucets as shown and can be equipped with standing waste, or the ordinary strainer waste, and an auxiliary pan used in the sink. In the special diet kitchen and baking room an ordinary sink of enameled iron, porcelain or vitreous ware should be installed, as described for such fixtures, with sufficient drain boards for each. LAUNDRY TUBS. — These can be of buff porcelain, stone or enameled iron. In the individual laundry trays in bath rooms the tubs should correspond to the remainder of the fixtures, and should be of buff or white porcelain or enameled iron. These trays are admirable in many ways, and for this purpose are superior to the stone trays, as they are integral, while the stone trays are made of slabs with joints cemented. The cocks on these should be of the turn handle, ground key pattern, or compression cocks of the turn handle Fuller pattern. All wash trays are made with and without backs, but for hospital purposes the integral back tray is the best. Stone trays would have to be placed at a dis- tance from the walls sufficient to run pipes, while in the tubs of other material the back is hollow to admit of these pipes and thus set close to the wall. Tubs for the laundry can be of any of the materials men- tioned, but the buff porcelain, enameled iron and stone trays are best. If the brass boiling pipe described under laundry equip- ment is put into the tub, the enameled iron or stone tub would be the best type to use. The number of such tubs depends upon the extent of the re- mainder of the equipment. Where washing machines are used, three tubs will be sufficient in all instances. These tubs can be supplied with running wastes or each tub can be equipped with an individual waste. The running waste must have a good trap which can be readily cleaned, placed on the last fixture with the running waste attached to the trap with a good slope toward the first tub. The ordinary S trap, or npn-siphon trap, will be suffi- cient in case individual traps are used. Eunning wastes and traps can be made of galvanized iron, rough brass or lead. Nickel- plated brass is not recommended for fixtures in laundries, owing to the steam and dampness in such places, causing corrosion and the constant care necessary to keep the nickel plating looking bright. DRINKING FOUNTAINS. — Drinking fountains are usually placed 256 PLUMBING conveniently in the corridor on each floor. Supplies for driukiug water can also be placed in the main kitchen and diet kitchens, but this would only occur in larger hospitals. The fountain should bo located in proximity to the diet kitchens. These fountains are of two types — the wall fountain and the pedestal fountain. The former are made for recessed fountains, as shown in Fig. 142, and FIG. 142. for fountains placed directly on the wall (Fig. 143). These foun- tains are made of porcelain, vitreous ware, enameled iron or mar- ble. The pedestal forms are made in the same materials and vary in design, but are all of the general type shown in Fig. 144. These fountains are equipped with a cold water faucet from the re- frigerator supply and a waste and S trap as shown. The Faucets should always be of the self-closing pattern. The supply should have a return pipe so that the circulation is complete, and so that cold water may be drawn immediately without the ueces- PLUMBING 257 sity of wasting the water which has been standing in the pipe. Each fountain should be connected to this return, as should all other fixtures at which the supply of drinking water is drawn. LABORATORY FIXTURES. — In the laboratory there should be at least one sink with long wooden drain boards on both ends. It is better to install the sink in the working table in such a position that it will be handy. The supplies can be brought up at the rear, or better at the side, if the table is accessible from both sides as FIG. 143. it should be. The filtered hot and cold water, as well as the house supply hot and cold water, should be brought to this fixture. The sink should be of enameled iron or vitreous ware and never of porcelain, as the enameled iron or vitreous ware sinks are not affected by acids or stains, while the porcelain is subject to stain- ing by acids and dyes.
| 35,350 |
https://stackoverflow.com/questions/64771431
|
StackExchange
|
Open Web
|
CC-By-SA
| 2,020 |
Stack Exchange
|
Kai Zheng, https://stackoverflow.com/users/642233, https://stackoverflow.com/users/8700044, jjoelson
|
English
|
Spoken
| 519 | 1,153 |
ScrollView works fine until I've fetched an image and update my view
I was fooling around with SwiftUI and Combine on my iPad's Swift playgrounds and trying to print out the communication details between Combine publishers and subscribers to MyConsole.
At first, I put some placeholder text into MyConsole and showed it in a ScrollView, and it scrolled without any problem.
Then I tapped the "Get Image" button to fetch an image from the internet, and the network request was perfectly successful too:
But now comes the problem: my ScrollView stops to scroll, it suddenly freezes. If I tap the "Reset" button to reset my ContentView, the ScrollView functions normally, it is able to scroll again.
Could anyone take a look at my following code, and tell me what was wrong with my ScrollView? Thanks.
import Combine
import SwiftUI
import PlaygroundSupport
class MyConsole: TextOutputStream, ObservableObject {
@Published private(set) var text = ""
// TextOutputStream
public func write(_ string: String) { text += string }
public static let shared = MyConsole()
private init() {}
public func clear(to text: String = "") { self.text = text }
}
// long text for ScrollView
let string = (1...40)
.map{ _ in "Lorem ipsum dolor sit amet, consectetur adipiscing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua.\n" }
.joined()
let url = URL(string: "https://source.unsplash.com/random")!
let console = MyConsole.shared
// performs a network request to fetch a random image from Unsplash’s public API
func imagePub() -> AnyPublisher<Image?, Never> {
URLSession.shared
.dataTaskPublisher(for: url)
.map { data, _ in Image(uiImage: UIImage(data: data)!)}
.print("image", to: console) // print to MyConsole
.replaceError(with: nil)
.eraseToAnyPublisher()
}
// ViewModel
class ViewModel: ObservableObject {
@Published var image: Image?
let taps = PassthroughSubject<Void, Never>() // simulate user taps on a button
var subscriptions = Set<AnyCancellable>()
init() {
console.clear(to: string)
taps
.map { _ in imagePub() } // map the tap to a new network request
.switchToLatest() // accept only the latest tap
.assign(to: \.image, on: self)
.store(in: &subscriptions)
}
// user intent
func getImage() { taps.send() }
}
// ContentView
struct ContentView: View {
// view model
@ObservedObject var viewModel = ViewModel()
@ObservedObject var console = MyConsole.shared
var body: some View {
VStack {
// image
viewModel.image?
.resizable().scaledToFit()
.frame(height: 300).border(Color.black)
// console
ScrollView {
Text(console.text)
}// ScrollView
.frame(height: 200).padding()
.border(Color.black)
.background(Color.purple)
// button
HStack {
Button(action: {
self.viewModel.getImage()
}, label: {
Text("Get Image")
.padding().foregroundColor(.white)
.background(Color.blue).cornerRadius(12)
})
Button(action: {
self.viewModel.image = nil
self.console.clear(to: string)
}, label: {
Text("Reset")
.padding().foregroundColor(.white)
.background(Color.pink).cornerRadius(12)
})
}
}.padding().background(Color.gray).shadow(radius: 8)
}
}
PlaygroundPage.current.setLiveView(ContentView())
Maybe it's because of Playgrounds? I remember having issues myself once.
I'm not sure if this is what's causing your problem, but you should use @StateObject instead of @ObservedObject for storing viewModel to indicate that the object is "owned" by this view. Technically SwiftUI is free to re-create your view as many times as it wants, and using @ObservedObject means the view model will be newly created each time. @StateObject will ensure it's only created once.
Also, you may have to add .receive(on: DispatchQueue.main) in imagePub to make sure the UI is updated on the main thread. That could be the issue.
| 24,348 |
https://github.com/frank-pang-msft/azure-sdk-for-net/blob/master/sdk/datafactory/Microsoft.Azure.Management.DataFactory/src/Generated/Models/DataFlowReference.cs
|
Github Open Source
|
Open Source
|
MIT
| 2,022 |
azure-sdk-for-net
|
frank-pang-msft
|
C#
|
Code
| 329 | 772 |
// <auto-generated>
// Copyright (c) Microsoft Corporation. All rights reserved.
// Licensed under the MIT License. See License.txt in the project root for
// license information.
//
// Code generated by Microsoft (R) AutoRest Code Generator.
// Changes may cause incorrect behavior and will be lost if the code is
// regenerated.
// </auto-generated>
namespace Microsoft.Azure.Management.DataFactory.Models
{
using Microsoft.Rest;
using Newtonsoft.Json;
using System.Collections;
using System.Collections.Generic;
using System.Linq;
/// <summary>
/// Data flow reference type.
/// </summary>
public partial class DataFlowReference
{
/// <summary>
/// Initializes a new instance of the DataFlowReference class.
/// </summary>
public DataFlowReference()
{
CustomInit();
}
/// <summary>
/// Initializes a new instance of the DataFlowReference class.
/// </summary>
/// <param name="referenceName">Reference data flow name.</param>
/// <param name="additionalProperties">Unmatched properties from the
/// message are deserialized this collection</param>
/// <param name="datasetParameters">Reference data flow parameters from
/// dataset.</param>
public DataFlowReference(string referenceName, IDictionary<string, object> additionalProperties = default(IDictionary<string, object>), object datasetParameters = default(object))
{
AdditionalProperties = additionalProperties;
ReferenceName = referenceName;
DatasetParameters = datasetParameters;
CustomInit();
}
/// <summary>
/// Static constructor for DataFlowReference class.
/// </summary>
static DataFlowReference()
{
Type = "DataFlowReference";
}
/// <summary>
/// An initialization method that performs custom operations like setting defaults
/// </summary>
partial void CustomInit();
/// <summary>
/// Gets or sets unmatched properties from the message are deserialized
/// this collection
/// </summary>
[JsonExtensionData]
public IDictionary<string, object> AdditionalProperties { get; set; }
/// <summary>
/// Gets or sets reference data flow name.
/// </summary>
[JsonProperty(PropertyName = "referenceName")]
public string ReferenceName { get; set; }
/// <summary>
/// Gets or sets reference data flow parameters from dataset.
/// </summary>
[JsonProperty(PropertyName = "datasetParameters")]
public object DatasetParameters { get; set; }
/// <summary>
/// Data flow reference type.
/// </summary>
[JsonProperty(PropertyName = "type")]
public static string Type { get; private set; }
/// <summary>
/// Validate the object.
/// </summary>
/// <exception cref="ValidationException">
/// Thrown if validation fails
/// </exception>
public virtual void Validate()
{
if (ReferenceName == null)
{
throw new ValidationException(ValidationRules.CannotBeNull, "ReferenceName");
}
}
}
}
| 41,092 |
https://github.com/yunsean/yoga/blob/master/yoga-core/yoga-common/src/main/java/com/yoga/core/json/DateTimeJsonSerializer.java
|
Github Open Source
|
Open Source
|
MIT
| 2,021 |
yoga
|
yunsean
|
Java
|
Code
| 43 | 180 |
package com.yoga.core.json;
import com.fasterxml.jackson.core.JsonGenerator;
import com.fasterxml.jackson.databind.JsonSerializer;
import com.fasterxml.jackson.databind.SerializerProvider;
import java.io.IOException;
import java.text.SimpleDateFormat;
import java.util.Date;
public class DateTimeJsonSerializer extends JsonSerializer<Date> {
private static final SimpleDateFormat formatter = new SimpleDateFormat("yyyy-MM-dd HH:mm:ss");
public void serialize(Date date, JsonGenerator jsonGenerator, SerializerProvider serializerProvider) throws IOException {
jsonGenerator.writeString(formatter.format(date));
}
}
| 39,984 |
https://github.com/n1xx1/monaco-macro-editor/blob/master/src/typings/@league-of-foundry-developers/foundry-vtt-types/src/foundry/foundry.js/pixi/shaders/abstractBaseShaders/standardIlluminationShaders/torchIlluminationShader.ts
|
Github Open Source
|
Open Source
|
MIT
| 2,021 |
monaco-macro-editor
|
n1xx1
|
TypeScript
|
Code
| 20 | 116 |
export default [
"@league-of-foundry-developers\\foundry-vtt-types\\src\\foundry\\foundry.js\\pixi\\shaders\\abstractBaseShaders\\standardIlluminationShaders\\torchIlluminationShader.d.ts",
"/**\n * Allow coloring of illumination\n */\ndeclare class TorchIlluminationShader extends StandardIlluminationShader {\n static fragmentShader: string;\n}\n"
]
| 2,666 |
https://github.com/coingaming/moon-design/blob/master/packages/charts/src/private/Map.tsx
|
Github Open Source
|
Open Source
|
MIT
| 2,023 |
moon-design
|
coingaming
|
TSX
|
Code
| 374 | 1,158 |
import React, { useRef, useState } from 'react';
import { Text } from '@heathmont/moon-core';
import { useTheme } from '@heathmont/moon-themes';
import { themed } from '@heathmont/moon-utils';
import { ComposableMap, Geographies, Geography } from 'react-simple-maps';
import styled from 'styled-components';
import { TooltipWrapper, Item, ColorPreview } from './Tooltip';
import worldMap from './World110m';
const Container = styled.div({
position: 'relative',
width: '60%',
height: '100%',
display: 'flex',
flexDirection: 'column',
alignItems: 'center',
justifyContent: 'center',
});
type Props = {
data: {
label: string | React.ReactNode;
code: string;
value: number;
opacity: number;
color: string;
}[];
};
interface MapData {
label: string | React.ReactNode;
code: string;
value: number;
opacity: number;
color: string;
}
interface MapProps {
data: MapData[];
}
export const Map: React.FC<MapProps> = ({ data }) => {
const theme = useTheme();
const defaultColor = themed('color', 'goku.80')(theme);
const tooltipRef = useRef<HTMLDivElement>(null);
const [hoveredItem, setHoveredItem] =
useState<MapData | null | undefined>(null);
const isCountryCode = (
code: string,
country: { ISO_A2: string; ISO_A3: string }
) => {
if (!code) return false;
return code.length === 2
? code === country.ISO_A2
: code === country.ISO_A3;
};
return (
<Container>
<TooltipWrapper
ref={tooltipRef}
style={{
visibility: hoveredItem ? 'visible' : 'hidden',
position: 'absolute',
left: 0,
top: 0,
transition: 'transform 0.4s ease',
}}
>
{!!hoveredItem && (
<Item>
<>
<ColorPreview
style={{
background: hoveredItem.color,
opacity: hoveredItem.opacity,
}}
/>
<Text size={12} as="span">
{hoveredItem.label}
</Text>{' '}
• {hoveredItem.value}
</>
</Item>
)}
</TooltipWrapper>
<ComposableMap
projection="geoMercator"
projectionConfig={{
scale: 120,
center: [0, 50],
}}
>
<Geographies geography={worldMap}>
{({ geographies }) =>
geographies.map((geography: any, index: number) => {
const country = geography.properties;
const activeItem = data.find((item) =>
isCountryCode(item.code, country)
);
const fillColor = activeItem ? activeItem.color : defaultColor;
const opacity = activeItem ? activeItem.opacity : 1;
return (
<Geography
// eslint-disable-next-line
key={`${country.ISO_A3}-${index}`}
tabIndex={-1}
geography={geography}
style={{
default: { fill: fillColor, outline: 'none', opacity },
hover: { fill: fillColor, outline: 'none' },
pressed: { fill: fillColor, outline: 'none' },
}}
onMouseLeave={() => {
setHoveredItem(null);
}}
onMouseMove={(event) => {
setHoveredItem(activeItem);
const ref = tooltipRef && tooltipRef.current;
if (!ref) return;
const parentElement = ref.parentElement;
if (!parentElement) return;
const parentRect = parentElement.getBoundingClientRect();
const tooltipRect = ref.getBoundingClientRect();
const x =
event.clientX - parentRect.left - tooltipRect.width / 2;
const y =
event.clientY - parentRect.top - tooltipRect.height * 1.2;
ref.style.transform = `translate(${x}px, ${y}px)`;
}}
/>
);
})
}
</Geographies>
</ComposableMap>
</Container>
);
};
| 1,114 |
https://github.com/vanessadean/dog_walker/blob/master/app/models/user.rb
|
Github Open Source
|
Open Source
|
MIT, LicenseRef-scancode-unknown-license-reference
| 2,015 |
dog_walker
|
vanessadean
|
Ruby
|
Code
| 142 | 552 |
class User < ActiveRecord::Base
# Include default devise modules. Others available are:
# :confirmable, :lockable, :timeoutable and :omniauthable
devise :database_authenticatable, :registerable,
:recoverable, :rememberable, :trackable, :validatable
has_one :household, foreign_key: "owner_id", dependent: :destroy
has_many :households, foreign_key: "walker_id"
has_many :pets, through: :household
has_many :appointments, foreign_key: "walker_id", dependent: :destroy
has_many :reviews, foreign_key: "walker_id", dependent: :destroy
has_many :reviews, foreign_key: "owner_id"
validates_presence_of :name, :email
mount_uploader :avatar, AvatarUploader
validates_integrity_of :avatar
validates_processing_of :avatar
def assign_household
household = Household.find_by(email: self.email)
if household
household.owner_name = self.name
household.owner_id = self.id
household.phone = self.phone
else
household = Household.create(email: self.email, address: "Please update your profile with your current address.")
household.owner_name = self.name
household.owner_id = self.id
household.phone = self.phone
household.walker_id = 17
end
household.save
end
def all_pets
self.households.collect { |house| house.pets }.flatten
end
def pet_owner_name
User.find(@user.reviews.owner_id).name
end
def text_to_user(body, phone)
@client = Twilio::REST::Client.new(ENV['TWILIO_SID'],ENV['TWILIO_AUTH_TOKEN'])
@client.account.messages.create(
:from => '+18037674105',
:to => ENV['MY_PHONE'],
:body => body
)
end
end
| 24,720 |
sn84037526_1929-12-12_1_1_1
|
US-PD-Newspapers
|
Open Culture
|
Public Domain
| 1,929 |
None
|
None
|
English
|
Spoken
| 739 | 1,224 |
The St. Croix, a weekly newspaper, printed and published daily (Sundays and Holidays excepted) by G. Johansen at the Avis Office. The paper is $50 cents monthly in advance, and $2.50 a single copy. Entered as second class matter May 26th, 1917, at the Post Office, Christiansted, St. Croix, V.J., under the Act of March 3, 1879. RED CROSS BUDGET SET AT $4,410,000 FOR YEAR. Rolt Call From Armistice Day To Thinks Giving Planned Washington, Nov. 2 - John Barton Payne, chairman of the American Red Cross, announced tonight that $4,410,000 would be required to meet relief appeals and other activities for the year ending next June 30. Of the total budget, the chairman said, $1,411,010 was to be set aside for relief in disasters and for preparedness in emergencies. The second largest outlay, he continued, would be for caring for World War veterans and their dependents and for men in the regular army. The membership in the annual roll call last year totaled 4,127,946. The proposed budget for the present year shows that an increasing membership is required to make possible expansion of activities. The roll call this year will start on Saturday and ends thanksgiving Day. In the year just closed, a total of $11,063,679 was spent, of which $8,206,627 was in disaster relief work. It included $5,883,725 contributed by the public for relief to West India hurricane victims. "New York Herald Tribune" - Make Your Christmas Gift An All-Year Reminder of Your Friends & Loved Ones. Give them year's subscription to their favorite magazine or periodical. Prices on application to ERIK R. STAKEMANN. Job Printing done at this office, CHRISTIANSTED, V. I. U, S. A, & HURSDAY, 12th DECEMBER, 1929. TO-NIGHT AT "CLOCK" TO-NIGHT AT 8:15 & C. GOOD NEWS! Here's The Picture You've Been Looking For! A Great Story is now A Greater Picture! "MOTHER KNOWS BEST" Come and see the Sensational Revelation of the Real. Life and Romances of a Great Star Behind the Seenes of her make believe world. The story is the talk of the whole nation... the picture the most discussed of the season’s offerings. Farents and children, you must see this sensational stirring picture which dares to speak the truth about our love-hungry daughters of today! To enable you all to see it, we have reduced the price from 40 cent to our usual prices of admission. YE pareucts, ask yourselves: Which is safer after all, Fiamiog youth or Love - starved Youth? Finming Youth with its flaming loves and potting paities, its midaight joy rides and moonlie ht kisses, or Love-starved Youth she!tered through lite, until, thrilled by the first kiss, it is swept along helplessiy, toend .. .. i1 Ycou’ll see the spswerin "MOTHER KNOWS BEx1", ADMISSION AS USUAL e A S e .StS A A ... 5 ' it R A B 0 o B i : (ihant. .hen Doing Your Chrisimas Shopping DROP IN AT Stakemann’s Store. AND SEE OR ASSORTMENT OF ‘T YS, Glassware. Handkerchiefs in Gift Boxes, Box Paper, {Christmas Cards, Christmas Wrapping Paper, Yinsel Rib bon, Christmas Seals.! Wash Puns, Galv, Buckets, Perfumes, Soaps, White Drill Kahki D:ill, laces, Keds, Work Pants, Headkerchiefs. Inzersoll Watches, Wrist Watches, and Alarm Clocks, Gillette, Durham, snd Everready Razor Blades, Gilleite and Auto 3Sirop Safety Razors, and for thed Automobile, Aiemite and Zerk Fittings, Grease and Penetrating oi., Sparton Horns, Batiery and Hand Types, Spark Plags, for Buick, Chevro let, Hudsor-Essex, and Ford, Chevrolet Oil Filters, Pumps, Pump Hose, Copper Tubing, Two Sizes, Gasoline Funn-ls, and Measures, Simoniz Polich, Vlire Flaps. Top Reervers, Br ke Juice, 8t tery Cables, High Tensi o Wiriaz, Fen der Paint., Black &nim-i Paint, and Fiashlizhts: Batteries and Buib= NOTICE. HE Bavk bogs 'o point out that, as a principle, and in consequence of re peated experiences, the Bank does not allow any parcel to te mailed 1o its ad dress, untess such parcel 15 intended for the Bank’s own use. Reeeipt of any varcel, not so intended, will be refused by the B:ink, and the Bank shzii ho obiiged to deciine any as sistance 1n connection with such pareel, IHE NALIONAL BANK OF IHE DANIsH WESTINDIES. Bermuda & West Indies Steamship Co. S. S. “DOUINICA” from the Leeward and Windward islands is due at Frederiksted at 7 o'clock on Saturday morning, and will be dispatched for New York, accepting freight and passengers. ROBERT L. MERWIN & 20 INC. Agents, No. 287.
| 19,534 |
https://it.wikipedia.org/wiki/Flg
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Flg
|
https://it.wikipedia.org/w/index.php?title=Flg&action=history
|
Italian
|
Spoken
| 24 | 60 |
Codici
FLG – codice aeroportuale IATA dell'aeroporto civile di Flagstaff (Arizona) (Stati Uniti)
Musica
FLG – Fedde Le Grand produttore di musica elettronica olandese
| 27,159 |
https://physics.stackexchange.com/questions/302397
|
StackExchange
|
Open Web
|
CC-By-SA
| 2,017 |
Stack Exchange
|
Chet Miller, Govind Balaji, dmckee --- ex-moderator kitten, https://physics.stackexchange.com/users/102308, https://physics.stackexchange.com/users/28241, https://physics.stackexchange.com/users/520, https://physics.stackexchange.com/users/83398, knzhou
|
English
|
Spoken
| 294 | 407 |
Why first law of thermodynamics based on internal energy and not enthalpy
First law is conservation of energy. It states whatever energy goes in or comes out of the system must have the same change in internal energy. But shouldn't conservation of energy apply on total energy (i. e,Enthalpy the sum of internal energy and pressure - volume energy.)?
A large fraction of the oddities in the usual presentation can be put down to that presentation being developed to describe steam engines. Those beasts don't work at constant pressure...
The change in "pressure-volume energy" you're talking about is just the $p\, dV$ work, which is already included in the First Law $dU = dW + dQ$ in the $dW$ term. So the First Law holds true.
If you want, you can work with the enthalpy $H$ instead of the internal energy; all this is doing is effectively moving the $p\, dV$ from the right-hand side of the First Law to the left-hand side, i.e. pulling it from $dW$ into $dH$. Similarly, you can define many alternative thermodynamic potentials that absorb any kinds of work terms you want.
However, these are all less fundamental than the internal energy, and their utility depends on the context. So we prefer to phrase the First Law in terms of just internal energy.
Yes, I would agree with this. Enthalpy is just function that we have defined, and that is convenient to work with is solving many different kinds of problems. If we had never defined the enthalpy function, we could still solve these problems. Internal energy is the more fundamental quantity.
What is the difference between Q and dQ ? How do you define a change in heat?
@GovindBalaji That's a different question, you should go ask it!
| 40,297 |
W3156386969.txt_1
|
Open-Science-Pile
|
Open Science
|
Various open science
| 2,021 |
Spatial Modeling of Labor Markets in the Areas of Cracow-Balice and Wroclaw-Strachowice Airports
|
None
|
English
|
Spoken
| 5,487 | 10,183 |
doi: 10.36689/uhk/hed/2021-01-069
Spatial Modeling of Labor Markets in the Areas of
Cracow-Balice and Wroclaw-Strachowice Airports
Agata SURÓWKA
Rzeszow University of Technology, Rzeszow, Poland; [email protected]
Abstract: When describing data on statistical units the key issue is their mutual relations.
They can be described in various ways, for example by means of spatial autocorrelation. The
study of spatial connections allows to determine what influences their differentiation in the
examined aspect. The article analyzes selected characteristics of the labor market in terms of
spatial relationships in districts located in the areas of influence of two airports in Poland
(Cracow-Balice and Wroclaw-Strachowice). The Moran’s I autocorrelation coefficient was
selected as the research tool, thanks to which it was possible to identify a given characteristic
within the studied area and in relation to a specific location with the neighboring locations.
The main issue can be presented in the form of questions: Are the neighboring districts
located in the areas of impact of airports characterized by a similar situation? Is it possible to
distinguish clusters of districts characterized by a similar specificity? The research hypothesis
had both theoretical and practical dimensions. It was formulated as follows: the areas of
influence of airports in Poland are characterized by a diversified spatial autocorrelation due
to the specificity of the labor market. It was verified during the research procedure.
Keywords: labor market; spatial autocorrelation; quantitative methods; air transport
JEL Classification: R11; O11
1. Introduction
Air transport is a factor accelerating the processes of globalization of the world economy
and its markets. It is also an important stimulus to level the chances of social and economic
development of countries, regions and continents. It is also important for the growth of
regional competitiveness or innovation. In the literature there are more and more positions
that research on the impact of transport infrastructure on the economic development of the
region is one of the most important ones carried out in the European Union. Apart from the
above, there are obvious and strong interdependencies between economic and social
development and the development of air transport. The economy and society generate
demand for air cargo transportation and the increase in the mobility and mobility of the
population supports the growth of the passenger transport market. Some authors showed
that recently research into the impact of air transport on regional labor markets has been of
great importance. The issue of the situation in the labor markets is important and has become
a source of interest for many authors like Bal-Domańska and Sobczak (2018), Malinowski and
Jablonska-Porzuczek (2020), Nikulin and Sobiechowska-Ziegert (2018), Szulc and Jankiewicz
(2017), Cracolici et al. (2009). The studies (Sardadvar & Rocha-Akis, 2016; Shaikin, 2012;
Siserova & Zudelova, 2015) showed that various analytical and research tools are used during
SPATIAL MODELING OF LABOR MARKETS IN THE AREAS OF AIRPORTS
their conduct. Longhi (2007) as well as Cracolici et al. (2009) explained that for example to
identify interdependencies spatial methods play an increasingly important role in
contemporary research. Their application works well in issues that are located in a specific
space (Shaikin, 2012; Szulc & Jankiewicz, 2017). Certainly, they include, among others
research on the impact of air transport on regional labor markets. That research can be found
in (Surówka, 2019). Verification of this type of phenomena using the tools of econometrics
and spatial statistics is helpful in determining the significance of the spatial factor in
explaining their variability and thus improves the quality of their description. The aim of the
article is to try to identify, by means of the spatial autocorrelation analysis, spatial
relationships occurring in districts located in the areas of impact of two selected airports in
terms of selected variables characterizing the labor market.
2. Methods of Measuring Spatial Autocorrelation
According to scientific sources spatial autocorrelation is a relationship at different spatial
points between different values of the same variable. As some authors rightly point out
spatial autocorrelation is directed to many sides and described as the influence of a
phenomenon or event on a point or points in space on the course of this event at a completely
different point or points. According to the theories preached by geographers, such a
dependence of the occurrence of the phenomenon decreases with the decreasing distance
separating two points. Consequently, it leads to a correlation between two points in different
locations in the value of the phenomena observed in them. Another definition indicates the
occurrence of such a relationship when by observing a phenomenon at one point, one can
notice an increased or decreased probability of such a phenomenon occurring at other
neighboring points. As a relationship it defines the degree of intensity of the relationship
between the values of two adjacent features. When the values of the neighboring areas are
similar there is a positive autocorrelation. On the other hand, when the values are more
diversified than the random distribution would indicate, then the phenomenon of negative
autocorrelation is observed. However, the phenomenon of spatial autocorrelation is always
associated with the occurrence of spatial dependence which may result from two reasons.
The first indicates a close relationship between the analyzed units with others through their
commune, voivodeship, village, regional or district affiliation. It can also be a territorial
affiliation to the same geographical realm. The existence of a border on the map does not limit
people and does not reduce their activity in most phenomena. The second reason points to
the economic and social aspect and the dispersion of people's seats in the territorial unit,
which largely depend on the location and distance from various objects with which they are
associated. The most commonly used coefficients for estimating autocorrelation in space are
the Geary and Moran’s I autocorrelation coefficients. The existence of a global spatial
autocorrelation is checked using the Moran’s I statistics. The formula for calculating the
Moran’s I coefficient can be found in the literature (Kołodziejczyk & Kossowski, 2016). Looks
like this:
SPATIAL MODELING OF LABOR MARKETS IN THE AREAS OF AIRPORTS
(1)
where:
n – number of units in space,
aij – individual elements of the neighborhood matrix A,
S0 – sum of all elements of matrix A,
yi – value of the phenomenon for the i-th unit,
y ̅ – generalized arithmetic mean from all areas.
The neighborhood matrix is a key element in creating a spatial analysis of an emerging
phenomenon. Another type is the spatial weight matrix. In addition to the matrix form it can
take the form of a graph. It reflects the spatial relations that occur between the individual
elements of a certain area, as well as the strength and closeness of their dependencies. The
arrangement of numbers takes the shape of a square. In matrix notation the relations between
the elements i = 1,2,3, ... n and j = 1,2,3, ... n are described in a binary system. This is the matrix
of weights aij, i = 1, ... n, j = 1, ... n, in which
1
𝑎𝑖𝑗 =
1,
0,
𝑔𝑑𝑦 "𝑖" 𝑖 "𝑗" 𝑡ℎ𝑒𝑦 𝑎𝑟𝑒 𝑛𝑒𝑖𝑔ℎ𝑏𝑜𝑟𝑠
𝑔𝑑𝑦 "𝑖" 𝑖 "𝑗" 𝑡ℎ𝑒𝑦 𝑎𝑟𝑒 𝑛𝑜𝑡 𝑛𝑒𝑖𝑔ℎ𝑏𝑜𝑟𝑠
(2)
The elements of the neighborhood matrix can take the form of two digits. Either one,
when the two examined areas are adjacent to each other, or if there are no adjacent boundaries
the field is completed with zero. Whether two areas are adjacent can be determined in various
ways. The most common way of defining this issue is when two areas have a common border
with each other. Another way to establish neighborhood is to determine the distance between
the focal points of both areas. If the measured distance is less than the distance z, then the
areas are assumed to be adjacent. The adjacency determined in this way forms the matrices
of A.
Interpretation of this measure allows to determine the degree of spatial autocorrelation.
Its occurrence depends on the position in relation to the value of the expression -1 / (n-1). If
it is greater than this expression, then it is said to observe a positive autocorrelation, and if it
is less than it is said to be negative. When this value is close to -1 / (n-1), the research assumes
that the distribution of y values is random. In case the number n has a high value then the
value of i can be zero, which means there is no spatial autocorrelation. In other words, if the
statistic result i> 0 then there is a positive autocorrelation, and the values of the observed
elements are similar. However, if the result i < 0, there is a negative autocorrelation, and the
values of the examined units are different. If the result is zero, the checkerboard effect occurs.
The significance of the spatial autocorrelation coefficient is very often tested. The hypothesis
about the lack of spatial autocorrelation is verified and it is the null hypothesis H 0 and its
existence, which is mentioned in the alternative hypothesis H1. For this purpose the T (I) test
is used:
SPATIAL MODELING OF LABOR MARKETS IN THE AREAS OF AIRPORTS
1
𝑇(𝐼) =
I − U(I)
(3)
𝑉𝑎𝑟(𝐼)
A detailed description of which can be found in the literature, for example Kołodziejczyk
and Kossowski (2016). Assuming that the null hypothesis is true I = U (I), the statistic of the
T(I) test has a distribution close to the standardized normal, but this convergence is slow. For
this reason, this test is rarely used and another permutation with ordered statistics is used.
Testing with it is performed by a k-fold process of permutating yi values between regions.
For each process the autocorrelation coefficient is calculated, and the empirical distribution
of the T(I) statistic is created from them.
Calculation of the coefficient of spatial autocorrelation Moran’s I is used in detecting the
spatial dependence along with its strength and character in the examined area. This method
of finding dependencies is comprehensive and global. Determines the averaged pattern of
dependence across the area. Importantly it is not sensitive to the existing deviations from the
averaged autocorrelation model and does not inform in any way about its instability. This
results in the lack of information about extremely strong positive or negative dependence
and outliers. In order to thoroughly examine the analyzed space local statistics are carried
out which involves calculating the value for each individual unit. This allows you
to accurately examine whether a specific region consists of a low or high value of the
analyzed variable. One of the methods of such research is the local Moran’s I statistic, which
is effectively used in the identification of agglomeration effects and divides them into sets of
low and high values. It allows you to extract the so-called hot spots, i.e. areas where the
phenomenon is characterized by a high value of a feature that are adjacent to areas with
equally high indices of this feature or conversely with adjacent areas with particularly low
values. The last stage of this research method is the preparation of a map of all objects
together with the illustration of the occurring similarity (Kołodziejczyk & Kossowski, 2016).
3. Analysis of the Diversification of Regional Labor Markets in the Pressure Area of
Cracow-Balice and Wroclaw-Strachowice Airports – Results of Own Research
In the literature areas of impact of airports are also called isochrones or areas of influence.
They are differently defined. In practical research, the most common definition is the fields
surrounding airports to which passengers are attracted. Otherwise it is an area within a
radius of 100 km or 1-2 hours by car from the airport (Kujawiak, 2016) explained the issue.
This criterion (100 km) was taken into account by the author in her own research. At this
point, a question should be asked how to identify the statistical units located in the studied
areas. A helpful tool for their verification is the Geostatistics Portal that can be found in
(Surówka, 2019). It was used in the conducted research. The study the text does not include
its detailed procedure description. It can be found in literature (Surówka, 2019). Thanks to
this approach it was possible to determine the districts located in the areas of the pressure of
the ports under study (see table 1) and to obtain statistical information for 27 analyzed
indicators which may characterize the situation on local labor markets.
SPATIAL MODELING OF LABOR MARKETS IN THE AREAS OF AIRPORTS
Table 1. Districts and cities with district rights belonging to the 100 km isochrone for WroclawStrachowice and Cracow-Balice Airports
Wroclaw
-Strachowice
Airport
CracowBalice
Airport
Areas: bolesławiecki, dzierżoniowski, głogowski, górowski, jaworski, jeleniogórski,
kamiennogórski, kłodzki, Legnicki, lubiński, lwówecki, milicki, oleśnicki, oławski,
polkowicki, strzeliński, średzki, świdnicki, trzebnicki, wałbrzyski, wołowski, wrocławski,
ząbkowicki, złotoryjski, Jelenia Góra, Legnica, Wrocław, żagański, wschowski, sieradzki,
wieluński, wieruszowski, brzeski, kluczborski, krapkowicki, namysłowski, nyski, oleski,
opolski, prudnicki, strzelecki, Opole, gostyński, jarociński, kaliski, kępiński, kościański,
krotoszyński, leszczyński, ostrowski, ostrzeszowski, pleszewski, rawicki, śremski, Kalisz,
Leszno
Areas: radomszczański, bocheński, brzeski, chrzanowski, dąbrowski, gorlicki, krakowski,
limanowski, miechowski, myślenicki, nowosądecki, nowotarski, olkuski, oświęcimski,
proszowicki, suski, tarnowski, tatrzański, wadowicki, wielicki, Cracow, Nowy Sącz, Tarnów,
dębicki, jasielski, mielecki, będziński, bielski, cieszyński, częstochowski, gliwicki, lubliniecki,
mikołowski, myszkowski, pszczyński, rybnicki, tarnogórski, bieruńsko-lędziński,
wodzisławski, zawierciański, żywiecki, Bielsko-Biała, Bytom, Chorzów, Częstochowa,
Dąbrowa Górnicza, Gliwice, Jastrzębie-Zdrój, Jaworzno, Katowice, Mysłowice, Piekary
Śląskie, Ruda Śląska, Rybnik, Siemianowice Śląskie, Sosnowiec, Świętochłowice, Tychy,
Zabrze, Żory, buski, jędrzejowski, kazimierski, kielecki, pińczowski, staszowski,
włoszczowski, Kielce
The following variables were selected for the analysis, with the help of which the
situation in the local labor markets can be characterized (Surówka, 2019, 2020):
X1- number of registered unemployed remaining without work for more than 1 year
X2- percentage of registered unemployed aged 25-34
X3- percentage of registered unemployed over the age of 45
X4- percentage of the unemployed with higher education
X5- percentage of the unemployed with post-secondary or secondary vocational
education
X6- percentage of the unemployed with basic vocational education
X7- job offers for disabled persons per 1,000 unemployed
X8- registered unemployment rate
X9- share of registered unemployed in the working age population
X10- share of the unemployed with higher education in relation to the number of people
of working age
X11- share of registered unemployed graduates among the total unemployed
X12- employed per 1,000 population
X13– number of employed in hazardous conditions per 1,000 persons employed in the
surveyed population
X14- injured in accidents at work per 1,000 employed persons in total
X15- average monthly gross salary
X16 - average monthly gross salary in relation to the national average (Poland = 100)
X17- entities entered in the REGON register for 10 thousand population.
X18- newly registered units in the REGON register for 10 thousand population
X19- natural persons conducting economic activity per 1,000 population
X20- foundations, associations and social organizations per 1,000 inhabitants
SPATIAL MODELING OF LABOR MARKETS IN THE AREAS OF AIRPORTS
X21- newly registered foundations, associations and social organizations with 10,000
inhabitants
X22- entities per 1,000 inhabitants of working age
X23- foreign capital per capita in working age
X24- non-working population per 100 working-age people
X25- post-working age population per 100 people in pre-working age
X26- post-working age population per 100 people of working age
X27- net migration per 1,000 people
Their selection was dictated by the research experience to date and the possibility of
obtaining statistical data that is explained by Surówka (2019) and Pancer-Cybuska et al.
(2014). In order to detect the nature and strength of the observed spatial relationships in a
given area the spatial autocorrelation coefficient Moran’s I is used in scientific research. It has
a global reach which makes it possible to determine the impact on space. By determining its
value, it is possible to determine such a relationship in the following way: when the
determined value is smaller than the expression -1 / (n-1) we deal with a negative spatial
autocorrelation, otherwise (the value of the coefficient is greater than this expression) with
autocorrelation positive. However, it should be borne in mind that when close values appear,
the distribution of x values is random in space. Besides, for large values of n (i.e. the number
of spatial units) this often means no spatial correlation. This is due to the fact that the value
of the expression does not differ significantly from zero. In order to determine the
significance of the obtained results the autocorrelation coefficient significance test is most
often used. In the course of the research procedure, using analytical and statistical programs,
the values of the global measure Moran’s I were determined and then the autocorrelation. A
matrix of common boundary was used in the study. The results obtained are synthetically
summarized in tables 1-2. Then the values of the expression 1 / (n-1) were determined, which
were respectively -0.018 (for Wroclaw-Strachowice Airport) and -0.015 (for the Cracow-Balice
Airport) which in the next stage were compared with the determined values of the Moran’s
I coefficients. Thanks to this, it was possible to determine the autocorrelation according to the
criterion:
For the Cracow Airport
•
I > -0,015 positive autocorrelation, which in the table is marked with the symbol +
•
I < -0,015 negative autocorrelation, which in the table is marked with the symbol For the Wroclaw Airport
•
I > -0,018 positive autocorrelation, which in the table is marked with the symbol +
•
I < -0,018 negative autocorrelation, which in the table is marked with the symbol The results obtained are synthetically summarized in tables 2-3.
SPATIAL MODELING OF LABOR MARKETS IN THE AREAS OF AIRPORTS
Table 2. Spatial analysis of regional labor markets in the area of impact of Cracow-Balice Airport
isochrone based on the global Moran’s I statistics (2011-2015).
Variable X1 Variable X2 Variable X3 I Z p-value AK I Z p-value AK I Z p-value AK 2015 2014 0.178 0.319 2.59 4.47 0.0097 0.0000 + + 0.453 0.400 6.29 5.55 <0.000001 <0.000001 + + 0.614 0.610 8.41 8.36 <0.000001 <0.000001 + + 2013 2012 0.369 0.394 5.15 5.48 <0.000001 <0.000001 + + 0.318 0.266 4.46 3.79 0.0000 0.0002 + + 0.567 0.567 7.81 7.91 <0.000001 <0.000001 + + 2011 0.426 5.89 <0.000001 + 0.184 2.66 0.0078 + 0.612 8.38 <0.000001 + Variable X4 Variable X5 Variable X6 2015 0.178 2.64 0.0084 + 0.515 7.12 <0.000001 + 0.278 3.93 0.0000 + 2014 2013 0.165 0.157 2.46 2.34 0.0139 0.0192 + + 0.518 0.525 7.19 7.32 <0.000001 <0.000001 + + 0.300 0.269 4.24 3.81 0.0000 0.0001 + + 2012 2011 0.148 0.170 2.22 2.53 0.0264 0.0114 + + 0.515 0.500 7.12 6.96 <0.000001 <0.000001 + + 0.305 0.276 4.29 3.90 0.0000 0.0000 + + 2015 2014 -0.005 0.052 0.136 1.05 0.8917 0.2947 + + 0.339 0.358 4.76 5.01 0.0000 0.0000 + + 0.507 0.526 7.01 7.24 <0.000001 <0.000001 + + 2013 2012 0.113 0.026 1.81 0.79 0.070 0.4322 + + 0.347 0.339 4.86 4.73 0.0000 0.0000 + + 0.527 0.501 7.27 6.94 <0.000001 <0.000001 + + 2011 -0.005 0.136 0.8917 Variable X10 + 0.362 5.06 <0.000001 Variable X11 + 0.507 7.01 <0.000001 Variable X12 + 2015 2014 0.478 0.478 6.67 6.67 <0.000001 <0.000001 + + 0.505 0.578 6.94 7.91 <0.000001 <0.000001 + + 0.312 0.330 4.44 4.68 0.0000 0.0000 + + 2013 2012 0.481 0.459 6.70 6.38 <0.000001 <0.000001 + + 0.574 0.532 7.86 7.32 <0.000001 <0.000001 + + 0.348 0.359 4.923 5.06 0.0000 <0.000001 + + 2011 0.535 7.37 <0.000001 Variable X13 + - + 0.366 5.15 <0.000001 Variable X15 + 2015 0.476 6.71 <0.000001 + - - - - 0.117 1.86 0.0628 + 2014 2013 0.477 0.491 6.72 6.89 <0.000001 <0.000001 + + 0.570 0.560 7.85 7.70 <0.000001 <0.000001 + + 0.103 0.104 1.74 1.76 0.0822 0.0788 + + 2012 2011 0.508 0.480 7.09 6.72 <0.000001 <0.000001 + + 0.560 0.616 7.73 8.46 <0.000001 <0.000001 + + 0.100 0.064 1.69 1.20 0.0908 0.2307 + + Variable X7 Variable X8 Variable X16 Variable X14 Variable X9 Variable X17 Variable X18 2015 2014 0.117 0.103 1.86 1.74 0.0624 0.0814 + + 0.288 0.297 4.11 4.23 0.0000 0.0000 + + 0.255 0.327 3.71 4.64 0.0002 0.0000 + + 2013 2012 0.104 0.100 1.76 1.69 0.0779 0.0912 + + 0.300 0.307 4.27 4.35 0.0000 0.0000 + + 0.291 0.278 4.18 3.99 0.0000 0.0000 + + 2011 0.064 1.20 0.2297 Variable X19 + 0.313 4.43 0.0000 Variable X20 + 0.300 4.28 0.0000 Variable X21 + Lata 2015 I 0.350 Z 4.93 p-value 0.0000 AK + 0.150 2.23 0.0256 + -0.006 0.122 0.9030 + 2014 2013 0.355 0.353 4.98 4.95 0.0000 0.0000 + + 0.152 0.170 2.26 2.50 0.0241 0.0124 + + 0.030 0.063 0.600 1.058 0.5487 0.2902 + + 2012 2011 0.358 0.360 5.02 5.05 0.0000 <0.000001 + + 0.170 0.176 2.49 2.57 0.0127 0.0101 + + -0.188 0.009 -0.053 0.324 0.9577 0.7458 + + 2015 0.271 Variable X22 3.884 0.0001 + - + 2014 2013 0.277 0.276 3.96 3.95 0.0000 0.0000 + + 2012 2011 0.280 0.283 3.99 4.03 0.0000 0.0000 + + Variable X23 - - 0.151 Variable X24 2.229 0.0258 0.011 0.006 0.42 0.34 0.6756 0.7334 + + 0.228 0.344 3.25 4.81 0.0011 0.0000 + + -0.019 0.015 -0.06 0.503 0.9498 0.6147 + 0.476 0.555 6.59 7.67 <0.000001 <0.000001 + + SPATIAL MODELING OF LABOR MARKETS IN THE AREAS OF AIRPORTS Variable X25 Variable X26 Variable X27 2015 0.499 6.87 <0.000001 + 0.418 5.78 <0.000001 + - - - - 2014 2013 0.501 0.504 6.89 6.94 <0.000001 <0.000001 + + 0.411 0.401 5.69 5.55 <0.000001 <0.000001 + + 0.176 0.164 2.65 2.46 0.0080 0.0137 + + 2012 2011 0.511 0.518 7.03 7.12 <0.000001 <0.000001 + + 0.406 0.410 5.62 5.69 <0.000001 <0.000001 + + 0.165 0.163 2.46 2.46 0.0137 0.0141 + + In the course of in-depth analyzes it was possible to draw detailed and multi-threaded conclusions. These include X1, X2 (2012), X4, X7, X12, X14, X8 (2013), X19 (2012) and X21 (2011). Analyzing the
feature of the number of registered unemployed persons who have been unemployed for
more than 1 year we observe a tendency to concentrate within a given location areas with
similar values of the analyzed variable in districts located in the pressure area of the CracowBalice Airport. However, as mentioned above, its absence is observed in the area of the
isochrone at Wroclaw-Strachowice Airport. This is confirmed, for example, in the negative
autocorrelation in the period 2014-2015. Detailed analysis of the data of this feature for the
Cracow-Balice Airport allows to distinguish groups of neighboring districts. The first group
includes objects located in the south-eastern part of the study area. Its lowest level in the
entire period under consideration is typical for the following districts: Staszowski, Jaworzno,
Zory and Ruda Slaska. It should be noted that these are units that also belong to the area of
influence of Katowice-Pyrzowice Airport. A group of the Wielicki, Myślenicki and Suski
districts also formed a separate group. They are located in the malopolskie voivodship. In the
study some authors have shown that it is characterized by a large spatial differentiation in
the level of long-term unemployment, understood as continuous unemployment for over a
year. The increase in the significance of p-value level of the X2 variable after 2012 may indicate
the ongoing process of improving the situation on local labor markets due to the examined
feature. Its lowest value in the entire research period is observed in Bielsko-Biala. Like the
previous one another feature (percentage of registered unemployed aged over 45) is
characterized by a positive spatial autocorrelation. The statistics of Moran’s I fluctuate here
in the ranges 0.497-0.529 (isochrone of Wroclaw-Strachowice Airport) and 0.567-0.614
SPATIAL MODELING OF LABOR MARKETS IN THE AREAS OF AIRPORTS
(isochrone of Cracow-Balice Airport). The hypothesis of its irrelevance is rejected with a pvalue of 0.05. Based on the results it can be assumed that this phenomenon is empirically
confirmed. It is also possible to identify global clusters of high and low values of this measure,
which have a constant character. The first are the following objects: staszowski, buski,
dabrowski, kazimierski and proszowicki. They are characterized by its lowest level. They are
also characterized by the lowest percentage of employees in recent years. Their occurrence is caused by the similar values of this indicator in the case of most objects.
Table 3. Spatial analysis of regional labor markets in the area of impact of Wroclaw-Strachowice
Airport isochrone based on the global Moran’s I statistics (2011-2015).
Variable X1 Variable X2 Variable X3 I Z p-value AK I Z p-value AK I Z p-value AK 2015 2014 -0.102 -0.057 -1.03 -0.48 0.300 0.634 - 0.397 0.409 5.12 5.25 <0.000001 <0.000001 + + 0.529 0.528 6.72 6.70 <0.000001 <0.000001 + + 2013 2012 -0.002 0.076 0.201 1.149 0.841 0.250 + + 0.175 0.087 2.39 1.30 0.0168 0.1953 + + 0.501 0.497 6.37 6.34 <0.000001 <0.000001 + + 2011 -0.001 0.209 0.834 + 0.121 1.70 0.0886 + 0.533 6.75 <0.000001 + Variable X4 Variable X5 Variable X6 2015 2014 0.071 0.080 1.15 1.27 0.2498 0.266 + + 0.280 0.239 3.73 3.18 0.0002 0.0015 + + 0.119 0.138 1.72 1.94 0.0855 0.0517 + + 2013 2012 0.068 0.093 1.11 1.43 0.268 0.153 + + 0.241 0.215 3.23 2.90 0.0012 0.0037 + + 0.151 0.167 2.09 2.28 0.0367 0.0225 + + 2011 0.068 1.11 0.268 + 0.183 2.51 0.0119 + 0.148 2.06 0.0396 + SPATIAL MODELING OF LABOR MARKETS IN THE AREAS OF AIRPORTS Variable X7 Variable X8 Variable X9 2015 -0.004 0.18 0.8536 + 0.267 3.50 0.0005 + 0.175 2.38 0.0174 + 2014 2013 0.017 0.042 0.46 0.78 0.6400 0.4340 + + 0.262 0.287 3.43 3.72 0.0006 0.0002 + + 0.183 0.201 2.46 2.68 0.0138 0.0074 + + 2012 2011 -0.004 -0.004 0.20 0.18 0.8414 0.8536 + + 0.302 0.268 3.90 3.49 0.0000 0.0005 + + 0.256 0.213 3.36 2.82 0.0008 0.0048 + + Variable X10 Variable X11 Variable X12 2015 2014 0.193 0.0917 2.63 1.35 0.0085 0.1763 + + 0.6203 0.5663 7.76 7.11 <0.000001 <0.000001 + + 0.0090 0.0092 0.34 0.34 0.7334 0.7331 + + 2013 2012 0.086 0.1566 1.29 2.18 0.1971 0.0295 + + 0.5559 0.563 7.02 7.07 <0.000001 <0.000001 + + 0.0107 -0.004 0.36 0.18 0.7175 0.8564 + + 2011 0.1206 1.70 0.0883 Variable X13 + - - -0.004 0.18 0.8564 Variable X15 + 2015 0.196 2.81 0.0050 + - - - - 0.152 2.62 0.0089 + 2014 2013 0.207 0.189 2.93 2.65 0.0033 0.0080 + + 0.014 0.108 0.42 1.57 0.6746 0.1168 + + 0.164 0.139 2.85 2.57 0.0044 0.0102 + + 2012 2011 0.136 0.235 1.99 3.26 0.0464 0.0011 + + 0.062 0.066 0.99 1.10 0.3185 0.2723 + + 0.0988 0.110 1.95 2.08 0.0512 0.0375 + + Variable X16 Variable X14 Variable X17 Variable X18 2015 0.110 2.08 0.0375 + 0.181 2.52 0.0118 + 0.333 4.37 0.0000 + 2014 2013 0.165 0.139 2.85 2.57 0.0044 0.0101 + + 0.171 0.173 2.39 2.42 0.0167 0.0156 + + 0.294 0.036 3.91 1.38 0.0000 0.1680 + + 2012 2011 0.099 0.110 1.95 2.08 0.0509 0.0377 + + 0.161 0.161 2.26 2.26 0.0236 0.0239 + + 0.305 0.370 3.99 4.83 0.0000 0.0000 + + Variable X19 Variable X20 Variable X21 2015 2014 0.120 0.120 1.71 1.71 0.0874 0.0876 + + 0.128 0.131 1.82 1.86 0.0681 0.0633 + + 0.134 0.147 1.87 2.06 0.0610 0.0396 + + 2013 2012 0.118 0.112 1.69 1.62 0.0905 0.1056 + + 0.141 0.158 1.97 2.18 0.0484 0.0295 + + 0.169 0.172 2.31 2.32 0.0211 0.0204 + + 2011 0.113 1.63 0.1041 Variable X22 + 0.158 2.18 0.0294 Variable X23 + 0.074 1.14 0.2550 Variable X24 + 2015 2014 0.167 0.158 2.34 2.23 0.0192 0.0258 + + 0.159 2.27 0.0235 + 0.218 0.285 2.93 3.76 0.0034 0.0017 + + 2013 2012 0.160 0.148 2.25 2.09 0.0245 0.0336 + + 0.180 0.179 2.56 2.53 0.0104 0.0114 + + 0.376 0.449 4.87 5.72 0.0000 <0.000001 + + 2011 0.149 2.11 0.0347 Variable X25 + 0.214 3.03 0.0024 Variable X26 + 0.457 5.808 <0.000001 Variable X27 + 2015 0.333 4.326 0.0000 + 0.124 1.767 0.0772 + - - - - 2014 2013 0.322 0.304 4.190 3.981 0.0000 0.0000 + + 0.129 0.144 1.83 2.01 0.0668 0.0442 + + 0.184 0.210 3.13 3.42 0.0017 0.0006 + + 2012 2011 0.318 0.315 4.149 4.102 0.0000 0.0000 + + 0.200 0.228 2.70 3.03 0.0070 0.0025 + + 0.247 0.233 3.96 3.85 0.0000 0.0000 + + Table description: I- global Moran’s I statistics, AK – spatial By analyzing the results obtained for the Wroclaw Airport we can draw the following conclusions. Some of them are also located in the area of the Katowice-Pyrzowice Airport. These are also
facilities with the highest percentage of people employed in hazardous conditions. The
persistently high percentage of unemployed graduates in almost all surveyed counties
should be considered a disturbing phenomenon. In terms of this feature the situation is most
favorable in wieruszowski region.
4. Discussion and Conclusion
The pace of development of European countries depends on many different factors. One
of the most important is the improvement of the situation on regional labor markets, which
can be determined in the course of research and data analyzes. The article is a continuation
of the author's own research in the field of regional development, innovation, the impact of
air transport on local labor markets and competitiveness of European Union regions. The
subject of interest in the text are the areas of influence of the Cracow-Balice Airport and
Wroclaw-Strachowice. In the course of such research the research hypothesis was positively
verified. Therefore, the statement that the districts located in the areas of impact in the
analyzed ports is characterized by a different (positive or negative) spatial autocorrelation of
the situation on regional labor markets should be considered justified. Moreover, the
examined objects are distinguished by statistically significant differentiation. The analysis of
the features selected for the study allowed to indicate where this differentiation is particularly
noticeable. In addition to the results included in the main content, we can also draw
conclusions. In the analyzed period, the persistence of a high percentage of graduates among
the unemployed in the areas of pressure in the ports under study should be considered a
negative phenomenon. Moreover, the districts located near the analyzed ports have
particularly low values of this measure. When analyzing the results of own research, it is
possible to observe a certain similarity of districts in terms of selected indicators describing
the situation on local labor markets in the south-eastern part of the studied area. The fact that
the development of transport is conducive to the settlement of new residents in the studied
SPATIAL MODELING OF LABOR MARKETS IN THE AREAS OF AIRPORTS
area is evidenced by for example the lowest migration balance. It can be said with certainty
that the districts located near the port are the most attractive places.
References
Bal-Domanska, B., & Sobczak, E. (2018). Educational Potential and the Situation of the Youth on the Labour
Market in the European Union. In Hradec Economic Days 2018 (Vol. 8, pp. 20-31).
Cracolici, M. F., Cuffaro, M., & Nijkamp, P. (2009). A spatial analysis on Italian unemployment differences.
Statistical Methods and Applications, 18(2), 275–291. https://doi.org/10.1007/s10260-007-0087-z
Kołodziejczyk, A., & Kossowski, T. (2016). Wykorzystanie metody autokorelacji przestrzennej do analizy
ubóstwa na obszarach wiejskich. Wiadomości statystyczne, 10(665), 22-32.
Kujawiak, M. (2016). Analiza obszaru oddziaływania portu lotniczego – przegląd metod badawczych. In Studia
Oeconomica Posnaniensia, Wydawnictwo Uniwersytetu Ekonomicznego w Poznaniu. (No. 4., pp. 112-124).
Longhi, S., & Nijkamp, P. (2007). Forecasting Regional Labor Market Developments under Spatial
Autocorrelation. International Regional Science Review, 30(2), 100–119.
https://doi.org/10.1177/0160017606298428
Malinowski, M., & Jabłońska-Porzuczek, L. (2020). Female activity and education levels in selected European
Union countries. Research in Economics, 74(2), 153–173. https://doi.org/10.1016/j.rie.2020.04.002
Nikulin, D., & Sobiechowska-Ziegert, A. (2018). Informal work in Poland - a regional approach: Informal work
in Poland - a regional approach. Papers in Regional Science, 97(4), 1227–1246.
https://doi.org/10.1111/pirs.12306
Pancer-Cybulska, E., Cybulski, L., Olipra, Ł., & Surówka, A. (2014). Transport lotniczy a regionalne rynki pracy w
Polsce. Wydawnictwo Uniwersytetu Ekonomicznego we Wrocławiu.
Sardadvar, S., & Rocha-Akis, S. (2016). Interregional migration within the European Union in the aftermath of
the Eastern enlargements: a spatial approach. Review of regional research-jahrbuch fur regionalwissenschaft, 3,
51-79.
Shaikin, D. (2012). Population's economical activity as an indicator of labour potential development (The
republic of kazakhstan case study). Actual problems of economics, 134, 531-538.
Siserova, M., & Zudelova, M. (2015). Spatial Econometric Modelling of Internal Labour Mobility. In Central
European Conference on Finance and Economics (CEFE) (pp. 663-670).
Surówka, A. (2019). Taksonomiczna analiza zróżnicowania sytuacji na lokalnych rynkach pracy na obszarze
ciążenia Lotniska Chopina w Warszawie jako metodologia zarządzania rozwojem regionalnym. Economic
and Regional Studies, 12(4), 230-240. https://doi.org/10.2478/ers-2019
Surówka, A. (2020). Comparative Analysis of the Dynamics of Indicator Changes GDP per Capita in the Regions
of Greece, Germany and Romania. In Proceedings of the International Scientific Conference Hradec Economic
Days 2020 (Vol. 10, pp. 749-760). https://doi.org/10.36689/uhk/hed/2020-01-085
Surówka, A. (2019). Portal Geostatystyczny jako narzędzie badawcze nierówności na lokalnych rynkach pracy.
Zeszyty Naukowe Uniwersytetu Rzeszowskiego Nierówności społeczne a wzrost gospodarczy, 59(3), 162-172.
Szulcl, E., & Jankiewicz, M. (2017). The labour market situation in medium-sized urban centres of the KujawskoPomorskie voivodeship and the problem of unemployment in the province (11th ed). Professor.
| 28,151 |
reportscasesarg08elligoog_32
|
English-PD
|
Open Culture
|
Public Domain
| 1,835 |
Reports of cases argued and determined in the Court of King's bench
|
Great Britain. Court of King's bench. [from old catalog] | Adolphus, John Leycester, 1795-1862, [from old catalog] reporter | Ellis, Thomas Flower, 1796-1861, [from old catalog] reporter
|
English
|
Spoken
| 7,661 | 10,519 |
of The Proprietors of the Gas Works, were rated upon "^^^^^S*" the som of 42/. for the gas works, and 8^ for certain for the use of a town, and to tenements, the sessions confirmed the rate absolutely lery rates on as to the tenements ; and, as to the gas works, subject to occupien of° the foUowing case. ^^^Z. The commissioners are appointed by stat 48 G. S. ^*^.*^b"J c.haayn.la) and stat 6 G. 4. c. cxxxviii. (J). The i*ter local act, ^ ' ^ ' Uieywereau- ground thonsed, if they saw fity to (a) StBt 48 G, 3. c. Ixixvii. (local sod personal, public), is " for manufacture lighting, watching, and regulating the streets and lanes, and other public gas for the pur- passages and places, in the town of J9flwrfcy." £!rt 'd^^'tlT Sect. S9 authorizes the commissioners (appointed by sect. 1 for carry* let out privale ing the act into execution) to purchase and provide lamps, &c., and to |*mpaf &c., to cause them to be fixed and lighted at such times as shall seem necessary. Il^^^/ | Sect 39. *' And for raising money for answering and defraying the them with gas ; expenses attending the carrying into execution the several purposes of this ^« profits to be act,** the commissioners are authorised yearly^ or oftener, as they shall ^^^^^' ^^^ ^ see occasion, to cause such sums to be imised by a rate or assessment on the gas ap. tenants or occupiers of houses, ftc, tenements and hereditaments, adjoin- p^ratus, and ing to or upon stneta, ftc, lighted under the authority of this act, accord- ^'th^u^^'oBes ing to the annual rent or value, not exceeding 8«. in the pound, as they of thut and the afaall think proper and neoessaiy for defraying the charges, &c. former act. (6) StBt 6 6. 4. c cxxxviii. (local and perranal, public), is «« to amend missiooerama* and enlarge the powers of** stat 48 O, 3. c. IxxxviL nufactured the Sect 1 appoints commissioners for carrying both acts into execution. S*s> *^ l^t Sect 3 enacts, ** That it shall be lawful for the said commissioners, by pli^d\hein wi'th and out of the monies authorised to be raised by the said recited act or gas, and ap- tUt act from time to time to cause the streets," ftc., « to be lighted with P^'^ *^^ ^« profits arising therefrom to the purposes directed by the acts. Held, that they i^efe not rateable as beneficial occupiers of the gas works. U u 4 gM 6*6 CASES IN EASTER TERM 1837. ground upon which the works are erected is within the respondent parish, and was formerly garden ground^ against and, as such, rated to the poor. It was afterwards pur- Commissioners chascd by John Malamj who erected the works in ques- BsTBRLirf tion upon it, and carried on the business of manufactur- ing gas there for his own benefit for about two years ; during all which time he was rated to the poor of Saint MartMSf as the proprietor and occupier of the said gas works. The commissioners afterwards, in 1828, in pur- suance of powers conferred upon them by stat 6 G. 4. gas or oil or any other materiali at such times of the year and in such manner as they may think proper," an^ to contract with any perMn, &€.» ** for lighting the same, and for furnishing pipes, lamps," &c. Sect. 4 enacts, ** That in case the said commissioners shall deem it vipedient to erect or purchase gas apparatus, and light the said streets,'* Stc, ** without contracting for the same,** it shall be lawful for them, ** from time to time to make and erect or purchase retorts, gasometers, receiven, and other buildings, cisterns, engines, and other apparatus,** and make such other works, and lay or purchase such pipes, &c., in such manner as they shall think fit ; « and for the purposes aforesaid it shaU be lawful for the said commissioners to purchase or rent or take on lease for yean any messuage or messuages and buildings, knd, ground, or. hereditaments, within the sud town of Beverley, which they may think proper.*' Sect. 7 enacti, " That in case the said commissioners shall deem it expedient to erect or purchase such gas apparatus, and to light the said streets,** &c., ** or any of them with gas, without contracting for the same «s aforesaid, it shall be lawful for the said commissioners, after sufficiently lighting such said streets,** ftc, " to let out or to grant to any person who shall be willing to take the same, any light or lights, burner or burners,** ftc^ " and to supply the same, with gas, upon such terms and conditions, «nd at such annual rents for the same, and in such manner as the said commissioners shall from time to time think proper : Provided neverthe- less, that all money to proceed therefrom or arise thereby be in the first instance applied to defray the expenses of the gas apparatus and other things connected therewith, and if there shaU be any overplus, then the same shall be applied generally for the purposes of the said recited act and thuact.'* c* cxxxviii. IN THK SeTENTH YeAB OF WILLIAM IV. " 647 c. cxxxviii., purchased the said ground with the gas 1837. works in question standing thereon, from Malam^ for 8,000/. ; they are still the proprietors of them, and have agdnut since that time carried on the business of manufacturing Comioitsionen gas there. For the purpose of completing such pur- Bsvielkt. chase, and for other purposes of the said act, and under the authority of the act, the commissioners have borrowed 8,500/1 on mortgage of the rates after men- tioned (a). In pursuance of the last mentioned act, from and after time of the above purchase, the commissioners have lighted the streets and other public passages of the town of Beverley with gas, without contracting for the same as they had done before the purchase ; and they have let out, to such persons as were willing to take the same, certain private lights of the descriptions specified in the said act, and have supplied such lights with gas, upon such terms and conditions, and at such annual rents, and in such manner, as they have from time to time thought proper. The commissioners have applied all the money proceeding therefrom to defray the expenses of the said gas apparatus and other things connected therewith, as by the last mentioned act is directed. And, for defray- ing the expense of lighting the said town as aforesaid, and of carrying into execution the several purposes of the said acts, the commissioners have from time to time, under the authority of the same, caused the necessary sums to be raised by rate on the tenants or occupiers of premises within the town; which sums they have uni- formly applied according to the directions of the said acts. (a) There w«re clauses in the last mentioned act, authoritlng this. The 648 CASES IN EASTER TERM 1837* The commissioners are the occupiers of the said gas works and premises, but have no beneficial occupation agauut ofy or emolument resulting from, the said gas works, ComminioDera premises, or other subject of the rate, in any personal for Lightinff , .. BxYKuxT. or private respect (a). If this Court should be of opinion that the commis- sioners were liable to be rated for the gas works, the order of justices was to be confirmed ; otherwise, to be amended by striking out so much of the rate as related to the gas works only. Archbcld in support of the order of sessions. The com- missioners are beneficial occupiers. They manufacture gas on the premises which they occupy. It will be contended that, inasmuch as they have applied all the money which they derive from the private lights let out by them to defray the expences of the apparatus, they derive no benefit from the occupation. But, as sect. 7 of stat. 6 G. 4. c. cxxxviii. authorises them to make profits by the manu&cture of gas, it is unimportant how they apply the profits when made. The land was used in the same way before the purchase, and was then rated. Hdt C. J., in an Anomfnums Case (6), said that no man, by appro- priating his lands to an hospital, ** can discharge or exempt them from taxes to which they were subject before, and throw a greater burthen upon their neigh- bours.'' Thfit dictum may perhaps be inconsistent with some later decisions; but it appears to be founded in good sense* [Lord Denman C. J. Supposing it to be (a) HSdifatdt for the appellants, pointed out that the words of the case here followed the language of Lord EUenbotovgh in Hex v. TerroU, 3 Mattt 514. (6) B Silk. 527. See Downing Coikge v. Purchas, S£.^ Ad. 162. till IN THE Seventh Year of WILLIAM IV. 649 stOl law, it applies only to yolcmtary appropriations: 18.^7. here the appropriation is by statute.] Rex v. Liver-- pool {a) will be relied upon on the other side. There the profits upon the dock estates were held not rateable because the statute directed their application to the pur* BBTZftwrf poses of the act, and, after such purposes were satisfied, the duties were to be lowered, so that there could be no surplus. The efiect of that was ultimately to distribute the profits arising from the duties among all frequenting the docks. In Bex o. TAe Trustees qf the Biver Weaver Navigation {b) a profitable surplus on the duties was equally impossible. In B£x t. The Commissioners ^ Salterns Load Sluice (c) the tolls were applicable to the purposes of the act, '* and to no other use or purpose whatsoever.'' These cases have been somewhat qualified by later decisions. But here the profits come in the first instance to the commissioners : sect 7, indeed, re- quires that they shall be applied to the purposes of the act; but when these purposes are satisfied there will, be a benefit to the commissioners. The ultimate appli- cation of profits, whether in the hands of corporations, commissioners, trustees, or others, does not destroy the rateability. Rex v. Jgar (<2), Rex v. Tevdre^wy (^), Rex V. Gardner (g), Rex v. Sudbury (A), Rex v. St. Giles York{i)i furnish instances of this principle. Hildyardj contra, was stopped by the Qourt (a) 1B.^C 61. (6) Note (c) to Bex ▼. Liverpool, T B, i C, 7a (c) 4 r. B. 7Sa (d) 14 JEatt, 956, (e) IS Eatt, 155. See Bex y. The Mayor, ffc. tfTork, aot^ 419. (g) 1 Cowp. 79. (A) IB. 4: a 889. {») SB,^Ad, 573. See alaoy The Governor, 4;c.,^theBruM Poory. Waii, 5 A. i S» I* Lord 650 CASES IN EASTER TERM 18S7. Lord Dbnman C. J« This rate cannot be sap- """"■"" ported. The commbsioners are appointed, by stat. The KiMO againti 48 G. S. c. Ixxxvii*) for lighting the town. Then stat. The CommiMaoDen 6 6. 4. c. cxxxviii. enlarges their powers. XJnder the BcTnLxirf fonner act they have power to rate. By sect 7 of the latter act, they have power to let lights, and they have done so. It is argued that this gives them a profitable occupation ; but sect. 7 directs that all money arising therefrom shall be applied, in the first instance, to de- fraying expenses, and then generally to the purposes of the act The case finds expressly that all the money has been so applied. The efiect of the act is, either that rates producing more than is requisite for the pur- poses of the act cannot be laid, or that when they produce more they must be lowered. If this rate were good, the commissioners would really have to rate the in- habitants for the mere purpose of paying the poor-rate. Bex V. Liverpool (a), which is in accordance with other decisions, has shewn that, where an act of parliament disposes of the whole of what is raised, there can be no beneficial occupation. LiTTLEOALE J. Under the first statute, the commis- sioners had power to raise rates to pay for the lighting of the town. Under that act, they must have bought their gas from the manufacturer. They now manufacture the gas themselvfs. Whatever saving they efiect by this goes to reduce the rate, and saves so much to persons liable to the poor-rate. If the commissioners are rated to the poor for this, they must increase their rate on the town t it is as bf oad as it is long. At all events there can THE Seventh Yeab of WILLIAM IV. 651 can be no surplus, and the principle established in Rex 1887. V. Uverpod {a) appUes. ^;;^^ ogaintt The Patteson J. The only material distinction suggested CommiMioDen between the present case and Bex v. IAverpo6l{a) is that BsrssLBrf in the latter case there was an express provision for reducing the rates, so as to leave only enough for the purposes of the act But the effect of the provisions here is the same. No profit could arise under the first act here, for there was merely a rate to meet expenses. Under the second act, a further fund arises from letting the lights ; but then this fund is directed to be applied to the same purposes as the rate, so that it merely goes to lessen the rate. Coleridge J. concurred. Order of Sessions quashed; the rate to be amended by striking out so much thereof as relates to the Gas Works. (a) 7J7. t* aei. CASES IN EASTER TERM ^ndojf, Saxon against George Castle, the elder, George Castle, the younger, and Browne, Gent., One, &c. PUintiff gave /^ASE. The declaration stated that, before the oom- defendiuitsa \^ ^ ^ .4, ,. wairmntofat- mittiDg &c., an action of assumpsit was pending up judgment if in the SherlfiPs' court, London^ at the suit of Castle the ihould be un- elder and Ceistle the younger, against the plaintifi^ for four day»*after ^loney had and received, and that, by agreement be- ■h^ ^6/^ tween the said parties for putting an end to the suit, the taiedUieume. plaintiff, on Novembet' 27th 18SS, executed a warrant Defenduits ^ ' ' procured a tax- of attorney to confess judgment on plaintiff's behalf Ationei parte; - , , . . ,. and, bj an in- for 100/« and costs, on the terms contained m a memo- ientationtothe raudum indorsed on the said warrant, '* whereby it was tainedfromhim declared that the said warrant of attorney was given by for m^^ the plaintiff to the defendants, G. C. the elder and G. C. ^a^ ^"^ ^® younger, to secure the payment of the sum of 18/. By order of a in manner thereinailer mentioned, together with the Judgconsum- ^ j i • j . , . , mons, a new costs and charges mcurred in a certam cause commenced directed, pend- in the sheriffs' court by the defendants G. C the elder defendanu * ^^d G. C. the younger against the plaintifis, and re- JuTiiiff. After- moved into the Court of King's Bench, and afterwards toMA)n ^^ sent to the sheriflS' court (being the said action of as- bad, and the sumpsit SO Commenced and pending as aforesaid)," such ^ duced. Plains tiff declared in caie for a wrongftil arrest, and defendant pleaded that the eoits had been taied and a sum found due, for which he arrested. Held, 1. That plaintiff might properly sue in case for a maliciooi arrest, and was not bound to declare for a deceitful representation to the Master. S. That the plea was not supported, there having been, in effect, no taxation when the defendant arrested : and that the plaintiff was not bound to reply the facts which rendered the first taxation invalid. But S. That judgment must be arrested, because the declaration (which set out the facts of the case) alleged only that the defendant had *< wrongfully and injuriously " delivered the writ to the sheriff, not adding « maliciously." costs Caitlx. IN THE Seventh Year of WILLIAM IV. 65S costs to be taxed as between attorney and client: that 1837. the 18/. was to be paid by instalments, viz., 6L on December 2Sthf 1833, 61. on January ^Sth^ 1834, and 6L agamu on February 28th, 1834, and the costs to be paid ** within four days after the Master should have taxed the same ; and that, if default should be made in pay- ment of either or any of the sums at the days and times therein above mentioned, judgment was to be entered up, and execution to issue for the whole or any part of such sum as should be then due and unpaid.'* The declaration then stated that, although, at the time of the committing &c., a part only, to wit 12/. of the said 18/., was due and unpaid, *' and although the said costs and charges incurred in the said cause in the said memo- randum mentioned had not been taxed by any of the Masters of the said Court of King's Bench, nevertheless the said defendants, disregardii^ the terms in the said memorandum expressed and contained, and their duty in that behalf, and contriving and intending to cause the said plaintiff to be ynprisoned and to be detained in prison for a much greater sum of money than was justly due and payable by him, according to the tenor of the said memorandum and the terms thereof, and to injure, prejudice, and aggrieve him the said plaintiff in this be- half, heretofore, to wit on the 6th day o^ February 1834, wrongfully and injuriously caused " a ca. sa. to be issued under colour of a judgment alleged to have been en- tered up on the warrant of attorney, and indorsed the said ca. sa. to levy 62/. 125., besides poundage, &c, the same then being a much greater amount than was then due and payable by plaintiff to the defendants Castle senior and Castk junior, according to the terms of the memorandum ; which writ the defendants, ^* contriving and 654i CASES IN EASTER TERM 1837. and intending as aforesaid) wrongfully and injuriously "T delivered " to the sheriffs, and they by virtue thereof againsi arretted plaintiff and detained him in custody, &c. Pleas, 1. Not Guilty. 2. That, before and at the time of the committing &c., the sum of 18/., mentioned in the said memorandum, was, according to the terms thereof, due and unpaid by plaintiff to Castle senior and Castle junioTf and that afterwards, and before the com- mitting 8cc., viz. 7th December 1883, the costs and charges incurred in the said cause in the said memorandum men- tioned were taxed by one of the Masters of the said Court at a large &c., viz. ML 12^, making, with the 182., 621. 12f., which remained unpaid until and at the time when &c., in the declaration mentioned, wherefore the last^mentioned defendants in their own right, and de- fendant Browne as their attorney and by their command, at the same time when &c., being more than four days after the said Master had taxed the said costs, caused and procured the said writ to be issued, &c« Veri- fication. Replication to this plea, de injuriiu Issue thereon. On the trial before Lord Denman C. J. at the sittings in London after Trinity term 1835, it appeared that the action in the sheriffs' court had been settled by the now plaintiff giving a warrant of attorney with a memo- randum, as stated in the declaration: that on De^ cember 7th, 1833, the now defendant Bratxme went before an assistant Master of the Court of King's Bench, and obtained a taxation of the costs in that court ex parte, no notice of taxation having been given to the now plaintiff's attorney on the record in the sherifis' court: and that the Master gave an allocatur for 417. 75., inclusive of the costs in that court, under- standing. Castlk. IN rat Seventh Year of WILLIAM IV. 655 standing, from the statement of the parties attending 18S7. him, that those costs had already been taxed in the "7 Sheriffs' Court; which, however, was not the case. A agavmt summons was then taken out, on the part of the now plaintiff, to obtain a review of the taxation ; and a Judge's order was obtained for the Master to tax the costs in the Sheriffs' Court. The Master thereupon referred those costs to the Prothonotary of the Sheriffs' Court. Pending the taxation by him, judgment was signed on the warrant of attorney ; and, on February 6th 1 834«, the now plaintiff was arrested on a ca. sa. indorsed to levy 62L 1 25., including the whole debt of 18/., and the full costs in the Sheriffs' Court. On February 8th he was discharged out of custody by a Judge's order. The costs in the Sheriffs' Court were afterwards taxed in that Court; and a new taxation was then had before the Master of the Court of King's Bench ; and on that occasion the costs of the cause were reduced by 22L : those in the Sheriffs' Court a|)pearing now to be 14/. less than on the first taxation. The Lord Chief Justice directed the jury that the first proceeding before the Master was no taxation at all, that it lay on the defendants to prove a taxation, and that they had shewn no right to arrest ; and he lefl it to the jury to say what damages the now plaintiff was entitled to for his imprisonment. Leave was reserved to move to enter a verdict for the defend- ants, on objections taken in the course of the trial ; and the plaintiff had a verdict. In the ensuing Michaelmas term, Kelly obtained a rule calling on the plaintiff to shew cause why a verdict should not be entered for the defendants, or one or more of them, or a new trial had ; and it was part of the rule, that the defendants should be at liberty to move to Vol, VI. X x arrest Castlk. 656 CASES IN EASTER TERM 1887. arrest the judgment. The ground for a new trial or verdict for the defendants was that the issue on their Saxon againtt part, ou the special plea, was supported by the evi- dence : the ground for arresting judgment was, that the declaration did not aver malice ; Scheibel v. Fairbain (a) was cited. Swann now shewed cause. The plea, that, at the time of the arrest, 18/. was due according to the memorandum, and that the costs had been taxed, was not borne out by the evidence. Assuming that the Castles might sign judgment for the whole 18/., on neglect to pay two instalments, there had been no taxation of costs at the time of the arrest. [Lord Denman C. J. Should not you have replied that there had been no legal taxation ?] It was unnecessary ; the proceeding which had taken place before the Master was a nullity. It is true that the now plaintiff might have brought an action for that irregular proceeding ; but he is not the less entitled to sue as he now does. As to the declaration, the facts stated supply the place of an aver* ment that the arrest was malicious. In Crozer v. Pilling (b) the refusal of a creditor to authorize the sheriff to discharge a debtor out of custody, on tender of the debt and costs, was held to be in itself primfi facie malicious. Under the circumstances alleged here, "wrongfully and injuriously" may be taken to imply malice. [Lord Denman C. J. In Crozer v. Pilling (b) no question arose on the pleadings.] No averment of (a) \B,fP. 388. KeUtft\ao contended, in moving for the rule, that, assuming the attorney to be liable in this action, the other defendants were not so, they being free from blame in the irregularity which had taken place; and he cited Stoke$ ▼. White, \ Cro. M. ^ ii. 823. S. C 4 2>r. 786. (ft) 4 J7. f C. 26. malice IN THE Seventh Year of WILLIAM IV. 657 malice was made in Wentworth y. Btdlen (a). [Cole^ 1837. ridge J. It does not appear from the report what the form of declaration was.] There the defendant, having agointt taken a cognovit from the plaintifF, sued out execution upon it for a larger sum than the terms of the cognovit warranted ; and Parke J. held that the action for issuing such execution was, in substance, an action for breach of contract. The same may be said of the present action; and, if the ground of it be a violation of contract, there is no necessity to shew malice. In an action for an illegal arrest malice is not averred. IPatteson J. That is in trespass, where the proceeding is altogether void. I never saw a declaration in case, for an arrest, without the word •* maliciously."] Bayley, contri. The plea was sufficiently proved. [Lord Denman C. J. Can you say that it was so as to the taxation ?] The defendants put in an allocatur for 62/. 125. The plaintiff's case was that this was, in truth, no allocatur. But, to set up this defence, they should have replied that the allocatur was void, and was super- seded by another. As it was, it appeared that the costs had in fact been taxed according to the terms of the memorandum. It may be a question whether the learned Judge who made the order for a new taxation could properly do so. [Lord Denman C. J. He had jurisdiction; we cannot inquire into that now. Pat' teson J. If the order was wrong yon should have ap- plied to the Court at the time.] The action is miscon- ceived. It should have been brought for improperly representing to the Master that the costs in the Sheriffs' (a) 9B,4; a 840. X X 2 Court 668 CASES IN EASTER TERM 18S7. Court had been taxed when they had not, whereby he was induced to make his allocatur for too large a sum. Saxon ® agamtt (On the other point he was not heard.) Casslx. Lord Denman C. J. There is no ground for a new trial in this case, because the plaintiff's points were proved. But, as to the form of action, I should have wished to see some authority for a statement, like that in the present declaration, omitting the allegation of malice. I am of opinion that the averment of malice was necessary. In Scheibel v. Fairbain (a), where a declaration in case stated that the defendants had sued out a capias ad respondendum against the plaintiff, who afterwards paid the debt, and that the defendants, neglecting their duty, did not countermand the arrest, but wrongfully neglected so to do, by means whereof the plaintiff was imprisoned, the judgment was arrested for want of an allegation of malice. In Gibson v. C&z- ters (b)y where the plaintiff, against whom the defendant had issued a bailable writ, paid the debt, but was after- wards arrested on an alias writ issued upon the original affidavit of debt. Lord Eldon nonsuited the plaintiff for want of proof of express malice, and the Court of Com- mon Pleas upheld that ruling. This last decision ap- pears indeed to have been questioned by Lawrence J., in Sinclair v. Eldred (c), but is maintainable, as the affi- davit of debt was made before the payment; and the party arresting does not appear to have known of the payment when the alias writ was taken out There are many cases in which the want of probable cause has (a) 1 27. i' P. 380. (6) ^B.^P. 1S9. (c) 4 Taunt, 7. been Caszli. IN THE Seventh Year of WILLIAM IV. 659 been held to be proof of malice, when alleged ; bat none 1S57- has been pointed out in which the omission to aver — - malice has been made up for by other allegations in the agahw manner here suggested. LiTTLEDALE J. The plaintiff here alleged that the writ was sued out upon an excessive demand. The de- fendant was to shew that 18/. was due, and that the costs, which he also claimed, had been taxed. I think the plea was proved as to the 18/., but not as to the costs. The taxation, having been set aside, was as if it had never been made; as if the parties had gone before some other person than the proper officer. So far, therefore, the charge in the declaration was not answered. As to the form of the declaration ; in trespass, where the act of arrest is in itself illegal, no averment of malice is neces- sary ; but in case for suing out a writ for more than is due, according to the precedents, and to the principles of distinction between actions of trespass and on the case, malice must be alleged. It may be said that such an averment is necessary where, in default of it, the excess complained of might be imputed to mistake, but that, where it appears on the proceedings of the Court itself, of which the arresting party must be presumed cognizant, tliatthe sum claimed by him could not be due, the al- egation of malice is superfluous. Nevertheless, I think that the plaintiff was bound to allege it ; the malice would in such a case be very easily proved ; but still it might be possible to shew that there was a mistake; and therefore, in point of form at least, malice ought to have been averred. The rule must be absolute for arresting the judgment. X X S Pattesok Carli. 660 CASES IN EASTER TERM 1887. Patteson J. It has been contended that this action "^^ should have been brought for a misrepresentation to the agatna Master; and that would be true, if the representation made had been the only act of the defendant, and no* thing which took place aderwards had been in his con- trol. But the compIaiiT there is, not merely of a mis- representation, but of acts of the defendant grounded upon it; an action for the arrest was, therefore, proper. Proof of malice was not called for, because malice was not alleged. The plea was not proved. At the time of the arrest the allocatur had been set aside ; and there- fore nothing was due for costs according to the me- morandum on the warrant of attorney. As to the form of the declaration, I have not the slightest doubt that, to support an action like the present, there must be malice express or implied, and that it must be alleged. If the allegation of malice were immaterial, it is not easy to say why the question as to proof should have arisen in many cases of this kind where it has been discussed whether want of probable cause was proof of malice. Coleridge J. I think that this action was well con- ceived ; but I have no doubt that, in an action for ar- resting without probable cause, an averment of malice is necessary. Rule absolute for arresting judgment. IN THE Seventh Yeae op WILLIAM IV. Reed against Cowmeadow and Rudge (a). Tf RESPASS for assaulting and falsely imprisoning ApartyhaTiDg i_ 1 • •!»• r>^ apprehended the plaintiff. On the trial before Parke B. at the another, and last Spring assizes at Gloucester j it appeared that the against him plaintiff had pulled down part of the chimney of a build- under stitl*7&' ing in the defendant Conmneadaafs possession; that f fi^forama- Cawmeadam thereupon took the plaintiff and (about Mcious injury ^ * ^ to property, the five in the afternoon) delivered him into the custody of justice dia- mimed the a constable, the defendant Rudge^ who, by Caameadatxfs complaint, direction, kept him in charge till the next morning; nion that the that the plaintiff was then dismissed without being taken had acted'under before a magistrate, the defendant Cotwmeadc/m having gul^lS"f<Il!*of obtained a summons for his attendance at a subsequent "g^^ according *■ to the proviso time; that the plaintiff and Cawmeadam afterwards at- of sect. 24. *' ^ An action of tended before a magistrate, and Cawmeadam made a trespass being 1 . 1 . . .«. t « ^ brought for the charge against the plaintiff under stat 7 & 8 G. 4. arrest, c. SO. 5. 24. ; and that the magistrate dismissed the the defendant, ' complaint, thinking that the plaintiff had acted under a underTboni reasonable supposition of right within the meaning of the ^e auIelLu*' proviso contained in that section. No notice of action '^^'^ ^® **■ * tute, was en- had been given, and, on the trial, a nonsuit was con- ^^^ ^ notice of action under tended for on this ground. The learned judge refused <• 4i ; and , . . , , , that, in default to nonsuit; and in summing up he stated to the jury of notice, the that the plaintiff, having acted under a colour of right, mi'i^hrproperly was in the same situation as if he had actually had a find f^the^ right; but that the question, as to the point of notice, fhJ^^^'u^ht was, whether the defendant Caumeadaw had acted under t^at he had ^ acted bonft fide, (a) This caie waa argued and decided on April 20d), but has been poUponcd, in Oider that It might immediately precede Wedge t. Berkeley. X X 4 a bona * COWMBASOW. 662 CASES IN EASTER TERM 1837* a bona fide belief that he was proceeding in pursuance ""■^"^ of the statute ; for that, if he did so believe, he was Re»d agahut ^ entitled to notice ; and his Lordship left it to the jury, under the circumstances, whether Cammeaiam had en- tertained such bon& fide belief. The jury found for the defendants. Ludlam Serjt., in this term, moved for a new trial on the ground of misdirection. No notice was necessary, under sect. 41 of stat 7 & 8 G. 4. c. SO., because the act for which the plaintiff was arrested falls within an exception, in the proviso of sect. 24, which takes the case entirely out of the statute. [Patteson J. referred to Beechey v. Sides (a), and BaUinger v. Ferris (6).] In Beechey v. Sides (a) the act with which the defendant had charged the plaintiff fell within sect. 20 of stat. 7 & 8 G. 4. c. SO., which does not contain any proviso like that of sect. 24. [Coleridge J. You say that, if a party has arrested, supposing the case not to be within the exception of sect 24, and it is within it, he is not entitled to notice.] If the case is within the exception, the statute, as far as it regards notice, is as if it had not passed. [Coleridge J. Suppose, instead of the enact- ment and exception in sect. 24, it had been provided that any person committing damage, &c, not under a reason- able supposition of right, shall be liable to be apprehended, and to pay a fine if convicted : do you say that a person who apprehended another, supposing him liable under that clause, would not be entitled to notice 7] The clause requiring notice takes away a common law right, and its operation is not to be extended. (a) BB.iC. 806. (b) I Mee.^ W. 628. S. C Tymh. $ Gr. 9S0. IPaitesan IN THE Sevekth Year OP WILLIAM IV. 66S [Pattesofi J. It does not take away the right of action ; 18S7. it only makes notice a requisite.] — OffOtfUf Lord Denman C. J. Beechey v. Sides {a) is nearly Cowii«adow. in point; and the doctrine of Lord Tenterden there is decisive of this case. > There must be no rule. Patteson and Coleridge Js. concurred. Rule refused {b). (a) 9 J?, j- C 806. (6) See the next case. Wedge against The Honourable Maurice Monday, Frederick Fitzhardinge Berkeley. "^ nPRESPASS. The declaration contained counts, Under itat. 1. For assaulting plaintiff. 2. For taking from <.i.,amagi8- him a wheelbarrow and a sack of grass, &c. Plea, Not detaining Guilty. On the trial before LiUledaU J. at the Lewes f^^'ion of Summer assizes, 1835, the following facts appeared, ^/i^yj"!?' The defendant, a magistrate, met the plaintiff's son ^^ *!!j!^!^ in the day-time wheelini; a barrow of new-mown crrass. under a bonA J ^ o » fide belief Ujat in sacks. The defendant stopped the barrow, and asked he was exe- what the sacks contained. According to the defendant's aUhougb'it ib«' case, the plaintiff's son answered that it was no business ^^no reMon- of the defendant's; the son himself stated in evidence *^lpiS?;°*^ ^"^ that he immediately told the defendant what was in the ^7^ '*®°?, ^ fides, as well as sacks, and told him also that a Mrs. Reynolds had given ^« rewonable- the plaintiff leave to cut it in a particular .field. The tuspidon, is a question for defendant said that he believed it to be stolen property, the jury, and should seize it as such. The plaintiff came up piaintiffseeks during the conversation, and, according to the evidence iJ^" without baTing given notice, it lies on him to cause the question of bona fidei to be put to the jury. on Wsooi Bbbulbt. 604 CASES IN EASTER TERM 1887* on his behalf, stated again the manner in which tht grass had been obtained. The defendant had it wheeled/ away to his own premises; but afterwards, finding on inquiry that it had not been stolen, he offered it back. The plainti£P lived in the defendant's neigh- bourhood ; he was a labourer in husbandry and looked after a farm ; he had no land of his own. No notice of action was given under stat. 24 G. 2, c. 44. s* 1. The defendant's counsel submitted that, for want of such notice, the plaintiff must be nonsuited. The learned Judge thought that there should have been notice, but he refused to nonsuit, giving leave, however, to move for a nonsuit Evidence was then gone into for the defend- ant. Ldttledale J., in summing up, stated to the jury that, the defendant being a magistrate, if he had reason- able ground of suspicion that the property was stolen, he was entitled to a verdict; but the learned Judge added that he saw no ground for such suspicion ; leaving the question, however, with the jury. A verdict was given for the plaintiff on the count for an asportavit, damages, 5/. In the ensuing term a rule nisi was ob* tained for entering a nonsuit 7)imer now shewed cause. Notice of action is re- quisite, under stat. 24 G. 2. c. 44. s. 1., in those cases only where the action is brought against a justice *^ for any thing by him done in the execution of his o£Bce.'' The act here complained of was not so done. If a magistrate commits an error in a proceeding regularly before him, he is entitled to notice ; but, if he sets aside legal forms, and, under colour of his o£Bce, stops a person on the high road, and detains property as stolen, merely upon his own view, he is entitled only to the protec- tion. IN THE Sevekth Year OP WILLIAM IV. 665 WsMt iigamai tioD, which a oonstable enjoysi that, iF he has acted 1837* erroneously, he Bhill be excused on shewing reasonable ground of suspicion. The latitude given to a justice of peace, and to a constable, in this respect, is shewn in 3 Hawk. P. a 178. b. 2. c. 13. s. 13. (a), and 2 Hal^s P. C. 86, 87, 90. part 2. c. 11. (i). In Cook v. Leo- nard {c) Bayley J. says, ^^ If a magistrate act in a case which his general character authorises him to do, the mere excess of authority " does not deprive the " magis- trate of that protection which is conferred upon those who act in execution of it ; but where there is a total absence of authority to do any part of that which has been done, the party doing the act is not entitled to that protection." And he proceeds to cite several of the cases in which notice of action to a magistrate has been held necessary or unnecessary. Here the ground of protection fails ; for there was no reasonable cause of suspicion, as the finding of the jury shews. Jame$ v. Saunders {d)f where the magistrate was held not entitled to notice, is like the present case. ILMledale J. If the magistrate acted without reasonable cause, the plainti£P would be entitled to a verdict; but it may be a different question whether notice should not have been given* Patteson J. You do not distinguish between right to do the act, and right to notice.] If the magistrate Acts without reasonable cause, he puts himself in the situ- ation of any other individual, and must rest on such defence as the common law gives him. [Lord Den-^ man C. J. The observations of Alderson J. and Bosan^ quet J. in James v. Saunders {e) apply here ; for the (a) 7th ed. 1795. (b) £d. 1800. (c) SB.t a 353, 4. (rf) 10 JBing. 429. (e) 10 Bing. 431. learned 666 CASES IN EASTER TERM r8S7. learned Judge in the present case was not asked to "~" leave it to the jury whether or not the defendant acted against housL fide.] The defendant's conduct shewed that he could not be acting bona fide. Plait^ contrsu No question was raised on the bona fides : the defence was put on the ground of right. But, if the magistrate acts bon& fide in the plain execution of his duty, he is entitled to notice, even though the sus« picion on which he acted may not prove justifiable. The object of notice is that he may tender amends if he has acted on a groundless suspicion. According to the argument on the other side, notice is to be given only where the suspicion was not groundless. In Staight y. Gee {a) Lord Tenterden held that a constable making an arrest for felony without reasonable cause was within the protection of stat 21 J^. 1. c. 12. 5. 5., which directs that actions against constables, for any thing done by virtue or reason of their offices, shall be brought in the county where such fact was done. In Hopkins v. Craooe (&), where the defendant was held not entitled to notice of action under stat. 5 & 6 ^. 4. c. 59. 5. 19., it is clear that, if the party had been a constable or the owner of the horse which was injured, the Court would have considered it a proper enquiry whether he had acted bona fide, and would have deemed him entitled to notice if he had so acted. The defendant here was a magistrate, and would have been justified in detaining the grass if he had done so on reasonable ground of suspicion ; he thought that he had such ground, and that he was doing his duty as a magistrate. In Cook v. (o) S Stark, N. P. C. 445. (6) 4A.i;E. 774. Clark Bebkxlet. IN THE Seventh Year of WILLIAM IV. 667 Clark (a) an officer who had entered a house, with a idS7. warrant, for the purpose of taking a person named in it whom he bon& fide believed to be there, was held entitled _ against to notice of action under stat. 46 6. 3. c. 87, 5. 21, (local and personal, public, Southwark Court of Re- quests Act), though the party was not in the house when he entered. Lord Denman C. J. The defendant was entitled to notice of action if, when doing that which is complained of, he was acting " in the execution of his office,'* within stat. 24 G. 2. c. 44. s. 1. . If he had acted on a reason- able ground of suspicion that the property was stolen, he would have been entitled to a verdict ; and the case went to the jury on that question, and they found against him. Now the question is, whether he acted in the ex- ecution of his duty, so as to be entitled to notice ; and I think he did, if, with some evidence before him, he really thought that property had been stolen, and seized what he believed to be so. At the end of the plaintiflrs case the defendant's counsel moved for a nonsuit. It is clear that at that time the plaintiff did not rely upon the want of bona fides. Evidence was gone into for the defendant ; and the case went to the jury on the point as to reasonable suspicion. That, however, left open the question whether notice was necessary or not, which depends on the bona fides. If the plaintiff meant to say that the defendant acted in the execution of his office colourably, or to discharge an old grudge, or otherwise in bad faith, he should have required the learned Judge to put the question of bona fides to the jury; and, if they (a} 10 JBmg, 19. had 668 CASES IN EASTER TERM 1837. had found against the defendant on that point, I should «» Bay that notice would not have been necessary. But agaimt that course was not taken : and therefore the rule must BBBKzunr.
| 6,816 |
US-16235417-A_1
|
USPTO
|
Open Government
|
Public Domain
| 1,917 |
None
|
None
|
English
|
Spoken
| 977 | 1,345 |
Shoe-stretching tree.
V. BENEDETTL SHOE STRETCHING TREE. APPLICATION FILED APRJfi. i917.
I a VJ m 2 v WITNESSES 97 5 g/gkgqfi 220.9220 m a I y M M' Mk ATTORNEYS W v Eatented Aug. 21, 1917. l
VINCELNZE) BENEDETTI,
sncn-srnnrcnme TREE.
M Specification of Letters Patent.
Application filed April 16, 1917.
Lssmsrn To all whom it may concern:
Be it known that I, Vmonxzo BENEDETTI, a citizen of the United States, and a resident of lnlisznhe, in the county and fmprm'ed ShoeStretching Tree, of which i c following 3 full, clear, and exthe principal objects which the present lD PDtlOH has 111 view are: to provide a device for stretching the leg of a shoe without changing; the dimensions of the foot of the shoe; (to provide a device for stretchii'ig the leg and toe of a shoe sin'mltn-neously; and to provide an apparatus the character mentioned with. re mova'liie ports to adopt the some for a, vnriety of services.
Drawings.
.l igure 1. is a side elevation of a tree constructed and arranged in accordance with the present invention, the some being shown in inactive position in a shoe;
Fig. 2 is a sinnler view showing the same in activeposition;v
Fig, 3 is :1 cross section, the section being taken cs on the line 3-43 in Fig. 1;
Fight is a detail view showing the front end of a fragment or the tree.
Description.
As seen in the drawings, the leg portion of a tree when constructed and arranged in accordance with the present invention, consists of two half sections 9 end 10 parted vertically to form the leg, heel and instep of the tree. The sections 9 and 10 'are pivotelly connected by a hinge 11. As shmvn in the drawings, the hinge 11 is locuted on a line extending through the heel and instep 13 of the tree Adjacent the upper endsof the sections 9 and area screw-threaded thimble 14: and a plate 15. The threads of the thimble 14 operntively engage threads on a screw 16 while the end of the screw 16 bears against the fees of the plate 15. As shown in Fig.
of the drawings, when the screw winced, the tree sections 9 and 10 are forced apart, the end of the screw lo'heering on the plate 15,. The bell section 17 of the tree hassfeather 18, the sides whereof are undercut to fit a groove formed in the section 5) under the instep 13 thereof. The ball sec tion 15 is detechehly mounted on the sec- I of Bergen and ltntelot New Jersey, haveinvented a new ends of said tree 16 is admeans pivotally Patented Aug. Serial No. 162,354; 4
2i, ism.
tion 9, being free to slide thereunder. When i desired, any length orshape of ball section 17 may be adjusted to thetree section 9 or said section may be omitted. as whenit is desired to stretch the leg p01 ion only of the shoe. Each ball section 17 has at the rear thereof, a wearing plate 19. The plate 19 is inclined permanently attached to the low the hinge 11.
Having a'tree constructed and arranged as above descrihed and as shown in the accompenyin drawings, the operation is as follows; T e operator desiring'to stretch the length of a shoe and the upper thereof first adjusts the ball section section 9, the shoe in the manner shown in Fig section 10 bethe drawings. By manipulating the screw' 16, the upper ends of the sections 9 and 10 are spread apart as shown best in Fig. 2 of the drawings. In this operation the lower end of the section 10 swinging on the pivot 11, moves forward. In doing so the hall section 17 is pressed forward. It is obvious that if the ball section 17 is designed to stretch the hall section of the shoe in which this will be accomplished at the some time that the upper end or open ing of the leg section of the shoe is stretched by the tree sections 9 and 10. Thus the two operations will he performed at one and the some time.
OZaims,
1. A shoe-stretching tree comprising a plurality of tree sections, one having an in step portion and the other a heel portion; means pivotally connecting said sections at a point in line with said instep and heel portions; means for separating the upper sections; and it too portion for said tree adapted for disposition in serv ice in sliding relation to the section having the instep portion and adapted for Inent toward the toe of the shoe by the section having the heel portion. 2. A shoe-stretching tree comprising a plurality of tree sections, one having an instep portion endthe other a heel portion; connecting said sections at a point in line ends of said tree sections; a toe portion for said tree adopted for disposition ITl'SGXVlCG in sliding relatmn to the section having the to correspond with a plate 20" movewith said instep and heel- 'portions; means for separating the upper 17 of the tree and then introduces the tree into ends of sa-id tree sections; a toe portion for a step instep portion and adapted for movement toward the toe of the shoe-by the section having the heel portion; and means operatively connecting said toe portion'and instep portion.
3. A shoe-stretching tree comprising a plurality of tree sections, one having an inportion and the other a heel portion; means pivotally connecting said sections at a point in line with said instep ortions; means'for separating the upper and heel for disposition in service said tree adapted to the in sliding relation toward the toe of the shoe by the sect on having the heel portion; and ineansflopjelrsection having the instep portion and adapted. for movement/ 5 atively connectingsaid toe portion 'ahdm- I VINGENZO BENEDETTI.
| 31,157 |
https://github.com/tychoandreakos/SURVEY-STMIK-AMIK-BANDUNG/blob/master/src/Components/Dashboard/SurveyForm/Form/QuestionAnsweredForm/MultiChoiceWrapper/index.js
|
Github Open Source
|
Open Source
|
MIT
| null |
SURVEY-STMIK-AMIK-BANDUNG
|
tychoandreakos
|
JavaScript
|
Code
| 432 | 1,520 |
import React, { useEffect, useCallback, useState } from "react";
import MultiChoiceV2 from "../../../Form/MultiChoiceV2";
import { v4 as uuid } from "uuid";
import { connect } from "react-redux";
import {
setMultichoiceID,
setMultichoiceInputstate,
setEditMultiChoice,
} from "../../../../../../Store/redux/action";
import { MULTICHOICE } from "../../../../../../util/varTypes";
const MultiChoiceWrapper = (props) => {
const {
inputState,
multiChoiceId,
setId,
setInput,
editResult,
editData,
setEditData,
} = props;
const [canRemoveDisabled, setCanRemoveDisabled] = useState(true);
const memoizedCallback = useCallback(() => {
let initialize = [];
if (editResult && editResult.index && editResult.data) {
for (const item of editResult.data) {
initialize = [...initialize, item._id];
}
} else {
initialize = [uuid()];
}
setId(initialize);
setInput([]);
}, [setId, setInput, editResult]);
const editDataCallback = useCallback(() => {
if (editResult && editResult.index) {
setEditData(editResult);
}
}, [editResult, setEditData]);
useEffect(() => {
editDataCallback();
}, [editDataCallback]);
useEffect(() => {
memoizedCallback();
}, [memoizedCallback]);
useEffect(() => {
if (multiChoiceId.length <= 1) {
setCanRemoveDisabled(true);
}
if (multiChoiceId.length >= 2) {
setCanRemoveDisabled(false);
}
}, [multiChoiceId]);
const inputStateHandler = (val, _id) => {
const data = [
{
...inputState[0],
[_id]: {
...val,
},
},
];
setInput(data);
};
const editStateHandler = (val, _id) => {
const newData = editData.data.map((item) => {
if (item._id === val._id) {
item = {
...item,
title: val.title,
selected: val.selected,
};
}
return item;
});
if (editData.data.find((item) => item._id !== val._id)) {
newData.push(val);
}
setEditData({
...editData,
data: newData,
});
};
const addNewMultiChoice = (_id) => {
const index = multiChoiceId.findIndex((id) => id === _id);
const newArray = Array.from(multiChoiceId);
const start = index + 1;
if (newArray[start] !== undefined) {
for (let i = newArray.length; i > index; i--)
newArray[i] = newArray[i - 1];
newArray[start] = uuid();
} else {
newArray.push(uuid());
}
setId(newArray);
};
const removeNewMultiChoise = (_id) => {
if (multiChoiceId.length > 1) {
const newArr = multiChoiceId.filter((id) => id !== _id);
setId(newArr);
}
};
const findResultDataID = (id) => {
const item = editData.data.find((item) => item._id === id);
return item ? item._id : id;
};
const findResultDataTitle = (id) => {
const item = editData.data.find((item) => item._id === id);
return item ? item.title : "";
};
let multiChoiceEL;
if (multiChoiceId && editData && editData.data) {
multiChoiceEL = multiChoiceId.map((id) => (
<MultiChoiceV2
key={findResultDataID(id)}
_id={findResultDataID(id)}
parentId={editData._id}
title={findResultDataTitle(id)}
canRemoveDisabled={canRemoveDisabled}
removeNewMultiChoise={removeNewMultiChoise}
addNewMultiChoice={addNewMultiChoice}
editStateHandler={editStateHandler}
edit={true}
/>
));
} else {
multiChoiceEL = multiChoiceId.map((id) => (
<MultiChoiceV2
key={id}
_id={id}
canRemoveDisabled={canRemoveDisabled}
removeNewMultiChoise={removeNewMultiChoise}
addNewMultiChoice={addNewMultiChoice}
inputStateHandler={inputStateHandler}
edit={false}
/>
));
}
return <>{multiChoiceEL}</>;
};
const mapStateToProps = (state) => {
return {
inputState: state[MULTICHOICE.SELF][MULTICHOICE.INPUTSTATE],
multiChoiceId: state[MULTICHOICE.SELF][MULTICHOICE.MULTICHOICEID],
editData: state[MULTICHOICE.SELF][MULTICHOICE.EDITMULTICHOICE],
};
};
const mapDispatchToProps = (dispatch) => {
return {
setId: (id) => dispatch(setMultichoiceID(id)),
setInput: (item) => dispatch(setMultichoiceInputstate(item)),
setEditData: (item) => dispatch(setEditMultiChoice(item)),
};
};
const MultiChoiceWrapperJoinRedux = connect(
mapStateToProps,
mapDispatchToProps
)(MultiChoiceWrapper);
export default MultiChoiceWrapperJoinRedux;
| 39,682 |
https://github.com/anshsarkar/TailBench/blob/master/moses/misc/processPhraseTable.cpp
|
Github Open Source
|
Open Source
|
MIT
| 2,022 |
TailBench
|
anshsarkar
|
C++
|
Code
| 444 | 2,153 |
#include <iostream>
//#include <fstream>
#include <sstream>
#include <vector>
#include <string>
#include <iterator>
#include <functional>
#include <sys/stat.h>
#include "moses/TypeDef.h"
#include "moses/ConfusionNet.h"
#include "moses/FactorCollection.h"
#include "moses/Phrase.h"
#include "moses/InputFileStream.h"
#include "moses/Timer.h"
#include "moses/TranslationModel/PhraseDictionaryTree.h"
using namespace std;
using namespace Moses;
Timer timer;
template<typename T>
std::ostream& operator<<(std::ostream& out,const std::vector<T>& x)
{
out<<x.size()<<" ";
typename std::vector<T>::const_iterator iend=x.end();
for(typename std::vector<T>::const_iterator i=x.begin(); i!=iend; ++i)
out<<*i<<' ';
return out;
}
inline bool existsFile(const char* filename)
{
struct stat mystat;
return (stat(filename,&mystat)==0);
}
inline bool existsFile(const std::string& filename)
{
return existsFile(filename.c_str());
}
int main(int argc,char **argv)
{
std::string fto;
size_t noScoreComponent=5;
int cn=0;
bool aligninfo=true;
std::vector<std::pair<std::string,std::pair<char*,char*> > > ftts;
int verb=0;
for(int i=1; i<argc; ++i) {
std::string s(argv[i]);
if(s=="-ttable") {
std::pair<char*,char*> p;
p.first=argv[++i];
p.second=argv[++i];
ftts.push_back(std::make_pair(std::string(argv[++i]),p));
} else if(s=="-nscores") noScoreComponent=atoi(argv[++i]);
else if(s=="-out") fto=std::string(argv[++i]);
else if(s=="-cn") cn=1;
else if(s=="-irst") cn=2;
else if(s=="-no-alignment-info") aligninfo=false;
else if(s=="-v") verb=atoi(argv[++i]);
else if(s=="-h") {
std::cerr<<"usage "<<argv[0]<<" :\n\n"
"options:\n"
"\t-ttable int int string -- translation table file, use '-' for stdin\n"
"\t-out string -- output file name prefix for binary ttable\n"
"\t-nscores int -- number of scores in ttable\n"
"\t-no-alignment-info -- omit alignment info from the binary ttable \n"
"\nfunctions:\n"
"\t - convert ascii ttable in binary format\n"
"\t - if ttable is not read from stdin:\n"
"\t treat each line as source phrase an print tgt candidates\n"
"\n";
return 1;
} else {
std::cerr<<"ERROR: unknown option '"<<s<<"'\n";
return 1;
}
}
if(ftts.size()) {
if(ftts.size()==1) {
std::cerr<<"processing ptree for ";
PhraseDictionaryTree pdt(noScoreComponent);
pdt.PrintWordAlignment(aligninfo);
if (ftts[0].first=="-") {
std::cerr<< "stdin\n";
pdt.Create(std::cin,fto);
} else {
std::cerr<< ftts[0].first << "\n";
InputFileStream in(ftts[0].first);
pdt.Create(in,fto);
}
} else {
#if 0
std::vector<PhraseDictionaryTree const*> pdicts;
std::vector<FactorType> factorOrder;
for(size_t i=0; i<ftts.size(); ++i) {
PhraseDictionaryTree *pdtptr=new PhraseDictionaryTree(noScoreComponent,
&factorCollection,
getFactorType(atoi(ftts[i].second.first)),
getFactorType(atoi(ftts[i].second.second))
);
factorOrder.push_back(pdtptr->GetInputFactorType());
PhraseDictionaryTree &pdt=*pdtptr;
pdicts.push_back(pdtptr);
std::string facStr="."+std::string(ftts[i].second.first)+"-"+std::string(ftts[i].second.second);
std::string prefix=ftts[i].first+facStr;
if(!existsFile(prefix+".binphr.idx")) {
std::cerr<<"bin ttable does not exist -> create it\n";
InputFileStream in(prefix);
pdt.Create(in,prefix);
}
std::cerr<<"reading bin ttable\n";
pdt.Read(prefix);
}
std::cerr<<"processing stdin\n";
if(!cn) {
std::string line;
while(getline(std::cin,line)) {
std::istringstream is(line);
#if 0
std::vector<std::string> f;
std::copy(std::istream_iterator<std::string>(is),
std::istream_iterator<std::string>(),
std::back_inserter(f));
#endif
std::cerr<<"got source phrase '"<<line<<"'\n";
Phrase F(Input);
F.CreateFromString(factorOrder,line,factorCollection);
for(size_t k=0; k<pdicts.size(); ++k) {
PhraseDictionaryTree const& pdt=*pdicts[k];
std::vector<std::string> f(F.GetSize());
for(size_t i=0; i<F.GetSize(); ++i)
f[i]=F.GetFactor(i,pdt.GetInputFactorType())->ToString();
std::stringstream iostA,iostB;
std::cerr<<"full phrase processing "<<f<<"\n";
pdt.PrintTargetCandidates(f,iostA);
std::cerr<<"processing with prefix ptr\n";
PhraseDictionaryTree::PrefixPtr p(pdt.GetRoot());
for(size_t i=0; i<f.size() && p; ++i) {
std::cerr<<"pre "<<i<<" "<<(p?"1":"0")<<"\n";
p=pdt.Extend(p,f[i]);
std::cerr<<"post "<<i<<" "<<(p?"1":"0")<<"\n";
}
if(p) {
std::cerr<<"retrieving candidates from prefix ptr\n";
pdt.PrintTargetCandidates(p,iostB);
} else {
std::cerr<<"final ptr is invalid\n";
iostB<<"there are 0 target candidates\n";
}
if(iostA.str() != iostB.str())
std::cerr<<"ERROR: translation candidates mismatch '"<<iostA.str()<<"' and for prefix pointer: '"<<iostB.str()<<"'\n";
std::cerr<<"translation candidates:\n"<<iostA.str()<<"\n";
pdt.FreeMemory();
}
}
} else {
// process confusion net input
ConfusionNet net(&factorCollection);
std::vector<std::vector<float> > weights;
for(size_t i=0; i<pdicts.size(); ++i)
weights.push_back(std::vector<float>(noScoreComponent,1/(1.0*noScoreComponent)));
while(net.ReadF(std::cin,factorOrder,cn-1)) {
net.Print(std::cerr);
GenerateCandidates(net,pdicts,weights,verb);
}
}
#else
std::cerr<<"ERROR: these functions are currently broken...\n";
exit(1);
#endif
}
}
}
| 47,462 |
https://www.wikidata.org/wiki/Q113354175
|
Wikidata
|
Semantic data
|
CC0
| null |
Stanley Moetoer
|
None
|
Multilingual
|
Semantic data
| 117 | 304 |
Stanley Moetoer
Surinaams dammer
Stanley Moetoer is een mens
Stanley Moetoer sekse of geslacht mannelijk
Stanley Moetoer beroep dammer
Stanley Moetoer voornaam Stanley
Stanley Moetoer land van nationaliteit Suriname
Stanley Moetoer familienaam Moetoer
Stanley Moetoer sport dammen
Stanley Moetoer Google Knowledge Graph-identificatiecode /g/11t7jj413g
Stanley Moetoer
Stanley Moetoer instance of human
Stanley Moetoer sex or gender male
Stanley Moetoer occupation draughts player
Stanley Moetoer given name Stanley
Stanley Moetoer country of citizenship Suriname
Stanley Moetoer family name Moetoer
Stanley Moetoer sport checkers
Stanley Moetoer Google Knowledge Graph ID /g/11t7jj413g
Stanley Moetoer
Stanley Moetoer instancia de humanu
Stanley Moetoer sexu masculín
Stanley Moetoer nome Stanley
Stanley Moetoer país de nacionalidá Surinam
Stanley Moetoer apellíu Moetoer
Stanley Moetoer deporte dames
| 995 |
https://github.com/hisuley/gds/blob/master/trunk/foundation/module_order.php
|
Github Open Source
|
Open Source
|
MIT
| 2,014 |
gds
|
hisuley
|
PHP
|
Code
| 790 | 2,931 |
<?php
if (!$IWEB_SHOP_IN) {
die('Hacking attempt');
}
function insert_order_info(&$dbo, $table, $insert_items)
{
$item_sql = get_insert_item($insert_items);
$sql = "insert into `$table` $item_sql ";
//echo $sql;
return $dbo->exeUpdate($sql);
//exit;
//echo mysql_insert_id();
//return mysql_insert_id();
}
function get_order_info(&$dbo, $table, $t_order_goods, $t_goods, $t_shop_info, $order_id, $user_id = 0, $shop_id = 0)
{
$sql = "select * from `$table` where order_id='$order_id' ";
if ($user_id) {
$sql .= " and user_id='$user_id'";
}
if ($shop_id) {
$sql .= " and shop_id='$shop_id'";
}
$v = $dbo->getRow($sql);
if (!$v) {
return false;
}
$sql = "select og.goods_id,og.goods_price,og.order_num,og.goods_name,og.id,
b.goods_thumb,c.user_id,c.shop_name from `$t_goods` as b,
`$t_shop_info` as c,`$t_order_goods` AS og where og.goods_id=b.goods_id AND og.order_id='{$v['order_id']}'AND c.shop_id='{$v['shop_id']}'";
$list = $dbo->getRs($sql);
$v['order_goods'] = $list;
return $v;
}
function get_order_info_bypayid(&$dbo, $table, $payid)
{
$sql = "select * from `$table` where payid='$payid' ";
// if($user_id) {
// $sql .= " and user_id='$user_id'";
// }
// echo $sql;
return $dbo->getRow($sql);
}
function get_order_info_by_order_id(&$dbo, $table, $order_id)
{
$sql = "select * from `$table` where order_id='$order_id' ";
return $dbo->getRow($sql);
}
function get_order_info_orderstatus(&$dbo, $table)
{
$sql = "select * from `$table` where order_status='1'";
// echo $sql;
return $dbo->getRow($sql);
}
function get_order_info_list(&$dbo, $table)
{
$sql = "select * from $table";
// echo $sql;
return $dbo->getRs($sql);
}
function upd_order_info(&$dbo, $table, $update_items, $order_id)
{
$item_sql = get_update_item($update_items);
$sql = "update `$table` set $item_sql where order_id='$order_id'";
// echo $sql;
return $dbo->exeUpdate($sql);
}
/* 收到的订单 */
function get_myoder_list(&$dbo, $t_order_info, $t_order_goods, $t_goods, $t_shop_info, $id, $page, $type, $state, $t_users)
{
$list = array();
if ($type == 'shop') {
$str = "";
if (!empty($state)) {
switch ($state) {
case 1:
$str .= " and order_status=1 ";
break;
case 2:
$str .= " and order_status=2 ";
break;
case 3:
$str .= " and pay_status=0 ";
break;
case 4:
$str .= " and pay_status=1 ";
break;
case 5:
$str .= " and transport_status=0 ";
break;
case 6:
$str .= " and transport_status=1 ";
break;
case 7:
$str .= " and order_status=3 ";
break;
case 8:
$str .= " and transport_status=0 and pay_status=1 ";
break;
case 9:
$str .= " and order_status=3 and seller_reply='0' ";
break;
}
}
$sql = "SELECT * FROM $t_order_info WHERE shop_id='$id' " . $str . " ORDER BY order_time DESC";
$list = $dbo->fetch_page($sql, $page);
foreach ($list['result'] as $k => $v) {
$sql = "select og.order_id,og.goods_id,b.goods_thumb,og.id,b.lock_flg,c.user_id,c.shop_name,b.goods_name,c.shop_id from `$t_goods` as b, `$t_shop_info` as c,`$t_order_goods` AS og where og.order_id='{$v['order_id']}' and og.goods_id=b.goods_id and c.shop_id='{$v['shop_id']}'";
$rs = $dbo->getRs($sql);
$list['result'][$k]['order_goods'] = $rs;
$sql = "SELECT user_name FROM $t_users WHERE user_id='{$v['user_id']}'";
$rs = $dbo->getRs($sql);
$list['result'][$k]['dname'] = $rs[0];
}
} else if ($type == 'groupbuy') {
$sql = "SELECT * FROM $t_order_info WHERE group_id='$id' ORDER BY order_time DESC";
$list = $dbo->fetch_page($sql, $page);
foreach ($list['result'] as $k => $v) {
$sql = "select og.order_id,og.goods_id,b.goods_thumb,og.id,b.lock_flg,c.user_id,c.shop_name,b.goods_name,c.shop_id from `$t_order_goods` as og, `$t_goods` as b, `$t_shop_info` as c where og.order_id='{$v['order_id']}' and og.goods_id=b.goods_id and c.shop_id='{$v['shop_id']}'";
$rs = $dbo->getRs($sql);
$list['result'][$k]['order_goods'] = $rs;
$sql = "SELECT user_name FROM $t_users WHERE user_id='{$v['user_id']}'";
$rs = $dbo->getRs($sql);
$list['result'][$k]['dname'] = $rs[0];
}
}
return $list;
}
/* 收到的订单 */
function get_myoder_list_with_search(&$dbo, $t_order_info, $t_order_goods, $t_goods, $t_shop_info, $id, $page, $type, $state, $t_users, $start_time = '', $end_time = '', $order_id = '')
{
$list = array();
if ($type == 'shop') {
$str = "";
if (is_numeric($order_id) && $order_id != 0) {
$str .= " and payid = " . $order_id;
}
if (!empty($start_time)) {
$str .= " and order_time >= '$start_time' ";
}
if (!empty($end_time)) {
$str .= " and order_time <= '$end_time' ";
}
if (!empty($state)) {
switch ($state) {
case 1:
$str .= " and order_status=1 ";
break;
case 2:
$str .= " and order_status=2 ";
break;
case 3:
$str .= " and pay_status=0 ";
break;
case 4:
$str .= " and pay_status=1 ";
break;
case 5:
$str .= " and transport_status=0 ";
break;
case 6:
$str .= " and transport_status=1 ";
break;
case 7:
$str .= " and order_status=3 ";
break;
case 8:
$str .= " and transport_status=0 and pay_status=1 ";
break;
case 9:
$str .= " and order_status=3 and seller_reply='0' ";
break;
}
}
$sql = "SELECT * FROM $t_order_info WHERE shop_id='$id' " . $str . " ORDER BY order_time DESC";
$list = $dbo->fetch_page($sql, $page);
foreach ($list['result'] as $k => $v) {
$sql = "select og.order_id,og.goods_id,b.goods_thumb,og.id,b.lock_flg,c.user_id,c.shop_name,b.goods_name,c.shop_id from `$t_goods` as b, `$t_shop_info` as c,`$t_order_goods` AS og where og.order_id='{$v['order_id']}' and og.goods_id=b.goods_id and c.shop_id='{$v['shop_id']}'";
$rs = $dbo->getRs($sql);
$list['result'][$k]['order_goods'] = $rs;
$sql = "SELECT user_name FROM $t_users WHERE user_id='{$v['user_id']}'";
$rs = $dbo->getRs($sql);
$list['result'][$k]['dname'] = $rs[0];
}
} else if ($type == 'groupbuy') {
$sql = "SELECT * FROM $t_order_info WHERE group_id='$id' ORDER BY order_time DESC";
$list = $dbo->fetch_page($sql, $page);
foreach ($list['result'] as $k => $v) {
$sql = "select og.order_id,og.goods_id,b.goods_thumb,og.id,b.lock_flg,c.user_id,c.shop_name,b.goods_name,c.shop_id from `$t_order_goods` as og, `$t_goods` as b, `$t_shop_info` as c where og.order_id='{$v['order_id']}' and og.goods_id=b.goods_id and c.shop_id='{$v['shop_id']}'";
$rs = $dbo->getRs($sql);
$list['result'][$k]['order_goods'] = $rs;
$sql = "SELECT user_name FROM $t_users WHERE user_id='{$v['user_id']}'";
$rs = $dbo->getRs($sql);
$list['result'][$k]['dname'] = $rs[0];
}
}
return $list;
}
?>
| 31,129 |
https://github.com/megahertz0/android_thunder/blob/master/dex_src/com/xiaomi/channel/commonutils/android/e.java
|
Github Open Source
|
Open Source
|
MIT
| 2,021 |
android_thunder
|
megahertz0
|
Java
|
Code
| 83 | 249 |
package com.xiaomi.channel.commonutils.android;
import android.os.Environment;
import java.io.File;
import java.io.FileInputStream;
import java.util.Properties;
public class e {
private static Boolean a;
public static synchronized boolean a() {
boolean z = false;
synchronized (e.class) {
if (a == null) {
try {
Properties properties = new Properties();
properties.load(new FileInputStream(new File(Environment.getRootDirectory(), "build.prop")));
if (!(properties.getProperty("ro.miui.ui.version.code", null) == null && properties.getProperty("ro.miui.ui.version.name", null) == null)) {
z = true;
}
a = Boolean.valueOf(z);
} catch (Throwable th) {
a = Boolean.valueOf(false);
}
}
z = a.booleanValue();
}
return z;
}
}
| 8,948 |
https://github.com/joegoldin/jak-project/blob/master/goal_src/levels/village2/assistant-village2.gc
|
Github Open Source
|
Open Source
|
ISC
| 2,021 |
jak-project
|
joegoldin
|
Common Lisp
|
Code
| 15 | 51 |
;;-*-Lisp-*-
(in-package goal)
;; name: assistant-village2.gc
;; name in dgo: assistant-village2
;; dgos: L1, VI2
| 19,630 |
https://stackoverflow.com/questions/10149111
|
StackExchange
|
Open Web
|
CC-By-SA
| 2,012 |
Stack Exchange
|
JuneL, Pooja Garg, Shaji, https://stackoverflow.com/users/23264654, https://stackoverflow.com/users/23264655, https://stackoverflow.com/users/23264656, https://stackoverflow.com/users/23298813, larizinha
|
English
|
Spoken
| 516 | 733 |
Executing nested loops+foreach+csh
It's been a while since I used csh formatting and I am having a little bit of trouble with a few things. Things seem so much easier to execute in Matlab, however I need to do this on the terminal because of the programs I am trying to interact with.
So here's what I want to do: I have a file del.txt that is structured like this
1
2
3
4
etc. So each value is in it's own row and there's one column for all the data. I have a bunch of other files that are within my directory. I want to match up say value 1 (which in this case is 1) with file 1 and value 2 with file 2, etc and so on and so forth. So here's what I did...
Code:
!/bin/csh
foreach a (cat del.txt)
foreach sta(ls *.HHZ)
echo a is $a
echo $sta
cat <<END>>macro.m
r $a
r $sta
END
sac macro.m
rm macro.m
end
end
However what I achieve is that it loops through all of the values in del.txt and each file and then moves on to the next file within my directory and loops through all of the values. I'm having trouble figuring out the format that this should be in to match up the correct values. I'm not doing much within the script yet until I can get them to match up. Please help Can someone tell me what I'm doing wrong? I read that the foreach command will execute all the commands on each file..but haven't been able to find a way to get around this. What I want it to do is take value 1 from del.txt and match it up with file 1 (sta) from the directory finish the loop, then take value 2 from del.txt and match it up with file 2 from the directory (sta). I've never done more than just simple iterations with csh on one subset of files, and I am not sure how to reference the values to one another. Any help would be greatly appreciated. I haven't found a simple way to do this without writing everything out. I looked at the 'for' and 'while' commands..if there is a simple way to do it I'm not seeing it.
Cheers,
K
IF I am understanding correctly, You have a txt file will list of strings and you want it to match with the files.
I am assuming by this particular statement of yours:
I want to match up say value 1 (which in this case is 1) with file 1
You mean to match the string at 1 with file name of file 1.
Here's a possible solution based on this assumption(this will help you anyway with loop):
#Store value in file.txt in a array
set file_var = `cat file.txt`
#Store file list in my_dir in a var
set my_dir = <your dir path>
set file_list_var = `ls $my_dir`
#Let's print "file Match: for every match
foreach var1 ($file_var)
foreach var2 ($file_list_var)
if("$var1" == "$var2") echo $var1 = $var2 : Match Found.
endif
endif
| 37,423 |
2QVTZTM66HMN73S6HVUDROQTHF46X3ZV_1
|
German-PD-Newspapers
|
Open Culture
|
Public Domain
| 1,935 |
None
|
None
|
German
|
Spoken
| 11,314 | 19,474 |
III Wir Jch ſter. ein⸗ ſoll paar gern tlich zanz nem I ſie und inge ange en ! “ eicht eicht t zu nter eda⸗ igen ſich , erm Be⸗ eres gut heit , da Art ge⸗ für ge⸗ und nen icht. ehe , wir r ab⸗ tige ein , geb ' ine ? “ ara du ann ös⸗ ußt Ge⸗ ein dir ühl chi , inn ün - ⸗ nun ine ts ! ja mit var ell⸗ gt. ) ote⸗ net ingt die nen keit den ner eim es uche ne⸗ eſes nen cht , des zäl⸗ und das das den 7 Mitteldeutschland 2 ⸗ / Allgemeine Zeitung für Mitteldeutſchland. Halleſche Neueſte Nachrichten ⸗ Halleſche Zeitung , Landeszeitung für Sachſen , Anhaltu. Thüringen m 69. Jahrgang / r. 89 Die außerordentliche Tagung des Völker⸗ bundsrates hat heute vormittag 11 Uhr mit einer geheimen Sitzung begonnen , in der die Tagesordnung feſtgelegt wurde. Eine öffent - liche Sitzung wird ſich anſchließen. Die zu der Tagung erwarteten Vertreter ſind in Genf eingetroffen. Unter den Dele - gierten fand bereits geſtern eine Reihe von Beſprechungen ſtatt , die ſich insbeſondere auf die Ergebniſſe der Konferenz von Streſa und auf die Ratstagung bezog. Beſonders Beneſch und Titulescu haben eine große Tätigkeit ent - faltet. Frankreichs „ Anklage “ Die franzöſiſche Denkſchrift an den Völkerbundsrat hat folgenden Wortlaut : 1. Am 16. März hat der deutſche Reichskanzler die Berliner Botſchafter der europäiſchen Mächte zu ſich gerufen , um ihnen vom Wort - laut eines Geſetzes Kenntnis zu geben , das in Deutſchland die allgemeine Wehrpflicht wiederherſtellt und das eine neue Einteilung der Armee in zwölf Armeekorps und in 36 Diviſionen vorſieht. An demſelben Tage trat das Geſetz in Kraft. Dieſer Maßnahme war ſchon am 9. März die offizielle Ankündigung der Wiedererrichtung einer deutſchen Militärluftfahrt vor - ausgegangen. Jn zwei ihrer wichtigſten Be⸗ ſtimmungen ſind ſomit die Klauſeln des Frie⸗ densvertrgges formell zurückgeſtoßen ſrépudie ) worden. Es iſt dies die Krönung ſconsécration ) langer und methodiſch im ge⸗ heimen verfolgter Anſtrengungen. Es iſt dies der Beweis der Bedeutung der in Deutſchland bereits vollbrachten Aufrüſtung , ganz abge⸗ ſehen von dem Plan , deſſen Vollbringung weiter verfolgt wird. Es iſt dies nicht nur die Verkündigung einer Politik. Dieſe iſt ſchon zur Tatſache geworden. Vor einem Jahre hat das Anwachſen des durch das Reich für das Jahr 1934/35 vor⸗ geſehenen Militärbudgets Europa bewegt , und die franzöſiſche Regierung hatte in dieſen vor⸗ ausſichtlichen Angaben ( die übrigens ſpäter weit überſchritten worden ſind ) eine Andeu - tung geſehen für den Entſchluß der deutſchen Regierung , ihre Aufrüſtung in Grenzen zu verfolgen , deren Richter ſie ſelbſt ſein wollte. Die Behörden des Reiches erhoben Proteſt gegen eine ſolche Auslegung. Jn einer Note , die der Außenminiſter des Reiches dem engli - ſchen Geſandten in Berlin am 11. April über⸗ mittelt hat , wird das Anwachſen der Ausgaben durch die Notwendigkeit gerechtfertigt , die Vorbereitungen für die Umwandlung in eine Milizarmee mit kurzer Dienſtzeit weiter zu verfolgen , und es wurde Einſpruch dagegen erhoben , daß der Haushalt des Luft - fahrt miniſteriums als Rüſtungshaus - halt angeſehen werden könne. Einige Tage ſpäter , am 27. April , ſprach dieſer ſein „ Er - ſtaunen “ darüber aus , daß man ſich ernſtlich über den Luftfahrthaushalt beunruhigen könne , deſſen Ausgaben nur dazu dienen ſollten , die Bevölkerung gegen die Luftangriffe zu ſchützen und die Zivilluftfahrt zu reorganiſieren. Noch am 20. Dezember beſtritt der Luftfahrtminiſter , daß das Reich mehr als einige Verſuchsappa⸗ xate beſitze. Drei Monate ſind ſeither ver⸗ richen , und der Reichskanzler Hitler iſt in der Lage , den britiſchen Staatsſekretär davon zu unterrichten , daß das Reich auf dem Ge - biete der Luftfahrt bereits die Gleichheit mit England erreicht habe. Es wird erlaubt ſein , feſtzuſtellen , daß , um zu einem ſolchen Ergebnis zu gelangen , eine Anſtrengung von einigen Wochen , fa — von einigen Monaten nicht genügt hätte. De⸗ mentis und Erklärungen erhalten daher ihren wahren Wert , und die Beſtrebungen , die ſie enthüllen , ihre wahre Bedeutung. „ Die Verletzung offenſichklich “. 2. Die Jnitiativen , an die hier erinnert worden iſt , ſind ein formeller Bruch der rn Klauſeln des Teils V des Verfatller Vertrags und der ſpäter über ihre Anwendung zwiſchen der deutſchen Regierung und den Regierungen der hauptſächlichſten alliierten Mächte auf der Botſchafterkonferenz abgeſchloſſenen Abkom⸗ men. An dem ſoſtematiſchen ebertreten die - ſer Vertragsartikel war ſchon lange kein Zweifel mehr erlaubt ; aber dieſe Ueber⸗ ſchreitungen waren ſo gut wie möglich ver⸗ Brauhausſtr. 16/17. - Fernr. 27431. Tel. - Adr. : Saale⸗ zeitung. Jm Falle höherer Gewalt ( Betriebsſtörung ) , Schriſtleitung , Verlag u. Druckeren. Halle (. ) , Groß⸗ beſteht kein Anſpruch auf Lieferung od. Rückvergütung borgen. Heute iſt die Verletzung offenſichtlich. Sie wird nicht beſtritten. Der Völkerbund hat die Aufgabe , ſich damit zu befaſſen. Der Völkerbund , der auf Achtung der internatio - nalen Verpflichtungen begründet und Wächter eines Paktes iſt , deſſen Präambel anerkennt , daß die Staaten , die „ die Zuſammenarbeit zwiſchen den Nationen entwickeln wollen “ und „ ihnen den Frieden und die Sicherheit garan - tieren wollen “ , „ gewiſſenhaft alle Verpflich - tungen der Verträge in den gegenſeitigen Be - ziehungen zwiſchen den organiſierten Völkern anerkennen “ müſſen , kann nicht gleichgültig bleiben bei der Behauptung einer politiſchen Methode , die direkt den Grundſätzen , auf welchen ſie beruht , und dem Zweck , den er ſich geſteckt , zuwider läuft. Deutſchland „ gefährdet ' die Abrüſtung 4. Jndem ſie das tut , hat die Regierung des Reiches den Erfolg der internationalen Verhandlungen über die Be ſchränkung der Rüſtungen , die unter den Auſpizien des Völkerbundes begründet auf Art. 8. des Völkerbundspaktes , vor ſich gehen , ernſtlich gefährdet , obſchon die Mächte viele Beweiſe ihres Willens , den Beſtimmungen dieſes Ar - tikels zu entſprechen , gegeben hatten. Was die franzöſiſche Regierung anbelangt , ſo müſſe ſie daran erinnern , daß ſie von 1921 bis 1928 die Dienſtzeit in Frankreich von drei Jahren auf ein Jahr herabgeſetzt habe , daß die für die Verteidigung der Metropole ſofort verwend - baren Streitkräfte ſich infolgedeſſen je nach der in Betracht gezogenen Lage um 42 oder um 60 v. H. vermindert haben , daß die Ueberſee - armee ihrerſeits ebenfalls bedeutende Vermin - derungen erfahren habe und daß die Ausfüh - rung des Luftbauprogramms nur in ganz ſchwachem Maße fortgeſchritten ſei. Ohne Zweifel hatten ſich die Schwieri g - keiten , die ſich einem Erfolg der Genfer Konferenz entgegenſetzten , angehäuft. Aber das hat die deutſche Regierung nicht von ihren Verpflichtungen be⸗ freit. Auch wenn , was die franzöſiſche Re - gierung formell beſtreitet , die Präambel von Teil V den Charakter und die Tragweite hätten , die man ihr manchmal geben ſolle , bleibe nichts deſto weniger eine wichtige Tat - ⸗ ſache beſtehen : Welches auch die Schwierig - keiten in der Erfüllung einer Aufgabe ſeien , die die Maßnahmen der deutſchen Aufrüſtung noch heikler machen , ſo haben während der Zeit , wo die Konferenz ihre Verhandlungen weiter verfolgt habe , die Mächte es nicht auf⸗ Deutſchlands Beſchlüſſe vom 16. März Aber auch nach dieſer Geſte iſt die Arbeit nicht aufgegeben worden. Am 3. Februar d. J. wurde auf die Jnitiative der franzöſiſchen und der engliſchen Regierung hin ein Pro - gramm aufgeſtellt , das von allen dem Frieden dienenden Mächten mit Genugtuung aufge - nommen wurde. Dieſes Programm hatte ſelbſt die Reichsregierung angenommen. Jhre Be⸗ ſchlüſſe vom 16. März haben es indeſſen entſchieden gefährdet. Es wäre nutzlos , wollte ſie ſich auf die Maßnahmen berufen , die andere Regierungen ſich gezwungen ſahen , in ihrem eigenen Lande zu ergreifen , denn dieſe Maßnahmen wurden durch die Entwicklung der deutſchen Rüſtungen gerechtfertigt. Es wäre nutzlos , wollte ſie ſich beſonders auf die Maßnahmen der franzöſiſchen Regierung be⸗ rufen , die , um den ans dem Krieg hervor - gegangenen Schwierigkeiten der Rekrutierung zu begegnen , dieſe Maßnahme hinſichtlich der Dauer der Militärdienſtzeit ergreifen mußte , die ſchon vor fünf Jahren durch die Vor - bereitende Abrüſtungskonferenz als berechtigt anerkannt wurde. Deutſchland hat einem inkternatio - nalen Problem eine einſeitige Löſung geben wollen. Die Verhandlungs - methode hat es durch die Methode der voll⸗ endeten Tatſachen erſetzt. Jhre Be⸗ ſchlüſſe , die mit dem ganzen Syſtem der Rüſtungsbeſchränkung unvereinbar ſind , haben für gang Europa die Frage der allgemeinen Halle ( Saale ) , Monkag , 15. April 1935 Monatulicher ohne Zuſtellgebühr 3. Bei der Aufnahme Deutſchlands in den Völkerbund hat ſich die Ver - ſammlung ausdrücklich auf Teil V des Ver - trages berufen , um das Militär - , Marine - und Luftfahrtſtatut feſtzuſetzen , dem das Reich entſprechen müßte. Sie hat von einer Er - klärung Kenntnis genommen , nach welcher Deutſchland „ tatſächliche Garantien ſeiner auf - richtigen Abſicht , die Verpflichtungen , die aus den Verträgen und ihren Anhängern hervor - gehen , inne zu halten “ , gibt. Jndem die deutſche Regierung die Beſtimmungen , die ihr Militärſtatut regeln , für null und nichtig er - klärt , hat ſie mit Ueberlegung einen der Fak - toren zerſtört , auf denen ihre Mitarbeit an der Genfer Einrichtung begründet iſt. gegeben , die Grundlage für eine internationale Einigung zu ſuchen. Die franzöſiſche Regierung iſt es ſich ſchul - dig , an die Vorſchläge zu erinnern , die ſie ſchon am 5. Februar 1932 für die Begrenzung der Bombenflugzeuge und ihre Zurverfügung - ſtellung an den Völkerbund und für die Schaf⸗ fung einer internationalen Macht im Zu - ſammenhang mit der beſten Organiſation der Sicherheit gemacht hat. Sie erinnert weiter an die Vorſchläge , die ſie am 14. November desſelben Jahres im Hinblick auf die Her - ſtellung eines europäiſchen Syſtems der Rüſtungsverminderung und der internatio - nalen Zuſammenarbeit gemacht hat. Sie er - innert an die Erklärung vom 11. Dezember 1932 , die die Gewährung der Gleichberechti - gung unlösbar an die Herſtellung eines Sicherheitsſyſtems bindet. Sie erinnert ſchließ - lich daran , daß im Oktober 1933 in einer Stunde , wo die internationale Lage ſich be⸗ reits zu verdunkeln begann aus Gründen , für die Frankreich keinerlei Verantwortung trägt , die franzöſiſche Regierung mit mehreren an⸗ deren Regierungen dahin übereingekommen war , ein Arbeitsprogramm vorzuſchlagen , das es der Genfer Konferenz erlaubt hätte , nütz⸗ liche und wirkſame Arbeit zu leiſten. Es iſt wahr , daß nach Kenntnisnahme dieſes Pro - gramms die Reichsregierung ſich für ver - pflichtet ſah , Genf zu verlaſſen und ſeinen Austritt aus dem Völkerbund an - zukündigen. Es handelt ſich um eine bru - tale Geſte , die durch nichts gerechtfertigt war , wie dies der Präſident der Konferenz ſelbſt feſtgeſtellt hat. Aufrüſtung in ihrer ganzen Schwere aufge⸗ worfen. Der Völkerbundsrat hat die Pflicht , ſich über die Verantwortlichkeit der ſo ge⸗ ſchaffenen Lage und über die Folgen , die ſie nach ſich zieht , auszuſprechen. Er muß auch die Schlußfolgerungen bekannt geben , die die Regierungen für ihre Abkommenspolitik daraus zu ziehen haben , die den Willen haben , die europäiſche Sicherheit aufrechtzuerhalten und zu vermitteln. Die „ Pflicht “ des Völkerbundes Eine noch bedeutendere Frage muß geſtellt werden , denn in einem Europa , in dem ſich die Methode der einſeitigen Kündigung inter⸗ nationaler Verpflichtungen verallgemeinern würde , würde es bald nur noch Platz für eine Machtpolitik geben. Keine Verhandlung iſt möglich , wenn im Laufe dieſer Verhandlungen einer der Teilnehmer das willkürlich an ſich reißt , was Gegenſtand der Verhandlungen iſt. Keine Verhandlung iſt außerdem nützlich , wenn die Ergebniſſe , ganz gleich welcher Art , durch den Willen einer der beteiligten Par - teien zerſtört werden können. Man ſollte dann bei den internationalen Beziehungen von vornherein den Begriff eines Vertrages oder einer Verpflichtung ausſchalten. Die Anſtren - ⸗ gungen der friedlichen Nationen gehen darauf hinaus , durch die Angriffs⸗ , gegenſeitigen Er⸗ leichterungs - und Beiſtandsverpflichtungen Anzeigenpreis nach Preis liſte Genfer Rakskagung hat begonnen Die franzöſiſche Denkſchrift / Was ſie enthält und was ſie verſchweigt Bezugspreis 1,85 RM. und 0,25 RM Zuſtellgebühr. durch die Poſt. ,30 RM. Einzelpreis 15 Pf. Und nun Genf ! Verſucht man die gegenwärtige außen - politiſche Situation Europas auf einen von allem diplomatiſchen und diplomatiſierenden Beiwerk befreiten Nenner zu bringen , ſo ſtellt ſie ſich nach Abſchluß der Konferenz von Streſa wie folgt dar : Die Wiedererrichtung der deutſchen Wehr - hoheit hat eine Anzahl Deutſchland nicht wohlgeſinnter Mächte in eine Aufregung ver - ſetzt , die nun auf verſchiedenen Konferenzen abreagiert wird. Frankreich iſt hier die treibende Kraft ſchlechthin. Es hat ſofort nach Verkündung des Wehrmachtgeſetzes durch den Führer den Völkerbund angerufen. Seine Abſicht geht dahin , den Völkerbund als Sanktionsinſtrument gegen die angebliche deutſche Vertragsverletzung zu mobiliſieren. Dabei hat es wohl nicht ſo ſehr an militäriſche Maßnahmen Deutſchlands gegenüber gedacht als an wirtſchaftliche und finanzielle. Jn ſeinen Wunſchträumen ſpiegelte ſich ſo etwas wie eine Kontinentalſpere gegenüber dem „ widerborſtigen “ Deutſchland wider - der Verſuch einer kalten Abwürgung , einer Be⸗ hinderung jeder umfaſſenden wirtſchaftlichen Möglichkeit für Deutſchland und damit auch einer hinreichenden militäriſchen Ausrüſtung , die im Hinblick auf Rohmaterialien ſelbſtver⸗ ſtändlich von einem gewiſſen Warenaustauſch auch mit außereuropäiſchen Ländern ange - wieſen iſt. Zu dieſem Zwecke ſicherte ſich Frankreich die Bundesgenoſſenſchaft der Sowjetunion , die es ſchon vor längerer Zeit „ für alle Fälle in den Völkerbundérat zurückholke , Es ſicherte ſich durch afrikaniſche Zugeſtänd - niſſe die italieniſche Unterſtützung. Es bekräftigte erneut das Zuſammenwirken mit der Tſchechoſlowakei. Es mobiliſierte die antideutſchen Jnſtinkte der Kleinen Entente und auch Oeſterreichs. Auf der anderen Seite ſteht Deutſchland , das im Bewußtſein der abſoluten Recht - mäßigkeit ſeines Handelns die Dinge mit großer Ruhe verfolgte und das auch noch da - durch einen diplomatiſchen Erfolg erzielte , daß ſich Polen nicht ohne weiteres in das Netz der franzöſiſchen Einkreiſung einſpannen ließ. Jn der Mitte zwiſchen beiden Mächte - gruppierungen ſteht England , deſſen Haltung von der Sorge diktiert wird , die kontinental - europäiſche Balance könnte zu ſehr nach der einen vder anderen Seite geſtört werden und nach dem Grundſatz handelte , daß England das Zünglein an der Waage bilden müſſe. Die Vorgänge von Streſa ſind ein Beweis dafür , daß die bösartige Haltung der Fran⸗ - zoſen ſich nicht in dem von dieſen gewünſchten Ausmaß durchzuſetzen vermocht hat. Jndem Deutſchland in der Oſtpaktfrage in geſchickter Weiſe ein Stück entgegenkam , hatten die Eng⸗ länder die Möglichkeit , die Diskuſſion in etwas ruhigere Bahnen zu lenken. So ſchloß Streſa mit einem Kompromiß , aus dem ge - ſchloſſen werden kann , daß auch die heute be⸗ ginnende Genfer Völkerbundstagung nicht unter allen Umſtänden ſo verläuft , wie es die Franzoſen gern möchten. Man hat den Ein - druck , daß ſich der Völkerbunösrat mit der Tatſache der deutſchen Gleichberechtigung und deren praktiſchen Auswirkungen abfinden und ſich darauf beſchränken wird , den Ver⸗ ſuch zu machen , für kommende Fälle - - alſo für die Zukunft - beſtimmte Maß - nahmen ins Auge zu faſſen. Zwar iſt die franzöſiſche Note an den Völkerbund außer⸗ ordentlich ſcharf und nahezu überladen mit heftigſten Angriffen gegenüber Deutſchland. Aber es ſteht zu erwarten , daß die Engländer , die ſich des Ernſtes der Lage durchaus bewußt ſind , dazu beitragen werden , es in Genf nicht zu Beſchlüſſen kommen zu laſſen , öie Deutſchland diffamieren und dadurch die europäiſche Lage in das gefährliche Randa gebiet der Exploſivzone abörängen würden. Dr. O. — 2 n — — — Wö ” „ JöÖÜ2 kollektiven Sicherheit zu ſchaffen. re. - — — S * — Jahrgang 1935 7 Nummer 89 nahmen ergreift , um der heute geſchaffenen Lage abzuhelfen und eine Wiederholung zu verhindern. Parole : „ Feſtigung des Friedens Das ſind die Betrachtungen , auf die die franzöſiſche Regierung die Aufmerkſam - keit des Völkerbundsrates lenken möchte. Ueberzeugt davon , daß die Achtung vor übernommenen Verpflichtungen jeder friedlichen Nation eine Pflicht iſt , iſt ſie ſich der Verpflichtungen bewußt , die die verſchiedenen Artikel des Paktes den Mitgliedern des Völ - kerbundes auferlegen. Sie wünſcht , das Ver - trauen unter den Völkern wiederhergeſtellt zu ſehen , und erklärt ſich mit allen Regierungen ſolidariſch , denen an der Feſtigung des Frie - dens gelegen iſt. Die franzöſiſche Regierung wartet vertrauensvoll darauf , daß ſich der Völkerbundsrat über die ihm unterbreitete ernſte Lage ausſpricht , daß er über die Gegen wart beſchließt und die Zukunft ſichert. Die Denkſchrift iſt von einer Note La - vals vom 9. April an den Generalſekretär des Völkerbunds begleitet , in der er ſich auf ſein Telegramm vom 20. März , durch das er die Einberufung Völkerbundsrats ver langt hat , beruft. Was nicht in der Dentſchrift ſteht e franzöſiſche Denkſchrift an den Völker - bhundsrat iſt nach ihrem erſten Eindruck , wenn auch in Form einer Anklageſchrift , mehr als das geſchickte Plädoyer für den tatſächlich Be - ſchuldigten. Zu Punkt 1 : Jn ihrer Grundtendenz geht die Denkſchrift völlig darüber hinweg , daß ſich Deutſchland in einer Zwangs - lage befand und ihm ſein Vorgehen durch das Verhalten der anderen vorgeſchrieben wurde. Auf der einen Seite war es laut Aeußerung franzöſiſcher Miniſter ſeit Jahren klar , daß Fra ich nicht daran dachte , die ver⸗ ſprochene Abrüſtungsverpflichtung ernſtlich durchzuführen. Auf der anderen Seite wurde Deutſchland durch ein Spiel mit wechſelnden Vorſchlägen künſtlich hingehalten , um daran verhindert zu werden , an die primitiv - ſten Sicherheitsmaßnahmen für ſein Territo - rium zu denken. Jn dieſer jahrelangen Pe - riode unauf richtiger Verſchleppun - gen gab es für Deutſchland nur eine Möglich - keit und nur eine ſelbſtverſtändliche Pflicht , nämlich notgedrungen alle Vorkehrungen und Vorbereitungen für eine angemeſſene Wehr ſoweit zu treiben , daß in dem Augenblick , in dem die letzte Hoffnung ſchwand , den Ver - ſailler Vertrag durch die anderen erfüllt zu ſehen , die angeſichts Deutſchlands Lage unent - behrlichen Rüſtungsmaßnahmen ſchlagartig einſetzen konnten. Dieſem offenkundigen Tat - beſtand wurde in Punkt 1 der Denkſchrift Direkt Gewalt angetan. Zu Punkt 2 : Wenn in der Denktſchrift die Präambel des Völkerbundsſtatuts zitiert wird , die ihren Mitgliedern Frieden und Sicherheit garantiere , dann hat Deutſchland ſeit 1926 , dem Beginn der Arbeiten jenes „ Vorbereitenden Abrüſtungsausſchuſſes “ , bis zum Jahre 1934 , alſo neun Jahre lang , uner - ⸗ müdlich darum gekämpft , dieſen Satz der Präambel auch für ſich angewendet zu ſehen. Wenn alſo der Völkerbund als „ Wärter der Verträge “ Deutſchland gegenüber in jahre - langen ſchweren Verzug geriet , ſo lag das daran , daß er untätig zuſah , wie die an⸗ Deren Mächte ſich um die eigene Abrüſtung Drückten und darüber hinaus ihre Rüſtungen überſtürzten , ohne ihren jeweiligen Rüſtungs - ſtand entſprechend dem Völkerbundsſtatut an⸗ zumelden. Die Rüſtungen wurden vielmehr in aller Heimlichkeit durchgeführt. „ Zu Punkt 3 : Wenn Deutſchland bei Ein - tritt in den Völkerbund auf das künftige Mili - tärſtatut des Völkerbunds ſich verpflichtete , ſo hat ſich Deutſchland ſo lange an dieſe Zuſage des Nico Doſtal : „ Die Vielgeliebte “ Operettenpremiere im halliſchen Stadttheater Anläßlich der Uraufführung dieſes neuen Werkes des Komponiſten der „ EClivia “ in Leipzig nahm der Referent Gelegenheit aus - zuſprechen , daß dieſe neue , ſauber gemachte Operette ſehr bald ihren Siegeszug über die deutſchen Bühnen antreten werde. Die Spiel - zeit iſt noch nicht zu Ende , und ſchon hören wir „ Die Vielgeliebte “ in Halle , nachdem ſie in Berlin in der Leipziger Originalbeſetzung ( Lilli Claus und Hermann Wolder ) einen Rieſenerfolg hatte. Gewiß : es iſt das alte Operettenſchema , bei dem ſich das Paar im erſten Akt kennen , und lieben lernt , im zweiten nach kurzem Glück infolge eines Mißverſtändniſſes aus - einandergeht und ſich am happy end des dritten Aktes wiederbekommt. Es iſt auch alles recht ſchön umſtändlich erdacht nach dem Rezept : warum denn einfach , wenn es doch kompliziert geht. Aber es ſind hübſche Ein - fälle da : daß im erſten Akt die beiden Doubles ver weltberühmten , vielgeliebten Filmſchau - ſpielerin Dena Darlo auf der Bühne er - ſcheinen , und von einem indiſchen Maharad - ſcha und einem ruſſiſchen Großfürſten mit Beſchlag belegt werden , indeſſen die echte Darlo als arme Stenotypiſtin mit dem ge - liebten Forſchungsreiſenden Peer Bille zu einer Fahrt ans Meer aufbricht - daß im zweiten Akt die ſizilianiſche Landſchaft mit der Taverne und dem alten Gemäuer dazu her - halten muß , eine muntere Parodie der Ver - diſchen Großen Oper hinzulegen - daß im dritten Akt endlich ein ganzes Filmatelier mit blitzenden Jupiterlampen und großem Ku - liſſenaufbau auf die Szene gezaubert wird , in der während einer Filmaufnahme Hie Darlo mit dem als Partner mitwirkenden Peer von zwei echten , nicht für ſie beſtimmten Standesbeamten ſich trauen läßt. Das alles , mag es noch immer im Kern konventtonell Stüreſa / Eine Donaukonferenz in Rom GSSSBGvGvwGwOaeeoOCèr0 ma gehalten , ſolange noch der Schimmer einer Hoffnung beſtand , daß die anderen Mächte noch daran denken würden , zur loyalen Her - ſtellung eines ſolchen Statuts zu ſchreiten. Erſt die Ueberzeugung , daß dies im Sinne der Sicherheit für alle nie geſchehen würde , gab Deutſchland ſeine Handlungs freiheit unbeſtreitbar und zwangsläufig wieder. Zu Punkt 4 : Die Abrüſtungs - beteue rungen Frankreichs wirken gerade für Deutſchlands Ohren nicht auf - richt i g. Während Deutſchland auf ein lang - dienendes Berufsheer von 100 000 Mann feſt - gelegt war , ſchuf ſich Frankreich eine Armee von vielen Millionen ausgebildeter Reſerven. Die Rüſtungsmaſchinerie arbeitete weiter unter Vervollkommnung aller Waffengattun - gen , namentlich der für Deutſchland ver - botenen , und ein unkontrollierbares potentiel de guerre wurde vertragswidrig geſchaffen. Wenn ſich dem Erfolg der Genfer Konferenz Schwierigkeiten entgegenſetzten , ſo iſt die Frage kaum ſchwer zu beantworten , wer dieſe Schwierigkeiten ſchuf. Deutſchland hat immer wieder durch neues Entgegenkommen verſucht , ſie auszuräumen. Dem immer wiederholten Auftürmen neuer Schwierig - keiten ſtand es ſchließlich machtlos gegenüber. Peinlich wirkt namentlich die Erinnerung der Denkſchrift an den franzöſiſchen Vorſchlag vom 5. Februar 1932 , Bombenflugzeuge dem Völkerbund zur Verfügung zu ſtellen , zumal dies an das Angebot Frankreichs , franzöſiſche Truppen als Beſatzung zur Abſtimmung an die Saar zu ſchicken , gemahnt. Wenn die Denkſchrift in dieſem Zuſammenhang auch an die bekannte Erklärung vom 11. Dezember 1932 erinnert , ſo iſt durch dieſe keine Aende rung der Methoden und Ziele entſtanden , denn gerade die willkürliche und einſeitige Auslegung des Begriffs „ Sicherheit “ ver - hinderte ſyſtematiſch ein Weitertreiben des Abrüſtungsproblems. Zu Punkt 5 : Wenn der Grundſatz auf - geſtellt wird , „ keine Verhandlung iſt möglich , wenn einer der Teilnehmer das an ſich reißt , was Gegenſtand der Verhandlungen iſt “ , ſo ſprechen alle franzöſiſchen Aufrüſtungsmaß - nahmen , zuletzt die Einführung der zwei - jährigen Dienſtzeit , Frankreich das Recht ab , als Anwalt dieſe Theſe zu vertreten. Wenn Frankreich glaubt , Deutſchland an die „ Feierlichkeit “ ſeiner in Verſailles auf - gezwungenen Verpflichtungen erinnern zu ſollen , ſo ſei hier nur an die im Schluß - protokoll von Locarno ſeitens Frankreichs ebenſo feierlich wie freiwillig übernommene Verpflichtung erinnert , unverzüglich zur Ab - rüſtung zu ſchreiten. Beflaggung der Kirchen am 20. April und 1. Mai. Der Reichsbiſchof hat die evangeliſchen Ge - meinden angewieſen , am 20. April , dem Ge - burtstag des Führers , und am 1. Mai , dem „ Nationalen Feiertag des deutſchen Volkes “ , die kirchlichen Gebäude zu beflaggen. Des Geburtstages des Führers iſt grundſätzlich in den Gottesdienſten des erſten Oſterfeiertages in Predigt und Kirchengebet zu gedenken. Wo der Wunſch nach einer gottesdienſtlichen Feier am 20. April ſelbſt gehegt wird , iſt ihm zu willfahren. Am 1. Mai iſt ebenfalls dort , wo von örtlichen nationalſoztialiſtiſchen For - mationen der Wunſch nach einer gottesdienſt - lichen Feier geäußert wird , ein Gottesdienſt zu paſſender Stunde zu halten. Sonſt iſt am zorabend des Tages zur m geetetg Zeit ein Gottesdienſt zu veranſtalten. Die Gottes - dienſte ſind mit Feſtgeläut zu umrahmen und die Kirchengebäude zu beflaggen. Pfingſttagung des VDA. in Königsberg. Die 55. Jahrestagung des Volksbundes für das Deutſchtum im Ausland findet dies - mal in Oſtpreußen , und zwar vom 7. bis 10. Juni in Königsberg ſtatt. Die Tagung ſoll eine große Gemeinſchaftskund - gebung im deutſchen Oſten ſein. Geſtern mittag 12. 30 Uhr wurde die Drei - mächte konferenz von Streſa abgeſchloſſen mit einem Schlußkommuniqué , das die Ueberſchrift : „ Gemeinſame Entſchließung der Konferenz von Streſa “ trägt und in dem es folgendermaßen heißt : Die Vertreter der Regierungen Jtaliens , Frankreichs und Englands haben in Streſa die allgemeine europäiſche Lage peprüft im Lichte der Ergebniſſe des Meinungsaus - tauſchs , der in den letzten Wochen ſtattgefun - ⸗ den hat. ſowie der Entſcheidung , die am 16. März von der deutſchen Regierung ge - fällt wurde und ſchließlich auf Grund der Auskünfte , die von den britiſchen Miniſtern während ihrer kürzlich ſtattgefundenen Be - ſuche in verſchiedenen Hauptſtädten Europas erlangt wurden. Nachdem der Einfluß dieſer Lage auf die Politik in Betracht gezogen war , wie ſie in den Abkommen von Rom und Lon⸗ don beſtimmt worden iſt , fanden ſie ſich in voller Uebereinſtimmung über die verſchiedenen Fragen , die beſprochen wurden. 1. Sie einigten ſich auf eine gemein - ſame Linie , die verfolgt werden ſoll , wenn der franzöſiſche Antrag an den Völkerbunds - rat zur Sprache kommt. 2. Die Auskünfte , die ſie erhalten haben , haben ſie in der Anſicht beſtärkt , daß die Ver - handlungen fortgeſetzt werden ſollen hinſicht - lich der Entwicklung , welche bezüglich der Siche ; rheit in Oſteuropa erſtrebt wird. 3. Die Vertreter der drei Regierungen prüften von neuem die öſterreichi ſ ch e Lage. Sie beſtätigten die engliſch - franzöſi ' ſch - italieniſchen Erklärungen vom 17. Februar und 27. September 1934 , durch die die drei Regierungen anerkannten , daß die Notwen - digkeit , die Unabhängigkeit und Un - verſehrtheit Oeſterreichs aufrecht zu erhalten , auch in Zukunft ihre gemeinſame Politik leiten werde. Hinſichtlich des franzöſiſch - ita - lieniſchen Protokolls vom 7. Januar 1935 und der engliſch - franzöſiſchen Erklärungen vom. Februar 1935 , in welcher der Beſchluß be - kräftigt wurde , ſich gemeinſam zu beraten im Hinblick auf Maßnahmen , die im Falle der Bedrohung der Unterſehrtheit und Unab - hängigkeit Oeſterreichs ergriffen werden müſſen , kamen ſie überein vorzuſchlagen , daß Vertreter aller der Regierungen , die im Pro - ⸗ tokoll von Rom aufgezählt ſind , zu einem möglichſt frühen Zeitpunkt zuſammentreten ſollen mit dem Ziel , die zentraleuropäiſchen Vereinbarungen abzuſchließen. 4. Was den ins Auge gefaßten Luft - pakt für Weſteuropa betrifft , ſo bekräf - tigen die Vertreter der drei Staaten die Grundſätze des Verfahrens , das eingeſchlagen werden ſoll , wie es im Londoner Kom - muniqué vom 83. Februar vorgeſehen iſt , und beſchloſſen , das Studium dieſer Frage aktèv fortzuſetzen in der Abſicht , einen Pakt zwiſchen den fünf Mächten abzuſchließen , die im Londoner Kommunigqus erwähnt werden , ſowie von allen zweiſeitigen Vereinbarungen , welche ihn begleiten können. 5. Als ſie zur Rüſtungsfrage ge - langten , haben die Vertreter der drei Mächte ins Gedächtnis gerufen , daß das Londoner Kommuniqué ein Abkommen vorſah , das frei mit Deutſchland ausgehandelt werden ſollte , um an die Stelle der entſprechenden Klauſeln des Teils V des Vertrags von Ver - ſailles zu treten. Sie unterzogen weiter die Handlungen der deutſchen Regierung und den Bericht Sir John Simons über ſeine Unterhaltungen mit dem deutſchen Reichs - kanzler über dieſen Gegenſtand einer ſorg - fältigen und beſorgten Beſprechung. Mit miniert hat. Montag , 15. Aprff Bedauern ſtellen ſie feſt , daß die Methode der einſeitigen Aufkündigung , die von der deut⸗ ſchen Regierung in einem Augenblick ange - wandt wurde , als gerade Schritte ergriffen waren , ein in freier Weiſe ausgehandeltes Abkommen über die Rüſtungsfrage zu er - reichen , das öffentliche Vertrauen in die Sicherheit einer friedlichen Oränung unter - Darüber hinaus hat das große Ausmaß des veröffentlichten Programms der deutſchen Aufrüſtung , das ſchon mitten in der Ausführung begriffen iſt , die zahlenmäßigen Schätzungen entwertet , auf die die An - ſtrengungen für eine Abrüſtung bisher ge - gründet waren , und die Hoffnungen erſchüt - tert , durch die jene Anſtrengungen inſpiriert waren. Die Vertreter der drei Mächte bekräftigen nichtsdeſtoweniger ihren ernſten Wunſch den Frieden zu erhalten durch Her - ſtellung eines Gefühls der Sicherheit , und erklären für ſich ſelbſt , daß ſie ernſtlich beſtrebt bleiben , ſich an jeder praktiſchen An ſtrengung zu beteiligen , durch die die inter - nationale Verſtändigung durch Begrenzung der Rüſtungen gefördert werden kann. 6. Die Vertreter der drei Mächte ziehen weiter den Wunſch in Betracht , der von den Staaten begründet worden iſt , deren Rüſtungsſtand durch die Friedensverträge von St. Germain , Trianon und Neuilly feſt - geſetzt worden iſt , die Reviſion dieſes Standes zu erreichen. Sie beſchloſſen , daß die anderen hierdurch berührten Staaten auf diplomatiſchem Wege von dieſem Wunſch unterrichtet werden ſollen. Sie kamen über - ein , dieſen anderen in Betracht kommenden Staaten die Prüfung dieſer Frage zu emp fehlen mit dem Ziel , ſie durch gegenſeitige Verſtändigung innerhalb des Rahmenwerkes allgemeiner und regionaler Sicherheits - garantien zu regeln. Hieran ſchloß ttalieniſche Erklärung folgenden Wortlauts : „ Folgende gemeinſame Er - klärung iſt von den Vertretern Jtaliens und Englands in Beziehung auf den Vertrag von Locarno abgegeben worden : Die Ver treter Jtaliens und Englands als Mächte , die an dem Vertrag von Locarno nur in der Eigenſchaft als Garantiemächte beteiligt ſind , bekräſtigen in formeller Weiſe alle ihre Ver - pflichtungen , die aus dieſem Vertrag hervor - gehen , und erklären ihre Abſicht , dieſe getreu - lich zu erfüllen , falls dies nötig werden ſollte. Soweit dieſe beiden Mächte dieſe Verpflich - tungen auf ſich genommen haben in Be - ziehung zu allen anderen Teilnehmern des Vertrags von Locarno wird dieſe gemein - ſame Erklärung , die auf der Streſa - Kon - ferenz , an der Frankreich teilnahm , abge - geben wurde , auch den Regierungen Deutſch - ſich eine engliſch - lands und Belgiens förmlich übermittelt werden. “ Zum Schluß enthält das abſchließende Kommuniqué folgende Schlußerklä - rung : Die drei Mächte , deren politiſches Ziel die gemeinſame Aufrechterhaltung des Friedens innerhalb des Rahmens des Völkerbundes iſt , befinden ſich in vollſtändi - ger Uebereinſtimmung , wenn ſie ſich mit allen praktiſchen Mitteln jeder einſeitigen Auf - kündigung von Verträgen widerſetzen , durch die der Friede Europas in Gefahr kommen kann , und ſie werden daher zu dieſem Zweck in enger und freundſchaftlicher Zuſammen - arbeit handeln. Der Sonnabend in Streſa Wie von verſchiedenen gut unterrichteten Seiten verlautet , ſtand im Mittelpunkt der Verhandlungen am Sonnabend die Frage der öſterreichiſchen Unabhängig - keit. Die drei Mächte ſollen den Plan ge - faßt haben , zur Regelung aller diesbezüglichen durchgehend , auch in den exotiſchen Fürſten und der übrigen Kuliſſe parodiſtiſch zu bleiben : es hat im Grunde etwas von dem echten Operettenſentiment , das nun einmal zu dem Publikumserfolg gehört. Es iſt weiterhin und vor allem mit großem Geſchick inſtrumentiert. Die halliſche Auf - führung verzichtete bewußt auf die großen , ungeheuer ſchwierigen Koloraturen , die in der Darlo - ⸗Rolle ſtehen ( die bei der Urauf - führung Lili Claus fünfmal hintereinander bringen mußte ) , ſie war auch ſonſt muſikaliſch mit ſicherem Griff eingerichtet und zeigte Doſtals Vermögen , eine Melodie zu ſchreiben , ein Duett zu komponieren und einen Tanz - ſchlager zu machen. Die Fülle der — oft nicht einmal weit hergeholten - Einfälle örängt ſich , das Orcheſter hat Rhythmus und Klang , wobei Harfe , geſtopfte Trompeten und Schlag - zeug geſchickt eingeſetzt werden. Am Dirigentenpult ſtand Karl Hamann , der junge Kapellmeiſter , der für dieſe Muſik die leichte , bewegliche Hand hat , um ſie in ihrem ſinnlichen Wohllaut aufklingen zu laſſen , zu ſtraffen und jazz - like Rhythmus zu treffen. Auch die ſorgfältig feilende muſi⸗ kaliſche Arbeit mit den Soliſten wurde ſpür - bar. Die Chöre , von Ernſt Kramer eingeübt , folgten mit gutem Gelingen , ſo daß ein ab⸗ W tes muſikaliſches Geſamtbild her - auskam. Die Regie führte Paul Herlt : klar glie - dernd , in friſchem Tempo , dramaturgiſch ſelb - ⸗ ſtändig und zum Vorteil der Aufführung ſichtend , erfreulich ſauber in der Geſamt - haltung. Er ſelbſt gab mit angenehmer Diſtinktion den Manager der Diva , Zeus Holiday. Die Hauptrolle war Annelies Niedner anvertraut , der ihre Fähigkeit , große Kleider mit Geſchmack und Geſchick tragen zu können , ſehr zuſtatten kam. Zu dem an⸗ enehmen Augeneindruck trat die wohltuenöe icherheit der Darſtellung und die muſikaliſch überzeugende Geſtaltung der Aufgabe : eine Vuß Jhr Partner. , Leiſtung aus einem — Wilhelm Kreienſen ( Peer Bille ) zeigte ſich als kuitivierter Sänger , der bewegliche Ernſt Vogler gab den munteren Tartarin , Lotte Stiller , um einiges zu laut , ſpielte die Jn - grid , Otto Tiedemann machte als Geſandter von Nordenien gute Figur , Erich Heimbach erntete mit dem dankbaren Wurzen als Pappilardo beſonderen und verdienten Erfolg. Ein Wort zu den Koſtümen : ſie ſahen durchweg wirklich gut aus ; das Kleeblatt der gut friſierten Dena Darlos ſowohl wie das muntere Ballett , das von Jlke Schellenberg einſtudiert war. Die Bühnenbilder , hell , freundlich , gut gegliedert mit dem inter - eſſanten Blick auf die Hinterbühne des The - aters , von Peter Krauſen. Jn Summa eine friſche , wohl anzuſehende und nicht minder anzuhörende Aufführung , mit Liebe und mit Glück in allen Teilen einſtudiert und von einem Beifall begleitet , der es dem Referen - ten leicht macht , das ſchon eingangs Geſagte auch für Halle gültig zu wiederholen : dieſe Vielgeliebte veroperettelte Greta Garbo wird auch in Halle viel volle Häuſer machen. Ehrhard Evers. l — T ,qä — W. E. Schäfer : „ Der Kaiſer und der Löwe “ Uraufführung in Meiningen. Das Theaterereignis des Sonntages für ganz Thüringen war die Uraufführung des neuen Schauſpiels von Walter Erich Schäfer , des Autors des „ 18. „ Oktober “. Wie ſchon der Titel des Werkes ahnen läßt , handelt es ſich um die Spannungen zwiſchen Barbaroſſa und Heinrich dem Lbwen , zwiſchen Hohen - ſtaufen und Welfen , zwiſchen dem mordiſchen Prinzip der Aktion und dem fäliſchen der Beharrung , zwiſchen dem Südweh des reichs - ſehnſüchtigen Kaiſer und dem Nordglauben des an den Boden der Heimat gebundenen r hab in dieſer Spielzeit d ß r haben in dieſer Spielzeit das große dramatiſche Geſchenk E. G. Kolbenheyers „ Gregor und Heinrich empfangen ; es gibt wohl kaum jemanden heute in Deutſchland , en - - der den ſo weit entfernten Stoff der deut - ſchen Kaiſergeſchichte ſo ernſthaft , ſo verant - wortungsbewußt und gewiſſenhaft , mit gleich großem Wiſſen und Können zu geſtalten ver - möchte. Auch W. E. Schäfer ſt nicht der Mann , die große Aufgabe zu löſen , die der Stoff ihm ſtellte. Er läßt das Stück als Legende und Oratorium ausklingen , und man empfindet , daß hier der Autor einen Ausweg gegangen iſt , der zwar möglich , aber nicht aus dem Stoff heraus notwendig war. Die Uraufführung unter ber Regie von Georg Lange mit Hermann Kießner und Walter Martin als Kaiſer und Löwe erzielte einen Achtungserfolg. S Furtwängler dirigiert in Wien. General⸗ muſikdirektor Furtwängler wurde ſoeben bei einem Aufenthalt in Wien verpflichtet , an der Wiener Staatsoper im Verlaufe der nächſten Saiſon und der nachfolgenden Spiel - zeiten im Rahmen ſeiner anderweitigen Ver⸗ pflichtungen zu dirigieren. Furktwängler reiſte ſodann nach Budapeſt , wo er die dort weilenden Wiener Philharmoniker dirigierte. Er wurde ſtürmiſch gefeiert. Reichsverweſer Horthy und ſeine Gattin wohnten dem Kon - zert bei. Max Mell Träger des Burgtheater⸗ - Ringes. * h — e e h e c * * e *. e c * n m * - De * e 33 e m 7 Vummer um 20. Mai eine Donankonfe - ⸗ r ch Rom einzuberufen , an der außer Frankreich und Jtalien auch die Kleine Entente , Polen und Oeſterreich teilnehmek ſollen. Auch eine Einladung an Dentſch - Jan d ſoll beabſichtigt ſein. während England und die Schweiz nur Beobachter entſenden wollen. Die Konferenz ſoll rein politiſchen Charakter tragen , alſo keine Wirtſchaftsfragen behandeln. In ihrem Rahmen ſoll auch die Wiederauf - ⸗ rüſtung Oeſterreichs beſprochen werden. Am Sonnabend ſoll weiter beſchloſſen worden ſein , daß die Luftpakte als zweiſeitige Ver⸗ träge abgeſchloſſen werden ſollen. Ferner ſoll am Sonnabend über die Frage einer Fort - ſetzung oder Liquidierung der Abrüſtungs - konferenz geſprochen worden ſein. England ſoll ſich für eine Fortſetzung ausgeſprochen haben. Jn Streſa geht ferner das Gerücht um , daß auch Polen in der Frage der öſtlichen Richtangriffspakte die gleiche Haltung wie Deutſchland einnehme und von dieſer ſeiner Anſicht die Konferenzmächte unterrichtet habe. Ein » weikes ,verkranliches Dokumenk „ Anregungen “ für die heutige Ratstagung ? Das „ Journal des Nations “ glaubt zu wiſſen , daß neben der franzöſiſchen Denk⸗ ſchrift noch ein zweites vertrauliches Doku - ment beſtehe , das die Anregungen enthalten ſoll , die die drei in Streſa anweſenden Mächte zu Händen der Rotsmitglieder und des Be - richterſtatters im Hinblick auf einen Entſchlie - ßungsentwurf des Völferbundsrates ausge - arbeitet hätten. Dieſe Anregungen ſeien fol - gende : 1. Der Rat ſoſſe die Unmösalich - keit bekräftigen , rechtlich und tatſächlich den Vertragsberuch in der internationalen Politik anzuerkennen. 2. Der Rat ſolle ſein Bedauern über den Beſchluß der deutſchen Regierung vom 16. März ausſprechen. 3. Der Rat ſolle die Schaffung eines Juriſtenaus - ſchuſſes beſchließen , der das Problem des Vertragsbruches prüfen und Vorſchläge ſiber die Maßnahmen machen ſolle , die in Zukunft auf Vertragsbrüche folgen müßten. 4. Der Rat ſolle die Entwickelung der Organiſation der Sicherheit durch regionale Pokte auf der Grundlage der gegenſeitigen Hilfeleiſtung vorſchlagen. Ueber dieſe vier Punkte beſtehe , ſo be⸗ hauptet das Blatt , zwiſchen den Vertretern Frankreichs , Englands und Italiens Einig - keit. Das alles beziehe ſich nicht auf Deutſch - land , ſondern ſei allgemein gehalten. England habe ſeine Zuſtimmung nicht nur für die automatiſche Einberufung des Rates , ſondern auch für Sanktionen finanzieller und wirtſchaftlicher Art für zukünftige Vertrags - brüche gegeben. Paris und London zu Skreſa Befriedigung über das Ergebnis. In großen Schlagzeilen verzeichnet die Pariſer Montagspreſſe als Hauptergebnis der Konferenz von Streſa die „ Bekräftigung der engliſch⸗franzöſiſch⸗italieniſchen Solidari - ⸗ tät “ , die nach Anſicht der Preſſe heute in Genf ihre erſte Feuerprobe zu beſtehen baben wird. Der offiziöſe „ Temps “ fpricht von einem großen Erfolg. Der „ pPetit Pariſien “ , der ſich erdreiſtet , die Stellung - nahme des Deutſchen Nachrichtenbüros gegen die franzöſiſche Denkſchrift als ein „ Gewebe wahrheitswidriger Behauptungen “ zu be⸗ ichnen , ſchreibt , aus den Beſchlüſſen von Streſa gewinne man den Eindruck einer ruhigen Stärke , die für die Gegenwart und voffentlich auch für die Zukunft die „ Ein⸗ ſchitchterungsgeſten “ ( 1 ) Deutſchlands neh - men werde. r Von zuſtändiger engliſcher Seite wird olgende britiſche Auffaſſung über das Er⸗ gebnis von Streſa bekanntgegeben : England habe keine neuen Ver pflichtungen auf ſich genommen und ſeine bisherigen nicht r ritert. Man müſſe es ganz klar heraus - ellen , daß man die einſeitige ( ! ) Aufkündi - ung von Verträgen , die einen grundlegen - g7 Charakter trügen , nicht zulaſſen könne. egen ſolche Aufkündigungen müſſe Proteſt eingelegt werden. England bleibe ſeinen Freunden treu. Gleichzeitig wünſche es aber , en Kreis ſeiner Freunde zu erweitern. zwas den Plan einer Donaukonferenz angehe , o werde England , falls ſeine Anweſenheit d Rom gewünſcht werde , als Beobachter eilnehmen. Zur Frage des Oſtpaktes wird — engliſcher Seite erklärt : „ Wir haben eine ehr befriedigende Erklärung von Deutſch⸗ e 8 erhalten. Wir ſehen jetzt zwei Grup - v von denen die eine Deutſchland und olen umfaßt , die andere ſich um Frankreich Wir viert. Die Standpunkte der Gruppen den ſich gegenſeitig nicht ſtören. “ Weiter Da ausdrücklich betont , daß man mit eutſchland in Fühlung bleiben wolle. s Von italieniſcher Seite wird über as Ergebnis von Streſa größte Befriedi - gung zum Ausdruck gebracht. e e Vor dem Verlaſſen Streſas gaben Laval und. Flandin kurze Erklärungen ab , die g franzöſiſchen Rundfunk verbreitet wurden. andin erklärte , daß die Solidarität der wo Mächte nicht nur in der Definierung , Pndern auch in der Handlung beſtätigt wor - ⸗ in ſei. Miniſterpräſident Flandin und Eng⸗ ſinde Premierminiſter Macdonald haben 29 übrigens bereits wieder nach Paris und candop zurückbegeben. Sie haben die Füh - mirt der Verhandlung in Genf ihren Außen - iniſtern überlaſſen. Von polniſcher Seite Gr Außenminiſter Berck an der heutigen d enfer Ratsſitzung teilnehmen. Von Hen⸗ ken on , dem Präſidenten der Abrüſtungs - t nferenz , heißt es , daß er bei den anwefſen - en Mächten wegen einer Einberufung des Präſidiums der Abrüſtungskonferenz ſondiere. Miffkeldenktſchkanß ? Saake - Bettung Jrreführende Auslegungen in verſchiedenen Preſſekommentaren haben die Reich sregie⸗ ſieren : 1. Jn den Berliner Beſprechungen hat der Führer und Reichskanzler der britiſchen Delegation mitgeteilt , daß die deutſche Regie - ſei , zum Oſtpakt in der vorgeſchlagenen Form ihren Beitritt zu erklären. Die deutſche Reichs - regierung ſei demgegenüber aber bereit , einem ſolchen kollektiven Sicherheitspakte ihre Zu⸗ ſtimmung zu geben dann , wenn er erſten s ſich aufbane auf gegenſeitigen und allgemeinen Nichtangriffsverpflichtungen und Schieds - gerichtsverfahren ; zweitens im Falle einer Friedensſtörung ein konſultatives Verfahren vorſehe ; drittens ſei die dentſche Reichs⸗ regierung bereit - unter Betonnung der Schwierigkeiten der einwandfreien Feſtſtellung eines Angreifers , ſich allgemeinen Maß⸗ nahmen der Nichtunterſtützung eines ſolchen anzuſchließen. Zu dieſem Angebot ſteht die deutſche Reichsregierung auch heute. 2. Der Führer und Reichskanzler hat in dieſer Beſprechung mitgeteilt , daß die deutſche Regierung nicht in der Lage ſei , einem Pakt - vorſchlag zuzuſtimmen , der , ſei es für alle oder für einzelne , mehr oder weniger automa - tiſche militäriſche Beiſtandsver - pflichtungen enthalte. Dieſe ſähe darin nicht ein Element der Friedenserhaltung , ſon - dern eher noch ein Element der Friedens - bedrohung. Die deutſche Reichsregierung be - kennt ſich auch heute zu dieſer Auffaſſung und zu der ſich daraus ergebenden Haltung. 3. Die Reichsregierung hat ſofort nach Uebernahme der Macht ihren Wunſch ausge - drückt , mit den umliegenden Staaten Nicht - angriffspakte abzuſchließen. Sie machte dieſen Vorſchlag , ohne eine eingehende Kenntnis beſtehender zwei - oder mehrſeitiger militäriſcher Abmachungen einzelner Staaten zu beſitzen , und ohne jede Bezugnahme auf ſie. Da ſie ſelbſt keine aggreſſiven Ab - ſichten hegt , fühlt ſie ſich von wirklichen Defenſivabkommen auch nicht betroffen. Auch zu dieſer Auffaſſung bekennt ſich die deutſche Regierung heute noch. So wenig ſie daher in der Lage iſt , einem Pakt beizutreten , der ſolche militäriſchen Verpflichtungen als ein weſent - Die polizeilichen Unterſuchungen , die im Zuſammenhang mit angeblichen ſenſationellen Enthüllungen über geplante Attentatsverſuche der deutſchen Jngenieure und Arbeiter bei den Brückenbauten in Pont de ' Arche in der Normandie angeſtellt wurden , haben , wie dies nicht anders zu erwarten war , zu einem kläglichen Figsko geführt. Die Beſchuldigun - gen eines franzöſiſchen Angeſtellten , der wegen Unterſchlagungen von dem Leiter der Arbeiten , dem deutſchen „ Chefingenieur Kiehne , entlaſſen wurde , und der ſich an ſeinem Vorgeſetzten rächen wollte , haben ſich als vollkommen haltlos herausgeſtellt. Der Angeſtellte hatte behauptet , die deutſchen Ar⸗ beiter hätten in einer dunklen Nacht eine Sprengſtoffladung in einen der Brücken - pfeiler gelegt mit der Abſicht , die Brücke ſpäter in die Luft zu ſprengen. Wie die poli - zeiliche Unterſuchung ergeben hat , hat man in dieſem Betonpfeiler eine Flaſche Calvados , „ das Nationalgetränk der Normandie “ , ſowie eine Bulle mit den Namen aller an dem Bau beſchäftigten Arbeiter und , einem alten Aberglauben huldigend , einige Geldſtücke eingemauert. Die Nachprüfung der Beſchuldigung , wo⸗ nach ein franzöſiſcher Wächter , der zuviel über die angeblichen Abſichten der deutſchen Ar - beiter gewußt habe , von dieſen heimlich er - mordet worden ſei , ergab , daß dieſer Wächter vergnügt und munter als Dockarbeiter in Rouen wiedergefunden wurde. Damit iſt wieder einmal eine jener üblen Brunnen - vergiftungen aufgeklärt , die beſonders in letz - ter Zeit die franzöſiſche Preſſe geradezu über - ſchwemmen. „ Jmmelmann “ und „ voelcke “ Benennung zweier Luftgeſchwader. Das Reichsluftfahrtminiſterium gibt be - kannt : Der Führer und Reichskanzler hat auf Vorſchlag des Reichsminiſters der Luft - fahrt , General der Flieger Göring , dem Fliegergeſchwader in Mecklenburg die Bezeich - nung „ Geſchwader Jmmelmann “ und dem Fliegergeſchwader in Niederſachſen die Beezichnung „ Geſchwader Boelcke “ ver - liehen , um neben dem unvergeßlichen größten Jagdflieger Deutſchlands , Freiherrn von Richthofen , auch die gleich ruhmvollen Namen ſeiner beiden Kameraden in der neuerſtande - nen Reichsluftwaffe fortleben zu laſſen. Die Mitteilung von dem Erlaß iſt in - zwiſchen durch eigenhändiges Schreiben des Reichsminiſters der Luftfahrt an die Mutter Jmmelmanns und die Eltern Boelckes ge - gangen , wobei General Göring ſeiner beſon - deren Freude darüber Ausdruck gab , der Uebermittler dieſes auch die Hinterbliebenen ehrenden Erlaſſes ſein zu können. Ein Arbeitgeber im Stundenlohn. Die pfälziſche Zeitung „ NSZ - ⸗Rheinfront “ veröffentlicht folgende aus Saarbrücken da⸗ tierte Bekanntmachung des Reichskommiſſars für die Rückgliederung , Gauleiter Bürckel : rung veranlaßt , ihren Standpunkt in der Frage des Oſtpaktes wie folgt zu präzi⸗ rung zu ihrem Bedauern nicht in der Lage Ein Oſtpakt , wie ihn Deutſchland ſieht Reichsregierung präziſiert ihren Standpunkt in der Frage des Oſtabkommens liches Element ſeines Jnhaltes und damit ſeiner Exiſtenz enthält , ſo wenig können ſolche außerhalb dieſes Paktes liegenden Ver - einbarungen die deutſche Reichsregierung be - hindern , ihrerſeits Nichtangriffspakte aus der oben fixierten Baſis abzuſchließen. Dies iſt der Sinn der Antwort der deutſchen Reichs - regierung auf die Frage des königlich - briti - ſchen Botſchafters , ob Deutſchland bereit ſei , einen Oſtpakt auf der von ihm ſelbſt angedeu - teten Grundlage abzuſchließen , auch für den Fall , daß andere Staaten unter ſich noch be - ſondere Abmachungen getroffen hätten , oder treffen würden. Die deutſche Reichsregierung will aber an dieſer Stelle die folgenden Bemerkungen nicht unterdrücken : Die von verſchiedenen Regie - rungen als nötig erachtete Ergänzung von Nichtangriffs - und Gewaltausſchließungspakten durch militäriſche Beiſtandsverpflichtungen be - ruht auf einem Widerſpruch in ſich. Entweder man glaubt an freiwillig über - nommene Verpflichtungen oder man glaubt an ſie nicht. Glaubt man an ſie , dann iſt die Notwendigkeit ſolcher militäriſcher Abmachun - gen nicht einzuſehen. Zweifelt man aber an der aufrichtigen Einhaltung einer übernomme - nen Nichtangriffsverpflichtung , dann iſt dieſer Zweifel genau ſo berechtigt gegenüber der ſinngemäßen Einhaltung der ergänzenben militäriſchen Verpflichtungen ſolcher Friedens - pakte. Wenn es möglich iſt , daß aus Nicht - angriffspakten Kriege entſtehen , ſo iſt es eben - ſo möglich , daß aus defenſtven Beiſtandspakten offenſive Angriffsverhandlungen kommen. Nur ſcheint der deutſchen Reichsregierung der Weg vom Gewalt - , Ablehnungs - und Aus - ſchließungspakt zum gewalttätigen Friedens - bruch ein weiterer zu ſein als der Weg von militäriſchen Verpflichtungen defenſiver Natur zu einer militäriſchen Haltung offenſiver Art. Die deutſche Reichsregierung ſieht aber nach wie vor in dieſer Entwicklung militäriſcher Bündniſſe in Europa kein Element einer kol - lektiven friedlichen Entwicklung oder einer Garantie des Friedens. Sie iſt daher auch nicht in der Lage , Pakte zu unterzeichnen , in denen ſolche Verpflichtungen ein integrieren - der Beſtandteil ſind , gleichgültig , ob für alle oder für einzelne Teilnehmer. Der vorſtehende Standpunkt iſt dem bri - t iſſchen Staatsſekretär des Aeußeren durch Vermittlung der Berliner Botſchaft amtlich mitgeteilt worden. Enkhüllke franzöſiſche „ Enkhüllungen “ „ Alteniaisverſuche deutſcher Jngenienre in Frankreich / Die Rache des Enllaſſenen „ Verſchiedentlich erfuhren wir über das aſoziale Verhalten eines Arbeitgebers. Jch habe die Gelegenheit wahrgenommen , mit dem Leiter der Staatspolizei Saarbrücken an Ort und Stelle den Sachverhalt zu überprüfen und mußte feſtſtellen , daß in dem Betrieb des frag - lichen Herrn zum großen Teil Stundenlöhne bezahlt werden , die zwiſchen 10 und 28 Pfen - nig liegen bei einer durchſchnittlichen Arbeits - zeit von täglich 13 bis 14 Stunden. Der Ar - beitgeber wurde ſofort in Haft genommen. Er wird unter Berückſichtigung , daß die Arbeiter bei ihm mit ihren Löhnen noch Familien zu ernähren haben , in einem angemeſſenen Durchſchnittslohn täglich ernährt , und zwar ſo lange , bis er nach dem Treuhänder der Arbeit verlangt , um mit dieſem die Lohn - verhältniſſe in ſeinem Betrieb in Ordnung zu bringen. “ Sonnkagsdienſt ohne Lohnabzug am Geburtstage des Führers. Der Reichsfinanzminiſter hat angeordnet , daß am Sonnabend vor dem diesfährigen Oſterfeſt , dem 20. April 1935 , der Dienſt bei den Behörden der Reichsfinanzverwaltung wie an Sonntagen zu regeln iſt. Auch Arbeiter dürfen im Rahmen der für Beamte und An - geſtellte geltenden Regeln von der Dienſt - leiſtung an dem genannten Tage ganz oder teilweiſe entbunden werden. Der Vorſtand der Dienſtſtelle hat in dieſem Falle anzuordnen , wann die ausfallenden Arbeitsſtunden , für die der Lohn bei der Lohnzahlung für die Woche vom 14. bis 21. April nicht abzuziehen iſt , nach - zuholen ſind. Eine Lohnkürzung für die am 20. April ausgefallenen Arbeitsſtunden tritt auch dann nicht ein , wenn die Arbeitsſtunden ſpäter nicht nachgeholt werden können. Der Führer im Ruhrgebiet Der Führer ſtattete am Sonntag dem 8s8sjährigen Parteigenoſſen und bekannten Wirtſchaftsführer Geheimrat Emil Kirdorf einen Beſuch ab und beſuchte gelegentlich dieſer Anweſenheit im Induſtriegebiet auch verſchiedene Jnduſtrieunternehmungen in Bochum und Eſſen. Eine Spezialiſtenkruppe in Frankreich Antrag in der franzöſiſchen Kammer. Wie das „ Echo de Paris “ mitteilt , hat der Abgeordnete Reynaud in der Kammer einen Geſetzesvorſchlag eingebracht , der die Schaf - fung einer aus Berufsſoldaten beſtehenden Spezialiſtentruppe vorſieht. Dieſe könnte überall eingeſetzt werden. “ “ * Die de en Azorenfahrer haben am e ſie ſagcnpee nach lücklichen Tagen in Ponta del Gada und be⸗ onders Horta angetreten Montkag , W. Aprik Pyrenäen⸗Expreß entgleiſte Schweres Eiſenbahnunglück bei Bordeaux. Ein folgenſchweres Eiſenbahnunglück , das drei Tote und zehn zum Teil ſehr ſchwer Verletzte gefordert hat , ereignete ſich auf der internationalen Strecke Hendaye - - Paris. Der ſogenannte gleiſte etwa 30 Kilometer vor Bordeaux bei der Durchfahrt durch den Bahnhof Marche - prime. Von den dreizehn Wagen ſprangen ſieben aus den Schienen und wurden umge - worfen oder ineinandergeſchoben. Der Zug hatte im Augenblick der Entgleiſung eine Pyrenäen - Expreß ent - Geſchmindigkeit von 108 Stdkm. Es iſt nur dem Umſtand zu verdanken , daß er ſich aus modernen Stahlwagen zuſammenſetzte , daß die Ausmaße des Unglücks nicht noch größer ſind. Immerhin wurde ein Wagen erſter Klaſſe gegen einen ſchweren Granitpfeiler geſchleudert und ſo ſtark zuſammengedrückt , daß es zunächſt überhaupt nicht möglich war , den darin befindlichen Schwerverletzten Hilfe zu bringen. Fünf Stunden lang war man bemüht , einen Angeſtellten der Eiſenbahnge - ſellſchaft , dem beide Beine abgequetſcht waren , und den man immer wieder durch Spritzen und Kognak ſtärkte , aus den Trümmern zu ziehen. Als dies endlich gelungen war , konnte man nur noch den inzwiſchen eingetretenen Tod feſtſtellen. Jn den Morgenſtunden hat man bereits mit den Aufräumungsarbeiten begonnen. Die Urſache des Unglücks ſoll an⸗ geblich darin zu ſuchen ſein , daß ein Rad des vierten Wagens ſich von der Achſe löſte. Der Tod der Alwa Gorbe Brutales Vorgehen eines Heiratsſchwindlers Anfang Februar wurde die 32jährige Haus - angeſtellte Alma Garbe in Spandau offenbar ermordet aufgefunden. Nach den bisherigen Ermittlungen hat der wenige Tage ſpäter feſtgenommene 25jährige Paul Polte ihren Tod mittelbar oder unmittelbar ver - ſchuldet. Er war der Kriminalpolizei als gewerbsmäßiger Heiratsſchwindler bereits be⸗ kannt. Auch dieſem Mädchen hatte er die Ehe verſprochen und es wenige Monate vor ihrem plötzlichen Ableben zum Abſchluß einer auf 5000 RM. lautenden Lebensverſicherung zu ſeinen Gunſten veranlaßt , deren Prämien er aus eigener Taſche zahlte. Die Leichenöffnung ergab , daß Alma Garbe durch Einnehmen von an ſich harmloſen , in größeren Mengen aber tödlich wirkenden Tabletten vergiftet wor - den war. Jn der Wohnung Poltes , der ſich ſtets als „ Syndikus “ oder „ Rechtsbeiſtand auszugeben pflegte , wurden noch Packungen dieſer Tabletten gefunden. Auch ſein für die Tatnacht angegebenes Alibi ſtimmt nicht. Jn dieſem Zuſammenhang konnte die Kri - minalpolizei einen Komplizen Poltes feſt⸗ nehmen , den 35jährigen „ Baumeiſter und Ar - chitekten “ — wie er ſich vorzuſtellen pflegte - Reinhard Benner. Mit ſeiner Feſtnahme , der bald noch einige andere folgten , kam man nun hinter das Treiben einer Bande von Heiratsſchwindlern , die vor keinem Mittel zurückſchreckte , um ihre Opfer auszuplündern. Die Zahl der geprellten Opfer konnte noch längſt nicht ermittelt werden. Der Maibaum für Berlin und Reich kommt diesmal ans dem Frankenwald. Den traditionellen Frühlungsgruß des deutſchen Waldes an Berlin und das Reich in Geſtalt eines ge waltigen Maibaumes wird in dieſem Jahre die bayeriſche Oſt - mark ſenden. Am Mittwoch , dem 17. April , vormittags 10 Uhr , ſoll der Rieſenbaum im Frankenwald bei Kronach geſchlagen werden. „ Winnie Mae “ erneut unkerwegs Poſt wieder auf Stratoſphärenflug. Der einäugige amerikaniſche Flieger Wiley Poſt iſt am Sonnabend um 14227 Uhr ME3Z zu einem ſogenannten Stratoſphärenflug nach New York geſtartet. Poſt beabſichtigt , ſich auf ſeinem Flug der Stratoſphäre zu nähern und in dieſen Höhenſchichten durch Erzielung einer übernormalen Fluggeſchwindigkeit einen neuen Rekord für die Strecke Kalifornien - New Dork aufzuſtellen. Er fliegt ſeine alte Maſchine „ Winnie Mae “ , mit der er zweimal die Erde umflogen und zahlreiche Höhenflüge unternommen hat. Poſt iſt ſchon mehrmals zu Höhenflügen nach New York geſtartet , mußte aber bisher jedesmal infolge irgendwelcher Störungen ſeinen Verſuch aufgeben. Eine Stadt ſteht in Flammen Das rumäniſche Städtchen Pascain ſteht ſeit der Nacht zum Sonnabend in Flammen. Der Brand breitete ſich über ganze Straßen - teile aus. Bis zum Morgengrauen waren über 50 Häuſer zu Aſche geworden. Da auch die Telefonleitungen zerſtört ſind , fehlen noch Angaben über die weiteren Ausmaße der Kataſtrophe und Einzelheiten über Opfer an Menſchenleben. Auf dem La⸗Plata⸗Strom iſt bei heftigem Sturmwetter das argentiniſche Petroleum - ſchiff „ Caloria “ untergegangen. Die Beſatzung ertrank. — ZDZ Eigentum und Verlag der Mitteldeutſchen Verlags - Aktien⸗ Geſellſchaft Otto Hendel - Druckerei Halle /S. Hauptſchriftleiter : Or. Harald Oldag. Heute , Montag , 20 bis gegen 22 i Uhr Im IuvundlLee die Liebe Eine Seemannskomödie von Fr. Lindcmann Dienstag , O bis geg. Z3 Uhr Die Vlelgenebte Operette von N. Dostal Zahl. d. Rate f. Mittw. - Stammk. erb. Stadimeater Haiie IIIIIIIIIII oder Vornoamen zum Zeichnen voo Wäsche usw la weben n. s mee am. Halle. Gr. Steinstr. be i billiger ſind die Klein anzeigen in der „ Saale - Zeitung “ WAIHAIIA Fernruf 283 85 Heute 20. 15 Uhr Abschle es und Ehrenaben Die Attraktionen CKuropas Morgen Dienstag Fremiere Trümpfe des Varietés 5 Carltons Sisters 5 3 Hollanaias 49 Richys Mäster Carter Boitzoff und Radvani Marietta benz Eillen Kauer und Partner 49 Eppedras Ry and Chelf Ununterbrochener Vorverkauf auch für die Ostertelertage Rundfunk am en Leipzig Wellenlänge 382. 50 : Mitteilungen für den Bauer. 00 : Funkgymnaſtik. 6. 15 : Schallplattenmuſik. 35 : Aus Hamburg. Morgenmuſik. 00 : Funkgymuaſtik. 20 : Morgenmuſil auf Schallplatten. 00 : Für die Frau : Wir machen eine Pauſe ; Dr. Helene Buſch Elsner. 20 : Sendepauſe 10. 00 : Wetter und Waſſerſtand , Wirtſchaftsnachrichten und Tages programm. 10. 15 : Sendepauſe. 11. 00 : Werbenachrichten mit Schall - plattenkonzert. 11. 30 : Zeit , Nachrichten und Wetter. 11. 45 : Für den Bauer. 12. 00 : Muſik für die Arbeitspauſe. ( Schallplatten. ) 13. 00 : Zeit , Nachrichten und Wetter. 13. 10 : Mittagsmuſik der Dresdner Soliſten - Vereinigung. Daz wiſchen 14. 00 : richten und Börſe. 14. 50 : Sendepauſe. 15. 30 : Jugend und Letibesübungen : Einzelkampf - Mannſchaftskampf. Geſpräch zwiſchen Heinz Dietzſch und Heinz Mägerlein. Zeit. Nach 45. 50 : Wirtſchaftsnachrichten. 16. 10. Auf der Suche nach einem Weg. Buchbericht von Dr. Otto Görner. 16. 30 : Erlebniſſe zweier Leipziger Dichter während des Sieben - jährigen Krieges ; Prof. Dr. Erich Michael. 16. 50 : Zeit , Mitteldeutſche Wirt⸗ ſchaftsnachrichten. Aus Rio de Janeiro : Braſilianiſche Wirt - ſchaftsnachrichten. 00 : Nachmittagskonzert des Leip - ziger Sinfonieorcheſters. 18. 20 : Für die Jugend : Wie wir dem Oſterhaſen auf Fahrt be⸗ gegneten. Hörfolge von Liſelotte Haaſe ; ausgeführt von Leipziger Jungmädel. 18. 40 : Wilhelm von Tegetthoff , der Sieger von Liſſa ; Kpt. z. S. a. D. von Waldeyer - Hartz. 19. 00 : Aus Hamburg : Unterhaltung und Tanz 20. 00 : Nachrichten. 20. 10 : Aus Dresden : Orcheſter⸗ konzert. Werte von Bach und Händel. Die Dresdner Philhar - monie. 22. 00 : Nachrichten und Sportfunk. 22. 30 : Aus München : Nachtmuſik. Deutschlandsender Wellenlänge 1571 *. 90 : Guten Morgen , lieber Hörer ! Glockenſpiel , Tagesſpruch , Choral,. 05 : Fröhliches Schallgeplätſche x mit Hans Lorenz *. 00 : Alles antreten zur gymnaſtik !. 15 : Die fröhliche Muſik geht weiter Funk - - Hans Lorenz bleibt dabei. 00 : Morgenſtändchen für die Haus frau. Die Kapelle Herbert Fröh lich ſpielt. 00 : Sperrzeit. 10. 00 : Neueſte Nachrichten. 10. 15 : Sendepauſe 10. 50 : Fröhlicher Kindergarten. 11. 15 : Deutſcher Seewetterbericht. 11. 30 : Lied am Vormittag. Cläre Winzler , Geſang ; am Flügel : Werner Kirchhoff. 11. 40 : Der Bauer ſpricht Der Vower hört : Die Pflanzenzüchter n Müncheberg. Funkbericht. „ ließend : Wetterbericht. 12. 00 : Mittagskonzert aus Frankfurt 12. 55 : Zeitzeichen der Deutſchen See - warte. 13. 00 : Glückwünſche. 13. 10 : Hexereien auf der Geige. ( Schallplatten. ; 13. 45 : Neueſte Nachrichten. 14. 00 : Allerlei - von Zwei bis Drei. 14. 55 : Programmhinweiſe , Wetter - und Börſenberichte. Frau culs Elſe 15. 15 : Die deutſche Hüterin des Brauchtums ; Haacke und Hermann Nagel. 40 : Erzieherfragen : Die neue Schulgemeinde. Jugendwalterin und Leiter einer Schulgemeinde unterhalten ſich. 16. 00 : Aus Hamburg : mittag. 17. 20 : 10 Minuten Funktechnik. 17. 30 : Jugendſportſtunde. 17. 45 : Klavierwerke von Mozart. 18. 20 : Politiſche Zeitungsſchau des Drahtloſen Dienſtes. [ G Bunter Nach - 18. 40 : Kin nationaler Seehafen ; Carl Völckers. 19. 00 : Und jetzt iſt Feierabend ! Volkskomiker - Volksinſtrumente ( Schallplatten ) 20. 00 : Kernſpruch. Anſchl. : Wetter - bericht und Kurznachrichten des Drahtloſen Dienſtes. 20. 25 : Sigrid Onegin ſingt. 21. 00 : Funkexpedition nach der Süd - ſee. Manuſkript Wilhelm Zie - ſemer. Spielleitung : Heribert Grueger. 22. 00 : Wetter⸗ , Tages⸗ und Sport⸗ nachrichten. Anſchließend : Deutſchlandecho. 22. 45 : Deutſcher Seewetterbericht. 23. 00 : Wir bitten zum Tanz ! Oskar Jooſt ſpielt. J FRANZ TRAEGER Rannischestra be 23 Gegründet 1878 Weingroßshandlung e Ulrichstraße 51 Jetzt haben Sie Gelegenheit , das Versäumte nachzuholen ! Morgen Dienstag Neuaufführung des einzigartigen , ungewöhnlich schönen Ruclolf - Forster - Filmes Rudolf Forster bietet in Doppelrolle als Rittmeister Graf Werffen und als Schulreiter Cavelli eine Anerhörte schuuspfelerische Lelstung ! - Das Geheimnis des Carlo Cavelli. In den weiteren Hauptrollen begeistern Angela Safloker Hans Moser Der Roman eines groß. Kovoliers S kin külmisches Heisterwerk O das mit seinem seelisch vertietten Spiel packt bis zum versöhnenden Ausklang. Ein Erfolg guk der ganzen linie der sich ebenbürtig mit dem von. Maskerade “ Sopder - Auszeichnung : „ Künstlerisch wertvol ] Heute letzter Tag. Schützenkönig wird ger Feſt W Kauf Garan Nummern. Fußwohl , Kirchnerſtr. 182. Hagrarbeiten Perücken , Locken in fachgem. Ausführung. Niedermann , Gottesackerſtr. 12. ragnen frische rMorcheln zu zwei 40 Pf. Pfd. billiger Reicherts , Geiststr. 37 Sport - Arfile kür fahdall - , Tennis - Hockey - Spieler , Kuderer , Turner , Zöpfe , Warnung Jch warne mit jeden , Marta geb. Künas Geld oder Waren auf mein. da ich für keinerlei Zahlungen auf Steuden Halle a. S. haofadrer hier - sowie für meiner Leichtathlettk , Touristik und Wintersport empfiehlt in grober Auswahl sehr preiswert H. Schnee ſicht. d. F. Edermann faſte , Große Steinstr. 48 zu borg. , Schrader , in dersaale - Zeitung dröngen Erfolg i SChau burg Ab morgen Dienstag : Einer der besten Großfilme der neuen Spielzeitl 934 35 Der Spion des Kaisers Napoleon ist die Glanzrolle von Gustav Grüncägens Ein gefährlicher Spieler zwischen zwei Fronten in dem Großfilm 2 — ⸗ S h * ſchwarzer Nager Johanna Nach dem gleichnamigen Roman in der „ Berliner Mlustrirten Zeitung Spiel und Gegenspiel : Gustav Gründgens Marianne Hoppe Paul Hartmann Ein Meisterwerk , wie wir es in o qlückiicher , Kküntt - lerizeh. Ausgegliehenheit zeit langem nicht ahnen ! Die Jugend hat Zutritt Heute letzter Tag : „ Die 4 Musketiere Am Riobeciepiate Lachsalven über Halſe ! szenen von so kö ssſstlicher Komik , cab d. Lachmut kein kaum zur AGuhe kommen Also steigen Sie ein und machen Sie mit : An dieser lustigen Fahrt sind beteiligt : lanne Hat - Herm. Thimig Hans Moser - Leo Slezak Rudolf Carl - Fritz imhoff Musik und Schlager : — — g 7 d * * e - z z man ihn aut das für Sie ! gerichiet , finden dah kann , Man muh nur genau hinsehen , dann sieht schon. - schöne , Osferhasenspiel Veberraschungen , Unsere Vorbereitungen für ihren billigen Einkauf und unsere ungewöhnlich große Auswahl an OSTER Geschenken in allen Lägern ist Seit Wochen haben wir jeder für wenig Geld efwaes womit reuft sich schon und die die bevorsfehen ! Alles unsere Ueberreschung uns ein - er freude bereifetf ! Da steht man machtlos Vis - à Vis Da hilft kein Basteln und Probieren. da muß ein Fachmann hin , der lür wenige Pfennige den Schaden behebt Gute Klempnermeister aufend in der Saale - Zeitung Ottomar Brehmer Nachf. Weingrosßshandlung Halle a. , Leipziger Straße 43 , Märkerstraße 11 , Geiststrabe 11 Best gepflegte MWeiß - und Rotweine De * — r z r Erholungswerk de des See Ah Biks6br - Fabrik a Südwein e See Sekt Brehmerliköre Fernruf 265 00 Weinprobierstube r deutschen dolkes ar h zu soliden Preisen inserieren W Mandeln. Pfd. 80 Sultaninen. Pfd. 8 J Korinthen. 1 Pfd. 28. 5 I Aohn , auch gem 1 Pfd. 36 - & R Vanillezucker 3 Pak. 70 Weizenmebl , Type 790 , 1 Pfd. 27 Srieff. Pfd. 20 Mischobst , - Frucht 1 Pfd 48 gefr. Aprikosen 1 Pfd. 68 I Puddingpulver — mit Vanilie. , Pfd. m. Erdbeer. , Pfd. m. Schok. - Geschm. / Pfd. 15 Apfelmus ca. - Pfd. - Dose Pflaumen ca. - Pfd - Dose G. Gebr. Kaffee / Pfd. S Ostereiergefülit i Pfd. 14 Osterschok. 100 - r. - T. 25 Schok. - Hasen , Stck. 35 , 20 , 10 ,. 5 J Wäffeleier u. hasen 10 Stck. T J Trinkeier. Stck. 0 lohapnisbeerwein * Fl , o. O. 425 teidelbee,weln „ S J at Wermutwein ! Tarragona „ 8S0 Apfelsinen 10 Sfck. Z0 grohe Zitronen 3 Stck. 22 Bruchrels. 1 Pfd. 72 - I Male (. ) e e -. Für clie Festtaqgqe empfehle ich meine anerkannt gut gepflegte Rhein - , Pfalz - u. Moselweine , Bordeaux - , Burgunderweine , su⸗ welne u. * o ⸗ ine , 500 , Likcöre ienste ] * — e e n e e mieerte - hiand Aus der Stadt Halle Jahrgang 1935 / Nummer 89 Montag , 15. April mit der Sammelbüchſe unkerwegs 14 000 ſammelten am Volkstag der Inneren Miſſion und die Hallenſer ſpendeten freudig Das war alſo geſtern der Volkstag der Jnneren Miſſion , eine Veranſtal - tung der evangeliſchen Kirche , die in ganz Deutſchland durchgeführt wurde und , wie ſich nach den vorliegenden Berichten ſchon jetzt ſagen läßt , ähnlich wie im Vorjahr einen ſchönen Erfolg gezeitigt hat. Es handelte ſich darum , dieſen einen Tag , den Staat und Partei in großzügiger Weiſe freigegeben hatten , in vollem Umfange zu nutzen , um den Ausfall an Hauskollekten , wie ſie früher mo - natlich einmal geſammelt wurden , einiger - maßen wettzumachen und den Anſtalten der Jnneren Miſſion die Mittel zuzuführen , die ſie für die Fortführung ihrer Arbeit unbedingt brauchen. Jn Halle hatten ſich 1300 bis 1400 Sammler und Sammlerinnen zur Verfügung geſtellt. Jn ſämtlichen Gemeinden gingen die Pfarrer mit gutem Beiſpiel vor - an , ihnen folgten die Mitglieder der kirchlichen Körperſchaften , Frauenhilfen und Jugend - kreiſe , Kindergottesdienſthelfer und Konfir - manden. So ſtanden am Sonnabend und Sonntag Halles Straßen durchaus im Zeichen des Volkstages. Einen eindrucksvollen Ver - lauf nahmen beſonders die geſtrigen Ver - anſtaltungen , deren Höhepunkt eine Reihe von Platzkonzerten bildeten. Unter großer Beteiligung und bei ſchönſtem Wetter klangen Choräle und Marſchmelodien durch die Stadt. In dankenswerter Weiſe hatten ſich eine An⸗ zahl namhafter Kapellen , ebenſo Kirchenchöre und Gruppen des Sängerbundes in den Dienſt der guten Sache geſtellt. Den muſikaliſchen Darbietungen folgten jeweils auch kurze Anſprachen , die noch einmal in aller Oeffentlichkeit Zweck und Ziel der Jnneren Miſſion umriſſen und die Gebefreudigkeit an⸗ regten. Jn den Kirchen wurde wie vorgeſehen über die Jnnere Miſſion gepredigt ; ebenſo beſchäftigten ſich die Kindergottesdienſte mit dieſem Thema. Jntereſſant iſt es , den Volkstag einmal durch die Augen eines Sammlers anzuſehen. Erfreuliche und weniger erfreu - liche Erfahrungen ſpiegeln ſich in ſeinem Bericht wieder. Deutlich wird , daß die Hal - lenſer , von mehr ver weniger vereinzelten Ausnahmen abgeſehen , auch am getrigen Volkstag ihre Gebefreudigkeit unter Beweis geſtellt haben. Trotz der zahlreichen Samm - lungen für das Winterhilfswerk , die ganz von ſelbſt eine gewiſſe Müdigkeit zur Folge haben mußten , iſt geſtern gern und willig für die Jnnere Miſſion gegeben worden. Wir laſſen den Bericht des Sammlers folgen : „ Jch habe mir den Volkstag vom Standö - punkt eines Sammlers betrachtet , ließ mich alſo mit Büchſe und Ausweiskarte verſehen und verſuchte dann mein Glück bei den Hal - lenſern. Ganz einfach war das nicht , begann ich doch erſt am Sonntagmorgen mit dem Sammeln , nachdem alſo ſchon öden ganzen Sonnabend über Hunderte von anderen Sammlern und Sammlerinnen das Feld abgegraſt hatten und Tauſende von Abzeichen verkauft worden waren. Als ich mir die Straßenpaſſanten daraufhin anſah , hatten ſich die meiſten ſchon „ eingedeckt “. So ſtellte es ſich alſo ſehr bald heraus , daß es gar nicht ſo leicht ſein würde , die 50 Abzeichen , die man mir in der Stadötmiſſion gegeben hatte , an den Mann zu bringen. Zunächſt verſuchte ich mein Glück auf der Straße , ſprach den erſten beſten , der mir begegnete , an und bat um eine Spende. Der Angeredete wandte ſich wortlos beiſeite. Der nächſte war zwar freundlicher , verwies aber auf ein Abzeichen an ſeinem Mantel. Dann war ich für eine Zeitlang allein auf der Straße ; am frühen Sonntag - morgen iſt eben der Verkehr in der halliſchen Jnnenſtadt nicht allzu groß. So ſtellte ich mich auf Lokale um , denn warum ſollte nicht an dieſem vöer jenem Stammtiſch , der gerade mit einem Früh - ſchoppen begann , für die Jnnere Miſſion ein , vielleicht auch zwei Groſchen für meine Büchſe abfallen ? Und ſiehe da , ich hatte mich nicht getäuſcht. Schon fing es an zu klappern in meiner Büchſe , und die Zahl meiner Ab - zeichen hatte ſich von 50 auf 47 verringert. Das nächſte Reſtaurant war eine Frühſtücks - ſtube , wo der Verkehr freilich auch noch nicht recht begonnen hatte. Jmmerhin rief mich eine Kellnerin an den Ausſchank , erkundigte ſich nach dem Zweck der Sache und kaufte eine Anſtecknadel. Die erſte Ueberraſchung an dieſem Sonntagmorgen ! Aber das wieder - holte ſich mehr als einmal : wo man es am wenigſten erwartete , war die Bereitwilligkeit , zu geben , am größten , während in anderen Fällen mürriſche und abweiſende Geſichter gezeigt wurden.
| 17,272 |
https://github.com/mendrik/feather/blob/master/test/test-head.ts
|
Github Open Source
|
Open Source
|
Apache-2.0
| 2,017 |
feather
|
mendrik
|
TypeScript
|
Code
| 257 | 836 |
/// <reference path='../out/javascripts/feather.d.ts' />
/// <reference path='../out/javascripts/demo.d.ts' />
const fs = require('fs'),
jsdom = require('jsdom'),
sinon = require('sinon'),
glob = require('glob'),
path = require('path')
const {JSDOM} = jsdom
const virtualConsole = new jsdom.VirtualConsole()
virtualConsole.sendTo(console, {omitJSDOMErrors: true})
import * as chai from 'chai'
chai.should()
chai.use(require('sinon-chai'))
const mockResponse = (server, url, file) => {
const ok = [200, { 'Content-type': 'application/json' }, fs.readFileSync(file, 'utf8')]
server.respondWith('GET', url, ok)
server.respondWith('POST', url, ok)
server.respondWith('DELETE', url, ok)
server.respondWith('PUT', url, ok)
}
const htmlSource = fs.readFileSync('test/pages/application.html', 'utf8')
const loadPage = () => new Promise((resolve, reject) => {
const dom = new JSDOM(htmlSource, {
resources: 'usable',
runScripts: 'dangerously',
virtualConsole: virtualConsole,
includeNodeLocations: true
})
const window = dom.window
window.XMLHttpRequest = sinon.useFakeXMLHttpRequest()
window.requestAnimationFrame = (func) => func()
sinon.xhr.supportsCORS = true
window['localStorage'] = {
getItem: (key: string) => this[key],
setItem: (key: string, val: any) => this[key] = val
}
window['matchMedia'] = (query: string) => ({
addListener: () => 0
})
window.document.requestAnimationFrame = (fn) => fn()
window.document.createRange = () => ({
createContextualFragment: (source) => {
const doc = window.document,
template = doc.createElement('template')
template.innerHTML = source
return doc.importNode((template as any).content, true)
}
})
const server = module.exports.server = sinon.fakeServer.create({
autoRespond: true,
autoRespondAfter: 1
})
glob.sync(__dirname + '/xhr/*.json').forEach((file) => {
const data = path.parse(file),
url = '/' + data.name.replace('-', '/')
mockResponse(server, url, './test/xhr/' + data.base)
})
window.document.addEventListener('DOMContentLoaded', () => {
if (window.document.readyState === 'complete') {
dom.reconfigure({ url: 'https://example.com/' })
resolve(window.window)
}
})
})
const featherStart = async () => loadPage().then((window: any) => {
try {
window.blockRouting = true
window.feather.start()
} catch (e) {
console.log(e)
}
return window
})
export {featherStart, loadPage}
| 40,048 |
https://ar.wikipedia.org/wiki/%D9%86%D8%A7%D9%81%D8%A7%D8%AA%D9%8A%D8%AE%D8%A7%D8%B1%D9%8A%D8%B3
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
نافاتيخاريس
|
https://ar.wikipedia.org/w/index.php?title=نافاتيخاريس&action=history
|
Arabic
|
Spoken
| 43 | 158 |
بلدية نافاتيخاريس (بالإسبانية: Navatejares) هي بلدية تقع في مقاطعة آبلة التابعة لمنطقة قشتالة وليون وسط إسبانيا.
الديموغرافيا
بلغ عدد سكان بلدية نافاتيخاريس 70 نسمة عام 2011 (وفقاً للمعهد الوطني للإحصاء الإسباني).
مراجع
مصادر
الموقع الرسمي لبلدية نافاتيخاريس
أماكن مأهولة في آبلة
بلديات آبلة
| 19,201 |
https://es.stackoverflow.com/questions/245781
|
StackExchange
|
Open Web
|
CC-By-SA
| 2,019 |
Stack Exchange
|
Pablo Andres Gutierrez Guerrer, gbianchi, https://es.stackoverflow.com/users/119161, https://es.stackoverflow.com/users/324
|
Danish
|
Spoken
| 1,931 | 6,972 |
Como usar el valor de una variable que se lleno en un metodo, desde otro metodo
Tengo la siguiente clase en la cual defino la siguientes variables al inicio de la misma
public class generarFactura {
String IMG = "C:\\PAM\\Facturador Electronico\\Repositorio\\FacturadorPAM\\57b29c1e5891\\web\\Resources\\img\\logo.png";
base64 convertirBase64 = new base64();
final String RUTA_PDF = "C:\\PAM\\Facturador Electronico\\Repositorio\\FacturadorPAM\\57b29c1e5891\\PDF";
final String CSS = "C:\\PAM\\Facturador Electronico\\Repositorio\\FacturadorPAM\\57b29c1e5891\\web\\documentos\\style.css";
//NOMBRE DE PRUEBA
String nombreArchivo = "prueba.pdf";
// Variables para agregar al PDF
public int numeroResolInicial;
private int numeroResolFinal;
private String nroResolucion;
public int tipoTransaccion;
int idCliente;
private String nombreCliente;
private String direcCliente;
private String telCliente;
private String tipoDocCliente;
private String docCliente;
private String emailCliente;
private String municipio;
private String departamento;
private double valDescuento;
private double valIVA;
private double valICA;
private double valReteFUENTE;
private double valReteIVA;
private double valReteICA;
private double valorNeto;
private double valorBruto;
private String subTotal;
private String valFinalFactura;
public String fechaExpedicion;
public String fechaVencimiento;
private int formaPago;
public String observacion;
public String factura;
private ArrayList<String> prodValor = new ArrayList<>();
private ArrayList<Integer> prodId = new ArrayList<>();
private ArrayList<String> descProdValor = new ArrayList<>();
private ArrayList<Integer> cantProdValor = new ArrayList<>();
private ArrayList<Double> vUnitProdValor = new ArrayList<>();
private ArrayList<Integer> descuentoProdValor = new ArrayList<>();
private ArrayList<Integer> impIVAValor = new ArrayList<>();
private ArrayList<Integer> impRetencionValor = new ArrayList<>();
private ArrayList<Integer> impICAValor = new ArrayList<>();
private ArrayList<Double> ValorTotal = new ArrayList<>();
private ArrayList<Integer> LreteIVA = new ArrayList<>();
private ArrayList<Integer> LreteICA = new ArrayList<>();
private ArrayList<Double> calValFinal = new ArrayList<>();
Image logo;
DecimalFormat formateo = new DecimalFormat("###,###,###.##");
public boolean generarFactura(factura tipoFactura, //tipo de formato a generar
factura cliente, //datos del cliente
Integer medioPago,
String fechaExpedicion, //fecha de expedicion
String fechaVencimiento,
String observacion, //observaciones de la factura
JSONArray producto, //JSONArray de productos
JSONArray descProducto, //JSONArray descripcion Productos
JSONArray cantProducto, //JSONArray cantidad Productos
JSONArray vUnitario, //JSONArray valor unitario Productos
JSONArray descuentoProd, //JSONArray descuento por Producto
JSONArray impIVA, //JSONArray impuesto IVA por Producto
JSONArray reteIVA,
JSONArray impRetencion, //JSONArray impuesto retencion por Producto
JSONArray impICA, //JSONArray impuesto ICA por producto
JSONArray reteICA,
JSONArray valorTotal) { //JSONArray valores totales por Producto
boolean result = false;
String sql;
String formatoFactura = null;
queriesSQL queries = new queriesSQL();
conexionBD dataBase = new conexionBD();
Connection conn;
PreparedStatement stmt;
ResultSet rs;
this.fechaExpedicion = fechaExpedicion;
this.fechaVencimiento = fechaVencimiento;
this.formaPago = medioPago;
this.observacion = observacion;
//creamos una instancia para agregar el logo
try {
logo = Image.getInstance(IMG, true);
} catch (BadElementException | IOException ex) {
Logger.getLogger(generarFactura.class.getName()).log(Level.SEVERE, null, ex);
}
//traemos el formato del tipo de documento que vamos a generar desde la BD
try {
Class.forName("com.microsoft.sqlserver.jdbc.SQLServerDriver");
sql = queries.getConsulta("traerFormato");
conn = dataBase.getConnection();
stmt = conn.prepareStatement(sql);
stmt.setString(1, tipoFactura.getTipoFactura());
rs = stmt.executeQuery();
if (rs.next()) {
tipoFactura.setFormatoFactura(rs.getString("formato"));
//asignamos el idTipoTransaccion a la variable global
tipoTransaccion = rs.getInt("id_tipo_factura");
result = true;
}
//decodificamos el formato en BASE64
formatoFactura = convertirBase64.decoder(rs.getObject(3).toString());
try {
dataBase.closeConnection(conn, stmt, rs);
} catch (SQLException e) {
Logger.getLogger(generarFactura.class.getName()).log(Level.SEVERE, null, e);
}
} catch (ClassNotFoundException | SQLException e) {
Logger.getLogger(generarFactura.class.getName()).log(Level.SEVERE, null, e);
}
//Llamamos al metodo que genera el documento PDF
generarPDF(formatoFactura, cliente, fechaExpedicion, fechaVencimiento, observacion, producto, descProducto, cantProducto, vUnitario, descuentoProd, impIVA, reteIVA, impRetencion, impICA, reteICA, valorTotal);
return result;
}
public boolean generarPDF(String formato, factura cliente, String fechaExpedicion, String fechaVencimiento, String observacion, JSONArray producto, JSONArray descProducto, JSONArray cantProducto, JSONArray vUnitario, JSONArray descuentoProd, JSONArray impIVA, JSONArray reteIVA, JSONArray impRetencion, JSONArray impICA, JSONArray reteICA, JSONArray valorTotal) {
boolean generoPDF = false;
String frtDiligenciado = null;
StringBuilder frtoBuilder = null;
frtoBuilder = new StringBuilder(formato);
String sql;
queriesSQL queries = new queriesSQL();
conexionBD dataBase = new conexionBD();
Connection con;
PreparedStatement stmt;
ResultSet rs;
try {
//paso 2 generacion documento
try ( //paso 1 generacion archivo
OutputStream archivo = new FileOutputStream(new File(RUTA_PDF, nombreArchivo))) {
//paso 2 generacion documento
Document documento = new Document();
//paso 3 generacion del archivo PDF
PdfWriter pdf = PdfWriter.getInstance(documento, archivo);
//paso 4 abrimos el documento
documento.open();
try {
Class.forName("com.microsoft.sqlserver.jdbc.SQLServerDriver");
sql = queries.getConsulta("listarCabeceraFactura");
con = dataBase.getConnection();
stmt = con.prepareStatement(sql);
stmt.setString(1, cliente.getNombreCliente());
rs = stmt.executeQuery();
if (rs.next()) {
//regimenCliente = rs.getInt("regimen");
this.idCliente = rs.getInt("id_cliente");
nombreCliente = rs.getString("nombre");
direcCliente = rs.getString("dirección");
telCliente = rs.getString("celular");
tipoDocCliente = rs.getString("concepto");
docCliente = rs.getString("documento");
emailCliente = rs.getString("email");
municipio = rs.getString("municipio");
departamento = rs.getString("departamento");
}
//llamamos los numeros de resolucion
try {
String sqlNroResol;
queriesSQL qNroResol = new queriesSQL();
conexionBD dbNroResol = new conexionBD();
Class.forName("com.microsoft.sqlserver.jdbc.SQLServerDriver");
sqlNroResol = qNroResol.getConsulta("numeracionFactura");
Connection conNroResol = dbNroResol.getConnection();
PreparedStatement psNroResol = conNroResol.prepareStatement(sqlNroResol);
ResultSet rsNroResol = psNroResol.executeQuery();
if (rsNroResol.next()) {
// asignamos los numeros de resoluciones inicial-final a las variables globlales y despues operaralas
numeroResolInicial = rsNroResol.getInt("numero_resol_inicial");
numeroResolFinal = rsNroResol.getInt("numero_resol_final");
// pasamos a String la resolucion para añadir al PDF
nroResolucion = String.valueOf(numeroResolInicial);
}
try {
dataBase.closeConnection(conNroResol, psNroResol, rsNroResol);
} catch (SQLException e) {
Logger.getLogger(generarFactura.class.getName()).log(Level.SEVERE, null, e);
}
} catch (ClassNotFoundException | SQLException ex2) {
Logger.getLogger(generarFactura.class.getName()).log(Level.SEVERE, null, ex2);
}
frtoBuilder.append("<table id='cuerpoFactura'><tr><td class='cuerpotd'>REFERENCIA</td><td class='cuerpotd' id='tdTituloDescripcion'>DESCRIPCION</td><td class='cuerpotd'>CANTIDAD</td><td class='cuerpotd'>DESCUENTO</td><td class='cuerpotd'>IVA</td><td class='cuerpotd'>V/R UNITARIO</td><td class='cuerpotd'>VALOR TOTAL</td></tr>");
//Convertimos todos los JSONArray a ArrayList en Java
try {
for (int i = 0; i < producto.length(); i++) {
prodId.add(producto.getJSONObject(i).getInt("id"));
prodValor.add(producto.getJSONObject(i).getString("valor"));
}
for (int i = 0; i < descProducto.length(); i++) {
descProdValor.add(descProducto.getJSONObject(i).getString("valor"));
}
for (int i = 0; i < cantProducto.length(); i++) {
cantProdValor.add(cantProducto.getJSONObject(i).getInt("valor"));
}
for (int i = 0; i < vUnitario.length(); i++) {
vUnitProdValor.add(vUnitario.getJSONObject(i).getDouble("valor"));
}
for (int i = 0; i < descuentoProd.length(); i++) {
descuentoProdValor.add(descuentoProd.getJSONObject(i).getInt("valor"));
}
for (int i = 0; i < impIVA.length(); i++) {
impIVAValor.add(impIVA.getJSONObject(i).getInt("valor"));
}
for (int i = 0; i < reteIVA.length(); i++) {
LreteIVA.add(reteIVA.getJSONObject(i).getInt("valor"));
}
for (int i = 0; i < impRetencion.length(); i++) {
impRetencionValor.add(impRetencion.getJSONObject(i).getInt("valor"));
}
for (int i = 0; i < impICA.length(); i++) {
impICAValor.add(impICA.getJSONObject(i).getInt("valor"));
}
for (int i = 0; i < reteICA.length(); i++) {
LreteICA.add(reteICA.getJSONObject(i).getInt("valor"));
}
for (int i = 0; i < valorTotal.length(); i++) {
ValorTotal.add(valorTotal.getJSONObject(i).getDouble("valor"));
}
} catch (JSONException ex) {
Logger.getLogger(generarFactura.class.getName()).log(Level.SEVERE, null, ex);
}
//Recorremos todos los ArrayList para agregarlos al Formato PDF
for (int i = 0; i < prodValor.size(); i++) {
System.out.println("prodcuto: " + prodValor.get(i));
frtoBuilder.append("<tr><td class='cuerpotd2'>").append(prodValor.get(i)).append("</td>");
for (String descProdValor1 : descProdValor) {
System.out.println("descripcionProducto: " + descProdValor.get(i));
frtoBuilder.append("<td class='cuerpotd2' id='tdDescripcion'>").append(descProdValor.get(i)).append("</td>");
break;
}
for (Integer cantProdValor1 : cantProdValor) {
System.out.println("cantidadProd: " + cantProdValor.get(i));
frtoBuilder.append("<td class='cuerpotd2' >").append(cantProdValor.get(i).toString()).append("</td>");
break;
}
for (Integer descuentoProdValor1 : descuentoProdValor) {
System.out.println("descuentoProd: " + descuentoProdValor.get(i));
frtoBuilder.append("<td class='cuerpotd2'>").append(descuentoProdValor.get(i).toString()).append(" %").append("</td>");
break;
}
for (Integer impIVAValor1 : impIVAValor) {
System.out.println("impIVAProd: " + impIVAValor.get(i));
frtoBuilder.append("<td class='cuerpotd2'>").append(impIVAValor.get(i).toString()).append(" %").append("</td>");
break;
}
for (Integer LreteIVA1 : LreteIVA) {
System.out.println("ReteIVAProd: " + LreteIVA.get(i));
break;
}
for (Integer impRetencionValor1 : impRetencionValor) {
System.out.println("impRetencionProd: " + impRetencionValor.get(i));
break;
}
for (Integer impICAValor1 : impICAValor) {
System.out.println("impICAProd: " + impICAValor.get(i));
break;
}
for (Integer LreteICA1 : LreteICA) {
System.out.println("ReteICAProd: " + LreteICA.get(i));
break;
}
for (Double vUnitProdValor1 : vUnitProdValor) {
//CALCULO DE LOS VALORES PARA REALIZAR LAS RESPECTIVAS OPERACIONES DE LA FACTURACION
double valorUnitario = vUnitProdValor.get(i);
valDescuento = ((descuentoProdValor.get(i) * 1.0) / 100) * vUnitProdValor.get(i);
valIVA = vUnitProdValor.get(i) * (impIVAValor.get(i) * 1.0 / 100);
valICA = vUnitProdValor.get(i) * (impICAValor.get(i) * 1.0 / 100);
valReteFUENTE = vUnitProdValor.get(i) * (impRetencionValor.get(i) * 1.0 / 100);
valReteIVA = valIVA * (LreteIVA.get(i) * 1.0 / 100);
valReteICA = valICA * (LreteICA.get(i) * 1.0 / 100);
valorBruto = vUnitProdValor.get(i) - valDescuento;
valorNeto = (valorBruto + valIVA) - valICA - valReteFUENTE - valReteIVA - valReteICA;
//añadimos el valorNeto al nuevo array para operar despues
calValFinal.add(valorNeto);
System.out.println("ValorUnitario: " + vUnitProdValor.get(i));
System.out.println("Descuento: " + valDescuento);
System.out.println("iva: " + valIVA);
System.out.println("ica: " + valICA);
System.out.println("reteFuente: " + valReteFUENTE);
System.out.println("calcreteIVA: " + valReteIVA);
System.out.println("calcreteICA: " + valReteICA);
System.out.println("valor total: " + valorNeto);
frtoBuilder.append("<td class='cuerpotd2'>").append("$ ").append(formateo.format(valorUnitario)).append("</td>");
break;
}
for (Double ValorTotal1 : ValorTotal) {
double valorTotal1 = ValorTotal.get(i);
System.out.println("valorTotalProd: " + ValorTotal.get(i));
frtoBuilder.append("<td class='cuerpotd2'>").append("$ ").append(formateo.format(valorTotal1)).append("</td>");
break;
}
frtoBuilder.append("</tr>");
}
//calculamos el subtotal de los productos
double subTotalProd = 0;
for (Double ValorTotal1 : ValorTotal) {
subTotalProd += ValorTotal1;
System.out.println("subTotal: " + subTotalProd);
subTotal = String.valueOf(formateo.format(subTotalProd));
}
//Despues de operados los valores, sumamos todos los valores para calcular el valor final de la Factura
double calcValFinal = 0;
for (int i = 0; i < calValFinal.size(); i++) {
calcValFinal += calValFinal.get(i);
System.out.println("valor final: " + calcValFinal);
valFinalFactura = String.valueOf(formateo.format(calcValFinal));
}
frtoBuilder.append("</table><table id='pieFactura'><tr><td id='tdObservacion'>Observaciones : <br/> TAG_OBSERVACIONES</td><td><table id='valores'><tr><td class='pietd'>SUBTOTAL</td><td>TAG_SUBTOTAL</td></tr><tr><td class='pietd'>TOTAL</td><td class='pietd'>TAG_MONEDA</td><td>TAG_VALOR_FINAL</td></tr></table></td></tr></table>");
frtDiligenciado = frtoBuilder.toString();
System.out.println(fechaVencimiento);
//llamamos los datos de la BD y reemplazamos por los TAGS del archivo
String p = String.valueOf(tipoTransaccion);
frtDiligenciado = frtDiligenciado.replace("TAG_NOMBRE_CLIENTE", nombreCliente)
.replace("TAG_DIR_CLIENTE", direcCliente)
.replace("TAG_TEL_CLIENTE", telCliente)
.replace("TAG_TDOC_CLIENTE", tipoDocCliente)
.replace("TAG_DOC_CLIENTE", docCliente)
.replace("TAG_EMAIL_CLIENTE", emailCliente)
.replace("TAG_CIUDAD_CLIENTE", municipio)
.replace("TAG_DEPART_CLIENTE", departamento)
.replace("TAG_FECHA_EXPEDICION", fechaExpedicion)
.replace("TAG_OBSERVACIONES", observacion)
.replace("TAG_NUM_RESOLUCION", nroResolucion)
.replace("TAG_LOGO", p)
.replace("TAG_FECHA_VENCIMIENTO", fechaVencimiento)
.replace("TAG_SUBTOTAL", "$ " + subTotal)
.replace("TAG_VALOR_FINAL", "$ " + valFinalFactura);
factura = convertirBase64.encoderFormato(frtDiligenciado);
} catch (ClassNotFoundException | SQLException ex) {
Logger.getLogger(generarFactura.class.getName()).log(Level.SEVERE, null, ex);
}
//seteamos el tamaño y la alineacion del logo y lo agregamos al documento
logo.setAlignment(Element.ALIGN_TOP);
logo.setAbsolutePosition(28f, 765f);
logo.scaleAbsolute(140f, 35f);
documento.add(logo);
//implementacion CSS
InputStream fileCSS = new FileInputStream(CSS);
//implementacion HTML
InputStream origen = new ByteArrayInputStream(frtDiligenciado.getBytes());
// parsear HTML a PDF
XMLWorkerHelper.getInstance().parseXHtml(pdf, documento, origen, fileCSS);
// cerrar documento y archivo
documento.close();
}
generoPDF = true;
} catch (FileNotFoundException e) {
Logger.getLogger(generarFactura.class.getName()).log(Level.SEVERE, null, e);
} catch (DocumentException | IOException e) {
Logger.getLogger(generarFactura.class.getName()).log(Level.SEVERE, null, e);
}
return generoPDF;
}
public boolean guardarCabeceraFactura() {
boolean result = false;
System.out.println(this.fechaExpedicion);
System.out.println(fechaExpedicion);
System.out.println(fechaVencimiento);
System.out.println(numeroResolInicial);
System.out.println("idcliente: "+idCliente);
System.out.println(tipoTransaccion);
System.out.println(factura);
return result;
}
public boolean guardarDetalleFactura() {
boolean result = false;
return result;
}
}
todas estas variables las lleno en los metodos generarFactura() y generarPDF(), sin embargo quiero utilizarlas en el metodo guardarCabeceraFactura() sin embargo ya no traen el valor, alguien me puede decir que error estoy cometiendo.
De antemano gracias a todos.
Aqui esta la instancia
===========================
factura f = new factura();
generarFactura gf = new generarFactura();
int boton = jObj.getInt("boton");
if (boton == 1) {
System.out.println("entro al boton 1");
f.setTipoFactura(jObj.getString("tipoFactura"));
f.setNombreCliente(jObj.getString("cliente"));
Integer medioPago = jObj.getInt("metodo_pago");
// f.setMoneda(jObj.getInt("moneda"));
String fechaVenc = jObj.getString("fechaVencimiento");
String fechaExp = jObj.getString("fechaExpedicion");
String observacion = jObj.getString("observacion");
JSONArray producto = jObj.getJSONArray("producto");
JSONArray descProducto = jObj.getJSONArray("descripcion");
JSONArray cantProducto = jObj.getJSONArray("cantidad");
JSONArray vUnitario = jObj.getJSONArray("valorUnitario");
JSONArray descuentoProd = jObj.getJSONArray("descuento");
JSONArray impIVA = jObj.getJSONArray("impIVA");
JSONArray impRetencion = jObj.getJSONArray("impuestoRetencion");
JSONArray impICA = jObj.getJSONArray("impICA");
JSONArray valorTotal = jObj.getJSONArray("valorTotal");
JSONArray reteIVA = jObj.getJSONArray("reteIVA");
JSONArray reteICA = jObj.getJSONArray("reteICA");
boolean gfPDF = gf.generarFactura(f, f, medioPago, fechaExp,
fechaVenc, observacion, producto, descProducto,
cantProducto, vUnitario, descuentoProd, impIVA, reteIVA,
impRetencion, impICA, reteICA, valorTotal);
if (gfPDF) {
respuesta = "{result: " + "ok}";
} else {
respuesta = "{result: " + "ERROR}";
}
} else if (boton == 2) {
System.out.println("entro al boton 2");
boolean gfGuardaFactura = gf.guardarCabeceraFactura();
if (gfGuardaFactura) {
respuesta = "{result: " + "ok}";
} else {
respuesta = "{result: " + "ERROR}";
}
}
System.out.println(respuesta);
JSONObject jsonGFPDF = new JSONObject(respuesta);
response.setContentType("application/json");
response.setCharacterEncoding("UTF-8");
response.getWriter().write(jsonGFPDF.toString());
Todas esas variables deberian existir en todos los metodos que decis, siempre y cuando estes usando la misma instancia del objeto que creaste. Podrias mostrar como haces las llamadas?
Primero que todo gracias!, ya agregue lo que me pediste
Tu problema es totalmente de logica.
tu metodo crea una nueva factura cada vez que entra:
Al hacer
generarFactura gf = new generarFactura();
Estas creando una nueva instancia de un objeto, distinto al que usaste antes. Es mas, el que creaste al apretar el boton uno, desaparecio una vez que terminaste de usarlo.
Si quisieras usar siempre la misma factura, deberias definirla a un nivel mas alto y crearla solamente cuando apretas crear factura, y en los otros metodos controlar que exista.
Notas al margen
Porque tu metodo GenerarFactura recibe 2 veces el mismo parametro f?
porque haces esto? respuesta = "{result: " + "ok}"; que es lo mismo que esto? respuesta = "{result: ok}";
Gracias por la observacion, hice caso y declare la instancia del objeto en un nivel superior.
Frente a las observaciones , el metodo generarFactura recibe dos veces el parametro F, por que hace referencia a una clase
y Por lo otro solo fue forma de como se ha manejado la respuesta,
Gracias por tu ayuda
@PabloAndresGutierrezGuerrer por favor lee el [tour]. Es importante que sepas como funciona el sitio para que recibas siempre mejores respuestas.No tiene ningun sentido que mandes dos veces f.
| 27,039 |
https://bpy.wikipedia.org/wiki/%E0%A6%8F%E0%A6%B2%E0%A6%95%E0%A7%8B%20%E0%A6%95%E0%A6%BE%E0%A6%89%E0%A6%A8%E0%A7%8D%E0%A6%9F%E0%A6%BF%2C%20%E0%A6%A8%E0%A7%87%E0%A6%AD%E0%A6%BE%E0%A6%A1%E0%A6%BE
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
এলকো কাউন্টি, নেভাডা
|
https://bpy.wikipedia.org/w/index.php?title=এলকো কাউন্টি, নেভাডা&action=history
|
Bishnupriya Manipuri
|
Spoken
| 84 | 583 |
এলকো কাউন্টি (ইংরেজি:Elko County), এহান তিলপারাষ্ট্র বা মার্কিন যুক্তরাষ্ট্রর পিছ বারার টেঙারা লয়াগর নেভাডা ষ্টেইট/রাজ্যর কাউন্টি আহান।
ভৌগলিক উপাত্ত
শহর এহার মাপাহানর অক্ষাংশ বারো দ্রাঘিমাংশ ইলতাই । আয়তনহান (হুকানা বারো পানিহান পুলকরিয়া): ১৭২০২.৯৪ বর্গমাইল, অতার মা পানিহান ২৩.৯১ বর্গমাইল (০.১৪%) বারো হুকানাহান ১৭১৭৯.০৩ বর্গমাইল।
জনসংখ্যার উপাত্ত
তিলপারাষ্ট্রর (যুক্তরাষ্ট্র) ২০০০ মারির মানুলেহা (লোক গননা) অনুসারে এলকো কাউন্টি-র জনসংখ্যা ইলাতাই ৪৫,২৯১ গ। ১৮,৪৫৬গ ঘরর ইউনিট আসে। হারি বর্গ মাইলে ১.১গ ঘর পরিসে বারো হারি বর্গ মাইলে ২.৬গ মানু থাইতারা।
পাসিতা
তিলপারাষ্ট্রর প্রশাসনিক লয়াগি
নেভাডা রাজ্যর কাউন্টিহানি
| 26,642 |
https://stackoverflow.com/questions/47425156
|
StackExchange
|
Open Web
|
CC-By-SA
| 2,017 |
Stack Exchange
|
DoesData, TOLULOPE ADETULA, code.cycling, https://stackoverflow.com/users/7245977, https://stackoverflow.com/users/8469870, https://stackoverflow.com/users/8692954
|
English
|
Spoken
| 230 | 719 |
How do I set the displayName of Firebase user using angular 4?
I have been trying to get the value of the displayName for my users that sign up using Email and password, It always gives me null.
This is my AuthService
@Injectable()
export class AuthService {
authState: any = null;
user$: Observable<firebase.User>;
constructor(private afAuth: AngularFireAuth,
private db: AngularFireDatabase,
private route: ActivatedRoute,
private userService: UserService) {
this.user$ = this.afAuth.authState;
this.afAuth.authState.subscribe((auth) => {
this.authState = auth;
});
}
signUp(email, password) {
this.afAuth.auth.createUserWithEmailAndPassword(email, password)
.then((user) => {
this.authState = user;
})
.catch(error => console.log(error));
}
private updateUserData(): void {
const path = `users/${this.currentUserId}`; // Endpoint on firebase
const data = {
email: this.authState.email,
name: this.authState.displayName
};
this.db.object(path).update(data)
.catch(error => console.log(error));
}
this is my signup.ts
export class SignupComponent implements OnInit {
constructor(private auth: AuthService,
private user: UserService) { }
ngOnInit() {
}
onSignup(form: NgForm) {
const user = firebase.auth().currentUser;
user.updateProfile({
displayName: form.value.username,
photoURL: 'https://example.com/jane-q-user/profile.jpg'
})
.then(function(response) {
const displayName = user.displayName;
}, function(error) {
console.log(error);
});
const name = form.value.username;
const email = form.value.email;
const password = form.value.password;
this.auth.signUp(email, password);
I don't know how I can use the name gotten from the signUp form and make it to the displayName for a firebase.user
Look at this https://stackoverflow.com/questions/37619609/update-user-information-in-firebase
please refrain from using the angularjs tag if your question is about angular
I'm still getting error 'Cannot read property 'updateProfile' of null
at SignupComponent'
| 23,433 |
https://en.wikipedia.org/wiki/Zhang%20Di
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Zhang Di
|
https://en.wikipedia.org/w/index.php?title=Zhang Di&action=history
|
English
|
Spoken
| 106 | 172 |
Zhang Di (Chinese: 张迪) is a female Chinese Judoka. She competed at the 1992 Barcelona Olympic Games and won a bronze medal in Women's 61 kg.
References
External links
Olympic bronze medalists for China
Living people
Olympic medalists in judo
Asian Games medalists in judo
Year of birth missing (living people)
Judoka at the 1990 Asian Games
Judoka at the 1994 Asian Games
Chinese female judoka
Medalists at the 1992 Summer Olympics
Asian Games gold medalists for China
Asian Games bronze medalists for China
Medalists at the 1990 Asian Games
Medalists at the 1994 Asian Games
Olympic judoka for China
Judoka at the 1992 Summer Olympics
| 27,464 |
https://openalex.org/W4396585227
|
OpenAlex
|
Open Science
|
CC-By-SA
| 2,021 |
Design Monthly Report Application in The Sub Division of Evaluation Planning and Reporting of The Department of Education and Culture of Bengkulu Province
|
Andry Ardian
|
Unknown
|
Spoken
| 3,648 | 8,573 |
Rancang Bangun Aplikasi Laporan Bulanan pada Sub Bagian
Perencanaan Evaluasi dan Pelaporan Dinas Pendidikan dan
Kebudayaan Provinsi Bengkulu Andry Ardian1); Leni Natalia Zulita2); Reno Supardi2)
1)Study Program of Informatics Faculty of Computer Science Universitas Dehasen Bengkulu
2) Department of Informatics, Faculty of Computer Science, Universitas Dehasen Bengkulu
Email: 1) [email protected] Andry Ardian1); Leni Natalia Zulita2); Reno Supardi2)
1)Study Program of Informatics Faculty of Computer Science Universitas Dehasen Bengkulu
2) Department of Informatics, Faculty of Computer Science, Universitas Dehasen Bengkulu
Email: 1) [email protected] How to Cite :
Ardian, A., Zulita, L. N., Supradi, R. (2021). Design Monthly Report Application in The Sub Division of
Evaluation Planning and Reporting of The Department of Education and Culture of Bengkulu
Province. JURNAL Komitek, 1(1). DOI: https://doi.org/10.53697/jkomitek.v1i1 ABSTRAK ARTICLE HISTORY
Received [10 Mei 2021]
Revised [08 Juni 2021]
Accepted [25 Juni 2021] ARTICLE HISTORY
Received [10 Mei 2021]
Revised [08 Juni 2021]
Accepted [25 Juni 2021] ARTICLE HISTORY
Received [10 Mei 2021]
Revised [08 Juni 2021]
Accepted [25 Juni 2021] Dalam proses pengelolaan data laporan bulanan kegiatan di
Lingkungan Dinas Pendidikan dan Kebudayaan Provinsi Bengkulu
belum mempunyai suatu aplikasi khusus yang dapat membantu
mengolah data serta menyimpan data secara otomatis. Hal ini
menyulitkan dan rentan terjadi kesalah perhitungan ketika ingin
membuat rekapan laporan bulanan, mengingat Dinas Pendidikan dan
Kebudayaan adalah salah satu instansi dengan jumlah kegiatan
terbanyak di pemerintahan Provinsi Bengkulu, oleh karena itu
dibutuhkan suatu aplikasi yang dapat membantu mengolah data
serta dapat menyimpan data hasil dari olahan tersebut. maka dari itu
di buatlah suatu Aplikasi Laporan Bulanan Menggunakan Aplikasi
Visual Basic. Net 2010 dan database SQL 2008 untuk mempermudah
penginputan laporan bulanan pada Instansi Dinas Pendidikan dan
kebudayaan Provinsi Bengkulu KEYWORDS
Application Monthly Report,
Visual Basic.Net 2010. SQL 2008 database This is an open access article under the
CC–BY-SA license 52 | Andry Ardian, Leni Natalia Zulita, Reno Supardi; Design Monthly Report Application in... ISSN: ISSN: e-ISSN : ABSTRACT ABSTRACT
In the process of managing monthly report data activities in the
Environment Department of Education and Culture of Bengkulu Province
does not have a special application that can help process data and store
data
automatically. This
makes
it
difficult
and
vulnerable
to
miscalculation when wanting to make a recap of monthly reports,
considering the Department of Education and Culture is one of the
agencies with the largest number of activities in the government of
Bengkulu Province, therefore it takes an application that can help process
data and can store data from the processed. therefore, an application is
needed that can help process data and can store data from the processed. therefore, create a Monthly Report Application Using Visual Basic
Applications. Net 2010 and SQL 2008 database to facilitate the input of
monthly reports at the Department of Education and Culture of Bengkulu
Province . 52 | Andry Ardian, Leni Natalia Zulita, Reno Supardi; Design Monthly Report Application in... Implementasi teknologi informasi dan komunikasi yang kian meluas, telah memberikan
banyak manfaat yang juga telah berimplikasi luas, terkait kinerja, performance usaha, kualitas
layanan yang makin membaik dan dirasakan masyarakat atau pelanggan. Teknologi informasi telah
banyak diterapkan di berbagai bidang di Indonesia, salah satunya adalah pada bidang
pemerintahan. Walaupun pada awalnya penerapan teknologi informasi pada bidang pemerintahan
di Indonesia kurang populer, akan tetapi lambat laun semakin banyak terobosan baru dan
pemerintah daerah yang mulai menggunakan teknologi informasi untuk melakukan komunikasi
dengan rakyat. Laporan Realisasi Anggaran (LRA) adalah laporan yang menyajikan informasi realisasi
pendapatan, belanja, transfer, surplus/defisit, pembiayaan, dan sisa lebih/kurang pembiayaan
anggaran, yang masing-masing diperbandingkan dengan anggarannya dalam satu periode. Laporan
bulanan adalah laporan manajerial yang dibuat oleh masing-masing fungsi atas program kerja dan
evaluasinya selama periode bulanan. Dinas Pendidikan dan Kebudayaan Provinsi Bengkulu merupakan salah satu instansi
pemerintahan yang terletak di Jalan Mayjen S.Parman No.7 Kota Bengkulu. Pada Dinas Pendidikan
dan Kebudayaan Provinsi Bengkulu sudah menggunakan komputer untuk membantu mengolah
data administrasi pada masing-masing bidang yang terdapat didalamnya. Aplikasi yang digunakan
adalah paket Microsoft Office, dimana yang sering dibuka adalah Microsoft Word dan Microsoft
Excel. Dalam proses pengelolaan data laporan bulanan kegiatan di Lingkungan Dinas Pendidikan
dan Kebudayaan Provinsi Bengkulu belum mempunyai suatu aplikasi khusus yang dapat membantu
mengolah data serta menyimpan data secara otomatis. ABSTRACT Hal ini menyulitkan dan rentan terjadi
kesalah perhitungan ketika ingin membuat rekapan laporan bulanan, mengingat dinas pendidikan
dan kebudayaan adalah salah satu instansi dengan jumlah kegiatan terbanyak di pemerintahan
provinsi bengkulu, oleh karena itu dibutuhkan suatu aplikasi yang dapat membantu mengolah data
serta dapat menyimpan data hasil dari olahan tersebut.. Pengertian Laporan Menurut klc.kemenkeu.go.id yang diakses pada 01 Desember 2020 LO (Laporan Operasional)
adalah laporan yang menyajikan kegiatan operasional keuangan yang mencakup pendapatan, biaya,
dan surplus/defisit disandingkan dengan periode sebelumnya. LRA (Laporan Realisasi Anggaran)
adalah laporan yang menyajikan perbandingan antara realisasi pendapatan dan belanja dengan
estimasi pendapatan dan pagu anggarannya yang telah ditetapkan pada awal tahun. Menurut
Lukmanul Hakim (2018:102) laporan bulanan adalah laporan manajerial yang dibuat oleh masing-
masing fungsi atas program kerja dan evaluasinya selama periode bulanan. Dari pengertian diatas
dapat disimpulkan Laporan Bulanan adalah laporan realisasi anggaran yang menyajikan
perbandingan antara realisasi pendapatan dan belanja selama periode bulanan. Aplikasi Indrajani (2018:3) “Aplikasi adalah program yang menentukan aktivitas pemrosesan informasi
yang dibutuhkan untuk penyelesaian tugas-tugas khusus dari pemakai komputer”. Paramytha
(2016:2) “Aplikasi merupakan perangkat lunak yang dikembangkan untuk menyelesaikan suatu
aplikasi”. Jadi menurut pengertian di atas, aplikasi merupakan program komputer yang dibuat
dengan tujuan membantu manusia dalam mengerjakan tugas tertentu. Entity Relationship Diagram Sukamto dan Shalahuddin (2018:50), ERD adalah pemodelan awal basis data yang
dikembangkan berdasarkan teori himpunan dalam bidang matematika. ERD digunakan untuk
pemodelan basis data relasional. Bahasa Pemrograman Visual Basic .Net Visual basic adalah bahasa pemerograman even-driven generasi ketiga dan Integrated
Development Enveriotment (IDE) dari Microsoft yang mulai diperkenalkan pada tahun 1991 Jubilee JURNAL KOMITEK, Vol. 1 No. 1 Juni 2021 page: 52 – 61| 53 ISSN: e-ISSN : Enterprise (2018 :1). Visual Basic merupakan pengembangan dari BASIC yang dibuat sebagai bahasa
pemerograman yang mudah dipelajari dan digunakan. Visual Basic memungkinkan proses Rapid
Aplication Development (RAD) dari aplikasi antarmuka, mengakses database dan membuat kontrol
objek. Enterprise (2018 :1). Visual Basic merupakan pengembangan dari BASIC yang dibuat sebagai bahasa
pemerograman yang mudah dipelajari dan digunakan. Visual Basic memungkinkan proses Rapid
Aplication Development (RAD) dari aplikasi antarmuka, mengakses database dan membuat kontrol
objek. Data Flow Diagram (DFD) Sukamto dan Shalahudin (2018:70), data flow diagram (DFD) atau dalam bahasa indonesia
menjadi Diagram Alir Data (DAD) adalah representasi grafik yang menggambarkan aliran informasi
dan transformasi informasi yang diaplikasikan sebagai data yang mengalir dari masukan (input) dan
keluaran (output). SQL Server Sql server merupakan Relational Database Management System (RDBMS) yang dikembangkan
oleh Microsoft sebagai software fungsi utama SQL Server adalah menampung dan menggunakan
data yang terintegrasi dengan aplikasi, baik pada komputer yang sama atau dari komputer lain
dalam jaringan Jubilee Enterprise (2018 : 2). Konsep Database Database merupakan jiwa dari sebuah aplikasi. Sebab Dengan pemanfaatkan database,
semua fitur, tool, menu dan fasilitas lainnya yang ada di dalam aplikasi, dapat terhubung satu
dengan yang lainnya . database tidak hanya sekedar tempat untuk menyimpan data. Database juga
digunakan untuk memfasilitasi user yang membutuhkan pemerosesan data baik untuk Analisa
maupun evaluasi Jubilee Enterprise (2018:1) 54 | Andry Ardian, Leni Natalia Zulita, Reno Supardi; Design Monthly Report Application in... 2. Design
Pada tahap ini akan dilakukan perancangan sistem berdasarkan hal dari analisa yang telah
dilakukan sebelumnya. Rancangan yang dibuat masih bersifat kontemporer, sehingga dapat
berubah-ubah tergantung dari keputusan tempat penelitian. Rancangan dilakukan untuk
mempermudah proses pembuatan aplikasi yang telah terkoneksi dalam database. 3. Coding dan Testing
Pada tahap ini akan dilakukan proses pembuatan aplikasi dengan syarat bahwa rancangan yang
telah dibuat sebelumnya telah disetujui oleh tempat penelitian. Proses coding dilakukan dengan
memasukkan kode pada rancangan. Kemudian proses testing dilakukan dengan menguji coba
aplikasi, guna mengetahui
apakah aplikasi sudah berjalan dengan baik atau belum apakah aplikasi sudah berjalan dengan baik atau belum. 4. Penerapan
Pada tahap ini akan dilakukan penerapan dari aplikasi yang telah dibuat ke tempat penelitian. Hal
ini diperlukan agar tempat penelitian dapat mengetahui bentuk hasil dari aplikasi yang telah dibuat
mulai dari proses input hingga output yang diberikan oleh aplikasi. 5. Pemeliharaan
Pada tahap ini akan dilakukan pemeliharaan secara berkala agar dapat menghindari anomali pada
sistem yang dibuat. METODE PENELITIAN Adapun metode penelitian yang digunakan penulis adalah metode pengembangan sistem. Metode pengembangan sistem yang digunakan adalah Waterfall. Adapun tahapan-tahapan metode
waterfall, antara lain : Gambar 1. Tahapan Metode Waterfall Gambar 1. Tahapan Metode Waterfall p
f
1. Analisa
Pada tahap ini akan dilakukan analisis kebutuhan sistem berdasarkan permasalahan yang terjadi. Analisa dilakukan dengan cara mengumpulkan data-data pendukung kemudian merumuskan
permasalahan yang terjadi. 1. Analisa
Pada tahap ini akan dilakukan analisis kebutuhan sistem berdasarkan permasalahan yang terjadi. Analisa dilakukan dengan cara mengumpulkan data-data pendukung kemudian merumuskan
permasalahan yang terjadi. 54 | Andry Ardian, Leni Natalia Zulita, Reno Supardi; Design Monthly Report Application in... 2. Design
Pada tahap ini akan dilakukan perancangan sistem berdasarkan hal dari analisa yang telah
dilakukan sebelumnya. Rancangan yang dibuat masih bersifat kontemporer, sehingga dapat
berubah-ubah tergantung dari keputusan tempat penelitian. Rancangan dilakukan untuk
mempermudah proses pembuatan aplikasi yang telah terkoneksi dalam database. HASIL DAN PEMBAHASAN Adapun antarmuka Rancang Bangun Aplikasi Laporan Bulanan Pada Sub Bagian Perencanaan,
Evaluasi Dan Pelaporan Dinas Pendidikan Dan Kebudayaan Provinsi Bengkulu, antara lain : Adapun antarmuka Rancang Bangun Aplikasi Laporan Bulanan Pada Sub Bagian Adapun antarmuka Rancang Bangun Aplikasi Laporan Bulanan Pada Sub Bagian Perencanaan,
Evaluasi Dan Pelaporan Dinas Pendidikan Dan Kebudayaan Provinsi Bengkulu, antara lain : 1. Form Login
Form login merupakan antarmuka muka aplikasi yang muncul ketika menjalankan
aplikasi ini. Pada form login tedapat field username dan password yang harus diisi. Adapun
form login terlihat pada Gambar 1. g
p
Gambar 1. Form Login Gambar 1. Form Login 2. Form Menu Utama
Form menu utama merupakan antarmuka aplikasi yang muncul ketika pengguna
berhasil melakukan login dengan memasukkan username dan password yang benar. Pada
Form menu utama terdapat sub menu yang dapat diakses oleh pengguna untuk proses
pengolahan laporan bulanan kegiatan. Adapun antarmuka form menu utama terlihat pada
Gambar 2. 2. Form Menu Utama
Form menu utama merupakan antarmuka aplikasi yang muncul ketika pengguna
berhasil melakukan login dengan memasukkan username dan password yang benar. Pada
Form menu utama terdapat sub menu yang dapat diakses oleh pengguna untuk proses
pengolahan laporan bulanan kegiatan. Adapun antarmuka form menu utama terlihat pada
Gambar 2. JURNAL KOMITEK, Vol. 1 No. 1 Juni 2021 page: 52 – 61| 55 ISSN: SSN:
e-ISSN :
Gambar 2. Form Menu Utama Gambar 2. Form Menu Utama 3. Form Input Tahun Anggaran
Form input tahun anggaran merupakan antarmuka aplikasi yang dapat digunakan
untuk mengolah data tahun yang ada pada Dinas Pendidikan dan Kebudayaan Provinsi
Bengkulu form ini berisi data tahun, jumlah pagu, nama penyusun laporan bulanan, dan
nama kepa sub bagian perencanaan, evaluasi dan pelaporan Adapun form input tahun
anggaran terlihat pada Gambar 3. 3. Form Input Tahun Anggaran 3. Form Input Tahun Anggaran
Form input tahun anggaran merupakan antarmuka aplikasi yang dapat digunakan
untuk mengolah data tahun yang ada pada Dinas Pendidikan dan Kebudayaan Provinsi
Bengkulu form ini berisi data tahun, jumlah pagu, nama penyusun laporan bulanan, dan
nama kepa sub bagian perencanaan, evaluasi dan pelaporan Adapun form input tahun
anggaran terlihat pada Gambar 3. Gambar 3. Form Input Tahun Anggaran
4. Form Input Program Kegiatan
Form input program kegiatan merupakan antarmuka aplikasi yang dapat digunakan
untuk mengolah data program kegiatan yang terdapat di Dinas Pendidikan dan Kebudayaan
Provinsi Bengkulu. Adapun form input data Program Kegiatan terlihat pada Gambar 4. Gambar 3. Form Input Tahun Anggaran 4. 56 | Andry Ardian, Leni Natalia Zulita, Reno Supardi; Design Monthly Report Application in... HASIL DAN PEMBAHASAN Form Input Program Kegiatan
Form input program kegiatan merupakan antarmuka aplikasi yang dapat digunakan
untuk mengolah data program kegiatan yang terdapat di Dinas Pendidikan dan Kebudayaan
Provinsi Bengkulu. Adapun form input data Program Kegiatan terlihat pada Gambar 4. Gambar 4. Form Input Program Kegiatan Gambar 4. Form Input Program Kegiatan p
g
g
5. Form Input Kegiatan
Form input kegitan merupakan antarmuka aplikasi yang dapat digunakan untuk
mengolah data kegiatan yang ada pada Dinas Pendidikan dan Kebudayaan Provinsi
Bengkulu. Adapun form input data kegiatan terlihat pada Gambar 5. 5. Form Input Kegiatan
Form input kegitan merupakan antarmuka aplikasi yang dapat digunakan untuk
mengolah data kegiatan yang ada pada Dinas Pendidikan dan Kebudayaan Provinsi
Bengkulu. Adapun form input data kegiatan terlihat pada Gambar 5. Gambar 5. Form Input Kegiatan Gambar 5. Form Input Kegiatan
6. Form Input Laporan Bulanan
Form input Laporan Bulanan merupakan antarmuka aplikasi yang dapat digunakan
untuk menginputkan data realisasi kegiatan perbulan dari tiap-tiap pemegang kegiatan. Adapun form input data Laporan Bulanan pada Gambar 6. Gambar 5. Form Input Kegiatan p
g
6. Form Input Laporan Bulanan
Form input Laporan Bulanan merupakan antarmuka aplikasi yang dapat digunakan
untuk menginputkan data realisasi kegiatan perbulan dari tiap-tiap pemegang kegiatan. Adapun form input data Laporan Bulanan pada Gambar 6. 6. Form Input Laporan Bulanan
Form input Laporan Bulanan merupakan antarmuka aplikasi yang dapat digunakan
untuk menginputkan data realisasi kegiatan perbulan dari tiap-tiap pemegang kegiatan. Adapun form input data Laporan Bulanan pada Gambar 6. JURNAL KOMITEK, Vol. 1 No. 1 Juni 2021 page: 52 – 61| 57 ISSN: Gambar 6. Form Input Laporan Bulanan Kegiatan Gambar 6. Form Input Laporan Bulanan Kegiatan 7. Form View Daya Serap Anggaran
Form View Daya Serap Anggaran merupakan antarmuka aplikasi yang dapat
digunakan untuk menampilkan hasil pengolahan data laporan bulanan form ini digunakan
untuk memantau daya serap anggaran berdasarkan kegiatan yang sedang berjalan pada
Dinas Pendidikan dan Kebudayaan Provinsi Bengkulu. Adapun form input View Daya Serap
Anggaran terlihat pada Gambar 7. 7. Form View Daya Serap Anggaran
Form View Daya Serap Anggaran merupakan antarmuka aplikasi yang dapat
digunakan untuk menampilkan hasil pengolahan data laporan bulanan form ini digunakan
untuk memantau daya serap anggaran berdasarkan kegiatan yang sedang berjalan pada
Dinas Pendidikan dan Kebudayaan Provinsi Bengkulu. Adapun form input View Daya Serap
Anggaran terlihat pada Gambar 7. Gambar 7. Form View Daya Serap Anggaran Gambar 7. Form View Daya Serap Anggaran Gambar 7. HASIL DAN PEMBAHASAN Form View Daya Serap Anggaran 8. Output data Rekapitulasi Laporan Bulanan Kegiatan Per Kegiatan. Output data Rekapitulasi
Laporan Bulanan Kegiatan Per Kegiatan merupakan hasil dari proses pengolahan data laporan
bulanan kegitan berdasarkan program kegiatan yang dipilih, maka kegiatan yang ada pada
program yang dipilih akan tampil sesuai dengan hasil pemerosesan per kegiatan. Adapun
Output data Rekapitulasi Laporan Bulanan Kegiatan Per Kegiatan terlihat pada Gambar 8. 8. Output data Rekapitulasi Laporan Bulanan Kegiatan Per Kegiatan. Output data Rekapitulasi
Laporan Bulanan Kegiatan Per Kegiatan merupakan hasil dari proses pengolahan data laporan
bulanan kegitan berdasarkan program kegiatan yang dipilih, maka kegiatan yang ada pada
program yang dipilih akan tampil sesuai dengan hasil pemerosesan per kegiatan. Adapun
Output data Rekapitulasi Laporan Bulanan Kegiatan Per Kegiatan terlihat pada Gambar 8. 8. Output data Rekapitulasi Laporan Bulanan Kegiatan Per Kegiatan. Output data Rekapitulasi
Laporan Bulanan Kegiatan Per Kegiatan merupakan hasil dari proses pengolahan data laporan
bulanan kegitan berdasarkan program kegiatan yang dipilih, maka kegiatan yang ada pada
program yang dipilih akan tampil sesuai dengan hasil pemerosesan per kegiatan. Adapun
Output data Rekapitulasi Laporan Bulanan Kegiatan Per Kegiatan terlihat pada Gambar 8. 58 | Andry Ardian, Leni Natalia Zulita, Reno Supardi; Design Monthly Report Application in... Gambar 8. Output data Rekapitulasi Laporan Bulanan Kegiatan Per Kegiatan
9. Output data Rekapitulasi Laporan Bulanan Kegiatan Per Program. Output data Rekapitulasi
Laporan Bulanan Kegiatan Per Program merupakan hasil dari proses pengolahan data laporan
bulanan kegiatan berdasarkan seluruh program kegiatan yang ada dalam 1 tahun anggaran. Adapun Output data Rekapitulasi Laporan Bulanan Kegiatan Per Kegiatan terlihat pada Gambar
9. Gambar 9. Output data Rekapitulasi Laporan Bulanan Kegiatan Per Program
10. Pengujian Sistem. Pengujian blackbox (blackbox testing) adalah salah satu metode pengujian
perangkat lunak yang berfokus pada sisi fungsionalitas, khususnya pada input dan output
Rancang Bangun Aplikasi Laporan Bulanan Pada Sub Bagian Perencanaan, Evaluasi Dan Gambar 8. Output data Rekapitulasi Laporan Bulanan Kegiatan Per Kegiatan Gambar 8. Output data Rekapitulasi Laporan Bulanan Kegiatan Per Kegiatan JURNAL KOMITEK, Vol. 1 No. 1 Juni 2021 page: 52 – 61| 59
Gambar 8. Output data Rekapitulasi Laporan Bulanan Kegiatan Per Kegiatan
9. Output data Rekapitulasi Laporan Bulanan Kegiatan Per Program. Output data Rekapitulasi
Laporan Bulanan Kegiatan Per Program merupakan hasil dari proses pengolahan data laporan
bulanan kegiatan berdasarkan seluruh program kegiatan yang ada dalam 1 tahun anggaran. Adapun Output data Rekapitulasi Laporan Bulanan Kegiatan Per Kegiatan terlihat pada Gambar
9. Gambar 9. 60 | Andry Ardian, Leni Natalia Zulita, Reno Supardi; Design Monthly Report Application in... HASIL DAN PEMBAHASAN Output data Rekapitulasi Laporan Bulanan Kegiatan Per Program
10. Pengujian Sistem. Pengujian blackbox (blackbox testing) adalah salah satu metode pengujian
perangkat lunak yang berfokus pada sisi fungsionalitas, khususnya pada input dan output
Rancang Bangun Aplikasi Laporan Bulanan Pada Sub Bagian Perencanaan, Evaluasi Dan
Pelaporan Dinas Pendidikan Dan Kebudayaan Provinsi Bengkulu. Adapun hasil pengujian black
box yang telah dilakukan, tampak pada tabel 10. Gambar 8. Output data Rekapitulasi Laporan Bulanan Kegiatan Per Kegiatan 9. Output data Rekapitulasi Laporan Bulanan Kegiatan Per Program. Output data Rekapitulasi
Laporan Bulanan Kegiatan Per Program merupakan hasil dari proses pengolahan data laporan
bulanan kegiatan berdasarkan seluruh program kegiatan yang ada dalam 1 tahun anggaran. Adapun Output data Rekapitulasi Laporan Bulanan Kegiatan Per Kegiatan terlihat pada Gambar
9. 9. Output data Rekapitulasi Laporan Bulanan Kegiatan Per Program. Output data Rekapitulasi
Laporan Bulanan Kegiatan Per Program merupakan hasil dari proses pengolahan data laporan
bulanan kegiatan berdasarkan seluruh program kegiatan yang ada dalam 1 tahun anggaran. Adapun Output data Rekapitulasi Laporan Bulanan Kegiatan Per Kegiatan terlihat pada Gambar
9 Gambar 9. Output data Rekapitulasi Laporan Bulanan Kegiatan Per Program
10. Pengujian Sistem. Pengujian blackbox (blackbox testing) adalah salah satu metode pengujian
perangkat lunak yang berfokus pada sisi fungsionalitas, khususnya pada input dan output
Rancang Bangun Aplikasi Laporan Bulanan Pada Sub Bagian Perencanaan, Evaluasi Dan
Pelaporan Dinas Pendidikan Dan Kebudayaan Provinsi Bengkulu. Adapun hasil pengujian black
box yang telah dilakukan, tampak pada tabel 10. Gambar 9. Output data Rekapitulasi Laporan Bulanan Kegiatan Per Program
10 P
ji
Si t
P
ji
bl
kb
(bl
kb
t
ti
)
d l h
l h
t
t d
ji 10. Pengujian Sistem. Pengujian blackbox (blackbox testing) adalah salah satu metode pengujian
perangkat lunak yang berfokus pada sisi fungsionalitas, khususnya pada input dan output
Rancang Bangun Aplikasi Laporan Bulanan Pada Sub Bagian Perencanaan, Evaluasi Dan
Pelaporan Dinas Pendidikan Dan Kebudayaan Provinsi Bengkulu. Adapun hasil pengujian black
box yang telah dilakukan, tampak pada tabel 10. JURNAL KOMITEK, Vol. 1 No. 1 Juni 2021 page: 52 – 61| 59 SSN:
e-ISSN : ISSN: Berdasarkan hasil pengujian pada Tabel 10 dapat ditarik kesimpulan bahwa Rancang
Bangun Aplikasi Laporan Bulanan Pada Sub Bagian Perencanaan, Evaluasi Dan Pelaporan
Dinas Pendidikan Dan Kebudayaan Provinsi Bengkulu dapat berjalan dengan baik dan
mampu mengatasi kesalahan operator dalam menginputkan data ke dalam aplikasi. HASIL DAN PEMBAHASAN Berdasarkan hasil pengujian pada Tabel 10 dapat ditarik kesimpulan bahwa Rancang
Bangun Aplikasi Laporan Bulanan Pada Sub Bagian Perencanaan, Evaluasi Dan Pelaporan
Dinas Pendidikan Dan Kebudayaan Provinsi Bengkulu dapat berjalan dengan baik dan
mampu mengatasi kesalahan operator dalam menginputkan data ke dalam aplikasi. Berdasarkan hasil pengujian pada Tabel 10 dapat ditarik kesimpulan bahwa Rancang
Bangun Aplikasi Laporan Bulanan Pada Sub Bagian Perencanaan, Evaluasi Dan Pelaporan
Dinas Pendidikan Dan Kebudayaan Provinsi Bengkulu dapat berjalan dengan baik dan
mampu mengatasi kesalahan operator dalam menginputkan data ke dalam aplikasi. 60 | Andry Ardian, Leni Natalia Zulita, Reno Supardi; Design Monthly Report Application in... KESIMPULAN DAN SARAN Kesimpulan 1. Rancang Bangun Aplikasi Laporan Bulanan Pada Sub Bagian Perencanaan, Evaluasi Dan
Pelaporan Dinas Pendidikan Dan Kebudayaan Provinsi Bengkulu dapat berjalan dengan
baik, mampu mengatasi kesalahan operator dalam melakukan penginputan data maupun
melakukan perhitungan sehingga dapat membantu dalam penyusunan laporan bulanan
kegiatan yang selama ini masih manual. 2. Proses pengolahan Laporan Bulanan Kegiatan dilakukan dengan mengimputkan data
program kegiatan, data kegiatan, jumlah anggaran yang ada Dinas Pendidikan dan
Kebudayaan Provinsi Bengkulu dan laporan realisasi kegiatan perbulan dari tiap-tiap
pemegang kegiatan, berdasarkan data tersebut dilakukan perhitungan oleh program untuk
menghasilkan 1 View langsung pada program dan 3 output data. 3. Berdasarkan hasil pengujian yang telah dilakukan, Rancang Bangun Aplikasi Laporan
Bulanan Pada Sub Bagian Perencanaan, Evaluasi Dan Pelaporan Dinas Pendidikan Dan
Kebudayaan Provinsi Bengkulu dari sisi fungsionalitas aplikasi berjalan dengan baik. 3. Berdasarkan hasil pengujian yang telah dilakukan, Rancang Bangun Aplikasi Laporan
Bulanan Pada Sub Bagian Perencanaan, Evaluasi Dan Pelaporan Dinas Pendidikan Dan
Kebudayaan Provinsi Bengkulu dari sisi fungsionalitas aplikasi berjalan dengan baik. Saran 1. Agar dapat mengimplementasikan Rancang Bangun Aplikasi Laporan Bulanan Pada Sub
Bagian Perencanaan, Evaluasi Dan Pelaporan Dinas Pendidikan Dan Kebudayaan Provinsi
Bengkulu dalam penyusunan laporan bulanan. 1. Agar dapat mengimplementasikan Rancang Bangun Aplikasi Laporan Bulanan Pada Sub
Bagian Perencanaan, Evaluasi Dan Pelaporan Dinas Pendidikan Dan Kebudayaan Provinsi
Bengkulu dalam penyusunan laporan bulanan. 2. Untuk kedepannya disarankan untuk membuat aplikasi berbasihs web, Mengingat
Perkembangan dan pengadopsian web sebagai E-Govermen, pada pemerintahan provinsi
Bengkulu sangat pesat.. JURNAL KOMITEK, Vol. 1 No. 1 Juni 2021 page: 52 – 61| 61 JURNAL KOMITEK, Vol. 1 No. 1 Juni 2021 page: 52 – 61| 61 DAFTAR PUSTAKA Indrajani.2018.Database Systems All in One – Theory, Practice, and Case Study. Jakarta: PT Elex
Media Komputindo. Indrajani.2018.Database Systems All in One – Theory, Practice, and Case Study. Jakarta: PT Elex
Media Komputindo. Jubilee Enterprise, 2018. Step by Step MS SQL Server. Penerbit PT Elex Media Komputindo :
Yogyakarta Jubilee Enterprise, 2018. Step by Step MS SQL Server. Penerbit PT Elex Media Komputindo :
Yogyakarta Kementrian Keuangan Republik Indonesia. Perbedaaan LO dan LRA. Diakses pada 01 Desember
2020. https://klc.kemenkeu.go.id/bdkptk-perbedaan-lo-
danlra/#:~:text=LRA%20(Laporan%20Realisasi%20
Anggaran)
%20
adalah,telah%20ditetapkan%20pada%20awal%20tahun. Kementrian Keuangan Republik Indonesia. Perbedaaan LO dan LRA. Diakses pada 01 Desember
2020. https://klc.kemenkeu.go.id/bdkptk-perbedaan-lo-
danlra/#:~:text=LRA%20(Laporan%20Realisasi%20
Anggaran)
%20
adalah,telah%20ditetapkan%20pada%20awal%20tahun. Lukmanul Hakim,2018. Strategi Keuangan Perusahaan. Penerbit Elex media komputindo, Jakarta Paramytha, Nina.2016.Dasar Pemrograman Komputer.Palembang:CV Citrabooks Indon Sadeli, Muhammad. 2011. 7 Jam Belajar Interaktif Visual Basic 2010 Untuk Orang Awam. Penerbit
Maxikom : Palembang. Hal 1-107. Sukamto, Rosa A dan Shalahuddin, M. 2018. Rekayasa Perangkat Lunak. Bandung:Informatika
Bandung. JURNAL KOMITEK, Vol. 1 No. 1 Juni 2021 page: 52 – 61| 61
| 49,563 |
6233896_1
|
Court Listener
|
Open Government
|
Public Domain
| 2,022 |
None
|
None
|
English
|
Spoken
| 1,688 | 2,099 |
The opinion of the court was delivered, July 7th 1870, by
Sharswood, J.
There have been twenty errors assigned on this record; but as the counsel for the plaintiff concede in their printed argument, all those which are founded upon the charge and the answers of the court to the points presented are resolvable into two questions. The first is as to the character of the relation between the parties, and the second as to the effect of the Act of *504Assembly of April 15th 1850, sect. 10, art. 5th, Pamph. L. 482, entitled “An Act regulating Banks.”
The action was instituted to recover from the defendant as administrator of William M. Beetem, who in his lifetime was cashier of the Carlisle Deposit Bank, the sum of §8000 alleged to have been paid to him by the plaintiff as the consideration for the purchase of sixty shares of stock of the Glenville Coal Company. The ground of it was that the contract of sale was fraudulent or illegal, and the plaintiff claimed the right to rescind it and recover back the purchase-money.
The evidence was very bald and meagre as to the circumstances of the sale. It tended to show that Beetem was the owner of 800 shares of the stock, which he had transferred to Spencer, Yila & Co. of Boston to hold for him: then a transfer of sixty of the shares by them to the plaintiff, dated January 18th 1865, and the payment by the plaintiff to Beetem of §2499.84 by a cheek dated February 4th 1865, and a note of the plaintiff of the same date, to the order of and endorsed by G. W. Hilton, for §500, which was deposited by Beetem in the Carlisle Deposit Bank as cash and paid April 8th 1865. In addition there were in evidence letters from Beetem to his brokers in Philadelphia, relating to the purchase for him of the 800 shares, from which it might be inferred that at the close of the year 1864 he apprehended loss by the investment or speculation. On the supposition that Burk-holder and Beetem were simply vendor and vendee there certainly was no evidence of any misrepresentation or fraud in the sale. Beetem bought the stock at §40 a share, and his mere expression of an apprehension that he would lose certainly did not even tend to prove that he had used any deceit in the subsequent disposition. It was urged that the fact that the stock stood in the names of Spencer, Yila & Co., and that the transfer was direct from them to the plaintiff, was sufficient primá facie to authorize the inference that Beetem had acted as the agent of Burkholder in making the purchase, and had concealed from him the fact that he was the beneficial owner. Substantially the court in their answer to the plaintiff’s sixth point, submitted this question to the jury. “If Mr. Beetem in place of making a purchase of the stock for Mr. Burkholder, in fact had stock, which he then held, assigned through another to Mr. Burkholder at greatly more than he knew to be its actual value, this would authorize a rescission of the contract by Mr. But the more important question in the cause is as to the effect *505of the Act of 1850. It provides “ that it shall not be lawful for the cashier of any bank to engage in any other profession, occupation or calling, either directly or indirectly, than that of the duties appertaining to the office of cashier; and if any cashier of the bank shall directly or indirectly engage in the purchase and sale of stocks, or in any other profession, occupation or calling other than that of his duties of cashier, such cashier upon conviction thereof in any court of criminal jurisdiction shall be sentenced to pay a fine not exceeding $500.” The main object of this provision undoubtedly was the security of the bank — to remove from the cashier, who necessarily has possession and control of the money and securities, all temptation to use such funds in his private speculations. Yet it cannot be questioned that, according to well-established principles, it invalidated all his contracts contrary to its mandate. The act is a public general statute of which all are bound to take notice. When an act or contract is prohibited under a penalty, it is unlawful and void, though the statute does not expressly so declare: Mitchell v. Smith, 1 Binn. 110; Seidenbender v. Charles’s Adm., 4 S. & R. 151; Columbia Bank and Bridge Co. v. Haldeman, 7 W. & S. 233. In Hall v. Franklin, 3 Mee. & Welsby 259, to an action of assumpsit by the endorsees against the endorser of a bill of exchange, the defendant pleaded that the bill was made and endorsed after the passing of the statute 17 Geo. 3, c. 99, which restrained spiritual persons from being occupied in any trade or dealing, that the plaintiffs were a banking company, of which certain spiritual persons holding benefices were partners and members, whereby said endorsement and promise in the declaration mentioned were void, it was held on demurrer that the plea was good. And see Young v. Robertson, 23 Legal Int. 365, a case decided in the District Court of Philadelphia on this provision of the Act of 1850. The proviso to the section of the Act of 1850 in question is, that it “ shall not be construed in such manner as to prevent any cashier from managing his own real estate or private property as heretofore, if such private property be not vested in mercantile, mechanical or manufacturing operations.” It may be that a purchase of stock in a coal company for investment merely, or a subsequent sale, would not be within, the prohibition, but when there is evidence, as there was in this case, that the cashier was engaged in speculating in stocks— buying for the mere purpose of making profit by a rise in the market price, especially when he was engaged in more than one transaction of the kind, the case is clearly within both the letter and spirit of the act. It is true that when a contract so prohibited by statute has been executed, both parties being in pari delicto, an action cannot be maintained by either party to rescind the contract: Addison on Contracts 149; Boutelle v. Melendy, 19 *506N. H. 196. The party who has paid the consideration cannot recover it back. Bat the law implies a promise to refund money had and received under an illegal contract where the plaintiff seeking to recover such money does not stand in pari delicto with the person who has received it, and from whom it is sought to be recovered: Addison on Cont. 67. Upon the evidence then was Burkholder the plaintiff in pari delicto with Beetem? Upon the face of the transaction, so far as it appears that he had any knowledge of it, he did not purchase the stock of Beetem, but of Spencer, Vila & Co. There is no evidence that he knew that the stock belonged to Beetem. There was nothing unlawful in the employment of a cashier as an agent to purchase the stock. The learned judge below recognised this to be the law, and instructed the jury that if Burkholder was not a party knowingly to the illegal transaction of Beetem he would not be affected by it, or precluded from rescinding the contract on the ground of fraud. We see no error in the several bills of exceptions on account of the rejection of testimony. The imaginations, thoughts, impressions and presumptions of witnesses who know nothing of the facts are surely inadmissible. When a witness states in a deposition no material facts, but denies his knowledge of any of the matters inquired of, the whole may be rejected as irrelevant, unless some special object is to be attained by showing his want of knowledge. That does not appear in regard to Earley’s deposition ; at least it was not stated that it was offered for that purpose. Transactions by Beetem with other persons, or representations made by him to *507others as to the value of Grlenville stock were clearly inadmissible; nor was the inventory of his estate, as to the appraised value of this stock in August 1865 at all relevant. This disposes of all the remaining errors except.the 20th.
There were several counts in the declaration, some in form ex contractu, and one in tort. At the opening of the cause the court required the plaintiff to elect on which counts he would proceed. The plaintiff then elected to proceed on the counts in assumpsit, and excepted to the ruling of the court. This is certainly a novel proceeding. I have looked in vain through the books for any precedent or authority to justify it. The mode of taking advantage of a misjoinder of counts is by demurrer in the first instance. The English books say that the declaration will be bad on general demurrer, in arrest of judgment or upon error: 1 Chitty on Pl. 206; 1 Saund. PL & Ev. 418; Brigden v. Parkes, 2 Bos. & Pul. 424. But in Martin v. Stille, 3 Whart. 337, in very much such a misjoinder as here, it was held that it could only be taken advantage of by special demurrer. In some cases in England a misjoinder will be aided by intendment after verdict: 1 Saund. Pl. & Ev. 418. If the defendant chooses to plead in bar, and go to trial on such a declaration, there is no authority in the judge to strike out any count, or to put the plaintiff to his election between a count in assumpsit and another in tort. For this error, however, we would not reverse; for it is plain that it did the plaintiff no harm. There was no evidence which he could have given under the count which he abandoned which was not admissible under the money counts.
Judgment reversed, and venire facias de novo awarded.
| 36,890 |
https://github.com/shortlink-org/shortlink/blob/master/internal/services/api-gateway/gateways/graphql/infrastructure/server/resolver/link_resolver.go
|
Github Open Source
|
Open Source
|
MIT
| 2,023 |
shortlink
|
shortlink-org
|
Go
|
Code
| 141 | 443 |
package resolver
import (
"context"
"fmt"
"github.com/segmentio/encoding/json"
link_rpc "github.com/shortlink-org/shortlink/internal/services/link/infrastructure/rpc/link/v1"
"github.com/shortlink-org/shortlink/internal/services/link/infrastructure/store/crud/query"
)
// Link ...
func (r *Resolver) Link(ctx context.Context, args struct {
Hash *string
}) (*LinkResolver, error) {
response, err := r.LinkServiceClient.Get(ctx, &link_rpc.GetRequest{Hash: *args.Hash})
if err != nil {
return nil, err
}
return &LinkResolver{
Link: response.Link,
}, nil
}
// Links ...
func (r *Resolver) Links(ctx context.Context, args struct {
Filter *query.Filter
}) (*[]*LinkResolver, error) {
// Filter to string
filterRaw, err := json.Marshal(args.Filter)
if err != nil {
return nil, fmt.Errorf("error parse filter args")
}
// Default value for filter; null -> nil
if string(filterRaw) == "null" {
filterRaw = nil
}
response, err := r.LinkServiceClient.List(ctx, &link_rpc.ListRequest{Filter: string(filterRaw)})
if err != nil {
return nil, err
}
links := []*LinkResolver{}
for _, item := range response.Links.Link {
links = append(links, &LinkResolver{
Link: item,
})
}
return &links, nil
}
| 31,339 |
12567636_1
|
Caselaw Access Project
|
Open Government
|
Public Domain
| 2,018 |
None
|
None
|
English
|
Spoken
| 89 | 134 |
¶ 1 Department I of the Court, composed of Chief Justice Fairhurst and Justices Johnson, Owens, Wiggins and Gordon McCloud, considered at its June 5, 2018, Motion Calendar whether review should be granted pursuant to RAP 13.4(b) and unanimously agreed that the following order be entered.
¶ 2 IT IS ORDERED:
¶ 3 That the petition for review is granted. Any party may serve and file a supplemental brief within 30 days of the date of this order, see RAP 13.7(d).
For the Court
/s/ Fairhurst, C.J. CHIEF JUSTICE.
| 33,701 |
https://github.com/joseantoniolopez/Quiz/blob/master/controllers/stadistics_controller.js
|
Github Open Source
|
Open Source
|
MIT
| null |
Quiz
|
joseantoniolopez
|
JavaScript
|
Code
| 85 | 410 |
var models =require ('../models/models.js');
exports.show = function(req,res){
var statistics = {
numero_preguntas: 0,
numero_comentarios: 0,
media_comentarios: 0,
preguntas_sin_coment: 0,
preguntas_con_coment: 0,
};
models.Quiz.count().then(function(preguntas){
statistics.numero_preguntas = preguntas;
models.Comment.count().then(function(comentarios) {
statistics.numero_comentarios = comentarios;
if (statistics.numero_preguntas!=0){
statistics.media_comentarios = Math.round((comentarios/statistics.numero_preguntas)* 100)/100;
} else {
statistics.media_comentarios=0;
}
models.Sequelize.query('SELECT count(1) AS n FROM "Quizzes" WHERE "id" IN (SELECT DISTINCT "QuizId" FROM "Comments")').then(function(con_comentarios){
statistics.preguntas_con_coment = con_comentarios[0].n;
models.Sequelize.query('SELECT count(1) AS n FROM "Quizzes" WHERE "id" not IN (SELECT DISTINCT "QuizId" FROM "Comments")').then(function(sin_comentarios){
statistics.preguntas_sin_coment = sin_comentarios[0].n;
res.render('statistics/show', {statistics:statistics, errors:[]});
});
});
});
});
}
| 10,426 |
https://github.com/EsupPortail/esup-stage/blob/master/src/main/java/org/esup_portail/esup_stage/repository/CritereGestionRepository.java
|
Github Open Source
|
Open Source
| 2,023 |
esup-stage
|
EsupPortail
|
Java
|
Code
| 31 | 166 |
package org.esup_portail.esup_stage.repository;
import org.esup_portail.esup_stage.model.CritereGestion;
import org.springframework.stereotype.Repository;
import javax.persistence.EntityManager;
import java.util.Arrays;
@Repository
public class CritereGestionRepository extends PaginationRepository<CritereGestion> {
public CritereGestionRepository(EntityManager em) {
super(em, CritereGestion.class, "cg");
this.predicateWhitelist = Arrays.asList("id.code", "id.codeVersionEtape", "libelle");
}
}
| 25,132 |
|
cihm_42808_8
|
English-PD
|
Open Culture
|
Public Domain
| 1,831 |
The British dominions in North America, or, A topographical and statistical description of the provinces of Lower and Upper Canada, New Brunswick, Nova Scotia, the Islands of Newfoundland, Prince Edward, and Cape Breton [microform] : including considerations on land-granting and emigration : to which are annexed, statistical tables and tables of distances, &c.
|
Bouchette, Joseph, 1774-1841
|
English
|
Spoken
| 6,931 | 10,759 |
There are likewise three small block-houses — one near the fort, another near the Iving's-scjuarc, in the centre of the city, and a third at the point below it, mounting a few guns and mortars. m I .1 ill I!' m m * " Skctclies of New Brunswick, &c. By an Inhabitant of tliu I'rovinci-. St. Jolm, 1825." I ' ■ hffii! M I i 1 Ml'f m ?i' ill 120 m:\v inuNswicK. h Ni'iir the last-nuM>ti()iic(l Mock-limise are tlircc small imtti'rics called Priiur iMlwanl, l-'ort Fridiiu'k, and (iravc-yard ; upon tlu' liri^dit, bc- y(»nd Fort Frcdt'iTk, u fourth hlock-lioiisi' has bt'cii rri'i-tcd ; the whole mounting about twenty ;;un,s of from six to twenty-four pound ealibrc, and a few mortars and howitzers: there is also a small fort on Partridge Island, furnished with two or thrie ^uns. Near Fort Howe is a ranj^e of very old barnicks, with a eonunissariat store-house and fui'l-house, from which extends a wharf, where vessels drawing- no more than seven feet water may at hi^h tide discharge their cargoes aloiij^-side, but for the unloading' of all otlu-rs scows or boats nnist be used. In the neigh- bourhood of the city are five saw am! two grist mills, which are a {^reat accommodation to the inhabitants; and also an extensive salt marsh, partially diked, the convenience of which is materially felt. The artillery barracks are in the city, in the main street, near the lower cove; the ordnance stores front upon Union-street, near the u])])er end of the town. The city of St. John's is ))lentifully suj)plied from the adjacent counties with all kinds of butchers' meat, vej^etables, fruit, poultry, and wood durini;- the summer months, and before the formation of the ice, and whilst it is sufliciently formed to afford a means of comnnmication ; durin<;- the spring- months the supply is less abundant. Fish is generally rather scarce. The other parishes of this county are but thinly settled, the habita- tions being j)rincipally confined to the sea-coast, where the advantages of the harbours make them a medium of comnnmication with the interior. The principal harbours of this county, besides that of St. .John, arc Quaco, situated about forty miles north-easterly from St. .Tohn, up the ]Jay of Fundy ; Manawaganiche, in the same bay ; the ISIus(iuash Cove ; the Dipper and the I. ittle Dipper Harbours, situate a few miles to the west- ward. They are all small, but afford safe anchorage to vessels of from .'iOO to 400 tons, and at all these jjlaces are settlements n a flourishing state. -^Vgriculture has recently occupied a good deal of attention, and is rapidly improving; and the country adjacent to the shore is consi- dered to be rich in minerals. Abundant as are the water communications throughout the vast nOADS— DIST.WCKS TO Qii:nr,c. 121 '^1. tract of coiiiitrv \vv luivc now traced, vi/. the wliolc coursi' of tlu' St. .lolin's from Lower Canada to the Hay of I'midy, I hire are likewise rcKids wherever a chain of settlements has shown the expediency of com- municatiop hetween one |)hice and anothir. It cannot he said, however, that these roads are continnally ellicient, or can becaUidated on as a con- stant practii-ahle mo(U' of conveyance. Few of tliem are passable for cnrria{fes for any continnous distances, and at many seasons of the yi'ar they are totally untraversuhle. The principal canses of these deficiencies are the facilities of water-carriage ; but the roadways are cl(>ared m.d the foundations laid, and as the ])opulation of the si'ttlements increases, they must, for mutual accommodati»»n, be projfressivi'ly |)erfected. The most important of these, perhaps, is the post road from Nova Scotia to Canada, which traverses this i)rovince diaj^onally from the city of St. .lohn, and rii'arly |)arallel to the rivi'r. This road, which runs on the western sule of the river, is passable for carria<;es as far as fourteen miles above Fre- derjckton, to which place the distance is ei<;hty-two and a half miles : l)ut it is only in sununer that it is practicable; in sprin<> and autunm it is very wet, and in winter the only mode of comnumication is by the ice on the river. From Frederickton to tlie (Jreat Falls is ])assable only for f()ot-i)asscngers. The distances by this route to Quebec are as follows : To FrciliTiektoii Fniin Kri'dcricktoii to I'resqu'isli' From Pri'siprisli' to tlic (Jreat Fulls Thunct! to till- JMiidawaska Falls To the River du Loup Thence to Quebec naj, miles. m' 4") 84; 1071 455' There is likewise a road on the eastern side of the river, by which the distance to Frederickton is increased to eighty-six miles ; but this extends no further than the Meductic Uapids, in the parish of Northampton. Almost all the great streams have, in like manner, a road running near and nearly parallel to them, which usually joins with the road of the nearest river on any great line of communication. Such is that which, running side by side with the Nashwak River, joins the road of VOL. II. 11 MiilH i 122 NEW BRUNSWICK. the south-west braneh of the IMiraniichi, thus forming a line of com- munication from Frederickton to Miramiclii Bay in the Gulf of St. Law- rence ; also that which, skirting the Keimebecasis in its whole course, communicates with that which accompanies the channel of the Petcon- diac. A like road attends the course of the Oromocto ; and in fact there is no chain of settlements in any part of this tract which has not a similar mode of connnunication, accompanying and supplying the deficiencies of those water channels, which are a preferable medium for the transporta- tion of heavy merchandise. tl CHAPTER IX. Cliarlottc County — Campo Hello — (Jrand Manan and Deer Islands — Wcstmorolaiid, and the remaining Counties — Miramichi Conflagration. TuiiNiNG to tlie westward from the St. John, on the southern boun- dary of the province, we come to Charlotte County, whicli is boiuidcd north by York, Suiibury, and Kings counties, cast by St. Jolui's, south ])y the liay of Fundy and Passamaquoddy Hay, and west by the St. Croix, which separates it from the United States. It contains eight parishes, viz. St. James's, St. Andrew's, St. Patrick's, St. David's, St. Ste- phen's, Pcnnfiekl, St. Cieorge's, and comprises also the Island of Campo Bello. Of these the principal is St. Andrew's, which is the shire town. It is situated at the north-eastern extremity of Passanuiquoddy IJay, on a narrow slip of lowland fronting on the bay, at the distance of sixty miles from St. Jolm's, and three from the American shores. In its rear rises a range of highlands ; its two principal streets run parallel to each other tlic whole length of the town on its water front, and arc intersected by several others crossing them at right angles. They are almost entirely built up with substantial houses of decent appearance. It has a church of the regular establishment, and one of the kirk of Scotland, presented to that community at his own expense by INIr. Christopher Scott. There are also a coin-t-house, a gaol, a grammar-school, and many handsome private buildings. There is a chamber of conunercc, an Agricultm-al and Emigrant Society for the county, a savings' bank, and a liible Society; also barracks and commissariat stores. The military force stationed here is trifling. There are no fortifications but two small block-houses aiul two batteries, composed of half-a-dozen pieces of ordnance. As a frontier town on the Tnited States, in the event of hostilities with that power its means of defence would become an object of important consideration. It is conveniently situated for commerce, and especially for the fishing- trade, which is carried on here to a large extent, for which the neigh- ^ 124 NEW BRUNSWICK. bouring islands afford inany facilities, and abiuidant supplies of cod. liaddock, tSiC. arc yielded by the adjacent waters. The lumber trade is also actively prosecuted here, and ship-building carried on to a consi- derable extent. The conununication with St. John's is principally by water, though there is a good road passing round the head of Passaniaquoddy and JNIace's bays, and crossing the xMagaguadavick lliver in the parish of St. (ieorgc, in the innnediate vicinity of Trout Lake. The whole of this line of road is ])retty well settled. The princi])al settlements arc on the lliver Dignadegwash, about twelve miles from St. Andrew's, at the Magaguada- vick Falls, four miles further, on I^-ake T^'l^ltang, at IJeaver Harbour, and at Dipper Harbour ; all those situated near the banks of rivers, extending some miles on their shores up the country. There is also a main road to Frederickton, ])assing through all the principal settlements in that part of the country; to that on the Magaguadavick lliver, on a north-easterly course, the distance thirty-five miles; to the Oromocto settlements, thirty-five more : it then follows for about twenty miles the course of the Oromocto nearly due north till it reaches the banks of the St. John's, and thence to Frederickton, on the banks of the river, ten miles. There is a considerable (piantity of reserved crown lands in this parish, com- pletely surrounding the town on the north and south-east sides; they are most desirably situated, commanding beautiful views adjacent to the lines of the principal streets, and well watered by numei'ous streams. There are one grist, and four saw-mills in this parish. The town of St. Andrew's is abundantly supplied with provisions of every description, and provender for cattle, at very moderate prices. In IS^-i its population amounted to !2:,268 souls, but at present it may be said to be about .5, .500. The parishes of St. David and St. Patrick, on the cast and north- east of St. Andrew's, are pretty thickly settled, and are furnished abund- antly with saw-mills, by which means large (piantities of boards are an- nually cut hero, su))))lying a most desirable and necessary article to new settlers, besides feeding an important branch of trade. In the latter parish a considerable (piantity of wheat and Indian corn are raised. St. Stephen's parish, on the west, is also remarkable for the quantity CHARLOTTE COrNTY— ISLANDS OF CAMPO BKLLO, Sec. l'i.5 of lumber it furnishes, the activity of its saw-mills, generally situated on the Sehoodiac River, and the <iuantity of boards they jjroduee, aniountiny; to some millions of feet in the course of a year. Tiiis ])arish likewise com- prises a considerable nund)er of farms in good cultivation. An average of .'}0()0 barrels of alewives are amiually taken at the falls of the Sehoodiac. The parish of Pennfield, which forms the easternmost division of the county, though of wide extent, is thiidy settled. The inhabitants arc principally ([uakers, and are settled on fertile tracts of land. The sawing of timber into boards by means of mills seems here likewise to be the chief employment of their industry. Several vessels have also been built here, at the mouth of the Poklogan Kiver ; but the ])o))ulation of the district is thin. The parish of St. (ieorgc is in the very heart of the coimty, and is traversed in its whole depth from Lake T/Ktang to its northern limits by the river Magaguadavick. This river was formerly contended by the Americans to be the true St. Croix, and consecjuently the western boundary of the province of New lirunswick — a claim, could it have been substantiated, which would have given to them all the valuable tract of country lying between this river and the Scodic. This ])arish is ra])idly rising into importance ; the tilled lands yield very fair crops of wheat, oats, potatoes, and flax, but are not favourable for ])asturing cattle. Large (piantities offish, which are annually caught in the lake and river, and cured, form an article of extensive internal commerce as well as of exportation. liime has also been ^jroduccd and mamifactured here to a ccMisiderable extent. The chief we;ilth, however, of the district consists of the immense ([uantities of excellent pine which are fomul in the interior parts of tlie jjarish ; they are admirably adapted for masts and spars, of which they furnish an almost inexhaustible supply. This, together with a vast ])roduce of other useful tind)er, furnishes constant employment for a considerable number of saw-mills, which cut up amnudly from .'},()()(),()()() to 4,()()(),()0() feet of deals and boards. This profitable application of human industry has spread wealth through the j)arish, now perha])s one of the most flourishing in the i)rovince. Ap])endant to the county of Charlotte arc the islands of Campo Hello and Cirand Manan, and Deer Island. The former was a few years 1 1 i 4i' ! ^ip ! 7"t I m I m 'liiif .: ML % IIG NEW BRUNSWICK. ilf back constituted into a parish, including all the smaller islands in Pas- samaquoddy liay; its length from north to south maybe estimated at eight miles, its average breadth about two miles, and its superficial con- tents about 4000 acres. It might, with little expense, be so fortified as to render it im])regnable. It is for the most part in a state of cultivation, and other tracts of it are very capable of tillage. The produce in timber has enabled the inhabitants to build several vessels of from 40 to 100 tons burden. The island has, since the year 1794, been a considerable entre- pot between Nova Scotia, New Brunswick, and the United States for the trade in gypsum, of which many thousand tons were landed previous to the last war, and reshipped in American vessels for various ports of the United States. A large trade is likewise carried on with the Ame- ricans in fish, caught by boats belonging to this island, and sold to them, imcvired, in exchange for ordinary provisions and contraband articles of trade. The principal harbour of the island is Harbour de I^ute, on its western side and near its northern extremity; this is a large and safe haven, having near its entrance a sj)ace nearly a mile square, which at low water is left dry, and might, without much expense, be converted into a dock. Grand Manan Island lies about seven miles to the southward of Campo IJello, a little west of I*assama(pioddy liay, and near the entrance of the Hay of Fundy. Its length is about twenty miles, and its mean breadth about five. On its south-east side lie a number of small islands, the largest of which does not coniprise more than 900 acres. The abund- ance of rocky ledges renders the navigation between this island and the smaller ones dangerous ; there is no landing-place on its northern shore but in two small coves, but these disadvantages do not prevent the in- habitants from carrying on the coast herring-fishery to a considerable ex- tent. The greater part of the island is under cultivation, the higher tracts producing various kinds of grain and potatoes, whilst the lower lands yield good grass. The face of the island is varied by many large ])onds, almost approaching to lakes, being from fifty to a hundred acres in ex- tent, besides some spacious tracts of salt marsh. It is sufficiently ftivour- able to agriculture to induce a large proportion of its inhabitants to con- fine their attention to farming oidy; there are, however, considerable DEER ISLAXD— COUNTY OF WESTMORELAND. 1-27 i^i portions still occupied by valuable timber, such as birch and white j)ine ; and minerals have been found, but the search has never been prosecuted to any material extent. No kind of animals seem indigenous to the soil; it is without bears, foxes, or any other race peculiar to the climate, and is equally free from every sjiecies of reptile. It derives some importance from its situation, overlooking the entrance into the IJay of Fundy, and is so far fortified by nature that a little assistance from art would render it almost invulnerable. There is one saw-mill on the island, and one or two for grist. Deer Island lies at the entrance of Passamaquoddy IJay, to the north of Cam])o IJello ; it is of triangular form : its extreme length from the southerly point to that on the north-east is six miles and tlnee-quartcrs, and its greatest breadth three miles. It is surrounded by a multitude of islets, and abounds in strong positions easily fortified. The number of its inhabitants is not large, so that one grist-mill suffices for them all. Their principal occupation is fishing, the produce of which they usually dispose of to the American traders. The county of Charlotte abounds with spacious, safe, and easily- accessible harbours, comprising the whole of those in Passamaquoddy Bay, those of JNIace's IJay, and L'Etang and Heaver harbours between them. It sends to the General Assembly four representatives. Directing our attention to the eastern side of the St. John, we come to the county of Westmoreland, situated at the head of the IJay of Fundy. It is bounded on the north by the coimty of Kent ; east by the Gulf of St. Lawrence; south by the boundary line separating it from the county of Cumberland in Nova Scotia, Cumberland IJasin, Chignccto IJay, and the county of St. John's; and on the WTst by a north line, drawn fi'om the northern boundary of St. John's County to the southern boundary of Northumberland, and separating it from King's County. It is divided into eight parishes, vi/. Westmoreland, Hillsborouj','h, Dorchester, JMonkton, Salisbury, Sackville, Hopewell, and IJotsford. No county in the province is more flourishing in proportion to its population, or offers greater capabilities for almost unlimited improve- ment : bounded on almost two-thirds of its extent by water, from which rv !* i \l II !■■ 128 NEW nRlNSWICK. lar^c tracts of valuable salt marsh have been rescued, readily communi- cating;- with the St. Lawrence and the Atlantic, it has every facility for trade, increased by the rivers which traverse it in every direction, and forward its p'-oduce from its interior districts to its shores. It was originally settled by French Acadians, wliose descendants are still mmierous, strongly reinforced by steady and industrious settlers from England, who apply to farming with ])erseverance and intelligence. The ])roduce in corn is very considerable, as likewise in hay; but the most profitable product of the county is the rearing of stock, for which the extensive tracts of diked salt marsh aitbrd inuuense advantage. A^ery considerable (juantities of butter and cheese are j)roduced here and ex])orted, and during the Anie- rican war from SOO to 900 head of fat cattle, and above 800 firkins of butter, were anmially sent to Halifax. The lliver Petcondiac, rising at the western extremity of the county, traverses about one half of its extent eastward, then making almost a right angle, flows in a course nearly southerly till it empties itself into Shepody IJay, an indentation from the IJay of Chignecto, thus flowing through the very heart of the county. The land on both sides of this river, especially on the northern and eastern sides, in the district termed the IJend, has been reported by Colonel Cockburn to the emigration committee of the House of Com- mons to be fit for the highest and most profitable ])urposes of agri- culture. " The land about the IJend in Petcondiac River (for so the place is called) was for a long time considered of inferior (piality, and was thereby prevented from being settled as soon and as thickly as might have been expected. The importance of the situation, however, at last brought it into repute, and the soil now proves to be as productive as any in the province. The number of houses that have lately been erected give it the a])pcarance of a town ; and although no .ogular village has been laid out, there is already some difficulty and much expense in procuring a space sufficient for a building-lot. This place stands on an isthmus, through which place the land communication between Nova Scotijvand all i)arts of New Brunswick and the Canadas does and must continue to pass. The distance from it to the Gulf of St. Lawrence, at Shediac, is only sixteen miles ; to the Bay of Fundy, either by land or water, twenty; WKSTMORI'LANl) COUNTY— lUVKRS—FOUT (TMnKUI^AND. 129 the river beiiijif navigable so far up for schooners of tlio largest class, and the road to Halifax good for any description of carriages the Avholc way. With such advantages of situation, the settlements at the IJend of IVtcon- diac cannot fail of rajjidly increasing in jjopulation and iui])ortanee. Tliere is a tract of vacant land on the other side of the river, said to amount to 20(),0()() or .'i()(),()()() acres, and to be throughout of first-rate <iuality.' The other principal rivers are the Missicjuash, the Medamcook. and the Shediac, on the banks of all which are numerous and flourishing settlements. INIost of the ])arishes have conunodious ])Iaces of worship and settled 'Ministers; there are also several lloman catholic chapels, with mi^ iva. "iiisters. belon"ii)ir •! Acadian settlers. IJcsides its acrri- cultural produce, one part of the wealth of this county arises from the immense sup])ly of grindstones furnished by some of the rocky districts, especially the Shepody mountains, near the shores of the Hay of Fundv, of which as many as i2(),()()0 have been exported in one year to the United States. There is little of the bustle of trade in this comity, but it is steadily progressing to ))rosperity by the certain though slower advance of agricultural improvement. The harbours ar(> not numerous, and the coast on the Ray of Fundv is for the most part rocky. The tide of the IJay of Fundy towards its head is remarked by that ])eculiar ])henomenon termed the IJoar, by which the receded waters seem to accmnulate without advancing, till the waves attain a considerable per])endicular height, when they rush forward with an incredible velocity and irresistible force, their roaring- noise striking terror even in the animals near the shore, who fly to the highlands in awe. Along the whole extent of coast, from Fort Cumberland to Cape Chignecto, and thence to Ca])e Enrage, the s})ring tides rise from forty- five to fifty-five feet, whilst in IJay \'erte, on the other side the istlunus. the common tides are from eight to ten feet perpendicular only. .At a place called the .Toggin, about fifteen miles from Fort Cmnberhuul, is found abundance of coals. The breed of horses and cattle h--'" been most sedulously improved by numerous settlers from Yorkshire in England. Fort Cumberland is situated one mile from the Missiciuasb lliver, on the boundary line between New IJrunswick and Xova Scotia, and i -•.I 'ii VOL. II. Iil> v\ * ^ 111 iij! 130 ^'E^v URUxswic'K. tluvc'-(|uartcrs of ii mile from C'liigiit'C'to l};iy. It was formerly a f2,()()cl fortification, bcitig a rf<j,ular pentagon, with a erown-work ; but that, as well as the barracks, was siifl'ercd to go to ruin, tiiough both are now imderg'oing considerable repairs and improvements. The distance fron) the fort, across the isthnnis, to Hay \'erte, is about fifteen miles; near to which line, on the eastern extremity, and bordering on Cumberland Jlasin, is the great salt marsh called Trantamaire. The roads in this county arc generally good ; that from St. .John, on the banks of the Ken- nebecasis and I'etcondiac Rivers, is tolerable dm-ing the summer, l)nt in spring and autunni is very wet. and in winter scarcely passable. The distance from St. John to Ilannnond's Uiver is fourteen miles and a half; thence to IIam])ton Ferry, ten miles; to Studville, eighteen; to Sussex Vale, six; thence to the liend of the Petcondiac, fifty; to JNIedamcook Bridge, fourteen; to Westmoreland Court-house, nine; to Sackville, ten; to Fort Cumberland, thirteen; making in all a distance of 14 1 1 miles. There is also a road from I-'rederickton to FortCundierland via tlieAVashe- damoak, by which the distance to the ferry over the W^ishedamoak is thirty-nine miles ; thence to Helle Isle, twelve; to the court-house, eighty- nine; and to the fort, three; in all, 1 4.'j miles. The only water route from the Fort to the Fetcondiac is by way of Cund)erland Basin, round Ca))c Maramguin, to Shepody Hay; but this navigation is far too rough for boats, none of which would venture the ])assage on ever so pressing an emergency. Westmoreland covers a surface of 2,120 square miles, and it returns four representatives to the Assembl3\ Turning now to the more northerly region of this extensive pro- vince, Ave have to contemplate the tract hitherto composing the county of Northumberland, which embraces more than one third of the whole ))rovince ; it is bounded north and north-west by the Bay of Chaleurs and the Iliver Ilistigouche, separating it from liower Canada, cast by the Gidf of St. I^awrencc, south by tiie county of Westmoreland, south- west by its own boundary line, separating it from Queen's and Sunbury counties, and west by the county of York. It comprises the parishes of Eldon, Addington, Beresford, Saiunarez, Bathurst, Alnwick, Newcastle, Northcsk, Gleneig, liUdlow, Chatham, Carlton, Nelson, Ilarcourt, IIus- kisson, Dundas, and Wellington. It has recently been divided into three m. COUNTIES or NOUTlUMnKULAM), KKNT, (iLOlCKSTKR. l.il counties, Gloucester and Kent l)einjT taken from it; tlw< first about .'],!){)! miles in superficies, stretcliin<( inon}T its Aviiole northern evtent, and I'omprisin^ Eldon, A(idin<fton, Heresford, Saumarez, and M.n hurst parislies; the latter, in surtaee about l.HOl s(|uare miles, cuttin-r in from the east side, southerly of the Miramiehi, and comprehendint;- Carlton, lluskisson, Dundas, aJid Wellington ])arishes; but for the ])ur])()ses of general description it Avill not be necessary to adhere to these divisions. In contemplating this vast section of the province, exceeding in the aggregate 1(),.'J(){) square miles, the mind is struck no less by its extent than by the mnnber and grandeur of the rivers by which it is Matered, and the length of coast it occupies. Of the rivers, the Miramiehi, opening into a spacious bay of the (iulf of St. liawrence, and stretching through the county to its south-western extrennty, and coimnunicating by easv portages with the St. .Fohn, is the most remarkable. It enters the ))ro- vince in latitude 17" 10' north, ami in longitude ();>" Avest. It is navi- gable for large ships for more than thirty miles. There is a sand-bar oil' the entrance, but it is at all times covered with a suflicient depth of Avater to tloat the vessels entering its mouth, wliich have rarely been either destroyed or injured. Near the sea the land is low, and covered oidy Avith dwarf trees; but as Ave advance into the coimtry, Ave soon find tracts of heavy tind)er. This river, at the distance of about fifty miles from the coast, separates into tAvo branches, Avhose direction is indicated by their names — the north-Avest and the south-Avest or main branch ; these receiving the Circat and liittle ScAvogle, the JJartholomcAv, the ]{enous. the Etienne, and the Taxis rivers. On the same shore, near its southern extremity, this ])rovince has the Cocagne River, and ])roceeding northerly the Chibouctouche, Uichi- buctoo, Konchibougouacisis, Konchibougouac, I5ay du \'in, and Nassau rivers, all emptying into the (iulf of St. JjaAvrence, and nortlnvard of the IMiramichi the Tabasintae and Tracadie rivers. On its northern side, bor- dering on thclJay of Chaleurs, are the Caraquctte IJiver. near its eastern extremity, falling into the harbour of the same name, and more Avesterly the Nipisignit, Avhich empties itself into the s])acious Ni])isigui<" 13ay ; still further Avest the Eel riAxr and the T'psahjuish, besides almost inmnnerable streams of less note. The whole tract abounds Avith s 2 M -\ ;.*i5:< 1 32 NEW IJUlNSWItK. tif timber of the most valuable ileseription — white ami ivd pine, birch, spruce, lieiiilt)ck, and iiuiple, wiiich the immerous streams afl'ord the most easy and commodious means of tor\vardin<^ ti> the market on llie seaboard. The soil, .IS is attested i»y tlie (piality of the tiMd)er, is of the best de- scription, and the fre(|uency of the streams leaves numerous ^•alnabIe slips of interval ; yet, notwithstandin*;' these advantaj^es, tliese counties are tiie thinnest settled and the worst cultivated in the whole pro- vince. There is scarcely any collection of houses worthy the name of a town in any of them : the port of Miramichi, the settlement of Chatham on the southern side of the ri\ er, and that of Newcastle on the north, are the principal, between which are the loading- establishments of Messrs. iVbrahams and Co. and of Messrs. Kankins, Though many wealthy merchants are settled at both these places, and each jmsscsses a church, court-house, gaol, \.c., there is nothing that can accord with the ex])ecta- tions that would naturalls be formed from the iimnense resources of the country. The wln)le of this desolation is probably accounted for by the temi)tation which the hnnber and tind)er trades furnish to the new settler, especially if j)ossessed of any ca|)ital. These counties produce in pro- fusion the finest tiud)er of America, and the convenience of transportation o])erates as a further inducement to settlers to contine their cares to this branch of labour and conunerce ; and there is no doubt but the preference given to this ])ursuit has materially retarded the im|)ro\ement of the province generally. Originally the iVmericans were permitted to act at j)leasure in the forests of the Miramichi — the jjrivilege has since been confined to JJritish subjects; but the conse(pience is that the finest of the timber has been destroyed, and the ])ersons so engaged maintaining no ijjterest in the country have wholly neglected to take any steps towards its improvement. The prospect of an immediate return still attracts ])ersons of small capital to embark in the lumber trade, but many have been ruined by that trade in the ])rovince of New IJrunswick, whilst liundreds have been gradually advancing to certain independence and prosperity by a steady attention to agricdture. 'I'he ((uantities of tind)er that have been felled, s([uar(xl, and exported from this part of the colony are enormous, and yet no one presents so few syniptonis of improvement. The pursuit of lumbering (perhaps a necessary evil LI .Miw:ui\G. i;3.j in coloni/in^ u Avildiriicss) soonis iiuU-rd of a (liinorali/iiiff ti'ndt'ncy, sonii'tiiiu's (U'priviiij^ its followiTs of tlii' iiiclination and oven t'aj)al)ilitv for c'oiisistiMit and steady industry. This uill he more apparent from a view of the method in Aviiieli u lund)erinif party is formed and eon- <hieted, and uhieh we have borrowed from a eursory view of these pro- vinees, i)y an inteHi«>ent and eandid writer*. These are composed of j)ers()iis Avlio are all eitiier liired by a master hnnherer, who ])ays them wages and finds tliem in provisions, or of indiviihials who enter into an understandin};' with eaeh otiur to iiave a joint interest in the jjroeeeds of tiieir labour. The necessary supplies of ))rovisions, elothinj;', iVe. are jUfeiierally obtained from the merchants on credit, in consideration of re- ceivintj; the timber which the hnnberers are to brinj;- down the river the following' smnmer. 'I'he stock deemed re(iuisite for a bnnberinjr party consists of axes, a cross-cut saw, cookin<;" utensils, a cask of rum, to- bacco and pipes, a sutlicient (piantity of biscuit, pork, beef, and fish. j)ease and ])earl barley for souj), with a cask of molasses to sweeten a de- coction usually made of shrubs or of the toj)s of the hendock tree, Jind taken as tea. Two or three y,)kes of oxen, with sufllcient lii'y to feed them, are also recjuired to haul the tind)er out of the woods. " \"\'hen thus prepared, tliese people ])roceed up the rivers, with the provisions, lVc. to the place fixed on for their winter establishment, which is selected as near a stream of water and in the midst of as much ])ine as possible. They eonnnence by clearing' away a few of the surroundin<r trees, and buildin*^ a camp of round logs, the Avails of which are seldom more than four or five feet high ; the roof covered with birch bark or boards. ^V j)it is dug under the cam|) to j)reserve any thing liable to injury from the frost. The fire is cither at the middle or at one end; the smoke goes out th.rougb the roof; hay, straw, or fir-branches are sjiread across or along the whole breadth of the habitation, on which they all lie down together at night to slcej), Avith their feet next the fire. AN'hen the fire gets low, he who first awakes t)r feels hiujself cold springs up and throws on five or six billets, and in this way they manage to have a large fire all night. One ])erson is hired as cook, whose duty is to have l)reakfast ready before daylight, at whicb time all the party rise, wlien * Historical and Di'scriptivc Sketches of the JIaritinie Colonics of British America. By .f. IM'Grcnor. Lomloii, lOl't!. 1! l:U NKW r.lUNSNVltK. t'iU'li luiiii t;il<t> Ills morning- (tr tlic indlspcnsahlc (lr:iiii of rnw rum lu'toiv bri'iikfast. 'I'liis humI consists of i)ri'!i(l or occiisioiially potatoes, with hoili'd bcrf, jjork, or lisli, and tea swci'tfiu'd with niohisscs. Diiiiu-r is usually the satiu\ with |Uiisc-stMip in place of toa, and the supper re- st'Uihh's the breakfast. 'I'hese men are enormous eaters, and they also drink _<4;reat <piantitii's of rum. which they scarcely ever dilute. Im- mediately after breakfast they divide int«> three jj;an;;s, one of which cuts down the trees, another hews them, and the third is employed with the oxen in haulin<{ the timber, either to one .ncneral road leadinj;- to the banks of the nearest stream, or at once to the stream itself. I''allen trees aiul other impediments in the way of the oxen are cut away with the axe. " The whole w inter is thus spent in unremittini;- labour. The snow covers the <;round from two to three feet from the setting- in of winter till A])ril : and, in the middli' of lir forests, often till the middle of May. When tlu' snow begins to dissolve in ^V])ril. the rivers swell, or. according; to the lund)erer's phrase, the freshets come down. At this time all the tind)er cut during the winter is thrown into tlu Avatcr, and floated down initil the river becomes sulliciently wide to make one or more rafts. The water at this period is exceedingly cold, yet for weeks the lumberers are in it from morning till night, and it is seldom less than a mouth and a half from the time that tl» ating the tind)er down the stream com- mences until the rafts are delivered to the merchants. Xo course of life can undermine the constitution more than that of a hnnberer or raftsman. The winter snow and frost, although severe, are nothing to endure in comparison with the extreme coldness of the snow water of the freshets, in wliich the hnnberer is day after day wet iij) to the middle, and often inunersed from head to foot. The very vitals are thus chilled and sa])])cd; and the intense heat of the suunner sun, a transition which almost immediately follows, must farther Aveakcn iuid reduce the whole frame. " To stimulate the organs in order to sustain the cold, these men swallow innnoderatc <pumtitics of ardent spirits, and habits of drunkenness are the usual consequence. Their moral character, with few exce])tions, is dishonest and worthless, Premature old age and .shortness of days form the inevitable fate of a lum])erer. After selling and delivering \\\) their \'^\ MIUAMKMII CONrLACilLVriON. ld.j rafts, tlu'V |>i»'*'< soine weeks in in(liil;;ciu'c'. (Ir'mUiiiu-, smoking', and «lashin^f oiriii a lon^ coat, llasliy waisti-oat and ln)usii's, Wellington or Hessian boots, a liandkeiTliiel' of many colonrs round the neek. a wateli with a long chain and nund)erlc.sH brass seals, and an unduelhi, Itefore winter they return again to the woods, and resume the pursuits t)f the preceding year. Some excepti(»ns I have however known to this ge- nerally true character of the hnnherers. Many young men of steady hal)its, who went from I'rince Kdward's Island and other placis to Mini michi. for tlu' express purpose of making money, have joined the linn- hering parties for two or three years, and after saving their earnings returned and purchased lands, \c. on whiih they now live very com- fortahly.' The backward state o!' the settlements «)n the banks of the Miramichi, and thence south-eastc y across the country, may perhaps be in some degree referred to the terrific conflagration which in ()ciol)er, lS!i.>, devastated iv tract of country upwards <»f .'{()() miles in extent. It is not an uncommon thing for liri's to be ligl.ied in t'.* woods, sometimes for the j)rotection which the suutke ailords from n s\itoes and flies, and sometimes for the assistance it aflonls the limdjerers in clearii' • the brush- wood ; and it appears that from some circujusi; ncc of this sort the woods on both sides of the north-west branch of the Miramichi and in the rerr > '' Newcastle had for some time been on fire, without exciting either alarm or attention : but when once these fire.s are fostered by the wind to a certain extent, their fury becoii.cs boiuidless; the rarefaction of the air produced by the heat occasions u rush of air from all (puu'ters, which constitutes a hurricane, and thus they are urged on by an irresistible and still increasing- power. laid waste, iiulci)cndent of the north -Avcst branch, the liai •tibog and the Na])|)an settlements. ] 'roll) one to two hundred ])eople have peris bed within iinniediate observation, and thrice that number are miserably burnt or otherwise wounded ; and at least two thousand of our fellow- creatures are left destitute of the means of subsistence, and thrown at present upon the humanity of the i)roviiice of New IJrunswick. " The number of lives that have been lost in the remote part of the woods, among the lumbering ])arties, cannot be ascertained for some time to come, for it is feared that few were left to tell the tale. " It is not in the power of language to describe the unparalleled scene of ruin and devastation which the ])arish of Newcastle at this moment presents; out of upwards of 2,}() houses and stores, fourteen of the least considerable only remain. The court-house, gaol cliurch, and barracks, Messrs. (iilmour, Kankiii, and Co.'s, and Messrs. Wm. Abra- hams and Co.'s establishments, with two ships on the stocks, are reduced to ashes. " The loss of property is incalculable; for the fire, borne upon the wings of -a hurricane, rushed U])on the wretched inhabitants witli such inconceivable rapidity, tliat the preservation of their lives could be their only care. j\mong the vessels on the river a number were cast on shore, three of Avliich, viz. the slii))s Concord of AMiitby, and Canada of North Shields, together with the brig Jane of Alloa, were consumed; others were fortunately extinguished after tiie fire had attacked them. " ^Vt Douglas Town scarcely any kind of property csca])ed the ravages of the flames, Avhicli swept off the surface every thing coining in contact with them, leaving but time for the unfortunate inhabitants to fly to the shore; and there by means of boats, canoes, rafts of timber, timber-lop, or any article, however ill calculated for the purpose, thev endeavoured to escape from the dreadful scene, and reach the town of Chatham, numbers of men, women, and children ])enshing in the attempt. " In some ])arts of the country the cattle have all been destroyed, or suffered greatly, and the very soil has been in many places parched and ision to si)eak of has been rescued from pn spej burnt up, ana no artick the Haines. " The hurricane raided with such dreadful violence that larye bodies :!l MIRAMICHI CONFLAGRATION. 137 of timber on fire, as also trees from the forest, and parts of the flaming houses annd stores, were carried to the rivers with amazing velocity, to such an extent, and affecting the water in such a manner, as to occasion large quantities of salmon and other fish to resort to land, hundreds of which were scattered on the shores of the north and south-west branches. " Chatham at present contains about 300 of the unfortunate sufferers, who have resorted to it for relief, and are receiving some partial assist- ance, and almost every hour brings with it, from the back settlements, burnt, wounded, or in a most abject state of distress ; and it is reported that nearly two hundred bodies have been actually destroyed." This fire extended as far northward as the Bay of Chaleurs, and south-eastward to Frederickton, to which town it communicated, de- stroying the governor's residence and about eighty other houses. The total loss of life could not be numbered at less than 500, whilst that of property defies calculation. The colonists met this dire calamity in the true spirit of charity, lavishing on their suffering fellow-scttlers every aid in tlieir power, stimulated and encouraged by the example of the governor, Sir HoAvard Douglas, who immediately repaired to the spot, and assisted by a noble subscription raised in Great Britain, in the otlier British colonies, and in the United States. The towns on the Miramichi have now nearly recovered from this devastation, and present as good an appearance as formerly; but the land will not soon recover from the loss of its timber, and the actual injury done it by such a combustion.
| 39,794 |
https://nl.wikipedia.org/wiki/Marmaverken
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Marmaverken
|
https://nl.wikipedia.org/w/index.php?title=Marmaverken&action=history
|
Dutch
|
Spoken
| 35 | 70 |
Marmaverken is een plaats in de gemeente Söderhamn in het landschap Hälsingland en de provincie Gävleborgs län in Zweden. De plaats heeft 416 inwoners (2005) en een oppervlakte van 110 hectare.
Plaats in Gävleborgs län
| 48,780 |
https://github.com/derherbst/card-promo/blob/master/markup/static/scss/main.scss
|
Github Open Source
|
Open Source
|
MIT
| null |
card-promo
|
derherbst
|
SCSS
|
Code
| 25 | 91 |
@import 'normalize';
/* Libraries, which is used in current project. */
@import 'entry/built-in-partials/service';
@import "blocks/page-header";
@import "blocks/main-logo";
@import "blocks/main-nav";
@import "blocks/introduction";
@import "blocks/main";
@import "blocks/section";
| 46,946 |
https://github.com/mlynek600/hotels/blob/master/src/components/Hotel/Card/HotelCardSelect.tsx
|
Github Open Source
|
Open Source
|
MIT
| null |
hotels
|
mlynek600
|
TypeScript
|
Code
| 106 | 315 |
import React from 'react'
import styled from 'styled-components'
const createSelectItems = (max: number): JSX.Element[] => {
const items = []
for (let i = 0; i <= max; i++) {
items.push(
<option key={i} value={i}>
{i}
</option>
)
}
return items
}
const selectItems = createSelectItems(14)
type HotelCardSelectProps = {
onSelectChange: (nightsNumber: number) => void
}
export const HotelCardSelect: React.FC<HotelCardSelectProps> = ({
onSelectChange,
}) => {
const handleSelectChange = (
event: React.ChangeEvent<HTMLSelectElement>
) => onSelectChange(Number(event.target.value))
return (
<Select defaultValue="placeholder" onChange={handleSelectChange}>
<option value="placeholder" disabled>
Nights
</option>
{selectItems}
</Select>
)
}
const Select = styled.select`
border-radius: 5px;
background-color: ${({ theme }) => theme.colors.white};
:hover {
cursor: pointer;
}
`
| 44,242 |
https://www.wikidata.org/wiki/Q21939471
|
Wikidata
|
Semantic data
|
CC0
| null |
Mount Bithongabel
|
None
|
Multilingual
|
Semantic data
| 124 | 289 |
Mount Bithongabel
Mount Bithongabel
Mount Bithongabel instans av berg
Mount Bithongabel Geonames-ID 8165790
Mount Bithongabel land Australien
Mount Bithongabel geografiska koordinater
Mount Bithongabel GNS-ID 11364045
Mount Bithongabel inom det administrativa området New South Wales
Mount Bithongabel
mountain in Australia
Mount Bithongabel instance of mountain
Mount Bithongabel GeoNames ID 8165790
Mount Bithongabel country Australia
Mount Bithongabel peakware mountain ID 4289
Mount Bithongabel coordinate location
Mount Bithongabel GNS Unique Feature ID 11364045
Mount Bithongabel located in the administrative territorial entity New South Wales
Mount Bithongabel
berg in Australië
Mount Bithongabel is een berg
Mount Bithongabel GeoNames-identificatiecode 8165790
Mount Bithongabel land Australië
Mount Bithongabel Peakware-identificatiecode voor berg 4289
Mount Bithongabel geografische locatie
Mount Bithongabel GNS Unique Feature-identificatiecode 11364045
Mount Bithongabel gelegen in bestuurlijke eenheid New South Wales
| 14,165 |
4d1418f2e9b35a2b03c92bff2a66ec05
|
French Open Data
|
Open Government
|
Licence ouverte
| 2,006 |
Code général des impôts, CGI., article 8
|
LEGI
|
French
|
Spoken
| 281 | 387 |
Sous réserve des dispositions de l'article 6, les associés des sociétés en nom collectif et les commandités des sociétés en commandite simple sont, lorsque ces sociétés n'ont pas opté pour le régime fiscal des sociétés de capitaux, personnellement soumis à l'impôt sur le revenu pour la part de bénéfices sociaux correspondant à leurs droits dans la société. En cas de démembrement de la propriété de tout ou partie des parts sociales, l'usufruitier est soumis à l'impôt sur le revenu pour la quote-part correspondant aux droits dans les bénéfices que lui confère sa qualité d'usufruitier. Le nu-propriétaire n'est pas soumis à l'impôt sur le revenu à raison du résultat imposé au nom de l'usufruitier. Il en est de même, sous les mêmes conditions : 1° Des membres des sociétés civiles qui ne revêtent pas, en droit ou en fait, l'une des formes de sociétés visées à l'article 206 1 et qui, sous réserve des exceptions prévues à l'article 239 ter, ne se livrent pas à une exploitation ou à des opérations visées aux articles 34 et 35 ; 2° Des membres des sociétés en participation - y compris les syndicats financiers - qui sont indéfiniment responsables et dont les noms et adresses ont été indiqués à l'administration ; 3° Des membres des sociétés à responsabilité limitée qui ont opté pour le régime fiscal des sociétés de personnes dans les conditions prévues à l'article 3-IV du décret n° 55-594 du 20 mai 1955 modifié ou dans celles prévues par l'article 239 bis AA. 4° De l'associé unique d'une société à responsabilité limitée lorsque cet associé est une personne physique ; 5° De l'associé unique ou des associés d'une exploitation agricole à responsabilité limitée.
| 4,567 |
US-202217693795-A_1
|
USPTO
|
Open Government
|
Public Domain
| 2,022 |
None
|
None
|
English
|
Spoken
| 6,765 | 8,311 |
Non-contacting monitor for bridges and civil structures
ABSTRACT
A system for monitoring the movement of objects, structures, models of structures, cables and the like provides for the acquisition of images with an optical sensing device such as a video camera fixedly mounted at a selected distance from the item studied, in which the images are arranged into frames divided into pixels which are characterized by an intensity reflected or emitted over a selected time interval, and a data processing system to calculate a physical displacement as function of time of the item being studied or a portion of the item being studied based on an output from the video camera, and in some embodiments the system visually distinguishes one or more locations in the frame to indicate a difference in the phase of motion for multiple objects appearing in the frame.
CROSS-REFERENCE TO RELATED APPLICATIONS
This continuation patent application claims the benefit of and priority to U.S. patent application Ser. No. 16/925,922, titled “Non-Contacting Monitor for Bridges and Civil Structures,” filed by the present inventor on Jul. 10, 2020 (now U.S. Pat. No. 11,275,496) which is a continuation application of Ser. No. 16/679,905 titled “Non-Contacting Monitor for Bridges and Civil Structures,” (now U.S. Pat. No. 10,712,924) as filed by the present inventor on Nov. 11, 2019, which is a continuation of U.S. patent application Ser. No. 15/731,350, “Non-contacting monitor for bridges and civil structures,” (now U.S. Pat. No. 10,521,098) as filed by the present inventor on May 31, 2017, which is a continuation of U.S. patent application Ser. No. 14/757,255, “Non-contacting monitor for bridges and civil structures,” (now U.S. Pat. No. 9,704,266) as filed by the present inventor on Dec. 9, 2015, now U.S. Pat. No. 9,704,266, issued on Jul. 11, 2017, and incorporated herein by reference in its entirety. This continuation application claims the benefit of each of the following Provisional patent applications filed by the present inventor: Ser. No. 62/090,729, “Optical detection of periodic movement”, filed on Dec. 11, 2014; Ser. No. 62/139,127, “Method for determining, comparing, measuring, and displaying phase”, filed on Mar. 27, 2015; Ser. No. 62/141,940, “Method and system for analysis of structures and objects from spatio-temporal data”, filed on Apr. 2, 2015; Ser. No. 62/139,110, “Adaptive array comparison”, filed on Apr. 14, 2015; Ser. No. 62/146,744, “Method of analyzing, displaying, organizing, and responding to vital signals”, filed on Apr. 13, 2015; Ser. No. 62/154,011, “Non contact optical baby monitor that senses respiration rate and respiratory waveform”, filed on Apr. 28, 2015; Ser. No. 62/161,228, “Multiple region perimeter tracking and monitoring”, filed on May 13, 2015; and Ser. No. 62/209,979, “Comparative analysis of time-varying and static imagery in a field”, filed on Aug. 26, 2015, by the present inventors; the disclosures of each of which are incorporated herein by reference in their entirety.
This application is related to the following applications, filed on Dec. 9, 2015 by the present inventor: Ser. No. 14/757,256, “Method of analyzing, displaying, organizing, and responding to vital signals”, Ser. No. 14/757,245, “Method of analyzing periodic motions in machinery”, Ser. No. 14/757,259, “Method of adaptive array comparison for the detection and characterization of periodic motion” the entire disclosures of each and every one of which are incorporated herein by reference.
BACKGROUND OF THE INVENTION Field of the Invention
The invention pertains to apparatus and methods for monitoring the movement of a structural member under a transient load. More specifically, the invention pertains to a non-contacting monitor for bridges, other civil structures, and models thereof.
Description of Related Art
There exists an overwhelming need for a cost efficient method of monitoring and assessing the health of our nation's infrastructure. Large-scale adoption of technology solutions in the infrastructure monitoring market would reduce the number of tragic and expensive failures, increase safety and public confidence in infrastructure, provide quantitative data for proper appropriation of funding for repairs, and streamline the inspection process facilitating state DOT compliance with federal bridge inspection regulations.
The current bridge health monitoring process is labor intensive, expensive, and largely empirical with little data available about real time bridge performance. All information that is currently compiled to determine a bridge rating is based on calculations derived from visual inspection, tools utilized to determine the quality of the materials in the bridge, and dye to look for cracks. None of these tools effectively rates the bridge on actual current performance under load because the only tools available for such measurements are expensive and not feasible for widespread use. Current infrastructure assessment techniques do not provide a safe environment for inspectors, as they require the use of bucket trucks, rappelling, and other risky means of getting the inspector close to the infrastructure to perform a thorough visual inspection. The inspector is also subject to danger from vehicular traffic around the inspection site.
There is a clear need for a low cost, simple to use, inspection technology to provide infrastructure inspection technicians with information that will solve several key problems with current inspection practices including: reducing the amount of time and money spent on inspections by providing data from areas that are difficult and time consuming to access, and quantifying inspections, which have traditionally been somewhat subjective visual inspections.
Objects and Advantages
Objects of the present invention include the following: providing a system for measuring the movement of a structural member in response to a transient load; providing a non-contacting monitor for bridges; providing a system for quantitatively evaluating the response of a structural member to dynamic loads to evaluate the condition of a bridge or other civil structure; providing a system for inspecting a bridge and tracking the condition of the bridge over time; providing a system for comparing the condition of a bridge with that of similar bridges in other locations; providing a system to evaluate the condition of bridges, track their condition over time and in comparison to one another so that improvements and inspection schedules may be prioritized; providing a system for tracking and enforcing compliance with bridge load limits and related vehicle permitting; and, providing a system for non-contacting measurement of deflection of model structures during seismic testing and simulation. These and other objects and advantages of the invention will become apparent from consideration of the following specification, read in conjunction with the drawings.
SUMMARY OF THE INVENTION
According to one aspect of the invention, a system for monitoring bridge loading comprises:
- - an optical sensing device fixedly mounted at a selected distance from a bridge and having an unobstructed view of a selected portion of the bridge structure; - a data processing system to analyze the output of the optical sensing device and calculate a physical displacement of the selected portion of the bridge structure as a function of time; - a triggering system to trigger an event and generate a time stamp whenever the data processing system detects that the physical displacement exceeds a preset threshold indicating an overload condition; - at least one digital imaging device fixedly mounted proximate to the bridge and positioned to record images of the vehicles on the bridge at selected times;
a synchronized communication means between the data processing system and the digital imaging device so that the images of the vehicles on the bridge may be acquired and time stamped, so that vehicle(s) causing the displacement event may be identified; and,
- - a data storage system to archive the time stamped images and the physical displacement data for later retrieval.
According to another aspect of the invention, a method for monitoring bridge loading comprises:
- - fixedly positioning an optical sensing device at a selected distance from a bridge and having an unobstructed view of a selected portion of the bridge structure; - fixedly positioning at least one digital imaging device proximate to the bridge and positioned to record images of vehicles on the bridge; - providing a data processing system in communication with the optical sensing device and the digital imaging device, the data processing system analyzing the output of the optical sensing device and calculating the physical displacement of the selected portion of the bridge structure as a function of time; - calibrating the data processing system by passing a test vehicle of known weight over the bridge so that a threshold level of displacement may be defined; - triggering an event and generating a time stamp whenever the physical displacement exceeds the threshold level, and causing the digital imaging device to record and time stamp the images of the vehicle(s) so that the vehicle(s) causing the displacement event may be identified; and, - archiving the time-stamped images and time stamped displacement data for later retrieval and analysis.
According to another aspect of the invention, a system for monitoring the condition of a bridge comprises:
- - a video camera stably positioned at a selected distance from a bridge and having an unobstructed view of a selected portion of the bridge structure; and, - a data processing system to analyze the output of the video camera over a selected time interval and calculate a physical displacement of the selected portion of the bridge structure as a function of time, and further including: - a GUI that displays: - a fixed image frame from the video camera, corresponding to a particular user-selected time within the time interval; - an indicator, movable by the user to select a portion of the structure for analysis; and, - a display of displacement versus time for the selected portion over the selected time interval, and optionally having therein a first movable cursor for the user to select the particular time within the time interval.
According to another aspect of the invention, a method for monitoring the condition of a bridge comprises:
- - stably positioning a video camera at a selected distance from a bridge and having an unobstructed view of a selected portion of the bridge structure; - collecting a video file of the structure over a selected total time interval; - using a data processing system to analyze the video and calculate a physical displacement of the selected portion of the bridge structure as a function of time, wherein the data processing system is controlled through a GUI having at least the following features: - a display of a single video frame corresponding to a user-selected time within the total time interval; - a movable indicator superimposed on the video frame to allow the user to select an area of the bridge structure for analysis; and, - a display of displacement versus time for the Region of Interest over the total time interval, the display optionally having therein a first movable cursor to allow the user to select a particular time within the total time interval and cause the video display to display the particular frame corresponding to that particular time; and, - optionally populating a searchable database with the video file and selected metadata associated with the video file.
According to another aspect of the invention, a system for seismic testing comprises:
- - a seismic simulator having a horizontal platform upon which a model structure to be tested is placed, with mechanical actuators to allow the horizontal platform to be moved in three dimensions at selected amplitudes and frequencies under the direction of a control system; - a video camera stably positioned at a selected distance from the structure and having an unobstructed view of a selected portion of the structure; and, - a data processing system to analyze the output of the video camera over a selected time interval and calculate a physical displacement of the selected portion of the structure as a function of time, and further including: - a GUI that displays: - a fixed image frame from the video camera, corresponding to a particular user-selected time within the time interval; - a movable indicator superimposed on the video frame to allow the user to select a portion of the structure for analysis; and, - a display of displacement versus time for the selected portion over the selected time interval, and optionally having therein a first movable cursor for the user to select the particular time within the time interval.
According to another aspect of the invention, a method for seismic testing comprises:
- - placing a model structure to be tested on a seismic simulator having a horizontal platform with mechanical actuators to allow the horizontal platform to be moved in three dimensions at selected amplitudes and frequencies under the direction of a control system; - stably positioning a video camera at a selected distance from the structure and having an unobstructed view of a selected portion of the structure; - collecting a video file of the structure over a selected total time interval while the platform is operating under the direction of the control system; - using a data processing system to analyze the video and calculate a physical displacement of the selected portion of the structure as a function of time, wherein the data processing system is controlled through a GUI having at least the following features: - a display of a single video frame corresponding to a user-selected time within the total time interval; - a movable indicator superimposed on the video frame to allow the user to select an area of the structure for analysis; and, - a display of displacement versus time for the selected area over the total time interval, the display optionally having therein a first movable cursor to allow the user to select a particular time within the total time interval and cause the video display to display the particular frame corresponding to that particular time.
BRIEF DESCRIPTION OF THE DRAWINGS
The drawings accompanying and forming part of this specification are included to depict certain aspects of the invention. A clearer conception of the invention, and of the components and operation of systems provided with the invention, will become more readily apparent by referring to the exemplary, and therefore non-limiting embodiments illustrated in the drawing figures, wherein like numerals (if they occur in more than one view) designate the same elements. The features in the drawings are not necessarily drawn to scale.
FIG. 1 is a schematic diagram of one embodiment of the present invention in which a camera is set up to acquire video images of a bridge.
FIG. 2 is a schematic diagram of a GUI showing a plot of displacement of a selected area of the structure versus time over the length of the video file, a cursor indicating a user selected instant time, and a video frame corresponding to the selected instant time
FIG. 3 is a schematic diagram of a GUI for the same video file as in the previous figure, but with a different instant time selected.
FIG. 4 is a schematic diagram of a GUI for the same video file as in the two previous figures, but with a different area of the structure selected.
FIG. 5 is a schematic diagram of a system to monitor a bridge for load violations and load permitting.
FIG. 6 is a schematic diagram of a system for observing model deflections during seismic testing.
FIG. 7 is a schematic diagram of another system for observing model deflections during seismic testing.
FIG. 8 is a schematic diagram of another system for observing model deflections during seismic testing.
FIG. 9 is a schematic diagram of a system for synchronizing an image acquisition system with the drive signals of a three-axis seismic simulator.
FIGS. 10A-10C illustrate the use of phase information to analyze vibrations in a bridge. FIG. 10A shows a video frame of a bridge after a truck (not shown) has passed over it.
FIG. 10B shows a single phase mask at 2.25 Hz, which is the fundamental frequency of the bridge.
FIG. 10C shows the same phase mask but multiplied by the intensity of the movement at each pixel.
FIGS. 11A-C illustrate the analysis of a seismic model, in which FIG. 11A is a frame of video of a model under seismic test, FIG. 11B is an image representing vibrations at 4.63 Hz, and FIG. 11C is an image representing vibrations at 2.84 Hz.
FIGS. 12A and 12B illustrate a video frame image containing an overlay generated by an edge detection process.
DETAILED DESCRIPTION OF THE INVENTION
In its most general sense, the invention comprises a non-contacting (optical) sensor positioned to observe a structural component that will be subject to dynamic loading. The optical sensor will, in many cases, preferably comprise a digital video camera capable of capturing a video file over a selected time interval. A system is provided to take the captured video (or other data file) and apply one or more analytical techniques to calculate the physical displacement or movement of a selected part of the structure. This is preferably done interactively by a user through an inventive graphical user interface (GUI) that allows the user to select a particular area of the component for detailed analysis, although it will be shown that some functions may be performed autonomously. A particularly novel and useful aspect of the system is that the user can select or change the area after the fact, i.e., from a single captured video file, the user is able to analyze the behavior of a first area over the entire time of the video file, then repeat the process for a second area, and so on. As will be shown in the Examples, this creates a unique ability to examine in detail the behavior of a large structure and evaluate possible points of weakness or deterioration using a single data file that can be collected quickly and safely. The analysis may involve calculating the maximum displacement, the frequency of any resonances that might be excited, the decay rate of vibrations, and the degree to which individual parts of the structure are moving in or out of phase with one another.
Various analytical or calculated data, and other identifying data, may be tagged as metadata associated with the video file and archived in a database for later retrieval. This feature allows the user to compare the performance of a particular structure over selected time intervals to monitor structural deterioration or aging, as well as to compare its performance to that of comparable structures to develop a statistical baseline, observe trends, prioritize maintenance and inspection strategies, and for other purposes. Among the metadata associated with the video file, there may be still images of the surrounding environment, e.g., traffic on a bridge, which may be time-stamped so that observed displacements may be correlated to vehicular loading for enforcement or other purposes.
The following Examples will serve to illustrate various aspects of the invention and how it may be used for various purposes. These Examples are intended for illustrative purposes only and are not intended to limit the scope of the invention as defined in the claims.
Bridge Analysis, Inspection, and Maintenance
In order to maintain the safety and integrity of transportation infrastructure, bridges are inspected at maintenance intervals defined by various standards and regulations. Such inspections are done by close visual inspection to look for cracks, corrosion, loose or missing bolts, and the like. It will be appreciated that this approach suffers from several shortcomings. First, it is time consuming and hazardous for the inspectors, requiring bucket trucks, rappelling, or other risky physical situations. Second, it is qualitative at best and doesn't provide a direct measure of the actual performance of the structure under loading. Third, because it isn't quantitative, the results are not easily compared to past results on the same structure or to the current performance of comparable structures elsewhere. Thus, trends are hard to spot and there is little opportunity to prioritize inspection and maintenance resources.
Example
FIG. 1 shows one setup for inspecting a bridge. A video camera 1 is placed stably on the ground, using a tripod or other suitable means, at some convenient distance from bridge 2 and having an unobstructed view of at least a portion of the bridge and preferably including a view of the traffic or vehicles 3 passing over the bridge deck. The video camera 1 collects a video file of sufficient length to include the passage of one or more selected vehicle(s) 3.
Example
FIG. 2 shows a screen shot of a graphical user interface (GUI) in accordance with one aspect of the invention. The screen displays a single image or frame 14 from the video file. To select a particular area of the structure for analysis the user can draw a box 11 in the image and the analysis for that location is automatically populated in the fields on the lower right. In this example, the output fields 15 include: Frequency of selected area (Hz), Decay constant of selected area, and Displacement of selected area (mm). An additional box 16 displays the location of cursors 13, 13′. The lower graph 12 shows the time waveform of displacement versus time over the course of the entire video acquisition for the area indicated by box 11 in the image. Graph 12 further includes cursors 13, 13′ movable by the user along the time axis, to select a particular time interval. When the user moves cursor 13 the video frame 14 is updated so that it corresponds to that selected instant time. In this case, the user has selected the time corresponding to the maximum displacement of the selected area, and as can be seen from the video frame, this time correlates with the moment when the large truck 3 is directly over the area 11. The user can perform various analyses for the time interval defined by cursors 13, 13′.
Example
FIG. 3 shows a screen shot of the same analysis as in FIG. 2 , but in this case the user has moved cursor 13 to a later time corresponding to a smaller displacement; in other words, the maximum load has passed and the structure is recovering and undergoing movement characteristic of damped oscillation. As can be seen from the new video frame 14′, this time correlates with a moment when the large truck 3 has now moved some distance away from the selected area 11.
Example
FIG. 4 shows a screen shot of the same analysis as in FIG. 2 , but in this case the user has moved the selected area 11 to a different position on the bridge, and has moved cursor 13 to the time corresponding to the maximum deflection. The new video frame 14″ shows, as expected, that the truck 3 is again directly over the bridge. The maximum deflection of the new area 11 is significantly less than that of the first area (0.4 versus 2.1 mm), as expected because the new area is closer to the support whereas the first area was in the center of the span.
The GUI may be configured to choose an area for analysis in a number of different ways, which can be varied based on user convenience, the type of analysis being done, and the specific conditions of the site. For example, the user may draw a box of a selected size and shape, e.g., a square or rectangle. The rectangle may be longer in the direction normal to the expected motion in order to improve the signal-to-noise ratio. Alternatively, the movable indicator may consist of a crosshair or other graphic indicating an X-Y coordinate in the image; in that case, the user may select a size and shape of the area around the selected X-Y coordinate to be analyzed, and this area may be a single pixel (if the image contains a sufficiently well-defined edge) or a group of pixels, e.g., a square of 8×8 pixels centered on the crosshair. Lastly, the data processor may select the area(s) to be analyzed, as will be described in a later Example.
It will be appreciated that the GUI may optionally display various other calculated data, such as actual values of time and displacement corresponding to the graph and cursors in box 12. It may further display user-provided information such as time, date, location, bridge identifier (name, identification number, owner, etc.). Such information will typically be tagged as metadata corresponding to the video file. The video file and its metadata will preferably be archived in a database, to be used as described in several Examples to be discussed.
It will be understood that although screen shots of the GUI are rendered herein in black and white or grayscale, color rendering may be employed as well, particularly to enhance phase images or highlight certain effects where a color rendering is more readily apparent to the user than a grayscale rendering.
Example
It is important to note that the analysis method shown in the preceding Examples is conducted after the video file has been collected. This means that from a single video file, acquired in a matter of minutes from a safe position away from the bridge and traffic, the user can extract a huge amount of information that is both quantitative and easily compared to data taken at other places and times.
From one video file, the user can select many individual areas, one at a time, and see the displacement at each area for a single passing load (compare FIGS. 2 and 4 ). If there is a large difference between the deflections of these two points under the same load, this could indicate a local structural problem that requires attention.
By performing the same analysis on the same bridge at selected intervals (say quarterly, annually, etc.) the user can easily see if the structure (or a particular component of it) has degraded. By yielding quantitative data and archiving it over time, trends can be easily and unambiguously identified.
It will be appreciated that an inspector may calibrate the system to a fairly high degree in the case of bridges that are not heavily traveled, by employing a large vehicle of known weight to drive over the bridge while a video file is collected.
Comparing Similar Components for Analysis.
As shown in several examples above, the invention allows a user to start with a single video file and move successively from one point to another, and for each point, view the movement history of the selected point over the entire time span of the video. Various components of an object can therefore be measured and compared across the field of view. It will be appreciated that symmetries often exist within a structure that allow for motions of those features to be compared with each other. Absolute behaviors are not always necessary to know when doing comparisons. For example all elements of similar size and shape can be measured with respect to phase, displacement, and frequencies among other things. Then these components can be compared against one another for deviations in these properties. Likewise, sets of components can be measured and their differences can be compared to other sets.
A standard deviation of a certain property may be measured and all similar components' deviations compared against the standard deviation to look for outliers or components outside a set threshold.
An example may be a set of structural members that exist on a bridge in sets of two at intervals on both side of the bridge. The various behaviors of the sets may be compared against other sets, perhaps directly opposite on the bridge, or the average behavior of a set may be compared against the average behavior of other sets. These variations may be analyzed for outliers or deviations in behaviors.
These measurements may be used as a baseline either at initial measurement or on initial installation of a device or structure. Ongoing trending against this baseline may be used to find abnormal behavior. Behaviors after alteration or retrofits may be measured against these values to determine if the desired effect has taken place or if it has corrected outlier behavior.
Many structures, particularly bridges, exhibit bilateral symmetry. One may therefore expect similar characteristics on the left and right, or the front and back. It is highly unlikely that a defect or other fault occurs symmetrically. Therefore programmed logic may be effectively used to identify false positive findings if such findings are bilaterally symmetrical.
Linear progressive symmetries may also be used. Cables are tensile members clamped at either end. Between the two ends it is reasonable to assume a cable has a constant cross section, a constant modulus to density ratio, and constant tension. With this understanding it is reasonable to expect that nodes and anti-nodes will be regularly spaced and progressively responsive to given input energies.
Symmetries may therefore be used to identify similarities and differences. Unexpected observations may include cases that appear to be symmetrical when they should not be, and those which do not appear to be symmetrical when they should be. Either situation may be an indicator of a problem or a false reading, depending on the specific case. For a given structure or structure type, a knowledge base may be developed so that the system may interpret and double-check results automatically. Observations that are consistent with the prescribed knowledge base may be interpreted to be accurate findings, and observations that are contrary to the knowledge base may be flagged for further study.
Example
Applicants contemplate that each video file will preferably be archived, along with metadata identifying the structure and the structure type, along with the time, date, and other pertinent conditions, such as weather, traffic, etc. It will be appreciated that such a database would then allow the pooling of information and experience so that a particular user may compare the results to a more statistically robust population. The database administrator may provide various levels of access to various subscribers, and may, for example, allow a user to view performance data for comparable bridges while perhaps removing information that might identify the specific location or owner of another bridge in the database.
It will be understood that the term “database administrator” does not necessarily imply that a human administrator per se is involved in determining access. For example, particular access rules may be associated with particular types of subscriptions or licenses, and the system may grant various levels of access based on a subscriber's credentials. It will be further understood that access to a multi-user database would normally be controlled in both directions, i.e., requiring particular credentials for uploading new data into the database as well as for accessing existing (archived) data.
The database can allow a newly-built bridge to be tested and baselined before it is placed into service. If sufficient data exist for other bridges of the same type, a video file may be acquired using a truck of known weight and comparing the deflections with those of other bridges of similar design. If any deflections are unusually large compared to those of the “peer group”, this could indicate that a construction defect exists, such as missing or loose bolts, missing or substandard welds, missing rebar, etc., and suggest that a hands-on inspection is needed before the bridge is approved or opened to traffic.
Example
The database may also be used by regulatory bodies, state-level Departments of Transportation, or others to quickly identify structures that need attention, need to have load limits reduced, or need to be inspected more frequently. In this way, limited resources may be used most effectively.
A well known problem arises when a caller reports that a possibly overweight vehicle was seen passing over a bridge. Although such a report might well be a “false alarm”, it typically triggers a costly physical inspection to look for possible damage. If archived data exist for the bridge in question, a video inspection can be done and the displacements quickly compared to past results to determine if the structural integrity has been compromised. In a related situation, overweight vehicles are occasionally given a permit to cross a particular bridge. Comparing before-and-after video inspection files would document that the vehicle had not damaged the bridge.
Example
A bridge monitor and transmitter may be unmanned and recording continuously, buffering a certain amount of data and overwriting older data. In this case, a transient event caused by an overweight vehicle might trigger the archiving of a selected time span of the video record, along with automatic analysis and reporting via any suitable communication means, such as a cellular, WiFi, or hard wired connection.
The inventive system may use any number of methods to extract pertinent data from the video file, as described in the following Examples. It will be seen that in some cases, the specific analytical method may be set by the user via the GUI, or the analysis may to some extent be hidden as far as the user is concerned, or essentially a “black box”, or prepackaged as a “recipe” to be followed. Some analysis procedures may be standardized and some internal decisions may be taken without user intervention. For example, if the system is intended to be used with a large number of substantially similar structures, a standard analysis procedure may be installed, so that each time a structure of a given type is analyzed, analogous areas are selected for study, or each time the system re-examines a particular structure the same areas are examined as were examined previously. Automating such decisions could reduce the level of variability and operator error and create a more consistent database.
In some cases, it is contemplated that the system may be permanently installed at a site and operate substantially autonomously over extended periods, with little or no user intervention.
Example
One suitable method for calculating displacements from video files is taught in U.S. Pat. No. 8,693,735, the entire disclosure of which is incorporated herein by reference. The displacement data shown in FIGS. 2-4 were calculated substantially according to this technique.
Example
For a bridge that may be heavily traveled or inspected frequently, a target or other fiducial mark may be permanently placed on one or more places on the structure to make displacement measurement easier and provide a reference point for future measurements.
Although in many Examples, it is contemplated that the video image is focused on a particular bridge or structural component under examination, from a vantage point on the ground, it will be appreciated that the invention may equally well be carried out in a reversed configuration in which the video camera is rigidly mounted on the bridge or component and is focused on a convenient stationary object in the environment. The fixed object might be a nearby landform, the edge of a building, bridge abutment, or other massive object. In such a configuration, the apparent motion of the fixed object will mimic the motion of the camera on the moving or vibrating component and the video file may be analyzed in a completely analogous manner as described earlier. It will be understood, in this case, that the motion of the camera might or might not be a perfect proxy for bridge motion, and in general it will not. Specifically, various displacement or vibration modes might exist in the camera mounting structure. If the camera is very rigidly mounted directly to a bridge beam, relative displacements between bridge and camera will be small and resonances will occur at very high frequencies. On the other hand, if the camera is mounted on a boom or a cantilevered arm as might be used in a street light or sign, then displacements relative to the bridge will inherently be higher and resonances will occur at lower frequencies. In some cases this may be usefully exploited; e.g., if it is known that vibrations at, say, 2 Hz would be damaging to the bridge, the camera mount might be intentionally configured to have a similar resonant frequency and thereby serve to visually amplify such movements and give an early warning that unsafe resonances are occurring.
Depending on the size and structural design of the bridge, it will in some cases be convenient to locate the camera on the bridge deck with a field of view encompassing overhead structural members, cables, and the like. In such situations, one may be able to view the structural member simultaneously with a portion of a building or other fixed object. The fixed object can then be used to correct for motions of the camera and thereby isolate motions of the structural member relative to the bridge deck.
Example
The invention may be temporarily deployed using a heavy, generally rigid base or tripod, and set up on a bridge with a clear line of sight to a stationary object such as a building. A vehicle of known weight (e.g., a 5-ton truck) would then drive across the bridge, and the apparent motion of the fixed object, calculated according to the inventive method, would serve as an accurate proxy for the real motion of the bridge. This configuration might be particularly suitable for situations in which it is difficult to find a good position on the ground from which to view the bridge (e.g., when dealing with a large span over a very wide waterway).
As described more fully in Applicant's co-pending application “Method of adaptive array comparison for the detection and characterization of periodic motion”, one can determine the frequency and phase of vibrations induced in a structure by a dynamic load.
Example
Use of phase imaging is illustrated in FIG. 10.
FIG. 10A shows a single image from a video sequence of a bridge. During this sequence a vehicle passed over the bridge (not shown).
FIG. 10B shows a single phase mask image depicting a single phase (that of the fundamental vibration of the bridge) at 2.25 Hz, the bridge fundamental frequency. In this image things moving in phase show up as white (value 1) whereas things that are out of phase show as black (value 0). The image is scaled such that 0 is black and 1 is white. One can see that the motion on the I-beam support shows a clear feature of motion indicating the entire span is moving in phase with itself, as one would expect.
FIG. 10C shows an image of the phase mask seen in FIG. 10B multiplied by the intensity at each pixel of the amplitude of the 2.25 Hz signal, which relates to motion. One can see that now the phase image is scaled with relative values. Furthermore the image is much cleaner as small amplitudes of frequencies can be set below a threshold using the noise reduction technique.
Example
Another use of phase information is to examine localized areas to determine if two connections are vibrating in phase or out of phase with each other, which might have important diagnostic value in particular structures.
Use of Associated Audio Data.
As noted earlier, many video recordings contain both image data and audio data collected and stored with a common time stamp. Applicants contemplate that the invention can exploit the associated audio data in a number of ways, with or without the use of a graphical user interface (GUI).
Example
The audio sensor (microphone) may be used to detect oncoming events and trigger the system to begin acquiring data (or analyzing data differently). A system positioned to monitor a bridge might, e.g., switch from a standby mode to an operating mode when the sound of an approaching train or truck is detected. This procedure might be particularly efficient in the case of railway bridges that are unloaded most of the time and are only loaded when a train is passing over.
Note that in this situation, the system might operate autonomously, with little or no human intervention during the triggering, acquisition, data analysis, and archiving processes.
Example
The system may include a GUI that takes advantage of time stamping so that the user may select a particular output feature (e.g., a maximum deflection in a bridge component) and the video frame corresponding to the time of that event will be displayed. If the complete video recording contains the audio track as well, the common time stamp will allow a segment of the audio to be played back for a time selected by the user for review. For example, if the user rewinds the file to review an off-normal event, the corresponding audio could be replayed to provide a better understanding of the nature and cause of the event.
To further increase the usefulness of the GUI as a visualization tool, images other than a raw video frame may be displayed instead of, or in addition to, the unprocessed video image, as described in the following Examples.
| 9,296 |
https://github.com/JamesLinus/ack/blob/master/modules/src/system/proto.make
|
Github Open Source
|
Open Source
|
LicenseRef-scancode-other-permissive
| 2,016 |
ack
|
JamesLinus
|
Makefile
|
Code
| 264 | 1,599 |
# $Id$
#PARAMS do not remove this line!
SRC_DIR = $(SRC_HOME)/modules/src/system
MOD_DIR = $(TARGET_HOME)/modules
LIBSYS = libsystem.$(LIBSUF)
OBJ = access.$(SUF) break.$(SUF) chmode.$(SUF) close.$(SUF) create.$(SUF) \
filesize.$(SUF) modtime.$(SUF) lock.$(SUF) open.$(SUF) read.$(SUF) \
remove.$(SUF) stop.$(SUF) system.$(SUF) time.$(SUF) unlock.$(SUF) \
write.$(SUF) seek.$(SUF) rename.$(SUF)
CSRC = $(SRC_DIR)/access.c $(SRC_DIR)/break.c $(SRC_DIR)/chmode.c \
$(SRC_DIR)/close.c $(SRC_DIR)/create.c $(SRC_DIR)/filesize.c \
$(SRC_DIR)/modtime.c $(SRC_DIR)/lock.c $(SRC_DIR)/open.c \
$(SRC_DIR)/read.c $(SRC_DIR)/remove.c $(SRC_DIR)/stop.c \
$(SRC_DIR)/system.c $(SRC_DIR)/time.c $(SRC_DIR)/unlock.c \
$(SRC_DIR)/write.c $(SRC_DIR)/seek.c $(SRC_DIR)/rename.c
SRC = $(SRC_DIR)/proto.make $(SRC_DIR)/system.h $(CSRC)
INCLUDES = -I$(SRC_DIR) -I$(MOD_DIR)/h
CFLAGS = $(COPTIONS) $(INCLUDES)
all: $(LIBSYS)
$(LIBSYS): $(OBJ)
rm -f $(LIBSYS)
$(AR) r $(LIBSYS) $(OBJ)
$(RANLIB) $(LIBSYS)
install: all
-mkdir $(MOD_DIR)/lib
-mkdir $(MOD_DIR)/h
cp $(LIBSYS) $(MOD_DIR)/lib/$(LIBSYS)
$(RANLIB) $(MOD_DIR)/lib/$(LIBSYS)
cp $(SRC_DIR)/system.h $(MOD_DIR)/h/system.h
if [ $(DO_MACHINE_INDEP) = y ] ; \
then mk_manpage $(SRC_DIR)/system.3 $(TARGET_HOME) ; \
fi
cmp: all
-cmp $(LIBSYS) $(MOD_DIR)/lib/$(LIBSYS)
-cmp $(SRC_DIR)/system.h $(MOD_DIR)/h/system.h
clean:
rm -f *.$(SUF) *.$(LIBSUF)
pr:
@pr $(SRC)
opr:
make pr | opr
lintlib:
$(MK_LINT_LIB) system $(MOD_DIR)/lib $(INCLUDES) $(CSRC)
access.$(SUF): $(SRC_DIR)/system.h $(SRC_DIR)/access.c
$(CC) -c $(CFLAGS) $(SRC_DIR)/access.c
break.$(SUF): $(SRC_DIR)/system.h $(SRC_DIR)/break.c
$(CC) -c $(CFLAGS) $(SRC_DIR)/break.c
chmode.$(SUF): $(SRC_DIR)/chmode.c
$(CC) -c $(CFLAGS) $(SRC_DIR)/chmode.c
close.$(SUF): $(SRC_DIR)/system.h $(SRC_DIR)/close.c
$(CC) -c $(CFLAGS) $(SRC_DIR)/close.c
create.$(SUF): $(SRC_DIR)/system.h $(SRC_DIR)/create.c
$(CC) -c $(CFLAGS) $(SRC_DIR)/create.c
filesize.$(SUF): $(SRC_DIR)/filesize.c
$(CC) -c $(CFLAGS) $(SRC_DIR)/filesize.c
lock.$(SUF): $(SRC_DIR)/lock.c
$(CC) -c $(CFLAGS) $(SRC_DIR)/lock.c
modtime.$(SUF): $(SRC_DIR)/modtime.c
$(CC) -c $(CFLAGS) $(SRC_DIR)/modtime.c
open.$(SUF): $(SRC_DIR)/system.h $(SRC_DIR)/open.c
$(CC) -c $(CFLAGS) $(SRC_DIR)/open.c
read.$(SUF): $(SRC_DIR)/system.h $(SRC_DIR)/read.c
$(CC) -c $(CFLAGS) $(SRC_DIR)/read.c
remove.$(SUF): $(SRC_DIR)/remove.c
$(CC) -c $(CFLAGS) $(SRC_DIR)/remove.c
rename.$(SUF): $(SRC_DIR)/rename.c
$(CC) -c $(CFLAGS) $(SRC_DIR)/rename.c
seek.$(SUF): $(SRC_DIR)/seek.c
$(CC) -c $(CFLAGS) $(SRC_DIR)/seek.c
stop.$(SUF): $(SRC_DIR)/system.h $(SRC_DIR)/stop.c
$(CC) -c $(CFLAGS) $(SRC_DIR)/stop.c
system.$(SUF): $(SRC_DIR)/system.h $(SRC_DIR)/system.c
$(CC) -c $(CFLAGS) $(SRC_DIR)/system.c
time.$(SUF): $(SRC_DIR)/time.c
$(CC) -c $(CFLAGS) $(SRC_DIR)/time.c
unlock.$(SUF): $(SRC_DIR)/unlock.c
$(CC) -c $(CFLAGS) $(SRC_DIR)/unlock.c
write.$(SUF): $(SRC_DIR)/system.h $(SRC_DIR)/write.c
$(CC) -c $(CFLAGS) $(SRC_DIR)/write.c
| 27,736 |
https://simple.wikipedia.org/wiki/Nightstand
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Nightstand
|
https://simple.wikipedia.org/w/index.php?title=Nightstand&action=history
|
Simple English
|
Spoken
| 160 | 222 |
A nightstand, (could also be called a night table or bedside table) is a small type of table. It is usually placed next to a bed or somewhere else in a bedroom. It is a coffee table which is used next to a person's bed at night time.
Before flushing toilets became common, nightstands usually had a chamber pot in them. Nightstands which were made a long time ago sometimes had a drawer, and they usually had a small cupboard at the bottom.
Nightstands used today usually also have a drawer. Things like lamps, alarm clocks, mobile phones, water or medication, which could be useful during the night, are often put either on top of or inside nightstands.
French, Italian and Spanish antique nightstands usually have a drawer and a small cupboard with only one door. They can also have special finishes, like bronze.
History
It is thought that the word nightstand was first used in 1892.
Gallery.
References
Furniture
| 39,354 |
7789565_1
|
Caselaw Access Project
|
Open Government
|
Public Domain
| 1,907 |
None
|
None
|
English
|
Spoken
| 6 | 11 |
No opinion. Judgment affirmed, with costs..
| 21,412 |
https://github.com/restimel/houseQuest/blob/master/src/components/common/SelectOrder.vue
|
Github Open Source
|
Open Source
|
MIT
| null |
houseQuest
|
restimel
|
Vue
|
Code
| 361 | 1,293 |
<template>
<div class="selectorder">
<div class="display-values">
<div v-for="(selected, idx) of internalValue"
class="displayed-item"
:key="'selected-' + gid + selected"
>
<span>{{optionsMap.get(selected)}}</span>
<span class="item-control">
<Icon icon="long-arrow-alt-up"
class="interactive-area"
:class="{disabled: idx === 0}"
title="Click to move this column up"
@click="up(selected)"
/>
<Icon icon="long-arrow-alt-down"
class="interactive-area"
:class="{disabled: idx === internalValue.length - 1}"
title="Click to move this column down"
@click="down(selected)"
/>
<Icon icon="times"
class="interactive-area"
title="Click to remove this column"
@click="drop(selected)"
/>
</span>
</div>
</div>
<label>
<Icon icon="plus" /> Add another column
<input
type="text"
v-model="inputValue"
:list="dataListId"
placeholder="Column name"
@change="changeValue"
@keydown.enter="changeValue"
@keydown.esc="inputValue = ''"
ref="columnAdder"
>
</label>
<datalist :id="dataListId">
<option v-for="option of optionsFilteredList"
:key="dataListId+option.id"
:value="option.id"
>
{{option.text}}
</option>
</datalist>
</div>
</template>
<script>
import Vue from 'vue';
let gid = 0;
export default {
props: {
value: {
type: Array,
default: function() { return []; },
},
options: {
type: Array,
default: function() { return []; },
},
},
data: function() {
return {
internalValue: Array.from(this.value),
inputValue: '',
gid: gid++,
};
},
computed: {
optionsList: function() {
return this.options.map((o) => {
if (typeof o === 'object') {
return o;
}
return {
id: o,
text: o,
};
});
},
optionsMap: function() {
const opts = new Map();
this.optionsList.forEach((o) => {
opts.set(o.id, o.text);
});
return opts;
},
optionsFilteredList: function() {
return this.optionsList.filter((o) => !this.internalValue.includes(o.id));
},
dataListId: function() {
return `dataList-selectOrder-${this.gid}`;
},
},
methods: {
addColumn: function() {
this.showColumnAdder = true;
},
up: function(id) {
const idx = this.internalValue.indexOf(id);
if (idx > 0) {
this.internalValue.splice(idx, 1);
this.internalValue.splice(idx - 1, 0, id);
}
},
down: function(id) {
const idx = this.internalValue.indexOf(id);
if (idx >= 0 && idx < this.internalValue.length - 1) {
this.internalValue.splice(idx, 1);
this.internalValue.splice(idx + 1, 0, id);
}
},
changeValue: function() {
const value = this.inputValue;
if (!value && !this.optionsMap.has(value)) {
return;
}
this.internalValue.push(value);
this.update();
this.inputValue = '';
},
drop: function(id) {
const idx = this.internalValue.indexOf(id);
if (idx >= 0) {
this.internalValue.splice(idx, 1);
this.update();
}
},
update: function() {
const value = Array.from(this.internalValue);
this.$emit('input', value);
this.$emit('change', value);
},
},
watch: {
value: function() {
this.internalValue = Array.from(this.value);
},
},
};
</script>
<style scoped>
.display-values {
display: flex;
flex-direction: column;
flex-wrap: wrap;
}
.displayed-item {
border: var(--selected-item-border);
padding: 0.2em 1em;
display: flex;
flex-direction: row;
justify-content: space-between;
}
.item-control > * {
margin-left: 0.25em;
}
</style>
| 42,064 |
bub_gb_9z2MveWE9S4C_8
|
German-PD
|
Open Culture
|
Public Domain
| 1,815 |
Geschichte der Bischöfe von Angsburg
|
Placidius Braun
|
German
|
Spoken
| 6,601 | 14,834 |
14» LX. ^einrieb V. ■ t einige au* tym SBifte an ben Faiferf* ©eneral ©aUa* abprbiten, ober 2«) neben i&nen ein ©Stetten an beufefben abgeben, ober 3.) ft# normal* auf ©erlange n ps einem Sufammentrttt tjerfU&ett wollten? 3^te Antwort war am n. gebe,: „@ie f Junten au* »ufrigen ©rünbeit feine Deputirten an ben faifert. 0eneral mttfcfcir efen, tiwb wettere Eonferenjen wären ganj rnu ni|, Zubern fle'wm tyrer gegebenen SrWdttmg uM)t abweisen f innren ; fie wollten aber mir 95epjie^u«9 mehrerer Äatfyolifen ein ©treibe» an ben ©eneral serfajfen unb abgeben laflen" (»)• 6* 6dP?bm : ^ Me^m ®^rci&e«' *>*!<$** fie bem «Uta? an NnYa". 9Wrat )itr «in jicfr »erlegten, erPtdrten fie ftd> bat ©enerai J)in : „baß (ie ju alfer griebfertigfeit gan} geneigt angenem, fi»Wi « :»lib. flfH4wit . ftt - «ifMT fOWO&I in ttefu gton* r JKegtment* t al* anbern poftttfdj en <Ba* <^en nt<$t«,ge()anbefe ob« t>erfägty a(* wa* bie f*ife*l, »efefcte mit gebraut, alfo au* je^t iqfc ;<tfem bemMgM' tt** *er ^aifer §ur 93e* ruf)tgung gemeiner ©tabt befehlen, tterorbnen, t>ergleid>en, bewilligen, refertwren unb btfpontren würbe* ftd> tjollfoinfflen begnügen wollten; mit berfttttte, ber ©eneral wolle biejjfall* ju man; nig(icf>* £et( unb 8Bol)ffa&rt ba*jenige in* 3Berf fe|«n, woburc^ jwifc^en betten 9>art(pien ba* vj-.i alte ■ Digitized by Google LX. £etitricf> V. 243 arte Bürgerliche Vertrauen furbcrftcfc wicber fyer; ^eflellt werben möd)te, unb bie ©acfje ba{)iu rie- ten , baß, bamit nicf>t längere ^Belagerung, unb fcurcf) junger unb Sflotf) bic fatfyoftfcben unb esan* geltfdjen £inwof)ner ;u ©runbe gefyen mußten, in SMfbe eine gute $6tr?ung erfolge, unb ermefb,- te* gänjfidje* Herberten btefer <Stabt \?erf)utee werbe (*). 44 Diefe* ©rf)»ei6en ttntfrjtiebneteit ber Sfbmimjkator t>on @t. Ufricf) , bie ©rabfpfTe* ger Jpteron. 3*uf)Qf unb S&eruarb Äef); linger, bann £on rab 9>eutinger, Davib SBelfer, Gf>riflop^ 3lfung, ©abriel ©cfjeffcnberget (/). 5. SDef (£. SErwanbteit waren mit Belastungen, Schreiben so unjewogen, dass sie ganz verwarfen, welche sie glaubten, dass sie ihren Interessen mehr zugedacht waren, bringen würden. Doch, sie waren aber gegen die Änderungen nicht äußerst wollten, so fanden sie, dass sie am 13. Sept. 2018, selbst in dem Miniaturator mit ihrem 'Ultima Verheid', dass sie dies Beträge betreffend Änderungen an dem General Öffnen gar nicht nachzuhalten seien, wenn sie sich nicht trauten, dass sie selbst zu überreichen, weil sie mehr zu ihr eigenen Bedürfnissen als zu ihren Pflichten als Stellvertreterin der Krone befanden. Die Süd Thronfrage floss durch die Swanfelden, auf eine einzige Weise. 2. Exegi. Stetig. 2. Tract. Die Unterhaltung floss ständig, die Frage der Religion, was für die Konstitution der Änderungen zu Karl V. ist, die freie und unversehrte Religion, Übung in Gebet, wohin sie schließen, was gut und was ist, wurden sie beobachtet und gesehen, was sie für Erklärungen und Gesichter und ersahen, dass sie etwas tun mussten, sie fragten, ob sie ihr Verlangen gesäset, wie sie antworteten, sie sollten ihre weitere Gliederung in der Hauptstadt, wenn sie fanden, dass die Bürger in der Stadt gegen die Änderungen erklärten, sie gegehen würden, was immer sie wünschten. § XXI. Die Änderungen in Breslau, die sich finden, als sie das Hauptquartier in Breslau, schlugen, wie das Bistum, das Reichsministerium und die Stadtvörsteher in Breslau, die Erklärungen abgaben, was für die Bürger in Breslau und die Änderungen an der Konstitution sind, wollten, die freie und unversehrte Religion, Übung in Gebet, was immer sie schließen, was gut und was ist, wurden sie beobachtet und gesehen, was sie für Erklärungen und Gesichter und ersahen, dass sie etwas tun mussten, sie fragten, ob sie ihr Verlangen gesäset, wie sie antworteten, sie sollten ihre weitere Gliederung in der Hauptstadt, wenn sie fanden, dass die Bürger in der Stadt gegen die Änderungen erklärten, sie gegehen würden, was immer sie wünschten. Der General schlug vor, dass die Bürger in Breslau ihre Bedürfnisse und Wünsche in einer Note an das Hauptquartier in Breslau schlugen, wie das Reichsministerium und die Stadtvörsteher in Breslau, die Erklärungen abgaben, was für die Bürger in Breslau und die Änderungen an der Konstitution sind, wollten, die freie und unversehrte Religion, Übung in Gebet, was immer sie schließen, was gut und was ist, wurden sie beobachtet und gesehen, was sie für Erklärungen und Gesichter und ersahen, dass sie etwas tun mussten, sie fragten, ob sie ihr Verlangen gesäset, wie sie antworteten, sie sollten ihre weitere Gliederung in der Hauptstadt, wenn sie fanden, dass die Bürger in der Stadt gegen die Änderungen erklärten, sie gegehen würden, was immer sie wünschten. Burgerschaft der Deputierten, und geben Synen hierauf Macht ben für Formell jener Gang eine Drung (p), durch mehrere Zusammenführungen und (Streitigkeiten) veranlagte, Subsidien. Pamphlet über Stoff und Jurisprudenz zu Raub und Worte ben 13, im Schatz von allen Seiten unter; jedem. Bei diesem Wort wird für die Farbe; übergangen, die Nationalität, die Stifter und Stiftungen festgesetzt: 1.) Was viel die Dietzion belangt, so ist das Vorwort mit Beimäßigungen und im 3. 1629- gefassten Gesetzen und Verordnungen bleibt jede jetzt ben in den 31. E. veneratenden 35ürgen auf das Gesetz. Einem nahe erlaubt und gesetzlichen Sin, eine Rodung auf und Ächten gut bauen, und hinein in einem Kostenaufschlägen ausgelegt, der sich durch jedes remitiren folgend, dass er nichts, als dass er sich durch unverständliche Auslegung zwingen müssen, gemäß 17., und von solchen seine im Dietchen verbotene Geistliche Kleidung vortragen wolle. 2.) Über gelehrte Geister, die zu registrierten Folgen es sehr bemerkt, gemäß im 3. 1629- gefassten Gesetzen und im Gesetz von Augsburg und im Reichsgesetz gemäß dem und von Reich. Diet. auf den vernetzten Interessen betätigten Vertrag seine Beziehungen haben; jedem lassen alle Gedanken. Reich. Diet. gefassten, dass sie ben an die verletzten Gesetze erinnern, nachdem die Interessen des Hauses sehr oft zu rauben und zu beugen, sind ben 13. Schatz von allen Seiten unter; jedem. Bei diesem Wort würde für die Farbe; übergangen, die Nationalität, die Stifter und Stiftungen festgesetzt: 3.) Zutritt für Verleger, die benannte Steigen folgend, biatot an gelegene Plätze, Verträge und alte Performen ungefähr 5 und fest bleiben. 4.) Der Schatz für die Genugtuung, die folgend ist, in der Steig ungemengt, bleibt unverändert frey und füßt verbleiben. 5.) Der Schatz für die Unterbringung im Regiment, foll es in allem nahe, der Generalverordnung A. K. V. . unb barüber in gebautem, im ^afytt 1629* ben 8» QTtor^ ergangenen Oefret gehalten, allein tot biegmal bas 3tegimenf wieber ^ergejlellt »erben, wie es tot ber f(f)H>ebif^en Qlcnberung gen>efen *c« 60 ^lß2r ©cfcaben unb 'iGerroüjlung, fo bei)* bes ben @ei(!licfcen unb <2iMtlid)en »etyrenb ber .ftriegsunru&e inner unb außer ber ©täbt, es fep burd) 33ranb, ^lünbcrung ober Otafcra, an ße* genbcn ober fa&renben (Sutern, roie bie immer ge* bannt werben mögen, beftye&en, bas foü bur$ geiualtfame DTiittel feineßu>cgs gefugt, fonbern einem 3eba>eben, ber 2lnfpru$ $u l;aben sermeint, ber löeg Kentens p(fen gclajjen fei>n* 70 £>i* CO »tefelbe. * ■ Digitized by Google LX. £etnri* V. 547 70 £>ie ©tobt, ein efcrfamer 3la# ober Diener fammt u)ren 3ugcj)6rigen foÜen burcfc 23cr; pfäubung, ^inwegfufcr , Dlan$ion unb *}3Iünbe* rung roeber an £eib iwd> ©ut auf Einerlei <XQtiß befdjtuert werben. 80» 93etttfft bie fdjwebtfdj e ©arnifon : 9.) t>ie cf)ur6aterifd)en gorberungen : 10.) ben frencn 2(6jug für alle, bie tu föwebiföen Dienftm unb onberetDO öerpflicfjtet waren : 12.) Die ©cifcfn, 13.) bcn ÜKarfd) ber 2(bjte[)enben unb 3ß{ie$eit; »oüenben^ranfen 2c. 21») Die faiferf. ©arni* fcn unb ©tatt&after : 22,) bie £tnquartierun/ gerne. @efd)cl;cn ju Cöwenberg ben 13. 2Rärj 1635 Sofgenbe* fani nid^t in ben 2Jfforb, aber ium Oicben&efcfceib, unb würbe ben 14. SJJldrj 1635» jur Antwort gegeben : n?i[fen , baß Ben bem ge|Trigen augsbur? yitUnkt* giften aicforb ber ©fabt 2ibgeorbnetc (Tcf) in bem f*«b. befdjircrt befunben, bag ben bürgern 21. 6. feine Äirdjeober^Mafc, in ber inbeffen, bis bie i(;nen »cruMÜigte Äird>e gebaut, bie Oteligionßüburrg i&rcr (Eoufefpon gehalten werben möge, $uge[af* fen, unb bie ilbgeorbneten e6 gleicfcfam unmog* Ii* !>al(en wollen , baß ein einziger !J3rabifanf (blcf> 00 Diefelbe. *48 LX. £etrtrtc& V* fol<$ großer 33ürgerfd)aft ber ©ebüfcr naä) fcorfte* £en f ömie ; ba&cr um (irtenjlon foldjer ©nab 'bcr> £nu ©eneral ©alias untertänig angehalten» £)al;cr i|I beu 21* £♦ 23erraanbten auf 3tatipfa« <ion beö Jlaifer6 nod) ferner bewilliget werben, nebeu bem ^3räbifanten nod> einen Reifer gu £al* ten, bann ju ij>rem ©otteßbicnfl berÄirrf)c gu ben QSarftiffcrn anö ©naben auf fec^s 2Doc^en gu ge* brand;cn ; unb mögen fitf) inmiffclß bei) Äaif* OTiaj* felbjl um Qlusgeig eines für ijjre 3teIigionsübung tauglichen Drtö bewerben it. ©cf4>c{>cn gu £ös wenberg ben i4*9Ttärj 163 5 9m4* SStfrf>of £ einriß ber ni($t6 fer)nltc^et tt^n be* wünfd)te, ale bafj bie f)6d)jc t>erberbüd)e ^Dii^; ^^^ ^eüigfett, Ärieg unb anbete* Ungemadj burdj et- il fünfte, nen aufrichtigen geieben geenbiget, unb ba* alte beutfd)e Vertrauen wieber f)ergejMt werben mödj; tc, legte eine <proteftatien wiber bie in bem 31& fotb ben 91. S. 9Serwanbten gemattete frege SXeli; gionöübung mit folgenbem ein : hingegen befennen unb bezeugen wir mfyt weniger, baß wir in benjenigen Wforb unb 23er* a,leid>, fo mit ber ©tabt Augsburg wegen gulaf* jung bes unf atj>olifc&cti Srercitiumö getroffen wer* ben, feiueßwegs bewilligen, ober un$ bargu t>er* fielen, (0 SUfclbe. lx. £cfimc&v. Freuden, weniger aber uns bei gefasst. Arischen Fion, bei wir einig un allein. Sonn und Himmel unbenagten Apotheke. Empfangen, auch werden wir Sermon in fernsten teuren geleiteten Gibt uns un fünfzig Tanten haben. Dulden, endlich un benehmen sich festlich finden, noch folgen, beruhigt. Jeidem gegenüber steht das Blatt. Diejauchsen auch all. Folgenden. Sturzen und Tauben leben, wie Münsther gespaldet. Münster. Sammt (wetti. Ernannten. Fasten, bei reif. Prüfung. Beruf. Garde und Vertragung. Nur ehemalige Ritterleuten. Sprüche. Wir führen. Übung un. Kekanab, diese gefassten Untertanen. Hierzu gebaute Stäben un berücksichtigt. Merkwürdig, nachdem sich vorgegangen. Geuer. Langwierige Spoliation un. Einquellungen. Uns versoffen, dass nicht weniger. Uns behagte. Allergnädigste Anfang. Unbenugsißige. Geistlichkeit. Beständig un. Unruhe. Werden, hieran wir un unfer. Stadtfürsten wenden un. Unser. Glück un. Gibt, auch erlangte un. Summation in. Recht. Erachtene un. Vollmögende rechtmäßige füustersüße. Unreif un unrecht begünstigt un belämmert werden. Redaktion vom 3. Jahr 1619. Erwerben, sprach, Juge fertig produzieren, wärben, sich festen besinnen, bemühen sich, fordern, notwendig, bedeutend, zehn an seiner Statt und in seinem Interesse, bei Constitution, her abgenommen, eingebogenen ober verferrten Streben, Äfter und anberufen, gesucht, übernehmen. Bevollmächtigt bei seinem Generalgouverneur (Kaiser, Sifer) und beauftragt ihn, gemäß voranbenannter Kommandierung, "dass er (Kaiser) Seine lieber Eroberung und Eigentumsverhältnisse freie Wahl, Augsburg, seine und das gesetzlich vorgeschriebene Verfahren, und für die vertriebenen und gefangen gehaltenen Personen wegen Einfluss, an gehörige Orte zu bringen, die Reformation zu befolgen, als seine geistliche Zutrittsklausel, wie nicht weniger alles zu besorgen, was ihm und seinem Reich an gelegen ist, vermögen seine hierüber ausgesprochenen Befehle, alle Vorstellungen und Anfragen anzunehmen, zu beantworten und zu erfassen, Zerstörung und Vorratshaus, besorgen und vollziehen, auch die Stadt, aber lebendig, zu erhalten, verbesserung und abwenden, anzuordnen, wie sich in allen Vorstellungen, was er selbst gegenwärtig, überzeugt oder verraten, für sich, seine Rechte, auch er, sein Gewaltsberechtigung, sein unbemühtes Tragen der Regalien, zulässig, gut regieren, die Ordnung, die Sicherheit, zu erhalten und zu wahren, Prozesse frei, müssen er, ander, berufen, sich zu begeben, getragen von Not, und Gewalt, seine. Ultrd) bem ©eneral criffnen i fie Rieben für festig, billig, man ©ott für ein so glurflidje, greig* IÜ0 laufe unb ein festgehaltene ©ott wir lobe b 14- unter Mittung aller ©locfcn, welche breitSal>re lang bei? Den Äatfyoltfen gefälligen Staat, unb mit 2ü>feurung be ©efdjüfceö fylate, 5Dec ©eneral genehmigte e*, unb e6 würbe no$ am undflienden tage IMbenbe in ber £ir$e ju @t. Ufr ud) in ©egenwart bed ©eneral, ber Offnere unb ©olbaten, mit unglaublicher Grube ber *4i t^olifen, na<^ bem SBunfd>e fcee 5Domprobste unb bte Stbminijtrator*, ©Ott wir loben bic§ auf ba e)ftergehaltene angefümmt, (*) O) €cbrei6en mit 5ßoÜnia*t öed »ifdjofd. SRel. Mr. (*> »lefelbe. SManum. Exeget. Digitized by Go< LX. stintiti) V. 9tm eften Slpril tarn Ott einticfc Staftal ter in Slug*burg an& 2Bof)l unterster, »ie t>iel bie Äatfyolife erbutbet Slatten# lief et fogleidj am undflienden Sage tie ©oftaten be$ benfetten and * unb 6e$ ben 8ti# tfyeraneru einquattiretu (c) Unb ba biefe nod> alle 3Urc$en im SBeftfc Ratten unb @otte$btenfl barinn hielten, . befahl tt, auf 2fofudj>ep bed fa* tf)o(tfc^en Älcru*, ifym ade ©<$töffel yt ben Sliv <\$eu einliefern (tf). In den 6ten 9ften am Efafreitag erfolgte bei 3. Ärstag aller Ärden. 3. Stierer wurden gefällt bei dieser Aktion wurde eine allgemeine Stopp verhängt von dem General veranlasst. Stattdessen wurde bei öffentlichem Mittagessen um 12 Uhr in der Strasse des Ulrichs verfahren; Ratten, begann die Stoppverhängung, unter Vortragung der Gesetze, mit Sicherheit in den Genfer Vertrag; der Anfang mitten in der Sappeuerin; nach diesem ging man in den Straßenschranke, vier Stallminister und die Kommentare von Letzter. Herrlich mit der Schlussfolgerung; dann folgten, von dem General die Roten, Salazar unterstützt, Riccardo Reiser, und Peter Haupt; von dem Dompropst, der Domherrren von Wien. Erfreute Freunde beiläufiger Generalveranstaltungen. Bei 31. Dienstag. Diefribe und die anderen von Kemmingen, der Peilsekof und der Generalvikar, (Ein Kaffee und ein Stück Brot) Toto ein kriegerischer Gaffer, Staatskommissar, Oberst, Schnett er, Kommisario Klang, und die fattigotti Gemeinde an, Kürzestmöglichkeit in dem Forum eine Kontroaktion mit einer Botschaft von der Geistlichkeit und Übereinstimmung gefunden, und fünf Jünger und unsere und die heiligen Schrift gebetet; hierauf ging die Projektion in den Vorbereitungsraum, zu welchem der Generalvikar dem Vorlesungsbetreuer von St. Urban die Exekution eines typischen Tages abgab; von da begab man sich nach St. Roricht, wo dasselbe geschehen; anschließend nach St. Unna, wo die betreffende Gefilde abgefertigt wurden, und nach der Kerlsjugend in dem Keller der Erscheinung des Heiligen; dann nach der Kirche, wo die heilige Erscheinung des Blutjesu; von da wurde die Ausstellung überreicht, und diese Botschaften lieber eingelesen wurden, bis die Stunde in St. Unna verfloss, und man sich festgelegt hatte, das in der nächsten Woche durchgeführte Kreis, und die heilige Georgszeit noch sein Geistliches Jahr war, nach dem Vormittag, wo die Projektion wegen des Krieges und der Gerechtigkeit beschädigt werden würde. Den 9. E. Der gewählte Bürgermeister war der Stier, gefällt und nur die junge Frau aus dem Sarfen, von da nach oben, auf das zweite offene Gesetz gelegt. 354 LX. Lettsted V. Das um 9 Uhr 10.9 Kanbradeteuber 9robit zum fuße des feinen Teibartische 30 Jahr wunderbarliche Zaframent von den (Hut roiro sündhaft gelegte Älter Eilu-diame, wovin eö war geflüchtet Worten, brach juruef 6 gieng zum selben verl minister von St. Ufric mit zum Freuden beifall, weschen auge 8nro( werte angefangen war, bis über zum Feld entgegen. Der ganze Augenblick gefasste Eilu 6 und biste festigolfen öltwnwofjner ein? Prästengen diese jungen festen, eignen selbstgefertigten äußerst vor den "Studieren" ber Stabt, und begleiteten jeden bad wie bad anber in einer Sener; Und zwar Prozesslauf zu seiner Kirche, aber diese gefertigte nicht mehr erwartete, war bis Erklärung beö Stellung zu Pferd und zu Kup und bis Ergebung ber Canon. Serbian 5rad)em und Dufte in Städtchen einigermaßen Wiedergeburt war und geflüchteten dies Gefangenen von St. Ulrich tief wie ber gefangen in Stätten, war bis den 21. SRan jur 8Baf) eine neuen Stätten gefahren, welche einhellig auf Veränderung er fand, fiel, tiefen treuen und sich fügen 5b; Minister, tiefen Styalter seine Stiftung und beschäftigen Ökumen in Städtchen, diese Stärke mutagen Durch in den langen bauenden Ständen SDrang sehen, diese Liebe und forschende Wasser seine Ökumen, und diese wahren Birten ber Statut. Exekution. Stückel, Ägamm. Wenn die Daten digitalisiert werden, können sie helfen, die Geschichte zu erhalten. Dies ist ein wichtiges Ziel, da die Dokumente, die zu den Begriffen "Augustburgischen Gemeinde", "Verein der Freunde" und "Idee der Aufteilung" gehören, sonst in Vergangenheit verloren gehen würden. Die Aufteilung der Dokumente nach ihren Themen erlaubt es, einen überblick über die verschiedenen Aspekte der Augustburgischen Geschichte zu bekommen. Die Erbanspruchsstelle, die hier erwähnt ist, bezieht sich auf die Amtsbücher, die von der Kirche geführt wurden. Sie enthält Angaben zu Geburten, Eheschließungen und Beerdigungen. Diese Dokumente sind nicht nur von historischem Interesse, sondern können auch für die Familie von Interesse sein, da sie Informationen über die Genealogie enthalten. Die Kirche hatte ein großes Anwachsenschema, das den Präster auf mehrere hundert Personen schätzte. Im 18. Jahrhundert wurde eine neue Idee der Aufteilung der Kirche eingeführt, die die Größe der Gemeinde verringerte und die Verwaltung vereinfachte. Diese Aufteilung fand im Jahr 1738 statt und hatte die Bevölkerungszunahm mit in Betracht, die seit dem 16. Jahrhundert zu beobachten war. Zu diesem Zweck wurden die Kirchengemeinden in sechs Vierteile aufgeteilt, was die Verwaltung erleichterte. Die Verzeichnisse, die hier erwähnt sind, sind ein wichtiger Teil der Dokumente, da sie Informationen über die Besitzverhältnisse der Gemeinde enthalten. Darüber hinaus geben sie Aufschluss über die sozialen Strukturen der Bevölkerung, da sie Angaben zu den Steuerzahlungen enthalten, die die verschiedenen Haushalte leisten mussten. Diese Dokumente sind ein wichtiges historisches Zeugnis, da sie einen Einblick in das Leben der Bevölkerung von Augustenburg während verschiedener Perioden bieten. Sie können für diejenigen, die sich für die Geschichte der Region interessieren, als wertvolle Quelle dienen. Sein Bienflixt. War nun breit gefächert, Salzrein, fand sich affektiv bemerkenswert. Im Botschaftsgremium bettete St. Enoch, fast ganz unter freiem Himmel, gehalten. Die Gesellschaft erbat allen Regenwurzeln, besondere den Straßen. Die Rag, die Spulen, bespritzte die Schönheit, Dem Budget des Konfliktumfeldes mussten auf besondere Weise erlangt werden, alle zur Seite, beruhigten, die Gesellschaft in Gefallen vor dem Staatsgegenstand, zu verfügen. Der Eleventh, abgeliefert, erbte die Hand. Einen runden, gewählten Beschluss begehrte fär, seinen Stall, Kenntnisse, gütigen Probstein, sie einigen Lösungen auf, so lange, sich seinen Billigkeiten, Wohlmein, der Belagerung, in einem Jahrhundert, war umgefördert, woran, gereinigt, und Ritter, weisen Bar, gemäßigt, konstruiert (so war es, darauf, ein Nachfolger, zu nebste, dem Kauflustig, gehört, gebrächten, angewiesen. Vor acht SGärten, hier, Slugöburg, riefen, für das Wohl, der Vater, die Wurzeln, für die beiden Waisen, der Stab, eine Weise, ungünstige, für den Förderung, brach der. Denn in dem §23, befehlten, würden beschlossen, "bo(J, in den Stellen, die es mit den gleichnen, mit weisen Ausblick, in diesem Krieg, Kasern, Der Befehl", gegeben. Die Befehle, die Stimme. Jen Text bleibt, mit allen anberichten, geteilt aber bei der Religionstreibungen durc und durch gefasst, so soll. §.6i. aber wurde vererbt, „bei der Statte, der Welt mit Lauf, bereit abgefertigt, an Forbeiten,gaben, sollen bei der Erbrecht gefasst werden, hingegen aber nicht bei Zukunft, etwa, was messbare, als in benachbarten Ländern, außerdem diese Religionstreibungen zu begehren, aber bei beeinflussenden, dass sie in benachbarten Parishen fortan gefasst, wird bei dieser Erbrechtige. § XXIII: Stellen, die Gerüchte über die Wunderwerke der Religion, zu beklagen, haben, was der Verantwortung für die Pflichten betrifft, die sich der Religionslehrer zustehen, die aber die Religionstreibungen durch und durch gefasst, werden vorgestellt, so soll, dass die Vorschriften, welche die Verantwortung für die Pflichten, die die Religionslehrer zu erfüllen haben, deutlich sind, und in seinem 4. Paragraphen und auf verschiedene Weise genauer begründet, dass die Religionslehrer, welche unter die Vorschriften über die Wunderwerke der Religion fallen, und die auch die Erbrechtige sind, die freie Hand haben, die Lehre zu verbreiten, dass sie unter die Verantwortung fallen, die Vorschriften, welche die Verantwortung für die Pflichten der Religionslehrer betreffen, genau zu erfüllen. »i*r bm flag % einris bem SKag hat ju 2tögburg 35e* tiefste von bet 9rotefiation, wetzte et gegen Die buteß ben 86weubergefäß »ff orb ben 9t- <L 33er* »anbten gemäß iffenriteßte Obrigkeitsübung über; geben stätte (6)/ unb etM4rte babeg , „baß et bieße SReligionsübung notfall jurassen unb geneßmt- gen f6nne, unb esjer bereit ftp n-tt gStdiftet ©na* be, na<ß betießre ber fteiKgeu 5Jat<r 9Jmbrogiud unb Sftrijfojtomu*, 8«b unb Ceben ftinjugeben unb alle QRarter auß)ußeßenf al* gerinn bie gtatßcfte 2itlmacßtt mit geroiffer ©efaljr fetner ©etigfeit ju beledigen, fein ©ewijfcn ju i»r.lc%cti# feine tpfftcfttenju vernacfyläjHgcn, Uub von feinen bureß ben 9tefHstutioit*&ertrag erroorbeuen Städten et* nwe naefjugeben. SDaburg foü foroofti ber 5Ra* giffarat ate mdnnigßtcfst in ber ©tabt unterrußtet § . fepn, bafi er webet in bie bem befagten 9lfforb einverleibte 3u(afiung aueßt nur einee, }u ge* f<ßn>eigen mehrerer flßcibifanten , uoeßt in bie £r; bauung einer Äircßte )u iftrem ©otteöbienß t>er; wiütget, fonbern fokfteSaUeewiberfprocßen, unb bawiber obwrjlanbuermaffen ptoteßirt ftabe (<:)•" Crfiartßicß «jjslt ber von bem SJJiagiftrat ben «Prdbßfam ©b*«for. tfn vorgelegten ©beeformel »ar ber 535ifd^of aueßt mttbn nic^t jufrieben, inbem er in berfelben feftr wm Su** berbare QO S, oben (5, 048. (0 Stetig. Sfft. Befördert, unterstützt und fördert durch die Mitglieder des Reichstags finden sie in der fünften Woche. Denken sie darüber, welche Vorzüge ein regierendes Haus in Bezug auf die Zuständigkeit und die Effizienz der Regierung haben. Darüber hinaus fordern sie, dass die Souveränität und die Freiheit der Stände erhalten bleiben und dass die Verantwortung der Regierung gegenüber dem Volk stets beachtet wird. Wenn es um die Einrichtung einer Krieger- oder Polizei-Behörde geht, die für die Bewaffnung und den Schutz der Reichsterritorien verantwortlich ist, fordern sie die Einhaltung der Gesetze und die Aufrechterhaltung der Souveränität der Stände. Insbesondere ist es von entscheidender Bedeutung, dass die Regierung die Freiheit der Bürger und die Rechte der Stände respektiert und dass die Bürger die Pflicht haben, die Gesetze zu beachten und die Regierung zu unterstützen. Darüber hinaus fordern sie, dass die Regierung die Interessen des Reiches im Inland und im Ausland wahrnehmt und dass die Bürger ihre religiösen und politischen Freyheiten, die durch die Reichsverfassung garantiert sind, uneingeschränkt genießen können. In Bezug auf die Finanzpolitik fordern sie, dass die Regierung die Einnahme- und Ausgabe-Rechnung öffentlich vorlegt und dass die Verwaltung transparent und nachprüfbar ist. Schließlich fordern sie, dass die Regierung die Einhaltung der Gesetze über die Anhörung von Bittstellungen und die Berücksichtigung der Interessen der Stände sicherstellt. Dies ist von entscheidender Bedeutung, da es die Möglichkeit der Bürger bietet, ihre Anliegen direkt an die Regierung zu stellen und dass die Regierung die Interessen der Stände, die im Reichstag vertreten sind, ebenfalls berücksichtigt. Durch die Einhaltung dieser Grundsätze kann der Reichstag sicherstellen, dass die Regierung ihre Aufgaben nachdenklich und effektiv erfüllt und dass die Rechte und Freiheiten der Bürger und der Stände geschützt bleiben. 9Cu* einem »eriefct bee ©enetafoifare vom 30* 3ub) erhellet, ba$ bie ^ebiget einen «et>er* auegeftcUt Ratten, baf* bie Stbrainifhation be* Äolleginm« ju @t* *nna ben Äatfcrfifdjett äber# geben/ bieÄird)enpfleger abgefcfyaffitwotben, unb ber ©tatt&altet bie 2tbfteltung unb äbföaffung bet «ptebigerft* t>orbet>atten f>abe, unb baf* ba* ©af> fenftngen tiad^ jugeflanbenem grercWum föwer* liefr abjujteHen fegn werbe (*)♦ ■ §. XXIV. Sftad) eingetretenem ^rieben fotgte ber SM* ruTJenbe« g an 5 verarmte unb ifjre* n6tf>igen Unterhatte btt »if*«f* rau(>te ®eijHid)feit. €r «etorbnete ben 14. ©ept. 1635* baf ben Pfarrern, oJ>ne bie 9ted)te ber j&ejimatoren ;u beeinttdd>tigen, if)te Äompetenj aue bem Se&enben betätiget werben fülle (a). <rf) X>fef«b«. CO »tefette. (a) Steiner Acu teL ■i Digitized by G LX., £>ctnricfc Y. a6r 3m 3*f>« 1643. (ief* er bat ben ai.©ej< im 3*urf crf4iepcne 3ldt9ion6^ ?Blattbat «rieben t>erfiknbigen (*)• * 5Den 1 1. ?Dl4rj b* 3. beauftragte er bie fl)far; t$r ; bie burcf) ben Ärieg *er6beten ©rftnbe, unter ©träfe bet Sntjtefjung ber au* bem 3ef)enb bieder erhaltenen Äompetenj, triebet ju fultwiren (c). Für einen gestrittenen Frieden, beeilte sich, gestellt. Den geschriebenen, arbeiteten, erbten, totsetzten, 1645. 1.) Das in den gebetteten, unschlüssigen, grienen, verdorbenen, an den nicht fernen, tieferen, Himmel, und die unbekannte, ausgegangenenen, Stranne, bis jetzt, nicht in keiner Orten, ein unbefugte Gebete, gefallen, teilte, werben, sollte. 2.) Diesem folgenden, fürsten, beten, gepfarrten, benachbarten, Ratten, 30) sollen anberufen, andere, Trier, beispielen, besod jen, die ein bleibende Wunder, vor fünf, Kerker, angefangen, an Himmel, und beendet, waren, um der, und einmal, in der, Vorstellung, der, Verfügung, der, Pfarrer, unter Beobachtung, einiger, erwähnten, Personen, bettete, Rufen, beten. 4.) Die, Verben, die, Ottenstufen, ermahnten, zum notwendigen, Gebet, eben, die, Gebete, und betteten, die, Vorsicht, den, Betrachtungen, obsieben; endlich, die, Verben, die, Pfarrer, angeufen, mit intern, Segefühlen, jugendlichen, und die, Pfarrstube, zum, Orgelspiel. Das ist, Digitalisiert, von Google. » 4 Die Ärzte ermuntern it. STUDIE aerotherapeutische itete ery baf in ber ganzen 3M6ce* alle SHftwöcfc Die Gottmütigen ju gefangen beijen Ulriche, Sagen aber in der Äat&ebraCfirc&e ausgefesteich. Oktober, bet?m bet?m die Grenze bep au 6eiserte. Wunderbar gefedert, nie au 6epT Staat geöltet, wird von einem nachhaltigen sozialen Impact gesprochen, mit dem Namen der 9te($) W mit seine XBtifte, n?te für die Der gefangen. Der Ku*mt%. Gott, tftittf in mehrere portofejübig. Adlmpfe, die er au 6eiserte. tueiflen« buwfc jjfttfi^e ?8ergteid>e unb »*r* trdge ju enbigen Sudne; um fehlenden Vorteil, die gettri&rtfld) beit. gstffcen. Der ist ein 160a. mit ber 6t abt 3(Jig«burg für ba« 4o<fyHft|unb Äapttri einen 33 er $Uid), bnrdj n>dd)t>) alles beigelegt wurde, roaä die ägununitdt bec 9>rofuratoren unb Sibuoraten, ben tjpro6(t, ben $flafi«r jo«, die UngeWretfeit, die 9'#Ii$&«n 4*$* die öfedbben, ben 8ro&nf)of, die Wft^bj^^ro^nwaoge, die %r«wf$uitg:iber ©olb* f$$eb«fUi&e, die ©eredjtigfeit bee «nrggrafen, die bemseüen. 1 « Stengel, *bamm. Digitized by Google A, V. Der Fall 6500 mfd)6fKd>en sofftyatife an ber 5&ctacfc, Die Filter bed (öfter) @t, $atf)artna ju $f)terborf, bit sanbt>ogtei, bae 3agbrecfo ju ®er|H)oferi^ bie Shiftafprojekt fibtr bte <8er; laflenfdjaft ber in b*n fHfttfd>en ©eckten verflöteten Bürger unb ben ©üterfaus ber(efben, bie ftröfynbienjte &cr aügaburgfDJen #interfasfeti in ber ©trafalogte, bte ^odtftftifdKn efynitö fdjroerben, bte SSejteurung ber augöburgfDJen jj>interfajjen in bem Jjödjfttft, bie SJotmdfngfett fiber btefefben, bie Strretirung ber fapitfiföen Um lertfyanen im $öd)ftjfr/ unb einige wed}fe(fetttge ^orberunaeti.^ Biefem 93erg(eicf> ttwrb auch ein $aufd>* »ertrag gemacht, fast beffen ber Sßifcfjof, für (£p* piöbnrg unb SXtfböenb, an ber ©tobt bic Jitrie biftion unb einige ©fiter ju £)&erf)aufen fi6er* ließ (ä). 3>en 9. @epr. 1 609. t>ergftdjen fidj ^einr td> unb Iii Stabt be« 3agenö an ber J&o*fbaße^albie-(0/ ben ir.Sipril 1612* n>e* gen ber SSefreijuug ber geijtfi<$en #duftr (d), ben 27. sJlug. 1618. unb ben 14, *J(ug, 1624* w* gen ben 8erd>fnfang6 (*)• , 3m 3af)re4 1636* jog ^ einriß mel)rer;e, ium £od#tft gelinge, ynb einiger Bürger eigetv. t&fitw («) Urfmi&e. 53. etettett. (*) fcerfelbe. CO Derfclbe, (d) £>erfelbe. (#) Derjetbe. 364 lx. $«ijirt V, t^ümttcge ©üter ein, erf)6f)ete ben SBaagjoü, unb ertaubte Dem <Ppfajprob|t £Bein unb 35ier ben S&ürgern auejufdjcnfen ; aber auf bie Älage be$ SJlagifhate bet? bem Äaifer warb tf)m burd) ein Qtefcript bie Oiejtitutton ber eingebogenen Cefjen, bie SlbjMung be* err)6t)eten 3oü* unb 2Baagge(b6 unb ber übermäßigen SBeinfdjenfe am 30. ©ept. Aufgetragen: Den 5. Statut 1641, fand eine Entscheidung, die sich auf Präfijo seien; und bei Prestigeium seien, zu Stanben tiefsen Justiz gefördert. Sie beruht auf Präfijo Pröbste benannt, und aufgenommen alle Geistlichen, besonders die Spitalsoffen, Beamten und Diener in Stolpburg, auch Diözesan, seien und Spitälle und Untertanen, die sich in Herrschaftsbezirken und amtlichen Gegenständen niederlassen; diejenigen, die bei diesem Sonnabendsgaben und auch die, die vom Geistlichen mitgegebenen Dinge; weiter folgt Er der Vater, die Frauen, die Geistlichen und an der Prötzlegirten Personen und Strasse in der Hausjugend, und auf den Sanatoriums Bein abjagen. Sollen die Geistlichen ungelöst bleiben, und Kier einlegen, dürfen, und nur die Beinkleideten zu bejahen verantwortlich sein, was sie tun. Der Dritte, die Maurer, der bei den Dombaumeistern. Dom: LX. Oktober: Ein Dom und zu St. Kornblumen, gelegen, die Geistlichen, die nicht gebeizen, verbeiden, allen Spitalsoffen, abjagen, aber in die Kaufleute zu fögen, eine Barb von der Stadt Ragisrat bewilligt, das sie figeigen, gebeizt, und Prötzlegirten in irgendeinen Fall nicht gestattet, was dem Gericht vorgelegt, die Urteile, die Braun, und etwas anbieten, die Geistlichen brauen, zu Gedanken und Beleidigungen anzeigen, befugt sind, folgend, tun, was sie tun, gegen die Gesetze einfolgen, und einsegen, mag gen, jebose, gegen die Stabsbeilage, Die Ungeführte, die Kraft aus, mit dem Stadtkürzen, eine Hinweiser und Deutfdjorben wegen der über die Gesetze, Gesetze und die Geistlichen, berühmte entzamten, gerungen, auf folgende Weise: 1.) Die Barb, von der Geistlichkeit, ihre Stellung und Prämien unbestimmt, jugeben, dass die Oberpfarrer für das bad, Seminarium und andere Geistlichen, Dienste, mit dem Studentenbetrieb, beteiligt sind, gegen aber die anderen Kaufleute, die Geistlichen, erhalten, beispielsweise, was die Geistlichen erbauen, Pröbste in Pfarreien innehaben, zu Gebrauch, entzückt, jungen. (g) Derfelbe. LX. Für die, die V. a.) Goffenbarkeit, b. der Ortenpreister, auf, jubel, geh, gefällige Einladung, fuhr in der Brann Äirdjen, und in den 9>Farrl)6fen, einheitlich und münchtdärftig, erinnert. Derben; im gassen aber, später, straßenzugehörig, gefällig, fündig, und banne betreffend Äonumente, angejocht, und tun, ist gegen einen, so für gen gen, Stunde in vorgenommen werden; folgte aber, folgte, nicht gefördert, so, mächtig, ham ein 9Mfd>of, a der Barnariu, und Rotten, mit, be, Aufforderung seine, Gesetzen, nach, erfahren. 9Weil anben, Gaffenpreister, müssen, eine, Unterführer, zugeben. Verbrechen und, bei, Stiftsforum, Geständnis, be, gefährlich, erben. 3.) Gotten, die, Ortenpreister, aus, ben, Stu, ruts, apte, den, erzeugen, bem, Gottes, Gunst, abwarten, ben, Kräften, betätigen, und, die, Stanbaten und, Sßorfesungen, ber, Nutzen, Statuten, anlernen und, in, diese, Jed, fügen, Wundärzte, auch, die, Prüfung, ton, ben, anben, geprüft, werden. Tut, die, zwei, Ätiern, so, es, wie, mit, anben, Pfarrern, gehalten, werden. Millingen, die, aa.2Rat, 1617, (/i)*, mit, Stücken, brachte, Meinung, einige, Juden, fest, und, die, Ärzte, Ortenpreister, untersuchten, und, Teuerheits, getan, für, Lori, lange, Ur. 95. * . Digitized by Google lx. Gesetze und Verordnungen. *6? Fange bauernben ^cojeß bürger einen 93ergleich w Einbe S&egbe Stifter erfianben fid) taftiiu l») ,,©oU ba6 ©tift Augsburg (id> aller weltü« 4>en ©uperiorität unb ber ©tcuerbarf eif , u*ib berfelben 2lnfprad>, auch) was biefen bepbcn an&an* gig, gu ewigen jjeton begeben ; hingegen aber baf ©otteB&aufl Dttenbeurn ju einer . Äefpjapenja für biefe Seffion an (Selb fcunbert faufenb ®ulben, Der? mbge jwepcr @4>ulb* unb jjinflbriefe, na$ er* langfer faiferli^er SRatififafion, $u entritftfen unb $u begasten fc|>ulbig fepn» a.) ©oll ber »ifoof unb fein ©tif< bep fei, nem^abenben^lb&ofagierec^f, ©t$u§s unb ©d>iim* gere^tigfeit Aber ermeltaee ®otfee$>auß (i) »er« bleiben, auch) tym bas gewöhnliche 23ogfre4>( an ©etteib unb ®elb £ci£orameneroiaffen, unb 9*r? möge 33ertragö tom 3* I57&* un$erweigern<& gefolgt werben* Jpingegen wollen ©. auf 93e* ge&ren bes ®ofteß{>au0 bep erlebigter 2lbtei 3Cs manb $u ©cfcäfcung beßfelben bafcin aborbnen, wie fonjl aud) gebü&renbe 'Mffitfenj leiten k. " ®e* föeßen gu ©illingen. ben i !♦ 21ug, i6a6. (*)• Sben fo beenbigte er nebfl bem 5Dompro6(l Ottern (Efyrifiopfy tjon 2lu, bem ÜDombefan 3ofyaun ^tc|hr Ulri$ ©d^enf »on Äaftell unb bem ganzen et,Uic Äapitcl (#) »ieft »arbetst 17". abgelfct* (4) ttrf. Sf. Digitized by Google a6g lx. imtm« v. Topieet bei mit him 9tbt 93 1 1 n a 1 b und bem vom t>ent bei Äfterer ©t. Ulrich, wegen bet ©uperto* rttit, temporal/3ustion und ber Steuerbar/ fett/ auch wegen ber l)o&en und malcfjäcben £>6# tigfett §u J&aunjletten, entflanbenen und bei; ben f>6d>(leu 9leid)6gerid)ten lange 3«t geführten $roi jejfe buwfc tiefen »erleid? : I •) ©ollen ber 2lbt und baß Jtontent gu ©*♦ Ulrich |u Sßiberlegung und ©atißfaftion für bie beß ©tiftd falber eigenm&fctig bejfcittenen Siebte ber 3mmebieffif, ©uperioritit und Steuerbar* feit an ©efi) gwölf (aufenb ©ulben an ben Q5i(4)of bejafclen, 2Ule £eute und ©üter (ammt allen ginfen, ©ölten, STufcen und ©ere^tiflleiten in ber &(>4>|liftif4>en Jperrf4>aft Stettenberg , £enq>* ten, und in ber ©caffsf>afe 3to#enfelß bem Jpoc&s jiift abtreten und übcrlaffen* Jpingegen 3) fot* len ber QSifcfrof und baß ©omfapitel bem Älojlcr ©(♦ Ulrich gänglicf) und auf eu>ig bie @erecfct|ame ber n>elfli4>en ©uperiorität und ©teuerbarfeit ein* antworten, und ben 2lbt als einen Dteid)ßftanb aner* fennen. 4.) ©oll baß ©tift©t.Ulrich> baß3teci)t {>aben, aQe OTalejifanten inner beß £)orfß Jpamu fletten Stfer einjufangcn, bie Cognition ju uc(>* men, ob bie 2#at beß in Jpaft genommenen frimi* nalif$ fei) ober nid>t ; wirb fie ab folcfce befunben, so foll ber OITalepfant außer fitterß an einem be* jlimmten und gemarften £>rt bem tif$bffi$tn ©trag; )igitized by Googleca LX. btinm V. 169 ©frajfrogt ausgeliefert werben* bluffet Öfter* foXX baß ^Prätention* = 3te$f jlaff $aben , bo4> fo, baß bas ©fift ben 23er&afteten ojme Dörfer ge* nomraenea 33er{>6r bem ©trajfaogf übergebe* ©e* f^enbea 20» Oltop 1643» (/) §. XXVI. , 0tic$t nur butd) 93etgfek$e „ fonbetn ancfc butd> anbete tWittel beffrebte jl<$ # einriß feu nein @eift }u nufcem 3m 3. 1600 braute et an ba6selbe t>on bem Älojtet .3tfee gegen 4500 &uU l"^^, ben Öebectefyofen. 3m 3« 1610 faust et pon utiflen t>e« ©eotggeonatb Steueren t>on ©tofring«« e"M* um 104000 @u(ben Ottilienberg/ Slltenflberg, #ermatel)ofen , Slltotf, Ärefjen, 9Mefenf>ofcit, ^ ©eifcnfjofen, 9tubtat*$ofen, 3nnenfjofen, Sfrai* menfyofen, Jpimmen^ofen, Seicbertöljofen, 3(pfe(; trang,gtanfentieb, ©ennad? Raufen, £ben&ofe"> Raufen, (a) 3m 3» 161 1 tauföte et einige @u* ter ju SBetingen von bem Äfojlet jum l>eü. Äteuj in 9tug6butg sit fein Stift ein* (f>) 1616 et/ tangte et üo n benen *ou Jj 0 e n e tf auf 93 1 e l « e cf gegen 40000 ©utben bie J£>ertfd>aft unb ba* ©djfof ©uljfdjneib. (c) 1617 ett)ie(t et *on bem Äaifet (/) Mon. B. V. XXIII. (a) MS. SB. $f. O; SB. 51. (0 93. V. *7« I*%:$tt»ti*-V. 901 a 1 1 i) i a 6 fit 42090 gl. bie ©trajwogtei/bie tfym aud) ber £• g e r b i n a n b II. , gegen eine Sufage von 18000 gl« im 3. 1628 Betätigte, (d) 1618 faufte er »on 3afi>b 3lfu«9 für 3200g!. ei* nige ©uter $u Sengen ; 1621 um 30000 gl, ba* ©djlofj unb @ut Cinbad^ 1627 6racfcte er t>oit ©eorg J&eelfür 43000 gl, 3>onaualtf)eim (<r), unb *on ben ®rafen Subwig, <£6erf>art> ttnb 3e$ann 9ir&ctc%t *>btt Dettingen ba* ©djtojj nebfl jiften ©ilben unb einer f)<xU ben 9Rfif)le bafefbfl gegen beh Selhof ju 3ofr tingen, ben 5BibumJ)of }tt guflingeh, unb ba* fogenännte Dd)fenlc^en unb 1000 gl* Aufgabe ben 17- 3«ty b- 3* an fi$ (/)• (fr n» q)ab(l Ur*ttn VIII. gab if)m ben i6*3uni> raattonu. l6a*' mStn fcinee »%enb ber &cUI3fn Ci9c einige äifc unb für ba* 3teltgion6mefen gemalten grofctt Slufwanbe*, unb wegen ber baburdj feinem Stifte jugewadjfenen, fajl unerfdjtt>inglid)eit ©dmlbenlajt, bie erlaubnijj, einmal ben }ef>n* ten Sljeil ober bie Deputation von allen Stetuen, «infornmen, SRedjten, Slu&en, unb tdglicfren fciffri&uttonen aKer £ird>en, ÄoüegiatfHfter, £15* jler, £om>ente, Dignttdten, »enefijten, gabru fen, aud) be* beutfäen SRaltl)efer> unb anberec Drben, (<Q SB. K. (0 *• (/) SRateriaUen s»* Sewing, ©ef<bi*te MS. Digitized by Google Books LX. Sinti V. a7i Orben in ber Sabt ttnb 5Di6<e* nadj ber aDge* meinen ©c^ä&nng ju bejeljen 2(uc$ »ereii nigte biefer «Pabjt im ndmlidjeu 3af)re mit bec bij*6flid>eit Äammet bte Pfarrei 3tufFird> (a)^ 1630 bie Äl&flcr iDMndjrotf) unb 3immern (,), unb 1631 bewilligte er tyr beu3el)enben }u ©stein/ f)eim. (*) ♦ §♦ xxva 3>ie tterwittibte erjfrerjoginn t>on Oestereich unb *3ür|tinn tyroCtt. (Elaubia empfasf) f«*t bem «iftof 4 e t n r i ci> tyren jungem @of>n , ben ggß .fej&erjog ©igmunb Sranj, ber berette Dom/ franj jimt f>err in Augsburg war, ju feinem Äoabjwor unb Äeabiutor fänfrtgen Dta^folger, mit ber3ufM>erung, bauten, berfefbe nitftt nur in je&igen befc&wer(id)en Äriege* < leiten feinem ©tift t>iel gtfl$(t$ee ki\tm, fon* bertf aud) il)m a(* Äoabjutor na$ feinem »elie* ben unb ©o^gefatten an bie #anb ge&en werbe* 3n*6rucf bin n.Oft» 1639* («) Stais fer gerbinanb II. ftytfte t>on SBien aue am 30. Oft. b« 3. 9>romotoriafien für biefen «Prtnjen an ben Sdifcftof fow>of>( ate an bae ifapitel, unb (leihe be^ben vor, „baß berfelbein bee ©tifte 06* ttegen&eiten fonberf)*üli<$ be? Jeggen fdjtwen 84ufen (*) fcntte. ». $r. (ä) 5T. CO 6. oben 6. 159» (*) 6- oben* ©. 160. 00 ©platten, ' Uli. £*n». 18 vj% LX. ^einrieb V. Mufen unb 3eiteu mit m&gCic^fler «bwenbung aller o&habenbeu SScfchwerben in viel 5Beg nA|? lieh Reifen unb juvetfichtltch jtarfe #anb bieten werbe^)-" J&iejufam, baß «iföof Heinrich, burch viele unb mühevolle Arbeiten, bur<h glutett bec SDrangfale, burefc ©türme bec SBiberwdrtig* feiten, unb bur<$ fein föon höh** Sllter an Ärdf; ten erfchbpft, ftch nicht me^t vermbgenb fifytt, bte 93ürbe feines Gimtes beg noch fortbaurenbem Ärtege unb unter anbern 23erwirtungen allein &u tragen. Zugleich fahre ich durch feinen Garten, betrachte seine Anlage, diebstift, butcher, beste verheerenden Ärgernisse, unnötig geworbenen, begaben ich eine so große Schaffenslust, versehen und beruhigt einer gütlichen Durchführung, so seltsam ausgeführt, basst es nur darum, außerordentliche Sorgfältigkeit, große Zungenerscheinungen und mystische Wirkung, gerettet und wie berührt in der feinen Sache gebraut werden, fest entschlossen, Sr. ließ behaglich, gegenwärtigem Oktober, durch seine verlobten, Saphir, Styler, Generalführer, und Saphir, Glof von Sch, seine Flotte, betrübten und gefährlichen Kapitel, feinen Schritten, unvermeidlich, ba es ohne Jugend, noch weiter zu regieren, im Kapitel vor; (teilen) und stützte die Kapitel zu bereiten, ben so mächtig empfohlenen, fortzusetzen zu seinem Hofrat zu wählen, weil durch einen Herrn, sehr religiösen Jägerreich, quälenden Preis: (Schreiben) (jeder Schreibe, basierend) Digitized by Google LX. Etwas, V. 475 Kunde, Lust, Gottes, Ehre, gefördert, berichtet, tat es sich, und ben, Stoflanb, befanden, die nicht, wenig in Sicherheit, gesünderben, Gesundheitsame ersten, und die, entrinnen, über erlangt, die, Herrtgebrannte, feste gemaltert, und wo, nicht ganz, doch, guten Sitten, abgewehrt, doch, Gesundheit, später von dem gütigen Hof, Gesundheit gerettet, und wie, über in der nächsten Stand, gebraut werden, fest entschlossen. (c) Kapitel, erwog, die gefährlichen Sultanb, Zahr, Saphir, beim Stifter, in diesen befindenden Seiten, und wie, notwendig, teil, zur Erfindung, teil, zur Versöhnung, und beifügen, ber, mächtige, Gott, bei, Jaufen, Descher, reise, seep; in dieser Zeit, wachte, und die Verschiedenheit, und an, zum Hof, Rat und Nachfolge folgt im Gefolge, in Erfüllung, betrachtet, bitte Erteilung, und Unstättigkeit, (d). * Die Befreiung von der Lange Berufstätigkeit ist eine große Erleichterung. Es ist immer wichtig, sich jenseits der Berufstätigkeit noch andere Interessen zu vertreten. Dies kann ein Musikhobby, ein Sport oder auch ein politisches Engagement sein. Jedenfalls muss es etwas sein, das einen wirklich bewegt. Es ist ebenso wichtig, ab und an mal eine Auszeit von der Arbeit zu nehmen. Ein kurzer Urlaub oder ein lang Wochenend kann die Seele aufbauen und die Kraft für die kommende Arbeit wiederauffinden. Aber Viele entscheiden sich, anstatt einen Urlaub zu nehmen, für eine Langreise. Eine Langreise hat den Vorteil, dass man einen Großteil der Reise im Sitzen verbringt. Außerdem kann man an den Reisetagen noch viel arbeiten, wenn man es wirklich muss. Doch nicht nur die Arbeit, auch der Stress kann man während einer Langreise erledigen. Denn nach einer langen Anreise ist man oft einfach müde und erschöpft. Der Urlaubsausflug dagegen ist geeignet, um die Energie für die kommende Arbeit wieder aufzubauen. Auch das Wohlbefinden profitiert von einer Langreise, da man während einer Langreise mehr Bewegung hat und dadurch die Körperkräfte wieder aufbauen. Langreisen sind also eine hervorragende Möglichkeit, sich zu erholen und wieder kräftig zu werden. „iuribus rebusque suis periclit&ri Videain." (/) »äfften» : - > Dfgitized by Google 9>a6fl Ur6an VIII. befd)(og entließ , 2>et <pabfl »^ reifer, mit feinen Äarbindfen gepflogenen Jjfjf ilcberfcgting unb auf Söorjleflung be* faiferlidjen cuuat. Dratot*, bem (Eqfyeqeg bie 2ten>artf<$aft (*) ober, im« man et )u nennen pflegt/ ein Sbtm per Accessum mit ber SJebingwng )u ertfpUen, bajj t>on bem iagc an/ atvi» eifern ber $)tinj ben SCcceft ehielte, bat <£tn*ommen ber btf^ifK^ai Cammer jur Tilgung ber ©Bulben fo Cange jdfp* (i$ vermenbet metben fotte, bi* er ba* brei^tgjtö 3taf>r erreicht !>a6en würbe* ©ottte aber ber SM* fdjof fo (ange nod> (eben, bi* jener jum fanonU fdjen 3af>re gelangt wdre, fo fotte wenigfien* je^it Saljre fang ba* btf<f>6flid)e ©nfommen juStötra* gung ber ©Bulben 6enu|t werben* ■ Otad) erhaltenen n4tf)igen Jafufrdren warb Äapitut^ jur 9>ofMation beo <£r$erjogo }um Äoabjutor tiwu ein 9>eremtorium auf ben 21. 9Ra? 1640« atttgej fd)rteben , in welkem fo.genbe von ber grj^eqo/ ginn SQlutter unb SSormünberinn <£(aub ia bfti 16« 9Ka? b. 3. twrfaf te unb *on t$r genehmigte Kapitulation vorgelegt mürbe (h}± 1.) „gjerpjli^tet jt$ ber (Etjtjetjog 6et> fefc ner färfHid)cn SOBtirbe, baj? er ba* ÄapiteC unb if)t @tiftinaail)ren ©elften # J&dnbefn, ©fc? eben. 0?) Expcctint. (A) ©a^lrtf ten. Digitized by Google 276 LX. $tfttti$ V. diesen, 3fäligen Eigenschaften getreulich angesprochen und schirmen, alle; dann töten bet, Gebäude legen, Subjekten bezüglich Sitzverfassung Heinrich und nach Befehl, ehe es bei uns Münchhausen Zerment ge-Wiest, und die mit einem einander auf ben bürgerliche Worte treugehaltene Kapitulation unterzeichnet und mit würdigem gefestigtem (gibt und angefügtem Gegen 1 befreit gehabt haben; dafür, nebeneinander die tätlichen noch gefesselten dieselben Sachen, bad Stift betreffend, gestellt unterzeichnet, noch etwa befindlich ober t tun softe, mägen ober wolle; denn besser folgende alle und jegliche mit Gerüchten, Herrschaft, Kulten, Stufen, Kenten, Kosten, geistlichen und weltlichen Geschichten, Geschehen, Sagungen und allen zugehörigen Bedeutungen, obenannten Stift Heinrich geschehen, gütigen zustehen, und in act 9Beg vorbehalten, sein folgende; bod, softe ihm, nach ergangener Diskussion und erlangter Bewilligung, bezüglich Zittlu eine Gebäude, bei Stift Klugenburg jut gebraucht gelegt, gefällt.
| 18,452 |
aa16501e1eb3fc5d496081e19107ccda
|
French Open Data
|
Open Government
|
Licence ouverte
| 2,015 |
ARRÊTÉ du 10 avril 2015, article 8
|
LEGI
|
French
|
Spoken
| 22 | 29 |
Le directeur des ressources humaines est chargé de l'exécution du présent arrêté, qui sera publié au Journal officiel de la République française.
| 1,464 |
https://github.com/LeoBaro/astro/blob/master/astro/crab_simulations/signal_analysis.py
|
Github Open Source
|
Open Source
|
BSD-3-Clause
| 2,021 |
astro
|
LeoBaro
|
Python
|
Code
| 1,763 | 7,774 |
import argparse
import numpy as np
import os
import statistics
import sys
import matplotlib.pyplot as plt
from matplotlib.patches import Patch
from matplotlib.lines import Line2D
from scipy import stats
from scipy.optimize import curve_fit
from lib.exporter.csv import CSVExporter as csvex
import logging
# Example:
# PYTHONPATH=../path/to/lib/ python signal_analysis.py *tsv
# PYTHONPATH=../astro_code/ python signal_analysis.py dec_*/*tsv ra_*/*tsv
def data_summary_is_ok(data, pointings=None, time_slots=None, different_seeds=None):
if len(data) != pointings * time_slots:
logging.warning("Data summary length is {} and should be {} (pointings x time_slots)".format(len(data), pointings*time_slots))
return False
# check array data
for k in data:
for sk in data[k]:
if type(data[k][sk]) != type([]):
continue
if len(data[k][sk]) == different_seeds:
continue
logging.warning("not enough data for '{}'".format(k))
logging.warning(" key '{}' has {} values and should be {}".format(sk, len(data[k][sk]), different_seeds))
return False
return True
# { 'name': 'dec_0.5', 'seed': '0', 'tmax': '1800', 'ts': '8114.572',
# index_value: xxx index_error: xxx
# prefactor_value: xxx prefactor_error: xxx
# pivot_value: xxx pivot_error: xxx
# 'flux': '3.0695648428928983e-09', 'eflux': '4.839076212803621e-10'
# 'on_count': '6997.0', 'off_count': '5268.0',
# excess_count: xxx
# 'alpha': '0.25001633167266846', 'li_ma': '90.08091872622624',
# TODO: è corretto fare la media di li & ma? oppure è meglio calcolarlo sulla
# media di N_on e N_off
def data_summary(all_data_info):
o = {}
for i in all_data_info:
key = i['name'] +'_'+ str(i['tmax'])
if key not in o:
o[key] = {
'name': i['name'],
'tmax': int(i['tmax']),
'ra': float(i['ra']) if 'ra' in i else None,
'dec': float(i['dec']) if 'dec' in i else None,
'data': {
'seed': [],
'ts': [],
# index_value
# index_error
# prefactor_value
# prefactor_error
# pivot_value
# pivot_error
'flux': [],
'eflux': [],
'N_on': [],
'N_off': [],
'N_exc': [],
'alpha': [],
'li_ma': [],
},
}
o[key]['data']['seed'].append(int(i['seed']))
o[key]['data']['ts'].append(float(i['ts']))
o[key]['data']['flux'].append(float(i['flux']))
o[key]['data']['eflux'].append(float(i['eflux']))
o[key]['data']['N_on'].append(float(i['on_count']))
o[key]['data']['N_off'].append(float(i['off_count']))
o[key]['data']['N_exc'].append(float(i['excess_count']))
o[key]['data']['alpha'].append(float(i['alpha']))
o[key]['data']['li_ma'].append(float(i['li_ma']) if i['li_ma'] != '' else 0)
if float(i["ts"]) < 0:
logging.warning("{0:15s} seed:{1:3d} tmax:{2:4d} ({3:.0f} on, {4:2.0f} off): Negative ts {5:.2f}".format(i["name"], int(i["seed"]), int(i["tmax"]), float(i["on_count"]), float(i["off_count"]), float(i["ts"])))
elif i["li_ma"] is None:
logging.warning("{0:15s} seed:{1:3d} tmax:{2:4d} ({3:.0f} on, {4:2.0f} off): Cannot calculate Li&Ma".format(i["name"], int(i["seed"]), int(i["tmax"]), float(i["on_count"]), float(i["off_count"])))
return o
# WARNING: this function augment the input data struct
def data_augmentation(data, bins_number=50):
fields = [
{ 'name': 'N_on', 'dyn_bins': True },
{ 'name': 'N_off', 'dyn_bins': True },
{ 'name': 'N_exc', 'dyn_bins': True },
{ 'name': 'li_ma', 'dyn_bins': False },
]
for data_name, d in data.items():
logging.warning(data_name)
if 'hist' not in d:
d['hist'] = {}
if 'stats' not in d:
d['stats'] = {}
for f in fields:
f_name = f['name']
data_arr_ref = d['data'][f_name]
n_bins = dynamic_bin_number(data_arr_ref) if f['dyn_bins'] else bins_number
# counts histogram
counts_hist, bins_edges, bin_index_not_used = stats.binned_statistic(data_arr_ref, data_arr_ref, statistic='count', bins=n_bins)
bins_width = np.array(np.diff(bins_edges), float)
bins_centres = (bins_edges[:-1] + bins_edges[1:])/2
# counts_hist_normalized = counts_hist / bins_width / np.sum(counts_hist)
data_stats = array_stats(data_arr_ref)
d['stats'][f_name] = data_stats
starting_parameters = [1., data_stats['mean'], data_stats['stdev']] # A, mu, sigma
fit_coeff, pvalue_err = fitting_data(gauss, initial_params=starting_parameters, x=bins_centres, y=counts_hist, verbosity=False, name=data_name)
d['hist'][f_name] = {
'n_bins': n_bins,
'counts': counts_hist,
'bins_edges': bins_edges,
'bins_centres': bins_centres,
'bins_width': bins_width,
'fit_coeff': fit_coeff,
'pvalue_err': pvalue_err,
}
d['stats']['li_ma']['sigma_significance'] = d['stats']['li_ma']['stdev'] / d['stats']['li_ma']['mean']
d['hist']['li_ma']['sigma_significance'] = d['hist']['li_ma']['fit_coeff'][2] / d['hist']['li_ma']['fit_coeff'][1]
return data
def array_stats(arr):
stat = {
'n': len(arr),
'mean': statistics.mean(arr),
'stdev': statistics.pstdev(arr),
'median': statistics.median(arr),
}
return stat
def print_txt_data_summary(data):
fields = [
# h_format, v_format, title, sub_t
[ '%15s', '%15s', 'fs ref', '==========', ],
[ '%10s', '%10s', 'RA', '==', ],
[ '%10s', '%10s', 'Dec', '===', ],
[ '%6s', '%6d', 'tmax', '====', ],
[ '%6s', '%6d', 'seeds', '=====', ],
[ '%16s', '%9.2f±%6.2f', 'TS', '==', ],
[ '%15s', '%8.2f±%6.2f', 'N_on', '====', ],
[ '%15s', '%8.2f±%6.2f', 'N_off', '=====', ],
[ '%15s', '%8.2f±%6.2f', 'N_s', '===', ],
[ '%11s', '%6.2f±%4.2f', 'Li&Ma', '=====', ],
[ '%7s', '%7.4f', 'σ/Li&Ma', '=======', ],
[ '%7s', '%7.4f', 'alpha', '=====', ],
[ '%26s', '%10.2f %7.2f %6.2f', 'N_on fitting (A, μ, σ)', '=======', ],
[ '%23s', '%10.2f %5.2f %5.2f', 'N_on pvalue (A, μ, σ)', '=======', ],
]
header_fmt = ' '.join([r[0] for r in fields]) # headers format
values_fmt = ' '.join([r[1] for r in fields]) # values format
print(header_fmt % tuple([r[2] for r in fields])) # titles
print(header_fmt % tuple([r[3] for r in fields])) # sub_titles separator
for d in sorted(data.values(), key=lambda i: (-1*i['tmax'], i['ra'], i['dec'])):
n_seeds = len(d['data']['seed'])
ts_m = array_stats(d['data']['ts'])
N_on_m = d['stats']['N_on']
N_off_m = d['stats']['N_off']
N_exc_m = d['stats']['N_exc']
li_ma_m = d['stats']['li_ma']
alpha_m = array_stats(d['data']['alpha']) # useless
sigma_sign = d['stats']['li_ma']['sigma_significance']
# fit_sig_sign = abs(d['hist']['li_ma']['sigma_significance'])
if alpha_m['stdev'] > 0.000001:
logging.error('Just a check. alpha stdev must be 0. alpha={}'.format(alpha_m))
exit(1)
print(values_fmt % (d['name'], d['ra'], d['dec'], d['tmax'], n_seeds,
ts_m['mean'], ts_m['stdev'],
N_on_m['mean'], N_on_m['stdev'],
N_off_m['mean'], N_off_m['stdev'],
N_exc_m['mean'], N_exc_m['stdev'],
li_ma_m['mean'], li_ma_m['stdev'],
sigma_sign,
alpha_m['mean'],
d['hist']['N_on']['fit_coeff'][0],
d['hist']['N_on']['fit_coeff'][1],
abs(d['hist']['N_on']['fit_coeff'][2]),
d['hist']['N_on']['pvalue_err'][0],
d['hist']['N_on']['pvalue_err'][1],
d['hist']['N_on']['pvalue_err'][2] ))
def print_html_data_summary(data):
from jinja2 import Template
t = Template("""
<!DOCTYPE html>
<html>
<head>
<meta charset="utf-8" />
<style>
.alnright { text-align: right; }
.spaced { float: right; width: 3em; }
table { width: auto; }
th, td { padding: 10px; }
th { background-color: #4CAF50; color: white; }
th { border-bottom: 1px solid #ddd; }
tr:nth-child(even) { background-color: #f6f6f6; }
tr:hover {background-color: #f2f2f2;}
p { margin: 0; padding 3px 5px; }
ul.gallery li {
list-style-type: none;
float: left;
border: 1px solid #a2a2a2;
padding: 1em;
margin: 1em;
}
</style>
<title>Crab signal</title>
</head>
<body>
<h2>Crab excess counts with on/off analysis</h2>
<table id="main_table">
{% set doing = {} %}
{% for d in rows %}
{% if d['name'] not in doing %}
<tr>
<th>name</th>
<th>tmax <br/> [sec]</th>
<th>Total <br/> seeds</th>
<th>On source <br/> counts [ph]</th>
<th>Off source <br/> counts [ph]</th>
<th>Excess <br/> counts [ph]</th>
<th>Li & Ma <br/> significance</th>
<th>Li & Ma <br/>σ / significance</th>
</tr>
{% endif %}
{% if doing.update({ d['name']: True }) %} {% endif %}
<tr>
<td id="{{ d['name'] }}">{{ d['name'] }} (<a href="#{{ d['img'] }}">plot</a>)</td>
<td class="alnright">{{ d['tmax'] }}</td>
<td class="alnright">{{ d['data']['seed']|length }}</td>
<td class="alnright">
<p>{{ '{0:.3f} ± {1:.3f}'.format(d['stats']['N_on']['mean'], d['stats']['N_on']['stdev']) }} <span class="spaced">data</span></p>
<p>{{ '{0:.3f} ± {1:.3f}'.format(d['hist']['N_on']['fit_coeff'][1], d['hist']['N_on']['fit_coeff'][2]|abs) }} <span class="spaced">fit </span></p>
</td>
<td class="alnright">
<p>{{ '{0:.3f} ± {1:.3f}'.format(d['stats']['N_off']['mean'], d['stats']['N_off']['stdev']) }} <span class="spaced">data</span></p>
<p>{{ '{0:.3f} ± {1:.3f}'.format(d['hist']['N_off']['fit_coeff'][1], d['hist']['N_off']['fit_coeff'][2]|abs) }} <span class="spaced">fit </span></p>
</td>
<td class="alnright">
<p>{{ '{0:.3f} ± {1:.3f}'.format(d['stats']['N_exc']['mean'], d['stats']['N_exc']['stdev']) }} <span class="spaced">data</span></p>
<p>{{ '{0:.3f} ± {1:.3f}'.format(d['hist']['N_exc']['fit_coeff'][1], d['hist']['N_exc']['fit_coeff'][2]|abs) }} <span class="spaced">fit </span></p>
</td>
<td class="alnright">
<p>{{ '{0:.3f} ± {1:.3f}'.format(d['stats']['li_ma']['mean'], d['stats']['li_ma']['stdev']) }} <span class="spaced">data</span> </p>
<p>{{ '{0:.3f} ± {1:.3f}'.format(d['hist']['li_ma']['fit_coeff'][1], d['hist']['li_ma']['fit_coeff'][2]|abs) }} <span class="spaced">fit </span> </p>
</td>
<td class="alnright">
<p>{{ '{0:.4f}'.format(d['stats']['li_ma']['sigma_significance']) }} <span class="spaced">data</span> </p>
<p>{{ '{0:.4f}'.format(d['hist']['li_ma']['sigma_significance']|abs) }} <span class="spaced">fit </span> </p>
</td>
</tr>
{% endfor %}
</table>
<h3>Plots</h3>
<ul class="gallery">
{% for d in rows %}
<li id="{{ d['img'] }}"><img src="{{ d['img'] }}" /> <a href="#main_table">back</a></li>
{% endfor %}
</ul>
</body>
</html>
""")
html = t.render(rows=data.values())
print(html)
def fitting_data(curve_fn, initial_params=[], x=[], y=[], verbosity=False, name=None):
res = curve_fit(curve_fn, x, y, p0=initial_params, full_output=verbosity)
coeff, var_matrix = res[:2]
if (len(res) > 2):
infodict, errmsg, ier = res[2:]
logging.error('infodict: {}\nerrmsg: {}\nier: {}'.format(infodict, errmsg, ier))
if np.all(np.diag(var_matrix) > 0):
perr = np.sqrt(np.diag(var_matrix))
else:
# https://stackoverflow.com/questions/28702631/scipy-curve-fit-returns-negative-variance
# print("covariance matrix:\n", var_matrix, file=sys.stderr)
# print("covariance matrix diag:\n", np.diag(var_matrix), file=sys.stderr)
# print(np.linalg.cond(var_matrix), file=sys.stderr)
# exit(1)
# should be -inf
perr = [0 for i in np.diag(var_matrix)]
logging.debug('Curve fit params: {}'.format(name))
logging.debug('{0:>10s} {1:9s} {2:9s}'.format('param no.', 'value', 'error'))
for i, c in enumerate(coeff):
logging.debug('{0:10d} {1:+8.6e} {2:+8.6e}'.format(i, c, perr[i]))
return coeff, perr
# no good with the quote
def gauss(x, *params):
A, mu, sigma = params
exp_num = -1 * (x-mu)**2
exp_den = 2. * sigma**2
return A * np.exp(exp_num / exp_den)
def gauss2(x, *params):
A, mu, sigma = params
exp_num = -1 * (x-mu)**2
exp_den = 2. * sigma**2
return A * 1. / (2. * np.pi * sigma**2)* np.exp(exp_num / exp_den)
def dynamic_bin_number(arr, max_val=None, min_val=None):
n = max(arr)-min(arr)
if max_val is not None and n > max_val:
n = max_val
if min_val is not None and n < min_val:
n = min_val
if n < 1:
n = 2
return int(n)
# seaborn graph with distplot. Same data, same gaussian loc/scale
# import seaborn as sns, numpy as np
# print(array_stats(d["ts_array"]))
# print(norm.fit(d["ts_array"]))
# sns.distplot(d["ts_array"], bins=50, kde=True, fit=norm, norm_hist=False)# , norm_hist=True) #array, bins=n_bins, fit=norm, norm_hist=True
def create_hist(ax, data, data_stats, xlabel=None, color="blue"):
bins_centres = data['bins_centres']
bins_width = data['bins_width']
fit_params = data['fit_coeff']
fitted_hist = gauss(bins_centres, *fit_params)
counts_hist = data['counts']
# histogram
ax.bar(bins_centres, height=counts_hist, width=bins_width, alpha=0.5, edgecolor=color, color=color, label='data')
# normal stats
# ax.plot(bins_centres, stats.norm.pdf(bins_centres, data_stats["mean"], data_stats["stdev"]), color="orange", linestyle="--", alpha=0.9, label='stats.norm\nμ:{0:.2e}\nσ:{1:.2e}'.format(data_stats['mean'], data_stats['stdev']))
# ax.axvline(data_stats["mean"], color="blue", linestyle="--", alpha=0.9)
# gauss fit
ax.plot(bins_centres, fitted_hist, linestyle="-.", color="green")
ax.legend( [ Patch(facecolor=color, edgecolor=color),
Line2D([0],[0], color="green", linestyle="-.") ],
[ 'Data. bins:{0}\nμ:{1:.2f}\nσ:{2:.2f}'.format(data['n_bins'], data_stats['mean'], data_stats['stdev']),
'Curve fit\nμ:{0:.2f}\nσ:{1:.2f}'.format(fit_params[1], abs(fit_params[2])) ],
loc='best' )
ax.set_xlabel('{0}'.format(xlabel))
ax.set_ylabel('counts')
def plot_data_summary(data, save_img=False):
rows_num=2
cols_num=2
img_format = 'png'
for d in list(data.values()):
# figsize in inch (width, height)
fig, ax = plt.subplots(nrows=rows_num, ncols=cols_num, figsize=(cols_num*4.5, rows_num*4.5))
fig.suptitle('{} t_{} sec'.format(d["name"], str(d["tmax"])), va="top", ha="center")
create_hist(ax[0][0], d['hist']['N_on'], d['stats']['N_on'], color="magenta", xlabel="N on")
create_hist(ax[0][1], d['hist']['N_off'], d['stats']['N_off'], color="red", xlabel="N off")
create_hist(ax[1][0], d['hist']['N_exc'], d['stats']['N_exc'], color="yellow", xlabel="N excess")
create_hist(ax[1][1], d['hist']['li_ma'], d['stats']['li_ma'], color="orange", xlabel="Li & Ma significance")
# Important: first tight_layout(), after adjust for the title
fig.tight_layout()
fig.subplots_adjust(top=0.90)
if save_img:
img_dir = "imgs_signal"
img_filename = "{0}/signal_{1}_{2:04d}.{3}".format(img_dir, d["name"], d["tmax"], img_format)
try:
os.makedirs(img_dir)
except FileExistsError as e:
logging.debug("The imgs dir {} already exists".format(img_dir))
plt.savefig(img_filename, format=img_format)
plt.close()
logging.debug("saving {}".format(img_filename))
d['img'] = img_filename
else:
plt.show()
plt.close()
return None
def plot_significance_sigma(data, save_img=False):
rows_num=2
cols_num=2
img_format = 'png'
data_plot = {}
for d in data.values():
if d['name'] not in data_plot:
data_plot[d['name']] = {
't': [],
'data_significance_sigma': [], # sigma
'fit_significance_sigma': [], # sigma
'data_sigma_significance': [], # sigma / significance
'fit_sigma_significance': [], # sigma / significance
}
stats_stdev = d['stats']['li_ma']['stdev']
fit_stdev = abs(d['hist']['li_ma']['fit_coeff'][2])
stats_sig_sign = d['stats']['li_ma']['sigma_significance']
fit_sig_sign = abs(d['hist']['li_ma']['sigma_significance'])
data_plot[d['name']]['t'].append(d['tmax'])
data_plot[d['name']]['data_significance_sigma'].append(stats_stdev)
data_plot[d['name']]['fit_significance_sigma'].append(fit_stdev)
data_plot[d['name']]['data_sigma_significance'].append(stats_sig_sign)
data_plot[d['name']]['fit_sigma_significance'].append(fit_sig_sign)
rows_num = int(len(data_plot)/2) +1
# figsize in inch (width, height)
fig, axes = plt.subplots(nrows=rows_num, ncols=cols_num, figsize=(cols_num*4.5, rows_num*4.5))#, sharey=True)#, sharex=True)
# fig.subplots_adjust(top=0.90)
names = list(data_plot.keys())
x_tick_labels = data_plot[names[0]]['t']
for ax_row in axes:
for ax in ax_row:
if len(names) > 0:
name = names.pop(0)
d = data_plot[name]
# ax.scatter(x=d['t'], y=d['data_significance_sigma'], s=15, color='blue', marker='x', label="data")
# ax.scatter(x=d['t'], y=d['fit_significance_sigma'], s=15, color='red', marker='x', label="fit")
ax.scatter(x=d['t'], y=d['data_sigma_significance'], s=15, color='blue', marker='x', label="data")
ax.scatter(x=d['t'], y=d['fit_sigma_significance'], s=15, color='red', marker='x', label="fit")
# ax.set_xticks(x_tick_labels[::-1])
# ax.set_xticklabels(x_tick_labels[::-1])
ax.set_title(name)
ax.set_xscale('log')
ax.set_ylabel('sigma / significance')
if len(names) == 0 or len(names) == 1:
# ax.set_xticks([0,10,100, 1000, 1800]) # x_tick_labels[::-1]
# ax.set_xticklabels([0, 10, 100, 1000, 1800]) # x_tick_labels[::-1]
ax.set_xlabel('time (sec)')
else:
ax.axis('off')
ax.grid(True)
ax.legend(loc='best')
fig.tight_layout(pad=5.0, h_pad=5.0)
plt.show()
plt.close()
# if save_img:
# img_dir = "imgs_signal"
# img_filename = "{0}/signal_{1}_{2:04d}.{3}".format(img_dir, d["name"], d["tmax"], img_format)
# try:
# os.makedirs(img_dir)
# except FileExistsError as e:
# logging.debug("The imgs dir {} already exists".format(img_dir))
# plt.savefig(img_filename, format=img_format)
# plt.close()
# logging.debug("saving {}".format(img_filename))
# d['img'] = img_filename
# else:
# plt.show()
# plt.close()
return None
if __name__ == '__main__':
parser = argparse.ArgumentParser(description="Analyze data from tsv")
parser.add_argument('files', help='the tsv file', nargs='+')
args = parser.parse_args()
original_data = []
file_count = 0
for fn in args.files:
file_data = csvex.load(fn, header=True, sep='\t')
file_count += 1
for fd in file_data:
original_data.append(fd)
logging.warning("File read: {}".format(file_count))
logging.warning(" data: {}".format(len(original_data)))
ds = data_summary(original_data)
if not data_summary_is_ok(ds, pointings=5, time_slots=9, different_seeds=5000):
exit(1)
# check the min/max TS
if False is True:
for d in ds.values():
ns = d['data']['N_exc']
print('{0:10.5f} {1:10.5f}'.format(np.min(ns), np.max(ns)))
exit(1)
# inplace augment
data_augmentation(ds, bins_number=10)
plot_data_summary(ds, save_img=True)
# plot_significance_sigma(ds, save_img=False)
# print_txt_data_summary(ds)
print_html_data_summary(ds)
| 44,850 |
ACCOTEXT000044473464
|
French Open Data
|
Open Government
|
Licence ouverte
| null |
HESION
|
ACCO
| null |
Spoken
| 3,789 | 5,587 |
accord de REVISION
a l’accord collectif du 1er mars 2018
Entre les soussignés
La Société HESION, Société par actions simplifiée au capital de 500 000,00 €, dont le siège social est situé 1, allée de la Rhubarbe 78 260 ACHERES, immatriculée au Registre du Commerce et des Sociétés de VERSAILLES sous le numéro 789 770 583, représentée par son Président, la Société Financière Praderoi, elle-même représentée par son Gérant XXX, ayant tout pouvoir à l’effet des présentes,
ci-après dénommée l’ « Employeur » ou « la Société » ou « l’Entreprise »,
d'une part,
Et
Le Comité Social et Économique représenté par XXX, membre titulaire de la délégation du CSE, représentant la majorité des suffrages exprimés en faveur des membres du CSE lors des dernières élections professionnelles,
ci-après dénommé « le CSE »
d'autre part,
Il est conclu le présent accord,
Préambule
A la suite du regroupement des sociétés Disfatel et Altaïr Vision, au sein d‘une seule et unique entité HESION, il a été signé un accord collectif en date du 1er mars 2018 applicable à compter du 22 mars 2018 à l’ensemble des salariés de l’entreprise.
Il apparaît que l’accord collectif de 2018 a besoin d’évoluer et de s’adapter au contexte social et économique de l’entreprise.
A cet effet, cet accord fait l’objet d’une révision, conformément aux dispositions de l’article 19 de l’accord collectif du 1er mars 2018.
A compter de sa date d’entrée en vigueur, le présent accord se substitue de plein droit aux stipulations de l’accord collectif du 1er mars 2018 qu’il modifie.
Il est rappelé que les dispositions du présent accord s’appliquent à l’ensemble des salariés de la société exerçant leur activité en France.
Cet accord est conclu pour une durée indéterminée.
I - DISPOSITIONS GENERALES
1. Durée du travail
1.1 Définition
Les dispositions du présent titre s’inscrivent dans la définition du temps de travail prévue par l’article L.3121-1 du Code du travail précisant que le temps de travail effectif est le temps pendant lequel le salarié est à la disposition de l’employeur et se conforme à ses directives sans pouvoir librement vaquer à ses occupations personnelles.
Les parties précisent que le travail effectif étant le temps de travail commandé par l’Employeur, tout dépassement des horaires de travail programmés, non expressément commandés par l’Employeur, ne saurait être pris en compte dans le temps de travail effectif.
1.2 Durée quotidienne maximale de travail
Il est rappelé que la durée quotidienne maximale de travail ne doit pas excéder 10 heures de travail effectif par jour.
Pour des motifs liés à l’accroissement de l’activité ou à l’organisation de l’Entreprise et notamment en raison de la participation de certains salariés à la réalisation de chantiers exceptionnels, des rendez-vous ou autres salons, cette durée quotidienne maximale de travail pourra être ponctuellement portée à 12 heures.
1.3 Durée hebdomadaire maximale de travail
Il est précisé que, conformément aux dispositions des articles L.3121-20 et suivants du Code du travail, les plafonds suivants ne peuvent pas être dépassés :
la durée maximale du travail au cours d'une même semaine ne peut pas dépasser 48 heures ;
la durée moyenne hebdomadaire du travail calculée sur une période quelconque de douze semaines consécutives ne peut pas dépasser 44 heures.
2. Horaires collectifs
Une note de service définira les horaires collectifs ainsi que les modalités d’application pratique de l’horaire collectif.
3. Heures supplémentaires
3.1. Qualification des heures supplémentaires
La qualification d’heures supplémentaires est accordée aux seules heures de travail effectif accomplies au-delà de la durée légale, à condition que ces heures aient été formellement et préalablement demandées et validées par le supérieur hiérarchique.
Toute heure supplémentaire est effectuée à la demande du responsable de service et fait alors l’objet d’un paiement ou d’un repos compensateur de remplacement.
3.2. Taux de majoration des heures supplémentaires
Les heures supplémentaires travaillées au-delà de 35h feront l’objet d’une majoration au taux unique de 10%, au titre des heures supplémentaires et d’une inscription spécifique sur le bulletin de salaire.
3.3. Repos compensateur de remplacement
Sur décision de la Direction, prise après information préalable de l’intéressé, les heures supplémentaires et/ou leurs majorations associées, pourront faire l’objet d’un repos compensateur de remplacement.
Ce repos compensateur de remplacement sera d’une durée de 1 heure et 6 minutes pour chaque heure supplémentaire (majorée à 10 %) effectuée.
Les repos compensateurs pourront être pris par le salarié, par demi-journée ou par journée complète, selon la procédure prévue par note de service.
Chaque salarié souhaitant prendre un repos compensateur devra obtenir l’autorisation expresse et préalable de la Direction.
Chaque journée ou demi-journée de repos compensateur acquise devra être prise dans un délai maximum de 4 mois.
A défaut, les repos seront perdus, sauf accord de la Direction pour proroger exceptionnellement ce délai ou les rémunérer.
Les heures supplémentaires dont le paiement est remplacé par un repos compensateur de remplacement, ainsi que les majorations y afférentes, ne s’imputent pas sur le contingent annuel d’heures supplémentaires.
4. Contingent annuel d’heures supplémentaires
Les heures supplémentaires sont accomplies dans le respect du contingent annuel d’heures supplémentaires. Celui-ci est fixé à 300 h par an et par salarié.
Ce contingent peut être dépassé en cas de surcroît exceptionnel d’activité, pour des raisons de sécurité ou des raisons impératives tels que des travaux urgents ou continus, pour des raisons climatiques ou en cas de contraintes commerciales ou techniques imprévisibles.
En cas de dépassement de ce contingent annuel, outre les majorations prévues par le présent accord en matière d’heures supplémentaires, les salariés bénéficieront d’une contrepartie obligatoire en repos dont la durée est calculée conformément aux dispositions légales en vigueur.
A titre informatif, l’article L.3121-33 du Code du travail précise que la contrepartie obligatoire en repos ne peut être inférieure à 50 % des heures supplémentaires accomplies au-delà du contingent annuel pour les entreprises de vingt salariés au plus et à 100 % des heures supplémentaires accomplies au-delà du contingent annuel pour les entreprises de plus de vingt salariés.
Ce temps de repos, qui ne se cumule pas avec les dispositions légales ou de la convention de branche ayant le même objet, sera pris dans un délai maximum de deux mois suivant la date à laquelle il aura été acquis.
L'utilisation de ces heures supplémentaires exceptionnelles ne doit pas avoir pour effet de dépasser les limites fixées aux articles 1.2 et 1.3 ci-dessus, sauf dérogation conformément à la législation en vigueur
II - DISPOSITIONS SPECIFIQUES AU FORFAIT ANNUEL EN JOURS
Il s’avère qu’un décompte horaire du temps de travail, qu’il soit journalier, hebdomadaire, mensuel ou annuel n’apparaît pas adapté pour certains salariés visés par le présent article et une mesure de la durée du travail exprimée en nombre de jours travaillés est plus appropriée pour ces salariés.
Aussi un forfait annuel en jours est mis en place pour ces catégories de salariés dont l’autonomie et la liberté d’action dont ils disposent rendent impossible la prédétermination de l’organisation de leur emploi du temps.
En conséquence le présent article prévoit la mise en place des forfaits jours, de manière à garantir le respect des durées maximales de travail, ainsi que des repos journaliers et hebdomadaires, conformément à loi du 19 janvier 2000, ainsi qu’aux dispositions des articles L3121-42 et suivants du code du travail.
Catégorie de salariés concernés
Conformément aux dispositions de l’article L.3121-58 du Code du travail, le présent article pourra s’appliquer aux :
salariés cadres dont la qualification, les responsabilités et l’autonomie permettent de satisfaire aux critères de la définition du cadre autonome suivante : « cadres qui disposent d'une autonomie dans l'organisation de leur emploi du temps et dont la nature des fonctions ne les conduit pas à suivre l'horaire collectif applicable au sein de l'atelier, du service ou de l'équipe auquel ils sont intégrés ».
En pratique, cette catégorie concerne notamment et pour exemple, mais pas exclusivement, les métiers suivants : responsables de service, chargés d’affaires, développeurs …
Aucune position minimum n’est requise pour l’application du forfait jours des salariés cadres. Seules la responsabilité et l’autonomie attachées à leur fonction, au regard de leur descriptif de poste, justifieront le recours au forfait jours.
Seuls les cadres dont la rémunération annuelle (fixe et variable) correspond à 120% du salaire minimum de la classification attribuée par la Convention Collective pourront bénéficier du forfait jours.
salariés non-cadres qui exercent leurs responsabilités avec une réelle autonomie et dont la durée du travail ne peut être évaluée précisément, de telle sorte qu’ils entrent dans la définition suivante : « salariés dont la durée du temps de travail ne peut être prédéterminée et qui disposent d'une réelle autonomie dans l'organisation de leur emploi du temps pour l'exercice des responsabilités qui leur sont confiées. »
En pratique, cette catégorie concerne notamment, mais pas exclusivement et pour exemple, les métiers suivants : coordinateur technique, techniciens, développeurs …
La position minimum requise est 2.2. coefficient 310 avec une rémunération annuelle (fixe et variable) correspondant à 120% du salaire minimum de la Convention Collective.
Ces salariés, non-cadres ou cadres autonomes, tout en étant soumis aux directives de l’Employeur ou de leurs supérieurs hiérarchiques dans le cadre de la réalisation de leurs missions, restent maîtres de l’organisation de leur emploi du temps et disposent d’une large autonomie, de liberté et d’indépendance dans l’organisation et la gestion de leur temps de travail pour exécuter les missions qui leur sont confiées.
Conditions de mise en application
Chaque salarié relevant du principe énoncé ci-dessus doit expressément donner son accord par écrit pour être valablement assujetti à ce dispositif. Cet accord prendra la forme d’une clause dans le contrat de travail ou d’un avenant au contrat de travail.
La nature des missions justifiant le recours à cette modalité est précisée dans la convention de forfait jours du salarié concerné.
Nombre de jours travaillés
Le nombre de jours travaillés dans l'année est fixé à 218 jours, journée de solidarité comprise, pour une année complète de travail et compte tenu d’un droit intégral à congés payés. L'année de référence est l’année calendaire, soit du 1er janvier au 31 décembre.
Le salarié est tenu de travailler le nombre de jours indiqué dans la convention individuelle de forfait en conformité avec le plafond précité, sauf exceptions. L'employeur ne peut, sans son accord, lui imposer de travailler au-delà de ce plafond.
Ce plafond de 218 jours n’intègre pas les congés supplémentaires conventionnels et légaux (congé d’ancienneté, congés de maternité ou paternité etc.). Ainsi, le nombre de jours travaillés sur la base duquel est fixé le plafond annuel propre à chaque convention de forfait est réduit selon le nombre de jours de congés supplémentaires conventionnels et/ou légaux acquis par les salariés.
De même, les absences indemnisées et les absences maladie non rémunérées sont déduites du nombre annuel de jours travaillés, fixé dans le forfait.
Pour les salariés qui entrent ou sortent de l’entreprise en cours d’année de référence, le nombre de jours à effectuer sera calculé prorata temporis en fonction du nombre de mois travaillés sur l’année et en tenant compte des droits réels à congés payés pour l'année de référence en cours.
Il sera indiqué sur le bulletin de paie de chaque salarié concerné le nombre de jours du forfait.
Pour les salariés ne bénéficiant pas d'un congé annuel complet, le nombre de jours de travail est augmenté à concurrence du nombre de jours de congés légaux auxquels le salarié ne peut prétendre.
Dépassement
Chaque salarié en forfait jours s’interdit de dépasser le nombre de jours fixés dans son forfait.
En cas de sujétion particulière, il pourra être convenu, entre l’Employeur et le salarié, de manière anticipée et par avenant annuel, d’accroitre le nombre de jours travaillés dans l’année, ce qui aura pour conséquence une rémunération supplémentaire.
Les jours travaillés dépassant le plafond de jours prévu dans le contrat de travail seront considérés comme des « jours supplémentaires » et seront compensés financièrement à une valeur de 120 %, sans toutefois dépasser 4 jours à l’issue de l’année civile. Ceci doit être prévu dans l’avenant annuel au contrat.
Le rachat des jours de repos fera l’objet d’une décision unilatérale de l’Employeur, en fonction de la situation économique et de la charge de travail de l’Entreprise. Chaque manager sera alors informé pour application auprès des salariés concernés.
Chaque responsable hiérarchique veillera, notamment par un suivi régulier et pertinent, à ce que les salariés concernés prennent bien leurs jours de repos, en temps et en heure.
Lorsque le salarié estime sa charge de travail trop importante ou à toute occasion, un entretien avec le supérieur hiérarchique est organisé sans délai, après réception du courrier de signalement du salarié concerné.
Nombre et modalités de prise des jours de repos
Le forfait de 218 jours ouvre droit à des jours de repos, dont le nombre évolue en fonction de la variation des jours fériés dans l’année de référence concernée.
Les périodes d’absence assimilées par l’article L. 3141-5 du Code du travail ou par la convention collective à du temps de travail effectif pour le calcul des congés payés généreront des droits à des jours de repos.
Dans le cas d’une année incomplète, le calcul du nombre de jours de repos auxquels le salarié a droit s’effectuera au prorata du temps passé dans l’entreprise.
La prise des journées de repos sera déterminée pour moitié à l’initiative de la Société.
Celle-ci fixera un calendrier en janvier de chaque année et définira ces jours de repos selon le positionnement des jours fériés et des « ponts » du calendrier. Celui-ci tiendra compte des nécessités de service et des permanences indispensables à la continuité de l’activité.
Le solde des jours de repos sera pris à la convenance des salariés.
Le délai de prévenance pour la proposition de jours de repos par le salarié est au minimum de quinze jours, sauf cas exceptionnels.
La Direction se réserve la possibilité, pour des considérations de charge de travail ponctuelle, de demander aux salariés de différer la prise de certains jours de repos posés.
Par ailleurs, les jours de repos ne peuvent être reportés d’une période annuelle sur l’autre. Ainsi, si la totalité de ces jours n’a pas été prise avant le 31 décembre d’une année de référence donnée, les jours restants sont perdus.
Limite à la durée du travail
Les salariés en forfait jours ne sont pas soumis aux heures supplémentaires conformément aux dispositions de l’article L.3121-62 du Code du travail.
Le temps de travail peut être réparti sur certains ou sur tous les jours ouvrables de la semaine, en journées complètes de travail.
Il est expressément convenu qu’aucune contrainte d’horaires précis ne pourra être imposée.
Toutefois, cette absence de contrainte s’entend en dehors des obligations inhérentes à la fonction (ex : réunion d’équipe) et ne signifie pas que les salariés peuvent s’absenter sans prévenir.
Le contrat de travail peut également prévoir, exceptionnellement, des périodes de présence nécessaires au bon fonctionnement de la société.
Il est cependant rappelé que le repos quotidien minimal est de 11 heures consécutives.
Le repos hebdomadaire sera de 35 heures consécutives au minimum. Le jour de repos hebdomadaire est le dimanche.
Il est rappelé que ces limites n’ont pas pour objet de définir une journée habituelle de 13 heures par jour mais une amplitude exceptionnelle maximale de la journée de travail.
De la même façon il est rappelé qu’une durée maximale de travail de 48h par semaine doit être respectée.
L’organisation du temps de travail par le salarié doit également respecter les jours de congés payés prévus.
Dans ce cadre, chaque salarié bénéficiant d’une convention de forfait annuel en jours, responsable de la gestion de son emploi du temps, doit faire le nécessaire pour organiser son temps de travail dans le respect des limites précitées, sous le contrôle de l’employeur.
L’amplitude des journées et la charge de travail devront rester raisonnables, compatibles avec les contraintes privées des salariés concernés et assurer une bonne répartition dans le temps, du travail des intéressés afin d’assurer la protection de leur sécurité et de leur santé.
Modalités de suivi de l’organisation et de la charge de travail
7.1 Document de suivi du forfait
Compte tenu de la spécificité du dispositif des conventions de forfait en jours, le respect des dispositions contractuelles et légales sera suivi au moyen d’un système déclaratif, chaque salarié en forfait annuel en jours remplissant le document de suivi du forfait mis à sa disposition à cet effet.
Le suivi du forfait jours se fera à la journée ou à la demi-journée.
Afin de faciliter la comptabilisation de ce suivi du forfait jours, le salarié devra donc remplir un document de suivi qu’il transmettra mensuellement à son supérieur hiérarchique mentionnant le nombre et la date des journées travaillées ainsi que le positionnement et la qualification des jours non travaillés, en :
Repos hebdomadaire
Congés payés
Congés autres
Jours fériés chômés
Jours de repos lié au forfait
Signalement d’un éventuel dépassement de la durée maximale.
Ce document rappellera la nécessité de respecter une amplitude et une charge de travail raisonnables et une bonne répartition dans le temps du travail du salarié.
Ce document de suivi sera établi mensuellement et validé par le responsable hiérarchique.
Pour permettre le contrôle effectif du nombre de jours travaillés, un décompte définitif devra par ailleurs être établi par le service Gestion et validé par le responsable hiérarchique à la fin de chaque année. Ce décompte fera apparaître, de la même façon, le nombre et la date des journées travaillées ainsi que la qualification des jours de repos (repos hebdomadaire, jours de congés payés, jours de repos, jour férié …) sur le formulaire correspondant.
7.2. Entretien individuel de suivi de l’organisation et de la charge de travail
Chaque année, au cours d’un entretien individuel entre le salarié concerné et son supérieur hiérarchique, un bilan sera fait afin d’examiner l’impact de ce régime sur la charge de travail du salarié, sur l’amplitude des journées de travail, sur l'articulation entre son activité professionnelle et sa vie personnelle, sur sa rémunération ainsi que sur l'organisation du travail dans l'entreprise.
Ces entretiens auront lieu au terme de chaque année civile.
7.3. Alerte du salarié
Par ailleurs, en cas de difficulté inhabituelle portant sur l'organisation ou la charge de travail, le salarié a la possibilité d'émettre, par écrit, une alerte auprès de l'employeur qui le recevra dans les 8 jours calendaires et formulera par écrit les mesures qui sont, le cas échéant, mises en place pour permettre un traitement effectif de la situation. Ces mesures feront l'objet d'un compte-rendu écrit et d'un suivi.
La Direction transmet, une fois par an, au CSE, le nombre d'alertes émises par les salariés ainsi que les mesures prises pour pallier ces difficultés.
Dans tous les cas, s’il apparaît d’une quelconque façon à l’employeur que la charge de travail et l’organisation du salarié révèlent une situation anormale, il recevra le salarié à un entretien sans attendre l’entretien annuel prévu ci-avant, afin d’examiner avec lui l’organisation de son travail, sa charge de travail, l’amplitude de ses journées et d’envisager toute solution permettant de traiter des difficultés identifiées.
Droit à déconnexion pendant les temps de repos
Afin d'assurer le respect des temps de repos et de congé et dans le cadre de l'articulation entre l'activité professionnelle et la vie personnelle et familiale, la sécurité et la santé du salarié, il est rappelé que les salariés bénéficient d’un droit à déconnexion des outils professionnels de communication à distance pendant leurs absences, leurs heures de repos et de congé.
La communication électronique interne et externe doit ainsi avoir lieu pendant les heures de travail. Par conséquent, les salariés ne sont tenus ni de consulter, ni de traiter immédiatement les mails reçus en dehors de ces horaires.
III - DISPOSITIONS RELATIVES AUX CONGES
Jours pour enfant malade
Tout parent d’un enfant à charge a le droit de bénéficier d’un congé rémunéré en cas de maladie ou d’accident de l’enfant dont il a la charge.
Ce congé rémunéré est limité à 2 jours par année civile et par enfant à charge.
Afin de bénéficier de ce congé, le salarié devra fournir un certificat médical de son médecin traitant, attestant de la nécessité de la présence du parent auprès de son enfant et indiquant le nom du parent et le nom de l’enfant à charge malade.
Un enfant est considéré à charge s’il remplit l’une des conditions suivantes :
Soit il vit au foyer et est âgé de moins de 13 ans au 31 décembre de l'année en cours,
Soit il vit au foyer et est en situation de handicap (pas de condition d’âge).
Jours de fractionnement
La période de congés payés, soit 25 jours ouvrés, est constituée d’une part, du congé principal (4 semaines ou 20 jours) et d’autre part, de la 5e semaine (5 jours).
Une partie de ce congé principal, soit 10 jours, doit être obligatoirement prise pendant la période légale, du 1er mai au 31 octobre.
L’entreprise autorise la prise du solde de ce congé principal en dehors de la période légale. Les salariés peuvent ainsi librement poser leurs congés payés, en tenant compte à la fois de leurs contraintes professionnelles et personnelles et après accord de leur responsable hiérarchique.
En contrepartie, les jours de fractionnement sont supprimés.
Ordre de départ et délais des congés payés
Il est rappelé que la période de référence pour l’acquisition des congés est l’année civile, soit du 1er janvier au 31 décembre.
En cas de litige, l’ordre de départ en congés payés tient compte :
de la situation de famille des salariés, notamment les possibilités de congés du conjoint, la présence au foyer d’un enfant ou d’un adulte handicapé ou d’une personne âgée en perte d’autonomie,
de son ancienneté au sein de l’entreprise
Les dates et l’ordre des départs sont définis par note de service.
IV - DISPOSITIONS FINALES, DUREE, REVISION ET DATE D’EFFET DE L’ACCORD
Les parties reconnaissent expressément que le présent accord constitue un tout indivisible et équilibré, qui ne saurait être mis en cause de manière fractionnée ou faire l’objet d’une dénonciation partielle.
Nonobstant le paragraphe précédent, le présent accord pourra être dénoncé à tout moment par l’une ou l’autre des parties signataires, sous la forme d’un courrier recommandé avec accusé de réception adressé par l’auteur de la dénonciation à l’autre partie. Une telle dénonciation ne sera effective qu’à l’issue d’un préavis de 3 mois.
Chaque partie pourra également demander la révision du présent accord selon les mêmes modalités que définies ci-dessus pour la dénonciation.
A l’expiration du délai d’opposition, le présent accord sera déposé en ligne sur la plateforme nationale « Télé Accords » et au greffe du Conseil de prud’hommes de Saint Germain en Laye.
Le présent accord sera consultable à tout moment par les salariés de l’entreprise.
Il est institué pour une durée indéterminée, à compter du 1er janvier 2022.
A Achères, le 14 octobre 2021
Pour la société HESION Pour le Comité Social et Économique
XXX XXX
| 17,024 |
traitepratiqued00richgoog_52
|
French-PD-diverse
|
Open Culture
|
Public Domain
| 1,860 |
Traité pratique d'anatomie médico-chirurgicale
|
Richet, A. (Alfred), 1816-1891
|
French
|
Spoken
| 6,815 | 11,093 |
Les organes contenus dans la cavité abdominale sont, les uns enveloppés presque complètement par la grande séreuse de l'abdomen, le péritoine, les autres simplement recouverts par cette membrane qui passe au-devant d'eux et n'a avec eux, le plus ordinairement, d'autres rapports que ceux de voisinage. Les premiers, grâce à cette disposition, sont extrêmement mobiles, flottants pour ainsi dire et sans atmosphère celluleuse; les autres sont plongés dans un tissu cellulaire abondant, et ne sont sujets à déplacement que dans les cas pathologiques. Ceux-là sont situés sur un plan antérieur; ceux-ci occupent en arrière la cavité la plus profonde de la cavité. Ces diverses considérations m'ont engagé à diviser tous les viscères abdominaux en deux catégories : 1° viscères contenus dans ce qu'on est convenu d'appeler la cantonade du péritoine; 2° viscères situés au-dessous et en dehors de cette membrane. Commencons par la cavité thoracique, dans laquelle on trouve les cavités pleurales et le médiasin, la cavité abdominale comprend donc deux regions distinctes : une région antérieure, l'intériorité abdominale, et une région postérieure ou extériorité abdominale. Cette division, qui est commandée par la nature même des choses, a cet autre avantage qu'elle répond à une nécessité pratique; les plaies qui atteignent les organes situés dans chacune de ces deux régions diffèrent essentiellement sous le double rapport du pronostic et du traitement. Région antérieure de la cavité abdominale, ou région infra-péritonéale. J'ai dit précédemment que dès la plus haute antiquité on avait senti le besoin de diviser artificiellement les parois abdominales en trois zones désignées sous les noms d'épigastrique, ombilicale et hypogastrique, et chacune de ces zones en trois reasons secondaires. Cette division, qui n'est pas acceptable lorsqu'il s'agit de décrire la constitution des parois elles-mêmes, devient au contraire indispensable lorsqu'on veut préciser les rapports des viscères avec tel ou tel point de l'abdomen; sans elle, il serait impossible de s'entendre. Elle va donc nous servir à faire ce que j'ai fait jusqu'ici, l'anatomie par superposition des plans. J'exposerai ensuite, au point de vue exclusivement médico-chirurgical, l'histoire du péritoine, celle du tube digestif de l'appareil biliaire et de la rate, en un mot de tous les organes enveloppés par la percussion abdominale. Superposition des plans. — Zone épigastrique. — La zone épigastrique se divise en l'épigastre proprement dit et en hypochondres droit et gauche. À l'épigastre, au-dessous des parois précédemment décrites, on rencontre une portion du lobe droit et le lobe gauche du foie séparés et maintenus par le ligament falciforme, au milieu duquel se trouvent quelques filets colliquels, derniers vestiges de la veine ombilicale; au-dessous du foie, la portion sous-diaphragmatique du renophonc, l'extrémité pylorique de l'estomac et la portion du duodénum qui y tient; entre le foie et l'estomac, l'épiploon gastrohépatique, qui se porte du droit à la courbure supérieure de l'estomac et renferme l'artère et les veines pyloriques, des vaisseaux lymphatiques et des nerfs. Plus bas et plus profondément se voit le hiatus de Winslow, par où l'on pénètre dans l'arrière-cavité du grand épiploon, hiatus borné par les vaisseaux hépatiques et les conduits biliaires; les deux dernières portions du duodénum; et enfin le pancreas, embrassé dans la courbure de cette portion intestinale. Ce dernier organe appartient à la région abdominale profonde, car le péritoine ne fait que le tapisser, aussi, d'ailleurs, que la portion correspondante du duodénum, qui se trouve ainsi filée d'une manière inamovible à la colonne vertébrale. Là encore on rencontre, toujours en dehors du péritoine et sur le côté gauche des corps vertébraux, l'aorte, de laquelle se détachent les artères diaphragmatiques inférieures, le trépied cœliaque, c'est-à-dire les artères coronaire, stomachique, hépatique et splénique, puis la mésentérique inférieure, les premières lombaires et les capsulaires; sur le côté droit des vertèbres, la veine cave inférieure; plus profondément encore, les piliers du diaphragme. Voici page 592. Région abdominale antérieure. 568 ANATOMIE DES REGIONS. Ces organes, le trépied cœliaque en tout, sont placés au milieu d'un tissu cellulaire dans lequel on trouve de nombreux ganglions lymphatiques, et surtout les ganglions nerveux d'où émanent ces filets, dont l'entrelacement véritablement inextricable constitue les plexus solaires et tous les plexus secondaires qui accompagnent les diverses branches artérielles. Hypochondre droit est presque entièrement occupé par le lobe droit du foie, qui, à l'état normal, ne doit pas dépasser les fausses côtes; chez les enfants et les femmes il déborde un peu leur bord inférieur, ce qui tient, chez les premiers, à son volume relativement plus considérable et au peu de développement du thorax, chez les secondes, à l'usage du corset. Son bord antérieur, relevé en haut et en avant, est débordé par le fond de la vésicule biliaire, qui répond aux cartilages des neuvième et dixième côtes. Au-dessous du foie se voient la portion gauche du colon transverse et tous les vaisseaux et nerfs qui viennent se rendre dans la scissure transverse; tout à fait en arrière la capsule sur-rénale et le bord supérieur du rein, qui laisse une empreinte sur la face postérieure du foie. Hypochondre gauche renferme le grand cul-de-sac de l'estomac, en avant duquel, chez beaucoup de sujets, on rencontre une bonne portion du lobe gauche du foie; en bas, et plus profondément placée, la rate, reliée à la grande courbure stomacrique par l'apiton gastro-splénique et les vasa breviora, en avant d'elle l'extrémité gauche du colon transverse, en arrière la capsule sur-rénale et le sommet du rein gauche. Zone ombilicale, divisée en ombilic et flancs droit et gauche, elle correspond à cette portion des parois abdominales comprise entre le bord inférieur des côtes et supérieur des os iliaques. A Vombilie, au-dessous du péritoine pariétal, on rencontre le grand épiploon recouvrant tous les organes contenus dans la région; en haut, le colon transverse; en bas, les circonvolutions les plus supérieures de l'intestin grêle et le pédicule qui s'étend à la colonne vertébrale, c'est-à-dire le mésentère, obliquement situé de gauche à droite, du côté latéral gauche de la deuxième vertèbre lombaire à la fosse iliaque droite. Au-dessous du péritoine, dans la région extra-péritonéale, se trouvent les grandes veines et les terminaisons de l'aorte abdominale qui vient de fournir les rénales, les spermatiques et la mésentérique inférieure, à gauche la veine cave inférieure. Le flanc droit est occupé d'arrière en avant par quelques anses d'intestin grêle, le colon ascendant, et plus profondément par le rein et l'urètre. Le flanc gauche a les mêmes rapports; le colon ascendant est remplacé par le colon descendant, généralement plus mobile. Zone hypogastrique. — Elle présente à considérer l'hypogastre sur la ligne médiane, et les fosses iliaques sur les côtés. Les parois de l'hypogastre présentent, avec les viscères abdominaux, des rapports très variables. Ainsi, quand la vessie est vide, le péritoine qui tapisse leur partie postérieure est en contact avec la convexité des circonvolutions de l'intestin grêle recouvertes par le grand épiploon; lorsqu'elle est remplie du liquide, au contraire, elle s'élevant du bassin dans l'abdomen, elle soulève le péritoine, chasse la masse du petit intestin et s'applique contre le bord postérieur des muscles grands droits, donc la séparation seulement le fascia transversalis. Chez la femme, l'utérus vient encore compliquer ces rapports, selon qu'il est ou non dans l'état de gestation, ou renferme des corps fibreux. DE LA CATÉCHISME ABDOMINALE. La fosse iliaque droite est occupée par des anses de l'intestin gracieux, qui recouvrent elles-mêmes le cécum et son appendice vermiculaire ; ces derniers, tantôt sont amplement appliqués contre le muscle iliaque par le péritoine qui passe au-devant d'eux, d'autres fois sont flottants à l'aide d'un mésocaecum. En dedans du cécum, on trouve suivant la courbure du détroit supérieur, se trouvent l'artère et la veine iliaques interne et externe, et enfin, sur un plan plus profond, les muscles psoas iliaques grands et le nerf crural compris dans leur gamme. Dans la fosse iliaque gauche, les rapports sont les mêmes, seulement le cécum est remplacé par l'iliaque du colon descendant, qui remplit, en se contournant, presque tout l'espace qui existe entre les parois abdominales et les muscles psoas iliaques. De nombreux ganglions lymphatiques, dits ganglions iliaques, plongés dans un drapeau cellulaire abondant et lamelleux, suivent la direction des vaisseaux iliaques eux-mêmes devant desquels ils sont placés, et forment comme une chaîne non interrompue. Le péritoine, — Décrire la marche du péritoine et de ses nombreux replis est une tâche qui incombe à l'anatomie descriptive ; je me bornerai donc à signaler les points de son histoire anatomique qui se rattachent à la pathologie tant interne que externe. Cette membrane tapisse toute l'étendue des parois supérieure et antérieure de l'abdomen, et de là descend dans le petit bassin ; la paroi postérieure lui est presque totalement dépourvue, ou plutôt elle en est séparée par une couche bouffante de tissu cellulaire qui renferme des organes nombreux et importants. Entourent aux viscères, ainsi que je l'ai dit déjà, les uns en sont presque complètement recouverts, comme la plus grande partie du tube digestif, le foie et la rate ; les autres en sont simplement recouverts, par une ou plusieurs de leurs faces. Il n'est pas plus possible pour le péritoine que pour les autres sérosés de démontrer l'existence d'une membrane partout continue, la surface séreuse seule, c'est-à-dire le feuillet épithélial, peut être suivie sans interruption et dans toute l'étendue de ce que l'on a nommé la cavité du péritoine. Mais cette cavité elle-même est-elle ? Non, si l'on entend par cavité un espace rempli par un gaz ou un liquide de permanence, car on n'en rencontre pas plus dans le péritoine que dans la plèvre, à l'état normal les parois de ces surfaces séreuses sont exactement appliquées l'une à l'autre. Néanmoins, on peut dire qu'il y a réellement cavité, en ce sens qu'elle se révèle dès qu'un peu de liquide est versé à la surface séreuse; elle existe en mécanisme virtuellement, et au point de vue pratique c'est un fait important à préciser. On comprend maintenant qu'il n'est pas tout à fait exact de dire que les intestins, le foie et la rate, soient renfermés dans la cavité du péritoine : en réalité, ils sont placés au-dessous de cette membrane et en dehors d'elle. Mais cette distinction, ou mieux dire cette subtilité anatomique, étant admise pour satisfaire les esprits exigeants, je me hâte d'ajouter qu'il me paraît indispensable de conserver le langage ordinaire, et de dire par exemple que l'intestin grêle est plongé dans la cavité péritonéale. Le péritoine n'ayant que son feuillet épithélial qui soit partout continu et par tout identique, et ses autres parties constituantes variant avec les divers organes sur lesquels on l'examine, on comprend qu'il doive présenter, relativement à ses propriétés et à sa structure, de notables différences. D'abord il est loin d'offrir partout la même épaisseur : là où il est soumis à une pression constante, comme à la partie inférieure et antérieure des parois abdominales, il est épais et résistant, tandis que sur les viscères, l'intestin, le foie par exemple, il est réduit à une fine mince et sans cohésion. Il en est de même de la couleur : transparent dans les épiploon, il est blanc-blanc et opaque derrière les muscles de l'abdomen. Partout où il tapisse les parois, il est doublé d'un tissu cellulaire lâche, dont les lames prêtent et se laissent facilement distendre ; sur les viscères, au contraire, il est uni aux parties sous-jacentes d'une manière tellement intime, qu'il est impossible de l'enlever autrement que par petits lambeaux de la finesse d'une pelure d'oignon, dont la longueur ne dépasse guère 2 ou 3 millimètres. Enfin il jouit d'une élasticité présentant, suivant les individus et l'endroit où on l'examine, de notables différences que l'on ne sait à quoi rattacher. Alors tantôt après s'être laissé distendre, il revient rapidement sur lui-même, tantôt il refuse de se laisser allonger ; ou bien lorsqu'on surmonte, sans le déchirer, sa résistance, il reste distendu. J'ai dit que, sur les viscères exceptés, il était doublé partout d'un tissu cellulaire lamellaire, facile à décoller; il est cependant quelques endroits où, même par les parois abdominales, il présente avec les parties sous-jacentes des adhérences plus intimes. J'ai signalé au voisinage de l'ombilic, entre le péritoine et le pourtour de la cicatrice ombilicale, des adhérences assez solides pour que, dans les hernies omnilicales, l'intestin éprouve de grandes difficultés à l'entraîner et à s'en former un sac. Aussi ce dernier est-il alors tellement aminci, qu'on a cru pendant longtemps qu'il n'existait pas. Mais c'est là l'exception, le péritoine pariétal est généralement doublé d'une couche de tissu cellulaire lâche, ce qui permet de le décoller facilement. Cette couche cellulaire peut, dans certains points, par suite des frottements ou des tiraillements auxquels elle est soumise, se convertir en une sorte de membrane fibro-cellulobé que soutient la lame séreuse et lui donne une grande force de cohésion. On a désigné cette lame sous le nom impropre de fascia propria. La présence de cette couche celluleuse condensée n'empêche pas la séreuse péritonéale de glisser sans difficultés sur les tissus sous-jacents. Il est intéressant pour le chirurgien d'étudier comment s'effectue ce glissement, cette locomotion du péritoine, qui constitue un des points les plus importants de son histoire chirurgicale. Si l'on saisit, ainsi que l'a expérimenté M. J. Cloquet, une portion du péritoine pariétal, celui de la fosse iliaque par exemple, et qu'on le soumette à des tractions modérées et réparties sur une assez large surface pour ne pas le déchirer, voici ce qu'on observe : les lamelles du tissu cellulaire sous-péritonéal se distendent insensiblement, les aréoles s'allongent et s'aplatissent, et le feuillet séreux se déplace sans que l'élasticité de son tissu propre paraisse être pour rien dans ce mouvement. Si au lieu d'expérimenter sur le péritoine pariétal, on saisit à pleines mains le paquet de l'intestin grêle, et qu'on exerce des tractions modérées sur son pédicule mésentérique, on voit ce dernier s'allonger insensiblement, et cet allongement se produit par le glissement, sur les côtés de la colonne vertébrale, de ses deux feuillets qui semblent marcher à la rencontre l'un de l'autre, puis finissent par s'adossèrent. On peut se convaincre, en disséquant la portion du péritoine, qu'on a ainsi dépliée, que les aréoles cellulaires n'ont point subi de modification. Celle que l'on appelle "migration du péritoine" est si facile à effectuer, même d'une manière instantanée, explique merveilleusement le mode d'évolution du sac, le rallongement quelquefois nodieux du mésentère dans les hernies, et la formation instantanée d'un sac par le tissu constitué, comme dans les cas de hernies qui se produisent brusquement; arrivent d'emblée à un développement considérable. De même, c'est grâce à ce tissu cellulaire sous-séreux que les chirurgiens doivent de pouvoir, sans sortir dans la cavité du péritoine, décoller cette membrane au loin et aller au loin chercher des artères profondément situées, comme par exemple, l'aorte. J'ai dit précédemment que le péritoine recouvrait presque complètement, mais non complètement, certains viscères, et que ceux mêmes qui en paraissaient le mieux en retrait, comme l'intestin grêle, avaient encore un pli de leur circonférence qui était dépourvu, celui qui répondait à l'éductoire où se rejoignent les deux feuillets mésentère. Mais il en est d'autres sur lesquels le péritoine ne fait que passer; la partie supérieure du duodénum et le pancréas sont dans ce cas, en sorte que ces organes sont presque étrangers au péritoine. Entre ces degrés extrêmes, il est des termes intermédiaires : et par exemple, le colon descendant, et l'iliaque qui lui fait suite, caecum et le colon ascendant, ne sont souvent tapissés par la sérosité que dans les trois quarts antérieurs de leur circonférence, le tiers postérieur restant appliqué sur la paroi abdominale postérieure dont il n'est séparé que par un tissu cellulaire très abondant. Cette disposition a été mise à profit par les chirurgiens pour traiter, dans les cas d'imperforation du rectum dans la cavité intestinale, sans intervenir le péritoine, et il est facile de comprendre qu'après avoir incisé les parois dominatrices dans toute leur épaisseur, non compris le péritoine qu'on repousse et colle, on puisse arriver en suivant la couche celluleuse sous-péritonéale jusqu'à une portion d'intestin dépourvue de sérosité. Quelquefois il arrive que le caecum et son appendice vermiculaire sont simple ment appliqués par le péritoine contre le tissu cellulaire de la fosse iliaque; dans ce cas, l'intestin se déplace et présente à l'anneau sa face celluleuse, la hernie est pourvue de sac, circonstance qui peut beaucoup embarrasser le chirurgien et faut donc toujours se méfier lorsqu'on opère une hernie étranglée du côté droit, surtout si c'est une hernie crurale. La structure du péritoine est celle de toutes les séroses, c'est-à-dire qu'elle varie en fonction des organes sur lesquels on l'étudie. On a vu, à l'article du système séreux en général (2), que là où les séroses pouvaient être considérées comme formant deribés membranes, et non point de simples surfaces, on leur distinguait trois feuillets : un superficiel, dit épithélial; un profond, constitué par le tissu cellulaire fibréux, et un intermédiaire, fibreux, véritable derme ou charpente de la membrane. Le feuillet épithélial est le seul qu'on trouve dans toute l'étendue de la séreuse abdominale; il constitue une véritable couche épaisse, une sorte de vernis étendu d'une manière uniforme sur tous les organes faisant partie du système de la cavité abdominale. Le feuillet fibreux n'existe que dans le péritoine pariétal et quelques-uns de ces replis désignés sous le nom de mésotèles; il est invasculaire dans le normal. Quant au feuillet profond, qu'on nomme plus justement couche sous-dermale, il est plus sujet encore à variations; on ne le rencontre d'une manière bien distinctive que dans quelques portions du péritoine pariétal et des mésotèles, et encore ne lui trouve-t-on nulle part cette uniformité qui caractérise d'autres membranes, les biomembranes par exemple. Ainsi, il est dans quelques endroits, le mésentère par exemple, parfondément parcé de nombreux vaisseaux capillaires que la transparence des deux feuillets permet de distinguer parfaitement, surtout chez les sujets qui ont souffert d'une péritonite, tandis que dans d'autres points, derrière les parois abdominales antérieures, il en est presque complètement dénué. Sur les viscères, là où la séreuse se trouve réduite au feuillet épithélial, on observe liement sur l'intestin où il est appliqué sans autre intermédiaire. On peut voir la transparence, la disposition arborescente du riche réseau capillaire artérioso-veineux qui appartient en propre au tube digestif et forme un de ses caractères distinctifs. Sur les parois abdominales, au contraire, outre le feuillet épithélial, ou reconstitué feuillet fibreux intermédiaire et la couche sous-séreuse; mais cette dernière, qui n'est autre que du tissu cellulaire dont les aréoles ont été aplaties et tassées par les éléments et les pressions, n'est pas plus vasculaire que l'est ce tissu en général, c'est-à-dire qu'elle l'est très peu. Ces différences dans la structure du péritoine selon les points où on excave que personne n'a fait ressortir, et qui ne sont pas moins prononcées que celles des propriétés physiques, me paraissent éclairer certains points obscure de sa pathologie, je veux parler surtout des variations et des inégalités présentes dans sa susceptibilité inflammatoire. Il n'est pas de chirurgien qui n'ait l'occasion de constater combien est vraie cette proposition aujourd'hui passée en adage, à savoir : que parmi les plaies du abdomen, celles qui ouvrent la péritonéale sont infiniment plus dangereuses que celles qui n'y pénètrent pas. Même dans ce dernier cas, la blessure n'est pas bornée aux parois musculaires, mais intéressé des organes inframurais, situés au-dehors du péritoine. Aussi, établi en principe, sans en donner de raisons satisfaisantes, que dans les opérations que l'on pratique sur le ventre il faut soigneusement éviter d'entamer la membrane, borner à la décoller. Pourquoi donc cette innocuité dans un cas, cette gracieuse inflammation dans l'autre? Avant de chercher l'explication de cet étrange phénomène, voyons d'abord les faits. Lorsqu'on pratique la ligature de l'artère iliaque, on est obligé de séparer le péritoine pariétal du tissu cellulaire sous-jacent dans une étendue considérable et de la face externe de cette membrane en rapport avec l'air; cependant, la péritonite n'est rare à la suite de cette opération, tandis qu'elle est fréquente dans les cas où la péritonéale a été ouverte, si petite que soit l'ouverture. Même innocuité des inflammations qui restent confinées dans la couche sous-péritonéale; tant que ne dépassent point le feuillet pariétal, et que le pus n'a de rapport qu'avec la face externe de cette membrane, les accidents demeurent ceux de tous les abscesses, ainsi qu'on l'observe si souvent dans les absences des ligaments larges et étoilés. Mais dès que les liquides produits par l'inflammation font irruption dans la cavité du péritoine, et se mettent en contact avec sa surface interne, les phénomènes de péritonite apparaissent et deviennent en général rapidement mortels. Qu'on me permette une hypothèse. On a vu précédemment que des trois feuillets qui entrent dans la structure du péritoine, un seul régnait dans toute l'étendue de la civière séreuse : c'est le feuillet épithélial. Faisant un instant abstraction de ce feuillet, on suppose qu'il ait disparu ; la cavité restera, mais ses parois vont se trouver singulièrement modifiées. Du côté des viscères, sur lesquels la couche épithéliale est appliquée sans intermédiaire, elles seront représentées par une immense surface ornée d'un réseau capillaire d'artères et de veines aussi riche, aussi serré, aussi fourni que nulle part ailleurs dans l'économie, et, de plus, pourvu de nerfs provenant du grand sympathique, doués comme tous les rameaux qui en émanent d'une sensibilité plus ou moins obtuse à l'état normal, mais s'exaltant à un degré inouï sous l'influence de divers pathologiques. Du côté des parois alimentaires, au contraire, au-dessous de la couche épithéliale, on rencontre le feuillet intermédiaire, véritable derme de la séreuse, armé de fibres de tissu cellulaire condensé presque dépourvu de vaisseaux et de nerfs, et doublé lui-même partout d'une couche celluleuse généralement peu vasculaire, sous laquelle, plus profondément encore, on trouve ici des aponévroses, là des muscles, tous tissus réfractaires aux inflammations. N'est-il pas évident que dans la cavité ainsi constituée, la susceptibilité inflammatoire sera fort inégalement répartie, et que si un irritant vient à y pénétrer, il trouvera dans la paroi formée par les viscères des éléments d'activité bien autrement nombreux et préparés que dans celle qui lui est opposée. Or c'est là précisément ce qui arrive dans le cas où l'air, pus, l'urine, la bile, ou tout autre liquide irritant s'introduit dans la cavité péri-tonicale. Le feuillet épithélial est incapable, vu sa minceur et son peu de consistance, de protéger longtemps les parties sous-jacentes, et d'ailleurs il disparaît au bout de quelques heures, ainsi que je l'ai démontré dans un travail expérimental. La cavité séreuse se trouve donc bientôt, en réalité, dans les conditions que j'ai supposées précédemment, et l'on comprend que l'inflammation trouve, dans la surface viscérale, des éléments de propagation et d'étendue et la richesse expliquent sa marche rapide et son intensité, éléments auxquels elle ne rencontre, ni dans les deux feuillets sous-jacents à la couche d'épithélium, ni dans les aponévroses, ni dans les muscles. Telle est la raison de cette innocuité des inflammations limitées au feuillet pariétal du péritoine, même lorsqu'elles sont très étendues; et l'on peut dire que, tant que la surface des viscères n'est pas en jeu, le danger n'est pas immédiat et peut être guéri. Mais dès que la cause irritante s'est mise en contact avec elle, le péril est commun, quelles heures suffisent pour le rendre irrémédiable. On pourra objecter, il est vrai, qu'il n'est pas de chirurgien qui n'ait eu à voir de larges plaies pénétrantes de l'abdomen, qu'on avait jugé d'abord devoir être promptement mortelles, se terminer heureusement, et que tous les jours on a sous les yeux des exemples de pénétration de l'air dans la cavité péritonéale n'ayant déterminé aucun accident. Les opérations de hernie étranglée, par exemple, seraient-elles à ce que, dans ces cas, l'action irritante de l'air sur la surface viscérale ne se serait pas prolongée pendant un temps suffisant pour donner lieu à la destruction de l'épithélium et à l'inflammation consécutive du réseau viscéral sous-jacent, cette irritabilité inflammatoire de la séreuse abdominale est très variable suivant les individus et la prédisposition du moment? Je ne sais; toujours est-il que les chirurgiens pénitents, lorsqu'ils sont forcés d'ouvrir la cavité péritonéale, donnent le conseil, empirique, il est vrai, mais consacré par l'expérience, de ne point trop prolonger les manœuvres, et de faire en sorte que si l'air ou d'autres irritants doivent nécessairement s'y introduire, au moins ils n'y prolongent point leur séjour. J'ai, quant à moi, la conviction que c'est dans la constitution anatomique très inégale des diverses parois de cette grande surface séreuse péritonéale qu'il faut chercher les causes de ces différences jusqu'ici inexpliquées, qu'on observe dans les phénomènes qui compliquent les affections de l'abdomen, et ce que j'ai dit afin de montrer qu'il est indispensable de réviser la théorie des plaies pénétrantes de la cavité du péritoine. Peut-être alors serait-on conduit, par l'observation réfléchie des faits pathologiques, à une pratique plus en rapport avec ce que nous enseignent l'anatomie et la physiologie. J'ai déjà dit que si, dans l'état normal, on ne pouvait admettre qu'il y eût une cavité péritonéale, dans le sens qu'on attache ordinairement à ce mot, il ne fallait pas cependant repousser cette expression, qui ne consacre pas une erreur, comme le croit M. Malgaigne, puisque cette cavité existe virtuellement. En effet, quoiqu'il n'y ait, à l'état normal, aucun vide entre les circonvolutions intestinales et les parois abdominales, il n'en est pas moins vrai que dès qu'un liquide arrive à la surface du péritoine, il trouve un espace prêt pour le recevoir, et que la cavité se trouve ainsi constituée. C'est ce qui arrive dans les cas où, soit les vaisseaux, soit les conduits ou réservoirs qui forment ces parois, se trouvent intéressés; on voit alors le sang, les matières alimentaires, la bile ou l'urine, s'épancher avec d'autant plus de facilité que la surface péritonéale est lisse, glissante et très étendue. Il est toutefois une contrainte qui modère cet écoulement, quelquefois même s'oppose jusqu'à un certain point à ce qu'il se fasse d'une manière continue et en grande quantité : c'est la compression qui résulte de l'antagonisme déjà signalé entre la ceinture contractile de l'abdomen, qui tend d'une manière incessante à se resserrer sur les viscères abdominaux, et la réaction élastique des intestins distendus par des gaz. Mais il faut pour cela que le liquide ait la tendance à se coaguler comme le sang, ou qu'il ne remplisse pas complètement le conduit qu'il parcourt, et qu'il y soit mélangé avec des gaz, comme les matières qui circulent dans l'intestin. S'il ne réunit aucune de ces deux conditions, s'il est fluide comme l'urine et remplissant toujours et sans mélange de gaz la cavité dans laquelle il est enfermé, comme ce dernier liquide et la bile, la pression réciproque des viscères et de la ceinture abdominale non-seulement n'empêchera pas l'épanchement d'avoir lieu, mais aura même pour résultat à peu près incapable de l'accélérer, à moins que la voie ne soit très petite et faite par un instrument piquant. DE LA CAVITÉ ABDOMINALE. Chemin Petit le fils, auquel on doit d'avoir mis en lumière quelques-unes de ces particularités, a été trop loin en affirmant que le sang se rassemblait toujours en un lieu, soit au voisinage du vaisseau blessé, soit dans un lieu plus ou moins éloigné et ordinairement déclive, et surtout en disant qu'il en était de même pour le chyme et le pus. Imbu de cette théorie, j'ai été plusieurs fois fort désappointé de trouver des épanchements considérables et diffus de sang et même de chyme à la suite de plaies pénétrantes. Et d'abord j'avais pris ces faits pour des exceptions. Mais une étude plus approfondie et une pratique plus étendue sur un terrain malheureusement trop condamné en accidents de ce genre, alors que je remplissais les fonctions de chirurgien en chef de l'ambulance établie aux Tuileries, en juin 1814, me démontrèrent que la limité des épanchements sanguins était un fait exceptionnel, si le vaisseau, soit artériel, soit veineux, dépassait un certain calibre, celui de la radiale par exemple, et que pour les matières alimentaires cet épanchement avait presque toujours lieu, exceptionnellement dans les cas où elles étaient en petite quantité et très gazeuses. Je crois donc que Petit a beaucoup trop généralisé un fait exceptionnel, et les expériences de Travers, sur les animaux, confirmatives des idées de Petit, ne sont rigoureusement concluantes que pour les animaux. Mais si cet antagonisme est insuffisant pour s'opposer à l'écoulement des liquides dans la cavité séreuse, il constitue du moins un merveilleux appareil de compression lorsqu'il s'agit d'exprimer des collections purulentes placées sous le péritoine. Il faut pour cela que l'abcès soit récent et ses parois encore molles et souples; car s'il est ancien, s'il a contracté des adhérences avec les parties environnantes ou si ses parois sont épaissies, cette tendance expulsive cesse d'avoir une influence décisive, et la cicatrisation du foyer, malgré ces heureuses conditions, peut se faire longtemps attendre. Du tube digestif et de ses annexes. — La portion abdominale du tube digestif se compose de la partie cardiaque de l'œsophage, de l'estomac, de l'intestin grêle et des gros intestins moins le rectum. La portion cardiaque ou abdominale de l'œsophage, si toutefois, dit M. Cruveilhier, on doit admettre une portion abdominale, est ordinairement très courte, et lorsqu'elle acquiert 3 ou 4 centimètres de longueur, cela suppose un abaissement de l'estomac. Enveloppée par le péritoine, elle ne présente rien d'intéressant à noter. L'estomac, dont la forme a été assez heureusement comparée à celle d'une corne muse, remplit presque entièrement l'hypochondre gauche et s'avance dans la région épastique jusqu'aux limites de l'hypochondre droit. Fixé par les insertions de l'œsophage et du duodénum et par les replis du péritoine, il est moins sujet au déplacement que la plupart des autres viscères abdominaux, et lorsqu'on le rencontre dans les hernies, c'est qu'il y a été attiré par le grand épiploon inséré à sa grande courbe. Obliquement dirigé en bas et à gauche, l'estomac, quoique abrité sous les douze côtes, est, comme le foie, sujet à déformation par l'usage des corsets trop serrés, ainsi que l'ont constaté Sommering et M. Cruveilhier. Il subit de considérables variations dans son volume, ce dont on peut s'assurer en percutant l'hypochondre et le flanc avant et après le repas. Mais ces changements, comme on peut le voir en insufflant sur le cadavre, ne portent en aucune façon sur la petite courbure que manifestent à ses deux extrémités l'éphocardie et le duodénum; aussi paraît-il exécuter, en se gonflant, une sorte de torsion sur ses deux insertions cardiaque et pylorique. C'est à la faveur du dédoublement des lames épiploïques entre lesquelles il est situé, que l'estomac doit de pouvoir ainsi s'amplifier et revenir ensuite facilement sur lui-même. L'extrémité pylorique, dont il serait si important de fixer les rapports d'une manière positive, à cause de l'intérêt qui se rattache à son exploration, est malheureusement sujette à beaucoup de variations. Cependant on peut dire que, règle générale, elle ne quitte point la région épigastrique, et qu'elle occupe ordinairement ses limites extrêmes du côté de l'hypoclone droit. Comme à toutes les autres portions abdominales du tube digestif, les deux dernières portions du duodénum exceptées, on décrit à l'estomac quatre tuniques : une séreuse, une musculeuse, une fibreuse et une muqueuse. Ses vaisseaux, fournis par les artères coronaires stomaciques, hépatiques et spléniques, forment au niveau de ses deux courbures un cercle artériel complet, duquel partent des rameaux qui couvrent ses faces antérieure et postérieure en se dirigeant perpendiculairement d'un bord à l'autre. D'où il résulte que, dans l'opération de la gastrotomie, il faut, pour éviter l'hémorrhagie, diriger l'incision parallèlement aux fibres circulaires, et avoir soin de se tenir à égale distance des deux courbures stomacales. Les veines de l'estomac se rendent dans la veine porte. Ses lymphatiques s'abouchent dans les nombreux ganglions situés au niveau de ses deux courbures, et ensuite dans ceux qu'on remarque autour du tronc cœliaque. Enfin, ses nerfs viennent du pneumogastrique et du grand sympathique. De l'intestin — L'intestin proprement dit est séparé de l'estomac par la valsee pylorique. On le divise en intestin grêle et en gros intestin ; une autre valvule, dite ileocaécale, établit leur démarcation. Quant à la division de l'intestin grêle elle-même en duodénum, jéjunum et iléon, elle est purement fictive et ne repose que sur des données plus ou moins spécieuses. Néanmoins, il faut la conserver comme facilitant l'étude du tube digestif. La valve pylorique, qui sépare l'estomac du duodénum, est représentée par un repli muqueux épais formé par la membrane muqueuse, que soulève ce pli de fibres charnues circulaires, auquel on a donné le nom de sphincter du pylorus. Sur le cadavre, l'orifice pylorique est fermé, et lorsqu'on y introduit le doigt, on éprouve la sensation d'un resserrement circulaire ; sur le vivant, il est également contracté et ne s'ouvre que par intervalles, pour laisser échapper les matières chymeuses, alors que l'on a fait subir à ces dernières l'estomac. On a dit que, le pylorus se refusait à livrer passage aux aliments non élaborés et aux corps étrangers ; c'est une erreur : après s'être opposé quelque temps à leur sortie, il les laisse passer dans le duodénum. Il en est de même des liquides intestinaux qu'on a tenté de prévoir ne pourraient traverser restant estomac ; les vomissures de matières fécales dans les hernies étranglées et la présence si fréquente de la bile dans la cavité stomacale prouvent sans réplique que le pylorus peut se laisser traverser par un courant dirigé en sens inverse. Il n'est donc pas besoin d'instituer des expériences sur les animaux pour démontrer un fait que personne ne conteste aujourd'hui. Le duodénum est la partie la plus fixe non-seulement de l'intestin, mais encore du tube digestif tout entier, ce qui tient à l'insertion des conduits biliaire et pancréatique, qui s'annoncent au commencement de cette portion du tube. Le jejunum, qui fait immédiatement suite au duodénum, ne peut réellement être paré de l'icône, et nous voyons M. Bion, en désespérant de cause, se rattacher à une ile de pure convention, et proposer d'appeler jejunum les deux cinquièmes supérieurs, et icône les trois cinquièmes inférieurs de l'intestin grêle. Cette portion du canal alimentaire est d'une mobilité extrême, et c'est là un des traits saillants de son histoire ; il obéit à la moindre pression, et ses circonvolutions, qui flottent et ondulent dans un liquide, se portent avec facilité d'un point de l'abdomen à l'autre. DSM déjoue qu'il existe une solution de continuité aux parois abdominales ou même il lie dans le bassin, le voit-on s'y présenter immédiatement et faire hernie. Sa longueur, compris celle du duodénum, varie entre 1 et 17 pieds, et cette étendue considérable est supportée par un pédicule relativement très court qui s'étend du côté gauche de la deuxième vertèbre lombaire à la fosse iliaque droite. Comme la totalité du canal, malgré les restrictions nombreuses qu'il décrit, est obligée de suivre la direction de ce pédicule mesentérique, on peut dire que l'intestin grêle est dirigé de gauche droite et de haut en bas. J'ai dit précédemment ce qu'il faut penser de cette partie du mésentère, je n'y reviendrai pas. Il est difficile d'assigner des rapports exacts à l'intestin grêle qui se porte partout il y a un vide à remplir, et qui voyage sans cesse de la cavité abdominale dans le bassin, sous l'influence des contractions du diaphragme et des muscles de la paroi abdominale. Ce que l'on peut dire de plus positif, c'est qu'il occupe rarement la région épigastrique, et qu'en général il répond rather aux régions ombilicale et hypogastrique qu'aux flancs et aux fosses iliaques. Dans la position verticale, il a tendance à pénétrer dans le bassin, et l'on a attribué aux pressions qu'il exerce sur l'abdomen les désagréments si fréquents de cet organe. Les circonvolutions intestinales répondent toujours aux parois abdominales par le point de leur circonférence qui est opposé à l'insémination mésentérique, et c'est toujours cette portion qui se présente d'abord dans les plaies et les hernies. Mais entre elle et les parois abdominales, s'insère ordinairement le grand épiploon jeté comme un voile sur la toiture de l'intestin grêle. Structure, si intéressante à étudier au point de vue physiologique, ne sera objet que de quelques remarques pratiques. Comme l'estomac, l'intestin offre à étudier quatre tuniques distinctes dans l'ordre suivant : une séreuse, une musculaire, une fibreuse et une muqueuse. La unique épithélium est ici représenté, ainsi que je l'ai dit déjà, par un simple cil épithélial, remarquable par une densité plus grande que partout ailleurs. Elle tournine à l'intérieur grêle une gaine complète, excepté au niveau de l'insertion mésoconique où une portion de sa circonférence en est dépourvue. C'est à la faveur de cette disposition que le tube digestif doit de pouvoir agrandir rapidement de volume en rompre sa tunique séreuse à peu près inextensible, et l'insuction prouve que c'est bien par une sorte de dédoublement des deux lames du mésentère que s'opère l'agrandissement du canal intestinal. Les vaisseaux et les nerfs abordent les parois intestinales par cette portion de la circonférence de l'intestin dépourvue de séreuse. ANATOMIE DES RÉGIONS. À travers la transparence du feuilleau serré on peut voir la couche musculaire, immédiatement au-dessous. Pour préparer, il suffit d'enlever cette couche épithéiale, ce qui n’est pas très facile, vu sa ténuité et son adhérence intime aux fibres charnues. Il me semble impossible d'admettre ici, avec M. Cruveilhier, une couche de tissu cellulaire sous-péritonéal. La tunicale musculaire est constituée par deux ordres de fibres, les uns superficiels, longitudinaux, les autres profondes, circulaires; ces dernières sont les plus nombreuses et les plus prononcées. Ce sont elles qui donnent lieu à ces mouvements vermiculaires de va-et-vient qu'on observe chez les animaux auxquels on ouvre l'abdomen, mouvements auxquels on a donné le nom de péristaltiques et antispasmodiques, parce qu'ils s'exercent alternativement de haut en bas et de bas en haut. Chez l'Homme, ces contractions sont bien moins prononcées que chez les animaux, ce qui tient sans doute à la faiblesse relative des fibres musculaires. J'ai eu l'occasion de m'en assurer dans un cas bien singulier; c'était sur un individu qui, à la suite d'un coup de feu tiré à bout portant, avait eu la presque totalité de la paroi abdominale antérieure enlevée. L'intestin grêle, qui, par un hasard incompréhensible, n'avait pas été blessé, sortait presque en totale par cette horrible plaie. Je me contentai de le recouvrir d'une couche d'ouate imbibée d'huile laudanisée tiède, et pendant tout le temps que durèrent ces diverses manœuvres, je fus frappé de la faiblesse et de la lenteur des contractions, ce qui m'étonna d'autant plus, que le blessé était en pleine digestion lorsque l'accident lui arriva. Cette "faiblesse" de la "contractilité" intestinale chez l'homme, comparée à celle que l'on observe sur les animaux carnivores, les chiens par exemple, me semble de nature à mettre en garde contre les expériences de Travers, desquelles il semblerait résulter qu'on peut blesser l'intestin, soit en long, soit en travers, le livrer même et le redonner ensuite dans le ventre, sans que l'animal éprouve autre chose que quelques vomissements. Chez ces animaux, la contraction des fibres musculaires est telle, qu'elle tient la plaie et s'oppose à l'éroulement des liquides intestinaux, en sorte que l'inflammation du péritoine se limite et reste modérée, ne s'étendant que rarement hors de la cavité séreuse. Or ce n'est pas ainsi que se passent les choses chez l'homme, et tous les chirurgiens savent combien sont rapidement mortelles les blessures des intestins, soit en long, soit en travers, lorsqu'on ne peut parvenir par la suture à empêcher l'évacuation des matières dans le péritoine. Quant à l'obstruction complète de l'intestin par une ligature, il suffit de réfléchir à ce qui se passe dans le volvulus, pour comprendre que dans la société humaine la mort en serait le résultat inévitable. C'est ici le cas de dire, plus que jamais, qu'il n'est pas possible de considérer des animaux à l'homme. 11 est toutefois une disposition anatomique qui, lorsque les plaies sont très étroites et faites par des instruments très pointus, peut, jusqu'à un certain point, s'opposer à l'écoulement des liquides intestinaux : c'est la facilité avec laquelle la membrane muqueuse fait hernie curieuse les lèvres de la plaie. Mais il n'y faut pas trop compter; car, pour que la blessure ne soit pas exactement obstruée, les mouvements péristaltiques de l'intestin feront sortir quêtes gouttes des matières ordinaires qui sont très acides que contient le tube intestinal, et cela suffit pour qu'une péritonite intense se déclare. Il n'y a donc guère que les piqûes faites avec des instruments extrêmement acérés, comme des aiguilles, qui jouissent de cette heureuse prérogative. Aussi, dans l'opération de la hernie étranglée, lorsqu'on ne peut réduire l'intestin léger autrement mesure par les gaz, a-t-on donné le conseil que j'ai suivi quelquefois, de le piquer avec une épingle pour le détendre. Une ouverture suffisante pour donner issue aux gaz sans laisser échapper les liquids, permet de le réduire plus facilement, et l'on évite ainsi de lui faire subir des torsions qui ne sont pas sans influence sur le développement de la péritonite. L'immque fibreuse, sur laquelle s'élancent les fibres charnues, tient ensuite et ne me dit rien à noter.
| 39,838 |
https://persist.lu/ark:70795/0c3skj/articles/DTL159_1
|
BNL Newspapers (1841-1879)
|
Open Culture
|
Public Domain
| 1,866 |
Pub. 9 Page 4
|
None
|
German
|
Spoken
| 184 | 388 |
Bekanntmachung. «m «reitan, den 28. d. %i&., um 1 Uhr N,ch< ntittanß, wird z» Habscheil», auf Anstehen der Erben Urfiaiiu, durch den Notar crrn eintner von Körich, zur öffentlichen Verftcisserung auf Borg der nachge» nannten lArnndgüter gcichritten: 1. ©in geiäumigtä Wohnhaus nebst Stallung, Scheune und Garten, in der Mit« des Dorfes gele- gen, und zu jedem Geschäfte geeignet. 2. Vier ©tuet Land und eine Parzelle ©arten. 3 (Sine Wie<e von 37 Aren, genannt Oligspelch. 4. (Sine hochstämmige Vuchen- und Xanncnljecte von 43 A. üO C. im Peifcschgrundgen. 5. (Sine Lohhecke von 16 A., nach 2 Jahren schleiß» bar, auf dem Stöbgen. 6. Eine Lohhecke von 75 A. 60 C. von bestem Stan- de und ausgezeichneter Loh, wovon 8/s nach einem Jahre schleihbar, im Ort genannt Theisengründgen. Alles auf dem Banne von Hobscheid gelegen. Die Versteigerung findet statt in der Schenke d« Wittwe Pauly. Für nähere Erkundigung wende man sich gefälligst an Herrn MllNs von Hobscheid. (1724) Verlag von Pierre Brück in Lurcinl'urg. Eben erschien. Luxemburger Oand Kalender auf das Jahr zum Gebrauche der Einwohner des Großher« zogthums Luxemburg. 101 ter Jahrgang. Preis: 5 Souö..
| 19,337 |
https://github.com/tgeijten/xo/blob/master/xo/container/container_algorithms.h
|
Github Open Source
|
Open Source
|
MIT
| 2,022 |
xo
|
tgeijten
|
C
|
Code
| 811 | 1,661 |
#pragma once
#include <vector>
#include <algorithm>
#include "xo/system/assert.h"
#include "xo/xo_types.h"
#include "xo/container/pair_type.h"
#include <cmath>
namespace xo
{
template< typename It, typename T >
T accumulate( It b, It e, T init ) {
for ( ; b != e; ++b )
init = init + *b;
return init;
}
template< typename It, typename T, typename Op >
T accumulate( It b, It e, T init, Op op ) {
for ( ; b != e; ++b )
init = op( init, *b );
return init;
}
template< typename C, typename T >
T accumulate( const C& cont, T init ) {
return accumulate( std::cbegin( cont ), std::cend( cont ), init );
}
template< typename C, typename T, typename Op >
T accumulate( const C& cont, T init, Op op ) {
return accumulate( std::cbegin( cont ), std::cend( cont ), init, op );
}
template< typename It, typename T >
T average( It b, It e, T v ) {
xo_assert( b != e ); return xo::accumulate( b, e, v ) / ( e - b );
}
template< typename It, typename T, typename Op >
T average( It b, It e, T v, Op op ) {
xo_assert( b != e ); return xo::accumulate( b, e, v, op ) / ( e - b );
}
template< typename C >
auto average( const C& cont ) {
return average( std::cbegin( cont ), std::cend( cont ), typename C::value_type() );
}
template< typename C, typename T, typename Op >
auto average( const C& cont, T init, Op op ) {
return average( std::cbegin( cont ), std::cend( cont ), init, op );
}
template< typename It, typename T >
auto mean_std( It b, It e, T v ) {
xo_assert( b != e );
auto mean = average( b, e, v );
auto acc = decltype( mean * mean )();
for ( auto i = b; i != e; ++i )
acc += ( *i - mean ) * ( *i - mean );
return std::make_pair( mean, std::sqrt( acc / ( e - b ) ) );
}
template< typename C > auto mean_std( const C& cont ) {
return mean_std( std::cbegin( cont ), std::cend( cont ), typename C::value_type() );
}
template < typename C, typename P > std::vector< index_t > sorted_indices( const C& cont, P pred ) {
std::vector< size_t > idx_vec( cont.size() );
for ( index_t i = 0; i < cont.size(); ++i ) idx_vec[ i ] = i;
std::sort( idx_vec.begin(), idx_vec.end(), [&]( size_t i1, size_t i2 ) { return pred( cont[ i1 ], cont[ i2 ] ); } );
return idx_vec;
}
template < typename C > std::vector< index_t > sorted_indices( const C& cont ) {
return sorted_indices( cont, std::less< typename C::value_type >() );
}
template< typename C > typename C::const_iterator min_element( const C& cont ) {
return std::min_element( std::begin( cont ), std::end( cont ) );
}
template< typename C > auto min_value( const C& cont ) { return *min_element( cont ); }
template< typename C > typename C::const_iterator max_element( const C& cont ) {
return std::max_element( std::begin( cont ), std::end( cont ) );
}
template< typename C > auto max_value( const C& cont ) { return *max_element( cont ); }
template< typename C > C sorted_copy( const C& cont ) { C res( cont ); std::sort( res.begin(), res.end() ); return res; }
template< typename It > typename std::iterator_traits< It >::value_type median_slow( It b, It e ) {
auto n = e - b;
xo_assert( n > 0 );
std::vector< typename std::remove_cv< typename std::iterator_traits< It >::value_type >::type > v( n / 2 + 1 );
std::partial_sort_copy( b, e, v.begin(), v.end() );
if ( n % 2 == 1 ) return v[ n / 2 ];
else return ( v[ n / 2 ] + v[ n / 2 - 1 ] ) / std::iterator_traits< It >::value_type( 2 );
}
template< typename It > auto median_non_const( It b, It e ) {
xo_error_if( e <= b, "Invalid range" );
auto n = e - b;
auto h = n / 2;
std::nth_element( b, b + h, e );
if ( n % 2 == 1 )
return *( b + h );
else return ( *( b + h ) + *std::max_element( b, b + h ) ) / 2;
}
template< typename C > typename C::value_type median( C v ) {
return median_non_const( std::begin( v ), std::end( v ) );
}
template< typename C > typename C::value_type median_non_const( C& v ) {
return median_non_const( std::begin( v ), std::end( v ) );
}
template< typename C > typename C::value_type median_slow( const C& v ) {
return median_slow( std::begin( v ), std::end( v ) );
}
template< typename C > typename C::value_type top_average( const C& vec, size_t count ) {
// #todo: use nth_element for better performance
C result( count );
std::partial_sort_copy( vec.begin(), vec.end(), result.begin(), result.end() );
return average( result );
}
}
| 33,706 |
https://github.com/Pablion/vscode-snippets-manager/blob/master/src/test/suite/extension.test.ts
|
Github Open Source
|
Open Source
|
MIT
| 2,022 |
vscode-snippets-manager
|
Pablion
|
TypeScript
|
Code
| 351 | 1,381 |
import * as assert from "assert";
// You can import and use all API from the 'vscode' module
// as well as import your extension to test it
import * as vscode from "vscode";
import {
CodeSnippetsEditor,
currentWebviewPanel,
} from "../../CodeSnippetsEditor";
import {
closeAllEditors,
createTestFile,
resetTestWorkspace,
testWorkspaceFolder,
} from "../util";
// import * as myExtension from '../../extension';
assert.ok(testWorkspaceFolder);
suite("Extension", () => {
const extensionID = "zjffun.snippetsmanager";
const extensionShortName = "snippetsmanager";
let extension: vscode.Extension<any> | undefined;
extension = vscode.extensions.getExtension(extensionID);
setup(async () => {
await closeAllEditors();
await resetTestWorkspace();
});
teardown(async () => {
await closeAllEditors();
await resetTestWorkspace();
});
test("All package.json commands should be registered in extension", (done) => {
if (!extension) {
throw Error("can't find extension");
}
const packageCommands = extension.packageJSON.contributes.commands.map(
(c: any) => c.command
);
// get all extension commands excluding internal commands.
vscode.commands.getCommands(true).then((allCommands) => {
const activeCommands = allCommands.filter((c) =>
c.startsWith(`${extensionShortName}.`)
);
activeCommands.forEach((command) => {
const result = packageCommands.some((c: any) => c === command);
assert.ok(result);
});
done();
});
});
test("Create snippet command should work when has selection", async () => {
const uri = await createTestFile("test content");
await vscode.commands.executeCommand("vscode.open", uri);
await vscode.commands.executeCommand("editor.action.selectAll", uri);
const res = await vscode.commands.executeCommand(
"snippetsmanager.createSnippet",
"test"
);
assert.ok(res);
});
test("Create snippet to command should work when has no selection", async () => {
const uri = await createTestFile("{}");
const res = await vscode.commands.executeCommand(
"snippetsmanager.createSnippetTo",
"test",
uri
);
assert.ok(res);
});
test("Explorer should work", async () => {
await vscode.commands.executeCommand(
"workbench.view.extension.snippetsmanager-snippetsView"
);
});
test("Code snippets editor should work", async () => {
const uri = await createTestFile("");
await vscode.commands.executeCommand("vscode.open", uri);
await vscode.commands.executeCommand("snippetsmanager.showEditor");
assert.ok(currentWebviewPanel);
await vscode.commands.executeCommand("workbench.action.splitEditorRight");
await vscode.commands.executeCommand(
"workbench.action.files.newUntitledFile"
);
assert.strictEqual(currentWebviewPanel, null);
await vscode.commands.executeCommand("vscode.open", uri);
await vscode.commands.executeCommand("snippetsmanager.showEditor");
assert.ok(currentWebviewPanel);
});
test("Code snippets editor context should currect", async () => {
const uri = await createTestFile("");
const uri2 = await createTestFile("");
const uri3 = await createTestFile("");
await vscode.commands.executeCommand("vscode.open", uri);
await vscode.commands.executeCommand("snippetsmanager.showEditor");
assert.ok(CodeSnippetsEditor.isActive);
await vscode.commands.executeCommand("vscode.open", uri2);
await vscode.commands.executeCommand("snippetsmanager.showEditor");
assert.ok(CodeSnippetsEditor.isActive);
await vscode.commands.executeCommand("vscode.open", uri3);
assert.ok(!CodeSnippetsEditor.isActive);
await vscode.commands.executeCommand("vscode.open", uri2);
await vscode.commands.executeCommand("snippetsmanager.showEditor");
assert.ok(CodeSnippetsEditor.isActive);
await vscode.commands.executeCommand("snippetsmanager.showSource");
assert.ok(!CodeSnippetsEditor.isActive);
await vscode.commands.executeCommand("snippetsmanager.showEditor");
assert.ok(CodeSnippetsEditor.isActive);
});
test("Code snippets editor open array json file should work", async () => {
const uri = await createTestFile(`[{"test": {}}]`);
await vscode.commands.executeCommand("vscode.open", uri);
await vscode.commands.executeCommand("snippetsmanager.showEditor");
assert.ok(currentWebviewPanel);
});
});
| 9,112 |
https://security.stackexchange.com/questions/110669
|
StackExchange
|
Open Web
|
CC-By-SA
| 2,016 |
Stack Exchange
|
English
|
Spoken
| 229 | 275 |
How do country's block politically charged spam?
I have a friend who is returning to China shortly, and I wanted to stay in touch with him so I got his email address. I was wondering what precautions does China (or any other dictatorial regimes for that matter) have so that I don't send him or anyone else politically charged content? As far as I know, most of the spam filtering that takes place is based on text analysis and ip reputation. Is this the only methods used or are there more advanced features as well? I would think that if the email is carefully crafted in content and comes from an IP with a good reputation these methods could be evaded. Most of the information on the web I can find seems to talk mostly about blocking websites, not email.
They may use machine learning and data analysis techniques similar to those used for spam filtering to find seditious content. As with spam filters, if you chose your wording carefully, most likely it will get through (but you need to be aware of what wording they are filtering on so it might take some trial and error).
If you want to employ methods of communication which require you to send sensitive information you could opt using SMIME or PGP to encrypt your email's content (providing they let this true).
| 3,233 |
|
Hindostan1_21
|
English-PD
|
Open Culture
|
Public Domain
| 1,820 |
Hindostan 1
|
Walter Hamilton
|
English
|
Spoken
| 7,083 | 10,000 |
A large district in the province of Bahar, situated about the 25th degree of north latitude. To the north it is bounded by the course of the Ganges, on the south and east by that of the Sone, and on the west by Chunar in the province of Allahabad. In 1784, the original Circar of Shahabad contained only 1,869 square miles ; but it has since been greatly augmented by incorporations from the adjacent territories. This district is extremely fertile, and in general popu- lous ; but towards the south west it still contains many tracts of waste land. In 1801, the proportion which the uncultivated land bore to the cultivated was estimated by the collector as one to four, exclusive of the hills which form the southern boundary ; but the accuracy of most of the returns given in at that time cannot be depended on, not being the result of actual investigation, but in most cases of mere conjecture. The district was then (in 1801) described by the public functionaries, as being in a progressive state of improvement, the cultivation having been extended very considerably subsequent to the decennial settlement of the land revenue. The zemindar s profit was then computed to amount to 40 per cent, on the land-tax, which in 1814 yielded 1,128,515 rupees; the abkarry 280 THE PROVINCE [district of or excise being 48,947 rupees. By the diligence of the revenue officers some lands have been discovered in Shahabad, not included in the revenue settlement above mentioned, but the extent is not great. In general the lands paying the land-tax are the best cultivated. The most valuable articles of agricultural produce are opium, tobacco, cotton, sugar, indigo, and hemp, and the cultivation of all (especially of sugar) was considered to be gradually increasing. The district contains no brick or mud private forts, nor are there any schools or seminaries within its limits where the Hindoo or Mahommedan laws are taught. In 1801, in consequence of instruc- tions from the Marquis Wellesley, then Governor-General, the board of revenue in Bengal circulated various queries on statistical subjects to the collectors of the different districts under that presidency. The result of their returns tended to establish the fact, that Shahabad contained two millions of inhabitants, in the proportion of one Mahommedan to twenty Hindoos; and, it is very much in favour of their general good conduct, that only one instance of gang robbery appeared on the calendar throughout the whole of 1813. — (J. Deane, Cokbrooke, J. Shakespeare &;c.) Arrah. — This is the principal town of the Shahabad district, and is both extensive and populous, but we have no accurate returns of the number of inha- bitants it contains. Lat. 25° 35' N. long. 84° 40' E. 35 miles west from Patna. Buxar (Bagsar). — A town in the Shahabad district, situated on the south east side of the Ganges, lat. 25° 35' N. long. 83° 57' E. 58 miles E. N. E. from Benares. The fort here, is of considerable size, and commands the Ganges, but it is now dismantled, nor is there a single fortified place between Calcutta and Allahabad. Every boat passing up and down the Ganges is obliged to come to at this place, and produce a pass ; every traveller by land does the same, the police being very strict. A celebrated victory was gained here in October 1764, by the British forces under Major, afterwards Sir Hector Munro, over the united armies of Shuja ud Dowlah and Cossim Ali Khan. The British army consisted of 856 Europeans, and 6,215 Sepoys, of whom 87 Europeans and 712 Sepoys were killed and wounded ; the combined troops were computed at 40,000 men, 2,000 of whom are supposed to have been slain in the battle. The flight of the allies was so rapid that that they did not stop at Buxar, but hastened to a nullah or small river beyond it, which being very full, many were drowned and slaughtered in attempting to pass. The plunder was very great as they left their tents standing; and their whole train of artillery, consisting of 133 pieces of various sizes, were taken. A native historian (Gholaum Hossein) describes the- camp of the two chiefs while advancing, in the following terms : M A bridge of boats being thrown SHAHABAD.] OF BAHAR. 281 over the Ganges, the allied armiesbegun their march in numbers not to be reckoned; but from the ignorance of the generals, and want of discipline, murdering and plundering each other. It was not an army but rather a moving nation." Travelling distance from Benares 70 miles ; from Calcutta by Moorshedabad 485, by Birboom 408 miles.— (Lord Vakntia, Forster, Bennett, %€») Dungy. — A town in the Shahabad district, 68 miles S. W. from Patna. Lat. 25° 10' N. long. 81° 10' E. Sasseram (Sahasram). — A town in the Shahabad district, 34 miles south from Buxar. Lat. 24° 58' N. long. 83° 58' E. Shere Khan, the Afghan, who expelled the Emperor Humayoon (the father of Acber) from Hindostan, was buried here, in a magnificent mausoleum, built in the middle of a great reservoir of water. The monument rises from the centre of the tank, which is about a mile in circumference, and bounded on each side by masonry ; the descent to the water being by a flight of steps now in ruins. The dome and the rest of the building is of a fine grey stone, at present greatly discoloured by age and neglect. — ( Hodges, %c.) Mooxeeh ( Mam?*). — A small town in the Shahabad district, 42 miles E. by S. from Benares. Lat. 25° 12' N. long. 83° 40' E. Rhotas ( Rahatas). — A town and pergunnah in the Shahabad district, the most westerly of the Bahar province, being bounded in that direction by the Caram- nassa river. In 1784, the Rhotas territorial subdivision contained 3,680 square miles, of which only 2,000 were plain arable ground, the rest being hilly and much covered with jungle. By Abul Fazel in 1582, it is described as follows: " Circar Rhotas, containing 18 mahals ; measurement 473,340 begahs, revenue 40,819,493 dams. This Circar furnishes 4,550 cavalry, and 162,000 infantry." The fortress of Rhotas is situated on the level top of an extensive mountain, about 81 miles travelling distance S. E. from Benares. Lat. 24° 38' N. 83° 50' E. A. D. 1542, Shere Shah, the Afghan, took this fortress, until then deemed im- pregnable, by a very shallow stratagem, from Raja Chintamun, the last of a long dynasty of Hindoo sovereigns, who had for many centuries [ruled this part of Hindostan. Shere Shah made it a depot for his family and treasure; but after his death it must have again reverted to the Hindoos, as in 1575, it was captured from a Raja of that faith by the Emperor Acber. For many years subsequent to the conquest of Bahar by the British, an opinion was very prevalent among the natives, that treasure to a large amount had been concealed in this vicinity, under ground, by Cossim Ali, or his agents, when compelled to evacuate the province in 1764. Positive native testimony being produced as to the exact spot, search in 1813 was made, by orders from Calcutta, at the village of Tellotho near Rhotas ; but nothing was found except 50 brass utensils, belonging VOL. I. 0 O THE PROVINCE [district or to a widow of the deceased proprietor of the premises where the search was made. This unexpected discovery being notified to the supreme government the widow was desired to account for the locality of these brazen vessels, which she did by declaring, that she had buried them three years before that date, during an irruption of some plunderers into the district of Mirzapoor, which assertion, the appearance of the metal, and some other circumstances which need not be detailed, tended to confirm. — (Stewart, Public MS, Documents, J. Grant, THE DISTRICT OF RAMGHUR (Ramaghara), A hilly and mountainous district, the jurisdiction of which, since it has been new modelled and extended, occupies the whole southern quarter of the Bahar province. To the north it is bounded by the district of Bahar Proper; on the south by Jushpoor; Gangpoor, and Singboom ; to the east it has Boglipoor, and Burdwan, and on the west Billounja, Sirgoojah, and Jushpoor. Besides the territory specifically named Ramghur, it now comprehends Palamow, Pachete, and Chuta Nagpoor, and a great part may be considered as properly belonging to the ancient Hindoo province of Gundwana. In 1784, Chuta Nagpoor, Palamow, and Ramghur, according to Major Ren- nells mensuration, contained 21,732 square miles, of which 16,732 were nearly waste. A great proportion of this division is from its situation rocky and unproductive, and can never be brought into a populous or cultivated condition, unless great encouragement be held out to clear the hitherto impenetrable woods and fast- nesses; and such is the uncivilized state of the district generally, that the natives cannot be expected to comprehend the laws by which they are governed. Commercial transactions are very insignificant, and confined mostly to the mere interchange and barter of commodities for domestic consumption. The hills abound with iron, which is collected and fused by the natives in their rude manner, and is the principal article of exportation, but the want of navigable rivers is a great obstruction to the extension of this traffic. Cultivation on the whole is improving, and barley has been introduced among the hill inhabitants since the British conquest. Within the Ramghur jurisdiction there are two roads of importance. The first is the great military road, which extends from Assoonsur to Barroon, on the banks of the Sone, 246 miles, and is usually repaired at the expense of government ; the other is one from Sheregotty, which joins the abovementioned great military road at Konnah Chitty. On the military road there were formerly from 30 to 40 bridges, but most of them have been swept away by the floods. There are many old brick forts in Ramghur, the ramghur.] ; OF BAHAR. 283 destruction of which was recommended by the magistrate at an fearly period of the British domination, as they afforded protection to refractory zemindars, and hordes of irregular banditti. There are here few durable buildings, and none at all for religious purposes. Neither are there any private schools or seminaries for teaching the Hindoo or Mahommedan law, education not extending beyond the accomplishments of reading and writing. In Ramghur, the mouhur tree grows spontaneously, and in great abundance among the rocky and otherwise barren parts of the mountains, and provides the natives with a convenient substitute for grain, as it will keep, when pulverized, for a whole season. By the natives, however, it is principally used for making an infusion like tea, which affords a nourishing and healthy beverage, but this process has been construed as coming within the regulations against illicit distil- lation. The principal rivers are the Dummodah and Burrakur, and the principal towns, Chittra (containing the head quarters and the jail), Ramghur, and Muc- kundgunge. The district is thinly inhabited, and a very great majority of the inhabitants are Hindoos of the Brahminical persuasion, but accurate returns of these particulars have not yet been published. One estimate makes the inhabi- tants of Ramghur Proper amount to half a million, in the proportion of one Ma- hommedan to 30 Hindoos. The Rajah of Chuta Nagpoor, who formerly exer- cised an independent jurisdiction within the limits of his own territories, is the highest in rank ; but there are besides many zemindars of extensive possessions and considerable personal influence, the Ramghur division being probably one of the least regularly arranged within the British sovereignty. This district has long been distinguished for the numerous crimes and devas- tation which occasioned annually the loss of many good soldiers from the un- healthiness of the country. The inhabitants of the adjacent plains have an unconquerable aversion to the hills, owing to the pestilential distempers they are liable to, as well as to the extreme barbarity of the hill natives, and the abundance of beasts of prey, such as tigers, bears, wolves, and hyenas. Theft is common throughout Ramghur, but murder, more prevalent among a particular class, which are the slaves possessed by persons inhabiting the mountainous and inaccessible interior, and of savage and ferocious habits. When petty disputes occur, these slaves are compelled by their masters to perpetrate any enormity, and are more especially employed for the purposes of assassina- tion. Any hesitation or repugnance on the part of the slave is attended with immediate death, which is equally his fate should he fail in the attempt. On the other hand, if he succeed, he is sought out by the officers of government and executed as a murderer. The usual police have hitherto been unable to seize the cowardly instigator, and if recourse be had to a military force, he re- o o 2 284 THE PROVINCE [district or tires into the jungles. On the occurrence of such an event, the whole country is thrown into confusion and rebellion, during which, many unoffending persons lose their lives ; and the troops, after many ineffectual efforts to execute the magistrates orders, return to their stations worn out with fatigue, and their numbers thinned by the pestilential atmosphere of the jungles. Neither do the slaves attach the slightest idea of guilt to the murders they are thus delegated to commit ; on the contrary, when seized, they always confess, and appear to ex- pect applause for having done their duty. Murder is here also frequently com- mitted through the mere ignorance and superstition of the people, who often put individuals to death under a belief that they possess magical influence, and make a destructive use of their knowledge. As may be supposed from the above description, the police of Ramghur is far from having attained even the distant approach to perfection, which is to be. found in some of the other districts subject to the British authority. In 1813, the number of gang robberies committed exceeded those of 1812, and some of them were attended with circumstances of great enormity. In the year last mentioned, several of the dacoit gangs were* led by the former proprietors of two small estates, sold by auction about nine years before, for arrears of revenue. Highway robbery, by gangs of from five to twenty persons, is the most prevalent offence, and the apprehension of the delinquents, owing to the nature of the country, difficult. Pilgrims, to the different places of Hindoo worship, who usually have some ready cash about them, are the most frequent sufferers on these occasions. In 1814, the police of Ramghur had not undergone any very essential improvement, and some of the local arrangements were considered by the superintendant of the lower provinces to be defective. The residence of the magistrate was usually above the ghauts or passes into the mountains, and cir- cumstances frequently rendered his visiting places also within the ghauts neces- sary. In this predicament it became difficult for bim to exercise an effectual controul over the territory adjoining to Bahar Proper, which state of things would naturally suggest the expediency of transferring all such places to the latter district. But here obstacles presented themselves, the jurisdiction of Bahar being already so extensive, that the management of any addition of magnitude would be utterly beyond the natural powers of any single judge and magistrate. To obviate this objection as far as practicable, it was recommended that a joint magistrate should be stationed at Sherighautty. — (W. T. Smith, J. Shakespear, Lord Ttignmouthj J, Grant, 8$c.) Chittra. — This is the chief town of the Ramghur district and residence of the judge and magistrate ; yet, on account of the thick and impenetrable jungles by which it is surrounded, it has never been considered safe to work the convicts bamghur.] OF BAHAR. 285 beyond the precincts of the town. It stands in lat. 24° 10' N. long. 84° 50' E. about 110 miles S. by W. from Calcutta. Koondah. — A town and pergunnah in the Ramghur district, 105 miles S.S.W. from Patna. Lat. 24° 20' N. long. 84° 38' E. Muckundgunge ( Mitcundaganj ). — A town in the Ramghur district, 114 miles S. by E. from Patna. Lat. 23° 57' N. long. 85° 25' E. Pausonauth ( Parswanatha ). — Samet Sichara, called in Major Rennell's map, Parsonauth ; is situated among the hills bordering Bahar and Bengal. Its holiness is held in great estimation by the Jainas, and it is said to be visited by pilgrims from the remotest parts of India. Parswa, or Parswannah, the 23d deified saint of the Jainas, and who perhaps was the real founder of the sect, was born in the suburbs of Benares, and died at the age of 100 years, on mount Sammeya, or Samet. — ( Colebrooke, 8$c.) Ramghur. — This town is situated on the banks of the Dummodah river, about 190 miles N. W. from Calcutta, and originally gave its name to the district, but it has since fallen to a secondary rank. Lat. 23° 38' N. long. 85° 43' E. Muckundgunge ( Muc und(t ganj). — This town stands about 114 miles S. by E. from Patna, and has a lead mine situated about 10 miles further west. Lat. 23° 57' N. long. 85° 25' E. Bigh (Bhiga). — A town in the Ramghur district, 90 miles south from Patna. Lat. 24° 14' N. long. 85°12'E. Jaulda. — A town in the Ramghur district, 1G5 miles N. W. from Calcutta. Lat. 23° 23' N. long. 85° 56' E. Palamow (Palamo). — This hilly and jungly territory belongs to the Bahar province, and now forms part of the jurisdiction subordinate to the judge and magistrate of Ramghur. It extends from the southern extremity of Ontaree to Burwa, a dependency of Chuta Nagpoor, a distance of 65 miles ; the whole extent of which formerly confined on the Maharatta pergunnahs of Sirgoojah and Jushpoor, and comprehends many ghauts or passes, of various degrees of strength and facility. But although the scarcity of grain and density of the woods might stop the ingress of a regular army r it has been experimentally proved, that they present no insurmountable obstacles to the predatory incur- sions of the Pindarries. There are no rivers of any magnitude^ but many small streams and rivulets, and the soil is in many parts strongly impregnated with iron. The revenue imposed on the Raja of Palamow was originally only 12,182 rupees; yet in 1805, Raja Chooramun Ray, the zemindar, was 17,199 rupees in arrears ; a situation owing to several causes, but chiefly to the inbe- cility of his own character. In the month of December, 1800, a very general insurrection broke out in the 286 THE PROVINCE [district of zemindary of Palamow, at the head of which was Booraun Singh, and a number of Cheroo leaders, who plundered and destroyed property belonging to the Raja and other land proprietors to a great amount ; and they, for their own protection, were obliged- to entertain a great many irregular foot soldiers. On the approach of ColonelJones with a detachment, the insurgents fled into Sirgoojah, and being there supported, so infested the division, that in 1801, it became necessary to march two battalions into Sirgoojah, for the purposes of enforcing adequate repa- ration for these outrages. On this expedition Colonel Jones was accompanied by the Palamow Raja, which involved him in great expense ; and in conse- quence of this alleviating circumstance, a great proportion of the arrears were then forgiven to the Raja by the Bengal government. In 1814, arrears having again accumulated to the amount of 55,700 rupees, owing to the incapacity of the Raja Chooramun Ray, and the refractory conduct of the disaffected Jaghiredars, (a species of permanent tenants,) this unfortunate pergunnah was brought to the hammer, and purchased by government for 51,000 rupees. The general regulations for the public dues and administration of justice, had before extended to this estate, in common with the other places dependent on the Bengal presidency ; but in consequence of the wild state of the country, consisting chiefly of hills and forests, and the rude manners of its inha- bitants, these regulations could not be said to have more than a nominal opera- tion in the interior. In fact, the realization of the revenue partook more of the nature of voluntary contributions, than of that active and punctual enforcement of the rights of government, which was practised in all the other old districts, and from which the landholders of Palamow had no peculiar claims to exemption. Besides these reasons, being a frontier station, it became of importance to vest the possession of the pergunnah in a person possessed of sufficient firmness to coerce the Jaghiredars, without oppressing them by illegal exactions or other severities. For the accomplishment of these purposes Raja Futteh Singh was selected, but he died in 1814, while the arrangement was under discussion, and at there- commendation of Captain Edward Roughscdge, then commanding the Ramghur Battalion, the rights of government were transferred to his son Raja Gunshaun Singh. In effecting this measure government made a considerable pecuniary sacrifice ; but the object proposed to be carried into execution were important ; as, besides rewarding a loyal and meritorious family, it provided for the internal management of the estate, for the realization of the revenue, and eventually for the general protection of a vulnerable frontier. It was at the same time deemed of primary moment, that the rights and immunities of the Jaghiredars should be maintained inviolate, for the furtherance of which object it was ordered that the HA MCI HI' r.] OF BAHAR. 287 amount of land-tax payable by each Jaghiredar respectively, should be endorsed on the back of the document which transferred the district to Raja Gunshaun Singh, in order to prevent future litigation and to give stability to the arrangement. Nor did the prior zemindar, Raja Chooramun Ray, sustain any real injury by the sale of his estate, he had long been a mere cipher in its management ; and nearly an ideot in understanding, dissolute, extravagant, and thoughtless, a character which unfortunately applies with tdo much justice to almost all the jungle zemindars. He was so indolent as wholly to abandon his station and respon- sibility, and was always ready to give a carte-blanche to any person who would undertake to supply him with 5 or 6 rupees daily for his personal expenses. This miserable chief of a distracted territory had no lineal heirs, and the collateral pretender was utterly unfjt for the vocation. The tenures of the Jaghiredars (a term borrowed by the Hindoos from the Mahommedans) in Palamow are rather of a singular description, and are said to be coeval with the establishment of the late zemindars family 22 years ago ; but there is no doubt that they were all originally removeable by the Rajas, who before the promulgation of the British code, exercised the power of life and death without curb or restraint, and the renewal of the sunnuds, or grants, at the suc- cession of each Raja, decides the discretional power to grant or withhold it. Like the rest of the Ramghur judicial division, Palamow is extremely thinly inhabited, and on account of the irregular and rocky nature of its surface, and the want of navigable rivers, will probably never attain any very numerous population. At present it does not contain any collection of habitations larger than an ordinary village. — (Public MS. Documents, Roughsedgc, Broughton, 8$c+) Palamow. — This village, from which the zemindary derives its name, stands in lat. 23° 50' N. long. 84° 8' E. 135 miles S. W. from Patna. Pachete (Packer). — A zemindary in the province of Bahar, at present mostly incorporated with the district of Ramghur. This large landed estate is bounded by Chuta Nagpoor and Ramghur, and in 1784 contained about 2779 square miles. It was once a frontier territory towards the western confines of Bengal, and still retains much of the sterility and barbarism of the neighbouring uncouth and mountainous region to the south. The unhealthiness of the climate has been proved by its destructive effects on the troops stationed at Jaulda. The principal towns are Pachete, Chatna, and Jaulda, which with the zemindary, were formerly held by a Rajpoot family named Narrain. The town of Pachete stands in lat. 23° 36' N. long. 86° 50' E. about 126 miles N. W. from Calcutta. Coal of a good quality has been found on this estate. — (J. Grant, fyc. §c.) Chatna. — A town in the Ramghur district. miles N. W. from Calcutta. Lat. 23° 2<y N. long. 87° E. 288 THE PROVINCE [district of Rogoxaltpoor. — A town in the Ramghur district, 130 miles N. W. from Calcutta. Lat. 23° 32' N. long. 86° 44' E. Chut a Nagpoor (Little Nagpoor). — This large zemindary is situated at the southern extremity of the province, and is now incorporated with the judicial division of Ramghur. It is bordered on the southern, eastern, and western quarters by the ancient Hindoo province of Gundwana, and was never completely subjugated by the Mahommedans, although the Rajas were reduced to the condition of tributaries by the Mogul viceroys of Bengal ; yet they were little interfered with so long as their contributions were punctually paid. This is an extensive hilly tract and much covered with wood, fostered with great care by the Rajas as a protection against invasion from without, and the nature of the country is such, as would render it very difficult and expensive either to penetrate or subdue, on account of the unhealthy jungles, so deleterious to troops not born on the spot. Like other hilly districts, Chuta Nagpoor contains the sources of many streams, but they do not swell to any considerable size until they quit its limits and reach the low grounds. Beneath the surface iron ore is found in abundance ; but this useful metal can be imported from Europe on such moderate terms, that its collection and fusion here present no encouragement to the specu- lator. The impervious jungles here conceal many strange tribes, who, even at this late period of Hindoo predominance, have not become converts to the Brah- minical doctrines, and are consequently classed by the priests among the abominable. The Khetauri, the Koeri, and the Dhanggar, are still the principal inhabitants of Chuta Nagpoor, where it is said that the latter, and probably also the former, do not speak the Hindi language. The Dhanggar are still impure, and probably unconverted or Mlechchas. The principal towns are Burwa and Maharajegunge. For many years subsequent to the British conquest, the Rajas of Chuta Nagpoor, of the Sahi family, assumed and exercised independent powers, the Bengal government having never investigated or determined the validity of their claims to such authority, they were consequently by the natives considered merely as tributaries, and of course entitled to independent jurisdiction within the limits of their own territories. Raja Deonauth Sahi would never allow that he was any further subordinate to the British government than as a tributary; indeed his political relations do not appear to have ever been clearly defined. He appears neither to have been recognized as a sort of independent chief, although a tributary ; nor as a zemindar holding lands liable to revenue. If the first, the provincial courts of justice had no right to question any of his acts, so long as he confined them to his own country ; if the second, he was amenable, like any other land-holder, to the regular process of the law, and of course liable to punishment RAMGHUR. ] OF BAHAR. 289 for contumacy. Prior to 1807, no decree of the Ramghur court of justice, disagreeable to the Nagpoor Raja, or rather to his dewan Dialnauth, had any effect within his district, unless backed by a detachment, and with such assist- ance the influence was merely temporary, until the troops had returned to their cantonments. In that year Raja Govindnaut Sahi Deo consented to the intro- duction of a systematic police into his country, and to enter into the usual engagements to render it efficient ; but it became perfectly evident during the negotiation that he had no intention of ever carrying it into execution. The authority of the British magistrate, consequently, within his zemindary, con- tinued merely nominal, and was obeyed or not, as the Raja and his cabinet felt disposed. When called on to assist in the apprehension of criminals, the person bearing the summons was usually subjected to personal chastisement, as an intruder into a territory where the British jurisdiction was not recognized. The late and present Rajas of Chuta Nagpoor have adhered with singular perseverance to the resolution of holding no personal intercourse, or communi- cation with the magistrates of the district, or with any of the public functionaries, preserving towards them, and all other Europeans, the most rigid invisibility. This preposterous determination they justified by a pretended vow, which they say the Raja who conquered the country ordered to be exacted from all his successors ; but the consequence has been that the lives and properties of his semi-barbarous subjects and their descendants, have always been at the mercy of an unprincipled dewan, or prime minister, who without any personal interest in the prosperity of the district, considers it his duty to withhold every informa- tion that is likely to interfere with his own usurped authority. This was practically experienced in 1803, when Colonel Broughton first endeavoured to penetrate through Chuta Nagpoor into Sumbhulpoor. On this occasion he was , furnished by the Marquis Wellesley with mandates, addressed to all the frontier zemindars, enjoining their zealous co-operation; but the Raja of Chuta Nagpoor was scarcely at the trouble to conceal his inclination to frustrate the expedition, and as a measure tending to effect this object, he made his dewan join the camp, with the view of preventing any well-disposed native from giving information, and to impede the advance of the detachment. The first native who joined and pointed out a practical road suddenly disappeared, and, notwithstanding a very active search, was never after heard of. In this manner the Raja, or rather his ministers, continuing to manifest the utmost contumacy, and a systematic resistance to the orders of government, a small force was at last, in 1809, marched into his country under the command of Captain E. Roughsedge, on the approach of which, the Raja, with a perturbation habitual to such recluses, quitted his capital, Maharajigunge, and fled into the VOL. I. P p • 290 THE PROVINCE [district of neighbouring jungles, where he endeavoured to persevere in his hereditary invi- sibility. Letters were dispatched to him by a private and confidential servant of his own, and also by two of his uncles ; but the infatuated chief resisted all persuasions for his return to Chuta Nagpoor, and withdrew further into the interior of Singhboom, where he remained so inaccessible, that when a letter was sent to him by a private messenger, the bearer was detained twenty miles distance from his actual residence for six days, and afterwards sent back with a reply, which, as all his servants had the unlimited use of his seal and signature, never could be established as genuine, nor could it be ascertained that the letter sent to him ever reached his hands. The object to be obtained by the employ- ment of this detachment, was the establishment of the authority of government over an immense estate, the proprietor of which, taking advantage of the impe- netrable nature of his country, had long contemned the supreme power, both with respect to the payment of his revenue, and in all questions connected with the support of the police and the administration of justice. Both these objects were attained, and the country brought under proper subordination, but of course with a great diminution of the Raja s personal authority, and the total annihilation of his minister s. For these severities, however, he was entirely indebted to the extreme folly of his measures, for prior to his misconduct, the Raja of Chuta Nagpoor probably possessed his zemindary on terms more advantageous than any other subject of the British government. In 1805 it was calculated, that from the tenants he realized 160,000 rupees per annum, while the land-tax he paid was only 13,000 rupees per annum. This sub-division of Bahar is designated by the term Chuta (little) to distinguish it from the other Nagpoor possessed by the Bhoonslah Maharatta family, and the name (Nagpoor) indicates that in the opinion of the natives the territory contains diamonds. — ( Roughsedge, Sealty, CoL Broughton, fyc. Burwa. — This town stands 240 miles W. N. W. from the city of Calcutta, and its vicinity, named Hazary Baugh, is usually the head quarters of the officer commanding the Ramghur provincial corps of sepoys. Lat. 23° 20' N. long. 84° 46' E. In 1801 the territories of Hurry Ram Sahy, the Raja of Burwa, were overrun and conquered by the neighbouring Raja of Sirgoojah, and not being supported by his immediate superior the Raja of Chuta Nagpoor, he was obliged to submit to the invader, whose troops kept possession several years, but retreated on learning the approach of a British detachment under Colonel Jones. Conceiving this a favourable opportunity, the Raja of Chuta Nagpoor determined to attempt RAMG H IR.] OF BAHAR. 291 its reconquest, but he stood not the least chance of success had not the British commander, and the magistrate of Ramghur, advised the Burwa chief to submit on the assurance of personal safety. He was in consequence induced to trust himself in the hands of the Raja's officers, who two days afterwards sent him under escort to Palcote, within a mile of which place he was taken out of his palanquin, and put to death in cold blood by the party guarding, who had been selected for this atrocious purpose. On this occasion no judicial inquiry was instituted, nor did it come to the knowledge of the Bengal government until 1807, so imperfectly was this portion of their dominions subdued, or even explored.— ( Roughsedge, $c.) Doessah. — A town in Chuta Nagpoor, 213 miles W. N. W. from Calcutta. Lat. 23° U N. long. 85° 16' E. Palcote (Palacata). — A small town in Chuta Nagpoor 220 miles W. by N. from Calcutta. Lat. 22° 58' N. long. 84° 40' E. Busseah. — A small town in Chuta Nagpoor, 210 miles, W. N. W. from Calcutta. Lat. 22° 5& N. long. 85° 1 1' E. p p2 THE PROVINCE OF ALLAHABAD. A large province of Hindostan Proper, situated between the 24th and 26th degrees of north latitude. To the north it is bounded by the provinces of Oude and Agra; to the south by the Hindoo province of Gundwana; on the east it has the provinces of Bahar and Gundwana; and on the west Malwah and Agra. In length it may be estimated at 270 miles by 120, the average breadth. By Abul Fazel, in 1582, this province is described as follows: " Soubah Allahabad is situated in the second climate. Its length, from Sunjowly Juanpoor to the southern provinces, is 160 coss, and the breadth from Chowsa Ferry to Gau- tumpoor includes 122 coss. To the east it has Bahar, on the north Oude, Baundhoo (Gundwana) lies on the south, and Agra on the west. The principal rivers of this soubah are the Ganges and Jumna; besides which are the Aruna, the Geyn, the Seroo, the Biruah, and several smaller ones. This soubah contains ten districts; viz. 1, Allahabad; 2, Ghazipoor; 3, Benares; 4, Juan- poor; 5, Manicpoor; 6, Chunar; 7, Bahtgorah ; 8, Callinger; 9, Korah; 10, Kurrah. These districts are subdivided into 177 pergunnahs; the revenue being 5,310,695 sicca rupees, and 1,200,000 betel nut leaves. It furnishes 11,375 cavalry, 237,870 infantry, and 323 elephants." During the reign of Aurengzebe, the arrangements of this province were new modelled; the division of Bhatta, or Baundhoo, which properly belongs to Gundwana, having been added to it. This territory was then considered as a new conquest, although long before partially subdued, and was subdivided into six lesser jurisdictions ; 1, Bhatta; 2, Sohagepoor; 3, Choteesghur, or Ruttun- poor; 4, Sumbhulpoor; 5, Gangpoor; and 6, Jushpoor, which were all formally annexed to Allahabad. With this addition of 25,000 square miles of a high mountainous unproductive country, Allahabad then comprehended 60,000 square miles ; but as the last mentioned tract was never thoroughly reduced to sub- jection, or occupied, it is much better in a geographical point of view that it were restored to the province of Gundwana, where in remote antiquity it com- posed part of the Gond state of Gurrah. In 1747, the existing subdivisions of this province were, 1, Allahabad; 2, Kurrah; 3, Korah; 4, Tarhar; 5, Manic- poor; 6, Benares; 7, Juanpoor; 8, Ghazipoor; 9, Chunar; 10, Callinjer; ll> ALLAHABAD. 293 Ahmedabad Gohrah; 12, Bhatta. At present the principal modern geographical and political subdivisions are the following : — 1. District of Allahabad, 5. The Rewah territory, 2. Benares, 6. District of Bundelcund, 3. District of Mirzapoor, 7. District of Caunpoor, 4. District of Juanpoor, 8. Manicpoor territory. The surface of this province adjacent to the rivers Ganges and Jumna is flat and very productive ; but to the south-west, in the Bundelcund territory, the country forms an elevated table land, diversified -with high hills, and abounding in strong holds. This portion of the province does not admit of such complete cultivation, but it contains within its limits the famous diamond mines of Pannah. Between these two divisions there is also a considerable difference of climate ; the former being extremely sultry, and subject to hot winds, from which the latter is exempted. The principal rivers in the north are the Ganges, Jumna, Goomty, and Caramnassa, besides many smaller streams, which supply an abundant moisture, and render several of the subdivisions, especially those of Benares and Allahabad, among the most fertile in Hindostan. In the hilly country to the south-west, the rivers are few, and smaller, the Kena and Goggra being the principal. The periodical rains and the water procured with consider- able labour from wells are consequently, in this quarter, chiefly relied on ; but upon the whole, Allahabad may be reckoned one of the most productive provinces of India. The exports from this country are diamonds, saltpetre, opium, sugar, indigo, cotton, cotton cloths, &c. ; the imports are various, salt from the maritime part& of Bengal being one of the principal articles in regular demand. Within the limits of the province are many large and celebrated towns, such as Benares, Allahabad, Callinjer, Chatterpoor, Juanpoor, Mirzapoor, Chunar, and Ghazi- poor. The total population is very considerable, and may be estimated to exceed seven millions in the proportion of one Mahommedan to eight Hindoos. In the remote times of Hindoo antiquity, this province must have held a high rank, as it contains the Chief Prayaga (Allahabad) and Benares, two of the holiest places of Brahminical pilgrimage, and the latter occupying in Hindostan the station which three centuries back Rome did in Christendom. At present the whole of this extensive province is comprehended within the limits of the British jurisdiction, and governed with a few modifications by the Bengal code of regulations, with the exception of a small portion of the Bundelcund division, which is held by petty native chiefs under British protection. We learn from Abul Fazel, that the territory composing the modern province of Allahabad was invaded so early as A. D. 1020, by Sultan Mahmood of Ghizni, 294 THE PROVINCE [rivers. who made a few compulsory converts to the Mahommedan faith. He returned again in 1023, but made no permanent establishment. It was afterwards wholly subdued by the Patan emperors of Delhi, and during the 15th century formed the basis of an independent kingdom, the capital of which was Juanpoor. Along with the other Patan conquests it devolved to the Moguls, and was formed into a distinct soubah by the Emperor Acber, who new named the Hindoo Sanctuary (or Prayaga) Allahabad, an appellation it still retains. After the fall of the Mogul dynasty, the northern quarter was appropriated by the Nabobs of Oude ; but in 1764, Korah and Allahabad were ceded to Shah Allum, the then nominal and fugitive sovereign of Delhi, through the interference of Lord Clive, with Shuja ud Dowlah, the Nabob of Oude. In 1772, they reverted to the latter, when that ill advised monarch of his own accord returned to Delhi, and became an engine of mischief in the custody of the Maharattas. The Bengal government acquired the Benares districts by treaty with Asoph ud Dowlah, in 1775, and Allahabad and the adjacent territories in 1801, by cession from Saadet Ali, his successor on the throne of Oude. The south eastern districts were received from the Maharatta Peshwa in 1803, in exchange for an equivalent tract in the Carnatic above the ghauts and Gujerat. — (Abut Fazel, J, Grant, 5th Report, Ironside, Sjp w ) Jumna River ( Yamuna).— This river has its source on the south-west side of the great Himalaya range, near the lofty peak of Jumoutri, estimated at 25,000 feet above the level of the sea. In April, 1817, when visited by Captain Hodgson, the snow at Jumoutri, which covered and concealed the stream of the Jumna, was 60 yards wide, and bounded on the right and left by mural precipices of granite. This mass of snow had fallen from the heights above, and when measured by a plumb line let down through one of the holes caused by the stream of a boiling spring, was found to be 40 feet thick. The mean latitude of these hot springs is 30° 58' N. from whence the Jumna flows south through the province of Gurwal, where at Kalsee Ghaut it is joined by the Tonse, which, at the point of junction, is the largest of the two. In this part of its course, it runs nearly parallel with the Ganges, and at the village of Guradwar, where they are only 40 miles distant, it has as broad a stream.
| 3,845 |
https://github.com/marcopinheiro/PI-Web-API-Client-Java-Android/blob/master/src/main/java/com/osisoft/pidevclub/piwebapi/api/DataServerApi.java
|
Github Open Source
|
Open Source
|
Apache-2.0
| 2,018 |
PI-Web-API-Client-Java-Android
|
marcopinheiro
|
Java
|
Code
| 3,217 | 11,146 |
/*
*
* Copyright 2018 OSIsoft, LLC
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
* You may obtain a copy of the License at
*
* <http://www.apache.org/licenses/LICENSE-2.0>
*
* Unless required by applicable law or agreed to in writing, software
* distributed under the License is distributed on an "AS IS" BASIS,
* WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
* See the License for the specific language governing permissions and
* limitations under the License.
*
*/
package com.osisoft.pidevclub.piwebapi.api;
import com.osisoft.pidevclub.piwebapi.ApiCallback;
import com.osisoft.pidevclub.piwebapi.ApiClient;
import com.osisoft.pidevclub.piwebapi.ApiException;
import com.osisoft.pidevclub.piwebapi.ApiResponse;
import com.osisoft.pidevclub.piwebapi.Configuration;
import com.osisoft.pidevclub.piwebapi.Pair;
import com.osisoft.pidevclub.piwebapi.ProgressRequestBody;
import com.osisoft.pidevclub.piwebapi.ProgressResponseBody;
import com.osisoft.pidevclub.piwebapi.models.*;
import com.google.gson.reflect.TypeToken;
import java.io.IOException;
import java.lang.reflect.Type;
import java.util.ArrayList;
import java.util.HashMap;
import java.util.List;
import java.util.Map;
public class DataServerApi {
private ApiClient apiClient;
public DataServerApi(ApiClient apiClient){
this.apiClient = apiClient;
}
public ApiClient getApiClient() {
return apiClient;
}
public void setApiClient(ApiClient apiClient) {
this.apiClient = apiClient;
}
/**
* Retrieve a list of Data Servers known to this service.
*
*/
public PIItemsDataServer list(String selectedFields, String webIdType) throws ApiException {
ApiResponse<PIItemsDataServer> resp = listWithHttpInfo(selectedFields, webIdType);
return resp.getData();
}
/**
* Retrieve a list of Data Servers known to this service. (with HTTP information)
*
*/
public ApiResponse<PIItemsDataServer> listWithHttpInfo(String selectedFields, String webIdType) throws ApiException {
okhttp3.Call call = listCall(selectedFields, webIdType,null,null);
Type localVarReturnType = new TypeToken<PIItemsDataServer>(){}.getType();
return apiClient.execute(call, localVarReturnType);
}
/**
* Retrieve a list of Data Servers known to this service. (asynchronously)
*
*/
public okhttp3.Call listAsync(String selectedFields, String webIdType, final ApiCallback<PIItemsDataServer> callback) throws ApiException {
ProgressResponseBody.ProgressListener progressListener = null;
ProgressRequestBody.ProgressRequestListener progressRequestListener = null;
if (callback != null)
{
progressListener = new ProgressResponseBody.ProgressListener() {
@Override
public void update(long bytesRead, long contentLength, boolean done)
{
callback.onDownloadProgress(bytesRead, contentLength, done);
}
};
progressRequestListener = new ProgressRequestBody.ProgressRequestListener() {
@Override
public void onRequestProgress(long bytesWritten, long contentLength, boolean done)
{
callback.onUploadProgress(bytesWritten, contentLength, done);
}
};
}
okhttp3.Call call = listCall(selectedFields, webIdType, progressListener, progressRequestListener);
apiClient.executeAsync(call, callback);
return call;
}
private okhttp3.Call listCall(String selectedFields, String webIdType, final ProgressResponseBody.ProgressListener progressListener, final ProgressRequestBody.ProgressRequestListener progressRequestListener) throws ApiException {
Object localVarPostBody = null;
String localVarPath = "/dataservers";
Map<String, String> localVarHeaderParams = new HashMap<String, String>();
Map<String, Object> localVarFormParams = new HashMap<String, Object>();
List<Pair> localVarQueryParams = new ArrayList<Pair>();
final String[] localVarAccepts = {"application/json", "text/json", "text/html", "application/x-ms-application"};
final String localVarAccept = apiClient.selectHeaderAccept(localVarAccepts);
if (localVarAccept != null) localVarHeaderParams.put("Accept", localVarAccept);
final String[] localVarContentTypes = {"application/json", "text/json" };
final String localVarContentType = apiClient.selectHeaderContentType(localVarContentTypes);
localVarHeaderParams.put("Content-Type", localVarContentType);
if (selectedFields != null)
localVarQueryParams.addAll(apiClient.parameterToPairs("multi", "selectedFields", selectedFields));
if (webIdType != null)
localVarQueryParams.addAll(apiClient.parameterToPairs("multi", "webIdType", webIdType));
if (progressListener != null)
{
apiClient.getHttpClient().networkInterceptors().add(new okhttp3.Interceptor() {
@Override
public okhttp3.Response intercept(okhttp3.Interceptor.Chain chain) throws IOException {
okhttp3.Response originalResponse = chain.proceed(chain.request());
return originalResponse.newBuilder()
.body(new ProgressResponseBody(originalResponse.body(), progressListener))
.build();
}
});
}
String[] localVarAuthNames = new String[] {"Basic" };
return apiClient.buildCall(localVarPath, "GET", localVarQueryParams, localVarPostBody, localVarHeaderParams, localVarFormParams, localVarAuthNames, progressRequestListener);
}
/**
* Retrieve a Data Server by name.
*
*/
public PIDataServer getByName(String name, String selectedFields, String webIdType) throws ApiException {
ApiResponse<PIDataServer> resp = getByNameWithHttpInfo(name, selectedFields, webIdType);
return resp.getData();
}
/**
* Retrieve a Data Server by name. (with HTTP information)
*
*/
public ApiResponse<PIDataServer> getByNameWithHttpInfo(String name, String selectedFields, String webIdType) throws ApiException {
okhttp3.Call call = getByNameCall(name, selectedFields, webIdType,null,null);
Type localVarReturnType = new TypeToken<PIDataServer>(){}.getType();
return apiClient.execute(call, localVarReturnType);
}
/**
* Retrieve a Data Server by name. (asynchronously)
*
*/
public okhttp3.Call getByNameAsync(String name, String selectedFields, String webIdType, final ApiCallback<PIDataServer> callback) throws ApiException {
ProgressResponseBody.ProgressListener progressListener = null;
ProgressRequestBody.ProgressRequestListener progressRequestListener = null;
if (callback != null)
{
progressListener = new ProgressResponseBody.ProgressListener() {
@Override
public void update(long bytesRead, long contentLength, boolean done)
{
callback.onDownloadProgress(bytesRead, contentLength, done);
}
};
progressRequestListener = new ProgressRequestBody.ProgressRequestListener() {
@Override
public void onRequestProgress(long bytesWritten, long contentLength, boolean done)
{
callback.onUploadProgress(bytesWritten, contentLength, done);
}
};
}
okhttp3.Call call = getByNameCall(name, selectedFields, webIdType, progressListener, progressRequestListener);
apiClient.executeAsync(call, callback);
return call;
}
private okhttp3.Call getByNameCall(String name, String selectedFields, String webIdType, final ProgressResponseBody.ProgressListener progressListener, final ProgressRequestBody.ProgressRequestListener progressRequestListener) throws ApiException {
Object localVarPostBody = null;
// verify the required parameter 'name' is set
if (name == null)
throw new ApiException("Missing required parameter 'name'");
String localVarPath = "/dataservers";
Map<String, String> localVarHeaderParams = new HashMap<String, String>();
Map<String, Object> localVarFormParams = new HashMap<String, Object>();
List<Pair> localVarQueryParams = new ArrayList<Pair>();
final String[] localVarAccepts = {"application/json", "text/json", "text/html", "application/x-ms-application"};
final String localVarAccept = apiClient.selectHeaderAccept(localVarAccepts);
if (localVarAccept != null) localVarHeaderParams.put("Accept", localVarAccept);
final String[] localVarContentTypes = {"application/json", "text/json" };
final String localVarContentType = apiClient.selectHeaderContentType(localVarContentTypes);
localVarHeaderParams.put("Content-Type", localVarContentType);
if (name != null)
localVarQueryParams.addAll(apiClient.parameterToPairs("multi", "name", name));
if (selectedFields != null)
localVarQueryParams.addAll(apiClient.parameterToPairs("multi", "selectedFields", selectedFields));
if (webIdType != null)
localVarQueryParams.addAll(apiClient.parameterToPairs("multi", "webIdType", webIdType));
if (progressListener != null)
{
apiClient.getHttpClient().networkInterceptors().add(new okhttp3.Interceptor() {
@Override
public okhttp3.Response intercept(okhttp3.Interceptor.Chain chain) throws IOException {
okhttp3.Response originalResponse = chain.proceed(chain.request());
return originalResponse.newBuilder()
.body(new ProgressResponseBody(originalResponse.body(), progressListener))
.build();
}
});
}
String[] localVarAuthNames = new String[] {"Basic" };
return apiClient.buildCall(localVarPath, "GET", localVarQueryParams, localVarPostBody, localVarHeaderParams, localVarFormParams, localVarAuthNames, progressRequestListener);
}
/**
* Retrieve a Data Server by path.
*
*/
public PIDataServer getByPath(String path, String selectedFields, String webIdType) throws ApiException {
ApiResponse<PIDataServer> resp = getByPathWithHttpInfo(path, selectedFields, webIdType);
return resp.getData();
}
/**
* Retrieve a Data Server by path. (with HTTP information)
*
*/
public ApiResponse<PIDataServer> getByPathWithHttpInfo(String path, String selectedFields, String webIdType) throws ApiException {
okhttp3.Call call = getByPathCall(path, selectedFields, webIdType,null,null);
Type localVarReturnType = new TypeToken<PIDataServer>(){}.getType();
return apiClient.execute(call, localVarReturnType);
}
/**
* Retrieve a Data Server by path. (asynchronously)
*
*/
public okhttp3.Call getByPathAsync(String path, String selectedFields, String webIdType, final ApiCallback<PIDataServer> callback) throws ApiException {
ProgressResponseBody.ProgressListener progressListener = null;
ProgressRequestBody.ProgressRequestListener progressRequestListener = null;
if (callback != null)
{
progressListener = new ProgressResponseBody.ProgressListener() {
@Override
public void update(long bytesRead, long contentLength, boolean done)
{
callback.onDownloadProgress(bytesRead, contentLength, done);
}
};
progressRequestListener = new ProgressRequestBody.ProgressRequestListener() {
@Override
public void onRequestProgress(long bytesWritten, long contentLength, boolean done)
{
callback.onUploadProgress(bytesWritten, contentLength, done);
}
};
}
okhttp3.Call call = getByPathCall(path, selectedFields, webIdType, progressListener, progressRequestListener);
apiClient.executeAsync(call, callback);
return call;
}
private okhttp3.Call getByPathCall(String path, String selectedFields, String webIdType, final ProgressResponseBody.ProgressListener progressListener, final ProgressRequestBody.ProgressRequestListener progressRequestListener) throws ApiException {
Object localVarPostBody = null;
// verify the required parameter 'path' is set
if (path == null)
throw new ApiException("Missing required parameter 'path'");
String localVarPath = "/dataservers";
Map<String, String> localVarHeaderParams = new HashMap<String, String>();
Map<String, Object> localVarFormParams = new HashMap<String, Object>();
List<Pair> localVarQueryParams = new ArrayList<Pair>();
final String[] localVarAccepts = {"application/json", "text/json", "text/html", "application/x-ms-application"};
final String localVarAccept = apiClient.selectHeaderAccept(localVarAccepts);
if (localVarAccept != null) localVarHeaderParams.put("Accept", localVarAccept);
final String[] localVarContentTypes = {"application/json", "text/json" };
final String localVarContentType = apiClient.selectHeaderContentType(localVarContentTypes);
localVarHeaderParams.put("Content-Type", localVarContentType);
if (path != null)
localVarQueryParams.addAll(apiClient.parameterToPairs("multi", "path", path));
if (selectedFields != null)
localVarQueryParams.addAll(apiClient.parameterToPairs("multi", "selectedFields", selectedFields));
if (webIdType != null)
localVarQueryParams.addAll(apiClient.parameterToPairs("multi", "webIdType", webIdType));
if (progressListener != null)
{
apiClient.getHttpClient().networkInterceptors().add(new okhttp3.Interceptor() {
@Override
public okhttp3.Response intercept(okhttp3.Interceptor.Chain chain) throws IOException {
okhttp3.Response originalResponse = chain.proceed(chain.request());
return originalResponse.newBuilder()
.body(new ProgressResponseBody(originalResponse.body(), progressListener))
.build();
}
});
}
String[] localVarAuthNames = new String[] {"Basic" };
return apiClient.buildCall(localVarPath, "GET", localVarQueryParams, localVarPostBody, localVarHeaderParams, localVarFormParams, localVarAuthNames, progressRequestListener);
}
/**
* Retrieve a Data Server.
*
*/
public PIDataServer get(String webId, String selectedFields, String webIdType) throws ApiException {
ApiResponse<PIDataServer> resp = getWithHttpInfo(webId, selectedFields, webIdType);
return resp.getData();
}
/**
* Retrieve a Data Server. (with HTTP information)
*
*/
public ApiResponse<PIDataServer> getWithHttpInfo(String webId, String selectedFields, String webIdType) throws ApiException {
okhttp3.Call call = getCall(webId, selectedFields, webIdType,null,null);
Type localVarReturnType = new TypeToken<PIDataServer>(){}.getType();
return apiClient.execute(call, localVarReturnType);
}
/**
* Retrieve a Data Server. (asynchronously)
*
*/
public okhttp3.Call getAsync(String webId, String selectedFields, String webIdType, final ApiCallback<PIDataServer> callback) throws ApiException {
ProgressResponseBody.ProgressListener progressListener = null;
ProgressRequestBody.ProgressRequestListener progressRequestListener = null;
if (callback != null)
{
progressListener = new ProgressResponseBody.ProgressListener() {
@Override
public void update(long bytesRead, long contentLength, boolean done)
{
callback.onDownloadProgress(bytesRead, contentLength, done);
}
};
progressRequestListener = new ProgressRequestBody.ProgressRequestListener() {
@Override
public void onRequestProgress(long bytesWritten, long contentLength, boolean done)
{
callback.onUploadProgress(bytesWritten, contentLength, done);
}
};
}
okhttp3.Call call = getCall(webId, selectedFields, webIdType, progressListener, progressRequestListener);
apiClient.executeAsync(call, callback);
return call;
}
private okhttp3.Call getCall(String webId, String selectedFields, String webIdType, final ProgressResponseBody.ProgressListener progressListener, final ProgressRequestBody.ProgressRequestListener progressRequestListener) throws ApiException {
Object localVarPostBody = null;
// verify the required parameter 'webId' is set
if (webId == null)
throw new ApiException("Missing required parameter 'webId'");
String localVarPath = "/dataservers/{webId}";
Map<String, String> localVarHeaderParams = new HashMap<String, String>();
Map<String, Object> localVarFormParams = new HashMap<String, Object>();
List<Pair> localVarQueryParams = new ArrayList<Pair>();
final String[] localVarAccepts = {"application/json", "text/json", "text/html", "application/x-ms-application"};
final String localVarAccept = apiClient.selectHeaderAccept(localVarAccepts);
if (localVarAccept != null) localVarHeaderParams.put("Accept", localVarAccept);
final String[] localVarContentTypes = {"application/json", "text/json" };
final String localVarContentType = apiClient.selectHeaderContentType(localVarContentTypes);
localVarHeaderParams.put("Content-Type", localVarContentType);
localVarPath = localVarPath.replaceAll("\\{webId\\}", apiClient.escapeString(webId.toString()));
if (selectedFields != null)
localVarQueryParams.addAll(apiClient.parameterToPairs("multi", "selectedFields", selectedFields));
if (webIdType != null)
localVarQueryParams.addAll(apiClient.parameterToPairs("multi", "webIdType", webIdType));
if (progressListener != null)
{
apiClient.getHttpClient().networkInterceptors().add(new okhttp3.Interceptor() {
@Override
public okhttp3.Response intercept(okhttp3.Interceptor.Chain chain) throws IOException {
okhttp3.Response originalResponse = chain.proceed(chain.request());
return originalResponse.newBuilder()
.body(new ProgressResponseBody(originalResponse.body(), progressListener))
.build();
}
});
}
String[] localVarAuthNames = new String[] {"Basic" };
return apiClient.buildCall(localVarPath, "GET", localVarQueryParams, localVarPostBody, localVarHeaderParams, localVarFormParams, localVarAuthNames, progressRequestListener);
}
/**
* Retrieve enumeration sets for given Data Server.
*
*/
public PIItemsEnumerationSet getEnumerationSets(String webId, String selectedFields, String webIdType) throws ApiException {
ApiResponse<PIItemsEnumerationSet> resp = getEnumerationSetsWithHttpInfo(webId, selectedFields, webIdType);
return resp.getData();
}
/**
* Retrieve enumeration sets for given Data Server. (with HTTP information)
*
*/
public ApiResponse<PIItemsEnumerationSet> getEnumerationSetsWithHttpInfo(String webId, String selectedFields, String webIdType) throws ApiException {
okhttp3.Call call = getEnumerationSetsCall(webId, selectedFields, webIdType,null,null);
Type localVarReturnType = new TypeToken<PIItemsEnumerationSet>(){}.getType();
return apiClient.execute(call, localVarReturnType);
}
/**
* Retrieve enumeration sets for given Data Server. (asynchronously)
*
*/
public okhttp3.Call getEnumerationSetsAsync(String webId, String selectedFields, String webIdType, final ApiCallback<PIItemsEnumerationSet> callback) throws ApiException {
ProgressResponseBody.ProgressListener progressListener = null;
ProgressRequestBody.ProgressRequestListener progressRequestListener = null;
if (callback != null)
{
progressListener = new ProgressResponseBody.ProgressListener() {
@Override
public void update(long bytesRead, long contentLength, boolean done)
{
callback.onDownloadProgress(bytesRead, contentLength, done);
}
};
progressRequestListener = new ProgressRequestBody.ProgressRequestListener() {
@Override
public void onRequestProgress(long bytesWritten, long contentLength, boolean done)
{
callback.onUploadProgress(bytesWritten, contentLength, done);
}
};
}
okhttp3.Call call = getEnumerationSetsCall(webId, selectedFields, webIdType, progressListener, progressRequestListener);
apiClient.executeAsync(call, callback);
return call;
}
private okhttp3.Call getEnumerationSetsCall(String webId, String selectedFields, String webIdType, final ProgressResponseBody.ProgressListener progressListener, final ProgressRequestBody.ProgressRequestListener progressRequestListener) throws ApiException {
Object localVarPostBody = null;
// verify the required parameter 'webId' is set
if (webId == null)
throw new ApiException("Missing required parameter 'webId'");
String localVarPath = "/dataservers/{webId}/enumerationsets";
Map<String, String> localVarHeaderParams = new HashMap<String, String>();
Map<String, Object> localVarFormParams = new HashMap<String, Object>();
List<Pair> localVarQueryParams = new ArrayList<Pair>();
final String[] localVarAccepts = {"application/json", "text/json", "text/html", "application/x-ms-application"};
final String localVarAccept = apiClient.selectHeaderAccept(localVarAccepts);
if (localVarAccept != null) localVarHeaderParams.put("Accept", localVarAccept);
final String[] localVarContentTypes = {"application/json", "text/json" };
final String localVarContentType = apiClient.selectHeaderContentType(localVarContentTypes);
localVarHeaderParams.put("Content-Type", localVarContentType);
localVarPath = localVarPath.replaceAll("\\{webId\\}", apiClient.escapeString(webId.toString()));
if (selectedFields != null)
localVarQueryParams.addAll(apiClient.parameterToPairs("multi", "selectedFields", selectedFields));
if (webIdType != null)
localVarQueryParams.addAll(apiClient.parameterToPairs("multi", "webIdType", webIdType));
if (progressListener != null)
{
apiClient.getHttpClient().networkInterceptors().add(new okhttp3.Interceptor() {
@Override
public okhttp3.Response intercept(okhttp3.Interceptor.Chain chain) throws IOException {
okhttp3.Response originalResponse = chain.proceed(chain.request());
return originalResponse.newBuilder()
.body(new ProgressResponseBody(originalResponse.body(), progressListener))
.build();
}
});
}
String[] localVarAuthNames = new String[] {"Basic" };
return apiClient.buildCall(localVarPath, "GET", localVarQueryParams, localVarPostBody, localVarHeaderParams, localVarFormParams, localVarAuthNames, progressRequestListener);
}
/**
* Create an enumeration set on the Data Server.
*
*/
public void createEnumerationSet(String webId, PIEnumerationSet enumerationSet, String webIdType) throws ApiException {
createEnumerationSetWithHttpInfo(webId, enumerationSet, webIdType);
}
/**
* Create an enumeration set on the Data Server. (with HTTP information)
*
*/
public ApiResponse<Void> createEnumerationSetWithHttpInfo(String webId, PIEnumerationSet enumerationSet, String webIdType) throws ApiException {
okhttp3.Call call = createEnumerationSetCall(webId, enumerationSet, webIdType,null,null);
return apiClient.execute(call);
}
/**
* Create an enumeration set on the Data Server. (asynchronously)
*
*/
public okhttp3.Call createEnumerationSetAsync(String webId, PIEnumerationSet enumerationSet, String webIdType, final ApiCallback<Void> callback) throws ApiException {
ProgressResponseBody.ProgressListener progressListener = null;
ProgressRequestBody.ProgressRequestListener progressRequestListener = null;
if (callback != null)
{
progressListener = new ProgressResponseBody.ProgressListener() {
@Override
public void update(long bytesRead, long contentLength, boolean done)
{
callback.onDownloadProgress(bytesRead, contentLength, done);
}
};
progressRequestListener = new ProgressRequestBody.ProgressRequestListener() {
@Override
public void onRequestProgress(long bytesWritten, long contentLength, boolean done)
{
callback.onUploadProgress(bytesWritten, contentLength, done);
}
};
}
okhttp3.Call call = createEnumerationSetCall(webId, enumerationSet, webIdType, progressListener, progressRequestListener);
apiClient.executeAsync(call, callback);
return call;
}
private okhttp3.Call createEnumerationSetCall(String webId, PIEnumerationSet enumerationSet, String webIdType, final ProgressResponseBody.ProgressListener progressListener, final ProgressRequestBody.ProgressRequestListener progressRequestListener) throws ApiException {
Object localVarPostBody = null;
// verify the required parameter 'webId' is set
if (webId == null)
throw new ApiException("Missing required parameter 'webId'");
// verify the required parameter 'enumerationSet' is set
if (enumerationSet == null)
throw new ApiException("Missing required parameter 'enumerationSet'");
String localVarPath = "/dataservers/{webId}/enumerationsets";
Map<String, String> localVarHeaderParams = new HashMap<String, String>();
Map<String, Object> localVarFormParams = new HashMap<String, Object>();
List<Pair> localVarQueryParams = new ArrayList<Pair>();
final String[] localVarAccepts = {"application/json", "text/json", "text/html", "application/x-ms-application"};
final String localVarAccept = apiClient.selectHeaderAccept(localVarAccepts);
if (localVarAccept != null) localVarHeaderParams.put("Accept", localVarAccept);
final String[] localVarContentTypes = {"application/json", "text/json" };
final String localVarContentType = apiClient.selectHeaderContentType(localVarContentTypes);
localVarHeaderParams.put("Content-Type", localVarContentType);
localVarPath = localVarPath.replaceAll("\\{webId\\}", apiClient.escapeString(webId.toString()));
localVarPostBody = enumerationSet;
if (webIdType != null)
localVarQueryParams.addAll(apiClient.parameterToPairs("multi", "webIdType", webIdType));
if (progressListener != null)
{
apiClient.getHttpClient().networkInterceptors().add(new okhttp3.Interceptor() {
@Override
public okhttp3.Response intercept(okhttp3.Interceptor.Chain chain) throws IOException {
okhttp3.Response originalResponse = chain.proceed(chain.request());
return originalResponse.newBuilder()
.body(new ProgressResponseBody(originalResponse.body(), progressListener))
.build();
}
});
}
String[] localVarAuthNames = new String[] {"Basic" };
return apiClient.buildCall(localVarPath, "POST", localVarQueryParams, localVarPostBody, localVarHeaderParams, localVarFormParams, localVarAuthNames, progressRequestListener);
}
/**
* Retrieves the specified license for the given Data Server. The fields of the response object are string representations of the numerical values reported by the Data Server, with "Infinity" representing a license field with no limit.
*
*/
public PIDataServerLicense getLicense(String webId, String module, String selectedFields, String webIdType) throws ApiException {
ApiResponse<PIDataServerLicense> resp = getLicenseWithHttpInfo(webId, module, selectedFields, webIdType);
return resp.getData();
}
/**
* Retrieves the specified license for the given Data Server. The fields of the response object are string representations of the numerical values reported by the Data Server, with "Infinity" representing a license field with no limit. (with HTTP information)
*
*/
public ApiResponse<PIDataServerLicense> getLicenseWithHttpInfo(String webId, String module, String selectedFields, String webIdType) throws ApiException {
okhttp3.Call call = getLicenseCall(webId, module, selectedFields, webIdType,null,null);
Type localVarReturnType = new TypeToken<PIDataServerLicense>(){}.getType();
return apiClient.execute(call, localVarReturnType);
}
/**
* Retrieves the specified license for the given Data Server. The fields of the response object are string representations of the numerical values reported by the Data Server, with "Infinity" representing a license field with no limit. (asynchronously)
*
*/
public okhttp3.Call getLicenseAsync(String webId, String module, String selectedFields, String webIdType, final ApiCallback<PIDataServerLicense> callback) throws ApiException {
ProgressResponseBody.ProgressListener progressListener = null;
ProgressRequestBody.ProgressRequestListener progressRequestListener = null;
if (callback != null)
{
progressListener = new ProgressResponseBody.ProgressListener() {
@Override
public void update(long bytesRead, long contentLength, boolean done)
{
callback.onDownloadProgress(bytesRead, contentLength, done);
}
};
progressRequestListener = new ProgressRequestBody.ProgressRequestListener() {
@Override
public void onRequestProgress(long bytesWritten, long contentLength, boolean done)
{
callback.onUploadProgress(bytesWritten, contentLength, done);
}
};
}
okhttp3.Call call = getLicenseCall(webId, module, selectedFields, webIdType, progressListener, progressRequestListener);
apiClient.executeAsync(call, callback);
return call;
}
private okhttp3.Call getLicenseCall(String webId, String module, String selectedFields, String webIdType, final ProgressResponseBody.ProgressListener progressListener, final ProgressRequestBody.ProgressRequestListener progressRequestListener) throws ApiException {
Object localVarPostBody = null;
// verify the required parameter 'webId' is set
if (webId == null)
throw new ApiException("Missing required parameter 'webId'");
String localVarPath = "/dataservers/{webId}/license";
Map<String, String> localVarHeaderParams = new HashMap<String, String>();
Map<String, Object> localVarFormParams = new HashMap<String, Object>();
List<Pair> localVarQueryParams = new ArrayList<Pair>();
final String[] localVarAccepts = {"application/json", "text/json", "text/html", "application/x-ms-application"};
final String localVarAccept = apiClient.selectHeaderAccept(localVarAccepts);
if (localVarAccept != null) localVarHeaderParams.put("Accept", localVarAccept);
final String[] localVarContentTypes = {"application/json", "text/json" };
final String localVarContentType = apiClient.selectHeaderContentType(localVarContentTypes);
localVarHeaderParams.put("Content-Type", localVarContentType);
localVarPath = localVarPath.replaceAll("\\{webId\\}", apiClient.escapeString(webId.toString()));
if (module != null)
localVarQueryParams.addAll(apiClient.parameterToPairs("multi", "module", module));
if (selectedFields != null)
localVarQueryParams.addAll(apiClient.parameterToPairs("multi", "selectedFields", selectedFields));
if (webIdType != null)
localVarQueryParams.addAll(apiClient.parameterToPairs("multi", "webIdType", webIdType));
if (progressListener != null)
{
apiClient.getHttpClient().networkInterceptors().add(new okhttp3.Interceptor() {
@Override
public okhttp3.Response intercept(okhttp3.Interceptor.Chain chain) throws IOException {
okhttp3.Response originalResponse = chain.proceed(chain.request());
return originalResponse.newBuilder()
.body(new ProgressResponseBody(originalResponse.body(), progressListener))
.build();
}
});
}
String[] localVarAuthNames = new String[] {"Basic" };
return apiClient.buildCall(localVarPath, "GET", localVarQueryParams, localVarPostBody, localVarHeaderParams, localVarFormParams, localVarAuthNames, progressRequestListener);
}
/**
* Retrieve a list of points on a specified Data Server.
*
*/
public PIItemsPoint getPoints(String webId, Integer maxCount, String nameFilter, String selectedFields, Integer startIndex, String webIdType) throws ApiException {
ApiResponse<PIItemsPoint> resp = getPointsWithHttpInfo(webId, maxCount, nameFilter, selectedFields, startIndex, webIdType);
return resp.getData();
}
/**
* Retrieve a list of points on a specified Data Server. (with HTTP information)
*
*/
public ApiResponse<PIItemsPoint> getPointsWithHttpInfo(String webId, Integer maxCount, String nameFilter, String selectedFields, Integer startIndex, String webIdType) throws ApiException {
okhttp3.Call call = getPointsCall(webId, maxCount, nameFilter, selectedFields, startIndex, webIdType,null,null);
Type localVarReturnType = new TypeToken<PIItemsPoint>(){}.getType();
return apiClient.execute(call, localVarReturnType);
}
/**
* Retrieve a list of points on a specified Data Server. (asynchronously)
*
*/
public okhttp3.Call getPointsAsync(String webId, Integer maxCount, String nameFilter, String selectedFields, Integer startIndex, String webIdType, final ApiCallback<PIItemsPoint> callback) throws ApiException {
ProgressResponseBody.ProgressListener progressListener = null;
ProgressRequestBody.ProgressRequestListener progressRequestListener = null;
if (callback != null)
{
progressListener = new ProgressResponseBody.ProgressListener() {
@Override
public void update(long bytesRead, long contentLength, boolean done)
{
callback.onDownloadProgress(bytesRead, contentLength, done);
}
};
progressRequestListener = new ProgressRequestBody.ProgressRequestListener() {
@Override
public void onRequestProgress(long bytesWritten, long contentLength, boolean done)
{
callback.onUploadProgress(bytesWritten, contentLength, done);
}
};
}
okhttp3.Call call = getPointsCall(webId, maxCount, nameFilter, selectedFields, startIndex, webIdType, progressListener, progressRequestListener);
apiClient.executeAsync(call, callback);
return call;
}
private okhttp3.Call getPointsCall(String webId, Integer maxCount, String nameFilter, String selectedFields, Integer startIndex, String webIdType, final ProgressResponseBody.ProgressListener progressListener, final ProgressRequestBody.ProgressRequestListener progressRequestListener) throws ApiException {
Object localVarPostBody = null;
// verify the required parameter 'webId' is set
if (webId == null)
throw new ApiException("Missing required parameter 'webId'");
String localVarPath = "/dataservers/{webId}/points";
Map<String, String> localVarHeaderParams = new HashMap<String, String>();
Map<String, Object> localVarFormParams = new HashMap<String, Object>();
List<Pair> localVarQueryParams = new ArrayList<Pair>();
final String[] localVarAccepts = {"application/json", "text/json", "text/html", "application/x-ms-application"};
final String localVarAccept = apiClient.selectHeaderAccept(localVarAccepts);
if (localVarAccept != null) localVarHeaderParams.put("Accept", localVarAccept);
final String[] localVarContentTypes = {"application/json", "text/json" };
final String localVarContentType = apiClient.selectHeaderContentType(localVarContentTypes);
localVarHeaderParams.put("Content-Type", localVarContentType);
localVarPath = localVarPath.replaceAll("\\{webId\\}", apiClient.escapeString(webId.toString()));
if (maxCount != null)
localVarQueryParams.addAll(apiClient.parameterToPairs("multi", "maxCount", maxCount));
if (nameFilter != null)
localVarQueryParams.addAll(apiClient.parameterToPairs("multi", "nameFilter", nameFilter));
if (selectedFields != null)
localVarQueryParams.addAll(apiClient.parameterToPairs("multi", "selectedFields", selectedFields));
if (startIndex != null)
localVarQueryParams.addAll(apiClient.parameterToPairs("multi", "startIndex", startIndex));
if (webIdType != null)
localVarQueryParams.addAll(apiClient.parameterToPairs("multi", "webIdType", webIdType));
if (progressListener != null)
{
apiClient.getHttpClient().networkInterceptors().add(new okhttp3.Interceptor() {
@Override
public okhttp3.Response intercept(okhttp3.Interceptor.Chain chain) throws IOException {
okhttp3.Response originalResponse = chain.proceed(chain.request());
return originalResponse.newBuilder()
.body(new ProgressResponseBody(originalResponse.body(), progressListener))
.build();
}
});
}
String[] localVarAuthNames = new String[] {"Basic" };
return apiClient.buildCall(localVarPath, "GET", localVarQueryParams, localVarPostBody, localVarHeaderParams, localVarFormParams, localVarAuthNames, progressRequestListener);
}
/**
* Create a point in the specified Data Server.
*
*/
public void createPoint(String webId, PIPoint pointDTO, String webIdType) throws ApiException {
createPointWithHttpInfo(webId, pointDTO, webIdType);
}
/**
* Create a point in the specified Data Server. (with HTTP information)
*
*/
public ApiResponse<Void> createPointWithHttpInfo(String webId, PIPoint pointDTO, String webIdType) throws ApiException {
okhttp3.Call call = createPointCall(webId, pointDTO, webIdType,null,null);
return apiClient.execute(call);
}
/**
* Create a point in the specified Data Server. (asynchronously)
*
*/
public okhttp3.Call createPointAsync(String webId, PIPoint pointDTO, String webIdType, final ApiCallback<Void> callback) throws ApiException {
ProgressResponseBody.ProgressListener progressListener = null;
ProgressRequestBody.ProgressRequestListener progressRequestListener = null;
if (callback != null)
{
progressListener = new ProgressResponseBody.ProgressListener() {
@Override
public void update(long bytesRead, long contentLength, boolean done)
{
callback.onDownloadProgress(bytesRead, contentLength, done);
}
};
progressRequestListener = new ProgressRequestBody.ProgressRequestListener() {
@Override
public void onRequestProgress(long bytesWritten, long contentLength, boolean done)
{
callback.onUploadProgress(bytesWritten, contentLength, done);
}
};
}
okhttp3.Call call = createPointCall(webId, pointDTO, webIdType, progressListener, progressRequestListener);
apiClient.executeAsync(call, callback);
return call;
}
private okhttp3.Call createPointCall(String webId, PIPoint pointDTO, String webIdType, final ProgressResponseBody.ProgressListener progressListener, final ProgressRequestBody.ProgressRequestListener progressRequestListener) throws ApiException {
Object localVarPostBody = null;
// verify the required parameter 'webId' is set
if (webId == null)
throw new ApiException("Missing required parameter 'webId'");
// verify the required parameter 'pointDTO' is set
if (pointDTO == null)
throw new ApiException("Missing required parameter 'pointDTO'");
String localVarPath = "/dataservers/{webId}/points";
Map<String, String> localVarHeaderParams = new HashMap<String, String>();
Map<String, Object> localVarFormParams = new HashMap<String, Object>();
List<Pair> localVarQueryParams = new ArrayList<Pair>();
final String[] localVarAccepts = {"application/json", "text/json", "text/html", "application/x-ms-application"};
final String localVarAccept = apiClient.selectHeaderAccept(localVarAccepts);
if (localVarAccept != null) localVarHeaderParams.put("Accept", localVarAccept);
final String[] localVarContentTypes = {"application/json", "text/json" };
final String localVarContentType = apiClient.selectHeaderContentType(localVarContentTypes);
localVarHeaderParams.put("Content-Type", localVarContentType);
localVarPath = localVarPath.replaceAll("\\{webId\\}", apiClient.escapeString(webId.toString()));
localVarPostBody = pointDTO;
if (webIdType != null)
localVarQueryParams.addAll(apiClient.parameterToPairs("multi", "webIdType", webIdType));
if (progressListener != null)
{
apiClient.getHttpClient().networkInterceptors().add(new okhttp3.Interceptor() {
@Override
public okhttp3.Response intercept(okhttp3.Interceptor.Chain chain) throws IOException {
okhttp3.Response originalResponse = chain.proceed(chain.request());
return originalResponse.newBuilder()
.body(new ProgressResponseBody(originalResponse.body(), progressListener))
.build();
}
});
}
String[] localVarAuthNames = new String[] {"Basic" };
return apiClient.buildCall(localVarPath, "POST", localVarQueryParams, localVarPostBody, localVarHeaderParams, localVarFormParams, localVarAuthNames, progressRequestListener);
}
}
| 29,590 |
https://www.wikidata.org/wiki/Q10840581
|
Wikidata
|
Semantic data
|
CC0
| null |
Chem communal house
|
None
|
Multilingual
|
Semantic data
| 142 | 340 |
Đình Chèm
Đình Chèm quốc gia Việt Nam
Đình Chèm là một đình
Đình Chèm nằm trong phạm vi của khu vực hành chính Hà Nội
Đình Chèm tọa độ
Đình Chèm hình ảnh Đình Chèm 2 - NKS.jpg
Đình Chèm ID trong sơ đồ tri thức của Google /g/113gpl2wk
Đình Chèm thể loại ở Commons Chem communal house
瞻亭
瞻亭 国家 越南
瞻亭 隶属于 村亭
瞻亭 所在行政领土实体 河內市
瞻亭 地理坐标
瞻亭 图像 Đình Chèm 2 - NKS.jpg
瞻亭 Google知識圖譜編號 /g/113gpl2wk
瞻亭 共享资源分类 Chem communal house
Chem communal house
Chem communal house country Vietnam
Chem communal house instance of Vietnamese communal house
Chem communal house located in the administrative territorial entity Hanoi
Chem communal house coordinate location
Chem communal house image Đình Chèm 2 - NKS.jpg
Chem communal house Google Knowledge Graph ID /g/113gpl2wk
Chem communal house Commons category Chem communal house
| 48,768 |
b21365805_0014_15
|
English-PD
|
Open Culture
|
Public Domain
| 1,845 |
The new statistical account of Scotland. [electronic resource]
|
Society for the Benefit of the Sons and Daughters of the Clergy | London School of Hygiene and Tropical Medicine
|
English
|
Spoken
| 7,228 | 9,714 |
In these circumstances, it is evident that the plough could never be employed, and the straight spade, which is made use of in other parts of the Highlands, is far more fatiguing to the workman, and, with the same exertion, would not perform half the work in the same period of time. But the most painful of all the operations is the finishing part. After the ground is turned up with the crooked spade, and the seed sown, a male, or more frequently a female, takes a kind of hand-harrow, and with this the person works with both hands backward and forward, up and down, till the whole surface is made quite smooth, and all the hollows ren- dered completely level : or otherwise,- a person gets a small har- row made of light wood, to which he fixes a rope, which he takes in his hand, and over his shoulder or round his breast, and, by dragging it after him, he harrows and finishes his land. This mode of working is peculiar to those who have small divisions of land, and cannot keep horses; but these are by far the greater number. It is quite obvious that such tenants as these can never improve land. On the contrary, they are constantly in arrears to the proprietors, and frequently to the amount of two and some- times three years rent. The poverty of the people is an insur- 230 INVEHNRSS-SHIRE. mountable obstacle in the way of any rural improvement. To per- sons in such low circumstances a lease would be of no aclvantafe, and as little would the proprietors be disposed to grant them one. In the whole parish, there is only one farm held on lease. Fisheries, — There is a kind of stake salmon-fishing in the pa- rish. The tenant is a south countryman, in company with some others. They hold the whole fishing on Lord Macdonald's pro- perty. The fish is cured in the village of Portree, and is sent off by steam for Glasgow, and sometimes thence for London. They pay a certain small rent for the whole fishing of five parishes. One of those stations is relinquished, as not paying the expense. The station in this parish is the next to that in point of success, and con- sequently cannot be productive to any profitable extent. There is no separate rent exigible for the fishing of it. The herring fishing, some years ago, was carried on here with considerable suc- cess. In a fine evening in the month of July or August, when all the boats belonging to this parish, together with those belonging to the adjacent parishes of Glenelg, Lochalsh, Lochcarron, Ap- plecross, Gairloch, and Lochbroom, and with them boats belong- ing to vessels from fifty to seventy sails in number, appeared in the sound'of Rasay, — a most delightful scene was exhibited. But the most agreeable and the most useful of all exhibitions was their return to the harbour next day, deeply laden with the rich- est and most delicious herrings. It is a matter deeply to be re- gretted, that the herring fishing in this quarter has been much on the decline for several years past, so much so, that failure in this branch of industry, together with other causes operating in- juriously, produced the ever-memorable destitution of the years 1836 and 1837. And were it not for the seasonable relief afford- ed by public contributions in every part of the British empire, both at home and abroad, the great body of the lower order of the community would have been swept off by the most appalling star- vation. Indeed, there is reason to fear that the herring-fishing will altogether disappear on the coast of this parish. This sta- tion was never so productive in herrings as were once Lochmad- dy in North Uist, Lochrog in Lewis, several arms of the sea in South Uist, and on the west side of the Isle of Skye ; and now in all these different localities, there is no fishing of any consequence. And why may not that happen also on the coast of this parish ? And should that unfortunately be the case, what will become ISLAND. OF SKYE — FORTREE. 2,31 of its immensely redundant, population, already sunk in the low- est degradation of misery and poverty? This is a matter high- ly deserving the most serious attention and consideration of all those having influence and power ; and it cannot fail to af- ford the highest satisfaction to every well-regulated mind, to. see the eff'orts now made by noblemen, proprietors, and others connected with the Highlands of Scotland, for transferring the poor and labouring classes of the community in these districts to the British colonies in North America, and more especially to Ca- nada. This appears to be the most eligible resort to the poor expatriated Highlander, in order to escape from his misery, to ac- quire comfort and independence, and where he will find employ- ment congenial to his habits and pursuits at home. The highest praise is due to Lord Macdonald for his liberality in this beneficent and patriotic enterprise, — he having this and last year expended large sums of money in conveying the poor people on his proper- ty (tenants or not tenants) to North America. And it is a matter devoutly to be wished, that other landed proprietors would follow his beneficent example, aswell as the Legislatureofthecountry, and thus provide comfortably for a noble race of men, — strengthen the hands of the local government in the American colonies, — and for ever put an end to disaff'ection to the state in that quax'ter. V. — Parochial Economy. Markets. — The village of Portree is the only place in the pa- rish in which markets are held for the sale of black-cattle. The population is nearly 300, including those in its immediate vicinity. There are several shop-keepers in the place who import meal and other commodities for the use of the country people. To the village of Portree there is a steam-boat plying from Glasgow once a-week, with a short cessation in the winter season. An excel- lent road has been constructed from one extremity of the parish to another, under the direction of the Parliamentary Commission- ers for building bridges and making roads in the Highlands and Islands of Scotland. This road is kept in repair by an assessment on the heritors of the county of Inverness. In the village there is a post-office, to which there is a post three times a week. Than the harbour of Portree there can hardly be a better. It is spacious enough to contain several hundred sail. It is shelter- ed on all sides, and from every wind that blows. From the very 232 INVERNESS-SniRE. liigh lands with which it is surrounded, the entry can very easily be found in the darkest night. The holding ground is of deep clay, and so firm and strong that it is very seldom, indeed, that a vessel is driven ashore, — and even should that unfortunately hap- pen, if she escapes from two or three rocky points, she will only be cast on a clayey or sandy bank. It is a good outlet for any quarter of the globe. At the entry, there is a breakwater formed by the hand of nature, which makes it narrow, but, at the same time, the water is very deep and the rock perpendicular at the edge. There are other harbours in the parish, but none to be compared to that of Portree. Ecclesiastical State. — The parish church is situated in the vil- lage of Portree, at a distance of about two miles from the northern, and fifteen from the southern extremity of the parish, and conse- quently not only not convenient, but altogether inaccessible to the great body of the people. It was built about sixteen years ago, and is in an excellent state of repair. It will accommodate about 800 sitters, and no payment is exacted from any of them. The manse was built about thirty years ago, and, as soon as any thing is wanted in the way of repair, it is immediately supplied by the liberal heritors of the parish, oh the application of the incum- bent. • The glebe is sufficiently extensive, and, for the most part, consists of moss and hill pasture. It is, however, very susceptible of improvement. In its present state, it is worth L.20 Sterling per annum. In the course of a few years,"and in the possession of a person able and willing to improve, it may be made doubly valuable. The amount of stipend is the minimum, — L.150 Ster- ling, payable partly by the heritors, and partly by the Govern- ment. There is no Government church, but there is a missionary minister in the parish, on the establishment of the Committee of the General Assembly for promoting the knowledge of Christianity in the Highlands and Islands of Scotland. His salary is paid by the Committee from the bounty annually allowed by the Crown for the reformation of the Highlands and Islands. There are no sectarians of any description in the parish. • The attendance at the different preaching stations in the pa- rish is from 300 to 400 souls, but frequently less in bad weather, when the people have a great distance to travel. The number of communicants in the parish, of late years, has greatly diminished, from a kind of delusion among the people. They seem now, how- ISLAND OF SKYE POIITKEE. 233 ever, to come to a better understanding, and, from present appear- ances, there is reason to believe that the number of communicants will soon be considerably increased. Ediicntion. — In this parish, there are two parochial schools, one by a society in Glasgow, and two Gaelic schools. In the paro- chial school situated in the village, English reading, writing, English grammar, arithmetic, book-keeping, geography, Latin, and the elements of Greek, &c. are taught. In the branch paro- chial school in Rasay, the elementary branches are only taught, and the same is the case in the Glasgow Society school. The pa- rochial teachers have all the accommodations to which they^ are by law entitled. The parochial school salary is the maximum, but the school-fees are only nominal. The people are so poor that they can scarcely afTord to pay any fees : and if the teacher insists on his right to receive fees from the scholars, their parents threaten to withdraw, and, in some instances, do actually withdraw their children from the school. As to the expense of education in these schools* there are no pupils in attendance from distant quarters. It is only the children in the immediate vicinity of the school that attend, and all the charges to which they are liable are the small sums ex- pended in buying books, and the tritie of school-fees which they occasionally pay. This is an expense to which they with reluc- tance subject themselves, as they are not by any means so desirous as could be wished to have their children educated. The blessing of education having been for the most part denied themselves, by their predecessors, they are not particularly anxious to bestow it on their successors. There are two districts in this parish so remote, that they are inaccessible to the parochial and all other schools. These are the districts of Glenmore and the Braes. In the former of these places, 50 scholars might attend a school, and in the latter, from 60 to 100, under a well-educated and systematic teacher. In both these localities, a subscription school has been taught occasionally, but the teachers were invariably so little qua- lified to discharge the duties of their office, and the remuneration for their labours so very inadequate, that little progress has hitherto been made in promoting the important object of education, and, consequently, many Instances of gross immorality occur among the people. At the same time, it is a matter of common observation, that profane swearing, intemperance, drunkenness, and the dese- INVERNESS. Q 234 INVERNESS-SHIRE. cration of the Sabbath, are not so common as they were twenty or thirty years ago. Poor and Parochial Funds. — The number of pooi- receiving aid is 89, and they receive from 2s. to 15s. each, and that only once a-year. The fund in aid of the poor arises from the in- terest of money, from the collection in the church, from occa- sional gratuities and benefactions by individuals, and from small sums exacted as fines from delinquents. The number of the poor hasbeenonthe increase annually, for some years past. They are sup- ported not so much from parochial funds or contributions, as they are by the charity and benevolence of their neighbours. The poorest of the people go about in the parish, and tliey are fed, and, in some instances clad, by the liberality of the inhabitants. It is only the most dire necessity that could ever induce the people to submit to the degradation of public begging; and nothing is so repugnant to their minds as to have their names inserted in the poor-list of the parish. Prisons. — There is one jail in the parish, and it has been occu- pied for the last year by sixteen offenders, eleven for riotous con- duct, four for housebreaking and theft, and one for forgery. The jail has been most insecure for some time past, and this has been fully evinced by the circumstance, that some prisoners have broken through it and made their escape. And certainly it is no matter of surprise, that every possible effort should be made by them for that purpose, when the bad treatment to which they are subjected is taken into consideration. Into the jail they are thrown without bed, without bedding, without fire, and with but a small allowance for their subsistence. By the humanity, however, and charity of some benevolent persons in the neighbourhood, these privations have been partly alleviated, if not removed. The jail has a keeper, who lias a certain small allowance made to him annually for his trouble by the county of Inverness. And the general superintendence is committed to the sheriff-substitute of the district of Skye, who holds his courts in the court room of the jail. Fairs. — There are three fairs held in the parish, one in the month of May, one in the month of July, and one in the month of November. The two former for the sale of black-cattle, and the latter for hiring servants, and for transacting other country busi- ness. Inns. — For the accommodation of persons who attend these ISLAND OF SKYE — PORTREE. 235 fairs, as well as travellers and others, there is an excellent public- house in the village of Portree. There is another public-house in the district of Sconcer. Both these inns are kept by very re- spectable individuals, and, in so far as the writer has been able to learn, they have no perpicious effects on public morals. Fuel. — The fuel chiefly used in this parish is peat. Every family may cut as much out of a peat bank as will serve them throughout the year. This they do in the commencement of the dry weather, in the months of April or May. And, as this operation is performed by the people at a time when they would otherwise be idle, it may be said to cost them no money. Miscellaneous Observations. On the surface of the parish, the greatest change has been produced by the Parliamentary and other district roads throughout the parish. In the architectural department, some very important variations have taken place. Since the date of the old Statistical Ac- count the elegant house of Rasay, the house occupied by Lord Mac- donald's chamberlain at Portree, thebank-housebuiltby theNational Bank of Scotland, the jail, and several other houses erected in the village by Lord Macdonald and other individuals, together with the church and manse, are all constructed. The parish is rather a pastoral than an agricultural district. To produce the greatest advantage, therefore, to proprietor and te- nants, it should be cut into sizable farms, with distinct boundaries to each, and of sufficient extent to support a family. These farms should be let on leases of from fifteen to twenty years endurance, and given to persons who have a sufficient capital to stock, and skill to manage them. But with the present immense population, in a place without commerce, without manufactures, without agriculture, and without any kind of permanent employ- ment for the people, no system that can be adopted will render them comfortable. To accommodate the people, the proprietors have tried many experiments. Previous to the year 1811, almost all the farms on Lord Macdonald's property in this parish were held in common, or, as it is termed, on runrig. About that period, finding that the people were rapidly increasing in number, and a great demand among them for land, with few exceptions, all the farms in pos- session of small tenants were cut into lots or crofts, and each of these was let to a family. In the course of a few years, a tenant 23(j INVERNESS-SHIRE. on a lot had a son, who, in opposition to every advice that could be given him, by parents, relatives, and friends, would, whether right or wrong, be married. To provide for this son, his wife, and his family, there was no other alternative than to give him a share gf the lot. The same individual letter has a daughter, to whom some young man becomes attached ; marriage is proposed and agreed upon ; but in the matrimonial contract, it is express- ly stipulated, that this new ally of the family shall have an esta- blishment on the lot. Thus on one portion of land, too small for the support of the original, there are now three families. It is easily seen that the si- tuation of these must be poor in the extreme. The proprietors show every kindness and indulgence. Their rents are not rigidly exacted at a term. There are instances of tenants being allowed to remain in arrear, some two, some three, and some even four years. It is, however, perfectly evident that no liberality on the part of proprietors can render the present immense surplus population in any measure comfortable. And there is, humanly speaking, no other way to provide for them than by emigration ; though cer- tainly, it would be for ever a matter of deep regret, that so noble a race of men should be under the necessity of leaving their native land and seeking an asylum on a foreign shore. But, as they are unable to effect this by any means within their own reach, they should be conveyed to any British settlement which may be thought eligible — all the expense defrayed, and lands provided for them in their adopted settlement, by the Government of the country. January 1841, ISLAND OF SKYE. PARISH OF KILMUIR. PRESBYTERY OF SKYE, SYNOD OF GLENELG. THE REV. ROBERT MACGREGOR, MINISTER.* I. — Topography and Natural History. Name. — Kilmuir is the most northern parish in the island of Skye. The name signifies the " Church of Mary," and is de- rived from the Gaehc words Cill, a chapel, or burying-ground, and Muire, Mary. The parish of old was frequently desig- nated St Mary's, as may be seen in Martin's History of the Isles, and in other ancient documents. Although the whole civil parish is now comprehended under the name Kilmuir, yet in former times only a small district of it went under that denomina- tion, viz. that in which the parish church was formerly built. The parish originally consisted of a variety of Cills^ which were dedi- cated to their respective tutelary saints, such as Kileana, Kilmar- tin, Kilmorie, Kildorais, Kilmaluag, Kilvaxter, Kilbride, &c. to each of which was attached a portion or district of the parish. Boundaries. — Kilmuir being a section of the northern end of Skye, is bounded for the most part by sea, viz. on the north, by the channel which intervenes between Skye and the islands of Lewis and Harris, commonly called the Minsh ; on the east by the sound of Gairloch ; on the south, by the parish of Snizort ; and on the west, ])artly by the Minsh, and partly by Loch Snizort. The dimensions of the parish vary considerably, and its almost semicircular form is rendered very irregular by a variety of small indentations and promontories. The extreme points of it may be distant in a straight line about 16 English miles ; its breadth, taken at right angles, varies from 6 to 10 miles; and it is supposed to contain about 50 square miles. The centre of the parish is in la- titude 57° 34' north, and in longitude 6° 15' west. * Drawn up by Mr Alexander Macgregor, A. M. liccntiato of tliu Church Scotland, and son of the incumbent. 238 INVERNESS-SHIRE. Topographical Appearances. — Kilrauir is in a manner bisected by the extremity of a range of hills, which passes through it and the ad- jacent parishes of Snizortand Portree. The highest may be com- puted to be about 1200 feet above the level of the sea. There is a variety of small hills, which are principally green, forming in some parts little glens through which small rivulets run to the sea; in other parts, they cause the formation of little lakes, of which there are many in the parish. These little hills are, also, in some places totally di- vided from the rest of the mountains, and, from their isolated and conical appearance, there are to be found here ahd there truly pictu- resque scenes. There is one hill in particular, to the top of which the access is easy by a gentle acclivity, while it is found abruptly to terminate in a huge perpendicular precipice about 600 feet high, overhanging a dark circular lake of great depth. This rock affords a secure nestling-place to eagles and other birds of prey. One scene in this parish — that of Quiraing — must be particu- larly noticed. This remarkable formation of nature consists of a secluded piece of level and fertile ground, which is concealed in the face of an almost inaccessible precipice. The hill in which it is situated, is about 1000 feet in height, and slopes by a steep de- clivity towards the west ; but towards the north-east, it presents a face of rugged precipices, much variegated by being here and there composed of huge basaltic columns, or massy fragments of fluted rocks. In other parts, large spaces, formed into concave sections, present themselves to the view, and have a majestic ap- pearance, from being ribbed transversely either by small fissures, or protuberant seams, over which a little rivulet drizzles in moist seasons of the year. In the face of this huge precipice, then, Quiraing is enshrined, and entirely hidden from the view of the visitor. This interesting spot consists of a green plot of ground, formed into an oblong platform of sufficient extent to contain six or seven regiments of soldiers. It is studded all round with mas- sive columns of rock, rising up in lofty peaks, by the intervention of deep chasms, which are for the most part inaccessible. On ap- proaching the great inlet to the eagerly looked-for platform, the passage is much obtruded by heaps of stone and rubbish, which have been washed down from the crevices by the gradual waste of successive ages. When these obstacles are overcome, the visitor finds himself at the entrance of a steep passage, which would seem to lead to the top of the hill. To the right of this entrance ISLAND OF SKYE — KILMUIR, 239 stands an isolated pyramid of rock, called the Needle. By considerable exertion the tourist gains the top of the pass, and be- holds with indescribable wonder the scene which opens to his view ! Instead of seeing, as he would expect, some narrow cave, he beholds a spacious opening before him, in the centre of which stands the above-mentioned platform. By descending a short dis- tance, and threading his way by a small path, he is instantly led to the beautiful green plain which it was all along his object to at- tain. Instead of being lively and enchanting, a night-like gloom falls over it, like a shroud of darkness ! The thick mist slowly floating through the pyramids, and concealing their rugged pinnacles from the view, gives a sombre appearance to the whole ! The visitor's imagination will lead him to think that the gloomy pyramids be- fore him bind earth and Heaven together ! He cannot but ad- mire ; yet, at the same time, he is filled with a sort of awe, which causes him to ascribe the marvellous works which lie shrouded be- fore him, to the wonderful doings of that Omnipotent Being who created all things ! The cultivated part of the parish is a kind of circular belt along its shores, about two miles of average breadth. It is naturally di- 240 INVHRNESS-SIIIUK. vided into three districts, that of Kihuuir, of Kilmaluag, and of Steinscholl or East-side. The surface of each of these districts IS almost wiiolly seen at one view from either extremity. The coast is hold, high, and rocky. Its extent, owing to the vast num- ber of small bays and headlands, is supposed to be no less than forty miles. In many places, the land is hemmed in by tracks of lofty and perpendicular precipices, most regularly formed into large parallel, square, round, and triangular pillars of basalt. There are varieties of small caves to be found concealed among these columns, In one place, there is a little spar-cave; and in another, there is one known by the name of Udmh an dir, — " the cave of the gold," respecting which several traditions are afloat among the natives. None of these caves, however, is pos- sessed of peculiarities worthy of any lengthened observations. Headlands. — The principal headlands are, Rutha-chuirn-leith, Rutha Bhorniskittaig, Rutha-hunish, Rutha-bheannachain, Rutha- ghara-fada, and Rutha-nam-braithrean. The principal bays or lochs are those of Cammusmore, Duntulm, Kilmaluag, and Al- tivaig or Staffin, none of which afford a safe anchorage, with the exception of Duntulm. Islands. — The principal islands are, lasgairor Yesker, Fladda- chuain, Tulm, Trodda, Altivaig, and Fladda. Of these Trodda is the most extensive and valuable. With the exception of Flad- da-chuain, the second largest of the group, none of them possess any remarkable peculiarities. They are all uninhabited, being merely rented for grazing by tacksmen, who look upon them as useful appendages to their farms. Fladda-chuain is about six miles from the nearest part of Skye, and is about three-fourths of a mile in length, and three hundred yards in average breadth. The quality of its grass is remarkably fine, and perhaps superior to any in the parish for pasturing a few sheep. It is surrounded by four lesser islands, which are capable of rearing only two or three sheep a piece. It is a remarkable fact, that in this little island, which is so far from any other land, and situated in the midst of a very salt, deep, and rapid channel, there are two or three fresh water springs. In former ages, it was inhabited by a family or two, who had a considerable portion of it under cultiva- tion. Although so remote and distant from the shore, it was an- ciently the site of a Druidical place of worship, which will be af- terwards mentioned. It is a curious phenomenon, well worthy the attention of the naturalist, that such animals as the toad, ISLAND OF SKYE— KILMUIR. 241 frog, mouse, rat, snail, &c. can have no existence in it, although all°the other islands of the parish abound with them. It is credi- tably reported, that mice have been carefully carried thither several times for experiment, but upon landing them that they instantly died.. Names of Hamlets, ^-c— In this and in most other parishes of the Hebrides the names of hamlets, hills, bays, promontories, &c. are evidently, for the most part, of Scandinavian origin. ^ In some cases, however, Gaelic roots with Scandinavian terminations, and vice versa, are to be met with. It is a remarkable fact, that the names given to certain localities by the natives of a foreign land, have been retained for so many ages and generations, as is the case here and elsewhere. When the prevalence of Scandinavian names is taken into consideration, and the great disproportion which they bear to those of Celtic origin, it will appear evident, that the number, power, and influence of the aboriginal popu- lation was but small in comparison with that of the Norwe- gian invaders. Most promontories end with the termination " nish," which must be the same with the French " nez," the Latin " nasus," the English « nose," the Gaelic " innis," an island or promontory, all meaning the projecting feature. We have therefore Hunish, Vaternish, Skernish, &c. In other parts of Scotland, such places have the termination " ness," as Strom- ness, Tarbetness, Buchanness, &c. The barony of Troternish seems evidently to derive its name from Trodda, a small island which is situated near the northern point of it, and the termination " nish," — that is Trodda-wM, now pronounced Troternish, the point or territory of Trodda. A great variety of places terminate in " host," as Orbost, Libost, Skeabost, Carboht, &c.; so do a number in " burg," as Resaburg, Scuddeburg, &c. Many ham- lets end with " garry," as Flodigarry, Osmagarry, &c. ; many with " latter," as Hunglatter, Seoglatter, &c. ; many with " shad- der," as Elishadder, Marishadder, &c. ; many with " sta" and " stadt," as Shulista, Dehsta, Herbusta, Monkstadt, Brunistadt, &c. As has been already observed, many places derive their appellations from saints, such as the followers of St Columba, and others ; but these, although frequently much corrupted, are pure- ly of Celtic origin. It is most remarkable, that no trace or vo- cable of the Scandinavian language is found, in any shape, in the language of the country, except names of hamlets and other loca- lities. The language of the inhabitants is purely Celtic. Meteor olo(jy.— Ki the parish is so much encompassed by sea, 242 INVERNESS-SHIRE. the temperature of the atmosphere, although exceedingly variable, seldom descends very low. No meteorological tables have been kept \n the parish, whereby the changes of temperature and varia- tions of climate might be stated with accuracy ; yet, it may be as- serted, generally, that the climate is very moist, rainy, and bois- terous. The mercury in the thermometer seldom falls below 25, or rises (with the exception, perhaps, of a few days in summer,) above 76° of Fahrenheit. The barometer, however, indicates frequent and sudden changes in the pressure of the atmosphere. The mercury, which generally stands at or near 29|°, has often been observed to rise or fall more than half an inch in the course of a day. The cold of winter is less intense, and the heat of summer less oppressive than in most other parts of the kingdom. Torrents of rain fall in all seasons of the year, and the moisture which descends in the Highlands of Scotland, in the form of snow, descends here, for the most part, in sleet and rain. For many years back, snow seldom lay on the ground above a day or two ; whereas, in former periods, severe snow storms were prevalent, and generally of long duration. In this respect, the seasons, from some unknown cause, have undergone a sensible change. Ow- ing to the prevalence of dampness, and the moist nature of the atmosphere, it is no easy matter to preserve polished iron, steel, and other metals free from rust. Knives, fire-irons, and all such utensils of polished metallic surfaces must be frequently rubbed or brushed, otherwise they would rust in a single day, unless kept in places heated by constant fires. The frequent rains of the place can only be accounted for, from its vicinity and exposure to the Atlantic, the exhalations of which, appearing in dark clouds, are conveyed eastward by the westerly breeze, and are naturally attracted by the hills and mountains of the Hebrides in general. The most prevailing wind is the south-west ; and, from the cause already stated, it is generally attended with rain. This wind, by sweeping across the western ocean, is necessarily saturated with moisture ; and, while it passes from a warmer to a colder climate, naturally deposits its humidity on the first land which obstructs its course. From the effects of this wind the hopes of the hus- bandman are frequently blasted ; and if it happen to prevail in the ripening months of autumn, the fruits of his industry and labour are in danger of being destroyed. Wind from the opposite quar- ter, viz. north-east, though frequently cold, is for the most part dry. ISLAND OF SKYE KILMUIR. 213 There is scarcely any thunder except in winter and spring, when it is very prevalent. Lightning is to be seen at all seasons, and some of the oldest inhabitants prognosticate the weather with a wonderful degree of correctness, both from the colour of the elec- tric fluid, and the time of day when it appears. It is generally observ- ed, that when vivid flashes of lightning are seen early in the morning, the ensuing weather will be unfavourable ; but while seen towards the evening, better hopes are entertained. It is remark- ed also, that when the aurora borealis is seen ascending high into the heavens, and when some rays have a reddish appearance, and in- stantly vanish to give place to others of a darker hue, then the weather will certainly change, and continue to be unfavourable for a length of time. The forms and colouring of Nature are frequently magnificent- ly grand. Scenes at times present themselves which are both in- teresting and impressive. Who can behold without a pleasing elevation of mind, the tempestuous Atlantic battling with the fury of the elements? What can be more beautiful than to witness the clouds of mist receding, in thickening folds, from the moun- tains, to the higher regions of the atmosphere, and leaving the landscape again to rejoice in the brightness of sunshine ! At times, they present phenomena like celestial mountains tinged with the riches and variety of prismatic colouring ! The splendour of the morning and evening drapery frequently baffles all descrip- tion. The aurora borealis, or polar lights, are often exceedingly brilliant ; as are likewise the solar rainbow, and the lunar halo. Such luminous meteors, certainly surpass in magnificence any ap- pearance of the kind in other parts of the kingdom. The natives prognosticate the weather in various ways. It may be noticed also, that they attribute much importance, not only here, but in most parts of the Highlands, to the phases of the moon, not solely in regard to the weather, but likewise to the season best fitted for performing many acts of labour. They imagine that an increasing moon com- municates a growing quality to most substances, while a decreas- ing moon has an opposite tendency, and causes such substances to decay or wither. Actuated by this supposition, they avoid, in ge- neral, slaughtering animals in the wane of the moon, as then, ac- cording to their idea, the meat will shrink and decrease while in process of cooking. On the other hand, they prefer cutting tim- ber, mowing hay, casting turf, and delving ground, between full and new moon, as they are under the belief, that by so doing, the 1nv1':une.siS-sihrE. processes of seasoning will be accelerated, and that the sap, or na- tural juice, weeds, &c. will more speedily decay. Diseases. — The diseases to which the inliabitants are most liable, and from which they sull'er most, are of an inflammatory kind, proceeding from their being continually exposed to damp and cold. During the spring and part of the winter, they are daily in the fields in all weathers, cultivating their patches of land ; consequently they are but seldom either dryly clad or shod. The complaints most prevalent are, acute rheumatism, pleuritic dis- orders, typhus fevers, pneumonia, asthma,' dyspepsia, erysipela- tous affections, and a diseased action of the lymphatic system. Small-pox, and other contagious diseases, at times make their ap- pearance, being generally brought to the parish by the labourers who frequent the towns and cities of the kingdom in quest of employment. Vaccination has been partially introduced, and the prejudice which the people had against it for a length of time, isgra- dually vanishing. There is no medical practitioner nearer than the village of Portree, upwards of twenty miles distant ; and the consequence is, that he is never sent for but in cases of extreme danger. Three or four individuals lately died at the age of 100. In the district of Steinscholl, a man died about twelve years ago, named John Nicolson, or MacCormaic, at the very advanced age of 105. There is one circumstance connected with this old man's history worthy of notice, which is, that he could repeat the mosfe of Ossian's Fingal, Temora, &c. with great fluency and precision. The writer of this heard him say that he committed these beau- tiful poems to memory, from hearing them repeated, when a boy, by his grandfather. If this fact be not sufficient to establish the authenticity of these unparalleled poems, it must surely establish the truth, that they existed before thetime of Macpherson, whoattempt- ed to translate them into the English language. The silly allegation' by some, that Ossian's poems were Macpherson's own production, is palpably confuted by MacCormaic and others, who could repeat them before Macpherson was born. But should that not have been the case, and should none have been found who could re- hearse them before Macpherson's time, the allegation, that they were either by Macpherson, or by any other in the age in which he lived, appears ridiculous in the sight of such as know the con- struction and beauty of the Celtic language. Hydrography. — Kilmuir, as has been already stated, is bounded on the one side by the channel called the Minsh, and on the ISLAND OF SKYE KILMUIIJ. 245 other by the Gauloch Channel, each being about twenty miles in average breadth. The water of these channels is exceedingly salt. The currents, although regular, are very strong and rapid. The bottoai of these channels must be very rugged, as the depths, which are generally great, vary in almost every place. The pa- rish is supplied with numerous excellent perennial fresh water springs, some of which have a copious discharge. There are also a few of the chalybeate nature, but not very much impregnated. The temperature of these springs varies but httle at any season of the year, as they seem to issue immediately from a great depth. On the farm of SteinschoU, there is a spring which was disco- vered, only a few years ago, whose water is supposed by some to be similar to that of Strathpeffer ; but such is not the case, as it is saline, and exhibits no trace of sulphuretted hydrogen. Six ounces of this water were analyzed by a celebrated chemist in the south, who found them to contain, muriates of lime and potash, sulphates of soda, lime, and magnesia, carbonate of lime, and a trace of peroxide of iron and organic matter. At a certain place in the parish, there is an accidental conflux of pure fresh-water springs, which form a small eUiptical pond of considerable depth. The bottom consists of whitish sand, which, by being visible through the transparent water, gives a beautiful greenish tinge to the whole. This small lake is surrounded by a little brushwood, and the rivulet which flows from it into the sea is pleasantly hemmed and edged with a few shrubs and bushes. The pond was anciently called Loch Sianta or Seunta, which means the sacred lake, and it retains the name to this day. The hallowed appearance of the situation did not escape the fancy of the ancient Highlanders, whose veneration for such places was carried to a ridiculous excess. Owing to the crystalline purity of the water, its copiousness, and the sequestered situation of this little Hebridean Siloam, they conceived it to be favoured with its divinity, to whom, in the early ages of darkness and ignorance, they were extremely punctual in making offerings of various kinds. In- valids always resorted thither, and imagined that they were bene- fited by drinking of its water, and by thoroughly washing them- selves in a bath erected for the purpose. These superstitions have, however, long ago ceased, and Loch Sianta, though beauti- ful as ever, has lost its ancient charms in this more enlightened age. On the sea-shore, where the rivulet which issues from Loch 24G INVERNESS-SHIRE. Sianta discharges itself into the deep, dilse, or Fuciis palmatus, of most superior quality is found, which is much prized by the natives, who frequently cook it like greens, and other vegetables, and reckon it a salutary dish. A little fresh water lake in the parish, called Loch Miaghailt, discharges its water by a subterraneous passage, through the rocks between it and the sea. Near where the stream from this loch spouts out from the precipice, may be seen the form of a High- lander, in full garb, in the face of the rock. From the striking resemblance of this cliff to a Highlander in complete costume, it received the name of Creaff nafeile, the rock of the kilt, and has been frequently admired by tourists in search of the picturesque. It can only be seen to advantage from a little distance at sea. Near the ancient house of Flodigarry, there is an eminence in close vicinity to the sea-shore, upon which, when a person stands, he hears under him a loud rumbling noise, which must be caused by the sea finding an entrance under the eminence, by means of some hollow recesses which are too deep to be seen. Not far from the house of Aird-mhic-ceolain, there is a remark- able natural formation called Slochd a' mhadaidh, where the sea dashes under a natural arch into a circular pool beyond it. From this pool there is a subterraneous passage of some hundred yards in length, through which a person may scramble, at low-water, and come out at the other end. At the place where the person comes out of that rough, dark passage, he sees before him a huge, iso- lated rock of considerable height, called Stachd-Lachlain. This rock is encompassed with quadrangular columns of basalt, and covered on the top with grass. As no one can scramble to its summit, marine fowls take possession of it for a nestling-place. In another place on the same farm, there is a variety of arches and passages, through which the sea dashes with a hollow rumbling noise.
| 50,631 |
US-201816758660-A_4
|
USPTO
|
Open Government
|
Public Domain
| 2,018 |
None
|
None
|
English
|
Spoken
| 2,250 | 3,012 |
Yield, purity, and productivity of each component obtained from rate model simulations for different feed composition cases. Sm Nd Pr Composition Target Controlling Controlling Yield Purity Yield Purity Yield Purity Total Sm:Nd:Pr Yield (%) Component γ L_(f) kf* (%) (%) P_(R) (%) (%) P_(R) (%) (%) P_(R) P_(R) Case A. Target All 3 Components with Minimum Target Yield 0.8 A1 (1:5:5) 80 Sm 0.027 0.45 613 80 99.6 1.6 94 99.9 9.8 95 99.9 9.1 20.5 A2 (5:1:5) 80 Nd 0.017 0.45 973 97 99.96 7.0 81 99.5 1.2 98 99.9 6.7 14.9 A3 (5:5:1) 80 Pr 0.018 0.49 821 96 99.98 7.2 96 99.9 7.4 85 99.6 1.2 15.8 A4 (10:1:1) 80 Nd 0.015 0.65 730 99 99.98 21.0 81 99.6 1.8 85 99.7 1.7 24.5 Case B. Target 2 of 3 Components with Minimum Target Yield 0.8 B1 (1:5:5) 80 Nd 0.084 0.38 230 — — — 81 99.6 26.9 82 99.6 25.0 51.9 B2 (5:1:5) 80 Pr 0.091 0.41 198 88 99.8 29.2 — — — 81 99.6 25.4 54.6 B3 (5:5:1) 80 Nd 0.084 0.42 210 88 99.8 28.0 81 99.6 26.3 — — — 54.3 Case C. Target Only 1 Major Component with Minimum Target Yield 0.8 C1 (10:1:1) 80 Sm 0.24 0.44 68 81 99.6 161.0 — — — — — — 161.0 C2 (1:10:1) 80 Nd 0.15 0.29 166 — — — 81 99.6 43.4 — — — 43.4 C3 (1:1:10) 80 Pr 0.17 0.28 158 — — — — — — 81 99.6 40.9 40.9 The parameters used for the design and simulations were listed in Table 2. Total feed concentration in all cases was 0.5 N. Dead volume in all cases was 2% of column volume. The unit of productivity (P_(R)) is kilogram per bed volume (m³) per day.
To conclude, a design method of general applicability was developed for an efficient separation process. This method is particularly useful in the isolation and purification of rare earth elements (REE) using a ligand-assisted displacement (LAD) chromatographic separation process. While it works for the separation of a mixture of any multivalence cations using a LAD, this method may find applications in the separation of any multicomponent mixtures using either a displacement chromatography or a LAD. Using the concept of the constant pattern mass transfer zone, the design method disclosed herein is to find the minimum required dimensionless groups using a general map to develop a constant pattern isotachic train in a LAD. From dimensionless groups, the column length, linear velocity, the maximum ligand concentration, feed loading volume or inner diameter may be obtained for the specific target yields without appealing to the method of trial and error. The developed method may also be applied develop a continuous process. The multi-zone LAD process is useful to improve the yield and productivity for high purity REE, especially, when the REE concentrations are orders of magnitude different in the feed.
In other words, there are two key elements in the design method. First, we developed a general correlation to enable one to design a displacement system to reach the constant-pattern state for systems with significant mass transfer effects (or non-ideal systems). Two key dimensionless groups were first developed by strategic combinations of the various parameters to reduce the multidimensional design space into two dimensions. Systematic rate model simulations were used to find the transition points from non-constant-pattern states to the constant-pattern states. The transition points were connected to form a curve, which divided the multi-dimensional design parameter space into two regions: the constant pattern region and the transient region. This curve was represented using a simple exponential correlation, which can be used to find the minimum column length to reach the constant pattern state for a given feed mixture and operating conditions (loading fraction and linear velocity). Operating in the constant pattern state using the minimum column length can maximize sorbent productivity and the yield of high purity product.
The second key element of the design method is a yield equation. To ensure specific product purity and yield can be achieved in a separation process, an equation for the yield of the target component was derived as a function of the key dimensionless groups controlling the constant pattern mass transfer zone length. One can achieve the desired yields and the constant pattern state by solving the minimum column length and the linear velocity from the yield equation and the general correlation. A selectivity weighted composition factor was developed to allow the design method to specify a minimum target yield for one or multiple components. The design method was verified using simulations and experiments for different target yields, ligand concentrations, and feed compositions. The targeted yields were achieved or exceeded in all cases tested. The minimum column length required to achieve a constant pattern-state and the productivity of LAD are limited by the lowest selectivity or by a minority component with a low concentration in the feed, even when it does not have the lowest selectivity. Sacrificing the yields of minor components can increase the total productivity significantly. The productivities achieved using this design method are 839 times higher than the literature LAD results for ternary separations with the same purity and similar yields.
Those skilled in the art will recognize that numerous modifications can be made to the specific implementations described above. The implementations should not be limited to the particular limitations described. Other implementations may be possible.
While the inventions have been illustrated and described in detail in the drawings and foregoing description, the same is to be considered as illustrative and not restrictive in character, it being understood that only certain embodiments have been shown and described and that all changes and modifications that come within the spirit of the invention are desired to be protected.
What is claimed is:
1. A method for designing an efficient separation process comprising the steps of: a. analyzing compositions of a feed mixture; b. selecting a sorbent, a displacer, and a presaturant; c. testing for intrinsic parameters of said sorbent and effective selectivity between any two components of said feed mixture; d. optimizing separation parameters using an algorithm based on the intrinsic parameters of selected sorbent, effective selectivity, components of said feed mixture, targeted yield and purity; and e. conducting said efficient separation process according to the optimized separation parameters.
2. The method of claim 1 further comprising a step of computational simulation for verification of the optimized separation parameters before conducting said efficient separation process of step e.
3. The method of claim 2, wherein said computational simulation is a versatile reaction and separation (VERSE) model simulation.
4. The method of claim 1, wherein testing for intrinsic parameters of said sorbent and effective selectivity between any two components of said feed mixture is carried out using a testing column of said sorbent.
5. The method of claim 4, wherein said intrinsic parameters for the testing column comprises particle radius, particle porosity, bed void fraction, phase ratio, intra-particle diffusion coefficient, axial dispersion coefficient, interstitial velocity, viscosity, and column capacity.
6. The method of claim 1, wherein said efficient separation process according to the optimized separation parameters is carried out using a column of specific inner diameter (ID) and length packed with said sorbent.
7. The method of claim 1, wherein said composition analysis of a feed mixture comprises concentration of individual components, feeding volume, pH, and mole ratio of individual components.
8. The method of claim 1, wherein said optimized separation parameters comprises feed loading volume, column length, linear velocity, and maximum displacer concentration.
9. The method of claim 1, wherein said method for designing an efficient separation process provides a minimum product loss with a high productivity.
10. The method of claim 1, wherein said efficient separation process is a displacement chromatographic separation process.
11. The method of claim 11, wherein said displacement chromatographic separation process is a ligand assisted displacement chromatographic separation process.
12. The method of claim 1, wherein said efficient separation process is a binary or ternary chromatographic separation process.
13. The method of claim 1, wherein said efficient separation process is a multicomponent chromatographic separation process.
14. The method of claim 1, wherein said efficient separation process is a ligand assisted displacement chromatographic separation process.
15. The method of claim 1, wherein said efficient separation process is a batch wise process.
16. The method of claim 1, wherein said efficient separation process is a continuous process.
17. The method of claim 1, wherein said efficient separation is a multi-zone process, wherein major components of said feed mixture are separated and purified with a first column and minor components of the feed mixture are separated and purified with a second column.
18. The method of claim 1, wherein said efficient separation is a two-step process, wherein major components of the feed mixture are separated and purified with a first column and minor components of the feed mixture are separated and purified with a second column.
19. The method of claim 1, wherein said efficient separation is a multi-step preparation process, wherein components of said feed mixture are divided into a plurality of groups with components of each group having a similar concentration, and components of each group are separated and purified together with one preparation column using said optimized separation parameters.
20. The method of claim 1, wherein said efficient separation process is a multi-zone process, wherein components of similar concentrations are grouped and separated on one column using said optimized separation parameters.
21. The method of claim 1, wherein said algorithm for obtaining optimized parameters for said effective separation process comprises the steps of: a. collecting column radius, particle size, column capacity, bed void, particle porosity, displacer concentration, diffusivity coefficients, feed concentration and composition, selectivity, target yield, pressure limit, and purity cut; b. calculating an overall mass transfer coefficient; c. determining a nonideal factor from an empirical correlation; d. calculating a loading fraction based said nonideal factor; e. calculating a flow rate for a plurality of column lengths based on said mass transfer coefficient; f. verifying that said flow rate is permissible under a specified pressure limit; g. determining productivity and selecting the highest productivity system; and h. generating a set of optimized parameters for said efficient separation process.
22. A computer program performing the method of claims 1-21.
23. A manufacture process incorporating the method of claims 1-21 in isolation and purification of a material of industrial importance.
24. A product manufactured according to the process of claim
23. 25. An algorithm for obtaining a set of optimized parameters for an efficient chromatographic separation process comprising the steps of: a. collecting column radius, particle size, column capacity, bed void, particle porosity, displacer concentration, diffusivity coefficients, feed concentration and composition, selectivity, target yield, pressure limit, and purity cut; b. calculating an overall mass transfer coefficient; c. determining a nonideal factor from an empirical correlation; d. calculating a loading fraction from said nonideal factor; e. calculating a flow rate for a plurality of column lengths based on said mass transfer coefficient; f. verifying that said flow rate is permissible under a specified pressure limit; g. determining a plurality of productivities and selecting the highest productivity system; and h. outputting a set of optimized parameters for said efficient chromatographic separation process.
26. The algorithm of claim 25, wherein the algorithm is for a displacement chromatographic separation process.
27. The algorithm of claim 26, wherein the algorithm is for a ligand assisted displacement chromatographic separation process.
28. The algorithm of claim 25, wherein the algorithm is for a batch wise separation process.
29. The algorithm of claim 25, wherein said efficient separation process is a continuous process.
30. A computer program performing the algorithm of claims 25-29.
31. A manufacture process incorporating the algorithm of claims 25-29 in isolating and purifying a material of industrial importance.
32. A product manufactured according to the process of claim
31. 33. An algorithm for obtaining a set of optimized parameters for a production separation process based a production goal comprising the steps of: a. collecting particle size, column capacity, bed void, particle porosity, displacer concentration, diffusivity coefficients, feed concentration and composition, selectivity, target yield, pressure limit, and purity cut; b. calculating an overall mass transfer coefficient; c. determining a nonideal factor from an empirical correlation; d. calculating a loading fraction from said nonideal factor; e. calculating a flow rate for a plurality of column lengths based on said mass transfer coefficient; f. verifying said flow rate is permissible under a specified pressure limit; g. determining a productivity for each column length and selecting a highest productivity system; and h. determining an inner diameter for a column required for said production goal; i. outputting a set of optimized parameters for said production chromatographic separation process.
34. An algorithm for obtaining optimized parameters for a production separation process based on a column comprising the steps of: a. collecting particle size, column capacity, bed void, particle porosity, displacer concentration, diffusivity coefficients, feed concentration and composition, selectivity, target yield, pressure limit, and purity cut; b. calculating an overall mass transfer coefficient; c. determining a nonideal factor from an empirical correlation; d. calculating a loading fraction from said nonideal factor; e. calculating a flow rate for column length of said column based on said mass transfer coefficient; f. verifying said flow rate is permissible under specified pressure limit for said column; otherwise, setting a flow rate at the pressure limit; g. outputting a set of optimized parameters for the preparative chromatographic separation process..
| 25,150 |
https://vi.wikipedia.org/wiki/Myrmecaelurus%20virgulatus
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Myrmecaelurus virgulatus
|
https://vi.wikipedia.org/w/index.php?title=Myrmecaelurus virgulatus&action=history
|
Vietnamese
|
Spoken
| 28 | 71 |
Myrmecaelurus virgulatus là một loài côn trùng trong họ Myrmeleontidae thuộc bộ Neuroptera. Loài này được Iqbal & Yousuf miêu tả năm 1991.
Chú thích
Tham khảo
Myrmecaelurus
| 22,142 |
https://ceb.wikipedia.org/wiki/Kecamatan%20Wedung
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Kecamatan Wedung
|
https://ceb.wikipedia.org/w/index.php?title=Kecamatan Wedung&action=history
|
Cebuano
|
Spoken
| 105 | 182 |
Distrito ang Kecamatan Wedung sa Indonesya. Nahimutang ni sa lalawigan sa Provinsi Jawa Tengah, sa kasadpang bahin sa nasod, km sa sidlakan sa Jakarta ang ulohan sa nasod.
Hapit nalukop sa kaumahan ang palibot sa Kecamatan Wedung. Dunay mga ka tawo kada kilometro kwadrado sa palibot sa Kecamatan Wedung may kaayo hilabihan populasyon. Ang klima habagat. Ang kasarangang giiniton °C. Ang kinainitan nga bulan Oktubre, sa °C, ug ang kinabugnawan Enero, sa °C. Ang kasarangang pag-ulan milimetro matag tuig. Ang kinabasaan nga bulan Enero, sa milimetro nga ulan, ug ang kinaugahan Septiyembre, sa milimetro.
Ang mga gi basihan niini
Mga subdibisyon sa Provinsi Jawa Tengah
| 37,523 |
https://github.com/reallinfo/meditations/blob/master/frontend/journal/entry.tsx
|
Github Open Source
|
Open Source
|
LicenseRef-scancode-public-domain
| 2,018 |
meditations
|
reallinfo
|
TSX
|
Code
| 540 | 1,867 |
import * as React from 'react';
import { Entry, Tag } from './state';
import { Editable, OcticonButton } from '../common/components';
import * as common from '../common';
import {
OcticonTag, OcticonTextSize, OcticonTrashcan, OcticonLink, OcticonX,
} from '../common/octicons';
import { modalContext, ModalProvider } from '../common/modal';
///// REACT COMPONENTS
interface CEntryProps {
/** If true, a link to the month the entry was created in will be added to the controls. */
context?: boolean;
entry: Entry;
/** A search string to highlight */
searchString?: string;
}
interface CEntryState {
editor: MediumEditor.MediumEditor;
}
/** A journal entry. */
export class CEntry extends Editable<CEntryProps> {
constructor(props: CEntryProps) {
super(props);
}
changeName(modal: ModalProvider) {
return modal.openModalPromptAllowEmpty(
'What would you like to name this entry? (leave empty to delete)',
'Name entry', this.props.entry.Name,
(name) => {
if (name !== this.props.entry.Name) {
if (name === '') {
common.post(`/journal/name-entry/${this.props.entry.ID}`);
} else {
common.post(`/journal/name-entry/${this.props.entry.ID}/${name}`);
}
}
});
}
addTag(modal: ModalProvider) {
return modal.openModalPrompt(
'What tag would you like to add to this entry? (leave empty to cancel)', 'Tag entry',
(tname) => {
// If input was empty or tag already exists, don't do anything
if (tname === '' || tname == null ||
(this.props.entry.Tags && this.props.entry.Tags.some(t => t.Name === tname))) {
return;
}
common.post(`/journal/add-tag/${this.props.entry.ID}/${tname}`);
});
}
removeTag(modal: ModalProvider, t: Tag) {
return modal.openModalConfirm(
`Are you sure you want to remove the tag #${t.Name}?`, 'Yes, remove it',
() => common.post(`/journal/remove-tag/${this.props.entry.ID}/${t.Name}`));
}
deleteEntry(modal: ModalProvider) {
return modal.openModalConfirm('Are you sure you want to remove this entry?', 'Yes, remove it',
() => common.post(`/journal/delete-entry/${this.props.entry.ID}`));
}
editorUpdated() {
return this.props.entry.Body !== this.body.innerHTML;
}
editorSave() {
common.post('/journal/update', {
ID: this.props.entry.ID,
Body: this.body.innerHTML,
});
}
render() {
// A link to the month the entry was written, if viewing in a non time based context (e.g. by
// name or by tag)
const ctxLink = this.props.context ?
// tslint:disable-next-line
`#view/${this.props.entry.CreatedAt.local().format(common.MONTH_FORMAT)}/${this.props.entry.ID}` :
false;
// In order, render:
// A header with title and title-changing control, then tags
// Other controls and timestamp on the rightmost
let body = this.props.entry.Body.slice(0);
if (!this.state.editorOpen && this.props.searchString) {
// TODO: This highlight needs to be undone during actual editing, otherwise medium-editor
// just saves the HTML.
const searchString = this.props.searchString.slice(0);
const esc = searchString.replace(/[-\/\\^$*+?.()|[\]{}]/g, '\\$&');
const reg = new RegExp(esc, 'ig');
body = body.replace(reg,
`<span class="entry-highlight">${this.props.searchString}</span>`);
}
return <modalContext.Consumer>
{modal =>
<section className="entry border bg-gray " id={`entry-${this.props.entry.ID}`}>
<div className="entry-header border-bottom">
<div className="d-flex flex-row flex-justify-between flex-items-center">
<div className="d-flex flex-row flex-items-center ml-2 mb-1 mt-1" >
<OcticonButton icon={OcticonTextSize} onClick={this.changeName(modal)}
tooltip="Change name" tooltipDirection="e" normalButton={true}
className="p-1 mr-2 d-flex flex-items-center" />
<h3 className="ml-1 d-flex flex-column flex-md-row" style={{ display: 'inline' }}>
<span className="d-flex flex-column flex-md-row">
#{this.props.entry.ID}
<span>{this.props.entry.Name && <strong>{this.props.entry.Name}</strong>}</span>
</span>
</h3>
<div className="ml-2 d-flex flex-md-row flex-column" style={{ display: 'inline' }}>
<OcticonButton icon={OcticonTag} tooltip="Add tag" tooltipDirection="n"
className="p-1 mr-2 d-flex flex-items-center" normalButton={true}
onClick={this.addTag(modal)} />
{this.props.entry.Tags && this.props.entry.Tags.map((t, i) =>
<button className="mt-4 mt-md-0 ml-md-3 tag " key={i}
style={{ borderRadius: '1px' }} >
<a href={`#tag/${t.Name}`} >#{t.Name}</a>
<OcticonButton icon={OcticonX} onClick={this.removeTag(modal, t)} />
</button>)}
</div>
</div>
<div className="entry-controls mr-2">
<strong>
{this.props.entry.CreatedAt.local()
.format(this.props.context ? 'M-D-YY h:mm A' : 'h:mm A')
}</strong>
{ctxLink &&
<OcticonButton tooltip="Go to context" icon={OcticonLink} href={ctxLink} />}
<OcticonButton icon={OcticonTrashcan} onClick={this.deleteEntry(modal)}
tooltip="Delete this entry" className="btn-danger ml-1" />
</div>
</div>
</div>
<div className="entry-body p-2 " id={`entry-body-${this.props.entry.ID}`}
ref={(body) => { if (body) this.body = body; }}
dangerouslySetInnerHTML={{ __html: body }}
onClick={this.editorOpen} />
</section>
}
</modalContext.Consumer>;
}
}
| 8,772 |
https://ja.wikipedia.org/wiki/%E6%A0%83%E7%A5%9E%E5%B1%B1%E9%BE%8D%E4%B8%80
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
栃神山龍一
|
https://ja.wikipedia.org/w/index.php?title=栃神山龍一&action=history
|
Japanese
|
Spoken
| 65 | 3,131 |
栃神山 龍一（とちかみやま りゅういち、2001年1月11日 - ）は、埼玉県入間市出身で、春日野部屋所属の現役大相撲力士。本名は神山龍一。身長180.1cm、体重168.7kg。最高位は西幕下3枚目（2023年1月場所）。
来歴
入間市の名門あんず幼稚園から入間市立金子小学校に入学すると、地域のサッカークラブ金子fcジュニアに入部する。そこでは身体が大きかったのでゴールキーパーをする事が多かった。しかし、指導が優しかったからか次第に監督らの言う事を聞かなくなっていく。それに業をにやした親は格闘技を薦めた。まず近くの空手道場に連れて行った所嫌がったので、その年の6月に行われたわんぱく相撲入間大会で、入間少年相撲クラブの入会チラシが親のポケットに数ヶ月入っていた事を契機に、相撲クラブへと繋がっていく。入部の決め手は土俵の砂が心地良かったとの事。空手を嫌がらなければ今頃は空手家であったのかもしれない。それまでは入間スイミングクラブにも入っていて、相撲クラブに入ると時を同じくして退会したが、今でも数百メートルは平気で泳げる。
小学2年の秋頃に入間少年相撲クラブで相撲を始めた。初の公式戦は伊勢神宮での奉納相撲大会であり、後に学生横綱となる中村泰輝が記念すべきデビュー戦の相手であった。身長も体重もおよそ倍くらい違い、無論3秒すら土俵にはいられなかった。第3回白鵬杯団体優勝に貢献。
中学卒業までに県内公式戦100連勝は今でも語り草となっている。相撲留学した埼玉入間市立黒須中時代に体重を増やし〈監督宅での合宿生活に拠る。〉、中学2年では全中団体優勝。個人ベスト32となる。中学3年では腰痛により出場さえも危ぶまれた中、青森県十和田で開催された2015年度全国中学校相撲選手権大会個人戦で優勝し、第45代中学生横綱の称号を得る。黒須中から2年連続の快挙であった。対戦相手は決勝トーナメントで齋藤（のちの北の若）や中村らを破った徳田（のちの徳之武藏）であり、当初は不利が予想されていたが見事に快勝する。因みに予選で齋藤と対戦していて勝利している。全中宿舎は星野リゾートでは無く、十和田から車で1時間も掛かる遠方であった。そこに準優勝者徳田も宿泊していたという1つのストーリーがあった。
中学時代には、全国少年相撲選手権大会での輝かしい2連覇も大将として成し遂げている。
埼玉栄高等学校時代の足首の負傷は2年時十和田大会でその年の高校横綱アマルサナー（のちの狼雅）に勝利した際に負傷したものである。高校の同期には北の若、西乃龍、二本柳らがいる。北の若とは公式戦では3年時の関東大会決勝で快勝している。
高校総体団体優勝（大将）、個人高校総体3位。国体団体優勝（大将）、個人国体準優勝。（準決勝は後の天皇杯覇者花田秀虎であり、快勝するものの決勝は齋藤に惜敗し天皇杯出場を逃す。この試合が高校時代最後の一番となった。）卒業後は天皇杯出場の為、大学入学が当初の希望であったが大相撲に行く事となる。
卒業式後、相撲部の三送会から大阪場所に直行する際、北の若と2人きりで新幹線に乗った事は誰も知らない2つ目のストーリーである。
▲
師匠春日野には明治大学での同級生が総監督を務める「入間少年相撲クラブ」出身という縁から、小学校2年時から目をかけられていた。2019年5月場所に序二段優勝。
2019年9月場所は初めての幕下で5勝2敗。
2020年11月場所で5勝2敗とし、2021年1月場所は幕下20枚目に昇進して勝負の場所であったが2勝5敗と跳ね返される。
「相撲の取り方が分からなくなった」とコメント。迷ったら基本に立ち返るしかない。ここが踏ん張り所であろう。
2021年3月場所は幕下38枚目であったが、左四つに変えて左下手を浅く取り始めた事から、6勝1敗と大勝した。特筆すべきは6番相撲での天王山戦であり、未来を予見する見事な一番であった。来場所は幕下15枚目前後となり活躍が期待出来る。
2021年5月場所は幕下16枚目であったが、順調に白星を重ね5勝2敗とし来場所は7枚目前後に昇進する。幕下での2場所連続勝ち越しは初である。
左四つから遮二無二前に出る押し相撲が光っていた。この相撲を更に磨けば関取も視野に入るか。
2021年7月場所は幕下8枚目であった。先場所同様な取り口で2連勝と圧倒的な勝ちを収めたが、稽古などで負傷してしまい精彩を欠いた取り組みとなった、3勝3敗で迎えた7番相撲では関取経験のある千代鳳を相手に善戦するも惜しくも敗れ一点の負け越しで終わる。
2021年9月場所は幕下15枚目であった。立ち会い強く当たれなくなっていて圧力に乏しく、初の2場所連続負け越しとなった。戦法の幅を広げる必要があろう。両手突き等、差しに拘らない相撲にする必要がある。
2021年11月場所は幕下22枚目であった。1番相撲で埼玉栄高校相撲部入部時のキャプテンである西川に恩返しが出来たが左手を負傷し、以来精彩を欠く相撲となってしまうも7番相撲で全中決勝戦の再現となる徳乃武蔵を破り、辛くも4勝3敗で来場所に繋げた。
2022年1月場所は幕下18枚目であった。脇が甘いのは変わらず立ち会いも今ひとつで、2勝5敗であった。
2022年3月場所は幕下39枚目であった。負傷も良くなり立ち会いの強さが戻ってきて6勝1敗と大勝ちした。
2022年5月場所は幕下13枚目であった。元関取2人に完勝して勝ち越すも取りこぼしが多かった。
2022年7月場所は幕下10枚目であったが、7番相撲で惜敗し1点の負け越しであった。
2022年9月場所は幕下14枚目であった。2番相撲で大関経験者の朝乃山と対戦し完敗を喫するも、そこから4連勝して5勝2敗で場所を終えた。
2022年11月場所は幕下6枚目であった、2連敗で始まったが、そこから3連勝して盛り返し、7番相撲で勝利し自己最高位での勝ち越しを決めた。来場所は幕下3枚目前後となりそうで正念場を迎える。
2023年1月場所は千秋楽7番相撲で十両昇格をかけた戦いとなったが、惜敗し3勝4敗であった。
2023年3月場所は幕下5枚目であったが何故か覇気がなく2勝5敗であった。
2023年5月場所は幕下15枚目であったが稽古中に靭帯損傷を負い全敗かと思われたが、辛うじて2勝した。
靭帯損傷は1ヶ月程度安静にしていれば元に戻るが〜。復活を期待したい。
2023年7月場所は幕下32枚目となり、負傷箇所も厳しい稽古で鍛えあげられたのか影響を感じさせない様子であり、
格の違いを見せつけた場所となった。6勝1敗。来場所10枚目前後となろう。
2023年9月場所は幕下12枚目となり、大勝ちが期待されたが1点の勝ち越しで留まる。やはり左四つを極めない限り
上は？
主な成績
2023年9月場所終了現在
通算成績
通算成績：110勝79敗（28場所）
各段優勝
序二段優勝：1回（2019年5月場所）
場所別成績
感染症拡大により中止
改名歴
栃神山 龍一（とちかみやま りゅういち）2019年1月場所 -
メディア出演
テレビ番組
ピラメキーノ（2012年10月4日・5日、テレビ東京）- ピラメキーノ大相撲秋場所
脚注
関連項目
大相撲力士一覧
外部リンク
2001年生
存命人物
埼玉県出身の大相撲力士
埼玉県出身の人物
埼玉栄高等学校出身の大相撲力士
春日野部屋
| 40,704 |
US-201514747364-A_1
|
USPTO
|
Open Government
|
Public Domain
| 2,015 |
None
|
None
|
English
|
Spoken
| 7,041 | 8,859 |
Charged particle beam apparatus, stage controlling method, and stage system
ABSTRACT
A stage system includes a stage that holds an object, a linear motor mechanism that moves the stage by a thrust force generated by a current flowing through the coil, and a control section that controls the current flowing through the coil. The current flowing through the coil in a state where the stage is maintained in the static state be greater than a minimum current amount required for generating the thrust force greater than a maximum static friction force of the stage with respect to the guide rails.
BACKGROUND OF THE INVENTION
The present invention relates to a stage control method for holding anobject and a stage system using the stage control method. Particularly,the invention relates to a charged particle beam apparatus such as anelectron microscope, an ion beam machining/observation apparatus, andthe like.
In recent years, integration of semiconductor products has been improvedmore and more and higher definition of a circuit pattern thereof hasbeen required. Various inspection means for the purpose of qualitycontrol and a yield increase have been used in a sample such as a waferon which the circuit pattern is formed. For example, there is a SEM typeinspection apparatus using an optical type inspection apparatus or ascanning type electron microscope (SEM) for inspecting foreign mattersor defects of the wafer by applying light. Furthermore, a scanning typeelectron microscope (hereinafter, referred to as a length measurementSEM) for measuring a dimensional accuracy of the circuit pattern byapplying a charged particle beam, a scanning type electron microscope(hereinafter, referred to as a review SEM) for evaluating the defects orthe foreign matters by applying the charged particle beam and imagingdefects of the circuit pattern or adhered foreign matters at a highmagnification, and the like are also used. These apparatuses arecollectively referred to as an inspection apparatus.
A stage used in such an inspection apparatus has a general configurationin which an X guide rail is attached to a base to guide an X table in anX-direction, the X table is mounted on the X guide rail, a Y tablecapable of moving in a Y-direction is further mounted on the X table,and a chuck holding a sample is mounted within a vacuum chamber. In sucha stage, in the related art, a combination of a ball screw and a rotarymotor is used as an actuator that is a driving source, but in recentyears, a case where a linear motor of which a structure is simple andmaintenance is also easy is used has been increased.
In order to continuously observe a plurality of positions of the wafer,it is necessary to move the stage and perform positioning of the wafer.In this case, if running of the stage is continued, a temperature of thestage is changed by heat generation of the linear motor. If thetemperature of the stage is changed, a positioning accuracy of aposition of the stage is degraded due to deformation, expansion, and thelike of the table. Furthermore, if a difference in the temperaturebetween the stage and the wafer that is transported is great, defectsthat a pattern cannot be positioned in a desired position may occur dueto thermal expansion of the wafer during the observation.
Regarding such a problem described above, an exposure apparatus in which“heat is generated in a motor bypassing at least a current to the motorsmaller than an excitation current required for driving the motor aftera stage is stopped, and thereby a temperature is controlled in a statewhere a stage 11 is neither heated nor cooled” is disclosed inJP-A-2004-111684.
An electron beam drawing apparatus in which “a sample stage is operatedduring a certain period of time until a temperature of the sample stagebecomes a set reference temperature or more”, that is, the stage ismoved and is idling during a period of non-operation of the apparatus toprevent a decrease in a temperature in a state of the non-operation ofthe apparatus is disclosed in JP-A-2003-309062.
SUMMARY OF INVENTION
However, in a case of a method disclosed in JP-A-2004-111684, a currentamount cannot be adjusted only in a range enough to keep a static stateof the stage, that is, in a range in which a driving force of the stagedoes not exceed a static friction force. Of course, in general, acurrent amount when the stage is driven is much greater than a currentamount when the stage is in the static state. A heat amount isdetermined by the current amount and a voltage. In this method, thecurrent amount cannot be sufficiently increased, and heat generationwhen the stage is operated and heat generation when the stage stops maynot be able to be the same extent.
Thus, as described in JP-A-2003-309062, it is conceivable that the stageis idling when the apparatus is not running and a temperature while thestage being driven is maintained. However, in this method, since thestage is operated in addition to an operation time required for originalobservation or inspection, a service life of a guide of the stage, abending wiring, and the like becomes shorter.
An object of the invention is to provide an apparatus in which atemperature change between a driving state and a static state of theapparatus is reduced and a positioning accuracy of a sample is improvedwithout affecting a service life of the apparatus.
In order to solve the problems described above, the present inventionprovides a stage system including: a stage that holds an object; alinear motor mechanism that moves the stage by a thrust force generatedby a current flowing through the coil; and a control section thatcontrols the current flowing through the coil. The current flowingthrough the coil in a state where the stage is maintained in the staticstate be greater than a minimum current amount required for generatingthe thrust force greater than a maximum static friction force of thestage with respect to the guide rails.
According to the invention, it is possible to reduce the temperaturechange between the driving state and the static state of the apparatuswithout affecting a service life of the apparatus. Thus, the positioningaccuracy of the sample can be improved. Objects, configurations, andeffects other than the above description will become apparent from thefollowing descriptions of embodiments.
BRIEF DESCRIPTION OF DRAWINGS
FIG. 1 is a schematic side view of a body of an inspection apparatus;
FIG. 2 is a front view of a stage of a first example;
FIG. 3 is a side view of the stage of the first example;
FIG. 4 is an explanatory view illustrating a flowchart of stagepositioning of the first example;
FIG. 5 is an explanatory view illustrating a transmission path of heatgenerated by an X-axis linear motor;
FIG. 6 is an explanatory view illustrating a transmission path of heatgenerated by a Y-axis linear motor;
FIG. 7 is a comparison explanatory view illustrating a temperaturechange of the stage;
FIG. 8 is an explanatory view illustrating a motor operating stateduring a warming up operation;
FIG. 9 is an explanatory view illustrating a current flowing through thelinear motor during driving of the stage;
FIG. 10 is an explanatory view illustrating a heat amount generated bythe linear motor during driving of the stage;
FIG. 11 is an explanatory view illustrating an average heat amountgenerated by the linear motor during driving of the stage;
FIG. 12 is an explanatory view illustrating a current amount flowingthrough the linear motor in a wafer processing sequence;
FIG. 13 is an explanatory view illustrating a motor operation rate in anapparatus having a low operation rate;
FIG. 14 is an explanatory view illustrating a temperature change in thestage of the apparatus having the low operation rate;
FIG. 15 is an explanatory view illustrating a current amount if thewarming up operation is applied to the apparatus having the lowoperation rate;
FIG. 16 is an explanatory view illustrating the temperature of the stageif the warming up operation is applied to the apparatus having the lowoperation rate;
FIG. 17 is an explanatory view illustrating the current amount if thewarming up operation with a reduced operation rate is applied to theapparatus having the low operation rate;
FIG. 18 is an explanatory view illustrating the temperature of the stageif the warming up operation with a reduced operation rate is applied tothe apparatus having the low operation rate;
FIG. 19 is a front view of a stage of a second example;
FIG. 20 is a side view of the stage of the second example;
FIG. 21 is an explanatory view illustrating an example of a currentcontrol state of the second example;
FIG. DESCRIPTION OF THE EMBODIMENTS
Hereinafter, an example of a charged particle beam apparatus using ascanning type electron microscope is described as an example of aninspection apparatus, but this is merely one example of the invention.The invention is not limited to the embodiments described below and maybe an apparatus which uses light. In addition, the charged particle beamapparatus in the invention is intended to broadly include an apparatusfor imaging an image of a sample using a charged particle beam. As anexample of the charged particle beam apparatus, an inspection apparatus,a review apparatus, and a pattern measuring apparatus using the scanningtype electron microscope are exemplified. Furthermore, the chargedparticle beam apparatus can be also applied to a sample machiningapparatus or a sample analyzing apparatus including a general purposescanning type electron microscope or a scanning type electronmicroscope. Furthermore, the following charged particle beam apparatusalso includes a system to which the charged particle beam apparatusdescribed above is connected via a network or a combined apparatus ofthe charged particle beam apparatus described above. In the followingexamples, an example in which the invention is applied to a review SEMis described as an example of the charged particle beam apparatus.
In this specification, “defect” is not limited to a defect of a patternand broadly includes observation objects such as foreign matters,pattern size abnormalities, and a structure failure.
In this specification, “sample” broadly includes inspection orobservation of objects. In the following description, as an example, asemiconductor wafer (hereinafter, referred to as wafer) is described.
Hereinafter, examples of the invention will be described in detail withreference to the drawings.
First Example
FIG. 1 schematically illustrates an entirety of an inspection apparatusof the example.
Mounts 7 for damping vibration of a floor are installed on a pedestal 6provided on the floor and the mounts 7 support a sample chamber 2 thatis a vacuum vessel. A column 1 that controls an electron beam 12 to begenerated and to scan the sample is installed in an upper portion of thesample chamber 2. The column 1 includes a deflector that deflects theelectron beam 12 so as to scan the sample or an objective lens thatconverges on the electron beam 12 on the sample in addition to anelectron source 11 generating the electron beam 12. In addition, thecolumn may include other various lens or apertures and a configurationof a charged particle optical system is not limited to the examples. Inaddition, the column 1 is provided with a detector 13 for detectingsecondary charged particles such as secondary electrons or reflectiveelectrons obtained by applying the electron beams to the sample.
The sample chamber 2 includes a stage 8 for holding and moving thesample and the stage 8 is capable of being driven in a horizontal plane(XY plane). A detailed description of the stage 8 is described belowwith reference to FIGS. 2 and 3.
A transportation chamber 3 in which a transportation robot 40 fortransporting the wafer between a preliminary exhaust chamber 4 and thesample chamber 2 is included is installed on the side of the samplechamber 2. Furthermore, the preliminary exhaust chamber 4 is installedon the side of the transportation chamber 3. The sample chamber 2 isconstantly evacuated by a vacuum pump (not illustrated) and an inside ofthe column 1 is also kept at a high vacuum state by a high vacuum pump(ion pump and the like) (not illustrated). On the other hand, anatmosphere-side gate valve 42 for isolating the preliminary exhaustchamber 4 from the atmosphere and a vacuum-side gate valve 41 forisolating the preliminary exhaust chamber 4 from the sample chamber 2are installed in the preliminary exhaust chamber 4. A wafer stand 43 isincluded on the inside of the preliminary exhaust chamber 4.
Here, a transportation path of the wafer will be simply described.
The atmosphere-side gate valve 42 is opened and a wafer 10 is introducedfrom the atmosphere side to the wafer stand 43 on the inside of thepreliminary exhaust chamber 4 by a transportation robot (notillustrated). Next, the atmosphere-side gate valve 42 is closed and theinside of the preliminary exhaust chamber 4 is evacuated by a vacuumpump (not illustrated). After a degree of vacuum of the preliminaryexhaust chamber 4 becomes approximately the same as that of the insideof the sample chamber 2, the vacuum-side gate valve 41 is opened and thewafer 10 is transported on the stage 8 included in the sample chamber bythe robot 40. The wafer 10 is disposed on an electrostatic chuck 23 ofthe stage 8 and electrostatic adsorption is performed.
A position of the wafer 10 transported on the stage 8 is managed bymeasuring a position of the stage by a laser interferometer 20. Thestage is positioned in coordinates to be observed and a signal of asecondary charged particles obtained by scanning the electron beam isdetected by the detector 13. An image is generated by performing acalculation in an image processing section included in a control system16 based on the signal and scanning information. The image may bedisplayed as a SEM image on a monitor 17 or may be stored in a storagedevice such as a hard disk (not illustrated).
In the inspection apparatus of the example, a control system forcontrolling an operation of each portion or a power supply (notillustrated) is included in addition to the above configuration. Thecontrol system described above or an image generation section may beconfigured as hardware by a dedicated circuit substrate or may beconfigured as software that is executed by a computer connected to theinspection apparatus. If the inspection apparatus is configured by thehardware, the inspection apparatus is realized by integrating aplurality of calculators executing the process on a wiring substrate, ina semiconductor chip, or in a package. If the inspection apparatus isconfigured by the software, the inspection apparatus is realized byexecuting a program executing a desired calculation process by mountinga general purpose high-speed CPU on the computer. An existing apparatusmay be upgraded by a recording medium in which the program is stored.Furthermore, the apparatus, the circuit, and the computer are connectedvia a wired or wireless network, and appropriate data is transmitted andreceived therebetween.
A structure of the stage will be described with reference to FIGS. 2 and3. FIG. 2 is a front view of the stage 8 of the example and FIG. 3 is aside view of the stage 8 of the example. Moreover, the structure of thestage described below is an example and the structure of the stage isnot limited to the following description. For example, a structure of astage described in a second embodiment may be employed.
An X linear motor fixing element 29 and an X guide 27 are installed on abase 24 supporting an entirety of the stage 8. An X table 25 is mountedon the X guide 27. An X linear motor movable element 30, an X brake 33,a Y linear motor fixing element 31, and a Y guide 28 are installed onthe X table 25. A Y table 26 is mounted on the Y guide 28. A Y linearmotor movable element 32, a Y brake 34, the electrostatic chuck 23, anda bar mirror 22 are installed on the Y table 26. In the followingdescription, both the linear motor movable element and the linear motorfixing element are simply referred to as a linear motor or a motor.
A force is generated by an interaction of the X linear motor fixingelement 29 and the X linear motor movable element 30 in a direction ofthe X guide 27. More specifically, a current flows through a coil andthereby a force is generated by an interaction of the coil and a magnetand the X table is moved along the X guide 27 together with the X linearmotor movable element 30 by the force. Furthermore, the X table can bemaintained in a static state by a friction force generated by pressingthe X brake 33 against the base 24. It is the same for the Y-direction,but the Y brake 34 presses against the X table 25 and the Y table 26 ismaintained in the static state by the friction force. The brake of theconfiguration is pressed from both sides of each table and forces areapplied in directions opposite to each other. Thus, a force other thanthe friction force by the brake is offset.
As an example of the above configuration, the fixing element of thelinear motor may be the magnet and the movable element may be the coil.The movable element of the linear motor may be formed of a plurality ofcoils. In addition, as an example, the fixing element of the linearmotor is formed of a plurality of magnets and adjacent magnets aredisposed so as to form a magnetic field in different directions fromeach other. The above configuration illustrates a configuration of amoving coil in which a coil side is moved, but the linear stage of theexample is not limited to the above configuration. In the linear stage,there is a mechanism in which the current flows through the coil bydriving of the linear motor and the thrust force is obtained bygenerating the magnetic field, but simultaneously it becomes a heatsource by a coil resistance.
Furthermore, it is preferable that the brake is an active brakeincluding an actuator such as a piezoelectric element and can performON/OFF control, but a specific configuration is not limited to the aboveconfiguration and the brake may be an active brake in which a movabletable is maintained in the static state.
An operation of the stage, that is, control of the linear motor movableelement, the linear motor fixing element, and the brake respectively inthe XY-direction is performed by the control system 16. That is, controlof a current amount of the motor described below is performed by thecontrol system 16. A control signal is transmitted and received by eachsignal line between the control system 16 and each member.
Next, a sequence during movement of the stage will be described withreference to FIG. 4.
First, current position information of the stage is obtained byinformation obtained by the laser interferometer (S10).
Next, a driving profile is generated from driving conditions such as thecurrent position, a target position, a speed, and acceleration (S20).
Next, the actuator of the brake is turned OFF and the brake is released(S30) and moving to the target position is started (S40).
A determination whether the target position is within an allowable rangeof the target position is executed in real time (S60) while obtaininginformation of the current position by the laser interferometer (S50).Here, real time means to include measurement at a predetermined timeinterval in which a moving distance of the stage per a time interval formeasuring the position of the stage is sufficiently short.
If the determination is okay, the brake is turned ON (S70), the positionof the stage is fixed to the position, and the operation of positioningis completed.
As described above, the heat source of the linear motor is the coilsection. In the configuration described above, heat is generated fromthe X linear motor movable element 30 and the Y linear motor movableelement 32. The heat amount is greater than a radiation amount radiatedthrough the guide rails and the base and a temperature of an entirety ofthe stage is increased during driving of the stage. On the other hand,the heat amount when the stage is stopped is smaller than that when thestage is driven. Thus, the temperature of the entirety of the stage islower than that when the stage is driven. Thus, if the stage repeatedlymoves and stops, the temperature of the stage is varied and thus apositioning accuracy is deteriorated. This will be described in detailwith reference to FIGS. 5 to 7.
First, a transmission path of heat from the linear motor will bedescribed with reference to FIGS. 5 and 6. Here, in order to considerheat transfer during stopping of the stage, an ON state of the brake isillustrated. FIG. 5 illustrates a transmission path 51 from the X linearmotor movable element and FIG. 6 illustrates a transmission path 52 fromthe Y linear motor movable element.
Heat of the X linear motor movable element passes through the X tableand reaches the base through the X guide or the X brake. Since the baseis mounted on the sample chamber, the heat transferred to the base istransmitted to the sample chamber and is radiated to the atmosphere. Inaddition, if the sample chamber includes a structure through whichcooling water flows, the heat is absorbed by a temperature controllingdevice (not illustrated) through the cooling water.
The heat of the Y linear motor movable element passes through the Ytable and reaches the X table through the Y brake or the Y guide.Thereafter, the heat reaches the base through the X guide or the X brakeand is absorbed in the sample chamber by the cooling water from achiller (not illustrated).
Here, in order to simplify a heat transfer model, it is assumed that thetemperature is higher in the order of the Y table, the X table, thebase, and the sample chamber. Thus, the heat transfer has a path flowingfrom top to bottom of the view. In fact, a phenomenon in which thetemperature of the table is reversed occurs in a transient state, butsince the invention is not intended to be affected by effects thereofdirectly, here, a simplified model is assumed. Furthermore, in fact,heat exchange occurs due to radiation, but since the amount of heatexchange is small compared to the heat transfer, here, the heat exchangeis ignored.
In such a stage, since a temperature gradient is generated based on thelinear motor movable element as a starting point, the temperature ofeach part is not uniform. In a method for controlling the temperature bymounting a heater on the table, it is difficult to simulate such atemperature gradient. Specifically, in a practical apparatus operatingstate, since a main heat source is the actuator, the temperaturegradient changes every hour and the portion in which the temperaturesensor is present can be controlled to be a desired temperature, but itis difficult to keep the entirety of the stage at the same temperatureat all times. If temperature control of the stage is performed by thetemperature sensor and the heater, a large number of the heaters and thetemperature sensors are mounted and very complex control is required soas not to interfere each heater control. Furthermore, since the heaterand a control device for the heater are required, it leads to anincrease in cost.
Furthermore, in the stage configuration in which a heating section(coil) of the linear motor is not moved, it is easy for the fluid toflow through the heating section, but if the coil that is the heatingsection is movable, a tube through which the fluid flows is moved inaccordance with the operation of the coil and if damage such as rubbingoccurs, there is a risk that a vacuum inner vessel is contaminated.
Next, in a case where the stage repeats moving and stop, the temperaturechange of the stage will be described with reference to FIG. 7.
A broken line 60 of FIG. 7 indicates the temperature change of the stageof the related art which does not implement temperature countermeasures.When the apparatus is operated, since there is the stage operation, thetemperature rises and when the apparatus is not operated, thetemperature is lowered. Thus, the temperature of the stage is greatlychanged by an operation time, a stage operation frequency, and anon-operation time. Here, the operation time indicates a time during thestage being actually moved and the non-operation time indicates duringthe stage being stopped.
Thus, in the example, therefore, a thrust force is generated in thelinear motor within a range of the friction force (the maximum staticfriction force of the stage against the guide rails) or less whileapplying the brake during the non-operation time. That is, maintainingthe static state of the stage and when the stage is maintained in thestatic state, the current amount flowing through the coil is greaterthan the minimum current amount required for generating the thrust forcegreater than the friction force of the brake. Moreover, in the linearmotor mechanism, as described in a third example, a correspondingrelationship between the coordinates of the stage and a current value,that is, a relationship (hereinafter, referred to as current profile)between a magnet position of the linear motor fixing element and thecurrent value flowing through each coil is set and stored by a driver ofthe linear motor. In the linear motor stage, the most thrust force isobtained generally when the current amount of the coil of each phase isa current value corresponding to the coordinates of the target. Thus,the phrase “the minimum current amount to generate the thrust forcegreater than the friction force of the brake” herein means a currentamount generating the thrust force greater than the friction force ofthe brake in a phase of the optimum current profile to generate thethrust force to the stage.
Thus, it is possible to generate heat from the motor portion similar tothat when the stage is operated while maintaining the static state ofthe stage. Specifically, when the friction force of the brake is equalto or greater than the thrust force of the motor during the stage beingoperated, since the same or more current amount that is needed duringstage being operated can flow through the motor, the heat generation canbe about the same level. In a case where the current to the linear motoris controlled by using the method of the example, the temperature changeof the stage is a solid line 61 of FIG. 7. A symbol TO indicates atemperature reached when the stage is stopped and the warming upoperation is performed in a sufficient amount of time. Hereinafter,performing control to generate heat in the linear motor while theapparatus is non-operated is referred to as the warming up operation.Specifically, in this specification, “warming up operation” means forthe current to flow through the coil of the linear motor so as to applythe thrust force to the stage while maintaining stopping of the stage.
FIG. 8 illustrates an operation rate of the motor if the example isused. Here, the operation rate of the motor indicates an average currentamount per a predetermined time for a rated current of the motor and theheat amount of the motor is great as the operation rate is increases.The predetermined time is a time interval used to calculate theoperation rate of the motor and, for example, may be a constant timeinterval or unit time. The operation rate=average current÷rated currentand is preferably and usually 1 or less considering a risk of burnout orthe like of the motor. A horizontal axis of FIG. 8 corresponds to ahorizontal axis of FIG. 7. The operation rate of the motor is an amountcorresponding to the current amount to the motor and the heat amount perunit time.
When the stage is operated, the operation rate of the motor is D1 andwhen the stage is not operated, the operation rate of the motor is D0.Here, if the motor is operated at D0, if the brake is not applied, thestage is driven and the brake of the friction force greater than thethrust force when the operation rate of the motor is D0 is applied.Thus, it is possible to maintain the stage in the static state.
Moreover, as described above, in the example, the heat amount generatedin the linear motor during the non-operation time is equal to the heatamount generated by the operation of the stage during the operation.Thus, it is possible to reproduce the same heating situation as theoperating state even in the non-operation state, but in practice, theoperation rate of the motor during the warming up operation iscalculated from a past stage movement record. Thus, a difference betweenthe operation rate of the motor during moving of the stage and theoperation rate of the motor during the warming up operation occurs.Thus, both do not have completely the same operation rate. Nevertheless,if the warming up operation during non-operation of the apparatus can bethe operation rate close to that of a practical driving state, thetemperature change is suppressed as shown in the solid line of FIG. 7.
A calculation method of the thrust force applied to the linear motorwill be described with reference to FIGS. 9 to 11.
FIG. 9 illustrates the current flowing through the linear motor movableelement (coil) when the stage is moved intermittently. During a stand-bytime of the operation of the stage mainly consisting of an accelerationsection (a), a constant speed section (b), and a deceleration section(c), obtaining of the SEM image, a transportation operation of thewafer, and the like are executed. Here, in the constant speed section(b), since a slight thrust force is required by a rolling resistance ofthe guide or a viscous resistance of oil, the current flows. Inaddition, in the deceleration section (c), on the contrary, since a loadof the motor is reduced by the rolling resistance of the guide or theviscous resistance of oil, the current value is smaller than that of theacceleration section (a).
A heat amount W of the coil can be obtained by the following Expression.W=V·I=Ω∩I ²
Thus, the heat amount generated per unit time by the current of FIG. 9is as illustrated in FIG. 10. If a total operation time T divides afilled area, an average heat amount Wa during an operation can becalculated (see FIG. 11). Next, it is possible to obtain an averagecurrent amount Ia from the average heat amount Wa by the followingExpression.Ia=(Wa/Ω)^(1/2)
It is possible to continue the heating state equivalent to the operationtime by flowing the average current amount Ia through the linear motorin the non-operation time. However, the upper limit value of the thrustforce is calculated in advance such that the thrust force exceeding thefriction force of the brake is not generate and it is necessary toelaborate a control method to prevent the thrust force from being theupper limit value or more by software or electrical hardware.
The current value flowing during the warming up operation, that is, thethrust force generated by the linear motor during the warming upoperation can be determined from the past history of the thrust force.Specifically, a thrust force command value (current value) during movingof the stage is stored in a storage section such as a memory and thethrust force can be calculated from thrust force command value logs andthe operation time accumulated in the control system when the operationtime is completed. That is, if an integral value of the current valuesover the total operation time is converted to the heat amount and isdivided by the total operation time, the average heat amount per unittime is obtained. Thus, the current value corresponding to the averageheat amount may be a current amount flowing during the warming upoperation. Moreover, here, for the sake of the description, the totaloperation time is averaged, but a predetermined time range to be objectfor calculation is set and the set time is averaged.
Thereafter, it is determined whether or not the thrust force commandvalue exceeds the friction force of the brake that is set in advance andif the thrust force command value does not exceed the range, the valueis employed as the command value during non-operation. On the otherhand, if the thrust force command value exceeds the friction force ofthe brake, the upper limit value that does not exceed the friction forceof the brake is applied as the thrust force command value. Here, if themaximum value is set considering a safety rate to the friction force, itis preferable because the stage is in a stably unmoving situation evenif there is an influence of the temperature or an influence of changesover time. The process of obtaining the current amount described abovemay be performed each time when a series of the sequence is completed ormay be performed each time when a plurality of the sequences isexecuted. Also, it may be performed for every predetermined time.
In the practical apparatus operating situation, a stage operation isexecuted in accordance with a sequence that is set in advance called aninspection recipe. FIG. 1 illustrates an example thereof and thesequence operation can be classified into operations R1 to R4.
A symbol R1 is a wafer transportation operation time. In R1, sincemoving of the stage is not present, the current value of the motor is 0.A symbol R2 indicates an alignment operation in which a plurality ofpatterns on the wafer are confirmed and the coordinates of the apparatusand the coordinates of the wafer are combined. In FIG. 12, it is assumedthat the stage control is jerk control in which the acceleration isgradually increased and decreased. Thus, a graph of the current valuehas a slope. In FIG. 9 described above, the acceleration and thedeceleration are assumed in which the acceleration has a constant valueand the jerk control is not present. Thus, the graph of the currentvalue comes to have a rectangular shape. Of course, also in R2, asillustrated in FIG. 9, the acceleration or the deceleration may beperformed by making the acceleration constant. The following is the sameas R3 and R4. R3 is an operation to actually inspect. In R3, since thestage moves to many points within the wafer, a moving distance per onetime is short and the process proceeds to the deceleration withoutreaching the maximum speed. Thus, the current value flowing through themotor is also small. R4 is an unloading operation of the wafer. Thestage moves to an unload position and then it is in the stand-by time.It is possible to derive the average heat amount Wa based on the historyof a series of the stage operation. Thus, for example, the averagecurrent amount during the warming up operation may be obtained in thenext wafer inspection process each time the wafer is unloaded.Furthermore, if the wafer is continuously input, since such a stageoperation is continuous, it may be a calculation target until all waferinspection sequence is completed. Thus, calculation accuracy is furtherincreased and it is possible to obtain the command value during thewarming up operation matching the actual conditions.
Furthermore, as another method, if the recipe of execution scheduled isknown and the stage moving profile can be predicted to some extent, itis possible to calculate the current command value during the warming upoperation. That is, the time average of the thrust force that occurswhen the stage is moved as the operating schedule is guessed based onthe future operating schedule of the stage and it is possible todetermine the thrust force (that is, the current value flowing throughthe coil of the linear motor) during the warming up operation based on aguessed result.
Furthermore, as another method, there is a method capable of efficientlycontrolling the temperature of the stage by calculating the temperatureby expanding the time such as for every hour, for every day, and forevery week.
For example, if only the inspection recipe observing one wafer iscalculated, as illustrated in FIG. 13, in a situation in which theoperation rate of the apparatus is low, non-operation of the apparatusis long and for only the observation of one wafer, as illustrated inFIG. 14, the temperature of the stage is not likely to rise andimmediately goes back to an original temperature. Thus, also the nextinspection is completed almost without receiving the influence of thetemperature change. On the other hand, as illustrated in FIG. 15, if thecommand value calculated only by the inspection recipe observing onewafer in the non-operation state of the apparatus is continuouslyapplied, as illustrated in FIG. 16, it is possible to constantlymaintain the temperature of the stage in a state where the temperatureis relatively high. However, power consumption is set largely by flowingthe current corresponding to the situation in which the inspectionrecipe continuously flows even in the non-operation state of theapparatus.
As described above, the time of the non-operation state of the apparatusis also included in the calculation of the command value by setting thecalculation range of a predetermined time interval. Thus, if thetemperature change can be allowed to a certain extent, it is possible tosuppress the command value applied during non-operation of theapparatus. FIG. 17 illustrates a state where the time of thenon-operation state of the apparatus is also included in the calculationof the command value and a current smaller than the current of theoperating state is set in the command value during the warming upoperation. As a result, as indicated by temperature curves of FIG. 18,there is a slight temperature change during the operation of theapparatus, but since the change is small during the non-operation,entire power consumption is suppressed. Thus, it is possible to suppressthe temperature change. However, since the temperature change relates tovarious factors such as specific heat of the stage, driving conditionsof the stage, the operation rate, and an exhaust heat capacity of thechiller, it is necessary to grasp in advance a correlation between thetemperature and the command value during the warming up operation by anexperiment.
Second Example
Next, as a second example, a control method in which a temperaturesensor is mounted on the stage and information thereof is fed back tothe command value during the warming up operation will be described withreference to FIGS. 19 and 20. Hereinafter, a description regarding thesame portions as the first example will be omitted.
In the first example, the operation rate of the stage is predicted andthe current of the motor is set, but if the frequency of the inspectionis greatly changed by time or if a recipe in which the operation rate ofthe stage is high and a recipe in which the operation rate of the stageis low are mixed in one inspection, it is difficult to accuratelypredict the heat amount of the motor. It is easy to maintain a constanttemperature by mounting the temperature sensor on the motor andcontrolling the current amount based on the information of thetemperature even if the operation rate of the stage is different.
In the example, a structure in which a Y brake is disposed at the centeris described. A temperature sensor 50 measuring the temperature of thestage is attached to the stage of the example. The temperature sensor 50may be attached to the stage of the structure described in the firstexample. Hereinafter, portions different from the structure of the stageof the first example are described.
In the stage of the example, a Y linear motor (Y linear motor fixingelement 31 and a Y linear motor movable element 32) is mounted on a sidesurface of an X table 25 and a Y table 26, and a Y brake 34 is mountedon a center portion of the Y table 26. Two Y brakes 34 are configured tosandwich a guide rail 38 from both sides and has a structure that canoffset a pushing force of the brake. The temperature sensor 50 isattached to the inside of an electrostatic chuck 23 and monitors theinformation of the temperature in a control system (not illustrated).
The control system performs feedback control of a value close to thetemperature of the operating state of the apparatus to a command valueduring the warming up operation as a target temperature. That is, if thetemperature is lower than the target temperature, the current less thanthe friction force of the brake is applied, the current value isdecreased in the vicinity of a target value, the feedback control isexecuted, and thereby the temperature is always close to the targettemperature.
In this case, the command value and the temperature of the electrostaticchuck are indicated in FIGS. 21 and 22. In the example, PID controlbased on the information of the temperature sensor is assumed. That is,the current flowing through the coil during the warming up operation isdetermined such that the temperature measured by the temperature sensoris within a predetermined target temperature range. Control is performedsuch that the current flows at the upper limit value IL at first becausethe temperature is much lower than a target temperature T and thecurrent is decreased if the temperature is close to the targettemperature T. However, since there is a time constant of heat transfer,the temperature is increased and overshooting is caused, and then thetemperature converges in the vicinity of the target temperature. In theexample, a case where a difference between the temperature of theapparatus and the target temperature is great immediately after startingof the apparatus and the like is illustrated, but the temperaturedifference between an actual temperature and the target temperature issmall during practical operation. Thus, the command value of the warmingup operation is not changed so much and it is possible to constantlymaintain the temperature of the electrostatic chuck in the operatingstate of the apparatus and the non-operation state of the apparatus.
Third Example
Next, a third example will be described with reference to FIGS. 23 and24. In the example, an example is described in which the warming upoperation described in the first and second examples is performed ineach position by moving the stage by a predetermined distance for eachpredetermined time.
First, a structure of a linear motor is described. Typically, the linearmotor is often configured of a coil of three phases (U phase, V phase,and W phase), and a plurality of same phases are used as each phase isone movable element. In FIG. 23, the movable element is indicated inwhich two coils of each phase are arranged. Linear motor movableelements (30 and 32) are configured of a total six coils consisting of Uphase coils 35, V phase coils 36, and W phase coils 37. In the linearmotor fixing element, a plurality of magnets are arranged such thatadjacent magnets generate a magnetic field having different directionsto each other.
FIG. 24 illustrates how the current flows through each phase in eachcoordinate if the stage is moved. A stage coordinate of the horizontalaxis of FIG. 24 means a coordinate (for example, value measured by thelaser interferometer) with respect to a reference position in the stage.A vertical axis of FIG. 24 is a current value flowing through the coilof each phase and a corresponding relationship between the coordinatesand the current value, that is, a relationship (hereinafter, referred toas a current profile) between the position of the magnet of the linearmotor fixing element and the current value flowing through each coil isset and stored by a driver of the linear motor. In the linear motorstage, in general, most thrust force is obtained when the current amountof the coil of each phase is a current value corresponding to a targetcoordinate.
| 23,298 |
sn83045462_1916-03-30_1_2_1
|
US-PD-Newspapers
|
Open Culture
|
Public Domain
| 1,916 |
None
|
None
|
English
|
Spoken
| 6,538 | 9,631 |
American observers have, as it would locate Villa some forty miles north-past of Namiquipa, instead of twice that distance to the south, where previous reports have placed him. Villa Has Scattered His Forces. The explanation which is generally accepted here is that Villa has adopted a time-honored plan of deceiving his pursuers. He is believed to have scattered his forces into several hands, which band travels in a different direction. dispensing the information that the chief fugitive is with it In the absence of any definite information. there is little left for anything except speculation, but Americans here who are not only well acquainted with Mexico, but know Villa himself and his habits of mind, are unshaken in their conviction that he is in full flight to the southeast. They point out that the district around Parral is the logical place for him to make for, as he has thousands of sympathizers there, and the constitutionalist government is almost unanimous authority except in the heavily garrisoned towns. The persistent calm which has reigned over northern Chihuahua for the last two weeks has created a feeling of optimism in some circles here, which is strongly in contrast with the pessimism that was general when the Americans were first sent across the border. Washington Has Shut Down on All News About the Use of the Railroads in Mexico SAN ANTONIO, Tex. May Washington has imposed strict secrecy on Gen. Kunstert regarding plans for using the Mexican Northwestern railroad under conditions imposed by the Mexican de facto government. He would not say today whether the Mexican government would not allow the Mexican government to use the Mexican railroad under conditions imposed by the Mexican de facto government. The immediate use of the line would be ordered. Cen. Fuoston received a code message from Washington last night regarding the railroad question. It is believed to have contained instructions for use of the Northwestern under the agreement with Carranza and orders that supplies be tendered for shipment from El Paso to Casas Grandes. He declined to comment on the text of the message or to say what action is contemplated or has been taken. Hope was expressed in military circles that further negotiations between the State Department and the military will result in the acquisition of certain concessions by which the shipping problem will be made easier. For one thing, the army desires authority to place guards over supplies to transit from the port if the goods cannot move as commercial freight. Because of the feeling that the railroad will not solve the transportation problem, under conditions imposed for its use, the operation of motor trucks between Columbus and the field will be continued for the present, according to information secured here. CARRANZA RAISES PAY OF MEXICAN SOLDIERS Hereafter, They Will Receive Fifty Cents a Day, in Rations, Not Money, However. MEXICO CITY, March. In a circular order, the minister of war, Gen. Obregon, has advanced the pay of private soldiers at five cents daily. This will be in the form of a $50,000 bond issue. ration, the allowance to take effect April 1. The order also calls for a pension to all widows and orphans of soldiers killed in a revolution. The pension will amount to one half of the daily pay of the soldier. It will become effective, May 1. This will be the first organized pension system ever introduced in Mexico. The constitutionalist government has demanded the recall of the Spanish vice consul at Aeapulco on the charge of interfering in Mexican internal politics. MERCHANTS BEAT ARMY TO FRONT WITH SUPPLIES. Rean Financial Harvest by Having Goods at Casas Grandes When Expedition Arrives. EL PASO, Tex., March 30.-American business men have beaten the American squadron in their attempt to supply supplies to General Pershing's expedition against the Northwestern railway, according to a dispatch from the Northwestern railway, according to a dispatch from the Northwestern railway. Mr. William Elliott, the American consul at the field base, had been informed that American merchantmen at the field base had suffered in several carloads of supplies south of El Paso. Two weeks ago, Mr. Elliott said, an American ship, up from Casas Grande, had made a successful trip to the east, carrying supplies to the south. The mail, it is said, was ready for the approach of the expeditionary force and escaped a harvest because of his foresight. Three loaded freight cars consigned. to <asas *\ ran des went over the river ! todav. d "pat' hed bv a 'oral wholesale + O0REGON RECOMMENDS EXPULSION OF ALIENS v r.'-r.i.m.", ...--a,' "<< ? ; furtheram e of the jceneral plan t?> expel foreigners from the country under article 33 of th" constitution. Minister of War Obrexort sent a communi'MiKm to Minister of Korrisn Relations Aguilar ycniT'lay. recommending that a:l foreigner ? 11 v.: in the republic who arc known to hav?: aided enemies of the constitutionalists' cause be ixrr?ar'i!?cs of ail former amnesty dr. -e?s if spf< ,al safe ond ts T :c rommunir ation closes as follows I he.jevc b> this rtiOHfis that w - v\ i 1 a voi'! tn t r f -.turc hav ? a K r at j number ?-f for?-ipn?-ry . n w.trrurilubiy j mix n Hie internal affairs of ?uj ountt.. It is reported that, among the number of passengers are on the list for expulsion. PEONS OF MAZATLAN IN ANTI-AMERICAN RIOT SAN? March 30. Mexican troops there, surrounded by the streets of Mazarin, have threatened to do harm to American residents here who, according to Francisco Villa, are ordered to stop the spread of the rebellion. The port, according to Francisco Villa, is in a state of siege. The officials of the port, who have been in the city, are preparing for the attack. Capt. Unucha said, has said that he was not apparent anti-American feeling among the more educated natives. AERO TRIPS TO TROOPS TO BE RESUMED TODAY COLUMBUS, N.M. March 30. Re-sumption of the army's dispatch line, which has been suspended temporarily because of climatic conditions, is expected today. Lieut. Edgar S. Gorrard said that he planned to start a flight to Casas Grandes and the planes from the front. For three days, there are expected to arrive. Lieutenant Gorrell prepared to carry more than 100 newspapers from various sections of the United States, for which the troops had asked. Reports received at the base cantonment hospital here spoke well of the stamina of the men at the front, percentage of sickness being at a minimum despite the burning sun of day and sharp chill of night to which the troops are exposed. A few cases of heat prostration have been reported, four negro infantry, who recently finished a detail of duty in the Philippines being brought here today. San Diego Wants Border Guard SAN DIEGO, Calif. March 11. Because of uneasiness among residents along the Mexican border in this country, officials, it was announced today, have sent a request to the War Department at Washington urging that troops stationed at several towns near the line. It was said there was no fear of an invasion, but that depredations by irresponsible bands were not in possible. HOUSE EXPECTS TO PASS IMMIGRATION BILL TODAY Measure With literacy Test and Oriental Exclusion Features Is Expected to Go Through. With prospects of final action on the bill, the House resumed consideration of the measure. Advocates of the bill predict its passage by an overwhelming vote of the House, which concedes defeat, although the hope to amend the measure in several parts is expressed. An amendment was adopted today modifying the effect of the Humphrey amendment adopted Tuesday, which proposed retaliation upon British Columbia for its exclusion of skilled and unskilled labor. It was discovered that the amendment, as drawn, would operate against Russia, and the new amendment, as adopted today, would limit the application to British Columbia. Opposes Deportation Clause. During a discussion of the provision for deportation of aliens who advocate the law here, the House decided that the bill would be a fair and just measure, and that it would be a fair and just measure. was unnecessary, as such crimes are punishable by law. He said that anarchy had ceased in this country years ago. ivr|'iiracin?m>r .Mirinsort "i wasnirrg ten pointed out that there is an organ cation of men who preach tin doctrine < lestruofion of property Represent;)tiv Burnett of Alabama said that the doc rine of unlawful destruction is anarc h' He said that men who want to let su<uen as preach that doctrine go aroun unmolested during the "long, dragging mail pace processes of the courts" at in effect aiding anarchists. The pre vision remained in the bill. SAMUEL B. ROSE DIES IN HIS FORTY-SIXTH YEAI Sad Lived in This City Since 188J Coming Here From Knoxvi 11 e. Tenn. Samuel B. Rose, forty-six \ < a rs ol i-losely identified with the building ii terests of Washington for th'- pa; twenty-six years, died yesterday aftei noon at his home. 4i'.h Columbia r<-a following an iiiro-ss of mora- than thr? months. Funeral services are to \ field tomorrow afternoon at L .'pt o cio? at the residence. Rev. J. J. Muir ??ft [dating. Interment is to b? at <L?lei wooc] cemetery .\fr Rcise was s<-.eo?r m? ruber of ll firm of Rose Hoc H?- had this city since 1SwR?, when h<* came t W ashington from knoxv :!: . T?-nr with his father and brothers. Member of Local Trade Bodies. He was a II . ruber of ' BoarcJ ? Trade, Chamber of Commerce, O Build'-rs Kxchang-e and of The Mare; Il? ?"S. B'snlrs i.is w.fr. Mrs I Konf hi u <?th?*r. Mrs \hr r W Kos ;?* ?l i hr? f chiblr u. A!?n<*c W . Mrrin H ;< rr^i Lillian May l{os?*. th?* followir I'rofhffami sist'Th are livinw Wi Imiii II ami 'wr ll"s.-. Mrs l!oh?* L. I'layton ami Miss Lillian Kos#*. all this ? il\ ;n:'l Mrs M L. Arnlfsmi :i i Mrs. f'hart?*s K?liriK'"M. both ?>f Kno. v 111??. T'-nri. ENTOMBED BY EXPLOSION Nine Miners Being Sought by Part of Rescuers. JOHNSTOWN, fa. M;,r.h HO Ni, : ' rs art- reported t<. havf hi^n #m t<?ml.i?J t'ala;. |. an >. p l?.s i< ?n in ti tft i hp > t th?' ? V.n^ma nj*h Srnok< I> ?"<>al < < nipany. at Seward, ri^ht mil fr?-:r? lure \\ "rKiiig <.;('? fully, r * s < 1; r s jur.t t r a ml th? for a fi l s Lt !!? * of 'J (i !? r > *: t iiPraii,'"' "J THe smoke i is w unable to locate the me - monsr whom was Sup*. John Wndde The initio b;: S Jn?t been Operated ? :15>;i< ity. which accounts for the wriir: .number o! miners at work when tl xjilosion occurred. LEADING FOR GOVERNOR D: C. H. Brough Runs Ahead L. C. Smith in Arkansas Primary. I.ITTI.K I.' ? K. March :i" Relur r tv-1 today from >?sterdays |?: mat;, election in tii.s state incrras t i I? . 1 of In. Charles H Hrounh l-'.i > ?-t tevil.e over I.. C. Smith of l?ew .. . j 5 * ox.:c.7,"h.i votes in the ra : ,: j 111 k u i'? : ua t o: i n 1 numi riat ion K.tt \\ Houses, present K-lai y of sta . J,.. ; , f | ;. \\ S rUlilliriK (lose v\ i .Indue S n:! t r. Thomas ? '.i rnpbell, in t t . i ral d.str ict Otis \V inj<Of in ? font tii. San o-l Imv.s. in ttie sixth. \\ \ < I nod\v : n. m tin seventh. w? > : - .1 : I.S Til'- otllfl T lit A !: fit * i v ' -ssiu ? n wrr?- i] riojfjiMsi K;u 'ii > on t he ian' for national co in t I ? ri . fi wt-t'f not available. DELAY OPERATION OF RULE Tlio n k u la f ton requiring sterilizati <.f glasses and oth< r contajn?TH *1 ?*- *i establishments where beveraxes fl isperised. soiled u ! '! to heroine eff< live July 1, will not he put into op< ation utitil after its practicability b been established. This was decided on today at a lie; : rv. given by the < 'oiniiUHfiOlters to t IMstrict of Columbia Retail I ?ruggis Assoclat Ion. As the result of confli iiik testimony as to the costs and d Acuities that will be experienced com pi v in sr with the proposed law, 1 < 'ormnissioners determined to consi< the matter further with a commit' represent!ng the druggists, saloon a restaurant proprietors and owners other establishments where drinks i sold. J ;s: ARMED GUARDS P PLIES re iCch ? n - ' ??????? hp _ hp ^8^*1 h p i^B^S^BBS^i ty X?*? 1 v p n t I > e a r n s ^ II Y^?-; >? y^?-I-P-S ; " " ^ I 1? '" x| I'PI.IK.S KOR TilK 7.noil MI-:\ OK kw-iih.i is tiii: mi. motoh " ! i nix I'tRTin i.ir n iirnsK i IKRRI) SOI.DIKItX hiihm. ox ti XX RI'ITIIIZFIIS. SENATE CONTINUES ;| ARMY BILL WOR t i r1 | Both Majority and Minori Are Hopeful of Prompt Actio on Measure. More serious opposition has been made to the bill, which is a substitute for the bill. The Senate today continued its work on the army increase in which is a substitute for the bill. Both the majority and minority sides are hopeful of prompt action on the measure. The bill was sent today to the Senate for amendment to the bill. Chairman Cham to the committee was determined to keep measures, yet it is expected that the bill will be pushed until disposed of. It is expected that the bill will be pushed until the Senate is disposed of. If the bill is not yet passed, it will be pushed until the Senate is disposed of. u. provision l!<- ?.' > not 1. -11 v - t " National 4 i I should l.?* US*-') as n l.asis foi a f-S'-r \ e force, and lave o instead, t pro\ ;si<m for the r; ?-a and training of a \o!unteer force urn I supervision of federal ann\ ot! I'ropo.-ci a mend aj.-ni s i" ail t atoe r>f defense measures i.rovidinv; for *i< ; f-rnmoi! manufaet ur< of annnuint: i- i an'l armament will )>< ["'imi' led i e.urie to a vote i" If: 11" IS* as a . j suit of file House d? rrio'-r.'i t : * *auj rlerision last f! isrh t Tim ruleu ?> e, in If tee was i r;st. I i;ef ,-r| to tome in in rule making in orde; fh< propo: 1 ~ amendm e r.' I- The a' ti'.n <?f th'- , ;i ..-as was a v ' ' torn. for a d \ o.-;, t . of govern rrn r,f ma riu fa of jr.- who fearer) that th bills W" ild die m roinioilti'o l.erai b-- of the f. i t thai the defense in ea SI had riot h- etofore l.ccn subjeet a mend men t Urged by Speaker Clark. ; The plan for n <> v?. rn m en t mainif; y | 1 I'-e was strongly uryed |.y Sfaa I : H:i \ of the n 11 i 11 ;i ry committee j Assurances wi-if u i v? 11 I. f * 11;?i m i ' "f the ?.: %,.! commit tr-c tl j 'lis. corn m 111 f>- w-.ul'l v??t?- Tiifj-"i|:tv ss j ih?- Senate armor plate factory hill. FOR $20,000,000 PLANT. t i.o Du Pont Company Proposes to F 1 j nish Nitrates to Government. j j' ) CV.unK' 1 for tlir K. J, du I'ont do t<.' mours Company has informed Sec mi l __ KING OF BULG/ . * fiMpSaSjZgjjflufjESL t i Ri a ii liSfl?fi?a2 t..IjwjjMLgyJfcL'. ^aaaaysw mtfS/&Sl? ik of) ; 4x^| '1'' *." ' ^ o?tv, rtif. *? ? in h f wmmmmammm????~i^mmmmmm^mt i n if r tff kl.\(i ok bl i.4.ahia (i), his p "'} jekow (31. ox a \isit t ire america. Minns THR arci escorting him to the a ROTECT MOTOR TRUC TO U. S. TROOPS IN * >-> : .i. jjpKflpM ' ".}#*?* :**?&> Tin: I MTKII SI XTHS FORI I.S l\ >IK\I<<! Tim KS \Y III<11 Tin: I M i l l) SI XTHS 111 xx row'kx illi:xi. ii-: xix< iiixks \ki: i?i:\m to iii:sist tary Rakpr that tit.1 mnipany stands! ready to I?11iId a great hydro-electric plant for- taking nitrogen from the air, ami to make tin- product a.vailahlft to mm the govprnii,- at for the n anu fa it nrf of W - xplosives at prions fixed by the See |1 retar y of War, if < "onjrrrss will clrmu" ll existing water pow ' laws, so as to make such a projeet practica hie. It was explained that the company cont eiiipla ted const rial i n u a plant costing w | $or more and capable of fut t * y | nishinjr ill the nitrates now iniportol j from I'htle. Spi-fcta rv Baker declines n to say what would he his attitude toward the project. 'FINEST7 PLAYGROUNDS : OUTLINED BY COL. HARTS of Makes Fourth Lenten Talk at y | Rauscher's and Tells of Plans for Potomac Park. Plans for what is proposed to be the finest public playground in the world were outlined by Col. W. W. Harts, in charge of the office of public buildings for the fourth time. The talk of fixing sanitary conditions in the city was discussed by Dr. George K. Bojverman of the city's president. " j Tliis pirt yu round. v. i.i.-ii is to he !<?? ::; - i' ii; Potomac I'.-irk, tin* p. ninsula J 1 ,rv! south of the present d<-vlopi'l area of ' '^'"jthal section, is to octjp;. ? of ;,tf* j 37? fiCP'S. according I" Co] Darts The '.at , j-r.}*! for its const i a.-? ion is ? -1 > ma t? ?t p;i- | at ? ! . ami .* expect ?*?i that: it : I j will be cop! p!?! ?<i wit h-n t.-a > cars. j i ' ? The ia rue plan which w a s x . i i 1 i2- : pc during the course - lecture is the H j sixth to ha \ bed constructed sisc ? flic iii?'?'pl:"fi of : . !UC. ami < ' o I ! Harts statc.j ;t is ..t present in j' lav I'll, hands of t 5.o , r< - - i on a 1 .apf.ro j ! ltd ! | W 1 a t I n ;; s < om ti; . t ' . atid !i:a! ll?' IS j ,|u. jia ad> to o i p ; i: i ; a | .! u > ,< j u a i , fi .'<!! y to!, a | | To Encourage Small Boating. 't011 j The plan pro-, op- for tin nr.? strur- j I noil of ;< < . i tii' !, <ut!ir- I!).' II i h ]:t ' _ , j ! M I ! : jnu. : I <" ; . "I 'A I'll tip4 I be . to . s i J f. _ in , >V ! ??: I 1' I ? ! IT o . ..nn ini.iMrs the l"M t (1 : ' I : Of I I,. : I.Tfr?.!:l of r(..(?:!' I.... . w it n .? v .-u |o . i.i ; u?u . t fit. ,13! w I h I I: y i. r . 1 i 1 1 J l of tii,. pro-.' ru - | J" ' !' ' ' 'r a ; A t o n u, ?! ' - p; fi for T it'* i se?l 1 pja> round iiOr'i' of Th" ? ;> n a i ;t If ;i J i l:? r u?- p;i r.t '!? lttii'I ! ' i. 1 : , ,j i;, 1. . : Miotid. , foot hall :*,'2 fmnis i'iit { e< iii'. i ha > k?-t hall fields. 1.' Iarg;e j r;r filtered Rwimming pools and a wadingf jse pool ; 1 ! i i L.? I u - ; j -. i lot r|i, . iff ; 11< 1! J O 1 Largp Stadium Planned. There is a large area, ordnance to the plans, a large house with 1000 workers and many baths and a stadium of at the point of a point. The plan is considered to be that this strip of pavement may be the seat of the Army and Navy for the United States. On South of The Hudson, one of the most significant of these holes is the one that is being done at the present time about small playgrounds for the children. The plan is believed to be that they do not fall under his supervision. Edward J. Wall of the United States Department of Education, has been appointed to the position of the superintendent of the schools. 11)1 KK FREDERIC MEETING THE KING L'STRIA A UEADUL ALTERS. % KS CARRYING SUP- PI MEXICO. 01 oJ ' *? %% Q OS Ma yeai ^SOU' - was flP^^'- ivh i ^ PP^^T "' - *r^x* ' :! "*; >t -';" _?. > '? .<-?-?' - j?fc; ** * _'JiJ&Qr- * H os * #*& - :' * >. '.-,>. ft; -' . - ' rtoi, r- i, ? f ' "^- x;. ' ... owi I __ S|?P? _____???? ,he erci i \RK IIKI\(; SHIPPF,|> TO THEM AS Kvp i S PI, A rEI) I A TO TIIK SER \ H 'K FOR fvn min WA POSSIKI.F, ATTACK R\ A 11,1, A jnp A mar EMBALMER IN PECK p fl VP CASE STILL MISSING 1 1 bp ? : as I t ha Eugene 0. Kane Is Charged ;;;; With Conspiring to Hide ; ? a Crime. M TOOK S9.000 HE OFFERED. and DR. A. W. WAITE DECLARES ?? -his recj ! f Attorney for Latter. Accused of Mur- ,,, v ;< n dcr. Denies Prisoner Contem- He for: plated Insanity Plea. has full abo Nl'W Y <' P K. Marc h 30.- One impnr- ant; 'ant wiincss rb sir. ?i by tho district at-? !orn**v to romplf-t" the chain "f cvi- *'al ge n I'-nc in the Peck murder case was still Kt., missing early today. llo is Eugene j sioi >. Kane, the embalni'-r who. according j io It. ,\;tlnir Warren Waite, accepted rs in cash as part payment of acci ?J'i cO't Walt*- was to have given him to 1 mor tor swearing that h< used arsenic in (jUf? mbalniiiig the body of Wait, s wealthy hos] father-in-law, .John K. Peek, of Grand 1 l:, " ' Conspiracy to Hide Crime, Charge. More than twcritv f o u r It ours have v^. iciss'-i sin.. d?iectives began their flep; ? a r?'li ft. I Kane ;n this city and in Long Island suburbs. The district atevei has ordered Kane's arrest on a j ^ 'lis. r g <- of cot,;-pi; ; r: g to hide a crime. I wish to question him also to whether others were involved in the alleged conspiracy near the city, bearing the photograph and the photograph of the deceased. The photograph was sent broadcast from police headquarters today on feet of the district attorney. A detective was detailed all night at the home, but he did not return, her. Mrs. Kate said she expected her husband to come home today. John S. Potter, the undertaker who resides at No. 1, had charge of Mr. Perkins' funeral, and was placed in charge of the examination last night, related denials that he had any part in the supposed plot. Dr. Waite still at the hospital. Dr. Waite stated that he is in the Bellevue Hospital. The district attorney expects to be an indictment of indictments for the case by the end of the week. "Wait." Attorney Walter P. Duel, now in the client's client, had no intention of calling the groundwork for an insanity case, which he told the district attorney. That an effort which he called "the asylum" drove him to prison. Mr. peel-, and his wife Houses Passes the Lever Bill. noo The Lever bill, authorizing the census representative to collect and publish monthly statistics of cottonseed and cottonseed products, was passed by the House late yesterday after an all-day debate, and now goes to the Senate. HEADQUARTERS B.,; I have ? run fPSlBi em| imt*( ami n# /mm hen re;t< nue 1 and __ 1 sect t w o a nd (111)1 KK. FREDERICK 12> A.\D GEN. g"c< 'HIS PHOTOGRAPH, RECRVED IN OF BILL GAIN AT THE TRAIN AND # [RUCK By AUTO, DEATH FOLLOWS s. Margaret Everly Victim : Accident on Pennsylvania Avenue Southeast. BULANCE IS DELAYED BECAUSE OF SPEED LAW j. Pullman Previously Had Is uea uraers That Ambulances Should Not Be Detained. rs. Margaret Everly, sixty-two rs old, from North Carolina avenue theast, last night about 7 o'clock ' knocked down by an automobile le Crossing Pennsylvania avenue r 7th street southeast and so seriously injured that she died at Casualty pital four hours later. It was said 'asualty Hospital that there was a iy in reaching the injured woman ng to an effort to comply with the d regulations following notice from police that more rare must be exercised in the matter of speeding. Mrs. Fry was so seriously injured, how that the loss of two or three minutes probably had little or no bearing on her case. Casualty Hospital this morning, superintendent stated that a police yesterday afternoon notified her that the speed law of twelve miles an hour applied to ambulances as well as her vehicles. The police, she added, that an excess of four or more miles an hour probably would be right. apt. Henry Schneider of the ninth said he sent Bicycle Police Cox to the hospital with instructions to inform the superintendent that the speed of the ambulance must not be great as it had been in the past; the chauffeur must, be careful, but the emergency cases no notice would be on if the speed limit was exceeded, said he suggested that an excess of or twelve miles an hour in some cases would be permitted. No Limit Fixed by Pullman. A. Pullman, superintendent of the Pullman, said he discussed the speed of automobiles with his captains yesterday. He was careful not to fix any limit on the speed. What he impressed upon captains, he said, was the fact that less driving must be stopped if the captains, he said, were told that under any circumstances, must be detained or delayed, said the police must get their initiation and present it after the run was made. A. Pullman said a man had been given by one hundred oral complaints but the speed of hospital ambulances, as long ago as last June or July, discussed the question with Dr. Lewis, superintendent of the Emergency Hospital. Not very long ago, he said, Mrs. Newman, wife of Dr. Newman, came near being run by one of the ambulances. Coroner Nevitt viewed the body of Everett, heard statements of the accident, and ordered a jury summoned to hear testimony at an inquest at the inquest this afternoon. It is said the station of loss of time on part of the hospital authorities in reaching the scene of the accident probably will be discussed. Widow of Police Sergeant. Every was the widow of Joseph Everly, who served in the police department as a desk sergeant for about ten years. She left home early last night and attended a Lenten service at Peters Church, stopping at a moving picture theater on her way home, saving the theater. Mrs. Everly started quickly across the street. She was on the south curb inclosing the park and car tracks in the middle of the thoroughfare when she was struck. Mrs. Everly was dragged about fifteen feet. Policeman Joseph Morgan, clerk inspector of the department's office at police headquarters, assisted in removing the automobile from Mrs. Everly and assisting in a nearby drug store, from where she was taken to the hospital by Dr. F. Men were her. The M. M. M'ahe, eighteen years old, of the flood Hope road, was an operator of the automobile killed Mrs. Everly. He stated Mrs. Everly appeared in the path of his automobile so suddenly that it was impossible for him to stop in time to make a stop. He was delayed at the police station and was permitted to go home, soon as he journeyed from the city to the fifth precinct station. He remained until a few minutes before the inquest was held. William H. deputy coroner, afternoon performed an autopsy on Everly's body in order that he might give the jury a detailed statement of the conditions of the ambulances in the ambulances. The complaint of the ambulances is answered by Commissioner Brownlow. The reason for restricting the rate of speed at which hospital ambulances have heretofore been operating, as a rule, is simple and sound, does not believe it is wise to endanger the lives of hundreds of people in need to save two or three minutes in getting to the succor of one. Some drivers of hospital ambulances are grossly abused by the privilege of riding at a high rate of speed by running through the city at a reckless speed when high speed was not necessary. Knowing that the police would stop them, some of the ambulances have taken advantage of the fact to endanger life and limb by reckless running, even when returning to the hospital with the ambulance. Complaints of recklessness. so many complaints of recklessness e tome to Maj. Pullman ami the imissioners and so many observa;s of recklessness have been made the major and the Commissioners % it was determined to require from nilance drivers sortie consideration the safety of the general public, t is very rare, indeed, that any in, or illness is affected by a delay hree or four minutes in the arrival tn ambulance. Practically the only i > in which such a small amount of j e is a consideration is that of lorrhage. ' "he statement attributed to authorior physicians of the t'asualty Hosd concerning" delay in the arrival the ambulance in the case of Mrs. irly is particularly ridiculous. To h ??th street and Penn.sylvania avesoutheast, traveling by way of ?th K streets, at the rate of twelve miles tour, would have taken an ambulance y three minutes and forty-seven )nds; at eighteen miles ati hour, , minutes ;pul fifty-five seconds; at nt\-five rttiles an hour, one minute thirty-three seconds, and at thirties an hour, one minute and fifteen jnds. Time Actually Required. i ro reach 7th street and Pennsylva nia avenue southeast, traveling; by way It of B street and Tth street, at the rate | IT of twelve miles an hour, would have! || taken an ambulance three minutes and i forty-three seconds; at twenty miles J [in hour, one minute and thirty-two j seconds, and at twenty-five miles an ; hour, one minute and twentv seconds. | If the ambulance had been run at the rate of twenty-five miles an hour, slightly over twice the legal rate, it would have only required about two minutes more to have reached thej point where Mrs. Kverly was struck. We are informed that it took the ambulance at least eighteen to twenty minutes to reach the point of destination after the call had been sent in to the hospital. FORT WILL BE MADE TO END CAR STRIKE Toledo, Ohio. Settlement Said to Be in the End Toledo, Ohio. Settlement Said to Be in the End Toledo, Ohio, March 18th - Settlement of the street car strike, which has been in effort during the last two days, depends upon the attitude of Henry L. Doherty of New York, according to an announcement of officials of the streetcar company early today. Doherty is expected to arrive some time today and go into conference with his agents. Mayor Charles M. Milroy will meet the traction magnate and union officials in an endeavor to bring about a settlement. The carmen are firm in their stand, it amounting virtually to an ultimatum. In effect, it is that it is any attempt is made to operate cars with non-union men a general strike of all organized departments of the Toledo Railways and Light Company would be called. This would deprive the city of heat, light, and power. Arrangements have been made for the picket every car barn in the city. KENNET H. L. BEARD DEAD. Private Secretary to Col. Drew's Linard. Foreign Trade Adviser. Kenneth L. Heard, twenty-two years old, private secretary to Col. Crew Linard, assistant foreign trade adviser of the State department, died last night at George Washington University Hospital, following an operation. The body is to be sent to Iowa, his father, C. Heard of that city, having been notified. Mr. Heard was born in Wisconsin. He was appointed to a position in the State department two years ago, and was made private secretary to Col. Linard about a year ago. Collision Proves Fatal. Arthur West, colored, knocked from his motor cycle at 3rd and 10th streets northwest last Sunday as a result of a collision with a taxicab, died at Casualty Hospital this morning about 11:30 o'clock. His death probably was due to a fracture of the skull. Louis R. Ruck, 414 7th Street southeast, chauffeur for the Federal Taxicab Company, who is alleged to have collided with West's motor cycle, was arrested at the time of the accident and released on bond in the sum of $2,000 for his appearance. War Prisoner's Offer. Willing to Come Here to Tell of Neutrality Violations. Franz von Rintelen, a German held in England as a prisoner of war, has sent word to officials here that he can give testimony of value in prosecuting neutrality cases and is willing to do so if permitted to come to the United States in custody, as was Herat von der Goltz, who arrived in New York Tuesday. Rintelen's offer will be considered, but British authorities probably would not be willing to let him cross to this country. Get Your These Gifts Specially Priced by All Consumers and Satisfied Customers. Pat-a-Xhowards Sale of DRESSING! Nothing to 25c Bottle But Wa pkg 25c Combination Salt, 1 pound pack. 25c Combination Salt, 1 pound pack. 25c Shredded Wheat, 1 pound package. California Peaches, extra quality, per pound. Pears, Roast, or Mustard. Consumers' Delight. If you once try it, you'll want it to many times and 30% off. Coffees... League of Conse PATRONIZE THE STO s?,r.??KST. ? H. T. Cover. 7th and C ata% G. Schmidt. 4 Va and P ata. / | \ northwest. A. H. Plltt. 61 h Mild O sta. K F- Turner. Ji$Sak$ 11426 14th?t. Columbia Tea "d C'ctfee Co., 1565 M. Capitol at. l" "Sa. .... 'g^RClT I-ar" Free Delivery to Every INSTIGATION OF ARMY AVIATION CORPS ENDS ?tion Recommended Said to Involv# Possible Court-Martial of Several Officers. Ph.- special army board. composed of speetor General G a rli rig-ton. Ad.it. Gen. e? "a i n atnl < ;.- M< ? "omb. "f e Army War < *f.1has < mipletcd :'s vestijration f the av at-on : \ e army and hos submitted its teport ? aj ?; *ri Scott chief of staff. who wi 1 > U before 1)?? S.. rotary >>f War for .< TV Til#1 hi 'IT'?I teeomtvndod : i ' i 11 11ur?. of which 1 ?s i?. ' h.? n .1 ,r?s? i. it is s:i id to involve (" i hl?* ? < >ur* i-'trU prooe. dmps against certain ottu ers C i e Aviation <'orp In Session Several Wrpks The army hoard w a t> * a r several Weeks and mad*- a t it ?r? ; h \ ?*st isat t??ti of the a\ a or\|ee, eluding mattcts ?1.-vcI<ped (iurr s th.? ial hy court martial of I.ieut. ? wis I' hiHidn r. judge advo. ate of the est erti <l?'|iar tin h a i w t h a t mpting to interfere with tin- admtntratioti of i apt \rthur S. ' owae. Knal <'ot|>s, recently in command e aviation s Itool ind depot . S. The case of Goodier is now in the Secretary of War. Lieutenant General Samuel, who was on duty at the War Department, was on duty at the War Department meeting. He was on duty at the War Department meeting. He is under treatment for injuries at the Water Heed Hospital. He is said to be gradually improving. FLOOD WATERS RISING. Expected to Pass Danger Mark at Cincinnati Today. In the vicinity of Cincinnati today, the Ohio stood at its peak, reaching a height of fifty feet, which is expected to pass late today. The Ohio stood at its peak, reaching a height of fifty feet. HUNTINGTON, March 3—The river, with a stage of only one foot above the city, was rising today, with a stage of only one foot above the city. All traffic in this vicinity have been failing for twenty-four hours. ROCK ESTER, N.Y., March 1—The weather conditions throughout southern Minnesota were much improved today. Rochester was confronted with serious conditions today, when at noon, the Genesee river exceeded its normal depth. Licenses Granted and Refused. The excise board has granted a replication of Pari & Braun to condense saloons at 7th Street Northwest, and of Charles Jacobsen for transfer to the license of the Sterling from the Breast, president. The board refused the application of John Walsh for a license at 11th Street Northwest and of John J. Kelly for a transfer of the license now held to Robert H. Kearney at 11th Street Northwest. Goes to Kensington, Md., Church. Rev. Charles Brady, for some years pastor of the Presbyterian Church at Parrows Point, Md., has resigned to accept a call to the pastorate of Warner Memorial Presbyterian Church at Kensington, Md., in succession to Rev. Dr. Henry Rumer, former moderator of the Presbyterian Church of Washington, who for some months past has been in charge of a southern Maryland church. He will come to Kensington May 1. Share of groceries, stores for Thursday, Friday, and Saturday, strictly fresh, add country butter, vegetables, and other vegetables. Head lettuce, good quality. Head lettuce, good quality. Pantry, 4 pounds Z.T, Columbus brand tallow, per pound, per pound, Fancy California Prunes, per pound, per pound, Fat Mackerel, Satin, tallow can, red, Libby OO Lemon Soap, extra value, at the price, per cake, Coffee, per pound, all the time, superior quality, imperishable. Friends RE NEAREST YOU SOI THFAST. Frankley Bros., 23 4th St. & Franklin Bros., 10th St. m ,? mikthkast. I.ulhrr K. Hall. 12th and H ata. J- Krau* Si sua, sgi ?' 13?fc ?. 0fj jkd,-^h., ? Section of the City *.
| 13,351 |
2017218622_1914-12-17_1_8_1
|
US-PD-Newspapers
|
Open Culture
|
Public Domain
| 1,914 |
None
|
None
|
Polish
|
Spoken
| 2,989 | 6,984 |
Wadomości Zwięzkowe. Chicago, Ill. Z POBEDENIA DELEGATÓW GMINY NO. 75 ZW. N. P. NA MÁODZIANKOWIE. W ostatni pięto, istopada b- r. odbyło się rozuluri.t zebranie de legatów Gminy 75 Z. N. P. w sali zwykłych posiedzeń p. J. Krech niaka na Młodziankowie. O godz. 8:15 wieczorem prezes ob. Józef Dydek otworzył posiedzenie przy licznym udziale delegatów. Se kretarz Gminy ob. T. Wojciecho wski odczytał protokół XI, który został bez zmian przyjęty. Komitet mandatów przedstawia nowe, względnie zmienione man daty z grup 1776, 56 i 844 Z. N. P. Odnośnych delegatów Izba uchwa la przyjęć do swego grona. Koreopondencya Zarządu Centralnego donosząca o przydziele niu nowej Grupy 1776 do Gminy 76, zostaje przyjętą do wiadomo ści. Taksamo postUM Zapiono z korea pondencyami z Wydziału Niepod ległościowego Z. N. P., w których jeat mowa o utworzeniu Komitetu Centralnego Polskiego Ratunko wego. Komitet Badawczy poleca do Wydziału Wsparć Z. N. P. apli kację ob. Piotra Nejmana z Gr. 268. — Izba uchwala udzielić żę danego poparcia. Imieniem Komitetu Obchodów sprawozdaje del. Wleklióaki. że program obchodu Powstania Li stopadowego w najbliższęcia w nim udziału. Wniosek Komitetu, ażeby delega ci Gminy występili in corpore na nabożeństwo za poległych w ko ściele śś. Młodzianków, przechodzi bez opozyeyi. Dalej na prośbę Ko mitetu, żeby pobliższe grupy do starczyły sztandarów celem ude Korowania estrady, obiecują to u ezynić Grupy 1524 (dwa sztanda ry), 865, 844, 1533, 268 i 1084. Po wybraniu pomocy z kilku de legatów dla komitetu na dzień ob chodu, Izba sprawozdanie przyj muje. Z kolei rzeczy zdaje sprawę ko mitet specyalny (del. Micek, Pey or i Cienciara) do wybadania sprawy, że w Wydziale Niepodle głościowym pełni obowiązki pra cownika członek Zarządu Central nego. Komitet ten różni się w opi nii. Raport większości opiewa, że Zarząd Centralny dla dobra sprawy tnisiał powierzyć tymczasowo funkcye sekretarza nowego Wy działu swemu zaufanemu oraz wy próbowanemu szermierzowi w sprawach zwięzkowych dyr- M. Kmieciakowi. Nie godzi się z tern członek komitetu ob. Cienciara. Wywięzuję się dhiasze debaty, w których bkrą udział delegaci: Maciontek, Jachimowski, Ciślak. Paluszek, Damsz, Wlekliński, Kor naszewski, Oinejt, Czarnecki i członkowie komitetu del. Micek o raz Peyor. Zdania się ważę i poja wia się. Ząd. Węśla, że by wybrać nowy komitet. Del. Micek podkreśla, że Zarząd Centralny jcwt gotów przyjąć każdej chwili innego sekretarza Wydziału Niepodległościowego, o ile się zajdzie uzdolniony aplikant. — Węśla o wybór nowego komitetu przechodzi. Następnie na wniosek del. Czar neckiego sprawozdanie pierwszego komitetu odłożono na stół. Do nowego komitetu prezes mia nuje delegatów: Da msza, Stąśka i Jachimowskiego. Przyjmuję. Powołany do sprawozdania da wniej obrany komitet w sprawie wydawania robót introligator skich do zakładów nieunijnych, (dcl. Panek, Wróblewski i Giba aiewiczj referuje, że sprawa ta się wła, bo nawet unja musiał węczyć i znaczek unijny zastał odjęty Pismom Z. N. P. Izba uchwala, ażeby komitetu. Badał da lej sprawę znaczka unijnego w drukarni Pism Związkowvch. Komitet do zbadania zarzutów przeciw del. W. Szpunarowi roz porzędza materiałem obciążają cym i na dowód tego del. Mistarz (czł. kom.) odczytuje pewien list kompromitujący, oraz artykuł z przed kilku lat z Dziennika Ludo W*F°- fird.de p. bzpunara otwarcie piętnują. Inny ozłonek komitetu del. Kol busz oznajmia, że w sprawie p. Szpunara odbyło się kilka posiedzeń, ale na żailnem nie był saminteresowany a nawet można rzec, że wprost zignorował wezwanie na ostatnie posiedzenie. Z tego powodu komitet wstrzvrauje się z poleceniem i niech Izba samo oceni, czy p. Szpunar zasłu guje na to, ażeby zasiadał między nami jako delegat Gminy. Trzeci komitetowy, del. Janowski występuje przeciw samemu o skarżenru, zarzucając mu brak formalności. W ten sposób złożony raport wywołuje ożywioną dyskusyę, która zabiera dość długi czas. Przemawiają delegaci: Samborski, Matczyńaki, Orpiszewski, Wojcieć, Dąbrowski, Przyprawa, Cienciara, Czarnecki, Wojcieć, Micek. Chmielewlcz, Bryg, Damsz, Ginejt — i jedni z nich o świadczają się za umorzeniem sprawy, wzglą. Àdnie za odłożeniem jej z powrotem do komitetu, a drudzy domagają się odpowiedniego postąpienia z p. Sapunarem na podstawie przedłożonego matę rys in kompromitującego. Na atole jest wniosek, ażeby sprawę przeciw p. Szpunarowi po zostawić jeszcze w komitecie, który też przechodzi. Komitet pozostawić ten sam* chooiaż miał chęć zrezygnować. Na nowe sprawy podniesiono, że data następnego zebrania w y pada w sam dzień Bożego Naro dzenia, więc należy postanowić od- bycie zebrania w innym dniu. —— Uchwalono sprawy podniesiono, że data pozostawić administracyi, która się porozu me z gospodarzem sali i datę od powiednio ogłosi. Delegacya grupy 865 (Tow. Młoda Polska) prosi o zareklamo w wanie po grupach, że jej staraniem odbędzie się 5 grudnia b. r. przed stawien. Je sztuki “Za Wisłę, za isłę, za którego dochód w połowie jest przeznaczony na Wydział Niepodległościowy. — Ogół przyjmuje ten apel do wiadomości obiecuje szlachetny cel poprzeć. Sekretarz Gminy podnosi podrzebę zakupienia pieczęci dla Gminy. — Uchwalono kupić pieczęć w dobrym gatunku, czem się zajmie administracya. Grupa 1341 To w. Rozwój Pola ków urządza w niedzielę 13 grud nia b. r* Wiec Niepodległościowy i prosi o poparcie Gminy. — Przy chylono się. Również przychylnie odpowie dziano na prośbę tej Grupy, ażeby sekretarz Gminy ob. T. Wojcie chowski sekretarzował na tym wnecu z upoważnienia Gminy 75. Sekretarz podnosi sprawę od czytów o reformie asekuracyjnej, nadsyłanych z Zarządu Centralne go, jakie powinny być w Gminie odczytywane. — Uchwalono, że tę sprawę omówi się na przyszłem posiedzeniu. Wobec wyczerpania programa posiedzenia, prezes zamyka je na odpowiednio postawiony wniosek o godzinie 11-toj w nocy. T. Wojciechowski, Sekretarz Gminy 75 Z. N. p. BEZPŁATNY DODATEK POWIEŚCIOWY OD NOWEGO ROKU Czytelnicy Dziennika Zwięzkowego będą otr zymywać raz na tydzień bezpłatny Dodatek Fowieściowy. Dodatek Powieściowy będzie zawierał ciekawe powieści, oraz opisy i ilustracye z wojny europejskiej. Każdy zeszyt Do datku Powieściowego będzie zawierał tyle treści, ile zawiera księżka o 33-ch stronicach, wartości ioc. W ciągu roku czytelnik otrzyma 52 zeszyty ogólnej wartości $5.20. Dziennik Zwięzkowy z Dodatkiem Powieściowym będzie kosztował $3.00 na rok, czyli o 750 drożej, aniżeli kosztuje obe cnie. Kto zapłaci prenumeratę przed Nowym Rokiem, otrzyma Dziennik Zwięzkowy z Dodatkiem Powieściowym po starej cenie $2.25. “ZAPŁAĆ TERAZ — OSZCZęDZISZ 750“ Wytnij ten kupon, wypisz na nim swój adres i z dołącze niem $2.25 nadeszlij na adres: 1 DZIENNIK ZWIĄ ZKOWY, 1406-08 W. Division St.f Chicago, III. Panowie: Posyłam w załęczeniu $2.25 i proszę przy syłać na mój adres Dziennik Zwięzkowy przez rok czasu a łdowy ygW)n,U Pr°52ę przys,ł<; b«P'»«ny Dodatek Powie Imię j nazwisko -- No. domu i ulica.... Mia,,°...Stan Do Szanownych Gmin i Grup Z. N. P. w Okręgu XI. na Zachód. Pennsylvanię. Szanovini Bracia i Siostry: — Przy nadchodzących uroczy stych świętach Bożego Narodze nia i Nowego Roku, pragnę wy razić Wam tutaj szczero-polskie życzenia “miłej gwiazdki” i szczęśliwego Nowego Roku i9*5-6<> Daj Boże, alby święto Narodzin Zbawiciela Świata natchnęło serca prawdziwych Chrześcian pragnieniem utrwalenia na świę cie Pokoju i Sprawiedliwości. Daj Boże, aby biedny nasz Na ród Polski wyszedł z wojennej pożogi, jaka ogarnęła w roku tym Ojczyznę naszą — Połączo nym i Walnym, aby się zadość stało sprawiedliwości i aby mógł wskutek tego nastać na świecie prawdziwy pokój dla wszystkich ludzi dobrej woli. Kilka miesięcy temu odzywa łem się do Was, drodzy Bracia i Siostry, abyście w my śl uchwały władz związkowych popierali szczerze i gorliwie Władział Nie podległościowy przy Zw. N. P., który zbiera fundusze na potrze by Ojczyzny naszej, a zwłaszcza w dobie obecnej potrzebny Roda kom naszym w starym kraju po krzywdzonym wielką wojną ka wałek chleba! Prosiłem Was, abyście zawię zywali komitety i urządzali Wie ce w celu zbierania pieniędzy i takowe odsyłali do Kasyera Zw. N. P. i muszę Wam teraz podzię kować, żeście pracowali dobrze, gdyż w kilku miesięcach popły nęły znaczne ofiary i jest już w kasie Wydziału Niepodległośció wego z górą IWszystko to jednak nie jest do-statecznem, aby wystarczyło na częściową choćby tylko ulgę w strasznej nie dzy i nieszczęściu w jakie pop Ała ludność polska na tereuie wojny i muszę się zwrócić do Waszę. Bracia i Siostry, abyście zdwoili energię Waszę i w tym obecnym sezonie świętach pono wili Wasze wysiłki żeby zasilić fundusz Wydziału Niepodległo ściowego przynajmniej dwu lub trzykroć tak wielką jak dotąd o fiarą. Odzywam się zwłaszcza do tych braci kamiennego serca, którzy jeszcze dotąd żadnej nio złożyli na potrzeby Ojczyzny o iiary, aby otworzyli sakiewki swoje i serca i złożyli datek do raźny i hojny. Wydział Niepodległościowy rozpoczął już akcyę aby fundus ze przez nas złożone jaknajprę dzej dosięgły Rodaków naszych w Polsce, zwłaszcza w Galicyi i Królestwie, gdzie woina najsro żej dotknęła mieszkańców. Urzędzajmy więc w zbliżają cym się sezonie poświętecznym, przedstawienia, ode zyty, wiece i t. p. (lecz nie bale ani tańce, bo na grobach nikt tańczyć nie po winien;, a na nich niech płyną składki na Wydział Niepod'egło ściowy. Nie zaniedbujmy też składek na ten cel Na posiedzeniach grup i gmin, zebraniach rodziunych i przyjacielskich, i będźmy wszy scy poborcami grosza na cel tak święty i szlachetny jak pomoc gi nęcym z głodu i zimna rodakom naszym. Gminom i grupom w okręgu XI-tym zwłaszcza polecam gorli wość i pilność w zajęciu się tę sprawą, abyśmy w zachodniej Pennsylvanii nie pozostali w ty le za innymi Okręgami Zw N. P. w zabieraniu zapomogi dla Roda ków naszych w starym kraju. Życzę w wyrazy Bratniego pozdrowienia R. S. Abczyński, Komisarz Z. N. P. TOW. AD ASTRA, GR. 1398 Na przedroczncm posiedzeniu Tow. “Ad Astra”, gr. 1398 Z.N. P. wybrano w dniu 7 grudnia b. r. następujęcy Zarzęd: Prezes: Ob. Raciborski, wice prezes Józef Jaks; Sekr. finanso y Jan L. Jasiński; kasyer Zejon Ulanowski; sekr. prot. Jan Wiśniewski. Daiegaci do Gmi any: Jan Przyprawa, Henry Rodner, Komisya szkontru jara: Leśnicki, Lokański, Sadowski. Odwaarny: Lucheik Leonie ki.ODEZWA. Do Delegatów Gminy w Filadelfii Nr. L Z. N. P. Drodzy Bracia i Siostry! Podaję do wiadomości, ze po siedzenie roczne Gminy odbędzie się w niedzielę dnia 27 grudnia b. r. o godzinie 3<ńej po południu w Domu Polskim, 211 Fairmont ave. 'Poczuwając się do obowiązku, odzywam się do delegatów Gmi ny nr. 1, tak do tych, którzy szer mierkę prowadzą od dłuższych lat, jak tych, którzy wejdą w ich grono, by w roku przyszłym był wydany pożędany owoc z ich pracy, by z godnościę do swego stanowiska wytrwale ł szczerze oddani dla spraw Zwięzku Naro dowego Polskiego, przyidużyli się też i rprawie polskiej. Pierwszem zadaniem delega tów jest przeprowadzić wybory na tem posiedzeniu by kandyda ci odpowiadali zdolnościami ja kich wymaga koniecznie ich przyszłe stanowisko. Delegaci nie j xłwmni się kierować osobi stemi uprzedzeniami, mając na myśli jedynie czystą pracę Z. N. P. Gmina wtenczas odpowiada swemu zadaniu, gdy jest zarzęd odpowiedni, a delegaci stale przybywają na posiedzenia. To też dlatego wzywam wszystkich delegatów grup do Gminy nr. i Z. X. P., by nie zabrakło ani je dnego, a wybór wypadł pomyśl ny i zadowolił każdego. Pomnąc musimy na to, że zgoda buduje a niezgoda rujnuje, zgodą i jedno ścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścięścię Tembodącj nam jednej myśli potrzeba, gdy żądają pomocy na si Bracia i Siojtry za oceanem żyjący, w trwodze uciekając bez wytkniętego celu o głodzie by u niknąć napadów brutalnego żoł dactwa naszych wrogów; a że nie mamy zakątka ziemi własnej wolnej, więc niema dla nich opie ki; błędni wycięgają ręce w stro nę naszęci z jękiem: dajcie nam chleba, jeżeli innego ratunku dla nas nie macie! Gminy powinny wzięcia się do akcyi czynnej, by nie wzdychaniem współczucia zaspokoić ich niedbale; przecież słowem współczucia nikt nie bę dzie eyty; dziś dać na chlefo, bo jutro może i nam tam być trze ba, by raz z niewoli lud wyswo bodzić, by powiedzieć jeszcze nie zginęła! Pracy nam potrzeba, by historya nie zapisa ła, żeśmy zim ni, bez poczucia na stosunki bęcne w Ojczyźnie. Idźmy w myśl założycieli tej organizacyi. że tworzy mściciela, który po mści wszystkie krzywdy Polski na wrogach naszych. Może zadu żo się rozpisałem, ale jakże nie pisać, kiedy "erce tak dyktuje, gdy patrząc dziś na sprawy Polski, ludzie zamożni oniemieli i dają znaki ramionami, że nic z tego zrozumieć nic można. Prze cież wołano swój do swego, a dziś się ma dobrze i odpowiada: “na co mi Polski gdy jestem w Ameryce”. W Ameryce lud obcy zbiera pieniędz dla Belgów, a nawet w polskich kościołach. Czyżby rzeczywiście Naród Polski był wydany na zagładę, że wróg wystawia do ostatniego Brata na bagnety, a głodnym Brat odmawia chle Gść był Naród Polski dla obcych i dziś nim pozostaje, nie wi dząc swego pod nosem, ale cu dze pod lasem. Przy nadchodzących świętach. Bożego Narodzenia Braciom i Siostrom IX. Okr. jak wszystkim pracownikom Związku Narodowiego Polskiego, ślę serdeczne życzenia. 21 bratniem pozdrowieniem Próść Borowicz, Kom i Prez. Gm. i. DO DELEGATÓW OMTNY 75 Z. N. P. NA MŁODZIAN KOWIE. Zawiadamia się «Szan. Delega tów Grup na Młodziankowie, że zebranie delegatów w tym mie sięciu odbędzie się dwa dni wcze śniej, aniżeli to wypada, bo w piętek ^5 grudnia jako dzień na szego regularnego zebrania przy pada święto Bożego Narodzenia. I Zebranie zatem odbędzie się w środę, 33 b. m. o godzinie 8 wie czorem w sali p. J. Krechniaka, róg ulic Noble i W. Huron. Z bratniem pozdrowieniem Józef Dydek, prezes, Tom, Wojciechowski, sekr. FARMY W ślicznej okolicy starej polskiej kolonii blisk.. wielkich portowych i najwlęksiycta przemysłu, wych atest, nieme upeln ani srogiej simy, ani gór, zbiorr odbywają et* 3 d.» 4 rezy rocznie. Sskoła etacya I koiolól w mlejacu. Warunki korsyatna. I. HERZ, 224 W. 34th St. New York, N.Y. RAPORT Kornisyi Immigracy, Związku Nar. Palsk. New York, N. Y za miesięc listopad.' Dochód: Od Zarzędcy Domu. 91.11 Od Zarzędcy Centralnego..400x0 Razem...491.11 Rozchód: 73. Reinfrarad Coal Co. 10 ton wnpU.66.50 73. Knickerbodkcr Gdnde Comek trał Railway guide. 8.00 74- New York Telephone °°. 751 75. Consolidated Gas Co. 4.40 76. Rnsenfeld za jarzyny... 44.03 77. R. Cl William Grocery ry. 1*3 25 7&. F. EtsenSberę, za pło czrwo. ia.oi 79. B. Kcmip, za mięso.... 59.10 80. New York Edison Co... 11.70 81. Pensya agenta J. Pengel.i.40.00 83. Pensya agenta J. Pengel.i.40.00 83. Pensya służęcej W. Smcreka.32.00 86. Pensya służęcej F. Garnowski. En el 18.00 87. Pensa sekretarza Komiskey! Im.to.oo Razem..506.50 Zestawienie: Z przeniesienia.667.81 Dochód M...M..491.1:1 Razem.......145893 Rozchód.506.50 Pozostaje w kasie.652.42 New York, N. Y.. 2 drud. 1014. W. Jungszlagier, sekretarz. A. Wawrowski, prezes. W. Wilusz, kasyer. Ludzie chełpią się czasem na miętnościami. nawet zbrod-nicze mi; jeno zawiść jest namiętnością trwoźmą i wstydliwą, której ni gdy wyznać się nie śmie. ZA DARMO. Kto chce darmo otrzymać Kalendarz na rok 1915 liczęcy 192 stronic, niech przyśle swój adres i dwucento wą markę na prze.-yłkę. Adres: APTEKA PARTOSA, 150 Second Ave., New York, Dept. 30. POTRZEBA roUrtników do ko palni węgla. Każdy mężczyzna robotnik otrzymuje 5 akcyi i dom z 5 akrową farmą, opał bez płatny i stałę. Strajków tu nigdy być nie może. Największa sposob ność dla robotnika otrzymać dom i -niezależność. Clinton and Company. 610 Bhie Island Ave. (Ogłoszenie.) POTRZEBA mężczyzn i dziew cząt do wyrobu obuwia gumo wego Płacimy wtenczas, kiedy wy się uczycie. Również potrze ba doświadczonych ludzi do wy robu gumowego obuwia i trze wików, także i Lumbermanów.. Zdrowa, czysta i stała prac przez cały rok i dobra zapłata. Nasza fabryka obuwia gumowe go jest największa w ćwiecie i najlepiej urządzona. 2najomość języka angielskiego nie wymaga na, dlatego, Iż dużo z naszych robotników jest narodowości pol skiej. The B. F. Goodrich Co. Akron, Ohio... (Ogłoszenie) Z riemi świętej. Pan Ja Dyck z Jerozolimy, Syria, pisze: “Czte ry dni temu, jak pudełko z Gomo zo, które od Was zamówiłem, do szło do mych rąk, po przejściu przez komorę celną. Bardzo mi przyjemnie, że Gomozo jest jużna miejscu. Ani jedna butelka nie była potłuczona. Teraz po cznę używać Gomozo w celu przywrócenia mego zdrowia. U zywałem już Gomozo przed kilko ma laty i wiem, że nie ma nic od powiedniejszego nad to.” We wszystkich klimatach, po między wszelkim narodem, Go mozo jest jedyne niezawodne i popularne lekarstwo. Używanie jego przez przeszło sto lat było probierzem, że ono jest stosowa ne jako środek leczniczy w dole gliwościach, tak rnmo dla męż czyzn jako i dla niewiast. Nie jest ono artykułem handlu — Ida tego nie jest do nabycia w aptekach. Specyalni agenci do starczają je ludowi, lub można je dostać wprost z laboratoryum fa brykantów, pr. Peter Fahrney & Sons Co., 19*35 So. Hoyne ave., Chicago, Ill. (Ogłoszenie.) Posiadamy więcej siły. niż wo li ; i tylko dla usprawiedliwienia się przed sobę samymi, wyobra żamy sobie często, że coś jest nie możliwe. HASSAN Kupony Papierosów mogą być zamienione na pożyteczne i Piękne Prezenta w jakiejbędź z niniejszych stacyi CHICAGO, ILLS. Ho. Clark St. 1528 W. Madison St. 750 H. Middleton St. 623 Ho. Clark St. 1330 Proprietor St. 1102 Ho. Halstead St. 627 IV. South St. 152H W. 71 h St. 1H Ho. Ashland Ave. Ml W. Hadno St. 1015 3 o Me At. 53 F Adelaide At. 20IS W. 12th At 520 W. Chicago aro. 1605 West 12th At 5081 Ho. Aahland ara. 4767 Broadway 3425 West 16th at. 881 West 12th At. 881 West 12th At. 881 West 12th At. 1026 Ho. IłalAtrd «t 600 W. 121 h At. 1021 Helmont ara 407 Ho. Kedile ara #14 Ht. Milwaukee aro. 1708 Waof Lake aro. 21 Horth Fifth aro.. 1058 Hoot IHtIaIob ot. Hló Hoath Halsted at. 506 Horfh Aroaao 61* Weila *1. 3426 South Illnsted it. 307 Ashland ate. 2*06 W. Chicago a»e. 2234 SorthwMlfrn itn 2100 >orth Park at 4014 Went 5th are. 2IM Ashland atr. 3*23 West 2*1 h lit. 1463 Fullerton are. *01 East 8rd ot ilM Indiana arr. 1644 Went 4 h traw ira 2647 North Kedile Monter ar d 1012 Wflaoa are. 1(33 Milwaukee are. 407 R. IK.th at. 113 East 1071 h aft. 3164 Moriran at. 316* West 26th aft 1310 Milwaukee are. 134* Rlae laland are. 33(3 West Fullerton ara 11** South Clark at. Mo Rine laland are. 3147 Went 22nd at. ©ART, rfDIAJTA. 2200 Broadway 302 Broadway M. Złotnlrk IKUIASA HARBOB, ISO. •401 Mlrhliran are. W razie niemośmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeśmeś Prezentowania Hassan Kupo nów w żadnem z miejsc powyżej wymienionych, można takowe nadesłać wprost do THE AMERICAN TOBACCO COMPANY Premium Departament 490 BROOME «T. New York, Ni Y.
| 2,052 |
https://github.com/wagnerhsu/packt-ASP.NET-Core-and-Vue.js/blob/master/Chapter18/Travel/src/core/Travel.Application/Dtos/Email/EmailDto.cs
|
Github Open Source
|
Open Source
|
MIT
| 2,022 |
packt-ASP.NET-Core-and-Vue.js
|
wagnerhsu
|
C#
|
Code
| 43 | 90 |
using System;
using System.Collections.Generic;
using System.Text;
namespace Travel.Application.Dtos.Email
{
public class EmailDto
{
public string To { get; set; }
public string Subject { get; set; }
public string Body { get; set; }
public string From { get; set; }
}
}
| 39,771 |
https://stackoverflow.com/questions/5904447
|
StackExchange
|
Open Web
|
CC-By-SA
| 2,011 |
Stack Exchange
|
Adhy, Danyon, Harsh Vyas, Leaaa XII, Loni, McKinnon Agerskov, MrEngineer, Yassine Azzabi, anish bista, bummi, https://stackoverflow.com/users/12741122, https://stackoverflow.com/users/12741123, https://stackoverflow.com/users/12741124, https://stackoverflow.com/users/12741218, https://stackoverflow.com/users/12741268, https://stackoverflow.com/users/12747021, https://stackoverflow.com/users/12747022, https://stackoverflow.com/users/1699210, https://stackoverflow.com/users/18161584, https://stackoverflow.com/users/5168165
|
English
|
Spoken
| 412 | 547 |
replication between SQL Server and MySQL server
I want to setup replication between SQL Server and MySQL, in which SQL Server is the primary database server and MySQL is the slave server (on linux).
Is there a way to setup such scenario? Help me .
possible duplicate of Replication between SQL Server and MYSQL
My answer might be coming too late, but still for future reference ...
You can use one of the heterogeneous replication solutions like SymmetricDS: http://www.symmetricds.org/. It can replicate data between any SQL database to any SQL database, altough the overhead is higher than using a native replication solution.
of course you can replicate MSSQL database to MYSQL
By using Linked Server in MSSQL.
for that you need to download ODBC drivers. and you can further search regarding how to create Linked server on SQL SERVER.
This option is very easy and Totally free. You can use OPEN QUERY FOR THIS.
By using SSIS Packages.
for that you need the Business Intelligence service of SQL SERVER. you can create SSIS Packages on Visual Studio and run them for replication.
I have worked on this very deeply and to be honest the easiest method is to work with linked server in mssql. rather than working on ssis packages which is quite hard to understand at first.
No. At least not without doing a lot of dirty, bad things. MSSQL and MySQL speak different replication protocols, so you won't be able to set it up natively (which is the way you'd want to handle it). At best, you could hack together some sort of proxy that forwards insert/update/delete/create/alter, etc. queries from one to the other. This is a terrible idea as they don't speak the same SQL except in the most common case. Even database dumps which wouldn't really be replication are generally incompatible between vendors.
Don't do it. If you must use different OSes on your servers, standardize the database to something that runs on both.
These two databases are from two different vendors. While I cannot say for sure, it is unlikely Microsoft has any interest in allowing replication to a different vendor's database server.
I work with Informix and MySQL. Both those databases have commands that dump the entire database to an ascii file format. You would need to see how that is done on MS SQL Server; ftp the dump to the server hosting the MySQL server; and then convert the dump into something MySQL can import.
| 28,152 |
https://ms.wikipedia.org/wiki/Gerhardshofen
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Gerhardshofen
|
https://ms.wikipedia.org/w/index.php?title=Gerhardshofen&action=history
|
Malay
|
Spoken
| 15 | 45 |
Gerhardshofen merupakan sebuah daerah terletak di munisipaliti Neustadt (Aisch)-Bad Windsheim, Bavaria, Jerman.
Bandar di Jerman
| 18,309 |
https://ru.wikipedia.org/wiki/%D0%AF%D0%B7%D1%8B%D0%BA%D0%BE%D0%B2%D0%BE%20%28%D0%A1%D0%B5%D0%BB%D0%B8%D0%B6%D0%B0%D1%80%D0%BE%D0%B2%D1%81%D0%BA%D0%B8%D0%B9%20%D1%80%D0%B0%D0%B9%D0%BE%D0%BD%29
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Языково (Селижаровский район)
|
https://ru.wikipedia.org/w/index.php?title=Языково (Селижаровский район)&action=history
|
Russian
|
Spoken
| 160 | 462 |
Языково — деревня в Селижаровском муниципальном округе Тверской области России. До 2020 года входила в состав ныне упразднённого Селижаровского сельского поселения Селижаровского муниципального района.
География
Деревня находится на западе центральной части Тверской области, в зоне хвойно-широколиственных лесов, в пределах Валдайской возвышенности, при автодороге , на расстоянии примерно 4 километров (по прямой) к северо-востоку от Селижарова, административного центра округа. Абсолютная высота — 249 метров над уровнем моря.
Климат
Климат характеризуется как умеренно континентальный, с относительно мягкой зимой и прохладным летом. Среднегодовая температура воздуха — 4 °C. Средняя температура воздуха самого холодного месяца (января) — −9 °C; самого тёплого месяца (июля) — 17 — 18 °C. Вегетационный период длится около 190 дней. Годовое количество атмосферных осадков составляет в среднем 598 мм, из которых большая часть выпадает в тёплый период. Снежный покров держится в течение 140 дней.
Часовой пояс
Население
Национальный состав
Согласно результатам переписи 2002 года, в национальной структуре населения русские составляли 77 % из 13 чел.
Примечания
Населённые пункты Селижаровского района
| 48,308 |
https://ceb.wikipedia.org/wiki/Long%20Jiao
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Long Jiao
|
https://ceb.wikipedia.org/w/index.php?title=Long Jiao&action=history
|
Cebuano
|
Spoken
| 50 | 101 |
Ang Long Jiao ngalan niining mga mosunod:
Republikang Popular sa Tsina
Long Jiao (kagaangan sa Republikang Popular sa Tsina, Zhejiang Sheng),
Long Jiao (kagaangan sa Republikang Popular sa Tsina, Fujian Sheng),
Lung Gyog, dalog, Tibet Autonomous Region,
Pagklaro paghimo ni bot 2016-03
Pagklaro paghimo ni bot Republikang Popular sa Tsina
| 30,229 |
US-202017627373-A_3
|
USPTO
|
Open Government
|
Public Domain
| 2,020 |
None
|
None
|
English
|
Spoken
| 7,088 | 12,282 |
In any case, the composition may comprise various antioxidants to retard oxidation of one or more component. Additionally, the prevention of the action of microorganisms can be brought about by preservatives such as various antibacterial and antifungal agents, including but not limited to parabens (e.g., methylparabens, propylparabens), chlorobutanol, phenol, sorbic acid, thimerosal or combinations thereof.
The RRM3-derived peptides may be formulated into a composition in a free base, neutral or salt form. Pharmaceutically acceptable salts, include the acid addition salts, e.g., those formed with the free amino groups of a proteinaceous composition, or which are formed with inorganic acids such as for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric or mandelic acid. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as for example, sodium, potassium, ammonium, calcium or ferric hydroxides; or such organic bases as isopropylamine, trimethylamine, histidine or procaine.
In embodiments where the composition is in a liquid form, a carrier can be a solvent or dispersion medium comprising but not limited to, water, ethanol, polyol (e.g., glycerol, propylene glycol, liquid polyethylene glycol, etc), lipids (e.g., triglycerides, vegetable oils, liposomes) and combinations thereof. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin; by the maintenance of the required particle size by dispersion in carriers such as, for example liquid polyol or lipids; by the use of surfactants such as, for example hydroxypropylcellulose; or combinations thereof such methods. In many cases, it will be preferable to include isotonic agents, such as, for example, sugars, sodium chloride or combinations thereof, and/or buffering agents to maintain physiologically acceptable pH values.
In other embodiments, one may use eye drops, nasal solutions or sprays, aerosols or inhalants in the present invention. Such compositions are generally designed to be compatible with the target tissue type. In a non-limiting example, nasal solutions are usually aqueous solutions designed to be administered to the nasal passages in drops or sprays. Nasal solutions are prepared so that they are similar in many respects to nasal secretions, so that normal ciliary action is maintained. Thus, in some embodiments the aqueous nasal solutions usually are isotonic or slightly buffered to maintain a pH of about 5.5 to about 6.5. In addition, antimicrobial preservatives, similar to those used in ophthalmic preparations, drugs, or appropriate drug stabilizers, if required, may be included in the formulation. For example, various commercial nasal preparations are known and include drugs such as antibiotics or antihistamines.
In certain embodiments, the RRM3-derived peptide is prepared for administration by such routes as oral ingestion. In these embodiments, the solid composition may comprise, for example, solutions, suspensions, emulsions, tablets, pills, capsules (e.g., hard or soft shelled gelatin capsules), sustained release formulations, buccal compositions, troches, elixirs, suspensions, syrups, wafers, or combinations thereof. Oral compositions may be incorporated directly with the food of the diet. Preferred carriers for oral administration comprise inert diluents, assimilable edible carriers or combinations thereof. In other aspects of the invention, the oral composition may be prepared as a syrup or elixir. A syrup or elixir, and may comprise, for example, at least one active agent, a sweetening agent, a preservative, a flavoring agent, a dye, a preservative, or combinations thereof.
In certain embodiments, an oral composition may comprise one or more binders, excipients, disintegration agents, lubricants, flavoring agents, and combinations thereof. In certain embodiments, a composition may comprise one or more of the following: a binder, such as, for example, gum tragacanth, acacia, cornstarch, gelatin or combinations thereof; an excipient, such as, for example, dicalcium phosphate, mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate or combinations thereof; a disintegrating agent, such as, for example, corn starch, potato starch, alginic acid or combinations thereof; a lubricant, such as, for example, magnesium stearate; a sweetening agent, such as, for example, sucrose, lactose, saccharin or combinations thereof; a flavoring agent, such as, for example peppermint, oil of wintergreen, cherry flavoring, orange flavoring, etc.; or combinations thereof the foregoing. When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, carriers such as a liquid carrier. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For instance, tablets, pills, or capsules may be coated with shellac, sugar or both.
Additional formulations which are suitable for other modes of administration include suppositories. Suppositories are solid dosage forms of various weights and shapes, usually medicated, for insertion into the rectum, vagina or urethra. After insertion, suppositories soften, melt or dissolve in the cavity fluids. In general, for suppositories, traditional carriers may include, for example, polyalkylene glycols, triglycerides or combinations thereof. In certain embodiments, suppositories may be formed from mixtures containing, for example, the active ingredient in the range of about 0.5% to about 10%, and preferably about 1% to about 2%.
Sterile injectable solutions are prepared by incorporating the RRM3-derived peptides of the invention in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and/or the other ingredients. In the case of sterile powders for the preparation of sterile injectable solutions, suspensions or emulsion, the preferred methods of preparation are vacuum-drying or freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered liquid medium thereof. The liquid medium should be suitably buffered if necessary and the liquid diluent first rendered isotonic prior to injection with sufficient saline or glucose. The preparation of highly concentrated compositions for direct injection is also contemplated, where the use of DMSO as solvent is envisioned to result in extremely rapid penetration, delivering high concentrations of the active agents to a small area.
The composition must be stable under the conditions of manufacture and storage, and preserved against the contaminating action of microorganisms, such as bacteria and fungi. It will be appreciated that endotoxin contamination should be kept minimally at a safe level, for example, less than 0.5 ng/mg protein.
In particular embodiments, prolonged absorption of an injectable composition can be brought about by the use in the compositions of agents delaying absorption, such as, for example, aluminum monostearate, gelatin or combinations thereof.
Pharmaceutical compositions comprising the RRM3-derived peptides of the invention may be manufactured by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes. Pharmaceutical compositions may be formulated in conventional manner using one or more physiologically acceptable carriers, diluents, excipients or auxiliaries which facilitate processing of the proteins into preparations that can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.
For topical administration the RRM3-derived peptides of the invention may be formulated as solutions, gels, ointments, creams, suspensions, etc. as are well-known in the art.
Systemic formulations include those designed for administration by injection, e.g. subcutaneous, intravenous, intramuscular, intrathecal or intraperitoneal injection, as well as those designed for transdermal, transmucosal, inhalation, oral or pulmonary administration.
For injection, the RRM3-derived peptides of the invention may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks' solution, Ringer's solution, or physiological saline buffer. The solution may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
Alternatively, the RRM3-derived peptides may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
For oral administration, the RRM3-derived peptides can be readily formulated by combining the RRM3-derived peptides with pharmaceutically acceptable carriers well known in the art. Such carriers enable the RRM3-derived peptides of the invention to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a patient to be treated. For oral solid formulations such as, for example, powders, capsules and tablets, suitable excipients include fillers such as sugars, e.g. lactose, sucrose, mannitol and sorbitol; cellulose preparations such as maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP); granulating agents; and binding agents. If desired, disintegrating agents may be added, such as the cross-linked polyvinylpyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
If desired, solid dosage forms may be sugar-coated or enteric-coated using standard techniques.
For oral liquid preparations such as, for example, suspensions, elixirs and solutions, suitable carriers, excipients or diluents include water, glycols, oils, alcohols, etc. Additionally, flavoring agents, preservatives, coloring agents and the like may be added.
For buccal administration, the RRM3-derived peptides may take the form of tablets, lozenges, etc. formulated in conventional manner.
For administration by inhalation, the RRM3-derived peptides for use according to the invention are conveniently delivered in the form of an aerosol spray from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the RRM3-derived peptide and a suitable powder base such as lactose or starch.
The RRM3-derived peptides may also be formulated in rectal or vaginal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.
In addition to the formulations described previously, the RRM3-derived peptides may also be formulated as a depot preparation. Such long acting formulations may be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection. Thus, for example, the RRM3-derived peptides may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
Alternatively, other pharmaceutical delivery systems may be employed. Liposomes and emulsions are well known examples of delivery vehicles that may be used to deliver RRM3-derived peptides of the invention. Certain organic solvents such as dimethylsulfoxide also may be employed, although usually at the cost of greater toxicity. Additionally, the RRM3-derived peptides may be delivered using a sustained-release system, such as semipermeable matrices of solid polymers containing the therapeutic agent. Various of sustained-release materials have been established and are well known by those skilled in the art. Sustained-release capsules may, depending on their chemical nature, release the RRM3-derived peptides for a few weeks up to over 100 days. Depending on the chemical nature and the biological stability of the RRM3-derived peptides, additional strategies for RRM3-derived peptides stabilization may be employed.
As the RRM3-derived peptides of the invention may contain charged side chains or termini, they may be included in any of the above-described formulations as the free acids or bases or as pharmaceutically acceptable salts. Pharmaceutically acceptable salts are those salts which substantially retain the biologic activity of the free bases and which are prepared by reaction with inorganic acids. Pharmaceutical salts tend to be more soluble in aqueous and other protic solvents than are the corresponding free base forms.
The RRM3-derived peptides of the invention will generally be used in an amount effective to achieve the intended purpose. For use to treat or prevent a disease condition, the RRM3-derived peptides of the invention, or pharmaceutical compositions thereof, are administered or applied in a therapeutically effective amount. A therapeutically effective amount is an amount effective to ameliorate or prevent the symptoms, or prolong the survival of, the patient being treated. Determination of a therapeutically effective amount is well within the capabilities of those skilled in the art, especially in light of the detailed disclosure provided herein.
For systemic administration, a therapeutically effective dose can be estimated initially from in vitro assays. For example, a dose can be formulated in animal models to achieve a circulating concentration range that includes the IC₅₀ as determined in cell culture. Such information can be used to more accurately determine useful doses in humans.
Initial dosages can also be estimated from in vivo data, e.g., animal models, using techniques that are well known in the art. One having ordinary skill in the art could readily optimize administration to humans based on animal data.
Dosage amount and interval may be adjusted individually to provide plasma levels of the RRM3-derived peptides which are sufficient to maintain therapeutic effect. Usual patient dosages for administration by injection range from about 0.1 to 50 mg/kg/day, typically from about 0.5 to 1 mg/kg/day. Therapeutically effective serum levels may be achieved by administering multiple doses each day.
In cases of local administration or selective uptake, the effective local concentration of the RRM3-derived peptides may not be related to plasma concentration. One having skill in the art will be able to optimize therapeutically effective local dosages without undue experimentation.
The amount of RRM3-derived peptide administered will, of course, be dependent on the subject being treated, on the subject's weight, the severity of the affliction, the manner of administration and the judgment of the prescribing physician.
The therapy may be repeated intermittently while symptoms detectable or even when they are not detectable. The therapy may be provided alone or in combination with other drugs. In the case of autoimmune disorders, the drugs that may be used in combination with RRM3-derived peptides of the invention include, but are not limited to, steroid and non-steroid anti-inflammatory agents.
Toxicity
A therapeutically effective dose of the RRM3-derived peptides described herein will generally provide therapeutic benefit without causing substantial toxicity. Toxicity of the RRM3-derived peptides can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., by determining the LD₅₀ (the dose lethal to 50% of the population) or the LD₁₀₀ (the dose lethal to 100% of the population). The dose ratio between toxic and therapeutic effect is the therapeutic index. In one embodiment, the RRM3-derived peptide exhibits a high therapeutic index. The data obtained from these cell culture assays and animal studies can be used in formulating a dosage range that is not toxic, for example, for use in human. The dosage of the RRM3-derived peptides described herein lies preferably within a range of circulating concentrations that include the effective dose with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See, e.g., Fingl et al., 1975, In: The Pharmacological Basis of Therapeutics, Ch. 1, p. 1) (incorporated herein by reference in its entirety.
Other Agents and Treatments
It is contemplated that other agents may be used in combination with the present invention to improve the therapeutic efficacy of treatment. These additional agents include immunomodulatory agents, agents that affect the upregulation of cell surface receptors and GAP junctions, cytostatic and differentiation agents, inhibitors of cell adhesion, or agents that increase the sensitivity of the hyperproliferative cells to apoptotic inducers. Immunomodulatory agents include tumor necrosis factor; interferon alpha, beta, and gamma; IL-2 and other cytokines; F42K and other cytokine analogs; or MIP-1, MIP-1β, MCP-1, RANTES, and other chemokines. It is further contemplated that the upregulation of cell surface receptors or their ligands such as Fas/Fas ligand, DR4 or DR5/TRAIL would potentiate the apoptotic inducing abilities of the present invention by establishment of an autocrine or paracrine effect on hyperproliferative cells. Increases in intercellular signaling by elevating the number of GAP junctions would increase the anti-hyperproliferative effects on the neighboring hyperproliferative cell population. In other embodiments, cytostatic or differentiation agents can be used in combination with the present invention to improve the anti-hyperproliferative efficacy of the treatments. Inhibitors of cell adhesion are contemplated to improve the efficacy of the present invention. Examples of cell adhesion inhibitors are focal adhesion kinase (FAKs) inhibitors and Lovastatin. It is further contemplated that other agents that increase the sensitivity of a hyperproliferative cell to apoptosis, such as the antibody C225, could be used in combination with the present invention to improve the treatment efficacy.
Hormonal therapy may also be used in conjunction with the present invention or in combination with any other cancer therapy previously described. The use of hormones may be employed in the treatment of certain cancers such as breast, prostate, ovarian, or cervical cancer to lower the level or block the effects of certain hormones such as testosterone or estrogen. This treatment is often used in combination with at least one other cancer therapy as a treatment option or to reduce the risk of metastases.
The RRM3-derived peptides of the invention may also be administered in conjunction with chemotherapy, radiation therapy or other immunotherapies. Anti-cancer agents for such combination therapy may, e.g., be selected from the groups of microtubule disruptors (e.g. vinca alkaloids such as vinblastine or vincristine, taxanes such as docetaxel or paclitaxel, epothilones such as ixabepilone), antimetabolites (e.g. anti-folates such as methotrexate or aminopterin, anti-purines such as fludarabine, 6-mercaptopurine or 6-thioguanine, anti-pyrimidines such as 5-fluorouracil, capecitabine or gemcitabine, hydroxyurea), topoisomerase inhibitors (e.g. camptothecin, irinotecan, topotecan, or podophyllotoxins such as etoposide), DNA intercalators (e.g. doxorubicin, daunorubicin, actinomycin, bleomycin), alkylating agents (e.g. cyclophosphamide, chlorambucil, nitrosureas such as carmustine or nimustine, streptozocin, busulfan, cisplatin, oxaliplatin, triethylenemelamine, dacarbazine), hormonal therapies (e.g. glucocorticoids, aromatase inhibitors such as tamoxifene, antiandrogens such as flutamide, gonadotropin-releasing hormone (GnRH) analogs such as leuprolide), antibiotics, kinase inhibitors (e.g. erlotinib, gefitinib, imatinib), receptor antagonists (e.g. antibodies targeting cell surface receptors known to promote carcinogenesis and tumor growth), enzyme inhibitors (e.g. cyclin-dependent kinase (CDK) inhibitors), amino acid-depleting enzymes (e.g. asparaginase), leucovorin, retinoids, activators of tumor cell apoptosis, and antiangiogenic agents.
The following are examples of methods and compositions of the invention. It is understood that various embodiments may be practiced, given the general description provided above.
EXAMPLES Example 1
The following methods and reagents were used in conducting the investigations described in Examples 2-12.
Cell Culture: Cell lines were obtained from ATCC and cultured as recommended. Protein extraction and immunoprecipitations (IPs): IP's were performed as previously described (Kumar P P, et al., eLife. e02805 (2014)). Input lanes contain 5% of protein lysate used for IP; 25% of IP'd material was loaded and subjected to immunoblotting.
Cell Lines: T47D, MCF7, HCC1428, ZR7530, MDA-MB361, MDA-MB453, HCC1954, HCC2157, MDA-MB468, DU4475, MDA-MB231, HCC1395, HCC38, PHF, PME, MCF10A, HEK293, HeLa, Jurkat, HUV-EC-C, UMUC3, HCT116 were purchased from ATCC. All cells were cultured and maintained as per the ATCC recommended protocols.
Human tissue samples and lysates: Normal human tissue lysates were obtained from Novus biologicals. Brain (NB820-59177), ovary (NB820-59243), liver (NB820-59232), small intestine (NB820-59255), bone marrow (NB820-59283), colon (NB820-59205) and lung (NB820-59239). Buffer composition of all the tissue lysates are similar to the Dignam buffer employed for all other lysates/IPs. Deidentified human breast tumor tissues were collected from the Geisinger Clinic surgical oncology biobank in accordance with IRB regulations. The tissues were flash frozen in liquid nitrogen following surgery and stored in −80° C. until immunoprecipitation.
Cell transfection: For overexpression of myc-tagged constructs, HEK293 cells were transfected with indicated vectors using lipofectamine-3000 reagent (ThermoFisher, L3000001) as per the manufacture's procedure. Transfections of siRNAs in T47D, MDA-MB231, PMEs, PHFs, and Jurkat cells were performed by using Neon transfection system (MPK10025). For the overexpression of vector or RRM3 domain in T47D, X-tremeGENE HP DNA transfection reagent (Roche) was used and the transfection was carried out as per the manufacturer's recommendations. siRNAs were used at the concentration of 100 nM in all the knockdown experiments.
Protein extraction and immunoprecipitations: IP's were performed as per the manufacturer's protocol (ThermoFisher, Dynabeads Co-Immunoprecipitation Kit: 14321D). Briefly, lysates were prepared with Dignam buffer and cleared lysates were incubated for 4 hours at 4° C. with specific antibodies followed by incubation with the pre-equilibrated Dynabeads Protein G (Invitrogen) for 2 hours at 4° C. with. Immunoprecipitated beads were washed three times with lysis buffer and resuspended in 6×SDS-loading buffer. Immunoprecipitated proteins were subjected to SDS-PAGE analysis followed by immunoblotting with specific antibodies. Note: Immunoprecipitation antibodies are listed at top and immunoblot antibodies listed at left for figures.
Antibodies: CAPERα (A300-291A) Bethyl laboratories, R-IgG (Santa Cruz (SC)-2027), m-IgG (Santa Cruz, SC-2025), Flag (Sigma, F3165), myc-tag (Santa Cruz, SC-40), Actin (Santa Cruz, SC-47778), H3K9me3 (Cell Signaling, 9754), H3K4me3 (Cell Signaling, 9751; active motif 39159), H3K27me3 (Cell Signaling, 9733), H3K9ace (Cell Signaling, 9649), H3K36me (Cell Signaling, 4909), H3 (Cell Signaling, 9715), H3K27ace (Abram (ab) 4729), H3K9ace (ab176916), Tubulin (CP-06, Calbiochem), rabbit polyclonal Ki67 (Vectorlabs), TBX3(A303-098A) Bethyl laboratories, Ezh2 (Cell Signaling, 5246), MLL1 (Active Motif, 61296), MLL2 (Novus Biologicals, NBP1-89123), EZH2 (Cell Signaling, 5246), WDR5 (Santa Cruz, SC-393080; Active Motif 61485), RbBP5 (Novus biologicals 600-252), ERα (Santa Cruz, SC-7207), HCF1 (ab 137618), Lamin A/C (Santa Cruz, E-1), HDAC1 (Cell Signaling, 2062), HNRNPC1/C2 (Santa Cruz, SC-32308), HNRNPU (Santa Cruz, SC-32315), PABP (Santa Cruz, SC-166027), SAP 155 (Santa Cruz, SC-514655), U2AF65 (Santa Cruz, SC-53942), DDX3 (Santa Cruz, SC-365768), HNRNPA1 (Santa Cruz, SC-32301), DDX17 (Santa Cruz, SC-130650), HNRNPD (Abram, ab61193), DDX21 (Santa Cruz, SC-376953). The WDR5 and ASH2L antibody were gifts from Danny Reinberg.
Plasmids: Wild type and truncations of CAPERα were generated by PCR amplification and then cloned into the pcDNA4/myc-His vector. Individual domains were cloned into PGEX-6P-1 vector. GST-tagged domains were cloned in pcDNA4/myc-His vector. GST-tagged RRM3 microdeletion constructs were synthesized by IDTDNA technologies as a g-block fragments and cloned in pCDNA4/myc-His vector. Cassettes for generating CPPs peptides were designed as g-blocks by IDTDNA technologies and cloned in to pGEX-6P-1. Correct sequence of all plasmids was confirmed.
Purification of GST-CAPERα proteins: GST-tagged RBM39 full length (FL) and deletion constructs were expressed in BL-21 DE3 cells and induced by 0.25 mM IPTG. Columns of GST and GST-RBM39 FL and deletions were prepared as per the manufacture's protocol (GE17075601). Bound proteins were eluted with one volume of elution buffer (50 mM Tris-HCl, 10 mM reduced Glutathione, pH 8.0) and analyzed by SDS-PAGE. Purified proteins were visualized by Coomassie brilliant blue stain. For the CPPs, the GST tag was removed by PreScission protease (GE Healthcare).
GST pull-down assays: GST-tagged RBM39 full length or individual domains, and GST bound columns were incubated with 5 mg of T47D Dignam lysate at 40° C. overnight. Beads were washed 3 times Dignam buffer C and bound proteins were analyzed by western blotting with the respective antibody.
Myc pull-down assays: Myc pull-down was performed as per manufacturer's protocol (ThermoFisher: Pierce c-Myc-Tag IP/Co-IP Kit: 2360).
Electrophoretic mobility shift assays (EMSAs): GST and GST-RBM39 FL and individual domains were purified and incubated with synthetic oligos (IDTDNA technologies) or PCR amplified and purified DNA segments of RBM39-MLL1 targets promoter regions. Protein-DNA binding reactions were resolved by 0.8% agarose gel or 6% native polyacrylamide gel electrophoresis and stained with SYBR GOLD nucleic acid stain and documented using ChemiDoc XRS+ system.
Nuclear and cytoplasmic separations were performed as per the manufacturer's protocol (GenDEPOT: N2100-010).
Retroviral transduction and selection of stable cells were performed as per the published literature (Kumar et al., 2014) (http://delangelab.rockefeller.edu/assets/file/Retrovirusprotocol.pdf). RBM39 shRNAs were generated as per the published literature (Kumar, P. P., et al., eLife, e02805 (2014)) and MLL1 shRNA were prepared from published MLL1 specific siRNAs (Caslini, C., et al., Mol Cell Biol 29:4519-4526 (2009); Hsieh, J. J., et al., Cell 115:293-303 (2003); Yokoyama A, et al., Mol Cell Biol. 24(13):5639-492004).
MLL shRNA FP: (SEQ ID NO: 48) GATCCAAGAAGTCAGAGTGCGAAGTCTCAAGAGGACTTCGCACTCTGAC TTCTTTTTTTTGGA MLL shRNA RP: (SEQ ID NO: 49) AGCTTCCAAAAAAAAGAAGTCAGAGTGCGAAGTCCTCTTGAGACTTCGC ACTCTGACTTCTTG
Population doubling assay/3T5 growth curves: were performed as in (Lessnick, S. L., et al., Cancer Cell 1:393-401 (2002)). T47D and MCF10A cells were plated in a 10 cm dish and transduced with retrovirus. After 24 hrs, cells were incubated with specific mammalian antibiotic medium (puromycin or blasticidin) for an additional 24-72 hrs. On day 0 of the 3T5 growth curve, cells were trypsinized, counted and 500,000 cells then plated per 10 cm dish. This procedure was repeated every 3 days for 15 days. Population doublings were calculated by (log N1/log 2)−(log N0/log 2) N1=current cell count, N0=Initial cell count. Curves shown in FIG. 5 are representative of 2 independent experiments. Curves shown are representative of 2 independent experiments.
Crystal violet assay/optical density method of cell quantitation: 5×10⁵ cells were plated per well in 6-well tissue culture plates. At times indicated cells were washed with PBS and fixed for 10 minutes in a 10% formalin solution. Cells were then rinsed with distilled water and subsequently stained with 100 μl 0.1% crystal violet solution for 30 min. Stained cells were rinsed with water to remove the excess traces of the staining solution. Cell-associated crystal violet dye was extracted with 500 μl of 10% acetic acid. Aliquots were collected and optical density was measured at 590 nm wavelength. Each point on the curve shown represents 3 independent wells.
RNA isolation and reverse transcription-PCR analysis: Total RNA was prepared using the RNeasy RNA isolation kit (Qiagen) or NucleoSpin RNA II Kit (Clontech) and cDNA was synthesized with cDNA EcoDry Premix Double Primed (Clontech). Q-RT-PCR was performed with So FastEvagreen Supermix (Bio-Rad) as per manufacturer's protocol.
siRNA Sequences:
Control siRNA: S: (SEQ ID NO: 50) AAUUCUCCGAACGUGUCACGUUU AS: (SEQ ID NO: 51) ACGUGACACGUUCGGAGAAUUUU RBM39 siRNA 1: S: (SEQ ID NO: 52) GACAGAAAUUCAAGACGUUUU AS: (SEQ ID NO: 53) AACGUCUUGAAUUUCUGUCUU RBM39 siRNA 2: S: (SEQ ID NO: 54) GAAGCGAAGUAGAGACAGAUU AS: (SEQ ID NO: 55) UCUGUCUCUACUUCGCUUCUU RBM39 siRNA 3: S: (SEQ ID NO: 56) AAGAUUGGGUUGCCUCAUAUUUU AS: (SEQ ID NO: 57) AAUAUGAGGCAACCCAAUCUUUU siSMART Pool: SiGENOME Human RBM39 (9584) SiRNA SMART Pool, (Dharmacon, M-011965-00-0010). siRNA knockdown: cells were transfected with control, CAPERα (Kumar et al., 2014) and MLL1 siRNAs (Caslini et al., 2009) using X-treme GENE HP DNA transfection reagent as per manufacturer's instructions. For RNA-sequencing, T47D cells were transfected with two CAPER specific siRNAs (Dowhan D H, et al., Mol Cell. 17(3):429-39 (2005)). For cell studies, a single siRNA was employed as in (Kumar et al., 2014).
Soft agar colony formation assay: To assay for anchorage-independent growth, 5×10⁵ control or CAPERα shRNA transduced T47D or MCF10A cells in 1.5 ml media with 0.35% agarose was applied on top of set 0.5% tissue culture grade agarose in 1.5 ml media in 6 well dishes. Cells were cultured for 14 days, dishes stained with 0.005% crystal violet, and colonies counted.
T47D mouse xenografts: All procedures were approved by the University of Utah IACUC. 10×10⁶ control or CAPERα shRNA transduced T47D cells were suspended in 25 μl Matrigel and implanted into the cleared right inguinal mammary fat pad of 3-week-old NOD/SCID mice as described (Wysocka J, et al., Cell. 121(6):859-72 (2005)). A subcutaneous estrogen pellet was also transplanted behind the shoulder blades. To determine tumor volume, the length and the width were determined by calipers. Tumor volume=½(length×width²).
Cell counts for CPP treatments: Cells were plated in 6-well dishes and incubated with 5 μM concentration of peptides. At days noted, cells were trypsinized and counted using a hemocytometer.
Bioinformatic analyses of RNA and ChIP-Seq data. ChIP-seq Data Standards and Processing Pipeline from ENCODE were employed. Each sample was sequenced with approximately 25M 50 bp reads. Single-end reads were aligned to UCSC HG19 using Burrows-Wheeler Aligner (BWA) (v0.7.15) (Li H, et al., Bioinformatics. 25(14):1754-60 (2009)) and sorted using Samtools (v1.3.1) (Li H, et al., Bioinformatics. 25(16):2078-9 (2009)). Duplicate reads were removed using Picard (v2.9.0) to generate final sorted BAM files. Peaks were called using MACS2 (Zhang Y, et al., Genome Biol. 9(9):R137 (2008)). Overlapped peaks from different individual peaks were merged to generate the final set of ChIP-Seq peaks and investigate the co-occurrency of peaks in different CAPER and MLL samples. To understand the function of these peaks, peaks were annotated to different gene regions according to the following parameters: coding, intronic, 5′ or 3′ UTR, promoter (2 Kb upstream from a transcription start site), upstream (10 Kb upstream from a promoter), downstream (10 Kb downstream from a transcription stop), and intergenic regions. De novo and known motif were then searched for in the ChIP-Seq peaks using HOMER (Heinz S, et al., Mol Cell. 38(4):576-89 (2010)). GREAT (McLean C Y, et al., Nat Biotechnol. 28(5):495-501 (2010)) was used to characterize biological function of target genes including Gene Ontology (GO) (Ashburner M, et al., Nat Genet. 25(1):25-9 (2000)) and MSigDB pathway analysis as described in the results. The function of target genes was annotated based on established lists of housekeeping genes (Eisenberg E, et al., Trends in genetics: TIG. 29(10):569-74 (2013)), oncogenes, and tumor suppressors (Lever J, et al., Nat Methods. 16(6):505-7 (2019)).
For RNA-Seq, raw paired end reads from the FASTQ files were trimmed with Cutadapt https://cutadapt.readthedocs.io/en/stable/to remove the low-quality tails. Reads were aligned on UCSC HG19 using Tophat2 (v2.0.12) (Trapnell C, et al., Nat Protoc. 7(3):562-78 (2012)) guided by RefSeq gene annotation downloaded from UCSC 2/6/19. Cufflinks (v2.2.1) was used to estimate the expression abundances of genes and transcripts. Cuffdiff was used to identify differentially expressed genes (DEGs) between the two replicates of control versus CAPER knockdown, with default parameters and a q-value <0.05 as the significance threshold for all subsequent analyses. DEGs were annotated to the four functional categories mentioned above and investigated the significance of enriched up/downregulated genes by comparing the observed fraction of DEGs among each category against the fraction of DEGs among all genes. The p-value was calculated based on the hypergeometric distribution.
Generation of synthetic peptides from the RRM3 domain: RRM3-derived peptides were commercially synthesized by Abm at purity >80%. Peptides were dissolved in 1λPBS at 1 mg/ml and used at 5 μM in low serum (1%) RPMI media.
MLL1 CRISPR/Cas KO procedure: T47D cells were plated on 6-well plate in complete growth medium (RPMI with 10% FBS). Cells were transfected with MLL CRISPR/Cas9 KO and MLL HDR plasmid at the ratio of 1:1.2 μg. The Neon transfection system was used with a single pulse at 1,700 pulse voltage and 20 ms pulse width. Transfected cells were plated in complete medium for 24 hours followed by puromycin selection. MLL1 knockout efficiency was measured by RT-PCR to assay for transcript levels.
Example 2 CAPERα Depletion Reduces Tumorigenesis and Cancer Hallmarks in Breast Cancer Cells
It was previously reported that CAPERα is required to regulate cell proliferation and prevent senescence of primary human fibroblasts, suggesting that CAPERα has oncogenic potential (Kumar et al., 2014). There is evidence that CAPERα plays a role in breast and other cancers (Mercier I, et al., Cell Cycle. 13(8):1256-64 (2014); Mercier I, et al., Am J Pathol. 174(4):1172-90 (2009); Chai Y, et al., Tumour biology: the journal of the International Society for Oncodevelopmental Biology and Medicine. 35(7):6311-7 (2014); Sillars-Hardebol A H, et al., Cellular oncology. 35(4):293-300 (2012); Dutta J, et al., J Virol. 82(21):10792-802 (2008); Huang G, et al., Cancer. 118(8):2106-16 (2012); Dai L, et al., Experimental hematology & oncology. 2(1):15 (2013)). It was investigated herein that CAPERα influences tumorigenesis and invasion in vivo. Cells were xenografted from the T47D ER+, luminal-like breast cancer cell line, transduced with either control or CAPERα shRNA-expressing lentivirus, into the cleared right inguinal mammary fat pad of 3-4 week-old NOD/SCID mice as previously described (DeRose Y S, et al., Current protocols in pharmacology/editorial board, SJ Enna. Chapter 14 (2013)). Effective knockdown of CAPERα protein was verified (FIG. 1A). At 15 weeks, removal of the implantation site revealed that all control xenografts had formed well vascularized tumors (examples shown in FIG. 1B). In marked contrast, 6/8 CAPERα knockdown (kd) xenografts had no tumor, and 2 had tumors that were significantly smaller than controls (examples FIGS. 1B, C).
Whether CAPERα regulated proliferation or survival of T47D and the triple-negative, basal-like breast cancer cell line MDA-MB231, as well as of the non-transformed MCF10A breast epithelial cell line and primary mammary epithelial cells (PMEs) was also investigated. CAPERα knock-down (kd) decreased proliferation of T47D and MDA-MB231 breast cancer cells assayed by crystal violet and population doublings, but did not have this effect in either MCF10A or PME cells (FIGS. 1E, F). Consistent with this, the percentage of Ki67+ cells at 48 hours post kd (FIG. 1G) was also significantly decreased only in breast cancer cells. Although T47D cell viability was unchanged, 20% of MDA-MB231 cells were dead indicating that the altered MDA-MB231 growth curve reflects a combination of decreased proliferation and cell death in response to CAPERα kd (total cell number decreased by 50%, with 20% attributable to cell death, FIGS. 1 H, I). Anchorage-independent cell growth was also decreased (FIG. 11A) as were transcript levels of a sample of cell cycle genes in breast cancer cells, but not benign breast cells (FIG. 11B). Thus, some breast cancer cell hallmarks require CAPERα yet survival and proliferation of normal breast epithelial cells are CAPERα independent.
Example 3 Loss of CAPERα Results in Global Changes in Activating Histone Marks
It was previously demonstrated that CAPERα kd in primary human fibroblasts resulted in altered H3K9 methylation and acetylation of promoter regions of target genes, repressing their transcription (Kumar et al., 2014). Whether decreasing CAPERα levels alters global histone epigenetic marks in breast cancer cells was investigated. The lysates from cells transfected with CAPERα or negative control siRNAs was analyzed. While the total amount of Histone-3 (H3) was unchanged, there was a dramatic decrease in the level of the activating H3K4me3 mark in both T47D and MDA-MB231 breast cancer lines (and in MDA-MB468, not shown) but not in PMEs (FIG. 11H). Histone association assays showed that CAPERα interacts with H3K4me3 and H3K9ace activating marks in breast cancer cells, but not PMEs (FIG. 11J). CAPERα kd decreased levels of H3K27ace and H3k9ace activating marks in T47Ds but had no effect on repressive marks (H3K9me3 or H3K27me3, FIG. 11H′). In contrast, in primary human fibroblasts (PHFs) the levels of activating marks increase, and repressive marks decrease after CAPERα kd (FIG. 34A) and CAPERα only interacts with repressive marks (FIG. 34C). This is consistent with the CAPERα/TBX3 corepressor previously reported in PHFs (Kumar et al., 2014).
Example 4 CAPERα Interacts with Histone Modifying Enzymes in a Cell-Specific Manner
The data presented herein indicate that CAPERα is involved in establishing or maintaining active epigenetic marks in breast cancer cells. Given the loss of H3K4me3 that was observed in CAPERα kd breast cancer cells, whether CAPERα interacts with MLL1 (i.e., whether MLL1 co-IPs with endogenous CAPERα (and the reciprocal) in T47 and MDA-MB231 breast cancer cells, but not in PMEs (FIG. 2A, B) was investigated. The CAPERα-MLL1 complex (henceforth called CAP/MLL1) was detected in breast cancer cell lines of all subtypes (Dai X, et al., J Cancer. 8(16):3131-41 (2017)), independent of p53 status or amount of CAPERα expressed (FIG. 12).
Importantly, co-IPs of lysates prepared from flash frozen human tissues showed no CAP/MLL1 interaction in normal breast, while CAPERα and MLL1 interacted in both ER+ and triple-negative breast cancers (FIG. 2C), indicating that the complex is not merely an epiphenomenon in breast cancer cell lines. CAP/MLL1 was undetectable in other human tissues, including those commonly adversely affected by chemotherapy (FIG. 2D). These results suggest that CAP/MLL1 complex may be specific to breast cancer cells. This is further supported by the observation that in addition to MLL1, CAPERα interacts with COMPASS factors ASH2L and MLL2 in T47D cells, whereas in primary fibroblasts, it interacts with corepressors HDAC-1 and TBX3 (FIGS. 13A, B). EZH2 can function as a coactivator or repressor in breast cancer cells (Tan J Z, et al., Acta pharmacologica Sinica. 35(2):161-74 (2014)) and interacts with CAPERα (FIG. 13A), while in primary fibroblasts it interacts with the CAPERα/TBX3 corepressor (FIG. 13B).
Whether MLL1 kd phenocopies CAPERα loss of function (FIG. 2E) was also tested. Akin to CAPERα, MLL1 kd decreased proliferation indices and H3K4me3 in breast cancer cells (FIG. 2FH). MCF10A cells were unaffected by MLL1 kd, while PMEs had a slight reduction in proliferation and H3K4me3 consistent with MLL1's known function in many normal cells. These data further support that the CAP/MLL1 complex plays a key role in regulating the status of histone marks and proliferation of breast cancer cells.
Example 5 CAPERα Interacts with Multiple Compass Complex Members in Breast Cancer Cells
Optimal MLL1 catalytic activity requires that it function within a core complex containing COMPASS proteins ASH2L, RbBP5 and WDR5 (Dou Y, et al., Nat Struct Mol Biol. 13(8):713-9 (2006)). Endogenous CAPERα, MLL1, ASH2L, RbBP5 and WDR5 reciprocally co-IP each other in T47D (FIG. 3A) and MDA-MB231 breast cancer cells (FIG. 3B), but not in PMEs (FIG. 3C).
Myc- and GST-pull downs were used in HEK293 cells to assay for direct interactions. Overexpressed myc-tagged CAPERα co-IP′d endogenous MLL1 in heterologous cells (FIGS. 3 D, E) and all MLL1 core complex members present in T47D lysates bound GST-CAPERα (FIG. 3F) but not GST alone (FIG. 3G).
CAPERα has three RRM domains, a transcriptional activation (AD), and estrogen receptor (ESR-ID) and JUN (JUN-ID) interaction domains (Uniprot, FIG. 14). To identify domain(s) necessary for binding with MLL1 complex, myc-tagged CAPERα deletion and isolated domain expression constructs were generated and expressed in heterologous cells (FIGS. 14A, B). WDR5 interacts with an N-terminal portion of CAPERα (FIG. 3H, lane 1), while MLL1, ASH2L, and RbBP5 co-IP′d with C-terminal regions (FIG. 3H, lanes 4, 5). Consistent with this, WDR5 interacts with the isolated RRM1 domain (located in the N-terminus, FIG. 3I, lane 1), while MLL1, ASH2L and RbBP5 interacted with RRM3 (C-terminal, FIG. 3I, lane 3). Purified individual domain GST-fusion proteins (FIG. 14C) incubated with T47D lysates confirm the myc pulldown interactions and show that they are direct (FIG. 3J). These breast cancer specific protein-protein interactions are of great functional and potential therapeutic importance since WDR5 provides an RNA binding pocket for the core complex while the RbBP5/ASH2L heterodimer forms a “joint catalytic center” with the SET domain of MLL1 (Cao F, et al., PLoS One. 5(11):e14102 (2010); Li Y, et al., Nature. 530(7591):447-52 (2016); Wysocka J, et al., Cell. 121(6):859-72 (2005); Odho Z, et al., J Biol Chem. 285(43):32967-76 (2010)).
Whether CAPERα depletion influences interaction of MLL1 core components was investigated. CAPERα kd disrupted the MLL1-ASH2L interaction (FIG. 3L and FIG. 14D), but not MLL1-WDR5 or MLL1-RbBP5 (FIG. 3L). Thus, CAPERα not only interacts with MLL1 components, but promotes complex integrity by facilitating MLL1-ASH2L interaction.
Although CAPERα directly interacts with estrogen receptor in yeast (Jung D J, et al., J Biol Chem. 277(2):1229-34 (2002)) and MLL1 interacts with HCF-1 in leukemia cells (Yokoyama A, et al., Mol Cell Biol. 24(13):5639-49 (2004)), interaction between CAPERα and either of these factors in T47D, MDA-MB231 or PME cells was not detected (FIG. 14F).
Example 6 CAPERα is Required for MLL1 Occupancy and Regulation of Known MLL1 Target Genes
BCL2L1, BCL6, JUNB, CCND1 and GATA3 are known MLL1 direct targets in U937 cells (Guenther M G, et al., Genes Dev. 22(24):3403-8 (2008)). ChIP-PCR shows that CAPERα and MLL1 co-occupy the promoters of these genes in T47D cells (FIG. 4A). Furthermore, assay of control and CAPERα kd cells revealed that MLL1 binding and H3K4me3 of these targets not only coincide with CAPERα chromatin occupancy, they require it (FIGS. 4B, C). RT-PCR showed that expression of these genes is markedly decreased by kd of CAPERα or MLL1 in T47D but not PME cells (FIGS. 4D-F). Since CAPERα kd has no effect on MLL1 protein levels (FIG. 14A), its effects on H3K4me3 and gene expression in T47D cells result from failure of the MLL1 complex to bind in the absence of CAPERα.
Example 7 Genome-Wide Analysis of CAPERα and MLL1 Chromatin Occupancy in T47D Breast Cancer Cells
Decreased bulk H3K4me3 levels after CAPERα kd suggest that its requirement for MLL1 function is pervasive in breast cancer cells. High-throughput sequencing of CAPER and MLL1 bound chromatin IP′d from T47Ds identified 5,741 bound regions for CAPERα (associated with 7743 genes) and 11,037 for MLL1 (10,882 genes) (FIG. 5A, Tables 1-3). Remarkably, >4,500 regions were co-occupied by CAPERα and MLL1. This highly significant 79% co-occupancy substantiates the importance of the CAP/MLL1 complex in regulating chromatin structure and downstream transcriptional pathways controlling breast cancer cell phenotypes. Because most peaks were greater than 1 Kb wide (as has been reported for MLL1 occupancy in other cell types (Xu H, et al., Cancer Cell. 30(6):863-78 (2016)) (FIG. 5B), they were referred to as cobound “regions”. The majority of cobound regions (78%) were in promoters/5′UTRs (FIG. 5C). In 8% of all cobound genes, CAP/MLL1 occupies very broad windows encompassing the entire gene; this includes “pioneer” factor genes GATA3 (FIG. 5F′) and FOXA1 that function upstream of estrogen receptor in luminal-like breast cancers (Chen K, et al., Nat Genet. 47(10):1149-57 (2015); Lever J, et al., Nat Methods. 16(6):505-7 (2019); Heinz S, et al., Mol Cell. 38(4):576-89 (2010); McLean C Y, et al., Nat Biotechnol. 28(5):495-501 (2010); Sanchez-Vega F, et al., Cell. 173(2):321-37 e10 (2018)). This broad occupancy is similar to H3K4me3/H3K27ace patterns that correlate with high levels of expression, maintenance of transcription, and transcriptional elongation in many normal cell types (Chen et al., 2015).
Of the 137 cancer driver genes enumerated by Vogelstein (Vogelstein B, et al., Science. 339(6127):1546-58 (2013)), 47% are co-occupied by CAP/MLL1 (p<2.0×10-09). The number of housekeeping, tumor suppressors and oncogenes (Lever J, et al., Nat Methods. 16(6):505-7 (2019)) bound by CAP/MLL11 is significantly higher than random (p values of 2.6×10-110, 6.12×10-24 and 2.43×10-60, respectively).
All co-bound regions and promoters for overrepresented motifs to were searched to identify sequences that may facilitate CAP/MLL1 binding. The most enriched de novo motif identified by HOMER (Heinz S, et al., Mol Cell. 38(4):576-89 (2010)) (FIG. 5D) is consistent with affinities revealed by EMSA assays showing recombinant CAPERα binds GC-rich oligonucleotides (FIG. 15A). The complete HOMER motif output for all cobound regions is shown in FIG. 16; GREAT analysis (McLean et al., 2010) yielded additional conserved motifs (FIG. 17). Enriched cobound promoter motifs (FIG. 21 and FIG. 22) include consensus motifs for MYC, Rb, E2F1 predicting direct targets of CAP/MLL1 in cell cycle regulation, while STAT1/3, ARNT, GABPB1/2 motifs predict cytokine, hypoxia and mitochondrial/metabolic targets, respectively.
The GREAT hierarchical tool allowed the identification of the most specific significantly enriched Gene Ontology (GO) Biologic Process (BP) terms. Then, the members of each term's geneset were manually examined and curated into functional categories (color key, FIG. 5D″). The pie charts in FIGS. 5 D-F show the number of BP terms in each category. The enriched BP terms and how they were coded by function/color are shown in S. FIGS. 5.4-5.6. Representative occupancy patterns for 5′ (promoter/TSS) cobound and whole gene cobound are shown in FIGS. 5 E′ and F′.
| 17,779 |
https://github.com/glyce/secdept-2.0/blob/master/application/views/pages/profile.php
|
Github Open Source
|
Open Source
|
MIT
| null |
secdept-2.0
|
glyce
|
PHP
|
Code
| 1,967 | 10,013 |
<link rel="stylesheet" href="<?php echo site_url('assets/style.css'); ?>">
<div class="row">
<div class="col-lg-3 col-sm-8">
<div class="card hovercard">
<div class="cardheader"></div>
<div class="avatar">
<img alt="" src="<?php echo site_url('assets/img/app/logoEBVSAI.png'); ?>">
</div>
<div class="info">
<div class="title">
<a target="_blank" href=""><?php echo ucfirst(strtolower($user_data->first_name)); ?> <?php echo ucfirst(strtolower($user_data->last_name)); ?></a>
</div>
</div>
</div>
<ul class="nav nav-pills nav-stacked">
<li><a href=""><i class="fa fa-users"></i> Total Guard Referral
<span class="label label-primary pull-right"><?php echo $total_refered_guards; ?></span></a></li>
<li><a href=""><i class="fa fa-envelope"></i> Message</a></li>
<li><a href=""><i class="fa fa-user"></i> My Security Guards</a></li>
</ul>
</div>
<div class="col-md-9">
<div class="row">
<div class="col-md-8">
<h4><?php echo ucfirst(strtolower($user_data->first_name)); ?> <?php echo ucfirst(strtolower($user_data->last_name)); ?></h4>
</div>
<div class="col-md-4">
<div class="box box-solid box-danger">
<div class="box-header with-border">
<h4 class="box-title">Summary</h4>
</div>
<div class="box-body no-padding">
<ul class="nav nav-pills nav-stacked">
<li>
<a href="">
<i class="fa fa-check"></i> Approved Guards
<span class="label label-primary pull-right"><?php echo count($referred_guards['approved']); ?></span>
</a>
</li>
<li>
<a href="">
<i class="fa fa-times"></i> Rejected Guards
<span class="label label-primary pull-right"><?php echo count($referred_guards['rejected']); ?></span>
</a>
</li>
</ul>
</div>
</div>
</div>
</div>
<div class="row">
<div class="col-lg-12">
<ul class="nav nav-tabs" role="tablist">
<li role="presentation" class="active"><a href="#pending" aria-controls="pending" role="tab" data-toggle="tab">Pending</a></li>
<li role="presentation"><a href="#approved" aria-controls="approved" role="tab" data-toggle="tab">Approved</a></li>
<li role="presentation"><a href="#rejected" aria-controls="rejected" role="tab" data-toggle="tab">Rejected</a></li>
</ul>
<div class="tab-content">
<div role="tabpanel" class="tab-pane active" id="pending">
<div class="table-responsive">
<table class="table table-hover table-striped" id="dt-client-sg-requests">
<thead>
<tr>
<th class="text-left">...</th>
<th class="text-left">Licensed No.</th>
<th class="text-left">Full Name</th>
<th class="text-center">Date Hired</th>
<th class="text-center" colspan="2">Action</th>
</tr>
</thead>
<tbody>
<?php if ( ! empty($referred_guards['pending'])): ?>
<?php foreach ($referred_guards['pending'] as $index => $pending_request): ?>
<tr>
<td class="text-left"><img src="class="img-circle" width="30" height="30"></td>
<td class="text-left">
<a class="btn btn-link" data-target="#modal-details-<?php echo md5($index).md5($pending_request['request_id']); ?>" data-toggle="modal">
<?php echo $pending_request['license_number']; ?>
</a>
</td>
<td class="text-left"><?php echo $pending_request['employee_fullname']; ?></td>
<td class="text-center"><?php echo $pending_request['date_hired']; ?></td>
<td class="text-center">
<a href="javascript:void(0);" data-toggle="modal" data-target="#modal-approve-<?php echo $index; ?>">
<i class="fa fa-check text-green"></i>
</a>
</td>
<td class="text-center">
<a href="javascript:void(0);" data-toggle="modal" data-target="#modal-reject-<?php echo $index; ?>">
<i class="fa fa-times text-red"></i>
</a>
</td>
</tr>
<?php endforeach; ?>
<?php else: ?>
<tr>
<td class="text-center" colspan="4">-- No Record Found --</td>
</tr>
<?php endif ?>
</tbody>
</table>
</div>
<?php if ( ! empty($referred_guards['pending'])): ?>
<?php foreach ($referred_guards['pending'] as $index => $pending_request): ?>
<div class="modal fade" id="modal-approve-<?php echo $index; ?>">
<div class="modal-dialog">
<div class="modal-content">
<div class="modal-header" style="background-color:darkred;">
<font color="white"><p class="modal-title"><i class="fa fa-exclamation-triangle">Confirmation Message</p></i></font></div>
<div class="modal-body">
Are you sure you want to Approve <b><?php echo $pending_request['employee_fullname']; ?></b>?
</div>
<div class="modal-footer">
<button class="btn btn-default" data-dismiss="modal">No</button>
<a href="<?php echo site_url('portal/approve_referal/'.$pending_request['request_id'].'/'.$user_data->id); ?>" class="btn btn-primary" >Yes</a>
</div>
</div>
</div>
</div>
<div class="modal fade" id="modal-reject-<?php echo $index; ?>">
<div class="modal-dialog">
<div class="modal-content">
<form action="<?php echo site_url('portal/reject_referal/'.$pending_request['request_id'].'/'.$user_data->id); ?>" class="form-horizontal" method="post">
<div class="modal-header"><h3 class="modal-title">Confirmation Message</h3></div>
<div class="modal-body">
<div class="form-group">
<div class="col-sm-offset-2 col-sm-9">
<h4 class="alert alert-info">Are you sure you want to Reject <b><?php echo $pending_request['employee_fullname']; ?></b>?</h4>
</div>
</div>
<div class="form-group">
<label class="control-label col-sm-2">Remarks</label>
<div class="col-sm-9">
<textarea name="remarks" id="" cols="4" rows="4" class="form-control"></textarea>
</div>
</div>
</div>
<div class="modal-footer">
<button class="btn btn-default" data-dismiss="modal">No</button>
<button class="btn btn-primary" type="submit">Yes</button>
</div>
</form>
</div>
</div>
</div>
<div class="modal fade" id="modal-details-<?php echo md5($index).md5($pending_request['request_id']); ?>">
<div class="modal-dialog modal-lg">
<div class="modal-content">
<div class="modal-header" style="background-color:#dd4b39;">
<button type="button" class="close" data-dismiss="modal">×</button>
<font color="white"><p class="modal-title"><i class="fa fa-user-circle"></i> Security Guard Information</p></font>
</div>
<div class="modal-body">
<?php
$record = $this->employee_model->get_with_user_data(array(
'where' => array('tbl_employees.id' => $pending_request['employee_id'])
), true);
$security_guard = $record[0];
?>
<ul class="nav nav-tabs">
<li class="active"><a href="#tab1-<?php echo md5($index); ?>" data-toggle="tab">Personal Information</a></li>
<li><a href="#tab2-<?php echo md5($index); ?>" data-toggle="tab">Educational Background</a></li>
<li><a href="#tab3-<?php echo md5($index); ?>" data-toggle="tab">Government ID Numbers</a></li>
<li><a href="#tab4-<?php echo md5($index); ?>" data-toggle="tab">Personal Records</a></li>
</ul>
<div class="tab-content">
<div class="tab-pane active fade in" id="tab1-<?php echo md5($index); ?>">
<table class="table table-hover">
<tr>
<td>First Name:</td>
<td><b><?php echo $security_guard['first_name']; ?></b></td>
<td>Gender:</td>
<td><b><?php echo $security_guard['gender_label']; ?></b></td>
</tr>
<tr>
<td>Middle Name:</td>
<td><b><?php echo $security_guard['middle_name']; ?></b></td>
<td>Address:</td>
<td><b><?php echo $security_guard['address']; ?></b></td>
</tr>
<tr>
<td>Last Name:</td>
<td><b><?php echo $security_guard['last_name']; ?></b></td>
<td>Civil Status:</td>
<td><b><?php echo $security_guard['civil_status_name']; ?></b></td>
</tr>
<tr>
<td>Date of Birth:</td>
<td><b><?php echo $security_guard['birth_date']; ?></b></td>
<td>Place of Birth:</td>
<td><b><?php echo $security_guard['birth_place']; ?></b></td>
</tr>
<tr>
<td>Citizenship:</td>
<td><b><?php echo $security_guard['citizenship']; ?></b></td>
<td>Religion:</td>
<td><b><?php echo $security_guard['religion']; ?></b></td>
</tr>
<tr>
<td>Height:</td>
<td><b><?php echo $security_guard['height']; ?></b></td>
<td>Weight:</td>
<td><b><?php echo $security_guard['weight']; ?></b></td>
</tr>
<tr>
<td>Color of the Eye:</td>
<td><b><?php echo $security_guard['eyes_color']; ?></b></td>
<td>Color of the Hair:</td>
<td><b><?php echo $security_guard['hair_color']; ?></b></td>
</tr>
</table>
</div>
<div class="tab-pane fade in" id="tab2-<?php echo md5($index); ?>">
<table class= 'table table-hover'>
<tr>
<th>Educational Attainment</th>
<th>School Name</th>
<th>Address</th>
<th>Year Start</th>
<th>Year End</th>
</tr>
<tr>
<td></td>
<td></td>
<td></td>
<td></td>
<td></td>
</tr>
</table>
</div>
<div class="tab-pane fade in" id="tab3-<?php echo md5($index); ?>">
<table class= 'table table-hover'>
<tr>
<th class="text-center">Licensed Number</th>
<th class="text-center">L.N Expiration Date</th>
<th class="text-center">SSS</th>
<th class="text-center">TIN</th>
<th class="text-center">HDMF</th>
<th class="text-center">PHIC</th>
</tr>
<tr>
<td class="text-center"><?php echo $security_guard['license_number']; ?></td>
<td class="text-center"><?php echo $security_guard['licensed_number_expiration']; ?></b></td>
<td class="text-center"><?php echo $security_guard['sss']; ?></td>
<td class="text-center"><?php echo $security_guard['tin']; ?></td>
<td class="text-center"><?php echo $security_guard['hdmf']; ?></td>
<td class="text-center"><?php echo $security_guard['phic']; ?></td>
</tr>
</table>
</div>
<div class="tab-pane fade in" id="tab4-<?php echo md5($index); ?>">
<table class="table table-hover">
<tr>
<td>NBI Expiration Date:</td>
<td><b></b></td>
<td>File:</td>
<td>
<a class="btn btn-link" data-target="#details-<?php echo md5($index); ?>" data-toggle="modal">
View File
</a>
</td>
</tr>
<tr>
<td>Medical Records Expiration Date:</td>
<td><b></b></td>
<td>File:</td>
<td><b></b></td>
</tr>
<tr>
<td>Police Clearance Expiration Date:</td>
<td><b></b></td>
<td>File :</td>
<td><b></b></td>
</tr>
<tr>
<td>Barangay Clearance:</td>
<td><b></b></td>
<td>File:</td>
<td><b></b></td>
</tr>
<tr>
<td>Neuro Certificate:</td>
<td><b></b></td>
<td>File:</td>
<td><b></b></td>
</tr>
</table>
</div>
</div>
</div>
<div class="modal-footer">
<button type="button" class="btn btn-warning" data-dismiss="modal">
<span class="fa fa-remove-circle"></span> Close
</button>
</div>
</div>
</div>
</div>
<?php endforeach; ?>
<?php endif ?>
</div>
<div role="tabpanel" class="tab-pane" id="approved">
<div class="table-responsive">
<table class="table table-hover table-striped" id="dt-client-sg-requests">
<thead>
<tr>
<th class="text-left">Licensed No.</th>
<th class="text-left">Full Name</th>
<th class="text-center">Date Hired</th>
<th class="text-center">Action</th>
</tr>
</thead>
<tbody>
<?php if ( ! empty($referred_guards['approved'])): ?>
<?php foreach ($referred_guards['approved'] as $index => $approved_request): ?>
<?php $modal_details_id = md5($index).md5($approved_request['request_id']); ?>
<tr>
<td class="text-left">
<a class="btn btn-link" data-target="#modal-details-approved-<?php echo md5($index).md5($approved_request['request_id']); ?>" data-toggle="modal">
<?php echo $approved_request['license_number']; ?>
</a>
</td>
<td class="text-left"><?php echo $approved_request['employee_fullname']; ?></td>
<td class="text-center"><?php echo $approved_request['date_hired']; ?></td>
<td class="text-center">
<a class="btn btn-warning btn-sm" title="Time Record" data-target="#details-<?php echo $modal_details_id; ?>" data-toggle="modal">
<span class="fa fa-clock-o" aria-hidden="true"></span>
</a>
<a class="btn btn-success btn-sm" title="Daily Activity" data-target="#dta-<?php echo $modal_details_id; ?>" data-toggle="modal">
<span class="fa fa-folder-open" aria-hidden="true"></span>
</a>
<a class="btn btn-danger btn-sm" title="Incident Report" data-target="#ir-<?php echo $modal_details_id; ?>" data-toggle="modal">
<span class="fa fa-folder" aria-hidden="true"></span>
</a>
</td>
</tr>
<?php endforeach; ?>
<?php else: ?>
<tr>
<td class="text-center" colspan="4">-- No Record Found --</td>
</tr>
<?php endif ?>
</tbody>
</table>
<?php if ( ! empty($referred_guards['approved'])): ?>
<?php foreach ($referred_guards['approved'] as $index => $approved_request): ?>
<?php $key = multidimensional_search($approved_schedule, array('id' => $approved_request['request_id'], 'client_id' => $approved_request['client_id'])); ?>
<?php $modal_details_id = md5($index).md5($approved_request['request_id']); ?>
<div id="details-<?php echo $modal_details_id; ?>" class="modal fade">
<div class="modal-dialog">
<form action="<?php echo site_url('portal/update_security_guard_schedule/'.$approved_request['request_id']); ?>" class="form-horizontal" method="post">
<div class="modal-content">
<div class="modal-header" style="background-color:#dd4b39;">
<font color="white"><p class="modal-title"><i class="fa fa-clock-o"> Time Record</p></font></i>
</div>
<div class="modal-body">
<div class="form-group">
<label class="control-label col-sm-3">Shift Work</label>
<div class="col-sm-8">
<?php
if (isset($approved_schedule[$key]['shift_schedule'])) {
$a = $approved_schedule[$key]['shift_schedule'];
$shift_schedules = get_shift_schedule();
$current_shift = search($shift_schedules, 'id', $a);
}
?>
<select name="shift_schedule" class="form-control" required="true">
<?php if (isset($current_shift[0]['id'])): ?>
<option value="<?php echo $current_shift[0]['id']; ?>"><?php echo $current_shift[0]['text']; ?></option>
<?php else: ?>
<option value="">--Select--</option>
<?php foreach ($shift_schedules as $shift_schedule): ?>
<option value="<?php echo $shift_schedule['id']; ?>"><?php echo $shift_schedule['text']; ?></option>
<?php endforeach; ?>
<?php endif; ?>
</select>
</div>
</div>
<div class="form-group">
<label class="control-label col-sm-3">Time In</label>
<div class="col-sm-8">
<input type="text" class="form-control time_start" name="time_start" required="true" value="<?php echo isset($approved_schedule[$key]['time_start']) ? $approved_schedule[$key]['time_start'] : ''; ?>">
</div>
</div>
<div class="form-group">
<label class="control-label col-sm-3">Time Out</label>
<div class="col-sm-8">
<input type="text" class="form-control time_end" name="time_end" required="true" value="<?php echo isset($approved_schedule[$key]['time_end']) ? $approved_schedule[$key]['time_end'] : ''; ?>">
</div>
</div>
<div class="form-group">
<label class="control-label col-sm-3">Over Time</label>
<div class="col-sm-8">
<input type="text" class="form-control" name="over_time" value="<?php echo isset($approved_schedule[$key]['over_time']) ? $approved_schedule[$key]['over_time'] : ''; ?>">
</div>
</div>
<div class="form-group">
<label class="control-label col-sm-3">Day Off</label>
<div class="col-sm-8">
<?php
if (isset($approved_schedule[$key]['day_off'])) {
$a = $approved_schedule[$key]['day_off'];
$days = get_days();
$current_dayoff = search($days, 'id', $a);
}
?>
<select name="day_off" class="form-control" required="true">
<?php if (isset($current_dayoff[0]['id'])): ?>
<option value="<?php echo $current_dayoff[0]['id']; ?>"><?php echo $current_dayoff[0]['text']; ?></option>
<?php else: ?>
<option value="">-----</option>
<?php foreach ($days as $day): ?>
<option value="<?php echo $day['id']; ?>"><?php echo $day['text']; ?></option>
<?php endforeach; ?>
<?php endif; ?>
</select>
</div>
</div>
</div>
<div class="modal-footer">
<button class="btn btn-danger" data-dismiss="modal">CANCEL</button>
<button class="btn btn-success" type="submit">SUBMIT</button>
</div>
</div>
</form>
</div>
</div>
<div id="dta-<?php echo $modal_details_id; ?>" class="modal fade" role="dialog">
<div class="modal-dialog">
<div class="modal-content">
<form action="<?php echo site_url('portal/send_daily_time_activity/'); ?>" method="post" class="form-horizontal">
<div class="modal-header" style="background-color:#dd4b39;">
<button type="button" class="close" data-dismiss="modal">×</button>
<font color="white"><p class="modal-title"><i class="fa fa-folder-open"> Daily Time Activity</p></font></i>
</div>
<div class="modal-body">
<div class="form-group">
<label for="" class="control-label col-sm-2">Title</label>
<div class="col-sm-9">
<input class="form-control" name="title" placeholder="Title:" required="true">
</div>
</div>
<div class="form-group">
<label for="" class="control-label col-sm-2">Body</label>
<div class="col-sm-9">
<textarea class="form-control" name="body" cols="20" rows="5" placeholder="Put some message here..." required="true"></textarea>
</div>
</div>
<div class="form-group">
<div class="col-sm-offset-2 col-sm-9">
<input type="hidden" name="employee_id" value="<?php echo $approved_request['employee_id']; ?>">
<input type="hidden" name="client_id" value="<?php echo $approved_request['client_id']; ?>">
<button type="submit" class="btn btn-primary btn-block"><i class="fa fa-paper-plane"></i> SEND</button>
</div>
</div>
</div>
</form>
</div>
</div>
</div>
<div id="ir-<?php echo $modal_details_id; ?>" class="modal fade" role="dialog">
<div class="modal-dialog">
<div class="modal-content">
<form action="<?php echo site_url('portal/send_incident_report/'); ?>" method="post" class="form-horizontal">
<div class="modal-header" style="background-color:#dd4b39;">
<button type="button" class="close" data-dismiss="modal">×</button>
<font color="white"><p class="modal-title"><i class="fa fa-folder">Incident Report</p></font></i>
</div>
<div class="modal-body">
<div class="form-group">
<label for="" class="control-label col-sm-2">Title</label>
<div class="col-sm-9">
<input class="form-control" name="inicident_title" placeholder="Title:" required="true">
</div>
</div>
<div class="form-group">
<label for="" class="control-label col-sm-2">Body</label>
<div class="col-sm-9">
<textarea class="form-control" name="inicident_body" cols="20" rows="5" placeholder="Put some message here..." required="true"></textarea>
</div>
</div>
<div class="form-group">
<div class="col-sm-offset-2 col-sm-9">
<input type="hidden" name="incident_employee_id" value="<?php echo $approved_request['employee_id']; ?>">
<input type="hidden" name="incident_client_id" value="<?php echo $approved_request['client_id']; ?>">
<button type="submit" class="btn btn-primary btn-block"><i class="fa fa-paper-plane"></i> SEND</button>
</div>
</div>
</div>
</form>
</div>
</div>
</div>
<div class="modal fade" id="modal-details-approved-<?php echo md5($index).md5($approved_request['request_id']); ?>">
<div class="modal-dialog modal-lg">
<div class="modal-content">
<div class="modal-header" style="background-color:#dd4b39;">
<button type="button" class="close" data-dismiss="modal">×</button>
<font color="white"><p class="modal-title"><i class="fa fa-user-circle"></i> Security Guard Information</p></font>
</div>
<div class="modal-body">
<?php
$record = $this->employee_model->get_with_user_data(array(
'where' => array('tbl_employees.id' => $approved_request['employee_id'])
), true);
$security_guard = $record[0];
?>
<ul class="nav nav-tabs">
<li class="active"><a href="#tab1-<?php echo md5($index).md5($approved_request['request_id']); ?>" data-toggle="tab">Personal Information</a></li>
<li><a href="#tab2-<?php echo md5($index).md5($approved_request['request_id']); ?>" data-toggle="tab">Educational Background</a></li>
<li><a href="#tab3-<?php echo md5($index).md5($approved_request['request_id']); ?>" data-toggle="tab">Government ID Numbers</a></li>
<li><a href="#tab4-<?php echo md5($index).md5($approved_request['request_id']); ?>" data-toggle="tab">Personal Records</a></li>
</ul>
<div class="tab-content">
<div class="tab-pane active fade in" id="tab1-<?php echo md5($index).md5($approved_request['request_id']); ?>">
<table class="table table-hover">
<tr>
<td>First Name:</td>
<td><b><?php echo $security_guard['first_name']; ?></b></td>
<td>Gender:</td>
<td><b><?php echo $security_guard['gender_label']; ?></b></td>
</tr>
<tr>
<td>Middle Name:</td>
<td><b><?php echo $security_guard['middle_name']; ?></b></td>
<td>Address:</td>
<td><b><?php echo $security_guard['address']; ?></b></td>
</tr>
<tr>
<td>Last Name:</td>
<td><b><?php echo $security_guard['last_name']; ?></b></td>
<td>Civil Status:</td>
<td><b><?php echo $security_guard['civil_status_name']; ?></b></td>
</tr>
<tr>
<td>Date of Birth:</td>
<td><b><?php echo $security_guard['birth_date']; ?></b></td>
<td>Place of Birth:</td>
<td><b><?php echo $security_guard['birth_place']; ?></b></td>
</tr>
<tr>
<td>Citizenship:</td>
<td><b><?php echo $security_guard['citizenship']; ?></b></td>
<td>Religion:</td>
<td><b><?php echo $security_guard['religion']; ?></b></td>
</tr>
<tr>
<td>Height:</td>
<td><b><?php echo $security_guard['height']; ?></b></td>
<td>Weight:</td>
<td><b><?php echo $security_guard['weight']; ?></b></td>
</tr>
<tr>
<td>Color of the Eye:</td>
<td><b><?php echo $security_guard['eyes_color']; ?></b></td>
<td>Color of the Hair:</td>
<td><b><?php echo $security_guard['hair_color']; ?></b></td>
</tr>
</table>
</div>
<div class="tab-pane fade in" id="tab2-<?php echo md5($index).md5($approved_request['request_id']); ?>">
<table class= "table table-hover">
<tr>
<th>Educational Attainment</th>
<th>School Name</th>
<th>Address</th>
<th>Year Start</th>
<th>Year End</th>
</tr>
<tr>
<td></td>
<td><?php echo $security_guard['school_name']; ?></td>
<td><?php echo $security_guard['school_address']; ?></td>
<td><?php echo $security_guard['year_start']; ?></td>
<td><?php echo $security_guard['year_end']; ?></td>
</tr>
</table>
</div>
<div class="tab-pane fade in" id="tab3-<?php echo md5($index).md5($approved_request['request_id']); ?>">
<table class= "table table-hover">
<tr>
<th class="text-center">Licensed Number</th>
<th class="text-center">L.N Expiration Date</th>
<th class="text-center">SSS</th>
<th class="text-center">TIN</th>
<th class="text-center">HDMF</th>
<th class="text-center">PHIC</th>
</tr>
<tr>
<td class="text-center"><?php echo $security_guard['license_number']; ?></td>
<td class="text-center"><?php echo $security_guard['licensed_number_expiration']; ?></b></td>
<td class="text-center"><?php echo $security_guard['sss']; ?></td>
<td class="text-center"><?php echo $security_guard['tin']; ?></td>
<td class="text-center"><?php echo $security_guard['hdmf']; ?></td>
<td class="text-center"><?php echo $security_guard['phic']; ?></td>
</tr>
</table>
</div>
<div class="tab-pane fade in" id="tab4-<?php echo md5($index).md5($approved_request['request_id']); ?>">
<table class="table table-hover">
<tr>
<td>NBI Expiration Date:</td>
<td><b></b></td>
<td>File:</td>
<td>
<a class="btn btn-link" data-target="#details-<?php echo md5($index); ?>" data-toggle="modal">
View File
</a>
</td>
</tr>
<tr>
<td>Medical Records Expiration Date:</td>
<td><b></b></td>
<td>File:</td>
<td><b></b></td>
</tr>
<tr>
<td>Police Clearance Expiration Date:</td>
<td><b></b></td>
<td>File :</td>
<td><b></b></td>
</tr>
<tr>
<td>Barangay Clearance:</td>
<td><b></b></td>
<td>File:</td>
<td><b></b></td>
</tr>
<tr>
<td>Neuro Certificate:</td>
<td><b></b></td>
<td>File:</td>
<td><b></b></td>
</tr>
</table>
</div>
</div>
</div>
<div class="modal-footer">
<button type="button" class="btn btn-warning" data-dismiss="modal">
<span class="fa fa-remove-circle"></span> Close
</button>
</div>
</div>
</div>
</div>
<?php endforeach; ?>
<?php endif ?>
</div>
</div>
<div role="tabpanel" class="tab-pane" id="rejected">
<div class="table-responsive">
<table class="table table-hover table-striped" id="dt-client-sg-requests">
<thead>
<tr>
<th class="text-left">Licensed No.</th>
<th class="text-left">Full Name</th>
<th class="text-center">Date Hired</th>
</tr>
</thead>
<tbody>
<?php if ( ! empty($referred_guards['rejected'])): ?>
<?php foreach ($referred_guards['rejected'] as $index => $rejected_request): ?>
<tr>
<td class="text-left"><?php echo $rejected_request['license_number']; ?></td>
<td class="text-left"><?php echo $rejected_request['employee_fullname']; ?></td>
<td class="text-center"><?php echo $rejected_request['date_hired']; ?></td>
</tr>
<?php endforeach; ?>
<?php else: ?>
<tr>
<td class="text-center" colspan="4">-- No Record Found --</td>
</tr>
<?php endif ?>
</tbody>
</table>
</div>
</div>
</div>
</div>
</div>
</div>
</div>
<link rel="stylesheet" href="<?php echo site_url('assets/libs/bower_components/eonasdan-bootstrap-datetimepicker/build/css/bootstrap-datetimepicker.min.css'); ?>">
<script src="<?php echo site_url('assets/libs/bower_components/moment/moment.js'); ?>"></script>
<script src="<?php echo site_url('assets/libs/bower_components/eonasdan-bootstrap-datetimepicker/build/js/bootstrap-datetimepicker.min.js'); ?>"></script>
<script>
$('.time_start').datetimepicker({
format: 'LT'
});
$('.time_end').datetimepicker({
format: 'LT'
});
</script>
| 27,575 |
https://www.wikidata.org/wiki/Q18074574
|
Wikidata
|
Semantic data
|
CC0
| null |
Erodium stipaceum
|
None
|
Multilingual
|
Semantic data
| 1,869 | 5,397 |
Erodium stipaceum
Erodium stipaceum vetenskapligt namn Erodium stipaceum, auktor Michael Pakenham Edgeworth, auktor Joseph Dalton Hooker, år för publikation av taxonomiskt namn 1874
Erodium stipaceum taxonomisk rang art
Erodium stipaceum instans av taxon
Erodium stipaceum nästa högre taxon Skatnävor
Erodium stipaceum Global Biodiversity Information Facility-ID 3829128
Erodium stipaceum IPNI-taxonnamn-ID 372440-1
Erodium stipaceum Tropicos-ID 100333736
Erodium stipaceum World Flora Online-ID wfo-0000677086
Erodium stipaceum Open Tree of Life-ID 6114214
Erodium stipaceum kort namn
Erodium stipaceum
Art der Gattung Reiherschnäbel (Erodium)
Erodium stipaceum wissenschaftlicher Name Erodium stipaceum, Autor(en) des Taxons Michael Pakenham Edgeworth, Autor(en) des Taxons Joseph Dalton Hooker, veröffentlicht im Jahr 1874
Erodium stipaceum taxonomischer Rang Art
Erodium stipaceum ist ein(e) Taxon
Erodium stipaceum übergeordnetes Taxon Reiherschnäbel
Erodium stipaceum GBIF-ID 3829128
Erodium stipaceum IPNI-TaxonName-ID 372440-1
Erodium stipaceum eElurikkus-ID 420215
Erodium stipaceum Tropicos-ID 100333736
Erodium stipaceum POWO-URN urn:lsid:ipni.org:names:372440-1
Erodium stipaceum World-Flora-Online-ID wfo-0000677086
Erodium stipaceum OTT-ID 6114214
Erodium stipaceum CoL-ID 3B96J
Erodium stipaceum Kurzname
Erodium stipaceum
Erodium stipaceum nome scientifico Erodium stipaceum, autore tassonomico Edgew., autore tassonomico Joseph Dalton Hooker, data di descrizione scientifica 1874
Erodium stipaceum livello tassonomico specie
Erodium stipaceum istanza di taxon
Erodium stipaceum taxon di livello superiore Erodium
Erodium stipaceum identificativo GBIF 3829128
Erodium stipaceum identificativo tassonomico IPNI 372440-1
Erodium stipaceum identificativo eBiodiversity 420215
Erodium stipaceum identificativo Tropicos 100333736
Erodium stipaceum identificativo Catalogue of Life 3B96J
Erodium stipaceum nome in breve
Erodium stipaceum
Erodium stipaceum
Erodium stipaceum
species of plant
Erodium stipaceum taxon name Erodium stipaceum, taxon author Michael Pakenham Edgeworth, taxon author Joseph Dalton Hooker, year of publication of scientific name for taxon 1874
Erodium stipaceum taxon rank species
Erodium stipaceum instance of taxon
Erodium stipaceum parent taxon Erodium
Erodium stipaceum GBIF taxon ID 3829128
Erodium stipaceum IPNI plant ID 372440-1
Erodium stipaceum eBiodiversity ID 420215
Erodium stipaceum Tropicos ID 100333736
Erodium stipaceum Plants of the World Online ID urn:lsid:ipni.org:names:372440-1
Erodium stipaceum World Flora Online ID wfo-0000677086
Erodium stipaceum Open Tree of Life ID 6114214
Erodium stipaceum Catalogue of Life ID 3B96J
Erodium stipaceum short name
Erodium stipaceum
especie de planta
Erodium stipaceum nombre del taxón Erodium stipaceum, autor del taxón Michael Pakenham Edgeworth, autor del taxón Joseph Dalton Hooker, fecha de descripción científica 1874
Erodium stipaceum categoría taxonómica especie
Erodium stipaceum instancia de taxón
Erodium stipaceum taxón superior inmediato Erodium
Erodium stipaceum identificador de taxón en GBIF 3829128
Erodium stipaceum identificador IPNI 372440-1
Erodium stipaceum identificador Tropicos 100333736
Erodium stipaceum Plants of the World online ID urn:lsid:ipni.org:names:372440-1
Erodium stipaceum World Flora Online ID wfo-0000677086
Erodium stipaceum identificador Open Tree of Life 6114214
Erodium stipaceum identificador Catalogue of Life 3B96J
Erodium stipaceum nombre corto
Erodium stipaceum
Erodium stipaceum nom scientifique du taxon Erodium stipaceum, auteur taxonomique Michael Pakenham Edgeworth, auteur taxonomique Joseph Dalton Hooker, date de description scientifique 1874
Erodium stipaceum rang taxonomique espèce
Erodium stipaceum nature de l’élément taxon
Erodium stipaceum taxon supérieur Erodium
Erodium stipaceum identifiant Global Biodiversity Information Facility 3829128
Erodium stipaceum identifiant International Plant Names Index d'une plante 372440-1
Erodium stipaceum identifiant eElurikkus 420215
Erodium stipaceum identifiant Tropicos d'un taxon 100333736
Erodium stipaceum identifiant Plants of the World Online urn:lsid:ipni.org:names:372440-1
Erodium stipaceum identifiant World Flora Online wfo-0000677086
Erodium stipaceum identifiant Open Tree of Life 6114214
Erodium stipaceum identifiant Catalogue of Life 3B96J
Erodium stipaceum nom court
Erodium stipaceum
вид растение
Erodium stipaceum име на таксон Erodium stipaceum, автор на таксон Edgew., автор на таксон Hook.f., дата на публикуване на таксон 1874
Erodium stipaceum ранг на таксон вид
Erodium stipaceum екземпляр на таксон
Erodium stipaceum родителски таксон часовниче
Erodium stipaceum IPNI plant ID 372440-1
Erodium stipaceum кратко име
Erodium stipaceum
вид растений
Erodium stipaceum международное научное название Erodium stipaceum, автор названия таксона Эджуорт, Майкл Пакенем, автор названия таксона Джозеф Долтон Гукер, дата публикации названия 1874
Erodium stipaceum таксономический ранг вид
Erodium stipaceum это частный случай понятия таксон
Erodium stipaceum ближайший таксон уровнем выше Аистник
Erodium stipaceum идентификатор GBIF 3829128
Erodium stipaceum код названия таксона в IPNI 372440-1
Erodium stipaceum код eBiodiversity 420215
Erodium stipaceum код имени таксона в Tropicos 100333736
Erodium stipaceum код Plants of the World Online urn:lsid:ipni.org:names:372440-1
Erodium stipaceum код World Flora Online wfo-0000677086
Erodium stipaceum код Open Tree of Life 6114214
Erodium stipaceum код Catalogue of Life 3B96J
Erodium stipaceum краткое имя или название
Erodium stipaceum
taxon, soort van planten
Erodium stipaceum wetenschappelijke naam Erodium stipaceum, taxonauteur Michael Pakenham Edgeworth, taxonauteur Joseph Dalton Hooker, datum van taxonomische publicatie 1874
Erodium stipaceum taxonomische rang soort
Erodium stipaceum is een taxon
Erodium stipaceum moedertaxon Erodium
Erodium stipaceum GBIF-identificatiecode 3829128
Erodium stipaceum IPNI-identificatiecode voor taxon 372440-1
Erodium stipaceum eBiodiversity-identificatiecode 420215
Erodium stipaceum Tropicos-identificatiecode voor taxon 100333736
Erodium stipaceum Plants of the World Online-identificatiecode urn:lsid:ipni.org:names:372440-1
Erodium stipaceum World Flora Online-identificatiecode wfo-0000677086
Erodium stipaceum Open Tree of Life-identificatiecode 6114214
Erodium stipaceum Catalogue of Life-identificatiecode 3B96J
Erodium stipaceum verkorte naam
Erodium stipaceum
Erodium stipaceum taxon nomen Erodium stipaceum, annus descriptionis 1874
Erodium stipaceum ordo species
Erodium stipaceum est taxon
Erodium stipaceum parens Erodium
Erodium stipaceum nomen breve
Erodium stipaceum
вид рослин
Erodium stipaceum наукова назва таксона Erodium stipaceum, автор таксона Майкл Пейкенем Еджворт, автор таксона Джозеф Долтон Гукер, дата наукового опису 1874
Erodium stipaceum таксономічний ранг вид
Erodium stipaceum є одним із таксон
Erodium stipaceum батьківський таксон Грабельки
Erodium stipaceum ідентифікатор у GBIF 3829128
Erodium stipaceum ідентифікатор рослини IPNI 372440-1
Erodium stipaceum ідентифікатор виду eBiodiversity 420215
Erodium stipaceum ідентифікатор Tropicos 100333736
Erodium stipaceum ідентифікатор Plants of the World Online urn:lsid:ipni.org:names:372440-1
Erodium stipaceum ідентифікатор World Flora Online wfo-0000677086
Erodium stipaceum ідентифікатор Open Tree of Life 6114214
Erodium stipaceum ідентифікатор Catalogue of Life 3B96J
Erodium stipaceum коротка назва
Erodium stipaceum
especie de planta
Erodium stipaceum nome del taxón Erodium stipaceum, autor del taxón Joseph Dalton Hooker, data de publicación del nome de taxón 1874
Erodium stipaceum categoría taxonómica especie
Erodium stipaceum instancia de taxón
Erodium stipaceum taxón inmediatamente superior Erodium
Erodium stipaceum nome curtiu
Erodium stipaceum
Erodium stipaceum ainm an tacsóin Erodium stipaceum, údar an tacsóin Michael Pakenham Edgeworth, údar an tacsóin Joseph Dalton Hooker, bliain inar foilsíodh ainm eolaíoch an tacsóin 1874
Erodium stipaceum rang an tacsóin speiceas
Erodium stipaceum sampla de tacsón
Erodium stipaceum máthairthacsón Erodium
Erodium stipaceum ainm gearr
Erodium stipaceum
specie de plante
Erodium stipaceum nume științific Erodium stipaceum, autorul taxonului Joseph Dalton Hooker, anul publicării taxonului 1874
Erodium stipaceum rang taxonomic specie
Erodium stipaceum este un/o taxon
Erodium stipaceum taxon superior Erodium
Erodium stipaceum identificator Global Biodiversity Information Facility 3829128
Erodium stipaceum nume scurt
Erodium stipaceum
Erodium stipaceum nome do táxon Erodium stipaceum, autor do táxon Michael Pakenham Edgeworth, autor do táxon Joseph Dalton Hooker, data de descrição científica 1874
Erodium stipaceum categoria taxonómica espécie
Erodium stipaceum instância de táxon
Erodium stipaceum táxon imediatamente superior Erodium
Erodium stipaceum identificador Global Biodiversity Information Facility 3829128
Erodium stipaceum identificador de nome de táxon IPNI 372440-1
Erodium stipaceum identificador de nome de táxon Tropicos 100333736
Erodium stipaceum nome curto
Erodium stipaceum
Erodium stipaceum naukowa nazwa taksonu Erodium stipaceum, autor nazwy naukowej taksonu Joseph Dalton Hooker, data opisania naukowego 1874
Erodium stipaceum kategoria systematyczna gatunek
Erodium stipaceum jest to takson
Erodium stipaceum takson nadrzędny Iglica
Erodium stipaceum identyfikator GBIF 3829128
Erodium stipaceum identyfikator nazwy taksonu IPNI 372440-1
Erodium stipaceum identyfikator eBiodiversity 420215
Erodium stipaceum identyfikator Tropicos 100333736
Erodium stipaceum identyfikator Plants of the World urn:lsid:ipni.org:names:372440-1
Erodium stipaceum identyfikator World Flora Online wfo-0000677086
Erodium stipaceum identyfikator Open Tree of Life 6114214
Erodium stipaceum nazwa skrócona
Erodium stipaceum
loài thực vật
Erodium stipaceum tên phân loại Erodium stipaceum, tác giả đơn vị phân loại Joseph Dalton Hooker, ngày được miêu tả trong tài liệu khoa học 1874
Erodium stipaceum cấp bậc phân loại loài
Erodium stipaceum là một đơn vị phân loại
Erodium stipaceum đơn vị phân loại mẹ Erodium
Erodium stipaceum định danh GBIF 3829128
Erodium stipaceum ID thực vật IPNI 372440-1
Erodium stipaceum ID Tropicos 100333736
Erodium stipaceum ID Plants of the World trực tuyến urn:lsid:ipni.org:names:372440-1
Erodium stipaceum tên ngắn
Erodium stipaceum
lloj i bimëve
Erodium stipaceum emri shkencor Erodium stipaceum
Erodium stipaceum instancë e takson
Erodium stipaceum emër i shkurtër
Erodium stipaceum
Erodium stipaceum tieteellinen nimi Erodium stipaceum, taksonin auktori Joseph Dalton Hooker, tieteellisen kuvauksen päivämäärä 1874
Erodium stipaceum taksonitaso laji
Erodium stipaceum esiintymä kohteesta taksoni
Erodium stipaceum osa taksonia Kurjennokat
Erodium stipaceum Global Biodiversity Information Facility -tunniste 3829128
Erodium stipaceum kasvin IPNI-tunniste 372440-1
Erodium stipaceum Tropicos-tunniste 100333736
Erodium stipaceum Plants of the World Online -tunniste urn:lsid:ipni.org:names:372440-1
Erodium stipaceum World Flora Online -tunniste wfo-0000677086
Erodium stipaceum Open Tree of Life -tunniste 6114214
Erodium stipaceum Catalogue of Life -tunniste 3B96J
Erodium stipaceum lyhyt nimi
Erodium stipaceum
Erodium stipaceum instancia de Taxón
Erodium stipaceum
espècie de planta
Erodium stipaceum nom científic Erodium stipaceum, autor taxonòmic Michael Pakenham Edgeworth, autor taxonòmic Joseph Dalton Hooker, data de descripció científica 1874
Erodium stipaceum categoria taxonòmica espècie
Erodium stipaceum instància de tàxon
Erodium stipaceum tàxon superior immediat Erodium
Erodium stipaceum identificador GBIF 3829128
Erodium stipaceum identificador de tàxons IPNI 372440-1
Erodium stipaceum identificador eBiodiversity 420215
Erodium stipaceum identificador de tàxons Tropicos 100333736
Erodium stipaceum identificador Plants of the World online urn:lsid:ipni.org:names:372440-1
Erodium stipaceum identificador World Flora Online wfo-0000677086
Erodium stipaceum identificador Open Tree of Life 6114214
Erodium stipaceum identificador Catalogue of Life 3B96J
Erodium stipaceum nom curt
Erodium stipaceum
Erodium stipaceum taksonomia nomo Erodium stipaceum, aŭtoro de taksono Joseph Dalton Hooker
Erodium stipaceum taksonomia rango specio
Erodium stipaceum estas taksono
Erodium stipaceum supera taksono Erodium
Erodium stipaceum IPNI-takononoma identigilo 372440-1
Erodium stipaceum numero en Tropicos 100333736
Erodium stipaceum mallonga nomo
Erodium stipaceum
Erodium stipaceum izen zientifikoa Erodium stipaceum, deskribapen zientifikoaren data 1874
Erodium stipaceum maila taxonomikoa espezie
Erodium stipaceum honako hau da taxon
Erodium stipaceum goiko maila taxonomikoa Erodium
Erodium stipaceum GBIFen identifikatzailea 3829128
Erodium stipaceum IPNI-ren identifikatzailea 372440-1
Erodium stipaceum eBiodiversity identifikatzailea 420215
Erodium stipaceum Tropicos-en identifikatzailea 100333736
Erodium stipaceum Open Tree of Life identifikatzailea 6114214
Erodium stipaceum Catalogue of Life identifikatzailea 3B96J
Erodium stipaceum izen laburra
Erodium stipaceum
Erodium stipaceum
especie de planta
Erodium stipaceum nome do taxon Erodium stipaceum, autor do taxon Joseph Dalton Hooker, data de descrición científica 1874
Erodium stipaceum categoría taxonómica especie
Erodium stipaceum instancia de taxon
Erodium stipaceum taxon superior inmediato Erodium
Erodium stipaceum identificador GBIF 3829128
Erodium stipaceum identificador de taxons IPNI 372440-1
Erodium stipaceum identificador eBiodiversity 420215
Erodium stipaceum identificador Tropicos 100333736
Erodium stipaceum identificador Plants of the World en liña urn:lsid:ipni.org:names:372440-1
Erodium stipaceum identificador World Flora Online wfo-0000677086
Erodium stipaceum identificador Open Tree of Life 6114214
Erodium stipaceum identificador Catalogue of Life 3B96J
Erodium stipaceum nome curto
Erodium stipaceum
Erodium stipaceum nomine del taxon Erodium stipaceum, data de description scientific 1874
Erodium stipaceum rango taxonomic specie
Erodium stipaceum instantia de taxon
Erodium stipaceum taxon superior immediate Erodium
Erodium stipaceum
Erodium stipaceum
speco di planto
Erodium stipaceum kurta nomo
Erodium stipaceum
Erodium stipaceum nom scientific Erodium stipaceum, data de descripcion scientifica 1874
Erodium stipaceum reng taxonomic espècia
Erodium stipaceum natura de l'element taxon
Erodium stipaceum taxon superior Erodium
Erodium stipaceum identificant GBIF 3829128
Erodium stipaceum identificant IPNI 372440-1
Erodium stipaceum identificant Tropicos 100333736
Erodium stipaceum nom cort
Erodium stipaceum
Erodium stipaceum nome taxológico Erodium stipaceum, autor do táxon Michael Pakenham Edgeworth, autor do táxon Joseph Dalton Hooker, data de descrição científica 1874
Erodium stipaceum categoria taxonômica espécie
Erodium stipaceum instância de táxon
Erodium stipaceum táxon imediatamente superior Erodium
Erodium stipaceum identificador GBIF 3829128
Erodium stipaceum identificador de táxons IPNI 372440-1
Erodium stipaceum identificador Tropicos 100333736
Erodium stipaceum nome curto
Erodium stipaceum
Erodium stipaceum nem brefik
| 32,544 |
https://stackoverflow.com/questions/2371785
|
StackExchange
|
Open Web
|
CC-By-SA
| 2,010 |
Stack Exchange
|
Bikramjeet Nath, Chris Martinez, Diego Cea López, Ivan Romanov, MAyadi, Prashant Lakhlani, Qéren Del No-Tiempo, Ronan Keane, https://stackoverflow.com/users/261560, https://stackoverflow.com/users/4820336, https://stackoverflow.com/users/4820337, https://stackoverflow.com/users/4820338, https://stackoverflow.com/users/4820382, https://stackoverflow.com/users/4820386, https://stackoverflow.com/users/4820405, https://stackoverflow.com/users/4820414
|
English
|
Spoken
| 117 | 270 |
javascript image object
<script type="text/javascript">
function GetSrc(elem)
{
alert ( elem.src );
}
</script>
<img src="images/yourimage.extn" id="img1" onclick="GetSrc(this);" />
i want to convert elem.src to string, String(elem.src); not working
elem.src is already a string, you can assign it to another string object or if you still have doubts, you can use .toString() method
It's already a string. You could also try:
var srcString = new String(elem.src);
but it is unnecessary.
You can already use the source as a string.
alert( document.getElementById("img1").src ); // images/yourimage.extn
You can set it too:
function GetSrc(elem) {
elem.src = "http://kol.coldfront.net/thekolwiki/images/c/ca/String.gif";
}
It is a string itself. No need to again convert to string.
alert ( typeof(elem.src) );
will give you a string
| 29,400 |
https://github.com/ajchdev/outside-event/blob/master/node_modules/@wordpress/components/build/range-control/mark.js
|
Github Open Source
|
Open Source
|
MIT
| null |
outside-event
|
ajchdev
|
JavaScript
|
Code
| 143 | 550 |
"use strict";
var _interopRequireDefault = require("@babel/runtime/helpers/interopRequireDefault");
Object.defineProperty(exports, "__esModule", {
value: true
});
exports.default = RangeMark;
var _element = require("@wordpress/element");
var _extends2 = _interopRequireDefault(require("@babel/runtime/helpers/extends"));
var _objectWithoutProperties2 = _interopRequireDefault(require("@babel/runtime/helpers/objectWithoutProperties"));
var _classnames = _interopRequireDefault(require("classnames"));
var _rangeControlStyles = require("./styles/range-control-styles");
/**
* External dependencies
*/
/**
* Internal dependencies
*/
function RangeMark(_ref) {
var className = _ref.className,
_ref$isFilled = _ref.isFilled,
isFilled = _ref$isFilled === void 0 ? false : _ref$isFilled,
label = _ref.label,
_ref$style = _ref.style,
style = _ref$style === void 0 ? {} : _ref$style,
props = (0, _objectWithoutProperties2.default)(_ref, ["className", "isFilled", "label", "style"]);
var classes = (0, _classnames.default)('components-range-control__mark', isFilled && 'is-filled', className);
var labelClasses = (0, _classnames.default)('components-range-control__mark-label', isFilled && 'is-filled');
return (0, _element.createElement)(_element.Fragment, null, (0, _element.createElement)(_rangeControlStyles.Mark, (0, _extends2.default)({}, props, {
"aria-hidden": "true",
className: classes,
isFilled: isFilled,
style: style
})), label && (0, _element.createElement)(_rangeControlStyles.MarkLabel, {
"aria-hidden": "true",
className: labelClasses,
isFilled: isFilled,
style: style
}, label));
}
//# sourceMappingURL=mark.js.map
| 22,745 |
cu31924013526409_12
|
English-PD
|
Open Culture
|
Public Domain
| 1,898 |
Evelyn Innes
|
Moore, George, 1852-1933
|
English
|
Spoken
| 7,891 | 9,836 |
Margaret might have helped her. Poor Margaret ! At that moment she caught sight of her mother's eyes. They seemed to watch her ; she seemed to know all about Owen, and afraid of the haunting, reproving look, Evelyn studied the long oval face and the small brown eyes so unlike hers. One thing only she had inherited from her mother — her voice. She had certainly not inherited her conduct from her mother ; her mother was one of the few great artistes against whom nothing could be said. Her mother was a good woman. . . . What did she think of her daughter ? And seeing her cold, narrow face, she feared her mother 2o6 EVELYN INNES would regard her conduct even more severely than her father. ... ' But if she had lived I should have had no occasion to go away with Owen.' She wondered. At the bottom of her heart she knew that Owen was as much as anything else a necessity in her life. . . . She moved about the room and wished the hands of the clock could be advanced a couple of hours, for then the terrible scene with her father would be over. If he could only forgive her at once and not make her miserable with reproaches, they could have such a pleasant evening. In this room her past life was blown about her like spray about a rock. She remembered the days when she went to London with her father to give lessons ; the miserable winter when she lost her pupils. . . . How she had waited in this room for her father to come back to dinner ; the faintness of those hungry hours ; worse still, that yearning for love. She must have died if she had not gone away. If it had to happen all over again she must act as she had acted. How well she remembered the moment when she felt that her life in Dulwich had become impossible. She was com- ing from the village where she had been paying some bills, and looking up she had suddenly seen the angle of a house and a bare tree, and she could still hear the voice which had spoken out of her very soul. ' Shall I never get away from this place ? ' it had cried. ' Shall I go on doing these daily tasks for ever ? ' The strange, vehement agony of the voice had frightened her. ... At that moment her eyes were attracted by a sort of harpsichord. 'One of father's ex- periments,' she said, running her fingers over the keys. ' A sort of cross between a harpsichord and a virginal ; up here the intonation is that of a virginal.' ' I forgot to ask you, miss ' — Evelyn turned from the window, startled ; it was Agnes who had come back — ' if you was going to stop for dinner, for there's very little in the house, only a bit of cold beef. I should be ashamed to put it on the table, miss ; I'm sure you couldn't eat it. Master don't think what he eats ; he's always thinking of his music. I hope you aren't like that, miss ? ' ' So he doesn't eat much. How is my father looking, Agnes I ' EVELYN INNES 207 ' Middling, miss. He varies about a good bit ; he's gone rather thin lately.' ' Is he lonely, do you think ... in the evenings ? ' ' No, miss ; I don't hear him say nothing about being lonely. For the last couple of years he never did more than come home to sleep and his meals, and he'd spend the evenings copying out the music' * And off again early in the morning ? ' ' That's it, miss, with his music tied up in a brown paper parcel. Sometimes Mr Dean comes and helps him to write the music' ' Ah I. but I'm sorry he doesn't eat better.' ' He eats better when Mr Dean's here. They has a nice little dinner together. Now he's taken up with that 'ere instrument, the harpy chord, they's making. He's comin' home to-night to nnish it ; he says he can't get it finished nohow — that they's always something more to do to it.' ' I wonder if we could get a nice dinner for him this evening ? ' ' Well, miss, you see there's no shops to speak of about here. You know that as well as I do.' ' I wonder what your cooking is like ? ' ' I don't know, miss ; p'r'aps it wouldn't suit you, but I've been always praised for my cooking.' 'I could send for some things; my coachman could fetch them from town.' * Then there's to-morrow to be thought about if you're stopping here. I tell you we don't keep much in the 'ouse.' ' Is my father coming home to dinner ? ' ■ ' I can't say for certain, mis';, only that he said 'e'd be 'ome early to finish the harpy chord. 'E might have 'is dinner out and come 'ome directly after, but I shouldn't think that was likely.' ' You can cook a chicken, Agnes ? ' ' Lor' ! yes, miss,' * And a sole ? ' ' Yes, miss ; but in ordering, miss, you must think ot to-morrow. ' Because I should have to get your rooms ready, miss.' ' That I can't tell, Agnes. ... I don't think so. . . . You won't tell my father I'm here when you let him in ? . . . I want it to be a surprise.' ' I won't say nothing, miss. I'll leave him to find it out.' Evelyn felt that the girl must have guessed her story, must have perceived in her the repentant daughter — the erring daughter returned home. Everything pointed to that fact. Well, it couldn't be helped if she had. ' If my father will only forgive me ; if that first dreadful scene were only over, we could have an enchanting evening together.' She was too nervous to seek out a volume of Bach and let her fingers run over the keys ; she played anything that came into her head, sometimes she stopped to listen. At last there came a knock, and her heart told her it was his. In another moment he would be in the room. But seeing her he stopped, and, without a word, he went to a table and began untying a parcel of music. ' Father, I've come to see you. . . . You don't answer, father, are you not going to speak to me ? I've been long- ing to see you, and now — ' ' If you had wanted to see me, you'd have come a month ago.' ' I was not in London a month ago.' ' Well, three weeks ago.' ' I ought to have done so, but I had no courage. I could only see you looking at me as you are looking now. Forgive me, father. . . . I'm your only daughter ; she's full of failings, but she has never ceased to love you.' He sat at the table fumbling with the string that had tied the parcel he had brought in, and she stood looking at him, unable to speak. She seemed to have said all there EVELYN INNES 209 was to say, and wished she could throw herself at his feet ; but she could not, something held her back. She prayed for tears, but her eyes remained dry ; her mouth was dry, and a flame seemed to burn behind her eyes. She could only think that this might be the last time she would see him. The silence seemed a great while. She repeated her words, 'I had not the courage to come before.' At the sound of her voice she remembered that she must speak to him at once of his choir, and so take their thoughts from painful reminiscence. ' I went to St Joseph's on Thursday, but you weren't there. You gave Vittoria's mass last Sunday. I started to go, but I had to turn back.' She had not gone to hear her father's choir, because she could not resist Lady Ascott's invitation, and no more than the invitation could she resist the lie ; she had striven against it, but in spite of herself it had forced itself through her lips, and now her father seemed to have some inkling of the truth, for he said, — 'If you had cared to hear my choir you'd have gone. You needn't have seen me, whereas I was obliged — ' Evelyn guessed that he had been to the opera. ' How good of him to have gone to hear me,' she thought. She hated herself for having accepted ' Lady Ascott's invitation, and the desire to ask him what he thought of her voice seemed to her an intolerable selfishness. ' What were you going to say, father ? ' ' Nothing. . . . I'm glad you didn't come.' ' Wasn't it well sung ? ' and she was seized with nervous- ness, and instead of speaking to him about his basses as she had intended, she asked him about the trebles. ' They are the worst part of the choir. That contra- puntal music can only be sung by those who can sing at sight. The piano has destroyed the modern ear. I dare- say it has spoilt your ear.' ' My ear is all right, I think.' ' I hope it is better than your heart.' Evelyn's face grew quite. still, as if it were frozen, and seeing the pain he had caused her he was moved to take her in his arms and forgive her straight away. He might havi; o 210 EVELYN INNES done so, but she turned, and passing her hand across her eyes she went to the harpsichord. She played one of the little Elizabethan songs, 'John, come kiss me now.' Then an old French song tempted her voice by its very appropriateness to the situation — ' ^ue vous me coutez cher, men cceur, pour vos plaisirs.' But there was a knot in her throat, she could not sing, she could hardly speak. She endeavoured to lead her father into conversation, hoping he might forget her conduct until it was too late for him to withdraw into resentment. She could see that the instru- ment she was playing on he had made himself. In some special intention it was filled with levers and stops, the use of which was not quite apparent to her ; and she could see by the expression on his face that he was annoyed by her want of knowledge of the technicalities of the instrument. So she purposely exaggerated her ignorance. He fell into the trap and going to her he said, ' You are not making use of the levers.' 'Oh, am I not?' she said innocently. 'What is this instrument — a virginal or a harpsichord ? ' 'It is a harpsichord, but it has much more power than the old harpsichord. I made it this winter. The volume of sound from the old harpsichord is not sufficient in a large theatre, that is why the recitations in Mozart's operas have to be played on the fiddles.' He stopped speaking and she pressed him in vain to ex- plain the instrument. She went on playing. ' The levers,' he said at last, ' are right and left of your knees. Press them.' She pretended not to understand. ' Let me show you.' He seated himself at the instru- ment. ' You see the volume of sound I obtain, and all the while I do not alter the quality of tone.' ' Yes, yes, and the sonority of the instrument is double that of the old harpsichord. It would be heard all over Covent Garden.' She could see that the remark pleased him. ' I'll sing " Zerline " if you'll play it.' ' You couldn't sing "Zerline," it isn't in your voice.' ' You don't know what my voice is like.' EVELYN INNES 211 ' Evelyn, I wonder how you can expect me to forgive you ; I wonder how I can speak to you. Have you for- gotten how you went away leaving me to bear the shame, the disgrace ? ' ' I have come to beg forgiveness, not to excuse myself. But I wrote to you from Paris that I was going to live with Lady Duckle, and that you were to say that I had gone abroad to study singing.' ' I'm astonished, Evelyn, that you can speak so lightly.' ' I do not think lightly of my conduct, if you knew the miserable days it has cost me. Reproach me as you will about my neglect toward you, but as far as the world is concerned there has been no disgrace.' ' You would have gone all the same ; you only thought of yourself. Brought up as you have been, a Catholic — ' ' My sins, father, lie between God and myself. What I come for is to beg forgiveness for the wrong I did you.' He did not answer, but he seemed to acquiesce, and it was a relief to her to feel that it was not the moral question that divided them ; convention had forced him to lay some stress upon it, but clearly what rankled in his heart, and prevented him from taking her in his arms, was a jealous, purely human feud. This she felt she could throw herself against and overpower. * Father, you must forgive me, we are all in all to each other ; nothing can change that. Ever since mother's death - — you remember when the nurse told us all was over— ever since I've felt that we were in some strange way dependent on each other. Our love for each other is the one unalter- able thing. My music you taught me ; the first songs I sang were at your concerts, and now that we have both succeeded — you with Palestrina, and I with Wagner — we must needs be aliens. Father, can't you see that that can never be ? if you don't you do not love me as I do you. You're still thinking that I left you. Of course, it was very wrong, but has that changed anything ? Father, tell me, tell me, unless you want to kill me, that you do not believe that I love you less.' The wonder of the scene she was acting— she never ad- mitted she acted ; she lived through scenes, whether fictitious 212 EVELYN INNES or real — quickened in her ; it was the long-expected scene, the scene in the third act of the ' Valkyrie ' which she had always played while divining the true scene which she would be called upon to play one day. It seemed to her that she stood on the verge of all her future — the mystery of the abyss gathered behind her eyes ; she threw herself at her father's feet, and the celebrated phrase, so plaintive, so full of intercession, broke from her lips, 'Was the rebel act so full of shame that her rebellion is so shamefully scourged ? Was my offence so deep in disgrace that thou dost plan so deep a disgrace for me ? Was this my crime so dark with dishonour ? Oh tell me, father ; look in mine eyes.' She heard the silence of orchestra, and her voice singing in sonorous space. She heard the clash of the chord at the end of the phrase, then a questioning accompaniment among the violins, and she was carried down like a drowning one into a dim world of sub-conscious being ; and in this half life all that was most true in her seemed to rise like a star and shine forth, while all that was circumstantial and ephemeral seemed to fall away. She was conscious of the purification of self; she seemed to see herself white and bowed and penitent. She experienced a great happiness in becoming humble and simple again. . . . But she did not know if the transformation which was taking place in her was an abiding or a passing thing. She knew she was expressing all that was most deep in her nature, and yet she had acted all that she now believed to be reality on the stage many times. It seemed as true then as it did now — more true ; for she was less self-conscious in the fictitious than in the real scene. She knelt at her father's or at Wotan's feet— she could not distinguish ; all limitations had been razed. She was the daughter at the father's feet. She knelt like the Magdalen. The position had always been natural to her, and habit had made it inveterate ; there she bemoaned the difficulties of life, the passion which had cast her down and which seemed to forbid her an ideal. She caught her father's hand and pressed it against her cheek. She knew she was doing these things, yet she could not do otherwise ; tears fell upon his hand, and the grief she expressed was so intense that he could not restrain his tears. But if she raised her face and EVELYN INNES 213 saw his tears, his position as a stern father was compro- mised ! She could only think of her own grief; the grief and regret of many years absorbed her ; she was so lost in it that she expected him to answer her in Wotan's own music ; she even smiled in her grief at her expectation, and continued the music of her intercession. And it was not until he asked her why she was singing Wagner that she raised her face. That he should not know, jarred and spoilt the harmony of the scene as she had conceived it, and it was not till he repeated his question that she told him. 'Because I've never sung it without thinking of you, father. That is why I sang it so well. I knew it all before. It tore at my heart strings. I knew that one day it would come to this.' ' So every time before was but a rehearsal.' She rose to her feet. ' Why are you so cruel ? It is you who are acting, not I. I mean what I say — ^you don't. Why make me miser- able ? You know that you must forgive me. You can't put me out of doors, so what is the use in arguing about my faults ? I am like that. you must take me as I am, and perhaps you would not have cared for me half as much if I had been diiFerent.' ' Evelyn, how can you speak like that ? You shock me very much.' She regretted her indiscretion, and feared she had raised the moral question ; but the taunt that it was he and not she that was acting had sunk into his heart, and the truth of it overcame him. It was he who had been acting. He had pretended an anger which he did not feel, and it was quite true that, whatever she did, he could not really feel anger against her. She was shrined in his heart, the dream of his whole life. He could feel anger against himself, but not against her. She was right. He must forgive her, for how could he live without her ? Into what dissimulation he had been foolishly ensnared I In these convictions which broke like rockets in his heart and brain, spreading a strange illumination in much darkness, he saw her beauty and sex idealised, and in the vision were the eyes and pallor of the dead wife, and all the yearning and aspiration of his own 2 1+ EVELYN INNES life seemed reflected back in this fair, oval face, lit with luminous, eager eyes, and in the tangle of gold hair fallen about her ears, and thrown back hastily with long fingers ; and the wonder of her sex in the world seemed to shed a light on distant horizons, and he understood the strangeness of the common event of father and daughter standing face to face, divided, or seemingly divided, by the mystery of the passion of which all things are made. His own sins were remembered. They fell like soft fire breaking in a dark sky, and his last sensation in the whirl of complex, diffused and passing sensations was the thrill of terror at the little while remaining to him wherein he might love her. ' I knew, father, dear, that you'd forgive me in the end. It was impossible to think of two like us living and dying in alienation. I should have killed myself, and you, dear, you would have died of grief. But I dreaded this first meet- ing. I had thought of it too much, and, as I told you, I had acted it so often.* ' Have I been so severe with you, Evelyn, that you should dread me ? ' ' No, darling, but, of course, I've behaved — there's no use talking about it any more. But you could never have been really in doubt that a lover could ever change my love for you. Owen — I mustn't speak about him, only I wish you to understand that I've never ceased to think of you. I've never been really happy, and I'm sure you've been miserable about me often enough ; but now we may be happy. "Winter storms wane in the winsome May." You know the Lied in the first act of the " Valkyrie " ? And now that we're friends, I suppose you'll come and hear me. Tell me about your choir.' She paused a moment, and then said, ' My first thought was for you on landing in England. There was a train waiting at Victoria, but we'd had a bad crossing, and I felt so ill that I couldn't go. Next day I was nervous. I had not the courage, and he proposed that I should wait till I had sung Margaret. So much depended on the success of my first appearance. EVELYN INNES 215 He was afraid that if I had had a scene with you I might break down.' 'Wotan, you say, forgives Brunnhilde, but doesn't he put her to sleep on a fire-surrounded rock ? ' ' He puts her to sleep on the rock, but it is she who asks for flames to protect her from the unworthy. Wotan grants her request, and Brunnhilde throws herself enraptured into his arms. " Let the coward shun Brunnhilde's rock — for but one shall win the bride who is freer than I, the god!"' ' Oh, that's it, is it ? Then with what flames shall I surroimd you ? ' ' I don't know, I've often wondered ; the flame of a promise — a promise never to leave you again, father, I caii promise no more.' ' I want no other promise.' The eyes of the portrait were fixed on them, and they wondered what would be the words of the dead woman if she could speak. Agnes announced that the coachman had returned. * Father, I've lots of things to see to. I'm going to stop to dinner if you'll let me.' ' I'm afraid, Evelyn — Agnes — ' ' You need not trouble about the dinner — Agnes and I will see to that. We have made all necessary arrange- ments.' ' Is that your carriage ? . . . You've got a fine pair of horses. Well, one can't be Evelyn Innes for nothing. But if you're stopping to dinner, you'd better stop the night. I'm giving the " Missa Brevis " to-morrow. I'm giving it in honour of Monsignor Mostyn. It was he who helped me to overcome Father Gordon.' ' You shall tell me all about Monsignor after dinner.' He walked about the room, unwittingly singing the Lied, ' Winter storms wane in the winsome May,' and he stopped before the harpsichord, thinking he saw her still there. And his thoughts sailed on, vagrant as clouds in a spring breeze. She had come back, his most wonderful daughter had come back ! He turned from his wife's portrait, fearing the thought 2i6 EVELYN INNES that her joy in their daughter's return might be sparer than his. But unpleasant thoughts fell from him, and happiness sang in his brain like spring-awakened water-courses, and the scent in his nostrils was of young leaves and flowers, and his very flesh was happy as the warm, loosening earth in spring. ' " Winter storms," ' he sang, ' " wane in the win- some May ; with tender radiance sparkles the spring." I must hear her sing that ; I must hear her intercede at Wotan's feet ! ' His eyes filled with happy tears, and he put questions aside. She was coming to-morrow to hear his choir. And what would she think of it ? A shadow passed across his face. If he had known she was coming, he'd have taken more trouble with those altos ; he'd have kept them another hour. . . . Then, taken with a sudden craving to see her, he went to the door and called to her. ' Evelyn.' ' Yes, father.' ' You are stopping to-night ? ' ' Yes, but I can't stop to speak with you now — I'm busy with Agnes.' She was deep in discussion with Agnes regarding the sole. Agnes thought she knew how to prepare it with bread crumbs, but both were equally uncertain how the melted butter was to be made. There was no cookery- book in the house, and it seemed as if the fish would have to be eaten with plain butter until it occurred to Agnes that she might borrow a cookery-book next door. It seemed to Evelyn that she had never seen a finer sole, so fat and firm ; it really would be a pity if they did not succeed in making the melted butter. When Agnes came back with the book, Evelyn read out the directions, and was surprised how hard it was to understand. In the end it was Agnes who explained it to her. The chicken presented some difficulties. It was of an odd size, and Agnes was not sure whether it would take half-an-hour or three-quarters to cook. Evelyn studied the white bird, felt the cold, clammy flesh, and inclined to forty minutes. Agnes thought that would be enough if she could get her oven hot enough. She began by raking out the flues, and EVELYN INNES 217 Evelyn had to stand back to avoid the soot. She stood, her eyes fixed on the fire, interested in the draught and the dis- solution of every piece of coal in the flame. It seemed to Evelyn that the fire was drawing beautifully, and she appealed- to Agnes, who only seemed fairly satisfied. It was doing pretty well, but she had never liked that oven ; one was never sure of it. Margaret used to put a piece of paper over the chicken to prevent it burning, but Agnes said there was no danger of it burning ; the oven never could get hot enough for that. But the oven, as Agnes had said, was a tricky one, and when she took the chicken out to baste it, it seemed a little scorched. So Evelyn insisted on a piece of paper. Agnes said that it would delay the cooking of the chicken, and attributed the scorching to the quantity of coal which Miss Innes would keep adding. If she put any more on she would not be answerable that the chimney would not catch fire. Every seven or eight minutes the chicken was taken out to be basted. The bluey-whitey look of the flesh which Evelyn had disliked had disappeared ; the chicken was acquiring a rich brown colour which she much admired, and if it had not been for Agnes, who told her the dinner would be delayed till eight o'clock, she would have had the chicken out every five minutes, so much did she enjoy pouring the rich, bubbling juice over the plump back. ' Father ! Father, dinner is ready ! I've got a sole and a chicken. The sole is a beauty ; Agnes says she never saw a fresher one.' ' And where did all these things come from ? ' 'I sent my coachman for them. Now sit down and let me help you. I cooked the dinner myself.' Feeling that Agnes's eye was upon her, she added, ' Agnes and I — I helped Agnes. We made the melted butter from the receipt in the cookery-book next door. I do hope it is a success.' ' I see you've got champagne, too.' ' But I don't know how you're to get the bottle open, miss ; we've no champagne nippers.' After some conjecturing the wires were twisted ofF with a kitchen fork. Evelyn kept her eyes on her father's plate. 2i8 EVELYN INNES and begged to be allowed to help him again, and she delighted in filling up his glass with wine ; and though she longed to ask him if he had been to hear her sing, she did not allude to herself, but induced him to talk of his victories over Father Gordon. This story of clerical jealousy and ignorance was intensely interesting to the old man, and she humoured him to the top of his bent. ' But it would all have come to nothing if it had not been for Monsignor Mostyn.' She fetched him his pipe and tobacco. * And who is Monsignor Mostyn ? ' she asked, dreading a long tale in which she could feel no interest at all. She watched him filling his pipe, working the tobacco down with his little finger nail. She thought she could see he was think- ing of something different, and to her great joy he said, — ' Well, your Margaret is very good ; better than I ex- pected — I am speaking of the singing ; of course, as acting it was superb.' ' Oh, father ! do tell me ? So you went after all ? I sent you a box and a stall, but you were in neither. In what part of the theatre were you ? ' 'In the upper boxes; I did not want to dress. She leaned across the table with brightening eyes. 'for a dramatic soprano you sing that light music with extraordin- ary ease and fluency.' ' Did I sing it as well as mother ? ' ' Oh, my dear, it was quite different. Your mother's art was in her phrasing and in the ideal appearance she presented.' ' And didn't I present an ideal appearance ? ' ' It's like this, Evelyn. The Margaret of Gounod and his librettist is not a real person, but a sort of keepsake beauty who sings keepsake music. I assume that you don't think much of the music ; brought up as you have been on the Old Masters, you couldn't. Well, the question is whether parts designed in such an intention should be played in the like intention, or if they should be made living creations of flesh and blood, worked up by the power of the actress into something as near to the Wagner ideal as EVELYN INNES 219 possible. I admire your Margaiet ; it was a wonderful performance, but — ' ' But what, father ? ' It made me wish to see you in Elizabeth and Brunn- hilde. I was very sorry I couldn't get to London last night.' * You'd like my Elizabeth better. Margaret is the only part of the old lot that I now sing, I daresay you're right. " Carmen " is a conventional type — all art is convention of one kind or another, and each demands its own interpreta- tion. But I hope you don't sing that horrid music' ' You don't like « Carmen " ? ' Mr Innes shrugged his shoulders contemptuously. ' " Faust " is better than that. Gounod follows — at a distance, of course — but he follows the tradition of Haydn and Mozart. " Carmen " is merely Gounod and Wagner. I hope you've not forgotten my teaching ; as I've always said, music ended with Beethoven and began again with Wagner.' ' Did you see Ulick Dean's article ? ' 'Yes, he wrote to me last night about your Elizabeth. He says there never was anything heard like it on the stage.' ' Did he say that ? Show me the letter. What else did he say ? ' ' It was only a note. I destroyed it. He just said what I told you. But he's a bit mad about that opera. He's been talking to me about it all the winter, saying that the character had never been acted ; apparently it has been now. Though for my part I think Brunnhilde or Isolde would suit you better.' The mention of Isolde caused them to avoid looking at each other, and Evelyn asked her father to tell her about Ulick — how they became acquainted and how much they saw of each other. But to tell her when he made Ulick's 220 EVELYN INNES acquaintance would be to allude to the time when Evelyn left home. So his account of their friendship was cursory and perfunctory, and he asked Evelyn suddenly if Ulick had shown her his opera. ' Grania ?' ' No, not " Grania," He has not finished " Grania," but " Connla and the Fairy Woman." Written,' he added, ' entirely on the old lines. Come into the music-room and you shall see.' He took up the lamp ; Evelyn called Agnes to get another. The lamps were placed upon the harpsichord ; she lighted some candles, and, just as in old times, they lost themselves in dreams and visions. This time it was in a faint Celtic haze ; a vision of silver mist and distant mountain and mere. It was on the heights of Uisnech that Connla heard the fairy calling him to the Plain of Pleasure, Moy Mell, where Boadag is king. And King Cond, seeing his son about to be taken from him, summoned Coran the priest and bade him chant his spells toward the spot whence the fairy's voice was heard. The fairy could not resist the spell of the priest, but she threw Connla an apple and for a whole month he ate nothing but that. But as he ate, it grew again, and always kept whole. And all the while there grew within him a mighty yearning and longing after the maiden he had seen. ' My dear father, manuscript, and at sight, words and music ! ' ' Come — begin.' ' Give me the chord.' He looked at her in astonishment. ' Won't you give me the keynote ? ' ' In the key of E flat,' he answered sternly. She began. ' Is that right f ' 'Yes, that's right. You see that you can still sing at sight. I don't suppose you find many prima donnas who can.' With her arm on his shoulder they sat together, playing and singing the music with which Ulick had interpreted the tale of ' Connla and the Fairy Woman.' ' You see,' he said, ' he has invented a new system of orchestration ; as a matter of fact, we worked it out together, but that's neither here nor there. In some respects it is not unlike Wagner ; the vocal music is mostly recitative, but now and then there is nearly an air, and yet it isn't new, for it is how it would have been written about 1500. You see,' he said, turning over the pages of the full score, ' each character is allotted a difFerent set of instruments as accompaniment ; in this way you get astonishing colour contrasts. For instance, the priest is accompanied by a chest of six viols ; i.e., two trebles, two tenors, two basses. King Cond is accompanied by a set of six cromornes, like the viols of various sizes. The Fairy WomaffMS a set of six flutes or recorders, the smallest of which is eight inches long, the biggest quite six feet. Connla is accompanied by a group of oboes and bassoons ; and another character is allotted three lutes with an arch lute, another a pair of virginals, another a regal, another a set of six sack- buts and trumpets. See how all the instruments ?re used in 223 EVELYN INNES the overture and in the dances, of which there are plenty, Pavans, Galliards, AUemaines. But look here, this is most important ; even in the instrumental pieces the instruments are not to be mixed, as in modern orchestra, but used in groups, alwzjs distinct, like patches of colour in impressionist pictures.' ' I like this,' and she hummed through the fairy's luring of Connla to embark with her. ' But I could not give an opinion of the orchestraticm without hearing it, it is all so new.' ' We haven't succeeded yet in getting together sufficient old instruments to provide an orchestra.' ' But, father, do you think such orchestration realisable in modern music ? I see very little Wagner in it ; it is more like Caccini or Monteverde. There can be very little real life in a parody.' ' No, but it isn't parody, that's just what it isn't, for it is natural to him to write in this style. What he writes in the modern style is as common as anyone else. This is his natural language.' In support of the validity of his argu- ment that a return to the original sources of an art is possible without loss of originality, he instanced the Pre-Raphaelite Brotherhood. The most beautiful pictures, and the most original pictures Millais had ever painted were those that he painted while he was attempting to revive the methods of Van Eyck, and the language of Shakespeare was much more archaic than that of any of his contemporaries. ' But explanations are useless. I tried to explain to Father Gordon that Palestrina was one of the greatest of musicians, but he never understood. Monsignor Mostyn and I understood each other at once. I said Palestrina, he said Vittoria — I don't know which suggested the immense advantage that a revival of the true music of the Catholic would be in making converts to Rome. You don't like Ulick's music ; there's nothing more to be said.' ' But I do like it, father. How impatient you are ! And because I don't understand an entire aestheticism in five minutes, which you and Ulick Dean have been cooking for the last three years, I am a fool, quite as stupid as Father Gordon.' EVELYN INNES 223 Mr Innes laughed, and when he put his arm round her and kissed her she was happy again. The hours went lightly by as if enchanted, and it was midnight when he closed the harpsichord and they went upstairs. Neither spoke ; they were thinking of the old times which apparently had come back to them. On the landing she said, — 'We've had a nice evening after all. Good-night, father. I know my room.' ' Good-night,' he said. ' You'll find all your things ; nothing has been changed.' Agnes had laid one of her old nightgowns on the bed, and there was her prie-dieu, and on the chest of drawers the score of Tristan which Owen had given her six years ago. She had come back to sing it. How extraordinary it all was 1 She seemed to have drifted like a piece of sea- weed ; she lived in the present though it sank beneath her like a wave. The past she saw dimly, the future not at all ; and sitting by her window she was moved by vague impulses towards infinity. She grew aware of her own littleness and the vastness overhead — that great unending enigma represented to her understanding by a tint of blue washed over by a milky tint. Owen had told her that there were twenty million suns in the milky way, and that around every one numerous planets revolved. This earth was but a small planet, and its sun a third-rate sun. On this speck of earth a being had awakened to a con- sciousness of the glittering riddle above his head, but he would die in the same ignorance of its meaning as a rabbit. The secret of the celestial plan she could never know. One day she would slip out of consciousness of it ; life would never beckon her again ; but the vast plan which she now perceived would continue to revolve, progressing towards an end which no man, though the world were to continue for a hundred million years, would ever know. Her brain seemed to melt in the moonlight, and from the enigma of the skies her thoughts turned to the enigma of her own individuality. She was aware that she lived. She was aware that some things were right, that some things were wrong. She was aware of the strange fortune that had lured her, that had chosen her out of millions. 224 EVELYN INNES What did it mean ? It must mean something, just as those stars must mean something — but what i Opposite to her window there was an open space ; it was fiill of mist and moonlight ; the lights of a distant street looked across it. She too had said, ' 'Tis hard upon me, I love my folk above all things, but a great longing seizes me.' That story is the story of human life. What is human life but a longing for something beyond us, for something we shall not attain ? Again she wondered what her end must be. She must end somehow, and was it not strange that she could no more answer that simple question than she could the sublime question which the moon and stars propounded. , That breathless, glittering peace, was it not wonderful ? It seemed to beckon and allure, and her soul yearned for that peace as Connla's had for the maiden. Death only could give that peace. Did the Fairy Maiden mean death ? Did the plains of the Ever Living, which the Fairy Maiden had promised Connla on the condition of his following her, lie behind those specks of light ? But what end should she choose for herself if the choice were left to her — to come back to Dulwich and live with her father ? She might do that — but when her father died ? Then she hoped that she might die. But she might out- live him for thirty years — Evelyn Innes, an old woman, talking to the few friends who came to see her, of the days when Wagner was triumphant, of her reading of 'Isolde.' Some such end as that would be hers. Or she might end as Lady Asher. She might, but she did not think she would. Owen seemed to think more of marriage now than he used to. He had always said they would be married when she retired from the stage. But why should she retire from the stage ? If he had wanted to marry her he should have asked her at first. She did not know what she was going to do. No one knew what they were going to do. They simply went on living. That moon- light was melting her brain away. XVII As they went to church, he told her about Monsignor Mostyn. Evelyn remembered that the very day she went away, he had had an appointment with the prelate, and while trying to recall the words he had used at the time — how Monsignor believed that a revival of Palestrina would advance the Catholic cause in England — she heard her father say that no one except Monsignor could have succeeded in so difficult an enterprise as the reformation of church music in England. The organ is a Protestant instrument, and in organ music the London churches do very well ; the Protestant congregations are, musically, more enlightened ; the flattest degradation is found among the English Catholics, and he instanced the Oratory as an extraordinary disgrace to a civilised country, relating how he had heard the great Mass of Pope Marcellus given there by an operatic choir of twenty singers. In the West-end are apathy and fashionable vul- garity, and it was at St Joseph's, Southwark, that the Church had had restored to her all her own beautiful music. Mon- signor had begun by coming forward with a subscription of one thousand pounds a year, and by such largesse he had confounded the intractable Jesuits and vanquished Father Gordon. The poor man who had predicted ruin now viewed the magnificent congregation with a sullen face. ' He has a nice voice, too, that's the strange part of it ; I could have taught him, but he is too proud to admit he was wrong.' However, bon gre trial gre, Father Gordon had had to sub- mit to Monsignor. When Monsignor makes up his mind, things have to be done. If a thousand pounds had not been enough, he would have given two thousand pounds ; 226 EVELYN INNES Monsignor was rich, but he was also tactful, and did not rely entirely on his money. He had come to St Joseph's with the Pope's written request in his hand that St Joseph's should attempt a revival of the truly Catholic music, if sufficient money could be obtained for the choir. So there was no gainsaying, the Jesuits had had to submit, for if they had again objected to the expense, Monsignor would come forward with a subscription of two thousand a year. He could not have afforded to pay so much for more than a limited number of years, ' but he and I felt that it was only necessary to start the thing for it to succeed.' Mr Innes told his daughter of Monsignor's social influ- ence ; Moiisignor had the command of any amount of money. There is always the money, the difficulty is to obtain the will that can direct the money. Monsignor was the will. He was all-powerful in Rome.
| 31,217 |
hal-03190138-2021%20Inorganic%20Chemistry%20HT.txt_1
|
French-Science-Pile
|
Open Science
|
Various open science
| 2,021 |
Sodium Site Exchange and Migration in a Polar Stuffed-Cristobalite Framework Structure. Inorganic Chemistry, 2021, 60 (7), pp.4322-4331. ⟨10.1021/acs.inorgchem.1c00319⟩. ⟨hal-03190138⟩
|
None
|
English
|
Spoken
| 7,455 | 12,357 |
Sodium Site Exchange and Migration in a Polar Stuffed-Cristobalite Framework Structure
Alberto J Fernández-Carrión, Aydar Rakhmatullin, Li Yang, Michael J Pitcher, Dominique Massiot, Florence Porcher, Mathieu Allix, Xiaojun Kuang
HAL is a multi-disciplinary open access archive for the deposit and dissemination of scientific research documents, whether they are published or not. The documents may come from teaching and research institutions in France or abroad, or from public or private research centers. L’archive ouverte pluridisciplinaire HAL, est destinée au dépôt et à la diffusion de documents scientifiques de niveau recherche, publiés ou non, émanant des établissements d’enseignement et de recherche français ou étrangers, des laboratoires publics ou privés.
S
odium Site
Exchange and Migration
in
Polar Stuffed Cristobalite Framework Structure
Alberto J. Fernández–Carrióna, Aydar Rakhmatullinb, Li Yanga, Michael J. Pitcherb, Dominique Massiotb, Florence Porcherc, Mathieu Allixb, Xiaojun Kuanga,d* a MOE Key Laboratory of New Processing Technology for Nonferrous Metals and Materials, Guangxi Key Laboratory of Optical and Electronic Materials and Devices, College of Materials Science and Engineering, Guilin University of Technology, Guilin 541004, P. R. China. b c CNRS, CEMHTI UPR3079, Univ. Orléans, F-45071 Orléans, France. Laboratoire Léon Brillouin, CEA Saclay, 91191 Gif Sur Yvette, France. d College of Chemistry and Bioengineering, Guilin University of Technology, Guilin 541004, P. R. China. Na1 Na2 Table of
Contents
.
Two-dimensional exchange 23Na NMR spectroscopy evidences sodium site exchange phenomenon in polar stuffed Cristobalite o-Na2MgSiO4 which triggers the long-range sodium migration. ABSTRACT: The study of ionic dynamics in solids is essential to understand and develop modern energy technologies. Here we study the ionic dynamics of orthorhombic Na2MgSiO4, an interesting case of a polar stuffed cristobalite-type structure that contains two inequivalent Na sites within the channels of the magnesium-silicate tetrahedral framework. Its preparation by solid state reaction method favours the presence of ~ 2% of Na vacancies, converting it into pure sodium ionic conductor with an optimized ionic conductivity of ~10–5 S cm–1 at 200 °C. The macroscopic migration has been characterized through impedance spectroscopy and molecular dynamics simulation which proves the pure sodium ionic character of the compound through hopping between Na1 and Na2 sites, forming three-dimensional migration zig-zag shaped paths. High– resolution solid–state 23Na magic MAS–NMR spectroscopy is employed to characterize the local structure and microscopic dynamics of sodium ion transport in Na2MgSiO4. Remarkably, variable temperature 23Na MAS NMR and two-dimensional exchange spectroscopy evidence for the first time a sodium site exchange phenomenon at room temperature, which further triggers the sodium ionic conduction at elevated temperatures.
Introduction
Ionic migration in solid state materials is a key physical phenomenon in numerous technologically important compounds such as solid state electrolytes used in batteries,1 electrochromic displays,2 sensors3 or solid oxide fuel cells (SOFCs).4 It is important to understand the interplay between ionic migration and structural chemistry, which helps improving the ionic conduction and guiding the materials design. Electrochemical impedance measurements (EIS) are frequently used to characterize the macroscopic long-range diffusional migration coupled to molecular dynamic (MD) simulations.5, 6 Nevertheless, detailed knowledge of the microscopic dynamic processes (set by the distance between neighboring atoms sites, i.e. at atomic and/or molecular scale) underlying ionic conductance is still required in order to fully understand and predict the behavior of ionic conducting materials. Among the different techniques characterizing solid state inorganic materials at local scale, solid state magic angle spinning nuclear magnetic resonance (MAS NMR) is a powerful tool. It has been widely employed to explore the local environment of certain atoms allowing, for instance, the concrete crystallographic description of unit cells, local structure around defects and so on. The application of this technique has been further enhanced by the possibility to acquire MAS NMR spectra at variable temperatures (VT MAS NMR),7 which expands the possibility to study the dynamic processes of mobile species present in solid state ionic conductors as a function of temperature.8 Moreover, for materials possessing multiple sites for mobile ions, it enables distinguishing ions moving on inequivalent sites that can lead to multiple possible pathways for diffusion. For this kind of materials, the clearest sign of diffusive dynamics is the merging of spectral peaks, initially assigned to atoms in different structural environments, with increasing temperature.9 The information on the ionic dynamics by NMR spectroscopy can be inpress in Inorganic Chemistry 3 further extended using two-dimensional exchange NMR spectroscopy (2D EXSY)10 that allows detecting exchange processes between ions on multiple sites during the initial migration stages. These techniques to study the ionic dynamics in solids have been frequently employed for characterizing the dynamics in lithium ion conductors.11, 12 Nevertheless, studies about the dynamics in Na ion conductors still remain scarcely explored even when they are potential materials as solid state electrolytes for batteries. In this study, we investigate the sodium dynamics in stuffed cristobalite Na2MgSiO4 using EIS and MD simulations coupled to NMR spectroscopy. This compound exhibits a tetrahedral framework based on corner-linked [SiO4]4- and [MgO4]6- units with two inequivalent sodium sites stuffing the channels formed in the tetrahedral network. It was initially identified as potential sodium ion conductor due to its framework structure, where three-dimensional (3D) conductivity might be expected.13, 14 Two different polymorphs have been reported at room temperature: firstly Baur synthesized it hydrothermally and described its structure in the nonpolar Pn space group (m-Na2MgSiO4),13 then Withers et al.15 prepared it following a sol-gel route and described its structure by using the polar Pna21 space group (o-Na2MgSiO4). Both orthorhombic and monoclinic structures contain an ordered Si/Mg distribution but differ in the pattern of tetrahedral tilting (Figure 1). Herein we obtain the polar o-Na2MgSiO4 phase and demonstrate remarkable sodium site exchange at room temperature between the two inequivalent Na sites, the subsequently triggered sodium migration and its mechanism at elevated temperatures in this polar stuffed cristobalite.
(a) (b) b c c a Figure 1. Tetrahedral framework structure comparison between m-Na2MgSiO4 (a) and oNa2MgSiO4 (b) as described by Baur (ICSD 15618) and Withers et al. (ICSD 84562), respectively. Shaded blue and grey tetrahedra contain Si and Mg, respectively. The O atoms are illustrated by red balls atoms. 2 Methods 2.1 Synthesis
Na2MgSiO4 has been synthesized by solid state chemistry route. Starting reagents were high purity Na2CO3 (99.99 %, Aladdin), MgO (99.8 %, Aladdin) and SiO2 (99.99 %, Aladdin). Both Na2CO3 and MgO were initially dried at 350 °C and 1000 °C overnight, respectively. The starting materials were weighed according to the stoichiometry and mixed in ethanol with an agate mortar and pestle. The dried mixtures were pressed under 4 Tons in a 12 mm diameter cylinder and calcined at 975 °C for 12 h for three times with intermediate grindings and pressings. The same batch of Na2MgSiO4 was used for the subsequent characterization techniques. Additionally, in order to maximize the ionic conductivity while preserving the polar orthorhombic phase, Na2–2xMg1–xSi1+xO4 (x = 0.015, 0.025) compounds were prepared following the same method through substitution of Mg for Si to induce sodium vacancies. In order to inpress in Inorganic Chemistry 5 prepare pellets for EIS measurements, the powder was mixed with polyvinyl acetate (PVA) and then sintered at 975 °C. 2.2
Characterization
Second-harmonic generation (SHG) measurements were carried out on the powders using the Kurtz–Perry method.16 The measurements were performed with a Q-switched Nd:YAG laser at a wavelength of 1064 nm. The intensity of the frequency-doubled output emitted from the samples was collected by a photomultiplier tube and compared to crystalline KH2PO4 (KDP, serving as reference). Differential scanning calorimetry (DSC) data was acquired on a PerkinElmer STA 8000 simultaneous analyzer. About 20 mg of o-Na2MgSiO4 was placed in an Al2O3 crucible, heated at a rate of 10 °C min–1 from room temperature to 800 °C, and then cooled to room temperature at the rate under flowing air. The identification of the crystalline phases was initially determined by laboratory X-ray powder diffraction (XRD), which were recorded on a Bragg−Brentano D8 Advance Bruker diffractometer (Cu Kα radiation) equipped with a LynxEye XE detector over an angular range of 10°< 2 < 130°. Variable temperature X-ray diffraction (VT–XRD) data were collected on Panalytical X’Pert PRO powder diffratometer (CuKα radiation) equipped with HTK1200N furnace over the 15–65°2 range every 50 °Cfrom RT up to 800 °C using 5°C/min heating and cooling rates, and allowing 3 min for temperature equilibration before collecting the data for 30 min at each set point. High–intensity and high–resolution synchrotron X-ray powder diffraction (SPD) data was recorded on the 11–BM diffractometer at the Advanced Photon Source, Argonne National inpress in Inorganic Chemistry 6 Laboratory (USA). For this experiment, a sample of nominal composition Na2MgSiO4 was used. 2 range with a 0.001 step size at room temperature. SPD data was acquired over the 0.5–50° Constant-wavelength (=1.2289 Å) neutron powder diffraction (NPD) data were collected at ambient temperature over the 10–120°2 range at 2 intervals of 0.05°on the 3T2 diffractometer at LLB-Orphée source (France). The diffraction patterns were analysed using the Rietveld method implemented in the TopasAcademic software17 to identify the corresponding phase and estimate the amount and distribution of Na content. The bond valence sum calculation for the Na–O, Si–O and Mg–O bonds obtained from Rietveld analysis were calculated according to the following expression18, 19
∑ vi = exp[(Rij − dij )/b] (1) where vi is the bond valence bond between the cation i and the anion j, b is a universal constant (0.37), dij is the observed bond length and the Rij values have been
taken as
1.803,
1.
693
and
1.64
Å for
Na–O
,
Mg–O
and
Si–O
bonds, respectively as defined by Brown and Altermatt.18 The compositional homogeneity of the samples was analyzed by SEM and energy-dispersive X-ray spectroscopy (EDS) using a ZEISS Gemini SEM 300 scanning electron microscope (SEM, Germany), equipped with OXFORD EDS analyzer (ULTIM MAX 170, U.K.). Solid state 23Na and 29Si NMR spectra were obtained using Bruker AVANCE I 400 (9.4 T), AVANCE III HD 750 (17.6 T), and AVANCE NEO 850 (20 T) NMR spectrometers. Chemical shifts were referenced to a 0.1 M NaCl solution for 23Na and tetramethylsilane (TMS) for 29Si. 23 Na magic-angle spinning (MAS) NMR spectra were acquired at 17.6 T and 20 T using MAS probes from Bruker, with 4 mm and 1.3 mm diameter rotors at the spinning rates of 12.5 kHz and 60 kHz, respectively. 29Si MAS NMR data were collected using a Bruker AVANCE I 400 (9.4 T) spectrometer with a single pulse experiment while samples were spun at a frequency of 7 inpress in Inorganic Chemistry 7 kHz in 7 mm Bruker probe. For 29Si π/2 pulse width was 5s with a recycle delay of 7200 s. The NMR parameters (chemical shifts, chemical shift anisotropies, asymmetry parameters, line widths, and quadrupolar parameters) were fitted using the DMfit program.20 Spin–lattice relaxation (SLR) times (T1) were obtained using a saturation recovery pulse sequence and the data were fitted to a stretched exponential of the form 1–exp[–(τ/T1)α] (2) where τ are variable delays and α is the stretch exponential coefficient (between 0.85 and 1). Variable temperature 23Na MAS NMR data (up to 730 °C) were acquired on a Bruker AVANCE III 750 MHz NMR spectrometer using the diode laser–heated NMR probe head described previously.21 The sample was sandwiched between two layers of ground KBr which allowed for monitoring of the effective sample temperature through the shift of 79Br resonance signal of KBr.22 In the high temperature laser heating setting, the sample is contained in an aluminum nitride container placed in a zirconia rotor and immobilized with two O-rings made from the sodium-containing ceramic that give some secondary signals in the high temperature experiments. 23 Na 2D exchange spectroscopy (EXSY) experiments were conducted at 17.6 T in a 4 mm rotor MAS probe while spinning at 12.5 kHz using the echo compensated EXSY pulse sequence developed by Messinger et al.23 The acquisition conditions were as follows: /2 pulse 7.75 s, mixing time 100 ms (1250 and 5000 rotor periods), recycle delay (d1) 2 s, with quadrature detection in indirect dimension. Alternating–current (AC) impedance spectroscopy measurements were performed with a Solartron 1260 frequency response analyzer over a frequency range of 10−1 – 107 Hz within the 100–800 °Ctemperature range. Platinum paste was coated on the opposite faces of the pellets inpress in Inorganic Chemistry 8 (80% relative density) and heat treated at 600 °C for 30 minutes to burn out the organic components in the paste to form platinum electrodes. The impedance data analysis was carried out through the equivalent circuit fitting using the ZView software.24 The activation energies (Ea) for ionic migration were determined from the slope of the conductivity curves by linear fitting of the Arrhenius equation: log( )=logA-(Ea/2.303RT) (3) where A is the pre–exponential factor, R is the gas constant, and T is the temperature in Kelvin. 2.3 Theoretical calculations
Density functional Theory (DFT) calculations for NMR parameters were performed using the CASTEP DFT code,25 employing the gauge including projector augmented wave (GIPAW) NMR calculations26 following the methodology previously reported.27 The atomistic static–lattice and molecular dynamics (MD) atomistic simulations have been carried out on the basis of the interatomic potential approach employing the General Utility Lattice Program (GULP) program.28, 29 The Buckingham potential function was employed to describe the interactions between ions with the shell model30 to describe the polarizability for the structure modeling of Na2MgSiO4. A three-body potential term was employed to describe the OSi-O interaction.31 The potentials parameters used for the atomistic simulations are summarized in Table S1,31, 32 and tested well to reproduce the crystal structure of Na2MgSiO4 (Table S2). The MD simulation for sodium migration in Na2–2xMg1–xSi1+xO4 were performed with the DL_POLY33 code in the NVT ensemble with a Berendsen34 thermostat on a 3×6×5 supercell model containing 2862 atoms (with the inclusion of the shell model) and having compositions of Na2MgSiO4 and Na1.95Mg0.975Si1.025O4. The system was equilibrated under a constant pressure of 1 atm for 100 ps, adding up to 1,250,000 time steps with a time step of 0.08 fs before initiating inpress in Inorganic Chemistry 9 the main MD simulations for 100 ps at specific temperatures within the 600 °C to 1000 °C temperature range. The substitutions of Mg with Si were randomly distributed in the supercell, resulting in Na vacancies uniformly distributed. The Visual Molecular Dynamic package35 was adopted to view the migration pathways of Na ions, and the data of mean square displacements (MSDs) were exported by using nMoldyn code.36 Sodium diffusion coefficients were obtained from the MSDs plots as a function of simulation time linear fitting. 3 Results and Discussion 3.1 Long range structure. The as-prepared Na2MgSiO4 compound exhibits weak second harmonic generation response (~0.125 ×KDP at room temperature), confirming a non-centrosymmetric structure. The laboratory XRD pattern of Na2MgSiO4 can be correctly indexed in the Pna21 space group with a ~10.89 Å, b ~ 5.29 Å, c ~ 7.06 Å, similar to the unit cell reported by Withers et al (ICSD 84562).15 This indexation was confirmed by high-resolution SPD pattern recorded at the 11BM beam line, with no evidence for symmetry reduction to the maximal non-isomorphic subgroups P1a1, Pn11 or P1121. These data revealed a strong and systematic asymmetry in the peak profiles, which is present throughout the pattern and is strongly hkl-dependent. In particular, the h00 peaks were found to exhibit substantial asymmetry with long tails towards high angles, whilst 00l exhibited similar tails towards low-angles, but the 0k0 peak were almost completely symmetrical (Figure S1). This is indicative of a complex microstrain with a- and c-parameters (which lie orthogonal to the channels in the framework) strained by compression and elongation respectively, with little apparent strain along the b-axis (which runs parallel to the channels, Figure 2a). The peak asymmetry was not apparent in the corresponding neutron diffraction pattern, due to the lower resolution of the instrument. The homogeneity of the sample was then inpress in Inorganic Chemistry 10 checked by EDS-SEM analysis which further evidenced a homogeneous distribution of elements at m-scale (see Figure S2) and no segregation of elements could be detected. We performed chemical analysis in different grains giving the average at% 46±1, 27±1, 27±2 for Na, Mg and Si, respectively. Thus, the EDS-SEM data further confirmed that our sample is well reacted as well as the presence of some Na defect probably arising from Na volatilization which commonly reported in the preparation of Na-based ceramics at high temperatures.14, 37, 38 (020) (a) (b) Intensity (a.u)
(400)
(
004) (310) c a 2.24 2.29 2.34 2.39 3.5 3.6 -1 Q spacing (Å ) b 100 (c) 80 a/ao (d) b/b0 Intensity (a.u.) c/co V/V0 wt(%) 60 40 20 0 1 2 3 4 5 6 7 8 9 0.990 -1 Q spacing (Å ) 0.995 1.000 1.005
Normalised cell parameters Figure 2. (a) [010] projections of the average o-Na2MgSiO4 structure emphasizing the tetrahedral framework. Grey and blue colors represent the Mg and Si atoms, respectively. Navy blue and yellow green colors indicate Na1 and Na2, respectively. Experimental (circles), fitted (dark green line) and difference curve (purple). The sets of vertical lines correspond to the reflection positions for each one of the seven unit cells of o-Na2MgSiO4 employed. Overall reliability factors: Rwp= 5.72%, Rp = 5.26%, χ2 = 1.44. d) Normalized refined lattice parameter distribution and unit cell weighting data obtained from SPD-NPD combined refinement. We then carried out a combined Rietveld refinement using the SPD and NPD datasets. To account for the peak asymmetry in the SPD pattern, we constructed a multiple-unit-cell Rietveld model starting from the published Pna21 structure of Na2MgSiO415 as explained in supplementary Note 1. Figure 2b depicts a representative view of the SPD final refinement (a general view can be found in Figure S3). Figure 2c presents the final refinement of the NPD pattern. The resulting refined structure represents a weighted average of the seven unit cells, whose refined lattice parameter distribution and weighting is shown in Figure 2d. The final refined composition was Na1.968(3)Mg0.968(4)Si1.032(4)O4, leading to a mechanism in which sodium volatilization induces sodium vacancies that are compensated by Si substitution for Mg according to Na2-2xMg1-xSi1+xO4. The multi-cell refinement results indicate that the sample contains a small sub-micro compositional distribution arising from uncontrollable Na volatilization that is strongly coupled to an anisotropic local distortion of the crystal structure that shortens/elongates the a/c lattice parameters respectively (see Figure 2d), while the b parameter is only weakly affected because the channels are distributed along this [010] direction (Figure 2a). This is possible because of the high flexibility of the framework structure through the tetrahedral connections even when the Si/Mg tetrahedra are quite rigid.39 Overall this causes the unit cell volume to be strained towards smaller values, which is consistent with the presence inpress in Inorganic Chemistry 12 of vacancies on the Na sites as well as the Si4+ substitution for the larger Mg2+. It is worth noting that careful examination of the final refinement of SPD data evidenced a set minor unindexed reflections (Figure S4). Although we could not assign them to any known compound within the Na2O-MgO-SiO2 phase diagram, it is consistent with the ed mechanism in which sodium vacancies from sodium volatilization are compensated by the substitution of Si for Mg, which drove the final composition of the sample into a multiple-phase coexistence. The validity of our multiple-unit-cell model was further corroborated with the preparation of two additional nonstoichiometric compounds belonging to the Na2-2xMg1-xSi1+xO4 system, i.e. x = 0.015, 0.025 which exhibit the same unit cell parameters evolution (smaller a axis, longer c axis but nearly unchanged b axis and overall unit cell volume reduction, Figure S5a-b). Table S1-2 gather the refined structural parameters and main bond distances of the main phase. The two inequivalent Na sites hosted within the channels in the -cristobalite structure exhibits similar number of vacancies (~1% and 2% in Na1 and Na2, respectively). Both are coordinated by twelve oxygens, although a careful observation of the Na–O bond lengths indicates the presence of five and four nearest oxygen to Na1 and Na2 sites, respectively, within 2.31–2.75 Å as first coordination spheres, while the rest are placed further than 3 Å. Therefore, considering Na1 as five coordinated and Na2 as four coordinated seems reasonable given their respective bond valence sums (BVS) 0.88 and 1.08 close to unit.
3.2
Short
range structure
29 Si MAS N
MR
. The room temperature 29Si MAS NMR spectrum (Figure S6) mainly contains one Si site in very symmetrical tetrahedral Si(4Mg) environment, confirming an ordered Si/Mg distribution in the structure. The value of the 29Si chemical shift, –69.3 ppm, and the full width at half-maximum (FWHM), 76 Hz (1.0 ppm), are close to those obtained by Withers et al., i.e., – inpress in Inorganic Chemistry 13 68.9 ppm and FWHM = 1.2 ppm.15 In addition, there is another weak resonance around –75.3 ppm. This signal may be attributed to the secondary phase observed by SPD. Nevertheless, we have dismissed it because the relative amount of Si in different environments is 94/6 according to the 29Si MAS NMR spectrum fit, while the amount of the impurity phase has been estimated as 0.3 wt% from the SPD pattern (calculated from the A020/Ai ratio, being A020 the integrated area of the (020) reflection and Ai the integrated area of the unindexed peak at 2 ～10.7°- Figure S4). More likely, the presence of this signal can be assigned to the existence of a Si(3Mg, 1Si) site as described by Withers et al. for the non-stoichiometric compounds in Na2-2xMg1-xSi1+xO4 system (i.e., -74.9 ppm).15 Moreover, the relative amount of Si in different environment (Si(4Mg) and Si(3Mg, 1Si)) determined as 94/6 is in reasonably good agreement to the refined composition, 97.8(3)/3.2(3).This further supports that some Si moves inside the Mg tetrahedra to compensate the charge imbalance due to Na volatilization. Theoretically, Si substitution for Mg in the fully ordered structure of Na2MgSiO4 would have led to formation of Si(0Mg, 4Si) and Si(3Mg, 1Si) centers. Nevertheless, the presence of additional environments (e.g. Si(0Mg, 4Si), Si(1Mg, 3Si) or Si(2Mg, 2Si)) were not detected, which indicates that small amount of Si substitution for Mg in the ordered Na2MgSiO4 avoids condensation of SiO4 tetrahedra. This may interrupt locally ordered Mg and Si distribution in Na2MgSiO4, which accounts for the swelling feature on the background of NPD data (Figure 2c). 23 Na MAS NMR. The room temperature 23Na MAS NMR spectrum revealed the presence of two Na sites with relative multiplicities of 1:1 with well–defined quadrupolar line shapes (Figure 3), as expected. From the fitted spectrum, the chemical shifts (δiso) and quadrupolar parameters (quadrupolar constant, CQ and asymmetry parameter, ηQ) were obtained and the assignment of 23 Na resonances to sodium crystallographic sites based on the DFT computations considering the inpress in Inorganic Chemistry 14 Mg/Si fully ordered structural model is given in Table 1. Na1 site exhibits a larger quadrupolar coupling CQ (3.3 MHz) than that observed for Na2 (2.1 MHz confirming the more distorted environment observed from the SPD data refinement (Figure 3). O3 Na2 O2 O1 O2 2.27 Å O1 Na1 2.65 Å 2.25 Å O4 O3 O3 50 O4 40 30 b) 20 10 d (23Na), ppm -10 0 - 20
Figure 3. Experimental (blue) and simulated (red) 23Na MAS NMR spectra at 20 T and 60 kHz recorded at room temperature. The fitting of the individual 23Na resonances at Na1 and Na2 sites are shown in purple and green, respectively. Inset: Sodium coordination polyhedra in Na1 and Na2 sites. The bond lengths have been obtained from Rietveld combined refinement on NPDSPD data. Table 1. 23Na isotropic chemical shifts (δiso), quadrupolar constants (CQ), integrated intensity (I) and asymmetry parameters (ηQ) obtained from the simulation of the 23Na MAS at 17.6 T and 20 T and calculated 23Na NMR parameters (isotropic magnetic shielding constant σiso, chemical shifts δisocalc, quadrupolar constant |CQcalc|, and asymmetry parameter ηQcalc) for o-Na2MgSiO4. Site Na1 Na2 δiso ±0.2ppm 16.0 28.7 CQ ±0.2MHz 3.3 2.1 ηQ ±0.1 0.74 0.42 I(%) ±2% 50 50 σiso ppm 537.9 521.6 δisocalc ppm 16.1 29.8 |CQcalc| MHz 3.86 2.33 ηQcalc 0.72 0.32 3.3
Macroscopic ionic migration inpress in Inorganic Chemistry 15
Electrochemical impedance spectroscopy (EIS). The electrical behavior characterization of the sample was undertaken by EIS. At temperatures below ~150 C, the spectra exhibit non-well defined shapes in the low frequency range (see Figure S7). Between ~150 – 400 °C, the spectra consist of one depressed semicircle arc in the high frequency region and one Warburg–type inclined line in the low frequency region with capacitances of >10–8 F·cm–1 at 10–1 Hz,40 indicative of ionic conduction. Figure 4a depicts the complex impedance plot of Na2MgSiO4 recorded at 154 °C,showing one asymmetric and depressed semicircular arc in high frequency region. In the C' vs. f plot two overlapping plateaus can be apparently discerned within 107–102 Hz region (Figure 4a, inset): the one in 102–103 Hz has capacitances ~2 pF·cm-1 and the other one within 105–106 Hz has smaller capacitances ~0.5 pF·cm-1. Both capacitance plateaus lie with the bulk responses,40 i.e. that the semicircular arc actually comprises two bulk components and may be indicative of the electrical inhomogeneous nature of the as-prepared Na2MgSiO4, probably due to partial Na volatilization. Apart from the overlapping bulk response arc and electrode response line, no apparent grain boundary response was observed in the complex impedance plot. Therefore deconvolution of complex impedance plot was performed through equivalent circuit fitting with two bulk and one electrode components, which is shown in Figure S8. The high frequency part of the bulk impedance data is a series combination of one bulk component consisting of Rb1, Cb1, CPE1 in parallel and the other bulk component consisting of Rb2, Cb2 in parallel. The fit gives Rb1 1.0(1)×107 Ω·cm, C1 4.3(3)×10–13 F· cm–1, Rb2 2.9(2)×106 Ω·cm and C2 1.9(1)×10–12 F·cm–1. It must be indicated that a CPE element is not included for the second element since its values are not meaningful and, indeed, a satisfactory fit was obtained. While increasing the temperature, the bulk response arc disappeared gradually and above 400 °C only electrode response was identified. The electrode response recorded at inpress in Inorganic Chemistry 16 650 °Cdoes not show any evident collapse after changing the atmosphere from pure nitrogen to pure oxygen, in contrast with the typical behavior to partial oxygen pressure exhibited by oxide ion conductors (Figure 4b).5, 41-43 Moreover, its ionic conductivity is maintained at different pO2 values (Figure 4b-inset). Therefore, the ionic conduction in o-Na2MgSiO4 arises from sodium cations instead of oxide ions. Figure 4c depicts the Arrhenius plots for the bulk conductivities of o-Na2MgSiO4.
It exhibits σb 10–5 S·cm–1 at 300 °C, in good agreement with the
values reported
by Baur13
and
Shannon,
14
and at
800
°C
its conductivity reaches 5×10-3 S·cm-1. Slight
curv
ature
was
observed on the
Arrhenius plot
of
bulk conductivity
: the
Ea
is ~0.73(1) e
V
within
100
–
500
°
C
and then decreases
at higher temperatures (~0.51
(2)
eV
between
500 – 800 °C).
This
evolution cannot
be
attribut
ed to any
structure change
, as
either VTX
RD or DSC data do not evidence any
structure
rearrangement apart from the enlargement of the
unit
cell parameters and
Na–
O bonds (
Figure
S9-S10,
respectively
). The change of Ea may be related to a local order-disorder transition of sodium vacancies at high temperature, where the sodium ions become progressively more mobile. Such local order-disorder of small amount of sodium vacancies is not enough to change significantly the environments of sodium ion in the structure. Therefore, it is hard to deduce the information on the order-disorder of sodium vacancies from the variable-temperature 23Na MAS NMR data described later. Moreover, the conductivity can be further improved by inducing more sodium vacancies through varying the stoichiometry allowing for the Mg substitution for Si in the tetrahedral network according to the Na2-2xMg1-xSi1+xO4 formula proposed above and achieves ~10–5 S·cm–1 at 200 °C for the o-Na1.95Mg0.975Si1.025O4 nominal composition (Figure 4c) while conserving the polar Pna21 structure. organic Chemistry 17 2 T (10 C) -13 0 2 4 10 10 10 10 Frequency (Hz) -1 2 6 0.5 1.0 Z'( ·cm) 4 3 10 10 -4 Na1.95Mg0.975Si1.025O4 -4 10 10 -4 -2 10 pO2 10 0 Rb 1.5 1 Na1.97Mg0.985Si1.015O4 -3 -3 2 Na2MgSiO4 10 -5 10 -6 10 -7 Air N2 10 O2 10 -8 0 0.5 5 10 1 3 0.0 0.0 6 (c) 10 Rb -1 4 5 -2 9 8 7 -1 10 10 -1 b (S·cm ) -11 b(S cm ) 10 3 -Z"( ·cm) 1.0 10 -1 -2 -Z"(10 ·cm) -9 (b) ~ 0.5 pF cm -1 ~2 pF cm-1 10 -1 C (F cm ) (a) 1.5 3 -9 0 1 2 3 10 1.0 3 Z' (10 ·cm) 1.5 2.0 2.5 -1 1000/T(K )
Figure 4. (a) Experimental (open circles) and calculated (red line) complex impedance plot of oNa2MgSiO4 at 154 °C in air and its deconvolution to two bulk components (in blue and green lines). The numbers denote the logarithms of the selected frequencies marked by filled circles. The inset shows the capacitance as a function of frequency of o-Na2MgSiO4 at 154 °C. (b) Complex impedance plots for o-Na2MgSiO4 at 650 °C under N2, air and O2. The inset depicts the pO2 dependency of the conductivity of Na2MgSiO4 at 650 °C. (c) Arrhenius plots of total conductivity for o-Na2-2xMgxSi1+xO4 (x = 0, 0.015, 0.025) compositions. MD simulation. Atomistic static lattice and MD simulations were carried out on the basis of the interatomic potential method for both o-Na1.95Mg0.975Si1.025O4 and o-Na2MgSiO4 nominal compositions. Figure 5a shows the calculated MSD values of Na, Mg, Si and O atoms in oNa1.95Mg0.975Si1.025O4 obtained at 1000 °C (generally higher temperatures than the experimental ones are required for the simulations to observe the long-range migration paths within the limited simulated time 100 ps). Only Na ions migrate through the structure; Mg, Si and O ions vibrate slightly around their lattice positions without long–range migration, in good agreement with the sodium ionic conduction character revealed by impedance spectroscopy. The sodium diffusion coefficients, calculated from the MSD values of Na ions, fall in the range of ~ 10–8–10–6 cm2·s–1 within the 700-1300 °C temperature range (Figure S11) and the calculated Ea obtained from the inpress in Inorganic Chemistry 18 Arrhenius plot of the sodium diffusion coefficients is 0.69(2) eV, which is between the experimental values in the high (0.73(1) eV) and low (0.51(2) eV) temperature ranges. The streaming and overlapping of positions of sodium ions originally at Na1 and Na2 sites in their scatter plots (Figure 5b), together with their MSD values suggest that both Na sites are involved in, and equally contribute to the sodium ion migration mainly through hopping between Na1 and Na2 sites, forming three-dimensional migration zig-zag shaped paths. For comparison, the MSD values for Na ions in Na2MgSiO4 (red dashed line in Figure 5a), i.e. free of vacancies, are remarkably lower than those calculated for Na1.95Mg0.975Si1.025O4 at the same temperature. This further supports that the presence of Na vacancies is ly necessary to observe ionic conductivity in Na2MgSiO4. inpress in Inorganic Chemistry 19 a) 3 Na 2 Mean square displacements (Å ) 2 MSD (Å ) 3 2 Na2 2 Na1 1 0 0 20 40 60 80 100 Time (ps) 1 O Mg Si 0 20 40 60 80 100 Time (ps)
b) a c Figure 5. (a) MSD values of Na, Mg, Si and O atoms in Na1.95Mg0.975Si1.025O4 as a function of time from the MD simulations at 1000 oC. The inset depicts the MSD values of Na1 and Na2 atoms. Green dashed line indicates the MSD for Na in vacancy-free Na2MgSiO4 compound at 1000 °C. (b) Scatter plots of sodium ion positions showing the diffusion paths consisting of both Na1 and Na2 sites at 1000 °C (marked by dashes lines) from MD simulations. Blue and greenish-olive dots denote sodium ions originally placed at Na1 and Na2 sites respectively.
3.4 Microscopic ionic migration. VT 23Na MAS NMR spectroscopy. Since the pure sodium ionic conduction nature is demonstrated in o-Na2MgSiO4, the sodium migration dynamics at local scale was monitored by VT 23Na MAS NMR spectroscopy. As aforementioned, the spectrum of o-Na2MgSiO4 recorded under a magnetic field of 17.6 T and spinning at 5 kHz exhibits two well–separated quadrupolar lines expressing second order line shapes. It is worth mentioning that when MAS NMR measurements were performed at room temperature, and without temperature regulation, the actual sample temperatures were 49±2 °C at 5 kHz (7 mm rotor) MAS and 52±2 °C at 12.5 kHz (4 mm rotor) due to frictional heating. Considering the 1D experiments (Figure 6a), we observed that the temperature increase from 49 °C up to 730 °C first led to the collapse of the quadrupolar line shapes merging to a single broad spectrum at 175–200 °C that then sharpened into an averaged line up to 730 °C. This behavior is closely related to what was observed for nepheline (a trydimite-type framework) at 500 °C and it is indicative of an ion exchange process. 9, 44 As indicated by the VT-XRD data, this tendency cannot be attributed to any structure change within the analyzed temperature range. We have estimated the activation energy for Na migration from 23 Na SLR time measurements (T1) (Figure S12). The linear slope indicates an Ea = 0.321 eV for fluctuations causing relaxation, which is much smaller than that obtained from conductivity measurements (0.51(2)–0.73(1) eV), probably because that NMR relaxation is occurring not only through cationic motion required for diffusion and conductivity, but also via local fluctuation of Na environment (via local ion hopping back and forth between sites and/or by motion of nearby defects). This may lead to lower activation energies than those for through-going (longrange) ionic diffusion alone.11, 47-49 It is worth noting that both techniques tends to reflect different averaging of the underlying distribution of dynamic processes and it is not surprising to inpress in Inorganic Chemistry 21 observe such a mismatch. 23 Na 2D EXSY experiments. In order to better understand the dynamics of sodium mobility in the material at moderate temperature and before the merging of quadrupolar line–shapes, we performed 23Na 2D EXSY experiments at 52 °C and 100 °C. The EXSY experiments (Figure 6b) allow evidencing slow ionic jumps between the 23Na crystallographic sites at the time scale of hundred of ms exchange or mixing time. Non-exchanged Na atoms do not change frequency during the mixing time but they sign on the diagonal which is homogeneously broadened by spin–spin relaxation (T2). Na atoms exchanging with a neighboring site will sign as off-diagonal (direct exchange between different structural positions) or on-diagonal cross-peaks (relayed exchange). Thanks to the specific line shapes of the cross-peaks correlating two second order broadened line-shapes, we implemented a simulation of the different components in DMfit (available from version #20200728 available on request) and to retrieve their respective contributions (integrals of diagonal and cross peaks).20 At 52 °C and 100 ms exchange we observe 83 % of non-exchanged Na atoms, 17 % of exchange between Na1 and Na2 sites and negligible self exchange; at 100 °C and 100 ms exchange, we observe at 23% of non-exchanged Na atoms, 48% of exchange between Na1 and Na2 sites and 28 % self exchange (Table S5). inpress
in Inorganic Chemistry 22 (a) T, oC MAS=5kHz 730 700 610 520 440 400 350 300 250 225 200 175 150 100 49(RT) 50 d (23Na), ppm 0 40 30 (b) 10 0 d (23Na), ppm 10 10 20 20 -20 -30 0 45.0 % % 45.0 32.1 % % 32.1 23.0 % 23.0 % 16.4 % % 16.4 11.7 % 11.7 % 8.4 % % 8.4 6.0 % 6.0 % 4.3 % % 4.3 3.0 % 2.2 % 0 116.0 % 82.9 % 59.2 % 42.3 % 30.2 % 21.6 % 15.4 % 11.0 % 7.9 % 5.6 % 30 30 0 -10 0 30 d (23Na), ppm 20 20 10 0 (c) 30 10 0 10 10 20 20 30 30 30 20 20 10 d (23Na), ppm 0 30 20 10 23 d
(
Na
),
ppm
Figure 6. (a) 23Na NMR spectra recorded at 17.6 T and MAS 5 kHz as a function of temperature. The weak 23Na signals between –5 and –2 ppm (red circle) arise from the ceramic O–rings used inpress in Inorganic Chemistry 23 to fix the AlN sample holder in place within the zirconia rotor. (b-c) 23Na 2D EXSY NMR spectra (left) obtained with 100 ms mixing time, (b) at 52 °C; (c) at 100 °C and their fitting results (right). 3.5 Global sodium migration mechanism in o-Na2MgSiO4
According to our data covering the sodium dynamics from macroscopic to microscopic range, an atomistic point of view of the Na migration can be understood as follows. Four Na1 atoms located in the second coordination sphere of the Na2 atom and also four Na2 atoms are placed in the second coordination sphere of the Na1 atom. Since the distances between two different sodium sites (3.12; 3.23; 3.30; 3.36 Å) are shorter than the distances between the same sites (from 4.77 up to 5.61 Å), we only observe exchange between Na1 and Na2 sites in the 23Na EXSY NMR spectrum at 52 °C (this step is illustrated in Figure 7a). Upon slight heating (100 °C), the sodium atoms start to migrate-diffuse within and between the channels of the magnesium–silicate framework. Then, with a further increase in temperature, the movement of atoms becomes very fast and we cannot distinguish these two states anymore on the NMR timescale as inferred from 23Na EXSY NMR data and the long range diffusion of sodium atoms takes place though the 3D framework of the structure mainly along the paths composed of alternate Na1 and Na2 sites, as exemplified in Fig 7b.
inpress in In
organic
Chemistry 24
(a) c a (b) c a b Figure 7. (a) <010> view of the sodium site exchange at low temperatures. Si, Mg, Na1 and Na2 are represented as blue, grey, navy blue and greenish spheres, respectively. (b) <010> view of Na2MgSiO4 refined structure emphasizing the voids along (010) direction. The macroscopic Na migration at high temperatures along the [100] (blue), [010] (red) and [001] (purple) directions are indicated. The interconnected Na atoms are placed at distances ranging 3.12-3.36 Å. 4 Conclusions
The sodium dynamics have been studied and described for the first time in polar stuffedcristobalite o-Na2MgSiO4 through a complementary set of techniques (EIS, MD simulations, (VT) 23 Na MAS NMR and 23Na EXSY NMR). o-Na2MgSiO4 exhibits two inequivalent Na sites and it should not exhibit ionic conduction on the strictly stoichiometric composition, according to molecular dynamics simulations. Yet, the synthesis route employed results partial Na inpress in Inorganic Chemistry 25 volatilization (~2 at%) that converts the material into a pure ionic conductor exhibiting moderated ionic conductivity (~ 10–5 S cm–1 at 300 °C) that can be further improved by inducing additional Na vacancies while keeping the polar structure according to Na2-2xMg1-xSi1+xO4 formula. 1D 23Na VT MAS NMR and 23Na EXSY NMR clearly evidence that a sodium site exchange at ~ RT takes place triggering the sodium ionic conduction at higher temperatures. This work demonstrates the sodium site exchange phenomenon for first time by 23Na EXSY NMR and paves the way to possible further identification of sodium ionic conductors from complex structures as 3D stuffed-cristobalite ones exhibiting multiple sites for mobile ions.
AUTHOR INFORMATION
Corresponding Author *E-mail: [email protected]
ACKNOWLEDGMENT
The authors thank the National Science Foundation of China (Nos. 21850410458, 22090043 and 21622101) Guangxi Natural Science Foundation (No. 2019GXNSFGA245006) as well as the CNRS (IR-RMN-THC Fr30560) for the financial support. Prof. Sangen Zhao is acknowledged for the help on SHG measurements. ASSOCIATED
CONTENT Supporting Information. SPD diffraction refinements; SEM-EDS elemental mapping for Na2MgSiO4; Laboratory XRD patterns of o-Na2-2xMg1-xSi1+xO4 samples and normalized refined lattice parameters; 29Si MAS NMR spectrum; Complex impedance plot at 60 °C; Equivalent circuit to fit the EIS spectrum recorded at 154 °C; VTXRD, DSC and unit cell evolution within inpress in Inorganic Chemistry 26 30–750 °C; Arrhenius plot of the sodium diffusion coefficient; 23Na spin–lattice relaxation times plotted against 1000/T; Structural parameters and selected interatomic distances at room temperature; Interatomic potential parameters used for the MD simulations and experimental and calculated structural parameters; Multiple-unit-cell Rietveld model description.
REFERENCES 1. Yabuuchi, N.; Kubota, K.; Dahbi, M.; Komaba, S. Research Development on Sodium-Ion Batteries. Chem. Rev. 2014, 114, 11636-11682. 2. Rosseinsky, D. R.; Mortimer, R. J. Electrochromic Systems and the Prospects for Devices. Adv. Mater. 2001, 13, 783-793. 3. Sun, J. Y.; Keplinger, C.; Whitesides, G. M.; Suo, Z. G. Ionic Skin. Adv. Mater. 2014, 26, 7608-7614. 4. Mahato, N.; Banerjee, A.; Gupta, A.; Omar, S.; Balani, K. Progress in Material Selection for Solid Oxide Fuel Cell Technology: A Review. Prog. Mater Sci. 2015, 72, 141-337. 5. Yang, X.; Fernández-Carrión, A. J.; Wang, J.; Porcher, F.; Fayon, F.; Allix, M.; Kuang, X. Cooperative Mechanisms of Oxygen Vacancy Stabilization and Migration in the Isolated Tetrahedral Anion Scheelite Structure. Nat. Commun. 2018, 9, 4484. 6. Xu, J.; Wang, J.; Rakhmatullin, A.; Ory, S.; Fernández-Carrión, A J.; Yi, H.; Kuang, X.; Allix, M. Interstitial Oxide Ion Migration Mechanism in Aluminate Melilite La1+xCa1–xAl3O7+0.5x Ceramics Synthesized by Glass Crystallization. ACS Appl. Energy Mater. 2019, 2, 2878-2888. inpress in Inorganic Chemistry 27 7. Kirchhain, H.; van Wüllen, L. Solid state NMR at very high temperatures. Prog. Nucl. Magn. Reson. Spectrosc. 2019, 114-115, 71-85. 8. Stebbins, J. F. In Modern Methods in Solid-state NMR: A Practitioner's Guide; The Royal Society of Chemistry: 2018; pp 262-288. 9. Stebbins, J. F. Dynamics in Ceramics. Science 2002, 297, 1285-1287. 10. Böhmer, R.; Storek, M.; Vogel, M. In Modern Methods in Solid-state NMR: A Practitioner's Guide; The Royal Society of Chemistry: 2018; pp 193-230. 11. Xu, Z.; Stebbins, J. F. Cation Dynamics and Diffusion in Lithium Orthosilicate - 2Dimensional Li-6 NMR. Science 1995, 270, 1332-1334. 12. Verhoeven, V. W. J.; de Schepper, I. M.; Nachtegaal, G.; Kentgens, A. P. M.; Kelder, E. M.; Schoonman, J.; Mulder, F. M. Lithium Dynamics in LiMn2O4 Probed Directly by TwoDimensional Li-7 NMR. Phys. Rev. Lett. 2001, 86, 4314-4317. 13. Baur, W. H.; Ohta, T.; Shannon, R. D. Structure of Magnesium Disodium Silicate Na2MgSiO4 and Ionic Conductivity in Tetrahedral Structures. Acta Crystallogr. B 1981, 37, 1483-1491. 14. Shannon, R. D. Ionic Conductivity in Sodium Magnesium Silicates. Phys. Chem. Miner. 1979, 4, 139-148. 15. Withers, R. L.; Lobo, C.; Thompson, J. G.; Schmid, S.; Stranger, R. A Modulation Wave Approach to the Structural Characterization of Three New Cristobalite-Related Sodium Magnesiosilicates. Acta Crystallogr. B 1997, 53, 203-220. inpress in Inorganic Chemistry 28 16. Kurtz, S. K.; Perry, T. T. A Powder Technique for the Evaluation of Nonlinear Optical Materials. J. Appl. Phys. 1968, 39, 3798-3813. 17. Coelho, A. A. TOPAS and TOPAS-Academic: an Optimization Program Integrating Computer Algebra and Crystallographic Objects Written in C++. J. Appl. Crystallogr. 2018, 51, 210-218. 18. Brown, I. D.; Altermatt, D. Bond‐Valence Parameters Obtained from a Systematic Analysis of the Inorganic Crystal Structure Database. Acta Crystallogr. B 1985, 41, 244-247. 19. O'Keeffe, M.; Brese, N. E. Bond-Valence Parameters for Anion-Anion Bonds in Solids. Acta Crystallogr. B 1992, 48, 152-154. 20. Massiot, D.; Fayon, F.; Capron, M.; King, I.; Le Calve, S.; Alonso, B.; Durand, J. O.; Bujoli, B.; Gan, Z. H.; Hoatson, G. Modelling One- and Two-Dimensional Solid-State NMR Spectra. Magn. Reson. Chem. 2002, 40, 70-76. 21. Rakhmatullin, A.; Šimko, F.; Véron, E.; Allix, M.; Martineau-Corcos, C.; Fitch, A.; Fayon, F.; Shakhovoy, R. A.; Okhotnikov, K.; Sarou-Kanian, V.; Korenko, M.; Netriová, Z.; Polovov, I. B.; Bessada, C. X-ray DIffraction, NMR Studies, and DFT Calculations of the Room and High Temperature Structures of Rubidium Cryolite, Rb3AlF6. Inorg. Chem. 2020, 59, 63086318. 22. Venkatachalam, S.; Schröder, C.; Wegner, S.; Van Wüllen, L. The Structure of a Borosilicate and Phosphosilicate Glasses and its Evolution at Temperatures Above the Glass Transition Temperature: Lessons from in situ MAS NMR. Phys. Chem. Glasses-B 2014, 55, 280287. inpress in Inorganic Chemistry 29 23. Messinger, R. J.; Ménétrier, M.; Salager, E.; Boulineau, A.; Duttine, M.; Carlier, D.; Ateba Mba, J.-M.; Croguennec, L.; Masquelier, C.; Massiot, D.; Deschamps, M. Revealing Defects in Crystalline Lithium-Ion Battery Electrodes by Solid-State NMR: Applications to LiVPO4F. Chem. Mater. 2015, 27, 5212-5221. 24. Johnson, D. Zview for Windows, Impedance/Gain Phase Graphing and Analysis Software, Scribner Associates: North Carolina, 2001. 25. Segall, M. D.; Lindan, P. J. D.; Probert, M.; Pickard C. J.; Hasnip, P.; Clark, S. J.; Payne, M. C. First-Principles Simulation: Ideas, Illustrations and the CASTEP Code. J. Phys.: Condens. Matter 2002, 14, 2717-2744. 26. Clark, S. J.; Segall, M. D.; Pickard, C. J.; Hasnip, P. J.; Probert, M. J.; Refson, K.; Payne, M. C. First Principles Methods Using CASTEP. Z. Kyrstallogr. 2005, 220, 567-570. 27. Šimko, F.; Rakhmatullin, A.; Florian, P.; Kontrík, M.; Korenko, M.; Netriová, Z.; Danielik, V.; Bessada, C. (Oxo)(Fluoro)–Aluminates in KF–Al2O3 System: Thermal Stability and Structural Correlation. Inorg. Chem. 2017, 56, 13349-13359.
| 8,250 |
https://github.com/janhohenheim/neuromorphic-engineering-one/blob/master/export_to_pdf.sh
|
Github Open Source
|
Open Source
|
MIT
| 2,021 |
neuromorphic-engineering-one
|
janhohenheim
|
Shell
|
Code
| 8 | 24 |
#!/bin/bash
poetry run jupyter nbconvert --to webpdf "$1"
| 34,414 |
https://github.com/reececomo/DeckTransition/blob/master/Source/DeckPresentationDelegate.swift
|
Github Open Source
|
Open Source
|
MIT
| 2,019 |
DeckTransition
|
reececomo
|
Swift
|
Code
| 88 | 263 |
//
// DeckPresentationDelegate.swift
// DeckTransition
//
// Created by Reece Como on 15/9/18.
// Copyright © 2018 Harshil Shah. All rights reserved.
//
import UIKit
/// Delegate methods provided by the drag
@objc
public protocol DeckPresentationDelegate {
/// Is drag allowed?
@objc optional func deckPresentationShouldAllowDragToBegin(_ panGestureRecognizer: UIPanGestureRecognizer) -> Bool
/// Called when drag began
@objc optional func deckPresentationDragDidBegin(_ panGestureRecognizer: UIPanGestureRecognizer)
/// Called when drag ended
@objc optional func deckPresentationDragDidEnd(_ panGestureRecognizer: UIPanGestureRecognizer, andViewControllerWillDismiss willDismiss: Bool)
/// Called during drag
@objc optional func deckPresentationDidDrag(_ panGestureRecognizer: UIPanGestureRecognizer, toPosition position: CGPoint)
}
| 37,259 |
https://github.com/denizsubasi/CCView/blob/master/creditcardviewlib/src/main/java/com/denizsubasi/creditcardview/ext/ViewExt.kt
|
Github Open Source
|
Open Source
|
Apache-2.0
| 2,020 |
CCView
|
denizsubasi
|
Kotlin
|
Code
| 187 | 664 |
package com.denizsubasi.creditcardview.ext
import android.content.Context
import android.view.KeyEvent
import android.view.View
import android.view.ViewTreeObserver
import android.view.inputmethod.EditorInfo
import android.view.inputmethod.InputMethodManager
import android.widget.EditText
inline fun EditText.onImeAction(crossinline action: (text: String) -> Unit) {
setOnKeyListener(View.OnKeyListener { _, keyCode, event ->
if ((event?.action == KeyEvent.ACTION_DOWN) && (keyCode == KeyEvent.KEYCODE_ENTER)) {
action(text.toString())
return@OnKeyListener true
}
false
})
setOnEditorActionListener { _, _, _ ->
action(text.toString())
true
}
}
inline fun EditText.onDone(hideKeyboard: Boolean = true, crossinline action: (text: String) -> Unit) {
imeOptions = EditorInfo.IME_ACTION_DONE
onImeAction {
if (hideKeyboard) hideKeyboard()
action(text.toString())
}
}
inline fun EditText.onNext(hideKeyboard: Boolean = true, crossinline action: (text: String) -> Unit) {
imeOptions = EditorInfo.IME_ACTION_NEXT
onImeAction {
if (hideKeyboard) hideKeyboard()
action(text.toString())
}
}
fun View.gone() {
this.visibility = View.GONE
}
fun View.invisible() {
this.visibility = View.INVISIBLE
}
fun View.visible() {
this.visibility = View.VISIBLE
}
fun View.showKeyboard() {
this.post {
requestFocus()
val imm =
context.getSystemService(Context.INPUT_METHOD_SERVICE) as InputMethodManager
imm.showSoftInput(this, InputMethodManager.SHOW_IMPLICIT)
}
}
fun View.hideKeyboard() {
val inputMethodManager =
context.getSystemService(Context.INPUT_METHOD_SERVICE) as InputMethodManager
inputMethodManager.hideSoftInputFromWindow(windowToken, 0)
}
inline fun <T : View> T.afterMeasured(crossinline f: T.() -> Unit) {
viewTreeObserver.addOnGlobalLayoutListener(object : ViewTreeObserver.OnGlobalLayoutListener {
override fun onGlobalLayout() {
if (measuredWidth > 0 && measuredHeight > 0) {
viewTreeObserver.removeOnGlobalLayoutListener(this)
f()
}
}
})
}
| 619 |
sn84026824_1888-01-13_1_3_2
|
US-PD-Newspapers
|
Open Culture
|
Public Domain
| null |
None
|
None
|
English
|
Spoken
| 1,250 | 2,476 |
An opportunity for bartering Rarely The beginning this week to clean up our entire Front department, taking an inventory of high-quality merchandise, will be measured and placed on our counter at prices that will make this wide of great interest for every lady in the county. A? cannot share the counter-room to properly display goods from all the week, we propose to sell them to revive our "Remnant Day," abandoned during the busy season. The first of these articles will be held on This day every article in the realm of a Remnant will be placed on the Remnant Counter, and special attention will be paid to the fact. Do not fail to attend this sale, you may find just the article you can buy at from one quarter to one-half value. So, what you will find on the counter: In Remnants of Dress Goods will allow you Black Cloth. Fancy Black Cloth. Check, trip-tipped Mixtures, Mixtures, Nails, Toothbrush, Hickory, and Colored; Plain, Cloth, and Aisle, etc. In Ladies and Children's Wares, we offer our entire stock, consisting of the latest flash Coats, Mixtures, and Aisle, and Short Wraps, Jackets in black and colored, Children's Coats, etc., regardless of price to close out, which we have left. In Hosiery, we offer a lot of Brocade Hoses and Oats and Kid Gloves, in Ladies' and Children's Coats, etc. Among these will be Men's and Women's, Bargains in Gloves, we will offer a lot of Fleece-lined and Shirts, etc., etc. P. A. HICKORY. ttam>>?>o llcture the latest novelty ; also, Kltuny and Anil i<ie 1 ?* <i Lasela. for sale hy Rogt-is, the liugcr*.QWU photographer. Ijitf Chrotnot In walnut frames, 75 cent*. at Rogers . Hignstown. ? -? . ? Large Chrorntu In gr.t frames, at II. Very large 'ill i'alnilngs !u deep gilt frames at f'J and I at Ruget *. Artntype* nicely framed, from 91. .V) to it. Fine steel Kngravlngs, hatidaonely framed, from |! to |l->, at Roger* > t iLtgeratow u photographer. AT BEACHLEY'S, H AGERriTO W Ml), < Hrprl IfiHNlarlHrer*. Besrttey * Co.. ire not only tne largest retail 4e i > r In carpet*, oil clotha, malting*. Ac., hu i mey are mailing Uie largeac carpet factory in Hag* rsiowu. If you wuiitahome made. rag or jute carpet made to order, go and *e? them before >ou give y??ur orJer. Work guaranteed. Prlees low. t ool Hralbrr. If you want rtann-i*. blanket*, underwear, yarn, oxafort*. Sr., go to Jw-*< htey. He liouglit at old price* and don't Intend to be anderaold. fr'u?lilon >? l?l?- J's? i lor i mc B?-acbley A Oo.'i Men and Boya' Fall and Winter hultlt ga are now on aale. Tbelr cot ter la Drat cla*a and prices low. I>rr?? 4av?r?l? Kcd?? rd Twilled Lie Alma cloth*. ?$ Beach leys re duced from 2S oeats to id cent*. They are going. I>r Ntiliilliac1* Ueallh i'sraeli are eacy Wearing and Durable, Try them. Hold at Hoacblej* s, POWDER Absolutely Pure. l lil* powilor nrvor Tiiicn. A marvel of |U>? rliy. hiii! wholMonixncN, Mow eccnomtrMl 'linn th?- < mIIiihi \ kind*, ?ntl <*!?? not h? miM tn pom petition with tin- mult! tu<l# of low t*??t.?l)?rt w>M?ht alum or |?li? ptlrtt? IHludfTH. Nt'ltl t nlfj in r<lNI. KoYAL HAKixai Co., 1'* Wall St.. New York. HI ANKH's AT fi ?sT. HI. \ N k I I - AT COST, n wkhs a ih'ni. KI.ANk I Ix AT ? ?< ?>I. BLANK K D* ATClM?r. HI. A NK K IS A I t'? M?T. I'OMKORTs AT Cos: r i'o.MKOI. I - \ i r.iHi niMK'ltls A I' i '< n|' ?'"MI OKI's \ r c< -?| t'? ?M K? ?li i X A I | ro.MKi'ltrs AT ? VIST. Illl. I MU It Illti'S A I J. F. WELSHANS' Vou v\ i 1 1 find a Splendid Stock of For eign lunl Domestic I)UV GOODS, M1LMNKKY, NOTIONS. AMD FANCY GOODS. I.AHIKs' Win llll.llKKN'K CLOAKS. Floor Oilcloths, I. A OIKS' AN D <111 1.DHKX'S GUM SHOES. All at Popular PricoB. Call ant' examine iuy mv Mock be fore |?u rclia.^i ng. No trouble to uliow IflMKlM. OU B ANNUAL CLEANING SALI <?f Full mut Winter (londa foninttnflM Wednesday, January 4, 1888. Itnthar iliaii mrry over tml twk ?w?v ?*? oiler otir ??nt in* at'Wk of Knll Mil Winter <?<M.<l?nt Inn Ihin cotl. Ciiihi- rarljf mi I ((?' Hi*- Hnrictli ?. Not* a few prlcea: CI/ ri ll I Si i DKPA HT M P. NT. Ovi-miata worth f \ uo l(?iui*>l to I J T It " ?? ft ?w ?< ?? 10 1*1 ?? 7 OU Holla M * III - ?? 6 ? .. .. )?| in " ?? 7 r?o ? ?? l ft ?> ?' ? 10 00 CL'HTOM TAlUiKINO liKPA KTMF.NT. Suit* to or>ler worth t2" '*? lledueni to fl? 00 2j <?) - VI <?> *> ?i ?? as mo HAT AMM'A I' IHCI'A ItTM KNT. Heavy U'lnlcr (>|i* worth .75 lie. lure. I t? ,.V? ?' .;?? " M Heavy Fur Capa reduced ne.irly ll>lf Prlea. MKV* Fl "ltNI-?IIIN?i Oowlw* HKI'AKT M K.ST. HriV) Fur Ulovea worth S 00 Kedt.eed U? 2 0 U ? 0U l?l If.* re.li.rtlon on nil Cnilmwrar. Olov<-? ami ('MI'llKHII Jar keta. lUMrt ANt) HHoK I'KI'AltTMKNT. Heavy Kip Boot* worth 2 .<0 luduced to 2 '*? 3 oo ?? 3 9 WomCB'l HratrjrKhort I !t> " WO I ?> * I IV Sarin- reduction In l.adl?*a and <?eiita Flna Miun. BLANKET AND HOB it DKI'AKl'MKNT. Heavy lap blanket worth 2 ?'? He.lu<-ed to I ftu X Vo 2 M A W? it !tt (irey or White Kobro < /to ? * 7ft " 7 <n - uo Blark K/i?*a 1? (*ji ?? 7 8? HKK-04 DP.PAKTMKNT. Iiri-iui <iooda worth ,Kl KnlurH t<i .It " M Hlark ind eol, HI Ik .Mi " .?> 1 2ft J? " I .? I 10 Alt lJr?M li'KKln ltedue?d In f'rlca, and all Iti-m J'rliniiiliiya at Half I'l ir*. HOUMK FI'KNIhHIXO HKPAIlTMI.NT. Heavy w. ami g. blanket* wth I ?i mi. to M l/i i ou " ? ?* " 2 00 Alt Blanketa, Coiuforta, uxl all / lea ?a*d In Houae Kuruialiliig ? ..^ed. WIIA1' HKPABI M* .. Pluah Coat* wurth 2> oo K*)u<*l to ?? 00 '? Ji 00 *? |ft on I'lujth Wrapa 2ft <? *? IS 00 VI W - U 00 Cap<- .Newrnarketi* J.', in ?? lo <?i ?0 00 - ? 0k Ja< keta 4 00 *? 2 40 7 6fl " ft 00 LAIJIEM rUHMHiilNO (KXMm. ladM , Mlw't an<J < hiMrau a L'iMj?rwcar ami Hoaiery Ke<iunn<| p.-r ?*r?t. The aiiov* re|<f fwiiisonir a f<?w of the man y articlea wr ortrr in thl? Mir. It will pay jrou t? vlalt ?xir ?t/>r?' If In ne*d ol ?uy v? int?r ??oud*. li'DEORArm. Haiceralown. Md. NOHCE. To all nartie* iDtlebU-d* t/> Jacob T. Hajrlev, of I>ufficld?i Depot, Jef fersos county, W. Va., by open ac .count, not?? or otherwise : Y'<?C are re?p?rtlolly riH|iie?ted to romi forward and acttle at one*. If not I will I pnwar.1 to eolleet \,y law. All < red 1 tor* of ??Id Hagltjr arc requeateri to yroduec tbolr account*, properly y* " vra ^or^atgl^ TmHi. JEPFB880N 8AVIX08 BANK DIVIDEND NOTICE. AMKMI.A>C(l'ALdlvMend of VA parWnl. on tb? i 'apt i at Htork will be paid Cm and after January 1'Nb. Mat. By order of the Board. . - _ H. P IfARBWOX.OMbler. Jan. I *? . ".
| 13,972 |
https://ceb.wikipedia.org/wiki/Tapinocyba%20corsica
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Tapinocyba corsica
|
https://ceb.wikipedia.org/w/index.php?title=Tapinocyba corsica&action=history
|
Cebuano
|
Spoken
| 55 | 103 |
Kaliwatan sa kaka ang Tapinocyba corsica. Una ning gihulagway ni Simon ni adtong 1884. Ang Tapinocyba corsica sakop sa kahenera nga Tapinocyba, ug kabanay nga Linyphiidae.
Kini nga matang hayop na sabwag sa:
Pransiya
Corse
Walay nalista nga matang nga sama niini.
Ang mga gi basihan niini
Kaka
Kaka sa Pransiya
Kaka sa Corse
Tapinocyba
| 33,949 |
https://ceb.wikipedia.org/wiki/Krueng%20Pandrah
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Krueng Pandrah
|
https://ceb.wikipedia.org/w/index.php?title=Krueng Pandrah&action=history
|
Cebuano
|
Spoken
| 57 | 110 |
Suba ang Krueng Pandrah sa Indonesya. Nahimutang ni sa lalawigan sa Nanggroe Aceh Darussalam Province, sa kasadpang bahin sa nasod, km sa amihanan-kasadpan sa Jakarta ang ulohan sa nasod. Krueng Pandrah nidagayday paingon ngadto sa Kadagatang Indyan.
Ang mga gi basihan niini
Mga suba nidagayday paingon ngadto sa Kadagatang Indyan
Mga suba sa Nanggroe Aceh Darussalam Province
| 32,856 |
https://github.com/kodek-sleuth/Contacts-book/blob/master/app/routes/view.js
|
Github Open Source
|
Open Source
|
MIT
| 2,019 |
Contacts-book
|
kodek-sleuth
|
JavaScript
|
Code
| 23 | 97 |
import express from 'express';
import contactController from '../controllers/contactController';
const router = express.Router();
router.get('/all', contactController.viewAll);
router.get('/view/email', contactController.viewByEmail);
router.get('/view/name', contactController.viewByName);
router.get('/view/:id', contactController.viewById);
export default router;
| 1,438 |
439636_1
|
Caselaw Access Project
|
Open Government
|
Public Domain
| null |
None
|
None
|
Unknown
|
Unknown
| 1,456 | 1,816 |
Per Curiam.
The writ of certiorari in this case brings under review an order of the board of public utility commissioners, dated November 26th, 1924, directing and ordering the Pennsylvania Railroad Company to provide a switch connection for a side track, when constructed on the property of the defendant the Central Transportation Company, from a point where the land of that company joins land owned by the Pennsylvania Railroad Company. The land of the Pennsylvania Railroad Company is now leased and occupied by the prosecutor Robert W. Kennedy. Company for its coal and lumber business- The switch connection is to enable the two defendant companies to receive car load freight on a tract of land desired to be developed for the joint use of the two defendant companies as a car barn, a garage for motor coaches and a material yard.
The Robert W. Kennedy Company procured a writ of certiorari to review the order. The Pennsylvania Railroad Company was admitted and joined as prosecutor with the Robert W. Kennedy Company. Both companies attack the order and file1 six reasons for setting it aside. The reasons are argued under three points in the prosecutors' brief.
Pirst. The board lacked jurisdiction to make the order.
Second. The order, in effect, takes the property of the prosecutors without anjr provision for just compensation.
Third. There was nu evidence to reasonably support the order made by the board.
The statute under which the order was made is an act concerning public utilities (Comp. Stat. of N. J., 1st Supp., p. 1278; Pamph. L. 1911, p. 378, part 2, § 16 E), which provides the board' shall have power; after hearing, upon notice, by order in writing, to direct any railroad engaged in carrying merchandise to construct, maintain and operate, upon reasonable terms, a switch connection with any private side track, which may be constructed by any shipper to connect with the railroad, ox street railway, where, in the judgment of the board, such connection is reasonable and practicable, and can be put in with safety, and will furnish sufficient business to justify the construction and maintenance of the same.
The objection that is urged and argued, however, is not to the validity of the statute under which the order was made. But it is the prosecutor Eobert W. Kennedy Company is in possession of the land over which' the defendants desire to cross with a side track. The interest of the Eobert W. Kennedy Company in -the land was. acquired from the Pennsylvania Eailroad Company bjr a lease dated September 24th', 1923, Exhibit 1, terminable at the will of the Pennsylvania Eailroad Company upon sixty days' notice, and that the Eobert W. Kennedy Company cannot be divested of its rights by the taking of any part of the land now occupied by it, except by condemnation. As the hoard of public utility commissioners has no power under the statute to condemn the interest in the land held by the Eobert W. Kennedy Company, the order of the board is therefore a nullity.
The answer made to this point is, the hoard is not proceeding under any assumed authority to condemn private property, hut is acting under express ^statutory authorization, and, therefore, the order made by it is legal. While it is conceded that the land is the private property of the Pennsylvania Eailroad Company, since it was acquired for its right of way, it is, nevertheless., charged with a public use. It does not under'the statute have the right, to. use the land in any way in which, it may desire to use' it as a private owner of real estate may d0', but may only use it for purposes consistent with the objects for which the railroad company was incorporated.
The Eailroad act (3 Comp. Slat, of N. J., p. 4220, § 3; Pamph,. L. 1903, p. 647, § 3) provides every railroad company shall have power to acquire, from time to time, and hold and use such real estate1 and other property as may, in the judgment of its directors, be necessary to accomplish the objects of its incorporation, and to sell land thus acquired when not necessary for such purposes and objects. So, section 13 limits the1 property which may be acquired by condemnation. So, it may lease or grant, for a short period of time, a part of its property for which it may have no immediate need. Armstrong v."Pennsylvania- Railroad Co38 N. J. L. 4.
While it is true the Pennsylvania Eailroad Company is the absolute owner of the land, the use to which it may be put is greatly restricted, the Pennsylvania Eailroad Company cannot by means of a lease create rights in the lessee, the Eobert W. Kennedy Company, superior to1 the rights which it has itself in the premises under the statute. The railroad company could not, -by means of a lease for. a long or a short -period of time, vest in the Eobert W. Kennedy Company the absolute right to use the land in the conduct of its coal and lumber business without being subject to tbe paramount duty to use tlie land for railroad purposes whenever the need therefor shall arise.
So, the Eobert W. Kennedy Company has always held tbe land subject to such use. The order of the board of public utility commissioners, therefore1, does not divest it of any rights which it formally had, for it merely requires the land shall now be put to that use.
This disposes of the point that the board had no jurisdiction in the premises, and that it was taking the property of the prosecutors without awarding just compensation, for which it had no power. The board, as stated, in making tbe order, was acting under express statutory authority.
The board found from the evidence before it the four conditions of fact to- exist, which justified the board in making the order under the statute, viz.:
1. That it was reasonable.
2. That it was practicable1.
3. That the switch can be put in with safety.
4. When put in it will furnish sufficient business to justify the construction and maintenance of the same.
The act (Pamph. L. 1918, p. 304) provides the order may be reviewed upon certiorari by the Supreme Court; such order may be set aside, in whole or in part, when it clearly appears that there was no evidence before the hoard to1 support reasonably the same, or that the same was without the jurisdiction of the board. The testimony under which the order was made has been returned with the writ of certiorari in the printed book. Our reading of it leads us to the conclusion that there was evidence before the board to support reasonably the order made. Hackensack Water Co. v. Board of Public Utility Commissioners, 95 N. J. L. 295. Hence, we cannot set the order aside for this reason., It would serve no useful purpose to restate the evidence from the printed book.
The two defendant companies attack that part of the order which provides the switch connection for a side track is made, "subject to the condition that petitioners shall bear any reasonable expense incident to the construction of the side track from the siding constructed upon the property of the Central Transportation Company to. the clearance point at the switch connection, and also the expense of any necessary rearrangement of the facilities of the Eobert W. Kennedy Company used by it in the conduct of its business., which facilities are located upon the land leased by it from the Pennsylvania Eailroad Company. If the parties cannot agree as to the reasonable amount of such expense an application may be made to the board to settle that aspect of the matter." These companies obtained a writ of certiorari and were admitted-as co-prosecutors under the writ. They then filed four reasons for setting aside that part of the order attacked by'them. The attack is made upon the grounds.—
First. There was no evidence to support that part of the order.
Second. The board lacked jurisdiction to impose upon the applicants the conditions.
Third. The conditions imposed are unreasonable.
Fourth. It gives to the Robert W. Kennedy Company rights as lessee, which the law of the state does not entitle it to.
It seems quite unnecessary to further follow the argument on this point in detail. The statute provides the order may be made upon reasonable terms; the facts do not seem to' be contradicted.
We think there is no legal merit in the argument on this branch of the case.
The order of the board is therefore affirmed in its entirety, and the writs of certiorari are dismissed, with costs..
| 33,600 |
https://github.com/aliostad/deep-learning-lang-detection/blob/master/data/train/php/71563dd76ff0335c91cfb43383dc9e46a9f83c66ServiceLocatorInterface.php
|
Github Open Source
|
Open Source
|
MIT
| 2,021 |
deep-learning-lang-detection
|
aliostad
|
PHP
|
Code
| 109 | 279 |
<?php
namespace TestBox\Framework\ServiceLocator;
use TestBox\Framework\ServiceLocator\service\ServiceInterface;
interface ServiceLocatorInterface
{
/**
* Add a Service
*
* @param string $key
* @param mixed $service
*/
public function addService($key,ServiceInterface $service);
/**
* Define a service
*
* @param array $options
*/
public function defineService($key, $options);
/**
* Return a service
*
* @param string $key
* @return mixed
*/
public function get($key);
/**
* Create or set an service alias
*/
public function addAlias($aliasKey,$targetKey);
/**
* Cheh if service exists
*
* @param unknown $serviceName
* @return boolean
*/
public function hasService($serviceName);
/**
* Check if service is instantiated
*
* @param string $serviceName
* @return boolean
*/
public function isInstantiated($serviceName);
}
| 37,410 |
https://github.com/HarrisonWei/NetEaseNews/blob/master/网易新闻/网易新闻/Classes/Tools/News.h
|
Github Open Source
|
Open Source
|
MIT
| 2,017 |
NetEaseNews
|
HarrisonWei
|
Objective-C
|
Code
| 58 | 264 |
//
// News.h
// 网易新闻
//
// Created by 曹魏 on 2017/8/6.
// Copyright © 2017年 itcast. All rights reserved.
//
#import <Foundation/Foundation.h>
@interface News : NSObject
//新闻标题
@property (nonatomic,copy)NSString *title;
//新闻来源
@property (nonatomic,copy)NSString *source;
//跟帖数量
@property (nonatomic,assign)int replyCount;
//配图地址
@property (nonatomic,copy)NSString *imgsrc;
//多图数组
@property (nonatomic,strong)NSArray *imgextra;
//是否大图标记.bool默认是yes
@property (nonatomic,assign,getter=isBigImage)BOOL imgType;
//加载指定URL的新闻数组
+ (void)loadNewsListWithURLString:(NSString *)urlString finished:(void(^)(NSArray *newsList))finished;
@end
| 3,731 |
https://openalex.org/W3192291267
|
OpenAlex
|
Open Science
|
CC-By
| 2,021 |
Development of Cold Plasma Technologies for Surface Decontamination of Seed Fungal Pathogens: Present Status and Perspectives
|
Jure Mravlje
|
English
|
Spoken
| 14,370 | 26,156 |
Citation: Mravlje, J.; Regvar, M.;
Vogel-Mikuš, K. Development of
Cold Plasma Technologies for Surface
Decontamination of Seed Fungal
Pathogens: Present Status and
Perspectives. J. Fungi 2021, 7, 650. https://doi.org/10.3390/jof7080650 Keywords: cold plasma; seeds; grains; microorganisms; fungi; agriculture; plant production;
food security Jure Mravlje 1,*
, Marjana Regvar 1
and Katarina Vogel-Mikuš 1,2 1
Biotechnical Faculty, University of Ljubljana, 1000 Ljubljana, Slovenia; [email protected] (M.R.);
[email protected] (K.V.-M.)
2
Jožef Stefan Institute, 1000 Ljubljana, Slovenia
*
Correspondence: [email protected] 1
Biotechnical Faculty, University of Ljubljana, 1000 Ljubljana, Slovenia; [email protected] (M.R.);
[email protected] (K.V.-M.)
2
Jožef Stefan Institute, 1000 Ljubljana, Slovenia
*
Correspondence: [email protected] Abstract: In view of the ever-growing human population and global environmental crisis, new
technologies are emerging in all fields of our life. In the last two decades, the development of
cold plasma (CP) technology has offered a promising and environmentally friendly solution for
addressing global food security problems. Besides many positive effects, such as promoting seed
germination, plant growth, and development, CP can also serve as a surface sterilizing agent. It can
be considered a method for decontamination of microorganisms on the seed surface alternative to
the traditional use of fungicides. This review covers basics of CP technology and its application in
seed decontamination. As this is a relatively young field of research, the data are scarce and hard
to compare due to various plasma setups and parameters. On the other hand, the rapidly growing
research field offers opportunities for novel findings and applications.
Citation: Mravlje, J.; Regvar, M.;
Vogel-Mikuš, K. Development of
Cold Plasma Technologies for Surface
Decontamination of Seed Fungal
Pathogens: Present Status and
Perspectives. J. Fungi 2021, 7, 650. https://doi.org/10.3390/jof7080650
Academic Editors: Antonieta De Cal,
Inmaculada Larena and
Paloma Melgarejo
Received: 23 June 2021
Accepted: 10 August 2021
Published: 11 August 2021 Review
Development of Cold Plasma Technologies for Surface
Decontamination of Seed Fungal Pathogens: Present Status
and Perspectives Jure Mravlje 1,*
, Marjana Regvar 1
and Katarina Vogel-Mikuš 1,2 Fungi
Journal of Fungi
Journal of Fungi
Journal of 1. Introduction According to The Food and Agriculture Organization of the United Nations (FAO)
predictions, the human population will reach almost 10 billion by 2050, making global food
security one of the greatest challenges of our time. It is estimated that the production of
food crops must increase up to 70% to meet the needs of a rapidly growing population [1]. The expansion of food production and economic growth is closely linked to environmental
issues such as deforestation, loss of biodiversity, depleted groundwater resources, and
greenhouse gas emissions, which contribute to climate change [2]. Moreover, the amount
of land available for cultivation is limited and declining due to drought, desertification,
salinization, erosion, etc., so future research activities need to focus on improving and
increasing the efficiency of food production and processing. Academic Editors: Antonieta De Cal,
Inmaculada Larena and
Paloma Melgarejo Publisher’s Note: MDPI stays neutral
with regard to jurisdictional claims in
published maps and institutional affil-
iations. One of the main concerns in most reported foodborne illness outbreaks involves
contaminated cereal grain [3]. Cereal contamination can occur at many stages: postharvest
transport, conditioning, sorting, storage, and packaging [4]. Fungal contamination is a
major safety problem in stored cereals [5], as it not only spoils the grain but also reduces its
cooking or baking quality, lowers its nutritional value, and alters its overall appearance by
causing unwanted odours and colours [6]. Furthermore, some fungi also produce toxic
substances, such as mycotoxins, with aflatoxins (produced by the genus Aspergillus) being
the most toxic [7,8]. For this reason, it is essential to protect crops, seeds, and their food
products from rot and/or pests [5]. Copyright: © 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article
distributed
under
the
terms
and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/). Fungi can infect seeds either in the field or during storage if conditions are favourable. The first group can be classified as preharvest fungi, with major genera Alternaria, Fusarium,
Cladosporium, Rhizopus etc., and the second as postharvest fungi, with genera Aspergillus https://www.mdpi.com/journal/jof J. Fungi 2021, 7, 650. https://doi.org/10.3390/jof7080650 J. Fungi 2021, 7, 650 2 of 18 2 of 18 and Penicillium being predominant [9]. Traditionally, seeds are mainly treated by fungicides,
the most effective and widely used method to prevent and suppress fungal growth [10]. 1. Introduction In the light of reducing the usage of pesticides, which are harmful to
humans and the environment, and with the growing demand for “pesticide-free food”,
in the past century treatments with biopesticides have become popular [10,12]. However,
even these methods are not always effective and have their shortcomings, as some CP
systems are still not cost-effective for mass production. Therefore, additional research in
this field is necessary to achieve environmentally friendly and economically feasible alter-
natives for pest management, which are needed both in pre- and postharvest production. g
g
This review covers the basics of CP technology, emphasizing its use in the field of
agriculture. The main focus is on fungal seed decontamination, covering most studies
performed up to date, with concluding remarks focused on the requirements for further
research in the field. 2. The Basics of Plasma Technology Plasma refers to the fourth state of matter, an ionized gas with unique properties. It is
the most common state of matter in space, since it accounts for more than 99% of the entire
universe [28]. Plasma is defined as a “quasi-neutral” medium with a neutral net charge [25],
but it is electrically conductive (as it contains free charge carriers) and has many properties
that distinguish it from neutral gasses and liquids [28,29]. It consists of electrons, atoms,
ions, radical species, and molecules, such as reactive oxygen species (ROS) and reactive
nitrogen species (RNS), in a fundamental or excited state, together with electromagnetic
radiation (UV photons and visible light). The chemically active species have a pronounced
antimicrobial effect and can be used for surface sterilization [5,28]. 1. Introduction Conventional treatment of seeds also includes different types of physical treatment with
the most common thermal treatment that inactivates the pathogen and leaves the seed
tissue viable [11]. In the light of reducing the usage of pesticides, which are harmful to
humans and the environment, and with the growing demand for “pesticide-free food”,
in the past century treatments with biopesticides have become popular [10,12]. However,
even these methods are not always effective and have their shortcomings, as some CP
systems are still not cost-effective for mass production. Therefore, additional research in
this field is necessary to achieve environmentally friendly and economically feasible alter-
natives for pest management, which are needed both in pre- and postharvest production. The emerging use of CP technology offers promising solutions for the inactivation and
elimination of fungi and their toxins. As a form of “non-thermal” processing technology,
where the treated objects are not exposed to excessive heat treatment, exposure to cold
plasma minimizes the impact on the quality and nutritional value of the products, while
maintaining high quality and additive-free products [5]. Over the last 20 years of research
in the field of plasma agriculture, numerous studies have shown that treatment with CP can
have a positive effect on seeds by improving the germination capacity, seed vigour, growth,
and overall performance of plants grown from plasma pre-treated seeds [13–22]. It has also
been found that plasma treatment causes microbial inactivation, thereby suppressing the
growth of bacterial and fungal pathogens responsible for various plant diseases [4–6,23–26]. In this perspective, CP technology could be a successful tool for improving seed quality by
promoting germination and surface decontamination for seeds (plant embryonic structure
for reproduction; in agriculture used for sowing and plant breeding) and grains (plant seeds
used as a food source for human or animal consumption). The importance of plasma tech-
nology has also increased in recent years in the food industry, as it appears to offer many
new applications, i.e., opportunities for new ‘in-package’ food technologies [23,25,27]. and Penicillium being predominant [9]. Traditionally, seeds are mainly treated by fungicides,
the most effective and widely used method to prevent and suppress fungal growth [10]. Conventional treatment of seeds also includes different types of physical treatment with
the most common thermal treatment that inactivates the pathogen and leaves the seed
tissue viable [11]. 2.1.1. Electrically Induced Plasmas Electrically-induced plasma is generated by electric breakdown and is the most widely
used method of generating plasma in the presence of an electric field [30]. Although
gases are electrically neutral and act as insulators that do not conduct electricity, there is
always a certain amount of stray charges in neutral gases. These are crucial in electrical
discharges, as they can be accelerated to high energy to excite the gas molecules (by
applying an electric field) and produce ionizing shocks, and hence, new charged particles. An electric discharge with DC or AC as a power source can be used to generate this type of
plasma. The most common types of DC discharges are corona discharge (when the current
range is 10−7–10−5 A), glow discharge (current range 10−5–1 A), and arc discharge (when
the applied current is bigger than 1 A) [31]. The best known and most commonly used
AC discharge, with the advantage of operating at atmospheric pressure, is the dielectric
barrier discharge (DBD), in which the two electrodes are covered by an insulating dielectric
barrier [32]. 2.1. Generation of Plasma Plasma is created by applying energy to gas, inducing the formation of ions (charge
carriers). Ionization is achieved by supplying thermal energy or applying electric current
or electromagnetic radiation [30]. Plasmas can be classified according to the type of energy
input, defining the plasma in terms of electronic density and temperature [28]. Depending on the conditions of generation, two plasma categories can be defined,
based on the relative energy levels of light (electrons, photons) and heavy particles (ions,
molecules) in the plasma [26]. The first group is the so-called “local thermodynamic
equilibrium” (LTE) or “thermal” plasma, which has a high electron density and an electron
temperature almost equal to the temperature of the heavy particles. The second group is
“non-local thermodynamic equilibrium” (non-LTE) or “cold” plasma (CP), which has a J. Fungi 2021, 7, 650 3 of 18 3 of 18 lower electron density and a lower temperature because the temperature of heavy particles
is much lower than the temperature of the electrons [28]. CP is generally referred to as
“low-temperature plasma” (LTP) or “non-thermal plasma” (NTP). This can be further
divided into quasi-equilibrium plasma (with a temperature around 100–150 ◦C) and non-
equilibrium plasma (with a temperature below 60 ◦C). The latter is particularly interesting
from a biological point of view, because it can be used to treat living matter without causing
thermal damage. CP can be generated at atmospheric or reduced pressure and requires
less energy compared to LTE. It can be generated by electric discharge with direct (DC) or
alternating current (AC) (with frequencies up to 100 kHz), radio frequency (RF) discharge
(with frequencies of 100 kHz–100 MHz), or microwave (MW) discharge (with frequencies
above 100 MHz) [5,28]. 2.2. Plasma Treatment Modes Biological samples can be exposed to plasma treatment in two different ways: The
first is “direct exposure”, where the treated sample is in direct contact with the plasma and
thus exposed to all agents generated by the plasma (the UV radiation and all the plasma
particles formed in plasma). The second is “indirect exposure”, where the treated sample is
placed at a distance or in an adjacent chamber, reducing the amount of heat and preventing
many reactive species and charged particles from reaching the sample [34]. Thus, it is not
exposed to UV radiation and is affected only by lower concentrations of long-lived plasma
species, such as ions, ROS, and RNS [35]. Indirect CP treatment can also be achieved via
treatment of seeds with plasma-activated liquids, such as plasma-activated water [36] or
plasma-activated sodium chloride [37]. As indirect CP treatment is usually weaker, longer
treatment times are needed to obtain similar effects as in direct treatment mode [38]. 2.1.2. Radio Frequency (RF) Induced Plasmas During RF discharge, the electrons move back and forth between the electrodes as
the field changes direction. This allows a more uniform plasma to be formed. Two types
of electrical configuration can be used: capacitively coupled (CC) or inductively coupled
(IC). The latter can be carried out as an “electrodeless discharge”, since the electrodes
can be placed outside the plasma chamber, thus eliminating contamination of plasma by
the electrode materials [31]. An example of RF-generated plasma system is presented
in Figure 1. W Figure 1. A schematic presentation of a RF-generated low-pressure CP system (adap
et al. 2021 [33]). Figure 1. A schematic presentation of a RF-generated low-pressure CP system (adapted by
Mravlje et al. 2021 [33]). Figure 1. A schematic presentation of a RF-generated low-pressure CP system (adap
et al 2021 [33])
Figure 1. A schematic presentation of a RF-generated low-pressure CP system (adapted by
Mravlje et al. 2021 [33]). J. Fungi 2021, 7, 650 4 of 18 2.1.3. Microwave (MW) Induced Plasmas 2.1.3. Microwave (MW) Induced Plasmas The main difference between MW and other types of discharges is that the electrons
absorb the microwave energy collectively (and not individually as in DC or RF) and convert
it directly into kinetic energy [31]. Both RF and MW discharges are generated and sustained
by high-frequency electromagnetic fields [30]. 3. Applications of Plasma Technology CP technology is applied in many different areas of science and technology, including
some of our everyday equipment. One of the most well-known applications is in electronics,
as used in plasma television (and other display panels) and lighting systems. It is also
used in materials science for design and processing of textiles and polymers, and more
recently in the synthesis of nanoparticles. Some other areas where cold plasma technology
is used also include analytical chemistry (spectroscopic analyses), alternative methods of
cleaning (e.g., waste water treatment or soil remediation), and ozone generation. Over
the last decade, the use of CP technology in life sciences such as biology, agriculture, food
science, and medicine has increased rapidly, creating promising multidisciplinary research
areas [5]. 3.1. Cold Plasma in Agriculture CP technology seems to be a promising and efficient green technology to improve
productivity throughout the food cycle without compromising food quality and safety [39]. Various studies confirmed that CP treatment promotes seed germination, growth, and
development in many plant species [22,40–44]. Positive effects of CP treatment on germi-
nation rate and/or development and growth have been reported for many economically
important agricultural crops such as wheat [14,43,45–49], maize [50,51], soybean [52,53],
rice [54], tomato [55–58], radish [22,59], bean [14,60], barley [20], rapeseed [61], grape [62],
mung beans [15], safflower [40], and quinoa [16]. g
[
],
[
],
q
[
]
Approaches or techniques that improve seed germination and enhance the growth and
overall performance of crops by mitigating soil and environmental stress and/or directly
affecting the seed growth process are referred to as “seed priming” techniques [60,63]. The
reduction of abiotic stress is often related to the optimization of the seed growth process
by altering the availability of water and oxygen in the soil. Seed CP treatment could be
considered as one of the seed-priming techniques. It can give different results depending
on the plant species studied and the type of gas used for plasma generation [64]. The possible mechanisms of CP treatment on seed germination and growth in-
clude: changes in the wetting properties by reducing the contact angle due to surface
oxidation [14,65]; stimulation of caryopsis by surface erosion [43]; changes in antioxidant
activity such as the production of reduction-type thiol compounds [66]; reduction of ab-
scisic acid content [67]; and changes in other endogenous plant hormones such as auxins,
cytokinins, and gibberellins [22,68], all of which are involved in the promotion of plant
growth. In short, CP influences seed germination and growth by alternating their physiolog- J. Fungi 2021, 7, 650 5 of 18 ical and biochemical properties. In addition to the direct plasma treatment, it has recently
been shown that the use of plasma-activated water can increase plant growth [47,58,69]
and enhance the effect of chemical fertilizers [69]. Apart from beneficial action on seed germination and plant growth and develop-
ment, one of the outstanding effects of plasma treatment is the sterilization of the seed
surface [6,70,71]. Free radicals and reactive oxygen species generated by CP induce bac-
tericidal and fungicidal effects, increasing the overall benefit of the CP technology [39]. 3.2. Cold Plasma for Seed Decontamination Currently, CP treatments are widely used to activate and achieve desired surface
changes of various materials and to decontaminate different kinds of surfaces, especially
sensitive biomaterials [18,73]. In the last 20 years, the potential of plasma technology for
elimination of biological contaminants has been increasingly investigated, since already
the first studies indicated that plasma tends to have very efficient germicidal properties
with many advantages over conventional sterilization methods and can therefore be an
effective decontamination agent [34,74]. The optimal decontamination time to achieve
sterilization depends on several factors: the type or species of microorganisms, the sur-
rounding medium, the power density of the plasma, and the type of gas used to generate
the plasma [74]. In this perspective, a new field of research has emerged that requires the
collaboration of scientists from different disciplines, such as plasma physicists, biologists,
microbiologists, and biochemists. g
One of the major issues in agriculture is poorly germinating seeds. Besides physiolog-
ical traits including primary and secondary seed dormancy [75,76], some of the reasons
for low germination rates of various plant seeds are epiphytic and phytopathogenic bac-
teria and filamentous fungi that contaminate seeds [18]. It has been shown that plasma
treatment is an efficient sterilizing agent that can inhibit or kill a wide range of microor-
ganisms on the surface of seeds and stored grains and can thus be used to decontaminate
seeds [4–6,23–26,64,70,71,77,78]. Most studies conducted to date have focused on the microbial inactivation or steril-
ization efficiency of CP on different bacterial species. However, to assess the efficiency of
plasma sterilization, the most resistant microorganisms should be tested [72]. Bacterial en-
dospores and fungi with thick cell walls seem to be the object of interest. It is essential that
all possible biological effects that can be caused by plasma are studied in detail and well
characterized before CP is accepted as an alternative approach to conventional sterilization
methods [26]. It is important to optimize the decontamination process to successfully
achieve the elimination of the target microorganisms [5]. We have already mentioned that
fungal contamination of stored seeds and cereals is considered an important safety issue,
therefore, it is crucial to suppress fungal growth. CP technology offers a promising solution
for inhibition of fungal growth (Figure 2), as discussed in the following section. 3.1. Cold Plasma in Agriculture The use of CP as a sterilizing agent is an alternative to conventional sterilization methods
involving various fungicides, being safe both for the operator and the subjects exposed
to the plasma, if the operating conditions and set up is optimal, and environmentally
friendly [72]. Moreover, CP treatment can also be used to remove harmful chemicals such
as fungicides and other pesticides from the surface of long-stored seeds [64]. However,
if seeds are intended for further sowing (preharvest CP treatment), their germination
parameters must stay unimpaired. 3.2. Cold Plasma for Seed Decontamination Most of the commercially used seeds are infected during storage with fungi of various
genera such as Alternaria, Aspergillus, Botrytis, Mucor, Penicillium, Rhizopus, Sclerotinia,
and Trichoderma [50,79]. It is known that more than 25 different fungal species infect
stored grains and legumes [80], with species of the genera Aspergillus and Penicillium being
responsible for most damage during storage and germination worldwide [6]. Filamentous
fungi occur everywhere in nature and pose a potential threat to humans and economically
important plant and animal species, as they can contaminate food at various stages of
production when temperature and humidity conditions are favourable [81]. The lack of J. Fungi 2021, 7, 650 6 of 18
steri-
e efficient and consistent seed disinfection methods is the main reason for sprout-associated
outbreaks with seed-associated microbiota being the primary source of their origin [79]. that fungal contamination of stored seeds and cereals is considered an important safety
issue, therefore, it is crucial to suppress fungal growth. CP technology offers a promising
solution for inhibition of fungal growth (Figure 2), as discussed in the following section. efficient and consistent seed disinfection methods is the main reason for sprout-associated
outbreaks with seed-associated microbiota being the primary source of their origin [79]. that fungal contamination of stored seeds and cereals is considered an important safety
issue, therefore, it is crucial to suppress fungal growth. CP technology offers a promising
solution for inhibition of fungal growth (Figure 2), as discussed in the following section. Figure 2. Decontamination of naturally occurring fungi on common buckwheat seeds (Fagopyrum
esculentum Moench) using radio-frequency-generated LP oxygen CP. Fungal growth after 1 week of
cultivation on PDA growth medium is shown [33]. Figure 2. Decontamination of naturally occurring fungi on common buckwheat seeds (Fagopyrum
esculentum Moench) using radio-frequency-generated LP oxygen CP. Fungal growth after 1 week of
cultivation on PDA growth medium is shown [33]. Figure 2. Decontamination of naturally occurring fungi on common buckwheat seeds (Fagopyrum
esculentum Moench) using radio-frequency-generated LP oxygen CP. Fungal growth after 1 week of
cultivation on PDA growth medium is shown [33]. Figure 2. Decontamination of naturally occurring fungi on common buckwheat seeds (Fagopyrum
esculentum Moench) using radio-frequency-generated LP oxygen CP. Fungal growth after 1 week of
cultivation on PDA growth medium is shown [33]. 3.2. Cold Plasma for Seed Decontamination Most of the commercially used seeds are infected during storage with fungi of vari-
ous genera such as Alternaria, Aspergillus, Botrytis, Mucor, Penicillium, Rhizopus, Sclerotinia,
and Trichoderma [50,79]. It is known that more than 25 different fungal species infect stored
grains and legumes [80], with species of the genera Aspergillus and Penicillium being re-
sponsible for most damage during storage and germination worldwide [6]. Filamentous
fungi occur everywhere in nature and pose a potential threat to humans and economically
important plant and animal species, as they can contaminate food at various stages of
production when temperature and humidity conditions are favourable [81]. The lack of
efficient and consistent seed disinfection methods is the main reason for sprout-associated
outbreaks with seed associated microbiota being the primary source of their origin [79]
Fungal species of the genus Fusarium, and in particular their mycotoxins, are known
to be one of the most important contaminants and as such a major problem in grain
and fruit production [5]. Mycotoxins of Aspergillus flavus can be very harmful, causing
haemorrhage and carcinogenesis [82]. New technologies are needed to reduce or prevent
fungal growth without compromising germination and posing safety issues. As CP is
considered to have good bactericidal and fungicidal effects on seeds when experimental
conditions, variable from species to species, are optimal [50], it could provide an alternative
for fungal decontamination of seeds. In Table 1, a review of studies in the field of seed
decontamination with both AP and LP CP is shown. outbreaks with seed associated microbiota being the primary source of their origin [79]. Fungal species of the genus Fusarium, and in particular their mycotoxins, are know
to be one of the most important contaminants and as such a major problem in grain an
fruit production [5]. Mycotoxins of Aspergillus flavus can be very harmful, causing haem
orrhage and carcinogenesis [82]. New technologies are needed to reduce or prevent funga
growth without compromising germination and posing safety issues. As CP is considere
Table 1. An overview of experiments studying the effects of cold plasma on fungal decontamination in various plant species. AI: Artificially infected. NO: naturally occurring. CP: cold plasma. LP: low-pressure. AP: atmospheric-pressure. SMD:
Surface micro-discharge. FB: fluidized bed. DCSBD: Diffuse Coplanar Surface Barrier Discharge. RF CC: radio-frequency
capacitively coupled. (S)DBD: (Surface) Dielectric Barrier Discharge. CDPJ: Corona Discharge Plasma Jet. P: power. F:
frequency. V: voltage. SPD: surface power density. 3.2. Cold Plasma for Seed Decontamination PVD: power volume density. TT: treatment time. NT: not tested. g
p
g g
p
g
y
to have good bactericidal and fungicidal effects on seeds when experimental conditions,
variable from species to species, are optimal [50], it could provide an alternative for fungal
decontamination of seeds. In Table 1, a review of studies in the field of seed decontami-
nation with both AP and LP CP is shown. Fungal
Species
Seed Type
Plasma Source
and Properties
Gas Type and
Exposure Time
Key Findings
% of
Germination
Ref. AI Aspergillus
spp. and
Penicillum
spp. Tomato (Lycopersicon esculentum),
wheat (Triticum durum), bean
(Phaseolus vulgaris), chick pea
(Cicer arietinum), soybean
(Glycine max) barley (Hordeum
vulgare), oat (Avena sativa), rye
(Secale cereal), lentil (Lens
culinaris), and corn (Zea mays)
LP CP
(500 mTorr);
‘ P: 300 W;
F: 1 kHz;
V: 20 kV
Air gas and SF6;
5–20 min
Significant
reduction to
below 1% of
initial fungal load
No significant
effect on wheat
and bean seeds
[6]
AI Aspergillus
parasiticus
Hazelnuts (Corylus avellane),
peanuts (Arachis hypogaea) and
pistachio nuts (Pistacia vera)
LP CP
(500 mTorr);
P: 300 W;
F: 1 kHz;
V: 20 kV
Air gas and SF6;
1–20 min
Air plasma 1-log
reduction of
initial load, SF6
plasma more
effective with app. 5-log decrease
(after 5 min TT)
NT
[70]
NO
microbiota
Chickpea (Cicer arietinum)
AP SMD CP;
SPD: 10 mW/cm2;
V: 5–17 kV
Ambient air;
0.5–5 min
Significant
reduction of
1–2 log of
microbial
contamination
Increased up to 3
min TT
[4] J. Fungi 2021, 7, 650 7 of 18 Table 1. Cont. Fungal
Species
Seed Type
Plasma Source
and Properties
Gas Type and
Exposure Time
Key Findings
% of
Germination
Ref. AI Aspergillus
flavus and A. parasiticus
Hazelnuts (Corylus avellane)
AP FB CP;
P: 460–655 W;
F: 25 kHz;
V: 5–10 kV
Air gas and N2;
1–5 min
Significant
reduction of app. 4-log (CFU/g)
after 5 min of air
gas plasma TT
NT
[83,84]
AI Fusarium
circinatum
(pine pest)
Pine (Pinus radiata)
AP DCSBD CP;
F: 14 kHz;
V: 10 kV
Air gas; 5–300 s
Reduction of
seedborne
pathogens
(14–100%)
No
significant effect
[85]
NO
microbiota
and AI
Fusarium
nivale, F. culmorum,
Trichothecium
roseum, A. flavus, A. 3.2. Cold Plasma for Seed Decontamination clavatus
Wheat (Triticum aestivum)
AP DCSBD CP;
PVD: 100 W/cm3;
P: 400 W
Ambient air;
10–600 s for
NO microflora;
1–300 s for AI
fungi-
infected seeds
Increased
inhibition of
microflora with
increased
treatment time;
Total devitaliza-
tion of NO
filamentous fungi
after 120 s TT
Increased up to
40 s TT, then
decreased
[18]
NO
microbiota
and AI A. flavus,
Alternaria
alternata, F. culmorum
Maize (Zea mays)
AP DCSBD CP;
PVD: 80 W/cm3;
P: 400 W
Ambient air;
60–300 s
Total
devitalization of
NO bacteria after
60 s and NO
fungi 180 s TT
No significant
effect up to 120 s
TT,
then decreased
[51]
NO fungi
(Fusarium,
Alternaria,
Stemphylium)
Wheat (Triticum aestivum),
spring barley (Hordeum vulgare),
blue lupine (Lupinus
angustifolius), soy (Glycine soja),
and field pea (Pisum arvense)
AP RF CC CP;
PVD: 0.6 W/cm3;
F: 5.28 MHz
Air gas; 2–20 min
Reduction of
fungal infection;
the most effective
TT at 10 and
15 min
Little
enhancement in
blue lupine and
field pea
[86]
NO fungal
microbiota
Wheat (Triticum aestivum)
AP CP;
F: 100 Hz–83 kHz;
V: 8 kV
Air gas; 3–30 s
Reduction of
fungal colonies
on wheat grains
at the optimum
10 s TT
No
significant effect
[87]
NO
microbiota
Sweet basil (Ocimum basilicum)
AP SDBD CP;
SPD: 80 mW/cm2;
F: 5 kHz
Humid air;
10–600 s
Significant
decrease in
microbial load
(up to 50% in
300 s TT)
No
significant effect
[88]
NO
microbiota
(molds and
yeasts)
Rapeseed (Brasica napus)
AP CDPJ CP;
F: 58 kHz
V: 20 kV, 58 kHz
Air gas; 0.5–3 min
Reduction by
2-log units
compared to
initial count
Positive effect up
to 1 min TT
[61]
NO bacteria
and fungi
Ginseng (Panax ginseng)
AP DBD;
F: 60 Hz;
V: 120 V
Ar and Ar/O2
mixture (80:20);
10 min each day,
3 days in a row
Ar/O2 plasma
mixture had
better bactericidal
and
fungicidal effect
Positive effect in
both mixtures
[89]
NO fungi
(molds and
yeasts)
Common buckwheat
(Fagopyrum esculentum) and
Tartary buckwheat (F. 3.2. Cold Plasma for Seed Decontamination It was shown for the
first time that AP CP had a decontamination effect on natural microbiota adhering to the
surface of seeds, as a significant reduction of microbial contamination was observed. In
addition to the time of AP CP treatment, the effectiveness of microbial inactivation was
strongly related to the size and shape of the seeds, with various structures (wrinkles, cracks)
on the seed surface forming a barrier and thus having an effect on the decontamination
efficacy of the microflora [90,91]. Uniform exposure of the entire seed surface to plasma
could be ensured by shaking the seed sample during plasma treatment [4]. In two consecutive studies, the effects of AP fluidized bed (FP) CP system treatment
on the effectiveness of surface decontamination of two aflatoxigenic Aspergillus species
on hazelnuts were studied. The air-gas plasma was more effective in reducing fungal
decontamination than nitrogen plasma, with a 5 min exposure to air plasma resulting in
a reduction of the initial fungal load in both species by about 4-log (CFU/g). It was also
found out that a 2 min plasma exposure resulted in a complete inactivation of the naturally
occurring hazelnut microbiota. The AP FB CP system was proposed as a convenient
solution for large-scale applications due to its low cost and operational feasibility [83,84]. g
pp
p
y
Effects of AP CP generated by Diffuse Coplanar Surface Barrier Discharge (DCSBD)
on wheat germination rate, seedling growth, and inactivation of surface microflora were
also studied [18]. DCSBD has been used due to its robustness, safety and applicability in
wet and dusty environments, being a good candidate for possible large-scale industrial
use. A complete devitalization of the initial count of naturally occurring filamentous fungi
occurred during 120 s AP CP treatment of wheat seeds. In the case of artificially infected
wheat seeds, representatives of the genus Fusarium spp. were most sensitive to AP CP
treatment, as complete growth inhibition was observed after a 60 s plasma treatment. Complete inhibition of the epiphytic fungus Trichothecium roseum was observed after a
180-s plasma treatment, while species of the genus Aspergillus proved to be more resistant. A. flavus was completely inhibited after 240 s exposure, while complete devitalization of A. clavatus was not observed even at the highest plasma treatment of 300 s. In a further study, the effects of DCSBD AP CP treatment on maize seeds were investi-
gated [51]. 3.2. Cold Plasma for Seed Decontamination tataricum)
LP RF CP (50 Pa);
P: 1400 W;
F: 27.12 MHz
Pure O2 plasma;
30–120 s
Reduction of
seedborne fungi
to below 50% of
control after 120 s
No significant
effect up to
45 s TT,
then decreased
[33]
In one of the first studies, the inactivation efficacy of LP CP treatment for two
pathogenic fungi (from the genera Aspergillus and Penicililum) on the surface of various Table 1. Cont. In one of the first studies, the inactivation efficacy of LP CP treatment for two
pathogenic fungi (from the genera Aspergillus and Penicililum) on the surface of various
artificially fungal-infected seeds was investigated. It was found that plasma treatment,
either with air gas or sulfur hexafluoride (SF6), successfully reduced fungal contamination
to levels of less than 1% of the initial fungal load without affecting the germination rate J. Fungi 2021, 7, 650 8 of 18 8 of 18 or the quality of the seeds. The best efficacy was achieved with a 15 min exposure to SF6
plasma, with a significant reduction of 3-log * units for both fungal species. (* Log reduction
is a measure of how thoroughly a decontamination process reduces the concentration of a
contaminant. It is defined as the common logarithm of the ratio of the levels of contam-
ination before and after the process, so an increment of 1 corresponds to a reduction in
concentration by a factor of 10). Plasma treatment was confirmed as a fast and functional
decontamination method to eliminate aflatoxin-producing fungi from the seed surface [6]. Similar plasma treatment properties (LP CP, air gas or SF6 plasma) were used to
investigate the effect of LP CP treatment on the elimination of Aspergillus parasiticus from
the surface of various nuts. A significant reduction in initial fungal load was observed,
as a 5-min air-gas plasma exposure resulted in a reduction of 1-log (and a further 5 min
exposure reduced the fungal load for a further 1-log). Again, SF6 plasma proved more
effective, resulting in a 5-log reduction of initial fungal load after 5 min plasma exposure. Plasma treatment was found very efficient in aflatoxin reduction. Interestingly, here the
air-gas plasma was more effective than SF6, since a 50% reduction of aflatoxin was observed
after 20 min of exposure [70]. p
AP CP was used for decontamination of Cicer arietinum seeds [4]. 3.2. Cold Plasma for Seed Decontamination The effectiveness of plasma treatment in decontaminating native microbiota
and seeds infected with some phytopathogenic fungal species was evaluated. A higher
proportion of contaminants of surface microorganisms belonged to filamentous fungi,
with the genera Aspergillus, Fusarium, and Penicillium being the most abundant. The total
devitalization of the initial count of naturally occurring filamentous fungi was observed
at 180 s plasma exposure, which is comparable to earlier studies on wheat seeds. Of the
artificially fungus-infected seeds, Fusarium culmorum was again recognized as the most
sensitive species, since already a 60 s plasma irradiation led to complete devitalization. On
the other hand, complete devitalization of both Aspergillus species was observed after a J. Fungi 2021, 7, 650 9 of 18 9 of 18 300 s plasma exposure (whereas 120-s exposure led to a reduction of 1-log CFU/g of seeds
of both species). In addition, no significant changes in the germination rate compared to
the control were observed in the 60- and 120-s plasma exposures, whereas the 60-s plasma
exposure increased the seedling’s vigour by as much as 23%. DCSBD AP CP was used to disinfect pine seeds contaminated with the fungus Fusar-
ium circinatum, a known quarantine pest of trees, infecting also many species of pine trees. A significant reduction of the fungal pathogen (even complete inactivation at higher ex-
posures) was observed, but unfortunately, the germination rate of pine seeds was also
reduced at all plasma exposures, with seeds exposed for more than 60 s not germinating at
all [85]. Some studies focused on the effects of CP treatment on naturally occurring fungal
microbiota. One of the first studies investigated the fungicidal effects of AP plasma
treatment on seeds of some economically important crops and legumes [86]. Here, 10 and
15-min CP treatments were the most effective in reducing fungal infection (by 6–14% of
the initial fungal load) and enhancing seed germination. Results were comparable to those
obtained with chemical fungicide pre-treatments of seeds. In a study focusing on the effects of AP CP on native fungal colonies of winter
wheat [87], the optimal exposure, where the best reduction of fungal colonies was observed,
was 10-s plasma exposure. SBDB AP CP treatment was also used to remove the native
microbial contamination in sweet basil (Ocimum basilicum) [88]. The plasma treatment sig-
nificantly reduced fungal contamination, especially during the longest exposure. 3.2. Cold Plasma for Seed Decontamination Alternaria
was the most common (82%) out of nine different isolated fungal genera naturally occurring
on sweet basil seeds. AP CP generated by corona discharge plasma jet (CPDJ) was used for
microbial decontamination of rapeseed seeds [61]. All microorganisms tested (including
various bacterial species, yeasts, and molds) were reduced in the range of 1.2–2.2 log
CFU/g after 3 min of treatment with CDPJ. Plasma treatment up to 2 min also resulted in
an improved germination rate and increased seedling growth. In all the above-mentioned
research, air was used as a feeding gas for plasma generation. In a recently published work, the effect of AP DBD CP of argon and argon/oxygen
mixture on decontamination of ginsengs seeds was studied [89]. With the mixture, better
fungicidal effects were achieved than with pure argon gas. Recently, LP RF-generated
oxygen CP was first used to treat naturally contaminated seeds of common and Tartary
buckwheat [33]. A significant reduction of seed-borne fungi (to less than 50% of control)
and changes in their diversity were achieved after the longest (120 s) CP treatment. How-
ever, longer CP treatment also negatively affected germination, so the treatment could be
applicable in grain production (postharvest), but not for sowing. 3.3.1. Effects of Reduced or Low-Pressure Plasmas (LPP) Moisan et al., 2001 [72] were among the first to conduct detailed studies on the effects
of LP plasma on bacteria. They found that the presence of certain reactive species and UV
emitters in the gas is strongly dependent on the pressure of the operating system. They
concluded that UV photons play a key role in microbial inactivation of plasma generated
at medium and low pressure (≤10 torr). In contrast, during operation at higher pressures
up to atmospheric pressure, a large proportion of the UV photons can be reabsorbed by the
ambient gas in the plasma, so that they cannot penetrate the samples and act as sterilizing
agents. The authors proposed a mechanism of plasma sterilization in an oxygen-containing
operating system with reduced pressure, consisting of three basic processes: 1. Inactivation of the genetic material by UV radiation: direct destruction of the genetic
material of microorganisms by UV radiation (a statistical process requiring a sufficient
number of DNA strand lesions). 2. Intrinsic photodesorption (photon-induced desorption): In this process, UV photons
break chemical bonds in microorganisms, resulting in atom-by-atom erosion of the
microorganisms and the formation of intrinsic small volatile molecules (such as CO
and CHx) as by-products. y p
3. Etching: a result of the adsorption of reactive species from the plasma onto the surface
of microorganisms, resulting in the formation of small volatile compounds (CO2,
H2O). This mechanism can be enhanced by UV photons (“UV-induced etching”),
acting synergistically with reactive species and even accelerating the elimination
rate of the microorganisms. In the absence of reactive species (e.g., O-atoms), only
the initial erosion process (intrinsic photodesorption) can take place, so that a much
longer time is required for sterilization (Adapted from [72]). In medium and LPP systems, the most important inactivation mechanism is DNA
destruction by UV irradiation, followed by erosion of microbial material by intrinsic pho-
todesorption and etching with reactive species, possibly enhanced by UV photons [72,94]. Hence, UV radiation makes a significant contribution to sterilization in LPP. The biological
action behind this is well known: UV radiation induces the formation of thymine dimers
in DNA, inhibiting its ability to replicate [93]. 3.3. Molecular Mechanisms behind Microbial Decontamination Plasma type and its properties are crucial for efficient seed sterilization [78]. In
contrast to conventional sterilization methods, CP sterilization results in non-linear shapes
of survival curves, indicating that CP sterilization is a very complex process in which
many factors influence the kinetics of microbial inactivation [92]. CP sterilization can be
carried out both in the glow (direct exposure) and afterglow (indirect exposure) regions
of the plasma, the former leading to shorter sterilization times and the latter being safer,
easier, and cheaper to handle [72]. CP is a highly effective method for inactivation of
microorganisms, since antimicrobial agents generated by CP attack many cellular targets
so that the development of resistance mechanisms is very unlikely or only possible to a
limited extent. The influence of heat during CP treatment is minimal, if not negligible, as it
is assumed that the temperature of the sample remains close to the ambient temperature
or in any case below the value that could cause thermal damage to the cells, as ions and
neutral molecules in the plasma remain relatively cold [34,93]. There is a general agreement that plasma-generated reactive agents trigger a complex
sequence of different biological interactions in microorganisms, with reactive species
playing an important role in antimicrobial efficacy [5]. However, different studies have J. Fungi 2021, 7, 650 10 of 18 drawn various conclusions about the main antimicrobial agents present in plasma that
cause inactivation of microorganisms, with the operating pressure at which CP is generated
being recognized as one of the main factors determining the predominant antimicrobial
mechanisms. Most of the research on molecular mechanisms governing sterilization was
performed on bacteria, but it is agreed that similar processes take place in fungi. 3.3.2. Effects of Atmospheric-Pressure Plasmas (APP) 3.3.2. Effects of Atmospheric-Pressure Plasmas (APP) In contrast to plasma systems with reduced pressure, the UV photons in atmospheric
or high-pressure plasma systems have not been attributed a significant role in the steril-
ization process [5,92]. This is because the gas mixtures used in APP systems do not emit
a sufficient dose of UV radiation at the germicidal wavelengths, while shorter generated
wavelengths do not penetrate depth enough to cause lethal damage to microorganisms [93]. Compared to LPP, sterilization with APP is characterized by more sophisticated mecha-
nisms and kinetics, namely the gas-phase collisions, which take place at higher pressure
and produce a wider range of active species involved in the sterilization process [102]. The energies of electrons are much higher than those of heavy particles (ions, neutrals),
and these electrons collide with atoms and molecules, resulting in an increased degree of
dissociation, excitation, and ionization of molecules [34]. In high-pressure plasma, the resulting reactive species play an important role in mi-
crobial inactivation. It is assumed that different reactive oxygen species (ROS) and reactive
nitrogen species (RNS), such as atomic oxygen (O), metastable oxygen (O2*), superoxide
(O2−), ozone (O3), hydroxyl radical (OH−), hydrogen peroxide (H2O2), nitride oxide (NO),
and nitride dioxide (NO2) play a key role in the sterilization process [34,74,78,93,102–107]. Oxygen-containing plasma mixtures were shown to have a particularly increased
germicidal effect [108–110]. One of the first and most comprehensive studies investigated
bacterial spore (from genus Bacillus) inactivation by AP DBD in two different gas mixtures:
pure helium and a mixture of 97% helium and 3% oxygen. After 10 min of plasma treatment,
the survival rate of the spores treated with pure helium was about 70%, while a much
higher killing rate was observed in the helium/oxygen mixture, with less than 10% of the
spores surviving. This large difference in inactivation efficacy can thus be attributed to the
presence of a variety of reactive oxygen species that are generated in the plasma (such as O
and O3) when oxygen is added to the gas mixture [111]. A major role in the inactivation
process of Aspergillus oryzae and Penicillium digitatum was attributed to atomic oxygen,
resulting in morphological changes in fungal hyphae [112]. Morphological damages of
fungal structures were also reported in a study where Aspergillus flavus cells were treated
with RF plasma jet, resulting in cell leakage and lower viability [113]. 3.3.1. Effects of Reduced or Low-Pressure Plasmas (LPP) A decisive weakness of this type of plasma
sterilization is that the penetration of UV photons is limited and the inactivation efficiency
thus depends on the thickness of the material (microorganisms): UV photons must reach
the DNA in the cells in order to effectively destroy it [94]. The primary role of UV photons
in microbial inactivation in LPP was confirmed by other authors [95–100]. However, dif-
ferent research groups have observed large differences in sterilization kinetics (shapes of
survival curves) in LPP sterilization techniques, which suggests that there are different
mechanisms responsible for sterilization, probably due to different conditions of plasma
generation [92]. Also, when considering the antimicrobial efficacy of the LPP system, the
vast majority of experiments was performed on bacterial cells and spores. However it has
been proposed that fungi could be more resistant to external stress (such as UV) due to a
protective layer of pigment melanin in their cell walls [101]. Although LPP have brought a significant improvement over traditional sterilization
methods, they still have some shortcomings, such as the need for vacuum, long processing
times, high costs, and the need for batch processing [92]. For this reason, studies in recent
years have focused mainly on research of atmospheric pressure (AP) plasmas, where
disadvantages of LPP are overcome and work at much higher pressures is enabled. J. Fungi 2021, 7, 650 11 of 18 11 of 18 3.3.2. Effects of Atmospheric-Pressure Plasmas (APP) Similar results were
obtained by AP DBD CP treatment of Aschochyta pinodella and Fusarium culmorum, where
damages in cell walls and cell membranes resulted in cell cytoplasm leakage [114]. The
main mechanisms behind CP-induced fungal inactivation process are shown in Figure 3. EW
12 of 19
treated with RF plasma jet, resulting in cell leakage and lower viability [113]. Similar re-
sults were obtained by AP DBD CP treatment of Aschochyta pinodella and Fusarium cul-
morum, where damages in cell walls and cell membranes resulted in cell cytoplasm leak-
age [114]. The main mechanisms behind CP-induced fungal inactivation process are
shown in Figure 3. Figure 3. Main agents and mechanisms governing fungal decontamination in cold plasma sterilization process. Reactive species interact with living cells and their macromolecules and influence
Figure 3. Main agents and mechanisms governing fungal decontamination in cold plasma sterilization process. This image
was created with BioRender.com. Figure 3. Main agents and mechanisms governing fungal decontamination in cold plasma sterilization process. Figure 3. Main agents and mechanisms governing fungal decontamination in cold plasma sterilization process. This image
was created with BioRender.com. J. Fungi 2021, 7, 650 12 of 18 Reactive species interact with living cells and their macromolecules and influence
their structural and biochemical properties. The inactivation of microorganisms and
their spores under APP has been attributed mainly to ROS and RNS [78,105], as they
can directly impact the cell walls and outer membranes of microorganisms [34,74]. They
could break the structurally important chemical bonds of the peptidoglycan layer, leading
to destruction of the bacterial cell wall [107]. Furthermore, charged particles can also
rupture the outer bacterial membrane [115]. Reactive species cause alterations in cellular
macromolecules, with membrane lipids being the most vulnerable group as they are located
near the cell surface and are thus most sensitive to ROS [116]. The CP-generated ROS were
also attributed a major role in physiological changes, especially oxidation of intracellular
organelles, particularly lipids and cellular proteins [117–119]. g
p
y
p
p
Montie et al., 2000 [116] examined the effect of APP on microbial inactivation and
structural changes in Gram-negative (E. coli) and Gram-positive bacteria (S. aureus). The E. coli cells were rapidly and severely damaged, exhibiting significant macromolecular leakage
caused by a rupture of the outer membrane (probably due to peroxidation of fatty acids). In contrast, S. aureus cells showed no morphological changes and cell leakage was delayed. 3.3.2. Effects of Atmospheric-Pressure Plasmas (APP) This was probably due to the thick polysaccharide cell wall layer characteristic of Gram-
positive bacteria, protecting them from ROS attack, but still allowing ROS diffusion and
attack on the cytoplasmic membrane, causing cell leakage. In both cases, macromolecules
are released, which leads to death of bacterial cells, with S. aureus still retaining its spherical
shape due to the thick peptidoglycan cell wall layer. Similar results were later confirmed
by Laroussi et al., 2003 [120], who investigated the effect of APP on Gram-negative (E. coli)
and Gram-positive bacteria (B. subtilis). These findings show that spores and yeasts are the
most resistant structures to plasma treatment due to a very thick layer of polysaccharides in
the cell wall [116]. Morphological changes resulting in cell wall and membrane alterations
that lead to increased permeability and cell leakage were also reported for fungal cells and
spores of Aspergillus sp. [83,84] and spores of Neurospora crassa, [117]. Three main killing
mechanisms of APP were proposed: (1) Lipid peroxidation, as a result of hydroxyl radicals
attacking unsaturated fatty acids. (2) Protein oxidation, due to amino acid oxidation. (3) DNA oxidation, caused by interactions with oxygen radicals, leading to the formation
of base adducts (Adapted from [116]). Destruction of DNA of fungal spores (Cordyceps
bassiana) treated with APP was also confirmed [121]. Examination of different gas mixtures led to a conclusion that the best bactericidal
effects are achieved in moistened oxygen and air [110]. In the mixture, humidity leads to
the formation of OH radicals that attack the external structures of bacterial cells; oxygen
produces ozone (O3) that interferes with cellular respiration; and air contains nitrogen that
leads to the production of NO and NOx, which contribute to the lethality of the process,
leading to more efficient microbial inactivation. AP air-gas mixture plasma is thus a very
efficient sterilizing agent. The role of RNS in fungal inactivation is less known and still
remains to be examined. APP systems are particularly useful and have a key advantage over LP plasmas, as
they do not require large vacuum devices and therefore offer the possibility of in-line
batch processing of seeds [64]. In addition, they have many potential advantages over
conventional sterilization methods because they are non-toxic, have low operating costs
and a short treatment time at low temperatures, do not use water in the process, and can
be used for a wide range of goods [122–124]. 4. Conclusions & Future Research CP is a prominent method for seed treatment, especially the AP CP systems, as they
do not require large vacuum chambers and provide in-line batch processing of grain. In
addition, the use of air as the feed gas for plasma generation provides the most effective
results in terms of seed surface changes, such as microbial decontamination and increased
wettability, and thus, increased water absorption due to changes in contact angle. The
introduction of novel, environmentally friendly alternatives for seed treatment could also J. Fungi 2021, 7, 650 13 of 18 reduce undesirable residues of xenobiotics such as organic fungicides, which are now
widely used in crop protection both in plants and in the environment. The reviewed papers
show that CP could be used as an alternative method for fungal decontamination of seeds. CP is also relatively safe for work, both for the operator and the treated subject, if the
treating parameters are optimized. Likewise, it requires relatively low energy input and can
therefore be an economically and environmentally sustainable method for decontamination. However, it is hard to compare various studies as plasma types and parameters used are
quite diverse. There is also a lack of systematic studies on the effects of different CP
treatments on various types of seeds and under different environmental conditions. It is
already clear from the studies carried out to date, that the effectiveness of different CP
treatments on fungal decontamination, seed germination, and plant growth depends on
the type of seed (plant species), storage conditions, and also on environmental factors. In
this perspective, there is a lack of field studies involving plasma-treated seeds. Up to this point, there is still not enough data to decide which CP treatment method
is effective in improving seed germination. The same applies to the effectiveness of CP
treatment on microbial inactivation and thus on seed decontamination, as the plasma
setups and parameters used in the different studies are quite varied. Since it was observed
in most studies that complete inactivation of microorganisms on the seed surface generally
requires longer plasma exposure times, which can cause damage and lead to inhibition of
germination, it appears that plasma treatment may be useful for decontaminating seeds
intended for storage or feeding. In the case of seeds intended for planting and cultivation
of crops, shorter exposure times should be used to achieve beneficial effects on germination
and growth parameters. 4. Conclusions & Future Research In addition, it is obvious that not only each type of seed, but
probably each pathogen species, requires different plasma exposure times for complete
inhibition, as sensitivity to plasma treatment seems to be species specific. There is also a
lack of data on the effect of CP treatment on seed endophytic fungi (both beneficial and
pathogenic). p
g
Future research should therefore focus on the unification of optimization of CP treat-
ment parameters for economically important crops and their pathogens, in particular
various types of filamentous fungi, known to contaminate seeds during storage and being
harmful to both seeds and humans, in order to ensure global food security. The use of
plasma techniques could also be beneficial in applications with horticultural as well as rare
and endangered plant species, and it should only be a few years until large scale CP will
be used for seed treatment. Author Contributions: Conceptualization, J.M. and K.V.-M.; investigation, J.M.; writing—Original
draft preparation, J.M.; writing—Review and editing, J.M., M.R. and K.V.-M.; visualization, J.M.;
supervision, M.R. and K.V.-M. All authors have read and agreed to the published version of
the manuscript. Funding: This research was funded by Slovenian Research Agency (ARRS): Young researcher grant
(Jure Mravlje), program group P1-0212-Plant biology and projects J7-9418, N1-0105 and L4-9305. This
publication is based upon work from COST Action CA19110-PlAgri, supported by COST (European
Cooperation in Science and Technology-www.cost.eu, accessed on 28 July 2021). Conflicts of Interest: The authors declare no conflict of interest. Conflicts of Interest: The authors declare no conflict of interest. 1.
FAO. How to Feed the World in 2050 Executive; FAO United Nations: Rome, Italy, 2009; Available online: http://www.fao.org/
fileadmin/templates/wsfs/docs/expert_paper/How_to_Feed_the_World_in_2050.pdf (accessed on 28 July 2021). p
p
p p
p
y
2.
FAO. The Future of Food and Agriculture: Trends and Challenges; Annual Report 2017; FAO United Nations: Rome, Italy, 2017; ISBN
9789251095515. 3.
Committee, N.A.; Criteria, M. Microbiological safety evaluations and recommendations on sprouted seeds. Int. J. Food Microbiol.
1999, 52, 123–153. [CrossRef] 4.
Mitra, A.; Li, Y.; Klämpfl, T.G.; Shimizu, T.; Jeon, J.; Morfill, G.E.; Zimmermann, J.L. Inactivation of Surface-Borne Microorganisms
and Increased Germination of Seed Specimen by Cold Atmospheric Plasma. Food Bioprocess Technol 2014, 7, 645–653. [CrossRef] References 1. FAO. How to Feed the World in 2050 Executive; FAO United Nations: Rome, Italy, 2009; Available online: http://www.fao.org/
fileadmin/templates/wsfs/docs/expert_paper/How_to_Feed_the_World_in_2050.pdf (accessed on 28 July 2021). 14 of 18 J. Fungi 2021, 7, 650 14 of 18 5. Misra, N.N.; Schluter, O.; Cullen, P.J. Cold Plasma in Food and Agriculture; Academic Press: Cambridge, MA, USA, 2016; ISBN
9780128013656. 6. Selcuk, M.; Oksuz, L.; Basaran, P. Decontamination of grains and legumes infected with Aspergillus spp. and Penicillum spp. by
cold plasma treatment. Bioresour. Technol. 2008, 99, 5104–5109. [CrossRef] Z.; Asi, M.R.; Ariño, A.; Akram, N.; Zuber, M. Aflatoxin contamination in different fractions of rice from Pa p
7. Iqbal, S.Z.; Asi, M.R.; Ariño, A.; Akram, N.; Zuber, M. Aflatoxin contamination in different fractions of rice from Pakistan and
estimation of dietary intakes. Mycotoxin Res. 2012, 28, 175–180. [CrossRef] [PubMed] 8. Iqbal, S.Z.; Asi, M.R. Assessment of aflatoxin M1 in milk and milk products from Punjab, Pakistan. Food Control 2013, 30, 235–239. [CrossRef] 9. Christensen, C.M. Deterioration of Stored Grains by Fungi. Bot. Rev. 1957, 23, 108–134. [CrossRef] 9. Christensen, C.M. Deterioration of Stored Grains by Fungi. Bot. Rev. 1957, 23, 108 134. [CrossRef]
10. Mancini, V.; Romanazzi, G. Seed treatments to control seedborne fungal pathogens of vegetable crops. Pest Manag. Sci. 2014, 70,
860–868. [CrossRef] 10. Mancini, V.; Romanazzi, G. Seed treatments to control seedborne fungal pathogens of vegetable cro
860–868. [CrossRef] 11. Baker, K.F. Seed Pathology—Concepts and Methods of Control. J. Seed Technol. 1979, 4, 57–67. 12. Gerhardson, B. Biological substitutes for pesticides. Trends Biotechnol. 2002, 20, 338–343. [CrossRef] 13. Los, A.; Ziuzina, D.; Boehm, D.; Cullen, P.J.; Bourke, P. Investigation of mechanisms involved in germination enhancement of
wheat (Triticum aestivum) by cold plasma: Effects on seed surface chemistry and characteristics. Plasma Process. Polym. 2019, 16,
1–12. [CrossRef] 14. Bormashenko, E.; Grynyov, R.; Bormashenko, Y.; Drori, E. Cold radiofrequency plasma treatment modifies wettability and
germination speed of plant seeds. Sci. Rep. 2012, 2, 1–8. [CrossRef] 15. Sadhu, S.; Thirumdas, R.; Deshmukh, R.R.; Annapure, U.S. Influence of cold plasma on the enzymatic activity in germinating
mung beans (Vigna radiate). LWT-Food Sci. Technol. 2017, 78, 97–104. [CrossRef] 16. Gómez-Ramírez, A.; López-Santos, C.; Cantos, M.; García, J.L.; Molina, R.; Cotrino, J.; Espinós, J.P.; Gon
chemistry and germination improvement of Quinoa seeds subjected to plasma activation. Sci. Rep. 201 y
g
p
Q
j
p
p
[
]
17. References Cold Plasma for Effective Fungal and Mycotoxin Control in Fo
i
i
Eff
d A
li
i
C
R
F
d S i F
d S f 2019 18 106 120 [C
R f] ,
;
,
;
p
,
; J ,
g
y
activation Effects, and Applications. Compr. Rev. Food Sci. Food Saf. 2019, 18, 106–120. [CrossRef] pp
25. Pankaj, S.K.; Bueno-Ferrer, C.; Misra, N.N.; Milosavljevi´c, V.; O’Donnell, C.P.; Bourke, P.; Keener, K.M.; Cullen, P.J. Applications of
cold plasma technology in food packaging. Trends Food Sci. Technol. 2014, 35, 5–17. [CrossRef] 25. Pankaj, S.K.; Bueno-Ferrer, C.; Misra, N.N.; Milosavljevi´c, V.; O’Donnell, C.P.; Bourke, P.; Keener, K.M.; C
cold plasma technology in food packaging. Trends Food Sci. Technol. 2014, 35, 5–17. [CrossRef] p
gy
p
g
g
26. Moreau, M.; Orange, N.; Feuilloley, M.G.J. Non-thermal plasma technologies: New tools for bio-decontamination. Biotechnol. Adv. 2008, 26, 610–617. [CrossRef] [PubMed] 27. Misra, N.N.; Yepez, X.; Xu, L.; Keener, K. In-package cold plasma technologies. J. Food Eng. 2019, 244, 21–31. [CrossRef]
28. Tendero, C.; Tixier, C.; Tristant, P.; Desmaison, J.; Leprince, P. Atmospheric pressure plasmas: A review. Spectrochim. Acta-Part B
At. Spectrosc. 2006, 61, 2–30. [CrossRef] 27. Misra, N.N.; Yepez, X.; Xu, L.; Keener, K. 27. Misra, N.N.; Yepez, X.; Xu, L.; Keener, K. In-package cold plasma technologies. J. Food Eng. 2019, 244, 2 M s a, N N ;
epe ,
;
u,
;
ee e ,
package co d p as
a tec
o og es J
ood
ng
0 9,
,
3
[C oss e ]
28. Tendero, C.; Tixier, C.; Tristant, P.; Desmaison, J.; Leprince, P. Atmospheric pressure plasmas: A review. Spectrochim. Acta-Part B
At. Spectrosc. 2006, 61, 2–30. [CrossRef] 29. Piel, A. Plasma Physics: An Introduction to Laboratory, Space, and Fusion Plasmas; Springer: Berlin/Heidelberg, Germany, 2010; ISBN
9788578110796. 30. Conrads, H.; Schmidt, M. Plasma generation and plasma sources. Plasma Sources Sci. Technol. 2000, 9, 441–454. [CrossRef]
31. Wong, C.S.; Mongkolnavin, R. Elements of Plasma Technology; Springer: Singapore, 2016; ISBN 978-981-10-0115-4. 30. Conrads, H.; Schmidt, M. Plasma generation and plasma sources. Plasma Sources Sci. Technol. 2000, 9, 441–454. [CrossRef] 30. Conrads, H.; Schmidt, M. Plasma generation and plasma sources. Plasma Sources Sci. Technol. 2000, 30. Conrads, H.; Schmidt, M. Plasma generation and plasma sources. Plasma Sources Sci. Technol. 2000, 9, 441–454. References Živkovi´c, S.; Puaˇc, N.; Giba, Z.; Grubiši´c, D.; Petrovi´c, Z.L. The stimulatory effect of non-equilibrium (low temperature) air
plasma pretreatment on light-induced germination of Paulownia tomentosa seeds. Seed Sci. Technol. 2004, 32, 693–701. [CrossRef]
ˇ p
p
g
g
18. Zahoranová, A.; Henselová, M.; Hudecová, D.; Kaliˇnáková, B.; Kováˇcik, D.; Medvecká, V.; ˇCernák, M. Effect of Cold Atmospheric
Pressure Plasma on the Wheat Seedlings Vigor and on the Inactivation of Microorganisms on the Seeds Surface. Plasma Chem. Plasma Process. 2016, 36, 397–414. [CrossRef] L.; Minchong, S.; Chunlei, Z.; Yuanhua, D. Cold plasma treatment enhances oilseed rape seed germination
s. Sci. Rep. 2015, 5, 1–10. [CrossRef] 19. Ling, L.; Jiangang, L.; Minchong, S.; Chunlei, Z.; Yuanhua, D. Cold plasma treatment enhances oilsee
under drought stress. Sci. Rep. 2015, 5, 1–10. [CrossRef] g
p
20. Park, Y.; Oh, K.S.; Oh, J.; Seok, D.C.; Kim, S.B.; Yoo, S.J.; Lee, M.J. The biological effects of surface dielectric barrier discharge on
seed germination and plant growth with barley. Plasma Process. Polym. 2018, 15, 1–8. [CrossRef] g
p
g
y
y
21. Henselová, M.; Slováková, L’.; Martinka, M.; Zahoranová, A. Growth, anatomy and enzyme activity changes in maize roots
induced by treatment of seeds with low-temperature plasma. Biologia 2012, 67, 490–497. [CrossRef] 21. Henselová, M.; Slováková, L’.; Martinka, M.; Zahoranová, A. Growth, anatomy and enzyme activity changes in maize roots
induced by treatment of seeds with low temperature plasma Biologia 2012 67 490 497 [CrossRef] ed by treatment of seeds with low-temperature plasma. Biologia 2012, 67, 490–497. [CrossRef] 22. Kitazaki, S.; Koga, K.; Shiratani, M.; Hayashi, N. Growth enhancement of radish sprouts induced by low pressure o 2 radio
frequency discharge plasma irradiation. Jpn. J. Appl. Phys. 2012, 51, 01AE01. [CrossRef] q
y
g p
p
pp
y
23. Misra, N.N.; Tiwari, B.K.; Raghavarao, K.S.M.S.; Cullen, P.J. Nonthermal Plasma Inactivation of Food-Borne Pathogens. Food Eng. Rev. 2011, 3, 159–170. [CrossRef] 24. Misra, N.N.; Yadav, B.; Roopesh, M.S.; Jo, C. Cold Plasma for Effective Fungal and Mycotoxin Co
Inactivation Effects, and Applications. Compr. Rev. Food Sci. Food Saf. 2019, 18, 106–120. [CrossRef] isra, N.N.; Yadav, B.; Roopesh, M.S.; Jo, C. ads, H.; Schmidt, M. Plasma generation and plasma sources. Plasma Sources Sci. Technol. 2000, 9, 441–454. [C
, C.S.; Mongkolnavin, R. Elements of Plasma Technology; Springer: Singapore, 2016; ISBN 978-981-10-0115-4. References [CrossRef]
31
Wong C S ; Mongkolnavin R Elements of Plasma Technology; Springer: Singapore 2016; ISBN 978 981 10 0115 4 Conrads, H.; Schmidt, M. Plasma generation and plasma sources. Plasma Sources Sci. Technol. 2000, 9, 441–
Wong, C.S.; Mongkolnavin, R. Elements of Plasma Technology; Springer: Singapore, 2016; ISBN 978-981-10-0 g
p
31. Wong, C.S.; Mongkolnavin, R. Elements of Plasma Technology; Springer: Singapore, 2016; ISBN 978-9 32. Bogaerts, A.; Neyts, E.; Gijbels, R.; Mullen, J. Van der Gas Discharge Plasmas and Their Applications, Spectrochimica Acta Part B
57. Spectrochim. Acta Part B 2002, 57, 609–658. [CrossRef] 33. Mravlje, J.; Regvar, M.; Stariˇc, P.; Mozetiˇc, M.; Vogel-Mikuš, K. Cold plasma affects germination and fungal community structure
of buckwheat seeds. Plants 2021, 10, 851. [CrossRef] mperature plasma-based sterilization: Overview and state-of-the-art. Plasma Process. Polym. 2005, 2, 391–400 34. Laroussi, M. Low temperature plasma-based sterilization: Overview and state-of-the-art. Plasma Pro
[CrossRef] 35. Stariˇc, P.; Vogel-Mikuš, K.; Mozetiˇc, M.; Junkar, I. Effects of nonthermal plasma on morphology, genetics and physiology of seeds:
A review. Plants 2020, 9, 1736. [CrossRef] 15 of 18 15 of 18 J. Fungi 2021, 7, 650 36. Zhou, R.; Li, J.; Zhou, R.; Zhang, X.; Yang, S. Atmospheric-pressure plasma treated water for seed germination and seedling
growth of mung bean and its sterilization effect on mung bean sprouts. Innov. Food Sci. Emerg. Technol. 2019, 53, 36–44. [CrossRef]
37. Oehmigen, K.; Winter, J.; Hähnel, M.; Wilke, C.; Brandenburg, R.; Weltmann, K.D.; Von Woedtke, T. Estimation of possible
mechanisms of Escherichia coli inactivation by plasma treated sodium chloride solution. Plasma Process. Polym. 2011, 8, 904–913. [CrossRef] 36. Zhou, R.; Li, J.; Zhou, R.; Zhang, X.; Yang, S. Atmospheric-pressure plasma treated water for seed germination and seedling
growth of mung bean and its sterilization effect on mung bean sprouts. Innov. Food Sci. Emerg. Technol. 2019, 53, 36–44. [CrossRef] 37. Oehmigen, K.; Winter, J.; Hähnel, M.; Wilke, C.; Brandenburg, R.; Weltmann, K.D.; Von Woedtke, T. Estimation of possible
mechanisms of Escherichia coli inactivation by plasma treated sodium chloride solution. Plasma Process. Polym. 2011, 8, 904–913. [CrossRef] 38. Fridman, G.; Brooks, A.D.; Balasubramanian, M.; Fridman, A.; Gutsol, A.; Vasilets, V.N.; Ayan, H.; Friedman, G. Comparison
of direct and indirect effects of non-thermal atmospheric-pressure plasma on bacteria. Plasma Process. Polym. 2007, 4, 370–375. [CrossRef] 39. Puaˇc, N.; Gherardi, M.; Shiratani, M. Plasma agriculture: A rapidly emerging field. Plasma Process. Polym. 2018, 15, 1–5. [CrossRef]
40. References Dhayal, M.; Lee, S.Y.; Park, S.U. Using low-pressure plasma for Carthamus tinctorium L. seed surface modification. Vacuum 2006,
80, 499–506. [CrossRef] 41. Lynikiene, S.; Pozeliene, A.; Rutkauskas, G. Influence of corona discharge field on seed viability and dynamics of germination. Int. Agrophys. 2006, 20, 195–200. g
p y
42. Šerá, B.; Šerý, M.; Viˇetzslav, Š.; Špatenka, P.; Tichý, M. Does cold plasma affect breaking dormancy and seed germination? A
study on seeds of lamb’s quarters (Chenopodium album agg.). Plasma Sci. Technol. 2009, 11, 750–754. [CrossRef]
43
Šerá B ; Špatenka P; Šerý M ; Vrchotová N ; Hrušková I Influence of plasma treatment on wheat and oat germination and g
p y
42. Šerá, B.; Šerý, M.; Viˇetzslav, Š.; Špatenka, P.; Tichý, M. Does cold plasma affect breaking dormancy and seed germination? A
study on seeds of lamb’s quarters (Chenopodium album agg.). Plasma Sci. Technol. 2009, 11, 750–754. [CrossRef]
43. Šerá, B.; Špatenka, P.; Šerý, M.; Vrchotová, N.; Hrušková, I. Influence of plasma treatment on wheat and oat germination and
early growth. IEEE Trans. Plasma Sci. 2010, 38, 2963–2968. [CrossRef] 44. Šera, B.; Straˇnák, V.; Serý, M.; Tichý, M.; Spatenka, P. Germination of chenopodium album in response to microwave plasma
treatment. Plasma Sci. Technol. 2008, 10, 506–511. [CrossRef] 45. Dobrin, D.; Magureanu, M.; Mandache, N.B.; Ionita, M.D. The effect of non-thermal plasma treatment on wheat germination and
early growth. Innov. Food Sci. Emerg. Technol. 2015, 29, 255–260. [CrossRef] ebili, N.O.; Ardebili, Z.O.; Shafaati, M.; Ghoranneviss, M. Non-thermal Plasma Induced Expression of Heat 46. Iranbakhsh, A.; Ardebili, N.O.; Ardebili, Z.O.; Shafaati, M.; Ghoranneviss, M. Non-thermal Plasma Induced Expression of Heat
Shock Factor A4A and Improved Wheat (Triticum aestivum L.) Growth and Resistance Against Salt Stress. Plasma Chem. Plasma
Process. 2018, 38, 29–44. [CrossRef] 47. Kuˇcerová, K.; Henselová, M.; Slováková, L’.; Hensel, K. Effects of plasma activated water on wheat: Germination, growth
parameters, photosynthetic pigments, soluble protein content, and antioxidant enzymes activity. Plasma Process. Polym. 2019, 16,
1–14. [CrossRef] 48. Meng, Y.; Qu, G.; Wang, T.; Sun, Q.; Liang, D.; Hu, S. Enhancement of Germination and Seedling Growth of Wheat Seed Using
Dielectric Barrier Discharge Plasma with Various Gas Sources. Plasma Chem. Plasma Process. 2017, 37, 1105–1119. [CrossRef]
49. Jiang, J.; Lu, Y.; Li, J.; Li, L.; He, X.; Shao, H.; Dong, Y. Effect of seed treatment by cold plasma on the resistance of tomato to
Ralstonia solanacearum (bacterial wilt). References PLoS ONE 2014, 9. [CrossRef] 48. Meng, Y.; Qu, G.; Wang, T.; Sun, Q.; Liang, D.; Hu, S. Enhancement of Germination and Seedling G
Dielectric Barrier Discharge Plasma with Various Gas Sources. Plasma Chem. Plasma Process. 2017, 3 Dielectric Barrier Discharge Plasma with Various Gas Sources. Plasma Chem. Plasma Process. 2017, 37, 1105–1119. [CrossRef]
49. Jiang, J.; Lu, Y.; Li, J.; Li, L.; He, X.; Shao, H.; Dong, Y. Effect of seed treatment by cold plasma on the resistance of tomato to
Ralstonia solanacearum (bacterial wilt). PLoS ONE 2014, 9. [CrossRef] 50. Filatova, I.; Azharonok, V.; Lushkevich, V.; Zhukovsky, A.; Gadzhieva, G.; Spasi, K. Plasma seeds treatment as a promising
technique for seed germination improvement. In Proceedings of the 31st ICPIG, Granada, Spain, 14–19 July 2013; pp. 4–7. Š
ˇ 51. Zahoranová, A.; Hoppanová, L.; Šimoncicová, J.; Tuceková, Z.; Medvecká, V.; Hudecová, D.; Kalináková, B.; Kovácik, D.; Cernák,
M. Effect of Cold Atmospheric Pressure Plasma on Maize Seeds: Enhancement of Seedlings Growth and Surface Microorganisms
Inactivation. Plasma Chem. Plasma Process. 2018, 38, 969–988. [CrossRef] 52. Li, L.; Jiang, J.; Li, J.; Shen, M.; He, X.; Shao, H.; Dong, Y. Effects of cold plasma treatment on seed germination and seedling
growth of soybean. Sci. Rep. 2014, 4, 1–7. [CrossRef] 53. Zhang, J.J.; Jo, J.O.; Huynh, D.L.; Mongre, R.K.; Ghosh, M.; Singh, A.K.; Lee, S.B.; Mok, Y.S.; Hyuk, P.; Jeong, D.K. Growth-inducing
effects of argon plasma on soybean sprouts via the regulation of demethylation levels of energy metabolism-related genes. Sci. Rep. 2017, 7, 1–12. [CrossRef] [PubMed] p
54. Khamsen, N.; Onwimol, D.; Teerakawanich, N.; Dechanupaprittha, S.; Kanokbannakorn, W.; Hongesombut, K.; Srisonphan, S. Rice (Oryza sativa L.) Seed Sterilization and Germination Enhancement via Atmospheric Hybrid Nonthermal Discharge Plasma. ACS Appl. Mater. Interfaces 2016, 8, 19268–19275. [CrossRef] [PubMed] 55. Jiang, J.; Li, J.; Dong, Y. Effect of cold plasma treatment on seedling growth and nutrient absorption of to
2018, 20. [CrossRef] 56. Măgureanu, M.; Sîrbu, R.; Dobrin, D.; Gîdea, M. Stimulation of the Germination and Early Growth of Tomato Seeds by
Non-thermal Plasma. Plasma Chem. Plasma Process. 2018, 38, 989–1001. [CrossRef] [
]
57. Meiqiang, Y.; Mingjing, H.; Buzhou, M.; Tengcai, M. Stimulating Effects of Seed Treatment by Magnetized Plasma on Tomato
Growth and Yield. Plasma Sci. Technol. 2005, 7, 3143. [CrossRef] 58. Sivachandiran, L.; Khacef, A. References Enhanced seed germination and plant growth by atmospheric pressure cold air plasma: Combined
effect of seed and water treatment. RSC Adv. 2017, 7, 1822–1832. [CrossRef] 59. Matra, K. Non-thermal Plasma for Germination Enhancement of Radish Seeds. Procedia Comput. Sci. 2016, 86, 132–135. [CrossRef]
60. Volin, J.C.; Denes, F.S.; Young, R.A.; Park, S.M.T. Modification of seed germination performance through cold plasma chemistry
technology. Crop Sci. 2000, 40, 1706–1718. [CrossRef] gy
p
61. Puligundla, P.; Kim, J.W.; Mok, C. Effect of corona discharge plasma jet treatment on decontamination and sprouting of rapeseed
(Brassica napus L.) seeds. Food Control 2017, 71, 376–382. [CrossRef] 62. Tounekti, T.; Mujahid, Z.U.I.; Khemira, H. Non-thermal dielectric barrier discharge (DBD) plasma affects germination of coffee
and grape seeds. AIP Conf. Proc. 2018, 1976, 10–14. [CrossRef] 16 of 18 J. Fungi 2021, 7, 650 63. Harris, D.; Pathan, A.K.; Gothkar, P.; Joshi, A.; Chivasa, W.; Nyamudeza, P. On-farm seed priming: Using participatory methods
to revive and refine a key technology. Agric. Syst. 2001, 69, 151–164. [CrossRef] y
gy
g
y
[
]
64. Randeniya, L.K.; De Groot, G.J.J.B. Non-Thermal Plasma Treatment of Agricultural Seeds for Stimulation of Germination,
Removal of Surface Contamination and Other Benefits: A Review. Plasma Process. Polym. 2015, 12, 608–623. [CrossRef] 64. Randeniya, L.K.; De Groot, G.J.J.B. Non-Thermal Plasma Treatment of Agricultural Seeds for Stimulation of Germination, 64. Randeniya, L.K.; De Groot, G.J.J.B. Non-Thermal Plasma Treatment of Agricultural Seeds for Stim
Removal of Surface Contamination and Other Benefits: A Review. Plasma Process. Polym. 2015, 12, 608 Removal of Surface Contamination and Other Benefits: A Review. Plasma Process. Polym. 2015, 12, 608–623. [CrossRef]
65. Bormashenko, E. Progress in understanding wetting transitions on rough surfaces. Adv. Colloid Interface Sci. 2015, 222, 92–103. [CrossRef] y
[
]
65. Bormashenko, E. Progress in understanding wetting transitions on rough surfaces. Adv. Colloid Interface Sci. 2015, 222, 92–103. [CrossRef] 65. Bormashenko, E. Progress in understanding wetting transitions on rough surfaces. Adv. Colloid Interf
[CrossRef] 66. Hayashi, N.; Ono, R.; Shiratani, M.; Yonesu, A. Antioxidative activity and growth regulation of Brassicaceae induced by oxygen
radical irradiation. Jpn. J. Appl. Phys. 2015, 54, 06GD01. [CrossRef] 67. Sudhakar, N.; Nagendra-Prasad, D.; Mohan, N.; Hill, B.; Gunasekaran, M.; Murugesan, K. Assessing Influence of Ozone in
Tomato Seed Dormancy Alleviation. Am. J. Plant Sci. 2011, 2, 443–448. [CrossRef]
ˇ 68. Stolárik, T.; Henselová, M.; Martinka, M.; Novák, O.; Zahoranová, A.; ˇCernák, M. References Effect of Low-Temperature Plasma on the
Structure of Seeds, Growth and Metabolism of Endogenous Phytohormones in Pea (Pisum sativum L.). Plasma Chem. Plasma
Process. 2015, 35, 659–676. [CrossRef] 69. Park, D.P.; Davis, K.; Gilani, S.; Alonzo, C.A.; Dobrynin, D.; Friedman, G.; Fridman, A.; Rabinovich, A.; Fridman, G. Reactive
nitrogen species produced in water by non-equilibrium plasma increase plant growth rate and nutritional yield. Curr. Appl. Phys. 2013, 13, 1–11. [CrossRef] 70. Basaran, P.; Basaran-Akgul, N.; Oksuz, L. Elimination of Aspergillus parasiticus from nut surface with low pressure cold plasma
(LPCP) treatment. Food Microbiol. 2008, 25, 626–632. [CrossRef] 71. Basaran, P.; Akhan, Ü. Microwave irradiation of hazelnuts for the control of aflatoxin producing Aspergillus parasiticus. Innov. Food Sci. Emerg. Technol. 2010, 11, 113–117. [CrossRef] u, J.; Moreau, S.; Pelletier, J.; Tabrizian, M.; Yahia, L. Low-temperature sterilization using gas plasmas: A
ments and an analysis of the inactivation mechanisms. Int. J. Pharm. 2001, 226, 1–21. [CrossRef] 72. Moisan, M.; Barbeau, J.; Moreau, S.; Pelletier, J.; Tabrizian, M.; Yahia, L. Low-temperature sterilizati
review of the experiments and an analysis of the inactivation mechanisms. Int. J. Pharm. 2001, 226, 1–2 p
y
73. Filatova, I.; Azharonok, V.; Gorodetskaya, E.; Mel, L.; Shedikova, O.; Shik, A. Plasma-radiowave stimulation of plant seeds
germination and inactivation of pathogenic microorganisms. Proc. Int. Plasma Chem. Soc. 2009, 19, 627. 74. Laroussi, M.; Alexeff, I.; Kang, W.L. Biological decontamination by nonthermal plasmas. IEEE Trans. Plasma Sci. 2000, 28, 184–188. [CrossRef] 75. Bewley, J.D.; Black, M. SEEDS: Physiology of Development and Germination, 2nd ed.; Springer Science & Business Media: Berlin,
Germany, 1994. 76. Chahtane, H.; Kim, W.; Lopez-Molina, L. Primary seed dormancy: A temporally multilayered riddle waiting to be unlocked. J. Exp. Bot. 2017, 68, 857–869. [CrossRef] [PubMed] 77. Hertwig, C.; Leslie, A.; Meneses, N.; Reineke, K.; Rauh, C.; Schlüter, O. Inactivation of Salmonella Enteritidis PT30 on the surface
of unpeeled almonds by cold plasma. Innov. Food Sci. Emerg. Technol. 2017, 44, 242–248. [CrossRef] 78. Deng, X.; Shi, J.; Kong, M.G. Physical mechanisms of inactivation of Bacillus subtilis spores using cold at
Trans. Plasma Sci. 2006, 34, 1310–1316. [CrossRef] 79. Navarro, S.; Donahaye, J. Innovative Environmentally Friendly Technologies to Maintain Quality of Durable Agricultural Produce;
Ben-Yehoshua, S., Ed.; CRC Press: Boca Raton, FL, USA, 2005; ISBN 9780203500361. 80. Duan, C.X.; Wang, X.M.; Zhu, Z.D.; Wu, X.F. Testing of Seedborne Fungi in Wheat Germplasm Conserved in the National Crop
Genebank of China. g
y
pp
y
89.
Lee, Y.; Lee, Y.Y.; Kim, Y.S.; Balaraju, K.; Mok, Y.S.; Yoo, S.J.; Jeon, Y. Enhancement of seed germination and microbial disinfection
on ginseng by cold plasma treatment. J. Ginseng Res. 2020, 45, 519–526. [CrossRef] References Eisenman, H.C.; Casadevall, A. Synthesis and assembly of fungal melanin. Appl. Microbiol. Biotechnol. 2012, 93, 931–940. [CrossRef] 101. Eisenman, H.C.; Casadevall, A. Synthesis and assembly of fungal melanin. Appl. Microbiol. Biote
[CrossRef] 102. Fridman, A. Plasma Chemistry; Cambridge University Press: New York, NY, USA, 2008; ISBN 9780521847353. 2. Fridman, A. Plasma Chemistry; Cambridge Universi 103. Deng, X.T.; Shi, J.J.; Kong, M.G. Protein destruction by a helium atmospheric pressure glow discharge: Capability and mechanisms. J. Appl. Phys. 2007, 101, 074701. [CrossRef] 104. Edelblute, C.M.; Malik, M.A.; Heller, L.C. Surface-dependent inactivation of model microorganisms
discharges and applied air flow. Bioelectrochemistry 2015, 103, 22–27. [CrossRef] g
pp
y
105. Gaunt, L.F.; Beggs, C.B.; Georghiou, G.E. Bactericidal action of the reactive species produced by gas-discharge nonthermal plasma
at atmospheric pressure: A review. IEEE Trans. Plasma Sci. 2006, 34, 1257–1269. [CrossRef] p
p
106. Lu, X.; Ye, T.; Cao, Y.; Sun, Z.; Xiong, Q.; Tang, Z.; Xiong, Z.; Hu, J.; Jiang, Z.; Pan, Y. The roles of the various plasma agents in the
inactivation of bacteria. J. Appl. Phys. 2008, 104, 053309. [CrossRef] Yusupov, M.; Bogaerts, A.; Huygh, S.; Snoeckx, R.; Van Duin, A.C.T.; Neyts, E.C. Plasma-induced destructio
components: A reactive molecular dynamics simulation. J. Phys. Chem. C 2013, 117, 5993–5998. [CrossRef] 107. Yusupov, M.; Bogaerts, A.; Huygh, S.; Snoeckx, R.; Van Duin, A.C.T.; Neyts, E.C. Plasma-induced destruction of bacterial cell wall
components: A reactive molecular dynamics simulation. J. Phys. Chem. C 2013, 117, 5993–5998. [CrossRef] 108. Herrmann, H.W.; Henins, I.; Park, J.; Selwyn, G.S. Decontamination of chemical and biological warfare (CBW) agents using an
atmospheric pressure plasma jet (APPJ). Phys. Plasmas 1999, 6, 2284–2289. [CrossRef] p
j
y
Dyer, F.F.; Dobbs, F.C.; Alexeff, I.; Garland, C.; Kang, W.L. On the use ofthe resistive barrier discharge to 109. Richardson, J.P.; Dyer, F.F.; Dobbs, F.C.; Alexeff, I.; Garland, C.; Kang, W.L. On the use ofthe resistive barrier discharge to kill
bacteria: Recent results. In ICOPS 2000 IEEE Conference Record-Abstracts, Proceedings of the 27th IEEE International Conference on
Plasma Science, New Orleans, LA, USA, 4–7 June 2000; IEEE: Piscataway, NJ, USA, 2000. y
g
g
bacteria: Recent results. In ICOPS 2000 IEEE Conference Record-Abstracts, Proceedings of the 27th IEEE International Conference on
Plasma Science, New Orleans, LA, USA, 4–7 June 2000; IEEE: Piscataway, NJ, USA, 2000. y
110. Kuzmichev, A.I.; Soloshenko, I.A.; Tsiolko, V.V.; Kryzhanovsky, V.I.; Bazhenov, V.Y.; Mikhnom, L.I.; Khomich, V.A. References Agric. Sci. China 2007, 6, 682–687. [CrossRef] 81. Frisvald, J.C.; Samson, R.A. Filamentous fungi in foods and feeds: Ecology, spoilage, and mycotoxin production. In Handbook of
Applied Mycology; Arora, D.K., Mukerji, K.G., Marth, E.H., Eds.; Marcel Dekker: New York, NY, USA, 1991. 82. Maity, J.P.; Chakraborty, A.; Saha, A.; Santra, S.C.; Chanda, S. Radiation-induced effects on some common storage edible seeds in
India infested with surface microflora. Radiat. Phys. Chem. 2004, 71, 1065–1072. [CrossRef] 83. Dasan, B.G.; Boyaci, I.H.; Mutlu, M. Nonthermal plasma treatment of Aspergillus spp. spores on hazelnuts in an atmospheric
pressure fluidized bed plasma system: Impact of process parameters and surveillance of the residual viability of spores. J. Food
Eng. 2017, 196, 139–149. [CrossRef] g
84. Dasan, B.G.; Mutlu, M.; Boyaci, I.H. Decontamination of Aspergillus flavus and Aspergillus parasiticus spores on hazelnuts via
atmospheric pressure fluidized bed plasma reactor. Int. J. Food Microbiol. 2016, 216, 50–59. [CrossRef] p
p
p
J
,
,
[
]
85. Šerá, B.; Zahoranová, A.; Bujdáková, H.; Šerý, M. Disinfection from pine seeds contaminated with fusar
& O’Donnell using non-thermal plasma treatment. Rom. Rep. Phys. 2019, 71, 1–12. 85. Šerá, B.; Zahoranová, A.; Bujdáková, H.; Šerý, M. Disinfection from pine seeds contaminated with fusarium circinatum nirenberg
& O’Donnell using non-thermal plasma treatment. Rom. Rep. Phys. 2019, 71, 1–12. 86. Filatova, I.; Azharonok, V.; Shik, A.; Antonuk, A.; Terletskaya, N. Fungicidal Effects of Plasma and Radio-Wave Pre-treatments
on Seeds of Grain Crops and Legumes. In Plasma for Bio-Decontamination, Medicine and Food Security; Springer: Dordrecht, The
Netherlands, 2012; pp. 469–479. 87. Kordas, L.; Pusz, W.; Czapka, T.; Kacprzyk, R. The effect of low-temperature plasma on fungus colonization of winter wheat
grain and seed quality. Pol. J. Environ. Stud. 2015, 24, 433–438. 88. Ambrico, P.F.; Šimek, M.; Morano, M.; De Miccolis Angelini, R.M.; Minafra, A.; Trotti, P.; Ambrico, M.; Prukner, V.; Faretra, F. Reduction of microbial contamination and improvement of germination of sweet basil (Ocimum basilicum L.) seeds via surface
dielectric barrier discharge. J. Phys. D Appl. Phys. 2017, 50, 305401. [CrossRef] g
y
pp
y
89. Lee, Y.; Lee, Y.Y.; Kim, Y.S.; Balaraju, K.; Mok, Y.S.; Yoo, S.J.; Jeon, Y. Enhancement of seed germination and microbial disinfection
on ginseng by cold plasma treatment. J. Ginseng Res. 2020, 45, 519–526. [CrossRef] 17 of 18 17 of 18 J. Fungi 2021, 7, 650 90. Caetano-Anollés, G.; Favelukes, G.; Bauer, W.D. References Optimization of Surface Sterilization for Legume Seed. Crop Sci. 1990, 30, 708–712. [CrossRef] 91. Charkowski, A.O.; Sarreal, C.Z.; Mandrell, R.E. Wrinkled alfalfa seeds harbor more aerobic bacteria and are more difficult to
sanitize than smooth seeds. J. Food Prot. 2001, 64, 1292–1298. [CrossRef] [PubMed] J
92. De Geyter, N.; Morent, R. Nonthermal Plasma Sterilization of Living and Nonliving Surfaces. Annu. Rev. Biomed. Eng. 2012, 14,
255–274. [CrossRef] 93. Laroussi, M. Nonthermal decontamination of biological media by atmospheric-pressure plasmas: Review, analysis, and prospects. IEEE Trans. Plasma Sci. 2002, 30, 1409–1415. [CrossRef] 94. Moisan, M.; Barbeau, J.; Crevier, M.; Pelletier, J.; Philip, N.; Saoudi, B. Plasma sterilization. Methods and mechanisms *. Pure Appl. Chem. 2002, 74, 349–358. [CrossRef] lz, A.; Walker, M.; Schumacher, U. Sterilisation with low-pressure microwave plasmas. Surf. Coat. Technol
CrossRef] 95. Feichtinger, J.; Schulz, A.; Walker, M.; Schumacher, U. Sterilisation with low-pressure microwave
2003, 174, 564–569. [CrossRef] 96. Sato, T.; Miyahara, T.; Doi, A.; Ochiai, S.; Urayama, T.; Nakatani, T. Sterilization mechanism for Escherichia coli by plasma flow at
atmospheric pressure. Appl. Phys. Lett. 2006, 89, 88–90. [CrossRef] 97. Shimizu, T.; Steffes, B.; Pompl, R.; Jamitzky, F.; Bunk, W.; Ramrath, K.; Georgi, M.; Stolz, W.; Schmidt, H.U.; Urayama, T.; et al. Characterization of microwave plasma torch for decontamination. Plasma Process. Polym. 2008, 5, 577–582. [CrossRef] 98. Trompeter, F.J.; Neff, W.J.; Franken, O.; Heise, M.; Neiger, M.; Liu, S.; Pietsch, G.J.; Saveljew, A.B. Reduction of Bacillus subtilis and
Aspergillus niger spores using nonthermal atmospheric gas discharges. IEEE Trans. Plasma Sci. 2002, 30, 1416–1423. [CrossRef] 99. Vicoveanu, D.; Popescu, S.; Ohtsu, Y.; Fujita, H. Competing inactivation agents for bacterial spores in radio-frequency oxygen
plasmas. Plasma Process. Polym. 2008, 5, 350–358. [CrossRef] 100. Philip, N.; Saoudi, B.; Crevier, M.C.; Moisan, M.; Barbeau, J.; Pelletier, J. The respective roles of UV phot
plasma sterilization at reduced gas pressure: The case of N2-O2 mixtures. IEEE Trans. Plasma Sci. 2002, 100. Philip, N.; Saoudi, B.; Crevier, M.C.; Moisan, M.; Barbeau, J.; Pelletier, J. The respective roles of UV photons and oxygen atoms in
plasma sterilization at reduced gas pressure: The case of N2-O2 mixtures. IEEE Trans. Plasma Sci. 2002, 30, 1429–1436. [CrossRef]
101. Eisenman, H.C.; Casadevall, A. Synthesis and assembly of fungal melanin. Appl. Microbiol. Biotechnol. 2012, 93, 931–940. [CrossRef] plasma sterilization at reduced gas pressure: The case of N2 O2 mixtures. IEEE Trans. Plasma Sci. 2002, 30, 1429 1436. [CrossRef]
101. References Feature of
sterilization by different type of atmospheric pressure discharges. In Proceedings of the International Symposium High Pressure
Low Temperature Plasma Chemistry, Greifswald, Germany; 2001; pp. 402–406. p
y
y
pp
111. Laroussi, M.; Leipold, F. Evaluation of the roles of reactive species, heat, and UV radiation in the inactivation of bacterial cells by
air plasmas at atmospheric pressure. Int. J. Mass Spectrom. 2004, 233, 81–86. [CrossRef] 112. Hayashi, N.; Yagyu, Y.; Yonesu, A.; Shiratani, M. Sterilization characteristics of the surfaces of agricultural products using active
oxygen species generated by atmospheric plasma and UV light. Jpn. J. Appl. Phys. 2014, 53, 05FR03. [CrossRef] 113. Suhem, K.; Matan, N.; Nisoa, M.; Matan, N. Inhibition of Aspergillus flavus on agar media and
atmospheric plasma treatment. Int. J. Food Microbiol. 2013, 161, 107–111. [CrossRef] 113. Suhem, K.; Matan, N.; Nisoa, M.; Matan, N. Inhibition of Aspergillus flavus on agar media and brown rice cereal bars using cold
atmospheric plasma treatment. Int. J. Food Microbiol. 2013, 161, 107–111. [CrossRef] p
p
114. Avramidis, G.; Stüwe, B.; Wascher, R.; Bellmann, M.; Wieneke, S.; von Tiedemann, A.; Viöl, W. Fungicidal
pressure gas discharge and degradation mechanisms. Surf. Coat. Technol. 2010, 205, S405–S408. [CrossR üwe, B.; Wascher, R.; Bellmann, M.; Wieneke, S.; von Tiedemann, A.; Viöl, W. Fungicidal effects of an atmosph p
g
g
g
f
115. Mendis, D.A.; Rosenberg, M.; Azam, F. A note on the possible electrostatic disruption of bacteria. IEEE Trans. Plasma Sci. 2000, 28,
1304–1306. [CrossRef] 116. Montie, T.C.; Kelly-Wintenberg, K.; Reece Roth, J. An overview of research using the one atmosphere uniform glow discharge
plasma (OAUGDP) for sterilization of surfaces and materials. IEEE Trans. Plasma Sci. 2000, 28, 41–50. [CrossRef] 116. Montie, T.C.; Kelly-Wintenberg, K.; Reece Roth, J. An overview of research using the one atmosphere uniform glow discharge
l
(OAUGDP) f
t
ili
ti
f
f
d
t
i l
IEEE T
Pl
S i 2000 28 41 50 [C
R f] 117. Kang, M.H.; Hong, Y.J.; Attri, P.; Sim, G.B.; Lee, G.J.; Panngom, K.; Kwon, G.C.; Choi, E.H.; Uhm, H.S.; Park, G. Analysis of the
antimicrobial effects of nonthermal plasma on fungal spores in ionic solutions. Free Radic. Biol. Med. 2014, 72, 191–199. [CrossRef] 117. Kang, M.H.; Hong, Y.J.; Attri, P.; Sim, G.B.; Lee, G.J.; Panngom, K.; Kwon, G.C.; Choi, E.H.; Uhm, H.S.; Park, G. Analysis of the
antimicrobial effects of nonthermal plasma on fungal spores in ionic solutions. .
a g, M.
.;
o g,
.J.;
tt , .; S
, G. .;
ee, G.J.;
a
go
,
.;
wo , G.C.; C o ,
.
.; U
,
.S.;
a k, G.
a ys s o t e
antimicrobial effects of nonthermal plasma on fungal spores in ionic solutions. Free Radic. Biol. Med. 2014, 72, 191–199. [CrossRef]
118. Lu, Q.; Liu, D.; Song, Y.; Zhou, R.; Niu, J. Inactivation of the tomato pathogen Cladosporium fulvum by an atmospheric-pressure
cold plasma jet. Plasma Process. Polym. 2014, 11, 1028–1036. [CrossRef] ,
;
,
;
g,
J
y
, ,
[
]
121. Lee, G.J.; Sim, G.B.; Choi, E.H.; Kwon, Y.W.; Kim, J.Y.; Jang, S.; Kim, S.H. Optical and structural properties of plasma-treated
Cordyceps bassiana spores as studied by circular dichroism, absorption, and fluorescence spectroscopy. J. Appl. Phys. 2015, 117,
023303. [CrossRef] [
]
122. Chiang, M.H.; Wu, J.Y.; Li, Y.H.; Wu, J.S.; Chen, S.H.; Chang, C.L. Inactivation of E. coli and B. subtilis by a parallel-plate dielectric
barrier discharge jet. Surf. Coat. Technol. 2010, 204, 3729–3737. [CrossRef] 119. Panngom, K.; Lee, S.H.; Park, D.H.; Sim, G.B.; Kim, Y.H.; Uhm, H.S.; Park, G.; Choi, E.H. Non-thermal plasma treatment
diminishes fungal viability and up-regulates resistance genes in a plant host. PLoS ONE 2014, 9, e99300. [CrossRef]
120. Laroussi, M.; Mendis, D.A.; Rosenberg, M. Plasma interaction with microbes. New J. Phys. 2003, 5, 41. [CrossRef] 123. Korachi, M.; Gurol, C.; Aslan, N. Atmospheric plasma discharge sterilization effects on whole cell fatty acid profiles of Escherichia
coli and Staphylococcus aureus. J. Electrostat. 2010, 68, 508–512. [CrossRef] diminishes fungal viability and up-regulates resistance genes in a plant host. PLoS ONE 2014, 9, e99300. [CrossRef]
120. Laroussi, M.; Mendis, D.A.; Rosenberg, M. Plasma interaction with microbes. New J. Phys. 2003, 5, 41. [CrossRef] 124. Song, H.P.; Kim, B.; Choe, J.H.; Jung, S.; Moon, S.Y.; Choe, W.; Jo, C. Evaluation of atmospheric pressure plasma to improve
the safety of sliced cheese and ham inoculated by 3-strain cocktail Listeria monocytogenes. Food Microbiol. 2009, 26, 432–436.
[CrossRef] [PubMed] g
y
p
g
g
p
120. Laroussi, M.; Mendis, D.A.; Rosenberg, M. Plasma interaction with microbes. New J. Phys. 2003, 5, 41. [CrossRef] References Free Radic. Biol. Med. 2014, 72, 191–199. [CrossRef]
118. Lu, Q.; Liu, D.; Song, Y.; Zhou, R.; Niu, J. Inactivation of the tomato pathogen Cladosporium fulvum by an atmospheric-pressure
cold plasma jet. Plasma Process. Polym. 2014, 11, 1028–1036. [CrossRef] 118. Lu, Q.; Liu, D.; Song, Y.; Zhou, R.; Niu, J. Inactivation of the tomato pathogen Cladosporium fulvum by an atmospheric-pressure
cold plasma jet. Plasma Process. Polym. 2014, 11, 1028–1036. [CrossRef] 18 of 18 18 of 18 J. Fungi 2021, 7, 650 g
y
p
g
g
p
120. Laroussi, M.; Mendis, D.A.; Rosenberg, M. Plasma interaction with microbes. New J. Phys. 2003, 5, 41. [CrossRef] 121. Lee, G.J.; Sim, G.B.; Choi, E.H.; Kwon, Y.W.; Kim, J.Y.; Jang, S.; Kim, S.H. Optical and structural properties of plasma-treated
Cordyceps bassiana spores as studied by circular dichroism, absorption, and fluorescence spectroscopy. J. Appl. Phys. 2015, 117,
023303. [CrossRef] 122. Chiang, M.H.; Wu, J.Y.; Li, Y.H.; Wu, J.S.; Chen, S.H.; Chang, C.L. Inactivation of E. coli and B. subtilis by a parallel-plate dielectric
barrier discharge jet. Surf. Coat. Technol. 2010, 204, 3729–3737. [CrossRef] 123. Korachi, M.; Gurol, C.; Aslan, N. Atmospheric plasma discharge sterilization effects on whole cell fatty acid profiles of Escherichia
coli and Staphylococcus aureus. J. Electrostat. 2010, 68, 508–512. [CrossRef] 124. Song, H.P.; Kim, B.; Choe, J.H.; Jung, S.; Moon, S.Y.; Choe, W.; Jo, C. Evaluation of atmospheric pressure plasma to improve
the safety of sliced cheese and ham inoculated by 3-strain cocktail Listeria monocytogenes. Food Microbiol. 2009, 26, 432–436. [CrossRef] [PubMed]
| 7,896 |
https://github.com/isuhao/ravl2/blob/master/RAVL2/Image/Processing/ChartDetector/chartdet.cc
|
Github Open Source
|
Open Source
|
BSD-Source-Code
| null |
ravl2
|
isuhao
|
C++
|
Code
| 595 | 2,156 |
// This file is part of RAVL, Recognition And Vision Library
// Copyright (C) 2004, University of Surrey
// This code may be redistributed under the terms of the GNU Lesser
// General Public License (LGPL). See the lgpl.licence file for details or
// see http://www.gnu.org/copyleft/lesser.html
// file-header-ends-here
//! rcsid="$Id: chartdet.cc 6169 2007-05-28 15:59:25Z craftit $"
//! lib=RavlChartDetector
//! docentry="Ravl.API.Images.Chart Detector"
//! file="Ravl/Image/Processing/ChartDetector/chartdet.cc"
//: Calibration Chart Detector
// Locates a calibration chart in an image.
#include "Ravl/Image/ChartDetector.hh"
#include "Ravl/Image/ChartLocalise.hh"
#include "Ravl/IO.hh"
#include "Ravl/StringList.hh"
#include "Ravl/Option.hh"
#include "Ravl/SArray1dIter3.hh"
#include "Ravl/SArray1dIter2.hh"
#include "Ravl/Image/WarpProjective.hh"
#include "Ravl/Image/DrawCross.hh"
#include "Ravl/Image/DrawCircle.hh"
using namespace RavlN;
using namespace RavlImageN;
//: Load chart points
SArray1dC<Point2dC> LoadChartPoints(StringC &filename) {
IStreamC is(filename);
if(!is)
return SArray1dC<Point2dC>();
DListC<Point2dC> points;
while(is) {
StringC buffer;
readline(is,buffer);
StringListC lst(buffer);
if(lst.Size() < 2)
continue;
DLIterC<StringC> it(lst);
Point2dC p;
for(int i = 0;i < 2;i++,it++)
p[i] = it->RealValue();
points.InsLast(p);
}
// Copy points to an array.
SArray1dC<Point2dC> ret(points.Size());
SArray1dIterC<Point2dC> rit(ret);
for(DLIterC<Point2dC> it(points);it;it++,rit++)
*rit = *it;
return ret;
}
int main(int nargs,char **argv) {
OptionC opt(nargs,argv);
bool verbose = opt.Boolean("v",true,"Verbose mode. ");
bool displayCourse = opt.Boolean("dc",false,"Display course localisation. ");
bool displayMatches = opt.Boolean("dm",false,"Display matches. ");
RealT inlierThreshold = opt.Real("id",10,"Inlier distance threshold. ");
UIntT ransacIterations = (UIntT) opt.Int("ri",50000,"RANSAC iterations to use in search.");
RealT acceptThreshold = opt.Real("at",0.7,"Threshold at which to just accept hypothesis ");
UIntT minRegionSize = opt.Int("ms",100,"Minimum region size to consider.");
UIntT minRegionMargin = opt.Int("mm",10,"Minimum region stability margin.");
UIntT patchSize = opt.Int("p",40,"Patch size. ");
StringC chartName = opt.String("c",PROJECT_OUT "/share/RAVL/pixmaps/CalibrationChart.png","Image of chart to search for. ");
StringC chartCoordFile = opt.String("co",PROJECT_OUT "/share/RAVL/pixmaps/CalibrationChart.coords","Calibration coordinages in the chart. ");
StringC matchFilename = opt.String("mf","","File containing matched coordinates.");
StringC sceneName = opt.String("","image.pgm","Image in which to search for chart. ");
opt.Check();
// --- Load some data ---
if(verbose)
cerr << "Loading chart image " << chartName << "\n";
ImageC<ByteT> chartImage;
if(!Load(chartName,chartImage)) {
cerr << "Failed to load image of chart. \n";
return 1;
}
SArray1dC<Point2dC> chartPoints = LoadChartPoints(chartCoordFile);
if(chartPoints.Size() == 0) {
cerr << "Failed to load chart coordinates from " << chartCoordFile << " \n";
return 1;
}
if(verbose)
cerr << "Loaded " << chartPoints.Size() << " calibration points \n";
if(verbose)
cerr << "Loading scene image " << sceneName << "\n";
ImageC<ByteT> sceneImage;
if(!Load(sceneName,sceneImage)) {
cerr << "Failed to load image to search. \n";
return 1;
}
// --- Find approximate position of chart in the image ---
if(verbose)
cerr << "Setting up chart detector. \n";
ChartDetectorC chartDetector(chartImage,minRegionSize,minRegionMargin);
chartDetector.SetInlierThreshold(inlierThreshold);
chartDetector.SetRANSACIterations(ransacIterations);
chartDetector.SetAcceptThreshold(acceptThreshold);
if(verbose)
cerr << "Searching for chart. \n";
Projection2dC transform;
if(!chartDetector.Apply(sceneImage,transform)) {
cerr << "Failed to find the chart in the image. ";
return 2;
}
if(verbose)
cerr << "Transform =" << transform << "\n";
// --- Do fine localisation of chart ---
if(verbose)
cerr << "Setting up fine localisation. \n";
ChartLocaliseC localise(chartImage,chartPoints,patchSize);
localise.SetVerbose(verbose);
if(displayCourse) {
// Put off display to here so we can use localise's Chart2Example routine.
WarpProjectiveC<ByteT> pwarp(chartImage.Frame(),transform.Inverse());
ImageC<ByteT> pimage = pwarp.Apply(sceneImage);
//RavlN::Save("@X:Ref",patch);
for(SArray1dIterC<Point2dC> it(chartPoints);it;it++)
DrawCross(pimage,(ByteT) 0,Index2dC(localise.Chart2Example(*it)),4);
Save("@X:PositionEstimate",pimage);
}
SArray1dC<Point2dC> matches;
SArray1dC<bool> matchesOk;
if(verbose)
cerr << "Computing fine localisation. \n";
localise.Apply(sceneImage,transform,matches,matchesOk);
UIntT pass = 0;
for(SArray1dIterC<bool> it(matchesOk);it;it++) {
if(*it)
pass++;
}
if(verbose)
cerr << "Found " << pass << " matches. \n";
if(displayMatches) {
ImageC<ByteT> simage(sceneImage.Copy());
for(SArray1dIter2C<Point2dC,bool> it(matches,matchesOk);it;it++) {
DrawCircle(simage,(ByteT) 255,it.Data1(),3);
if(it.Data2())
DrawCross(simage,(ByteT) 0,it.Data1(),3);
}
Save("@X:Matches",simage);
}
if(!matchFilename.IsEmpty()) {
if(verbose)
cerr << "Writing match file '" << matchFilename << "'\n";
OStreamC os(matchFilename);
if(!os) {
cerr << "Failed to open output file '" << matchFilename << "'\n";
return 1;
}
os << pass << "\n";
for(SArray1dIter3C<Point2dC,Point2dC,bool> it(chartPoints,matches,matchesOk);it;it++) {
if(it.Data3())
os << it.Data1() << " 0 " << it.Data2() << "\n";
}
}
// --- Actually do some calibration ?? ---
if(verbose)
cout << "Done. \n";
return 0;
}
| 47,884 |
https://www.wikidata.org/wiki/Q96312785
|
Wikidata
|
Semantic data
|
CC0
| null |
Brunnsvikens trädgård
|
None
|
Multilingual
|
Semantic data
| 103 | 345 |
Brunnsvikens trädgård
handelsträdgård i Solna kommun
Brunnsvikens trädgård instans av plantskola
Brunnsvikens trädgård land Sverige
Brunnsvikens trädgård inom det administrativa området Solna kommun
Brunnsvikens trädgård bild Brunnsvikens trädgård, juni 2020c.jpg
Brunnsvikens trädgård geografiska koordinater
Brunnsvikens trädgård uttal (ljudfil) LL-Q9027 (swe)-Moonhouse-Brunnsvikens trädgård.wav, verkets eller namnets språk svenska
Brunnsvikens trädgård Commons-kategori Brunnsvikens trädgård
Brunnsvikens trädgård
Brunnsvikens trädgård instance of plant nursery
Brunnsvikens trädgård country Sweden
Brunnsvikens trädgård located in the administrative territorial entity Solna Municipality
Brunnsvikens trädgård image Brunnsvikens trädgård, juni 2020c.jpg
Brunnsvikens trädgård coordinate location
Brunnsvikens trädgård pronunciation audio LL-Q9027 (swe)-Moonhouse-Brunnsvikens trädgård.wav, language of work or name Swedish
Brunnsvikens trädgård Commons category Brunnsvikens trädgård
| 16,448 |
https://github.com/JasperFloorBloomreach/gov-scot/blob/master/repository-data/webfiles/src/scripts/govscot/component.google-analytics.js
|
Github Open Source
|
Open Source
|
MIT
| 2,020 |
gov-scot
|
JasperFloorBloomreach
|
JavaScript
|
Code
| 79 | 271 |
// GOOGLE ANALYTICS COMPONENT
/* global window, initGTM */
(function() {
'use strict';
function setUserType(userType) {
window.dataLayer[0].userType = userType;
}
window.dataLayer = window.dataLayer || [{}];
var xhr = new XMLHttpRequest();
xhr.open('GET', '/service/usertype', true);
xhr.timeout = 1000;
xhr.onreadystatechange = function() {
if (xhr.readyState === 4) {
var userType;
if (xhr.status === 200) {
var response = JSON.parse(xhr.responseText);
userType = response.userType;
} else {
userType = 'error';
}
setUserType(userType);
initGTM();
}
};
xhr.ontimeout = function() {
setUserType('timeout');
initGTM();
};
xhr.send(null);
})();
| 21,214 |
bim_eighteenth-century_arguments-and-decisions_dreghorn-john-maclaurin_1774_43
|
English-PD
|
Open Culture
|
Public Domain
| 1,774 |
Arguments, and decisions, in remarkable cases, before the High Court of Justiciary, and other supreme courts, in Scotland. Collected by Mr Maclaurin. 1774
|
Dreghorn, John Maclaurin, Lord.
|
English
|
Spoken
| 7,562 | 11,692 |
1152 3115 b. 177. ee Sams. ariſing from the exceſi ve uſe of ſpiritous li quors, ©:c.,—In Collection academigue Sur P hiſtoire, naturelle, &c. à Di- jon 1756, tom. 4. p. 15. 16. it is ſaid, that flame may be made to come out of the ſtomachs. of. dead animals, by a certain method of tying, ſqueezing, and then opening them. It is there too related, that at ſeveral public diflec- tions, VAPQUFs in the ſtomach. of the ſubject had ſeveral times. taken fire. The chapter in that bock from which theſe particulars are taken, concludes i in theſe words. '** Ce.n'elt. pas ſeulement de Veſtomac des cadavres qu'on a va ſortir des ftammes 3 ; pluſicurs auteurs tres connus aſſeurent, que ce meme pheno- mene a Fe gbſcrvs dans . les hommes vivans. Thomas, Bartholin, cent. 1. «. rapporte..d apres 4 Adolph.,. ' Orſtuis, au- un cavalier Folonois du tems de «. 1a Reine Bone, ayant bü deux verres deau de vie, toit mort, apres wne ee des flammes tar la bouche. Le meme Bartholin, cent. 3. 5 * F rapporte 5 Ne 66, A D DPIT ION S and N' O'TE-8, 755 räpporte encore Vhiſtoire de trois autres perſonnes, qui ars une debauc hie «'\P'enu*de vie, Eprouverent les memes red. dont deux furent auſſi & Suffoguts ar les flammes, et le troifieme n' evita la mort qu'en buvant © Protnptement de Peaut froid, et ce qui convenoit encore Aus du 11 de “ chevre.” 50 TH * CI No 69. p. 186. Caſe of Forbes, 1758. Viriginis immature contrectatio, Oc. | ad 4 | 111 ' I * 777 1p44 Forbes's crime was aggravated by the higheſt breach of truſt ; and his caſe ſeems Tomewhat analogous to that of a tutor who debauches his ward, or of a prieſt who debauches women whoſe confeſſor he is. The , courts of France, though without any particular law againſt theſe crimes, have not ſcrupled however to inflict a capital puniſhment on thoſe who have been guilty of them. « Arret du parlement de Grenoble, du 31. Janvier 1660, qui condamna un « pretre d' tre pendu, puis brule, pour avoir abus6 du ſacrement de confeſ- « ſion, porte ſes mains ſur le ſein et autres parties de plus de cent femmes cc pendant qu'il confeſſoit. Baſſet, tom. 1. liv. 6. tit. 19. chap. 6. 4 Dick. des arreſts, v Voce. * condamne à mort, 7 Y ayant ni boy ni ordonnance qui 225 cette peine « ce crime. Ce proces a été juge à la Tournelle criminelle, par arret du « 22, Juin 1673, lequel a confirme la ſentence du lieutenant criminel du cha- “ telet de Paris, et le lendemain 23. Ce pretre, directeur de religieuſes, fit « 'amende honorable à Notre Dame, enſuit il fut pendu et brulẽ avec ſon pro- « ces, dans la place Maubert. Journal du Palais, tome 2. pag. 972. et ce cy-apres inceſte Jpirituet. ” Vn tuteur ayant Etc trouve par les Capitouls couche en 1 cheniſe, avec fa „ pupille, agee de 10 a 11 ans, toute nue, dans un lit, Etant appellant de la * ſentence de Capitouls, qui Pavoient condamne a étre mis en quatre quar- « tiers: mais ætant certific par la viſite faite par deux bartuers et deux ſages * femmes, que la fille n'avoit point &te deflorèe, fut ſeulement condamne à cc faire amende honorable en audience, en chemiſe, tete nue, la Tarr au col, &« et une torche ardente en la main, et aux galeres pour dix ans, et en 500 < leres vers la dite pupille pour ſon marriage, et en 100 livres à la reparation e de la ville Arrit du þ. du Ti oulouſe, du 13: Sept. 1 '5 81. Diet. des 0 ar. « reſts, v Voce Tuteur, tome 3. b. 78 1. n. 44. Se? N W 5 C 2 It 756 APP) HI NN Oo W M Kaner mch thatſt did ot appear from tha cvidance Forbes had raviſhed auy of the girls, but that they were rather willing. They ere not put upon cath, I was preſent when he received his ſentence ; and remember, that after it was pronounced he made a long canting ſpeech to the court, full of quotations from ſcrigture - Some of them\ being ; peculiarly\improper, and; oceaſioning laughter, the court ſilenced him before he had done. July 3. 1638, William Bell, convict of raviſhing Janet Palconar, a girl of twelve ytars of age; er rſpenſi\i; e. hanged. ' MS. Abſt. i. 240 Feb 40, 1639, Henry Spendie, butcher in Edinburgh, was indicted for forcin g, deflowering, (See p.go.) / and abuſing, the body of Agnes Stewart, an infant of fix years of age, by riving [tearing] her ſecret parts, to the effuſion of her blood, and hazard of her life, He judicially confeſſed the fact, and two doc. tors and a ſurgeon deponed, . Quod parietes pudendi erant excoriati ab agi- tatione; quod ĩmum pudendum, qua cum anu conjungitur, erat laceratum; quod la ſumma parte pudendi os pubis erat depreſſum; quod partes in- « cumbentes illi valde intumeſcebant, et magno cum dolore cruciaban- « tur; preeterca quod ipſa capacitas pudendi erat dilatata ad quantitatein « pudendi fere in pubere; et hæc cenſemus eſſe vera indicia læſæ virginitatis | « rypte.”—He was found guilty, and fentenced to be hanged.” MS. Abſt. 1. 3757 376 A libel for the very ſame fact was found relevant againſt James Gray cobler; Aug. 9. 170g. The jury found, That the child Iſabel Cleugh | was in the houſe with James Gray, but not ſeen until the door was opened ; and found tlie ſaid James Gray was lying on the floor, moving his belly up and down,” and that he refuſed to open the door after ſcveral rude knocks.— He was diſiniſſed. In this caſe it was pleaded for the pannel, That there was no lacetationlibelted.” Anl. Though that be an aggravation when it happens, yet ſpecialties may prevent it. In 1761, one Ripley, a corporal, was hang- ed for raviſhing a girl of fix years of age.— There was a terrible laceration pro- red in chat caſ e | Feb. 2. 1641; Alexander Gylor, climber in the Baſs, indicted for the rape of Janet Bouſſie, à gitl of ten years of age.— The proof was, declarations by midwives and doctors of the child having her body lacerate; but no proof is recorded of the pannel having committed the crime. The aſſize, however, found him eulpable and guiſty; with this declaration, That they could not find, nor affirm, that the pannet had fick [ſuch] carnal copulation with the young virgin as à man has with a woman, in reſpect of her young years.—He was entenced, in obediencb to an àct of coukil, to be ſcourged, burnt in the | | cheek, Ne 6g. ADPDITIONSVHaH N Or S. 75 check and baniſhed for life; and to be impriſoned," til aft opportetitty offer of lending lim 3 SIGs _ * ur n W. 03 md eig dt 10 e 31 29316 1601 (1, | 16 7 fai 59719591 51 Nee moioryg an! 11 1013810UP 10 t JTHOD * I 01 N55: q! 2 HATS Aol 6 5 0 *311 HD OOETLLOTOTE! Q o d ti N. 2696" Caſe of Janet Heath, "ou child. muri: 50. Our act 1690 ſeems tohave been copied from a Frenchy ſtatute ; ; which i is thus ſtated in, the Dict. des Arr. There is a paſſage in Principles of 3 law, which, gals SG I can not forbear tranſcribing : © Penal laws are to check the arm of wickedneſs, hut not to wage war with the natural ſentiments, of the heart. | Contrary to, c this principle is the ſtatute, , which, making the concealment. of pregnancy a undeniable evidence of. Oo compeils unhappy women to, break through. J 50 <1 „ aer Se H N DTT * « through the betoming pride and modeſty of ther ſex, and tö be tlie firſt « officious publiſhers of their owt! ihe?” Then in a note, 21{t James I. Thar worten delivered of baftstd children, to avoid their ſhame, & 1d to efthpe pultſhnitht, do ſecretiy tity ati Conctal the deatli of iti <VWHiIdrE ig tlie prcambple of tlie ſtatüte? tlie modern *expoſition oft „Which 1s a good mane, that cruel laws have a natural tendency to their « Own diffolutiön lin the Abhorrence of mankind. It is now the conſtant prac- «tice of the coutts fts”to require, , that the body of the child ſhall be found, be. et Hofe A vidi ion bike lace: an d if it ſhould happen, that the mo- 1 N 6 ther h had any cildbed. linen, ec Sthel preparatives in her poſſeſſion, p prior & to her delivery, 1 it is 5 generally admitted as a proof, that no concealment was 6 intended. Laſtly, it it is not unuſual to require ſome degree of evidence, « that the child was actually born alive, before the ungenerous preſumption, M (FU the mother was the wilful author of the death of her new -born infant, 4A Perl mitted to'affe& her. Theſe humane deviations, from the harſh in- cc junctions of t the ſtatute, have nearly amounted to a tacit abrogation | Kg Ser, too, Voltaire? 8 Commentary on Beccario's book, 5 1. It is not a little ſurpriſing, that the laws of poliſhed nations ſhould have dif- fered 0 very much as to infanticidium. It is allowed to parents at this day amon g the ( Chineſe and thouſands of infants ate expoſed and periſh every year at Bean in the moſt, ſhocking manner. See Recherches Philoſoph. ſur les Egyptiens © et les Chinois, tom. 1.Þ. 61. | It was allowed in ſeveral ſtates of Greece; and Ariſtotle approves of giving this right to parents. See Noodt's treatiſe, intitled, Fulius Paulus ; ive De parti expoſitione et nece apud veteres, c. 1. Though it was not permitted by Romulus, or the laws of the Twelve Tables; yet it took place among the Römans thi das, and continued even under the reign of Conſtantine, and other Chriſtian Emperors. It was firſt diſcharged, under pam of deaths, by Valeitinian, J. 2: ay De infant. ea; ; id. ibid. c. 2. 5. 6. The ane auther ttatiſcrbes 5 a paſſage from Plutarch; from which it ap- pears, that the Stoics held the ped in utero to be partem ventris, non ani- mal, Empedocles fœtus non eſſe quidem animal, ſpiritu tamen præditum, 4 in utero; primam autem animalis reſpirationem fieri cum partu editur, « decedent humore « qui e elt i n foetu, et in exhauſti locum ſuccedente in vaſa L 11 EDU) OTNT Of Dios 0 6 xeſerata | Acre C: externo. Jiogenes inanimata naſci animalia; ſed cum calore E ] . 91 ce atque inſitum calorem na ul atque natum eſt animal, animum in pulmone ; 4e attrahere. Herophilus naturalem fœœtui in utero non animatem motum per- cc N mittit, Net: ADH ION S. and NOTES. 259 * mittit, motuſque cauſam edit nervos; animalia autem tum demum fieri, cum ex utero effuſa aliquid aeris accipiunt.“ Ihis ſtrange theory, that the fœtus is at no time alive in the belly, though it may go far to excuſe women who procure abortions, yet has not the; leaſt tendency, to excuſe the expoſing the foetus after it has drawn breath ; 3. upon which all agree it immediately becomes an animal. The law of I England ſeems, in ſome meafure, to have adopted this theory. By that law, (according to Hale), the plea of pregnancy does not ſtay execu- tion of a capital ſentence, unleſs the woman be with child of a quick child ; Pleas of the crown, vol. 1. p. 368. 369- This ſuppoſes the theory of genera- tion to be better aſcertained than it is, or, in all probability, ever will be. How can it be known, but that the fœtus may be alive before it ſtir in the belly ſo as that its motions may be felt? See the Ency OR 0 voce Ame, vol. 1. p. 330. 7171 tains, that the fœtus is completely formed in ſemine virili; and he = "wh that, with a microſcope, he ſaw one perfect in all its parts in a drop of that liquor let fall into a glaſs of water. He gives a drawing of this homuncio ; from this he infers, that le premier accouchement is by the male, the her by t the female; and that the two differ only as majus et minus; ; Gautier, obſ.. ſur Phiſt. natur. d Paris, 1756. If this theory be juſt, many Tun inferences as to child murder might be drawn from it. But the law does not view things with microſcopic eyes. See, as to this theory, Ency clopedie, voce Ap es. The plea of pregnancy, ſupported by the affidavit of midwives, has been al- : ways ſuſtained by the court of juſticiary, without ever inquiring (o far as Lre- member) whether the woman be with quick child or not. The Roman law makes no ſuch diſtinction; J. 18. F. De /tat. hom. It does not allow a woman with child to be put to the torture; J. 3. F. De jen. Neither indeed ought ſhe to be whipped, or made to undergo any corporal puniſhment that muſt oc- caſion a violent ſnock to the body. The French courts alſo ſtay, execution. when the , pregnancy is certain, without | inquiring further ; ;. Did. des arr. un- der G Groſſeſſe celee. If the idea upon which the law of England juſt n. now mentioned, Proceeds, be well founded, does it not follow, that a woman ho procures an abortion. before the child be quick, ought, not to be at all puniſhed A yet all la awyers are: agreed, that ſhe incurs an arbitrary puniſhments, N 72. 7 ADDITIONS wd NOTES wy, No 72. p. 211. Caſe of Janet Ronald, 1763. OPINIONS on this Caſe. Stricnrn. I am of opinion, that adjourning the court falls under the two acts. It has been the conſtant practice to incloſe immediately. If one ad- journment be made, another may be made; and ſo one juryman might have fallen ill again. Supported by practice, Sir G. Mackenzie and L. Royſton. Nota, This was irregular to adjourn before the jury incloſe. Notes on two caſes in Sir G. Mackenzie. : If a neceſſity ſhould happen, the jury may be diſmiſſed, and the pannel pro- ſecuted anew. Nothing in the law hinders it: the peace of the public re- quires it. AVUCHINLECK. I am of opinion, that it is not in tlie power of the court to adjourn, after the jury is charged with a pannel. The great ſecurity of ſub- jects is trial by juries : particular care to keep them chaſte. If, after the jury 1s charged with the pannel, there are opportunities to tam- per, the trial muſt fall; the verdict they give cannot produce a ſentence, Pannel now intitled to be acquitted, becauſe proceedings irregular, It would be dangerous if ſuch accidents ſhould produce an abſolute acquittal, In England, many inſtances of diſcharging a jury, and taking a new one. Whitebread's cafe, 1679, a bad one, and juſtly cenſured. Lord Delamere's caſe. But in later caſes, it is fixed, that when ſuch a happens, the jury may be diſcharged, and a new one ſet. I am for putting it into the interlocutor, that the jury might have been diſ. charged, and the pannel tried anew. ALEMOOR. Lam of opinion we did wrong. A jury ought never to be ad- journed on any account, after charged with the pannel. This does not fall di- rely under the acts; but it is there ſuppoſed, that they are to incloſe directly: So Sir George Mackenzie; and he — diſapproves of the two deciſions. Practice has confirmed this. An adjournment, even before proof is finiſhed, the ſame — of tam= pering. I am alſo of opinion, that the jury might have been diſmiſſed, and the pannel tried anew. At the ſame time, no diſcretionary power of diſmiſſing the jury; it can only be in caſes of the moſt urgent neceſſity. There wil ADD T1 Om & md NOS. n — 88 is no reaſon or ſenſe, * ſuch accidents ſhould operate a total ac- qui In England, the ſolid rule is, That a jury once charged, cannot be diſcharged without a verdict. But in caſes of accident, they may be diſcharged, and the pannel tried anew. There may be a diſcharge in caſes of neceſſity, but not a voluntary one. Had the judges at Perth diſcharged the j 1 the pannel * have been tried ane w; but ſhe has ſuffered by going on, and may be under difadvanta- ges as to a new trial, Kaus. Iam of opinion, that the diets of, the juliciary-court, are on” Nee eee the trial muſt fall. I alſo think, that the pannel may be tried anew. Lam not clear how far, in this caſe, the pannel may not * tried anew: however, I acquieſce. AT; JosTICE-CLERK. The court al agree. Of ſane | opinion. 1 always thought that no adjournment can be made, The inſtance may Peril, and a new trial brought, agreeable to the law of England. Dangerous, if the] jury has gone through the town, to impannel them a- The ſanftion of a jury 8 being tampered with,! is to acquit, by the acts. . Conſent cannot do in a capital caſe ; and in others, riot unleſs there be the utmoſt neceſſity. , Feb. 19. 1672, Henry Gordon having been brought to trial for deforce- ment, the verdi& returned was, Having conſidered the libel, and depoſi- tions of witneſſes, againſt Henry Gordon of Braco, the verdict of the aſſize « is, Guilty, except three perſons.” —Sentence was delayed till the 26th. Then it was objected by the counſel for the pannel, That no regard can be paid to the verdict, becauſe two of the jurors, before it was Wrote out and ſubſcri- bed, went out of the room in which they were incloſed, and ſpoke with ſeve- ral perſons, and did not return, until a macer, and another perſon, expoſtu- lated with them, and forced them back; which was s Clearly contrary” to the OP: | | Ihe two jurors did not come out from any bad defign, and not till aſs hy verdict v Was agreed to; E and the | jury only « can n judge, whether the ſta- | 5D TY. OR ' tute 14 Ne: 1. f Wat * n 252 ADDITIONSiad NOTES. No 5 tute has been contravened ; for the act expreſily ſays, they are warranted to aſſoilzie the pannel. Replied, The meaning of the act is not ſuch : and it would have been ab- ſurd if it had; for what if the whole jurors had withdrawn before the verdict was ſubſcribed ? It cannot be maintained, that they themſelves muſt judge whether they had diſobeyed the acc. The jury have not an arbitrary power of acquitting or not: when the act is diſobeyed, they muſt acquit ; and the court, finding the matter of fact relevant, and proved, may ordain the j jury to aſſoilzie, and declare the pannel free. | The court, by their interlocutor, repelled the alledgeance, in reſpect of the anſwer, © unleſs the pannel would alledge in thir terms, © viz. That ſome of & the members of inqueſt came out before the votes were concluded; and af. te ter gathering thereof, the chancellor had verbally intimate the fame to the ce aſſize, albeit the verdict was not formally reduced in ſcriptis, and ſubſcri- e bed: And the Lords find, That they themſelves are judges to the relevancy ce of the ſaid alledgeance ; and the. probation: ought to be before them, and « thereafter to be remitted to the ſame aſſtze; who were to incloſe, and re- turn their verdict thereanent. MS. Abſt. iii. 127. No 74. p. 258. Caſe of Sir Fohn Gordon, 1766. King's Advocate cannot be compelled to give his inſtance to a proſecution. Jan. 24- 1726, a petition was preferred to the court of juſticiary by Marga- ret Jamieſon, and other people in Glaſgow, ſetting forth, · That a bill for ob- taining criminal letters, at their inſtance, charging Captain Buſhell, and others, to appear and ſtand trial, for the crimes of murder and mutilation, committed by them upon a number of perſons, near relations to the petitioners : That this bill was preſented to his Majeſty's Advocate, and his concurrence required in common form; and after ſeveral proteſts taken againſt him, he alledges, that certain remiſſions from his Majeſty have been preſented to him, pardoning the crimes of which the ſaid perſons were accuſed ; and that therefore no con- courſe for the crown can be given: That the petitioners ſhall not enter upon the queſtion, Whether the Advocate ought to concur, notwithſtanding theſe re- miſſions ? but ſhall only obferve, ſhe knows not whether theſe have been duly obtained and expede, nor indeed any thing at all about them ; and therefore the proſecution ſhould go on, till theſe are pleaded on by the parties accuſed, when the * will have an opportunity of objecting to them: That in ſeveral No 74. ADDITIONS and NOTES. 763 ſeveral caſes, proſecutions had been carried on after the Advocate's concourſe was withdrawn, as in the caſe of a ſoldier tried ſome years ago for a murder, and Charteris's caſe. Since, then, proſecutions may be carried on after the Advocate's concourſe is withdrawn, it is plain they may be commenced with- out it. Beſides, it was never pretended he can prejudge the claim of the pri- vate proſecutor to an aſſythment; and therefore the proſecution ſhould go on, as an aſſythment is not due till conſtat de crimine; and that cannot be cog- noſced any where but in this court ; therefore praying their Lordſhips to grant warrant for criminal letters,” &c. Jan. 24. 1726, the court ordained this petition to be anſwered by his Ma- jeſty's Solicitor and Advocate by to-morrow at twelve o'clock. Jan. 27. an- ſwers were put in for the Solicitor ; in which it is admitted, © That his con- courſe had been required, as ſet forth in the petition ; but he repreſented, That the intended proſecution was not of a private nature ; that it concerned the adminiſtration of his Majeſty's government and public juſtice ; and as to ſuch, it had never been thought, that the crown-lawyers were under the power and direction of private complainers. It was their duty not to give the concourſe of the crown to vexatious ſuits ; and in no caſe did the court ever enjoin or ordain the Advocate to give his concourſe to a criminal bill: That willing to avoid general queſtions that might be attended with difficulty, he ſhall not ſtate the reaſons why the interpoſition of the court has not at any time heretofore been demanded, and why, he believes, it would not in this caſe be granted: it is ſufficient for him to ſay, that no perſon can ſeriouſly believe the power of. proſecuting ad vindictam publicam derived from the crown, can be moved at pleaſure by private parties. He has not yet refuſed his concourſe ; but appre- hending the caſe required attention, has forbore to give a poſitive anſwer to the demand, as the petitioners had delayed for ſeveral months to offer any ſervice ; and he hopes the reaſons aſſigned in his anſwer to the proteſts refer- red to in the petition, will juſtify his delay hitherto, and excuſe him from be- ing obliged. to give a poſitive anſwer forthwith, as no cauſe is ſhewn why ſuch a proſecution ſhould be hurried on. He declares, from the regard he has to the court, that it was always his intention to give ſatisfaction to the parties within a reaſonable time, either by. concurring. or refuſing, if he was adviſed it was reaſonable and legal for him ſo to do. due regard to the honour of the crown, and the ſafety of the ſubject; and therefore he is not to be driven precipitately to trials: And he is perſuaded the court will not think it reaſonable to interpoſe immediately upon the requeſt of private parties, as if they were the judges of the proper ſeaſon when the public laws ought to be put in execution. In reſpect whereof, he hoped the court would either refuſe the petition, or at leaſt delay giving any injunction concerning the matter for a reaſonable time, and until his Majeſty's Solicitor be further heard.” The above is taken from a written copy of the petition and anſwers, which I found in a collection of criminal papers made by a gentleman who was one of the crown-lawyers in 1726 ; but I cannot find any thing in the record re- lative to this matter. This may be owing to an error in the dates of the co- pies I had, or perhaps to the matter _ tranſaQed before Judgement was 8 Iven. No 75. p. 299. Caſe of Halladay, 1767. Per jury. See the caſe of Mr James Row miniſter at Monyvaird, Aug. 9. 166 5, and different diets afterwards ; MS. Abſt. ii. 204. ef /eqg. This caſe is but imper. fectly ſtated by Mackenzie, tit. Perjury. See, too, Mr John Biltoun's caſe, Nov. 9. 1658; MS. Abſt. i. 463. 464. 469. In this laſt caſe the libel was laid on Q. M.'s act. It was ſuſtained, but he was aſſoilzied by the jury. See, too, the caſe of Margaret Wood, Feb. 23. 1631. It was not judged, but there are long pleadings ; MS. i. 3 32. 333. et ſeqgq. October 28. 1715, George Montgomery was indifted, at the Advocate's in- ſtance, for perjury; and the fact charged was, That he, at a meeting of his fa- ther's creditors, did declare openly, publicly, and audibly, that he agreed and conſented they ſhould have a preference upon his father's eſtate; real and per- ſonal, waving any title he had to a preference by his marriage-ſettlement, or otherwiſe, as appeared from the ſederunt and written minutes of the ſaid meet- ing, and will more fully appear by the proof to be led in this cauſe; at leaſt he, at that meeting, did openly agree and conſent in words to the above pur- poſe : and yet he did thereafter, in preſence of one of the Lords of Seſſion, judicially fwear, depone, and affirm, upon his folemn oath, that at the ſaid meeting he did not conſent to any preference in favour of his father's credi- tors; which judicial oath is ſubſcribed by him and the dagen in the clerk's hands. Pleaded No 75. ADDITIONS and NOTES, 765 Pleaded for the pannel, 1½, The charge being founded upon a judicial oath, not yet adviſed by the court before which it was emitted, the import of it is not known: and as the creditors have prayed for a re-examination of the pannel, on account of ſome uncertainties in his oath, if that be allowed, he will have an opportunity to explain himſelf, and add circumſtances from. recollec- tion, which will take off any ſuſpicion of perjury. 2dly, Perjury cannot be in- ferred from an oath emitted on a reference; J. 1. et 2. C. De reb. cred. And it appears from a deciſion in 1677, obſerved by Mackenzie in his Criminals, tit. Perjury, that witnefles cannot be purſued for perjury upon the depoſitions of other witneſſes. gdly, The oath founded on has this limitation, “ in ſo far « as he remembers ;”* therefore perjury cannot be inferred from it, as want of memory cannot be criminal: And although it be not preſumeable that one will forget a ſolemn fact, yet a tranſitory act, or an expreſſion, may at ſome di- ſtance of time eſcape the memory. 4thly, The libel is not relevant, becauſe the preciſe terms of the words of the promiſe or agreement libelled, are not ſet forth, which ſhould have been done, that the pannel might have been heard upon the import of them; and witneſſes ought not to be allowed to be examined upon their notions and imaginations as to what he ſaid, ſeeing they may readily have miſtaken his meaning. For which reaſon, 5thly, our law does not allow a promiſe to be proved by witneſſes even ad civilem effedtum. 6thly, The place is not libelled' where either the promiſe or oath were emit- ted, which ought to have been done; Mackenzie, tit. Libels, $ 2. I. 3. F. De accuſat. Anſwered to the 1/7, Criminal proſecutions do not depend on civil actions. This purſuit is ad vindictam publicam, and has no connection with the civil cauſe, which may be tranſacted or dropped by the private party. The promiſe and oath libelled are both clear, and the eourt and jury can very well judge of them. To the 2d, In a purſuit ad vindictam publicam, the law does not diſ- tinguiſh between the different kinds of oaths. If a lie be judicially affirmed upon oath, perjury is committed. An oath upon reference puts an end to the civil queſtion ; but a criminal proſecution for perjury is ſtill competent; J. 21. 22. . De dolo malo. As to the law quoted from the Code, the firſt agrees with the PandeQs, and the other may be underſtood of the caſe in which per- juratum quodam colore ; and the Code does not derogate from the Pandects, excepting ñſty conſtitutions of Juſtinian; and Mackenzie retutes this pre- tended diſtinction. This caſe differs from that of witneſſes. If two witneſſes depoſe one way, and two another, there is no way of knowing which ſet has | ſpoke ” pl — _ — — — = — — * 2 * 6 — 2 —— — — —k —.:0⁊ 766 ADDITIONS and NOTES. Nog; ſpoke the truth. To the 3d, The quality of non memini will not in fado troprio ſave from the imputation of perjury, eſpecially as to a recent fact; and that quality is not added to the part of the oath libelled on. To the 4th, The words are ſufficiently ſpecified in the libel; and it will be conſidered, whether the agreement libelled has been made out by theſe, or other words direQly to that purpoſe. To the 5th, That in this caſe, a minute is produced, which will ſupport the depoſitions of witneſſes, and render them more circumſtantial, by aſſiſting the memory: And in criminal matters, witneſſes are admitted to prove emiſſions of words, ſuch as verbal injuries, blaſphemy, &c. ; and all the pannel's argument can infer is, that the proof mult be clear, without any darkneſs or doubt; of which the jury will judge. To the 6th, This crime does not conſiſt in one act; and the place, ſo far as neceflary, is ſufficiently qualified, viz. that the promiſes were made at a general meeting of the credi- tors, and the. oath emitted before Lord Couper, at the e place of de po- ſing, judicially. Ihe court found, The pannel his having in manner libelled, openly, publicly, and audibly, promiſed, agreed, or conſented, to the preference of his fathers creditors, to all pretences he had to his father's eſtate, real or per- fonal, by his marriage-ſettlement, or any other manner of way whatſomever ; or the ſaid pannel his agreeing, or giving conſent, to give preference to his fa- ther's creditors, excluſive of his own pretenſions to his father's means and ef- feats, by openly declaring his conſent in theſe terms, or in other words and expreſſions to the ſame purpoſe ; and his having judicially upon oath denied, or contradicted the fame, relevant to infer the pains of perjury : and repelled the haill defences proponed for the pannel, and remitted,” &c. Afterwards the pannel ſet forth, That he was a landed man ; which he proved by his in- feftment; and objected, there was not a ſufficient number of landed men cited to be on the jury. The diet was deſerted ſimpliciter. Abridg. N* 76, p. 308. Caſe of Foſeph Taylor, 1765. hed tet 18. 1617, Mr John Muirhead notary in Tweedmouth, indiQted for forgery and perjury. Alledged for the pannel, He is a ſtranger, having lived for many years in England; and therefore this is not forum competens, but he ought to be remitted to the judges in England, conform to the act of parliament. Anſ. The act quoted concerns only perſons living in En gland, and fugitate, cited for laughter, and certain-other crimes ; of which the crime libelled No 56. ADDITIONS and NOTES, 767 libelled is none. The pannel came willingly to Scotland to be a witneſs —The Juſtice, notwithſtanding the alledgeance, remits, &c.. Upon this the Abridger obſerves, © It is probable the crime was committed in Scotland, elſe it would ſeem the declinature was well founded : and by the dittay it appears, both the forgery and perjury were committed in Scotland ; the perjury before the Lords of Seſſion, by his falſely ſwearing in their preſence the deed to be a true deed, and the next day acknowledging the ſame to be falſe. —He was convicted, and ſentenced to be hanged. MS. Abſt. i. 402. See, too, Alexander Pearſon's caſe; in which the offence libelled * him, Lord Ochiltree, and others, leaſing- making, and ſlanderous ſpeeches a- gainſt certain noblemen, was committed in England. He urged, That ſuppo- ſing the fact charged not to be criminal in England, it would be contrary to all law and juſtice to puniſh him in any other place, on pretence the fact was criminal in the country where he was tried. The diet was continued from time to time, and at laſt deſerted with the Advocate's conſent.— A full account of this caſe is given in Ruſhworth's Hiſt. Collect. MS. Abſt. i. 343. 344. In 1769, or 1770, it is informed, a Scotchman was indicted at Carliſle for ſteal- ing a horſe in Scotland which he had brought to England; but the judges found they could not try him.— This caſe, it is ſaid, gave riſe to the act 13th Geo. III. & for the more effectual execution of the criminal laws in the two parts of the 4 united kingdom.” This act is imperfect; for it provides no method for compel- ling witneſſes reſiding in the one country to go and give evidence in the other. A ſtatute ought to paſs, obliging people living in England to appear, and give evidence before commiſſioners appointed by the court of ſeſſion for taking proofs there. In a cauſe depending at preſent before the court of ſeſſion, it was neceſ- fary for one of the parties to examine ſeveral Engliſh manufacturers. The court granted a commiſſion for that purpoſe ; but the witneſſes refuſed to ap- pear. The lawyers here, imagining the court of king's-bench, or the Chan- cery, could give relief in ſuch a caſe, directed the advice of Engliſh counſel to be taken upon the proper remedy : they were conſulted accordmgly ; but an- ſwered, They knew of no precedent for compelling witnefles in ſuch a caſe to appear and give evidence, We pay more reſpect in this country to Engliſh commiſſions, N 78, 768 5 ene e 8 and NOTE 8. No 78. n ID ene eee ene eee e 7 2 486 een AG Writ} ps, © 272! Na. y83:ipgpe,. Caſe of Janet Nicol, N Pact <6 In one caſe, a reduction was attempted before the court of juſticiary.— March 7. 1680, Alexander Strachan of Glenkindy having been apprehended for ſlaughter, became bound in'a bond of compearance for himſelf, and ſuch of KEE 2 ants and ſervants as ſhould be cited as parties or witneſſes, under a ty ur 1. 20, 20,000 Scots. Some of them not having appeared, the bo Peg * — g appe nd Ki 5 ed for 10 and the | forfeiture was g gifted to Sir Adam Blair; who raed Me ben dene, "He b dion of the bo jpdged tract an 8 eſtate. 4 55 rought a redu on of the nd "i ow #+ 0% but prejudice to o him to apply to the 5 or giherwile, for remeid, as accords, Pat Sia: 4; = 4 4 464.07 i ih 203 M10 » This is taken from a note of caſes made upon a ſearch | in 176 * when the queſtion, as to 8 He, competency of appeal from the juſticiary, was in agita- fd. #414 7 # "I 1 wen (Nv 864 p.. Caſe of John Raybould, 1768, Forgery. * . Id a”, dts: AW +. TER 5 Had this plea been BG up ill the proſecutors had concluded their proof, and then been urged to the jury, it would in all probability have ſaved his life : but it did not occur to his counſel till after the indictment was begun to be read. From their not having, time, to deliberate, it was offered prematurely. It. is ſurpriſing, that it ſhould have been overlooked in all former caſes. Care has always been taken ſince, by the proſecutors of this crime, to ſerve a liſt of witneſſes upon the pannel 15 can prove the identity. No 87. p. 474. COPE oe James Kenia 118 * TY * 4850 dane in his MS. notes on Mackenzie, p. 230, obſerves, 66 'Tho' regularly theſe interlocutory ſentences are final, the forms not allowing re- chiming ; yet there are ſeveral precedents, by which, upon new ſuggeltions and arguments, interlocutors have been altered, as Feb. 2. 1674, Aſſint's cale ; Nov. 19. 1674, Rutherford; Feb. 5. 1683, Laurie; June 29. 1691, Fyfe; Aug; 3- 1697, Keith; Aug. 5. 1692, Captain Wallace; in which caſe the que. | ſtion N* gr. ADDITIONS and NOTES: 769 ſtion was argued, Whether, in form, there could be any pleadings on the re- levancy, either of the libel or defences, after ſigning the interlocutor? and the ; court allowed them to plead and thereafter they pronounced a new interlocu- tor. The like in Barclay's caſe, Nov. 12. 1668.” No 82. p. 483. Caſe of James Steven, 1768. In the caſe of Irving for breaking priſon, July 26. 1673, it was objected by the lawyers for the pannel, © That the dittay is not relevant; becauſe, though &« it be founded on the common law and practick of this kingdom, yet it con- « deſcends upon no law, whereupon either the crime or pains libelled can be & inferred ; and ſeeing it is only ſubſumed, that the pannel was in priſon for « a civi{ debt, there is no law, common or . municipal, can be adduced to « infer the crimes and pains hbelled.” The Advocate replies, © That the dittay is opponed, which is moſt relevant, without condeſcending on any laws in the propoſition : for the law is, and ought to be, known to the judge; and a dittay is relevant without a pro- foſition; and the crime contained in the propoſition, viz. breaking the rious, that there needs neither a propoſition nor a condeſcending on parti- « cc cc King's priſon, and robbing his Majeſty of his priſoners, is a crime ſo noto- cc & cular laws, the common law, and law of nations, being fo unqueſtionably c clear as to the ſame.” MS. Abſt. iii. 25 1. 252.—Sir George Mackenzie for the pannel, in his duply, does not controvert this. The following aphoriſm of Beccario is a panegyric on the ſyllogiſtical form of our indiatments : ** In omni delitto ſi deve fare dal giudice un ſillogiſmo 64. perfetto ; la maggiore deve aſſere la lege generale: la minore l'azione con- “ forme, o no alla legge ; la conſeguenza, la. liberta, o la pena.” Dei delitti e delle pene, S 4. ed. 1772. In this caſe of Steven, and others, it was further argued for the 8 That in caſe the libel were ſuſtained, the proſecutor muſt either divide tl. trial, or allow ſome of the perſons whoſe names he had thrown into the Gy to be examined as witneſles for the reſt; according to Mackenzic's nals tit. Exculp. S 11. I do not remember the anſwer for the proſecutors, further than that they inſiſted the demand was unprecedented. There was no occaſion to determine this point; but the judge, in deliver. ing his n ſaid, he thought the demand reaſonable, and that he remem- 5 E bered: 770 ADH d 82 0 MO THS. N2 54 bered a caſuſin ici it had been granted. The caſe alluded to was, Ei gine, a trial for a riot and battery at Stirling in 1748. It gave riſe to mutual proceſſes; in each of which there was a number of defenders: and, 4th July 1748, the digt was of nſent | deſerted ag {t one ak, e ſide, and thre the Sie , that they Og give Evidence. A og 18 JUS oe of conſent, it 5 not properly be referred to as a precedent; ; though probably the en was wing. #2 the opinion; f the court A. proſecutor ſurely ought. not to be allow. cd a pmg panne Of lis Mienęſſess merely hy throwing: their names} into the ec theacfor) Whehilitappears from dircumſtances that ſuch:may be his views: @ het B e sdnſenench if the trial be not divided, it either Huld he lſo on the q teis admitted as vitneſſes for one another. Lluis gaeſtion was agitated in a toceſa brouglu before the court of ſeſſion, in 13683 bieter Williamſon a againſt. ſeveral ꝓcople in Aberdeen, It was a res qucon afl a dgeroct arhitralʒ but he callsd as partie, not only thole in whole, faut ves preneyuneads butithe arbiter, and twe procutators in Aberdeen, by hee Mmalpractices hei alledgeda it had been obtained, and concluded a- gainſt them, or damages. Thoſe in hoſe favour the decree was, alledged, that he had, made ce two procurators parties, in order to prevent their exami. nation-as: witneſſes for the othær defenders ; and therefore they inſiſted, either that lac ouch ſinſt daſcuſs theſe tur that they ſhould be admitted to give e- videncea ve The Bord Ordinary allowed thein depoſitions to be taken; but or- dered them to he ſealed up, eee eee eee of the court. Incthis judge ment che | purſuer acquieſced- This queſtion was again conſidared, 1 Ss 4 in hs caſe of Margaret and: Agnes Adams, d young girls, (one of them about twenty, the; other, abqut ſixtcen), brought to trial lalh winter for the robbery and mur- der of an old woman ho kept. a ſnoꝑ in Glaſgow. The counſel for the Young- eſt offered to prove by the eldeſt, that the. ,youngeſt had no concern in che affair, and he inſiſted he ſhould be allowed t adduce her, as ſhę Was a 3 : ſary witgeſs, there beings according the {hewing of the indictment, no o- ther perſon preſent. But che court refuſcd, to admit her; and, all the judges were of that ppinion ſaxe one. It is not however, to be. ſuppoſed the court thought, that in no caſe whatever could one pannel be witnęſs for another. The ſolution of this queſtion ſeems to depend upon circumſtances. If there be rea- ſon to preſume, or ſuſpeſt, from citeumſtances, that the;profecutor has thrown the names of ſame perſons into the indictment with no other view than to de- iy * ee he aught to be diſappointed. | Other 7 7+; mm 1 * EI } - No 82; ADDIVTION S and NOTE 8.“ 77¹ Othericaſes-t too a perhaps be ae in which-this Oats refuſed. 160 Uns Nui & 101-1611) 6 „ 8 4 1 * 1 9 9 3 - 'Þ „ - # # (11 | 14 5 J. 4 13 [71 1 010 4 No 84. p. p. 50 5 "hi of Mungo Campbell, os; Mur der. 1 26. Suicide. ON 2 FO QUT r7oCl3 1611 91! | A gemleman who was ſome years 4 tried at a circuit bor an ahl, "lates y informed me of a circumſtance in his trial, which will manifeſt the neceſſity of admitting peremptory challenges. In the liſ:of forty-five: jurors ſerved upon him along with the eriminal letters, he obſerved the name f a mary with whom he had been long on very bad terms, and therefore had great reaſon to wiſh he ſhould not be upon his jury, though he was averſe to challenge him. Having mentioned this to his counſel, he, the night before the trlal, wuited upon the judge, and told him the caſe. The judge ſaid he would tfiink of it, and make inquiry about the man. Next morning he aequainted the counſel, that he was aſſured this man was a very intelligent perſon; and very prope to be put upon the jury. The counſel repeated the objection, but without effect. Upon which he ſignified, that he would challenge him, as ſeveral cireumſtan- ces that indicated enmity againſt the pannel could be proved: againft this man.
| 46,799 |
Subsets and Splits
Token Count by Language
Reveals the distribution of total tokens by language, highlighting which languages are most prevalent in the dataset.
SQL Console for PleIAs/common_corpus
Provides a detailed breakdown of document counts and total word/token counts for English documents in different collections and open types, revealing insights into data distribution and quantity.
SQL Console for PleIAs/common_corpus
Provides a count of items in each collection that are licensed under 'CC-By-SA', giving insight into the distribution of this license across different collections.
SQL Console for PleIAs/common_corpus
Counts the number of items in each collection that have a 'CC-By' license, providing insight into license distribution across collections.
Bulgarian Texts from Train Set
Retrieves all entries in the training set that are in Bulgarian, providing a basic filter on language.
License Count in Train Set
Counts the number of entries for each license type and orders them, providing a basic overview of license distribution.
Top 100 Licenses Count
Displays the top 100 licenses by their occurrence count, providing basic insights into which licenses are most common in the dataset.
Language Frequency in Dataset
Provides a simple count of each language present in the dataset, which is useful for basic understanding but limited in depth of insight.
French Spoken Samples
Limited to showing 100 samples of the dataset where the language is French and it's spoken, providing basic filtering without deeper insights.
GitHub Open Source Texts
Retrieves specific text samples labeled with their language from the 'Github Open Source' collection.
SQL Console for PleIAs/common_corpus
The query performs basic filtering to retrieve specific records from the dataset, which could be useful for preliminary data exploration but does not provide deep insights.
SQL Console for PleIAs/common_corpus
The query retrieves all English entries from specific collections, which provides basic filtering but minimal analytical value.
SQL Console for PleIAs/common_corpus
Retrieves all English language documents from specific data collections, useful for focusing on relevant subset but doesn't provide deeper insights or analysis.
SQL Console for PleIAs/common_corpus
Retrieves a specific subset of documents from the dataset, but does not provide any meaningful analysis or insights.
SQL Console for PleIAs/common_corpus
Retrieves a sample of 10,000 English documents from the USPTO with an open government type, providing a basic look at the dataset's content without deep analysis.
SQL Console for PleIAs/common_corpus
This query performs basic filtering to retrieve entries related to English language, USPTO collection, and open government documents, offering limited analytical value.
SQL Console for PleIAs/common_corpus
Retrieves metadata of entries specifically from the USPTO collection in English, offering basic filtering.
SQL Console for PleIAs/common_corpus
The query filters for English entries from specific collections, providing a basic subset of the dataset without deep analysis or insight.
SQL Console for PleIAs/common_corpus
This query performs basic filtering, returning all rows from the 'StackExchange' collection where the language is 'English', providing limited analytical value.
SQL Console for PleIAs/common_corpus
This query filters data for English entries from specific collections with an 'Open Web' type but mainly retrieves raw data without providing deep insights.
Filtered English Wikipedia Articles
Filters and retrieves specific English language Wikipedia entries of a certain length, providing a limited subset for basic exploration.
Filtered English Open Web Texts
Retrieves a subset of English texts with a specific length range from the 'Open Web', which provides basic filtering but limited insight.
Filtered English Open Culture Texts
Retrieves a sample of English texts from the 'Open Culture' category within a specific length range, providing a basic subset of data for further exploration.
Random English Texts <6500 Ch
Retrieves a random sample of 2000 English text entries that are shorter than 6500 characters, useful for quick data exploration but not revealing specific trends.
List of Languages
Lists all unique languages present in the dataset, which provides basic information about language variety but limited analytical insight.