identifier
stringlengths 6
14.8k
| collection
stringclasses 50
values | open_type
stringclasses 7
values | license
stringlengths 0
1.18k
| date
float64 0
2.02k
⌀ | title
stringlengths 0
1.85k
⌀ | creator
stringlengths 0
7.27k
⌀ | language
stringclasses 471
values | language_type
stringclasses 4
values | word_count
int64 0
1.98M
| token_count
int64 1
3.46M
| text
stringlengths 0
12.9M
| __index_level_0__
int64 0
51.1k
|
|---|---|---|---|---|---|---|---|---|---|---|---|---|
https://github.com/mzhg/PostProcessingWork/blob/master/app/src/main/assets/nvidia/crest/shaders/AnimWavesWaveParticle1.frag
|
Github Open Source
|
Open Source
|
Apache-2.0
| 2,022 |
PostProcessingWork
|
mzhg
|
GLSL
|
Code
| 111 | 346 |
#include "OceanLODData.glsl"
uniform float _Amplitude = 5;
// TODO add this for all ocean inputs?
uniform float _Weight;
in float2 worldPos;
out float4 OutColor;
void main()
{
float3 centerPos = float3(unity_ObjectToWorld[3][0],unity_ObjectToWorld[3][1],unity_ObjectToWorld[3][2]);
float2 worldOffsetScaledXZ = worldPos - centerPos.xz;
float m_LengthToCenter = length(worldOffsetScaledXZ);
// power 4 smoothstep - no normalize needed
// credit goes to stubbe's shadertoy: https://www.shadertoy.com/view/4ldSD2
// float r2 = dot( worldOffsetScaledXZ, worldOffsetScaledXZ);
float _Radius = 3;
float r2 = m_LengthToCenter/ _Radius;
if(r2 >= 1.0) discard;
/*if( r2 > 1.0 *//*|| m_LengthToCenter > _Radius*//*){
OutColor = float4(0);
return;
}*/
r2 = 1.0 - r2;
float y = r2 * r2 * _Amplitude;
OutColor = float4(0.0, y * _Weight, 0.0, 0.0);
}
| 32,860 |
https://github.com/soramitsu/fearless-Android/blob/master/runtime/src/main/java/jp/co/soramitsu/runtime/chain/remote/model/ExternalApiRemote.kt
|
Github Open Source
|
Open Source
|
Apache-2.0
| 2,023 |
fearless-Android
|
soramitsu
|
Kotlin
|
Code
| 11 | 43 |
package jp.co.soramitsu.runtime.chain.remote.model
class ExternalApiRemote(
val type: String?,
val url: String?
)
| 9,005 |
https://it.wikipedia.org/wiki/Faustin-Archange%20Touad%C3%A9ra
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Faustin-Archange Touadéra
|
https://it.wikipedia.org/w/index.php?title=Faustin-Archange Touadéra&action=history
|
Italian
|
Spoken
| 136 | 233 |
Dopo aver studiato alle università di Bangui e di Abidjan, ha ottenuto due dottorati di ricerca in matematica, uno all'Università di Lilla, l'altro all'Università di Yaoundé. Dal 1989 al 1992 è stato vicepreside della facoltà di scienze dell'Università di Bangui; nel 2004 è diventato vicedirettore della stessa.
Il 22 gennaio 2008 è stato nominato primo ministro dal presidente François Bozizé dopo le dimissioni del governo di Élie Doté. Dopo un anno, il 18 gennaio 2009, Bozizé ha sciolto il governo di Touadéra in vista della formazione di un nuovo governo di unità nazionale, ma il giorno seguente ha affidato un nuovo incarico a Touadéra che ha formato un nuovo esecutivo, nel quale solo 10 ministri del precedente governo hanno mantenuto il proprio posto.
Altri progetti
Collegamenti esterni
Primi ministri della Repubblica Centrafricana
Presidenti della Repubblica Centrafricana
| 44,257 |
https://github.com/chaikovs/MML/blob/master/machine/MML_ROOT/machine/SOLEIL/StorageRing/insertions/HU640_MatlabScripts/.cvsignore
|
Github Open Source
|
Open Source
|
BSD-3-Clause
| 2,019 |
MML
|
chaikovs
|
Ignore List
|
Code
| 5 | 17 |
Old_Scripts
tests
RUNS
Bazar
*.mat
| 24,320 |
revistadomuseup00paulgoog_5
|
French-PD-diverse
|
Open Culture
|
Public Domain
| 1,895 |
Revista do Museu Paulista
|
Museu Paulista
|
French
|
Spoken
| 6,812 | 11,496 |
Le second stade est évidemment celui qui précède immédiatement la puberté. À cette période de développement, la lame ventrale et la paire antérieure des pattes copulatrices sont aussi développées que chez l'adulte; tout au moins n'avons-nous pas pu saisir de différence précieuse. Par contre, dans la patte postérieure (fig. 236), l'article terminal est beaucoup moins développé que chez l'adulte, alors que l'article basilaire est à peu de chose près de la même dimension, comme le montre une comparaison de la figure 236 avec la figure 254 (adulte). Et que ces différences ne constituent pas une anomalie individuelle d'un animal adulte, découle de ces faits : 1.) que l'animal a un ou deux somites de moins que les adultes, avec 3 segments apodes (au lieu d'un chez les adultes), qu'il est donc immature ; 2.) que 2 autres individus, semblables au premier quant au nombre des somites et des segments apodes, ont présenté identiquement la même particularité. Il s'agit donc bien là d'un « stade spécial », qui ne paraît avoir d'équivalent ni chez les Spirostomides, ni chez les Iulides Européens, autant du moins que nous pouvons en juger. Ce qui ajoute encore à l'intérêt de ce stade spécial du Rhinocricus asper, c'est que les trois individus signalés proviennent d'Alto da Serra, c'est à dire d'une localité de montagne, de l'altitude de 800 mètres ou la moyenne de la température est forcément plus basse que celle des localités de plaine. Si nous rapprochons ces observations de celles faites par le Dr. Verhoeff sur le Tachypodoiulus albipes, nous verrons qu'il existe un parallélisme étroit entre les phénomènes observés en Europe et ceux qui se déduisent de nos observations, à savoir que la température probablement influe sur le mode de développement de nos arthropodes. Chez les Julides paléarctiques, elle produit le Schaltstadium, chez les Spirobilides, elle entraîne l'apparition du stade spécial dont nous venons de parler. Et cette même action a tout naturellement sa répercution sur les dimensions qu'acquièrent ces individus des régions froides. Pour mettre ce fait plus en évidence, nous donnons dans le tableau ci-dessus les moyennes de nombre de somites, de diamètre et de longueur d'échantillons de Rhinocricus asper de deux localités différentes, telles qu'elles ressortent des mesurations qui figurent en tête de la description de cette espèce. LOCALITÉS Moyenne de « segments » pour les « individus » ayant 1 segment apical. Moyenne de Diamètre pour les « mêmes » individus. Moyenne de Longueur pour les « mêmes » individus. Femelle Mâle Femelle Mâle Femelle Mâle Alto da Serra (Montagne) 48.8 72.7 77.5 59.8 Le fait que nous avons relaté plus haut que Alto da Serra est une localité boisée, et par conséquent propice au développement des Diplopodes, semble donner raison à Verhoeff qui attribue principalement à l'abondance de nourriture l'apparition du Schalstadium des Lucides européens. Mais comme ici aussi intervient la question de température, nous persistons à voir en elle la cause prédominante des modifications que nous constatons dans la croissance de nos Arthropodes. Nous ne concevons pas bien, en effet, qu'un agent (comme la nourriture abondante qui doit favoriser le développement de l'animal) puisse déterminer l'apparition d'un stade (et d'un sexe) supplémentaire ayant pour résultat de retarder d'autant la puberté de l'animal. Nous comprendrions mieux le concours de deux agents, l'un défavorable (température) retardant la puberté et prolongeant la période de croissance, et l'autre favorable (nourriture abondante) contribuant au développement de l'animal pendant la période supplémentaire de croissance. Indicateur que les animaux de la montagne ont des dimensions plus grandes et un envergement plus élevé que les animaux de la plaine. Il est vrai que la opposition, mais il est bon de remarquer que la différence est la plus variable des trois moyennes et que elle dépend essentiellement de l'état de l'animal. Du reste ce tableau n'a rien d'extraordinaire il est sur un trop petit nombre d'individus il indique suffisamment, dans les limites où les chiffres ont le plus de précision, que c'est bien celle observée par Verhoeff d'Europe. de nos observations peut donc se résumer : Le développement des pattes copulatrices et des Rhinocricus est différé chez les Iulides paléarctiques. — Chez les préexistence s'effectue progressivement et les marques d'étapes parcourues permettent d'apprecier le progrès. Tandis que chez la croissance procède par à-coups, les differences mises à part entre les premiers stades, et ce n'est qu'à la veille de la métamorphose, les organes du jour au lendemain la forme et la taille s'effinent définitivement conserver. Le développement est ralenti par des conditions climatiques réalisées à une certaine altitude, d'ailleurs celui des deux modes de croissance, mode de croissance des Iulides, et croissance des Spirostreptus-Rhinocricus. Le phénomène de ralentissement se produit dans la région paléarctique que dans la région tropicale. Tous les Iuloidea, dont les immatures sont, c'est la paire postérieure des pattes qui se développe les plus tard, les premières, chez les Spirostreptus, elle est informe tandis que la paire antérieure est déjà ébauchée (fig. 176, 177 et 1900). Chez les Rhinocricus, au stade spécial signalé (fig. 236), la paire antérieure est complètement formée alors que la paire postérieure n'a pas encore atteint ses dimensions normales. Nous remarquerons pour terminer que, si la croissance des Spirostreptus-Rhinocricus est différente de ce que nous la supposions lorsque nous écrivions sur ce sujet dans le Zoologischer Anzeiger en décembre 1900, cette constatation n'infirme en rien la conclusion à laquelle nous étions arrivés alors, savoir : que le Schaltstadium des Iulides paléarctiques n'est que le reliquat de l'héritage des formes archaïques, reliquat qui a disparu simplement chez la Forma typica des Iulides, la forme la plus perfectionnée. CLEF DICHOTOMIQUE des IULIDÉE N. B. — Il n'a pas été tenu compte dans la clef dichotomique des caractères des formes jeunes. En contre, il est bon d'observer que, s'il a été possible de donner à cette clef une précision suffisante pour déterminer des groupes d'espèces, il n'en a pas toujours été de même lorsqu'il s'est agi de caractériser nettement chaque espèce en particulier. Étant donné l'extrême analogie que présentent certaines espèces entre elles, comme par exemple Spirostreptus ochrurus et S. perfidus, les espèces du groupe du Spirostrepus Sebastianus, ou bien encore Rhinocricus Nattereri et Rh. pugio, il a fallu se rebattre sur des caractères qui, par leur variabilité ou leur faible importance, ne permettent pas d'atteindre à une détermination rigoureuse; pour ce faire il sera essentiel de recourir aux dessins des pattes copulatrices. 1 — Une paire de pattes sur le 3ème segment (Spirobolidae) . 25 Pas de pattes sur le 3ème segment 2 — 115 — 2 — Un pore sur le 5ème segment . 8 Pas de pore sur le 5ème segment (Spirostreptus) .... H 3 — Quatre fossettes sur la lèvre supérieure (Auloparophobostomy) . 10 Plus de quatre fossettes sur la lèvre supérieure (Pseudo nannolene) , 4 4 — Des impressions subcirculaires planes aux environs du pore répugnatoire . Pseudosporomitis callipyge. Pas d'impressions dans les côtés 5 5 — Valves anales non marginées . Pseudosporomitis paulista Valves anales marguées . 6 6 — Metazonites fortement rugueux (Pseudosporomitis longicomus sebastianus) Metazonites lisses ou striés . ' T 7 — Bord postérieur du dernier segment déprimé et canalisé longitudinalement . Pseudosporomitis patagonica Bord postérieur du dernier segment ni déprimé ni canalisé 8 8 — Metazonite un peu plus élevé que le prozonite . Pseudosporomitis tricolor. La différence de niveau entre prozoalie et métazonite est indistincte ou nulle. Metazonite foncé avec une bande claire le long du bord postérieur. Pseudotricolor gra Melazonite froncé avec une bande claire dans sa moitié antérieure. Metazonite lisse ou presque lisse Spirale (Alloporus) princeps. Metazonite ponctué ou ponctué cuireux Spirale (Alloporus) setiger. Valves armées d'épines aux angles supérieurs et inférieurs Spirale (Cladostomum) flavofasciatus. Valves inermes. Metazonite strié longitudinalement parfois écourté Spirale (Cladostomum) dorsosulcatum. Il n'existe de stries franches qu'au-dessous de la ligue des pores. Angle antérieur du premier segment moins ouvert que l'angle postérieur, en pointe aiguë (fig. 199). Spirale (Scaphiostoma) fuscipes mâle. Angle antérieur du second segment plus ouvert ou aussi ouvert que l'angle postérieur, plus ou moins arrondi. Bord postérieur du premier segment non échancré, droit ou convexe (fig. 209). Bord postérieur du second segment échancré près de l'angle postérieur (fig. 183). Stries concentriques nombreuses, occupant la moitié ou plus de la moitié du prozonite. Stries concentriques peu nombreuses (3 à 6), occupant le tiers ou le quart du prozonite. Face lisse, antennes ne dépassant pas le second segment. Spirale (Cladostomum) parvulare luteus. Face rugueuse, antennes dépassant le 1er segment. Metazonite plissé sur le dos. Spiracle (Cladostomum). angustifrons Metazonite entièrement uni, indépendamment de la sculpture du tégument. Spiracle (Scaphiostoma). fuscipes femelle Suture complète ou brisée dans les flancs ou sur le dos. Corps grêle, diamètre ne dépassant guère 1/20 de la longueur (2.70 : 50.). Spiracle (Cladostomum). Corps plus ramassé (2.70 : 36., ou 5.40 : 90., 3.50 : 50.). 2 ou 3 stries concentriques visibles sous le ventre; téguments cuireux ponctués. Spiracle (Cladostomum). Aucune strie visible sous le ventre; téguments striolés vaguement cuireux. Spiracle (Cladostomum). 10 stries longitudinales sous le ventre. Spiracle (Cladostomum). Stries longitudinales sous le ventre. Spiracle (Cladostomum). Sculpture rugueuse du métazonite seul. Spiracle (Gymnosternum). Sculpture rugueuse du métazonite et prozonite, let soyeux; pores bas; stries longitudinales commençant près du pore; extrémités noires. Spiracle (Gymnosternum). Dixième segment presque oblique antérieurement (fig. 183). Spiracle (Gymnosternum). Dixième segment presque anguleux antérieurement (fig. 186). Spiracle (Gymnosternum). Ventrale d'un grand nombre d'écussons marqué de 2 impressions en croissant (Scobina) (Rhinocricus). Ventrale dépourvue d'impressions en croissant. Élongement du bord postérieur du dernier segment dépasse franchement. Paraspirobolus paulus. Tangle supérieur des valves anale. 27 Le bord postérieur du dernier segment ne dépasse pas le Tangle supérieur des valves. 30 Le prolongement du dernier segment est étranglé, donnant naissance à une pointe plus ou moins spiniforme. Rhin, asper. Le prolongement n'est pas étranglé et, vu par la face dorsale, cache les valves. 28 Dernier segment d'une seule couleur (foncée). 29 Dernier segment bordé de jaune d'œuf. Rhin, pugio. 30 Les individus ayant 1 segment, apode, ont 52 à 60 segments, 51 à 100 millimètres de long et 4,50 à 7,50 millimètres de diamètre; forme assez élancée; souvent brun foncé avec les pattes jaunes. Rhin, Nattereri. Les individus ayant 1 segment, apode, ont 55 segments, 77 à 100 millimètres de long et 6,50 à 7,50 millimètres de diamètre; forme plus massive; généralement plus foncée à bordure rouge. Rhin, pugio. 30 Metazonite à ponctuations nettes. Rhin, concinnus. Metazonite sans ponctuations nettes; 31 segments; la strie qui précède la suture est étroite; le prozonite est faiblement chagriné. Rhin, moestus, 42 - 45 segments; la strie qui précède la suture est assez large; le prozonite est nettement chagriné. 32 - Rebord marginal du 1er segment bien marqué; les stries et strioles des somites, denses et accusées sous le ventre, produisent un faible reflet soyeux; prozonite uniformément chagriné-ponctué; forme allongée, longueur 150 mill. Rhin, sericiventris - Rebord marginal très fin, stries et strioles ni particulièrement denses ni accusées sous le ventre; sur le dos, entre la suture et la strie qui la précède, le prozoonite présente quelques ponctuations plus fortes; forme plus courte, longueur 52 - 71 mill. Rhin, limbatus. Fam. Pseudonannolepididae Silvestri 1895 Genre PSEUDONANNOLENE SILVESTRI 1895 Faciès d'un Spirostreptus, mais généralement plus grêle. Disposition des pattes sur les premiers somites comme chez Spirostreptus, 1. 1. 1. 0. 2. 2 (c'est-à-dire, 1 paire sur chacun des trois premiers segments, 0 paire sur le quatrième et 2 paires sur les somites 5 et 6). Nous employons dans ce travail les termes adoptés par le Dr. O. von Rath. Gnathochilarium : promentum divisé transversalement, la partie antérieure divisée elle-même longitudinalement (le schema qu'en a donné le Dr. Silvestri est exact). Organe copulateur constitué par deux paires de pattes modifiées, divisé en deux groupes de deux pattes chacun ; chaque groupe se compose de la patte antérieure et de la patte postérieure correspondante soudées ensemble (ou tout au moins très fortement adhérentes) sur les deux tiers environ de leur longueur ; les deux groupes ne sont reliés entre eux que par une membrane en forme de selle, plus ou moins chitinisée (lame ventrale). Chaque patte émet un prolongement (lame terminale) qui reste libre ; celui de la patte postérieure est généralement arrondi, à bord épaissi et hérissé de pointes (ou soies épaisses) plus ou moins longues ; celui de la patte antérieure est au contraire compliqué de lamelles translucides enchevêtrées, souvent hérissées de granulations, qui dissimulent l'ouverture de la rainure. La rainure séminale paraît appartenir à la patte antérieure. Le bord externe de la patte postérieure est intimement adhérent au bord externe de la patte antérieure correspondante, formant une arête à peine émoussée ; le bord interne de ces deux pattes est replié l'un vers l'autre, de façon à donner naissance à une face triangulaire interne, inégale et semée de petites dents obtuses, souvent très nombreuses, qui sont plantées sur le rebord de la patte postérieure. Chaque patte est montée sur une poche trachéenne ; il y en a donc quatre. Le Dr Silvestri a donné plusieurs figures de pattes copulatrices de Pseudonannoleme argentins, mais tout autre que ces dessins sont schématiques, nous les considérons moins orangé dans les flancs ; dernier segment et valves noires, ces dernières finement ourlées de jaune au bord libre ; pattes jaune d'ocre plus ou moins ternies de brun. Corps grêle, élancé ; les segments étant un peu étranglés par la suture, le métamérite est un peu relevé, mais la coloration du bord postérieur le fait paraître plus élevé encore qu'il ne l'est en réalité. Tête très brillante, lisse presque jusqu'à sur la livre qui est faiblement cuirassée et marquée de nombreux (6 — 7) fossettes. Sillon occipital fin, court, plus ou moins marqué, s'arrêtant brusquement dans un fin sillon transversal interoculaire. Antennes écartées à la base, longues, atteignant le bord postérieur du cinquième somite ; le troisième article est au moins aussi long que le second, le sixième est assez détaché, étant étranglé à la base, le dernier porte quatre bâtonnets coniques. Yeux petits, subovales, anguleux vers le sommet de la tête, écartés d'environ deux fois leur grand diamètre, composés de 32 — 31 ocellules petits mais convexes et distincts, en 5 rangées à peu près droites (7.8.8.6.3 — 8.8.8.6.3). Joues arrondies antérieurement. Le premier segment (fig. 134) est enveloppant, lisse sur le dos et indistinctement striolé dans les cotés; ceux-ci sont arrondis, le bord antérieur n'est pas échancré, l'angle antérieur n'est pas distinct et l'angle postérieur l'est à peine, le bord postérieur est plutôt un peu convexe; la surface est labourée de nombreuses (environ 8) stries rapprochées, dont la majeure partie incomplète. Le second segment est simplement aplati sous le ventre. Sur les somites du tronc, le prozonite est mat ou à peine luisant, alors que le métazonite est très brillant. La sculpture du prozonite, indistincte à la loupe, apparaît sous le microscope comme très finement squameuse, coupée de très fines strioles; les stries concentriques occupent environ la moitié du prozonite, elles sont à peine distinctes à la loupe, mais sous un plus fort grossissement on les voit jalonnées de petites ponctuations brillantes; elles sont un peu mieux marquées sous le ventre. Le métazonite est semé sur le dos de longues stries longitudinales très fines entre mêlées d'autres plus courtes, sur un fond presque lisse et très brillant. Les stries longitudinales du ventre sont fines, elles sont complètes jusqu'à une certaine distance du pore. Celui-ci est assez grand, situé assez haut dans les flancs et environ au premier tiers du métazonite. La suture est étranglée, large, ponctuée, droite. Le dernier segment (fig. 135) est lisse comme les métazonites du tronc, son bord postérieur est un peu proéminent, mais nullement anguleux, complètement arrondi au contraire, il atteint l'angle supérieur des valves sans les couvrir. Les valves sont lisses, très brillantes, médiocrement saillantes; elles sont très globuleuses jusqu'au bord, en hémisphère; leurs bords sont très finement margines. L'écaillé ventrale est courte et large, arrondie en segment de cercle. Les écaillés ventrales non striées. Stigmates petits, punctiformes. Pattes assez longues, armées d'une longue griffe, semées de poils rigides clairsemés mais assez longs. Chez le mâle, les joues sont un peu épaisse et arrondie inférieurement. Les pattes sont dépourvues de pochettes. Les hanches et la lame ventrale de la première paire de fig. 137 forment une masse conique tronquée semée de poils courts. La lame ventrale de la deuxième paire (fig. 137) est largement échancrée au bord interne pour faire place au pénis, qui est très petit et qui est représenté plus gros dans la figure 138; sur la figure 136 on remarque, outre la paire de poches trachéennes (pt), d'autres organes qui leur sont parallèles (x), visibles par transparence de la chitine, et dont nous ne connaissons pas l'équivalent; nous les aurions pris pour des trachées, s'il n'en existait pas déjà une paire sous forme de poches trachéennes. La conformation de ces deux paires de pattes est d'ailleurs très voisine de celle des pattes de Spirostreptus; elles ne présentent pas de variations saillantes chez les espèces qui suivent. 125 Chaque patte copulatrice (fig. 139 à 141) forme une masse subconique tronquée, composée de la patte antérieure et de la patte postérieure du même côté, réunies comme il a été dit. La patte antérieure se termine par une lamelle subrectangulaire peu profondément découpée et munie d'une petite pointe aiguë à son sommet. La patte postérieure est plus étroite que la patte antérieure, son extrémité est tordue, arrondie en spatule, à bord cilié ; son arête interne est munie d'une double rangée de petites dentelures. Nous avons reconnu en outre sur la face interne feutre les deux lames, une robuste apophyse à laquelle s'attache le fort muscle en éventail vu par transparence sur la figure 141 ; c'est probablement aussi sur la face interne (postérieure) de la patte antérieure que s'abrite la rainure séminale, dont nous croyons avoir aperçu la trace. L'organe repose sur deux poches trachéennes longues et grêles, fortement sinueuses, à angle droit avec l'organe. São Paulo ; Itapetininga Janvier 1897. Alto da Serra 1896. Pseudonannolene tricolor gracilis, var. Femelle : Longueur C2 mill. ; diamètre 2.90 mill. 61 segments; 113 paires de pattes; 2 segments apodes; Extrêmement voisin du tricolor typique, mais plus grêle et, par suite, plus élancé. Comme coloration nous remarquons que la bordure sanguine des somites affecte une forme subtriangulaire. La différence de neuveau entre le prozonite et le metazonite paraît un peu plus faible. Le prozonite n'est pas sensiblement plus mat que le metazonite. São Paulo; Piquete Janvier 1897. Il s'agit probablement d'une espèce différente du tricolor, mais en l'absence de caractères différentiels nets, nous l'envisageons provisoirement comme une variété de tricolor. 126 Pseudonannolene longicorns Porat, 1888 Var. : sebastianus, (n. var). (Pl. VI, fig. 128 à 133) Discriminé Concret Séinfinité de l'acte et pitta Begin PROVISION Femelle âge 22 2.25 1.35 2.50 2.80 68 106 Personne Bibliothèque, Septembre 1860. Femelle 67 101 101 2 Plumeuse, Janvier 1831. Femelle 101 "Âge 103 Belle (8. P.) Pénelope M.Âge 3.60 117 m AIM da Sem. Femelle 103 63 Silk. 8 de Aoat 1855. Unión. 63.— 70. M. said— SI. SI a.30 M S3 109 106 VI 2 2 Mâle.. M. SIbo 1.10 68 m S Bibliothèque, Septembre 1698. Mâle.. 29. 1.65 87 M £4 SI 103 109 109 Ilk« de Bio Bébital. Unión.. 61. 68 — 3.70 4.50 Circonstance, Décembre 1895. Unión.. £3.— ÏM. 70. 2 AIM de Serre. Unión.. 3.20 8.50 Unión, 8 Aoat issue. Unión Calomel Pon Coloration brun-noir avec les somites bordés de couleur claire, la bordure est généralement rouge brun que ou rouge sang sur le dos, passant au jaune d'ocre dans les flancs ; la tête, le premier et le dernier segment et les valves anales sont fauves, plus ou moins ternies de. brun; parfois les flancs, depuis la ligne des pores, sont entièrement fauves ; d'autres fois le pore est accompagné de deux ponctuations claires, Une en dessus, l'autre au dessous. Les antennes sont jaune fauve, parfois tirant sur le brun à l'extrémité ; pattes fauves. Corps élancé, généralement grêle, rétréci en arrière de la tête, médiocrement brillant, parfois un peu soyeux. Le métazonite est plus élevé que le prozonite. Tête lisse et brillante, parfois indistinctement plissée au-dessus de la lèvre, qui porte au moins six fossettes pilifères; sillon occipital très court et très fin, généralement peu distinct. Antennes longues, dépassant le quatrième somite et atteignant parfois le bord du cinquième (mâle), grêles, le sixième article n'est guère plus large que les précédents; 4 bâtonnets à l'extrémité. Les yeux sont subarrondis, écartés d'environ 1 1/2 fois leur grand diamètre, composés d'ocelles petits et distincts, au nombre d'environ 33 — 39 en 5 ou 6 rangées (8. 9. 9. 7. 6 — 9. 8. 7. 5. 3. 1). Premier segment (fig. 128) un peu globuleux dans les côtés, un peu enveloppant; le bord antérieur est indiscinctement échancré au-dessous des yeux, le bord postérieur est faiblement convexe; les côtés sont rétrécis et arrondis, leur surface est labourée de 6 ou 8 striures assez profondes, dont quelques-unes (2 ou 3) sont généralement incomplètes. Les segments du tronc sont un peu étranglés par la suture qui est ponctuée. Sur le prozonite, les stries concentriques, indistinctes à la loupe, apparaissent sous le microscope semées de ponctuations brillantes, fines et espacées; elles occupent un peu plus de la moitié antérieure du prozonite sur les dos, et l'envahissent presque entièrement sous le ventre où elles sont d'un peu plus distinctes; la dernière strie concentrique (postérieure) est un peu mieux que les autres. La seconde moitié du prozonite, mate sous la loupe, est extrêmement finement striolée longitudinalement. Le metazonite est fortement rugueux-granuleux, à l'exception d'une étroite bande transversale dorsale, contiguë à la suture, qui est simplesment semée de strioles extrêmement fines; un fin sillon longitudinal médian sur le dos. Au-dessous des pores, cette sculpture s'atténue et les stries longitudinales apparaissent ; elles sont fines et peu serrées, elles sont complètes à une petite distance du pore. Celui-ci est assez petit et s'ouvre à l'hauteur des flancs, à moitié environ du métazonite. Le dernier segment, cuireux à la base, devient rugueux près du bord postérieur ; il est coupé par quelques stries transversales ; le bord postérieur est complètement arrondi, il atteint et recouvre même, mais sans le dépasser, l'angle supérieur des valves anales qui est représenté par une faible arête transversale. Les valves sont très peu saillantes, mais très fortement globuleuses, à tel point que le bord libre, qui est très finement marginé, est dépassé par la partie globuleuse de la valve. L'écaillé ventrale est courte, son bord est à peine arrondi. Lame ventrale striée transversalement. Stigmates punctiforaves. Pattes médiocrement longues, grêles, armées d'un ongle grêle. Chez le mâle, les pattes sont dépourvues de caractères sexuels. Les pattes copulatrices (fig. 130 à 132) ressemblent à celles du P.v. tricolor, surtout par la comparaison des organes qu'on peut le mieux les caractériser. Chez Ps. sebasticmus, la paire antérieure est moins triangulaire, son bord externe est plus régulièrement arqué, l'épaulement externe qui précède la lame terminale est plus arrondi, le bord interne est plus échancré et plus sinueux ; la lame terminale est un peu plus étroite et moins anguleuse. La lame terminale de la paire postérieure (vue par la face postérieure) est moins déjetée latéralement et un peu moins longue (comparez les figures 132 et 141). Nous représentons (fig. 133) les dentelures de la facette interne sous un fort pressing ; on remarque que, dans l'épaisseur du tégument, à chaque dentelure correspond un pilier indiqué par les lignes ponctuées. Sur une préparation à la potasse, les piliers se détachent nettement en clair sur le fond jaune de la chitine. São Paulo ; São-Sebastião Setembro 1896, Santos Septembre 1896, Piquete Janvier 1897, Belém, Alto da Serra. Bahia 8 Août 1896. Cette espèce semble si voisine de Valloporus longicornis de Porat, que nous ne croyons pas pouvoir l'en séparer complètement ; mais comme l'auteur suédois parle dans sa diagnose de «valvulae anales sublaves, distincte marginatae» et de «sterna laevia», et que d'autre part les différences entre espèces sont minimes, nous nous croyons en droit de distinguer notre espèce sous un nom de variété, qui lui resterait si la nécessité se présentait d'en faire une espèce distincte. Pseudouspionele paulista, n. sp. (PI. VI, fig. 142 à 147) Longueur en Millimètres toutes en Millimètres tres Ventral. 70— Nombre de Segments 3.5' 3.60 Nombre de paires de pattes 74 72 135 133 Segments apodes 3 2 PROVENANCE Cerqueira Cesar, Décembre 1896. Distribué 60 65 3.20 3.50 75 74 137 139 4 2 Cerqueira Cesar, Décembre 1896. Noir (cendré ?) avec le bord postérieur des somites gris-olivâtre ; l'extrémité antérieure du corps et les valves tirent sur le jaune. Pattes ocrassées, ternies de brun. Corps allongé grêle, un peu rétrifié derrière la tête. Très brillant, sans différence de niveau entre le métazonite et le prozonite. Tête lisse et brillante ; 3-3 fossettes sur la lèvre. Le sillon occipital, réduit à une dépression au sommet de la tête, au point où il recoupe un fin sillon transversal interoculaire. Yeux petits, subovales, écartés d'environ 1 1/2 ou 2 fois leur grand diamètre, composés d'ocelles petits mais distincts, au nombre de 37 à 39 en 5 à 6 rangées droites (10.10.9.6.2—10.9.8.6.5.1). Antennes longues, atteignant le bord postérieur du quatrième somite, un peu moniliformes vers l'extrémité, peu soyeuses et même presque glabres dans la moitié basilaire, mais densément plantées de soies sur les cinq derniers articles. 4 bâtonnets à l'extrémité. Premier segment (fig. 142) un peu globuleux dans les côtés, à surface lisse et brillante. Le bord antérieur est faiblement échancré à la hauteur des yeux et forme à son intersection avec le bord postérieur un angle droit à pointe arrondie, un peu replié sous le ventre ; le bord postérieur est un peu convexe dans le voisinage de l'angle. La surface des côtés est marquée d'environ six striures proportionnellement étroites et médiocrement profondes, plus ou moins régulières et complètes. Sur les segments du tronc, le prozonite est nettement divisé en deux moitiés inégales ; l'une antérieure, la plus petite, mate avec de nombreuses striures concentriques indistinctes ; l'autre postérieure, complètement lisse, ou avec de rares striures indistinctes, et très brillante. La suture est bien marquée, à peine étranglée, et délicatement ponctuée. Le metazonite est lisse aussi et brillant ; les striures y sont beaucoup plus denses, tout en étant très peu distinctes ou distinctes seulement près du bord postérieur. Le pore est petit, il s'ouvre à mi-hauteur dans les flancs et au premier tiers environ du metazonite. Les striures longitudinales du metazonite s'arrêtent loin du pore, étant presque limitées au ventre ; elles sont fines et espacées. Le dernier segment (fig. 143) est finement ou extrêmement finement cuireux, moins brillant que les autres somites, parfois déprimé transversalement au deuxième tiers ; son bord postérieur est à peu près arrondi ou très largement anguleux, il atteint, sans le recouvrir, l'angle supérieur des valves anales. Les valves sont peu saillantes et très globuleuses, mais le bord libre, qui est complètement arrondi, n'est pas rentrant comme chez Ps. callipyge; leur surface est extrêmement finement cuite, assez brillante. L'écaillé ventral est courte, son bord postérieur est faiblement arqué. Lames ventrales presque lisses ou extrêmement finement et densément striolées transversalement. Stigmates punctiformes. Pattes assez longues. Comparées aux pattes copulatrices du Ps. sebasticus et du Ps. tricolor, celles du Ps. paulista (fig, 144 à 147) sont plus larges, le bord externe est plus convexe, plus arrondi; le lambeau apical de la paire antérieure est plus étroit et plus long, son bord supérieur est armé de 2 épines en partie recouvertes par des lamelles transparentes, qui présentent des granulations du côté externe. Le lambeau apical de la patte postérieure est plus arrondi, un peu plus globuleux, surmonté de longues lanières. São-Paulo; Cerqueira Cesar Décembre 1896. Pseudecanthus callipyge, n. sp. (PL Vil, fig. 154 à 159) Femelle: longueur 49 mill.; diamètre 2.70 mil; 85 segments; 99 paires de pattes; 2 segments apodes. Paraná. Mâle: longueur 57 mill.; diamètre 3.30 mil; 56 segments; 103 paires de pattes; 2 segments apodes. Paraná. Coloration brun-fauve, avec le vertex, les prothoraces, le dernier segment et les valves plus foncés, parfois presque noirs; la lèvre, le bord postérieur des souches au dessous des pores et les pattes sont fauves, plus clairs que le fond; antennes de la couleur du fond ou un peu plus foncées; le metazonite peut également présenter une ligne transversale claire le long de la suture. Corps élancé, un peu rétréci derrière la tête, sans différence sensible de niveau entre le prozonite et le metazonite ; luisant sur le dos, plus brillant dans les flancs et sous le ventre (ce dernier caractère permet de le reconnaître de Ps. paulista, dont il est d'ailleurs très voisin). Tête lisse et brillante, faiblement striolée au-dessus de la lèvre qui porte 3-3 toisettes. Une dépression punctiforme au sommet de la tête, en contact avec une faible strie interoculaire, tient lieu de sillon occipital. Yeux petits, subovales, écartés d'au moins 2 fois leur grand diamètre, composés de 33 — 38 ocelles petits mais distincts, sur 6 rangées (5.6.7.8.5.2 — 7.8.8.7.5.3). Antennes longues, dépassant le quatrième somite (Mâle), ou atteignant le bord postérieur du cinquième (Femelle), grêles, un peu moniliformes, surtout vers l'extrémité ; 4 bâtonnets tactiles à l'extrémité. Premier segment (fig. 154) un peu globuleux dans les côtés, et un peu enveloppant ; à surface presque lisse et brillante. Le bord antérieur est subéchancré au-dessous des yeux, le bord latéral est arrondi et le bord postérieur est très faiblement convexe ; il n'y a pas trace ni de l'angle antérieur ni de l'angle postérieur ; la surface est labourée d'environ cinq sillons assez larges et assez profonds, plus ou moins réguliers. Sur les segments du tronc, la partie dorsale est moins brillante que les flancs et le ventre, les stries concentriques sont fines et n'occupent que la moitié du prozonite ; l'autre moitié est mate, sans sculpture distincte sous la loupe, mais pourtant avec des strioles longitudinales extrêmement fines et peu définies. La suture est ponctuée. Sur le dos le métazonite est très finement, mais distinctement striolé ; les strioles sont longues, droites, denses, elles s'atténuent dans les flancs qui présentent, par contre, des dépressions subcirculaires ou transversales larges et très peu profondes, disposées en séries concentriques ; ces dépressions sont limitées aux flancs des somites du milieu du corps ; les stries longitudinales sont fines, complètes, assez espacées et s'arrêtent loin du pore. Les pores s'ouvrent à mi-hauteur des flancs au premier tiers environ du métazonite. Le bord postérieur des trois ou quatre avant-derniers somites est plissé longitudinairement (an semper ?). Le dernier segment (fig. 155) est faiblement courbeux à la base, et un peu plus fortement en arrière ; le bord postérieur est arrondi et recouvert, sans le dépasser, l'angle supérieur des valves anales. Les valves sont presque lisses, peu saillantes, plus globuleuses à la base que près du bord ; chez la femelle, celui-ci, bien que présentant une dépression marginale distincte, n'est pas rebordé ; chez le mâle au contraire, la dépression ainsi que le rebord sont nets. L'écaile ventrale est courte et large ; son bord est faiblement convexe. Les tentacules extrêmement finement et densément striolés transversalement. Stigmates trigono-punctiformes. Pattes assez courtes. La patte copulatrice (fig. 156 à 159) ne diffère de celle des espèces précédentes que par des détails relevant de la comparaison des figures 159 et 181, 141, 147. Toutefois, la lame apicale antérieure semble un peu plus étroite, plus effilée, et la lamelle épineuse est moins développée. Les lanières de la lame apicale postérieure sont moins longues que chez Ps. Paulista. Paraná. Pseudocannulepe scalaris, n. sp. (PI. VI et VII, fig. 148 à 153) Femelle : longueur 50 mill.; diamètre 2.60 mill.; 61 segments; 11 paires de pattes; 2 segments apodes. Buenos-Aires. Coloration brun-fauve sur le dos, avec une bande transversale d'un beau jaune doré contigue à la suture, occupant presque la moitié antérieure du métaméritite, et interrompue à la hauteur du pore; sur quelques somites, la suture est précédée d'un filet irrégulier transversal de même couleur. Les flancs sont plus jaunâtres, le prozonite paraissant plus clair que le métazonite. Tête fauve; antennes fortement tachées de brun; pattes fauves; dernier segment et valves anales noirâtres. Corps élancé, grêle, un peu rétréci derrière la tête, sans différence de niveau sensible entre le prozontite et le métazonite; assez brillant. Tête presque lisse, brillante au sommet et jusqu'à près de la lèvre qui est finement rugueuse et ornée de nombreuses fossettes. Sillon occipital aussi fin que le sillon interoculaire; ce dernier très net. Yeux subpyriformes écartés d'environ deux fois leur grand diamètre, composés de 35 ocelles très petits, mais distincts, en 7 rangées (4, 6, 5, 3). Antennes assez longues, atteignant le bord du quatrième somite, faiblement épaissies à l'extrémité, vêtues de soies courtes et peu denses; (?) bâtonnets à l'extrémité. Le premier segment (fig. 148) est assez lisse et brillant; les côtés sont arrondis, sans traces d'angles; le bord antérieur est droit (non éclaté), le bord postérieur est un peu concave; la surface est labourée de quatre stries larges, la marginale non comprise. Sur les segments du tronc, prozonites et metazonites ont la même sculpture, c'est-à-dire que, sous la loupe, ils apparaissent extrêmement finement, presque indistinctement, et densément striolés longitudinalement. Au-dessous des pores, les téguments sont un peu plus brillants que sur le dos, la suture est pontuée. Les stries longitudinales sont fines, elles ne sont entières qu'à une certaine distance du pore. Celui-ci est assez grand et s'ouvre à mi-hauteur des flancs et à moitié environ du metazonite. Le dernier segment (fig. 149) est convexe, plus fortement en arrière; son bord postérieur est largement ogival, presque arrondi, il est un peu déprimé de chaque côté de la ligne médiane donnant ainsi naissance à une carène indistincte dans le quart postérieur du somite. Les valves sont peu saillantes, très globuleuses jusqu'au bord libre qui est caréné, le rebord marginal résultant d'une impression (ou sillon) large, avec contours arrêtés. Écaille ventrale courte, à bord postérieur un peu anguleux. — 135 Pattes assez courtes. Joues du mâle un peu épaissies inférieurement. Pattes copulatrices (fig. 150 à 153) proportionnellement plus étroites que chez les espèces précédentes. Patte antérieure à bord externe presque droit jusqu'à mi-hauteur, brusquement rétrécie à ce point, formant ensuite un lambeau apical long et étroit, qui dépasse de beaucoup la pointe du lambeau postérieur. Le bord interne de la patte postérieure ne porte que quelques rares (6 à 8) dentelures ; les lanières du lambeau apical sont longues sur la patte antérieure, et courtes en arrière. La femelle est inconnue. Argentine : Buenos-Aires. Pseudonannolene patagonica, n. sp. (Pl. VII. fig. 160 à 165; Femelle : longueur 47 mill. ; diamètre 2.40 mill. ; 60 segments ; 109 paires de pattes ; 2 segments apodes. Carmen de Patagones. Coloration noire sur le dos et brun-rouge dans les flancs ; au bord postérieur des somites une étroite bande jaune vif ; extrémités du corps brun-rouge très foncé ou noir ; pattes ocracées. Corps grêle, assez élancé, un peu rétréci derrière la tête. Les métazonites sont très faiblement surélevés ; les téguments sont assez brillants ; ils ne sont pas lisses, ils présentent un grain aplati microscopique, qui n'est reconnaissable qu'à un fort grossissement. Tête presque lisse, assez brillante; lèvre faiblement rugueuse, très peu échancrée, avec 3+3 fossettes rapprochées; sillon très fin, non déprimé, se perdant en avant dans un sillon interoculaire extrêmement fin. Yeux subpentagonaux, écartés d'environ 1 1/2 fois leur grand diamètre, composés d'environ 43 ocelles petits mais très distincts en 7 rangées presque droites (8.11.10.8.7.6.3). Antennes longues, atteignant le bord postérieur du cinquième somite, vêtues de soies peu denses et très courtes; 4 bâtonnets à l'extrémité. Le premier segment est parsemé de strides vagues; il est un peu globuleux latéralement et enveloppant; les côtés sont taillés en angles arrondis, le bord antérieur est faiblement échancré à la hauteur des yeux et un peu convexe au dessous; le bord postérieur n'est pas convexe, il est taillé obliquement avant Tangle, de sorte que le niveau de l'angle correspond à la moitié du segment; on compte de chaque côté environ 8 stries assez larges et profondes. Les prozonites du tronc présentent dans leur moitié antérieure de très petites ponctuations brillantes qui permettent seules de reconnaître les stries concentriques, car celles-ci sont obsolètes; dans la moitié postérieure le prozonite est indistinctement striolé. La suture est un peu étranglée et nettement ponctuée. Sur le metazonite, les strioles sont plus denses et plus accentuées que sur le prozonite; les stries longitudinales sont assez nombreuses et fines, elles remontent jusqu'à une distance du pore, qui s'ouvre à mi-hauteur environ des flancs et à moitié du metazonite, juste à la limite entre la coloration noire du dos et la coloration brun-rouge du ventre. Le bord postérieur du dernier segment est presqu'entièrement arrondi, ou indistinctement anguleux, et recouvre, sans le dépasser, l'angle supérieur des valves; sa surface, lisse à la base devient graduellement coutueuse et, sur le dos, son bord postérieur est déprimé et cannelé longitudinalement. Les valves anales sont presque lisses, avec quelques strioles cependant, courtes, très globuleuses jusqu'au bord qui est très finement margané; le rebord est plus saillant que la convexité des valves. L'écaile ventrale est courte, large, à bord postérieur presque transversal. Lames ventrales nettement striées transversalement. Stigmates punctiformes. Pattes médiocrement allongées. Les "pattes copulatrices" (fig. 162 à 165) sont proportionnellement courtes et arrondies, en même temps qu'un peu globuleuses; la face interne est pourvue de nombreuses dents. Le lambeau apical de la patte antérieure est étroit et long, il représente le tiers de la longueur totale de la patte; l'extrémité est arrondie, c'est-à-dire sans prolongement épineux; le bord interne présente près de la base quelques cils courts. Le lambeau apical de la paire postérieure est de moitié moins long que l'autre, arrondi, son bord postérieur forme une forte dent émoussée. La femelle est inconnue. Argentine: Carmen de Patagones. [Para. Spirostreptids] Pocock, 1893 Les caractères des Spirostreptides sont assez connus pour que nous n'ayons pas à les énumérer. En ce qui concerne le Gnathochilarium, il suffit de renvoyer le lecteur à la thèse du Dr. von Rath (von Rath N. 86), où il en trouvera une description détaillée. À l'égard des pattes copulatrices, dont Voges (Voges N. 7) a donné une description, il est bon de relever certaines interprétations de cet auteur qui sont erronées. Voges compare la première paire à un cylindre aplati d'avant en arrière, et fendu longitudinalement; jusqu'ici rien de mieux. Mais il considère ce cylindre comme constitué par la fusion des deux pièces qui sont connues chez les huit palpiers arctiques pr. dits sous la dénomination de «patte copulatrice antérieure» (ou lame anterior) et «lame antérieure de la patte copulatrice postérieure» (ou lame media); ceci n'est pas exact. Nous savons par les travaux du Dr. Verhoeven que la lame media appartient positivement à la patte copulatrice postérieure; si donc l'interprétation de Voges était exacte, il faudrait supposer que la lame media s'est séparée de la patte postérieure pour s'unir à la patte antérieure. Cette supposition, outre qu'elle n'est guère probable, est contredite par le fait suivant. Chez un jeune de Spirostreptus (Alloporus) setigerus, dont nous avons figuré le copulateur (fig. 176, 177), nous voyons que la patte antérieure, au lieu d'affecter la forme d'un cylindre, est complètement étalée et que son lambeau antérieur est déplié sur le côté externe du lambeau postérieur; la languette antérieure de la patte antérieure est simplement cavée pour servir de logement à la patte postérieure (PP), qui est rudimentaire. Il y a donc lieu d'admettre que le lambeau antérieur n'est qu'un développement latéral du lambeau postérieur qui se trouve replié en avant chez l'adulte, et que les deux lambeaux appartiennent bien à la même patte, qui est l'homologue de la patte antérieure seule des luHdes d'Europe. Avant de passer à la patte postérieure, nous voulerions encore attirer l'attention sur le talon cetineux qui existe à la base externe de la patte antérieure (tn). Ce talon, de forme grossièrement triangulaire, est constitué par deux feuillets fortement reliés l'un à l'autre par des muscles et par d'épaisses membranes ; l'un de ces feuillets, l'externe, fait partie de la patte postérieure ; l'autre, le feuillet interne, appartient à la patte antérieure. Lorsque l'animal n'est pas adulte (fig. 176, 177), ce talon, au lieu d'être relevé sur le côté de l'organe, plonge dans l'intérieur du sac copulateur. Cette position jointe au fait que c'est sur ses bords que s'insèrent les membranes du sac copulateur, pourrait faire supposer que cette pièce est l'homologue de la hanche ; mais ce point demande une investigation plus attentive. La rainure séminale qui parcourt dans toute sa longueur la patte postérieure, semble aboutir entre les feuillets du talon ; et ce qui donne une certaine vraisemblance à cette supposition, c'est que, sur la figure 220 (Sp. seminiferus), nous avons trouvé dans ce voisinage le tronçon d'un canal (prostat) qui paraît être l'équivalent du canal prostatique des Mammifères.
| 24,434 |
https://github.com/kvark/VK-GL-CTS/blob/master/external/vulkancts/modules/vulkan/api/vktApiGetMemoryCommitment.cpp
|
Github Open Source
|
Open Source
|
Apache-2.0
| null |
VK-GL-CTS
|
kvark
|
C++
|
Code
| 1,520 | 6,785 |
/*-------------------------------------------------------------------------
* Vulkan Conformance Tests
* ------------------------
*
* Copyright (c) 2016 The Khronos Group Inc.
* Copyright (c) 2016 Samsung Electronics Co., Ltd.
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
* You may obtain a copy of the License at
*
* http://www.apache.org/licenses/LICENSE-2.0
*
* Unless required by applicable law or agreed to in writing, software
* distributed under the License is distributed on an "AS IS" BASIS,
* WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
* See the License for the specific language governing permissions and
* limitations under the License.
*
*//*!
* \file
* \brief Memory Commitment tests
*//*--------------------------------------------------------------------*/
#include "vktApiGetMemoryCommitment.hpp"
#include "vkDeviceUtil.hpp"
#include "vkQueryUtil.hpp"
#include "vkRefUtil.hpp"
#include "vkImageUtil.hpp"
#include "vkMemUtil.hpp"
#include "vkPrograms.hpp"
#include "vktTestCase.hpp"
#include "vkTypeUtil.cpp"
#include "vkCmdUtil.cpp"
#include "vkObjUtil.cpp"
#include "tcuTestLog.hpp"
using namespace vk;
using tcu::TestLog;
namespace vkt
{
namespace api
{
struct MemoryCommitmentCaseParams
{
deUint32 bufferSize;
deUint32 bufferViewSize;
deUint32 elementOffset;
};
class MemoryCommitmentTestInstance : public vkt::TestInstance
{
public:
MemoryCommitmentTestInstance (Context& context, MemoryCommitmentCaseParams testCase);
tcu::TestStatus iterate (void);
deUint32 getMemoryTypeIndex (VkMemoryPropertyFlags propertyFlag, VkPhysicalDeviceMemoryProperties pMemoryProperties);
Move<VkCommandPool> createCommandPool () const;
Move<VkCommandBuffer> allocatePrimaryCommandBuffer (VkCommandPool commandPool) const;
bool isDeviceMemoryCommitmentOk (const VkMemoryRequirements memoryRequirements);
private:
const tcu::IVec2 m_renderSize;
};
MemoryCommitmentTestInstance::MemoryCommitmentTestInstance(Context& context, MemoryCommitmentCaseParams testCase)
: vkt::TestInstance (context)
, m_renderSize (testCase.bufferViewSize, testCase.bufferViewSize)
{
}
class MemoryCommitmentTestCase : public vkt::TestCase
{
public:
MemoryCommitmentTestCase (tcu::TestContext& testCtx,
const std::string& name,
const std::string& description,
MemoryCommitmentCaseParams memoryCommitmentTestInfo)
: vkt::TestCase (testCtx, name, description)
, m_memoryCommitmentTestInfo (memoryCommitmentTestInfo)
{}
virtual ~MemoryCommitmentTestCase(void){}
virtual void initPrograms (SourceCollections& programCollection) const;
virtual TestInstance* createInstance (Context& context) const
{
return new MemoryCommitmentTestInstance(context, m_memoryCommitmentTestInfo);
}
private:
MemoryCommitmentCaseParams m_memoryCommitmentTestInfo;
};
tcu::TestStatus MemoryCommitmentTestInstance::iterate(void)
{
const VkMemoryPropertyFlags propertyFlag = VK_MEMORY_PROPERTY_LAZILY_ALLOCATED_BIT;
const VkPhysicalDevice physicalDevice = m_context.getPhysicalDevice();
const InstanceInterface& vki = m_context.getInstanceInterface();
const VkPhysicalDeviceMemoryProperties pMemoryProperties = getPhysicalDeviceMemoryProperties(vki,physicalDevice);
const deUint32 memoryTypeIndex = getMemoryTypeIndex(propertyFlag, pMemoryProperties);
Allocator& memAlloc = m_context.getDefaultAllocator();
bool isMemoryAllocationOK = false;
const deUint32 queueFamilyIndex = m_context.getUniversalQueueFamilyIndex();
const VkComponentMapping componentMappingRGBA = { VK_COMPONENT_SWIZZLE_R, VK_COMPONENT_SWIZZLE_G, VK_COMPONENT_SWIZZLE_B, VK_COMPONENT_SWIZZLE_A };
const DeviceInterface& vkd = m_context.getDeviceInterface();
const Move<VkCommandPool> cmdPool = createCommandPool();
const Move<VkCommandBuffer> cmdBuffer = allocatePrimaryCommandBuffer(*cmdPool);
const VkDevice device = m_context.getDevice();
Move<VkImageView> colorAttachmentView;
Move<VkRenderPass> renderPass;
Move<VkFramebuffer> framebuffer;
Move<VkDescriptorSetLayout> descriptorSetLayout;
Move<VkPipelineLayout> pipelineLayout;
Move<VkShaderModule> vertexShaderModule;
Move<VkShaderModule> fragmentShaderModule;
Move<VkPipeline> graphicsPipelines;
if (memoryTypeIndex == static_cast<deUint32>(-1))
TCU_THROW(NotSupportedError, "Lazily allocated bit is not supported");
const VkImageCreateInfo imageParams =
{
VK_STRUCTURE_TYPE_IMAGE_CREATE_INFO, // VkStructureType sType;
DE_NULL, // const void* pNext;
0u, // VkImageCreateFlags flags;
VK_IMAGE_TYPE_2D, // VkImageType imageType;
VK_FORMAT_R32_UINT, // VkFormat format;
{256u, 256u, 1}, // VkExtent3D extent;
1u, // deUint32 mipLevels;
1u, // deUint32 arraySize;
VK_SAMPLE_COUNT_1_BIT, // deUint32 samples;
VK_IMAGE_TILING_OPTIMAL, // VkImageTiling tiling;
VK_IMAGE_USAGE_COLOR_ATTACHMENT_BIT |
VK_IMAGE_USAGE_TRANSIENT_ATTACHMENT_BIT, // VkImageUsageFlags usage;
VK_SHARING_MODE_EXCLUSIVE, // VkSharingMode sharingMode;
1u, // deUint32 queueFamilyCount;
&queueFamilyIndex, // const deUint32* pQueueFamilyIndices;
VK_IMAGE_LAYOUT_UNDEFINED, // VkImageLayout initialLayout;
};
Move<VkImage> image = createImage(vkd, device, &imageParams);
const VkMemoryRequirements memoryRequirements = getImageMemoryRequirements(vkd, device, *image);
de::MovePtr<Allocation> imageAlloc = memAlloc.allocate(memoryRequirements, MemoryRequirement::LazilyAllocated);
VK_CHECK(vkd.bindImageMemory(device, *image, imageAlloc->getMemory(), imageAlloc->getOffset()));
const VkImageViewCreateInfo colorAttachmentViewParams =
{
VK_STRUCTURE_TYPE_IMAGE_VIEW_CREATE_INFO, // VkStructureType sType;
DE_NULL, // const void* pNext;
0u, // VkImageViewCreateFlags flags;
*image, // VkImage image;
VK_IMAGE_VIEW_TYPE_2D, // VkImageViewType viewType;
VK_FORMAT_R32_UINT, // VkFormat format;
componentMappingRGBA, // VkComponentMapping components;
{ VK_IMAGE_ASPECT_COLOR_BIT, 0u, 1u, 0u, 1u } // VkImageSubresourceRange subresourceRange;
};
colorAttachmentView = createImageView(vkd, device, &colorAttachmentViewParams);
// Create render pass
renderPass = makeRenderPass(vkd, device, VK_FORMAT_R32_UINT);
// Create framebuffer
{
const VkImageView attachmentBindInfos[1] =
{
*colorAttachmentView,
};
const VkFramebufferCreateInfo framebufferParams =
{
VK_STRUCTURE_TYPE_FRAMEBUFFER_CREATE_INFO, // VkStructureType sType;
DE_NULL, // const void* pNext;
(VkFramebufferCreateFlags)0,
*renderPass, // VkRenderPass renderPass;
1u, // deUint32 attachmentCount;
attachmentBindInfos, // const VkImageView* pAttachments;
(deUint32)m_renderSize.x(), // deUint32 width;
(deUint32)m_renderSize.y(), // deUint32 height;
1u // deUint32 layers;
};
framebuffer = createFramebuffer(vkd, device, &framebufferParams);
}
// Create descriptors
{
const VkDescriptorSetLayoutBinding layoutBindings[1] =
{
{
0u, // deUint32 binding;
VK_DESCRIPTOR_TYPE_UNIFORM_TEXEL_BUFFER, // VkDescriptorType descriptorType;
1u, // deUint32 arraySize;
VK_SHADER_STAGE_ALL, // VkShaderStageFlags stageFlags;
DE_NULL // const VkSampler* pImmutableSamplers;
},
};
const VkDescriptorSetLayoutCreateInfo descriptorLayoutParams =
{
VK_STRUCTURE_TYPE_DESCRIPTOR_SET_LAYOUT_CREATE_INFO, // VkStructureType sType;
DE_NULL, // cost void* pNexŧ;
(VkDescriptorSetLayoutCreateFlags)0,
DE_LENGTH_OF_ARRAY(layoutBindings), // deUint32 count;
layoutBindings // const VkDescriptorSetLayoutBinding pBinding;
};
descriptorSetLayout = createDescriptorSetLayout(vkd, device, &descriptorLayoutParams);
}
// Create pipeline layout
{
const VkPipelineLayoutCreateInfo pipelineLayoutParams =
{
VK_STRUCTURE_TYPE_PIPELINE_LAYOUT_CREATE_INFO, // VkStructureType sType;
DE_NULL, // const void* pNext;
(VkPipelineLayoutCreateFlags)0,
1u, // deUint32 descriptorSetCount;
&*descriptorSetLayout, // const VkDescriptorSetLayout* pSetLayouts;
0u, // deUint32 pushConstantRangeCount;
DE_NULL // const VkPushConstantRange* pPushConstantRanges;
};
pipelineLayout = createPipelineLayout(vkd, device, &pipelineLayoutParams);
}
// Create shaders
{
vertexShaderModule = createShaderModule(vkd, device, m_context.getBinaryCollection().get("vert"), 0);
fragmentShaderModule = createShaderModule(vkd, device, m_context.getBinaryCollection().get("frag"), 0);
}
// Create pipeline
{
const std::vector<VkViewport> viewports (1, makeViewport(m_renderSize));
const std::vector<VkRect2D> scissors (1, makeRect2D(m_renderSize));
graphicsPipelines = makeGraphicsPipeline(vkd, // const DeviceInterface& vk
device, // const VkDevice device
*pipelineLayout, // const VkPipelineLayout pipelineLayout
*vertexShaderModule, // const VkShaderModule vertexShaderModule
DE_NULL, // const VkShaderModule tessellationControlModule
DE_NULL, // const VkShaderModule tessellationEvalModule
DE_NULL, // const VkShaderModule geometryShaderModule
*fragmentShaderModule, // const VkShaderModule fragmentShaderModule
*renderPass, // const VkRenderPass renderPass
viewports, // const std::vector<VkViewport>& viewports
scissors); // const std::vector<VkRect2D>& scissors
}
// getMemoryCommitment
isMemoryAllocationOK = isDeviceMemoryCommitmentOk(memoryRequirements);
const deUint32 clearColor[4] = { 1u, 1u, 1u, 1u };
const VkClearAttachment clearAttachment =
{
VK_IMAGE_ASPECT_COLOR_BIT, // VkImageAspectFlags aspectMask;
0u, // deUint32 colorAttachment;
makeClearValueColorU32(clearColor[0],
clearColor[1],
clearColor[2],
clearColor[3]) // VkClearValue clearValue;
};
const VkOffset2D offset =
{
0,
0
};
const VkExtent2D extent =
{
256u,
256u
};
const VkRect2D rect =
{
offset,
extent
};
const VkClearRect clearRect =
{
rect,
1u, // baseArrayLayer
1u // layerCount
};
// beginCommandBuffer
beginCommandBuffer(vkd, *cmdBuffer);
const VkImageMemoryBarrier initialImageBarrier =
{
VK_STRUCTURE_TYPE_IMAGE_MEMORY_BARRIER, // VkStructureType sType;
DE_NULL, // const void* pNext;
0, // VkMemoryOutputFlags outputMask;
VK_ACCESS_COLOR_ATTACHMENT_WRITE_BIT, // VkMemoryInputFlags inputMask;
VK_IMAGE_LAYOUT_UNDEFINED, // VkImageLayout oldLayout;
VK_IMAGE_LAYOUT_COLOR_ATTACHMENT_OPTIMAL, // VkImageLayout newLayout;
VK_QUEUE_FAMILY_IGNORED, // deUint32 srcQueueFamilyIndex;
VK_QUEUE_FAMILY_IGNORED, // deUint32 destQueueFamilyIndex;
image.get(), // VkImage image;
{ // VkImageSubresourceRange subresourceRange;
VK_IMAGE_ASPECT_COLOR_BIT, // VkImageAspectFlags aspectMask;
0u, // deUint32 baseMipLevel;
1u, // deUint32 mipLevels;
0u, // deUint32 baseArraySlice;
1u // deUint32 arraySize;
}
};
vkd.cmdPipelineBarrier(*cmdBuffer, VK_PIPELINE_STAGE_TOP_OF_PIPE_BIT, VK_PIPELINE_STAGE_COLOR_ATTACHMENT_OUTPUT_BIT, (VkDependencyFlags)0, 0, (const VkMemoryBarrier*)DE_NULL, 0, (const VkBufferMemoryBarrier*)DE_NULL, 1, &initialImageBarrier);
beginRenderPass(vkd, *cmdBuffer, *renderPass, *framebuffer, makeRect2D(0, 0, 256u, 256u), tcu::Vec4(0.0f, 0.0f, 1.0f, 1.0f));
vkd.cmdBindPipeline(*cmdBuffer, VK_PIPELINE_BIND_POINT_GRAPHICS, *graphicsPipelines);
// clearAttachments
vkd.cmdClearAttachments(*cmdBuffer, 1, &clearAttachment, 1u, &clearRect);
endRenderPass(vkd, *cmdBuffer);
endCommandBuffer(vkd, *cmdBuffer);
// queueSubmit
const VkQueue queue = m_context.getUniversalQueue();
submitCommandsAndWait(vkd, device, queue, *cmdBuffer);
// getMemoryCommitment
isMemoryAllocationOK = (isMemoryAllocationOK && isDeviceMemoryCommitmentOk(memoryRequirements)) ? true : false;
if (isMemoryAllocationOK)
return tcu::TestStatus::pass("Pass");
return tcu::TestStatus::fail("Fail");
}
class MemoryCommitmentAllocateOnlyTestInstance : public vkt::TestInstance
{
public:
MemoryCommitmentAllocateOnlyTestInstance (Context& context);
tcu::TestStatus iterate (void);
};
class MemoryCommitmentAllocateOnlyTestCase : public vkt::TestCase
{
public:
MemoryCommitmentAllocateOnlyTestCase (tcu::TestContext& testCtx,
const std::string& name,
const std::string& description)
: vkt::TestCase (testCtx, name, description)
{}
virtual ~MemoryCommitmentAllocateOnlyTestCase(void){}
virtual TestInstance* createInstance (Context& context) const
{
return new MemoryCommitmentAllocateOnlyTestInstance(context);
}
};
MemoryCommitmentAllocateOnlyTestInstance::MemoryCommitmentAllocateOnlyTestInstance(Context& context)
: vkt::TestInstance (context)
{
}
tcu::TestStatus MemoryCommitmentAllocateOnlyTestInstance::iterate(void)
{
const VkPhysicalDevice physicalDevice = m_context.getPhysicalDevice();
const VkDevice device = m_context.getDevice();
const InstanceInterface& vki = m_context.getInstanceInterface();
const DeviceInterface& vkd = m_context.getDeviceInterface();
const VkPhysicalDeviceMemoryProperties pMemoryProperties = getPhysicalDeviceMemoryProperties(vki,physicalDevice);
const VkMemoryPropertyFlags propertyFlag = VK_MEMORY_PROPERTY_LAZILY_ALLOCATED_BIT;
const int arrayLength = 10;
VkDeviceSize pCommittedMemoryInBytes = 0u;
VkDeviceSize allocSize[arrayLength];
// generating random allocation sizes
for (int i = 0; i < arrayLength; ++i)
{
allocSize[i] = rand() % 1000 + 1;
}
for (deUint32 memoryTypeIndex = 0u; memoryTypeIndex < VK_MAX_MEMORY_TYPES; ++memoryTypeIndex) //for memoryTypes
{
if((pMemoryProperties.memoryTypes[memoryTypeIndex].propertyFlags & propertyFlag) == propertyFlag) //if supports Lazy allocation
{
for (int i = 0; i < arrayLength; ++i)
{
const VkMemoryAllocateInfo memAllocInfo =
{
VK_STRUCTURE_TYPE_MEMORY_ALLOCATE_INFO, // VkStructureType sType
NULL, // const void* pNext
allocSize[i], // VkDeviceSize allocationSize
memoryTypeIndex // deUint32 memoryTypeIndex
};
Move<VkDeviceMemory> memory = allocateMemory(vkd, device, &memAllocInfo, (const VkAllocationCallbacks*)DE_NULL);
vkd.getDeviceMemoryCommitment(device, memory.get(), &pCommittedMemoryInBytes);
if(pCommittedMemoryInBytes != 0)
{
tcu::TestLog& log = m_context.getTestContext().getLog();
log << TestLog::Message << "Warning: Memory commitment not null before binding." << TestLog::EndMessage;
}
if(pCommittedMemoryInBytes > allocSize[i])
return tcu::TestStatus::fail("Fail");
}
}
}
return tcu::TestStatus::pass("Pass");
}
deUint32 MemoryCommitmentTestInstance::getMemoryTypeIndex(VkMemoryPropertyFlags propertyFlag, VkPhysicalDeviceMemoryProperties pMemoryProperties)
{
for (deUint32 memoryTypeIndex = 0u; memoryTypeIndex < VK_MAX_MEMORY_TYPES; ++memoryTypeIndex)
{
if((pMemoryProperties.memoryTypes[memoryTypeIndex].propertyFlags & propertyFlag) == propertyFlag)
return memoryTypeIndex;
}
return static_cast<deUint32>(-1);
}
void MemoryCommitmentTestCase::initPrograms (SourceCollections& programCollection) const
{
programCollection.glslSources.add("vert") << glu::VertexSource(
"#version 310 es\n"
"layout (location = 0) in highp vec4 a_position;\n"
"void main()\n"
"{\n"
" gl_Position = a_position;\n"
"}\n");
programCollection.glslSources.add("frag") << glu::FragmentSource(
"#version 310 es\n"
"#extension GL_EXT_texture_buffer : enable\n"
"layout (set=0, binding=0) uniform highp usamplerBuffer u_buffer;\n"
"layout (location = 0) out highp uint o_color;\n"
"void main()\n"
"{\n"
" o_color = texelFetch(u_buffer, int(gl_FragCoord.x)).x;\n"
"}\n");
}
Move<VkCommandPool> MemoryCommitmentTestInstance::createCommandPool() const
{
const VkDevice device = m_context.getDevice();
const DeviceInterface& vkd = m_context.getDeviceInterface();
const deUint32 queueFamilyIndex = m_context.getUniversalQueueFamilyIndex();
return vk::createCommandPool(vkd, device, VK_COMMAND_POOL_CREATE_TRANSIENT_BIT, queueFamilyIndex);
}
Move<VkCommandBuffer> MemoryCommitmentTestInstance::allocatePrimaryCommandBuffer (VkCommandPool commandPool) const
{
const VkDevice device = m_context.getDevice();
const DeviceInterface& vkd = m_context.getDeviceInterface();
return vk::allocateCommandBuffer(vkd, device, commandPool, VK_COMMAND_BUFFER_LEVEL_PRIMARY);
}
bool MemoryCommitmentTestInstance::isDeviceMemoryCommitmentOk(const VkMemoryRequirements memoryRequirements)
{
const VkFormat colorFormat = VK_FORMAT_R32_UINT;
const VkPhysicalDevice physicalDevice = m_context.getPhysicalDevice();
const InstanceInterface& vki = m_context.getInstanceInterface();
const VkMemoryPropertyFlags propertyFlag = VK_MEMORY_PROPERTY_LAZILY_ALLOCATED_BIT;
const VkPhysicalDeviceMemoryProperties pMemoryProperties = getPhysicalDeviceMemoryProperties(vki,physicalDevice);
const VkDeviceSize pixelDataSize = m_renderSize.x() * m_renderSize.y() * mapVkFormat(colorFormat).getPixelSize();
for (deUint32 memTypeNdx = 0u; memTypeNdx < VK_MAX_MEMORY_TYPES; ++memTypeNdx)
{
if((pMemoryProperties.memoryTypes[memTypeNdx].propertyFlags & propertyFlag) == propertyFlag) //if supports Lazy allocation
{
const VkMemoryAllocateInfo memAllocInfo =
{
VK_STRUCTURE_TYPE_MEMORY_ALLOCATE_INFO, // VkStructureType sType
NULL, // const void* pNext
pixelDataSize, // VkDeviceSize allocationSize
memTypeNdx // deUint32 memoryTypeIndex
};
const VkDevice device = m_context.getDevice();
const DeviceInterface& vkd = m_context.getDeviceInterface();
Move<VkDeviceMemory> memory = allocateMemory(vkd, device, &memAllocInfo, (const VkAllocationCallbacks*)DE_NULL);
VkDeviceSize pCommittedMemoryInBytes = 0u;
vkd.getDeviceMemoryCommitment(device, memory.get(), &pCommittedMemoryInBytes);
if(pCommittedMemoryInBytes <= memoryRequirements.size)
return true;
}
}
return false;
}
tcu::TestCaseGroup* createMemoryCommitmentTests (tcu::TestContext& testCtx)
{
static const MemoryCommitmentCaseParams info =
{
2048u, // deUint32 bufferSize
256u, // deUint32 bufferViewSize
0u, // deUint32 elementOffset
};
de::MovePtr<tcu::TestCaseGroup> getMemoryCommitmentTests (new tcu::TestCaseGroup(testCtx, "get_memory_commitment", "Memory Commitment Tests"));
{
getMemoryCommitmentTests->addChild(new MemoryCommitmentTestCase(testCtx, "memory_commitment", "memory_commitment_test", info));
getMemoryCommitmentTests->addChild(new MemoryCommitmentAllocateOnlyTestCase(testCtx, "memory_commitment_allocate_only", "memory_commitment_allocate_only_test"));
}
return getMemoryCommitmentTests.release();
}
} //api
} //vkt
| 33,443 |
https://en.wikipedia.org/wiki/Eslamabad%2C%20Shahreza
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Eslamabad, Shahreza
|
https://en.wikipedia.org/w/index.php?title=Eslamabad, Shahreza&action=history
|
English
|
Spoken
| 40 | 76 |
Eslamabad (, also Romanized as Eslāmābād) is a village in Manzariyeh Rural District, in the Central District of Shahreza County, Isfahan Province, Iran. At the 2006 census, its population was 4,489, in 997 families.
References
Populated places in Shahreza County
| 7,998 |
https://unix.stackexchange.com/questions/305037
|
StackExchange
|
Open Web
|
CC-By-SA
| 2,016 |
Stack Exchange
|
Archemar, heemayl, https://unix.stackexchange.com/users/181036, https://unix.stackexchange.com/users/68757, https://unix.stackexchange.com/users/79818, user4556274
|
English
|
Spoken
| 117 | 254 |
Copy file using ssh
I'm trying to copy from my local machine a file via SSH,
but it doesn't work.
devel@siscom-online:~$ scp devel@siscom-online:pgadmin.log /home/user/Downloads/
devel@siscom-online's password:
/home/user/Downloads: No such file or directory
devel@siscom-online:~$
Do you have a user named user?
Use a directory name which exists on your system. /home/devel/Downloads might work. Your current working directory should work: "scp devel@siscom-online:pgadmin.log ." Note the space and then dot at the end of the command.
we also like text sample, not screen shot who are unsearchable.
The path /home/user/Downloads/ does not exist on your system or is not accessible. Make sure that the destination directory exits, before starting the copy operation with scp.
It would be scp devel@siscom-online:~/pgadmin.log /home/devel/Downloads/
| 38,419 |
https://github.com/gravypower/Dimmy/blob/master/src/Dimmy.Engine/Pipelines/Pipeline.cs
|
Github Open Source
|
Open Source
|
MIT
| 2,020 |
Dimmy
|
gravypower
|
C#
|
Code
| 89 | 262 |
using System.Collections.Generic;
using System.Linq;
namespace Dimmy.Engine.Pipelines
{
public abstract class Pipeline<TNode, TContext>
where TNode : Node<TContext>
{
protected TContext Context { get; set; }
private readonly List<TNode> _nodes;
protected Pipeline(IEnumerable<TNode> nodes)
{
_nodes = nodes
.OrderBy(n=>n.Order)
.ToList();
}
public void Execute(TContext context = default)
{
var root = default(TNode);
var previous = default(TNode);
if (context != null)
{
Context = context;
}
foreach (var node in _nodes)
{
if (root == null)
{
root = node;
}
else
{
previous.Register(node);
}
previous = node;
}
root?.Execute(context);
}
}
}
| 27,982 |
https://www.wikidata.org/wiki/Q30687750
|
Wikidata
|
Semantic data
|
CC0
| null |
2017 British Speedway Championship
|
None
|
Multilingual
|
Semantic data
| 41 | 61 |
2017 British Speedway Championship
2017 British Speedway Championship point in time 2017
2017 British Speedway Championship instance of season
2017 British Speedway Championship sports season of league or competition British Speedway Championship
2017 British Speedway Championship Google Knowledge Graph ID /g/11dymw3c06
| 34,268 |
https://github.com/kkcookies99/UAST/blob/master/Dataset/Leetcode/valid/78/171.cpp
|
Github Open Source
|
Open Source
|
MIT
| null |
UAST
|
kkcookies99
|
C++
|
Code
| 32 | 150 |
class Solution {
public:
vector<vector<int>> XXX(vector<int>& nums) {
vector<vector<int>> ans;
vector<int> t;
ans.push_back(t);
for(int i=0;i<nums.size();i++)
{
int n=ans.size();
for(int j=0;j<n;j++)
{
t = ans[j];
t.push_back(nums[i]);
ans.push_back(t);
}
}
return ans;
}
};
| 42,140 |
https://de.wikipedia.org/wiki/Crucey-Villages
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Crucey-Villages
|
https://de.wikipedia.org/w/index.php?title=Crucey-Villages&action=history
|
German
|
Spoken
| 162 | 403 |
Crucey-Villages ist eine französische Gemeinde mit Einwohnern (Stand: ) im Département Eure-et-Loir in der Region Centre-Val de Loire; sie gehört zum Arrondissement Dreux und zum Kanton Saint-Lubin-des-Joncherets.
Geographie
Crucey-Villages liegt etwa 22 Kilometer westsüdwestlich von Dreux am Flüsschen Gervaine. Umgeben wird Crucey-Villages von den Nachbargemeinden Brezolles und Saint-Lubin-de-Cravant im Norden, Prudemanche im Norden und Nordosten, Laons im Nordosten und Osten, Saint-Ange-et-Torçay im Osten und Südosten, Maillebois im Südosten und Süden, Louvilliers-lès-Perche im Süden, La Saucelle im Südwesten sowie Les Châtelets im Südwesten und Westen.
Durch die Gemeinde führt die frühere Route nationale 839 (heutige D939). Im Süden der Gemeinde liegt die frühere Dreux-Louvilliers Air Base der US Air Force, die heute als Radarstation Nostradamus genutzt wird.
Geschichte
Durch Gesetz vom 7. Dezember 1972 wurden die Gemeinden Crucey, Mainterne und Vitray-sous-Brézolles zusammengeschlossen.
Bevölkerungsentwicklung
Sehenswürdigkeiten
Kirche Saint-Aignan in Crucey aus dem 17. Jahrhundert, Ausstattung teilweise Monument historique
Kirche Saint-Laurent in Mainterne
Kirche Saint-Sulpice in Vitray-sous-Brézolles
Schloss La Choltière
Weblinks
Ort in Centre-Val de Loire
| 19,577 |
https://pl.wikipedia.org/wiki/Diecezja%20nikopolska
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Diecezja nikopolska
|
https://pl.wikipedia.org/w/index.php?title=Diecezja nikopolska&action=history
|
Polish
|
Spoken
| 82 | 213 |
Diecezja nikopolska (; ) – jedna z 2 diecezji obrządku łacińskiego w Kościele katolickim w Bułgarii ze stolicą w Ruse. Ustanowiona diecezją w 1789 bullą papieską przez Piusa VI. Biskupstwo podlega bezpośrednio (do) Stolicy Apostolskiej.
Historia
Diecezja nikopolska została erygowana na terenie północnej Bułgarii w 1789 roku bullą papieża Piusa VI. Pierwszą siedzibą ordynariusza był Nikopol, natomiast w pierwszej połowie XX wieku stolica biskupstwa została przeniesiona do Ruse.
Biskup
Biskup diecezjalny: bp Strachił Kawalenow (od 2021)
Linki zewnętrzne
Nikopolska
Religia w Ruse
| 22,342 |
https://github.com/Christopher96/addswift/blob/master/middleware/admin.js
|
Github Open Source
|
Open Source
|
MIT
| null |
addswift
|
Christopher96
|
JavaScript
|
Code
| 29 | 57 |
/*
* Checks whether a user is admin and redirects to startpage if not
*/
export default function({ store, redirect }) {
if (!store.getters['auth/isAdmin']) {
return redirect('/')
}
}
| 6,725 |
https://github.com/Devi0usM0nk/assetfinder/blob/master/main.go
|
Github Open Source
|
Open Source
|
MIT
| 2,021 |
assetfinder
|
Devi0usM0nk
|
Go
|
Code
| 489 | 1,576 |
package main
import (
"bufio"
"encoding/json"
"flag"
"fmt"
"io"
"io/ioutil"
"net/http"
"os"
"strings"
"sync"
"time"
)
var cfg Config
func main() {
var subsOnly bool
override := make(map[string]*bool)
cfg.ymlparser()
flag.BoolVar(&subsOnly, "subs-only", cfg.Flags.SubsOnly, "Only include subdomains of search domain")
// Flag for all Modules... Sorry Little messy
override["fetchCertSpotter"] = flag.Bool("cert", cfg.Flags.CertSpotter, "<Boolean> Toggle CertSpotter source")
override["fetchHackerTarget"] = flag.Bool("ht", cfg.Flags.HackerTarget, "<Boolean> Toggle HackerTarget source")
override["fetchThreatCrowd"] = flag.Bool("t", cfg.Flags.ThreatCrowd, "<Boolean> Toggle ThreatCrowd source")
override["fetchCrtSh"] = flag.Bool("crt", cfg.Flags.CrtSh, "<Boolean> Toggle CrtSh source")
override["fetchDNSDB"] = flag.Bool("d", cfg.Flags.DNSDB, "<Boolean> Toggle DNSDB Enterprise source")
override["fetchDNSDBCommunity"] = flag.Bool("dC", cfg.Flags.DNSDBCommunity, "<Boolean> Toggle DNSDB Community source")
override["fetchFacebook"] = flag.Bool("f", cfg.Flags.Facebook, "<Boolean> Toggle Facebook source")
override["fetchPassiveTotal"] = flag.Bool("p", cfg.Flags.PassiveTotal, "<Boolean> Toggle PassiveTotal source")
override["fetchWayback"] = flag.Bool("w", cfg.Flags.Wayback, "<Boolean> Toggle Wayback source")
override["fetchVirusTotal"] = flag.Bool("v", cfg.Flags.VirusTotal, "<Boolean> Toggle VirusTotal source")
override["fetchFindSubDomains"] = flag.Bool("fs", cfg.Flags.FindSubDomains, "<Boolean> Toggle FindSubDomains source")
override["fetchUrlscan"] = flag.Bool("u", cfg.Flags.Urlscan, "<Boolean> Toggle Urlscan source")
override["fetchBufferOverrun"] = flag.Bool("b", cfg.Flags.BufferOverrun, "<Boolean> Toggle BufferOverrun source")
flag.Parse()
var domains io.Reader
domains = os.Stdin
domain := flag.Arg(0)
if domain != "" {
domains = strings.NewReader(domain)
}
sources := []fetchFn{
fetchCertSpotter,
fetchHackerTarget,
fetchThreatCrowd,
fetchCrtSh,
fetchFacebook,
//fetchWayback, // A little too slow :(
fetchDNSDBCommunity, // Per Hour only 4 domains as Community Edition has limit of 25 query per hour and each domain takes 6 request for complete result for community edition See=>dnsdbCommunity.go Line 13
fetchPassiveTotal,
//fetchDNSDB,
fetchVirusTotal,
fetchFindSubDomains,
fetchUrlscan,
fetchBufferOverrun,
}
sources = toggleSources(override, sources)//Toogle Sources according flags
out := make(chan string)
var wg sync.WaitGroup
sc := bufio.NewScanner(domains)
rl := newRateLimiter(time.Second)
for sc.Scan() {
domain := strings.ToLower(sc.Text())
// call each of the source workers in a goroutine
for _, source := range sources {
wg.Add(1)
fn := source
go func() {
defer wg.Done()
rl.Block(fmt.Sprintf("%#v", fn))
names, err := fn(domain)
if err != nil {
//fmt.Fprintf(os.Stderr, "err: %s\n", err)
return
}
for _, n := range names {
n = cleanDomain(n)
if subsOnly && !strings.HasSuffix(n, domain) {
continue
}
out <- n
}}()
}}
// close the output channel when all the workers are done
go func() {
wg.Wait()
close(out)
}()
// track what we've already printed to avoid duplicates
printed := make(map[string]bool)
for n := range out {
if _, ok := printed[n]; ok {
continue
}
printed[n] = true
fmt.Println(n)
}
}
type fetchFn func(string) ([]string, error)
func httpGet(url string) ([]byte, error) {
res, err := http.Get(url)
if err != nil {
return []byte{}, err
}
raw, err := ioutil.ReadAll(res.Body)
res.Body.Close()
if err != nil {
return []byte{}, err
}
return raw, nil
}
func cleanDomain(d string) string {
d = strings.ToLower(d)
// no idea what this is, but we can't clean it ¯\_(ツ)_/¯
if len(d) < 2 {
return d
}
if d[0] == '*' || d[0] == '%' {
d = d[1:]
}
if d[0] == '.' {
d = d[1:]
}
return d
}
func fetchJSON(url string, wrapper interface{}) error {
resp, err := http.Get(url)
if err != nil {
return err
}
defer resp.Body.Close()
dec := json.NewDecoder(resp.Body)
return dec.Decode(wrapper)
}
| 27,711 |
sn84026817_1908-05-27_1_1_1
|
US-PD-Newspapers
|
Open Culture
|
Public Domain
| null |
None
|
None
|
English
|
Spoken
| 4,904 | 6,718 |
THE WEEKLY REGISTER. FORTY-SIXTH YEAR. POINT PLEASANT, MASON COUNTY, WEST VIRGINIA. WEDNESDAY, MAY 27, 1908. NO. 42 TIPPETT'S. The greatest bargains and the largest stock of wall papers, we meet all competition; bring in your samples from mail order houses and we will do as well or better by you. Pay no attention to wall paper peddlers with sample books, we have the stock, and 25 percent cheaper, besides you get just what you need, no more, no less and pay for what you use, no more. 5cts per roll up to the finest goods made, no extra charge for borders. Fine, skilled, sober workmen, paper hangers and decorators that are up to date, to do your work promptly, cheaply, correct. You should see our immense stock of Lace Curtains, embracing all styles and quality, from the cheap pairs at 48cts. to the handsome goods for parlors and bedrooms from 98c. to $12.00. No one carries such a stock, in this city, as we are the acknowledged leaders and headquarters for these goods, and we sell at prices others pay for these goods where they buy from dry goods jobbers. Window shades all grades, from the Felt on spring rollers at 10cts. to the cloth at 25cts that others are selling at 15cts, on up to the finest grades in oil and linen; we are keeping in stock this season those special goods not heretofore kept in this place. You can get what you want, when you want it, at Tippett's. Go carts, beauties, correct Styles, manufactured by the best firm in the U. S., Heywood's goods from $5.00 to $20.00. Carpets, room size rugs, linoleum, oil cloth, mattings from the cheap China goods at 12 cents up to the finest Japanese novelties at 35 cents, (these patterns sell in the cities at 65 cents.) See our Sultana Carpets at 35 cents. Our 9x12 room size rugs Japanese Brussels, at $10.00. Our 6 ft. Japanese rugs at $1.48. Our Japanese matting rugs at 75 cents. Our linoleum at 45 cents. Our lace curtains at 68, 98, $1.48 per pair, without doubt worth from $1.25 to $3.00 per pair any place you go. Oak dressers, square glass, at $5.98. Oak parlor stands at 65 cents. Oak chiffoniers at $5.98. Oak sideboards at $12.50. Folding Iron couches and beds including cotton mattress, $6.50 to $10. Morris chairs $4.98. Kitchen cabinets all makes and prices. Iron and brass beds from the cheapest to the finest. Sofas, couchs, Davenports, bedroom suits, parlor stands, combination bookcases, sectional bookcases. Fine bed lounges and couches, $9.98. Curtain poles trimmed complete, in mahogany, oak or white enameled, three for 25 cents. See our cotton felt mattress at a special price for 30 days only, $10.00 worth regular $15.00. We are well equipped in the Furniture and Undertaking business, carry a large and complete stock, and you can always depend on getting just what you want when you come after it. We own our own vehicles and teams. Funeral cars both white and black. Skilled licensed embalmers. Our prices have always been reasonable; in fact, we have always endeavored to be lower than you could secure the same service elsewhere. When in need of anything in this line, give us a call and we will have the opportunity of showing you that no one is "just half as cheap as Tippett." We would like to see that party cut our prices in two. We are always prepared to answer calls promptly, and render the best of service, will go any place bad weather or good, night or day, if called—not otherwise. If our services are needed, you will have to send us word—we will not come to your house uninvited, or with a lie upon our lips, by stating that "the deceased had made special requests," etc., nor have we. Doctors or others interested in our behalf, as agents or solicitors, for money or political effect. Tippett's goods are always right; you can depend on what they tell you; no false impressions or misrepresentations. You are always welcome. Call and see our large and general line of goods. Headquarters for porch screens and furniture. Miss Furniture, Wall paper, Carpets and Undertaking Point Pleasant, W. Va. NOTICE. List of applications for license for liquor licenses, offering for sale and selling and receiving orders for, spirituous liquors, wines, cider, beer, liquor, drinks of like nature. In the town of Point Pleasant, Monroe county, West Virginia, for the year commencing July 1st, 1885, published in accordance with Act of the Legislature. Name Ko#d?leuee Place for wblrli Application In .llmli1 Homer Smith Point I'lcasaut, W. Va Spencer Hotel, nor. Main and Fourth Nt? Uavid Price Point PicaMant, NV. Va... .WW Mali: street. <!. M. Nutter Point PIcuHniit, W. Va K Hide Main Mt. hot. Tnlrd and Fourth nt? C. W. Alexander Point Pleasant, W. Va.... About 11*0 feet Went ol k. St M. depot K. K, I*. Arrlngton Point Pleasant, W. Va Phoenix Hotel, K Hide Mnlnhet. 4th*fc5tli Ida Urrcnh'c Pdlnt Pleasant, W. Va.... K whte Main nl. hot. Flr*t and Second 8t> .J It. Short Point Pleasant, W. Va Corner First and Malusts. K Hide Jouli <1. Htortz ..Point Pleasant, \V . Va K Hide Main, het Mil and Uth sts \v. C. \VH ALKY. Clerk. uhj c?4w 'J he Town of Point Pleawanl. Huntington Business College. A Modern School ol liusliiess lor llotli Soxoh. HUNTINUro.V, W. VA. For twelve years wo have devoted our timo to the business of preparing ambitious youung men and women for positions as Book-keopers, Stenographer*, Telegraph Operators, Hank Clerks, etc. More than 3,000 .student*; in positions. School open all the year. 581 have enrolled in our now school in the Caldwell Building. That's the way they come. Our students take po sitions almost daily?that's the way they go. Expenses less than at other schools. Opportunities belter for placing students 011 account of our extensive advertising. Write for catalogue. "W. DR.XIPXjEJ'Sr, 2Prl:n.cJ.;pa.l. L. L. CALDWELL & CO. HEIGHTS, W. VA. General Store. FRESH MEATS A SPECIALTY Fancy and Staple Groceries?Headquarters for Country Produce.' The market price IN CASIf for Butter, Eggs and Fowls. Goods delivered to any part of the city promptly. PHONE 3122. PHONE YOUR ORDERS. "Dr. Thomas' Electric Oil is the best remedy for that often fatal disease; oroup. Has been used with success in our family for eight years." - Mrs. L. Whitesore, Potsdam, N.Y. For a mild, easy action of the bowels, a single dose of Doan's Regulets is enough. Treatment cures habitual constipation, 25 cents a box. Ask your druggist for them. A few stories of alighting and exiting days by L. S. Mills, Copyright 1908, by L. S. Mills. Nestled among the green hills of western Connecticut there stands today, a little way back from the lonely country road, a brown, weather-beaten farmhouse. On each side of the door the woodbine climbs, and overhead it forms in an arch of living green. On the west side, "Come back by the low bank to your wall," the old-fashioned red roses bloom in all their sparkling splendor. Here oftentimes a few years ago merry schoolgirls, with cheeks that matched the glow of the roses, paused to gather a banquet for teacher's desk or to place beneath the logs in the little graveyard on Memorial day. And oftentimes. Too, they paused to listen to the pilot words of Mrs. Maynard, who lived here alone. They wondered at the sadness of her voice as she said: "Yes; you are welcome to the roses." Then smile, hope would light her face as she added, "When Henry comes home, he'll tidy up the yard and pick a rose for me as he did a nice long ago." After the sun had set and the shadows had crept down the hillside through the graveyard and filled all the valley with darkness, the lamp was lit and placed in the window, where its rays lighted the pathway leading to the road. By the time Mary Maynard would sit, her hands folded. She was waiting for Henry. Forty-five years ago, on May 30, men by the way, brought home Mary, his fair young bride. Buying: "Mother, here is my place!" she said, "I love her as you love me, and don't let her be lonely, for tomorrow I go to the front; but, God being willing. I'll come back." On the following day, earth and sky allied blended in perfect harmony, the roses bloomed in splendor. On the grassy bank they sat, Mary and Henry, beside the clustering blossoms, Henry had picked one of the roses and lovingly placed it in Mary's hair, Mary was she then. In all the freshness of youth's bright morning. Tenderly she placed her hand on Henry's shoulder and with loving, pleading eyes whispered: "Henry, please don't go." Sadly, slowly, he replied: "Mary, I must. But watch for me. I'll come back to you." So they parted on that fateful day, and the birds sang, the breezes crept softly by, and the roses scouted the air. Henry alone on the doorstep led Henry marching out of the valley led them not. Those were trying days for north and south. The union's best were playing each other in terrible battles. After Hinesldo's defeat at the battle of Fredericksburg in December, 1862, there had been a call for more men to fill the broken ranks, and Henry May had enlisted. Early as he loved Henry Harper, he could not resist the union's call any longer. At first Mary leaded with him. Then she realized the need and bravely gave her consent, only requesting that they be married before he went. When on that last day as they sat together by the I'oses, though she whispered him to remain, she knew he would go? That though all the sorrow at parting she wished him to go?wished him the true spirit of her dreams. Thus it was that Henry went, and Henry came to live with Henry's mother. Just those two in the little farmhouse, for Henry's father had bent all over years back while hauling logs from the wood lot. The field had overgrown coming down the steep hillside. Henry's mother had seen it from the window where she sat knitting and, failing to find any way from his side, crushed and bleeding, they brought him home just in the close of the cold winter's day, and he died in half an hour. After this, they had toiled on. Henry, growing stronger and more manly, overcoming gradually the sorrow caused by chronic constipation. The cause of constipation is a lack of energy in the body, which causes constipation. Foley's Orange Laxative cures constipation as it regulates the liver and bowels, restoring the natural action of these organs. Commence taking it today and you will feel better at once. Foley's Orange Laxative does not nauseate or gripe and is pleasant to take. Refuse substitutes, sold by his father's death. But his mother's heart seemed buried in the lonely grave on the hillside with her husband, and, though she gave Henry unbounded. Founded love, she cared for Miltie else till Mary came and Henry went. Then also talked of Henry and found in Mary a ready timelier. He the two became fast friends with one hope—the safe return of Henry. The weeks went by, and together they read the papers telling of the war. Henry, too, wrote sometimes to his mother, but more often to Mary. His letters told of the weary waiting and the seemingly useless marching and counter-arching, yet he was always the same brave, loving Henry. Soon the war would be over, and Mary would meet him, and they would sit by the rosebushes again. In her dreams, she saw him, her soldier, her "boy in blue," amid the roar and smoke of battle. "They won the crest; he takes the flag; he is a hero." The dream changed, and she saw him alight from the train at the village station. The neighbors had read of his brave deeds in the papers and had come to cheer him. Once more the vision changed, and hand in hand they ate by the rosebushes. He placed a rose in her hair and, gently kissing her cheek, whispered: "Mary, we won't part any more." And, looking to his well-beloved face to read the love his voice expressed, it seemed the face of Henry, but old, so old, and his hair so gray. One day there came news of his swift advance northward in July, 1863. There would be a battle. Mary wrote a long letter full of love and cheer to Henry. But no answer came. In the papers were rumors of a great battle being fought. It was at Gettysburg. Would I,oe win? The suspense was awful to millions of northern people as they waited with bated breath for news from the front. "Leo retreats!" This was the report that came to me on the fourth day, and the drawn faces relaxed. Then followed columns of "killed," "wounded," "missing." Thousands of homes were plunged in gloom, for many a husband's name and many a son's name and many a lover's name was there. A neighbor's boy brought the papers that evening. Though he came on swiftly, Mary couldn't wait, but ran out to meet him. Together Mary and Henry's mother looked down the long list of "killed." Not there! Thank God! Then the list of "wounded." Not there! Then "missing"? Henry Muynard! "There is hope," said Mary. But she sat with the paper tightly clasped. All night she sat thus and heeded not the time nor saw the neighbors who came to comfort her. As the sunlight stole in the east window they gently lifted her and placed her on the bed. After a time, she slept and dreamed of Henry. He was on the crest of a hill behind a low bank of earth. Hundreds of men were at his right and left. Before him, advancing up the hill, were thousands of men with gray uniforms. Then began the roar of artillery, and the smoke of battle rolled over all, and she saw him no more. Yet, half waking, half sleeping, she seemed to hear him say, as on that day of parting; "Watch for me! I'll come back to you!" Then began the years of waiting—weary years. In the afternoon when looking for Henry, dreamy look in her eyes. So the time passed. Each succeeding year? Toil a moment away from her beauty. Looking behind it, broader and deeper, the clown and the almanac. Henry's mother died and was laid away in the quiet graveyard, and the years rolled out the snows came and went; the roses bloomed. Schoolgirls came for them and in time grew to womanhood, and other girls came. Each evening the lamp was placed in the window. Each day Mary watched and waited. The sympathetic neighbors kindly cared for her few wants. Many letters had been sent to the war department inquiring for Henry Maynard, but "Missing after the battle of Gettysburg" was all the reply. In a pleasant room in Melbourne, Australia. Hubert Smith had served forty years ago, he had come to Australia, or had found himself there, but with no remembrance of where he had been before. He had become a merchant in a small way at first, but gradually increased his business till at the time of his sickness, he had become a man of means with a small fortune, and he had been married. All day he had tossed about in favor. "Tonight there will be a change," the story told by the young man. The function of the kidneys is to strain out the impurities of the blood which is constantly passing through them. Foley's Kidney Remedy makes the kidneys healthy so they will strain out all waste matter from the blood. Take Foley's Kidney Remedy at once and it will make you well. The work was done many and many a day, Mary sat on the doorstep looking down the road, looking for Henry. To the many friends who come and went, Mary seldom spoke. She was like one prepared, her thoughts far away and a happy home. HUMAN FILTERS See the new sailors at Mrs. L.J. Williamson's. By EARL MARBLE He told me many stories about the olden days, of deeds of daring valor amid the battle's blaze, as toward the village churchyard, we wound our solemn way, when I kept step with grandpa on dear Memorial day. I CARRIED blooming branches from mother's lilac tree, and every one had flowers. As far as eye could see, And bands made lovely music As we pursued our way, When I kept step with grandpa On dear Memorial day. I THOUGHT of that this morning When down the village street The yearly sad procession Went on with reverent feet; I thought, as they without him Pursued their solemn way, Keeping grandpa Memorial doctor said, and the nurse watched patiently till he seemed to grow quiet, and finally he slept. Then she knew the crisis was past. When he awoke in the morning he was Hubert Smith no more, but Henry Maynard, and all the reinforcements of Mary and home came over him. He had been wounded in the head at the battle of Gettysburg. In a seemingly fatal condition he was left on the field until after the battle. He was cared for by a farmer and when partly recovered wandered away, giving no name. How he reached Australia he never learned. His recovery was speedy, and he hastened to America to find Mary if possible. "Oh, Mary, are you waiting? Shall I see you?" he cried. And all night he paced the steamer's deck over whelmed with love and longing. On May 30, 1905, Mary sat in the doorway, looking down the road. Her hair, once black, was now streaked with gray. She had been looking at the roses and thinking of Henry. "Will he come today?" An hour later an old roan came slowly up the road and turned up the pathway to the house. Mary, waiting on the doorstep, knew it was Henry, for the face was the face she saw in her dream. "Henry!" "Mary!" That is all those two said as they clasped hands and sat once more On the grassy bank where the roses bloom. But heart spoke to heart in a love and joy deeper than all words and deeper than all thought. Heavy, impure blood makes a muddy, pimply complexion, head no longer, nausea, indigestion. Thin blood makes you weak, pale, sickly. Burdock Blood Bitters makes the blood rich, red, pure, restores perfect health. Have your clothes cleaned and pressed, it makes them look like new and makes them last twice as long. O. O. Tippett, Tailor, S"/epf on Old Glory. Charles Carlton Collin, who was a war correspondent during the conflict between the states, relates an incident showing the remarkable fidelity of a loyal Unionist to the flag. When Mr. Collin entered Charleston, S. C., in 1805, just after the evacuation of that city by the Confederates, who had held the place for four years, he observed a small Union flag floating from a window. Collin knocked at the door, which was opened by a middle-aged German resident. The newspaper man told the citizen that he had been loyal as to say the stars and stripes while the city was still beset by Confederate spies. "Come inside and I will show you a still bigger American flag," said the man of the house. Collin accepted The invitation. The loyal Teuton brought forth a large flag, somewhat crumpled. "There," he said, "my wife and I have slept on that flag every night for four years. We had it. Be wed inside our roattress." SERIOUS RESULTS FEARED You may well fear serious results from a cough or cold, as pneumonia and consumption start with a cold. Foley's Honey and Tar cures the most obstinate coughs or colds and prevents serious results. Refuse substitutes. Stops itching instantly. Onions, eczema, salt rheum, tetter, hives, herpes, sores? Doan's Ointment. At any drug store. The Demi of the Army is the Martial Achievement of Infant in Arms. By ROBERTUS LOVE, 1908. By Robertus Love, 1908. WHO was the youngest Union soldier in the Civil War? Every little while this interesting question is asked in a daily springs up a crop of claimants, either for themselves or for others. Very probably the youngest soldier is not now alive, and if alive, he is a grizzled veteran, for it is forty-three years since the war ended. Mere boys were plentiful on both sides of the territory. "UR. PRESIDENT, I WAS DELEGATE. Soile in THE WAR." Of the stripling who bore muskets were surprisingly youthful, while there were drummer boys of amazingly tender years. Perhaps the youngest drummer was Johnnie Brooks, later John L. Brooks, Esq., who practiced law at Ellsworth, Kan. Johnnie went into the service as a drummer boy at the age of nine years. He served from July. 1813, to August. Ist. But he was not enlisted. His father was a lifer in the musicians' corps, and the boy went along to beat a drum. One of Johnny's sad duties was to beat the dead march in Indianapolis when the body of President Lincoln was borne through the streets there to be in state for a brief time during the journey from Washington to Springfield. Thirty years after the war, this drummer boy's congressman introduced a resolution to have the secretary of war muster in and discharge John K. Brooks, so that he might get the regular pay for his two years of service. Only a few months ago an application was received by the New Jersey adjutant general for a civil war veteran's medal, as provided by the state legislature, for Daniel Williams, who was believed to have been the youngest drummer boy regularly enlisted. Williams went into the volunteer service when he was eleven years, five months, and sixteen days old. That was in 1862. He served with both New Jersey and Pennsylvania volunteers. Mr. Williams now resides in Washington. One of the most remarkable records for a drummer boy is that made by John R. Clem, now a colonel in the regular army. Clem was the famous "drummer boy of Stillborn." After General Grant became president in 1859, a youth scarcely eighteen years of age gained admission to the White House. "Mr. President," he said, "I came to request you to admit me to the Military academy at West Point." "Why don't you take the medal?" Regular examination Y" asked the president. "I have done so, but I failed to pass," admitted the boy. "That is very unfortunate," said the president, "but you should have studied harder." "Mr. President," said the applicant, "while the other boys who took the examination with me were in school, I was in the war." "What war?" exclaimed the president. "What war?" "The civil war. I served four years." The soldier president looked the youth in the eye. John Clein produced his pallets, showing that he told the truth. President Grant commissioned him as second lieutenant in the regular army. Another drummer boy whose record shines brightly was J. C. Julius Langbell, who in later life became a well-known city Judge in New York. When a mere boy he enlisted as a drummer in the Ninth New York volunteers, known as the Hawkins zouaves, a regiment which did some of the fiercest and most picturesque fighting of the war. He was the youngest drummer boy from New York state and was said to be the third youngest in all the Union armies. Langbell served chiefly in the Virginia campaigns like the big soldiers in his regiment, he was dressed in the zouave uniform, with baggy knee trousers and short, flaring jacket, his head covered with a tasseled cap. So slight and childish Langbell looked that he seemed out of place among the strong, rough men around him, but every man in the regiment loved the little drummer boy. One big soldier who had a sweetheart up home named Jennie declared that the boy looked like "the girl he left behind him," so the drummer was known by his grown-up comrades as "Jennie" I.angbeln. Adjutant Bartholomew of "Jennie's" regiment took a particular interest in the boy. He had promised Langbelu's mother that he would look after the little fellow as well as he could. At the battle of Camden, or Sawyer's Lane, near the southern end of the Dismal swamp canal, the Hawking zouaves made a desperate charge. A fragment of exploding shell plowed a frightful furrow in the neck of Adjutant Bartholomew, who, crazed by the shock and pain, staggered outside the Federal formation and wandered silently. PERSONAL If any person suspects that their kidneys are deranged, they should take Foley's Kidney Remedy at once and not risk having Bright's disease or diabetes. Delay gives the disease a stronger foothold and you should not delay taking Foley's Kidney Remedy. It is a pity to see a person neglect indications of kidney or bladder trouble that may result in about between the lines in a bone of fire from both armies. "Jcunlo" saw what happened to his friend. He rushed to the wounded man and managed to pilot him to a place of reasonable safety, airing Bartholomew's drink of water from his canteen, the little drummer dashed away to find the regimental surgeon. The doctor probed the wound with his fingers and told the boy that the adjutant was done for and it would do no good to move him. But after the doctor had gone to other duties, the boy hunted up the "Digestrum" in the "Charles Wiley," who helped him carry Bartholomew to a house. When the Union forces were driven back, "Jennie" refused to leave his friend to fall into the enemy's hands, he succeeded in getting the officer into an army wagon and remained in attendance until Bartholomew was safe in the Federal hospital on Roanoke Island. The adjutant recovered and told what the boy had done for him. More than thirty years later, Judge Langbell received the medal of honor for that service. Two other young drummers from New York were Fred W. Kitschy and Philip Corell, both with the Ninety-ninth volunteers. These boys were sons of the regiment of three years. After they returned home and grew up, they married sisters and for many years lived within a few blocks of each other. Like "Jennie" Langbell, these boys saw much service in the region near Norfolk, Va. Mrs. Kitschy in later life told some interesting facts about the life of the drummed boys. "We lived the same as the soldiers," he said, "being served with the same sort of uniforms, generally too big and the same sort of service." Bright's disease when Foley's Kidney Remedy will cure irregularities and strengthen these organs. Take Foley's Kidney Remedy at the first sign of danger. Cold That Hang On Ojlds that hang on in the spring deplete the system, against the nerves, and open the way for various illnesses. Take Foley's Honey and Tar. It quickly stops the cold and expels the cold. It is safe and certain to satisfy. JOHN MOOKS Philo Corell told how he and Fred Ritschy were put to bed one night by a motherly southern woman in her guest chamber, tucked in "Just Like mother used to do at home," and then given a good night kiss by the tender hearted Virginia lady, who had a boy of her own in the field fighting against them. Next morning their hostess gave them a fine breakfast and then loaded them down with yams. Sometime ago the Wisconsin legislature voted a gold medal to Q. EL Francisco, living at that time in Mason City, Iowa, in the belief that he was the youngest Union soldier who served in the civil war. Francisco had enlisted at fourteen years of age. Very soon stories began to appear in behalf of other "youngest soldiers." O. H. Wynn of Sioux City, Iowa, had enlisted at the age of thirteen years and eleven months. J. H. Repplinger of Detroit gave his enlistment age as thirteen years and four months. Andrew V. Minks of Chicago reduced this record by one month. Then one Gilbert Van Kandt, also of Chicago, took away the laurels of Links. Van Kandt's enlistment was on Aug. 31, 1902, at the age of ten years, eleven months and eleven days. He showed that he had joined Company L, Seventy-ninth Ohio volunteers, on that date at Port William, Clinton county, O., by special permission from the war department and that he was mustered out at Camp Denison on June 6, 1910. He drew a soldier's pay and did a soldier's duties for nearly three years. He was in the battle of Resaca, but later was assigned to headquarters to carry dispatches. Van Kandt rode a pony during this service. When he went to Washington to be mustered out, his pony was taken away from him. He wanted to take the animal home, and he went to President Andrew Johnson and stated his case. The president personally wrote an order that the boy be permitted to keep the pony.
| 29,397 |
sn88064069_1921-10-13_1_4_1
|
US-PD-Newspapers
|
Open Culture
|
Public Domain
| null |
None
|
None
|
English
|
Spoken
| 3,022 | 5,026 |
Special Reduction on Men's Suits Don't forget that we are making a special price on Seasonable Suits for Men and Young Men and it will be time well spent to visit our store and see what we have to offer, before making a purchase elsewhere. For everything in Ladies' and Gents' Ready-to-Wear, visit our store and save money. J. S. McConathy Arcadia, La. By Mrs. D. X. Brown, Jr. : Telephone No. 34 Miss Lida Reynolds visited Shreveport last week. Misses Alys Bond and Miss Conger visited Ruston Sunday afternoon. Mrs. Callahan has been a welcome guest of her granddaughter, Mrs. Baxter Sutton, this week. Miss Jessie Brown spent the weekend in Shreveport, the guest of Miss Susie Ferguson. Mrs. J. N. Jones and daughter, Miss Vashti Jones, visited Shreveport on Tuesday on business. Tanlac is made of roots, herbs and barks and contains no minerals or opiates. City Drug Co. Miss Leola McConathy spent the last weekend with her sister, Mrs. Cecil Atkins, in Homer. Mr. and Mrs. Jos. Dawidoff spent the holidays of the Feast of the Atonement in Monroe this week. Mr. and Mrs. Leo Daniel and little daughters, Elihabeth and Mabel, will leave Thursday for a fortnight's visit to Mineral Wells, Texas. Mrs. Geo. Shields went to Shreveport on Tuesday to visit her daughter, Miss Elizabeth Shields, who is a student of Foster Hall School in that city. Dr. and Mrs. Henry Shehee have as guests last week Mr. and Mrs. Sanders Fowler and two little children, of Oil City, and Miss Colquitt, Dr. May and Dr. Curtis Williams, of Shreveport. People who have been helped by Tan are always anxious and willing to tell others about it. City Drug Co. Mrs. Mosely, of Winfield, who has been a guest of her son, Dr. J. M. Mosely and family, here, left on Tuesday to visit her daughter, Mrs. Scheen, who is teaching in the Doylestown school. Miss Clyde Iobley, of the Department of Home Economics in Baton Rouge, was a visitor to this school last Wednesday. From here she visited the Y. Blenville school, Miss Luda Reynolds taking her down in her car. The friends of Mrs. Effie Howell congratulate her on the splendid grade which she made in her examination given by the progressive series of music, which has been accepted as the stand for the public schools. She made the friends of Miss Mary Maddox, who are glad to know that she is held in much high esteem at the school she attends in Tuscaloosa, Ala. She has been made president of her Sunday school class, director of the choir of the Y.W.C.A., and has been elected member of the students' council. The residence, well located, is well located; but for information, see Mrs. H.L. Mr. and Mrs. B.A. Madden have as their weekend Mr. and Mrs. T. Madden, of Shreveport, who are over in their car on Saturday evening and remained until Sunday as guests of Mr. and Mrs. Paul Mad. Homer, the latter will also visit the week-end with his parents, Mr. and Mrs. Madden, of Minden, accompanied by their Misses Clara Glen and Lyne Watkins, who were guests of Mr. and Mrs. Andrew at the home of Mr. and Mrs. Jos. Atkinson on Monday. A Bible study, which was attended by Mrs. Jos. Atkinson, was held at the home of Mrs. Jos. Atkinson on Monday. was l. P. Woodman, and discussed the various social meetings held by the association. The meeting was held in the courthouse, next Monday. Ira Ed Wilkins will conduct the Sunday school at the Sunday school. Misses Luda Reynolds, and Pawnee Glover's worked at the Tea Room, serving lunches, etc., which netted a neat little sum. The Young Matrons Sunday School, one class of the Baptist Sunday School, was entertained by Mrs. B. A. Brewer, on Tuesday afternoon. The president of the class, Mrs. Howell Jones, conducted a very interesting program, in which several assisted. A contest, in which famous Bible women figured, was quite entertaining, and another pleasant feature was the Story of Ruth told and by Mrs. J. B. Herring. Mrs. Reeves' or beautiful bungalow was made more attractive for this occasion by the lavish use of ferns and other decorative plants last and beautiful zinnias in their gorgeous ecru and varied hues. Delicious refreshments of chicken salad, date sandwiches, pickles, crackers, and fruit were served to the guests. The co-hostess with Mrs. Reeves for this delightful entertainment was Mrs. Little Jno. Smelley. It's to You, can't have good health with a disordered stomach. Correct your stomach disorders with Tanlac and you'll be well and strong. City Drug Co. Mrs. A. F. Storm, president of the State Federation of Women's Clubs, has named the week of Oct. 17-22, as its Federation Week in Mississippi. The oil clubs selecting any day in that week and as Federation Day. The purpose of this week is twofold. To launch a campaign to raise funds, to complete the endowment fund for the Federation in order to put it on a business basis; hoping that through the combined efforts of all the districts it might be accomplished, and another great and important object is that a time in each year be set apart when the women of our organization may learn and tell to others the merits of the Federation, which next to the church is the greatest federation organization for women and has done more worthwhile things for women in the last Louisiana than any other agency. It is to be hoped that much is to be gained from this educational campaign, for while much has been done, we are doing so little compared to our opportunities, to the need, for we have not yet achieved the spirit of the Federation of Women, the spirit of individual service. The relatives and friends from out of town who attended the funeral on Saturday of the late Mrs. G. W. Edwards, and visited the family in their over-crowded sorrow, were Mr. and Mrs. J. H. Edwards, of Mt. Lebanon; Mr. and Mrs. F. K. Buckley, of Ruston; Mrs. A. B. Hort. Man, of Gibsland, and her son, Mr. Of Omie Hortman, of Ruston L. I. I.: Ed Mr. and Mrs. J. B. Edwards, Mt. Lebanon; Mrs. Edwards' sisters, Mrs. Talbot and Miss Bonnie Buckley, of Moor. Lingsport; her daughters, Mrs. Hudson and husband, of Ruston; Mrs. Brice and husband, of Gibsland; and Mrs. Ransome, of Newport News, Va. Mrs. Alton Crews, a relative from Fort Reno, was also present. Mrs. J. C. Cox and son, Byron Cox, of Mt. Lebanon, attended the funeral and assisted Rev. Cox in the mausoleum. The funeral services were conducted at the Baptist Church on Saturday afternoon by Rev. J. C. Cox, and was attended by the relatives and friends of the deceased and the family. Many beautiful floral offerings were sent from various places, an eloquent testimony of affection and esteem in which this good woman was held. The deepest sympathy of friends is extended to the sorrowing family in this, their irreparable loss. METODIST CHURCH WINGS. Mr. and Mrs. Charles B. Wodten were received into the church at Arcadia by certificate last Sunday evening, and Mr. Peare W. Dants was received at Mt. Moriah by Baptism and vows in the afternoon, asking a total of forty-two additions during the present conference year. A choice company of Arcadia Methodists. odista were present last Wednesday evening at the prayer meeting. At the prayer meeting, all other matters, it is a reflection of the fact that it is behind in its praying. Seven o'clock is the hour, come. The Missionary Society met last Monday at the residence of Mrs. Dr. Atkinson. Complete reports are not in, but the reports to date indicate around $125 in the orphanage collection last Sunday in Sunday School and Church. The next annual conference meets in Alexandria November 9th. Bishop Col W. F. McMurray will preside. POSTED NOTICE. The public is hereby warned not to trespass on any of my lands, same having been duly posted according to law. Said lands are located in Bienville parish, and described as follows: NW 1/4 of SW 1/4 of SW 1/4 of SW 1/4, NW 1/4 of SE 1/4, SW 1/4 of NE 1/4, Sec. 11, NE 1/4 of NE 1/4, Sec. 10-18-6. This 10th day of October, 1921. T. C. JOHNSON, Arcadia, La. CARD OF THANKS. We wish to sincerely thank our friends and neighbors for the many deeds of kindness shown us during the illness and death of our wife and mother, and for the many expressions of sympathy manifested by the beautiful floral offerings. May God's richest blessings rest upon each of you. G. W. EDWARDS, Mrs. R. P. BRICE, Mrs. R. L. HUDSON, Mrs. VELMA RANSONE, NONIE, MARY, E. B. and BILLIE EDWARDS. HOME ECONOMICS DEPIR THE MENT DOING GOOD WORK In Arcadia High School of Miss Clyde Mobberly, of the Department of Education at Baton Rouge, visited our school last Wednesday. Miss Mobberly is the assistant supervisor of Home Economics for Louisiana. We will anxiously await her report, hoping that it will be favorable in every respect. of a It should be of interest to the com 1l munity to know that in the Home Eco n, nomics department t his session there at are more than 40 girls now enrolled.Two , ae of the girls, Nita Auld and Louise Mc In Keathan, are going to have an exhibit I at the Fair. This is to be considered e ,n quite an 'honor for the ones who enter >r this contest,; it will mean that they o are to make their dresses and wear " them on the stage in Shreveport at et the appointed time. We hope that ' these girls will be the winners, in that it means a prise of $25. This depart ment of our school work has always )Idone well under the excellent manage 6. ment of the head of the department, g, Miss Bond. i The Boy Scouts organization has at Sall times had a wholesome influence Ion town and school life. And now that this orgyization is affiliated with the school, we will see the results of its teachings and practices exemplied in the life and character of the bays who constitute its membership. A. good scout is a good boy, a good bop is a good student, as he grows into manhood he wll become a worthy eiti Dress Goods --ALL INDS -ALL COLORS SComplete stock at the best . Prices. Dave Hffman (:<§ Q. zen of his: town and community, being ever on the right side of every issue that will face the people. The school motto for the session of 1921-22 is "Good Work" in every department and grade. Yet there is to be given special attention throughout the entire school to singing and to penmanship. The friends and patrons of the school are always welcome, and we hope that as they visit the school from time to time, they will enjoy the singing and give special attention to the work in penmanship. REPORTER BIENVILLE. E. C. Poole, of Homer, was a weekend visitor to home folks. G. W. Bolton was a visitor to Shreveport this week. Mr. Roy Huckaby, of Chesnut, spent Sunday here with home folks. Miss Ollie D. Huggaby spent the weekend with home folks. Mr. Loyd Frye, of Saline, was a visitor here Sunday. Dr. I. Blume, of Cedar Grove, was a business visitor here several days this week. Messrs. W. H. Grier and G. R. Cummings motored from Haynesville Saturday night and spent Sunday here. Miss Leola Cargill, of Haynesville, a former teacher in the high school, was the guest of Miss Vera Mae Crawford Saturday and Sunday. Sherwood Lowe, of Shreveport, visited home folks this weekend. His many friends were glad to see him again after an absence of some length. We regret very much that Miss Luda Reynolds was unable, on account of illness, to return Monday to resume her work in the school. During her short stay here she has endeared herself not Only to the teachers and pupils, but to the patrons as well. We hope that she may soon be able to return. A box supper was given at the school building Friday night for the purpose of raising money to purchase playground equipment and add to the grade libraries. In connection with the supper, a contest was held to decide on the most popular young lady. Mr. Ambrose, of Little Rock, in a pleasing manner, sold the boxes to the highest bidder. There were fifty-five boxes sold in the contest. Miss Marie Wilson and Miss Nova Holland were the contestants. Miss Holland received the highest number of votes and was presented with a beautiful cake. The evening's entertainment was quite a success in every way. Over a hundred dollars was realized from the sale of boxes and contest. JAMESTOWN. Mr. T. W. Edwards made a business trip to Arcadia Monday. Mr. Boles had with him Sunday his brother from Cotton Valley. Miss Ethel Evans went to Minden Friday shopping. Mr. Lary Smith motored to Arcadia Thursday. Miss Essie Cook spent the weekend with her parents at Taylor. Miss Jewell Bogan spent the weekend with home folks at Castor. HAY, GRAIN, FEEDSTUFF CAN GIVE YOU A THING PICE ON TEN ABOVE IN ANY QUANTITY. WHO IS MAGNIFICENT AND ARE DELICIOUS. CHOICE PEACOCK GREEN ALFALFA DIRECT CONNECTION WITH KANSAS CITY AND THE MEXICO BAY MEXICO BAY MEXICO. G. L. SHIELDS HAVE YOU GIVEN US A CHANCE TO SHO W YOU WHAT WE HAVE IN Ladies' Ready-to-Wear GENT'S FURNISHINGS Dry Goods and Dry Goods and Dry Goods. Notions? If so, were you satisfied? If you were not, tell us and we will make you satisfied. NELSON, ROW CO. We Strive to Satisfy." Gibsland, La. Mr. Earl Hamner, of Haughton, spent Monday with relatives. Mrs. T. I. Smith and children went to Shreveport Saturday. Mrs. G. H. Wiggins and daughter, Dale, were Castor visitors Monday. Mrs. Cora Ponett spent Thursday and Friday in Shreveport with her sister, Mrs. Wood. Misses Eva and Maggie Frye and Susie Mac Wedgeworth spent the weekend with Miss Ethel and Vera Evans. Mr. W. L. Bailiff left Friday for Taylor, Ark., where he will attend the association. Mr. Herbert Todd, who is in school at Shreveport, spent the weekend with home folks. Mr. Clarence Nix and William Evans were business visitors to Hope Thursday. Messrs. Jessie McCoy, G. H. Wiggins and others went to Arcadia Sunday. Mr. Henry Warsham and family from Heflin, were guests of Mr. W. D. Hammer Saturday and Sunday. Mr. and Mrs. Chandler, Mr. L. F. McCoy and son, Brady, motored to Arcadia Thursday. Miss Beulah Anderson, from near Minden, returned home Monday after a visit to her sister, Mrs. Denton. Mr. and Mrs. H. O. Carson attended the funeral of Mrs. Carson's mother, Mrs. Noland, of Coushatta, who was buried at Gibsland Thursday. Their many friends sympathize with Mr. and Mrs. Andrew Lord in the death of their little child, which occurred Saturday evening. Mr. Vergil Jackson and wife, Mrs. Grey Statharp and wife, Mrs. Roy Hays and Mrs. Sam Linsey and daughter motored from Coushatta Sunday to visit Mr. and Mrs. Mrs. E. A. Nix. ORDINANCE. Be it ordained, by the Palice Jury of Blenville Parish, in legal session convened, that the president of Police Jury be, and he is hereby authorized and requested to send our a circular letter and give legal notice that this body will receive bids in accordance with the provisions of Act 205 of 1912 for Fiscal Agent of Bienville Parish, La. O*ee*eoo*eeoo* * J. S. WILLIAMS. * Nery Pile. Ob lice in o *. S. Mcenltd's Htere * * Areadia, La. * W. D. Gof Bertram Barnette * 00FP BARNETT * * At eys at glaw * Practice In btn. adl * Federal Courts * Oeel Comnaerlal BankBl. o Aredi,ltirslan 666 Curs Malaria Chills and er, 88. lns Feer, Cd. as Ia akle, ar me- nefmslo4, 6 [20t. ___________I On roll call the members voted on the above ordinance as follows: Yeas.--Bert Davis, J. H. Thurmond. J. F. Allums, W. H. Bogan, A. G. Whitlow and J. H. King. Nays.-None. Buy your Typewriter ribbons, Type writer carbon paper, second sheets, letterheads, envelopes, bill heads, card albums, etc., from us. We guarantee satisfaction. BIENVILLE DEMOCRAT. * Office Phone 195-Res. Phone 159 " * DR. H. A. BURTON * * Veterinarian * * Arcadia,..... Louisiana * opeur rig* I i3aq. illlJ D. INll oF. -Under oNa ar Eithk ter You know you need Insurance. We know how your policies correctly. We appreciate your and assure you no per cent protection and per, DANI EL BRYAN & gas "Insurance of Every Kind Known to the Right" STOP! TURN TO THE RIGHT Here and go to B. E. Lowery's to buy your Groceries and Flour. Just received a A Crack of the Best Flour On the Market This Flour will be sold at best prices in My complete line of Staple and Fancy Going at prices equally as low. FOR THE BEST FLOUR AND GR THE LOWEST PRICES, SEE-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.- SCompare the trouble and uncrtainty of this with our methbod. Our truck calls at your do'for at a ceitdL time. As much gasoline or kerosene as you need is ferred to your tank., You buy at to-day's prices. PU.1 and freshness are guaranteed. Freight 5hipmnnts. delUl' and charges are completely eliminated. Should you flid' more gasoline or kerosene than you receivedl you can id;I phone for additional delivery. Compare-and we believe you will be (,cnvinced that : the Wilkerson Way is the Better Way. Inci entally, neot every community Is served in this way but muist depend ep - tirely on drum shipments. WILKERSON OIL DISTRIBUTING CO. --Jobbers of---- Gaoline, .Keruen Iubricatong Oils and Grea se Ask us for prices Arcadia, Louisians One or the veo.. cadia; s(ven room; chardl: garage: ,11 city w lt,.r and 11igi main str,+t.; e,_ (cash. lalCee fourar (J-135-tf Sif ***** -3i treaM w Schi " (h'IT! O.
| 35,545 |
cu31924003595802_30
|
US-PD-Books
|
Open Culture
|
Public Domain
| null |
None
|
None
|
English
|
Spoken
| 6,998 | 9,059 |
and palatable. Authorities on diet regard both of these as being of importance. Tunnicliffe writes: "Recent research has distinctly taught us that, from the point of view of its nutritive value, great importance attaches to the appetising appearance of food. ' ' (Blue Book on the Use of Preservatives in Food, p. xxxi.). Hutchison is also strongly in favour of regarding the flavour of food as one of the essential characteristics of the diet. He sums up his position by the remark : " To persons of jaded appetite, however, and to invalids and convalescents, the flavouring agents of the food are very powerful aids to digestion, and no adjustment of the diet in such cases can be regarded as satisfactory which leaves this consideration out of account. " {Food and Dietetics, p. 274.) On general dietary principles, therefore, there is a scientific justification for the popular preference. 542. Complementary Foods to Bread. — In view of the fact that bread is naturally deficient in protein and fat, amongst organic nutrients, and in lime among mineral matters, it may be well to indicate those arti- cles of food which are appropriately regarded as complementary or sup- plementary to bread itself. Bread is very rarely eaten alone ; meat and cheese supply its deficiency in protein; leguminous vegetables such as haricot beans have the same effect. Fat is almost universally added to bread in the form of butter. Dietetically, jam or other sweets cannot be regarded as an efficient substitute for butter, margarine, or dripping. In view of the deficiency in lime, milk is strongly indicated as an accompani- ment to bread. Here custom anticipates science by causing bread-and- milk to occupy a prominent position in the dietary of children. May not the reputation of "the halesome parritch" as a bone-food be largely due to the milk consumed therewith rather than to the oats from which it is prepared ? In improved methods of bread-making, both fat and milk are at times employed. Both are good; but the latter especially, whether with or without the cream, selves to, increase the lime content of the bread. If bread be made entirely with skimmed milk, a half kilo (approximately 1 lb.) will contain about 0.3 gram of lime, or roughly the daily amount required by an infant. Such bread would be far better adapted to the requirements of pregnant women than that from whole-meal. Judging by analogy, the addition of a small proportion of an appropriate lime salt would be a further advantage. Such salt might possibly be the car- bonate, which would be changed into the chloride by the hydrochloric acid of the gastric juice ; or it might be added direct as the chloride, in which case it would partly replace sodium chloride or common salt. In some districts a portion of the liquor used in making dough con- sists of lime-water; the lime of this is converted into the carbonate, by the carbon-dioxide gas evolved during fermentation. The use of hard waters for bread-making, i.e., those containing calcium carbonate or sul- phate, also adds to the lime content of the bread. Hard water is itself an important source of lime in the daily income of food, and may under certain circumstances contribute that substance in excess. 543. Summary. — The foregoing data justify the following conclu- sions. Taking breads as supplied by the baker, white bread is weight for weight more nutritious than whole-meal or ordinary brown breads. The average best white bread is more nutritious than the second quality or .that made from the darker or low-grade flours. When from any kind of wheat, standard patent (which is practically the whole of the flour of the wheat) is compared with "entire-wheat," BREAD-MAKING. 393 and graham flour from the same wheat, the white flour yields more nutri- ment and energy than either of the others. The addition of finely divided bran to white flour lowers the nutritive value of the mixture. The addition of germ in excess of that normally present in wheat, mcreases the nutritive valyie of the bread. "Wheat and all kinds of flour therefrom are comparatively poor in mineral constituents. The phosphoric acid is largely in excess of the lime. No diseased condition is known, which can be clearly traced to a deficiency of phosphorus in the diet. All breads contain more phosphates than are absorbed by the human digestive system. All wheat preparations are deficient in lime. Bran is detrimental to healthy bone-formation. The human body requires phosphorus in two distinct forms, as organic compounds for the building up of brain and other phosphoric tissues, and as inorganic salts for the building up of bone tissue which consists largely of calcium phosphate. In case of deficiency of compounds of either type, the body is probably able to utilise for both purposes phosphorus com- pounds of either variety. Wheat is liable to bacteriological contamination, which conceivably may be of objectionable or even dangerous character. The whole-meal will obviously contain the same bacteria as the wheat. The low-grade flours contain less bacteria than the wheat, but some are still present. The high-grade or patent flour is practically bacteriologically clean, even when made from a contaminated wheat. The bakers' best white bread is more attractive and palatable than darker coloured or whole-meal breads made from plain flour or meal only. These in themselves are valuable nutritive assets. The nutritive deficiencies of bread are best remedied by the addition of butter, milk, cheese, meat, and leguminous vegetables to the diet. These supply respectively fat, lime salts, and protein. Hard water, or appro- priate lime salts added direct, would probably help in correcting the deficiency of lime in wheat. No case has been made out for recommending the use of whole-meal bread by growing children or pregnant or nursing women. 544. Vitamines, or Accessory Food Factors. — In the last edition of this work reference was made (page 558) to certain experiments of Hopkins of Cambridge from which he drew tke conclusion that young children would grow and thrive much better on a dietary largely consist- ing of bread made from 80 per cent, extraction flour than on a dietary containing a similar proportion of white bread. This view was based, not on the superior nutritive value and digestibility in the ordinary sense, but on his opinion that the longer extraction flour contains "certain at present unrecognised food substances, perhaps in very minute quantities, whose presence allows our systems to make full use of the tissue building elements of the grain. ' ' Since that date much important work has been done in this direction. In the briefest possible manner, the present day knowledge and conclusions are here summarised. The theory of those physiologists who have given this subject their attention is that there exists a class of substances provisionally termed "vitamines," which exercise most important functions in the process of nutrition, and yet "are present in articles of food in quantities far too small to constitute any appreciable contribution to the energy supply of the body."_ The first step in this research was the discovery that if minute quantities of certain constituents are removed from a food it, the food, wholly fails to support nutrition. Further, if these substances are again returned to the food, health is once more restored. The best known of these cases is that 394 THE TECHNOLOGY OF BREAD-MAKING. of the rice-eating nations, with whom completely white polished rice induces a disease known as beri-beri ; while if the husk only is removed, and the skin of the grain and the germ retained, rice in this condition not only prevents the disease, but acts as a cure in the ease of those suffering from this complaint. The following "vitamines" have been more or less separated and identified : — - 1. Fat-Soluble A. This substance is probably produced by plants during growth, and is found both in the green leaves and in the germ of many seeds. Animals do not seem to possess the power of synthesising this body ; but store it up in relatively considerable quantities from their vegetable food. As a result butter and egg-yolk are comparatively rich in this substance. It is soluble in reagents which dissolve fats, such as ether, and gen- erally also in fats themselves. Heat slowly destroys it, and four hours' exposure to a temperature of 100° C. serves to make butter fat inactive in this direction. Fat-soluble A is essentially an agent for developing growth. If young animals are deprived of it in their food, there are no immediate results, as a reserve stock is carried in the body. As soon, however, as this is exhausted, growth ceases and the animals become extremely susceptible to invasions of disease of a bacterial nature, especially tuberculosis. Adult animals tolerate a deficiency of this substance for some time, but ultimately the general state of health is seriously lowered, and the ca- pacity for resisting disease inroads disappears. In cases where deficiency conditions have been set up, health to a greater or less extent may be restored by the use of food containing this body. A shortage of Fat-solu- ble A as distinct from its absence results in lowered vitality and growing powers. Distribution in Food Stuffs. The following table shows how both Pat-soluble A and another body, Water-soluble B, are distributed among articles of food. The compara- tive quantities are indicated by the terms. Large, Moderate, Small, Absent. Fats — Butter, Cream Mutton and Beef Fat .,.. Lard Most Vegetable Oils and Fats Margarine, animal origin (except lard) .... „ (vegetable origin and lard) Cod-liver Oil Meats and Fish — Lean Beef or Mutton Liver, Kidneys, Heart Lean Fish (as cod, haddock) Fat „ (as herring, salmon) Wheals Germ Endosperm Bran Whole Meal Bread White Bread Vegetables — Cabbage, Lettuce, Spinach Miscellaneons — Nuts (walnuts and fatty nuts) Milk (cows' whole, raw) " (skim) Cheese (whole milk) (skim milk) Whole Eggs (fresh or dried) Egg Yolk Egg White Yeast ,, Extract Meat Extract (commercial) Fat-soluble A. Water-soluble B. Large, moderate. Absent. Moderate. Absent. Absent. Moderate. Absent. Large. Absent. Inconclusive result. Small. Moderate. Moderate to small. Absent. Very slight, if any. Moderate. „ Moderate. Large. Absent. Absent. Inconclusive result. Moderate. Small. Absent. Moderate. Small. Small. Moderate. Moderate. Small. Absent. Small. Moderate. Absent. Moderate. Large. Large. Large. Absent. Large. Large. Absent. Absent. BREAD-MAKING. 395 Water-SoluUe B. — This is a substance of vegetable and animal origin, as shown by its principal sources, which are seed embryos or germs, and also yeast and egg yolk. It differs from Fat-soluble A in that it is insoluble in ether, and is soluble in water. Water-soluble B is neces- sary to promote a satisfactory growth in young animals, and also it is the special factor in preventing the occurrence of beri-beri and neuritic diseases in man. and animals. So far as the action of heat is concerned, during the baking of bread the temperature does not rise sufficiently high to cause any serious diminution in the activity of this substance. Water-soluble B is also necessary to the growth of young animals; in addition it is requisite for adults. In both cases, with its deprivation, there is a fall in body weight, with a fatal termination. Animals do not seem to build up any reserve of this substance, so that as soon as the sup- ply ceases, the ill effects are quickly visible. Certain specific diseases, of which beri-beri is an example, follow from the absence or markedly in- sufficient supply of Water-soluble B. "Beri-beri is rare though not un- known where white bread is eaten, because the consumption of this type of cereal food is usually accompanied by a sufficiency of other food-stuffs containing the essential principle." Deficiency Diets. — The distribution of vitamines, or accessory food- factors in an ordinary mixed dietary is so wide that but little or no im- portance attaches to their comparative absence from white bread. When, however, famine conditions prevail, as in times of war, the range of vitamine containing substances may become dangerously narrow and consequently the conservation of their every source is simply a provision of safety. Notwithstanding its various disadvantages, actual necessity may then make the use of long extraction flours or even whole-meal bread imperative as a measure of getting the greatest possible amount of direct nutriment and accessory food-factors from a given weight of wheat. The authors are indebted for the summarisation of much of the above information to a Report on Vitamines, iy the Medical Research Com- mittee, published iy His Majesty's Stationery Office, to which the reader is referred for a more detailed account of the subject. CHAPTER XVIII. BAKEHOUSE DESIGN. 545. Selection of Site. — In determining the site for a bakery, one of the first matters to engage attention should be to select a locality suitable from a commercial point of view. A practical baker would at once satisfy himself whether or not a neighbourhood looked as though it were growing and improving, or the reverse ; whether it was already over-stocked with bakeries, or whether there were still openings; whether full prices were being obtained, or whether the locality was an undercutting one. The nature of the roads, whether hilly or level, and all items bearing on the cost of getting flour into the bakehouse and of delivering bread from the bakehouse, would be duly noted, and the proper weight given to them in forming a judgment as to the suitability of the spot. AU these may fairly be termed commercial aspects of the question ; but beyond these there are considerations which are more intimately associated with the practical necessities of bread-making. Among these a leading place must be given to the degree of fresh air obtainable, and generally hygienic surroundings. The situations best adapted for selling bread are not necessarily those also best suited for making the same. A good shop will be naturally where rents rule high and property is valuable ; as a result, baking operations are of necessity frequently conducted in a far too limited space for the most efficient and healthy working. In consequence, the system of having bakeries in more thinly populated districts, where land is less valuable and a building ca- pacious enough to accommodate modern labour-saving plant can be erected, and using the shops as selling places only, is being more and more adopted. "With large firms having abundance of capital this is comparatively easily managed, but in the case of smaller concerns greater difficulty exists. But except where really good bakehouses are actu£illy in use, it is a matter for serious consideration whether the bakehouse should not be altogether distinct from the shop. However crowded a locality, there may generally be found at a not unworkable distance a site where a bakehouse, pure and simple, may be erected. The bread rounds may be served direct from where the bread is baked, and only those goods brought to the shop which are requisite for a counter trade. The difficulty is that this means two places to be supervised instead of one ; but even when under the same roof the bakehouse is absolutely dis- tinct from the shop, and the hours of work are by no means simultaneous. By the use of the telephone, communication between the two becomes such that orders and messages may be readily transmitted. Granted that arrangements of this kind mean extra expense, still in the matter of hygienic requirements the public is master, and will in the long run in- sist, in no uncertain manner, upon bread-making being carried on under satisfactory sanitary conditions, and the trader who keeps ahead of time, reaps a handsome reward for his enterprise. There is no doubt that a bakery on the ground flour has a far better chance than one situated underground. No one more thoroughly recog- nises than the authors the difficulties, in many cases, of finding in old BAKEHOUSE DESIGN. 397 bakers' shops accommodation for the bakehouse other than below the shop, and also that many bakeries exist below the street level, and are yet clean and healthy ; but it is in spite of their situation, and not because of it, that they are thus clean. To keep them so requires far more effort and attention than when they are above ground. When a new building is being erected, it may frequently be an advantage to have a sloping site, thus permitting two approaches on different floor levels; this, however, is not often obtainable. It may further mean that the district is hilly and, so, difficult for the delivery of bread. The site should be dry and well drained; also well ventilated, but sheltered as far as possible from exposure to cold winds, especially on the north and east sides. The top of a hill has advantage over the bottom for the delivery of bread, inas- much as the full vans have a downhill journey. 546. Requirements in the Building.— These will be best grouped under various headings, each of which will be considered in turn. The following general conditions should, however, be borne in mind in connection with all that follows, and especially in reference to the de- scription of typical bakehouses illustrated. Floors. — Many different types of floors have been tried, but it may be accepted that the best plan is to select some type of flagged or tiled floor. Owing to heavy traffic certain parts of the floors wear more than others, and no homogeneous flooring material that will lend itself to effi- cient repair in selected places has yet stood the test of hard work. The heat in bakehouses, together with the short time during, which repair work can be permitted, constitute the great difficulties in this respect. It is obvious therefore that stone flagging, artificial stone slabs, tiles or hard bricks, which can all be readily removed in worn places, and relaid effi- ciently without interruption to work or fear of break up, form the ideal materials for a bakehouse floor. In certain factories where the wear is very heavy, floors have been introduced with a surface of cast-iron plates with hexagonal honeycomb perforations. The plates are laid on cement and the holes filled with cement to the upper surface. Walls and Ceiling. — These should preferably be of washable material (glazed bricks, parian cement, tiles or the like) ; all piers should be out- side the building ; only plain surfaces should be used inside and no sharp corners should be employed. Thus, the walls should join one another, the ceiling or the floor, by a rounded corner with a radius of at least one inch. Where considerations of expense make such perfection impossible, plain brickwork walls, kept well lime-washed, are the only alternative which can be recommended. Upper floors should preferably be ferro-concrete with girders and joists cased in cement, again avoiding all sharp corners. Windows and Doors should be placed to avoid draughts as far as pos- sible; they should be well fitting, especially on walls exposed to strong winds. Sloping window sills are advisable, as they prevent the accumula- tion of dust and cannot be used for the storage of odds and ends, which are not only objectionable, but are often the cause of broken windows. Chimneys should never be less than .9 in. by 9 in., measured intern- ally, and should run up outside main walls to above the ridge of roof or highest building adjoining. Avoid cowls and horizontal connections, and never put a round chimney pot on a square chimney unless its diameter equals the diagonal of the square chimney section. One chimney to take a number of ovens is quite satisfactory if large enough and properly ar- ranged, but often a number of smaller ones is less costly. Roofs should exclude draughts as well as wet. If fitted with ventilat- ors these should have means for control. Avoid too much glass roofing 398 THE TECHNOLOGY OP BREAD-MAKING. over the actual doughing room and bakery (in such cases where there is no floor over) : it is too hot in the summer and too cold in the winter. General. — Avoid fixtures as far as possible; let all tables, troughs, bread racks and fittings be on casters or wheels to facilitate transporta- tion and cleanliness. Motive Power. — Gas engines are shown in some of the plans on ac- count of their being the most usually available source of power, and also the heaviest and most difficult to accommodate, thus showing that lighter or smaller prime-movers will have ample room. Space and often expense will of course be saved by adopting electric motors where current is avail- able. The subject of motive power is fully dealt with in paragraphs 562 to 564. 547. Working Requirements — Compactness. — In natural sequence ihere next come forward for consideration the requirements of the baker in using the building, as these must vitally affect the design. Among such one of the first to occur is that of compactness : bakeries are not wanted to be long and straggling, or with the work going on simultan- eously in more than one place. There is otherwise the inevitable loss of time resulting from inadequate supervision, and also that necessarily following from ovens, machinery, tables, etc., being too far away from each other, and what is more important the difficulty of ensuring the cor- rect temperature and atmosphere. In the next place, matters must be so arranged that all approaches and exits are under control, so that the delivery of flour and raw material, and also the packing up and dispatch of bread and finished goods, may be easily and efficiently checked. Where at all practicable, all means of egress and ingress should be through the one main entrance, or, if through different entrances, the whole of these should be under control from the office. In the case of a retail trade, there must be ready means of delivering goods from the bakehouse to the shop. This necessitates, in the case of bakery and shop being on the same level, a direct passage from one to the other. With a bakery either under or over the shop level, the best plan is a simply constructed lift. 548. Ventilation. — As already explained, efficient ventilation is com- pulsory under the Factory Act, but apart from that the necessities of the case would lead every baker to ensure his ventilation being as perfect as possible. With all hot work the cOmfort and health of the operatives FiC. 34. — Diagram Showing Ventilating- Air-Currents. require abundance of fresh and pure air. The ventilation of a bakery is fraught with some difficulty, as it is extremely important that there be no draughts nor sudden chills throiugh the admission of large quantities of BAKEHOUSE DESIGN. 399 cold ait m a short space of time. Ventilation is usually effected by what are known as convection currents, the scientific explanation of which has been given in the introductory chapter. Briefly, air expands as it gets hot, and consequently is lighter, bulk for bulk, than when cold. As a result hot (light) air is displaced by cold (heavy) air, and it may be said that hot air floats upwards, and cold descends to take its place. From this it follows that in rooms where gas is burning or where there is any source of heat, the upper part of the room is distinctly the hotter. If air-flues are led upwards from the upper portion of a room used as a bakery, the hot air will escape from these, while cold air will stream in to take its place at the lower levels if suitable openings are provided. This eifect is easily studied in the accompanying figure. No. 34. Immediately over the ovens is an uptake to which a sliding door is attached; this is exceedingly simple, and is readily worked by a cord from the fioor level. At the sides in various places are inlet pipes; the tops of these are so placed that the cold air cannot strike directly on troughs or other vessels containing ferments, sponges, or doughs. A useful form of ventilating flue is constructed from a compound chimney pipe such as shown in sketch, Pig. 35. This pipe is made of earthenware, in lengths of from 12 in. to 18 in., with spigot and faucet joints like those of an ordinary drain pipe. But on one side of the flue pipe is formed a cham- ber; this separate chamber or flue is the air flue. The heat of the chimney portion warms the air flue, and so creates a powerful draught through it. Oven chimneys may, as shown, be constructed of such pip- ing ; so also in underground bakehouses may the flues for fires in rooms aboA'e, the air flue being carried down into the bakery. Windows may be used for ventilating purposes, but it is then a good plan to place a board on the lower side, so as to cut off any direct indraught. 549. Constancy of Temperature. — Sudden changes in temperature are of course largely produced by draughts, but also may be due to the construction and materials used in the actual building of the bakehouse. Lath and plaster are not the most suitable methods of building bakehouse walls. These should be constructed either of stone or brick of sufiicient thickness, and if the latter be used a fairly solid brick is an advantage. Brickwork should be cemented on the surface, or other steps taken to en- sure its being water-tight. The same reasons which militate against thin walls also apply to iron. For light sheds corrugated iron may do very well, but it is not the material for bakery construction. Its ready con- ductivity of heat causes the bakery to be extremely cold in winter and hot in summer. For the same reasons open iron roofs are to be condemned. To prevent fluctuations in temperature there is nothing so~ effective as having another room over your bakery, and the common practice of hav- ing the flour store above is more than justified by its influence in main- taining an equable temperature in the bakery itself. Suitable roofing is also important and should receive careful consideration. Slated roofs are not necessarily the best, but the builder, architect or engineer should be able to advise as to the best roofing to suit any given locality, if his attention be drawn to the need for roofing such as will be warm in winter .and cool in summer. Special attention may be here called to suitable Fic. 35. — ^Ventilating Chimney Pipe. 400 THE TECHNOLOGY OF BREAD-MAKING. specialised roofing felts, which are not only excellent but durable and cheap. (See also paragraph 584.) 550, Arrangements for Ovens. — It may be taken as a cardinal prin- ciple of the authors that ovens should be fired from outside the portions of the building in which baking operations are carried on. In conjunc- tion with this, one has of course to bear in mind the fact that internal firing, or firing in some other way from the front, is much preferred by Some bakers J but such reasons as once existed for such preferences can hardly be said to apply today. Oven constructions are now available which enable any class of work to be perfectly carried on, and are yet arranged to be fired from outside the bakery proper. Supposed inap- plicability of modern externally fired ovens for certain classes of work is more imaginary than real, and there are now ovens available which, fired from outside the bakery, do as good quality work as others with the fire manipulated within the bakehouse proper. This view leads the authors to suggest the provision in bakeries of a separate stokehole, with means of access from the bakery, and separate entrances for the bringing in of fuel and the carting away of ashes. Ovens may be built within the bakery itself, but where practicable the authors prefer to have them outside, with leian-to or other roof covering over the ovens themselves only. This sepa- rate building can then receive independent ventilation, so as to avoid un- due heating.by the oven of the bakery itself. Where there is a row of ovens, their faces and doors should be flush with, or form part of, one wall, and this wall should be carried of course right up to the ceiling. This should be done even if the ovens are within the main building, and have the upper rooms extending over them. Such a wall may also assist to bear the superincumbent weight, if desired to do so, but it is well so to arrange matters that independent pillars or columns are provided between each oven to carry the weight above. The general work may be faced up uni- form with these, or the ovens may be slightly recessed, so as to give a somewhat improved architectural effect, but in either case ovens and buildings should be separate and distinct from each other. The design of the bakehouse must depend somewhat on the nature of ovens selected. These resolve themselves, so far as British practice is con- cerned, into several types, of which the ordinary oven loaded with a peel (usually a rectangular chamber) and the drawplate oven, which is nar- row and elongated, are the most frequent. The particular shape of this latter variety is determined by the width of plate over which men can set bread by hand, except for close-set bread and other varieties which lend themselves to the use of setters. This consideration practically limits the width of drawplates to six feet, which space can be readily spanned by reaching from either side. 551. Machinery. — The arrangements in this matter must depend largely on the space at command and its shape and other characteristics. The engine should have a separate room provided for it. This is not often a matter of great difficulty, because in even a small bakehouse the engine may be screened off with a glass and woodwork partition. Naturally, in arranging machinery and the bakery generally, provi- sion will be made for running materials about as little as possible. In Great Britain, flour store-rooms are generally at the top of the bakery, and the flour is at once raised there when brought into the building owing to the convenience of utilising the laws of gravity for the conveyance of the flour and dough to the lower floors. In countries with more severe climates, however, where extreme cold and heat is experienced, the flour is often stored in underground cellars to enable it to be kept at a uniform BAKEHOUSE DESIGN. 401 temperature. Elevators are then employed for conveying it to the top floor for distribution as before referred to. 552. Typical Bakery Designs.— Having dealt with general prin- ciples, an effort will next be made to show how these principles may be embodied in everyday work. For that purpose the following descriptions, illustrated by plates VII to IX are given. It must be remembered that these are not to be taken as complete working drawings ; many little de- tails of construction are omitted, because they do not affect the general principles of the design. 553. Single Peel Oven Bakehouse.— On Plate VII there is shown a .<?mall bakehouse fitted with one peel oven, which may be of the one-deck or two-deck type. The outside width is 18 ft. 6 in., windows all in front, and depth 30 ft. The choice as to which of the two types of ovens men- tioned shall be decided upon, will be governed by consideration of size and nature of trade as well as cost : for guidance in this respect refer to paragraphs 597 et seq. dealing with ovens. The firing arrangement is at the side, giving a separate stokehole, fitted with coke bunker. The assumption is that the oven is not accessible at the back; in fact, that no facilities for either light or entrance are obtainable from -anywhere but the front. Beyond showing a kneading trough and tempering tank (see paragraph 577) at one side, no attempt has been made to introduce fix- tures and utensils ; the places for the latter will suggest themselves to the baker in looking over the plan. The staircase leading to the flour store above is arranged so as not to interfere with the lighting of the bake- house, and to enable the kneading trough to occupy a position in which it is not exposed to the draught from the entrance doorway. In the flour loft is shown in outline the position of a sifting machine (see paragraph 576), through which flour is intended to be delivered into the trough be- low. This machine is readily worked by hand, and should be considered indispensable as all flour bags contain foreign matter such as oddments of string, fluff, etc., which may easily escape the dough maker. The oven portion of the building is covered by a lean-to roof, one storey high, aad raised and louvred portions should be fitted at the upper part of the roof to provide ventilation. The top of the oven is separated from the bake- house by a brick wall, but is open to the stokehole, which is therefore also efficiently ventilated. A large amount of work could be easily done in a bakehouse of this type. Assuming a two-deck oven, the lower chamber should preferably be reserved for bread and the upper for confectionery, and with a modern steampipe oven in which each chamber is fired independently of the other and capable of yielding a batch of 2 lb. crusty loaves per 1J4 hours, a trade of 30 to 35 sacks (280 lbs.) per week is possible. In addition to this a considerable output of confectionery and cake will be obtained by using the oven during the hours in which the bread baking is stopped. The introduction of proper drainage and sanitary appliances would render this bakehouse, small as it is, perfect, from a hygienic point of view — so perfect, at least, as hand-making appliances will permit. 554. Bakehouse for Two Peel Ovens. — The next plan on the same Plate, VII, is one of a larger bakehouse, in which both front and side light is obtainable, although it will be seen the latter can be easily dis- pensed with. This bakery is shown fitted with two peel ovens, which again would preferably be two-deck. One of the upper ovens may be ar- ranged as a steam-retaining sloped sole oven for glazed or Vienna bread. The suggestion here is that the ovens shall be fired at the back, and ac- cordingly a stokehole extends the whole length of the .back; opening from 402 THE TECHNOLOGY OF BREAD-MAKING. PLATE VII. Plans of Bakehouses. With One Peel Oven. With Two Peel Ovens. ^-J-^i 71 UiM II' '"^ r--.-=_^ ^ 1 ri^.:^^^^^ B 1 _: ■ c 1 RPJFERENCES. A. Open Yard. B. Flour Store. C. Sifter and Shoot. D. Bakehouse. E. Dough Trough. F. Moulding Table. G. Tempering Tank. H. Stoke-hole. J.. Confectionery and Stores. K. Office. L. Furnaces. BAKEHOUSE DESIGN. 403 PLATE VIII. Plans of Single Drawplate Oven Bakery. REFERENCES. A. Gas Engine. B. Dough Divider. C. Moulding Table. E. "Single Blade" Kneading Machine. F. Drawplate Oven. D. Stoke-hole. G. Flour Store. H. Blending Hopper, Sifter and Shoot. J. Drawplate. K. Space for Dough Trucks and Proving Dough. L. Front-fired Drawplate Oven. 404 THE TECHNOLOGY OF BREAD-MAKING. the passage to the stokehole is a door leading to a small yard, in which are built a lavatory and men's offices. In order to protect workmen this passage is roofed over, but left open on side nearest the yard. The bakery has a table in the centre, while sufficient kneading troughs would find room against the walls. A sifting machine and tempering tank, as before described, are shown in a position to which the troughs may be in turn conveniently moved. All kneading troughs should be on casters to enable them to be readily moved to suit the work as also to enable thor- ough cleaning of floors, walls and corners. To the right hand of tte bakery is a small office, and behind is a pastry j-oom. Over the bakery is the flour store, arranged as in the previous sketch. A bakehouse such as this would have capacity for a large trade, and with properly selected ovens there would be no difficulty in turning out a hundred sacks per week, and also the corresponding amount of small goods, confectionery, and cake. Of course, the amount of bakehouse space might in such a case be increased with advantage, or the space might be altered in shape to meet exigencies of site. The sketch is merely intended to indicate the minimum space required for the amount of work wanted. No provision has been made here for machinery, but such could easily be adopted if desired. Bread-rooms and other conveniences should be attached to the bakery front, or side opposite ovens. 555. Single Drawplate Oven Bakery. — Plate VIII shows plans of a bakehouse fitted with a split-type drawplate oven. Fig. 60, over which may also with advantage be built a peel oven, see Fig. 61, in the case of mixed trades. This arrangement lends itself well to a site where there is a very narrow frontage and plenty of depth. The sketch has been pre- pared on this assumption, and shows a bakery standing on a piece of ground 15 ft. 4 in. in width. This might be still further diminished by lessening the width of the passage round the stokehole, which in the plan is 3 ft. wide. By resorting to the plan of having the oven fired at front Fig. 36. — Oven for Small Bakery. and within the bakehouse. Fig, 4, Plate VIII, the total width might still further be reduced to 10 ft. inside and 12 ft. 4 in. external width. Or even in this case the oven might be fired at the back by arranging a spiral staircase or step-ladder down into the stokehole from over the oven BAKEHOUSK DESIGN. 405 through the flour store above. Sucli very narrow sites are not, however, likely to often occur, and the staircase arrangement is not recommended. A.S drawn, it is assumed that no light is available from the sides, and ac- cordingly small windows are placed over the ovens into the bakehouse. This plan shows the position of flour-blending, sifting, doughing, and Fig. 37. — Interior of Small Machine Bakery. dividing machinery, arranged in the bakehouse, and also parts of the same overhead. The engine-room is in front of the bakery, and beyond that is the bread-room. A bakery such as this forms an interesting and fairly complete installation. With this plant, especially where the draw- plate has over it a peel oven, or is of the two-deck variety, an extensive and varied trade may be done, and instances are known in which over a hundred sacks (280 lbs.) per week have been regularly turned out with similar equipment, provided sufficient space for dough trucks be avail- able. The machine plant indicated could very well turn out sufficient work to warrant the erection of another oven beside that shown, making of course the bakehouse correspondingly wider. With increased width rearrangement of space would permit the depth to be reduced. Fig. 36 shows an oven such as this bakery might have and Fig. 37 a view of a bakery fitted with two-deck draw-plate ovens and machinery on a small scale. 556. Shop and Overhead Bakery. — The designs given on Plate IX take into consideration a business which is supposed to be in the main street of a good neighbourhood where the exigencies of the circumstances demand both bakehouse and shop to be in close proximity. It is assumed that the only access to the premises is from the front or street side, there only being at the back a limited amount of air and lighting space, which cannot be utilised in any way in connection with the manufacturing op- erations of the business. 406 THE TECHNOLOGY OF BREAD-MAKING. Regarding the shop itself, much must of necessity be left to the nature of the business and the individual taste of the proprietor. It goes with- out saying that window space is required for the display of goods; this is provided by two windows, each about 10 ft. in length. On the one side of the shop is a counter, and the other is fitted with a table, which may also be used for counter purposes. Toward the back of the shop some small tables are placed, for the purpose of serving light refreshment — tea and cofEee. Descending from the back of the shop is a staircase leading to lavatories and retiring rooms in the basement. These are in- dicated by dotted lines on the ground-floor plan. A passage from the bottom of the staircase leads to one set of lavatories and w^.c. 's on the left hand. Another similar set is reached through the room shown under part of the bread-room. This basement room, with the adjoining conveniences, could be retained for the staff, the others being reserved for the accommo- dation of customers, and both kept separate and distinct from each other. This basement might also be used for the preparation of light refresh- ment to be sent up by a small lift fixed by the top of the stairs. It being assumed that the only approach to the building is from the front, means of ingress and egress to the bakery have been provided by a side passage on the right hand of the shop ; this goes right through to the back of the building, and has doors leading into the bread-delivery room and the ofSce.
| 19,031 |
https://zh.wikipedia.org/wiki/%E5%87%A1%E8%8E%B1%E8%92%99%E5%B7%B4%E5%B0%94
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
凡莱蒙巴尔
|
https://zh.wikipedia.org/w/index.php?title=凡莱蒙巴尔&action=history
|
Chinese
|
Spoken
| 15 | 311 |
凡莱蒙巴尔（，，意为“蒙巴尔附近的凡”）是法国科多尔省的一个市镇，属于蒙巴尔区。
地理
（）面积，位于法国勃艮第-弗朗什-孔泰大區科多尔省，该省份为法国中东部省份，北起奥布省，西接涅夫勒省和约讷省，南至索恩-卢瓦尔省，东南接汝拉省，东临上索恩省，东北部与上马恩省接壤。
与接壤的市镇（或旧市镇、城区）包括：。
的时区为UTC+01:00、UTC+02:00（夏令时）。
行政
的邮政编码为，INSEE市镇编码为。
政治
所属的省级选区为。
人口
于时的人口数量为人。
参见
科多尔省市镇列表
参考文献
科多尔省市镇
| 5,427 |
https://github.com/aliozkara/PokemonCards/blob/master/app/src/main/java/alico/com/pokemoncards/ui/activity/pokeList/di/PokeListModule.java
|
Github Open Source
|
Open Source
|
Apache-2.0
| 2,018 |
PokemonCards
|
aliozkara
|
Java
|
Code
| 91 | 452 |
package alico.com.pokemoncards.ui.activity.pokeList.di;
import alico.com.pokemoncards.api.Api;
import alico.com.pokemoncards.ui.activity.pokeList.PokeListActivity;
import alico.com.pokemoncards.ui.activity.pokeList.core.PokeListModel;
import alico.com.pokemoncards.ui.activity.pokeList.core.PokeListPresenter;
import alico.com.pokemoncards.ui.activity.pokeList.core.PokeListView;
import alico.com.pokemoncards.utils.rx.RxSchedulers;
import dagger.Module;
import dagger.Provides;
import rx.subscriptions.CompositeSubscription;
/**
* Created by alicanozkara on 20.12.2017.
*/
@Module
public class PokeListModule {
PokeListActivity activity;
public PokeListModule(PokeListActivity context) {
this.activity = context;
}
@PokeListScope
@Provides
PokeListView provideView(){
return new PokeListView(activity);
}
@PokeListScope
@Provides
PokeListPresenter providePresenter(RxSchedulers schedulers, PokeListView view, PokeListModel model) {
CompositeSubscription subscriptions = new CompositeSubscription();
return new PokeListPresenter(schedulers, model, view, subscriptions);
}
@PokeListScope
@Provides
PokeListActivity provideContext(){
return activity;
}
@PokeListScope
@Provides
PokeListModel provideModel(Api api){
return new PokeListModel(activity, api);
}
}
| 9,532 |
https://github.com/silentorb/mythic-kotlin/blob/master/projects/mythic-desktop/src/main/kotlin/silentorb/mythic/desktop/DesktopDisplay.kt
|
Github Open Source
|
Open Source
|
MIT
| 2,020 |
mythic-kotlin
|
silentorb
|
Kotlin
|
Code
| 724 | 2,204 |
package silentorb.mythic.desktop
import org.lwjgl.glfw.GLFW.*
import org.lwjgl.stb.STBImage.*
import org.lwjgl.system.MemoryStack
import org.lwjgl.system.MemoryUtil
import silentorb.mythic.debugging.getDebugBoolean
import silentorb.mythic.platforming.*
import silentorb.mythic.resource_loading.ioResourceToByteBuffer
import silentorb.mythic.spatial.Vector2i
import java.nio.ByteBuffer
fun createWindow(title: String, config: PlatformDisplayConfig): Long {
// val pid = ManagementFactory.getRuntimeMXBean().getName()
// println("pid: " + pid)
glfwDefaultWindowHints() // optional, the current window hints are already the default
glfwWindowHint(GLFW_VISIBLE, GLFW_FALSE) // the window will stay hidden after creation
glfwWindowHint(GLFW_RESIZABLE, GLFW_TRUE) // the window will be resizable
glfwWindowHint(GLFW_SAMPLES, config.multisamples)
if (getDebugBoolean("DEBUG_OPENGL")) {
glfwWindowHint(GLFW_OPENGL_DEBUG_CONTEXT, GLFW_TRUE)
}
// val pid = ProcessHandle.current().getPid()
// Even if the window is maximized and not using windowedDimensions, the initial dimensions determine
// the dimensions used when the window is restored
val dimensions = config.windowedDimensions ?: Vector2i(800, 600)
val window = glfwCreateWindow(dimensions.x, dimensions.y, title, MemoryUtil.NULL, MemoryUtil.NULL)
if (window == MemoryUtil.NULL)
throw RuntimeException("Failed to create the GLFW window")
return window
}
fun createHeadlessWindow(): Long {
glfwDefaultWindowHints()
glfwWindowHint(GLFW_VISIBLE, GLFW_FALSE)
val window = glfwCreateWindow(320, 200, "", MemoryUtil.NULL, MemoryUtil.NULL)
if (window == MemoryUtil.NULL)
throw RuntimeException("Failed to create the GLFW window")
glfwMakeContextCurrent(window)
return window
}
fun centerWindow(window: Long) {
MemoryStack.stackPush().use { stack ->
val width = stack.mallocInt(1)
val height = stack.mallocInt(1)
glfwGetWindowSize(window, width, height)
val videoMode = glfwGetVideoMode(glfwGetPrimaryMonitor())!!
glfwSetWindowPos(
window,
(videoMode.width() - width.get()) / 2,
(videoMode.height() - height.get()) / 2
)
}
}
fun initializeFullscreen(window: Long, resolution: Vector2i? = null) {
val monitor = glfwGetPrimaryMonitor()
val videoMode = glfwGetVideoMode(monitor)!!
glfwSetWindowMonitor(
window, monitor, 0, 0,
resolution?.x ?: videoMode.width(),
resolution?.y ?: videoMode.height(),
videoMode.refreshRate()
)
glfwFocusWindow(window) // For some reason the window loses focus when switching to fullscreen mode?
}
fun initializeWindowed(window: Long, dimensions: Vector2i?) {
if (dimensions != null) {
val monitor = glfwGetPrimaryMonitor()
val videoMode = glfwGetVideoMode(monitor)!!
glfwSetWindowMonitor(window, 0, 0, 0, dimensions.x, dimensions.y, videoMode.refreshRate())
glfwSetWindowSize(window, dimensions.x, dimensions.y)
centerWindow(window)
} else {
glfwMaximizeWindow(window)
}
}
fun initializeWindow(window: Long, config: PlatformDisplayConfig) {
when (config.windowMode) {
WindowMode.fullscreen -> initializeFullscreen(window, config.fullscreenDimensions)
WindowMode.windowedFullscreen -> initializeFullscreen(window)
else -> initializeWindowed(window, config.windowedDimensions)
}
glfwMakeContextCurrent(window)
// Enable v-sync
glfwSwapInterval(if (config.vsync) 1 else 0)
glfwShowWindow(window)
}
fun getWindowInfo(window: Long): WindowInfo {
MemoryStack.stackPush().use { stack ->
val width = stack.mallocInt(1)
val height = stack.mallocInt(1)
glfwGetWindowSize(window, width, height)
return WindowInfo(Vector2i(width.get(), height.get()), window)
}
}
val loadImageInfoFromFile: ImageInfoLoader = { filePath ->
var width = 0
var height = 0
var channels = 0
MemoryStack.stackPush().use { stack ->
val widthBuffer = stack.mallocInt(1)
val heightBuffer = stack.mallocInt(1)
val channelBuffer = stack.mallocInt(1)
// Load only some of the initial bytes of the image.
// Currently only supports PNG. Other image formats may work too, it depends on whether the amount
// of bytes loaded is sufficient.
val imageBuffer = ioResourceToByteBuffer(filePath, 64, true)
val success = stbi_info_from_memory(imageBuffer, widthBuffer, heightBuffer, channelBuffer)
if (!success) {
val reason = stbi_failure_reason()
throw RuntimeException("Failed to load texture file info!" + System.lineSeparator() + reason)
}
width = widthBuffer.get()
height = heightBuffer.get()
channels = channelBuffer.get()
}
ImageInfo(
width = width,
height = height,
channels = channels
)
}
val loadImageFromFile: ImageLoader = { filePath ->
var buffer: ByteBuffer? = null
var width = 0
var height = 0
var channels = 0
MemoryStack.stackPush().use { stack ->
val widthBuffer = stack.mallocInt(1)
val heightBuffer = stack.mallocInt(1)
val channelBuffer = stack.mallocInt(1)
val imageBuffer = ioResourceToByteBuffer(filePath)
stbi_set_flip_vertically_on_load(true)
buffer = stbi_load_from_memory(imageBuffer, widthBuffer, heightBuffer, channelBuffer, 0)
if (buffer == null) {
val reason = stbi_failure_reason()
throw RuntimeException("Failed to load a texture file!" + System.lineSeparator() + reason)
}
width = widthBuffer.get()
height = heightBuffer.get()
channels = channelBuffer.get()
}
if (buffer != null)
RawImage(
buffer = buffer!!,
info = ImageInfo(
width = width,
height = height,
channels = channels
),
)
else
null
}
fun setDisplayOptions(window: Long, previous: PlatformDisplayConfig, options: PlatformDisplayConfig) {
if (
previous.windowMode != options.windowMode ||
(options.windowMode == WindowMode.windowed && previous.windowedDimensions != options.windowedDimensions) ||
(options.windowMode == WindowMode.fullscreen && previous.fullscreenDimensions != options.fullscreenDimensions)
) {
initializeWindow(window, options)
}
}
fun getDesktopDisplayModes(): List<DisplayMode> {
val monitor = glfwGetPrimaryMonitor()
val modes = glfwGetVideoModes(monitor)!!
return modes.map {
DisplayMode(
resolution = Vector2i(it.width(), it.height())
)
}
}
class DesktopDisplay(val window: Long) : PlatformDisplay {
override fun initialize(config: PlatformDisplayConfig) = initializeWindow(window, config)
override fun getInfo(): WindowInfo = getWindowInfo(window)
override fun swapBuffers() = glfwSwapBuffers(window)
override fun hasFocus() = glfwGetWindowAttrib(window, GLFW_FOCUSED) == 1
override fun setOptions(previous: PlatformDisplayConfig, options: PlatformDisplayConfig) {
setDisplayOptions(window, previous, options)
}
override fun getDisplayModes(): List<DisplayMode> = getDesktopDisplayModes()
override fun shutdown() {
// The window will eventually get destroyed automatically when the application closes
// but at least in some cases manually destroying the window is significantly faster
glfwDestroyWindow(window)
}
override val loadImage: ImageLoader
get() = loadImageFromFile
override val loadImageInfo: ImageInfoLoader
get() = loadImageInfoFromFile
}
| 46,901 |
https://it.wikipedia.org/wiki/Karlheinz%20Klotz
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Karlheinz Klotz
|
https://it.wikipedia.org/w/index.php?title=Karlheinz Klotz&action=history
|
Italian
|
Spoken
| 4 | 14 |
Biografia
Palmarès
Collegamenti esterni
| 10,883 |
https://openalex.org/W2319654564
|
OpenAlex
|
Open Science
|
CC-By
| 2,013 |
The TFOS International Workshop on Contact Lens Discomfort: Report of the Contact Lens Interactions With the Ocular Surface and Adnexa Subcommittee
|
Nathan Efron
|
English
|
Spoken
| 26,958 | 51,089 |
Copyright 2013 The Association for Research in Vision and Ophthalmology, Inc.
www.iovs.org j ISSN: 1552-5783 Correspondence: Lyndon Jones; [email protected]. Correspondence: Lyndon Jones; [email protected]. ee the tables in the Introduction for the members of the TFOS International Workshop on Contact Lens Discomfort
b
i
d S
b
3 2013 Submitted: September 3, 2013 Submitted: September 3, 2013 Accepted: September 4, 2013 Accepted: September 4, 2013 Citation: Efron N, Jones L, Bron AJ, et al. The TFOS International Workshop on Contact Lens Discomfort: Report of the Contact Lens Interactions
With the Ocular Surface and Adnexa Subcommittee. Invest Ophthalmol Vis Sci. 2013;54:TFOS98–TFOS122. DOI:10.1167/iovs.13-13187 Keywords: contact lenses, discomfort, dryness, cornea, conjunctiva, eyelids T
he report of this subcommittee concerns the impact of
contact lenses (CLs) on the ocular surface, with a particular
emphasis on CL discomfort (CLD). We define the ocular
surface, its regional anatomy, and the physiological responses
of each region to CL wear. THE TEARS AND TEAR FILM T The exposed ocular surface is at all times covered by the tear
film. When the eyes are closed, the tear-filled space so formed is
termed the conjunctival sac. Aqueous tears, secreted by the
main and accessory lacrimal glands, enter the upper and outer
parts of the sac, replenishing the tears. As the eyes open, in the
upstroke of the blink, the tears exposed by the widening
palpebral fissure form the preocular tear film and the tear
menisci.16–18 The precorneal tear film is estimated to be
approximately 3 lm in thickness.19 Special Issue Special Issue The TFOS International Workshop on Contact Lens
Discomfort: Report of the Contact Lens Interactions With
the Ocular Surface and Adnexa Subcommittee Nathan Efron,1 Lyndon Jones,2 Anthony J. Bron,3 Erich Knop,4 Reiko Arita,5 Stefano Barabino,6
Alison M. McDermott,7 Edoardo Villani,8 Mark D. P. Willcox,9 Maria Markoulli,9 and the members
of the TFOS International Workshop on Contact Lens Discomfort 1Institute of Health and Biomedical Innovation, and School of Optometry and Vision Science, Queensland University of Technology,
Kelvin Grove, Queensland, Australia 1Institute of Health and Biomedical Innovation, and School of Optometry and Vision Science, Queensland University of Technology,
Kelvin Grove, Queensland, Australia , Q
,
2Centre for Contact Lens Research, School of Optometry and Vision Science, University of Waterloo, Waterloo, Ontario, Canada
3Nuffield Laboratory of Ophthalmology, University of Oxford, Oxford, United Kingdom , Q
,
2Centre for Contact Lens Research, School of Optometry and Vision Science, University of Waterloo, Waterloo, Ontario, Canada
3Nuffield Laboratory of Ophthalmology, University of Oxford, Oxford, United Kingdom y
p
gy
y
g
4Ocular Surface Center Berlin, Department for Cell and Neurobiology, Center for Anatomy, Charit´e-Universit¨atsmedizin Berlin,
Berlin, Germany
5 4Ocular Surface Center Berlin, Department for Cell and Neurobiology, Center for Anatomy, Charit´e-Universit¨atsmedizin Berlin,
Berlin, Germany y
5Itoh Clinic, Saitama, Japan 5Itoh Clinic, Saitama, Japan Itoh Clinic, Saitama, Japan
6Clinica Oculistica, Dipartimento di Neuroscienze, Riabilitazione, Oftalmologia, Genetica, e Scienze Materno Infantili, University of
Genoa, Genoa, Italy
7 ,
, J p
6Clinica Oculistica, Dipartimento di Neuroscienze, Riabilitazione, Oftalmologia, Genetica, e Scienze Materno Infantili, University of
Genoa, Genoa, Italy ,
, J p
Clinica Oculistica, Dipartimento di Neuroscienze, Riabilitazione, Oftalmologia, Genetica, e Scienze Mater
Genoa, Genoa, Italy ,
, J p
6Clinica Oculistica, Dipartimento di Neuroscienze, Riabilitazione, Oftalmologia, Genetica, e Scienze Materno Infantili, University of
Genoa, Genoa, Italy ,
,
y
The Ocular Surface Institute, University of Houston College of Optometry, Houston, Texas 7The Ocular Surface Institute, University of Houston College of Optometry, Houston, Texas
8Department of Clinical Sciences and Community Health, University of Milan and Eye Clinic San Giuseppe Hospital, Eye Clinic
Fondazione IRCCS Ca’ Granda Ospedale Maggiore Policlinico, Milan, Italy 8Department of Clinical Sciences and Community Health, University of Milan and Eye Clinic San Giuseppe Hospital, Eye Clinic
Fondazione IRCCS Ca’ Granda Ospedale Maggiore Policlinico, Milan, Italy 8Department of Clinical Sciences and Community Health, University of Milan and Eye Clinic San Giuseppe Hospital, Eye Clinic
Fondazione IRCCS Ca’ Granda Ospedale Maggiore Policlinico, Milan, Italy 9School of Optometry and Vision Science, The University of New South Wales, Sydney, New South Wales, Australia DEFINITION OF THE OCULAR SURFACE The ocular surface consists of the continuous mucosal surface
that begins with the cornea centrally and extends, via the
limbus, to the bulbar and fornical conjunctiva to end with the
tarsal conjunctiva.1,2 Classically, the tarsal conjunctiva is further
subdivided into proximal and distal parts by the presence of a
subtarsal fold,3 which runs parallel to the lid margin at
approximately 2 mm from its posterior border. The distal part,
termed the marginal conjunctiva, is of particular importance to
lid function during blinking and extends from the fold to the
mucocutaneous junction on the occlusal surface of the lid
margin. That part that is apposed to the globe is the site of the
so-called ‘‘lid wiper’’ zone of the lid, which has an important
role in distributing the tear film across the ocular surface. Many
aspects of the ocular surface are covered in several excellent
reviews, including the functional anatomy and immunology,4–6
ocular allergy,7,8 and ocular surface reconstruction.9–15 The menisci, lying at the interface between the lid margins
and the surface of the globe, provide the route by which the
tears reach the lacrimal puncta and canaliculi and thence enter
the nasolacrimal system. In the steady state, tears lost from the
exposed ocular surface by evaporation during the blink interval
and those lost by tear drainage, balance that produced by tear
secretion. Meibomian lipid (meibum), derived from the tarsal
meibomian glands, is delivered to the lid margin skin just
anterior to the mucocutaneous junction and is spread onto the
surface of the tear film in the upstroke of the blink.20,21 The tear
film lipid layer retards evaporative water loss from the eye,
playing a critical role in protecting the ocular surface from
desiccating stress. TFOS98 Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/2017 IOVS j October 2013 j Vol. 54 j No. 11 j TFOS99 CL Interactions With the Ocular Surface and Adnexa FIGURE 1. The Lacrimal Functional Unit is an integrated system comprising the lacrimal glands, ocular surface (cornea, conjunctiva, meibomian
glands, goblet cells, and lids), and the sensory and motor nerves that connect them. Trigeminal sensory fibers arising from the ocular surface,
particularly the cornea, run to the superior salivary nucleus in the pons, from where efferent fibers pass, in the nervus intermedius, to the
sphenopalatine ganglion. Here, postganglionic fibers arise that terminate in the lacrimal gland, nasopharynx, and vessels of the orbit. CL INTERACTIONS WITH THE OCULAR SURFACE Contact lens discomfort must relate to the interactions
between the CL and the ocular surface and alterations to its
tissues during lens wear. These changes are described below
on a regional basis. The ocular surface is richly innervated by trigeminal afferents
and the lacrimal and meibomian glands each receive a
parasympathetic and a sympathetic nerve supply. Inputs and
outputs from these nerves form the basis of a reflex arc between
the ocular surface, brainstem, and lacrimal glands, which adjusts
tear secretion to meet daily demands. This is referred to as the
lacrimal functional unit.33,34,37 The sensory innervation of the
cornea is particularly rich,38 while that of the lid margin mucosa
is similar to that of the central cornea.39 These afferents
cooperate to stimulate reflex tear production and spontaneous
blinking, in addition to mediating sensation. Additional inputs to
the lacrimal gland from higher centers of the brain are involved
in emotional tears. Sensory inputs from the nasolacrimal system
may suppress tear production.40 Figure 1 graphically portrays
this integrated system. UNIT The ocular surface may be thought of as an integrated functional
unit,5,22,23 protected from environmental stress by homeostatic
processes that control tear flow and tear film formation.24 In
addition to the cornea and conjunctiva,4 its component parts
include the main25–27 and accessory lacrimal glands,28 the
meibomian glands29 and mucin-producing epithelial cells and
goblet cells,30 the blink mechanism,31 and events accompanying
the closed eye condition.32 Homeostasis involves, in particular, a
reflex arc between the ocular surface and the brain stem,33,34
and in addition, immunologic,35 inflammatory,35 and endocrine
regulation.36 OCULAR SURFACE AND THE LACRIMAL-FUNCTIONAL A loss of sensory drive to the brain stem salivary or blink
centers can inhibit tear secretion41–44 and reduce the rate of
spontaneous blinking,45,46 compounding the effect of desiccat-
ing stresses to the eye. Impairment of feedback by either injury
or inflammatory cytokines acting on the ocular surface may be
an important contributor to ocular surface inflammation in dry
eye disease.4,33,34,47–54 DEFINITION OF THE OCULAR SURFACE Another neural
pathway controls the blink reflex, via trigeminal afferents and the somatic efferent fibers of the seventh cranial nerve. Higher centers feed into the
brainstem nuclei and there is a rich sympathetic supply to the epithelia and vasculature of the glands and ocular surface 23 Figure courtesy of FIGURE 1. The Lacrimal Functional Unit is an integrated system comprising the lacrimal glands, ocular surface (cornea, conjunctiva, meibomian
glands, goblet cells, and lids), and the sensory and motor nerves that connect them. Trigeminal sensory fibers arising from the ocular surface,
particularly the cornea, run to the superior salivary nucleus in the pons, from where efferent fibers pass, in the nervus intermedius, to the
sphenopalatine ganglion. Here, postganglionic fibers arise that terminate in the lacrimal gland, nasopharynx, and vessels of the orbit. Another neural
pathway controls the blink reflex, via trigeminal afferents and the somatic efferent fibers of the seventh cranial nerve. Higher centers feed into the
brainstem nuclei and there is a rich sympathetic supply to the epithelia and vasculature of the glands and ocular surface.23 Figure courtesy of
Michael Stern. Epithelium Epithelial cells harvested by corneal impression cytology
from SCL wearers were also found to be larger than those from
non–lens wearers.85,86 Overall, for hydrogel and silicone
hydrogel (SiHy) DW lenses, effects on cell size are minor but
become more obvious with EW.77 For rigid lenses, cells
increase in size by 10% to 30% during DW.87 One hypothesis
for this increase in cell size is that it is associated with slowing
of epithelial renewal, such that cells are retained on the surface
for a longer period of time, allowing more time for them to
flatten and enlarge,84 but other factors, such as mechanical
compression, particularly with rigid lenses, may be involved.77
Holden and colleagues88 reported that long-term EW of SCL
caused a 5.6% decrease in epithelial thickness. Several other
studies have used in vivo laser scanning confocal microscopy
(LSCM) to study lens effects on the epithelium. Ladage and
colleagues87 did not see an effect on epithelial thickness after 4
weeks of DW SCL, whereas an almost 10% decrease in
thickness was observed with rigid lens wear. They also noted
that epithelial cell surface area increased 3% to 10%, depending
on lens type. Patel and colleagues89 showed that temporal but
not central epithelial thickness was reduced in corneas of long-
term (>10 years) CL wearers. Corneal epithelial basal cells
were found to be less regular in low oxygen transmissibility
(Dk/t) lens wearers than high Dk/t and non–lens wearers, and
both types of lens wear were associated with epithelial
thinning, compared with non–lens wearers.90 Yagmur and
colleagues91 studied the eyes of hydrogel CL wearers (average
wear duration of approximately 3.5 years) and controls. They
observed that corneal epithelial cells were enlarged in eyes
wearing lenses with a mean Dk/t ratio of approximately 27. They attributed this and other corneal changes, such as
reduced keratocyte density, to both mechanical and hypoxic
effects. A recent review by Robertson76 summarizes epithelial
thickness and size changes with various materials as a function
of wear modality and the author suggests partial dependence
on oxygen transmission for thinning associated with overnight
hydrogel wear, but a mechanical cause for that seen with first-
generation SiHy lenses. p
Descemet’s membrane is the basal lamina of the endothe-
lium and forms a scaffold over which endothelial cells may
spread to maintain continuity following cell loss or injury. Epithelium Many different effects of CL wear on the corneal epithelium
have been reported. The epithelial cells of the cornea secrete a
range of active soluble molecules into the tear film. This is
discussed more fully in the subcommittee report on the CL
interactions with the tear film. Morphological Changes. CL wear has a number of effects
on corneal morphology and ultrastructure, including epithelial
thinning and increased cell size.76–78 Using specular micros-
copy, Mathers and colleagues79 reported that extended wear
(EW) soft contact lenses (SCL) and daily wear (DW) rigid lenses
resulted in larger epithelial cells than controls, whereas the
epithelial cells of DW SCL subjects were not different from
controls. Similarly, other studies show that while mean cell
area is not affected by DW, lenses worn on an EW modality
induce a gradual increase in cell area.80–84 The transparent stroma is one of the most highly organized
tissues of the body, composed of collagen fibrils arranged as
flat lamellae, lying within a matrix of proteoglycans. The
lamellae show greater interweave anteriorly, where a propor-
tion are inserted into Bowman’s layer.62,63 The narrow and
highly uniform width and spacing of the fibrils within the
lamellae is the basis of stromal transparency.64 Peripherally, as
the lamellae pass through the limbus to combine with the
sclera, this order is lost and the marked variation in fibril
diameter and spacing results in the opacity of the sclera. Sandwiched between the lamellae are the keratocytes, which
form an interconnecting network coupled by gap junc-
tions.65,66 These cells are responsible for production and
maintenance of the stromal collagen and the proteoglycans,
which maintain spacing between the collagen fibrils. Kerato-
cytes, transforming to myofibroblasts, are also the source of the
fibrotic response to corneal stromal injury,67,68 which can lead
to permanent scarring. IOVS j October 2013 j Vol. 54 j No. 11 j TFOS100 IOVS j October 2013 j Vol. 54 j No. 11 j TFOS100 In humans, mature corneal endothelial cells do not divide
significantly and their density decreases with age,74 and cells
spread and enlarge to maintain a functional monolayer. Excessive cell loss due to injury can disturb the functional
integrity of the endothelium, leading to corneal decompensa-
tion, stromal swelling, and loss of transparency.75 cells express a glycocalyx composed chiefly of transmembrane
mucins,30 which confers wettability to the corneal surface.57 A
similar arrangement occurs in the conjunctiva. The glycocalyx,
together with the tight junctions, creates a relatively impervi-
ous barrier to the passage of small, water-soluble molecules,
such as the dyes used in clinical practice to stain the cornea
(e.g., fluorescein and lissamine green).58,59 This is the basis for
the very limited degree of punctate staining of the cornea and
conjunctiva seen in the normal eye. The nutrition of the cornea relies almost entirely on
materials supplied by the aqueous humor. The oxygen supply
is provided by the tear film for the anterior cornea and from the
anterior chamber for the posterior cornea. Carbon dioxide, the
product of cellular metabolism, is readily lost to the
atmosphere. j
y
Deeper cells are highly interdigitated and connected by
desmosomes. The deepest layer consists of columnar, basal
cells, which are approximately 10 lm in diameter. The
intercellular space, narrow in the normal epithelium, is
expanded in the presence of epithelial edema and the
separation of these regularly arranged cells, acting as a
diffraction grating, is responsible for the ‘‘rainbows around
lights’’ reported in the presence of early epithelial edema.60
Specialized adhesion complexes, consisting of hemidesmo-
somes, anchoring fibrils, and anchoring plaques attach these
cells firmly to the underlying anterior limiting layer, which is
composed of fine, tightly woven collagen fibrils.61 These form
a smooth, rigid base for the epithelium. Corneal Structure and Function The cornea is the transparent, anterior, avascular part of the
corneoscleral envelope, separated from the sclera by the
limbus. It has a rich sensory nerve supply from the trigeminal
nerve,55,56 details of which are discussed in the subcommittee
report on the neurobiology of discomfort and pain. The cornea is covered by a stratified squamous, nonkera-
tinized epithelium whose surface cells are connected by tight
junctions that seal the intercellular space. These cells exhibit
microplicae, which increase the surface area and facilitate
interactions with the tear film. The apical membranes of these Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/2017 CL Interactions With the Ocular Surface and Adnexa IOVS j October 2013 j Vol. 54 j No. 11 j TFOS100 CL Interactions With the Ocular Surface and Adnexa ‘‘Corneal staining’’ is a general term that
refers usually, to the punctate uptake of a dye, such as
fluorescein, rose Bengal, or lissamine green, into the corneal
epithelium.115 Corneal staining is an ubiquitous feature of CL wear;
however, it is important to note that it is also frequently
observed in non–lens wearers.116,117 The frequency of corneal
staining of any severity in a population of CL wearers may be as
high as 60%,116 but often staining is of a low level and generally
clinically insignificant. Brautaset and colleagues118 reported an
incidence of 19.5% corneal staining among 338 adapted
hydrogel lens wearers, with no subjects displaying staining
greater than grade 2 (on a 0–4 scale). To date, no direct correlation between any of these
morphological changes with CLD has been reported. Epithelial Homeostasis. Studies have shown that the
normal process of sloughing of corneal epithelial cells is
impeded by CL wear. This occurs with all lens types and wear
modalities and tends to recover over time, suggesting that an
adaptation to lens wear occurs.87,98,99 Normal exfoliation is an
apoptotic process driven by factors such as eyelid shear forces
and centripetal pressure and involves loss of superficial cell
expression of the antiapoptotic protein Bcl-2 prior to
sloughing. Yamamoto and colleagues100 observed a reduction
in the total number of Bcl-2–negative and TUNEL- (marker for
apoptosis) staining cells, suggesting that rigid lens wear blocks
necessary changes in Bcl-2 expression that must occur before
exfoliation is possible. Lens-induced effects on desquamation
do not appear to be related to lens Dk/t.77,101 Corneal staining can be caused by a number of factors,
which can be grouped into various categories, including
mechanical, inflammatory, exposure, metabolic, toxic, allergic,
and infectious. Sources of mechanical staining include lens
defects, poor lens quality (e.g., rough edge),119 lens binding
(which may occur with overnight EW rigid lenses),120
excessive lens bearing due to poor fit, foreign bodies beneath
the lens, or abrasion occurring during lens insertion or
removal. More than a decade of studies indicate that lens wear
inhibits basal epithelial cell proliferation in the central cornea,
causes delay in vertical migration as cells move toward the
surface, and reduces apoptotic desquamation of superficial
cells. As normal corneal epithelial homeostasis helps maintain
a smooth surface for refraction of light and barrier function,
compromise to this process could contribute to ocular surface
changes that lead to CLD. However, to date, no direct
correlation has been demonstrated. CL Interactions With the Ocular Surface and Adnexa In SCL wearers, exposure keratitis manifests typically as a
band of inferior arcuate staining.121,122 This is due to epithelial
disruption as a result of drying of the corneal surface121–123 and
is often associated with incomplete blinking. Desiccation
staining with SCL can be categorized as a form of exposure
keratitis.124,125 This condition appears as a central punctate
stain and most often occurs when high water content lenses
are made too thin, causing water to be drawn out of the cornea
when the lens dehydrates.126 The classic pattern of 3 and 9
o’clock staining in rigid lens wearers is also primarily thought
to represent a form of exposure keratitis, whereby the eyelids
are bridged away from the corneal surface at the lens edge at
the 3 and 9 o’clock corneal locations.127 Barrier Function. The corneal epithelium forms a
formidable barrier to the external environment and disruption
of the barrier may result in edema and permit entry of
microbes. Thus, compromise of the barrier by CL wear is an
important issue. Although an early study by Boets and
colleagues102 did not show any difference in corneal epithelial
permeability in CL wear using a peroxide or biguanide care
solution, hypoxia associated with lens wear has been
implicated in reducing corneal barrier function. All CLs are known to induce various levels of epithelial
hypoxia and hypercapnia,128 resulting in the production of
various metabolites (e.g., lactic and carbonic acid). Evidence
that such changes can adversely affect comfort is lacking. p
g
Clinical studies using fluorometry to quantify fluorescein
penetration from the tear film to the stroma, indicate that
hypoxia and also tear stagnation play a significant role in
reducing epithelial barrier function with various modalities of
lens wear.103–107 However, other factors are also involved. Two
studies using SiHy lenses, which eliminate concerns associated
with hypoxia, confirm this. Lin and colleagues108 demonstrat-
ed changes in epithelial permeability under a 30-day continu-
ous wear modality. Notably, Asian eyes appeared to be more
susceptible to permeability changes than non-Asian eyes. Duench and colleagues109 demonstrated an increase in
epithelial permeability with DW of a SiHy lens, which they In a case-control study of 413 CL wearers, Nichols and
Sinnott129 examined a variety of lens- and subject-related
factors, to determine their potential association with sodium
fluorescein corneal staining. CL Interactions With the Ocular Surface and Adnexa CL Interactions With the Ocular Surface and Adnexa Alonso-Caneiro and colleagues92 recently reported on the
use of optical coherence tomography to assess the effects of 6
hours of SCL wear on morphology. Subtle, but significant,
changes were observed and these were most apparent at the
limbus, presumably due to greater pressure in this area. Epithelial thinning of 2.84 6 0.84 lm was observed for the
cornea versus 5.47 6 1.71 lm for the limbus, with the SiHy
lens causing the least surface changes. proposed was due to mechanical effects from the stiffer SiHy
material. They were also able to show increases associated
with the use of solutions. No direct link between CLD and
epithelial permeability has been shown. Corneal Erosions. CL wear has been associated with
corneal erosions, in which a full-thickness detachment of
epithelium in a localized, well-circumscribed area of the cornea
occurs.110–112 As reviewed by Markoulli and colleagues,111
several mechanisms may be involved, including lens adhesion,
mechanical damage from exacerbated thinning due to lens
dehydration, bacterial proteases, and reduced epithelial density
leading to reduced hemidesmosomes. Hypoxia-related de-
creased carbon dioxide efflux and epithelial cell acidification
may contribute to altered cell appearance and metabolism
during wearing of lenses with low Dk/t.113,114 This complica-
tion is typically symptomatic, especially following lens
removal. g
g
A scanning electron microscopic study on samples of
epithelium harvested prior to photorefractive keratectomy
showed that there was no difference in the number of surface
microvilli among CL wearers and non–lens wearers, but that
epithelial mucin was reduced in the lens-wearing group.93
Morphological studies in orthokeratology models have re-
vealed an expected central epithelial thinning and peripheral
thickening for myopic correction, and the reverse for
hyperopic corrections.94–97 Nieto-Bona and colleagues97 used
LSCM to study epithelial morphological changes induced by 1
month use of orthokeratology lenses. Basal epithelial cell
density was reduced and wing and superficial cells showed
enhanced visibility. Superficial cells also were increased in
height and width. Corneal Staining. Epithelium Contiguous cells are joined by macula occludens junctions,
which form a more leaky barrier than that found in the
epithelium. They permit the movement of water and nutrients
from the aqueous humor into the cornea. The energy-
dependent activity of the corneal endothelium, driving Naþ/
Kþ-activated ion pumps, and the movement of sodium (Naþ)
and bicarbonate (HCO3) ions out of the cornea, leads to a
steady, osmotically driven, outward movement of water into
the anterior chamber.69 This generates a negative hydrostatic
pressure within the stroma, reduces its water content (corneal
deturgescence), and preserves the regular order of the collagen
fibrils necessary for its transparency. This negative pressure,
transmitted to the intercellular spaces of the epithelium,
ensures that it is normally edema-free. When endothelial function fails and the hydrostatic
pressure in the stroma becomes less negative, the stroma
swells, fibril order is lost, and the cornea thickens and becomes
progressively less transparent. Stromal swelling is more limited
anteriorly where the lamellar interweave is greatest.70,71 In the
presence of a normal ocular pressure, when the hydrostatic
pressure becomes positive, epithelial corneal edema also
occurs72,73 and there is a further and more marked loss of
transparency, due to irregular, surface astigmatism. Epithelial,
and to some extent stromal edema, may also result from
breaches in the corneal epithelium. Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/2017 Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/201 IOVS j October 2013 j Vol. 54 j No. 11 j TFOS101 CL Interactions With the Ocular Surface and Adnexa Several factors were shown to be
related to increased corneal staining, including increased daily
wearing times (P ¼ 0.0006), lower income (P ¼ 0.0008),
lissamine green conjunctival staining (P ¼ 0.002), CL deposi-
tion (P ¼ 0.007), increased tear meniscus height (P ¼ 0.007),
and decreased hydrogel nominal water content (P ¼ 0.02). The
wearing of SiHy lenses (as opposed to hydrogel lenses) was
protective against corneal staining (P ¼ 0.0004). Notably, these Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/2017 CL Interactions With the Ocular Surface and Adnexa IOVS j October 2013 j Vol. 54 j No. 11 j TFOS102 have studied whether any change in keratocyte density is
related to CLD. authors reported that neither CL care solutions nor disinfec-
tants were associated with increased corneal staining. Stromal Opacities. Apparently benign posterior stromal
opacities or white dots have been reported in the corneas of
CL wearers.137,147–150 These stromal opacities seen using slit
lamp biomicroscopy may be related to the stromal microdots
seen using LSCM. The microdots have a size of 1 to 4 lm.151,152
The initial contention that the appearance of the microdots
was associated only with CL wear has been tempered by the
finding that these can also be seen in the corneas of non–lens
wearers, albeit to a lesser extent.137 The pathology and
etiology of these formations is unknown. Although Brooks
and colleagues148 and Hsu and colleagues153 noted that the
development of deep stromal opacities was associated with
ocular discomfort and photophobia, none of the other reports
of deep stromal opacification or stromal microdots have
reported any associated discomfort. Stromal Opacities. Apparently benign posterior stromal
opacities or white dots have been reported in the corneas of
CL wearers.137,147–150 These stromal opacities seen using slit
lamp biomicroscopy may be related to the stromal microdots
seen using LSCM. The microdots have a size of 1 to 4 lm.151,152
The initial contention that the appearance of the microdots
was associated only with CL wear has been tempered by the
finding that these can also be seen in the corneas of non–lens
wearers, albeit to a lesser extent.137 The pathology and
etiology of these formations is unknown. Although Brooks
and colleagues148 and Hsu and colleagues153 noted that the
development of deep stromal opacities was associated with
ocular discomfort and photophobia, none of the other reports
of deep stromal opacification or stromal microdots have
reported any associated discomfort. Stroma Keratocyte Density. Using LSCM, various authors have
reported the normal keratocyte density in the anterior stroma
to be approximately 993 cells/mm2, or 29,917 cells/mm3,
decreasing toward the posterior stroma to approximately 621
cells/mm2, or 18,733 cells/mm3, an approximate 60% decrease
in cells per area or volume.137 Also, keratocytes in the
posterior stroma are less densely packed and overall their
nuclei appear to be slightly larger and flatter than those in the
anterior stroma.137 Keratocyte density does not differ between
males and females or between right and left eyes of a
subject.138 There is a decline in the density of keratocytes
throughout the stroma with age,138,139 as well as an increase in
the spacing of collagen fibers throughout life (by approximate-
ly 14% by age 90 years).140 The stroma also contains nerve
fibers and microdots, which are small highly reflective dots
found throughout this tissue layer. The composition of these
microdots is unknown, but it has been hypothesized that they
represent dysgenic or apoptotic cellular remnants lying
dormant in the stroma.137 While infiltration of the cornea during overt adverse
responses is associated with ocular symptoms, they may also
be present in asymptomatic patients, indicating that there is
not a straightforward relationship between low levels of
corneal infiltration and comfort during CL wear. Stromal Neovascularization. Wear of low Dk/t CLs may
be associated with the ingrowth of blood vessels into the
normally transparent cornea.158 This process of neovascular-
ization is generally categorized as superficial or deep stromal. CL-induced neovascularization is asymptomatic and thus not
related to CLD. CL Interactions With the Ocular Surface and Adnexa Relatively little information is available relating corneal
staining to discomfort. A paradox of the corneal staining
response is that there appears to be no clear relationship
between the severity of staining and the degree of ocular
discomfort. For example, an exposure keratitis in the form of
an extensive inferior arcuate diffuse staining pattern can be
virtually asymptomatic, whereas a small tracking stain caused
by a foreign body trapped beneath a rigid lens can be
excruciatingly painful. Studies examining corneal staining associated with the
combination of various CL materials and solutions have
produced equivocal results, with some studies showing no
correlation between CLD and staining130–132 and others
indicating that increased staining is associated with a reduction
in lens comfort.133–135 A recent study, comparing dryness and
corneal staining in a group of Asian and non-Asian wearers,136
demonstrated that the Asian subjects exhibited a greater
amount of staining and reported a higher level of CLD. Among
Asians, CLD and staining were not related, whereas they were
among non-Asians. Stromal Infiltrates. CL wear may result in recruitment of
cells into the cornea. These cells or ‘‘infiltrates’’ are presumed
to be polymorphonuclear leukocytes (neutrophils) from the
limbal vasculature, and this has been confirmed from corneal
biopsies of CL wearers, with the adverse event named CL
peripheral ulcer.154 While a review of adverse events with CL
wear is beyond the scope of this article, infiltrates of the
cornea can occur without symptoms and may occur even in
the absence of lens wear.155 The rate of asymptomatic
infiltrates in the cornea of CL wearers appears to be influenced
by wearing different combinations of SiHy lenses and
multipurpose disinfecting solutions,156 although these results
are equivocal.157 Despite many publications examining corneal staining
associated with CL wear, overall, there appears to be, at best,
a weak link between CLD and corneal staining and it is not a
major factor for most CL wearers. Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/2017 Limbus Endothelial Polymegethism. Polymegethism describes
changes in endothelial cell size that occur such that the
endothelial cells have a greater variation in cell size than
normal, and is closely related to chronic hypoxia.172,173
Increases in corneal endothelial polymegethism are asso-
ciated
with
the
wear
of
polymethyl
methacrylate
(PMMA),144,164–167,174–178 rigid gas permeable,144,171,179,180
and conventional hydrogel88,166,169,171,177,178,181–185 lenses. However, SiHy168,186 and silicone elastomer187 lenses do not
induce significant levels of polymegethism. It is likely that the
etiology of endothelial polymegethism is the same as that for
endothelial blebs, in which lens-induced hypoxia and hyper-
capnia causes an acidic shift at the endothelium,162 resulting in
altered cell morphology. Thus, endothelial polymegethism
represents a chronic response and endothelial blebs represent
an acute response to the same stimuli. Limbal Structure. The limbus is a ring of tissue
approximately 1.5 mm wide that marks the transition between
the clear cornea and the sclera.191 The epithelium thickens on
passing from the cornea to limbus and the number of cell layers
increases to approximately 10192,193 and become arranged into a
parallel series of radially disposed bars, separated by a vascular
connective tissue.194 These are the palisades of Vogt.195
Visibility of the palisades at the slit-lamp is greatly enhanced in
pigmented eyes, where the epithelial bars are outlined by
pigmented basal cells. The vessels of the palisades arise from an
episcleral vascular ‘‘circle,’’ which also gives rise to the anterior
conjunctival arteries and to the subepithelial marginal arcades of
the cornea.196,197 The latter vessels form a series of vascular
loops that surround the corneal periphery, their central tips
providing a useful surface landmark for the periphery of
Bowman’s layer. They can be the source of superficial new
vessels, arising as a pathological response to CL wear or to
corneal injury, inflammation, or infection. The morphological changes that constitute polymegethism
have been explained by Bergmanson,188 who conducted an
ultrastructural study of the corneas of six long-term CL
wearers. In normal circumstances, the lateral cell walls are
extremely interdigitated. Bergmanson188 noted that CL wear
causes the cell walls to reorient so that, rather than remaining
normal to the endothelial surface, they straighten out and align
obliquely. The interpretation of this observation in terms of the
three-dimensional structure of the endothelium is that endo-
thelial cells have changed shape but the volume of each cell
remains constant. Endothelium The etiology of endothelial blebs has been explained by
Holden and colleagues.162 These authors attempted to induce Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/201 IOVS j October 2013 j Vol. 54 j No. 11 j TFOS103 CL Interactions With the Ocular Surface and Adnexa blebs using a variety of stimulus conditions, and concluded
that one physiological factor common to all successful
attempts to form blebs was a local acidic pH change at the
endothelium. Two separate factors induce an acidic shift in the
cornea during CL wear128: an increase in carbonic acid due to
retardation of carbon dioxide efflux and increased levels of
lactic acid as a result of lens-induced hypoxia and the
consequent increase in anaerobic metabolism. When silicone
elastomer lenses are worn, such metabolic changes do not take
place because of their extremely high Dk/t. The time course of
the appearance of blebs following lens insertion, and
resolution following lens removal, is consistent with the time
course of corneal pH change.163 appearance, containing normal organelles. This raises the
possibility that, rather than representing an adverse effect,
endothelial polymegethism is a nonproblematic adaptation to
chronic metabolic stress induced by CLs. Sweeney177 has drawn an anecdotal association between
endothelial polymegethism and a condition that she termed
‘‘corneal exhaustion syndrome.’’ This is a condition in which
patients who have worn hydrogel CLs for many years suddenly
develop a severe intolerance to lens wear, characterized by
CLD, reduced vision, photophobia, and an excessive edema
response. These patients also displayed a distorted endothelial
mosaic and moderate to severe polymegethism. Although the
link between endothelial polymegethism and corneal exhaus-
tion syndrome is not proven, it does appear that certain
wearers can develop an intolerance of lenses over time as a
response to chronic and severe lens-induced hypoxia. Howev-
er, this is unlikely with modern CL materials and the link
between hypoxia and CLD remains tenuous. Endothelial Cell Density. Numerous studies have dem-
onstrated a decrease in corneal endothelial cell density in the
central corneas of rigid164–167 and soft166,168–170 lens wearers. One possible explanation for the apparent CL-induced
endothelial cell loss has been provided by Wiffen and
colleagues,171 who compared central and peripheral corneal
endothelial cell densities in non–lens wearing subjects and
long-term CL wearers. Endothelium Central cell density (2723 6 366 cells/
mm2) was found to be significantly higher than peripheral cell
density (2646 6 394 cells/mm2) for the non–lens wearing
group, but not for the CL-wearing group (2855 6 428 cells/
mm2 central; 2844 6 494 cells/mm2 peripheral). Based on
their results, Wiffen and colleagues171 suggested that CL wear
causes a mild redistribution of endothelial cells from the
central to the peripheral cornea. Thus, while there is no actual
endothelial cell loss, there is a reduction in endothelial cell
density in the central region of the cornea, which is
counterbalanced by a commensurate increase in cell density
in the corneal mid-periphery. The overall endothelial cell
population of the cornea is therefore likely to be unaffected by
CL wear and no reports exist of a correlation in cell density
with CLD. Endothelial Permeability. There is disagreement in the
literature as to whether CL wear alters endothelial permeabil-
ity. Dutt and colleagues189 reported a significant increase in
mean endothelial permeability, measured using corneal fluo-
rophotometry, among CL wearers, indicating a defect in their
endothelial barrier function. A significant increase in the mean
endothelial pump rate was also noted among CL wearers. Using similar techniques, Chang and colleagues184 reported
decreased endothelial permeability among CL wearers. In
contrast, Bourne190 reported that the relative endothelial
pump rate of 20 long-term CL wearers did not differ
significantly from that of control subjects. Despite these many alterations to the endothelium, to date
there have been no reports of CLD associated with nonsevere
endothelial cell changes. Endothelium Endothelial Blebs. A phenomenon referred to as ‘‘endo-
thelial blebs’’ can be observed in the endothelium of CL
wearers.159 The appearance is of black, nonreflecting areas in
the endothelial mosaic that correspond with the position of
individual cells or groups of cells. Inagaki and colleagues160
compared the time course of endothelial bleb formation and
disappearance between lenses of varying Dk/t in 20 subjects. Lenses of higher Dk/t induced the lowest bleb response and no
difference was observed between rigid and soft lenses of
similar Dk/t values. CL wear has an effect on keratocytes. Several studies have
demonstrated an apparent loss of keratocyte density of
approximately 18% to 30% in the anterior stroma and 7% to
18% in the posterior stroma, when wearing various lens types
on either DW or EW schedules.91,141–143 The decrease in
density was maintained when accounting for possible ede-
ma.141 However, not all studies have found this decrease.89,144
When a reduction has been noted, the density change was not
affected by the Dk/t of the lens material.141,145 In a study
examining the differences between no lens wear, SiHy lens
wear, and high Dk/t rigid lens wear, Kallinikos and col-
leagues146 found some reduction in keratocyte density in the
anterior stroma with rigid lens wear, and in the posterior
stroma with SiHy lenses compared with no lens wear.146 These
authors suggested that this was due to the physical presence of
the lens and perhaps mechanical stimulation of the release of
epidermal growth factor and IL-8 from corneal epithelial cells. Loss of keratocytes may be more profound for SCL wearers
compared with rigid gas permeable wearers.145 No reports Histological studies of this response were conducted by
Vannas and colleagues.161 The ‘‘blebbed’’ endothelium dis-
played edema of the nuclear area of cells, intracellular fluid
vacuoles, and fluid spaces between cells. Thus, endothelial
blebs appear to be the result of a local edema phenomenon,
whereby the posterior surface of the endothelial cell bulges
toward the aqueous. The endothelial cell bulges in this
direction because this represents the path of least resistance,
as Descemet’s membrane provides much greater resistance to
cell swelling than the aqueous humor. Light from the blebbed
cell is reflected away from the observer, which explains why
they appear dark or absent. Corneal Edema While one study showed an improvement in comfort during
lens wear after refitting with high Dk/t SiHy lenses and a
corresponding decrease in limbal redness,212 another study
demonstrated a similar improvement in comfort (but not
limbal redness) even after refitting high Dk/t lens wearers into
low Dk/t daily disposable hydrogel lenses.214 The type of SiHy
lens worn makes a difference to comfort, even though there
may be no difference in clinical scores of limbal redness,215
and while wearing a low Dk/t lens on a daily disposable basis
resulted in increased limbal redness compared with wearing
high Dk/t lenses on the same schedule, there was no
relationship to comfort,205 suggesting that factors other than
oxygen permeability (and, thus, limbal redness) are more
important in the factors that drive the comfort response. The amount of edema is related primarily to the extent of
corneal hypoxia that is induced by the lens. With low Dk/t
hydrogel and rigid lenses, daytime central corneal edema
typically varies between 1% and 6%,242 and the level of
overnight central edema measured on awakening generally falls
in the range 10% to 15%.243 SiHy lenses induce less than 3%
overnight central corneal edema,244 which is similar to the level
of overnight edema without lenses. While corneal swelling represents both a chronic and acute
response to hypoxia, epithelial microcysts are considered to be
an important indicator of chronic metabolic stress in the corneal
epithelium in response to wearing low Dk/t lenses. Bergman-
son245 postulated that microcysts represent an extracellular
accumulation of broken down cellular material trapped in the
basal epithelial layers. In a process similar to that which occurs
in Cogan’s microcystic dystrophy,246 the epithelial basement
membrane reduplicates and folds, forming intraepithelial sheets
that eventually detach from the basement membrane and
encapsulate the cellular debris. There is no proven association
of epithelial microcysts with CLD. Limbal Stem Cell Deficiency. Corneal Edema All CLs induce some level of edema, including silicone elastomer
lenses, which have extremely high Dk/t values.232 CLs restrict
corneal oxygen availability,128,233,234 creating a hypoxic envi-
ronment at the anterior corneal surface. To conserve energy, the
corneal epithelium begins to respire anaerobically. Lactate, a by-
product of anaerobic metabolism, increases in concentration
and moves posteriorly into the corneal stroma. This creates an
osmotic load that is balanced by an increased movement of
water into the stroma. The sudden influx of water cannot be
matched by the removal of water from the stroma by the
endothelial pump, resulting in corneal edema and corneal
thickening.235,236 A number of other possible mechanisms have
been suggested as playing a role in lens-induced corneal edema,
including retardation of carbon dioxide efflux (leading to tissue
acidosis),128 mechanical effects,237 temperature changes,238
hypotonicity,239 and inflammation.240 Nguyen and colleagues241
have shown that the variability in CL-induced corneal swelling is
associated with both corneal metabolic activity and endothelial
function. This suggests that individuals with larger levels of
corneal metabolic activity produce more lactic acid and thus
more swelling. g
With the advent of SiHy lenses, the number of studies
examining limbal redness increased, with studies demonstrat-
ing no difference in limbal redness during wear of high Dk/t
SiHy lenses compared with no lens wear.204 Use of low Dk/t
soft lenses on a daily disposable basis resulted in higher levels
of limbal redness than that determined when wearing two
types of high Dk/t silicone hydrogel lenses.205 During EW, low
Dk/t hydrogel lens wearers showed significantly higher levels
of limbal redness than high Dk/t SiHy lens wearers.203 Refitting
subjects from low Dk/t hydrogel lenses to high Dk/t SiHy
lenses in either DW or EW schedules results in a significant
decrease in limbal redness after just a few weeks.206–209
Refitting subjects with high Dk/t lenses also results in reduced
signs of corneal neovascularization.210–212 High Dk/t lenses do
not induce changes to limbal redness even after 3 years of
EW.213 There is little evidence that limbal redness is related to CLD. Limbus By observing only the apical surface of the
endothelium on specular reflection, it appears that a disparity
in cell size has developed, whereas, in reality, the cells have
merely become reoriented in three-dimensional space. Basal, niche-like regions of the epithelial palisades house the
stem cells of the cornea, whose division maintains the corneal
epithelium.198,199 These cells divide infrequently in the normal
cornea but give rise to daughter, transient amplifying cells,200
which migrate centripetally from the limbus to the cornea. Their further progeny migrate to the surface and undergo
apoptosis prior to shedding. Limbal Redness. The limbus can respond to CL wear by
engorging the limbal vasculature, which is usually referred to
as ‘‘limbal redness.’’ During wear of low Dk/t SCL, the number
of vessels filled with blood and the extent of filling increases,
but this does not happen during wear of PMMA lenses,201
suggesting that the response is local and not affected by
hypoxia occurring at the central cornea. Papas202 demonstrat- y
p
A further observation of Bergmanson188 is that, although
the endothelium of CL wearers showed some inter- and intra-
cellular edema, the cells were otherwise of a healthy Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/2017 Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/201 IOVS j October 2013 j Vol. 54 j No. 11 j TFOS104 CL Interactions With the Ocular Surface and Adnexa reversal of stem cell deficiency.230,231 As yet there is no evidence
for changes in limbal stem cells being related to CLD, and it
seems unlikely that this could account for the acute form of CLD
that occurs toward the end of the day, after as little as 1 day of
wear in a neophyte wearer. ed that when eyes were exposed to anoxic conditions (100%
nitrogen in goggles), the limbal vasculature responded by
increasing blood flow, resulting in increased redness. Sustained
increases in limbal redness during wear of low Dk/t lenses may
lead to growth of limbal vessels into the cornea, which is
considered to be an adverse response to lens wear. Wear of low
Dk/t soft lenses for 9 months on an EW schedule results in a
significant increase in neovascularization.203 Corneal Edema Limbal stem cells serve as
the source for corneal epithelial cells, thus stem cell deficiency
leads to an abnormal corneal surface, which exhibits fluorescein
staining and a dull irregular reflex, often accompanied by
decreased vision.216 Other complications include photophobia,
inflammation, hyperemia, recurrent or persistent epithelial
defects, conjunctivalization, scarring, and ulceration.216 Several
studies show that SCL wear may result in stem cell deficien-
cy.216–229 The condition may be focal, affecting a small area, or,
more rarely, occur as a severe, almost total stem cell loss.216,229
It has been suggested that the more severe form is the result of
additional pathology to a cell population already stressed by
years of lens wear that finally ‘‘exhausts’’ the stem cells.229 The
true cause of the stem cell deficiency remains unknown, but it
has been proposed that it may result from hypoxia and/or
mechanical friction on the limbal tissue.216,220,228 Dillehay247 argued that increasing levels of available oxygen
during CL wear lead to improved comfort. However, these
arguments were based largely on anecdotal information. No
concrete evidence exists linking oxygen availability or the level
of corneal edema during CL wear with CLD, and a recent review
supports this.248 In a retrospective study of almost 600 SCL wearers, 2.4% of
subjects were found to have focal limbal stem cell deficiency,221
with approximately one-third being symptomatic, suggesting
that the condition is more common than one would expect and
often goes undetected.216 Notably, the preponderance of
subjects were female.216,221,229 Prolonged wear (both hours
per day and numbers of years of wear) may also be a
contributing factor.216,229 At least two studies show that the
epitheliopathy resulting from this deficiency was primarily
present in the superior cornea.216,221 Rigid gas permeable and
scleral lenses do not cause limbal stem cell deficiency; indeed,
these lenses have been reported as having beneficial effects in
the management of corneal conjunctivalization and in the Shape Changes They found
greater conjunctival staining in symptomatic subjects both
with and without lens wear. These authors suggest that the
pattern of staining indicates that the CL causes changes to the
conjunctiva in areas not only confined to the lens edge, which
they attributed to evaporation due to destabilization of the tear
film by the CL.270 Shape changes may also be induced by lens ‘‘binding,’’ in
which the lens becomes immobile, which may occur with DW
and EW of rigid lenses. Based on subject reports, lens binding
occurs in 29% of DW258 and 50% of EW259 rigid lens subjects. Most other forms of lens-induced corneal shape change are
either rare or are known to be associated with specific types of
poorly designed or ill-fitting lenses.260 Corneal curvature changes in orthokeratology are deliber-
ately induced to obtain a refractive effect, and appear to result
from a combination of short-term corneal molding and a longer-
term redistribution of anterior corneal tissue.261,262 It has also
been suggested that the tear reservoir generated by the steeper
secondary curves leads to pressure changes that are responsible
for the corneal tissue redistribution.262,263 y
Various hypotheses have been postulated regarding CL-
induced conjunctival staining, including changes to lens
parameters with lens wear (Meadows DL, et al. IOVS
2009;50:ARVO E-Abstract 5652), CL modulus (Meadows DL,
et al. IOVS 2009;50:ARVO E-Abstract 5652), poor lens fit
(Meadows DL, et al. IOVS 2009;50:ARVO E-Abstract 5652),271
or poor edge design.266 Meadows and colleagues (Meadows
DL, et al. IOVS 2009;50:ARVO E-Abstract 5652) found that
changing the lens material and fit impacted the level of
conjunctival staining, whereas changing solution did not make
a difference. Ozkan and colleagues272 correlated changes to
lens parameters with conjunctival staining. They showed a
decrease in diameter with lens wear and increasing tempera-
ture, both in vivo and ex vivo, which did not correlate with
comfort or conjunctival staining.272 They were able to show
that lenses with a ‘‘knife’’ or ‘‘chisel’’ edge-form caused more
staining than a lens with a relatively ‘‘round’’ edge design. Shape Changes Videokeratographic corneal mapping techniques reveal that all
forms of CL wear are capable of inducing small, but statistically
significant, changes in corneal topography.249–252 Ruiz-Montene-
gro and colleagues249 reported the prevalence of abnormalities
in corneal shape to be 8% in a control group of non-CL wearers,
versus 75% in PMMA lens wearers, 57% in DW rigid lens
wearers, 31% in DW hydrogel lens wearers, and 23% in EW
hydrogel lens wearers. The results of studies investigating corneal shape changes
with SiHy lenses are equivocal. Various authors failed to observe Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/2017 Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/201 IOVS j October 2013 j Vol. 54 j No. 11 j TFOS105 CL Interactions With the Ocular Surface and Adnexa corneal curvature changes in subjects wearing low-253–255 and
high-modulus253,254 SiHy lenses, during observation periods
ranging from 1 to 18 months. However, Dumbleton and
colleagues256 observed a small degree of central corneal
flattening in both major meridians of 0.35 diopters (D) in
subjects wearing high-modulus SiHy lenses over a 9-month
period. Gonzalez-Meijome and colleagues250 noted a similar
phenomenon in SiHy lens wearers over a 12-month wearing
period. Maldonado-Codina and colleagues257 noted that, over a
12-month period of continuous wear, corneal curvature of
subjects wearing high-Dk/t rigid lenses became flatter by 0.13
mm, compared with 0.04 mm for subjects wearing high-Dk/t
SiHy lenses (P ¼ 0.0003). The refractive findings in subjects
wearing these lenses mirrored the corneal curvature changes. often observed approximately 2 mm from the limbus, coinciding
with the SCL edge.266 This is thought to be due to CL movement
or changes in tear film characteristics at the lens edge.267 Several studies have shown greater conjunctival staining
with CL wear compared with no CL wear. Lakkis and
colleagues268 showed a significantly higher level of conjunc-
tival staining in hydrogel wear compared to non–lens wearers,
and found this to correlate with dryness and itchiness. Maldonado-Codina and colleagues267 showed greater conjunc-
tival staining with two SiHy lenses compared with no lens wear
or hydrogel lens wear. In a retrospective analysis of 338
experienced lens wearers, Brautaset118 found conjunctival
staining in one-third of subjects. Morgan and colleagues269
found significantly greater conjunctival staining in a group of
35 neophytes fitted with SiHy daily disposable lenses
compared with non–lens wearers, and this was the only
clinical parameter measured to change significantly with lens
wear. Guillon and Maissa270 assessed conjunctival staining and
comfort in CL wearers using lissamine green. Shape Changes However, no significant difference in comfort was found
between edge types after 1 week of wear and there was no
correlation between conjunctival staining and comfort, or
conjunctival staining and bulbar or limbal redness.272 This is in
agreement with Maissa and colleagues,266 who showed that
conjunctival staining is most severe nasally and least severe
superiorly, a factor they attribute to the flatter conjunctival
topography in the nasal quadrant. To date, there are no reports linking CL-induced corneal
shape change to CLD. Temperature Change Purslow and colleagues264 used a noncontact infrared camera to
record the ocular surface temperature (OST) in subjects wearing
hydrogel and SiHy CLs on a DW and EW basis. They found that
OST immediately following CL wear was significantly greater
compared to non–lens wearers (37.1 6 1.78C vs. 35.0 6 1.18C;
P < 0.005). Lens surface temperature was highly correlated to,
but lower than, OST (by 0.62 6 0.38C). There was no
difference with modality of wear, but significant differences
were found between the hydrogel and SiHy lens materials (35.3
6 1.18C vs. 37.5 6 1.58C; P < 0.0005). The authors concluded
that OST is greater with hydrogel and greater still with SiHy CLs
in situ, regardless of modality of wear, and concluded that the
effect is likely due to the thermal transmission properties of the
CL material. Whereas Purslow and colleagues264 assessed OST immedi-
ately following CL wear, Ooi and colleagues265 developed a two-
dimensional simulation of heat propagation in the human eye
using finite element analysis to estimate OST during CL wear. In
contrast to Purslow and colleagues,264 they calculated that the
corneal surface temperature during CL wear decreased by an
average of 0.52 6 0.058C compared with a bare cornea, for all
lens types. The authors suggested that an increase in
evaporation rate when a CL is worn increases the cooling effect
on the ocular surface, resulting in a lower corneal surface
temperature during lens wear. Neither of the above groups who
examined OST changes with CL wear examined any link to CLD. In rigid CL wearers, 3 and 9 o’clock corneal staining is
visualized with the instillation of fluorescein, and is often
accompanied by bulbar and limbal hyperemia and conjunctival
staining. Greater inferior conjunctival staining in rigid CL
wearers has been reported in a retrospective study by
Swarbrick and Holden.120 Van der Worp and colleagues273
showed that eyes with conjunctival staining demonstrated
more corneal staining, compared with those with no conjunc-
tival staining. Symptoms were more frequently reported in
those with conjunctival staining, compared with those
without.273 Conjunctival Flaps. The incorporation of silicone compo-
nents into SCL materials, which increases the lens Dk/t, results
in materials with higher modulus values.274 As a result,
mechanical complications with SiHy materials are greater than
those encountered with lower modulus hydrogel materi-
als.110,112,275 One of these complications has been termed
‘‘conjunctival flaps.’’112,276–280 These have been described as Bulbar Conjunctiva Conjunctival Staining. Dyes that have been used to assess
conjunctival staining include sodium fluorescein, rose Bengal,
and lissamine green. In SCL wearers, conjunctival staining is Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/2017 IOVS j October 2013 j Vol. 54 j No. 11 j TFOS106 CL Interactions With the Ocular Surface and Adnexa ‘‘irregular free ends of the conjunctival tissue which move with
blinking or other digital manipulation.’’278 SCLs.267 Both subjective and objective assessment of bulbar
conjunctival vasculature did not show a significant progres-
sive change with SCL wear over a 10-month period.286 A
significant difference was found in the rigid wearers in the
temporal bulbar conjunctiva after 4 months of wear, a factor
that was attributed to adaptation to rigid lens wear.286
Cheung and colleagues287 hypothesized that CL use causes
damage to the conjunctival microvasculature by direct vaso-
occlusion, due to damage to the conjunctival vessels or to the
conjunctiva itself. These investigators compared the abnor-
malities in the conjunctival microvasculature of CL wearers
with at least 2 years of experience with non-CL wearers. They
found significantly higher abnormalities in CL users as
opposed to non-CL wearers, and reported increased vessel
diameter and changes to vessel contour in the region of the
CL edge.287 g
g
p
Conjunctival flaps are typically found 1.5 mm from the limbus
in CL wearers and have been reported to resolve with lens
discontinuation (Markoulli M, et al. IOVS 2007;43:ARVO E-Abstract
5391). Graham and colleagues279 found a 39% occurrence of
conjunctival flaps in EW with SiHy lenses, whereas Santodomingo
and colleagues280 reported a higher incidence with lotrafilcon A
compared with balafilcon A and more events when lenses were
worn overnight. Bergmanson and colleagues277 performed con-
junctival impression cytology (CIC) on three non-CL wearers, three
CL wearers with conjunctival flaps, and three CL wearers without
conjunctival flaps. All CL wearers were fitted with lotrafilcon A in
the 8.4-mm base curve. These authors found the samples taken
over the conjunctival flap to consist of multilayers of epithelial
cells and goblet cells and to be devoid of inflammatory cells. In
contrast, the nonflap groups had only a single layer of epithelial
cells. Bulbar Conjunctiva The authors conclude that conjunctival flaps consist of
essentially healthy tissue that has been displaced by the CL
edge.277 A biopsy study of the conjunctival tissue in the region of
the conjunctival flap, compared with nonflap tissue in the same
eye, supports the findings of the CIC study, that indeed there is
no sign of inflammation.278 While the exact etiology of
conjunctival flaps remains unknown, one compelling hypoth-
esis put forward by Bergmanson and colleagues277 is that the
mechanical effect of the lens edge results in a ‘‘snow plough’’
effect, where the CL ‘‘shovels’’ piles of epithelial cells aside. These cells form new desmosomal junctions to each other, but
lose their connection to the underlying tissue, except to the side
that they remain adherent. Conjunctival Squamous Metaplasia. CL wear can induce
distinct changes to the conjunctiva around the limbus,
characterized by conjunctival squamous metaplasia (i.e.,
flattening of epithelial cell shape and enlarged cell diameter
with loss of goblet cells)288 and alterations to the nuclei of cells
that has been termed ‘‘snake-like chromatin’’289 (Figs. 2, 3). This was observed in all CL wearers in the first systematic and
prospective studies on conjunctival cytology in CL wearers by
Knop and Brewitt.290,291 These changes are believed to occur
as a result of mechanical friction on the epithelial cell surface,
and may be reversed by cessation of lens wear.288 Studies by Adar and colleagues292 and Sengor and col-
leagues293 confirmed that almost all CL wearers have varying
degrees of squamous metaplasia. Simon and colleagues294
investigated the correlation between severity of cytological
alterations and symptoms in wearers of SCLs and rigid gas
permeable CLs. They found that 60% of symptomatic CL
wearers had cytological alterations after 6 months of CL wear,
which increased in severity with duration of CL wear and
occurred at a higher prevalence and severity in symptomatic
compared with asymptomatic CL wearers. This supports
similar findings from Adar and colleagues,292 who observed
in a population of soft and rigid CL wearers that 60% of CL
wearers had minor complaints and that the presence of
complaints was related to a higher prevalence and severity of
cytologic changes in such subjects. The clinical impact of conjunctival flaps is currently unclear
and it is not known whether their detection requires lens wear
discontinuation until resolution. Bulbar Conjunctiva From the literature available
to date it would appear not, although flaps may be an
indication of a poor-fitting CL,277 which could require a change
of lens modulus, edge design, base curve, or wear schedule. There appears to be no correlation between CLD and
conjunctival flaps. j
Lid Parallel Conjunctival Folds. Lid parallel conjunctival
folds (LIPCOFs) are subclinical parallel folds of the lower
bulbar conjunctiva, parallel to the lower lid margin and have
been found to be present in dry eye, but are not age-related.281
Pult and colleagues282 showed that lid wiper epitheliopathy
(LWE) and LIPCOF correlated with dryness in CL wearers, but
other clinical factors, such as corneal staining, bulbar redness,
or tear break-up time, did not correlate. The authors suggest
that this could be due to a similar etiology of friction. The
correlation among LIPCOF, reduced tear film stability, and LWE
could be suggestive of a mechanical etiology.282 LWE also
correlated positively with bulbar redness, suggesting that
irritation from lens fit or other factors may be related to their
development.282 These two studies support a potential causative link
between cytological alterations in CL wear and CLD. In
asymptomatic subjects, none of the rigid gas permeable
wearers and one-third of the SCL wearers had abnormal CIC
samples, possibly due to differences in fit between these lens
types. In a prospective study,288 it was observed that
conjunctival squamous metaplasia was evident after only 2
weeks of CL wear. The extent of alterations appeared to reach
a plateau within 6 months of CL wear, as later confirmed by
another study,294 although a longer study time would be
necessary to verify this. After CL wear ceased, the cytological
conjunctival changes proved to be reversible, although this
took much longer (up to 2 years) than their induction in the
first case.288 This finding obviously argues against a strong
association with CLD, as CLD is rapidly relieved by removal of
the lens from the eye. p
Conjunctivochalasis. Conjunctivochalasis has been de-
fined as the redundant, loose, nonedematous conjunctival
tissue found at the lower eyelid, typically in older people. Because of its location at the position of the tear prism, it is
thought that the presence of conjunctivochalasis can disturb
the distribution of the tear film. Bulbar Conjunctiva Increased bulbar hyperemia has been report-
ed in asymptomatic CL wear, in wearers of both rigid and Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/2017 Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/201 IOVS j October 2013 j Vol. 54 j No. 11 j TFOS107 CL Interactions With the Ocular Surface and Adnexa FIGURE 2. Conjunctival epithelial changes (squamous metaplasia) in CL wearers. After start of CL wear, a rapid change of the normal small cuboidal
cell shape ([A] nucleo/cytoplasmic [n/c] ratio of approximately 1:1) into flat cells with enlarged diameter ([B] n/c ratio of approximately 1:5–1:8 or
more) occurs in the bulbar conjunctiva, within the excursion zone of the lens. Double arrowheads in (B) indicate folding of flattened cell margins. Light microscopy; scale bars: 10 lm. Reprinted with permission from Knop E, Brewitt H. Morphology of the conjunctival epithelium in spectacle
and contact lens wearers—a light and electron microscopic study. Contactologia. 1992;14E:108–120. Copyright 1992 Georg Thieme Verlag. FIGURE 2. Conjunctival epithelial changes (squamous metaplasia) in CL wearers. After start of CL wear, a rapid change of the normal small cuboidal
cell shape ([A] nucleo/cytoplasmic [n/c] ratio of approximately 1:1) into flat cells with enlarged diameter ([B] n/c ratio of approximately 1:5–1:8 or
more) occurs in the bulbar conjunctiva, within the excursion zone of the lens. Double arrowheads in (B) indicate folding of flattened cell margins. Light microscopy; scale bars: 10 lm. Reprinted with permission from Knop E, Brewitt H. Morphology of the conjunctival epithelium in spectacle
and contact lens wearers—a light and electron microscopic study. Contactologia. 1992;14E:108–120. Copyright 1992 Georg Thieme Verlag. This work highlighted the need for more objective and
repeatable means by which to assess GCD by CIC.298–299 dramatically within just a few millimeters.288,305 Thus, even a
small alteration in the location at which the CIC is conducted
could produce very different results, without being related to
true changes in GCD. Bulbar Conjunctiva Increased matrix metal-
loproteinase expression has been reported in the fibroblasts of
conjunctivochalasis, suggesting that this is a result of collagen
degradation.283 In support of this hypothesis, Zhang and
colleagues,284 using optical coherence tomography, found
reduced conjunctival thickness in those with conjunctivocha-
lasis and in older subjects. Mimura and colleagues285 reported
an increase in conjunctivochalasis with increasing duration of
CL wear. No reports linking CLD and conjunctivochalasis exist. y
Goblet Cell Density. Goblet cell density (GCD) is
potentially an important morphological factor in CL wear
because the mucin they secrete,30,295,296 along with lubricating
proteins,297 is conceivably important for their ability to reduce
friction on the ocular surface, which could be linked to CLD. CL-induced changes in GCD, as identified by CIC, have been
summarized by Doughty.298 This review indicated that most
published studies concluded that CL wear results in a decrease
in goblet cells in the conjunctiva, but the data are equivocal,
with several studies showing no change or indeed an increase. y
Goblet Cell Density. Goblet cell density (GCD) is
potentially an important morphological factor in CL wear
because the mucin they secrete,30,295,296 along with lubricating
proteins,297 is conceivably important for their ability to reduce
friction on the ocular surface, which could be linked to CLD. CL-induced changes in GCD, as identified by CIC, have been
summarized by Doughty.298 This review indicated that most
published studies concluded that CL wear results in a decrease
in goblet cells in the conjunctiva, but the data are equivocal,
with several studies showing no change or indeed an increase. Goblet Cell Density. Goblet cell density (GCD) is
potentially an important morphological factor in CL wear
because the mucin they secrete,30,295,296 along with lubricating
proteins,297 is conceivably important for their ability to reduce
friction on the ocular surface, which could be linked to CLD. CL-induced changes in GCD, as identified by CIC, have been
summarized by Doughty.298 This review indicated that most
published studies concluded that CL wear results in a decrease
in goblet cells in the conjunctiva, but the data are equivocal,
with several studies showing no change or indeed an increase. Hyperemia. Increased bulbar hyperemia has been report-
ed in asymptomatic CL wear, in wearers of both rigid and Hyperemia. Bulbar Conjunctiva Potential reasons for variations in GCD when assessed by
CIC have been well described.288,301,302 Variations in results
are related to a number of factors, including differences in
sampling location, methodology to collect the sample, grading
scale used to assess the collected tissue for squamous
metaplasia, and field of view used to examine the tissue
collected.288,299,300,302–304 One major issue when attempting
to differentiate changes in GCD over time relates to the fact
that in the perilimbal 12 o’clock position, which is the location
used in many studies to conduct CIC, GCD changes One other method that shows some promise for evaluating
conjunctival changes is LSCM. Efron and colleagues306
performed in vivo LSCM on the bulbar conjunctiva of 11
healthy non-CL wearers and 11 asymptomatic CL wearers. The
authors found greater conjunctival epithelial cell density in CL
wearers in all cardinal positions compared with the non–lens
wearing counterparts, but a reduced conjunctival epithelial
thickness in lens wearers. The authors attribute this thinning to FIGURE 3. Conjunctival epithelial changes in CL wearers show a peculiar rearrangement of the nuclear chromatin (‘‘snake-like chromatin’’). Light
microscopy overview (A) shows a group of such cells that are arranged similar to a fish ‘‘swarm,’’ here in a 7 to 1 o’clock direction. Increased
magnification (B) shows individual flattened cells and nuclei with different stages of snake-like chromatin. Chromatin material, detached from the
nuclear periphery, forms a central elongated structure that is first bar-shaped (nucleus ‘‘7’’ in [B]) and later undulated (nucleus ‘‘8’’ in [B]). Advanced stages develop a central segmentation (nuclei ‘‘10,’’ ‘‘11’’ in [B]) . The accumulation of chromatin in the long axis of the nucleus together
with later segmentation of the nucleus by cytoplasmic filaments that are rolled around it indicate the presence of chronic mechanical friction at the
ocular surface of lens wearers that is conceivably related to CLD. Light microscopy; scale bars: 10 lm. (A) Reprinted with permission from Knop E,
Brewitt H. Morphology of the conjunctival epithelium in spectacle and contact lens wearers—a light and electron microscopic study. Contactologia. 1992;14E:108–120. (B) Reprinted from Knop E, Reale E. Fine structure and significance of snakelike chromatin in conjunctival
epithelial cells. Invest Ophthalmol Vis Sci. 1994;35:711–719.375 FIGURE 3. Conjunctival epithelial changes in CL wearers show a peculiar rearrangement of the nuclear chromatin (‘‘snake-like chromatin’’). Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/2017 Bulbar Conjunctiva Light
microscopy overview (A) shows a group of such cells that are arranged similar to a fish ‘‘swarm,’’ here in a 7 to 1 o’clock direction. Increased
magnification (B) shows individual flattened cells and nuclei with different stages of snake-like chromatin. Chromatin material, detached from the
nuclear periphery, forms a central elongated structure that is first bar-shaped (nucleus ‘‘7’’ in [B]) and later undulated (nucleus ‘‘8’’ in [B]). Advanced stages develop a central segmentation (nuclei ‘‘10,’’ ‘‘11’’ in [B]) . The accumulation of chromatin in the long axis of the nucleus together
with later segmentation of the nucleus by cytoplasmic filaments that are rolled around it indicate the presence of chronic mechanical friction at the
ocular surface of lens wearers that is conceivably related to CLD. Light microscopy; scale bars: 10 lm. (A) Reprinted with permission from Knop E,
Brewitt H. Morphology of the conjunctival epithelium in spectacle and contact lens wearers—a light and electron microscopic study. Contactologia. 1992;14E:108–120. (B) Reprinted from Knop E, Reale E. Fine structure and significance of snakelike chromatin in conjunctival
epithelial cells. Invest Ophthalmol Vis Sci. 1994;35:711–719.375 CL Interactions With the Ocular Surface and Adnexa IOVS j October 2013 j Vol. 54 j No. 11 j TFOS108 clusters, resulting in changes in the meibomian gland
contribution to the precorneal tear film. a similar mechanism to that seen in corneal thinning in CL
wear, as a result of mechanical and metabolic effects. The
increased density was attributed to the delayed desquamation
as a result of lens wear. GCD was not found to differ between
the two groups. Several studies have reported the prevalence of MGD in CL
and non-CL wearers.320,322–324 A meta-analysis of such
studies325 revealed that the prevalence did not differ
significantly between the two groups, thus suggesting that
CL wear may not increase the risk for MGD. This could be
because many of these studies employed small sample sizes
and used a wide variety of methods to confirm MGD. To date, data linking GCD to CLD are lacking, but
potentially worthy of future evaluation, particularly around
the lid wiper region. Studies should examine the time course of
GCD, and whether this links to CLD, or if the magnitude of
GCD is linked to the severity of CLD. In contrast, Arita and colleagues326 provided direct
evidence that CL wear may affect the morphology of
meibomian glands. Bulbar Conjunctiva Morphological observation of the meibo-
mian glands revealed that the frequency of meibomian gland
loss was significantly higher in CL wearers compared with
non–lens wearers. These results strongly suggest that CL wear
is a potential cause of alteration in meibomian glands, and
may result in MGD. Meibomian Gland Orifice Changes Foaming of the lower tear meniscus, especially toward the
outer canthus, is sometimes observed in individuals with CL-
associated MGD.320,322 Korb and Henriquez320 found that
foaming on the lower lid margins was apparent in 66.2% of
symptomatic CL wearers but in only 3.7% of asymptomatic CL
wearers (P < 0.0001). Hypersecretory CL-associated MGD is
characterized by the release of a large volume of meibomian
lipid (meibum) at the lid margin (foaming) in response to
pressure on the tarsus. It remains unclear, however, whether
the increased amount of lipid is the result of true hyperse-
cretion, or the damming back of mildly obstructed secre-
tions.319 Long-standing cases of CL-associated MGD may be
linked to lid margin abnormalities, such as vascularization,
morphological irregularity of the lid margin, blockage
(plugging) of orifices, and damage to the mucocutaneous
junction.327 In severe cases, in which the meibomian gland
orifices are blocked, there is an absence of glandular
secretion. Symptomatic CL wearers in whom lid margin
abnormalities are not apparent may have a condition referred
to as ‘‘nonobvious MGD.’’328 CL wear is known to induce CL papillary conjunctivitis
(CLPC) in some wearers, which was first noted by Spring.309 It
is a papillary reaction on the upper tarsal conjunctiva
accompanied by discomfort and mucous production. The
condition has been described in detail by Allansmith and
colleagues,310–312 and has been associated with both soft and
rigid CL wear and can lead to CL intolerance and discontin-
uation of wear. The term ‘‘giant papillary conjunctivitis’’ is
more general and indicates a noninfectious inflammatory
disorder involving the superior tarsal conjunctiva with the
presence of papillae measuring 0.3 mm or larger. While subjects with overt CLPC will be symptomatic, there
have been no direct reports linking CLD with general,
nonpathological changes to the palpebral conjunctiva. However, the use of sensitive grading scales313,314 may be
useful in detecting subtle changes to the palpebral conjunc-
tiva, and may be useful in linking palpebral conjunctival
changes with CLD. In one study that examined differences in
comfort response and slit-lamp findings between two groups
of CL wearers using different multipurpose disinfecting
solutions, there was a possible effect of palpebral roughness
on the symptoms of grittiness and scratchiness during CL
wear.315 Palpebral Conjunctiva The palpebral conjunctiva plays an important role in control-
ling the interaction with the ocular surface and the CL. Slit-
lamp examination of the upper tarsal conjunctiva reveals a
pink mucous membrane with a satin-like, or a fine, uniform
papillary appearance. Allansmith307 reported that 14% of non-
CL wearers had a satin-smooth conjunctival appearance of the
upper tarsal plate, 85% had small uniform papillae, and 1% had
nonuniform papillae. Korb and colleagues308 reported that
0.6% of healthy subjects showed conjunctival papillae of more
than 0.3 mm on the upper tarsal conjunctiva. Morphological Changes of Meibomian Glands Some studies have found no relation between meibomian
gland dropout and CL wear.329,330 However, these studies
examined only the glands in the central area of the lower
eyelid, which may not necessarily reflect meibomian gland
changes across the full width of the lid margin. Arita and
colleagues331 use a noninvasive meibography system that
allows observation of the meibomian glands in both upper
and lower eyelids (Fig. 4). They found that CL wear likely
affects the morphology of meibomian glands, with the effects
being greater on meibomian glands throughout the upper
eyelid than on those in the lower eyelid.326 Partial or
complete loss of the meibomian glands in each eyelid was
significantly higher for CL wearers than for control individ-
uals. The length of the affected meibomian glands was less
than half that observed for normal glands. These patterns of
meibomian gland changes were rarely detected in non–lens
wearers, and suggest that CL wear is a potential cause of
MGD. IMPACT OF CLS ON MEIBOMIAN GLANDS The meibomian glands are large sebaceous glands that are
located in the tarsal plates of the eyelids316,317 and produce
the lipids that serve, as the outermost layer of the preocular
tear film, to retard evaporation of the aqueous phase of the
tears.318 Meibomian gland dysfunction (MGD) is a chronic,
diffuse abnormality of the meibomian glands, commonly
characterized by terminal duct obstruction and/or qualitative/
quantitative changes in the glandular secretion. This may
result in alteration of the tear film, symptoms of eye irritation,
clinically apparent inflammation, and ocular surface dis-
ease.319 There is a long-standing clinical impression that CL wear
increases the risk of MGD. Korb and Henriquez320,321
investigated the meibomian glands of individuals with a
primary complaint of CL intolerance. They described clinical
and cytological evidence indicating that the syndrome is due
to obstruction of the meibomian gland orifices by desqua-
mated epithelial cells that tend to aggregate in keratotic The results of Arita and colleagues326 also suggested that
CL wear produces different effects on the upper and lower
eyelids. Wearers of rigid lenses showed a tendency for
meibomian gland dropout in the upper eyelid, whereas
wearers of SCLs showed a tendency for shortening of the
glands in the lower eyelid. Their data suggested that lens
material does not play a key role in CL-associated MGD. Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/2017 Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/201 IOVS j October 2013 j Vol. 54 j No. 11 j TFOS109 CL Interactions With the Ocular Surface and Adnexa FIGURE 4. Representative noninvasive meibography images in a control subject (A, B) and in two CL wearers (C–F). Noninvasive meibography
views of the meibomian glands from the conjunctival side, with the lids everted. The meibomian glands appear white. (A, B) A 31-year-old female,
non-CL user. Meibomian glands in the upper (A) and lower (B) eye lids were observed. Shortening or dropout of meibomian glands was not
observed. (C, D) A 37-year-old male who had used rigid CLs for 17 years. Those regions of the upper lid where meibomian glands were absent,
appear black (drop out) (C). Shortening and distortion of meibomian glands were observed in the lower eye lid (D). (E, F) In a 32-year-old female
who had used hydrogel CLs for 13 years, most meibomian glands in both the upper and lower eyelids were shortened. meibomian gland dropout and eyelid margin inflammation in
the pathogenesis of CL-induced dry eye. meibomian gland dropout and eyelid margin inflammation in
the pathogenesis of CL-induced dry eye. Villani and colleagues332 examined morphological changes in
meibomian glands and the status of periglandular inflammation
in CL wearers by LSCM (Fig. 5) and then investigated the
relation between clinical and confocal findings. LSCM was
applied to determine the cell density of the mucocutaneous
junction epithelium, acinar unit density and diameter, glandu-
lar orifice diameter, meibum secretion reflectivity, and the
appearance of the glandular interstice and acinar wall. The
duration of CL wear was found to be correlated with acinar
unit diameter (P < 0.05). Morphological changes in the
meibomian glands revealed by LSCM were indicative of signs
of meibomian gland dropout, duct obstruction, and perigland-
ular inflammation. A comprehensive LSCM evaluation of the
ocular surface in CL wearers should better clarify the role of IMPACT OF CLS ON MEIBOMIAN GLANDS The shortening of the
meibomian glands began not at the free border of the lid (in the region of the orifices), but proximally (in the fixed border of the tarsal plate). FIGURE 4. Representative noninvasive meibography images in a control subject (A, B) and in two CL wearers (C–F). Noninvasive meibography
views of the meibomian glands from the conjunctival side, with the lids everted. The meibomian glands appear white. (A, B) A 31-year-old female,
non-CL user. Meibomian glands in the upper (A) and lower (B) eye lids were observed. Shortening or dropout of meibomian glands was not
observed. (C, D) A 37-year-old male who had used rigid CLs for 17 years. Those regions of the upper lid where meibomian glands were absent,
appear black (drop out) (C). Shortening and distortion of meibomian glands were observed in the lower eye lid (D). (E, F) In a 32-year-old female
who had used hydrogel CLs for 13 years, most meibomian glands in both the upper and lower eyelids were shortened. The shortening of the
meibomian glands began not at the free border of the lid (in the region of the orifices), but proximally (in the fixed border of the tarsal plate). Meibum Composition It remains unclear whether CL wear affects meibum composi-
tion or whether meibum composition affects the comfort of CL
wear. Robin and colleagues333 found that all 15 subjects who
wore EW SCLs and had lipid deposition on the lens showed
abnormalities of meibomian gland morphology. Only 2 of the 13
subjects without lipid deposition on the lens had meibomian
gland abnormalities. These results suggest that MGD may be
associated with the development of SCL deposits, which can
impact lens wettability and ultimately lead to CLD. It is possible that CL wear affects not only the lipid layer of
the tear film but also meibum composition itself. However, there
is still a dearth of information regarding the exact nature of FIGURE 5. Meibomian gland changes in CL wearers, illustrated by in vivo confocal microscopy, performed at the lid margin. (A) Meibomian glands
of a 35-year-old male, showing no obvious changes in acinar lumina (*), wall thickness (arrow), or interstitial space (#). (B) A 32-year-old male: The
acinar unit density and size are slightly reduced and there is apparent periglandular infiltration (#), presumably by inflammatory cells. (C) A 39-year-
old female: The acinar units appear greatly enlarged and hyper-reflective (*). FIGURE 5. Meibomian gland changes in CL wearers, illustrated by in vivo confocal microscopy, performed at the lid margin. (A) Meibomian glands
of a 35-year-old male, showing no obvious changes in acinar lumina (*), wall thickness (arrow), or interstitial space (#). (B) A 32-year-old male: The
acinar unit density and size are slightly reduced and there is apparent periglandular infiltration (#), presumably by inflammatory cells. (C) A 39-year-
old female: The acinar units appear greatly enlarged and hyper-reflective (*). Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/2017 IOVS j October 2013 j Vol. 54 j No. 11 j TFOS110 CL Interactions With the Ocular Surface and Adnexa IGURE 6. Tissue zones at the posterior eye lid margin. (A) Complete upper eye lid with meibomian gland (mg) and cilia (c); the area marked b
otted rectangle represents the inner lid border. The rounded outer lid border (olb) can be differentiated from the sharp inner one (ilb) and the
d margin (flm) extends from the cilia (c) to the meibom orifice. (B) The inner lid border is seen with the aqueous tear meniscus (aqt) overlying
ne of Marx, and the tear film lipid layer (lip, not to size). Meibum Composition The lid wiper is the only point of the lid margin that is apposed to and in touch with
obe; the upper tarsal conjunctiva is separated from the globe by Kessing’s space (Ks in [A, B]). The marginal conjunctiva constitutes a thicke FIGURE 6. Tissue zones at the posterior eye lid margin. (A) Complete upper eye lid with meibomian gland (mg) and cilia (c); the area marked by a
dotted rectangle represents the inner lid border. The rounded outer lid border (olb) can be differentiated from the sharp inner one (ilb) and the free
lid margin (flm) extends from the cilia (c) to the meibom orifice. (B) The inner lid border is seen with the aqueous tear meniscus (aqt) overlying the
line of Marx, and the tear film lipid layer (lip, not to size). The lid wiper is the only point of the lid margin that is apposed to and in touch with the
globe; the upper tarsal conjunctiva is separated from the globe by Kessing’s space (Ks in [A, B]). The marginal conjunctiva constitutes a thickened
epithelial lip that represents the device for distribution of the tear film during a blink. (C) The lid wiper has goblet cells (white dots in [B, C]) for a
rich mucin-water gel at the surface for lubrication and reduction of friction. Further zones of the posterior lid border are the mucocutaneous
junction (mcj, the surface of which is the line of Marx) located between the crest of the inner lid border and the meibom orifice. The cornified
epidermis extends from the free lid margin around the posterior rim of the meibom orifices where the meibomian oil is delivered onto the
precorneal tearfilm. In most parts only the surface cells are shown. (A) Reprinted with permission from Knop N, Korb DR, Blackie CA, Knop E. The
lid wiper contains goblet cells and goblet cell crypts for ocular surface lubrication during the blink. Cornea. 2012;31:668–679. (B, C) Modified from
Knop E, Knop N, Zhivov A, et al. The lid wiper and mucocutaneous junction anatomy of the human eyelid margins: an in vivo confocal and
histological study. J Anat. 2011;218:449–461. FIGURE 6. Tissue zones at the posterior eye lid margin. (A) Complete upper eye lid with meibomian gland (mg) and cilia (c); the area marked by a
dotted rectangle represents the inner lid border. Meibum Composition The rounded outer lid border (olb) can be differentiated from the sharp inner one (ilb) and the free
lid margin (flm) extends from the cilia (c) to the meibom orifice. (B) The inner lid border is seen with the aqueous tear meniscus (aqt) overlying the
line of Marx, and the tear film lipid layer (lip, not to size). The lid wiper is the only point of the lid margin that is apposed to and in touch with the
globe; the upper tarsal conjunctiva is separated from the globe by Kessing’s space (Ks in [A, B]). The marginal conjunctiva constitutes a thickened
epithelial lip that represents the device for distribution of the tear film during a blink. (C) The lid wiper has goblet cells (white dots in [B, C]) for a
rich mucin-water gel at the surface for lubrication and reduction of friction. Further zones of the posterior lid border are the mucocutaneous
junction (mcj, the surface of which is the line of Marx) located between the crest of the inner lid border and the meibom orifice. The cornified
epidermis extends from the free lid margin around the posterior rim of the meibom orifices where the meibomian oil is delivered onto the
precorneal tearfilm. In most parts only the surface cells are shown. (A) Reprinted with permission from Knop N, Korb DR, Blackie CA, Knop E. The
lid wiper contains goblet cells and goblet cell crypts for ocular surface lubrication during the blink. Cornea. 2012;31:668–679. (B, C) Modified from
Knop E, Knop N, Zhivov A, et al. The lid wiper and mucocutaneous junction anatomy of the human eyelid margins: an in vivo confocal and
histological study. J Anat. 2011;218:449–461. Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/2017 Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/201 IOVS j October 2013 j Vol. 54 j No. 11 j TFOS111 CL Interactions With the Ocular Surface and Adnexa FIGURE 7. Lid wiper epitheliopathy. Horizontal band of lid margin
staining extending horizontally from the medial canthus to the lateral
canthus, and from the Marx line (sharp green line or border of
superior staining) to the tarsal sulcus fold. Lid wiper epitheliopathy
stained with fluorescein (top) and lissamine green (bottom). Photo
courtesy of Sruthi Srinivasan. Lid Margin Anatomy The lid margin can be structurally and functionally differentiated
into three distinct zones: the anterior and posterior lid border,
and the free lid margin that is located between these.2 The
posterior border has at least three zones (Fig. 6)336: the posterior
extension of the free lid margin skin epidermis (that encircles
the meibomian orifices), the transition between the epidermis
and conjunctival mucosa (mucocutaneous junction with its
surface being the line of Marx), and the lid wiper zone (or the
marginal conjunctiva). LWE may be one of the few clinical signs truly associated
with dryness in lens wearers and nonwearers and much work is
currently under way to determine its value in providing a better
understanding of CLD. Meibum Composition represent the wiping surface of the lid border.340,341 However,
this theory is not supported by its geometrical orientation to the
globe, by the fact that it is visible in the upper eye lid without lid
eversion,342 and because it lacks specific lubrication.296 The conjunctiva extending proximally from the posterior lid
margin to the subtarsal fold, corresponds to the lid-wiper region
of the lid margin,343,344 which is directly apposed to the surface The conjunctiva extending proximally from the posterior lid
margin to the subtarsal fold, corresponds to the lid-wiper region
of the lid margin,343,344 which is directly apposed to the surface
of the globe and is important in tear distribution during blinking
and eye movements.336 Riolan’s muscle, the most central part of
the orbicularis muscle at the lid margin, probably plays a role in
this, as does the lubricative function of the goblet cells present
in this region.296 of the globe and is important in tear distribution during blinking
and eye movements.336 Riolan’s muscle, the most central part of
the orbicularis muscle at the lid margin, probably plays a role in
this, as does the lubricative function of the goblet cells present
in this region.296 Lid Wiper Epitheliopathy A thickened epithelium at the posterior lid margin was observed
as long ago as 1877 by Sattler345 and later by Virchow and
Saemisch.346 However, its immediate functional implication was
not recognized until the mid-1960s by Ehlers.347 He noticed that
this ‘‘bead gliding over the cornea’’ must be assumed to be a
perfect ‘‘windscreen wiper.’’ More recently, this region has
received increased attention because of an observation by Korb
and colleagues343,344,348 linking changes in this region of the lid
in subjects who are symptomatic of dryness. The authors
postulate that when the tear film is thinned or becomes
unstable, or a lens surface is not stable and wettable, there is an
increased mechanical/frictional effect on the lid-wiper region, as
the lid travels across the ocular or lens surface during blinking. This process may lead to lid-wiper trauma and epitheliopathy,
which can be viewed clinically by staining the marginal
conjunctiva with commonly used ophthalmic dyes343,344,349
(Fig. 7). FIGURE 7. Lid wiper epitheliopathy. Horizontal band of lid margin
staining extending horizontally from the medial canthus to the lateral
canthus, and from the Marx line (sharp green line or border of
superior staining) to the tarsal sulcus fold. Lid wiper epitheliopathy
stained with fluorescein (top) and lissamine green (bottom). Photo
courtesy of Sruthi Srinivasan. meibum, as a result of the small sample quantities available. Recent advances in analytical techniques have provided some
insight into meibum composition,334,335 but further work is
necessary to determine the extent of interindividual variability
in normal meibum, its effect on the comfort of CL wear, and the
effect of lens wear on meibum composition. LWE is found in 67% to 80% of symptomatic CL wearers, but
in only 13% to 32% of asymptomatic subjects.343,350 This
condition is also observed in the lower eyelid,351 but
significantly different LWE scores between symptomatic and
asymptomatic subjects were found only in the upper eyelid.352
By histology it has been verified in selected cases that cells with
atypical keratinization (para-keratinization) increase in number
and extend from the natural stainable line of Marx, where they
physiologically occur, over the surface of the lid wiper
epithelium.336 IOVS j October 2013 j Vol. 54 j No. 11 j TFOS112 TABLE. Frequency of Microbes Isolated From Lids of Non–Lens Wearers and Lens Wearers353,354,356–361,363
Microbial Type
Non-CL Wearers,
% Subjects
CL Wearers,
% Subjects
Gram-positive bacteria: Firmicutes, Firmibacteria, Bacillales
Coagulase-negative staphylococci
84–100
28–97
capitis/warneri/cohnii/saprophyticus
<1
2–43
epidermidis/hominis
28
25–62
haemolyticus
2–8
lugdunensis
<1–3
hyicus
5
intermedius
<1–2
schleiferi
<1
1–3
Staphylococcus aureus
3
<1–21
Planococcus sp. <1–1
Bacillus sp. 22–26
<1–5
Gram-positive bacteria: Firmicutes, Firmibacteria, Lactobacillales
Streptococcus pneumoniae
<1
S. pneumoniae and viridans streptococci
6
<1–3
Viridans streptococci
<1–41
1–15
Streptococcus sp. 4
1–6
Lactobacillus sp. <1–1
Gram-positive bacteria: Actinobacteria, Actintobacteridae, Actinomycetales
Micrococcus sp. 6–14
0–26
Stomatococcus sp. 1–2
Corynebacterium sp. 43
<1–32
Propionibacterium sp. 4–18
<1–61
Gram-negative bacteria: Proteobacteria, Gamma proteobacteria, Pseudomonadales
Acinetobacter baumannii
4
Acinetobacter sp. <1
<1–9
Moraxella sp. <1
1–3
Moraxella catarrhalis
<1
Neisseria sp. 5–6
<1–6
Pseudomonas sp. <1
1–3
Pseudomonas aeruginosa
<1–1
Gram-negative bacteria: Proteobacteria, Gamma proteobacteria, Enterobacteriales
Escherichia coli
<1–3
Escherichia vulneris
<1
<1–1
Enterobacter sp. <1–1
Enterobacter cloacae
<1
Proteus sp. 3
Serratia marcescens
<1–6
<1–3
Serratia ficaria
6
<1–1
Serratia liquefaciens
3
Gram-negative bacteria: Proteobacteria, Gamma proteobacteria, Pasteurellales
Haemophilus influenzae
<1
<1–5
Haemophilus parainfluenzae
<1
Gram-negative bacteria: Proteobacteria, Beta proteobacteria, Burkholderiales
Achromobacter sp. <1–1
Achromobacter xylosoxidans
<1
Gram-negative bacteria: Bacteroidetes, Flavobacteriaceae, Flavobacteriales
Chryseobacterium meningosepticum
<1 TABLE. Frequency of Microbes Isolated From Lids of Non–Lens Wearers and Lens Wearers353,354,356–361,363 TABLE. Frequency of Microbes Isolated From Lids of Non–Lens Wearers and Lens Wearers353,354,356–361,363 ABLE. Frequency of Microbes Isolated From Lids of Non–Lens Wearers and Lens Wearers353,354,356–361,363 Changes in Normal Microbiota g
j
The lid-wiper region is a thickened epithelial ‘‘lip’’ that has a
conjunctival mucosal morphology that extends from the tarsal
conjunctiva up to the crest of the posterior lid border, is
apposed to the globe, and helps to distribute the precorneal tear
film. The lid wiper contains goblet cells that produce mucin,
which is likely used for lubrication and reduces the frictional
force between the globe and lid margin during blinking.296 The
lid wiper, because it is conceivably the only part of the lid
margin that is in direct contact with the globe,337 will be in
contact with the CL surface and is thus subjected to mechanical
friction during the blink. The lid wiper zone has the highest
neural sensitivity of all the conjunctival and lid regions, and is
similar in this respect to the central cornea.39,338 Thus, it is of
obvious importance during lens wear. The lid margin is more frequently colonized with microbes
than the conjunctiva and CLs,353 but the frequency of isolation
varies. The number of colony-forming units that can be grown
from swabs of the lid range from zero in some subjects up to
465.354–357 As shown in the Table, the most frequently isolated microbes
are the coagulase-negative staphylococci, in both non–lens
wear358–361 and during lens wear.353,354,356,357,360,362,363 Other commonly isolated bacteria from both lens wearers and non–
lens wearers include Micrococcus sp., viridans streptococci and
other Streptococcus sp., Corynebacterium sp., Propionibacte-
rium sp., and Bacillus sp. Gram-negative bacteria are not
commonly isolated from the lid margins of CL or non-CL
wearers. Stapleton and colleagues353 found that the frequency of
isolation of microbes from lids increased significantly with time
for experienced wearers of DW lenses, but for experienced
wearers of EW lenses the frequency of isolation of microbes
from lids reduced with time, but there was a greater frequency
of isolation of potentially pathogenic microbes during EW. Other The line of Marx extends from the crest of the posterior lid
border and is seen at the bottom of the tear meniscus.339 A thin
band of stainable epithelial cells directly behind the mucocuta-
neous junction is the basis for Marx’s line. Previously, the line of
Marx was assumed to be the zone in touch with the globe and to Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/201 IOVS j October 2013 j Vol. 54 j No. 11 j TFOS112 CL Interactions With the Ocular Surface and Adnexa Microbial Type pneumoniae and viridans streptococci
Viridans streptococci
Streptococcus sp. Lactobacillus sp. Gram-positive bacteria: Actinobacteria, Actintobacteridae, Actinomycetales
Micrococcus sp. Stomatococcus sp. Corynebacterium sp. Propionibacterium sp. Gram-negative bacteria: Proteobacteria, Gamma proteobacteria, Pseudomonad
Acinetobacter baumannii
Acinetobacter sp. Moraxella sp. Moraxella catarrhalis
Neisseria sp. Pseudomonas sp. Pseudomonas aeruginosa
Gram-negative bacteria: Proteobacteria, Gamma proteobacteria, Enterobacteria
Escherichia coli
Escherichia vulneris
Enterobacter sp. Enterobacter cloacae
Proteus sp. Serratia marcescens
Serratia ficaria
Serratia liquefaciens
Gram-negative bacteria: Proteobacteria, Gamma proteobacteria, Pasteurellales
Haemophilus influenzae
Haemophilus parainfluenzae
Gram-negative bacteria: Proteobacteria, Beta proteobacteria, Burkholderiales
Achromobacter sp. Achromobacter xylosoxidans Microbial Type Gram-positive bacteria: Firmicutes, Firmibacteria, Bacillales
Coagulase-negative staphylococci
84–100
28–97
capitis/warneri/cohnii/saprophyticus
<1
2–43
epidermidis/hominis
28
25–62
haemolyticus
2–8
lugdunensis
<1–3
hyicus
5
intermedius
<1–2
schleiferi
<1
1–3
Staphylococcus aureus
3
<1–21
Planococcus sp. <1–1
Bacillus sp. 22–26
<1–5
Gram-positive bacteria: Firmicutes, Firmibacteria, Lactobacillales
Streptococcus pneumoniae
<1
S. pneumoniae and viridans streptococci
6
<1–3
Viridans streptococci
<1–41
1–15
Streptococcus sp. 4
1–6
Lactobacillus sp. <1–1
Gram-positive bacteria: Actinobacteria, Actintobacteridae, Actinomycetales
Micrococcus sp. 6–14
0–26
Stomatococcus sp. 1–2
Corynebacterium sp. 43
<1–32
Propionibacterium sp. 4–18
<1–61
Gram-negative bacteria: Proteobacteria, Gamma proteobacteria, Pseudomonadales
Acinetobacter baumannii
4
Acinetobacter sp. <1
<1–9
Moraxella sp. <1
1–3
Moraxella catarrhalis
<1
Neisseria sp. 5–6
<1–6
Pseudomonas sp. <1
1–3
Pseudomonas aeruginosa
<1–1
Gram-negative bacteria: Proteobacteria, Gamma proteobacteria, Enterobacteriales
Escherichia coli
<1–3
Escherichia vulneris
<1
<1–1
Enterobacter sp. <1–1
Enterobacter cloacae
<1
Proteus sp. 3
Serratia marcescens
<1–6
<1–3
Serratia ficaria
6
<1–1
Serratia liquefaciens
3
Gram-negative bacteria: Proteobacteria, Gamma proteobacteria, Pasteurellales
Haemophilus influenzae
<1
<1–5
Haemophilus parainfluenzae
<1
Gram-negative bacteria: Proteobacteria, Beta proteobacteria, Burkholderiales
Achromobacter sp. <1–1
Achromobacter xylosoxidans
<1
Gram-negative bacteria: Bacteroidetes, Flavobacteriaceae, Flavobacteriales
Chryseobacterium meningosepticum
<1 microbes, such as fungi or protozoa, are not usually isolated. There are no reports of viral colonization of lids in healthy
asymptomatic subjects. There have been no studies to date examining the lid
microbiota during CLD. One study359 examined the lid
microbiota of dry-eye subjects (including those with MGD or
Sj¨ogren’s
increased
with hea
colony-fo
to be mo
Staphyloc
Gram-positive bacteria: Firmicutes, Firmibacteria, Bacillales
Coagulase-negative staphylococci
capitis/warneri/cohnii/saprophyticus
epidermidis/hominis
haemolyticus
lugdunensis
hyicus
intermedius
schleiferi
Staphylococcus aureus
Planococcus sp. Bacillus sp. Gram-positive bacteria: Firmicutes, Firmibacteria, Lactobacillales
Streptococcus pneumoniae
S. pneumoniae and viridans streptococci
Viridans streptococci
Streptococcus sp. Lactobacillus sp. Gram-positive bacteria: Actinobacteria, Actintobacteridae, Actinomycetales
Micrococcus sp. Stomatococcus sp. Corynebacterium sp. Propionibacterium sp. Gram-negative bacteria: Proteobacteria, Gamma proteobacteria, Pseudomonadales
Acinetobacter baumannii
Acinetobacter sp. Moraxella sp. Moraxella catarrhalis
Neisseria sp. Pseudomonas sp. Pseudomonas aeruginosa
Gram-negative bacteria: Proteobacteria, Gamma proteobacteria, Enterobacteriales
Escherichia coli
Escherichia vulneris
Enterobacter sp. Enterobacter cloacae
Proteus sp. Serratia marcescens
Serratia ficaria
Serratia liquefaciens
Gram-negative bacteria: Proteobacteria, Gamma proteobacteria, Pasteurellales
Haemophilus influenzae
Haemophilus parainfluenzae
Gram-negative bacteria: Proteobacteria, Beta proteobacteria, Burkholderiales
Achromobacter sp. Achromobacter xylosoxidans
Gram-negative bacteria: Bacteroidetes, Flavobacteriaceae, Flavobacteriales
Chryseobacterium meningosepticum
Unidentified gram-negative rods
Fungi (molds or yeasts) Gram-positive bacteria: Firmicutes, Firmibacteria, Bacillales
Coagulase-negative staphylococci
capitis/warneri/cohnii/saprophyticus
epidermidis/hominis
haemolyticus
lugdunensis
hyicus
intermedius
schleiferi
Staphylococcus aureus
Planococcus sp. Bacillus sp. Gram-positive bacteria: Firmicutes, Firmibacteria, Lactobacillales
Streptococcus pneumoniae
S. IMPACT OF CLS ON BLINKING Blink patterns impact lens movement and the degree to which
the lens and ocular surface may dry between blinks, both of
which can affect the interaction of the lens with the ocular
surface. In addition, a lens that is too mobile will interact with
the lid during the blink and can influence lens comfort. Thus,
consideration of blinking in CL wearers is warranted. Blinking exerts both a backward, squeeze pressure on the
lens and a shearing force, parallel to its anterior surface.370–372
As the lens moves or fluid is exchanged behind the lens, these
forces are transmitted to the cornea, limbus, and bulbar
conjunctiva to varying degrees, according to lens type and
fitting characteristics. Although there is limited tear exchange
under a soft lens during the blink, the volume and distribution
of fluid behind the lens is a major determinant of mobil-
ity.121,373 The post-lens tear fluid provides lubrication between
the lens and the corneal surface and cushions the effects of
blinking. It also facilitates tear exchange with the body of the
tears and, thus, is important for the removal of cells and debris
from behind the lens.374 For the relatively mobile, rigid corneal
lens, the relationship between the lens and the ocular surface
is dynamic. The lens moves with the eye during a large eye
movement. By contrast, eye movement when wearing a well-
fitted, relatively immobile soft lens will draw the lens surface
across the upper and lower tarsal conjunctiva during
horizontal versions, the locus of contact changing when the
eye is elevated or depressed. These differences in physical
interaction between lens subtypes and the ocular surface are
relevant to the development of a variety of well-described
complications that can result in CLD, including lid-wiper
epitheliopathy.343 However, detailed studies of the relationship
between the blink during wear of different CL types and CLD
have yet to be undertaken. The manner in which a CL interacts with the ocular surface
during eye movement and blinking is distinctly different for
soft, rigid, or scleral lenses, due to differences in size, material,
modulus, form, and fitting philosophy for these lens types. Rigid corneal lenses require a greater period of adaptation and
often modify blink patterns during this adaptation phase. Although soft lenses are intrinsically tolerable,364 acceptance is
greatly influenced by a variety of material properties, including
water content, modulus, oxygen transmission, and wettability. Gram-positive bacteria: Firmicutes, Firmibacteria, Bacillales p
Coagulase-negative staphylococci
capitis/warneri/cohnii/saprophyticus
epidermidis/hominis
haemolyticus
lugdunensis
hyicus
intermedius
schleiferi
Staphylococcus aureus
Planococcus sp. Bacillus sp. <1
2–43
28
25–62
2–8
<1–3
5
<1–2
<1
1–3
3
<1–21
<1–1
22–26
<1–5
ria, Lactobacillales
<1
6
<1–3
<1–41
1–15
4
1–6
<1–1
bacteridae, Actinomycetales
6–14
0–26
1–2
43
<1–32
4–18
<1–61
a proteobacteria, Pseudomonadales
4
<1
<1–9
<1
1–3
<1
5–6
<1–6
<1
1–3
<1–1
a proteobacteria, Enterobacteriales
<1–3
<1
<1–1
<1–1
<1
3
<1–6
<1–3
6
<1–1
3
a proteobacteria, Pasteurellales
<1
<1–5
<1
roteobacteria, Burkholderiales
<1–1
<1
cteriaceae, Flavobacteriales
<1
<1–2
2–5
2–4 Micrococcus sp. Stomatococcus sp. Corynebacterium sp. Propionibacterium sp. Pseudomonas sp. Gram-negative bacteria: Proteobacteria, Gamma proteobacteria, Enterobacteriales
Escherichia coli Sj¨ogren’s syndrome) and found that all dry-eye subjects had
increased numbers of colonies of bacteria isolated compared
with healthy non–dry eye subjects (106 6 82 vs. 12 6 18
colony-forming units per lid, respectively). There also tended
to be more frequent lid colonization by Corynebacterium sp.,
Staphylococcus aureus, and coliform bacteria in the dry-eye Sj¨ogren’s syndrome) and found that all dry-eye subjects had
increased numbers of colonies of bacteria isolated compared
with healthy non–dry eye subjects (106 6 82 vs. 12 6 18
colony-forming units per lid, respectively). There also tended
to be more frequent lid colonization by Corynebacterium sp.,
Staphylococcus aureus, and coliform bacteria in the dry-eye microbes, such as fungi or protozoa, are not usually isolated. There are no reports of viral colonization of lids in healthy
asymptomatic subjects. j
There have been no studies to date examining the lid
microbiota during CLD. One study359 examined the lid
microbiota of dry-eye subjects (including those with MGD or Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/2017 IOVS j October 2013 j Vol. 54 j No. 11 j TFOS113 CL Interactions With the Ocular Surface and Adnexa substantial in the case of corneal and scleral lenses, resulting in
greater mobility for rigid corneal lenses. For the scleral lens,
mobility and tear exchange is restricted by size and peripheral
interactions with the bulbar conjunctiva. A key function of the
blink is to replenish the tear film in front of and behind the
lens. Gram-positive bacteria: Firmicutes, Firmibacteria, Bacillales In some circumstances, lens fit may interfere with
spreading of the tear film and this, along with the presence
of the lens-edge–related meniscus, may encourage drying
outside the edge of the lens (resulting in 3 and 9 o’clock
staining), which can influence rigid lens comfort.368,369 subjects compared with the non–dry eye control group. Given
these findings, and the changes that occur to the lid microbiota
during lens wear, there is the possibility that the ocular
microbiota might have some role in CLD. Blinking and Its Role in CLD Blink rate is strongly influenced by the surrounding environ-
ment, attention, eye exposure, personal activity, and mental
state and may vary with age and sex. Wide variations in normal
blink rate are reported, likely due to the influence of different
environmental conditions or measurement techniques. Blink
rate is increased in dry eye disease and is further amplified by
increasing airflow over the eye, in both healthy individuals and
subjects with dry eye complaints.365,366 The increased blink
rate appears to serve two functions, in that it refreshes the tear
film more frequently and also increases the period of tear film
coverage over the ocular surface, as both blink frequency and
blink time are increased. In contrast, a reduction in blink rate
increases the blink interval, thereby increasing evaporative loss
from the eye for a given palpebral aperture size. This has
obvious consequences for lens behavior, particularly related to
tear film break-up and surface drying over the lens. Finally,
blink completeness is reduced in CL wearers compared with
healthy individuals.46 IMPACT OF CLS ON BLINKING Lens surface drying and feelings of discomfort will potentially
impact blink frequency. CONCLUSIONS AND FUTURE DIRECTIONS This report has reviewed CL-associated changes to the ocular
surface and adnexa, and has considered which of these
changes are associated with CLD. We have concentrated on
physiological changes that may be associated with CL wear, but
not necessarily identified or designated as an adverse response. In this context, some evidence is available to suggest a link
among LIPCOF, conjunctival metaplasia, GCD, MGD, and LWE
with CLD, with the strongest evidence being that related to
MGD and LWE. No convincing evidence of a link to CLD was
unearthed with respect to any of the other forms of CL-
associated tissue changes considered in this report. This report has reviewed CL-associated changes to the ocular
surface and adnexa, and has considered which of these
changes are associated with CLD. We have concentrated on
physiological changes that may be associated with CL wear, but
not necessarily identified or designated as an adverse response. In this context, some evidence is available to suggest a link
among LIPCOF, conjunctival metaplasia, GCD, MGD, and LWE
with CLD, with the strongest evidence being that related to
MGD and LWE. No convincing evidence of a link to CLD was
unearthed with respect to any of the other forms of CL-
associated tissue changes considered in this report. Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/2017 References 24. Tiffany JM. Tears in health and disease. Eye (Lond). 2003;17:
923–926. 1. Knop E, Korb DR, Blackie CA, Knop N. The lid margin is an
underestimated structure for preservation of ocular surface
health and development of dry eye disease. Dev Ophthalmol. 2010;45:108–122. 25. Sullivan DA, Wickham LA, Rocha EM, Kelleher RS, da Silveira
LA, Toda I. Influence of gender, sex steroid hormones, and
the hypothalamic-pituitary axis on the structure and function
of the lacrimal gland. Adv Exp Med Biol. 1998;438:11–42. 2. Bron A, Tripathi D, Tripathi B. Ocular appendages: eyelids,
conjunctiva, and lacrimal apparatus. In: Bron A, Tripathi D,
Tripathi B, eds. Wolff’s Anatomy of the Eye and Orbit. London: Chapman & Hall Medical; 1997:30–84. 26. Ruskell GL. Nerve terminals and epithelial cell variety in the
human lacrimal gland. Cell Tissue Res. 1975;158:121–136. 27. Dartt DA. Signal transduction and control of lacrimal gland
protein secretion: a review. Curr Eye Res. 1989;8:619–636. 3. Wolff E. Anatomy of the Eye and Orbit. London: HK Lewis;
1948. 28. Seifert P, Spitznas M, Koch F, Cusumano A. The architecture
of human accessory lacrimal glands. Ger J Ophthalmol. 1993;
2:444–454. 4. Knop E, Knop N. A functional unit for ocular surface immune
defense formed by the lacrimal gland, conjunctiva and
lacrimal drainage system. Adv Exp Med Biol. 2002;506:835–
844. 29. Bron AJ, Tiffany JM. The contribution of meibomian disease
to dry eye. Ocul Surf. 2004;2:149–165. 5. Knop E, Knop N. Anatomy and immunology of the ocular
surface. Chem Immunol Allergy. 2007;92:36–49. 30. Gipson IK, Argueso P. Role of mucins in the function of the
corneal and conjunctival epithelia. Int Rev Cytol. 2003;231:
1–49. 6. Paulsen F. Functional anatomy and immunological interac-
tions of ocular surface and adnexa. Dev Ophthalmol. 2008;
41:21–35. 31. VanderWerf F, Brassinga P, Reits D, Aramideh M, Ongerboer
de Visser B. Eyelid movements: behavioral studies of blinking
in humans under different stimulus conditions. J Neuro-
physiol. 2003;89:2784–2796. 7. Bonini S, Lambiase A, Sgrulletta R, Bonini S. Allergic chronic
inflammation of the ocular surface in vernal keratoconjunc-
tivitis. Curr Opin Allergy Clin Immunol. 2003;3:381–387. 32. Sack RA, Sathe S, Beaton A. Tear turnover and immune and
inflammatory processes in the open-eye and closed-eye
environments: relationship to extended wear contact lens
use. Eye Contact Lens. 2003;29:S80–S82; discussion S83–S84,
S192–S194. 8. Stern ME, Siemasko KF, Gao J, Calonge M, Niederkorn JY,
Pflugfelder SC. References Evaluation of ocular surface inflammation in
the presence of dry eye and allergic conjunctival disease. Ocul Surf. 2005;3:S161–S164. 9. Tseng SC. Amniotic membrane transplantation for ocular
surface reconstruction. Biosci Rep. 2001;21:481–489. 33. Stern ME, Beuerman RW, et al. A unified theory of the role of
the ocular surface in dry eye. Adv Exp Med Biol. 1998;438:
643–651. 10. Kruse FE, Reinhard T. Limbus transplantation for reconstruc-
tion of the ocular surface [in German]. Ophthalmologe. 2001;98:818–831. 34. Stern ME, Beuerman RW, Fox RI, Gao J, Mircheff AK,
Pflugfelder SC. The pathology of dry eye: the interaction
between the ocular surface and lacrimal glands. Cornea. 1998;17:584–589. 11. Tsai RJ, Sun TT, Tseng SC. Comparison of limbal and
conjunctival autograft transplantation in corneal surface
reconstruction in rabbits. Ophthalmology. 1990;97:446–455. 35. Knop E, Knop N. Influence of the eye-associated lymphoid
tissue (EALT) on inflammatory ocular surface disease. Ocul
Surf. 2005;3:S180–S186. 12. Geerling G, Borrelli M. Adnexal surgery for severe ocular
surface disease. Semin Ophthalmol. 2005;20:101–112. 13. Dogru M, Tsubota K. Current concepts in ocular surface
reconstruction. Semin Ophthalmol. 2005;20:75–93. 36. Sullivan DA, Edwards JA, Wickham LA, et al. Identification
and endocrine control of sex steroid binding sites in the
lacrimal gland. Curr Eye Res. 1996;15:279–291. 14. Fernandes M, Sridhar MS, Sangwan VS, Rao GN. Amniotic
membrane transplantation for ocular surface reconstruction. Cornea. 2005;24:643–653. 37. The definition and classification of dry eye disease: report of
the Definition and Classification Subcommittee of the
International Dry Eye WorkShop (2007). Ocul Surf. 2007;5:
75–92. 15. Hopkinson A, McIntosh RS, Tighe PJ, James DK, Dua HS. Amniotic membrane for ocular surface reconstruction: donor
variations and the effect of handling on TGF-beta content. Invest Ophthalmol Vis Sci. 2006;47:4316–4322. 38. Rozsa AJ, Beuerman RW. Density and organization of free
nerve endings in the corneal epithelium of the rabbit. Pain. 1982;14:105–120. 16. Wolff E. The muco-cutaneous junction of the lid margin and
the distribution of the tear fluid. Trans Ophthalmol Soc U K. 1946;66:291–308. 39. McGowan DP, Lawrenson JG, Ruskell GL. Touch sensitivity of
the eyelid margin and palpebral conjunctiva. Acta Ophthal-
mol (Copenh). 1994;72:57–60. 17. Miller KL, Polse KA, Radke CJ. Black-line formation and the
‘‘perched’’ human tear film. Curr Eye Res. 2002;25:155–162. 40. Paulsen F, Thale A, Schaudig U. Nasolacrimal ducts and the
dry eye [in German]. Ophthalmologe. 2002;99:566–574. 18. Gaffney EA, Tiffany JM, Yokoi N, Bron AJ. IOVS j October 2013 j Vol. 54 j No. 11 j TFOS114 CL Interactions With the Ocular Surface and Adnexa should also examine whether the magnitude or timing of
changes can be linked to the magnitude and timing of CLD. 21. Yokoi N, Yamada H, Mizukusa Y, et al. Rheology of tear film
lipid layer spread in normal and aqueous tear-deficient dry
eyes. Invest Ophthalmol Vis Sci. 2008;49:5319–5324. 22. Gipson IK. The ocular surface: the challenge to enable and
protect vision: the Friedenwald lecture. Invest Ophthalmol
Vis Sci. 2007;48:4391–4398. Acknowledgments Disclosure: Each workshop participant’s disclosure data can be
found in the Appendix of the Introduction. 23. Stern ME, Gao J, Siemasko KF, Beuerman RW, Pflugfelder SC. The role of the lacrimal functional unit in the pathophysiol-
ogy of dry eye. Exp Eye Res. 2004;78:409–416. CL Movement During Blinking In the CL wearer, physical stresses are generated between the
lens and the ocular surface, which vary according to lens type
and fit, the nature and extent of the lid and eye movements,
and how the lens sits on the surface of the eye. When investigating the source of CLD, a full examination of
all the anterior ocular structures that can be impacted by CL
must be undertaken. This report draws particular attention to
the importance of undertaking a careful assessment of the
meibomian glands and lid margins, so as to establish the role
that changes to these tissue structures may play in the cause of
CLD. The points of contact with the cornea and conjunctiva in
the primary position of gaze differ significantly among the
major lens subtypes. In the blink interval, rigid corneal lenses
sit on the cornea, within the palpebral aperture, either making
no contact with the lids, or, with a lid-attached fit, engaging
with the upper tarsus. Occasionally, the lower lens edge may
be supported on the lower lid margin.367 In comparison, soft
and scleral lenses tuck beneath the upper and lower lid
margins, straddling the cornea and perilimbal conjunctiva, and,
with scleral lenses, extend onto the bulbar conjunctiva. Although soft lenses are flexible and modify their shape over
the corneal and limbal area, scleral lenses are not, and conform
very differently to either rigid corneal or soft lenses. There is
only a very thin film of fluid between a soft lens and the cornea
and minimal tear exchange occurs. The tear film is more Potential future areas of study could include closer
inspection of the role of corneal staining in CLD, the
development of more repeatable methods to ascertain GCD,
and extensive work characterizing changes to the meibomian
glands during CL wear and the role of LWE in CLD. Such
studies would benefit from longitudinal designs that attempt to
understand what pathophysiological changes occur in new
wearers over time and whether changes to CL materials,
design, fit, or other changes impact MGD and LWE. Studies Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/201 IOVS j October 2013 j Vol. 54 j No. 11 j TFOS114 IOVS j October 2013 j Vol. 54 j No. 11 j TFOS115 Endothelial cell density to
predict endothelial graft failure after penetrating keratoplasty. Arch Ophthalmol. 2010;128:63–69. 51. McDermott AM, Perez V, Huang AJ, et al. Pathways of corneal
and ocular surface inflammation: a perspective from the
cullen symposium. Ocul Surf. 2005;3:S131–S138. 76. Robertson DM. The effects of silicone hydrogel lens wear on
the corneal epithelium and risk for microbial keratitis. Eye
Contact Lens 2013;39:67–72. 52. Dana MR, Hamrah P. Role of immunity and inflammation in
corneal and ocular surface disease associated with dry eye. Adv Exp Med Biol. 2002;506:729–738. 77. Ladage PM. What does overnight lens wear do to the corneal
epithelium? Is corneal refractive therapy different? Eye
Contact Lens. 2004;30:194–197; discussion 205–206. 53. Pflugfelder SC. Antiinflammatory therapy for dry eye. Am J
Ophthalmol. 2004;137:337–342. 78. Bergmanson JP. Effects of contact lens wear on corneal
ultrastructure. Cont Lens Anterior Eye. 2001;24:115–120. 54. Pflugfelder SC. Tear fluid influence on the ocular surface. Adv Exp Med Biol. 1998;438:611–617. 79. Mathers WD, Sachdev MS, Petroll M, Lemp MA. Morphologic
effects of contact lens wear on the corneal surface. CLAO J. 1992;18:49–52. 55. Muller LJ, Marfurt CF, Kruse F, Tervo TM. Corneal nerves:
structure, contents and function. Exp Eye Res. 2003;76:521–
542. 80. Tsubota K, Hata S, Toda I, Yagi Y, Sakata M, Shimazaki J. Increase in corneal epithelial cell size with extended wear
soft contact lenses depends on continuous wearing time. Br J
Ophthalmol. 1996;80:144–147. 56. Marfurt CF, Cox J, Deek S, Dvorscak L. Anatomy of the human
corneal innervation. Exp Eye Res. 2010;90: 478–492. 57. Cope C, Dilly PN, et al. Wettability of the corneal surface: a
reappraisal. Curr Eye Res. 1986;5:777–785. 81. Tsubota K, Toda I, Fujishima H, Yamada M, Sugawara T,
Shimazaki J. Extended wear soft contact lenses induce
corneal epithelial changes. Br J Ophthalmol. 1994;78:907–
911. 58. Argueso P, Tisdale A, Kaura R, Tiffany JM. Mucin character-
istics of human corneal-limbal epithelial cells that exclude
the rose bengal anionic dye. Invest Ophthalmol Vis Sci. 2006;
47:113–119. 82. Tsubota K. In vivo observation of the corneal epithelium. Scanning. 1994;16:295–299. 59. Argueso P, Guzman-Aranguez A, Mantelli F, Cao Z, Ricciuto J,
Panjwani N. Association of cell surface mucins with galectin-
3 contributes to the ocular surface epithelial barrier. J Biol
Chem. 2009;284:23037–23045. 83. Tsubota K, Yamada M. Corneal epithelial alterations induced
by disposable contact lens wear. Ophthalmology. 1992;99:
1193–1196. 60. Miller D, Benedek G. Intraocular Light Scattering. Spring-
field, IL: Charles Thomas; 1973. IOVS j October 2013 j Vol. 54 j No. 11 j TFOS115 CL Interactions With the Ocular Surface and Adnexa of topical ocular anaesthesia. Graefes Arch Clin E
Ophthalmol. 2005;243:306–312. CL Interactions With the Ocular Surface and Adnexa of topical ocular anaesthesia. Graefes Arch Clin Exp
Ophthalmol. 2005;243:306–312. 67. Jester JV, Petroll WM, Cavanagh HD. Corneal stromal wound
healing in refractive surgery: the role of myofibroblasts. Prog
Retin Eye Res. 1999;18:311–356. 44. Borges FP, Garcia DM, Cruz AA. Distribution of spontaneous
inter-blink interval in repeated measurements with and
without topical ocular anesthesia. Arq Bras Oftalmol. 2010;
73:329–332. 68. Gatlin J, Melkus MW, Padgett A, et al. In vivo fluorescent
labeling of corneal wound healing fibroblasts. Exp Eye Res. 2003;76:361–371. 45. Abelson MB, Holly FJ. A tentative mechanism for inferior
punctate keratopathy. Am J Ophthalmol. 1977;83:866–869. 69. Dawson DG, Ubels JL, Edelhauser HF. Cornea and Sclera. In:
Levin L, Nilsson SFE, Ver Hoeve J, Wu SM, eds. Adler’s
Physiology of the Eye. Edinburgh: Elsevier; 2011:71–130. 46. Collins MJ, Iskander DR, Saunders A, Hook S, Anthony E,
Gillon R. Blinking patterns and corneal staining. Eye Contact
Lens. 2006;32:287–293. 70. Cristol SM, Edelhauser HF, Lynn MJ. A comparison of corneal
stromal edema induced from the anterior or the posterior
surface. Refract Corneal Surg. 1992;8:224–229. 47. Sullivan D. Possible mechanisms involved in the reduced tear
secretion in Sj¨ogren’s syndrome. In: Homma M, Sugai S, Tojo
T, Miyasaka N, Akizuki M, eds. Sj¨ogren’s Syndrome. State of
the Art. Amsterdam: Kugler Press; 1994:13–19. 71. Edelhauser HF. The balance between corneal transparency
and edema: the Proctor Lecture. Invest Ophthalmol Vis Sci. 2006;47:1754–1767. 48. Stern ME, Pflugfelder SC. Inflammation in dry eye. Ocul Surf. 2004;2:124–130. 72. Hatton MP, Perez VL, Dohlman CH. Corneal oedema in ocular
hypotony. Exp Eye Res. 2004;78:549–552. 49. Knop E, Knop N. Lymphocyte homing in the mucosal
immune system to the Eye-Associated Lymphoid Tissue
(EALT). In: Zierhut M, Sullivan DA, Stern ME, eds. Immunol-
ogy of the Ocular Surface and Tearfilm. Amsterdam: Swets &
Zeitlinger; 2004:35–72. 73. Bron AJ. UV-riboflavin cross-linking of the cornea in bullous
keratopathy: appraising the rationale. Cornea. 2011;30:724–
726; author reply 726. 74. Bourne WM, Nelson LR, Hodge DO. Central corneal
endothelial cell changes over a ten-year period. Invest
Ophthalmol Vis Sci. 1997;38:779–782. 50. Pflugfelder SC, Stern ME. Future directions in therapeutic
interventions for conjunctival inflammatory disorders. Curr
Opin Allergy Clin Immunol. 2007;7:450–453. 75. Lass JH, Sugar A, Benetz BA, et al. References A mass and solute
balance model for tear volume and osmolarity in the normal
and the dry eye. Prog Retin Eye Res. 2010;29:59–78. 41. Jordan A, Baum J. Basic tear flow. Does it exist? Ophthal-
mology. 1980;87:920–930. 19. King-Smith PE, Fink BA, Hill RM, Koelling KW, Tiffany JM. The
thickness of the tear film. Curr Eye Res. 2004;29:357–368. 42. Nakamori K, Odawara M, Nakajima T, Mizutani T, Tsubota K. Blinking is controlled primarily by ocular surface conditions. Am J Ophthalmol. 1997;124:24–30. 20. Goto E, Tseng SC. Kinetic analysis of tear interference images
in aqueous tear deficiency dry eye before and after punctal
occlusion. Invest Ophthalmol Vis Sci. 2003;44:1897–1905. 43. Naase T, Doughty MJ, Button NF. An assessment of the
pattern of spontaneous eyeblink activity under the influence Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/2017 IOVS j October 2013 j Vol. 54 j No. 11 j TFOS115 Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/2017 IOVS j October 2013 j Vol. 54 j No. 11 j TFOS116 108. Lin MC, Yeh TN, Graham AD, et al. Ocular surface health
during 30-day continuous wear: rigid gas-permeable versus
silicone hydrogel hyper-O2 transmitted contact lenses. Invest
Ophthalmol Vis Sci. 2011;52:3530–3538. 89. Patel SV, McLaren JW, Hodge DO, Bourne WM. Confocal
microscopy in vivo in corneas of long-term contact lens
wearers. Invest Ophthalmol Vis Sci. 2002;43:995–1003. 90. Jalbert I, Sweeney DF, Stapleton F. The effect of long-term
wear of soft lenses of low and high oxygen transmissibility on
the corneal epithelium. Eye (Lond). 2009;23:1282–1287. 109. Duench S, Sorbara L, Keir N, Simpson T, Jones L. Impact of
silicone hydrogel lenses and solutions on corneal epithelial
permeability. Optom Vis Sci. 2013;90:546–556. 91. Yagmur M, Okay O, Sizmaz S, Unal I, Yar K. In vivo confocal
microscopy: corneal changes of hydrogel contact lens
wearers. Int Ophthalmol. 2011;31:377–383. 110. Dumbleton K. Noninflammatory silicone hydrogel contact
lens complications. Eye Contact Lens. 2003;29:S186–S189;
discussion S190–S191, S192–S194. 92. Alonso-Caneiro D, Shaw AJ, Collins MJ. Using optical
coherence tomography to assess corneoscleral morphology
after soft contact lens wear. Optom Vis Sci. 2012;89:1619–
1626. 111. Markoulli M, Papas E, Cole N, Holden B. Corneal erosions in
contact lens wear. Cont Lens Anterior Eye. 2012;35:2–8. 112. Lin MC, Yeh TN. Mechanical complications induced by
silicone hydrogel contact lenses. Eye Contact Lens. 2013;39:
115–124. 93. Forte R, Cennamo G, Del Prete S, Cesarano I, Del Prete A. Scanning electron microscopy of corneal epithelium in soft
contact lens wearers. Cornea. 2010;29:732–736. 113. Giasson C, Bonanno JA. Corneal epithelial and aqueous
humor acidification during in vivo contact lens wear in
rabbits. Invest Ophthalmol Vis Sci. 1994;35:851–861. 94. Choo JD, Caroline PJ, Harlin DD, Papas EB, Holden BA. Morphologic changes in cat epithelium following continuous
wear of orthokeratology lenses: a pilot study. Cont Lens
Anterior Eye. 2008;31:29–37. 114. Holden BA. The Glenn A. Fry Award lecture 1988: the ocular
response to contact lens wear. Optom Vis Sci. 1989;66:717–
733. 95. Cheah PS, Norhani M, Bariah MA, Myint M, Lye MS, Azian AL. Histomorphometric profile of the corneal response to short-
term reverse-geometry orthokeratology lens wear in primate
corneas: a pilot study. Cornea. 2008;27:461–470. 115. Morgan PB, Maldonado-Codina C. Corneal staining: do we
really understand what we are seeing? Cont Lens Anterior
Eye. 2009;32:48–54. 96. Ding H, Pu A, He H, et al. Changes in corneal biometry and
the associated histology in rhesus monkeys wearing ortho-
keratology contact lenses. Cornea. 2012;31:926–933. 116. IOVS j October 2013 j Vol. 54 j No. 11 j TFOS116 Guillon JP, Guillon M, Malgouyres S. Corneal desiccation
staining with hydrogel lenses: tear film and contact lens
factors. Ophthalmic Physiol Opt. 1990;10:343–350. 97. Nieto-Bona A, Gonzalez-Mesa A, Nieto-Bona MP, Villa-Collar C,
Lorente-Vel´azquez A. Short-term effects of overnight ortho-
keratology on corneal cell morphology and corneal thick-
ness. Cornea. 2011;30:646–654. 117. Norn MS. Micropunctate fluorescein vital staining of the
cornea. Acta Ophthalmol (Copenh). 1970;48:108–118. 118. Brautaset RL, Nilsson M, Leach N, et al. Corneal and
conjunctival epithelial staining in hydrogel contact lens
wearers. Eye Contact Lens. 2008;34:312–316. 98. Ren DH, Yamamoto K, Ladage PM, et al. Adaptive effects of
30-night wear of hyper-O(2) transmissible contact lenses on
bacterial binding and corneal epithelium: a 1-year clinical
trial. Ophthalmology. 2002;109:27–39; discussion 39–40. 119. Efron N, Veys J. Defects in disposable contact lenses can
compromise ocular integrity. Int Contact Lens Clin. 1992;19:
8–18. 99. Cavanagh HD, Ladage PM, Li SL, et al. Effects of daily and
overnight wear of a novel hyper oxygen-transmissible soft
contact lens on bacterial binding and corneal epithelium: a 13-
month clinical trial. Ophthalmology. 2002;109:1957–1969. 120. Swarbrick HA, Holden BA. Rigid gas permeable lens binding:
significance and contributing factors. Am J Optom Physiol
Opt. 1987;64:815–823. 100. Yamamoto K, Ladage PM, Ren DH, et al. Effects of low and
hyper Dk rigid gas permeable contact lenses on Bcl-2
expression and apoptosis in the rabbit corneal epithelium. CLAO J. 2001;27:137–143. 121. Little SA, Bruce AS. Role of the post-lens tear film in the
mechanism of inferior arcuate staining with ultrathin
hydrogel lenses. CLAO J. 1995;21:175–181. 122. Zadnik K, Mutti D. Inferior arcuate corneal staining in soft
contact lens wearers. Int Contact Lens Clin. 1985;12:110–
114. 101. Ladage PM, Jester JV, Petroll WM, Bergmanson JP, Cavanagh
HD. Role of oxygen in corneal epithelial homeostasis during
extended contact lens wear. Eye Contact Lens. 2003;29:S2–
S6; discussion S26–S29, S192–S194. 123. Barr JT. Peripheral corneal desiccation staining—lens mate-
rials and designs. Int Contact Lens Clin. 1985;12:139–142. 102. Boets EP, Kerkmeer MJ, van Best JA. Contact lens care
solutions and corneal epithelial barrier function: a fluoro-
photometric study. Ophthalmic Res. 1994;26:129–136. 124. Holden B, Sweeney D, Seger RG. Epithelial erosions caused
by thin high water content lenses. Clin Exp Optom. 1986;69:
103–107. 103. Lin MC, Polse KA. Hypoxia, overnight wear, and tear
stagnation effects on the corneal epithelium: data and
proposed model. Eye Contact Lens. 2007;33:378–381;
discussion 382. 125. Orsborn GN, Zantos SG. CL Interactions With the Ocular Surface and Adnexa IOVS j October 2013 j Vol. 54 j No. 11 j TFOS116 CL Interactions With the Ocular Surface and Adnexa IOVS j October 2013 j Vol. 54 j No. 11 j TFOS116 IOVS j October 2013 j Vol. 54 j No. 11 j TFOS115 84. Lemp MA, Gold JB. The effects of extended-wear hydrophilic
contact lenses on the human corneal epithelium. Am J
Ophthalmol. 1986;101:274–277. 61. Gipson IK. Adhesive mechanisms of the corneal epithelium. Acta Ophthalmol Suppl. 1992;202:13–17. 85. Stapleton F, Kasses S, Bolis S, Keay L. Short term wear of high
Dk soft contact lenses does not alter corneal epithelial cell
size or viability. Br J Ophthalmol. 2001;85:143–146. 62. Muller LJ, Pels E, Vrensen GF. The specific architecture of the
anterior stroma accounts for maintenance of corneal
curvature. Br J Ophthalmol. 2001;85:437–443. 86. O’Leary DJ, Madgewick R, Wallace J, Ang J. Size and number
of epithelial cells washed from the cornea after contact lens
wear. Optom Vis Sci. 1998;75:692–696. 63. Bron AJ. The architecture of the corneal stroma. Br J
Ophthalmol. 2001;85:379–381. 64. Knupp C, Pinali C, Lewis PN, et al. The architecture of the
cornea and structural basis of its transparency. Adv Protein
Chem Struct Biol. 2009;78:25–49. 87. Ladage PM, Yamamoto K, Ren DH, et al. Effects of rigid and
soft contact lens daily wear on corneal epithelium, tear
lactate dehydrogenase, and bacterial binding to exfoliated
epithelial cells. Ophthalmology. 2001;108:1279–1288. 65. Watsky MA. Keratocyte gap junctional communication in
normal and wounded rabbit corneas and human corneas. Invest Ophthalmol Vis Sci. 1995;36:2568–2576. 88. Holden BA, Sweeney DF, Vannas A, Nilsson KT, Efron N. Effects of long-term extended contact lens wear on the
human cornea. Invest Ophthalmol Vis Sci. 1985;26:1489–
1501. 66. Spanakis SG, Petridou S, Masur SK. Functional gap junctions
in corneal fibroblasts and myofibroblasts. Invest Ophthalmol
Vis Sci. 1998;39:1320–1328. Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/2017 Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/2017 IOVS j October 2013 j Vol. 54 j No. 11 j TFOS116 Corneal desiccation staining with
thin high water content contact lenses. CLAO J. 1988;14:81–
85. 126. Mirejovsky D, Patel AS, Young G. Water properties of
hydrogel contact lens materials: a possible predictive model
for corneal desiccation staining. Biomaterials. 1993;14:
1080–1088. 104. Lin MC, Soliman GN, Song MJ, et al. Soft contact lens
extended wear affects corneal epithelial permeability:
hypoxic or mechanical etiology? Cont Lens Anterior Eye. 2003;26:11–16. 127. van der Worp E, De Brabander J, Swarbrick H, Nuijts R,
Hendrikse F. Corneal desiccation in rigid contact lens wear: 3-
and 9-o’clock staining. Optom Vis Sci. 2003;80:280–290. 105. Lin MC, Graham AD, Fusaro RE, Polse KA. Impact of rigid gas-
permeable contact lens extended wear on corneal epithelial
barrier function. Invest Ophthalmol Vis Sci. 2002;43:1019–
1024. 128. Ang JH, Efron N. Corneal hypoxia and hypercapnia during
contact lens wear. Optom Vis Sci. 1990;67:512–521. 106. Lin MC, Graham AD, Polse KA, McNamara NA, Tieu TG. The
effects of one-hour wear of high-Dk soft contact lenses on
corneal pH and epithelial permeability. CLAO J. 2000;26:130–
133. 129. Nichols JJ, Sinnott LT. Tear film, contact lens, and patient
factors associated with corneal staining. Invest Ophthalmol
Vis Sci. 2011;52:1127–1137. 130. Pritchard N, Young G, Coleman S, Hunt C. Subjective and
objective measures of corneal staining related to multipur-
pose care systems. Cont Lens Anterior Eye. 2003;26:3–9. 107. McNamara NA, Polse KA, Fukunaga SA, Maebori JS, Suzuki
RM. Soft lens extended wear affects epithelial barrier
function. Ophthalmology. 1998;105:2330–2335. Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/2017 IOVS j October 2013 j Vol. 54 j No. 11 j TFOS117 CL Interactions With the Ocular Surface and Adnexa 131. Garofalo RJ, Dassanayake N, Carey C, Stein J, Stone R, David
R. Corneal staining and subjective symptoms with multipur-
pose solutions as a function of time. Eye Contact Lens. 2005;
31:166–174. 151. Bohnke M, Masters BR. Long-term contact lens wear induces
a corneal degeneration with microdot deposits in the corneal
stroma. Ophthalmology. 1997;104:1887–1896. 152. Trittibach P, Cadez R, Eschmann R, Sarra GM, Boehnke M,
Frueh BE. Determination of microdot stromal degenerations
within corneas of long-term contact lens wearers by confocal
microscopy. Eye Contact Lens. 2004;30:127–131. 132. Jones L, MacDougall N, Sorbara LG. Asymptomatic corneal
staining associated with the use of balafilcon silicone-
hydrogel contact lenses disinfected with a polyaminopropyl
biguanide-preserved care regimen. Optom Vis Sci. 2002;79:
753–761. 153. Hsu M, Tu E, Bouchard C. IOVS j October 2013 j Vol. 54 j No. 11 j TFOS116 Malik NS, Moss SJ, Ahmed N, Furth AJ, Wall RS, Meek KM. Ageing of the human corneal stroma: structural and
biochemical changes. Biochim Biophys Acta. 1992;1138:
222–228. 161. Vannas A, Holden BA, Makitie J. The ultrastructure of contact
lens induced changes. Acta Ophthalmol (Copenh). 1984;62:
320–333. 141. Efron N, Perez-Gomez I, Morgan PB. Confocal microscopic
observations of stromal keratocytes during extended contact
lens wear. Clin Exp Optom. 2002;85:156–160. 162. Holden BA, Williams L, Zantos SG. The etiology of transient
endothelial changes in the human cornea. Invest Ophthal-
mol Vis Sci. 1985;26:1354–1359. 142. Jalbert I, Stapleton F. Effect of lens wear on corneal stroma:
preliminary findings. Aust N Z J Ophthalmol. 1999;27:211–
213. 163. Bonanno JA, Polse KA. Corneal acidosis during contact lens
wear: effects of hypoxia and CO2. Invest Ophthalmol Vis Sci. 1987;28:1514–1520. 143. Weed KH, MacEwen CJ, Cox A, McGhee CN. Quantitative
analysis of corneal microstructure in keratoconus utilising in
vivo confocal microscopy. Eye (Lond). 2007;21:614–623. 164. Dada VK, Jain AK, Mehta MR. Specular microscopy of
unilateral hard contact lens wearers. Indian J Ophthalmol. 1989;37:17–19. 144. Hollingsworth JG, Efron N. Confocal microscopy of the
corneas of long-term rigid contact lens wearers. Cont Lens
Anterior Eye. 2004;27:57–64. 165. MacRae SM, Matsuda M, Phillips DS. The long-term effects of
polymethylmethacrylate contact lens wear on the corneal
endothelium. Ophthalmology. 1994;101:365–370. 145. Ohta K, Shimamura I, Shiraishi A, Ohashi Y. Confocal
microscopic observations of stromal keratocytes in soft and
rigid contact lens wearers. Cornea. 2012;31:66–73. 166. Setala K, Vasara K, Vesti E, Ruusuvaara P. Effects of long-term
contact lens wear on the corneal endothelium. Acta
Ophthalmol Scand. 1998;76:299–303. 146. Kallinikos P, Morgan P, Efron N. Assessment of stromal
keratocytes and tear film inflammatory mediators during
extended wear of contact lenses. Cornea. 2006;25:1–10. 167. McMahon TT, Polse KA, McNamara N, Viana MA. Recovery
from induced corneal edema and endothelial morphology
after long-term PMMA contact lens wear. Optom Vis Sci. 1996;73:184–188. 147. Pimenides D, Steele CF, McGhee CN, Bryce IG. Deep corneal
stromal opacities associated with long term contact lens
wear. Br J Ophthalmol. 1996;80:21–24. 168. Doughty MJ, Aakre BM, Ystenaes AE, Svarverud E. Short-term
adaptation of the human corneal endothelium to continuous
wear of silicone hydrogel (lotrafilcon A) contact lenses after
daily hydrogel lens wear. Optom Vis Sci. 2005;82:473–480. 148. Brooks AM, Grant G, Westmore R, Robertson IF. Deep
corneal stromal opacities with contact lenses. Aust N Z J
Ophthalmol 1986;14:243–249. 169. IOVS j October 2013 j Vol. 54 j No. 11 j TFOS116 Confocal microscopy of contact
lens keratitis presenting as central toxic keratopathy. Eye
Contact Lens. 2011;37:377–380. 133. Diec J, Evans VE, Tilia D, Naduvilath T, Holden BA, Lazon de
la Jara P. Comparison of ocular comfort, vision, and SICS
during silicone hydrogel contact lens daily wear. Eye Contact
Lens. 2012;38:2–6. 154. Holden BA, Reddy MK, Sankaridurg PR, et al. Contact lens-
induced peripheral ulcers with extended wear of disposable
hydrogel lenses: histopathologic observations on the nature
and type of corneal infiltrate. Cornea. 1999;18:538–543. 134. Willcox MD, Phillips B, Ozkan J, et al. Interactions of lens
care with silicone hydrogel lenses and effect on comfort. Optom Vis Sci. 2010;87:839–846. 155. Hickson S, Papas E. Prevalence of idiopathic corneal
anomalies in a non contact lens-wearing population. Optom
Vis Sci. 1997;74:293–297. 135. Andrasko G, Ryen K. Corneal staining and comfort observed
with traditional and silicone hydrogel lenses and multipur-
pose solution combinations. Optometry. 2008;79:444–454. 156. Carnt NA, Evans VE, Naduvilath TJ, et al. Contact lens-related
adverse events and the silicone hydrogel lenses and daily
wear care system used. Arch Ophthalmol 2009;127:1616–
1623. 136. Tran N, Graham AD, Lin MC. Ethnic differences in dry eye
symptoms: Effects of corneal staining and length of contact
lens wear. Cont Lens Anterior Eye. In press. 157. Chalmers RL, Keay L, McNally J, Kern J. Multicenter case-
control study of the role of lens materials and care products
on the development of corneal infiltrates. Optom Vis Sci. 2012;89:316–325. 137. Efron N. Contact lens-induced changes in the anterior eye as
observed in vivo with the confocal microscope. Prog Retin
Eye Res. 2007;26:398–436. 158. Efron N. Corneal neovascularization. In: Efron N, ed. Contact
Lens Complications. London: Elsevier, 2012:214–224. 138. Patel S, McLaren J, Hodge D, Bourne W. Normal human
keratocyte density and corneal thickness measurement by
using confocal microscopy in vivo. Invest Ophthalmol Vis
Sci. 2001;42:333–339. 159. Zantos SG, Holden BA. Transient endothelial changes soon
after wearing soft contact lenses. Am J Optom Physiol Opt. 1977;54:856–858. 139. Hollingsworth J, Perez-Gomez I, Mutalib HA, Efron N. A
population study of the normal cornea using an in vivo, slit-
scanning confocal microscope. Optom Vis Sci. 2001;78:706–
711. 160. Inagaki Y, Akahori A, Sugimoto K, Kozai A, Mitsunaga S,
Hamano H. Comparison of corneal endothelial bleb forma-
tion and disappearance processes between rigid gas-perme-
able and soft contact lenses in three classes of dk/l. Eye
Contact Lens. 2003;29:234–237. 140. Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/2017 IOVS j October 2013 j Vol. 54 j No. 11 j TFOS118 CL Interactions With the Ocular Surface and Adnexa 193. Feng Y, Simpson TL. Corneal, limbal, and conjunctival
epithelial thickness from optical coherence tomography. Optom Vis Sci. 2008;85:E880–E883. 171. Wiffen SJ, Hodge DO, Bourne WM. The effect of contact lens
wear on the central and peripheral corneal endothelium. Cornea. 2000;19:47–51. 172. MacRae SM, Matsuda M, Shellans S. Corneal endothelial
changes associated with contact lens wear. CLAO J. 1989;15:
82–87. 194. Miri A, Alomar T, Nubile M, et al. In vivo confocal
microscopic findings in patients with limbal stem cell
deficiency. Br J Ophthalmol. 2012;96:523–529. 173. Stocker EG, Schoessler JP. Corneal endothelial polymegath-
ism induced by PMMA contact lens wear. Invest Ophthalmol
Vis Sci. 1985;26:857–863. 195. Goldberg MF, Bron AJ. Limbal palisades of Vogt. Trans Am
Ophthalmol Soc. 1982;80:155–171. 196. Meyer PA, Watson PG. Low dose fluorescein angiography of
the conjunctiva and episclera. Br J Ophthalmol. 1987;71:2–
10. 174. Schoessler JP, Woloschak MJ. Corneal endothelium in veteran
PMMA contact lens wearers. Int Contact Lens Clin. 1981;8:
19–25. 197. Meyer PA. The circulation of the human limbus. Eye (Lond). 1989;3:121–127. 175. Schoessler JP. Corneal endothelial polymegethism associated
with extended wear. Int Contact Lens Clin. 1983;10:144–156. 198. Schlotzer-Schrehardt U, Kruse FE. Identification and charac-
terization of limbal stem cells. Exp Eye Res. 2005;81:247–
264. 176. Hirst LW, Auer C, Tseng SC, Khodadoust AA. Specular
microscopy of hard contact lens wearers. Ophthalmology. 1984;91:1147–1153. 199. Kulkarni BB, Tighe PJ, Mohammed I, et al. Comparative
transcriptional profiling of the limbal epithelial crypt
demonstrates its putative stem cell niche characteristics. BMC Genomics. 2010;11:526. 177. Sweeney DF. Corneal exhaustion syndrome with long-term
wear of contact lenses. Optom Vis Sci. 1992;69:601–608. 178. Odenthal MT, Gan IM, Oosting J, Kijlstra A, Beekhuis WH. Long-term changes in corneal endothelial morphology after
discontinuation of low gas-permeable contact lens wear. Cornea. 2005;24:32–38. 200. Tseng SC. Concept and application of limbal stem cells. Eye
(Lond). 1989;3:141–157. 201. McMonnies CW, Chapman-Davies A, Holden BA. The vascular
response to contact lens wear. Am J Optom Physiol Opt. 1982;59:795–799. 179. Esgin H, Erda N. Corneal endothelial polymegethism and
pleomorphism induced by daily-wear rigid gas-permeable
contact lenses. CLAO J. 2002;28:40–43. 202. Papas EB. The role of hypoxia in the limbal vascular response
to soft contact lens wear. Eye Contact Lens. 2003;29:S72–
S74; discussion S83–S84, S192–S194. 180. Nieuwendaal CP, Odenthal MT, Kok JH, et al. Morphology and
function of the corneal endothelium after long-term contact
lens wear. IOVS j October 2013 j Vol. 54 j No. 11 j TFOS118 Invest Ophthalmol Vis Sci. 1994;35:3071–3077. 203. Dumbleton KA, Chalmers RL, Richter DB, Fonn D. Vascular
response to extended wear of hydrogel lenses with high and
low oxygen permeability. Optom Vis Sci. 2001;78:147–151. 181. Carlson KH, Bourne WM. Endothelial morphologic features
and function after long-term extended wear of contact
lenses. Arch Ophthalmol. 1988;106:1677–1679. 204. Papas EB, Vajdic CM, Austen R, Holden BA. High-oxygen-
transmissibility soft contact lenses do not induce limbal
hyperaemia. Curr Eye Res. 1997;16:942–948. 182. Lee JS, Park WS, Lee SH, Oum BS, Cho BM. A comparative
study of corneal endothelial changes induced by different
durations of soft contact lens wear. Graefes Arch Clin Exp
Ophthalmol. 2001;239:1–4. 205. Diec J, Lazon de la Jara P, Willcox M, Holden BA. The clinical
performance of lenses disposed of daily can vary consider-
ably. Eye Contact Lens. 2012;38:313–318. 183. Suzuki N, Okamura T. The effect of disposable contact lenses
on the corneal endothelium [in Japanese]. Nihon Ganka
Gakkai Zasshi. 2006;110:511–519. 206. Long B, McNally J. The clinical performance of a silicone
hydrogel lens for daily wear in an Asian population. Eye
Contact Lens. 2006;32:65–71. 184. Chang SW, Hu FR, Lin LL. Effects of contact lenses on corneal
endothelium—a morphological and functional study. Oph-
thalmologica. 2001;215:197–203. 207. Malet F, Pagot R, Peyre C, et al. Clinical results comparing
high-oxygen and low-oxygen permeable soft contact lenses
in France. Eye Contact Lens. 2003;29:50–54. 185. Doughty MJ, Aakre BM. Central versus paracentral endothe-
lial cell density values in relation to duration of soft contact
lens wear. Eye Contact Lens. 2007;33:180–184. 208. Chalmers RL, Dillehay S, Long B, et al. Impact of previous
extended and daily wear schedules on signs and symptoms
with high Dk lotrafilcon A lenses. Optom Vis Sci. 2005;82:
549–554. 186. Aakre BM, Ystenaes AE, Doughty MJ, Austrheim Ø, West-
erfjell B, Lie MT. A 6-month follow-up of successful refits from
daily disposable soft contact lenses to continuous wear of
high-Dk silicone-hydrogel lenses. Ophthalmic Physiol Opt. 2004;24:130–141. 209. Long B, Schweizer H, Bleshoy H, Zeri F. Expanding your use
of silicone hydrogel contact lenses: using lotrafilcon A for
daily wear. Eye Contact Lens. 2009;35:59–64. 187. Schoessler JP, Barr JT, Fresen DR. Corneal endothelial
observations of silicone elastomer contact lens wearers. Int
Contact Lens Clin. 1984;11:337–341. 210. Woods J, Jones L, Woods C, Schneider S, Fonn D. Use of a
photographic manipulation tool to assess corneal vascular
response. Optom Vis Sci. 2012;89:215–220. 188. Bergmanson JP. Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/2017 IOVS j October 2013 j Vol. 54 j No. 11 j TFOS116 Sanchis-Gimeno JA, Lleo A, Alonso L, Rahhal MS, Mart´ınez-
Soriano F. Differences in corneal anatomy in a pair of
monozygotic twins due to continuous contact lens wear. Cornea. 2003;22:243–245. 149. Remeijer L, van Rij G, Beekhuis WH, Polak BC, van Nes J. Deep corneal stromal opacities in long-term contact lens
wear. Ophthalmology. 1990;97:281–285. 150. Pinckers A, Eggink F, Aandekerk AL, van ’t Pad Bosch A. Contact lens-induced pseudo-dystrophy of the cornea? Doc
Ophthalmol. 1987;65:433–437. 170. Leem HS, Lee KJ, Shin KC. Central corneal thickness and
corneal endothelial cell changes caused by contact lens use
in diabetic patients. Yonsei Med J. 2011;52:322–325. IOVS j October 2013 j Vol. 54 j No. 11 j TFOS118 IOVS j October 2013 j Vol. 54 j No. 11 j TFOS119 Histopathological analysis of the corneal
epithelium after contact lens wear. J Am Optom Assoc. 1987;
58:812–818. 224. D’Aversa G, Luchs JL, Fox MJ, Rosenbaum PS, Udell IJ. Advancing wave-like epitheliopathy. Clinical features and
treatment. Ophthalmology. 1997;104:962–969. 246. Cogan DG, Kuwabara T, Donaldson DD, Collins E. Microcys-
tic dystrophy of the cornea. A partial explanation for its
pathogenesis. Arch Ophthalmol. 1974;92:470–474. 225. Schwartz GS, Holland EJ. Iatrogenic limbal stem cell
deficiency. Cornea. 1998;17:31–37. 226. Lim L, Wei RH. Laser in situ keratomileusis treatment for
myopia in a patient with partial limbal stem cell deficiency. Eye Contact Lens. 2005;31:67–69. 247. Dillehay SM. Does the level of available oxygen impact
comfort in contact lens wear? A review of the literature. Eye
Contact Lens. 2007;33:148–155. 227. Nguyen DQ, Srinivasan S, Hiscott P, Kaye SB. Thimerosal-
induced limbal stem cell failure: report of a case and review
of the literature. Eye Contact Lens. 2007;33:196–198. 248. Guillon M. Are silicone hydrogel contact lenses more
comfortable than hydrogel contact lenses? Eye Contact Lens. 2013;39:86–92. 228. Bhatia RP, Srivastava R, Ghosh A. Limbal stem cell study in
contact lens wearers. Ann Ophthalmol (Skokie). 2009;41:
87–92. 249. Ruiz-Montenegro J, Mafra CH, Wilson SE, Jumper JM, Klyce
SD, Mendelson EN. Gan IM, Corneal topographic alterations
in normal contact lens wearers. Ophthalmology. 1993;100:
128–134. 229. Chan CC, Holland EJ. Severe limbal stem cell deficiency from
contact lens wear: patient clinical features. Am J Ophthal-
mol. 2013;155:544–549.e2. 250. Gonzalez-Meijome JM, Gonzalez-Perez J, Cervi˜no A, Yebra-
Pimentel E, Parafita MA. Changes in corneal structure with
continuous wear of high-Dk soft contact lenses: a pilot study. Optom Vis Sci. 2003;80:440–446. 230. Martin R. Corneal conjunctivalization management with high
Dk RGP contact lenses. Cont Lens Anterior Eye. 2009;32:
147–150. 251. Liu Z, Pflugfelder SC. The effects of long-term contact lens
wear on corneal thickness, curvature, and surface regularity. Ophthalmology. 2000;107:105–111. 231. Schornack MM. Limbal stem cell disease: management with
scleral lenses. Clin Exp Optom. 2011;94:592–594. 252. Wang X, McCulley JP, Bowman RW, Cavanagh HD. Time to
resolution of contact lens-induced corneal warpage prior to
refractive surgery. CLAO J. 2002;28:169–171. 232. La Hood D, Sweeney DF, Holden BA. Overnight corneal
edema with hydrogel, rigid gas-permeable and silicone-
elastomer contact lenses. Int Contact Lens Clin. 1988;15:
149–153. 253. Alba-Bueno F, Beltran-Masgoret A, Sanjuan C, Biarn´es M,
Mar´ın J. Corneal shape changes induced by first and second
generation silicone hydrogel contact lenses in daily wear. IOVS j October 2013 j Vol. 54 j No. 11 j TFOS119 237. Thoft RA, Friend J. Biochmical aspects of contact lens wear. Am J Ophthalmol. 1975;80:139–145. 215. Santodomingo-Rubido J. The comparative clinical perfor-
mance of a new polyhexamethylene biguanide- vs a
polyquad-based contact lens care regime with two silicone
hydrogel contact lenses. Ophthalmic Physiol Opt. 2007;27:
168–173. 238. Martin DK, Fatt I. The presence of a contact lens induces a
very small increase in the anterior corneal surface temper-
ature. Acta Ophthalmol (Copenh). 1986;64:512–518. 216. Jeng BH, Halfpenny CP, Meisler DM, Stock EL. Management of
focal limbal stem cell deficiency associated with soft contact
lens wear. Cornea. 2011;30:18–23. 239. Hill RM. Osmotic edema associated with contact lens
adaptation. J Am Optom Assoc. 1975;46:897–899. 240. Efron N, Holden BA, Vannas A. Prostaglandin-inhibitor
naproxen does not affect contact lens-induced changes in
the human corneal endothelium. Am J Optom Physiol Opt. 1984;61:741–744. 217. Puangsricharern V, Tseng SC. Cytologic evidence of corneal
diseases with limbal stem cell deficiency. Ophthalmology. 1995;102:1476–1485. 218. Donisi PM, Rama P, Fasolo A, Ponzin D. Analysis of limbal
stem cell deficiency by corneal impression cytology. Cornea. 2003;22:533–538. 241. Nguyen T, Soni PS, Brizendine E, Bonanno JA. Variability in
hypoxia-induced corneal swelling is associated with variabil-
ity in corneal metabolism and endothelial function. Eye
Contact Lens. 2003;29:117–125. 219. Tan DT, Ficker LA, Buckley RJ. Limbal transplantation. Ophthalmology. 1996;103:29–36. 242. Morgan PB, Brennan NA, Maldonado-Codina C, Quhill W,
Rashid K, Efron N. Central and peripheral oxygen transmis-
sibility thresholds to avoid corneal swelling during open eye
soft contact lens wear. J Biomed Mater Res B Appl Biomater. 2010;92:361–365. 220. Jenkins C, Tuft S, Liu C, Buckley R. Limbal transplantation in
the management of chronic contact-lens-associated epitheli-
opathy. Eye (Lond). 1993;7:629–633. 221. Martin R. Corneal conjunctivalisation in long-standing
contact lens wearers. Clin Exp Optom. 2007;90:26–30. 243. Holden BA, Mertz GW. Critical oxygen levels to avoid corneal
edema for daily and extended wear contact lenses. Invest
Ophthalmol Vis Sci. 1984;25:1161–1167. 222. Bloomfield SE, Jakobiec FA, Theodore FH. Contact lens
induced keratopathy: a severe complication extending the
spectrum of keratoconjunctivitis in contact lens wearers. Ophthalmology. 1984;91:290–294. 244. Fonn D, du Toit R, Simpson TL, Vega JA, Situ P, Chalmers RL. Sympathetic swelling response of the control eye to soft
lenses in the other eye. Invest Ophthalmol Vis Sci. 1999;40:
3116–3121. 223. Clinch TE, Goins KM, Cobo LM. Treatment of contact lens-
related ocular surface disorders with autologous conjunctival
transplantation. Ophthalmology. 1992;99:634–638. 245. Bergmanson JP. IOVS j October 2013 j Vol. 54 j No. 11 j TFOS118 Histopathological analysis of corneal endo-
thelial polymegethism. Cornea. 1992;11:133–142. 211. Dillehay SM, Miller MB. Performance of Lotrafilcon B silicone
hydrogel contact lenses in experienced low-Dk/t daily lens
wearers. Eye Contact Lens. 2007;33:272–277. 189. Dutt RM, Stocker EG, Wolff CH, Glavan I, Lass JH. A
morphologic and fluorophotometric analysis of the corneal
endothelium in long-term extended wear soft contact lens
wearers. CLAO J. 1989;15:121–123. 212. Bergenske P, Long B, Dillehay S, et al. Long-term clinical
results: 3 years of up to 30-night continuous wear of
lotrafilcon A silicone hydrogel and daily wear of low-Dk/t
hydrogel lenses. Eye Contact Lens. 2007;33:74–80. 190. Bourne WM. Clinical estimation of corneal endothelial pump
function. Trans Am Ophthalmol Soc. 1998;96:229–239;
discussion 239–242. 213. Stern J, Wong R, Naduvilath TJ, Stretton S, Holden BA,
Sweeney DF. Comparison of the performance of 6- or 30-
night extended wear schedules with silicone hydrogel lenses
over 3 years. Optom Vis Sci. 2004;81:398–406. 191. Oyster CW. The cornea and the sclera. In: Oyster CW, ed. The
Human Eye: Structure and Function. Sunderland, MA:
Sinauer Associates Inc; 1999:325–378. 214. Fahmy M, Long B, Giles T, Wang CH. Comfort-enhanced daily
disposable contact lens reduces symptoms among weekly/
monthly wear patients. Eye Contact Lens. 2010;36:215–219. 192. Feng Y, Simpson TL. Comparison of human central cornea
and limbus in vivo using optical coherence tomography. Optom Vis Sci. 2005;82:416–419. CL Interactions With the Ocular Surface and Adnexa CL Interactions With the Ocular Surface and Adnexa IOVS j October 2013 j Vol. 54 j No. 11 j TFOS119 Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/2017 IOVS j October 2013 j Vol. 54 j No. 11 j TFOS120 Clin
Hemorheol Microcirc. 2012;51:77–86. 266. Maissa C, Guillon M, Garofalo RJ. Contact lens-induced
circumlimbal staining in silicone hydrogel contact lenses
worn on a daily wear basis. Eye Contact Lens. 2012;38:16–
26. 288. Knop E, Brewitt H. Induction of conjunctival epithelial
alterations by contact lens wearing. A prospective study. Ger
J Ophthalmol. 1992;1:125–134. 267. Maldonado-Codina C, Morgan PB, Schnider CM, Efron N. Short-term physiologic response in neophyte subjects fitted
with hydrogel and silicone hydrogel contact lenses. Optom
Vis Sci. 2004;81:911–921. 289. Marner K. ‘Snake-like’ appearance of nuclear chromatin in
conjunctival epithelial cells from patients with keratocon-
junctivitis sicca. Acta Ophthalmol. 1980;58:849–853. 268. Lakkis C, Brennan NA. Bulbar conjunctival fluorescein
staining in hydrogel contact lens wearers. CLAO J. 1996;22:
189–194. 290. Knop E, Brewitt H. Conjunctival cytology in asymptomatic
wearers of soft contact lenses. Graefes Arch Clin Exp
Ophthalmol. 1992;230:340–347. 291. Knop E, Brewitt H. Morphology of the conjunctival epithelium
in spectacle and contact lens wearers—a light and electron
microscopic study. Contactologia. 1992;14E:108–120. 269. Morgan PB, Chamberlain P, Moody K, Maldonado-Codina C. Ocular physiology and comfort in neophyte subjects fitted
with daily disposable silicone hydrogel contact lenses. Cont
Lens Anterior Eye. 2013;36:118–125. 292. Adar S, Kanpolat A, S¨ur¨uc¨u S, Uckakhan OO. Conjunctival
impression cytology in patients wearing contact lenses. Cornea. 1997;16:289–294. 270. Guillon M, Maissa C. Bulbar conjunctival staining in contact
lens wearers and non lens wearers and its association with
symptomatology. Cont Lens Anterior Eye. 2005;28:67–73. 293. Sengor T, Gurdal C, Kirimlioglu H, Irke¸c M, Aydin S. Colour-
coded mapping technique in impression cytology—findings
in soft contact lens wearers and patients with other external
eye diseases. Ophthalmologica. 2002;216:155–158. 271. Young G, Coleman S. Poorly fitting soft lenses affect ocular
integrity. CLAO J. 2001;27:68–74. 272. Ozkan J, Ehrmann K, Meadows D, Lally J, Holden B, de la Jara
PL. Lens parameter changes under in vitro and ex vivo
conditions and their effect on the conjunctiva. Cont Lens
Anterior Eye. 2013;36:171–175. 294. Simon P, Jaison S, Chopra SK, Jacob S. Conjunctival
impression cytology in contact lens wearers. Indian J
Ophthalmol. 2002;50:301–306. 273. van der Worp E, de Brabander J, Hendrikse F. Evaluation of
signs and symptoms in 3- and 9-o’clock staining. Optom Vis
Sci. 2009;86:260–265. 295. Guzman-Aranguez A, Argueso P. Structure and biological
roles of mucin-type O-glycans at the ocular surface. Ocul
Surf. 2010;8:8–17. 274. Tighe B. Contact lens materials. In: Phillips A, Speedwell L,
eds. Contact Lenses. Edinburgh: Butterworth-Heinemann;
2006:59–78. 296. IOVS j October 2013 j Vol. 54 j No. 11 j TFOS120 257. Maldonado-Codina C, Morgan PB, Efron N, Efron S. Compar-
ative clinical performance of rigid versus soft hyper Dk
contact lenses used for continuous wear. Optom Vis Sci. 2005;82:536–548. 279. Graham AD, Truong TN, Lin MC. Conjunctival epithelial flap
in continuous contact lens wear. Optom Vis Sci. 2009;86:
e324–e331. 280. Santodomingo-Rubido J, Wolffsohn J, Gilmartin B. Conjunc-
tival epithelial flaps with 18 months of silicone hydrogel
contact lens wear. Eye Contact Lens. 2008;34:35–38. 258. Woods CA, Efron N. Regular replacement of daily-wear rigid
gas-permeable contact lenses. J Br Contact Lens Assoc. 1996;
19:83–89. 281. Miller WL, Narayanan S, Jackson J, Bergmanson J. The
association of bulbar conjunctival folds with other clinical
findings in normal and moderate dry eye subjects. Optometry
2003;74:576–582. 259. Woods CA, Efron N. Regular replacement of extended wear
rigid gas permeable contact lenses. CLAO J. 1996;22:172–
178. 260. Wilson SE, Lin DT, Klyce SD, Reidy JJ, Insler MS. Rigid contact
lens decentration: a risk factor for corneal warpage. CLAO J. 1990;16:177–182. 282. Pult H, Purslow C, Berry M, Murphy PJ. Clinical tests for
successful contact lens wear: relationship and predictive
potential. Optom Vis Sci. 2008;85:E924–E929. 261. Swarbrick HA, Wong G, O’Leary DJ. Corneal response to
orthokeratology. Optom Vis Sci. 1998;75:791–799. 283. Li DQ, Meller D, Liu Y, Tseng SC. Overexpression of MMP-1
and MMP-3 by cultured conjunctivochalasis fibroblasts. Invest Ophthalmol Vis Sci. 2000;41:404–410. 262. Alharbi A, Swarbrick HA. The effects of overnight orthokera-
tology lens wear on corneal thickness. Invest Ophthalmol
Vis Sci. 2003;44:2518–2523. 284. Zhang XR, Zhang ZY, Hoffman MR, Li QS, Liu B, Zhou HM. The effect of age and conjunctivochalasis on conjunctival
thickness. Curr Eye Res. 2013;38:331–334. 263. Sridharan R, Swarbrick H. Corneal response to short-term
orthokeratology lens wear. Optom Vis Sci. 2003;80:200–206. 285. Mimura T, Usui T, Yamamoto H. Conjunctivochalasis and
contact lenses. Am J Ophthalmol. 2009;148:20–25.e1. 264. Purslow C, Wolffsohn JS, Santodomingo-Rubido J. The effect
of contact lens wear on dynamic ocular surface temperature. Cont Lens Anterior Eye. 2005;28:29–36. 286. Owen CG, Fitzke FW, Woodward EG. A new computer
assisted objective method for quantifying vascular changes of
the bulbar conjunctivae. Ophthalmic Physiol Opt. 1996;16:
430–437. 265. Ooi EH, Ng EY, Purslow C, Acharya R. Variations in the
corneal surface temperature with contact lens wear. Proc
Inst Mech Eng H. 2007;221:337–349. 287. Cheung AT, Hu BS, Wong SA, et al. Microvascular abnormal-
ities in the bulbar conjunctiva of contact lens users. IOVS j October 2013 j Vol. 54 j No. 11 j TFOS119 Cont Lens Anterior Eye. 2009;32:88–92. 233. Bonanno JA. Effects of contact lens-induced hypoxia on the
physiology of the corneal endothelium. Optom Vis Sci. 2001;
78:783–790. 254. Santodomingo-Rubido J, Gilmartin B, Wolffsohn J. Refractive
and biometric changes with silicone hydrogel contact lenses. Optom Vis Sci. 2005;82:481–489. 234. Stickel TE, Bonanno JA. The relationship between corneal
oxygen tension and hypoxic corneal edema. Optometry. 2002;73:598–604. 255. Yeniad B, Adam YS, Bilgin LK, G¨oz¨um N. Effect of 30-day
continuous wear of silicone hydrogel contact lenses on
corneal thickness. Eye Contact Lens. 2004;30:6–9. 235. Klyce SD. Stromal lactate accumulation can account for
corneal oedema osmotically following epithelial hypoxia in
the rabbit. J Physiol. 1981;321:49–64. 236. Iskeleli G, Karakoc Y, Akdeniz-Kayhan B, Kayhan U, Gurler B,
Ozkan S. Comparison of tear lactate dehydrogenase activities
of different types of contact lens wearers and normal control
group. CLAO J. 1999;25:101–104. 256. Dumbleton KA, Chalmers RL, Richter DB, Fonn D. Changes
in myopic refractive error with nine months’ extended wear
of hydrogel lenses with high and low oxygen permeability. Optom Vis Sci. 1999;76:845–849. CL Interactions With the Ocular Surface and Adnexa IOVS j October 2013 j Vol. 54 j No. 11 j TFOS120 Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/2017 IOVS j October 2013 j Vol. 54 j No. 11 j TFOS121 322. Ong BL, Larke JR. Meibomian gland dysfunction: some
clinical, biochemical and physical observations. Ophthalmic
Physiol Opt. 1990;10:144–148. 301. Doughty MJ. Contact lens wear and the development of
squamous metaplasia of the surface cells of the conjunctiva. Eye Contact Lens. 2011;37:274–281. 323. Marren SE. Contact lens wear, use of eye cosmetics, and
Meibomian gland dysfunction. Optom Vis Sci. 1994;71:60–
62. 302. Doughty MJ. Objective assessment of contact lens wear-
associated conjunctival squamous metaplasia by linear
measures of cell size, shape and nucleus-to-cytoplasm ratios. Curr Eye Res. 2011;36:599–606. 324. Ong BL. Relation between contact lens wear and Meibomian
gland dysfunction. Optom Vis Sci. 1996;73:208–210. 303. Calonge M, Diebold Y, S´aez V, et al. Impression cytology of
the ocular surface: a review. Exp Eye Res. 2004;78:457–
472. 325. Schaumberg DA, Nichols JJ, Papas EB, Tong L, Uchino M,
Nichols KK. The international workshop on meibomian
gland dysfunction: report of the subcommittee on the
epidemiology of, and associated risk factors for, MGD. Invest
Ophthalmol Vis Sci. 2011;52:1994–2005. 304. Doughty MJ. Reliability of nucleus-to-cell and nucleus-to-
cytoplasm calculations for conjunctival impression cytology
specimens. Curr Eye Res. 2012;37:583–591. 305. Kessing SV. Investigations of the conjunctival mucin. (Quantitative studies of the goblet cells of conjunctiva). (Preliminary report). Acta Ophthalmol (Copenh). 1966;44:
439–453. 326. Arita R, Itoh K, Inoue K, Kuchiba DA, Yamaguchi T, Amano S. Contact lens wear is associated with decrease of meibomian
glands. Ophthalmology. 2009;116:379–384. 327. Knop E, Knop N. Meibomian glands: part IV. Functional
interactions in the pathogenesis of meibomian gland
dysfunction (MGD) [in German]. Ophthalmologe. 2009;
106:980–987. 306. Efron N, Al-Dossari M, Pritchard N. Confocal microscopy of
the bulbar conjunctiva in contact lens wear. Cornea. 2010;
29:43–52. 307. Allansmith MR. Pathology and treatment of giant papillary
conjunctivitis. I. The US perspective. Clin Ther. 1987;9:443–
450. 328. Blackie CA, Korb DR, Knop E, Bedi R, Knop N, Holland EJ. Nonobvious obstructive meibomian gland dysfunction. Cor-
nea. 2010;29:1333–1345. 308. Korb DR, Allansmith MR, Greiner JV, Henriquez AS,
Richmond PP, Finnemore VM. Prevalence of conjunctival
changes in wearers of hard contact lenses. Am J Ophthal-
mol. 1980;90:336–341. 329. Nichols JJ, Sinnott LT. Tear film, contact lens, and patient-
related factors associated with contact lens-related dry eye. Invest Ophthalmol Vis Sci. 2006;47:1319–1328. 330. Paugh JR, Knapp LL, Martinson JR, Hom MM. Meibomian
therapy in problematic contact lens wear. Optom Vis Sci. 1990;67:803–806. 309. Spring TF. Reaction to hydrophilic lenses. Med J Aust. 1974;1:
449–450. 310. IOVS j October 2013 j Vol. 54 j No. 11 j TFOS121 Allansmith MR, Korb DR, Greiner JV, Henriquez AS, Simon
MA, Finnemore VM. Giant papillary conjunctivitis in contact
lens wearers. Am J Ophthalmol. 1977;83:697–708. 331. Arita R, Itoh K, Inoue K, Amano S. Noncontact infrared
meibography to document age-related changes of the
meibomian glands in a normal population. Ophthalmology. 2008;115:911–915. 311. Allansmith MR, Korb DR, Greiner JV. Giant papillary
conjunctivitis induced by hard or soft contact lens wear:
quantitative histology. Ophthalmology. 1978;85:766–778. 332. Villani E, Ceresara G, Beretta S, Magnani F, Viola F, Ratiglia R. In vivo confocal microscopy of meibomian glands in contact
lens wearers. Invest Ophthalmol Vis Sci. 2011;52:5215–
5219. 312. Allansmith MR, Baird RS, Greiner JV. Vernal conjunctivitis and
contact lens-associated giant papillary conjunctivitis com-
pared and contrasted. Am J Ophthalmol. 1979;87:544–555. 333. Robin JB, Nobe JR, Suarez E, Jester JV, Smith RE. Meibomian
gland evaluation in patients with extended wear soft contact
lens deposits. CLAO J. 1986;12:95–98. 313. Lofstrom T, Anderson JS, Kruse A. Tarsal abnormalities: a new
grading system. CLAO J. 1998;24:210–215. 334. Green-Church KB, Butovich I, Willcox M, et al. The
international workshop on meibomian gland dysfunction:
report of the subcommittee on tear film lipids and lipid-
protein interactions in health and disease. Invest Ophthal-
mol Vis Sci. 2011;52:1979–1993. 314. Efron N, Pritchard N, Brandon K, et al. A survey of the use of
grading scales for contact lens complications in optometric
practice. Clin Exp Optom. 2011;94:193–199. 315. Young G, Keir N, Hunt C, Woods CA. Clinical evaluation of
long-term users of two contact lens care preservative
systems. Eye Contact Lens. 2009;35:50–58. 335. Pucker AD, Nichols JJ. Analysis of meibum and tear lipids. Ocul Surf. 2012;10:230–250. 316. Knop N, Knop E. Meibomian glands. Part I: anatomy,
embryology and histology of the Meibomian glands [in
German]. Ophthalmologe. 2009;106:872–883. 336. Knop E, Knop N, Zhivov A, et al. The lid wiper and muco-
cutaneous junction anatomy of the human eyelid margins: an
in vivo confocal and histological study. J Anat. 2011;218:449–
461. 317. Knop E, Knop N, Millar T, Obata H, Sullivan DA. The
international workshop on meibomian gland dysfunction:
report of the subcommittee on anatomy, physiology, and
pathophysiology of the meibomian gland. Invest Ophthalmol
Vis Sci. 2011;52:1938–1978. 337. Kessing SV. A new division of the conjunctiva on the basis of
x-ray examination. Acta Ophthalmol (Copenh). 1967;45:
680–683. 338. Lowther GE, Hill RM. IOVS j October 2013 j Vol. 54 j No. 11 j TFOS120 Knop N, Korb DR, Blackie CA, Knop E. The lid wiper
contains goblet cells and goblet cell crypts for ocular surface
lubrication during the blink. Cornea. 2012;31:668–679. 275. Holden BA, Stephenson A, Stretton S, et al. Superior
epithelial arcuate lesions with soft contact lens wear. Optom
Vis Sci. 2001;78:9–12. 297. Schmidt TA, Sullivan DA, Knop E, et al. Transcription,
translation, and function of lubricin, a boundary lubricant, at
the ocular surface. JAMA Ophthalmol. 2013;131:766–776. 276. Lofstrom T, Kruse A. A conjunctival response to silicone
hydrogel lens wear. Contact Lens Spectrum. 2005;20:42–44. 298. Doughty MJ. Contact lens wear and the goblet cells of the
human conjunctiva—a review. Cont Lens Anterior Eye. 2011;
34:157–163. 277. Bergmanson JP, Tukler J, Leach NE, Alabdelmoneam M, Miller
WL. Morphology of contact lens-induced conjunctival
epithelial flaps: a pilot study. Cont Lens Anterior Eye. 2012;35:185–188. 299. Doughty MJ. Goblet cells of the normal human bulbar
conjunctiva and their assessment by impression cytology
sampling. Ocul Surf. 2012;10:149–169. 278. Markoulli M, Francis IC, Yong J, et al. A histopathological
study of bulbar conjunctival flaps occurring in 2 contact lens
wearers. Cornea. 2011;30:1037–1041. 300. Doughty MJ. Sampling area selection for the assessment of
goblet cell density from conjunctival impression cytology
specimens. Eye Contact Lens. 2012;38:122–129. Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/2017 CL Interactions With the Ocular Surface and Adnexa CL Interactions With the Ocular Surface and Adnexa IOVS j October 2013 j Vol. 54 j No. 11 j TFOS121 IOVS j October 2013 j Vol. 54 j No. 11 j TFOS122 CL Interactions With the Ocular Surface and Adnexa with those of HIV-negative patients. Cornea. 1997;16:400–
405. 342. Korb DR, Blackie C. Marx’s line of the upper lid is visible in
upgaze without lid eversion. Eye Contact Lens. 2010;36:149–
151. 359. Albietz JM, Lenton LM. Effect of antibacterial honey on the
ocular flora in tear deficiency and meibomian gland disease. Cornea. 2006;25:1012–1019. 343. Korb DR, Greiner JV, Herman JP, et al. Lid-wiper epitheliop-
athy and dry-eye symptoms in contact lens wearers. CLAO J. 2002;28:211–216. 360. Sankaridurg PR, Markoulli M, de la Jara PL, et al. Lid and
conjunctival micro biota during contact lens wear in
children. Optom Vis Sci. 2009;86:312–317. 344. Korb DR, Herman JP, Greiner JV, et al. Lid wiper epitheliop-
athy and dry eye symptoms. Eye Contact Lens. 2005;31:2–8. 345. Sattler H. Beitrag zur Kenntnis der normalen Bindehaut des
Menschen. Graefes Arch Ophthalmol. 1877;23:1–28. 361. Larkin DF, Leeming JP. Quantitative alterations of the
commensal eye bacteria in contact lens wear. Eye (Lond). 1991;5:70–74. 346. Virchow H, Saemisch T. Mikroskopische Anatomie der
¨usseren Augenhaut und des Lidapparates in Graefe-
Saemisch Handbuch der gesamten Augenheilkunde, Band
1, 1. Abteilung, Kapitel II. Leibzig: Verlag W. Engelmann;
1910:431. 362. Willcox MD, Power KN, Stapleton F, Leitch C, Harmis N,
Sweeney DF. Potential sources of bacteria that are isolated
from contact lenses during wear. Optom Vis Sci. 1997;74:
1030–1038. 347. Ehlers N. The precorneal film. Biomicroscopical, histological
and chemical investigations. Acta Ophthalmol Suppl. 1965:
81(suppl):1–134. 363. Leitch EC, Harmis NY, Corrigan KM, Wilcox MD. Identifica-
tion and enumeration of staphylococci from the eye during
soft contact lens wear. Optom Vis Sci. 1998;75:258–265. 348. Korb DR, Herman JP, Blackie CA, et al. Prevalence of lid
wiper epitheliopathy in subjects with dry eye signs and
symptoms. Cornea. 2010;29:377–383. 364. Dumbleton KA, Woods CA, Jones LW, Fonn D. Comfort and
adaptation to silicone hydrogel lenses for daily wear. Eye
Contact Lens. 2008;34:215–223. 349. Korb DR, Herman JP, Finnemore VM, Exford JM, Blackie CA. An evaluation of the efficacy of fluorescein, rose bengal,
lissamine green, and a new dye mixture for ocular surface
staining. Eye Contact Lens. 2008;34:61–64. 365. Tsubota K. Tear dynamics and dry eye. Prog Retin Eye Res. 1998;17:565–596. 366. Tsubota K, Hata S, Okusawa Y, Egami F, Ohtsuki T, Nakamori
K. Quantitative videographic analysis of blinking in normal
subjects and patients with dry eye. Arch Ophthalmol. 1996;
114:715–720. 350. IOVS j October 2013 j Vol. 54 j No. 11 j TFOS122 Yeniad B, Beginoglu M, Bilgin LK, et al. Lid-wiper epitheli-
opathy in contact lens users and patients with dry eye. Eye
Contact Lens. 2010;36:140–143. 367. Miller D. An analysis of the physical forces applied to a
corneal contact lens. Arch Ophthalmol. 1963;70:823–829. 351. Shiraishi A, Yamanishi S, Yamamoto Y, Yamaguchi M, Ohashi
Y. Lid-wiper epitheliopathy in patients with dry eye
symptoms [in Japanese]. Nihon Ganka Gakkai Zasshi. 2009;113:596–600. 368. Schnider CM, Terry RL, Holden BA. Effect of lens design on
peripheral corneal desiccation. J Am Optom Assoc. 1997;68:
163–170. 352. Berry M, Pult H, Purslow C, Murphy PJ. Mucins and ocular
signs in symptomatic and asymptomatic contact lens wear. Optom Vis Sci. 2008;85:E930–E938. 369. Schnider CM, Terry RL, Holden BA. Effect of patient and lens
performance characteristics on peripheral corneal desicca-
tion. J Am Optom Assoc. 1996;67:144–150. 353. Stapleton F, Willcox MD, Fleming CM, Hickson S, Sweeney
DF, Holden BA. Changes to the ocular biota with time in
extended- and daily-wear disposable contact lens use. Infect
Immun. 1995;63:4501–4505. 370. Allaire PE, Flack RD. Squeeze forces in contact lenses with a
steep base curve radius. Am J Optom Physiol Opt. 1980;57:
219–227. 371. Chauhan A, Radke CJ. The role of fenestrations and channels
on the transverse motion of a soft contact lens. Optom Vis
Sci. 2001;78:732–743. 354. Stapleton F, Willcox MD, Sansey N, Holden BA. Ocular
microbiota and polymorphonuclear leucocyte recruitment
during overnight contact lens wear. Aust N Z J Ophthalmol. 1997;25:S33–S35. 372. Creech JL, Chauhan A, Radke CJ. Dispersive mixing in the
posterior tear film under a soft contact lens. Ind Eng Chem
Res. 2001;40:3015–3026. 355. Hart DE, Hosmer M, Georgescu M, Farris RL. Bacterial assay
of contact lens wearers. Optom Vis Sci. 1996;73:204–207. 373. Little SA, Bruce AS. Hydrogel (Acuvue) lens movement is
influenced by the postlens tear film. Optom Vis Sci. 1994;71:
364–370. 356. Szczotka-Flynn LB, Bajaksouzian S, Jacobs MR, Rimm A. Risk
factors for contact lens bacterial contamination during
continuous wear. Optom Vis Sci. 2009;86:1216–1226. 374. McNamara NA, Polse KA, Brand RJ, Graham AD, Chan JS,
McKenney CD. Tear mixing under a soft contact lens: effects
of lens diameter. Am J Ophthalmol. 1999;127:659–665. 357. Ozkan J, Zhu H, Gabriel M, Holden BA, Willcox MD. Effect of
prophylactic antibiotic drops on ocular microbiota and
physiology during silicone hydrogel lens wear. Optom Vis
Sci. 2012;89:326–335. 375. Knop E, Reale E. IOVS j October 2013 j Vol. 54 j No. 11 j TFOS121 Sensitivity threshold of the lower lid
margin in the course of adaptation to contact lenses. Am J
Optom Arch Am Acad Optom. 1968;45:587–594. 318. Knop E, Knop N, Schirra F. Meibomian glands. Part II:
physiology, characteristics, distribution and function of
meibomian oil [in German]. Ophthalmologe. 2009;106:
884–892. 339. Norn MS. Vital staining of the canaliculus lacrimalis and the
palpebral border (Marx’ line). Acta Ophthalmol (Copenh). 1966;44:948–959. 319. Nelson JD, Shimazaki J, Benitez-del-Castillo JM, et al. The
international workshop on meibomian gland dysfunction:
report of the definition and classification subcommittee. Invest Ophthalmol Vis Sci. 2011;52:1930–1937. 340. Doughty MJ, Naase T, Donald C, Hamilton L, Button NF. Visualisation of ‘‘Marx’s line’’ along the marginal eyelid
conjunctiva of human subjects with lissamine green dye. Ophthalmic Physiol Opt. 2004;24:1–7. 320. Korb DR, Henriquez AS. Meibomian gland dysfunction and
contact lens intolerance. J Am Optom Assoc. 1980;51:243–
251. 341. Shaw AJ, Collins MJ, Davis BA, Carney LG. Eyelid pressure:
inferences from corneal topographic changes. Cornea. 2009;
28:181–188. 321. Henriquez AS, Korb DR. Meibomian glands and contact lens
wear. Br J Ophthalmol. 1981;65:108–111. Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/2017 Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/2017 CL Interactions With the Ocular Surface and Adnexa IOVS j October 2013 j Vol. 54 j No. 11 j TFOS122 IOVS j October 2013 j Vol. 54 j No. 11 j TFOS122 Fine structure and significance of snakelike
chromatin in conjunctival epithelial cells. Invest Ophthalmol
Vis Sci. 1994;35:711–719. 358. Gritz DC, Scott TJ, Sed´o SF, Cevallos AV, Margolis TP,
Whitcher JP. Ocular flora of patients with AIDS compared Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/2017 Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933599/ on 03/07/2017
| 3,000 |
bub_gb_24hxnB-7JYIC_5
|
Latin-PD
|
Open Culture
|
Public Domain
| 1,643 |
Esdras et Nehemias. Commentario literali allegorico, et morali, primùm illustrati. Authore R.P. Nicolao Lombardo, Macerensi Societatis Iesu theologo. ..
|
Lombard, Nicolas
|
Latin
|
Spoken
| 7,048 | 18,293 |
exccptis, qux pauloancc retulimus , vt poce nunquam mandaca hccris , excidc- lint. Addcndum hlc quoquc quod icftc oblcruauit San&ius in Zachariam , non admodum laborandum cflc inScriptura facra, dc anno vulgari , fcu pohtico,cciam ciim fcrmo cft, dc rc poUtica , ac propha- na , nunquam cnim , aut fcrc nunquam 1 1 . Ds fsrtem feptem , net non tjr oclo , op- timnm fsrtem femmiseonfer menfe Tijri, in sgrum tuum , neque tsmen in menfe Cssleu , sfeminsndo suocsre ■ vbiagic dc mcnfc Scptembri , &c O&obri , qui n* > uuiiiju*i» ""»■ » - — 1 r * facrara Scripcuram, annivulgaris racio- g cura a Nifsn deducti lcpcimus iinc , &c <%A"tiinc. \Ar\nr\ fnnt fcmcnri tacicnda*.(i ncm habcrc , &c ccrtc cxempla occurrunt nonpauca, in quibus &c ordo mcnfiura notatur , &c numcrus : dc rcbus oranino non (acris , qux dc anno facro eflc intel- ligcnda ncrao ibitinficias. Ec i. fit cx r. Machab. cap. 4. Etsnte mstutinumjur- rexemntquints & vicefims dte menjis no- ni. Hic cft racnfis Cssleu z. Efther j. Hic eftmenfts frimus , cuim vocsbulum efl jiifsm- 6c cap. 8. Erst *tuem temput ter- tij menfts , qui sfpeUst^Siusr,. &c cap.2. oftauus , idonci func femcnci facicndx.u* vcro a mcnfe Scpccmbri , eflecMarcius fcpcimus , octauus Aprilis, qui menfes inepti funt fcmcnci faciendx , quia cunc mecuncur frugcs , in Iudxa,8c raeflis hor- dcacex manipuli cffcruntur.Eam ob rcm, in eo qucm conftituimus ordine, non tara vulgaris anni , quam facri , rationcm ha- bcndam efle duximus , ficque primo loco menfcm Maruum , qui vcrc anni facn prirauseft , confticuunus. H primutnEfdrx.1 ^ CAPVT PRIMVM. SVMMA SEV SYNOPSIS Capitis. / dum bene capra Babylone , deuiflifque Chaldais Cyrus in illo* rum Imperium pedem infertt cum ecce in tanti tamque eximij , vt tpfe tnterpretatur , a ludaorum Deo accepti benefcii memmam, acltonemtjue grattarum t omntbus ,cjm cx Ifraeliticogenere ejfent, ditiontjua (ubdttts , m lJacrtam remtgrandi itbere , ibtcpuc inflaurandi templi, quod (haldaorum ftammis atque tnccndto vajiatum fundttits Cr euerfum noue- rat%facultatemjacit, idcjne non voce tantum .fdf.riptura , hoccfr} ediclo, rtgta fidecy authorttate frrmato : cjuin vt iterillud ,fane longum, commodius confi. ciant, edicit iis cjut Babylone ,aut vbtltbet ,tnreotonibusfuis, ctiamnum adhuc permanere ac commorari maltnt , vtpropecluros tn I udaamgentiles fuos , fuo are atcjueadeo caterts omnibus , cumudprof-cfltonem injtituendam t tum ad operis molittonem tnchoandam tneccfj arits fubjtdtts adiuuare neyauenturt cjuodproii- xe , nec tnmtt prafhtere , immo , & Rex tpfe ,pro re igiofo templt cultu, atcjue ad adi< facra mmtjlertum , vafa omnta aurea , argcntca , ac demumt quicqutd oiifhprctiojum Nabuchodonojorex templo ,invrbisdireptione fujlulerat , hbera- Itter Iudais rejHtuitt &* permanus vmus c Principtbus Hterufalem rcportari curautt. A Domini Dci Ifrael, ipfc eft Dcus quicft inj-hcrufalcm. CAPVT PRIMVM Eldrx. N Annoprimo Cyri Rcgis Pcrfarum , vc complcrctur vcrbum Domini , cxorc Hic- remix fufcirauit Dominus fpin tum Cyri Rcgis- i. Hxc dicic Cyrus Rex Pcrfa- rum , Omnia Rcgna dcdic mihi Dominus Dcus cccli,& lpfcprx- ccpic mihi vc xdificarcm ci do- muminHicruIalcm quxcftinlu- dxa. 3. Quiseft in vobis dc vniucrfo populo cius,fit Dcus lllius cum ip- io , afcendat in Hicrulalctn qux cftin ludxj , & xdihcctdomum B 4. Ec omncs reliqui in cunctis locis vbicumquc habitanc adiu- ucntcum viridcloco fuo argcnco 6c aurc, & fubftantia & pcconbus, cxcepcoquod voluncarie ofrcrunr ccmplo Dci quod cft in Hicrufa- lcm. 5. Ec furrexcrunc principespa- rrum dc IudacV: Bcniamin , &Sa- ccrdotcsc\'.Leuita:, &omniscuius Dcus fufcicauit fpiritum, vc afcen- dcrcnc ad xdificandum templum Domini quoderacinHierufalcm, 6. Vniucrfiqucquierant in cir- cuitu , adiuucrunc manus corum invafisargcntcis&aurcis, in fub- ftantu & lumcncis, in lupcllcdcili, cxccptishis qux/potcobtuleranc. 7. Rcx quoquc Cyrus proculic primutn Efdrx., 4« phushb. 10. Anciquit. cap. 12. vbi ftacim A eius» vti 6. Danicliscapitccontinctur,C/* poft dcui&am Babyloncm , Danialcm ri rtgis Perfmrmm , &c quidni 8c Mcdo- Propheum a Dario vi&orc in Mcdiam du&um , maximoque in honore ibi ha- bitum rcfcrt , fcd cx Hieronymo , mco iudicio,rcstotafaciliusilluirratur. Is igi- . tur in 5. caput DanieLU fic edificrit: quod, jtMiHjmt i -f vlMtmte Qyro Rcvc Vcrfmrum rjr umtttMm DMrt0 Rege Mcdorum ,Jolms Dmnmtjmc- tlUftr/tt: <*fi*(fe i» regnt Jcribitmr , ordo st*tuejr proptnqnitstit ejr regni Jermstms tjt. Ds- rims tntm ftxsgints duormm snnormm er.it & Msim regnum Medorum qusm Verfsrum legimms , rjr suunculus erst rum ? quia nirairura , primum Impcrium deui&o Aftyag;: , auo fuo , vr rcferc lufti- nuslib. 1. aut qudd Xcnophon indicat, Cyaxare a.iunculo morcuo , urxta alios Dario , Medorum Impcnum tranftulit in Pcrfas, 8c licet regnum Medorum clTer honorabilius , tamcn caput Monarchix Cnr j^- pofuitin Pcrfidc ', co quod ibi primd rc- tnr Cjrut gnauerat , &c nuta Perfx lpfum euexcrant Rtx Vtrft- in Regnum. ha Lyranus in hunc locum , rMm u*~ ncquectiam hinccxiftimcshoc temporc, rT« "** non fuifle apud Cyrum, rJabylonis Im- ^^^, qmsre qui pnor erst iure nstmr* /mcceffor B pcrium , fcdapud Darium duntaxat ,c uis regntdebuttnmmer/tri.vndecrin vifione auunculum , qudd hic Rex Pcrtanimvo qm* contrs Bsbjlonem legitmr t*m in tf*j* e*p. 18. qm*m tnHierem. c*p. lft snimsd- uerttrc lictt,eos qut Bsbjlonem®num Chsldsorum emerfmri ersnt folos Medos nominsri , nulls Vcrjsrum f*H* mcntie- »e. HxcHicron.quxvcaliaSan£tio non difpliccnt, quod rcm dirTicilem, fi non omnino , faltcm aliqua ratione compo- nunt,fcd quodaddit Cyrum non um bcl • h Babylonici auftorcm quam adiutorcm fuifle vcrcor , vt oranibus non probct. ccfi cnim cum Dario auunculo copias fuas coniunxcrit, tamcn bdlo primura Baby- lone appctufic, ac prxcipuas parccs in illa oppugnanda, cxpugnanda , dir picnda- quc obiifte ac demura rcra orancm cius prxfcrtim opcra confe&am , paflim vno omnes Hiftorici confenfu aircuerant. Scd quxras , quid caufic fit cur cura Ba- curvr*- bylonici Impcrii cucrforcm omncspro- fh*n* hi- phanxhiitonxfcriptorcs,CynimagnoI- Sfwim cy- cant , Darii vix aut nunquam meminc- mm vnmm rint, facrx fcnpturx conua,inhocfaci- ftreBdlj- nurc vulgando , Darium vnura cclebrcnt, ""t 'tutr Cyrum Penc pi^tcreant ; dc prophanis ftrtm ttU fcriproribus , hxceftcpoccft ratio, quod Irtmt S*- partira htincDarium Mcdum , Aftyagis cctur , tc inierius v. 1. fc regem Pcrfarum appcllct ipfe , non regcra Babylonis: HA dttit Cjms rex Perjsrmm. Cum cnim Chaldxomm Imperium , cuius eracca- put Babylon , Babylone cap» transfcrrc- tur ad Perfas , qui fibi Rceis Pcrfarum vendicat nomen , idcm libi Babylonis vendicat Impcrium : vno itaquc ob hanc cauiam Rcgis Perlarurn nommc contcn- ais fuit ; nam quod addunt aliqui Cyrum modcftixgratia, filuifTe nomen nouum, & antiqui tantunj mcminifrc , quodfonc adhuc in viuisagerct Darius , dubium ad* modum U infirmum cft , vtcompleretur verbum Domini ex ore Hieremid , efr» -Bel- le hic textus aim illo confcntic Ub. i. Pa. ^h.. ralip. cap. v. ao. vbi fic habetur : Si qmie euaferst glsdium dttfiu» i» Bsbjlo* »em fermimit Rcgi , ejr filiis > dtntc impera- retrex Vtrf*rum , vt compleretmr fcrmo Dsmini ex ore Hieremi*. Vcrba autcm pvophccix Hieremix , quibus confignata crat capriui populi libcrtas , hxc liint cap. 19. Hxc difit Dominus cmm caperint im- pleriinBnbjlont 70. *nni, vijitsbovos* /rf*fcit*bo fupeyvot verbmm meum bo. r*t'CMm Hkttmt* V4TU* in nmm , vtreduemm vos *dlocum ijinm, ejrc- ttd duttm fiuumnonagnoucrin:,vtquiferc Aftya- D quod&fupcriuscap. zj.v.n. itfdcm pc-Utudt7o Ddrum gisfolamMandancmCyri matrcm darc dnntdxdt i^lcjmccumtamen Iofephus Ub. 1. An- f?"* ^ % tiq. difcitis vcrbis, Darium Aftya^is h- ftdttrtnif. 1 ' / D. f* ttmme- hum nommet , ahoapud brxcosnomine mmm. nuncupanim,Cyaxarcmfcilicet, partira quod brcuetempus Impcriicius neglexe- imc,vtquivno rninus anno regnauerit, eoque prxfercun , quod Cyrum rcipfa Imperio pocitum fcirenc , cx poccftacc, Darium aucem cx Cyri indulgenria : ac rcrum fjcrarura fcriptores , qui rcs non vulgaicslub co contt^iJlc norant , acvc- rc longanarrationcaapoftcros tranfmif- luricrant ,ciusrcgni iu mcmincrunt , vt folumBabylonici Impertifcribant hxrc- ne vcrbis dixcrat , vcrba enim Hicrcmix, 4-mit p£ h^cipfafunt : Eritvniuerf* terr*b*cinbtiiinrd. tntd trdt dftiaiidtt fotitudintm dr i» Jluporem tjrferuicnt om- ,u ntt gtntes ift* Regi B*^jlo»isyo. *nnis%t4 cumqueimpleti fucrintjo. snni, vijitM?t bo faper Regem Bttbjlonis , ejr fupr*gen- tcm Hl*m , dicit Dominns , (jr fmpertet' ram Cbaldxorum.Prx&ixcziX. iuquc Hie- remias non femcl.vc cx lupcrioribus con* ftac , non amplius 70. annis duraruram ludxoium captiuiutem , & fub finem il- husjcemporis excifum iri aPerfis Sc Mc- dis Chaldxorum Imperium. SmJcitamit Dominut jpititmm CjriRcgit Verf*rum, ert Ergo vt promifia in grariam populi dem , 8c centum viginti prouinciamm ♦ fui , 8c intenraus longi antea Babyloni F 4* Commentarius in Librum ab Hieremta comminationcs , non fru- A but in lacum lconum conietfut futr.it di- ftra cxcidiflc euentu ipfu Dcusconfirma rct , fufcitauitDominus fpiritum Cyrt> id eft | voluncacem cxcicauit , tjr traduxit vocem > fcu Hcbraicc, tranfire fccitvo- cem >id eft , vocc prxconis denunciatiic , liberam cfle cuique , dc Iudxorum gence, redeundi in pacriam faculcaccm > nec id vocc canciim , licct id plus fatis habiturum cflec momcnci , cum carlca apud fuos va- lerec auchoricace & poccncia : fcd cciam fcrtptura per quam manifccius de regta volum.it c coniurct ; Verfcripturam igi- tur , id eft , pcr edi&um rcgium , cuius dicit etiam , res enimerat cognttione di- gniftimm > quid illiin conuiuto HrJta^a- rts, quodin rem Medorum atqnc Perfarum faceretejr diuinam erga ipjumprouiden- tiam patefaceret , non ita multo ante ncci- derat , ntcminm libentcr audtuit de N.%- buchodcnoforis inter befitas commora- tiont ptrftpttnnium > dt re/titutn tiforms humanoque iudtcio > devifa abillofidtuM quadripertita, tjjr forte tiiamde quatuor animalibus a \c vtjis > qua quatuorimpe- riaportcnderenttdefociis fuit infornatem flagranttjstmam conieftis tjr multiplici cur. hxc erac forma qux proximo Vcrfu fcqui- g prodigio Ubtratis , hac tliaque Danielem Cyrojludiose retuttjfe credtbile ejt , quod intelligcret eorum cognitionem multum ad Jdolorum contemptum , multum md veri Dci venerationem eycultum effevalitu* ram.Sxc ille. Ciim itaque Danicl magni apud Cy- rum cflec nominis Sc paflun muabilium pitracor,conic&orfomniorum , reuela- cor arcanorum , myftenorum Dci fum- mus Intcrprcsaudiret, audiic viciilimex Danicle Cyrus , quid pocuTimum Deus tunc tcmporis ab illo exigcrec, ille.in- quam Dcus qui eumad cantum imperium cucxiflct , qui eius npprthtndijftt dtxte- ram , vtfubiittrtt anttfaeitm ttusgtntts ejr dorfa rtgum vtrttrtt > qui ante eum prtgrtjfus in pralium gloriofos ttrrarum humiliaffet , pcrtas areas contriuijfet > ejr icftes ferreos tonfregiffet > qui dcdtjfet ei thtfauros abfctnditos > ejr arcanafecrctc rum patefeciffet,qua quidemomnia de eo tam ex imic loquiturtjrratiocinaturJfaia* cap. 4f nimirum vtfilios Jfraelis deferui- tute liberatos in patriam dimitteret , ejrt. Hxc crgo ciim probc tencret Cyrus , 6c Dcus in dies maiorem Uli erga Daniekm, bcneuolcntiam , totamque iliius gcntcm inftillarct, maioribus natu Ifraclis anni- Hacdicit Cyrus '■ fed iuuat hic pauld fu- oJlui ^pwdcrc , quemadmodum Deus nudiuvfm ^citauitfpiricum, fcu voluncaccm Cyri, fit Dtut JC quibus candem vfus mcdiis , cam illi vtfttriium cogitationen>iniecic , vc libcrucem ca- feu vtUn ptjuo populo conccdcrcc 8c vniucrfam ttm Cjn ludxorum gcnccm , qux fcdcs fuas inco- txctuitt icoat a(Jco craflarcr humaniccr: fcioqui- adlibntA ■%• »•/• •» i r • .- ttm ptftdt dem a plcriiquc omnibus , obicruart ,dil- ittiatrmm policum fuiflc prius a Dco Cyn animum, tmttitn- pcrllaiam Prophetam , vc pofteaminus **m' . fe Cyrus, ad Dci impulfum , volunutcm- quceiusexequendam , dimcilem prxbc- ret , fcd quo duce acque auchore id fa- £him , vc Cyrus cum ifaia , qui ducencis ance Cyrum annis excicic , confueueric? cius prophecias nioluere pocuic , mquies , aut de illis inaudire quidpiam : ccrtcfcri- bit Iofcphus lib. n. Anciquic. cap. i. C v rum ex IccTione libn Ifayx, cognouiflc , dcftinacum fe diuinitus ad inftauranduni ccmpluni Hicrofolimicanum , idcoqucfic edichim de admittendis ad illud xdifl- • candum Iudxts pcrfcripfifle , idem afttr- matTheodorccusin capuc i- Danieiisded quis Ifaiara Prophecam perlegendum Cyro Principi in manus dedic \ quis,quid XI. Dtrii f0(- r« DtmuX prifbtts Cyrt nm tgnttm , tn ■;ut Qymt iffttfnii Ijdidt dt t* frtfht- uf[tt , in- ttlUxtt. ineo legcndum , expendcndumvequod D rcntibus , ftatuit publico dccrcto , notum facereomnibus , ac ftacuere , quid fieri placercc in hoc gencre , quiJque libi diui- nicus cflet impcratum: fic igitur Domi- nusfpit ituniCyri fufciuuit , Cjiim nimi- rum ei pcrfuafum cft , ex le&ionc vatici- nii Ifaix , tn quo canco ance 6c viftorias fuasprxdici,ficuomenfutim czprimivi- derac , inflgnem illam v; doriam dc Ba- byloniis reportaum , Sc tanum imperii acceflionem a Iudxorum Deo (ibi diuini- tus fuiflc conceflam : vnde fadhim eft , vtcum primum cxcitante Dco fibi , ac di- uini numinis impulfu , fubiit iliiusmen- tem antiqux promuTionis, & uncx digni- tacis rccordatio , diunus procraftinandum non cenfucrit , fcd quod debcre fe Dco ipfum proximcfpectarct indicauit? Placet in cam rem Saliani conie&ura ; cx aiius Annalibus cxcerpu qttx fequun- tur ftudiofus le&or accipict. Cyrum , tn - quit , Danitlis optri ad vaticintj Jfaia cognitiontm vtmfft conittfart licct, tism tnim Danitl, Daric Mtdo Cyriftttro ej? Jmperij eonfortt tharifsimus txtittrit, fummoque apud tum magiitratu futrit funitns > vt facrx lictci x cam apcrcc indi - canc ,ncn petuit Cyro ignotui e(ft, immo illipl/tne • ytnerationi ntque dciniratieni futt , qnW'ntmdubitat Cyrum vtlpriua- sis t>arii iitttrit vel publtco eius decreto mnt faitem rumore mtncio didiciffe quid DAnitli contigtrat cum inuidorum arti- 2 primum Efdrac. cxiftimabat , vt Iudzorum caufz faueret cofqucfcruiUitcUbcrarct, in gratianimi figntficationcm quam primum implcuir. Vcrf. x- HatiicitCyrui Etx Pcrfa- A cm tdHlurttm &c.Edictum Rcgium , vcl ipfa vcr- Cwimff— borum forma loquitui , de quo oppor- tumlud*- tunum cft vt a nobts ctiam obiwr illud ctum Mon inucftifctur , cur non Darii potius, quam djni D*"Cyi.iautpcrzqucDarij ac Cyri nomine m Cyl"fi>- iniigniatur,cgo»ne mulris immorcr , in rc n^nr, quz vix ccrto nobis conftare poteft, fic concigilfccxiftimo, vcl quod vt iam fu- pcriusmonuimus.fumma cflct in Cyro poteftas , licct Darius nomcn ctiarantim tdillum * Cafare Augufio > vt defcribere- turvniucrfusorbis , non ornnis abfblutc fcdquifubicctuscrat Romano Impcno, itemactorum 2.Erantin Ierufalem viri Eeligiofi ab emni natione, aua fubQalo tfi, idcftab omni Rcgionc quam habi- Q"?"""1* ubantludziadfolcmnitaccm illara con- • • uenireioliti.Quod ii quzras quomodo di- re„_ caturDcusdcdiflcCyrorcgnaterrz,cum ttdtre <m* illa occuparit non uirefcdvi ^tmorwn pfrv,m'p- facilis rdponiio > nihil iniuftum cft rcfpc- €tu Dci. Sic Efttus, in quam fcntcntiam ' confulcndum lllud Iob cap. n. v. 18. Cumille irn.\a\t;deus Jilicu tmj>le(fet do- adJuic Rcgis rctincrct, vcl quod non lon- B moseorum tjuorumfcntetta protul jita me, gc ab lpfo nafcentis impcui cxordio, Da - rius ipfe , iam e viuis cxccflerac , vel quod is relicta noui Impsrij adrainiftratione Cyro , ad Medos rcdierat , vel quod cum Darius ob ztatcm iam grandiorcm 8c fc- nii fatifccntisin commoda ,tantam Lmpc* r>ii molcra fuftincrc non pofict , touim pondus in Cyri humcros tranfraifit. Por- ro Iofcphus lib. ir. antiq. cap. i. Vcrbis paulum imrautatis > bc aicriptura diuafis nonnihil , hoc cdictum Cyri fic reprcfcn- uc Vutman: mt Dtuftraximum Rcgcm vrbis tonJiituit , huttc illum e(fe tredo, qutm Jfraelitarum adoratpopulust isenim idcft impiorura & cap. ii.v.6, Abundant talcrnncula pritionum & audatfcr pro- vocant Deum cum ipfe dederit cmnia in Q"^** ».r. j • n. \ s Ihitvtr- manuseorumiclicauoduimuc plcruque / , c__ i n- t j- • . i-fr "ftcJitrU' homincs poliident dtutur /)cus dcdilic, turprZtf- Cunon nih' cius nuniacpcrmiiruidpoi- rumDeide fiolj Et ipfc pracepitmthi vt jtdsficarem-ti tiifit-nda domumtn lcrufaltm. Exiftimoprzccptum " *mo ,n illud dc domoDci zdificanda.rcfcrri pof- fc vt cumquc pcrcommode ad iliud 1 faiz de Cyro vaticinanus cap. 45. v. 4. Prop- ttrjcruum mcum Jacob drjfratl cicQum mtum vocauite nominc tuo Sc v. ij. vbi itcm de Cyro , Ego fufcitaui cum adiujh- mcumnomenpcr fuos Prophttas pradtxit q tiamejr omnesvtaj tius dirigam ipfe adi (■• qnod templum ciut adificaturus fim Hicrofalimis in ttrra Iuda. Ommaregnaterrx deditmihi Dominut Quo ftnfu Deus Cteli &c Sic publico cdicto tcfta- 'vtrum Jtr tura voluit, quod vinccrct , quod rcgna - DtMm dt- tcc j ^UQj viucrct , non (uis ipfius viribus, diptCyro rc£m iis.Dciomnia modcrantis benig- tmniA rtr -ii ndtr,r*vt mutl » ac patrocimo , tnbucndum : Cjrui iift quodautcm ait iibttradiuomnia rcgna frtditdt. tcrrz per hypcrbolcm accipc , in iola quippe Afta rcgnauit, vel iic intciligc, quzmcafunt , omnia dcdit mihi Dcus, icutcrramChaldzorumatquc adco ter- raraorancra,quammco railu fubiugaui Impcnodiuuiiuts mthi conccuam ag« ficabtt Ciuitattmtjr captiuttattm mtam dimitttt &c. Quod Cyrus , vt potc pcracuti vir ingcnu , optimc inccilcxit, cura ipii a Danicle oftcnlura cft> vt fcribic I ofephus , Sc ab co Theodorctus in caput primum Daniclis in finc > iicquc cx hoc vacicinto in animum induxic , id dcbcic ie iingulari Dci prouidcntiz , vc dum ipfum tot cumulat ornamcntis , 6c opibus, fut etiam populi commoiiicati prouidcat , tsc duiini numinis honon, extmcndo ccmplo coniiiitum eflc vdic , ccrtc quo alio fcrip- turz loco przceptura huiufmodi indi 1- djmelfe potuerit >non vidco,2c ficuti Cyrm funt. alia , quz iigni auc przcepii loco '«t7"/*» nofco. Nirnirum,aunin fcriptura facra -ry vidcri poifinc, ciulraodi func,quantum _ ctufraodi locucioncs occurntnt fzpc nu- intclligo, vc alienum a religione homi- ^ pt ncm , mouerc facilc non potuerint : Cete- rruenda riim pioptius htc examtnandi locus cft,an vrl>i f«tt- Cynisrdictofuo, vt tcmpli inftaurandi, flftr™ Im~ iic cxcruendz vrbis ipfius Hicrofolimz, **"Jtcn>t- poteitacem fcccric ; vidco racioncs in vcraraquc pancra > quzftionera agicanci- bus,non decifcac primu m ccrcura eft, in Cyri dccrcto um quod hic rccitatur quam quod habctur cap. 6. v. j. nullara pknc iieri vrbis mencioncm » fcd Tcm- N„d^} pliduncaxac, dcindc conftat.ctiam.pcr-y^wM milfioncmillam vrbis zdificandz fadtara rmtntnt ab Artaxerc Longimano , anno vigcfitno Fij mcrocxplicaridcbcnc accomodatc adrc oc iocum dc quibusfcvraoinltituitur.Hac obfcruacioncmua<LcHicronimus ad illud Ifaiz c. ij. vt difptrdaut cmnem ttrrtrm non>inquic,totum orbcra, fcd omncrn cerram Babylonis Chaldzorura > Idioma cnim cft fcripnuz,vcomnem ccrram, il- lius fignihcct Prouinci* > de qua fcrmo cft. huius obfciuacionis piurima paifnn variis in locis excmpla rcpciiss , in quibus a^nofccrc cft, voccs vniucrfalcs vt vo- cantprorcrum naturaad cercum aliquod fpatiumcontrahi,uaLuczcap. 1. Exiit 44 CommentariusinLibrum regnifui, vc pcrfpicuc habecur z. Efdrz A poflcnc , niii mccnibus clauderencur ? rc- xvi. •••>'••■ cap. 2. hxc ncganci fentencix fauerc quo- quo modo vidcntur. In contraria fentsntia eft Iofcphus Hb. t ■>(: antiq. cap. i. quem hic caulamfiiam n.«m ^/o- orantcm audtrc non pigcbic , Conuocatis, ottttui clarioribus apud Babj/loncm !uixis{de Cj- ffphnt rtltquitur) attfeillts pcrmitttrc vtprofi- *»th<x a»- cifcanturtnpatriam , vrbcmtjuc Hicrojo- f lima & DeiTtmplum adificcnt dtnuo SC nirfum paulo poft.inducic cundc fcribcn- cemad Prcfcccosludxoru/w<kw, inquic, ijui Regienemmcam hsbitant permtjt, vt quicuqucvellcc in propna,rcucrti pacriam vrbcdcriuocondcrcntj&Tcmplum Dci Hierofolimis dificarcnneodcquo pnus loco.Hxc Iofcphus adcuiusparccs hbcn- tcr acccdo , quod fi I faix vatictnio cxcica- tumcflcCyrum fatcmur, non modoad foluendam capciuicaccm Iudcorum, fcd ctiam ad Tcmplum xditicandum , res confctta propcmodum vidctur, fi qui- dcm in co vattcinio dcCiuicatc quoquc cx xditicandalcgicur, Quidtcocjro Pajhr 8 mcus estj cmncm valuntatemmcam com- - wrw »rr< k« w * » » . t . f t • r • ( ffw f fw \ rlfrr tr Vffw JJ frM.pttbis > hxc eit auccm voluncas cius qui dico Hterufolcm adificoberis ty templo fundaberis , nec cnim vidccur confenca- neum diftrahcrc ccmporibus , quc. ica iur?t mtntd. liquum eft vc qux duo in in contrariam partcmailacafunc, breuitera nobis dilu- v*; I!- anmr,ficigicur cxiittmo.quod Cyrus in yw«^[" cdiclofiio non vrbis , fed cancum Tcmpli *r*mmrnt4 mcinineric , id in caufa fuifle, vel quod <uuuuitmr altcrum ex alccio facilc incelligi poflet, vcl certc quod in ccmpti duncaxac inftau- racionem , non vcro ciuitacis, fumpcus ip- ie fuppcdicarec , vc cx capite 6. v. 4. con- itabic •, idque Iofcphus iam antc cicatus fatis apcrtc ionuit , cum enim dixif- fcc,aCyrodi£tum Iudxisfc pcrmicccrc» vc vrbciu, ScTcmplum, xdificarennfub- dic, nam Sc ipfiim Dcum futurum Ulis au- xiho&fefcripcurum vicinis Iudcx duci- busac fatrapis , vc conferrcnc eis aumm Sc argcntum , ad ccmpli fabricam , 8c vi- tcimas ad facrificia , quod ii vrbis quoquc 1.4. t.i ruiiTec mcncio , pcriculum crac nc ctiam fumpcus rcgios Iudxi , co vcUcnc cxccndcrcjfi quidcmvc cx Rcgula niris noaim cit , odia rejbinguntur , fauoret ampliantur^, Sc quod fcic vecus Ula vox, bcncficium principts quam amphffime mcuprccandum clt;ad alcerum dc pcr- miJfione Arcaxcrxis Long/iuartt, pro vrbc xdificanda , fic commodc rcipon- dcri poccft , ica fa£tum cflc , quontam naruttoneconiuncia , vt vno Sc ab vno C cumhoftcs Iudxonim,monuoCyrocam Tcmplum ,aliociuiiaccm , &abalio,in ftauran cemporc Dcus voluenc, addc cla- rius id ipfum a frophcta dici his vcrbis cap. 4f. v.13. Jffc adificnbit Ciuitatem rneom ry- eaptiuitatcm mc/tm dtmittet. Qux ex omnium inccrprenim fcnfu de Cyro incclligunnir verum,vc aliun- de rcs tnccrca fic, quod in Efdra Icgi- tui cap. 4. v. ia. Omncm dubitationis aniam prcfcinderc vidcrur,nimirum co loco diicrcis vcrbis ludcit^iuitatcm xdi- ficaifc dtcuncur , quod finc dubio ntli im- pctraca 1 Cyro poccitacc nunquam cifcnc •ggreifi,;v«nw»» fityRegi , inquiunc Iu- vibis quam TcmpH inftauracioncm im- pcdiuiilcnt, Sc ludxiaDario Hyftafpis, Templi cantum cxx^lincandi facuhatcm impctraiTcnt , nccefleruic poftca , ab illo Rcgc.ciuicacisquoque rcparandx, ope- ra , £idrx & Nehemix , poceftaccm obci. ncri,vcfuolocodcinccps vidcbicur. Vcrf. 3. guis cftinvobts dcvniuerfo xVtlL populo cius,fit Dtus illius cum i}>fo,Aj- ? cend/ttin Hieruf/tlem Scc Edifti Rcgij EJia'gr^ cratta , ad omncs omntno ludxos pcrcincc „ cum Babylont tum ahbi commoran- jmd^us m- ccs , & ( quod obiccr hic notandum ,Sc r, - - U4.,s roniucpoite.-ifiifius indicabicur) cumeo *deu dcorura 1 aducrfarii , <jui*lud*i,quisften- ® tcmpotc , ad lpias cciam AfTyriorum rc- 1uim *fy dcruntktc , ndnos vcr.crunt in Bicmfn- gioncs exccndct ccur.Chaldxorum impe 'y*™™* lcm , ctnit/itcm rcbellcm ey pefsimnm num ,non eosmodo comprchcndic , qui j(™™ttf c duabus cribubus a Nabuchodonofore bH(,Mt ^ adducti fucrant m Babyloniam , aut in fi- nnrrt <m- inirimas Babyloni ,fubiectasquc antiquo ftnd* tfi Babyloniorum impcrio proumcias ; fcd cos eciam , qui c dcccm aliis cribuous, ptius ab Airyrits fucrant fub iugum indu- £li,&in illonim rcgiones deportati, fic omnibusloquitur , fic cntquc dc htdxo- nim populo vbi vbi iit , fiuc in Chalixa , ikiein Airyna. In Iu(jxam rcdcundipo- tcftacem facic Cyrus, qui Chaldxorum & AiTyriorumimpcrium , Pcrfanimim- pcrio fubiicccrac ; ponto , quod incerfcric qnam /tdificant extrucnjcs muros cius rjr parietes componentes, hxccum fcripfciint iniraici Iudxorum ad Cambyfem , Cyi i fucccfiorcni, vc pofteavidcbicur,quisnon intclitgic ad Cyrumquoquc piius tuilR; rcripcutos,nifi ideius neri voluncace cog- r. ..:^at , quid quoJ, vt ciiutas iimtil cum Temp'o xdihcarctur, co adigcbac ctdTn.\> ^uomodo enim ccmplum ip- nc ium »q«omodococcius donaria, Sc pre- riofa iuppcllex , quomodo cot Iudxo- xum millia .(jui Babylonc rcdicranr , in- «cr inimicos uifcnluTtmos, in cuco cfio I primum fiDcus illius cum ipfo > faris indicac , fa- . A M . miliarcm 8c viitatam anciquis illis fxculis (.tmmunil, - - ._. . _ * j r.- Mftmlu. *omiamfuuicquJtmImperatons edictis ris, •vtotmt acquc dccrctis obferuarctiu , yc bcncuola lptti*M aliqua Rcgium auc Impaacorium dccrc- fert fmt mm prccacioprxccdcrcc > folcmni vocc ittmo. concepu iicaapudChaldxos&Babylo- " >»;■■■: r %n S i c - r i ruos , tcaapud Pa las , etnm , dum lciun- frmifa "a ulorum fucrc lmpauiciuus rci cxcm- fnbdnis » vc de prophanis Auchoribus caccam, f*ttm At cx faipcma pccerc licct , non pauca , dc f*\uttm*d B_>byloniisquidcm ,apudDaniclcm cap. prtcmw . v. 98. iic Nabuchodondfor in cdiao Rcgiopopulum peramantcrac bcnignc g falutac: Nmbuchodonofor Rex omntbuspo- pulis gtntibus tjrli»guis,qui hmbttantt» vniutrjm terret pmx vobis muitiplieetur dc Periis vcro cum alibi , cum hic infcrius tfdrx cap. 4. v. 17. decrcto Xcrxis hoc pr^Hxum cft,FerimmmiJitRexm/l Reum eyc Et cmteris trmn fluttium , fmluttmdi- tcns drpscem , & Daniclis 6. v. a<5. Darii decrecum ii<; habcc , Dmrius Rex fcrtpjit vniuetfi populn , trtbubus ty linguis hmbi - tmntibus invniiterfm terripmy vobis mul- tiplicctur, fcd pne cxcciis omnibus illu- ftriscft,vtcxpcndcncifacis pacebic fcolix hxcimpriroisac bcneuola, Rcgto Cyri q c_u<5coaccextaprecacio,y7/Detf stpfms cum ipjo. Qua fcilicec populo Iudxorum at- queadcofubdicisfuis iingularcm diiumi numiuis fauorcm 8c graciam, quod bono- rum ommum maximum , eft peculia- reminquam Deioptimi maximi in ipfos prouidentiam , quin Sc incimam camque mucuam, iplorum, cum ipfo communio- ncm , acque confcnfum cxopcat 1 ' "/'' 'ji Ocuj qut ejl iu Hitrufmlem Scc. hxc verba pcr parenthcfun infcrca Cytuiriy- funt ( jpfc Dcu^, fdlicec vaus quali di- * cerct talcm hunc acnolco &c vcicor <vn* Dcton .. Xr - »ii ■ *'n*twnft Nuniium «hipc non obicurc colhgttur, ftttitws u i*rn nira Cyrum.cxiitimaifc , Dcum quc mrn frlfo- in Hicrufalem coluerant Iudxi,aut folum D ,um Deari c(Tc Dcum » ,auc ccrtc Dcoium omnium ,r!tg,t»cm m2Ximum ^eofpc-tat vox illa, ipfc cft Dcus.qux prxclarara vnius Dei cogni- Dtifidcti' iioncm-Ctonrcflioncm lnnucre vidccur, que cbfer- 8-cum prxomnibus 3cab ommibusco" ■u n«n lcndummdicacqu-mquamnec co tcm- y.fiuu. pocei aut poftmodu m vnquam, falforum Deomm culnim, airitamquc religioncm, pemms abiecilfe , faus conilat cx hiAorix prophanx montimcmis? qiidfit, vtdi- ccndum iit , h quo tandcm modo ( vt pu- bhca vocc conteftari vifus cft ) Dcum vnum crcdidit , in illius vnius hJc acque obfcruantiaminus perftitilTie» Verf. 4. Ft omnes reliqnt ex tunHit lo' X X eif vbicumque hmbitmnt mdtuutnl eum de XIX. Efdrx. 4y loctfuoScc Perhamaniteraimpopulo ^sj^s ^udxorum agit Cyrus , ita enim libcrltn ^imm iu- ci rcdeundi in pacriam facultatcm conce* jZ< Mre dit, vt taracn cxcedae non cogat nec iffrmtttn fuis fimbus cxpelU velit,& ccrtc lofcphus "5**,. ■ 1 a .* 1 indemui- Jib. 11. Anciq. cap. 1. muicos aic mancic^i^^^ maluifle.apudBabyloncm jquibusxgrc^ B4t,y, eracpoireflioncs fuas relinqucre,qurn& UneremM- Hcbrxi quoquc dicunt illos qui rcmanfe- fcr*nt iSx- re , acatfc fibi piincipcm , quem voca- t*iofesbt rcnt kohe,HmgSmlnb, auus incmimiTc'f,,/f^",w'' vidccurOrigencs I10.4. Paiarchomergo nonexpcllic quidcm iudxos cditioneiua Cyrus , fcd abire iis qui volcnt pamirtit , omnibusbcnc precatus, qux iummaeft ipiius humanitas ,imo aliorum aiam cx- citat libaalitaccm crga cos , qui pcnuna impcditi , ionginquum ita fuicipac rion pofltnc , vc fciliccc gcminam cxerceanc bcntgnicatein, aliam in viaticum paupc- rumuanimtgrancitim, aliam In donaiia in ccmplum Dci, &c hoc cft quod x\i,Ad- iuucntcum viri de Itco fuo excepto queei volunt.me ojferunt Templo Deiquod cft inHicrufmlem tyc. Icaquc qui rcmancnc in Babylonc, auc alibi iiib Chaldxomm adhuc aucpotiusPerfarum dominaude- gae malum , eos vulc conferrc aiiquid iis quiibuncin Hierufalcm, fortaflis taxaro eciam quancum quifque confcrre debear, aic Mariana , prxtcr dona qux voluntahe templo mitcac quiuis potcrit , cuius rci amplifllmam ommbus facic poteftatcm.- Dixi , prxtcr dona , hoc ferc enim , vox, - Exccpto qux in cexcueft ,addendo,non,'r'*'<^"' e»cludcndo,vtiniimiIi infaius oftcndam «'J, '^* quod auccmaddit San£kius , dici poflc , il- biqucnonimprobabilc viJcri, non cogi qniin Bm- Iud.ros,futeIfiaelitas cx omnibus cribu- tylmiArt- bus , vi cdicti Rcgij , vc pro abaintium "^fer*™ fiimptibus , aucTcmpIi facrifiajs , aliquid n*nfermtf- cxpcnderent , icd potius illis permitti.ccii-^. j M non pcnitus improbo , ncc enim modica tum<?av*~ vel cx eofolo Cyri hbcralitas extara.cum j.l paflim plutimis in rcgms cautntm eiTe vi- tldindtfi» dcamus , nc inde ad extcrna 8c aliena lo- jjjijf'* ca , aut pecunte , aur equi , ant quxcum- ^'yi/^J quc dcmum aliis regionibus ornamcnco tn\t4tibus ciTcpoffcnc/exporcencur *, tamcn exifti- di*»*reni\ mo canci Principis pietati magis confenta-^ ncum , vc Iibetnm id curuis eiTc noluerir, fcd dicioribus faiccra , iifque omnibus qui vbicumquc in Impcrii fui finibus ,foli in quo diu inuaaauaanc vbertace sc pul- chricudinecapti remanerent, quaii mul- €tx loco indixcric , vt alijs ftatim pofe- «uris fubiidiaadviam viflumque necef- faria iuppeditarcnc ; Cxterum nocac hic Lyranus fcaindum Hcbrxos variari cex- cujn , 6c cxpoiitioncm fcnfumquc Uca* F iii " ac Commentarius in Librum eflc huiusmodi » tjr cmntm rtliquum, (c\. A & Lcuitxtjromniscuius fufcittuit fpiri licct dc Iudxis quinon poteft afcende- tum vt afccnierent tjrc. Aiiuucnt tum viriieUco fuotjrc. Idcfr vicini cius , ctiam Genulcs prouidcndo de 1 cxpenfis & vchiculo , ita prxccpic Cyrus, addic, Exctpto quoi voluntaric offcrunt tfrc. Quia fcilicct pr^ter, Iudxos ipfos multi etiam Gentiles , audientes virtutcni Oci Ifracl ,obtulcrunt muita munera , ad xdihcandum Templum in Hicrufalcm , qucd fuerat dcftruc~rum , cxemploRc. gis animati ; Tandcm 8c illud quoqucpo- lcremo addcndum , nihil mirum eflc ii, quodfupumonui,hxc loqucndi fbrma, Excepto quoi voluntaritvffcrunt , non excludit aut ncgat , fcd potius addit.acqtic ru:flrt>i.t- confirnur , idemque cenferi debet ac pra- L J'J* ter quti , idcm cnim paflim , multisin vcur cx- ^cripturx lons diccndum de vocc abfqt* ttM» &■ quxaugcndiconfirmandique vtm habct, .Aiffft nonmiinicndiaucexcludendi: vt cruditi **" iain olim nourunt incerprctcs , iic Zacha- nt*m '''jrix i.v.A.AbfqucmurohabitabuurHieru- mtnutrefti f , J1 , . , , A M'trt &- J m prjt multttudtne homsnum , ldcit. aufimani nabitabitur Ciuitas non folum qu;imra. mcenia eft fed ctiam qux cxtra pomcriuro ita Iofue , cap. 17. v. y. JLtcec/icruntfu- nicults Adsnaffe dec tm,abjque tcrra 0'a- laai , id cft prxtcr terram , Galaad quam iam podidcbant ; iic Iudic. 8. v. i6.Fuit ponitts poftulatarum in anrium, millcfep* tingentis aurificU,'abfqut ornamentisejr monilibustjr prattrtorquts aurtas camelo- Tttm , vbi* iilud (prtttr) quod fcquitur, apcrte indkat , quid figniiicct, abfqut, quod prcccdic , fic igitui a iimili quoddc ^ abfqne frcqucnter dicitur in fcriptur.i, non vidco cur dici ctiam non poific dc txcepto quoi, in Hcbrcoii confulatur, ics facUior cil 6c magis pcrvia , habct cnim ccxtui Hcbraicus nouo inH.i- ncdabah , ideft cum oblatione fponunca &ita vctcunt7o.Tigurina, Pagninus, 8c communiccr alii > quafi dicat cum. dono fpontanso , liux prxtcr donum fponta- ncum pro Tcraplo, dabunt ctiam alia, pro longi icineris viatico , 8c hcc haftenus dc Cyri decrcto» quod qucnudmodum npublicas rclatum cftcabiilas. ScinEc- aunis Ciuitatc Mcdix confcruacum , oftea dicccut cap. c,. jntcrim pjr pro- miik^m cdicxumfacxa Iudxis icmi- grapdv in patriam poccftatc , paratifquc ntcad idomnibus, ait Efdras. V. f. Etfurrexerunt Principes Fa- ,ie luiaeJrBeniamind' Suceriotcs B l) X.XII tru <>< - omnibus prxccpit , aut potius pcrmific,af- ccndere in Hicrufalcm, fcd untum dc Iuda Sc Bcniamin &c uibu Lcui dicuntur afcendere voluifle,nam dccem tribus,fub Hicroboam Rcgc , a Tcmplo Dci sc culcu pieutis funt alienatx , & ideo a Re- gibus AiTy riorum fuerunt in capcmicatcm adduftx , ncc vnquam omnesin Patriam pcrhibcnrurvenilli; ,fcd Iudas & Bcnia- min& tribus Leuitica,ad quamTcmpli miniftcrium pcrtincbat, quamuispecca- u dccem U'ibuum imiurcntur , nunquam habiutionemvrbis, ScTcmpli cercmo- nias dcfercbant , vndc&vlcimr a Chal- dxis funt captx , ficprimx Pcriis rcgnan- tibus redirc permiiTx , quia fcilicct de Tnbu Iuda & Lcuitica ortus cftDomi- nusnoftcr.ait Lyranushoc Ioco, tribus quoque Bcniamin tllis fe religiofa fide adiunxit,maximc quiaHieruialcm in etus foncfuic , &ideo collatx mifcricordiz paniccps ciTc mcruit. Quod iiqui dc dc- ccm tribubusrcdierant cenc pauci crant, nempe aliqux forte reiiquix , quz cuafcrantmanus Rcgum Aflyiiorum, 8c coniunxcrunt fe tribubus pr^didxis tem- ' «, poreloiix, vt habeturz. Paralip. c 14. " v. ir. quxwcrimtu^nilitcrcaptiuatx pcr Nabuchodonofor.flc iimilitcr rcdicrunc nittUurM. qui voiuerunc redixe Sic illc . Ergo li- rtrtftld cec cx omnibus force cnbubus , VaUlS fx- rtditum Jt pcccmponbus , mulu cx captiuiutc tc-1»*'* Xen- migranntinludxam ,tatncn primo hoc|*w'"*?r commcacu , illi auc folum , auc ^^gua^^*^ cx paitc rcdiifle vidcntur, qui a Nabu-,,.^^ chodonofor tranllati fucrc B.ib y/oncm , t*mum*ut hi autcm luerc ex tribu Iudx Sc Benia- manu tx 1 n i n qux domui adhxfcr e Dauidicx ,qua • p^ttde *h do deccm alix abftractx func a Hicroboa ™ &populusduas inpartcsdiue£hIScft,iiccx',,' 'frtm* V r , r r -T- 1 eommeutu tribu Lcui qux ie proptcr 1 cmplum.cui redterttnt. cxlubebat minifterium , duabus aliis tribubus applicuic quod autcm obfcruac Sancxius cx cap. 37. Ezcch. v. zz. vbi fub vno ducc, omncs crtbus dicuntur fucurx, hinccolJigtpoile, aliquos cx dcccm cri- bubus rcuerfos cum zorobabcle &: Icfu oui pi .mc huius remigracionis Prmcipes tuercfic fi non difplicct, tamen Sc in aliud etiam cempus , ab hoc primo rcdicu, Pro- phccx vaticinium referri potcrtiqtio tcm- pore , cum mutci pcr varias viasfic tur- m.i5,c dcccm tribubns rcdtcrinc, liccac dicere euentu illud confirmaaim, Ecct tgoaffumam ifrael iemeiio nationum ai qttas abierunt ejr congregabo cos -vniiquc tjr^iiucameos ai humum fuam ,tjr fa- ciam as in ztntcm vnam in terra, in mon- Quitum tjjfcntdc dtttrtmur primum Efdrar. 47 tibvslfrttl&Rexvnuserit emnibus im- A &: alia mmenu > doflinlia adonera.iiuc plauftraliaad vccturam ,intirmx mulcicu- ditudinis , vc labor pro patria , rcligioncq; fufccpcus, ciufmodifociorum humaniutc recrcarctur. D ubiu tamen hic cx quorun- dam fcnccncia &: poti/Hmum Saliani , re - Jinquicui >anid intclligcndum iic dc Iu- dxisrcmanencibus , an dealienigenis, qui ^ ftrsnsejrnom erunt vltrn dux Gtntes nec diuidcntur nmpltus in duo regun. Porro quipnmumhic fefc adrcditum in Hie- rufalem accingunt dicuntur Princifes V*- trumfrt. iic vulgaris vcrfio, proximc ad notioncm vocis Hebraicx , fcd Hicrony ■ mus ad faciliorc intelligeciam iic vertere (olet, capita , aut Principes familiarum 6c iureddunt 70. &cc, communitcr alij, fruutots Principcs Pacrun\ Iuda 8c Beniamin, Tdtrnm cr hue Prinripes famUiarum , illi crant , qui fdmihdtu. lnccilcniorcsillarumcribuum , digniutc atque authoritatc rcliquos antccedebant, ait Sahanus , fcd addcndum vidctur di- ueribsfuiflc Paucs» farailias , a Pttncipi- bus aut Capitibus umiUarum» cum cnim inqualibettribu, mulci cfllnc Hacrcs fa- miiias,qui in fua quiquedorno Patcr-vo- caretur, crantctiam alij qui muluium fa< miliarum Patres Sc Capiu Hiccbancur, qui ic alio nominc Pactiarchx nuncupa- bantur , qualcs fuerunt duodccim r-iKj Iacob , quiin cocidem uibus , gcnus dim- ferunt liracliucum.&C qui itb. 1. Paraii- pom. cap. 8. aS.Pacriarchx vocancurfic cognacionum Principes Sc fic enim ibi Icrlia , Sc Eiia &c Zcchri Filu Icroham hi func Pacriarchx <.v cognacionum Prm- ( cipcsquihabiuucruncin Hicrulalcm. Et omnis euius Deus fujcitnuit Sfiri- tum &Cz. Hinc coniUc , non omnes re- «iuilc , mulci fi quidcm reuncbantur in Babyionc , ob manurniflionem , & pof- feflioncs quas ibi acquilierant,propteiea dicicur omnisaiiusfufciuuic Dcus Spiri- cum , id cft omnis cui mcricem redeundi infpirauic per graciam cihcaccm.Ncque vcro nuhi dubium cfle poccft , quin mul- cis ctiam aiiis , rcpccendx aique inftau- ranixpacrix , dciidcrium inlpiratum flc, auc a Dco mie&a cogiuuo , quos camcn ttcntmnti aut bonorum , qur uulia icgionc poflc- Cyro gucincari volucrunt, aercc Ioic- clMtl & Jtrifijut t O Amicos, imJdii cr xxiy. phus lib. 11. antiq. cap. Rcgios,nominac,cgo vcro dc.vcrifque Ctmtltim nonvideoquid vcccc mtelhgi , itaquc &:'•""*'' dc cxtciis , qui fc Cyro giatos , Sc ludxis *J£//'*°I* amtcos ac beneuolos exhibcrc volucrunc, & dc Iudxis capciuis adhuc , qui primo hoc commraui non func profc£ti,auc quia non libuic , quod exccrna &c pcregrina co- moracio magis ipiis piacercc , auc quia res ipforamiamduris&domeftica nondum crac facis ad profcttioncm cxpcdiu,quid- quid auc abcuncium vfui auc rehgioni ac Tcmpii miniftcrio opporutnum vidcba- «tut libcraliccr conculaunc Sic. Vcri. 7. Rtxejuoque tyrus prctulit v*J* Tcmpti Demmi qu* tulerut N*bu- sbodonojor de HitruJsUm ejr poJuer*t 1» Tcmplo Deijui ejrc. Magnum fenc Rcgix bcncuolcncixaigumcnium, quod dccrecofuoahorum libcraliutcm exciu- ric 1 ad cos adiuuandos , fcd ncque vci bo contcncus; pius Princcps, cttam prxiuic cxcmplo,nam prxcerquam quod voluic Tcmplu fuis fumpcibus xdificari vc cx fe- quentibus aperte conftabit , &:prxfcrttm excap. 6. v. 4. Vndc dccrcmm illius, fupetiusa nobis explicatum fupplendum cil, vafa cciam c Templo olim a Nabu* choforafporuca,volcns libenfque rciti- cuic , cur auccm Cy rus rcfticui iuflcric vaia Q«tipo' qiixiiicrancaiponaudc Templo i onn njjtmmm ni ( quod eximiam profccto acque inii- Cy*** **- gnem eius piaacem arguic; hxc pcculia- fmffr,t riscaufa , hiic cx non nuilortim fenfu , au- unfttd* lui*: Df» demncautvxoiumquas lbi duxerantfic D dicrat quippc Deum offenfum concra ™m\ y^. Baluzar Rcgem Babylonis , eo qubd ,„,/<,,■-. •Lft tutt funt. tttdm dtfj nltorumquos ex lllarum confuetudmc ^runJfht- ^ccPclant»amorat Audiuma redeun- rlmi "»L ft- ^° rctalaau*t *kd illorum , eo modo quo aiiorum qui reapic infpirance Deo rcdic runc , fpuicusnondtcicur fufciutus, quia nimirum ilii Dco infpiianti , non iunc obfccuti , auc quia aim primum hanc mc- cem fufccpiilenc, poft modum ab ca, ali- qua tenutione dcpulli func. Verf. 6. Vntucrjique uui er*nt in cir*- cuitu ndiuumruntmunui eorum, quicir- cumquaque vicini erinc Babylonis. Iu- dxis abeuncibus,auc redicu parancibus,li» berali manu porrrexcrunt aurum acquc argencum, variamicem fuppollccrilcm, uucprovia,uucpro domo ftabili,cquos, ea applicuiilcc viibus humanis & propha f»r affertd. nis,adminifterium mcnfx , bibendo in tdjtttt^m cis , cum ducibus fuis , vxoribus &: concu- 1 em? 1- bmis , vc habecur Danielis 5. propter quod Baluzar ipfa noftc fcquenti interfcdnis fucnt capta Baby lonc ; vcritus igitur Cy- rus, nc lim.lc quid-piampeccarcr,contra Deum , vaiorum omnium lubcns fe pof- fcflione abdicauit, Sc ea confeftim Iudxis reddi imperauit , hanc caufam refcrt Ly- ranus; melius ex Sanftio, BC alns.cau- famhancfuiffc dixtmus, audieratCyms quid dc ipfo prxdixiifet Prophcca maxi- mus Ifaias , didiceracque , ab eo paracos libicifcingcntcsthclauios cuius ptouiU- 4$ Commcntarius in Librum lionis fidem expertus fuerac, cum im- A bafar aim his qui afccndcbanc de tranf- mcnfas Chaldxorum & Aflyrioru opes migratione Babylonis in Hierufalcm viftoracccpiflct , quarc cum tot cantof quethciaurosabfconditos ,&: ncana fe- cretorum , vt ait facer vatcs cap. 45. Cy • rumipfum alloqucns, cum tot opcs fic ga- zas , cum tantum auri argentiquc pon- dus Regnorumfpoliisco!ic£tum diuinx libcrahcati ac magnificcncix referat ac- ccptum » ftauiit quam primum commodc pocuit , gratiam ci rependere, reftitucns quicquid pretiofum Nabuchodonolor cx Tcmplo fuftulerat , fuftulcrat autcm plu- rima, qux lib. 4. Rcgum cap. 25 .ficHic- rcmix cap. 51. numerancur , quxquidem quia non omnia hic numerantur, ccnfcn- dum eftideoficri quia dc ilhs nonnulla auc iam pcrierant aut cerrc in prophanos vfus fucrant conrlata. Vcrf. 8 . Ver manum Mithridatis Filij G*^*bmr *r.numtr*uit t* S*(f*b*f*r Vrintifi lud* ejrc. Et li non ita certo dc- finiri poflc vidcatur qius proptie fucric hic Safiabafar,tamcncumis dicatur Iu- dx Princcps , placcc quod a plcritquc no- SdJJdbjfir. catumanimaducrro, fic a Chaldxis vo catum fuiiTcZorobabcI, cui vafaTcm- • pli a Cyro data lunc , in Hicrufalcm rcfe- renda, ac proindncflc binomincm. Fuic autcm Zorobabcl Dux populi , cx fcmi- xxrii. Q*i Z>r» JlebrM iiCbdldtu rv»(4iur Danicl autcm non lcgttur reduflc dc Ba- bylone in Hicrufalem >quin pocius dici- turfepultusinBabylone, rcmanlitcnim ibi ad confolationcm Iudxorum rcma- f*»*ntur nencium co quddmagnx clTct poccftatis, Htjfl d" apud Regcs, vndc 8c 3 anno Cyri facta \fum *t citilli decima vifio vc habccur Daniclis s*nui,jf*r lo.ficanno. t. Cyridacafuitludxis ra- Djmelem cultas redcundi, vc habctur ftarim 1. vcr- fw,(lf fX*- fu huius hiftorix $ac proindc , mclius di- fI,mAnt- ceturhunc Saflabalar ruilTc Zorobabc- lcm *> quod (i quis volucrit cum Hcbrxis icntire, potent diccrc Daniclcm , liccc de B Babylonc rcdicric in Hicrufalcm > ca- mendeprofcttioncludxorum fic de co- ponatione vaforum difpofuiflc , fic ideb ipiiprimum tradira fuilTc > pcncs qucm tocius ncgocii cura cflct , 8cc. Porro Mi- thridaccs per cuius manum vafa annumc- rantur Saifabafar , quiquc dicicur FUius Cazabar , feamdum vulgaum lc&io- ncma Pagnino vcrcitur chefaurarius ,fi- uuic.170. Sixci .ScTigurina, Iofcphus quoque , jtraiii Rcgii prxfe&um vocar> vcrum ( grxca Rcgia .; &c Bafil. Gazabar canquam nomen propnum accipiunt, in coquc cum vulg.ua noftra confcntiunt; tandem 8c hoc loco obfcruationc dignum ne Rcgio > Fihus Salachielis &c nepos C eft.fic a foluu capciuiucc Iudzorum Ma- Icchomx Rcgis > qui Babylonc nacus, giftrams, Duccs,ac Princ»pes,a Perfa 4»tt me» ilm-4 qa* Jiomen habuic a fpc parentis , quod ahc- nusaconfulioncfucuiuscflec.hoc cnim fonac intcrprctacio vocis Hcbraicx>Zo • robabcl > Baby lonij autem cum SaiTaba- farcm appcllaucrunc , ita Lytanus, Dio- nyf. Tornicllus , Vacablus .immoficlo- fcphus > loco iam fxpius citaco > femcl r.tquc itcrum Mithridati cuius ui tcxtu mcntio cft>adiungit Zorobabelcm»cius- ^ quc rci /ignumcitquod Saflabafar ,un- "7n*Ab4fS cum ^icitur • in noc hb- cixm rcs cft > cum eundcm Chaldxis vd Pctiis, alioqui cnim Hc- tjfe 4tZ: brxo vocabulo, Zorobabcl appcllatur, rtbdielem ficm catalogis vbi nominatur Zoroba- bclnullacltmcntio Saftabafaris , acce- dit qiiod cap. 5. v. S. dicicur Zoroba- bclifundaile Tcmplum, cap. autem j. V. 16. dicicur Sailabifar pofuiiTc funda- mcn ta ccmph. Et ccrtc con ftat magnam parccro nominum Gcntiliriorum populi ludaici , variatam eflc in 1'abylone, vt Dameli & fociorum eius, fic Nehcmix quicapite fcquenti v. 63. vocatur Athar- fata,vt paflim conlcntiunt intcrpictes, choinc unicn Hcbrxi tcftc Lyrano hunc Saiiabafar.fuifle Daniclcm , fcd httera iequens , vidctui huic opinioni contradi- ccrccum fubdicui vniucrfa tulic Safla- D unlit, 4IU. rum Impcracoreeciamnum adhuc dcfig- nacosruiiTc.nequeid Iud^onun Princi- pibus ruiflc commilfum > nifi ex pcculia- s*jf*l"f*r ri priuilcgio > quarc cum SaiTabafar Prin- ^ cipi cradica dicuncur vafa Tcmpli, pro V rchgiofoculm, eo cemporc a Pcrfarum 4bit>f»Ver- Rcgc confticutus eft Pnnccps , quod con- f4mmr\e^e ftacex capicc 5. v. 14. vbi dicirur promlic dffi- Cyrusvafaficc. EtjUisfmnt S*(f»li4tfMr> L*"**- q<*tm Princtpem eonjtttuit. Dc Efdra,cap.. E: v. 14. Ttt Autem inq*it Artaxtrxtt ' tonjlituc ludictsrfr Prttjidts'. Sci. Efdrx cap. 5. v. 14. idcm dcfeipfo rradic Nehc- mias | A dte inquit* qu* frttceptrnt Rex mthivt e(fem Dux in ttrrmlud*. V. 9- EthiceflnumeruscorumPhittl* MurttttrtgintM.PhtAltt mrgeutt* mille ejrc Conftacquidem numemm vaiorum cam aureorum, quam argcntcomm , in vni- ucrfum , fuifle quinque millufic quadra- ginu , vt infcrius dicicur v. 11. fcd ll lorum nic cancum parcem ahquam in fpecic , fcnpcura rccenfuic, nimirum 1499 duo millia quadringenca nonaginu nouem in Grxco Sixci , numerantur omnino, per fpccics fuas {499 quinque millia qua- dringenca nonaginu noucm , Iofcphus habcc diuerfos omnino nuracros , 6c va- ^ fomi» f^Atid tem pli fipptl. iix fatiU- timhtcdtfl srtbitm & fnij vfttt fucritilliwt intemplo. XXIX. rnmum Efdrz. .0 forum fpecics, quorum omniu fumm» cft A mzcranuar^ntri r^nnJ- • ^ tantuoi4i«o. quatuor aiiljte. duccnto- ^SSh^iS 8CnCr,<*ar* tum&dccem.Orjfctuandumautcrn&jl- lud hic proprie occui ric quod notat cti5 Dionyfius Carthullartus Phialas fijifle vafa in quibus vmum libationis fufum confidciabatur an cflct aptum adfacrifi- cia. Cultri vtgtttti nouem , fj-c. Erant cultri magni,quorum vfuscrat ad diuidendas hoaias,7o.veitunr,rnutatoria ( fcilicct vcftium)quafidiccrct, iuxta verfioncm illam, veftcs pretiofar, &c. Scjfht nttret '<$MM*, tyc Scyphi , alijs pc!ucs,vcl crateres aliis cochlearia /unt. y io St-tfhiMTztnutftcHHiii&c. Sci- licct Scyphi aurci,p,imj gcncris, ic for- — argentcis m»- cipiebatur fangutsholtiarum , fcd-inau> reisponabaturintra fandum. fmdorum in dic fcu fcfto cxpiatioms ait Lyranus. & curo coDionyfiusCarthufianus in hunc locum. * 0,nntm v»f* »*res & srtoxt*. tutnaut mtllts 0umdrin^aum , £c in- ccll.gc tam cxprcfla hic quam tacita, vt fuperius indieaui, noncnim enume- rauitfigtJlatimfupcriusomnia, fedprar- cipuatantum,vndc nil mirum fi quar funt pofitavnaminfummam coltata , multo minoremnumcrumcrnciant, quam cml »n tcxtu aftruitur. • ALLEGORIA ET TROPOLOGIA Capitis i. tiKorale & Myfticumin btcverU In anno primo Cyri , &c. i. Efdrs r. rtmtttenscHmfoteftatcmdiJicanttiTemflL Oncftdifficile Chriftu B hic in Cyro rcprarfcn- tare & gcneris humant vindiccm & aflerrorem fin aiTcttore libenatis Iudaicxfuo vclut in ty- « P°* *,od aiunt» atVc «magine adum- fttuttM hratum contcmplari. Enimvcro in hunc A*tyUnkM]ocumflc di{}c,i( Bcda citatui in glofla ftrCyrum orciinaria , ucnc Cyrus deftrucio Chal- tTMd*cit*r darotum impcriopopulumDci libcrauit Jilttyrici fcinpatriamrcmifir,* tcmplum inccn- u£Z HiS^u$. Tcxd*Rc>" i Dnid, «nocediwtum etiam pcr lirteras raani- ftTMltHtt feftauit : Ita Chrilhis dcftruc3o diaboli ftrChrijfs rcgnoy elcclosfuos, qui crant difpcrfi, C abciustyrannidc in Ecclefiam congrc- gauit. quac in prarfenti iuftificata ex fide , paccm habct ad Dcu, pcr ipfum &: ad vi- jioncmpcrpcruarpacis fdtmat, Hicrufa- lem quippc vifio pacis dicitur,Tcmplum quoquc inccnium reftaurari fccit, cum illosquiinfidi.santiqui hoftisfidem pcr- didcrant,adfalutcm reducens. habira- tionc lua dignos cfficit, fcripturas ctiam lacras,& fanSas^pcr vniuerfum mundum nuttit, quibu$fidcm fui nomini$,& fpcm fclutis cun<ai$ qui ad rcgnum fuum pcm ncntideftelc<fri$prxdicat } Paulo ajitex Myitagog.am hac verfat Lyranus, Cyru* //. «nqu.t figuram geflit noflri Saluatoris , quiahcut Cyrus reiaxauit captiuitatem SnfutAl.
| 15,251 |
https://openalex.org/W4293525658
|
OpenAlex
|
Open Science
|
CC-By
| 2,022 |
Insights into a Mineral Resource Chlorite Mica Carbonate Schist by Terahertz Spectroscopy Technology
|
Mei‐Hui Yang
|
English
|
Spoken
| 7,266 | 14,679 |
Citation: Yang, M.; Zhang, S.; Huang,
H.; Ma, Y.; Hao, S.; Zhang, Z.; Zheng,
Z. Insights into a Mineral Resource
Chlorite Mica Carbonate Schist by
Terahertz Spectroscopy Technology. Energies 2022, 15, 6314. https://
doi.org/10.3390/en15176314 Keywords: mineral resources; terahertz; absorption coefficients; refractive index; porosity; pyrolyzation;
non-destructive method energies energies Article ihui Yang †, Siqi Zhang †, Haochong Huang *, Yuanyuan Ma, Sibo Hao, Zili Zhang and Zhiyu School of Science, China University of Geosciences (Beijing), Beijing 100083, China
* Correspondence: [email protected] (H.H.); [email protected] (Z.Z.)
† These authors contributed equally to this work. Abstract: Nowadays, the mineral resources formed by geological processes have been effectively
utilized with the boom exploration of novel technologies. Traditional analytical methods, such as
X-ray Fluorescence, X-ray diffraction, and Scanning electron microscopy, remain the commonly used
approaches for resource detection. However, recent accelerations in terahertz component progress
have promoted researchers to discover more potential technologies in mineral resource exploration. In this article, the various porosities and calcination products of Chlorite mica carbonate schist, a
mineral resource and potent medicine, are detected using the terahertz time–domain spectroscopy. The terahertz constant measurement of Chlorite mica carbonate schist tablets including the amplitude
and phase values was carried out. After Fourier transforms, notable differences of absorption coeffi-
cients and refractive index are observed from these experimental samples, which have compelling
indications to quantitatively analyze the pore conditions and pyrolytic properties of mineral resources. This active research has vital implications for the rock reservoir properties analysis and mineral
energy utilization. It is also identified that terahertz time–domain spectroscopy can be considered as
a promising method for the qualitative, reliable, and efficient detection of mineral resources. Citation: Yang, M.; Zhang, S.; Huang,
H.; Ma, Y.; Hao, S.; Zhang, Z.; Zheng,
Z. Insights into a Mineral Resource
Chlorite Mica Carbonate Schist by
Terahertz Spectroscopy Technology.
Energies 2022, 15, 6314. https://
doi.org/10.3390/en15176314 1. Introduction As an irreplaceable material basis for social development, rich mineral resources play
key roles in socioeconomic operation, industrial reform, and medical advancement [1–3],
and thus, the relevant research in their characteristics, detection analysis, and application
possess stupendous significance [4]. The Chlorite mica carbonate schist (Lapis Chloriti), as
an essential mineral resource and traditional medicine, is a kind of layered mineral com-
posed of metamorphic biotite schist and chlorite mica carbonates [5]. The main elements of
Lapis Chloriti are Si, Fe, Mg, Al, K, etc. As a mica mineral, the structure is an octahedral
cation layer between two Silicone tetrahedra. The layered structure of Lapis Chloriti allows
possessing static potential differences, promoting cation exchange and having favorable
adsorption properties [6]. For such properties, it has the effects of eliminating phlegm and
calming diseases such as asthma and epilepsy [7]. As a raw material for the decoction of
traditional Chinese medicine, its calcined products and the ingredients’ properties, as well
as the rate of disintegration, play a crucial role in the efficacy [8,9]. Academic Editor: Nikolaos
Koukouzas Received: 19 July 2022
Accepted: 28 August 2022
Published: 29 August 2022 Publisher’s Note: MDPI stays neutral
with regard to jurisdictional claims in
published maps and institutional affil-
iations. On the other hand, Lapis Chloriti is a carbonate mineral that can be widely applied to
the research of energy storage electrolytes of fuel cells and can be dissolved in electrolytes
to enhance carbon electro-oxidation [10]. In addition, the rock also contains the mineral
chlorite which acts as a good pointer mineral for the oil reservoir [11]. The chlorites
can obstruct the pore throats, which is critical to the development of reservoirs. Based
on the above background, this study of the mineral Lapis Chloriti has significance for
energy utilization. Therefore, a reliable and non-destructive mineral resource detecting Copyright:
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article
distributed
under
the
terms
and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/). https://www.mdpi.com/journal/energies Energies 2022, 15, 6314. https://doi.org/10.3390/en15176314 Energies 2022, 15, 6314 2 of 10 method is critical to quantitatively analyze various mineral resource characteristics. At
present, the research of mineral resources and their material properties is mainly detected
by X-ray Fluorescence (XRF), X-ray diffraction (XRD), and Scanning electron microscope
(SEM). G. Y. S. K. Swamy et al. 1. Introduction characterized the metal concentrations of Indian Ayurvedic
medicines by using WD-XRF spectrometry [12]. Yang, F et al. studied the biochar–mineral
interfacial behavior of incubated biochar using XRD and SEM-ED [13]. B. Lubelli et al. investigated the porosity and pore size distribution of kaolin and bentonite based on the
freeze-dried samples and cryo-FIB-SEM observations [14]. L. Mei et al. assessed the mean
optical path length and the gas absorption in gas-filled porous media with a combination
method of frequency–domain photon migration and gas in scattering media absorption
spectroscopy [15]. However, these traditional methods may damage the pharmacological
properties of the non-renewable mineral resources or involve adverse chemical pollution. In
addition, the XRD and XRF technologies hardly support the detection of organic matter due
to the strong ionization characteristics of X-rays. The inefficiency makes it necessary to find
a feasible and non-destructive method. THz-TDS can provide an appropriate complement
for the existing detection technologies. Terahertz waves, lying between the microwave and
infrared bands of the electromagnetic spectrum, have many unique properties, such as low
energy security, strong selective penetration, and high coherence properties [16]. In recent
years, the terahertz “gap” has received widespread attention and extensive research from
domestic and international researchers. Terahertz technology has emerged with the development of lasers and electronics. Outstandingly, terahertz time–domain spectroscopy (THz-TDS), as an emerging detection
method, is a non-destructive measuring device, from which the real-time power of tera-
hertz pulses can be obtained with a high signal-to-noise ratio (SNR) compared to infrared
spectroscopy, and THz-TDS can directly measure the amplitude of the electric field with-
out contacting samples [17–19]. These advantages have made THz-TDS technology gain
significant progress in biology, energy, and geology [20–22]. In this paper, the THz-TDS is
employed to characterize a Chinese medicine of Lapis Chloriti. The extent of the poros-
ity and the variance of the calcined pharmaceutical composition are mainly focused on. Absorption coefficients and refractive indices both have illuminated that Lapis Chloriti
can be well identified with the aid of traditional testing methods. Therefore, it provides a
convenient and contactless medium for the identification of mineral resource detection. 2. Materials and Methods The Lapis Chloriti gravels purchased from the mineral medicine market were used as
the raw material in this study. The gravels were crushed in an agate mortar and passed
through a 200 mesh to obtain powders of particle size of about 75 µm. Then, one part of
the powders was placed in a tableting machine to form porous tablets with pressures of 1
to 5 pressure for THz-TDS measurements. The others were calcined with a muffle furnace. The temperatures of calcination treatments were 100 ◦C, 350 ◦C, 500 ◦C, 600 ◦C, and 700 ◦C,
respectively. The heating rate was 10 ◦C/min and the thermal insulation time was 2 h, then
they were left to naturally cool. After calcination treatments, the Lapis Chloriti powders
and polytetrafluoroethylene (PTFE) powders were mixed in a ratio of 2:1. Each tablet was
0.3 g in the experiments, and the thicknesses of the tablets were measured by a micrometer. g
p
y
The THz-TDS measurements with a transmission configuration were performed using
a spectrometer [23,24]. The femtosecond pulse with a central wavelength of 800 nm, a pulse
width of 100 fs, and a repetition frequency of 80 MHz was generated by a mode-locked
Ti-sapphire laser. The initial light was divided by a beam splitter into the pump beam and
probe beam, and the stronger pump light went through the delayed system and conducted
the gallium arsenide crystal to produce terahertz waves. After being reflected, collimated,
and focused by a parabolic mirror, the terahertz pulses penetrated samples and carried their
optical information. Finally, both the terahertz bumps simultaneously reached the ZnTe
photodetector crystal with a thickness of 2 mm. Terahertz waves are relatively unaffected
by far-infrared band noise and this THz-TDS device can deliver a higher signal-to-noise Energies 2022, 15, 6314 3 of 10 ratio (dynamic range >60 dB). In the experiment, the time delay between pumping and
detecting light was modified by a software-controlled translating stage movement with
a moving step of 0.005 mm and a time window range of 20 ps. The range of terahertz
spectrum was 0.1–3.5 THz, the actual frequency resolution based on the signal acquisition
frequency conversion was 50 GHz, and the minimum resolution of the instrument was
5 GHz. Here, the waveform signals before and after placing samples were both recorded in
the transmissive measurement. 2. Materials and Methods The sample-free result was calculated as the reference
signal, and the other one was the sample signal. During the data processing, the Fourier
transformations were applied to convert the time–domain signals into frequency–domain
with the assumption that the sample surfaces are smooth and homogeneous. The refractive
index of air is 1. E0 shows the incident wave function, and frequency–domain signal of the
terahertz wave after passing through samples can be denoted as: Esam = η
4en
(en + 1)2 ·exp
−jenωd
c
·E0
(1) (1) The reference wave function without placing the sample is expressed as: The reference wave function without placing the sample is expressed as: Ere f = η·exp
−jωd
c
·E0
(2) (2) By combining Equations (1) and (2), the complex refractive index and the ratio of the
propagation function H can be obtained as follows: H =
4en
(en + 1)2 ·exp
−κenωd
c
·exp
−j(en −1)ωd
c
(3) (3) en = n −jκ
(4) en = n −jκ (4) The real and imaginary parts of the complex refractive index in Formula (4) are known as
the refractive index (n) and extinction coefficient (κ), respectively. en is approximated with the re-
fractive index. The amplitude angle and logarithm can be extracted as following transformations: ∠H = −(n −1)ωd
c
(5) (5) ln|H| = ln
4n
(n + 1)2 −κ ωd
c
(6) (6) Based on Formulas (5) and (6), the refractive index (n) and the extinction coefficient (κ)
which is the phase and amplitude described in the following are then calculated as: n = 1 −c
ωd∠H
(7)
κ =
c
ωd
(
ln
"
4n
(n + 1)2
#
−ln|H|
)
(8) n = 1 −c
ωd∠H
(7) n = 1 −c
ωd∠H
(7)
c
d
(
ln
"
4n
2
#
−ln|H|
)
(8) (7) κ =
c
ωd
(
ln
"
4n
(n + 1)2
#
−ln|H|
)
(8) (8) The relationship between the extinction coefficient κ and the absorption coefficient α
can be obtained as:
αc The relationship between the extinction coefficient κ and the absorption coefficient α
can be obtained as:
αc κ = αc
2ω
(9)
α = ωκ
c
(10) (9) (10) In the above formulas, η represents the transmission factor, d is the sample thickness,
ω is the angular frequency, and c is the propagation speed of light, respectively. 3. Results and Discussion There are so many novel approaches to measure the porosity of minerals, such as pyc-
nometry [25], nitrogen gas sorption, mercury porosimetry [26], and X-ray micro-computed
tomography (micro-CT) [27]. In this work, to explore various porosities of tablets, terahertz
spectra are used for identification, as shown in Figure 1. The terahertz time–domain data
of different pressures are shown in Figure 1a. The reference represents the signal with no
sample in the cell. It can be found that the amplitude of the terahertz pulse decreases with
the increasing pressures. Simultaneously, increasing pressures also induce the regularity
of a time delay in the phase of terahertz pulses, which can be attributed to the variation
in the optical path of the terahertz wave transmission in the tablets, which is induced by
the refractive index and thicknesses of the tablets. The time–domain spectrum is subjected
to a Fast Fourier transform (FFT) to obtain the frequency–domain spectrum. It is worth
mentioning that the impact of data set loss from this process was suppressed with the
cooperation of the hardware stability and an algorithm smooth function. Regarding the
configuration of the spectral detection system, the terahertz time–domain spectroscopy
system (TDS) produced by China Daheng Technology Co., Ltd. (Beijing, China) was applied
and its instruments are all fixed in a one-piece unit to be stable and reliable. The Gallium
Arsenide (GaAs) photoconductive antenna used at the signal generating end can generate
a relatively high signal-to-noise ratio terahertz pulse. In addition, the unique penetrating
properties of terahertz waves prevent them from being scattered as much as other bands,
and the window material, Teflon, that we mixed into the sample also reduces this from
happening. At the same time, in order to prevent the water vapor from interfering with
the experiment, the spectrometer was purged with dry air during the measurements and
the relative humidity was less than 5%. The whole measurements were performed at a
room temperature of 23 degrees Celsius. On the other hand, there are six hundred initial
data points used for the field strength FFT, and the adjacent array means the smoothing
function was introduced to avoid jerky avalanches [28] during the data calculation process. The experimental results are shown in Figure 1b, where the frequency–domain spectrum of
the sample tends to zero around 1.6 THz, so the data analysis range is selected from 0.2
to 1.6 THz. 2. Materials and Methods Based on Energies 2022, 15, 6314 4 of 10 4 of 10 the above calculation of the algorithm model, the optical constants of the sample can be
obtained finally. the above calculation of the algorithm model, the optical constants of the sample can be
obtained finally. 3. Results and Discussion Moreover, compared with absorption coefficients, the refractive
index is another important parameter that can also reflect optical information about the
tablet. The porosity presents a decreasing tendency as the value of the refractive index
increases from about 2.1 to 2.45, as shown in Figure 1d. As shown in Figure 1c, the absorption coefficients increase as the frequency increases. This could be ascribed to the high-frequency response of the rotation or vibration of
molecules [29,30]. In the continuous frequency range, absorption coefficients have a neg-
ative correlation with porosity. Moreover, compared with absorption coefficients, the
refractive index is another important parameter that can also reflect optical information
about the tablet. The porosity presents a decreasing tendency as the value of the refractive
index increases from about 2.1 to 2.45, as shown in Figure 1d. ,
g
In order to directly observe the porosities of tablets, SEM images of tablets with var
ious porosities are displayed in Figure 2. As the porosity decreases, the tablet surface has
become denser. It illuminates that the existence of porosities in the mineral tablet is related
to the surface roughness of the tablet. Due to the tablet prepared by a powder status o
the Lapis Chloriti, a little debris is observed on the tablet surface. All those factors wil
affect the release and absorption of the tablet ingredient. It shows a positive correlation
between the surface roughness and the porosity [31]. g
In order to directly observe the porosities of tablets, SEM images of tablets with various
porosities are displayed in Figure 2. As the porosity decreases, the tablet surface has become
denser. It illuminates that the existence of porosities in the mineral tablet is related to the
surface roughness of the tablet. Due to the tablet prepared by a powder status of the Lapis
Chloriti, a little debris is observed on the tablet surface. All those factors will affect the
release and absorption of the tablet ingredient. It shows a positive correlation between the
surface roughness and the porosity [31]. between the surface roughness and the porosity [31]. Table 1. Values of the thickness and the porosity of the tablets. Pressure (ton)
H (mm)
P (%)
1
1.109
25.2
2
1.029
19.4
3
1.019
18.6
4
0.979
15.3
5
0.950
12.7
It is acknowledged that the porosities are in a specific relation to the terahertz fre-
quencies from the above discussions. 3. Results and Discussion It can be observed that the amplitude of the frequency–domain spectrum also
decreases as the pressure increases. The following formula is used to estimate the porosity. P = 1 −Vl
VT
(11) P = 1 −Vl
VT
(11)
V
m/ρ
V
π
d2
H
(12) P = 1 −Vl
VT
(11) P = 1 −Vl
VT
(11)
Vl = m/ρl, VT = π
d
2
2
H
(12) (11) Vl = m/ρl, VT = π
d
2
2
H
(12) (12) where P is the porosity, Vl is the volume of Lapis Chloriti, VT is the volume of tablets, m
is the weight of tablets, ρl is the density of Lapis Chloriti, and d and H are the diameter
and the thickness of the tablet, respectively. For each tablet, m is 0.3 g, ρl is 2.7 g/cm3, and
d is 13 mm. The thicknesses and porosities of the tablets are summarized in Table 1. As
the pressure increases, the thickness of the tablet decreases, which induces the reduction
of porosity. Table 1. Values of the thickness and the porosity of the tablets. Pressure (ton)
H (mm)
P (%)
1
1.109
25.2
2
1.029
19.4
3
1.019
18.6
4
0.979
15.3
5
0.950
12.7 Table 1. Values of the thickness and the porosity of the tablets. Energies 2022, 15, 6314
Energies 2022, 15, 6314 5 of 10
5 of 10 Figure 1. Terahertz time–domain spectra (a) and terahertz frequency–domain spectra (b) of table
under various pressures. Frequency‐dependent absorption coefficients (c) and refractive index (d
of tablets with various porosities. Figure 1. Terahertz time–domain spectra (a) and terahertz frequency–domain spectra (b) of tablets
under various pressures. Frequency-dependent absorption coefficients (c) and refractive index (d) of
tablets with various porosities. Figure 1. Terahertz time–domain spectra (a) and terahertz frequency–domain spectra (b) of tablet
under various pressures. Frequency‐dependent absorption coefficients (c) and refractive index (d
of tablets with various porosities. Figure 1. Terahertz time–domain spectra (a) and terahertz frequency–domain spectra (b) of tablets
under various pressures. Frequency-dependent absorption coefficients (c) and refractive index (d) of
tablets with various porosities. As shown in Figure 1c, the absorption coefficients increase as the frequency increases
This could be ascribed to the high‐frequency response of the rotation or vibration of mol‐
ecules [29,30]. In the continuous frequency range, absorption coefficients have a negative
correlation with porosity. 3. Results and Discussion Moreover, the research of calcination products has great significance for t
f
l
h
d h
d
Figure 3. Absorption coefficients fit as a function of the porosity at selected frequencies (a) and th
refractive index fits as a function of the porosity (b). Figure 3. Absorption coefficients fit as a function of the porosity at selected frequencies (a) and the
refractive index fits as a function of the porosity (b). nation of energy pyrolysis characteristics and this process can reduce impurit
toxicity of harmful substances as well as help to exert efficacy of traditiona
especially for mineral medicine. Therefore, calcination treatments of Lapis C
also worth being investigated. Table 2 shows the XRF results of the calcination
Chloriti samples from 23 °C to 700 °C. In addition to the main compositions sh
table, other trace elements are below 1% and some harmful heavy metal elem
Moreover, the research of calcination products has great significance for the determi‐
nation of energy pyrolysis characteristics and this process can reduce impurities and the
toxicity of harmful substances as well as help to exert efficacy of traditional medicine
especially for mineral medicine. Therefore, calcination treatments of Lapis Chloriti are
also worth being investigated. Table 2 shows the XRF results of the calcination of the Lapis
Chloriti samples from 23 °C to 700 °C. In addition to the main compositions shown in the
table, other trace elements are below 1% and some harmful heavy metal elements are be‐
Moreover, the research of calcination products has great significance for the deter-
mination of energy pyrolysis characteristics and this process can reduce impurities and
the toxicity of harmful substances as well as help to exert efficacy of traditional medicine,
especially for mineral medicine. Therefore, calcination treatments of Lapis Chloriti are also
worth being investigated. Table 2 shows the XRF results of the calcination of the Lapis
Chloriti samples from 23 ◦C to 700 ◦C. In addition to the main compositions shown in the
table, other trace elements are below 1% and some harmful heavy metal elements are below
0.005%. The variance of the main components is insensitive to the calcination temperatures. Meanwhile, the change of carbonate constitutes cannot be accurately obtained by XRF. To further characterize the Lapis Chloriti after calcination at different temperatures,
the XRD patterns are shown in Figure 4. 3. Results and Discussion To clearly illustrate the dependency, absorption
coefficients at five selected frequencies of 0.6, 0.8, 1.0, 1.2, and 1.4 THz from Figure 1c are
picked and fit as a function of porosity, as shown in Figure 3a. It is found that the porosity
and absorption coefficients fit well with an Allometric model [30]. Figure 3b shows the
relationship between the refractive index and the porosity. There, the refractive index is
the average value of the refractive indices in the frequency range of 0.2 to 1.6 THz. The
error bar is the average value between the maximum and minimum values of the refractive
index. It presents almost a linear tendency as the porosity increases (from 12% to 26%). Energies 2022, 15, 6314 6 of 10
0.2 to 1. e refrac Figure 2. SEM images of tablets with various porosities. From (a–e), the porosities are 2
18.6%, 15.3%, and 12.7%, respectively. Figure 2. SEM images of tablets with various porosities. From (a–e), the porosities are 25.2%, 19.4%,
18.6%, 15.3%, and 12.7%, respectively. Figure 2. SEM images of tablets with various porosities. From (a–e), the porosities are 25.2%, 19.4%
18.6%, 15.3%, and 12.7%, respectively. Figure 2. SEM images of tablets with various porosities. From (a–e), the porosities are 25
18.6%, 15.3%, and 12.7%, respectively. Figure 2. SEM images of tablets with various porosities. From (a–e), the porosities are 25.2%, 19.4%,
18.6%, 15.3%, and 12.7%, respectively. Figure 2. SEM images of tablets with various porosities. From (a–e), the porosities are 25.2%, 19.4%,
18.6%, 15.3%, and 12.7%, respectively. Figure 3. Absorption coefficients fit as a function of the porosity at selected frequencie
refractive index fits as a function of the porosity (b). Moreover, the research of calcination products has great significance for t
atio
of e e
y
y oly i
ha a te i ti
a d thi
o e
a
edu e i
u it
Figure 3. Absorption coefficients fit as a function of the porosity at selected frequencies (a) and the
refractive index fits as a function of the porosity (b). Figure 3. Absorption coefficients fit as a function of the porosity at selected frequencies (a) and the
refractive index fits as a function of the porosity (b). Figure 3 Absorption coeffic fit as a function of the porosity at selected frequ refractive index fits as a function of the porosity (b). 3. Results and Discussion Those results in‐
dicate that the calcination of Lapis Chloriti does not induce the obvious variation of the
phase composition, which means that the size and shape of the unit cell are almost iden‐
tical [33]. There is also some research indicating that the solvent molecules with large
atomic displacement parameters or disordered solvent molecules contribute little to the
XRD intensities [34]. Consequently, both the XRF and XRD patterns show the difficulties
of the analysis and identification of Lapis Chloriti under different calcination tempera‐
tures. Figure 4. The XRD patterns of the Lapis Chloriti sample after calcination at different temperatures. T bl
XRF
l
b
i
i i
f L
i Chl
i i
l
diff
Figure 4. The XRD patterns of the Lapis Chloriti sample after calcination at different temperatures. Table 2. XRF results about main compositions of Lapis Chloriti samples at different temperatures. Main Compositions (%)
23 ◦C
100 ◦C
350 ◦C
500 ◦C
600 ◦C
700 ◦C
MgO
10.386
10.135
10.464
10.518
10.392
10.491
Al2O3
12.069
11.943
12.086
12.148
12.188
12.236
SiO2
41.660
41.976
41.858
41.781
42.012
41.903
K2O
6.692
6.657
6.631
6.686
6.663
6.664
CaO
5.381
5.339
5.321
5.212
5.156
5.230
Fe2O3
19.851
19.744
19.678
19.652
19.696
19.580
TiO2
2.046
2.053
2.038
2.047
2.042
2.027
p
g
p
cate that biotite and chlorite are the main constituents of Lapis Chloriti [32]. With the in‐
creasing calcination temperatures, the positions of characteristic peaks have not altered
substantially while the intensity of the characteristic peaks has changed. Those results in‐
dicate that the calcination of Lapis Chloriti does not induce the obvious variation of the
phase composition, which means that the size and shape of the unit cell are almost iden‐
tical [33]. There is also some research indicating that the solvent molecules with large
atomic displacement parameters or disordered solvent molecules contribute little to the
XRD intensities [34]. Consequently, both the XRF and XRD patterns show the difficulties
of the analysis and identification of Lapis Chloriti under different calcination tempera‐
tures. Figure 4. The XRD patterns of the Lapis Chloriti sample after calcination at different temperatures. Figure 4. The XRD patterns of the Lapis Chloriti sample after calcination at different temperatures. Table 2. XRF results about main compositions of Lapis Chloriti samples at different temperatures. cate that biotite and chlorite are the main constituents of Lapis Chloriti [32]. 3. Results and Discussion The characteristic peaks between 5 and 30◦indicate
that biotite and chlorite are the main constituents of Lapis Chloriti [32]. With the increasing
calcination temperatures, the positions of characteristic peaks have not altered substantially
while the intensity of the characteristic peaks has changed. Those results indicate that the
calcination of Lapis Chloriti does not induce the obvious variation of the phase composition,
which means that the size and shape of the unit cell are almost identical [33]. There is
also some research indicating that the solvent molecules with large atomic displacement
parameters or disordered solvent molecules contribute little to the XRD intensities [34]. Energies 2022, 15, 6314 7 of 10
t Consequently, both the XRF and XRD patterns show the difficulties of the analysis and
identification of Lapis Chloriti under different calcination temperatures. XRF. To further characterize the Lapis Chloriti after calcination at different temperatures,
the XRD patterns are shown in Figure 4 The characteristic peaks between 5 and 30° indi Consequently, both the XRF and XRD patterns show the difficulties of the analysis and
identification of Lapis Chloriti under different calcination temperatures. XRF. To further characterize the Lapis Chloriti after calcination at different temperatures,
the XRD patterns are shown in Figure 4 The characteristic peaks between 5 and 30° indi Consequently, both the XRF and XRD patterns show the difficulties of the analysis and
identification of Lapis Chloriti under different calcination temperatures. XRF. To further characterize the Lapis Chloriti after calcination at different temperatures,
the XRD patterns are shown in Figure 4 The characteristic peaks between 5 and 30° indi Table 2. XRF results about main compositions of Lapis Chloriti samples at different temperatures. Main Compositions (%)
23 ◦C
100 ◦C
350 ◦C
500 ◦C
600 ◦C
700 ◦C
MgO
10.386
10.135
10.464
10.518
10.392
10.491
Al2O3
12.069
11.943
12.086
12.148
12.188
12.236
SiO2
41.660
41.976
41.858
41.781
42.012
41.903
K2O
6.692
6.657
6.631
6.686
6.663
6.664
CaO
5.381
5.339
5.321
5.212
5.156
5.230
Fe2O3
19.851
19.744
19.678
19.652
19.696
19.580
TiO2
2.046
2.053
2.038
2.047
2.042
2.027
p
g
p
cate that biotite and chlorite are the main constituents of Lapis Chloriti [32]. With the in‐
creasing calcination temperatures, the positions of characteristic peaks have not altered
substantially while the intensity of the characteristic peaks has changed. 4. Conclusions
4. Conclusions In summary, THz‐TDS is demonstrated to be a sensitive method for detecting the
optical properties of the mineral Lapis Chloriti. As essential material properties of mineral
resources, the porosity and pyrolysis properties are characterized in this paper by te‐
rahertz time–domain spectroscopy techniques with comparisons of various traditional an‐
alytical methods. According to the absorption coefficients and refractive indices, the iden‐
tifications of porosities and calcination products of Lapis Chloriti are realized at 0.2–1.6
THz. This work not only highlights the validity of THz‐TDS in monitoring the mineral
resource Lapis Chloriti, but also opens a non‐invasive horizon for the in‐line detection of
traditional medicine. What is more, the research on the pyrolysis characteristics of Lapis
Chloriti in this paper can provide theoretical and experimental references for the energy
utilization of mineral materials. Mineral resource detection is meaningful research with
enormous geological significance and economic benefits, which contributes to such novel
analytical technology and is critical to energy development. In summary, THz-TDS is demonstrated to be a sensitive method for detecting the
optical properties of the mineral Lapis Chloriti. As essential material properties of mineral
resources, the porosity and pyrolysis properties are characterized in this paper by terahertz
time–domain spectroscopy techniques with comparisons of various traditional analytical
methods. According to the absorption coefficients and refractive indices, the identifications
of porosities and calcination products of Lapis Chloriti are realized at 0.2–1.6 THz. This
work not only highlights the validity of THz-TDS in monitoring the mineral resource
Lapis Chloriti, but also opens a non-invasive horizon for the in-line detection of traditional
medicine. What is more, the research on the pyrolysis characteristics of Lapis Chloriti in
this paper can provide theoretical and experimental references for the energy utilization
of mineral materials. Mineral resource detection is meaningful research with enormous
geological significance and economic benefits, which contributes to such novel analytical
technology and is critical to energy development. Author Contributions: H.H. and Z.Z. (Zhiyuan Zheng) initiated the experiments. Y.M., S.H. and
Z.Z. (Zili Zhang) prepared the samples. Y.M. and S.H. performed the experiments. M.Y. and S.Z. developed the idea, analyzed the results, and wrote the manuscript. H.H. and Z.Z. (Zhiyuan Zheng)
provided funding acquisition and project administration. All authors have read and agreed to the
published version of the manuscript. Author Contributions: H.H. and Z.Z. (Zhiyuan Zheng) initiated the experiments. Y.M., S.H. and
Z.Z. (Zili Zhang) prepared the samples. Y.M. and S.H. performed the experiments. 3. Results and Discussion With the in
creasing calcination temperatures the positions of characteristic peaks have not altered Figure 4. The XRD patterns of the Lapis Chloriti sample after calcination at different temperatures
Figure 4. The XRD patterns of the Lapis Chloriti sample after calcination at different temperatures. Table 2. XRF results about main compositions of Lapis Chloriti samples at different temperatures. Main Compositions (%) 23 °C
100 °C
350 °C
500 °C
600 °C
700 °C
MgO
10.386
10.135
10.464
10.518
10.392
10.491
Al2O3
12.069
11.943
12.086
12.148
12.188
12.236
SiO2
41.660
41.976
41.858
41.781
42.012
41.903
K2O
6.692
6.657
6.631
6.686
6.663
6.664
CaO
5.381
5.339
5.321
5.212
5.156
5.230
Fe2O3
19.851
19.744
19.678
19.652
19.696
19.580
TiO2
2.046
2.053
2.038
2.047
2.042
2.027
As a versatile evaluation method, THz‐TDS can not only determine the porosity of
tablets, but also can characterize different calcination products of Lapis Chloriti. Figure 5a
As a versatile evaluation method, THz-TDS can not only determine the porosity of
tablets, but also can characterize different calcination products of Lapis Chloriti. Figure 5a
displays the frequency-dependent absorption coefficients of different calcination temper-
atures. It presents a certain tendency that the absorption coefficients decrease upon the
increase in the calcination temperatures. This is due to the layered structure of the mineral
Lapis Chloriti, which is filled with various metal ions coordinated to the hydroxyl group. High temperatures can destroy the hydroxyl group and lead to subtle variances of dielectric
properties. In this case, compared to XRD patterns, where the detection peaks which
appear in the figure are almost identical, the terahertz wave has a sensitive response to this
alternation which attributes to the high absorption coefficients of the hydrogen bonds at
terahertz frequencies [35]. Furthermore, absorption coefficients present an excellent linear
correlation with specific frequencies, as shown in Figure 5b. Those results indicate that
THz-TDS can distinguish Lapis Chloriti under different calcination temperatures. Energies 2022, 15, 6314 8 of 10
lent lin‐
ate that Figure 5. Frequency‐dependent absorption coefficients of various calcination temperatures (a) and
the absorption coefficients fit as a function of temperatures at different frequencies (b). C
l
i
Figure 5. Frequency-dependent absorption coefficients of various calcination temperatures (a) and
the absorption coefficients fit as a function of temperatures at different frequencies (b). Figure 5. Frequency‐dependent absorption coefficients of various calcination temperatures (a) and
the absorption coefficients fit as a function of temperatures at different frequencies (b). 3. Results and Discussion Figure 5. Frequency-dependent absorption coefficients of various calcination temperatures (a) and
the absorption coefficients fit as a function of temperatures at different frequencies (b). 4. Conclusions
4. Conclusions M.Y. and S.Z. developed the idea, analyzed the results, and wrote the manuscript. H.H. and Z.Z. (Zhiyuan Zheng)
provided funding acquisition and project administration. All authors have read and agreed to the
published version of the manuscript. Funding: This work was supported by the National Natural Science Foundation of China
(61805214), the Fundamental Research Funds for the Central Universities (2652022203, 2652019107,
2652020032). China University of Geosciences (Beijing) 2020 Educational Reform Project
(XNFZ202014, HHSKE202017), Young Talents Promotion Project of Beijing Association for Science
d T
h
l
(2020 2022)
Funding: This work was supported by the National Natural Science Foundation of China (61805214), the
Fundamental Research Funds for the Central Universities (2652022203, 2652019107, 2652020032). China
University of Geosciences (Beijing) 2020 Educational Reform Project (XNFZ202014, HHSKE202017), Young
Talents Promotion Project of Beijing Association for Science and Technology (2020–2022). and Technology (2020–2022). D
A
il bili
S
N
li
bl
Data Availability Statement: Not applicable. and Technology (2020–2022). Data Availability Statement: Not applicable. Data Availability Statement: Not applicable. C
fli t
f I t
t Th
th
d
l
fli t f i t
t
Conflicts of Interest: The authors declare no conflict of interest. ff
6.
Makbul, S.A.A.; Jahan, N.; Ahmad, G. Hajrul yahood (Lapis judaicus): An important mineral drug of Unani system of medicine
for the management of urolithiasis. J. Ethnopharmacol. 2018, 222, 165–170. [CrossRef] 1.
Dubiński,
J.
Sustainable
Development
of
Mining
Mineral
Resources.
J.
Sustain.
Min.
2013,
12,
1 6.
https://doi.org/10.7424/jsm130102.
2.
Aryee, B.N.A. Ghana’s mining sector: Its contribution to the national economy. Resour. Policy 2001, 27, 61–75.
y
g
y
y
3.
Zhou, B.; Li, Z.; Chen, C. Global Potential of Rare Earth Resources and Rare Earth Demand from Clean Technologies. Minerals
2017, 7, 203. [CrossRef] 2.
Aryee, B.N.A. Ghana s mining sector: Its contribution to the national economy. Resour. Policy 2001, 27, 61 75.
https://doi.org/10.1016/s0301‐4207(00)00042‐8.
3.
Zhou, B.; Li, Z.; Chen, C. Global Potential of Rare Earth Resources and Rare Earth Demand from Clean Technologies. Minerals
4.
Dumakor-Dupey, N.K.; Arya, S. Machine Learning—A Review of Applications in Mineral Resource Estimation. Energies 2021,
14, 4079. [CrossRef] References
1.
Dubi´nski, J. Sustainable Development of Mining Mineral Resources. J. Sustain. Min. 2013, 12, 1–6. [CrossRef] 1.
Dubiński,
J.
Sustainable
Development
of
Mining
Mineral
Resources.
J.
Sustain.
, J
p
g
J
,
,
[
2.
Aryee, B.N.A. Ghana’s mining sector: Its contribution to the national economy. Resour. Policy 2001, 27, References
1.
Dubi´nski, J. Sustainable Development of Mining Mineral Resources. J. Sustain. Min. 2013, 12, 1– References
1.
Dubiński,
J.
Sustainable
Development
of
Mining
Mineral
Resources.
J.
Sustain.
Min.
2013,
12,
1–6.
https://doi.org/10.7424/jsm130102.
2.
Aryee, B.N.A. Ghana’s mining sector: Its contribution to the national economy. Resour. Policy 2001, 27, 61–75.
https://doi.org/10.1016/s0301‐4207(00)00042‐8.
3.
Zhou, B.; Li, Z.; Chen, C. Global Potential of Rare Earth Resources and Rare Earth Demand from Clean Technologies. Minerals
2017, 7, 203. https://doi.org/10.3390/min7110203.
References
1.
Dubi´nski, J. Sustainable Development of Mining Mineral Resources. J. Sustain. Min. 2013, 12, 1–6. [CrossRef]
2.
Aryee, B.N.A. Ghana’s mining sector: Its contribution to the national economy. Resour. Policy 2001, 27, 61–75. [CrossRef]
3.
Zhou, B.; Li, Z.; Chen, C. Global Potential of Rare Earth Resources and Rare Earth Demand from Clean Technologies. Minerals
2017, 7, 203. [CrossRef]
4.
Dumakor-Dupey, N.K.; Arya, S. Machine Learning—A Review of Applications in Mineral Resource Estimation. Energies 2021,
14, 4079. [CrossRef]
5.
Lee, S.; Xu, H.F. Powder XRD and TEM study on crystal structure and interstratification of Zn-chlorite (baileychlore). Powder
Diffr. 2017, 32, 118–123. [CrossRef]
6.
Makbul, S.A.A.; Jahan, N.; Ahmad, G. Hajrul yahood (Lapis judaicus): An important mineral drug of Unani system of medicine
for the management of urolithiasis. J. Ethnopharmacol. 2018, 222, 165–170. [CrossRef] References Energies 2022, 15, 6314 9 of 10 9 of 10 7. Ridgway, C.; Bawuah, P.; Markl, D.; Zeitler, J.A.; Ketolainen, J.; Peiponen, K.-E.; Gane, P. On the role of API in determining
porosity, pore structure and bulk modulus of the skeletal material in pharmaceutical tablets formed with MCC as sole excipient. Int. J. Pharm. 2017, 526, 321–331. [CrossRef] J
[
]
8. Johansson, B.; Alderborn, G. The effect of shape and porosity on the compression behaviour and tablet fo
materials formed from microcrystalline cellulose. Eur. J. Pharm. Biopharm. 2001, 52, 347–357. [CrossRef [
]
born, G. The effect of shape and porosity on the compression behaviour and tablet forming ability of granular
om microcrystalline cellulose. Eur. J. Pharm. Biopharm. 2001, 52, 347–357. [CrossRef] y
p
9. Wang, Y.; Feng, F.; Wang, Z. Determination of Selected Elements in Aqueous Extractions of a Traditional Chinese Medicine
Formula by ICP-MS and FAAS: Evaluation of Formula Rationality. Anal. Lett. 2010, 43, 983–992. [CrossRef] y
y
10. Jang, W.-J.; Kim, H.-M.; Shim, J.-O.; Yoo, S.-Y.; Jeon, K.-W.; Na, H.-S.; Lee, Y.-L.; Lee, D.-W.; Roh, H.-S.; Yoon, W.L. Deactivation of
SiO2 supported Ni catalysts by structural change in the direct internal reforming reaction of molten carbonate fuel cell. Catal. Commun. 2017, 101, 44–47. [CrossRef] 11. Wang, G.; Chang, X.; Yin, W.; Li, Y.; Song, T. Impact of diagenesis on reservoir quality and heterogene
Chang 8 tight oil sandstones in the Zhenjing area, Ordos Basin, China. Mar. Pet. Geol. 2017, 83, 84–96. .; Yin, W.; Li, Y.; Song, T. Impact of diagenesis on reservoir quality and heterogeneity of the Upper Triassic
ndstones in the Zhenjing area, Ordos Basin, China. Mar. Pet. Geol. 2017, 83, 84–96. [CrossRef] 12. Swamy, G.Y.S.K.; Ravikumar, K. Characterization of Indian Ayurvedic herbal medicines for their metal concentrations using
WD-XRF spectrometry. X-ray Spectrom. 2010, 39, 216–220. [CrossRef] p
y
y
p
[
]
13. Yang, F.; Zhao, L.; Gao, B.; Xu, X.; Cao, X. The Interfacial Behavior between Biochar and Soil Minerals and Its Effect on Biochar
Stability. Environ. Sci. Technol. 2016, 50, 2264–2271. [CrossRef] 14. Lubelli, B.; de Winter, D.A.M.; Post, J.A.; van Hees, P.J.; Drury, M.R. Cryo-FIB–SEM and MIP study of porosity and pore size
distribution of bentonite and kaolin at different moisture contents. Appl. Clay Sci. 2013, 81, 358–365. [CrossRef] 15. Mei, L.; Svanberg, S.; Somesfalean, G. References Combined optical porosimetry and gas absorption spectroscopy in gas-filled porous media
using diode-laser-based frequency domain photon migration. Opt. Express 2012, 20, 16942–16954. [CrossRef] 16. Cheng, H.; Huang, H.-C.; Yang, M.-F.; Yang, M.-H.; Yan, H.; Panezai, S.; Zheng, Z.-Y.; Zhang, Z.; Zhang, Z.-L. Characterization of
the remediation of chromium ion contamination with bentonite by terahertz time-domain spectroscopy. Sci. Rep. 2022, 12, 11149. [CrossRef] [PubMed] [CrossRef] [PubMed] 17. Miao, X.Y.; Zhan, H.L.; Zhao, K. Application of THz technology in oil and gas optics. Sci. China Phys. Mech. Astron. 2017, 60,
88–90. [CrossRef] 18. Huang, H.C.; Qiu, P.Y.; Panezai, S.; Hao, S.B.; Zhang, D.L.; Yang, Y.Q.; Ma, Y.Y.; Gao, H.; Gao, L.; Zhang, Z.L.; et al. Continuous-
wave terahertz high-resolution imaging via synthetic hologram extrapolation method using pyroelectric detector. Opt. Laser
Technol. 2019, 120, 105683. [CrossRef] Zhang, X.-C. Materials for terahertz science and technology. Nat. Mater. 2002, 1, 26–33. [CrossRef] 19. Ferguson, B.; Zhang, X.-C. Materials for terahertz science and technology. Nat. Mater. 2002, 1, 26–33 20. Yang, Y.P.; Lei, X.Y.; Yue, A.; Zhang, Z.W. Temperature-dependent THz vibrational spectra of clenbuterol hydrochloride. Sci. China Ser. G Phys. Mech. Astron. 2013, 56, 713–717. [CrossRef] y
21. Jiang, C.; Zhao, K.; Fu, C.; Xiao, L.Z. Characterization of Morphology and Structure of Wax Crystals in Waxy Crude Oils by
Terahertz Time-Domain Spectroscopy. Energy Fuels 2017, 31, 1416–1421. [CrossRef] 22. Miao, X.Y.; Zhan, H.L.; Zhao, K.; Zhang, Z.W.; Xu, L.; Zhang, C.L.; Xiao, L.Z. Terahertz-dependent PM2.5 monitoring and grading
in the atmosphere. Sci. China Ser. G Phys. Mech. Astron. 2018, 61, 104211. [CrossRef] p
y
23. Hao, S.B.; Huang, H.C.; Ma, Y.Y.; Liu, S.J.; Zhang, Z.L.; Zheng, Z.Y. Characterizations of the Calamine tablets by terahertz
time-domain spectroscopy. Optik 2019, 187, 278–284. [CrossRef] 24. Ma, Y.Y.; Huang, H.C.; Hao, S.B.; Qiu, K.-F.; Gao, H.; Gao, L.; Tang, W.C.; Zhang, Z.L.; Zheng, Z.Y. Insigh
hydrous minerals using terahertz time-domain spectroscopy. Sci. Rep. 2019, 9, 9265. [CrossRef] [PubM 25. Brewer, C.E.; Chuang, V.J.; Masiello, C.A.; Gonnermann, H.; Gao, X.; Dugan, B.; Driver, L.E.; Panzacchi, P.; Zygourakis, K.;
Davies, C.A. New approaches to measuring biochar density and porosity. Biomass-Bioenergy 2014, 66, 176–185. [CrossRef] pp
g
y
p
y
gy
26. Cychosz, K.A.; Guillet-Nicolas, R.; García-Martínez, J.; Thommes, M. Recent advances in the textural characterization of
hierarchically structured nanoporous materials. Chem. Soc. Rev. 2017, 46, 389–414. [CrossRef] 27. Ramandi, H.L.; Mostaghimi, P.; Armstrong, R.T.; Saadatfar, M.; Pinczewski, W.V. p
y
Matˇej, Z.; Matˇejová, L.; Kužel, R. XRD analysis of nanocrystalline anatase powders prepared by var
Correlations between micro-structure and crystal structure parameters. Powder Diffr. 2013, 28, S161–S183. oles, A.; Mulch, A.; Pluijm, B.D. Near-surface clay authigenesis in exhumed fault rock of the Alpine Fault Zon
-H-Ar isotopic, XRD and chemical analysis of illite and chlorite. J. Struct. Geol 2018, 111, 27–41. [CrossRef] 34.
Ito, M.; Nambu, K.; Sakon, A.; Uekusa, H.; Yonemochi, E.; Noguchi, S.; Terada, K. Mechanisms for Improved Hygroscopicity of
L-Arginine Valproate Revealed by X-ray Single Crystal Structure Analysis. J. Pharm. Sci. 2017, 106, 859–865. [CrossRef] g
p
y
y
g
y
y
35.
Ito, M.; Tokuda, R.; Suzuki, H.; Sakamoto, T.; Terada, K.; Noguchi, S. Desolvation be
follow-up by terahertz spectroscopy. Int. J. Pharm. 2019, 567, 118446. [CrossRef] g
p
y
y
g
y
y
J
,
,
[
]
35.
Ito, M.; Tokuda, R.; Suzuki, H.; Sakamoto, T.; Terada, K.; Noguchi, S. Desolvation behavior of indinavir sulfate ethanol and
follow-up by terahertz spectroscopy. Int. J. Pharm. 2019, 567, 118446. [CrossRef] References Porosity and p
coal: A micro-computed tomography study. Int. J. Coal Geol. 2016, 154–155, 57–68. [CrossRef] .H.; Jiang, X. Crackling noise and avalanches in minerals. Phys. Chem. Miner. 2021, 48, 1–15. [CrossRef] 28. Salje, E.K.H.; Jiang, X. Crackling noise and avalanches in minerals. Phys. Chem. Miner. 2021, 48, 1– 29. Chakraborty, M.; Bawuah, P.; Tan, N.; Ervasti, T.; Pääkkönen, P.; Zeitler, J.A.; Ketolainen, J.; Peiponen, K.-E. On the Correlation of
Effective Terahertz Refractive Index and Average Surface Roughness of Pharmaceutical Tablets. J. Infrared Millim. Terahertz Waves
2016, 37, 776–785. [CrossRef] 30. Eleveld, D.J.; Proost, J.H.; Vereecke, H.; Absalom, A.R.; Olofsen, E.; Vuyk, J.; Struys, M.M.R.F. An Allomet
Pharmacokinetics and Pharmacodynamics. Anesthesiology 2017, 126, 1005–1018. [CrossRef] 31. Wang, W.Y.; Sun, J.J.; Dong, C.L. Biotite weathering by Aspergillus niger and its potential utilization. J. Soil. Sediment 2016, 16,
1901–1910. [CrossRef] 32. Boles, A.; Mulch, A.; Pluijm, B.D. Near-surface clay authigenesis in exhumed fault rock of the Alpine Fault Zone (New Zealand);
O-H-Ar isotopic, XRD and chemical analysis of illite and chlorite. J. Struct. Geol 2018, 111, 27–41. [CrossRef] 33. Matˇej, Z.; Matˇejová, L.; Kužel, R. XRD analysis of nanocrystalline anatase powders prepared by various chemical routes:
Correlations between micro-structure and crystal structure parameters. Powder Diffr. 2013, 28, S161–S183. [CrossRef] 10 of 10 10 of 10 Energies 2022, 15, 6314
| 35,856 |
https://github.com/rafl/test-continuous/blob/master/lib/Test/Continuous.pm
|
Github Open Source
|
Open Source
|
Unlicense
| 2,019 |
test-continuous
|
rafl
|
Perl
|
Code
| 972 | 2,517 |
use strict;
use warnings;
package Test::Continuous;
use 5.008;
our $VERSION = '0.62';
use Exporter::Lite;
use App::Prove;
use File::Find;
use File::Modified;
use Cwd;
use Module::ExtractUse;
use List::MoreUtils qw(uniq);
use File::Temp qw(tempdir tempfile);
use File::Path qw(rmtree);
use File::Spec;
use TAP::Parser;
use TAP::Parser::Iterator::Stream;
use Archive::Tar;
use IO::File;
use Test::Continuous::Formatter;
our @EXPORT = qw(&runtests);
{
no warnings;
*{App::Prove::_exit} = sub {};
}
my @prove_args;
my @tests;
my @changes;
my @files;
sub _files {
return @files if @files;
find sub {
my $filename = $File::Find::name;
return if ! -f $filename;
return unless $filename =~ /\.(p[lm]|t)$/;
push @files, $filename;
}, getcwd;
return @files;
}
sub _tests_to_run {
my %dep;
my $p = Module::ExtractUse->new;
for my $t ( @tests ) {
$p->extract_use($t);
for my $used ($p->array) {
next unless $used =~ s{::}{/}g;
$used .= ".pm";
push @{$dep{$used}||=[]}, $t;
}
}
my @tests_to_run = uniq sort map {
if (/.t$/) {
$_;
}
else {
my $changed = $_;
map { @{$dep{$_}} } grep { index($changed, $_) >= 0 } keys %dep;
}
} @changes;
return @tests if @tests_to_run == 0;
return @tests_to_run;
}
sub _run_once {
my $dir = tempdir;
my $file = $dir . "/$$.tar";
my @tests = _tests_to_run;
my $prove = App::Prove->new;
$prove->process_args(
"--formatter" => "Test::Continuous::Formatter",
"--archive" => $file,
"-m",
"-b",
"-l",
"--norc",
@prove_args,
@tests
);
$prove->run;
_analyze_tap_archive($dir, $file, @tests);
}
sub _analyze_tap_archive {
my ($dir, $file, @tests) = @_;
my $cwd = getcwd;
chdir($dir);
my $tar = Archive::Tar->new;
$tar->read($file, 0);
$tar->extract();
chdir($cwd);
for my $test (@tests) {
my $file = File::Spec->catfile($dir, $test);
my $fh = IO::File->new;
$fh->open("< $file") or next;
my $parser = TAP::Parser->new({
stream => TAP::Parser::Iterator::Stream->new( $fh )
});
my @warning = ();
my @comment = ();
while (my $result = $parser->next) {
if ($result->is_comment) {
push @comment, $result->as_string;
}
elsif ($result->is_unknown) {
push @warning, $result->as_string;
}
}
if (@warning) {
Test::Continuous::Notifier->send_notify(join("\n", "$test:", @warning), "warning");
}
if (@comment) {
Test::Continuous::Notifier->send_notify(join("\n", "$test:", @comment));
}
}
rmtree($dir);
}
sub runtests {
if (@ARGV) {
# print "ARGV: " . join ",",@ARGV, "\n";
while ($ARGV[-1] && -f $ARGV[-1]) {
push @tests, pop @ARGV;
}
@prove_args = @ARGV;
} else {
find sub {
my $filename = $File::Find::name;
return unless $filename =~ /\.t$/ && -f $filename;
push @tests, $filename;
}, getcwd;
}
print "[MSG] Will run continuously test $_\n" for @tests;
my $d = File::Modified->new( files => [ _files ] );
while(1) {
if ( @changes = $d->changed ) {
print "[MSG]: $_ was changed.\n" for @changes;
$d->update();
_run_once;
}
sleep 3;
}
}
1;
__END__
=head1 NAME
Test::Continuous - Run your tests suite continusouly when developing.
=head1 VERSION
This document describes Test::Continuous version 0.61
=head1 SYNOPSIS
Very simple usage:
% cd MyModule/
% perl -MTest::Continuous -e runtests
If you want to provide prove arguments:
% perl -MTest::Continuous -e runtests -- --verbose --shuffle
=head1 DESCRIPTION
I<Continuous Testing> is a concept and tool to re-run software tests
as soon as the developer saved the source code.
See also L<http://groups.csail.mit.edu/pag/continuoustesting/> for the
original implementation of Continuous Testing as a Eclipse plugin.
See also Zentest L<http://www.zenspider.com/ZSS/Products/ZenTest/> for
the same concept of implementation in Ruby's world.
=head1 INTERFACE
=over
=item runtests
This is the only function that you should be calling, directly
from command line:
perl -MTest::Continuous -e runtests
It'll start monitoring the mtime of all files under current working
directy. If there's any update, it'll run your module test under t/
directory with L<App::Prove>.
Test result are displayed on terminal. Also dispatched to Growl if
C<Log::Dispatch::MacGrowl> is installed. Big plus for perl programmers
on Mac.
C<Test::Continuous> will auto detect the subset of tests to run.
For example, say you have two test files C<feature-foo.t> and
C<feature-bar.t> which test ,and use, your module C<Feature::Foo>
and C<Feature::Bar> respectively. C<Test::Continuous> can catch
this static dependency and only run C<feature-foo.t> when C<Feature::Foo>
is modified, C<feature-bar.t> will only be ran if C<Feature::Bar>
is modified.
If a C<.t> file is modified, only that test file will be ran.
Dynamic module dependency is more difficult to detect and needs
further research.
=back
=head1 CONFIGURATION AND ENVIRONMENT
Test::Continuous requires no configuration files or environment variables.
=head1 DEPENDENCIES
L<App::Prove>, L<Log::Dispatch>, L<Log::Dispatch::MacGrowl>,
L<Module::ExtractUse>
=head1 INCOMPATIBILITIES
None reported.
=head1 BUGS AND LIMITATIONS
No bugs have been reported.
Please report any bugs or feature requests to
C<[email protected]>, or through the web interface at
L<http://rt.cpan.org>.
=head1 TODO
=over
=item A good name for executable.
=item Accept a per-module config file to tweak different parameters to prove command.
=back
=head1 AUTHOR
Kang-min Liu C<< <[email protected]> >>
=head1 LICENCE AND COPYRIGHT
Copyright (c) 2008,2009 Kang-min Liu C<< <[email protected]> >>.
This module is free software; you can redistribute it and/or
modify it under the same terms as Perl itself. See L<perlartistic>.
=head1 DISCLAIMER OF WARRANTY
BECAUSE THIS SOFTWARE IS LICENSED FREE OF CHARGE, THERE IS NO WARRANTY
FOR THE SOFTWARE, TO THE EXTENT PERMITTED BY APPLICABLE LAW. EXCEPT WHEN
OTHERWISE STATED IN WRITING THE COPYRIGHT HOLDERS AND/OR OTHER PARTIES
PROVIDE THE SOFTWARE "AS IS" WITHOUT WARRANTY OF ANY KIND, EITHER
EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED
WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE. THE
ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE SOFTWARE IS WITH
YOU. SHOULD THE SOFTWARE PROVE DEFECTIVE, YOU ASSUME THE COST OF ALL
NECESSARY SERVICING, REPAIR, OR CORRECTION.
IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING
WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MAY MODIFY AND/OR
REDISTRIBUTE THE SOFTWARE AS PERMITTED BY THE ABOVE LICENCE, BE
LIABLE TO YOU FOR DAMAGES, INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL,
OR CONSEQUENTIAL DAMAGES ARISING OUT OF THE USE OR INABILITY TO USE
THE SOFTWARE (INCLUDING BUT NOT LIMITED TO LOSS OF DATA OR DATA BEING
RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD PARTIES OR A
FAILURE OF THE SOFTWARE TO OPERATE WITH ANY OTHER SOFTWARE), EVEN IF
SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF
SUCH DAMAGES.
| 47,109 |
<urn:uuid:71c20671-65d6-43ea-b1c7-84f1a1214604>
|
French Open Data
|
Open Government
|
Various open data
| null |
https://www.elysee.fr/front/pdf/elysee-module-4739-fr.pdf
|
elysee.fr
|
Dutch
|
Spoken
| 1,512 | 3,584 |
VALERY GISCARD D'ESTAING DEVANT LA
COMMUNAUTE FRANCAISE DE BAHREIN,
LORS DE SON VOYAGE OFFICIEL AU
PROCHE-ORIENT, MANAMA, LE LUNDI 3
MARS 1980
`POLITIQUE ETRANGERE ` RELATIONS FRANCO - BAHREINIES` MES CHERS
COMPATRIOTES LES FRANCAISES ET LES FRANCAIS DE BAHREIN,
- JE SUIS VENU VOUS REMERCIER ET VOUS FELICITER PARCE QUE VOUS ETES L'AVANT-
GARDE DE LA FRANCE DANS CET ETAT, COMME LES FRANCAISES ET LES FRANCAIS QUI
VIVENT DANS LE GOLFE `PERSIQUE` SONT L'AVANT-GARDE DE LA FRANCE. JE DIS BIEN
- IL Y A MOINS DE DIX ANS, NOUS N'AVIONS PAS DE RELATIONS DIPLOMATIQUES AVEC
BAHREIN. IL Y A SIX ANS, NOUS N'AVIONS PAS D'AMBASSADEUR ET D'AMBASSADE.
NOUS N'AVIONS PAS NON PLUS DE REPRESENTATION COMMERCIALE PROPRE. LORSQUE
NOUS REGARDONS LE CHEMIN PARCOURU, QUE VOYONS-NOUS ? EN 1972 `ANNEE` :
ETABLISSEMENT DES RELATIONS DIPLOMATIQUES £ EN 1974 : DESIGNATION D'UN
AMBASSADEUR. DESORMAIS, UN AMBASSADEUR REPRESENTE NOTRE PAYS DANS CET
ETAT : IL A ETE CHOISI EN-RAISON DE SES QUALITES AUVERGNATES. IL EST RARE POUR
MOI DE RETROUVER DANS MES VOYAGES OFFICIELS UN AMBASSADEUR QUI SOIT EN
MEME TEMPS UN DES ANCIENS ELECTEURS DANS LE CANTON DONT J'ETAIS
CONSEILLER_GENERAL £ JE SAIS QU'IL EN A GARDE LA FIDELITE ET LES QUALITES.\
`POLITIQUE ETRANGERE ` RELATIONS FRANCO - BAHREINIES` EN 1976, JE RECEVAIS A
PARIS, POUR LA PREMIERE FOIS, EN VOYAGE OFFICIEL CHEIKH ISSA. ME VOICI, EN
REPONSE A SON INVITATION.
- CECI MONTRE LE CHEMIN QUI A ETE PARCOURU PAR LA FRANCE ET PAR CETTE AVANT-
GARDE QUE VOUS CONSTITUEZ, DANS LE DEVELOPPEMENT DE NOS RELATIONS AVEC
L'ETAT DE BAHREIN. BEAUCOUP D'ENTRE VOUS SONT ARRIVES DEPUIS PEU, CERTAINS
ET CERTAINES D'ENTRE VOUS Y ONT UNE ACTIVITE LIEE A DES CHANTIERS £ D'AUTRES
APPARTIENNENT A DES ORGANISATIONS QUI Y RESTERONT DE FACON PLUS DURABLE.
- J'AI DIT AVANT-GARDE, PARCE QUE QUELS QUE SOIENT CES EFFORTS, QUELS QUE
SOIENT CES RESULTATS, NOUS NE POUVONS PAS CEPENDANT LES CONSIDERER COMME
SATISFAISANTS. PENDANT LE DEJEUNER SI AMICAL QUI M'ETAIT OFFERT PAR LES
HAUTES AUTORITES BAHREINIES, J'AI DEMANDE COMBIEN IL Y AVAIT D'EUROPEENS OU
D'OCCIDENTAUX DANS L'ILE. IL Y EN A PLUSIEURS MILLIERS, PAS LOIN DE 10000, ET
VOUS SAVEZ QU'IL N'Y A QUE 328 `NOMBRE` FRANCAIS. IL Y A ENCORE UNE LARGE
PLACE POUR LE DEVELOPPEMENT DE NOTRE ACTION ET DE NOTRE INFLUENCE. J'EN
DIRAIS DE MEME POUR NOS ACTIVITES COMMERCIALES.\
`POLITIQUE ETRANGERE ` RELATIONS FRANCO - BAHREINIES` JE SUIS ACCOMPAGNE
PAR M. LE MINISTRE DU COMMERCE EXTERIEUR `JEAN-FRANCOIS DENIAU`, QUI EST
VENU ICI RECEMMENT OU IL A CONDUIT DES NEGOCIATIONS £ PAR LE MINISTRE DE
L'INDUSTRIE `ANDRE GIRAUD` QUI EST EN MEME TEMPS LE MINISTRE DE L'ENERGIE £
PAR LE MINISTRE DE LA CULTURE `JEAN-PHILIPPE LECAT` £ VOUS AVEZ APPRECIE
CERTAINEMENT LES MANIFESTATIONS CULTURELLES QUI ONT EU _LIEU ICI A
L'AUTOMNE. SI JE SUIS ACCOMPAGNE DE CETTE IMPORTANTE DELEGATION, C'EST
PARCE QUE NOUS AVONS ENCORE BEAUCOUP A FAIRE POUR DEVELOPPER NOS
RELATIONS ET NOS ECHANGES.
- DANS CE PAYS EN PLEIN DEVELOPPEMENT, MALGRE CE QUI A ETE ACCOMPLI, MALGRE
LES EFFORTS DE L'AVANT-GARDE, MALGRE L'ACTION DE NOS SERVICES, AUXQUELS JE
TIENS A RENDRE HOMMAGE, NOS ECHANGES NE REPRESENTENT ENCORE ENVIRON QUE
2,4 % `STATISTIQUE` DES IMPORTATIONS DE BAHREIN, C'EST-A-DIRE PRESQUE DIX FOIS
MOINS QUE CELLES DE NOTRE PARTENAIRE BRITANNIQUE ET BEAUCOUP MOINS QUE
CELLES DE PUISSANCES QUI N'ONT PAS DE LIENS HISTORIQUES AVEC LES ETATS DE LA
REGION. SI BIEN QUE L'AVANT-GARDE DOIT ETRE SUIVIE, JE L'ESPERE, PAR LE GROS DE
LA TROUPE. MAIS LES FRANCAISES ET LES FRANCAIS QUI VIENDRONT TRAVAILLER ICI
S'INSPIRERONT DE VOS LECONS ET DE VOTRE EXEMPLE. CAR VOUS DONNEZ UNE TRES
BONNE IMAGE DE CE QUE PEUT ETRE LA PRESENCE DE LA FRANCE DANS UN TEL PAYS.\
`POLITIQUE ETRANGERE ` RELATIONS FRANCO - BAHREINIES` VOUS ETES LOIN DE CHEZ
VOUS, DANS UNE PARTIE DU MONDE DONT L'ENVIRONNEMENT EST TRES DIFFERENT DE
VOTRE ENVIRONNEMENT FAMILIER. NEANMOINS, VOUS DETES SENSIBLES, J'EN SUIS
PERSUADE, A LA QUALITE DE L'ACCUEIL QUE VOUS RESERVENT LES AUTORITES ET
L'ADMINISTRATION DE BAHREIN. POURQUOI CET ACCUEIL ? C'EST PARCE QUE DANS CE
PAYS, COMME DANS LES ETATS VOISINS, LA POLITIQUE DE LA FRANCE EST APPRECIEE
ET COMPRISE. VOUS QUI ETES ICI, LOIN DE VOTRE PAYS, QUI OBSERVEZ LES REALITES
DE CETTE REGION DU MONDE, VOUS VOYEZ COMBIEN IL EST IMPORTANT QUE LA
POLITIQUE DE LA FRANCE SOIT APPRECIEE ET COMPRISE.
- CETTE POLITIQUE QUE VEUT-ELLE ETRE ? J'AI RAPPELE RECEMMENT A NOS
COMPATRIOTES, MAIS VOUS ETIEZ TROP LOIN POUR SUIVRE L'EMISSION, QUE C'EST UNE
POLITIQUE INDEPENDANTE. NATURELLEMENT, NOUS SAVONS QUE NOUS SOMMES UNE
DEMOCRATIE OCCIDENTALE. NATURELLEMENT, NOUS SAVONS QUE NOUS SOMMES UN
PAYS D'EUROPE AYANT DE NOMBREUSES SOLIDARITES AVEC NOS PARTENAIRES. MAIS,
NOUS CONDUISONS UNE POLITIQUE INDEPENDANTE, C'EST-A-DIRE UNE POLITIQUE QUI
EXPRIME LA POSITION ET LE JUGEMENT DE LA FRANCE SUR LES EVENEMENTS DU
MONDE CONTEMPORAIN. D'AILLEURS, VOUS QUI RENCONTREZ ICI DES BAHREINIS, VOUS
DEVEZ OBSERVER COMBIEN ON SOUHAITE QUE SUR UN CERTAIN NOMBRE DE SUJETS,
FACE A UN CERTAIN NOMBRE DE DIFFICULTES, LA FRANCE FASSE ENTENDRE SA VOIX.\
`POLITIQUE ETRANGERE ` RELATIONS FRANCO - BAHREINIES` DONC, UNE POLITIQUE
INDEPENDANTE. EN MEME TEMPS UNE POLITIQUE QUI S'EFFORCE DE DEFENDRE DES
POINTS_DE_VUE JUSTES ET OUVERTS. JUSTES, CELA VEUT DIRE QUE NOUS DEVONS
PARTOUT OU IL Y A DES DIFFICULTES DANS LE MONDE, RECHERCHER DES SOLUTIONS
QUI SOIENT EQUITABLES ET REPONDENT AUX ASPIRATIONS PROFONDES DES PEUPLES.
C'EST CELA TRADITIONNELLEMENT LA POLITIQUE DE LA FRANCE. SI LA POLITIQUE DE LA
FRANCE NE RESTAIT PAS UNE POLITIQUE QUI S'EFFORCE DE FAIRE PREVALOIR DES
SOLUTIONS JUSTES ET DES SOLUTIONS DE PROGRES, ELLE APPARAITRAIT EN RUPTURE
OU EN CONTRADICTION AVEC NOTRE TRADITION HISTORIQUE.
- PARFOIS, ON CHERCHE A EXPLIQUER LES ATTITUDES QUE NOUS PRENONS PAR LA
CONSIDERATION DE NOS INTERETS. NOUS AVONS A EN TENIR _COMPTE ET JE
N'ASSUMERAIS PAS LES RESPONSABILITES DE MA CHARGE SI JE NE TENAIS PAS
_COMPTE DES INTERETS DE LA FRANCE. MAIS DANS LES ORIENTATIONS DE NOTRE
POLITIQUE EXTERIEURE, NOUS REGARDONS PLUS LOIN QUE NOS INTERETS. NOUS
ENTENDONS DANS UN MONDE QUI EST SOUVENT TOURMENTE, BOULEVERSE,
REPRESENTER LES PRINCIPES QUI SSONT LES NOTRES. CES PRINCIPES, QUI ONT FAIT LA
REPUTATION DE LA FRANCE, FONT QUE NOUS AVONS, DANS LE MONDE ACTUEL, DES
CHOSES A DIRE ET DES CHOSES A PROPOSER.\
`POLITIQUE ETRANGERE ` RELATIONS FRANCO - BAHREINIES` L'AUTRE ASPECT DE LA
POLITIQUE DE LA FRANCE DONT VOUS APERCEVEZ CERTAINEMENT LA NECESSITE, C'EST
LE DEVELOPPEMENT DE NOTRE ACTIVITE ECONOMIQUE DANS TOUS SES ASPECTS. J'AI
CITE, TOUT A L'HEURE, CE CHIFFRE DE 2,4 % `STATISTIQUE` DES IMPORTATIONS DE
BAHREIN, PAYS AMI. CELA MONTRE LA MARGE QUI EXISTE DEVANT NOUS POUR
DEVELOPPER L'ACTIVITE DES FRANCAIS POUR AMELIORER L'EMPLOI, POUR ELEVER LA
QUALITE DE LA PRODUCTION ET DU NIVEAU_DE_VIE DE NOTRE PAYS. NOUS DEVONS
SOUHAITER AVOIR UNE ECONOMIE QUI SOIT A LA FOIS EFFICACE, ACTIVE ET QUI SE
SITUE A LA POINTE DU PROGRES EN CE QUI CONCERNE LA HAUTE QUALIFICATION DE
NOS PRODUITS ET DE NOS SERVICES. VOUS APERCEVEZ ICI LA COMPARAISON AVEC
TOUTES LES ECONOMIES DU MONDE £ IL EST NECESSAIRE POUR NOUS QUE LA
COMPARAISON AVEC L'ECONOMIE FRANCAISE SE FASSE TOUJOURS A NOTRE AVANTAGE
£ CECI DEPEND, BIEN ENTENDU, DU TRAVAIL DES FRANCAISES ET DES FRANCAIS DE
TOUTES CONDITIONS, DE TOUTES SPECIALITES. C'EST POURQUOI J'AI, VOUS LE SAVEZ,
COMME AMBITION, POUR L'ECONOMIE FRANCAISE, QU'ELLE SOIT, JE LE RAPPELLE,
ACTIVE, EFFICACE ET ATTEIGNANT LES PLUS HAUTS NIVEAUX DE QUALIFICATION DANS
LE MONDE.\
`POLITIQUE ETRANGERE ` RELATIONS FRANCO - BAHREINIES` VOILA CE QUE JE VOULAIS
DIRE A L'AVANT-GARDE POUR LA FELICITER ET POUR LA REMERCIER. VOILA L'EXEMPLE
QUI SERA SUIVI PAR TOUS CEUX QUI VIENDRONT TRAVAILLER A VOS COTES, CES
FRANCAISES ET CES FRANCAIS QUI SERONT PLUS NOMBREUX DANS L'AVENIR A VIVRE A
L'EXTERIEUR. JE DIS "L'EXTERIEUR", PARCE QUE JE SOUHAITE QUE PENDANT CES
PERIODES DE SEJOUR QUE LES FRANCAISES ET LES FRANCAIS PASSENT
A_L_ETRANGER, ILS ACQUIERENT LA CONNAISSANCE, LA FAMILIARITE, L'INTERET POUR
LA VIE DES PEUPLES QU'ILS COTOIENT. CES FRANCAIS QUI VONT VIVRE A L'EXTERIEUR,
ILS FONT PARTIE DE NOTRE COMMUNAUTE NATIONALE. LES MOYENS MODERNES DE
COMMUNICATION FONT QUE DESORMAIS ON PEUT VIVRE AU LOIN ET NE PAS SE SENTIR
LOIN £ JE SOUHAITE QUE VOUS SENTIEZ COMBIEN VOUS CONTINUEZ A FAIRE PARTIE DE
NOTRE COMMUNAUTE NATIONALE. IL FAUT DONC QUE NOS LOIS, NOS LOIS SOCIALES,
NOS LOIS FISCALES, NOS LOIS CIVIQUES FASSENT EN SORTE QUE LES FRANCAIS
DE_L_ETRANGER SE SENTENT TRAITES AVEC JUSTICE AU-SEIN DE NOTRE COMMUNAUTE
NATIONALE. C'EST UNE DES TACHES DE M. LE MINISTRE DES AFFAIRES ETRANGERES,
QUI A CREE RECEMMENT UNE DIRECTION DES FRANCAIS DE_L_ETRANGER ET DONT JE
SOUHAITE QU'ELLE DEVELOPPE SON ACTIVITE, DE FACON A ETRE L'INTERLOCUTEUR
NATUREL DE TOUTES LES FRANCAISES ET DE TOUS LES FRANCAIS POUR LES
PROBLEMES QUI SE POSENT A EUX A_L_ETRANGER.
- JE VOULAIS VOUS FELICITER, JE VOULAIS VOUS REMERCIER, JE VOULAIS VOUS DIRE
AUSSI LE PLAISIR PERSONNEL QU'ANNE-AYMONE `GISCARD D'ESTAING` ET MOI-MEME
PRENONS A VOUS RENCONTRER AUJOURD'HUI DANS LA LOURDE CHARGE DU
PRESIDENT DE LA REPUBLIQUE FRANCAISE. IL Y A DES MOMENTS QUI SONT TRES
HEUREUX ET TRES ENCOURAGEANTS POUR LUI £ CE SONT LES MOMENTS OU IL
RENCONTRE SES COMPATRIOTES ET OU IL PEUT AVEC EUX SE FELICITER DE CE QU'ILS
FONT POUR MAINTENIR LA REPUTATION ET L'INFLUENCE DE LA FRANCE.
| 16,643 |
2567641_1
|
Caselaw Access Project
|
Open Government
|
Public Domain
| 1,938 |
None
|
None
|
English
|
Spoken
| 1,004 | 1,213 |
Mr. Justice Stone
delivered the opinion of the court:
Judgment was procured against the appellant in the municipal court of Chicago in the sum of $1459, as damages for breach of guaranty on certain bonds. He brings the cause directly to this court on the ground that the constitutionality of certain rules of the municipal court is involved.
It appears that after suit was filed against him, summons and several alias summonses were returned "defend ant not found." On April 27, 1937, another alias summons was issued returnable May 10, following. It was returned marked as having been served on the defendant at 105 W. Adams street, his office or place of business, by leaving a copy thereof and copy of a statement of claim with "Miss A. Mattie," employed by the defendant. The return also showed that a copy of the summons had been mailed to the defendant at 105 W. Adams street.
The appellant entered his special appearance and moved to quash the summons. This motion was supported by affidavits and was allowed. On September 28, following, the appellee filed his petition for leave to serve appellant under rule ioa of the municipal court. Upon an ex parte hearing the court entered an order authorizing such service and directing the manner of making it. The return of the bailiff recited that service was had upon appellant by serving Vera Mattei at 105 W. Adams street, in Chicago, and by mailing a copy of the writ to appellant at 105 W. Adams street. On return day, appellant, under a special and limited appearance, filed a motion, supported by affidavits, to quash the service, summons and return, upon the grounds (1) the purported service violates the fourteenth amendment of the constitution of the United States; (2) the order directing service under rule ioa of the municipal court amounted to denial to appellant of due process of law, and (3) the purported service was not had in accordance with the statutes of this State. Affidavits in support of the motion recited that the appellant had not been personally served with summons, had not authorized any person to accept service on his behalf, is not a resident of the State of Illinois and has no home, place of abode or place of business in this State, but resides in Indiana; that Vera Mattei, upon whom service was had, is not his employee but was an employee of the Bendix Aviation Corporation.
A hearing was had on the motion to quash and appellee's objections thereto. It was there shown, without dispute, that the appellant had, for a number of years, maintained a home at 1701 E. Jefferson street, in the city of South Bend, Indiana; that he is a registered voter of the fourth district of that city; that he is president of the Bendix Aviation Corporation, which corporation maintains offices at 105 W. Adams street, Chicago, and that Vera Mattei, the person upon whom service was had, was employed by the corporation and not by the appellant. The trial court held that under rules 10 and ioa of the municipal court the service of summons was good, for the reason that the municipal court had power to fix the mode of service of summons; that such was merely a matter of practice and procedure, and that the evidence was sufficient to show that the appellant maintained an office in Chicago.
There is no contention that personal service was had upon the appellant but the appellee insists that service pursuant to rules 10 and ioa was sufficient, and that the trial court had sufficient evidence to warrant the finding that appellant was a resident of Illinois. Rule 10 provides, in effect, that when a party is to be served as an individual, such service may be had by leaving a copy thereof, together with the papers attached, stamped by the clerk as a true copy, with such party personally, or, if he have a usual place of abode, by leaving such copy, together with a copy of the papers attached thereto, at such usual place of abode with some member of the family of the age of ten years and upwards, informing such person of the contents thereof; or "if such party maintains an office or place of business in the city of Chicago at which he carries on business and receives mail, by leaving such copy together with copy of papers attached thereto at such office or place of business with some person there employed by him as manager, cashier, salesman or saleswoman, if of the age of twenty-one years or upwards, and informing such person of the contents thereof." Rule 10 provides, also, that when such service is not made by personal delivery to the person to be summoned, a copy of the summons, together with a copy of the papers attached, shall be mailed to the defendant at his usual place of abode or at such office or place of business, as the case may be. Rule ioa provides: "In any case in which an officer is unable from any cause to make due service of a summons, the court upon application therefor and upon notice to the bailiff may direct such service to be made in such manner as the court may deem proper," etc.
The questions arising on this record have been disposed of by the holding of this court in Danoff v. Larson, 368 Ill. 519, where it was held that the municipal court did not have power to provide by rule a method of service of summons different from that required by the statutes and constitution. The evidence in this case is clear that appellant was not a resident of this State. The municipal court was without jurisdiction of the person of the appellant. The judgment of that court is reversed and the cause is remanded, with directions to vacate the judgment so entered and sustain appellant's motion to quash the summons and return thereon.
Reversed and remanded, with directions..
| 24,971 |
https://zh.wikipedia.org/wiki/%E6%9D%8E%E7%91%9F%E5%A8%A5
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
李瑟娥
|
https://zh.wikipedia.org/w/index.php?title=李瑟娥&action=history
|
Chinese
|
Spoken
| 8 | 195 |
李瑟娥（韓語：이슬아）韓國職業圍棋棋手，目前為二段，1991年11月20日出生。
国际比赛成绩
2008年正官庄杯中2胜1负；
2010年穹窿山兵圣杯八强；
2010年亞洲運動會圍棋比賽男女混合雙人賽中與朴廷桓搭配，獲得金牌。女子團體賽和李玟真、金侖映、趙惠連搭配獲得金牌。
參考資料
韓國棋院
韓國圍棋棋手
| 33,988 |
https://www.wikidata.org/wiki/Q37434007
|
Wikidata
|
Semantic data
|
CC0
| null |
Fehrenbacher
|
None
|
Multilingual
|
Semantic data
| 3,049 | 10,339 |
Fehrenbacher
family name
Fehrenbacher instance of family name
Fehrenbacher Soundex F651
Fehrenbacher Cologne phonetics 376147
Fehrenbacher Caverphone FRNPK1
Fehrenbacher different from Fehrenbacher, criterion used family name has to use a different item than disambiguation page
Fehrenbacher native label
Fehrenbacher writing system Latin script
Fehrenbacher Commons category Fehrenbacher (surname)
Fehrenbacher Digital Dictionary of Surnames in Germany ID 8694
Fehrenbacher attested in 2010 United States Census surname index
Fehrenbacher Wolfram Language entity code Entity["Surname", "Fehrenbacher"]
Fehrenbacher Géopatronyme ID FEHRENBACHER
Fehrenbacher Geneanet family name ID FEHRENBACHER
Fehrenbacher
achternaam
Fehrenbacher is een familienaam
Fehrenbacher Soundex F651
Fehrenbacher Keulse fonetiek 376147
Fehrenbacher Caverphone FRNPK1
Fehrenbacher niet gelijk aan Fehrenbacher, gebruikt criterium achternaam versus doorverwijspagina
Fehrenbacher label in oorspronkelijke taal
Fehrenbacher schriftsysteem Latijns alfabet
Fehrenbacher Commonscategorie Fehrenbacher (surname)
Fehrenbacher DFD-identificatiecode voor achternaam 8694
Fehrenbacher Wolfram Language-entiteitscode Entity["Surname", "Fehrenbacher"]
Fehrenbacher Géopatronyme-identificatiecode FEHRENBACHER
Fehrenbacher GeneaNet-identificatiecode voor familienaam FEHRENBACHER
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher is 'n van
Fehrenbacher Soundex F651
Fehrenbacher Nie dieselfde as Fehrenbacher
Fehrenbacher inheemse etiket
Fehrenbacher skryfstelsel latynse alfabet
Fehrenbacher Commons-kategorie Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher
Fehrenbacher
apelliu
Fehrenbacher instancia de apelliu
Fehrenbacher Categoría en Commons Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher
Fehrenbacher
apellíu
Fehrenbacher instancia de apellíu
Fehrenbacher Soundex F651
Fehrenbacher fonética de Colonia 376147
Fehrenbacher Caverphone FRNPK1
Fehrenbacher diferente de Fehrenbacher, criteriu utilizáu los apellíos tienen d'usar un elementu distintu del de la respeutiva páxina de dixebra
Fehrenbacher nome nativu
Fehrenbacher sistema d'escritura alfabetu llatín
Fehrenbacher categoría de Commons Fehrenbacher (surname)
Fehrenbacher códigu d’entidá en Wolfram Language Entity["Surname", "Fehrenbacher"]
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher sistem panyuratan Aksara Latin
Fehrenbacher
Schreibnam
Fehrenbacher is a Schreibnam
Fehrenbacher Caverphone FRNPK1
Fehrenbacher Commons-Kategorie Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
anv-tiegezh
Fehrenbacher natur an elfenn anv-tiegezh
Fehrenbacher disheñvel diouzh Fehrenbacher
Fehrenbacher anv er yezh a orin
Fehrenbacher lizherenneg Lizherenneg latin
Fehrenbacher rummad eus Commons Fehrenbacher (surname)
Fehrenbacher
prezime
Fehrenbacher je prezime
Fehrenbacher Soundex F651
Fehrenbacher Cologne fonetika 376147
Fehrenbacher Caverphone FRNPK1
Fehrenbacher izvorni naziv
Fehrenbacher pismo latinica
Fehrenbacher kategorija na Commonsu Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher
cognom
Fehrenbacher instància de cognom
Fehrenbacher Soundex F651
Fehrenbacher fonètica de Colònia 376147
Fehrenbacher Caverphone FRNPK1
Fehrenbacher no s'ha de confondre amb Fehrenbacher, criteri utilitzat els cognoms han d'utilitzar un element diferent del de la pàgina de desambiguació
Fehrenbacher nom en la llengua original
Fehrenbacher alfabet alfabet llatí
Fehrenbacher categoria de Commons Fehrenbacher (surname)
Fehrenbacher identificador Digitales Familiennamenwörterbuch Deutschlands 8694
Fehrenbacher atestat a índex de cognoms del cens dels Estats Units del 2010
Fehrenbacher codi d'entitat en Wolfram Language Entity["Surname", "Fehrenbacher"]
Fehrenbacher identificador Géopatronyme FEHRENBACHER
Fehrenbacher identificador Geneanet de cognom FEHRENBACHER
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher categuria in Commons Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher
Fehrenbacher
příjmení
Fehrenbacher instance (čeho) příjmení
Fehrenbacher Soundex F651
Fehrenbacher kolínská fonetika 376147
Fehrenbacher Caverphone FRNPK1
Fehrenbacher rozdílné od Fehrenbacher, použité kritérium příjmení musí používat jinou položku než rozcestník
Fehrenbacher v původním jazyce
Fehrenbacher písmo latinka
Fehrenbacher kategorie na Commons Fehrenbacher (surname)
Fehrenbacher
nôzwëskò
Fehrenbacher to je nôzwëskò
Fehrenbacher
cyfenw
Fehrenbacher enghraifft o'r canlynol cyfenw
Fehrenbacher yn wahanol i Fehrenbacher
Fehrenbacher label yn yr iaith frodorol
Fehrenbacher system ysgrifennu yr wyddor Ladin
Fehrenbacher categori Comin Fehrenbacher (surname)
Fehrenbacher dynodwr Wolfram Language (endid) Entity["Surname", "Fehrenbacher"]
Fehrenbacher
efternavn
Fehrenbacher tilfælde af efternavn
Fehrenbacher Soundex F651
Fehrenbacher Kølnfonetik 376147
Fehrenbacher Caverphone FRNPK1
Fehrenbacher forskellig fra Fehrenbacher, kriterium familienavn/efternavn må have et andet emne end flertydig side
Fehrenbacher lokalt navn
Fehrenbacher skriftsystem latinske alfabet
Fehrenbacher Commons-kategori Fehrenbacher (surname)
Fehrenbacher
Familienname
Fehrenbacher ist ein(e) Familienname
Fehrenbacher Soundex F651
Fehrenbacher Kölner Phonetik 376147
Fehrenbacher Caverphone FRNPK1
Fehrenbacher verschieden von Fehrenbacher, verwendetes Kriterium Familienname und Begriffsklärungsseite nicht identisch
Fehrenbacher Name in Amts- oder Originalsprache
Fehrenbacher Schrift lateinisches Schriftsystem
Fehrenbacher Commons-Kategorie Fehrenbacher (surname)
Fehrenbacher DFD-Kennung 8694
Fehrenbacher bestätigt in 2010 United States Census Familiennamen-Index
Fehrenbacher Wolfram-Language-Entitätscode Entity["Surname", "Fehrenbacher"]
Fehrenbacher Géopatronyme-Kennung FEHRENBACHER
Fehrenbacher Geneanet-Familiennamen-Kennung FEHRENBACHER
Fehrenbacher
Familienname
Fehrenbacher ist eine Instanz von Familienname
Fehrenbacher verschieden von Fehrenbacher, verwendetes Kriterium Familienname und Begriffsklärungsseite nicht identisch
Fehrenbacher Name in Amts- oder Originalsprache
Fehrenbacher Commons-Kategorie Fehrenbacher (surname)
Fehrenbacher
Familienname
Fehrenbacher ist eine Instanz von Familienname
Fehrenbacher verschieden von Fehrenbacher, verwendetes Kriterium Familienname und Begriffsklärungsseite nicht identisch
Fehrenbacher Commons-Kategorie Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
family name
Fehrenbacher instance of family name
Fehrenbacher writing system Latin script
Fehrenbacher Commons category Fehrenbacher (surname)
Fehrenbacher
surname
Fehrenbacher instance of surname
Fehrenbacher Soundex F651
Fehrenbacher Cologne phonetics 376147
Fehrenbacher Caverphone FRNPK1
Fehrenbacher different from Fehrenbacher, criterion used surname has to use a different item than disambiguation pages
Fehrenbacher writing system Latin script
Fehrenbacher Commons category Fehrenbacher (surname)
Fehrenbacher Wolfram Language entity code Entity["Surname", "Fehrenbacher"]
Fehrenbacher
familia nomo
Fehrenbacher estas familia nomo
Fehrenbacher Soundex F651
Fehrenbacher kolonja fonetiko 376147
Fehrenbacher alia ol Fehrenbacher, uzita kriterio familia nomo devas havi alian paĝon ol la ĝenerala apartigila listo
Fehrenbacher nomo en originala aŭ oficiala lingvo
Fehrenbacher skribo latina alfabeto
Fehrenbacher Komuneja kategorio Fehrenbacher (surname)
Fehrenbacher ento-kodo de programlingvo Wolfram Entity["Surname", "Fehrenbacher"]
Fehrenbacher
apellido
Fehrenbacher instancia de apellido
Fehrenbacher Soundex F651
Fehrenbacher fonética de Colonia 376147
Fehrenbacher Caverphone FRNPK1
Fehrenbacher diferente de Fehrenbacher, criterio utilizado los apellidos deben usar un elemento diferente del de la respectiva página de desambiguación
Fehrenbacher nombre en la lengua nativa
Fehrenbacher alfabeto alfabeto latino
Fehrenbacher categoría en Commons Fehrenbacher (surname)
Fehrenbacher identificador del Diccionario Digital de Apellidos alemán 8694
Fehrenbacher atestiguado en índice de apellidos del censo de los Estados Unidos de 2010
Fehrenbacher código de entidad en el lenguaje de programación Wolfram Entity["Surname", "Fehrenbacher"]
Fehrenbacher identificador Géopatronyme FEHRENBACHER
Fehrenbacher identificador Geneanet de apellido FEHRENBACHER
Fehrenbacher
perekonnanimi
Fehrenbacher üksikjuht nähtusest perekonnanimi
Fehrenbacher mitte segamini ajada Fehrenbacher, kasutatud kriteerium perekonnanimi peab olema täpsustuslehest erinev üksus
Fehrenbacher omakeelne nimetus
Fehrenbacher kiri ladina kiri
Fehrenbacher Commonsi kategooria Fehrenbacher (surname)
Fehrenbacher
abizen
Fehrenbacher honako hau da abizen
Fehrenbacher Soundex F651
Fehrenbacher honen desberdina Fehrenbacher, erabilitako irizpidea abizenek eta argipen orriek elementu desberdinak erabili behar dituzte
Fehrenbacher jatorrizko izena
Fehrenbacher alfabetoa latindar alfabetoa
Fehrenbacher Commons-eko kategoria Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher nombri nativu
Fehrenbacher
Fehrenbacher lesdinkeejum
Fehrenbacher
sukunimi
Fehrenbacher esiintymä kohteesta sukunimi
Fehrenbacher Soundex F651
Fehrenbacher Kölnin fonetiikka 376147
Fehrenbacher Caverphone FRNPK1
Fehrenbacher eri kuin Fehrenbacher, käytetty kriteeri sukunimellä täytyy olla eri kohde kuin täsmennyssivu
Fehrenbacher nimi alkuperäiskielellä
Fehrenbacher kirjoitusjärjestelmä latinalaiset aakkoset
Fehrenbacher Commons-luokka Fehrenbacher (surname)
Fehrenbacher sukunimen Geneanet-tunniste FEHRENBACHER
Fehrenbacher
sukunimi
Fehrenbacher
Fehrenbacher
ættarnavn
Fehrenbacher er eitt ættarnavn
Fehrenbacher Commonscat Fehrenbacher (surname)
Fehrenbacher
nom de famille
Fehrenbacher nature de l’élément nom de famille
Fehrenbacher Soundex F651
Fehrenbacher algorithme phonétique de Cologne 376147
Fehrenbacher Caverphone FRNPK1
Fehrenbacher à ne pas confondre avec Fehrenbacher, critère utilisé les noms de famille et les pages d'homonymie doivent être associés à des éléments différents
Fehrenbacher nom dans la langue d'origine
Fehrenbacher système d'écriture alphabet latin
Fehrenbacher catégorie Commons Fehrenbacher (surname)
Fehrenbacher identifiant Dictionnaire de nom de famille numérique Allemagne 8694
Fehrenbacher attesté dans index des noms de famille recensés aux États-Unis en 2010
Fehrenbacher code d'entité du langage de programmation Wolfram Entity["Surname", "Fehrenbacher"]
Fehrenbacher identifiant Géopatronyme FEHRENBACHER
Fehrenbacher identifiant Geneanet d'un nom de famille FEHRENBACHER
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher as en bääftnööm
Fehrenbacher nööm uun aanj spriak
Fehrenbacher skraft latiinsk alfabeet
Fehrenbacher Commons-kategorii Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher
efternamme
Fehrenbacher is in efternamme
Fehrenbacher Soundex F651
Fehrenbacher Commons-kategory Fehrenbacher (surname)
Fehrenbacher
sloinne
Fehrenbacher sampla de sloinne
Fehrenbacher Soundex F651
Fehrenbacher foghraíocht Köln 376147
Fehrenbacher Caverphone FRNPK1
Fehrenbacher éagsúil ó Fehrenbacher
Fehrenbacher lipéad sa teanga dhúchais
Fehrenbacher córas scríbhneoireachta aibítir Laidineach
Fehrenbacher catagóir Commons Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher
sloinneadh
Fehrenbacher eisimpleir de sloinneadh
Fehrenbacher eadar-dhealaichte bho Fehrenbacher
Fehrenbacher ainm dùthchasach
Fehrenbacher roinn-seòrsa Commons Fehrenbacher (surname)
Fehrenbacher
apelido
Fehrenbacher instancia de apelido
Fehrenbacher Soundex F651
Fehrenbacher fonética de Colonia 376147
Fehrenbacher Caverphone FRNPK1
Fehrenbacher non confundir con Fehrenbacher, criterio empregado os apelidos deben usar un elemento diferente do da súa páxina de homónimos
Fehrenbacher nome na lingua orixinal
Fehrenbacher alfabeto alfabeto latino
Fehrenbacher categoría en Commons Fehrenbacher (surname)
Fehrenbacher identificador Digitales Familiennamenwörterbuch Deutschlands 8694
Fehrenbacher código de entidade en Wolfram Entity["Surname", "Fehrenbacher"]
Fehrenbacher identificador Geneanet de apelido FEHRENBACHER
Fehrenbacher
Fehrenbacher héra iñe'ẽteépe
Fehrenbacher
Fehrenbacher
Fehrenbacher
Familiename
Fehrenbacher isch e Familiename
Fehrenbacher verschide vo Fehrenbacher, verwendets Kriterium Familiename und Begriffsklärig sind nöd identisch
Fehrenbacher Name i de Amts- oder Originalsprooch
Fehrenbacher Alphabet latynischs Alphabet
Fehrenbacher Commons-Kategori Fehrenbacher (surname)
Fehrenbacher
sliennoo
Fehrenbacher lipaid dooghyssagh
Fehrenbacher
Fehrenbacher iri sunan gida
Fehrenbacher suna a harshen gida
Fehrenbacher tsarin rubutu Baƙaƙen boko
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
prezime
Fehrenbacher jest prezime
Fehrenbacher različito od Fehrenbacher
Fehrenbacher ime u domaćem jeziku
Fehrenbacher pismo latinica
Fehrenbacher kategorija na Zajedničkom poslužitelju Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher
Fehrenbacher je swójbne mjeno
Fehrenbacher w hamtskej rěči
Fehrenbacher alfabet łaćonski alfabet
Fehrenbacher kategorija na Commons Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher se yon non fanmi
Fehrenbacher
vezetéknév
Fehrenbacher osztály, amelynek példánya családnév
Fehrenbacher Soundex F651
Fehrenbacher Caverphone FRNPK1
Fehrenbacher saját nyelvén
Fehrenbacher írásrendszer latin betűs írás
Fehrenbacher Commons-kategória Fehrenbacher (surname)
Fehrenbacher Géopatronyme-azonosító FEHRENBACHER
Fehrenbacher Geneanet-családnévazonosító FEHRENBACHER
Fehrenbacher
Fehrenbacher
Fehrenbacher differente de Fehrenbacher
Fehrenbacher nomine original local
Fehrenbacher systema de scriptura alphabeto latin
Fehrenbacher categoria in Commons Fehrenbacher (surname)
Fehrenbacher
nama keluarga
Fehrenbacher adalah nama keluarga
Fehrenbacher Soundex F651
Fehrenbacher berbeda dengan Fehrenbacher, berdasarkan nama keluarga harus memiliki butir yang berbeda dari halaman disambiguasi
Fehrenbacher label dalam bahasa asli atau resmi
Fehrenbacher sistem penulisan aksara Latin
Fehrenbacher kategori di Commons Fehrenbacher (surname)
Fehrenbacher kode entitas Wolfram Entity["Surname", "Fehrenbacher"]
Fehrenbacher
Fehrenbacher
ahà nnà
Fehrenbacher N'ụdị ndị dị ka ahà nnà
Fehrenbacher Igwe okwu Cologne 376147
Fehrenbacher Igwe ekwentị FRNPK1
Fehrenbacher akara ala
Fehrenbacher Ngalaba commons Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher panagsurat a sistema sinuratan a Latin
Fehrenbacher kategoria ti Commons Fehrenbacher (surname)
Fehrenbacher
surnomo
Fehrenbacher esas surnomo
Fehrenbacher diferanta de Fehrenbacher
Fehrenbacher kategorio di Commons Fehrenbacher (surname)
Fehrenbacher
eftirnafn
Fehrenbacher er ættarnafn
Fehrenbacher Commons flokkur Fehrenbacher (surname)
Fehrenbacher
cognome
Fehrenbacher istanza di cognome
Fehrenbacher Soundex F651
Fehrenbacher fonetica Cologne 376147
Fehrenbacher Caverphone FRNPK1
Fehrenbacher distinto da Fehrenbacher, criterio utilizzato i cognomi usano elementi diversi dalle pagine di disambiguazione
Fehrenbacher nome originale locale
Fehrenbacher sistema di scrittura alfabeto latino
Fehrenbacher categoria su Commons Fehrenbacher (surname)
Fehrenbacher identificativo Dizionario digitale dei cognomi in Germania 8694
Fehrenbacher codice entità Wolfram Language Entity["Surname", "Fehrenbacher"]
Fehrenbacher identificativo Géopatronyme FEHRENBACHER
Fehrenbacher identificativo Geneanet FEHRENBACHER
Fehrenbacher
Fehrenbacher
Fehrenbacher serese mupli lazme'e
Fehrenbacher
efternavn
Fehrenbacher
jeneng pancer
Fehrenbacher minangka jeneng pancer
Fehrenbacher kategori ing Commons Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher jergilikli atı
Fehrenbacher jazıw sisteması Latın jazıwı
Fehrenbacher Commons kategoriyası Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher isem aẓaran
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
tek, ata-tek, äwlet esim
Fehrenbacher
tek, ata-tek, äwlet esim
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Nohnahme
Fehrenbacher es e Beischpell för e(n(e)) Nohnahme
Fehrenbacher Saachjobb op Wikkimehdija Commons Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher mînakek ji bo paşnav
Fehrenbacher kategoriya Commonsê Fehrenbacher (surname)
Fehrenbacher
hanow
Fehrenbacher ensampel a hanow teylu
Fehrenbacher label teythyek
Fehrenbacher klass Commons Fehrenbacher (surname)
Fehrenbacher
nomen gentilicium
Fehrenbacher est nomen gentilicium
Fehrenbacher categoria apud Communia Fehrenbacher (surname)
Fehrenbacher
alkunya
Fehrenbacher
Familljennumm
Fehrenbacher ass eng/e(n) Familljennumm
Fehrenbacher Soundex F651
Fehrenbacher Kölner Phonetik 376147
Fehrenbacher Caverphone FRNPK1
Fehrenbacher verschidde vun Fehrenbacher, Krittär Familljennumm net identesch mat Homonymiesäit
Fehrenbacher Numm an der Amts- oder Originalsprooch
Fehrenbacher Alphabet laténgescht Alphabet
Fehrenbacher Commons-Kategorie Fehrenbacher (surname)
Fehrenbacher Wolfram-Sprooch-Entitéitscode Entity["Surname", "Fehrenbacher"]
Fehrenbacher
Fehrenbacher sistem de scrive Alfabeta latina
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher nom in la lengua original
Fehrenbacher
Fehrenbacher
Fehrenbacher
pavardė
Fehrenbacher tai yra pavardė
Fehrenbacher pavadinimas originalo kalba
Fehrenbacher rašto sistema lotynų abėcėlė
Fehrenbacher Vikitekos kategorija Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher
Fehrenbacher
uzvārds
Fehrenbacher ir uzvārds
Fehrenbacher Soundex F651
Fehrenbacher Ķelnes fonētika 376147
Fehrenbacher Caverphone FRNPK1
Fehrenbacher nosaukums oriģinālvalodā
Fehrenbacher alfabēts latīņu alfabēts
Fehrenbacher Commons kategorija Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher
Fehrenbacher sokajy Commons Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher
ingoa whānau
Fehrenbacher
nama keluarga
Fehrenbacher contoh nama keluarga
Fehrenbacher Soundex F651
Fehrenbacher berbeza daripada Fehrenbacher, menurut nama keluarga perlu guna butir yang berbeza daripada laman nyahkekaburan
Fehrenbacher label asli
Fehrenbacher sistem tulisan tulisan Rumi
Fehrenbacher kategori Commons Fehrenbacher (surname)
Fehrenbacher kod entiti Bahasa Wolfram Entity["Surname", "Fehrenbacher"]
Fehrenbacher
kunjom
Fehrenbacher istanza ta' kunjom
Fehrenbacher kategorija tal-Commons Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher caverphone FRNPK1
Fehrenbacher nun 'i e' Fehrenbacher
Fehrenbacher
etternavn
Fehrenbacher forekomst av etternavn
Fehrenbacher Soundex F651
Fehrenbacher Köln-fonetikk 376147
Fehrenbacher Caverphone FRNPK1
Fehrenbacher forskjellig fra Fehrenbacher, kriterium etternavn må ha annet element enn pekerside
Fehrenbacher lokalt navn
Fehrenbacher alfabet det latinske alfabetet
Fehrenbacher Commons-kategori Fehrenbacher (surname)
Fehrenbacher Wolfram Language-id Entity["Surname", "Fehrenbacher"]
Fehrenbacher Géopatronyme ID FEHRENBACHER
Fehrenbacher Geneanet familienavn ID FEHRENBACHER
Fehrenbacher
Familiennaam
Fehrenbacher is en Familiennaam
Fehrenbacher Caverphone FRNPK1
Fehrenbacher nich dat sülve as Fehrenbacher, bruukt Kriterium Familiennaam un Mehrdüdig Begreep sünd twee verscheden Saken
Fehrenbacher Naam in de Amts- oder Originalspraak
Fehrenbacher Schriftsystem latiensch Alphabet
Fehrenbacher Kategorie op Commons Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher kategory up Commons Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher
Fehrenbacher
etternamn
Fehrenbacher førekomst av slektsnamn
Fehrenbacher Soundex F651
Fehrenbacher ikkje det same som Fehrenbacher, med kriterium etternamn må ha eit anna element enn fleirtydingssida
Fehrenbacher lokalt namn
Fehrenbacher alfabet det latinske alfabetet
Fehrenbacher Commons-kategori Fehrenbacher (surname)
Fehrenbacher Wolfram Language-id Entity["Surname", "Fehrenbacher"]
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
nom d’ostal
Fehrenbacher natura de l'element cognòm
Fehrenbacher de pas confondre amb Fehrenbacher
Fehrenbacher nom dins la lenga originala
Fehrenbacher alfabet alfabet latin
Fehrenbacher categoria Commons Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher alimbawa ning apelyídu
Fehrenbacher tubung awus
Fehrenbacher sistema ning pamagsulat Alpabetung Latin
Fehrenbacher Kategoriya ning Commons Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher ta un fam
Fehrenbacher nòmber nativo
Fehrenbacher kategoria di Commons Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher catégorie de wikipedia commons Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
nazwisko
Fehrenbacher jest to nazwisko
Fehrenbacher Soundex F651
Fehrenbacher Kölner Phonetik 376147
Fehrenbacher Caverphone FRNPK1
Fehrenbacher inne niż Fehrenbacher, stosowane kryteria nazwisko i strona ujednoznaczniająca powinny być osobnymi elementami
Fehrenbacher nazwa oryginalna
Fehrenbacher system pisma alfabet łaciński
Fehrenbacher kategoria Commons Fehrenbacher (surname)
Fehrenbacher identyfikator DFD 8694
Fehrenbacher poświadczone w Indeks nazwisk w spisie powszechnym USA z 2010 r.
Fehrenbacher kod obiektu w języku Wolfram Entity["Surname", "Fehrenbacher"]
Fehrenbacher identyfikator Géopatronyme FEHRENBACHER
Fehrenbacher identyfikator nazwiska Geneanet FEHRENBACHER
Fehrenbacher
cognòm
Fehrenbacher
Fehrenbacher
sobrenome
Fehrenbacher instância de apelido
Fehrenbacher Soundex F651
Fehrenbacher fonética Cologne 376147
Fehrenbacher Caverphone FRNPK1
Fehrenbacher diferente de Fehrenbacher, critério usado sobrenomes devem usar um item diferente das páginas de desambiguação
Fehrenbacher nome nativo
Fehrenbacher alfabeto alfabeto latino
Fehrenbacher categoria da Commons Fehrenbacher (surname)
Fehrenbacher código de entidade na linguagem Wolfram Entity["Surname", "Fehrenbacher"]
Fehrenbacher
nome de família
Fehrenbacher instância de sobrenome
Fehrenbacher Soundex F651
Fehrenbacher fonética Cologne 376147
Fehrenbacher Caverphone FRNPK1
Fehrenbacher diferente de Fehrenbacher
Fehrenbacher nome nativo
Fehrenbacher sistema de escrita alfabeto latino
Fehrenbacher categoria na Commons Fehrenbacher (surname)
Fehrenbacher código de entidade na linguagem Wolfram Entity["Surname", "Fehrenbacher"]
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher Commons Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher
nume de familie
Fehrenbacher este un/o nume de familie
Fehrenbacher Soundex F651
Fehrenbacher fonetica Köln 376147
Fehrenbacher Caverphone FRNPK1
Fehrenbacher diferit(ă) de Fehrenbacher, criteriu utilizat numele de familie trebuie să aibă un element diferit de paginile de dezambiguizare
Fehrenbacher nume în limbile autohtone
Fehrenbacher sistem de scriere alfabetul latin
Fehrenbacher categorie la Commons Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher categoria de Commons Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher diffirenti di Fehrenbacher
Fehrenbacher nomu nativu
Fehrenbacher alfabbetu alfabbetu latinu
Fehrenbacher catigurìa di Commons Fehrenbacher (surname)
Fehrenbacher
faimily name
Fehrenbacher instance o faimily name
Fehrenbacher different frae Fehrenbacher
Fehrenbacher native label
Fehrenbacher writin seestem Laitin script alphabet
Fehrenbacher Commons category Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher
goargu
Fehrenbacher lea sohkanamma
Fehrenbacher čállinvuohki latiinnalaš alfabehta
Fehrenbacher Commons-kategoriija Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
maŋŋepnamma
Fehrenbacher
priezvisko
Fehrenbacher je priezvisko
Fehrenbacher rozdielne od Fehrenbacher
Fehrenbacher v pôvodnom jazyku
Fehrenbacher písmo latinské písmo
Fehrenbacher kategória na Commons Fehrenbacher (surname)
Fehrenbacher
priimek
Fehrenbacher primerek od družinsko ime
Fehrenbacher Soundex F651
Fehrenbacher kölnska fonetika 376147
Fehrenbacher Caverphone FRNPK1
Fehrenbacher razlikuje se od Fehrenbacher, kriterij priimek mora uporabljati drug predmet, kot je razločitvena stran
Fehrenbacher ime v domačem jeziku
Fehrenbacher abeceda latinica
Fehrenbacher kategorija v Zbirki Fehrenbacher (surname)
Fehrenbacher potrjeno v Cenzusni imenik priimkov Združenih držav Amerike 2010
Fehrenbacher oznaka entitete Wolfram Language Entity["Surname", "Fehrenbacher"]
Fehrenbacher
Fehrenbacher
Fehrenbacher
fuelhkienomme
Fehrenbacher
maŋepnamma
Fehrenbacher
Mazita eMhuri
Fehrenbacher
Fehrenbacher
mbiemër
Fehrenbacher instancë e mbiemër
Fehrenbacher Soundex F651
Fehrenbacher Fonetikë e Këlnit 376147
Fehrenbacher Caverphone FRNPK1
Fehrenbacher emërtimi në gjuhën amë
Fehrenbacher sistemi i shkrimit alfabeti latin
Fehrenbacher kategoria në Commons Fehrenbacher (surname)
Fehrenbacher
prezime
Fehrenbacher je prezime
Fehrenbacher kategorija na Ostavi Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
efternamn
Fehrenbacher instans av familjenamn
Fehrenbacher Soundex F651
Fehrenbacher Kölnfonetik 376147
Fehrenbacher Caverphone FRNPK1
Fehrenbacher ej samma som Fehrenbacher, kriterium efternamn och förgreningssidor får ej dela objekt
Fehrenbacher originalnamn
Fehrenbacher skriftsystem latinska alfabetet
Fehrenbacher Commons-kategori Fehrenbacher (surname)
Fehrenbacher belagt i efternamnsindex för folkräkningen i USA 2010
Fehrenbacher entitets-id i Wolfram language Entity["Surname", "Fehrenbacher"]
Fehrenbacher Géopatronyme-ID FEHRENBACHER
Fehrenbacher Geneanet familjenamn-ID FEHRENBACHER
Fehrenbacher
jina la ukoo
Fehrenbacher ni mfano wa jina la ukoo
Fehrenbacher mfumo wa uanadishi alfabeti ya Kilatini
Fehrenbacher Jamii ya vitu vya kawaida Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher ôryginalne miano
Fehrenbacher kategoryjŏ Commons Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
soyadı
Fehrenbacher nedir soyadı
Fehrenbacher sesli dizinde F651
Fehrenbacher Köln ses bilgisi 376147
Fehrenbacher Caversham ses bilgisi FRNPK1
Fehrenbacher yerel dildeki adı
Fehrenbacher yazı sistemi Latin alfabesi
Fehrenbacher Commons kategorisi Fehrenbacher (surname)
Fehrenbacher Almanya Dijital Soyadı Sözlüğü kimliği 8694
Fehrenbacher Wolfram Dili varlık kodu Entity["Surname", "Fehrenbacher"]
Fehrenbacher Géopatronyme kimliği FEHRENBACHER
Fehrenbacher Geneanet aile adı kimliği FEHRENBACHER
Fehrenbacher
Fehrenbacher Ntlawa wa Commons Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher Wikicıyıntıqta törkem Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher istansa de cognome
Fehrenbacher Soundex F651
Fehrenbacher algoritmo fonètego de Cologne 376147
Fehrenbacher Caverphone FRNPK1
Fehrenbacher difarènte de Fehrenbacher
Fehrenbacher nome inte ła łéngua orizenałe
Fehrenbacher alfabeto alfabeto latin
Fehrenbacher categoria Commons Fehrenbacher (surname)
Fehrenbacher ID Digitales Familiennamenwörterbuch Deutschlands 8694
Fehrenbacher ID Géopatronyme FEHRENBACHER
Fehrenbacher ID Geneanet de nome de fameja FEHRENBACHER
Fehrenbacher
họ
Fehrenbacher là một họ
Fehrenbacher Soundex F651
Fehrenbacher khác với Fehrenbacher
Fehrenbacher nhãn bản ngữ
Fehrenbacher hệ thống chữ viết bảng chữ cái Latinh
Fehrenbacher thể loại ở Commons Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
Fehrenbacher
no d’ famile
Fehrenbacher nateure di l’ elemint no d' famile
Fehrenbacher
apelyidu
Fehrenbacher
Fehrenbacher
ifani
Fehrenbacher
Fehrenbacher àkórí orúkọ ẹbí
Fehrenbacher Ẹ̀ka Commons Fehrenbacher (surname)
Fehrenbacher
Fehrenbacher
isibongo
Fehrenbacher isibonelo se isibongo
費倫巴徹
姓氏 (Fehrenbacher)
費倫巴徹 隸屬於 姓氏
費倫巴徹 Soundex F651
費倫巴徹 科隆發音學 376147
費倫巴徹 Caverphone FRNPK1
費倫巴徹 母語標籤
費倫巴徹 書寫系統 拉丁文字
費倫巴徹 共享資源分類 Fehrenbacher (surname)
費倫巴徹 文獻出處 2010年美國姓氏指數普查
費倫巴徹 Wolfram語言實體代碼 Entity["Surname", "Fehrenbacher"]
費倫巴徹 Geneanet姓氏標識符 FEHRENBACHER
费伦巴赫尔
姓氏 (Fehrenbacher)
费伦巴赫尔 隶属于 姓氏
费伦巴赫尔 Soundex F651
费伦巴赫尔 科隆发音学 376147
费伦巴赫尔 Caverphone FRNPK1
费伦巴赫尔 母语标签
费伦巴赫尔 書寫系統 拉丁文字
费伦巴赫尔 共享资源分类 Fehrenbacher (surname)
费伦巴赫尔 文獻出處 2010年美國姓氏指數普查
费伦巴赫尔 Wolfram语言实体代码 Entity["Surname", "Fehrenbacher"]
费伦巴赫尔 Geneanet姓氏标识符 FEHRENBACHER
費倫巴徹
姓氏 (Fehrenbacher)
費倫巴徹 隸屬於 姓氏
費倫巴徹 Soundex F651
費倫巴徹 科隆發音學 376147
費倫巴徹 母語標籤
費倫巴徹 書寫系統 拉丁文字
費倫巴徹 共享資源分類 Fehrenbacher (surname)
費倫巴徹 Wolfram語言實體代碼 Entity["Surname", "Fehrenbacher"]
| 7,028 |
https://id.wikipedia.org/wiki/SS%20Edmund%20Fitzgerald
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
SS Edmund Fitzgerald
|
https://id.wikipedia.org/w/index.php?title=SS Edmund Fitzgerald&action=history
|
Indonesian
|
Spoken
| 82 | 174 |
SS Edmund Fitzgerald ialah kapal barang pembawa bijih besi yang secara mendadak tenggelam di Danau Superior pada tanggal 10 November 1975 sekitar pukul 7:30 PM. Tak seorang pun mengetahui mengapa kapal itu tenggelam. 29 ABK-nya tenggelam. Orang-orang yang tenggelam dalam kapal diingat oleh keluarganya dan juga dalam lagu berjudul The Wreck of the Edmund Fitzgerald oleh penyanyi Kanada Gordon Lightfoot.
Anggota kru
ABK Edmund Fitzgerald di perjalanan terakhirnya termasuk:
Referensi
Pranala luar
News story from CBC
SS Edmund Fitzgerald Online
Edmund Fitzgerald
| 49,686 |
https://cy.wikipedia.org/wiki/Disg%20ffynidwydd
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Disg ffynidwydd
|
https://cy.wikipedia.org/w/index.php?title=Disg ffynidwydd&action=history
|
Welsh
|
Spoken
| 185 | 485 |
Math a rhywogaeth o ffwng yn nheulu'r Sarcoscyphaceae yw'r Disg ffynidwydd (Lladin: Pithya vulgaris; Saesneg: Fir Disco). 'Y Botymau a'r Cwpannau' yw'r enw ar lafar ar y grwp mae'r ffwng yma'n perthyn iddo, ond nid yw'n derm gwyddonol. Mae'r enwau hyn yn cael eu defnyddio i ddisgrifio siap y ffwng. Mae'r teulu Sarcoscyphaceae yn gorwedd o fewn urdd y Pezizales.
Ffyngau
Credir fod rhwng 2.2 a 3.8 miliwn o wahanol rywogaethau o ffwng, a'u bod yn perthyn yn nes at grwp yr anifeiliaid nag at blanhigion. Gelwir yr astudiaeth o ffwng yn "feicoleg", sy'n dod o'r Groeg μύκης (mykes) sef 'madarchen'. Mae tua 120,000 o'r rhain wedi'u disgrifio gan naturiaethwyr megis Carolus Linnaeus, Christiaan Hendrik Persoon ac Elias Magnus Fries. Oherwydd mai prin iawn yw gwybodaeth gwyddonwyr am y pwnc hwn, mae tacson y ffyngau'n newid o ddydd i ddydd. Credir bod oddeutu 20,000 o rywogaethau o ffyngau yng ngwledydd Prydain.
Aelodau eraill o deulu'r Sarcoscyphaceae
Mae gan Disg ffynidwydd ambell aelod arall yn y teulu hwn, gan gynnwys y canlynol:
Gweler hefyd
Rhestr Goch yr IUCN
Llên Natur
Cyfeiriadau
Pezizales
Y Botymau a'r Cwpannau
| 50,190 |
https://github.com/candidosales/material-time-picker/blob/master/projects/material-time-picker/src/public_api.ts
|
Github Open Source
|
Open Source
|
MIT
| 2,021 |
material-time-picker
|
candidosales
|
TypeScript
|
Code
| 36 | 130 |
/*
* Public API Surface of material-time-picker
*/
export { WClockComponent } from './lib/w-clock/w-clock.component';
export { WTimeComponent } from './lib/w-time/w-time.component';
export { WTimeDialogComponent } from './lib/w-time-dialog/w-time-dialog.component';
export { MaterialTimePickerComponent } from './lib/material-timepicker/material-timepicker.component';
export * from './lib/material-time-picker.module';
| 517 |
https://nl.wikipedia.org/wiki/Dineutus%20himalayensis
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Dineutus himalayensis
|
https://nl.wikipedia.org/w/index.php?title=Dineutus himalayensis&action=history
|
Dutch
|
Spoken
| 28 | 54 |
Dineutus himalayensis is een keversoort uit de familie van schrijvertjes (Gyrinidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1945 door Guignot.
Schrijvertjes
| 21,840 |
US-201514599258-A_3
|
USPTO
|
Open Government
|
Public Domain
| 2,015 |
None
|
None
|
English
|
Spoken
| 5,882 | 8,517 |
In various embodiments, tobacco paperboard can be used to fabricate a stiffer or harder container formed from fibrous pulp comprising about 5 to about 100 (e.g., about 75 to about 90) dry weight percent tobacco-based pulp. In an embodiment, the tobacco paperboard is formed from fibrous pulp comprising about 85 dry weight percent tobacco fibers. The remaining portion of the fibrous pulp can be wood based pulp, for example. Papermaking additives can be combined with the pulp such that the paperboard comprises about 80-95 dry weight percent fiber materials, the balance being papermaking additives known in the art. In some embodiments, paperboard basis weights range from about 50 to about 275 g/m², or about 175 to about 275 g/m². In some embodiments, caliper of a tobacco paperboard can range from about 0.003 inches to about 0.200 inches (i.e., about 3 mils to about 200 mils).
For example, in some embodiments, a solid bleached sulfate board, comprising bleached, chemically pulped tobacco stalk and a pigmented coating on both surfaces, can be used for cigarette packaging. The pulp can be produced from the kraft pulping process, for example. The pulp can be treated in various ways to prepare them for a paperboard machine. For example, the pulp can be refined to modify surface structure of the fibers. As discussed above, swelling in water can expand the surface area of the fibers and thereby improve strength of the final paper product. Additives such as alum and rosin sizing can be used to increase water repellency of the fibers and other agents can be used to increase the whiteness of the fibrous material, for example.
In various embodiments, more pliable paper or paperboard can be used to fabricate a softer, more flexible container formed from a fibrous pulp comprising about 5 to about 100 (e.g., about 75 to about 100) dry weight percent tobacco-based pulp. Papermaking additives can be combined with the pulp such that the paper or paperboard comprises about 80-95 dry weight percent fiber materials, the balance being papermaking additives known in the art. This pliable paper can also be used as labels and other packaging materials, for example. The basis weight of the pliable paper can range from about 10 to about 150 g/m² (e.g., about 10 to about 75 g/m² or about 60 to about 90 g/m², for example. In some embodiments, caliper of a pliable paper or paperboard can range from about 0.001 inches to about 0.200 inches (i.e., about 1 mils to about 200 mils). In some embodiments, caliper of pliable paper can range from about 1 mils to about 6 mils, for example.
In various embodiments, tobacco paper can be used as the paper substrate in a barrier layer. The tobacco paper used to fabricate barrier paper can be formed from fibrous pulp comprising about 5 to about 100 (e.g., about 75 to about 90) dry weight percent tobacco-based pulp. In an embodiment, the tobacco paperboard is formed from fibrous pulp comprising about 85 dry weight percent tobacco fibers. The remaining portion of the fibrous pulp can be wood based pulp, for example. Papermaking additives can be combined with the pulp such that the paper comprises about 80-95 dry weight percent fiber materials, the balance being papermaking additives known in the art. In some embodiments, barrier basis weights range from about 10 to about 150 g/m² (e.g., about 50 to about 150 g/m²).
The following examples are provided to illustrate further the present invention, but should not be construed as limiting the scope thereof. Unless otherwise noted, all parts and percentages are by weight.
EXPERIMENTAL
The present invention is more fully illustrated by the following examples, which are set forth to illustrate the present invention and are not to be construed as limiting thereof. In the following examples, mm means millimeter. All weight percentages are expressed on a dry basis, meaning excluding water content, unless otherwise indicated.
Example 1
In the following non-limiting example, duplicate soda cooks are carried out on stalk and root samples. The results are quite similar for the duplicates, showing good repeatability. Both materials produce pulp with a Kappa number in the bleachable range. The unbleached pulp for both samples is made into board-weight handsheets and tested for strength properties.
Cooks are done in two types of 10-liter batch digesters: the “classic” M&K unit, as well as a similar unit designed and built by North Carolina State University (NCSU). Both types feature indirect electrical heating and liquor recirculation.
After cooking, the material is fiberized by passing it through a Bauer 8-inch disk refiner with a plate gap of 0.020 inches. For the second replicate on each material, a second pass is done at 0.005 inches. The fiberized material, now considered pulp, is passed through a slotted screen with 0.010 inches, to remove chives and unpulped material. The screened accepts are test for yield, Kappa number, brightness, fiber length distribution, and freeness.
Pulping data are shown in Table 1 below.
TABLE 1 Pulping Results for Stalks and Roots Samples Cook# 1 2 3 4 Tobacco Type Burley Burley Burley Burley Raw Material Type Stalk Root Stalk Root Digester MK NCSU MK MK MK Pulping Data NaOH, % on OD 43 43 43 43 Material Liquor to Fiber Ratio 6:1 6:1 6:1 6:1 Max Temp ° C. 170 170 170 170 Time to Temp, 60 60 60 60 Minutes H Factor 2100 2100 2100 2100 Black Liquor pH 12.6 12.6 12.6 12.5 REA Residual Alkali 24.9 24.9 26.2 24.5 (gpl as Na2O) % Alkali Consumed 65.2 65.2 63.5 65.8 Pulp Testing Total Yield, % of OD 33.9 35.1 32.5 34.9 Raw Material % Rejects in Pulp 0.0 0.0 0.0 0.0 Screened Yield, % 28.6 30.9 28.5 28.5 on OD Raw Material Kappa Number 12.9 8.9 14.2 8.2 Freeness 592 593 431 488 ISO Brightness 29.4 46.8 28.2 47.7 Avg, Fiber Length, 0.800 0.649 0.741 0.629 length-wtd, mm Fiber width, microns 25.5 23.5 26.2 24.3 Fines, % by number 16.86 14.82 30.52 30.42
For the stalk cooks, the cooks are well repeatable, even when two different types of batch digesters are used. It is noted that the yield and Kappa number can be affected by the quality of the raw material. In addition, the Kappa number for the root cooks is lower than the Kappa numbers for the stalks, indicating easier delignification. The screened yield is about the same for the stalk and root cooks. The fiber length is lower in the root-based pulp than in the stalk-based pulp, which is reasonable because stalk fibers are used for plant support while root fibers are used for storage.
For both cooks, the Kappa numbers can be considered to be in the bleachable range. It should be noted that in this example, the cooked mass for the second cook on each raw material is passed through the defiberizing refiner twice. The second plate gap is quite tight (0.005 inches). As a result, the pulp is somewhat refined, as shown by the lower freeness, decreased fiber length, increased fiber width, and increased fines. Therefore, this pulp is not used for sheet testing, but the results are still useful to look at the repeatability of the procedure and the uniformity of the raw material. Both pulps appear fairly light-colored, as compared to unbleached wood pulp. The stalk pulp is much brighter, which may be due to the significantly lower Kappa number. Both pulps are quite clean. The paperboard handsheets (also referred to as pads) made from each pulp are shown in FIG. 5.
Example 2
In the following non-limiting example, six soda cooks are carried out on stalk and root samples. Tobacco stalk and root pulps are made into board-weight handsheets for evaluation.
Two cooks (#5 and #6) are done in an M&K digester. A more practical 24% caustic charge is used, as well as a 160° C. maximum temperature and an H-factor of 1000. For the sixth cook (#6), the stalk is soaked overnight in excess distilled water, and the water is drained prior to pulping with the same conditions as for Cook #5. A second sample of stalk is soaked, drained, and then analyzed for yield loss during soaking. For Cook #6, the alkali charge is based on the original starting weight of material, instead of adjusting for the yield loss during soaking.
Pulping data are shown in Table 2 below.
TABLE 2 Pulping Results for Stalks and Roots Samples Cook# 1 2 3 4 5 6 Tobacco Type Burley Burley Burley Burley Burley Burley Raw Material Type Stalk Root Stalk Root Stalk Stalk Digester MK NCSU MK MK MK MK MK Pulping Data Pretreatment — — — — — Pre-soak NaOH, % on OD Material 43 43 43 43 24 24 Liquor to Fiber Ratio 6:1 6:1 6:1 6:1 6:1 6:1 Max Temp ° C. 170 170 170 170 160 160 Time to Temp, Minutes 60 60 60 60 60 60 H Factor 2100 2100 2100 2100 1000 1000 Black Liquor pH 12.6 12.6 12.6 12.5 11.9 12.3 REA Residual Alkali (gpl as Na2O) 24.9 24.9 26.2 24.5 3.8 10.5 % Alkali Consumed 65.2 65.2 63.5 65.8 90.1 72.6 Pulp Testing Total Yield, % of OD Raw Material 33.9 35.1 32.5 34.9 44.0 38.7 % Rejects in Pulp 0.0 0.0 0.0 0.0 9.7 0.15 Screened Yield, % on OD Raw Material 28.6 30.9 28.5 28.5 29.4 35.0 Kappa Number 12.9 8.9 14.2 8.2 45.9 33.4 Freeness 592 593 431 488 633 608 ISO Brightness 29.4 46.8 28.2 47.7 30.4 Avg, Fiber Length, length-wtd, mm 0.800 0.649 0.741 0.629 0.866 0.769 Fiber width, microns 25.5 23.5 26.2 24.3 28.4 27.7 Fines, % by number 16.86 14.82 30.52 30.42 28.68 26.79 PFI Refining on Brownstock Freeness, CSF, at 500 revs 433 1000 revs 366 569 2000 revs 469 3000 revs 392 418 4000 revs 5000 revs 6000 revs 291 393
The stiffness measurements of the stalk and root pulps are comparable to (and perhaps slightly higher than) a wood-based sheet. The folding endurance, however, is unexpectedly 15-40 times higher. Bursting strength testing does not show that bonding strength is unusually high for the stalk and root sheets. For the Cook #5 done on the stalk, using a more practical caustic charge of 24%, the resulting Kappa is 45.9, which can still be considered bleachable. For Cook #5, the lower alkali charge and H-factor results in a higher Kappa number (45.9) and screened rejects (9.7%) than for Cooks 1 and 3. When the stalk is soaked overnight in distilled water and drained, and the cook is repeated (Cook #6), the Kappa number falls to 33.4, and rejects decrease considerably. In order to determine the amount of material lost during soaking, a second sample of chips is soaked, drained, and then oven dried. Portions of the stalk and root pulps from Cooks #1 and #2 are refined in a standard laboratory PFI mill, to decreasing freeness levels. The refined pulps are formed into standard British handsheets according to TAPPI standards, with a target basis weight of 233 g/m². The sheets are then tested for Taber stiffness (T489), MIT double fold (T511) and bursting strength (T403). The PFI refining and handsheet testing results for Cooks #1 and #2 are shown below in Table 3.
TABLE 3 Results of PFI Refining and Handsheet Testing for Unbleached Pulps Standard Cook #1 Stalk, Kappa = 12.9 Cook #2 Root, Kappa = 8.9 PFI Revs — 500 1000 2000 3000 6000 500 1000 2000 3000 6000 Freeness — 433 366 392 291 569 469 418 393 CSF Basis 236 235 258 235 233 248 245 254 257 246 Weight (g/m²) Caliper 12 11.7 11.8 10.0 10.5 12.1 13.2 12.2 11.3 (mils) Apparent 0.774 0.791 0.861 0.923 0.871 0.807 0.756 0.828 0.855 Density (g/cm³) Taber 57 (avg) 67.6 84.0 53.2 49.3 61.3 68.2 65.8 57.2 Stiffness Units MIT double- 520 19979 12833 18179 7568 folds, 0.5 kg Burst Index — 3.6 3.7 4.5 3.4 3.2 3.4 3.7 (kPa*m²/g)
Basis weight and caliper values for the sheets are similar to the wood-based standard values. Stiffness values for the directionless handsheets are somewhat higher for both stalk and root than for the machine direction (MD) and cross direction (CD) average of the machine-made standard sheet. The values obtained for the folding endurance are 15-40 times higher than for the standard. The standard sheet is tested and broke at the 500 value indicated by the specifications.
It is well known that, for some nonwood fibers with thin and easily-collapsed cell walls, the bonding strength, as measured by tensile or burst in handsheets, can actually be higher than for thick-walled, longer fibers such as softwoods. The reason is that the collapsed fibers are better able to form a hyper-bonded network, which leads to a high tensile and bursting strength. Typically, however, tearing strength and folding endurance are much lower. To see if superior fiber bonding is responsible for the high folding endurance values obtained for the tobacco pulps, bursting strength is measured for some of the sheets. As can be seen in Table 3 above, the bursting index results range between 3.6 and 4.5. This is the same range noted in the literature for softwood linerboard and also for bamboo linerboard. Therefore, hyper-bonding alone does not seem to be the cause of the high folding values for tobacco pulps.
In summary, both tobacco stalk and root materials, even when over-cooked, produce unbleached pulps with mechanical properties similar to those specified for a wood-based solid bleached sulfate standard sample.
Example 3
In this non-limiting example, two small cooks are done on tobacco stalk using two different alkali charges. Cooks #7 and #8, both done on Burley stalk, are identical except that Cook #8 uses an alkali charge 4% lower (on OD) than Cook #7. Pulping data are shown in Table 4 below.
TABLE 4 Pulping Results for Stalk Samples Cook# 7 8 Tobacco Type Burley Burley Raw Material Type Stalk Stalk Digester MK MK Pulping Data Pretreatment — — NaOH, % on OD Material 27 23 Liquor to Fiber Ratio 6:1 6:1 Max Temp ° C. 160 160 Time to Temp, Minutes 60 60 H Factor 1000 1000 Black Liquor pH 12.1 13.1 REA Residual Alkali (gpl as Na2O) 3.9 6.0 % Alkali Consumed 91.3 84.3 Pulp Testing Total Yield, % of OD Raw Material 43.9 37.6 % Rejects in Pulp 1.2 4.0 Screened Yield, % on OD Raw Material 35.2 24.4 Kappa Number 37.5 53.2 Freeness 594 602 ISO Brightness 22.7 19.2 Avg, Fiber Length, length-wtd, mm 0.777 0.882 Fiber width, microns 27.8 28.6 Fines, % by number 24.62 20.60 PFI Refining on Brownstock Freeness, CSF, at 500 revs 531 582 1000 revs 444 495 2000 revs 3000 revs 321 334 4000 revs 5000 revs 6000 revs 185 208
Portions of each unbleached pulp are refined in a standard laboratory PFI mill, to decreasing freeness levels. The refined pulps are formed into standard British handsheets according to TAPPI standards, with a target basis weight of 60 g/m². The sheets are then tested for the following properties: Taber stiffness (T489); tensile strength (T494); tearing resistance/strength (T414); Scott internal bond (T833); Parker roughness, using soft backing and 20 kPa (T555); and Cobb water absorption (T441). Handsheet testing data are shown in Table 5 below.
TABLE 5 Results of PFI Refining and 60 g/m² Handsheet Testing for Unbleached Pulps Cook #7 Stalk, Kappa = 37.5 Cook #8 Stalk, Kappa = 53.2 PFI revs 500 1000 3000 6000 500 1000 3000 6000 Freeness, CSF 531 444 321 185 582 495 334 208 Basis Weight, g/m2 66.3 65.8 65.9 64.3 64.6 66.5 66.0 65.4 Caliper, mils 4.27 3.98 3.56 2.99 4.45 3.83 3.35 3.29 Apparent Density, g/cm3 0.611 0.650 0.729 0.846 0.571 0.684 0.775 0.782 Parker Roughness, 20, soft, 5.70 6.10 6.82 7.52 6.59 7.59 7.55 7.53 microns Tensile Index, Nm/g 54.3 59.8 62.4 66.8 42.8 55.6 63.3 62.2 Tensile Energy Absorption, J/g 0.648 0.893 0.940 0.838 0.429 0.569 0.761 0.611 Tear Index, mN*m2/g 5.52 5.49 5.67 4.77 4.68 4.35 5.01 4.62 Taber Stiffness Units 1.4 1.2 1.0 0.7 1.3 1.0 0.8 0.8 Scott Internal Bond 1.44 1.86 3.58 5.39 1.20 2.62 4.89 5.54 (normalized), Nm/g Cobb Water Absorption, g/m2 150 140 120 80 150 130 110 100 MIT Double Folds, 0.5 kg loading 3547 15216 MIT Double Folds, 1 kg loading 2086 4669
The handsheet properties are best analyzed by plotting them versus freeness and comparing them to tabulated data. For this comparison, data for two bleached wood pulps are chosen—eucalyptus hardwood and northern softwood (NIST standard data). Both reference pulps are from kraft cooks, with chlorine-dioxide-based bleaching. FIG. 6 shows the “refining curve,” a plot of freeness (CSF) versus PFI revolutions for both tobacco stalk pulps, along with the wood pulp reference pulps. As expected, both tobacco stalk pulps refine easier than softwood, but they are a bit harder to refine compared to eucalyptus. As shown in FIG. 7, both stalk pulps have handsheet densities similar to hardwood and softwood pulp.
In FIG. 8, the tensile index (tensile strength normalized by dividing it by the sheet basis weight) is plotted versus freeness. As expected, the tobacco pulps have a much lower tensile strength compared to softwood (fiber length and wall thickness play a key role in bonding strength), but they are similar in nature to eucalyptus. Typical values for paper in the literature range from 20-70 Nm/g.
As shown in FIG. 9, the tearing strength for both tobacco pulps does not change much over the range of refining freeness values. While inferior to softwood, the values for tobacco are only moderately lower than those for eucalyptus. Typical values for wood-based paper in the literature range from 6-7, moderately higher than those measured for the tobacco pulps.
FIG. 10 is a plot of tensile strength (index) versus tearing strength (index). While both tobacco pulps are mechanically inferior compared to softwood, the data indicate that the tobacco pulps are as good as, and possibly better than, eucalyptus.
As can be seen in FIG. 11, the Tensile Energy Absorption (TEA) values obtained for the tobacco pulps are comparable to lightly-refined eucalyptus, but inferior at lower freeness levels. No reference data are available for softwood. This result tends to indicate that the tobacco sheets, while having appreciable tensile strength, are somewhat brittle and not stretchy.
FIG. 12 shows a plot of Parker roughness values versus freeness (higher values mean lower smoothness). The values obtained for the tobacco pulps are unusual in that they increase with increased refining and smoothness normally increases with refining. While the values are higher than those for eucalyptus at lower freeness levels (higher refining), they are well within the range of values noted in the literature for hardwood handsheets made from PFI-refined pulp (5.5-6.8).
There is no plot for Taber Stiffness values because no reference data are available. However, the values obtained for the tobacco pulps are within the range of 0.7-3, as noted in the literature. Similarly, there is no plot for Cobb water absorption values. It should be noted that the Cobb test is intended for sized papers (sizing is a chemical treatment to make paper less absorbent). However, the tobacco sheets are not sized. As expected, the values are high because of the lack of sizing. Typical values for sized paper grades in the literature range from 20-30 g/m².
A folding endurance test is also performed on the handsheets. The results are relatively high. Sheets from Cook #7 are tested using both 0.5 kg and 1 kg loading. The results are well above 2000 double folds, a level normally associated with currency papers.
In summary, there are some modest differences in sheet properties for the two tobacco pulps produced at two different Kappa numbers, but in general the sheets made from the pulps are similar. In addition, with the exception of a moderately lower tearing strength and excessively high folding endurance, the sheet properties for the tobacco pulps are similar to, and sometimes better than, those noted for an eucalyptus hardwood reference pulp. The test values obtained are within the range of values found in the literature for hardwood pulps.
Example 4
In the following non-limiting example, tobacco root material is cooked at pilot scale and formed into paper.
First pilot cooks are completed. Samples of the pulps show a significant content of poorly-fiberized materials (called “rejects” or “shives” in the paper industry). To remove these materials, the pulp slurry is fed to an Ahlstrom M-200 Centrisorter pressure screen equipped with slots of 0.010 inches. Good fibers passing through the screen are directed to a separate tank, while the rejected materials (a mixture of rejects and good fiber) are fed back into the feed tank. In addition, a Gauld Periflow screen with a slotted basket with slots of 0.0006 inches is used to rescreen the slurry. In the event a large amount of sand/grit remains in the pulp slurry, a Beloit Posi-Flow centrifugal cleaner can be used to remove the contaminates.
Once the slurry is acceptable, the slurry is pumped across a slanting screen (hydrasieve) to remove excess water. Most fibers cannot achieve optimum strength for papermaking without refining, a mechanical process which flattens them and increases their surface area for bonding. Therefore, the dewatered slurry is passed through a Sprout-Bauer 12-inch disk refiner equipped with a 150 hp motor. The refiner plate gap is reduced to increase motor loading 12 kW above no-load.
Softwood market pulp is repulped and then refined at 0.85% consistency using two passes through the Sprout-Bauer refiner. For the first pass, the refiner is loaded to 55 kW, 10 kW higher than the no-load value of 45 kW. The flow rate is approximately 100 grams/minute. For the second pass, the refiner is loaded to 60 kW above the no-load value of 50 kW. The refined softwood fiber is added to the tobacco pulp slurry. The resulting refined softwood slurry represents 15% by weight of the total furnish. The consistency of the slurry, after softwood addition, is 1.4%.
The papermaking process is somewhat difficult for this slurry. Using the material that includes the 15% refined softwood pulp, a heavy sheet of about 188 g/m² is fabricated. Alternative basis weights of paper can be fabricated. There is some tendency for the sheet to stick to the press rolls, predominantly on the felt side (first press, bottom felted). Therefore, the first press is by-passed. The sheet runs fine through a second press, which is a reverse-fed press (i.e., the wire side of the sheet is contacted with the press roll). This behavior indicates the non-uniform distribution of fine/sticky materials in the wet end, which is not unusual for nonwood pulp grades. In addition, the dryer section shows that tobacco-based pulp is difficult to dewater and dry. Therefore, different levels of wood-based pulp can be added to the tobacco pulp to improve papermaking characteristics. Alternatively, machines with features to accommodate a weak sheet (e.g., no open draws, pickup felts, etc.) can be used to form paper from 100% tobacco root fiber pulp.
Example 5
In the following non-limiting example, soda cooks are carried out on root samples to a produce a pulp with a Kappa number in the bleachable range (i.e., a Kappa value of about 20). The pulp is formed into standard British handsheets according to TAPPI standards, with a target basis weight of 175 to about 275 g/m². The refined fibrous pulp comprises about 85 dry weight percent tobacco root fibers. No other additives are added to the handsheets.
The handsheets are capable of forming a hard carton package for cigarettes. As illustrated in FIG. 13, cartons 305 fabricated from the tobacco-derived handsheets without lacquer can be printed on. FIG. 13 further illustrates that the cartons 300 fabricated from tobacco-derived handsheets with lacquer can be printed on. The graphics quality is acceptable, even with this non-refined pulp. Accordingly, the cartons fabricated from tobacco-derived paper perform as desired for commercial use.
Many modifications and other aspects of the disclosure set forth herein will come to mind to one skilled in the art to which the disclosure pertains having the benefit of the teachings presented in the foregoing descriptions and the associated drawings. Therefore, it is to be understood that the disclosure is not to be limited to the specific aspects disclosed and that modifications and other aspects are intended to be included within the scope of the appended claims. Although specific terms are employed herein, they are used in a generic and descriptive sense only and not for purposes of limitation.
That which is claimed:
1. A paper material comprising: a fibrous material comprising at least 5 dry weight percent of fibers derived from a plant of the Nicotiana species; wherein the paper material has a basis weight ranging from about 5 g/m² to about 450 g/m²; and wherein the paper material has a caliper ranging from about 0.01 mils to about 200 mils.
2. The paper material of claim 1, wherein the fibrous material comprises at least 50 dry weight percent of fibers derived from a plant of the Nicotiana species.
3. The paper material of claim 1, wherein the paper material has a tearing index ranging from about 4.0 mN*m²/g to about 6.5 mN*m²/g.
4. The paper material of claim 1, wherein the paper material has a tensile index ranging from about 35 Nm/g to about 70 Nm/g.
5. The paper material of claim 1, wherein the paper material has a Tensile Energy Adsorption ranging from about 0.1 J/g to about 1.0 J/g.
6. The paper material of claim 1, wherein the paper material has a bursting index ranging from about 3.0 kPa*m²/g to about 5.0 kPa*m²/g.
7. The paper material of claim 1, wherein the paper material has a Scott internal bond ranging from about 1.0 to about 6.0.
8. The paper material of claim 1, wherein the paper material has a bending resistance ranging from about 0.1 Tabor Stiffness units to about 2.0 Tabor Stiffness units.
9. The paper material of claim 1, wherein the paper material has a bending resistance ranging from about 55 Tabor Stiffness units to about 90 Tabor Stiffness units.
10. The paper material of claim 1, wherein the paper material has a folding endurance ranging from about 3000 to about 20,000 MIT double folds at 0.5 kg loading.
11. The paper material of claim 1, wherein the paper material has a folding endurance ranging from about 2000 to about 5000 MIT double folds at 1.0 kg loading.
12. The paper material of claim 1, wherein the paper material has a Parker roughness value ranging from about 5.0 to about 8.0.
13. The paper material of claim 1, wherein the paper material has a Cobb value ranging from about 50 g/m² to about 200 g/m².
14. The paper material of claim 1, wherein the basis weight ranges from about 10 g/m² to about 150 g/m² and the caliper ranges from about 0.1 mils to about 6.0 mils; and wherein the paper material is suitable for use in a smoking article in the form of at least one of a tipping material, a plug wrap and a wrapping material.
15. The paper material of claim 14, wherein the paper material comprises about 55-70 dry weight percent of the fibrous material, and wherein the fibrous material comprises about 40-60 dry weight percent of fibers derived from a plant of the Nicotiana species.
16. The paper material of claim 14, wherein the paper material comprises about 55-90 dry weight percent of the fibrous material, and wherein the fibrous material comprises about 40-60 dry weight percent of fibers derived from a plant of the Nicotiana species.
17. The paper material of claim 14, wherein the paper material comprises about 55-70 dry weight percent of the fibrous material, and wherein the fibrous material comprises about 5-20 dry weight percent of fibers derived from a plant of the Nicotiana species.
18. The paper material of claim 1, wherein the basis weight ranges from about 10 g/m² to about 150 g/m² and the caliper ranges from about 1.0 mils to about 200 mils; and wherein the paper material is suitable for use in at least one of a soft carton container suitable to house smoking articles, a label, and a paper substrate of a barrier layer.
19. The paper material of claim 18, wherein the paper material comprises about 80-95 dry weight percent of the fibrous material, and wherein the fibrous material comprises about 75-100 dry weight percent of fibers derived from a plant of the Nicotiana species.
20. The paper material of claim 1, wherein the basis weight ranges from about 50 g/m² to about 275 g/m² and the caliper ranges from about 3.0 mils to about 200 mils; and wherein the paper material is suitable for use in a at least one of a hard carton suitable to house smoking articles and a container suitable to house smokeless tobacco products.
21. The paper material of claim 20, wherein the paper material comprises about 80-95 dry weight percent of the fibrous material, and wherein the fibrous material comprises about 75-90 dry weight percent of fibers derived from a plant of the Nicotiana species.
22. A smoking article comprising: a tobacco rod comprising a lighting end and a mouth end, wherein the tobacco rod comprises a circumscribing wrapping material; a filter element, wherein the filter element is positioned adjacent to the mouth end of the tobacco rod such that the filter element and the tobacco rod are axially aligned in an end-to-end relationship; wherein the filter element is circumscribed along its outer circumference or longitudinal periphery by a layer of outer plug wrap; wherein the filter element is attached to the tobacco rod using tipping material that circumscribes both the entire length of the filter element and an adjacent region of the tobacco rod; and wherein at least one of the wrapping material, the outer plug wrap, and the tipping material comprises a paper material comprising a fibrous material comprising at least 5 dry weight percent fibers derived from a plant of the Nicotiana species; wherein the paper material has a basis weight ranging from about 10 g/m² to about 150 g/m²; and wherein the paper material has a caliper ranging from about 0.01 mils to about 8.0 mils.
23. The smoking article of claim 22, wherein the tipping material comprises the paper material, wherein the paper material comprises about 55-70 dry weight percent of the fibrous material, and wherein the fibrous material comprises about 5-100 dry weight percent of fibers derived from a plant of the Nicotiana species.
24. The smoking article of claim 22, wherein the plug wrap comprises the paper material, wherein the paper material comprises about 75-90 dry weight percent of the fibrous material, and wherein the fibrous material comprises about 5-100 dry weight percent of fibers derived from a plant of the Nicotiana species.
25. The smoking article of claim 22, wherein the wrapping material comprises the paper material, wherein the paper material comprises about 55-70 dry weight percent of the fibrous material, and wherein the fibrous material comprises about 5-100 dry weight percent of fibers derived from a plant of the Nicotiana species.
26. A container, comprising: a body having a bottom wall and a side wall, the bottom wall and the side wall defining an internal storage compartment adapted for storage of a product; and a top configured to be engaged with the body, wherein at least one of the bottom wall, side wall, and top comprises a paper material, wherein the paper material comprises a fibrous material comprising at least 5 dry weight percent fibers derived from a plant of the Nicotiana species; wherein the paper material has a basis weight ranging from about 10 g/m² to about 275 g/m²; and wherein the paper material has a caliper ranging from about 1.0 mils to about 200 mils.
27. The container of claim 26, wherein the basis weight ranges from about 10 g/m² to about 150 g/m² and the caliper ranges from about 1.0 mils to about 200 mils.
28. The container of claim 27, wherein the paper material comprises about 80-95 dry weight percent of the fibrous material, and wherein the fibrous material comprises about 5-100 dry weight percent of fibers derived from a plant of the Nicotiana species.
29. The container of claim 26, wherein the basis weight ranges from about 50 g/m² to about 275 g/m² and the caliper ranges from about 3.0 mils to about 200 mils.
30. The container of claim 29, wherein the paper material comprises about 80-95 dry weight percent of the fibrous material, and wherein the fibrous material comprises about 5-100 dry weight percent of fibers derived from a plant of the Nicotiana species.
31. The container of claim 26 further comprising a bather material suitable to prevent moisture from reaching contents of the container, wherein the barrier material comprises a paper substrate comprising about 85-90 dry weight percent of a second fibrous material, and wherein the second fibrous material comprises about 5-100 dry weight percent of fibers derived from a plant of the Nicotiana species.
32. The container of claim 26, further comprising a wrapping material extending about a perimeter of the container.
33. The container of claim 26, wherein the internal storage compartment contains a plurality of products selected from the group consisting of cigarettes, smokeless tobacco products, and food products.
34. The container of claim 26, wherein the top is removable from the body.
35. The container of claim 26, wherein the top is engaged with the body.
36. The container of claim 26, wherein the container is a smokeless tobacco container or a cigarette pack.
37. The container of claim 26, wherein the top and body are generally cylindrical.
38. A method of producing a fibrous material comprising: combining a tobacco input from a plant of the Nicotiana species with a strong base; heating the combined tobacco input and strong base to form a tobacco pulp; forming at least one layer of tobacco pulp; drying the at least one layer of tobacco pulp; pressing the at least one layer of tobacco pulp to form a paper material comprising a fibrous material comprising at least 5 dry weight percent of fibers derived from a plant of the Nicotiana species; wherein the paper material has a basis weight ranging from about 5 g/m² to about 450 g/m²; wherein the paper material has a caliper ranging from about 0.01 mils to about 200 mils; and constructing at least one of a smoking article and a container that comprises the paper material.
39. The method of claim 38, wherein the strong base is selected from the group consisting of sodium hydroxide, potassium hydroxide, sodium carbonate, sodium bicarbonate, potassium carbonate, potassium bicarbonate, ammonium hydroxide, ammonium bicarbonate, ammonium carbonate, and combinations thereof.
40. The method of claim 38, wherein the tobacco pulp is exposed to a bleaching agent.
41. The method of claim 38, wherein the layer of tobacco pulp is dried to at least 10% moisture content or less.
42. The method of claim 38, wherein a plurality of layers are pressed into a single paper product.
43. The method of claim 38, wherein a binder solution is applied to a surface of the layer of tobacco pulp to improve binding properties of the fibrous material..
| 27,079 |
https://stackoverflow.com/questions/10176509
|
StackExchange
|
Open Web
|
CC-By-SA
| 2,012 |
Stack Exchange
|
Andrew Thompson, DAVE KARL SIOCO, Ims Yr, Kamal Khan, Kappei, Pawan Singh, https://stackoverflow.com/users/1307791, https://stackoverflow.com/users/1312527, https://stackoverflow.com/users/23334745, https://stackoverflow.com/users/23334746, https://stackoverflow.com/users/23334747, https://stackoverflow.com/users/23335095, https://stackoverflow.com/users/23336056, https://stackoverflow.com/users/418556, smile, user1307791
|
English
|
Spoken
| 918 | 1,801 |
Access external .jar resources from java
I am working on a multi module Java project, it consists of multiple projects in Eclipse that depend on each other, now to add GUI Theme support I have created a Java project that does not contain any code, just the icons and pictures needed for the GUI, I made it a Java project so Maven will build it into a .jar. Now there's a main Application that loads the multiple projects into a main GUI, which gets its icons from resources within the actual modules at the moment. All I want to do is load all these resources from the external dummy .jar that is included in the classpath of the main application's .jar. Every method I have found so far does not seem to work. The .jar contains no actual java .classes, so there is no ClassLoader to reference. Are there any other methods to load the pictures without extracting the .jar?
This question looks like a duplicate of http://stackoverflow.com/questions/403256/how-do-i-read-a-resource-file-from-a-java-jar-file
"he .jar contains no actual java .classes, so there is no ClassLoader to reference." If the Jar is on the run-time class-path of the app., the resources should be found using getResource() (in the context class loader) with an 'path from root' such as /path/to/the.png
It was actually a simple error on my part (I used a non existent path). Apparently Java has no problem with grabbing resources from the classpath no matter where getResource() is called from. Someone explained to me that Java basically builds a filesystem out of all the used jars when it's run, so the access is quite simple and globally available. Thanks for the suggestions everyone!
Three things you might try:
Create a dummy class in the resource jar, which you could use to get the ClassLoader reference.
Use URLClassLoader, if you know, where your jar-File resides.
You always have the possibility to create your own ClassLoader by extending java.lang.ClassLoader.
Treat the external jar file as a zip-archive and read the images/resource something like this:
public ZipStuff(String filename) throws IOException
{
ZipFile zf = new ZipFile(filename);
Enumeration<? extends ZipEntry> entries = zf.entries();
while (entries.hasMoreElements()) {
ZipEntry ze = entries.nextElement();
ImageIcon ii = new ImageIcon(ImageIO.read(zf.getInputStream(ze)));
JLabel l = new JLabel(ii);
getContentPane().add(l);
}
setVisible(true);
pack();
}
In this case I have a jar file with one single image which I load into a JLabel. The ZipStuff-class is a JFrame.
You could get all of the resources (all jar files on classpath should work even one without classes):
Enumeration<URL> resources = null;
try {
resources = Thread.currentThread().getContextClassLoader().getResources(someResource);
} catch (Exception ex) {
//no op
}
if (resources == null || !resources.hasMoreElements()) {
resources = ClasspathReader.class.getClassLoader().getResources(someResource);
}
Then check to see if the current resource is a file. Files you can deal with direct as files.
But your question was about jar files so I wont go there.
while (resources.hasMoreElements()) {
URL resource = resources.nextElement();
if (resource.getProtocol().equals("file")) {
//if it is a file then we can handle it the normal way.
handleFile(resource, namespace);
continue;
}
At this point you should have only jar:file resources so...
Split up the string that looks like this:
jar:file:/Users/rick/.m2/repository/invoke/invoke/1.0-SNAPSHOT/invoke-1.0-SNAPSHOT.jar!/org/node/
into this
/Users/rick/.m2/repository/invoke/invoke/1.0-SNAPSHOT/invoke-1.0-SNAPSHOT.jar
and this
/org/node/
Here is the code to do the above devoid of pesky error checking. :)
String[] split = resource.toString().split(":");
String[] split2 = split[2].split("!");
String zipFileName = split2[0];
String sresource = split2[1];
System.out.printf("After split zip file name = %s," +
" \nresource in zip %s \n", zipFileName, sresource);
Now we have the zip file name so we can read it:
ZipFile zipFile = new ZipFile(zipFileName);
Now we can iterate through its entries:
Enumeration<? extends ZipEntry> entries = zipFile.entries();
while (entries.hasMoreElements()) {
ZipEntry entry = entries.nextElement();
/* If it is a directory, then skip it. */
if (entry.isDirectory()) {
continue;
}
String entryName = entry.getName();
System.out.printf("zip entry name %s \n", entryName);
See if it starts with the resource we are looking for.
if (!entryName.startsWith(someResource)) {
continue;
}
There were two tricks I did earlier to see if it was a directory
boolean isDir = !someResource.endsWith(".txt");
This only works because I am looking for resources that ends with .txt and I assume if it does not end with .txt that it is an dir /foo/dir and /foo/dir/ both work.
The other trick was this:
if (someResource.startsWith("/")) {
someResource = someResource.substring(1);
}
Classpath resource can never really start with a starting slash. Logically they do, but in reality you have to strip it. This is a known behavior of classpath resources. It works with a slash unless the resource is in a jar file. Bottom line, by stripping it, it always works.
We need to get the actual fileName of the darn thing. The fileName part from the entry name.
where /foo/bar/foo/bee/bar.txt, and we want 'bar.txt' which is the fileName. Back inside of our while loop.
while (entries.hasMoreElements()) {
ZipEntry entry = entries.nextElement();
...
String entryName = entry.getName(); //entry is zipEntry
String fileName = entryName.substring(entryName.lastIndexOf("/") + 1);
/** See if the file starts with our namespace and ends with our extension. */
if (fileName.startsWith(namespace) && fileName.endsWith(".txt")) {
Next we see if these entry matches our criteria and if so read contents of the file to System.out.
try (Reader reader = new InputStreamReader(zipFile.getInputStream(entry))) {
StringBuilder builder = new StringBuilder();
int ch = 0;
while ((ch = reader.read()) != -1) {
builder.append((char) ch);
}
System.out.printf("zip fileName = %s\n\n####\n contents of file %s\n###\n",
entryName, builder);
} catch (Exception ex) {
ex.printStackTrace();//it is an example/proto :)
}
}
You can see the full example here: Sleepless in Pleasanton.
| 50,210 |
https://github.com/snoweek/-/blob/master/grade_functions.php
|
Github Open Source
|
Open Source
|
Apache-1.1
| null |
-
|
snoweek
|
PHP
|
Code
| 105 | 1,027 |
<?php
define('SAE_MYSQL_USER','');//用户名 : SAE_MYSQL_USER
define('SAE_MYSQL_PASS','');//密 码 : SAE_MYSQL_PASS
define('SAE_MYSQL_HOST_M','');//主库域名 : SAE_MYSQL_HOST_M
define('SAE_MYSQL_HOST_S','');//从库域名 : SAE_MYSQL_HOST_S
define('SAE_MYSQL_PORT','');//端 口 : SAE_MYSQL_PORT
define('SAE_MYSQL_DB','k');//数据库名 : SAE_MYSQL_DB
function connect_mysql(){
mysql_connect(SAE_MYSQL_HOST_M.':'.SAE_MYSQL_PORT,SAE_MYSQL_USER,SAE_MYSQL_PASS);
mysql_select_db(SAE_MYSQL_DB, $db);
}
function check_user($submit_open_id){
$db=mysql_connect(SAE_MYSQL_HOST_M.':'.SAE_MYSQL_PORT,SAE_MYSQL_USER,SAE_MYSQL_PASS);
$dbc=mysql_select_db(SAE_MYSQL_DB, $db);
$q="select student_id from user where open_id='$submit_open_id'";
$r=mysql_query($q);
if(mysql_num_rows($r)==1){
while($user=mysql_fetch_array($r)){
$result=$user['student_id'];
}
}else{
$result=0;
}
return $result;
}
function insert_user($submit_open_id,$submit_student_id){
$db=mysql_connect(SAE_MYSQL_HOST_M.':'.SAE_MYSQL_PORT,SAE_MYSQL_USER,SAE_MYSQL_PASS);
$dbc=mysql_select_db(SAE_MYSQL_DB, $db);
$q="insert into user(open_id,student_id)values('$submit_open_id','$submit_student_id')";
$r=mysql_query($q);
$rows=mysql_affected_rows();
return $rows;
}
function delete_user($submit_open_id){
$db=mysql_connect(SAE_MYSQL_HOST_M.':'.SAE_MYSQL_PORT,SAE_MYSQL_USER,SAE_MYSQL_PASS);
$dbc=mysql_select_db(SAE_MYSQL_DB, $db);
$q="delete from user where open_id='$submit_open_id'";
$r=mysql_query($q);
$rows=mysql_affected_rows();
return $rows;
}
function search_grade($submit_student_id){
$db=mysql_connect(SAE_MYSQL_HOST_M.':'.SAE_MYSQL_PORT,SAE_MYSQL_USER,SAE_MYSQL_PASS);
$dbc=mysql_select_db(SAE_MYSQL_DB, $db);
$q="select course,grade from grade_list where student_id='$submit_student_id'";
$r=mysql_query($q);
$grade_list=array();
if(mysql_num_rows($r)!=0){
while($g=mysql_fetch_array($r)){
$grade=array();
$grade['course']=$g['course'];
$grade['grade']=$g['grade'];
$grade_list[]=$grade;
}
$result=$grade_list;
}else{
$result=0;
}
return $result;
}
?>
| 29,719 |
https://sv.wikipedia.org/wiki/Tipula%20trifasciculata
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Tipula trifasciculata
|
https://sv.wikipedia.org/w/index.php?title=Tipula trifasciculata&action=history
|
Swedish
|
Spoken
| 35 | 78 |
Tipula trifasciculata är en tvåvingeart som beskrevs av Gabriel Strobl 1900. Tipula trifasciculata ingår i släktet Tipula och familjen storharkrankar.
Artens utbredningsområde är Spanien. Inga underarter finns listade i Catalogue of Life.
Källor
Storharkrankar
trifasciculata
| 7,223 |
https://github.com/kfr2/magically/blob/master/protected/views/priceSearch.tpl.php
|
Github Open Source
|
Open Source
|
Unlicense
| 2,022 |
magically
|
kfr2
|
PHP
|
Code
| 75 | 360 |
<?php
/**
* Author: Kevin Richardson <[email protected]>
* Date: 6/20/11 11:19 AM
*/
?>
<div data-role="page" data-theme="a" id="priceSearch">
<div data-role="header">
<a href="/" title="magically.us homepage" data-icon="home" rel="external">home</a>
<h1>price search</h1>
</div>
<div data-role="content">
<form id="priceSearchForm">
<div data-role="fieldcontain">
<label for="cardName">name</label>
<input type="text" id="cardName" placeholder="card name">
</div>
<div data-role="fieldcontain">
<label for="cardType">card type</label>
<select data-role="slider" id="cardType">
<option value="normal" selected="selected">normal</option>
<option value="foil">foil</option>
</select>
</div>
<input data-role="fieldcontain" type="submit" id="doPriceSearch" value="price search" data-theme="b">
</form>
</div>
<div data-role="content" id="priceData">
</div>
<?php
include("pageFooter.tpl.php");
?>
</div>
| 26,529 |
<urn:uuid:293eaa5b-cafd-40fd-90bf-9b2ac0251bef>
|
French Open Data
|
Open Government
|
Various open data
| null |
https://francearchives.gouv.fr/facomponent/1884c91a943ada655e845b5639ab25d9c5ca5123
|
francearchives.gouv.fr
|
Limburgish
|
Spoken
| 13 | 23 |
Dossier : 2000 X 37094
Document d'archives : Dossier : 2000 X 37094
| 26,968 |
sn88086023_1909-04-20_1_5_1
|
US-PD-Newspapers
|
Open Culture
|
Public Domain
| null |
None
|
None
|
English
|
Spoken
| 2,093 | 3,154 |
ELECTRIC PAGES. DAILY EAST OF OREGON, PENDLETON, OREGON. TUESDAY, APRIL 20, 1909. PAGE FIVE. THE Shirt Waists $1.66 This week we will give away absolutely FREE. Your choice of 400 Shirt Waists. One Waist Free With Every Skirt Over 500 skirts to choose from and every one this season's style. Prices from $4 to $22.50. A $1.00 WAIST FREE WITH ANY $1.00 SKIRT A $1.25 WAIST FREE WITH ANY $5.00 SKIRT A $1.50 WAIST FREE WITH ANY $7.00 SKIRT A $1.75 WAIST FREE WITH ANY $7.00 SKIRT A $2.00 WAIST FREE WITH ANY $8.00 SKIRT A $2.00 WAIST FREE WITH ANY $10.00 SKIRT A $3.00 WAIST FREE WITH ANY $12.50 SKIRT A $3.00 WAIST FREE WITH ANY $12.50 SKIRT A $5.00 WAIST FREE WITH ANY $18.00 SKIRT A $5.00 WAIST FREE WITH ANY $18.00 SKIRT NO CHARGES FOR ALTERATIONS 75 Ladies and Misses Suits On sale this week at about what the material is worth. We are still showing a beautiful assortment of Suits in all sizes for little women and regular sizes up to 42. ALTERATIONS FREE F. E. Livengood & Co. WILL REPRESENT PENDLETON IN CONTEST AT WHITMAN Ripi Olives, Green Olives, Sweet and Sour Pickles. Cream, Limburger and Camembert Cheese. A full line of canned and pickled fish. Phone us your orders, we have Phones, both Main 28. Mih Punsy Ireland and Harold Warner Selected By the Faculty Last Night at Whitman May 8 Held at the Same Time as the Tri-State Field Meet Second Contest at Washington State College. Miss Tansy Ireland and Harold Warner will represent the Pendleton high school school in the declamation contests at Walla Walla and Pullman this year. The selections were made at a meeting of the faculty, held last evening. The first contest will be at Whitman college the evening of May 8 and will be in connection with the tri-state field meet to be held there, that afternoon and the one preceding. The second contest will be held at the Washington state college, May 15 and will also be in connection with the big inter-scholastic field meet which is under the auspices of that college. This will be Miss Ireland's first appearance in a contest of this kind but she has displayed much marked ability in this line and it is expected she will be able to make a good showing. Warner won the eastern Oregon oratorical contest last year, was a member of last year's debating team and leader of this year's team which has just won the championship of the eastern Oregon district. It is therefore expected that he will be able to render a good account of himself in the Pullman contest. The orator to represent the school in the contest to be held here the evening of May 22, following the big eastern Oregon high school track meet has not yet been selected. It will probably be Roy Rowland, however, another member of the debating team. Arrangements are also being made for the next debate which may be held in this city. The opposing team will be from the Newberg high school which has won the championship of that district. If successful in that debate, the Pendleton speakers will then enter the final contest for the championship of the state. RESULTS OF THE BIG YESTERDAY GRAY BROS. GROCER. Y CO. LOCALS STANDING OF CONTESTANTS FOR CARNIVAL QUEEN. Pastime pictures please all. Better suit. 315. Bond Bros. Suits up to $27.50 at Bond Bros. for $15. New York style clothes for $15 per at Bond Bros. Call at Nissen Implement Company If you need a fine buggy. Wanted Good, clean, large rags, at the East Oregonian office. Fresh fish every day at Pendleton Cash Market. Phone Main 101. Look over Bond Bros, clothing racks, then take your choice for $16. Large car of fine buggies just received by Nissen Implement Company. For rent, nicely furnished cottage, close in on north side. Inquire this office. Public stenographer, E. O. Bldg., one door south new Northern Pacific depot. Fine line of rubber tired vehicles Just received by Nissen Implement Company. Position wanted by lady stenographer and typewriter. References given. Enquire this office. For sale cheap Furniture and furnishings for six room lodging house. Enquire 613 Garden street. For Sale Alfalfa and fruit farm, 12 miles west of Pendleton. Enquire Bertha Anger 442 Bernard Genevieve Clarke, 371 Irmal Mann, 301 Genevieve Clarke, 269 Ivy Hill, 217 IN NORTHWESTERN LEAGUE. Tuconia 2 Vancouver 0. Tacoma, April 19. Jess Baker, Tacoma's southpaw, was unhitched today and the Tigers won a clean-cut victory, 2 to 0. Baker allowed but three scattered hits and was remarkably steady. Not a visiting player reached second base, two attempts at steals being nipped by Catcher Kella-ckey. The locals batter Warren Hall freely, three of the nine hits being for extra bases. The fielding on both sides was snappy and clean, every chance being handled without error. Score R. H. E. Tacoma 2 9 0 Vancouver 0 3 0 Batteries Baker and Kellackey; at the Standard Grocery for information. Clothes that fit your form and are Hall and Sugden up-to-date at Bond Bros., for $15 a suit. Seattle, Portland, April 19. Seattle made it possible acreage tracts in vicinity of Portland. H. P. Whitman, 819 Cham- bv a Great batting rally in the ninth. OREGON THEATRE, Tuesday April 30 One Merry Musical Night JONNIE & ELLA CALVIN IN THE FASCINATING MUSICAL MIX-UP PEOPLE WITH A BIG BEAUTY CHORUS A COMPLETE PRODUCTION; CARLOAD of Scenery and Electric Effects. Special Prices: Lower Floor $1.00 75c Balcony 50c 35c. Seats on Sale at Pendleton Drug Co. Monday 10 a. m. Louis in an exciting finish today. Score R. H. E. Cincinnati 3 4 1 St. Louis 2 8 1 Batteries Fromme and Roth; Higginson and Beebe, Bresnahan. Boston 3 Brooklyn 2. Boston, April 19. Brooklyn and Boston broke even in today's games, the morning event being won by the home team 3 to 2, and the visitors shutting them out in the afternoon, 5 to 0. Morning score R. H. E. Boston 3 12 0 Brooklyn 2 7 0 Batteries Chappelle and Smith Bell and Marshall. Taft and Vice President Sherman witnessed the one-sided contest. Score R. H. E. Washington 4 7 4 Boston 8 11 1 Batteries Gray and Blankenship, street; Steels, Cicotte and Corrigan. GAMES IN AMERICAN. New York 4 Philadelphia 2. Philadelphia, April 19. New York today defeated Philadelphia. The visitors were shut out until two were out in the seventh, when they scored three runs, enough to win the game on Laporte's triple, Knight's single, passed to Demmitt and McIlveen and Crees' single. Score R. H. E. Philadelphia 2 7 2 New York 4 10 2 Batteries Dygert and Vickers and Thomas! Warhop and Doyle and Blair. Boston 4 Washington 8. Washington, April 19. Gray was wild and ineffective today, Boston defeating Washington easily. President Beautiful Pictures Free. Tallman & Co. have on display in their windows copies of some of the world's famous paintings. One of these pictures will be given to each purchaser of $1 North of goods from their store on Saturday, April 24. These pictures are worthy of a place in any home. Be the possessor of one. Object to Strong Medicine. Many people object to taking the strong medicines usually prescribed by physicians for rheumatism. There is no need of internal treatment in any case of muscular or chronic rheumatism, and more than nine out of every ten cases of the disease are of one or the Other of these varieties. When there is no fever and little (if any) swelling, you may know that it is only necessary to apply Chamberlain's Liniment freely to get quick relief. Try it. For sale by all good dealers. THE PENDLETON DRUG CO. IF IT'S GOOD WE HAVE IT Marriage License Issued. A marriage license was issued this morning to Victor C. Burke and Miss Josephine Stroble, both of this city. Dress like they do on old Broadway and do it for $15 at Bond Bros. Now. Oregon and Idaho Wool Sales Dates for 1909. May 19, Wednesday, Payette, Idaho. May 21, Friday, Midvale, Idaho. May 22, Saturday, Weiser, Idaho. May 24, Monday, Pendleton, Ore. May 27, Thursday, Heppner, Ore. May 29, Saturday, Echo, Ore. June 1, Tuesday, Shaniko, Ore. June 4, Friday, Pilot Rock, Ore. June 5, Saturday, Baker City, Ore. June 7, Monday, Ontario, Ore. June 8, Tuesday, Payette, Idaho. June 10, Thursday, Midvale, Idaho. June 11, Friday, Weiser, Idaho. June 15, Tuesday, Shaniko, Ore. June 18, Friday, Heppner, Ore. June 21, Monday, Vale, Ore. June 22, Tuesday, Ontario, Ore. June 24, Thursday, Joseph, Ore. June 25, Friday, Enterprise, Ore. June 29, Tuesday, Shaniko, Ore. July 1, Thursday, Heppner, Ore. Regarding other sales dates, address until May 1st, William Ellery, Secretary, 252 Summer Street, Boston. After May 1st, address P. O. Box 51, Pendleton, Oregon. Later sales dates at many of the above towns will probably be made. ber of Commerce. Lost On Court or Main street, Sunday, crested brooch with imitation diamond setting in centre. Return to this office for reward. For rent New 5-room cottage, with modern conveniences. Lot 60x100. Also new barn and yard, Enquire 513 Pine street. Fine new line of Hams, Bacon, Smoked Meats and Lard at Pendleton Cash Market. Phone Main 101. Pendleton Cash Market, best meats. For Sale 160 acres, 130 acres plowed, 50 acres in fall wheat, and 10 acres of garden land, good house, barn and outbuildings. C. H. Sellers, 743, Main street, Pendleton, Ore. Inning, when the score was 4 to 2 against them. Portland had batted Rush steadily through the game, while Chinnault was a mystery to Seattle except in the sixth, when four hits gave two runs. In the ninth, with the score 4 to 2 in Portland's favor, Fortier was hit with a pitched ball. Crocker got a double and Akin scored both of them with a hit. Raymond went out at first but Capron planked the ball against the fence, scoring Akin and winning one of the most exciting games imaginable. Score R. H. E. Seattle 5 9 1 Portland 4 9 1 Batteries Rush and Custer, tier; Chinnault and Sheehan. For- THE PENDLETON DRUG CO. YOUR BEST INVESTMENT OUR EXPERIENCE People put middle life usually have some kidney or bladder disorder that saps the vitality, which is naturally lower in old age. Foley's Kidney Remedy corrects urinary troubles, stimulates the kidneys, and restores strength and vigor. It cures Spokane 6 Aberdeen 4. Spokane, April 19. Burnett's clean hit past Herbert in the last of the ninth, with one gone, scored Connors from second and won today's game from Aberdeen, 3 to 2. Jensen affirms that the acid troubles by strengthening the kidneys so they will strain out the uric acid that settles in the muscles and joints, causing rheumatism. Koe In the sixth inning, would have scored a shut-out. Score by Innings: Aberdeen ......00000200 0 2 Spokane 0000101 0 13 BELMONT ILVAOK $2.50 Rl'SSI.W STROP $1.00 GERMAN 1IOXK $100 ItrilBEK-SEr BlUSlt BO SHAVING Mill 35 PINE NTT CREAM 25 BY-LOW TAMTM rOWDEK . . .25 STYPTIC PENCIL 10 MIAVINO KOAH 10 $6.05 All for 3 Dollars KOEPPENS The Drug Store That Serves You Best. NATIONAL LEAGUE KESnTS. Philadelphia 3 New, York 2. New York, April 19. The Phila delphia Nationals today won their first victory of the season, defeating New York 3 to 2, by bunching hits on Crandnll In the third Inning. Score R. H. E. Philadelphia 3 6 2 New York 2 4 1 Batteries Moren and Docin; Ray mond, Durham, Crandall and Schlel. Brooklyn 5 Boston 0. Afternoon game II. H. E. Boston 0 5 3 Brooklyn 5 10 5 Batteries McCarthy and Bower- man; Mclntyre and Bergen. Cincinnati .1 St. mil 2. Cincinnati, April 19. Cincinnati went Into first place by defeating St. Spring and Summer. Footwear Sale To make room for a new line of Edwin C. Burt Oxfords we have coming, we will place on sale Wednesday morning, sale to continue one week, our entire line of new oxfords in patent, vici, gun metal, tan and ox-blood at the following prices: $4.00 Oxfords $3.50 Oxfords $3.00 Oxfords $2.50 Oxfords Shoe Bargains for Ladies and Children $1.50 and $2.00 Children's Shoes placed on sale in bins now 98c. $4.00 Ladies' Sorosis Shoes, french heels, at . . $ 1 .50 $2.00 and $2.50 Misses Shoes at $1.35. i at $3.48 at $2.95 at $2.48 at $2.(0 ALEXANDER DEFT. STORE GIVERS OF BEST SHOE VALUES. J.
| 14,647 |
https://www.wikidata.org/wiki/Q29638494
|
Wikidata
|
Semantic data
|
CC0
| null |
Xisha Tou
|
None
|
Multilingual
|
Semantic data
| 55 | 109 |
Xisha Tou
Xisha Tou land Kina
Xisha Tou instans av kap
Xisha Tou Geonames-ID 8264674
Xisha Tou geografiska koordinater
Xisha Tou GNS-ID 11461944
Xisha Tou
Xisha Tou country People's Republic of China
Xisha Tou instance of cape
Xisha Tou GeoNames ID 8264674
Xisha Tou coordinate location
Xisha Tou GNS Unique Feature ID 11461944
Xisha Tou
| 17,631 |
https://openalex.org/W4240192480
|
OpenAlex
|
Open Science
|
CC-By
| 2,020 |
Septal Perforator Artery
| null |
English
|
Spoken
| 61 | 143 |
Qeios · Definition, February 2, 2020 Open Peer Review on Qeios Open Peer Review on Qeios Septal Perforator Artery National Cancer Institute National Cancer Institute Qeios ID: 9ZTWWC · https://doi.org/10.32388/9ZTWWC Source National Cancer Institute. Septal Perforator Artery. NCI Thesaurus. Code C102348. The arteries arising from the right posterior descending artery that supply the
interventricular septum. Qeios ID: 9ZTWWC · https://doi.org/10.32388/9ZTWWC 1/1
| 7,178 |
https://github.com/miyakogi/wdom_py/blob/master/docs/guide/samples/new1.py
|
Github Open Source
|
Open Source
|
MIT
| 2,021 |
wdom_py
|
miyakogi
|
Python
|
Code
| 28 | 106 |
from wdom.tag import Ul, Li
ul = Ul()
li1 = Li('item1')
li2 = Li('item2')
...
ul.appendChild(li1)
ul.appendChild(li2)
...
print(ul.html_noid)
# by append
ul2 = Ul()
ul2.append(Li('item1'), Li('item2'))
print(ul2.html_noid)
| 13,935 |
https://github.com/DogWars/pipetools/blob/master/publish_docs.py
|
Github Open Source
|
Open Source
|
MIT
| 2,020 |
pipetools
|
DogWars
|
Python
|
Code
| 190 | 669 |
"""
A script for generating a README file and publishing docs on github pages.
"""
import codecs
import re
from paver.easy import sh, BuildFailure
from pipetools import foreach, foreach_do, where, X, pipe, unless
DOC_ROOT = 'http://0101.github.io/pipetools/doc/'
readme_template = """
`Complete documentation in full color <{0}>`_.
.. image:: https://travis-ci.org/0101/pipetools.svg?branch=master
:target: https://travis-ci.org/0101/pipetools
Pipetools
=========
{{0}}
But wait, there is more
-----------------------
See the `full documentation <{0}#contents>`_.
""".format(DOC_ROOT)
link_template = u"`{text} <%s{url}>`_" % DOC_ROOT
link_replacements = (
# :doc:`pipe-utils' documentation<pipeutils>`.
(r":doc:`([^<]*)<([^>]*)>`", {'url': r'\2.html', 'text': r'\1'}),
# :func:`~pipetools.utils.where`
(r":func:`~pipetools\.utils\.([^`]*)`",
{'url': r'pipeutils.html#pipetools.utils.\1', 'text': r'\1()'}),
) > foreach([X[0] | re.compile, X[1] | link_template])
def create_readme():
with codecs.open('docs/source/overview.rst', 'r', 'utf-8') as overview:
with codecs.open('README.rst', 'w+', 'utf-8') as readme:
overview.read() > pipe | fix_links | readme_template | readme.write
def fix_links(string):
for pattern, replacement in link_replacements:
string = pattern.sub(replacement, string)
return string
commit_readme = """
git add README.rst
git commit -m "(readme update)"
"""
update_gh_pages = """
git checkout gh-pages
git merge master
git rm -rf doc
sphinx-build -b html docs/source/ doc
git add doc
git commit -m "doc update"
git checkout master
"""
runscript = X.split('\n') | where(X) | unless(BuildFailure, foreach_do(sh))
if __name__ == '__main__':
create_readme()
runscript(commit_readme)
runscript(update_gh_pages)
| 17,632 |
sn90005351_1921-02-18_1_3_1
|
US-PD-Newspapers
|
Open Culture
|
Public Domain
| null |
None
|
None
|
English
|
Spoken
| 2,562 | 4,150 |
CALLE DON I AN - RECORD FRIDAY, FEDERAL 18, 1921 PAGE THREE COULDN'T WORK A DAY IN ONE LONG MONTHS Farmers Were Down In Red And Helpless For Two Months Gains 15 Pounds Taking Tanlac and Health Is Restored. "I had a long time of work, but in just a few weeks I found Tinned to my health, I had to be added many years to my life," said C. C. Granville, a well-to-do farmer at Ira, Vermont. "My health broke down in January and I was down in bed for two months. I could not even go over. After I got up I could not do any work at all and for a month I was not able to walk to the barn. "I had a bad case of constipation, had dizzy spells, lost weight and was so weak and in down that I could hardly get around the house. I read a statement from a man in Darlington, Vermont, who said Tanlac had been up for some time. On the strength of that, I concluded taking Tanlac, my stomach was very much improved. My appetite has come back and my stomach is very much improved. I am not bothered with frequent headaches and dizziness and sleep better than I did. I have been built up in every way and have gained about fifteen pounds. I am sixty-nine years old, but in fine health for a man of my age and in working on the farm every day. Tanlac is sold in St. Johnsbury by Laundry's Drug Store and in West St. Johnsbury, I could not see my strength back by C. H. Colburn and in my opinion, I would fill up with a bottle and get so in Danville by J. W. Gillis. FRI DAY, FRIDAY Special for This Week Your Choice of Three Ce v lo n Formosa M i x e d 383 Ter Pound in our specially line For A 10 25c 1-1- -7 1-2 H. P. Fairbanks Morse Electric Motor. -Fairbanks Morse Induction Starter Switch. 1 Geared Hoist with Clutch and Cable. 1 Derrick Hoist with Cable and 1 Pulleys. Also Shafting, Pulleys, Belting. These have all been used but are in extra good condition. THE C. H. GOSS CO. St. Johnsbury, Vermont The value of the same service, Sold in the bean with all rich flavor Scaled for the Ground to your order. We are going out of business and everything must be sold. We still have some choice bargains in Millinery goods. You would be astounded at some of the values you can get in Velvets, Ribbons, Straw Hats and everything in the Millinery Line. We also are disposing of our store fixtures including a counter, show case, cash register, small safe, cabinet of drawers, hat stands, etc. MUDGETT & WAITE Railroad Street, St. Johnsbury. See the Delight Store Windows and from by the most reliable price. The Best of Everything at a saving is the Policy of Genuine Store Publishing. Margarine Supreme "Sweet Pluff" 3 lb. Churned from the Best, Sol the Best to EVERY BUY A BENEFIT See Windows for Other Special Rice, candy-lbs. 21c, Haking Powder, XX, lb., 20c Pure Extracts. 2 lb. Vanilla and Lemon, 2 oz. bottle Roasted Peanuts 2 qts. 20c Direct importation Co. "Ilenefit Store" WEDDED LIFE Mr. and Mrs. S. J. Hanson Honored by Many Friends at Happy Gathering St. Valentine's Eve was the occasion of the palmy days of many friends, old and new, at the home of Mr. and Mrs. S. J. Hanson. Beauty to celebrate the golden anniversary, in a beautiful floral arrangement. The hospitable home was stitched to its utmost capacity to receive the welcome guest. The decorations of gold and white prevailed throughout the rooms. Vases of jonquils adorned the dining room, and the decorations of gold and white prevailed throughout the rooms. The decorations of gold and white prevailed throughout the rooms. The reception of the guests was a most enjoyable one, with the exception of the guests being the guests of honor and the guests of honor. The reception was a most enjoyable one, with the exception of the guests being the guests of honor and the guests of honor. The reception was a most enjoyable one, with the exception of the guests being the guests of honor and the guests of honor. The reception was a most enjoyable one, with the exception of the guests being the guests of honor and the guests of honor. The reception was a most enjoyable one, with the exception of the guests being the guests of honor and the guests of honor. Co ti rad lìerk, rejne-tiitinjr the Lodge of Odd Fellows, spoke in behalf of the order to which Mr. Hastings has for many years been a member, present being a beautiful electric lamp with the best wishes of all the members. Mr. Hastings most feelingly and earnestly responded to both. Ernest Skinner of Passumpsic, added to the pleasure of the evening by his beautiful voice in many objects, assisted at the piano by Miss Kellie Wright. Telcirranis, letters and cards were received throughout the day, from distant friends. Home member the marriage of the three sisters and friends. Mrs. Hastings being the only surviving member. Miner L. Carpenter, high honor, Mrs. Hastings and his wife of H. X. IL, were present on the occasion. LYNDON VILLE given by the elite, Sheriffs, and it is expected to succeed. The advance sale of seats was very good, the east shows (good talent), and everything should go well with the young actors. Monday evening next, the Phi Beta Kappa Society held their annual exhibition at the Music Hall, and no doubt this, the fifth annual event will be as successful as the predecessors. I must, by Cure-Attend FARMERS ATTENDS FARMERS ATTENDS You are interested in buying standard quality oats, corn, cottonseed, bran, gluten, flour, ready rations and other mill feeds at rock bottom prices; Come to the Farmer's Meeting at G. A. R. Hall Citizens Savings Bank Block I shall be there to quote you prices that will startle you, whether in Lumber, ton, or carload lots, for prompt or deferred delivery as desired, f. o. b. car St. Johnsbury. I have been in the grain business for several years and am equipped to serve you. At This Meeting I Shall Seek to Demonstrate (1), That I am ready to establish a grain and feed store in St. Johnsbury and sell standard goods at market plus a small commission for handling, if farmers will give me their patronage. (2) That minor which have come to me to the effect that a representative of the Farmer's Exchange claimed to quote current market prices on grain products recently in Walden and Hardwick, plus a small commission of from 75c to $1.50 per ton, are misleading and that some prices quoted were, in instances, from $6 to $8 per ton above current market quotations. (3) That rumors as to alleged statements by this representative of the Farmer's Exchange that I have been extortionate with farmers in Walden and Hardwick in the matter of prices are prejudiced, unfair and untrue. In the midst of my representative, A. E. Atkins, before you buy another supply of grain, feed or flour. It will save you dollars. He is covering St. Johnsbury and nearby towns this week. Mr. È. H. Hallett of the Farmer's Exchange is invited to at tend this meeting. C. A. SMITH EAST HARDWICK, VT. FOR SALE e. .Small fain inilr.. l'i oni Fall halik- Sboi inad, - arie- land, ni-trly of aboul teli acies, hah'.nce i-uniini(f .prilli v.-atei, mg a'iout line ,-;-.M-V orclie-t..i, and lei tv.-hments wii! j :i M-m-d in the b'i'l. ! Mr and Mr... Will Chi aey, fornii r j e-idelit- iure. v-;v called lle.e la-',. Fl-esday to a'.'.,--: the funeral cf .T - ..J . ' on s a el Jifl-i pasturi'. coi t !;:' hou.-e ami barn, line locai ion, vill sejl or trade for villane proH.'i'ty. These ; ,nall placo will be in domami this niornint:'; come e'.uly. 1 bave several liew place.s li-ted in the il l.i'Ve. My olhce o)!en e'eninn'.-. A. B. DOW'S AGENCY Tel. One. Office over Bailey'u Music ' !:'. a-tman Ko-i-r, X. Y., tlu. Offico over Bailey'u Woonis li in inni ni a mi in in .li il', . pr-r-; . . 1 ''. ' 1 . 1 1 .' b .Ir. I.llìi!-:V o i represeiitat :c dak Company of li;.- been ni town a leu- day vuilv. cailm.j- un ali the iinolorai ers, bolli jh ofo;--ional and amateur, e,ivin;f theni advice and inlruction.-, and reeommemliii;;- improved niethods ol v.o'k. Mr.-. .1 film .Merrill of Newpoit is i with ber mother, Mrs Henry W'al-on, I for a few days. i day S I'utler of Kandolph, who is ; now li-in,u' with bis ilaiiK'hter, Mr:. li. 11. Moore was in town cullili? on I ohi fncndsthis week. ! The jrirl l'riends of Miss (.Menu J Uell united in ivin ber a pleaant -urpri.-e arty 1 liar.-Uay evenni;-, on the ève of ber departure from home. Sin- lcaves l'riday l'or V liitelield, X. IL, where she is to take up the training for a nurse, in the Morrison hospital. Miss Hill was present with a silk umbrella as a pallid gift. A most delightful evening was spent by the young lady and her friends. Sery of the second grade be-t proper in penmanship. Great mystery of Monday the the torn; was solved by the first and second grades of Fairbanks villa school marched into dis, Tillon's room and were entertained by the third and fourth grades at a Valentino party. Each one received a good heart as a favor after the entrance box had been opened and contents distributed. NO TIRE OUR WANT ADS PAY BIG REDUCTIONS Will be offered on monuments, markers, headstones and in cutting inscriptions at our THREE DAY SALE Which opens on Thursday. People who have been planning to purchase a memorial for a deceased loved one may secure just what they want at this opportunity sale. We are going to give 30 to 35 DISCOUNT on every product of our plan. We have about 15 monuments all set up and ready for delivery. You may have your choice. Following is a list of bargains in monuments: SCHOOL NOTES Mr. Tilton and her third and commanded of Fairbanks villa school. The banks will be entertained at the Globe theater Saturday afternoon. Miss Hawkins and her friends and the students enjoyed a lively ride to North Danville Saturday. (liner Tui?eon of the fir.-t traile and llarold Johnson of the second won in arithmetic 1: s t week; in pkonies l'd' io Mdlreavv of the first rude and l' ranci- Nichol.- of 1he sec oml H'rade v.ere the winner:.. Klsmore Kilburn of the first K''nde and 7 ( CTI I OFF TOBACCO "Ko-To-lIac'' has lielped thousaiuhi to break the coally nerve-t-huttorintf tobacco habit. Wlienevcr you bave a lonijinpf for u cifrarottc, cio.ar, pipe, m- fnr fi rlif'Ur. tilt:- nl i.,, , l,n ii,,l,.t; Iliaco. Vfi-Tn-1 !ar. fjihlet io iminfh in sti ad, lo belp relievo that awful de- sire. Shortly the habit may bc coni-1 pletely broken, and you are' better od' ' im iiUdly, phy.sically, Jìnancially. It's ,'o easy, so .simplo. Get a box of No-To-l!ac and if it doe.sn't relea.se you t innì ali cravin; for tobacco hi any forni, your druy-pist will refund yotu nioney vrithout queiition. Have you a Farm to scll? Have you a Timber lot to sell? Have you Village property to sell? Have you a Business to sell? You should list them with us at once, that they may appear in our 1921 Cata logne. Catatonia Real Estate Cojnc. 71 Railroad Street, St Johnsbuiy, Vt. Thone 578 Classified Dept. VVANTED r $ 12ìj monument l(K) monument J?oOO monument JjwlOO monument $290 monument $225 monument $1-10 monument $275 $205 fol io r l'or $2.'5 l'or $225 l'or Sl!)() for $115 Headstones $20.00. Kound raised letters which were $1.00 now SO cents. This is the first sale of its kind in the monumentai business. Do not miss it. The Veilleux Granite Co. Opposile 15. iV M. Station piiniic ;i1m.t l li: Open from 7 lo I p. ni. Appointments make by LOOK WHO'S HERE GLOOM CHASERS! REAL JOY MAKERS! Once a game this live young bunch of harmony experiences is coming to town WANTED Live stock, Beef, Lamb, Veal and Poultry at market price. Summitville Slumber House, Omer Duval, manager. Phone 651. 179tf WANTED A housekeeper for family of two. Apply to Mrs. Winfield P. Gaakell, Bailey's Music Rooms, St. Johnsbury, Vt. 181HX; WANTED A journeyman painter. All round man. Steady work. Want sooner as possible. Apply Georgi S. Stevens, Central Street, Woodsville, N. H. 1U! tf WANTED OR TO TAKE CARE OF children and assist with housework. Mrs. H. A. Hafner, 87 3hun Street. Tel. 576-1:. 198-200"' SEVENTI SEASON Glee and Mandolin Chairs. Latest popular and classical music. Reading, Sketches, Solos, Special Acts, Novelties. I;ii(!t'r auspices of Company 1; 1 1 The Artillery, Saturday Eve., Feb. 26 WANTED Second hand Pool Table. Standard size. Must be in good condition. Write J. O. Preston, St. John-burg. 189tf MAID for general housework. Mrs. H. C. Newell, 15 Church Street. 190tf WANTED Girl for general housework. Mr. C. E. Brown, DO Main St. 115 tf WANTED - Girl for general housework. Apply Impey and Cummings. VM tf WANTED - Woman as bookkeeper by experienced young woman. 1200- WANTED - Experienced farm hand. I Apply to T. II. Stiles, Merchant bank ! block. 198-109 WANTED a cnpable woman for onerai bouseAvork in small family in vilbiRe of St. Johnsbury. Apply by lette r, statiiiK waecs and jfivinf; idea of experience. Audress K, C'aledo ìi i a n-1 leeoni, 1W-1 W WANTED A po-tition u,s maid. Uox 44, East Ibirke, Vt. 197-200 WANTED TWO tmat appeiiriiie; ouni? meli to trruel on the road with crew manai.',er. Mir.t be hu.-,tlers and willinjv to work. Strici!;- commi." sion work. .'. J. -h I.aii,ljid, t.'um miiiKS House, lletwei u , and (.o0. 1117- U'I t'LEKK-TV J'IS'I'S, (nii'ii o, vvimn-n, over 17) for -ovei'nniriil depar'. nielil'S I J( p''.' monili. l':e.ou-, ex pericnee iniiicci' ..a ' , . l'or fin: pa'!i ì fiila i-i. of A.-nniiia!ion.-, n :tr John Léonard, (f'Miini Cii Servire Ex- ,-i mini'i", i I 07 1 I'. i m i i ' -.1 1 1 N in-'.! mi, 1 1. '. ;U ... W n h W ANI.' ED .'d I In: vi'ur round i. No. I, St. l.-na lo!i!i. i-rk tu y, mi on. I Vt. L'.r.i l'arni ME LOTTE SEI'AKATOR for side Cali C'uledonian. 18J tf FOU SALE Situare liiunf table, condì, Morris chair, maculine rack ami a few k lichen utensile. C'ali mornintfs and evenine;s, with exeop tion of Fridav cveninij. Mav E. lleath, 27 ClilT Street. 198-199 I ()K SA LK Sale ut Mennt nnd Park.;. 181 tf FOU SALE Baby iJlcigh, Iroii Sink. Tel. j!ll-M. 180 tf l'OÌ: SALI: Sterlinf: ra-nye, roll top dv: k. Cali 56p:W. 1!' l'Oli SALE Drv Tour foot ba'd u ood. Sawe.l 12 or 1G inches if want e,l. l'hone ,vM-i. I!'7-I'"i LOS'J- 1 1 ul ni Seal nei-kpiec:. Le v.ard. Mr.-,. E. N. Kandall, 1'! Uoyn- Tel filili' Imi avellile. Tel i;7-W 197-l'iT.
| 17,183 |
https://github.com/ProjetoALES/ales-website/blob/master/backend/student/migrations/0001_initial.py
|
Github Open Source
|
Open Source
|
MIT
| 2,020 |
ales-website
|
ProjetoALES
|
Python
|
Code
| 159 | 849 |
# Generated by Django 2.2.5 on 2019-10-20 07:35
from django.conf import settings
from django.db import migrations, models
import django.db.models.deletion
class Migration(migrations.Migration):
initial = True
dependencies = [
migrations.swappable_dependency(settings.AUTH_USER_MODEL),
]
operations = [
migrations.CreateModel(
name="Student",
fields=[
(
"id",
models.AutoField(
auto_created=True,
primary_key=True,
serialize=False,
verbose_name="ID",
),
),
("school", models.TextField(max_length=200, verbose_name="Escola")),
(
"year",
models.TextField(
choices=[
("EF7", "7º do Fundamental"),
("EF8", "8º do Fundamental"),
("EF9", "9º do Fundamental"),
("EM1", "1º do Médio"),
("EM2", "2º do Médio"),
("EM3", "3º do Médio"),
],
max_length=3,
verbose_name="Série",
),
),
(
"student_proof_url",
models.URLField(verbose_name="URL do atestado de matrícula"),
),
(
"user",
models.OneToOneField(
on_delete=django.db.models.deletion.CASCADE,
to=settings.AUTH_USER_MODEL,
),
),
],
),
migrations.CreateModel(
name="Guardian",
fields=[
(
"id",
models.AutoField(
auto_created=True,
primary_key=True,
serialize=False,
verbose_name="ID",
),
),
("phone", models.TextField(max_length=20, verbose_name="Telefone")),
("cpf", models.TextField(max_length=14, verbose_name="CPF")),
(
"student",
models.OneToOneField(
on_delete=django.db.models.deletion.CASCADE,
to="student.Student",
),
),
(
"user",
models.OneToOneField(
on_delete=django.db.models.deletion.CASCADE,
to=settings.AUTH_USER_MODEL,
),
),
],
),
migrations.CreateModel(
name="EmergencyContact",
fields=[
(
"id",
models.AutoField(
auto_created=True,
primary_key=True,
serialize=False,
verbose_name="ID",
),
),
("name", models.TextField(max_length=200, verbose_name="Nome")),
("phone", models.TextField(max_length=20, verbose_name="Telefone")),
(
"student",
models.OneToOneField(
on_delete=django.db.models.deletion.CASCADE,
to="student.Student",
),
),
],
),
]
| 35,020 |
https://min.wikipedia.org/wiki/Bathropsis%20peruviana
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Bathropsis peruviana
|
https://min.wikipedia.org/w/index.php?title=Bathropsis peruviana&action=history
|
Minangkabau
|
Spoken
| 38 | 102 |
Bathropsis peruviana adolah saikua langau dari famili Asilidae. Spesies ko juo marupokan bagian dari ordo Diptera, kelas Insecta, filum Arthropoda, dan kingdom Animalia.
Spesies iko mampunyoi insting predator nan agresif dan makanan utamonyo adolah saranggo lain.
Rujuakan
Asilidae
| 27,834 |
https://openalex.org/W2999246371
|
OpenAlex
|
Open Science
|
CC-By
| 2,020 |
Altered Levels and Isoforms of Tau and Nuclear Membrane Invaginations in Huntington’s Disease
|
Marta Fernández‐Nogales
|
English
|
Spoken
| 11,687 | 23,431 |
Edited by:
Xin Qi, Edited by:
Xin Qi,
Case Western Reserve University,
United States Case Western Reserve University,
United States Case Western Reserve University,
United States Reviewed by:
Cristina Di Primio,
Normal School of Pisa, Italy
Alberto Rábano,
Fundacion Centro De Investigacion
De Enfermedades Neurologicas,
Spain *Correspondence:
José J. Lucas
[email protected] Altered Levels and Isoforms of Tau
and Nuclear Membrane Invaginations
in Huntington’s Disease Marta Fernández-Nogales 1 and José J. Lucas 2,3* 1Instituto Neurociencias Alicante (CSIC-UMH), San Juan de Alicante, Spain, 2Centro de Biología Molecular Severo Ochoa
(CBMSO)(CSIC-UAM), Madrid, Spain, 3Networking Research Center on Neurodegenerative Diseases (CIBERNED), Instituto
de Salud Carlos III, Madrid, Spain Since the early reports of neurofibrillary Tau pathology in brains of some Huntington’s
disease (HD) patients, mounting evidence of multiple alterations of Tau in HD brain
tissue has emerged in recent years. Such Tau alterations range from increased total
levels, imbalance of isoforms generated by alternative splicing (increased 4R-/3R-Tau
ratio) or by post-translational modifications such as hyperphosphorylation or truncation. Besides, the detection in HD brains of a new Tau histopathological hallmark known as
Tau nuclear rods (TNRs) or Tau-positive nuclear indentations (TNIs) led to propose HD as
a secondary Tauopathy. After their discovery in HD brains, TNIs have also been reported
in hippocampal neurons of early Braak stage AD cases and in frontal and temporal
cortical neurons of FTD-MAPT cases due to the intronic IVS10+16 mutation in the Tau
gene (MAPT) which results in an increased 4R-/3R-Tau ratio similar to that observed
in HD. TNIs are likely pathogenic for contributing to the disturbed nucleocytoplasmic
transport observed in HD. A key question is whether correction of any of the mentioned
Tau alterations might have positive therapeutic implications for HD. The beneficial
effect of decreasing Tau expression in HD mouse models clearly implicates Tau in HD
pathogenesis. Such beneficial effect might be exerted by diminishing the excess total
levels of Tau or specifically by diminishing the excess 4R-Tau, as well as any of their
downstream effects. In any case, since gene silencing drugs are under development to
attenuate both Huntingtin (HTT) expression for HD and MAPT expression for FTD-MAPT,
it is conceivable that the combined therapy in HD patients might be more effective than
HTT silencing alone. Keywords: huntington’s disease, tau, tauopathy, tau nuclear rod (TNR), tau nuclear indentation (TNI) INTRODUCTION Huntington’s Disease Overview REVIEW REVIEW
published: 17 January 2020
doi: 10.3389/fncel.2019.00574 published: 17 January 2020
doi: 10.3389/fncel.2019.00574 Tau Gene and Isoforms Generated by Alternative
Splicing Tau is a microtubule-associated protein (MAP) that was first
discovered in 1975 by Weingarten when it was co-purified along
with tubulin (Weingarten et al., 1975). In humans, this protein
is encoded by the gene MAPT that is located in the region
q21.31 on chromosome 17 and contains 16 exons (Neve et al.,
1986; Andreadis et al., 1992), while in mouse is located on
chromosome 11. The human MAPT gene has two haplotypes,
the more common H1 and the unusual H2 haplotype. The
latter results from a large—approximately 970 kb—chromosomal
inversion and a 238 bp deletion in intron 9 (Stefansson et al.,
2005; Caillet-Boudin et al., 2015). Regarding neuropathology, HD is characterized by neuronal
death, primarily of medium-sized spiny neurons of the striatum
producing a progressive atrophy of the basal ganglia (Hedreen
and Folstein, 1995; Mitchell et al., 1999) but also in other
structures that are related to cognition such as the cortex and
hippocampus (Zheng and Diamond, 2012), which explains the
different symptoms that patients suffer. Nowadays, there is no
cure for HD and, normally, death takes place between 15 and
20 years after the onset of the symptoms. The MAPT gene is expressed at its highest levels in neurons
in the central nervous system where it contributes to the
maintenance of neuronal polarity by promoting microtubule
assembly and stability. Multiple Tau isoforms are generated by alternative splicing. The exons that are alternatively spliced in adult CNS are exons
2, 3 and 10, and their combinatorial usage generates six Tau
isoforms in the adult human brain (Andreadis, 2005; Liu and
Gong, 2008). On one hand, alternative splicing of exons 2 and
3 generates Tau isoforms that differ by the absence or the
presence of an insert of 29 or 58 amino acids—corresponding to
exons 2 or 2 and 3—in the N-terminal region. Thus, exon 2 can
appear alone but exon 3 never appears independently of exon
2. This way the so-called 0N, 1N or 2N isoforms are generated
(Andreadis et al., 1995). On the other hand, the exclusion or
inclusion of exon 10—encoding a 31 amino acid sequence that
provides one of the four possible tubulin-binding repeats in the
C-terminal region of the protein—results in either 3R or 4R
isoforms (Goedert and Spillantini, 2011). Citation: Huntington s Disease Overview
Huntington’s disease (HD) is an autosomal dominant neurodegenerative disorder caused by a
mutation in the gene that encodes for the protein Huntingtin (Htt). This mutation consists on an
abnormal expansion of a CAG triplet (>35) in exon 1 of the gene that encodes for a stretch of
polyglutamine (polyQ) in the N-terminal region of the protein (Gusella et al., 1993; MacDonald
et al., 1993) and, thus, HD belongs to the group of the polyglutamine diseases (Zoghbi and Orr,
2000). Clinically, HD patients suffer multiple symptoms that include motor (involuntary body Fernández-Nogales M and Lucas JJ
(2020) Altered Levels and Isoforms of
Tau and Nuclear Membrane
Invaginations in
Huntington’s Disease. Front. Cell. Neurosci. 13:574. doi: 10.3389/fncel.2019.00574 January 2020 | Volume 13 | Article 574 Frontiers in Cellular Neuroscience | www.frontiersin.org 1 Fernández-Nogales and Lucas Tau and TNIs in HD movements, chorea, dystonia, and gait abnormalities), cognitive
(decreases in attention and mental flexibility) and psychiatric
and/or behavioral impairment (apathy, irritability, impulsivity,
depression and suicidal wishes) due to the affectation of different
parts of the brain (Vonsattel and DiFiglia, 1998; Sturrock and
Leavitt, 2010; Kim and Fung, 2014). Population without the
disease has between 6 and 35 CAG triplets in the HTT gene, while
individuals with expansions of 40 or more repeats develop HD. Carriers of 36–39 CAG repeats have lower penetrance and later
onset of the disease (Andrew et al., 1993). There is a relationship
between the length of CAG repeat and the onset and severity of
the disease leading to a worse prognosis as the length increases
[Snell et al., 1993; Genetic Modifiers of Huntington’s Disease
(GeM-HD) Consortium, 2019]. oligomers without changes in monomers according to Sarkosyl
based protein fractionation, suggesting that abnormal translation
and/or protein turnover is responsible for Htt misregulation in
HD (St-Amour et al., 2018). The aggregation of mHtt produces an histopathological mark
in form of spherical inclusions that are detected in the nuclei
and cytoplasm of neurons in HD patients (DiFiglia et al., 1997)
but also in different transgenic animal models like mice (Davies
et al., 1997) or Drosophila (Warrick et al., 1998). Inclusions can
be detected using antibodies against Htt but also against other
epitopes like polyQ or ubiquitin (DiFiglia et al., 1997; Sapp et al.,
1997; Vonsattel et al., 2008). Citation: There is growing evidence that HD
inclusions, in addition to mHtt, can nucleate other proteins like
those that are characteristic of other neurodegenerative diseases,
like α-synuclein -found in Parkinson’s disease (Corrochano et al.,
2012; Herrera and Outeiro, 2012; Tomas-Zapico et al., 2012),
TDP-43 -found in amyotrophic lateral sclerosis- (Schwab et al.,
2008; Coudert et al., 2019), or Tau -found in Tauopathies such as
Alzheimer’s disease (Fernández-Nogales et al., 2014; Vuono et al.,
2015; St-Amour et al., 2018). As in other polyglutaminopathies, illness is mainly due to
a toxic gain of function of the expanded polyQ-containing
protein and also of the expanded CAG-containing mRNA
(Shieh and Bonini, 2011; Nalavade et al., 2013; Martí, 2016)
rather than to a loss of function of mutant Htt (mHtt). Although the latter may also contribute to some of the
HD-specific symptoms (Zuccato and Cattaneo, 2014). The Htt
protein is expressed ubiquitously throughout the body with
high levels in the brain and testes (Schulte and Littleton,
2011). It interacts with different partners that are implicated in
cellular dynamics -like cytoskeleton, endocytosis, trafficking, and
adhesion-, metabolism, protein turnover, transcription and RNA
processing (Kaltenbach et al., 2007) and participates in vesicular
transport, synaptic transmission and autophagy, playing a role
in embryogenesis, signal transduction and cell adhesion (Schulte
and Littleton, 2011; Smith-Dijak et al., 2019). The absence of Htt
causes embryonic lethality while mice lacking one Htt allele do
not show phenotypical changes (Nasir et al., 1995). Frontiers in Cellular Neuroscience | www.frontiersin.org Tau Gene and Isoforms Generated by Alternative
Splicing Truncated N-terminal portions of mHtt can be generated
through
proteolytic
cleavage
by
caspases,
calpains
or
other endoproteases and this favors the agglomeration of
mHtt—driven by the self-aggregation of polyQ. This process
eventually leads to the formation of oligomers and globular
intermediates that can interfere with multiple intracellular
functions in the cytoplasm (such as organelle and mRNA
transport, protein turnover, or mitochondrial function among
others) and in the nucleus where gene expression can get altered
(Graham et al., 2006). Besides, N-terminal fragments of mHtt are
not only produced by proteolytic cleavage but also by aberrant
splicing (Bates et al., 2015). Recently, it has been observed in
a cohort of 56 HD patients a decrease in the levels of total Htt
levels (using EM48 and CH00146 antibodies) and an increase
in the levels of the N-terminal fragment without alteration in
Htt mRNA levels. This is accompanied by an increase in Htt The
N-terminal
region
binds
to
plasma
membrane
components to regulate interactions while the C-terminal
part of the protein binds microtubules (Derisbourg et al., 2015). January 2020 | Volume 13 | Article 574 Frontiers in Cellular Neuroscience | www.frontiersin.org Frontiers in Cellular Neuroscience | www.frontiersin.org 2 Fernández-Nogales and Lucas Tau and TNIs in HD If we focus our attention in the C-terminal region, 4R-Tau
isoforms bind microtubules with higher affinity and are
more efficient at promoting microtubule assembly in vitro
compared to 3R-Tau isoforms that have less affinity for
microtubules (Lu and Kosik, 2001). More precisely, both
4R-Tau and 3R-Tau isoforms increase the growth rate of
microtubules, but 3R-Tau shows less efficacy in protecting
microtubules from disassembly than 4R-Tau isoforms (Panda
et al., 2003). During development, 0N3R isoform is the
most abundant making 3R-Tau to predominate over 4R-Tau
(Kosik et al., 1989). However, in healthy human adult brain,
3R-Tau and 4R-Tau are equally represented (Goedert et al.,
1989). In the case of the adult mouse brain, 4R-Tau isoforms
are predominant (Kosik et al., 1989; Takuma et al., 2003). The microtubule-binding repeats also comprise the paired-
helical filament (PHF) core that is the primary structure
of aggregated Tau filaments (Wischik et al., 1988) and
dysregulation of the balance between 3R-Tau and 4R-Tau
isoforms has been shown to contribute to neurodegeneration
(Liu and Gong, 2008), as we are going to comment in
more detail. Functions of Tau In healthy neurons, Tau is almost exclusively located in the
axon (Wang and Mandelkow, 2016) where, as mentioned,
it is implicated in microtubule assembly and stabilization. Microtubules are polar structures with a plus and a minus-end
and they are formed from α and β-tubulin heterodimers. Tau binds both α and β-tubulin subunits and can promote
microtubule growth (Witman et al., 1976; Kadavath et al., 2015). The assembly of microtubules consists of a phase of rapid
polymerization and a steady-state, where no assembly occurs. Assembly occurs at the plus end while disassembly occurs at
the minus end, keeping the overall length of the microtubule
equal. Tau reduces the frequency of depolymerization by binding
along the outer surface. Microtubule dynamics in the nervous
system requires a high degree of stability. While the N-terminal
region of Tau could contribute to the formation of microtubule
bundles as it functions as a spacer in between them (Chen
et al., 1992), the C-terminal region binds to microtubules to
regulate their polymerization (Cleveland et al., 1977). In healthy
conditions, due to its ability to modify microtubule dynamics
(Trinczek et al., 1999; Dixit et al., 2008), Tau contributes to
regulate different cellular functions such as transport of mRNA
and proteins along the axons, as well as neurite extension. Accordingly, when Tau is knocked down, neurite formation is
inhibited altering processes such as neuronal differentiation or
synaptic plasticity (Caceres and Kosik, 1990; Kempf et al., 1996;
Stamer et al., 2002; Spillantini and Goedert, 2013). Moreover,
Tau is present in small amounts in dendrites and even in the
nucleus where it can bind to DNA protecting it from damage
(Wei et al., 2008; Violet et al., 2014). DNA binding of Tau takes
place at both genic and intergenic regions (Benhelli-Mokrani
et al., 2018) and results in modulation of gene expression (Siano
et al., 2019). Interestingly, nuclear Tau has also been involved in
nucleolar transcription (Maina et al., 2018) and the decrease in
nuclear Tau (detected with Tau-100 antibody) that takes place y
g
g
Phosphorylation of Tau reduces its affinity for microtubule
and different plasma membrane components, thus reducing
microtubule stability. For example, phosphorylation on Ser-214
and Thr-231 promotes detaching of Tau from microtubules. Post-translational Modifications of Tau Post-translational Modifications of Tau
Tau
protein
can
be
modified
after
translation
by
phosphorylation,
glycosylation,
ubiquitination,
acetylation
or truncation, among others (Martin et al., 2011). Regarding
phosphorylation of Tau, it can be phosphorylated in serine,
threonine and tyrosine residues with 85 potential sites of
phosphorylation, of which 45 have been validated (Wang
and Mandelkow, 2016). The sites of phosphorylation can be
divided depending on the kinases that can phosphorylate
them: proline-directed kinases -like glycogen synthase kinase 3
(GSK-3), cyclin-dependent kinase 5 (CDK-5), cyclin-dependent
kinase 1 (CDK-1), mitogen-activated protein kinase (p38), c-Jun
N-terminal kinases (JNK), and other stress kinases—and non-
proline-directed kinases—like protein kinase A (PKA), protein
kinase C (PKC), calmodulin kinase II (CaMK-II), microtubule
affinity regulating kinase (MARK) or casein kinase 2 (CK2). Frontiers in Cellular Neuroscience | www.frontiersin.org Tau Gene and Isoforms Generated by Alternative
Splicing in AD CA1 and dentate gyrus neurons along disease progression
might be pathogenic by leading to decreased protein synthesis
(Hernández-Ortega et al., 2016). Finally, different mutations that
alter the proportion of Tau isoforms as well as post-translational
modifications can modify the affinity of Tau for microtubules. The differential interaction of 4R-Tau and 3R-Tau with the
microtubules may have important implications for neuronal
diseases as the regulated expression of both isoforms is required
for the correct function of the neurons. Therefore, in summary,
both a loss of function of Tau and a toxic gain of function due to
aggregate formation can contribute to neurodegeneration. Functions of Tau Deregulation of Tau phosphorylation is deleterious for neurons
and has been implicated in many diseases such as AD,
where Tau hyperphosphorylation favors its detachment from
the microtubules thus increasing the levels of soluble Tau
available for self-aggregation leading to the formation of
neurofibrillary tangles (NFT) and/or neuropil threads (NT;
Wang and Mandelkow, 2016). GSK-3 is believed to play an
important role in Tau hyperphosphorylation as it is able
to phosphorylate the majority of the residues which are
hyperphosphorylated in AD (Lovestone et al., 1994) and its levels
are increased in AD brains (Pei et al., 1997). Apart from kinase
hyperactivity, dysregulation of phosphatases can also lead to
pathogenic hyperphosphorylation. Different phosphatases such
as PP1, PP2A, PP2B (calcineurin) and PP2C can eliminate
phosphates from Tau but only PP1, PP2A, and PP2B (Gong
et al., 2004) have been shown to dephosphorylate abnormally
hyperphosphorylated Tau. Not only phosphorylation modulates Tau activity. Acetylation
can also regulate its function as it has been observed that, in vitro,
it can preclude microtubule assembly (Min et al., 2010; Cohen
et al., 2011). Important sites of acetylation are K163, K274, K280,
K281, and K369, with K281 and K274 being acetylated in AD
patients (Tracy et al., 2016). Interestingly, when the levels of
acetylated Tau are increased, its levels of phosphorylation are
reduced (Min et al., 2010). January 2020 | Volume 13 | Article 574 Frontiers in Cellular Neuroscience | www.frontiersin.org Frontiers in Cellular Neuroscience | www.frontiersin.org 3 Fernández-Nogales and Lucas Tau and TNIs in HD Other
post-translational
modifications
that
include
N-glycosylation,
truncation
and
isomerization
stabilize
PHFs. It has been described that N-glycosylation is related
to Tau hyperphosphorylation and Tau aggregation (Ledesma
et
al.,
1995). N-glycosylation
stabilizes
aggregated
PHFs
leading to tangle formation in AD. Phosphorylation on
Ser-717 completely abolishes the O-GlcNAcylation on this
site, while phosphorylation on Ser-713 and Ser-721 reduces
O-GlcNAcylation. O-GlcNAcylation on Ser-717 decreases the
phosphorylation on Ser-721 by about 41.5%. Truncation of Tau
can also promote aggregation as Tau fragments have been found
in the PHFs of AD patients (Wischik et al., 1988). reduce microtubule assembly contributing to PHFs stabilization
and its aggregation forming NFTs (Barghorn et al., 2000). Regarding intronic mutations, they are located around exon
10 affecting its rate of inclusion and they lead to an imbalance
of the ratio of 4R- and 3R-Tau isoforms (Liu and Gong, 2008). TAU PATHOLOGY IN HUNTINGTON’S
DISEASE Along the last decades, many studies have demonstrated Tau
alterations and Tau-positive histopathological hallmarks in HD
patients as well as in animal models that could be contributing
to the progression of the disease. Here, we aim to review these
pieces of evidence to elucidate the role of Tau in the disease and
to elaborate on whether this offers opportunities for therapeutic
interventions to ameliorate HD prognosis. Finally, Tau can be ubiquitinated and this modification
has mainly been found in aberrant aggregates such as the
inclusion bodies found in Pick’s or Parkinson’s diseases or
in PHFs in AD (Mayer et al., 1989; Morishima-Kawashima
et al., 1993). PHF-Tau can be modified by three different forms
of
poly-ubiquitination,
‘‘Lys-48’’-linked
poly-ubiquitination
is the major form but ‘‘Lys-6’’-linked and ‘‘Lys-11’’-linked
poly-ubiquitination could also occur. Tau Mutations and Tauopathies The alteration of the amount and the structure of the Tau
protein can disturb its localization and, as a consequence, its
function producing different pathological effects. Tauopathies
are a class of neurodegenerative disorders that are characterized
by the aggregation and intracellular deposition of Tau in neurons
and/or glial cells as a consequence of abnormal increase in the
levels of phosphorylation, abnormal splicing of the mRNA or
mutations in MAPT gene. Tauopathies can be divided into: (a) primary Tauopathies
that are a major class of Frontotemporal Lobar Degeneration
(FTLD)
neuropathology
and
can
present
clinically
with
several
forms
of
Frontotemporal
Dementia
(FTD)—like
Frontotemporal
Dementia
with
parkinsonism
linked
to
chromosome 17—(FTDP-17), progressive supranuclear palsy
syndrome (PSP) or corticobasal degeneration (CBD); and
(b) secondary or non-primary Tauopathies like Alzheimer’s
disease (AD) in which neurofibrillary Tau neuropathology
occurs in addition to the amyloid-β (Aβ) plaques. The various
Tauopathies affect different brain regions and cell types and they
also show differences in the ratio of Tau isoforms present in the
Tau filaments (Sergeant et al., 2005). In AD, there are similar
levels of 3R-Tau and 4R-Tau in the PHFs (Goedert et al., 1995)
while other Tauopathies like PSP or CBC show an increase in
4R-Tau isoforms and others like PiD show an increase in 3R-Tau
isoforms (Arendt et al., 2016). Polymorphisms It has been described that the MAPT H1 haplotype—that is
the most abundant—could be a genetic risk factor for some
Tauopathies like PSP or CBD (Houlden et al., 2001; Pittman
et al., 2004). Also, H1 haplotype increases the expression of total
MAPT transcript as well as specifically increases the inclusion
of exon 10 and therefore the proportion of 4R-Tau isoforms
(Myers et al., 2007). In HD, Tau polymorphisms have been linked
to the progression of cognitive deficits. In a group of 960 HD
patients that were genotyped for the H1 and H2 haplotypes-
using the SNP rs9468, Vuono et al. (2015) reported that there
is a correlation between increased number of CAG repeats and
increased rate of cognitive decline in H2 carriers and that Tau
H2 haplotype carriers show accelerated cognitive deterioration
compared to H1/H1 homozygous carriers. Frontiers in Cellular Neuroscience | www.frontiersin.org Tau Levels Regarding Tau protein levels, a high increase in the levels of total
Tau (Tau-5 antibody) was found in the cortex of HD patients
and this is accompanied with the appearance of lower molecular
weight (35 and 39 KD) bands (Fernández-Nogales et al., 2014),
while no changes were found in the striatum (Fernández-Nogales
et al., 2014). However, a more recent report has shown elevated
Tau total mRNA levels in the putamen of HD patients (St-Amour
et al., 2018). Importantly, the presence of an excess of Tau in HD
brains most likely contributes to disease as Tau knock-down has
been demonstrated to attenuate motor abnormalities in an HD
mouse model (Fernández-Nogales et al., 2014). Tau Phosphorylation in HD p
y
As previously described, Tau functions are modulated by
site-specific phosphorylation and its alteration produce a toxic
loss of function as the microtubule-binding ability is decreased,
but also a toxic gain of function as it generates deposits as a
result of its aggregation. There are multiple studies showing
Tau hyperphosphorylation in HD that could contribute to
the disease. The first evidence of Tau hyperphosphorylation
in HD patients was obtained by immunohistochemistry with
the AT8 antibody which revealed positive staining -with or
without NTs in 13 of 27 analyzed patients (Jellinger, 1998). In good agreement, a recent study on 16 cases including
young HD cases (26 and 40 years) has shown AT-8 positive
neuronal inclusions with different shapes and conformations like
ring-like perinuclear, flame-shaped and globular inclusions in
the cortex and striatum as well as astrocytic plaques, NT, dots
and nuclear rods (Gratuze et al., 2015; Vuono et al., 2015). Using
antibodies other than AT-8, an increase in Tau phosphorylation
at Ser396/Ser404/Ser199 and Thr205 epitopes, while no changes
in epitopes Ser235/Ser262/Ser356, has been observed in the
putamen of a cohort of 56 patients (St-Amour et al., 2018). Recently, hyperphosphorylated Tau (detected with antibodies
AT8, CP13, AT180b and PHF-1) has been detected in fetal tissue
transplanted into cortex and striatum of two HD cases (Cisbani
et al., 2017). Alternative splicing of exon 10 is regulated by a system
of factors that bind to the RNA regulating the splicing of
the pre-mRNA itself. Among these factors, the family of
the serine- and arginine-rich (SR) proteins participate on
constitutive splicing while also regulating alternative splicing. Some members of this family promote the inclusion of exon 10,
while others suppress it. Several studies have shown that SRSF1
(ASF/SF2), SRSF2 (SC35), SRSR6 (SRp55), and SRSF9 (SRp30c)
promote exon 10 inclusion, while SRSF3, SRSF4, SRSF7, and
SRSF11 suppress its inclusion (Qian and Liu, 2014). It was bioinformatically predicted (Sathasivam et al., 2013)
and biochemically confirmed (Schilling et al., 2019) that the
splicing factor SRSF6 can bind CAG RNA repeats and this
leads to incomplete splicing of Htt RNA and to production
of a small form of Htt known as exon 1-Htt (Sathasivam
et al., 2013). Besides, SRSF6 was indeed found altered in the
striatum of HD patients and in the R6/1 mouse model of the
disease, as it gets sequestered into mHtt inclusions (Fernández-
Nogales et al., 2014). Aberrant Splicing of Tau in HD p
g
As previously commented, in some Tauopathies including PSP,
CB, Pick’s disease (PiD) and FTLD with Tau+ inclusions (FTLD-
Tau), alteration of alternative splicing of exon 10 produces
an imbalance in 4R-Tau and 3R-Tau isoforms (Park et al.,
2016). Regarding HD, we demonstrated that patients (and mouse
models of the disease, like the R6/1 and HD94 mice) show an
increase in the ratio 4R-Tau/3R-Tau mRNA isoforms in cortex
and striatum, accompanied by an increase of the levels of 4R-Tau
protein. In the striatum, there also was a decrease in 3R-Tau
protein (Fernández-Nogales et al., 2014). The imbalance of 4R-
Tau/3R-Tau mRNA isoforms was corroborated by Vuono et al. Missense, silent and intronic mutations in the MAPT gene
have been directly related to different Tauopathies or constitute
a risk factor for them (Goedert and Jakes, 2005). In 1998,
it was discovered that mutations on the MAPT gene cause
FTDP-17, confirming that Tau dysfunction is sufficient to
cause neurodegeneration. These patients showed filamentous
Tau inclusions in neurons and glia and atrophy of the frontal
and temporal lobes (Hutton et al., 1998; Poorkaj et al., 1998;
Spillantini et al., 1998). There are different missense mutations
like ∆K280, P301L, G272V, V337M, R406W and N279K that January 2020 | Volume 13 | Article 574 Frontiers in Cellular Neuroscience | www.frontiersin.org 4 Fernández-Nogales and Lucas Tau and TNIs in HD (2015) in the cortex and striatum of a cohort of 16 patients. More precisely, they detect 1N3R and 2N4R mRNA and protein
isoforms and found an increase in 4R-Tau isoforms that leads
to an altered ratio of isoforms. Recently, using putamen samples
from a higher number of patients (St-Amour et al., 2018), it
was shown a 2.5-fold increase in 4R-Tau/3R-Tau ratio at the
protein level and a 1.8-fold increase at the mRNA level, due
to an upregulation of 4R-Tau isoforms. The high number of
samples analyzed in that study allowed them to conclude that
the top increment takes place in grade 2 cases regarding the
mRNA and in grade 3 cases regarding the protein, resulting in
higher 0N4R and lower 1N3R isoforms (St-Amour et al., 2018). Aberrant Splicing of Tau in HD All these findings regarding altered isoform ratio in HD are very
relevant in view of the fact that alteration in the ratio of 4R-Tau
and 3R-Tau isoforms is sufficient to cause neurodegeneration
(Hutton et al., 1998; Qian and Liu, 2014), as this might
contribute per se to HD neurodegeneration independently of
other deleterious effects of mHtt, thus becoming a therapeutic
target for HD. of mHtt inclusions (Fujioka et al., 2013; Ishigaki et al., 2017). Although no association was apparent between SFPQ nuclear
signal intensity and presence or absence of HD-associated
intranuclear inclusions in striatal and cortical neurons of seven
HD cases (Baskota et al., 2019), the reduced nuclear availability
of free FUS in HD and, as a consequence, a decreased interaction
with SFPQ, might affect 4R-Tau/3R-Tau ratio. More recently, St-Amour et al. (2018) have explored the
alternative splicing that affects exon 2 and 3 on the MAPT
gene. It has been observed an increase of 1.7 fold-change in
the isoforms that do not contain exons 2 and 3 (0N-Tau) at
mRNA level and a 0.5 fold-change in the isoforms that only
contain exon 2 (St-Amour et al., 2018). Further investigation
is required to know the effect of the alteration in the ratio of
these isoforms in the progression of the disease as the N-terminal
region of Tau participates in the interaction with different
membrane components. Frontiers in Cellular Neuroscience | www.frontiersin.org TAU-POSITIVE NUCLEAR MEMBRANE
INVAGINATIONS AND OTHER
HISTOPATHOLOGICAL MARKS IN HD In animal models of HD, there are plenty of demonstrations
of Tau hyperphosphorylation. Thus, Gratuze et al. (2015)
showed increased Tau hyperphosphorylation at PHF-1 epitope in
presymptomatic R6/2 whereas symptomatic R6/2 mice displayed
Tau hyperphosphorylation at multiple Tau phospho-epitopes
like AT-8, CP13, PT205 and PHF1 in the hippocampus. Besides,
the zQ175 knock-in mice show increased phosphorylation with
PS199. Similarly, Blum et al. (2015) showed that R6/2 and
KI140 mice display increased phosphorylation in Ser404 and
Ser396 by western blot and also by immunofluorescence with
the pSer396 antibody in KI140 mice. Besides, they also detected
a decrease in Tau1 (unphosphorylated Tau) in R6/2 and
KI140 mice. For decades, there have been numerous histopathological
reports of HD patients in whom the presence of NFT—the
histopathological
hallmark
characteristic
of
different
Tauopathies such as Alzheimer’s disease—has been detected
(McIntosh et al., 1978; Myers et al., 1985; Reyes and Gibbons,
1985; Moss et al., 1988; Caparros-Lefebvre et al., 2009). More
systematic studies using larger patient cohorts have detected
Tau pathology in 60% (16/27; Jellinger, 1998) or 80% (9/11;
Davis et al., 2014) of HD cases. Due to the growing evidence
of the presence of Tau pathology in HD patients and in an
attempt to understand how it may or may not contribute to
the pathology of the disease, different studies in which animal
models and patients are used have tried to systematically analyze
this question. The phosphorylation of Tau is a balance between the activity
of its kinases and phosphatases (Sergeant et al., 2008). One of
the main kinases that phosphorylates Tau is GSK-3 which has
been shown to mediate Tau phosphorylation in Alzheimer’s
disease (Hernandez et al., 2013) and bipolar disorder (Beaulieu
et al., 2004; Li et al., 2010). However, there is a dramatic
decrease in GSK-3 levels and activity in the striatum and
cortex from HD patients (Lim et al., 2014; Fernández-Nogales
et al., 2015) as well as in R6/1 mouse model (Saavedra et al.,
2010; Fernández-Nogales et al., 2015), while an increase in
active pGSK-3β-Tyr216 does take place in hippocampus of HD
patients and R6/2 mice (L’Episcopo et al., 2016). Tau Phosphorylation in HD The Q111 striatal knock-in
cellular model that mimics the polyglutamine expansion shows
Tau hyperphosphorylation when there is pharmacological
inhibition of PP2B/calcineurin in comparison with Q7 cells
(Gratuze et al., 2015). mHtt and Tau Co-localization Different approaches have been attempted to study if mHtt
and Tau are directly or indirectly related to understand
the mechanism of the confluence of both proteinopathies in
HD patients. Some co-localization between mHtt aggregates
(evidenced with EM48 antibody) and Tau deposits stained with
antibodies that recognize 3R-Tau, 4R-Tau or pathologically
phosphorylated Tau (AT-8 and pS199) has been detected in
cortical and striatal sections of HD patients (Vuono et al.,
2015). In contrast, other studies have failed to detect Tau
within HD inclusions. For instance, Tau (Ht-7 antibody) could
not be found in mHtt inclusions (evidenced with ubiquitin
antibody) by immunofluorescence in cortical tissue of HD
patients (Fernández-Nogales et al., 2014). Similarly, in animal
models, no co-localization of both proteins could be found
by confocal immunofluorescence using Tau pSer396 and mHtt
(2B4 or EM48) antibodies in KI140 mice (Blum et al., 2015). To clarify if there is or not an authentic co-localization
between
both
proteins,
different
co-immunoprecipitation
studies
have
been
performed. In
human
tissue,
no
co-immunoprecipitation between both proteins was observed
using the Tau 5 antibody that detects total Tau and the EM-48 in
striatal homogenates of HD patients (Fernández-Nogales et al.,
2014). No co-immunoprecipitation between both proteins was
achieved either with cortical samples of KI140 mice nor was Tau
detected in cortical Sarkosyl-insoluble protein fractions from
R6/2 mice (Blum et al., 2015). Interestingly, in BIFC experiments
in vitro with constructs with 25Q (wt) or 103Q mHtt and Tau
fused with non-fluorescence halves of a fluorescence reporter
protein, Blum et al. (2015) observed that when they put together
103Q and Tau, 103QHtt is recruited in the microtubular
cytoskeleton network. Besides, Tau is hyperphosphorylated and,
although its subcellular distribution is altered and its aggregation Tau Phosphorylation in HD The activity and localization of SR
proteins could be modulated by post-translational modifications
such as phosphorylation of their multiple serine and threonine
residues, and such phosphorylation is required, in general, for the
translocation of SR proteins from the cytoplasm to the nucleus. In this regard, it has been shown an increase in the levels of
phosphorylation of SRSF6 in the striatum and cortex of HD
patients and R6/1 mice (Fernández-Nogales et al., 2014) which
may favor dissociation from nuclear speckles (Yin et al., 2012;
Naro and Sette, 2013). This, together with the sequestration of
SRSF6 into mHtt inclusions, suggests a decrease in SRSF6 activity
that could explain the modulation observed of exon 10 splicing in
HD. Moreover, SRSF6 not only modulates alternative splicing of
MAPT, as it also modulates alternative splicing of MAP2, another
MAP whose alternative splicing is altered in HD (Cabrera and
Lucas, 2017). There is some controversy regarding the presence of
hyperphosphorylated Tau in the Sarkosyl-insoluble fraction
obtained from HD brains. While Vuono et al. (2015) found
elevated AT-8 Tau in this fraction, two different studies
failed to replicate this. More precisely, we did not detect
hyperphosphorylated Tau (with AT-8 or with PHF-1) in this
insoluble fraction of HD brains (Fernández-Nogales et al., 2014)
and neither did the more recent study by St-Amour et al. (2018) which analyzed a much higher number of HD cases. Interestingly, in the latter, they report that multiple antibodies
against Tau phospho-epitopes were below detection levels in the
Sarkosyl-insoluble fraction. Recently, it has been proposed the splicing factor proline- and
glutamine-rich (SFPQ) could also be responsible for the
4R-Tau/3R-Tau imbalance as it has been shown to modulate
exon 10 splicing and to interact with FUS, one major component Regarding
cellular
and
animal
models
of
HD,
mHtt
expression promotes Tau hyperphosphorylation at Ser396 as Frontiers in Cellular Neuroscience | www.frontiersin.org January 2020 | Volume 13 | Article 574 5 Fernández-Nogales and Lucas Tau and TNIs in HD that both Casp2 and ∆Tau314 proteins are higher in the
striatum (caudate nucleus) and prefrontal cortex (Brodmann’s
area 8/9) of HD patients as compared non-HD individuals
(Liu et al., 2019). evidenced in cells in which Tau was co-transfected with mHtt,
in contrast to what happens when Tau is co-transfected with
wild type Htt in which the levels of phosphorylation are
maintained stable (Blum et al., 2015). TAU-POSITIVE NUCLEAR MEMBRANE
INVAGINATIONS AND OTHER
HISTOPATHOLOGICAL MARKS IN HD It has been
reported that GSK-3β, CamKII, AKT, JNK, p38, ERk or CDK-5
are not activated in R6/2 and Q175 mice and there is even
increased Ser9 phosphorylation of GSK-3β (resulting in the
inactive form of the kinase) and reduced phosphorylation and
levels of CamKII, as well as reduced cdk5 and ERK expression
in the cortex of R6/2 and KI140 mice (Deckel et al., 2002;
Blum et al., 2015; Gratuze et al., 2015). Together, all these
results do not fit with the Tau hyperphosphorylation observed
in HD. In contrast, and regarding the phosphatases implicated
in Tau dephosphorylation, it has been shown a decrease in
PP1, PP2A and PP2B expression in R6/2 mouse model and a
significant reduction in Calcineurin/PP2B expression in KI140
(Blum et al., 2015; Gratuze et al., 2015) which may explain the
hyperphosphorylation phenotype. Frontiers in Cellular Neuroscience | www.frontiersin.org Tau Truncation in HD As
mentioned,
Tau
truncation
may
be
relevant
to
neurodegeneration as it may alter the Tau function and
favor the formation of Tau aggregates. There are different
truncated forms of Tau depending on the protease responsible
for the cleavage. The ∆Tau314 has been demonstrated to be
generated by Casp2 and to cause synaptic dysfunction and
cognitive deficits in cellular and transgenic mouse models of
FTDP-17 (Zhang et al., 2014). Recently, it has been reported January 2020 | Volume 13 | Article 574 Frontiers in Cellular Neuroscience | www.frontiersin.org 6 Tau and TNIs in HD Fernández-Nogales and Lucas FIGURE 1 | Presence of Tau nuclear indentations (TNIs) in Huntington’s disease (HD) brains. (A) Immunoelectron microscopy analysis of HD neurons with HT-7
positive nuclear indentations. Red arrows indicate the diaminobenzidine precipitate. (B) Immunohistochemistry with RD4 and Ht-7 antibodies in neurons of HD brain. (C) HT-7 immunofluorescence (green) with DAPI (blue) counterstaining in HD striatal neurons. FIGURE 1 | Presence of Tau nuclear indentations (TNIs) in Huntington’s disease (HD) brains. (A) Immunoelectron microscopy analysis of HD neurons with HT-7
positive nuclear indentations. Red arrows indicate the diaminobenzidine precipitate. (B) Immunohistochemistry with RD4 and Ht-7 antibodies in neurons of HD brain. (C) HT-7 immunofluorescence (green) with DAPI (blue) counterstaining in HD striatal neurons. favored, it is not obvious the existence of a toxic interaction of
both proteins and further studies are needed to clarify that. that this structure has an ordered filamentous ultrastructure
immunopositive for Tau that fills neuronal invaginations of
the nuclear envelope that partially or totally span the neuronal
nuclear space (Fernández-Nogales et al., 2014). This new Tau
histopathological hallmark thus seems to fill the previously
reported neuronal nuclear membrane invaginations detected in
ultrastructural analyses and whose incidence is higher in striatum
of HD patients than in control subjects (Bots and Bruyn, 1981;
Roos and Bots, 1983). Examples of TNIs evidenced by IHC, IF
and immuno-EM are shown in Figure 1. The presence of TNIs in
HD brains was confirmed in an independent study with a higher
number of HD patient samples (Vuono et al., 2015) although,
in this case, using the AT-8 antibody against phosphorylated
Tau. Tau-Positive Cytoplasmic Aggregates Tau-Positive Cytoplasmic Aggregates
In view of the abnormal Tau ‘‘processing’’ that we initially
detected in HD brains (Fernández-Nogales et al., 2014) that
leads to an alteration of 4R-Tau/3R-Tau ratio in favor
of 4R-Tau isoforms (similar to that seen in some FTD
forms caused by intronic Tau mutations), we explored the
possibility of Tau deposits in HD brains. We detected granular
cytoplasmic Tau deposits which often form perinuclear rings
in cortical and striatal neurons (Fernández-Nogales et al.,
2014) by immunohistochemistry with antibodies that recognize
4R-Tau isoforms (RD4), 3R-Tau isoforms (RD-3) or Total Tau
(Tau-5 and HT-7), but not with anti-phospho-Tau antibodies. Vuono et al. (2015) detected similar Tau deposits like perinuclear
rings, flame-shaped and globular inclusions as well as astrocytic
plaques in striatum and cortex of HD subjects but, in this case,
with an antibody against phosphorylated Tau (AT-8). Similarly,
in a more recent study, Cisbani et al. (2017) also detected AT-8
positive neuronal inclusions—apart from NFTs and NTs—in
striatum and cortex of HD patients. Tau Truncation in HD In contrast, a recent study on samples from seven HD cases
(Vonsattel grades 3 and 4), failed to detect TNIs (Baskota et al.,
2019) and they reasoned that this may be due to technical features
because the variety of antibodies they used did not detect neurons
with cytoplasmic Tau staining, which are the ones displaying
TNIs in the above-mentioned studies which do detect them. In
HD mouse models, TNIs have also has been detected with Tau-5
and RD4 antibodies in the R6/1 and HD94 mice although with
much lower abundance than in human HD tissue (Fernández-
Nogales et al., 2014). Tau-Positive Nuclear Membrane
Invaginations Interestingly, TNIs can be found in brain tissue of other
neurodegenerative diseases. More precisely, in two Tauopathies:
AD and FTD. Thus, we detected TNIs in the hippocampus
of different Braak stage AD patients using the RD4 antibody
(Fernández-Nogales et al., 2014). More recently, TNIs have also
been detected in frontal and temporal cortex samples from two
independent cohorts of patients with FTD-MAPT due to the
MAPT intronic IVS10+16 mutation (Paonessa et al., 2019). Such
mutation increases exon 10 inclusion and, therefore, increases
the 4R-Tau/3R-Tau ratio in favor of 4R-Tau isoforms (similar to
what we have described in HD brains). g
Interestingly, we also described for the first time the presence
of Tau nuclear indentations (TNIs) also known as Tau Nuclear
Rods (TNRs) in the striatum and cortex of HD patients
(Fernández-Nogales et al., 2014). We detected TNIs using
antibodies that recognize 4R-Tau isoforms (RD4), 3R-Tau
isoforms (RD-3), Total Tau (Tau-5 and HT-7) or Tau oligomers
(T22), but not with antibodies against phosphorylated Tau
(such as AT-8 or PHF-1; Fernández-Nogales et al., 2014). Immuno-electron microscopy with HT-7 antibody revealed January 2020 | Volume 13 | Article 574 Frontiers in Cellular Neuroscience | www.frontiersin.org 7 Fernández-Nogales and Lucas Tau and TNIs in HD Paonessa et al. (2019) also detected increased incidence of
TNIs in IPSC-neurons derived from FTD-MAPT cases due to the
MAPT IVS10+16 mutation and also, but to a lower extent, from
FTD-MAPT cases due to missense P301L mutation that produces
an aggregation-prone form of Tau. correction of any of these tau alterations and of this Tau
histopathological hallmark might have positive therapeutic
implications for the disease. Regarding the therapeutic implications of the current
knowledge of the involvement of Tau in HD pathogenesis, a
convincing evidence supporting that Tau contributes to HD
pathogenesis originates from the beneficial effect of decreasing
Tau expression in HD mouse models by combining with
Tau knock-out mice—even partial reduction in heterozygous
knock-out background (Fernández-Nogales et al., 2014). This
beneficial effect might be due to the attenuation of the excess
total levels of Tau in the cortex of HD mice or by attenuation
specifically of the excess 4R-Tau observed both in striatum and
cortex. FUNDING Research in the laboratory of JL is supported by CiberNed-ISCIII
collaborative grants 2013/09-2, 2015-2/06 and 2018/06-5 to JL
and by grants from Spanish Ministry of Science, Innovation,
and Universities (MICINN): SAF2015-65371-R and RTI2018-
096322-B-I00 to JL, by the European Union FEDER funds,
the Fundación Botín by the Banco Santander through its
Santander Universities Global Division and by Fundación
Ramón Areces and Fundación Alicia Koplowitz. MF-N was
the recipient of an FPI fellowship from MICINN/MINECO. MF-N holds a postdoctoral contract from Generalitat Valenciana
(APOSTD/2018/087). ETHICS STATEMENT Brain specimens reviewed in this study from frontal cortex
and striatum of HD subjects and controls were provided by
Institute of Neuropathology (HUB-ICO-IDIBELL) Brain Bank
(Hospitalet de Llobregat, Spain), the Neurological Tissue Bank of
the IDIBAPS Biobank (Barcelona, Spain), the Banco de Tejidos
Fundación Cien (BT-CIEN, Madrid, Spain) and the Netherlands
Brain Bank (Amsterdam, The Netherlands). Written informed
consent for brain removal after death for diagnostic and research
purposes was obtained from brain donors and/or next of
kin. Procedures, information and consent forms have been
approved by the Bioethics Subcommittee of Centro Superior de
Investigaciones Científicas (Madrid, Spain). Tau-Positive Nuclear Membrane
Invaginations But in any case, since gene silencing drugs are under
development to attenuate both HTT expression for HD and to
attenuate MAPT expression for FTD-MAPT (Mullard, 2019), it
is conceivable that the combined therapy in HD patients might
be more effective than HTT silencing alone. Regarding the possible pathogenic relevance of TNIs, lamin
dysfunction and neuronal nuclear indentations in AD have
been linked to the improper cytoskeletal/nucleoskeletal coupling
that was suggested as a novel mediator of neurotoxicity in
Tauopathies (Frost et al., 2016) and more recently, pathological
Tau has been shown to impair nucleocytoplasmic transport in
Tau-overexpressing mice and AD brain tissue (Eftekharzadeh
et al., 2018) which has been further confirmed recently
(Paonessa et al., 2019). In this regard, nuclear integrity
and nucleocytoplasmic transport have also been reported
altered in Huntington‘s disease (Gasset-Rosa et al., 2017;
Grima et al., 2017). Regarding the mechanism by which TNIs get formed, analysis
of a transgenic mouse model that overexpresses human 4R-Tau
with a FTLD with the P301S Tau point mutation revealed
that Tau alteration is sufficient for TNI formation/detection
(Fernández-Nogales et al., 2017). Similarly, a Drosophila model
with pan-neuronal expression of a disease-causing mutant form
of human Tau, TauR406W, produces nuclear invagination that
co-localizes with phosphorylated Tau (Cornelison et al., 2019). These observations raised the question of whether increased Tau
(either total Tau or 4R-Tau regardless of point mutations) fills
nuclear invaginations formed by Tau-independent mechanisms
or whether the incidence of nuclear envelope invaginations
increases upon Tau alteration, for instance, because it stabilizes
microtubule bundles that deform the nucleus. The latter is
precisely what Paonessa et al. (2019) demonstrate in human
iPSC-derived neurons with MAPT P301L and MAPT IVS16+
10 mutations as treatment with nocodazole significantly reduced
the proportion of neurons with nuclear invaginations and
restored round nuclear morphology. This is in contrast with the
fact that the number of nuclear indentations in hippocampal
neurons of P301S mice is not higher than in wild type mice
(Fernández-Nogales et al., 2017). In case the induction of nuclear
envelope invagination upon Tau alteration occurred only in
culture, TNI detection in histopathological analysis still emerges
as an efficient way to screen for brains with altered Tau (levels,
isoform ratio, or simply function). Additional work will be
needed to clarify this. PATHOGENIC AND THERAPEUTIC
IMPLICATIONS: FUTURE DIRECTIONS Here we have shown multiple alterations of Tau in HD brain
tissue which range from increased total levels, imbalance of
alternative splicing-generated isoforms, hyperphosphorylation
and truncation, to the formation of Tau-positive cytoplasmic
aggregates and nuclear envelope invaginations. The likely
pathogenic role of the latter—through interference of nuclear
envelope function—and the possible mechanisms by which
TNIs are formed are also discussed. A key question is whether AUTHOR CONTRIBUTIONS Both authors (MF-N and JL) revised the literature and wrote the
manuscript. REFERENCES Corrochano, S., Renna, M., Carter, S., Chrobot, N., Kent, R., Stewart, M., et al. (2012). α-Synuclein levels modulate Huntington’s disease in mice. Hum. Mol. Genet. 21, 485–494. doi: 10.1093/hmg/ddr477 Andreadis, A. (2005). Tau gene alternative splicing: expression patterns, regulation
and modulation of function in normal brain and neurodegenerative diseases. Biochim. Biophys. Acta 1739, 91–103. doi: 10.1016/j.bbadis.2004.08.010 Coudert, L., Nonaka, T., Bernard, E., Hasegawa, M., Schaeffer, L., and Leblanc, P. (2019). Phosphorylated and aggregated TDP-43 with seeding properties are
induced upon mutant Huntingtin (mHtt) polyglutamine expression in human
cellular models. Cell. Mol. Life Sci. 76, 2615–2632. doi: 10.1007/s00018-019-
03059-8 Andreadis, A., Broderick, J. A., and Kosik, K. S. (1995). Relative exon affinities and
suboptimal splice site signals lead to non-equivalence of two cassette exons. Nucleic Acids Res. 23, 3585–3593. doi: 10.1093/nar/23.17.3585 Davies, S. W., Turmaine, M., Cozens, B. A., DiFiglia, M., Sharp, A. H., Ross, C. A.,
et al. (1997). Formation of neuronal intranuclear inclusions underlies the
neurological dysfunction in mice transgenic for the HD mutation. Cell 90,
537–548. doi: 10.1016/s0092-8674(00)80513-9 Andreadis, A., Brown, W. M., and Kosik, K. S. (1992). Structure and novel exons of
the human tau gene. Biochemistry 31, 10626–10633. doi: 10.1021/bi00158a027 Andrew, S. E., Goldberg, Y. P., Kremer, B., Telenius, H., Theilmann, J.,
Adam, S., et al. (1993). The relationship between trinucleotide (CAG) repeat
length and clinical features of Huntington’s disease. Nat. Genet. 4, 398–403. doi: 10.1038/ng0893-398 Davis, M. Y., Keene, C. D., Jayadev, S., and Bird, T. (2014). The co-occurrence
of Alzheimer’s disease and Huntington’s disease: a neuropathological study
of 15 elderly Huntington’s disease subjects. J. Huntingtons Dis. 3, 209–217. doi: 10.3233/jhd-140111 Arendt, T., Stieler, J. T., and Holzer, M. (2016). Tau and tauopathies. Brain Res. Bull 126, 238–292. doi: 10.1016/j.brainresbull.2016.08.018 Deckel, A. W., Elder, R., and Fuhrer, G. (2002). Biphasic developmental changes
in Ca2+/calmodulin-dependent proteins in R6/2 Huntington’s disease mice. Neuroreport 13, 707–711. doi: 10.1097/00001756-200204160-00034 Barghorn, S., Zheng-Fischhofer, Q., Ackmann, M., Biernat, J., von Bergen, M.,
Mandelkow, E. M., et al. (2000). Structure, microtubule interactions, and paired
helical filament aggregation by tau mutants of frontotemporal dementias. Biochemistry 39, 11714–11721. doi: 10.1021/bi000850r Derisbourg, M., Leghay, C., Chiappetta, G., Fernandez-Gomez, F. J., Laurent, C.,
Demeyer, D., et al. (2015). Role of the Tau N-terminal region in microtubule
stabilization revealed by new endogenous truncated forms. Sci. Rep. 5:9659. doi: 10.1038/srep09659 Baskota, S. U., Lopez, O. L., Greenamyre, J. T., and Kofler, J. (2019). REFERENCES MAP2 splicing is altered in Huntington’s
disease. Brain Pathol. 27, 181–189. doi: 10.1111/bpa.12387 Caceres, A., and Kosik, K. S. (1990). Inhibition of neurite polarity by tau
antisense oligonucleotides in primary cerebellar neurons. Nature 343, 461–463. doi: 10.1038/343461a0 Fernández-Nogales,
M.,
Santos-Galindo,
M.,
Merchán-Rubira,
J.,
Hoozemans, J. J. M., Rábano, A., Ferrer, I., et al. (2017). Tau-positive
nuclear indentations in P301S tauopathy mice. Brain Pathol. 27, 314–322. doi: 10.1111/bpa.12407 Caillet-Boudin, M. L., Buee, L., Sergeant, N., and Lefebvre, B. (2015). Regulation of
human MAPT gene expression. Mol. Neurodegener. 10:28. doi: 10.1186/s13024-
015-0025-8 Frost, B., Bardai, F. H., and Feany, M. B. (2016). Lamin dysfunction mediates
neurodegeneration in tauopathies. Curr. Biol. 26, 129–136. doi: 10.1016/j.cub. 2015.11.039 Caparros-Lefebvre, D., Kerdraon, O., Devos, D., Dhaenens, C. M., Blum, D.,
Maurage, C. A., et al. (2009). Association of corticobasal degeneration and
Huntington’s disease: can Tau aggregates protect Huntingtin toxicity? Mov. Disord. 24, 1089–1090. doi: 10.1002/mds.22204 Fujioka, Y., Ishigaki, S., Masuda, A., Iguchi, Y., Udagawa, T., Watanabe, H.,
et al. (2013). FUS-regulated region- and cell-type-specific transcriptome
is
associated
with
cell
selectivity
in
ALS/FTLD. Sci. Rep. 3:2388. doi: 10.1038/srep02388 Chen, J., Kanai, Y., Cowan, N. J., and Hirokawa, N. (1992). Projection domains
of MAP2 and tau determine spacings between microtubules in dendrites and
axons. Nature 360, 674–677. doi: 10.1038/360674a0 Gasset-Rosa, F., Chillon-Marinas, C., Goginashvili, A., Atwal, R. S., Artates, J. W.,
Tabet, R., et al. (2017). Polyglutamine-expanded huntingtin exacerbates
age-related disruption of nuclear integrity and nucleocytoplasmic transport. Neuron 94, 48.e4–57.e4. doi: 10.1016/j.neuron.2017.03.027 Cisbani, G., Maxan, A., Kordower, J. H., Planel, E., Freeman, T. B., and
Cicchetti, F. (2017). Presence of tau pathology within foetal neural allografts
in patients with Huntington’s and Parkinson’s disease. Brain 140, 2982–2992. doi: 10.1093/brain/awx255 Genetic Modifiers of Huntington’s Disease (GeM-HD) Consortium. (2019). CAG
repeat not polyglutamine length determines timing of Huntington’s disease
onset. Cell 178, 887.e14–900.e14. doi: 10.1016/j.cell.2019.06.036 Cleveland, D. W., Hwo, S. Y., and Kirschner, M. W. (1977). Purification of tau,
a microtubule-associated protein that induces assembly of microtubules from
purified tubulin. J. Mol. Biol. 116, 207–225. doi: 10.1016/0022-2836(77)90213-3 Goedert, M., and Jakes, R. (2005). Mutations causing neurodegenerative
tauopathies. Biochim. Biophys. Acta 1739, 240–250. doi: 10.1016/j.bbadis.2004. 08.007 Cohen, T. J., Guo, J. L., Hurtado, D. E., Kwong, L. K., Mills, I. P., Trojanowski, J. Q.,
et al. (2011). The acetylation of tau inhibits its function and promotes
pathological tau aggregation. Nat. Commun. 2:252. doi: 10.1038/ncomms1255 Goedert, M., and Spillantini, M. G. (2011). REFERENCES Spectrum
of tau pathologies in Huntington’s disease. Lab. Invest. 99, 1068–1077. doi: 10.1038/s41374-018-0166-9 Bates, G. P., Dorsey, R., Gusella, J. F., Hayden, M. R., Kay, C., Leavitt, B. R., et al. (2015). Huntington disease. Nat. Rev. Dis. Primers 1:15005. doi: 10.1038/nrdp. 2015.5 DiFiglia, M., Sapp, E., Chase, K. O., Davies, S. W., Bates, G. P., Vonsattel, J. P.,
et al. (1997). Aggregation of huntingtin in neuronal intranuclear inclusions and
dystrophic neurites in brain. Science 277, 1990–1993. doi: 10.1126/science.277. 5334.1990 Beaulieu, J. M., Sotnikova, T. D., Yao, W. D., Kockeritz, L., Woodgett, J. R.,
Gainetdinov, R. R., et al. (2004). Lithium antagonizes dopamine-dependent
behaviors mediated by an AKT/glycogen synthase kinase 3 signaling cascade. Proc. Natl. Acad. Sci. U S A 101, 5099–5104. doi: 10.1073/pnas.0307921101 Dixit, R., Ross, J. L., Goldman, Y. E., and Holzbaur, E. L. (2008). Differential
regulation of dynein and kinesin motor proteins by tau. Science 319, 1086–1089. doi: 10.1126/science.1152993 Eftekharzadeh, B., Daigle, J. G., Kapinos, L. E., Coyne, A., Schiantarelli, J.,
Carlomagno, Y., et al. (2018). Tau protein disrupts nucleocytoplasmic transport
in Alzheimer’s disease. Neuron 99, 925.e7–940.e7. doi: 10.1016/j.neuron.2018. 07.039 Benhelli-Mokrani, H., Mansuroglu, Z., Chauderlier, A., Albaud, B., Gentien, D.,
Sommer, S., et al. (2018). Genome-wide identification of genic and intergenic
neuronal DNA regions bound by Tau protein under physiological and stress
conditions. Nucleic Acids Res. 46, 11405–11422. doi: 10.1093/nar/gky929 g y
Blum, D., Herrera, F., Francelle, L., Mendes, T., Basquin, M., Obriot, H.,
et al. (2015). Mutant huntingtin alters Tau phosphorylation and subcellular Fernández-Nogales, M., Cabrera, J. R., Santos-Galindo, M., Hoozemans, J. J.,
Ferrer, I., Rozemuller, A. J., et al. (2014). Huntington’s disease is a four-repeat
tauopathy with tau nuclear rods. Nat. Med. 20, 881–885. doi: 10.1038/
nm.3617 Blum, D., Herrera, F., Francelle, L., Mendes, T., Basquin, M., Obriot, H.,
et al. (2015). Mutant huntingtin alters Tau phosphorylation and subcellular
distribution. Hum. Mol. Genet. 24, 76–85. doi: 10.1093/hmg/ddu421 et al. (2015). Mutant huntingtin alters Tau phosphorylation and subcellular
distribution. Hum. Mol. Genet. 24, 76–85. doi: 10.1093/hmg/ddu421 Bots, G. T., and Bruyn, G. W. (1981). Neuropathological changes of the
nucleus accumbens in Huntington’s chorea. Acta Neuropathol. 55, 21–22. doi: 10.1007/bf00691525 Fernández-Nogales, M., Hernández, F., Miguez, A., Alberch, J., Ginés, S., Peréz-
Navarro, E., et al. (2015). Decreased glycogen synthase kinase-3 levels and
activity contribute to Huntington’s disease. Hum. Mol. Genet. 24, 5040–5052. doi: 10.1093/hmg/ddv224 Cabrera, J. R., and Lucas, J. J. (2017). ACKNOWLEDGMENTS We thank Felix Hernández, Ivó H. Hernández and María Santos-
Galindo for suggestions and critical reading of the manuscript. January 2020 | Volume 13 | Article 574 Frontiers in Cellular Neuroscience | www.frontiersin.org 8 Tau and TNIs in HD Fernández-Nogales and Lucas REFERENCES Pathogenesis of the tauopathies. J. Mol. Neurosci. 45, 425–431. doi: 10.1007/s12031-011-9593-4 Goedert, M., Spillantini, M. G., Jakes, R., Crowther, R. A., Vanmechelen, E.,
Probst, A., et al. (1995). Molecular dissection of the paired helical filament. Neurobiol. Aging 16, 325–334. doi: 10.1016/0197-4580(95)00017-9 Cornelison, G. L., Levy, S. A., Jenson, T., and Frost, B. (2019). Tau-induced nuclear
envelope invagination causes a toxic accumulation of mRNA in Drosophila. Aging Cell 18:e12847. doi: 10.1111/acel.12847 January 2020 | Volume 13 | Article 574 Frontiers in Cellular Neuroscience | www.frontiersin.org 9 Fernández-Nogales and Lucas Tau and TNIs in HD Goedert, M., Spillantini, M. G., Jakes, R., Rutherford, D., and Crowther, R. A. (1989). Multiple isoforms of human microtubule-associated protein tau:
sequences and localization in neurofibrillary tangles of Alzheimer’s disease. Neuron 3, 519–526. doi: 10.1016/0896-6273(89)90210-9 L’Episcopo, F., Drouin-Ouellet, J., Tirolo, C., Pulvirenti, A., Giugno, R., Testa, N.,
et al. (2016). GSK-3β-induced Tau pathology drives hippocampal neuronal cell
death in Huntington’s disease: involvement of astrocyte-neuron interactions. Cell Death Dis. 7:e2206. doi: 10.1038/cddis.2016.104 Gong, C. X., Liu, F., Wu, G., Rossie, S., Wegiel, J., Li, L., et al. (2004). Dephosphorylation
of
microtubule-associated
protein
tau
by
protein
phosphatase 5. J. Neurochem. 88, 298–310. doi: 10.1111/j.1471-4159.2004. 02147.x Li, X., Liu, M., Cai, Z., Wang, G., and Li, X. (2010). Regulation of glycogen
synthase kinase-3 during bipolar mania treatment. Bipolar Disord. 12, 741–752. doi: 10.1111/j.1399-5618.2010.00866.x Lim, N. K., Hung, L. W., Pang, T. Y., McLean, C. A., Liddell, J. R., Hilton, J. B.,
et al. (2014). Localized changes to glycogen synthase kinase-3 and collapsin
response mediator protein-2 in the Huntington’s disease affected brain. Hum. Mol. Genet. 23, 4051–4063. doi: 10.1093/hmg/ddu119 Graham, R. K., Deng, Y., Slow, E. J., Haigh, B., Bissada, N., Lu, G., et al. (2006). Cleavage at the caspase-6 site is required for neuronal dysfunction and
degeneration due to mutant huntingtin. Cell 125, 1179–1191. doi: 10.1016/j. cell.2006.04.026 Liu, F., and Gong, C. X. (2008). Tau exon 10 alternative splicing and tauopathies. Mol. Neurodegener. 3:8. doi: 10.1186/1750-1326-3-8 Gratuze, M., Noël, A., Julien, C., Cisbani, G., Milot-Rousseau, P., Morin, F.,
et al. (2015). Tau hyperphosphorylation and deregulation of calcineurin
in mouse models of Huntington’s disease. Hum. Mol. Genet. 24, 86–99. doi: 10.1093/hmg/ddu456 Liu, P., Smith, B. R., Huang, E. S., Mahesh, A., Vonsattel, J. P. G., Petersen, A. J.,
et al. (2019). A soluble truncated tau species related to cognitive dysfunction
and caspase-2 is elevated in the brain of Huntington’s disease patients. REFERENCES Association of missense and 5’-splice-site mutations in tau with the
inherited dementia FTDP-17. Nature 393, 702–705. doi: 10.1038/31508 Mayer, A., Siegel, N. R., Schwartz, A. L., and Ciechanover, A. (1989). Degradation
of proteins with acetylated amino termini by the ubiquitin system. Science 244,
1480–1483. doi: 10.1126/science.2544030 McIntosh, G. C., Jameson, H. D., and Markesbery, W. R. (1978). Huntington
disease associated with Alzheimer disease. Ann. Neurol. 3, 545–548. doi: 10.1002/ana.410030616 Ishigaki, S., Fujioka, Y., Okada, Y., Riku, Y., Udagawa, T., Honda, D., et al. (2017). Altered tau isoform ratio caused by loss of FUS and SFPQ function leads
to FTLD-like phenotypes. Cell Rep. 18, 1118–1131. doi: 10.1016/j.celrep.2017. 01.013 Min, S. W., Cho, S. H., Zhou, Y., Schroeder, S., Haroutunian, V., Seeley, W. W.,
et al. (2010). Acetylation of tau inhibits its degradation and contributes to
tauopathy. Neuron 67, 953–966. doi: 10.1016/j.neuron.2010.08.044 Jellinger, K. A. (1998). Alzheimer-type lesions in Huntington’s disease. J. Neural
Transm. 105, 787–799. doi: 10.1007/s007020050095 Mitchell, I. J., Cooper, A. J., and Griffiths, M. R. (1999). The selective vulnerability
of striatopallidal neurons. Prog. Neurobiol. 59, 691–719. doi: 10.1016/s0301-
0082(99)00019-2 Kadavath, H., Hofele, R. V., Biernat, J., Kumar, S., Tepper, K., Urlaub, H., et al. (2015). Tau stabilizes microtubules by binding at the interface between tubulin
heterodimers. Proc. Natl. Acad. Sci. U S A 112, 7501–7506. doi: 10.1073/pnas. 1504081112 Morishima-Kawashima, M., Hasegawa, M., Takio, K., Suzuki, M., Titani, K., and
Ihara, Y. (1993). Ubiquitin is conjugated with amino-terminally processed
tau in paired helical filaments. Neuron 10, 1151–1160. doi: 10.1016/0896-
6273(93)90063-w Kaltenbach, L. S., Romero, E., Becklin, R. R., Chettier, R., Bell, R., Phansalkar, A.,
et
al. (2007). Huntingtin
interacting
proteins
are
genetic
modifiers
of
neurodegeneration. PLoS
Genet. 3:e82. doi:
10.1371/journal.pgen. 0030082 Moss, R. J., Mastri, A. R., and Schut, L. J. (1988). The coexistence and
differentiation of late onset Huntington’s disease and Alzheimer’s disease. A
case report and review of the literature. J. Am. Geriatr. Soc. 36, 237–241. doi: 10.1111/j.1532-5415.1988.tb01807.x Kempf, M., Clement, A., Faissner, A., Lee, G., and Brandt, R. (1996). Tau binds to the distal axon early in development of polarity in
a microtubule- and microfilament-dependent manner. J. Neurosci. 16,
5583–5592. doi: 10.1523/JNEUROSCI.16-18-05583.1996 Mullard, A. (2019). Pioneering antisense drug heads into pivotal trials for
Huntington disease. Nat. Rev. Drug Discov. 18, 161–163. doi: 10.1038/d41573-
019-00018-7 Kim, S. D., and Fung, V. S. (2014). An update on Huntington’s disease: from
the gene to the clinic. Curr. Opin. Neurol. REFERENCES Acta
Neuropathol. Commun. 7:111. doi: 10.1186/s40478-019-0764-9 Grima, J. C., Daigle, J. G., Arbez, N., Cunningham, K. C., Zhang, K., Ochaba, J.,
et al. (2017). Mutant huntingtin disrupts the nuclear pore complex. Neuron 94,
93.e6–107.e6. doi: 10.1016/j.neuron.2017.03.023 Lovestone, S., Reynolds, C. H., Latimer, D., Davis, D. R., Anderton, B. H.,
Gallo, J. M., et al. (1994). Alzheimer’s disease-like phosphorylation of
the microtubule-associated protein tau by glycogen synthase kinase-3 in
transfected mammalian cells. Curr. Biol. 4, 1077–1086. doi: 10.1016/s0960-
9822(00)00246-3 Gusella, J. F., MacDonald, M. E., Ambrose, C. M., and Duyao, M. P. (1993). Molecular genetics of Huntington’s disease. Arch. Neurol. 50, 1157–1163. doi: 10.1001/archneur.1993.00540110037003 Lu, M., and Kosik, K. S. (2001). Competition for microtubule-binding with dual
expression of tau missense and splice isoforms. Mol. Biol. Cell 12, 171–184. doi: 10.1091/mbc.12.1.171 Hedreen, J. C., and Folstein, S. E. (1995). Early loss of neostriatal striosome
neurons in Huntington’s disease. J. Neuropathol. Exp. Neurol. 54, 105–120. doi: 10.1097/00005072-199501000-00013 Hernández-Ortega, K., Garcia-Esparcia, P., Gil, L., Lucas, J. J., and Ferrer, I. (2016). Altered machinery of protein synthesis in Alzheimer’s: from the nucleolus to
the ribosome. Brain Pathol. 26, 593–605. doi: 10.1111/bpa.12335 MacDonald, M. E., Ambrose, C. M., Duyao, M. P., Myers, R. H., Lin, C.,
Srinidhi, L., et al. (1993). A novel gene containing a trinucleotide repeat that
is expanded and unstable on Huntington’s disease chromosomes. Cell 72,
971–983. doi: 10.1016/0092-8674(93)90585-e Hernandez, F., Lucas, J. J., and Avila, J. (2013). GSK3 and tau: two
convergence points in Alzheimer’s disease. J. Alzheimers Dis. 33, S141–S144. doi: 10.3233/jad-2012-129025 Maina, M. B., Bailey, L. J., Wagih, S., Biasetti, L., Pollack, S. J., Quinn, J. P.,
et al. (2018). The involvement of tau in nucleolar transcription and the
stress response. Acta Neuropathol. Commun. 6:70. doi: 10.1186/s40478-018-
0565-6 Herrera, F., and Outeiro, T. F. (2012). α-synuclein modifies huntingtin
aggregation in living cells. FEBS Lett. 586, 7–12. doi: 10.1016/j.febslet.2011. 11.019 Martí, E. (2016). RNA toxicity induced by expanded CAG repeats in Huntington’s
disease. Brain Pathol. 26, 779–786. doi: 10.1111/bpa.12427 Houlden, H., Baker, M., Morris, H. R., MacDonald, N., Pickering-Brown, S.,
Adamson, J., et al. (2001). Corticobasal degeneration and progressive
supranuclear palsy share a common tau haplotype. Neurology 56, 1702–1706. doi: 10.1212/wnl.56.12.1702 Martin, L., Latypova, X., and Terro, F. (2011). Post-translational modifications of
tau protein: implications for Alzheimer’s disease. Neurochem. Int. 58, 458–471. doi: 10.1016/j.neuint.2010.12.023 Hutton, M., Lendon, C. L., Rizzu, P., Baker, M., Froelich, S., Houlden, H., et al. (1998). REFERENCES The clinical and genetic features
of
Huntington
disease. J. Geriatr. Psychiatry
Neurol. 23,
243–259. doi: 10.1177/0891988710383573 Qian, W., and Liu, F. (2014). Regulation of alternative splicing of tau exon 10. Neurosci. Bull. 30, 367–377. doi: 10.1007/s12264-013-1411-2 Takuma, H., Arawaka, S., and Mori, H. (2003). Isoforms changes of tau protein
during development in various species. Brain Res. Dev. Brain Res. 142, 121–127. doi: 10.1016/s0165-3806(03)00056-7 Reyes, M. G., and Gibbons, S. (1985). Dementia of the Alzheimer’s type and
Huntington’s disease. Neurology 35, 273–277. doi: 10.1212/wnl.35.2.273 Tomas-Zapico, C., Diez-Zaera, M., Ferrer, I., Gomez-Ramos, P., Moran, M. A.,
Miras-Portugal, M. T., et al. (2012). α-Synuclein accumulates in huntingtin
inclusions but forms independent filaments and its deficiency attenuates early
phenotype in a mouse model of Huntington’s disease. Hum. Mol. Genet. 21,
495–510. doi: 10.1093/hmg/ddr507 Roos, R. A., and Bots, G. T. (1983). Nuclear membrane indentations
in Huntington’s chorea. J. Neurol. Sci. 61, 37–47. doi: 10.1016/0022-
510x(83)90053-9 Saavedra, A., Garcia-Martinez, J. M., Xifro, X., Giralt, A., Torres-Peraza, J. F.,
Canals, J. M., et al. (2010). PH domain leucine-rich repeat protein phosphatase
1 contributes to maintain the activation of the PI3K/Akt pro-survival
pathway in Huntington’s disease striatum. Cell Death Differ. 17, 324–335. doi: 10.1038/cdd.2009.127 Tracy, T. E., Sohn, P. D., Minami, S. S., Wang, C., Min, S. W., Li, Y., et al. (2016). Acetylated tau obstructs kibra-mediated signaling in synaptic plasticity and
promotes tauopathy-related memory loss. Neuron 90, 245–260. doi: 10.1016/j. neuron.2016.03.005 Sapp, E., Schwarz, C., Chase, K., Bhide, P. G., Young, A. B., Penney, J., et al. (1997). Huntingtin localization in brains of normal and Huntington’s disease patients. Ann. Neurol. 42, 604–612. doi: 10.1002/ana.410420411 Trinczek, B., Ebneth, A., Mandelkow, E. M., and Mandelkow, E. (1999). Tau regulates the attachment/detachment but not the speed of motors in
microtubule-dependent transport of single vesicles and organelles. J. Cell Sci. 112, 2355–2367. Sathasivam, K., Neueder, A., Gipson, T. A., Landles, C., Benjamin, A. C.,
Bondulich, M. K., et al. (2013). Aberrant splicing of HTT generates the
pathogenic exon 1 protein in Huntington disease. Proc. Natl. Acad. Sci. U S A
110, 2366–2370. doi: 10.1073/pnas.1221891110 Violet, M., Delattre, L., Tardivel, M., Sultan, A., Chauderlier, A., Caillierez, R., et al. (2014). A major role for Tau in neuronal DNA and RNA protection in vivo
under physiological and hyperthermic conditions. Front. Cell. Neurosci. 8:84. doi: 10.3389/fncel.2014.00084 Schilling, J., Broemer, M., Atanassov, I., Duernberger, Y., Vorberg, I., Dieterich, C.,
et al. (2019). REFERENCES 150,
346–365. doi: 10.1111/jnc.14723 Panda, D., Samuel, J. C., Massie, M., Feinstein, S. C., and Wilson, L. (2003). Differential regulation of microtubule dynamics by three- and four-repeat tau:
implications for the onset of neurodegenerative disease. Proc. Natl. Acad. Sci. U S A 100, 9548–9553. doi: 10.1073/pnas.1633508100 Snell, R. G., MacMillan, J. C., Cheadle, J. P., Fenton, I., Lazarou, L. P.,
Davies, P., et al. (1993). Relationship between trinucleotide repeat expansion
and phenotypic variation in Huntington’s disease. Nat. Genet. 4, 393–397. doi: 10.1038/ng0893-393 Spillantini, M. G., Bird, T. D., and Ghetti, B. (1998). Frontotemporal dementia
and Parkinsonism linked to chromosome 17: a new group of tauopathies. Brain
Pathol. 8, 387–402. doi: 10.1111/j.1750-3639.1998.tb00162.x Paonessa, F., Evans, L. D., Solanki, R., Larrieu, D., Wray, S., Hardy, J.,
et al. (2019). Microtubules deform the nuclear membrane and disrupt
nucleocytoplasmic transport in tau-mediated frontotemporal dementia. Cell
Rep. 26, 582.e585–593.e585. doi: 10.1016/j.celrep.2018.12.085 Spillantini,
M. G.,
and
Goedert,
M. (2013). Tau
pathology
and
neurodegeneration. Lancet Neurol. 12, 609–622. doi: 10.1016/S1474-4422(13)
70090-5 j
Park, S. A., Ahn, S. I., and Gallo, J. M. (2016). Tau mis-splicing in the pathogenesis
of neurodegenerative disorders. BMB Rep. 49, 405–413. doi: 10.5483/bmbrep. 2016.49.8.084 Stamer, K., Vogel, R., Thies, E., Mandelkow, E., and Mandelkow, E. M. (2002). Tau blocks traffic of organelles, neurofilaments and APP vesicles in neurons
and enhances oxidative stress. J. Cell Biol. 156, 1051–1063. doi: 10.1083/jcb. 200108057 Pei, J. J., Tanaka, T., Tung, Y. C., Braak, E., Iqbal, K., and Grundke-Iqbal, I. (1997). Distribution, levels and activity of glycogen synthase kinase-3 in the Alzheimer
disease brain. J. Neuropathol. Exp. Neurol. 56, 70–78. doi: 10.1097/00005072-
199701000-00007 St-Amour, I., Turgeon, A., Goupil, C., Planel, E., and Hebert, S. S. (2018). Co-
occurrence of mixed proteinopathies in late-stage Huntington’s disease. Acta
Neuropathol. 135, 249–265. doi: 10.1007/s00401-017-1786-7 Pittman, A. M., Myers, A. J., Duckworth, J., Bryden, L., Hanson, M., Abou-
Sleiman, P., et al. (2004). The structure of the tau haplotype in controls
and in progressive supranuclear palsy. Hum. Mol. Genet. 13, 1267–1274. doi: 10.1093/hmg/ddh138 Stefansson, H., Helgason, A., Thorleifsson, G., Steinthorsdottir, V., Masson, G.,
Barnard, J., et al. (2005). A common inversion under selection in Europeans. Nat. Genet. 37, 129–137. doi: 10.1038/ng1508 Poorkaj, P., Bird, T. D., Wijsman, E., Nemens, E., Garruto, R. M., Anderson, L.,
et al. (1998). Tau is a candidate gene for chromosome 17 frontotemporal
dementia. Ann. Neurol. 43, 815–825. doi: 10.1002/ana.410430617 Sturrock, A., and Leavitt, B. R. (2010). REFERENCES 27, 477–483. doi: 10.1097/WCO. 0000000000000116 Myers, A. J., Pittman, A. M., Zhao, A. S., Rohrer, K., Kaleem, M., Marlowe, L., et al. (2007). The MAPT H1c risk haplotype is associated with increased expression
of tau and especially of 4 repeat containing transcripts. Neurobiol. Dis. 25,
561–570. doi: 10.1016/j.nbd.2006.10.018 Kosik, K. S., Orecchio, L. D., Bakalis, S., and Neve, R. L. (1989). Developmentally
regulated expression of specific tau sequences. Neuron 2, 1389–1397. doi: 10.1016/0896-6273(89)90077-9 Ledesma, M. D., Bonay, P., and Avila, J. (1995). Tau protein from Alzheimer’s
disease patients is glycated at its tubulin-binding domain. J. Neurochem. 65,
1658–1664. doi: 10.1046/j.1471-4159.1995.65041658.x Myers, R. H., Sax, D. S., Schoenfeld, M., Bird, E. D., Wolf, P. A., Vonsattel, J. P.,
et al. (1985). Late onset of Huntington’s disease. J. Neurol. Neurosurg. Psychiatry 48, 530–534. doi: 10.1136/jnnp.48.6.530 January 2020 | Volume 13 | Article 574 Frontiers in Cellular Neuroscience | www.frontiersin.org 10 Fernández-Nogales and Lucas Tau and TNIs in HD Nalavade, R., Griesche, N., Ryan, D. P., Hildebrand, S., and Krauss, S. (2013). Mechanisms of RNA-induced toxicity in CAG repeat disorders. Cell Death Dis. 4:e752. doi: 10.1038/cddis.2013.276 and related neurological disorders. Expert Rev. Proteomics 5, 207–224. doi: 10.1586/14789450.5.2.207 Sergeant, N., Delacourte, A., and Buée, L. (2005). Tau protein as a differential
biomarker of tauopathies. Biochim. Biophys. Acta 1739, 179–197. doi: 10.1016/j. bbadis.2004.06.020 Naro, C., and Sette, C. (2013). Phosphorylation-mediated regulation of alternative
splicing in cancer. Int. J. Cell Biol. 2013:151839. doi: 10.1155/2013/151839 Shieh, S. Y., and Bonini, N. M. (2011). Genes and pathways affected by
CAG-repeat RNA-based toxicity in Drosophila. Hum. Mol. Genet. 20,
4810–4821. doi: 10.1093/hmg/ddr420 Nasir, J., Floresco, S. B., O’Kusky, J. R., Diewert, V. M., Richman, J. M.,
Zeisler, J., et al. (1995). Targeted disruption of the Huntington’s disease gene
results in embryonic lethality and behavioral and morphological changes in
heterozygotes. Cell 81, 811–823. doi: 10.1016/0092-8674(95)90542-1 Siano, G., Varisco, M., Caiazza, M. C., Quercioli, V., Mainardi, M., Ippolito, C.,
et al. (2019). Tau modulates VGluT1 expression. J. Mol. Biol. 431, 873–884. doi: 10.1016/j.jmb.2019.01.023 Neve, R. L., Harris, P., Kosik, K. S., Kurnit, D. M., and Donlon, T. A. (1986). Identification of cDNA clones for the human microtubule-associated
protein tau and chromosomal localization of the genes for tau and
microtubule-associated protein 2. Brain Res. 387, 271–280. doi: 10.1016/0169-
328x(86)90033-1 Smith-Dijak, A. I., Sepers, M. D., and Raymond, L. A. (2019). Alterations in
synaptic function and plasticity in Huntington disease. J. Neurochem. REFERENCES Deregulated splicing is a major mechanism of RNA-induced
toxicity in Huntington’s disease. J. Mol. Biol. 431, 1869–1877. doi: 10.1016/j. jmb.2019.01.034 Vonsattel, J. P., and DiFiglia, M. (1998). Huntington disease. J. Neuropathol. Exp. Neurol. 57, 369–384. doi: 10.1097/00005072-199805000-00001 Schulte, J., and Littleton, J. T. (2011). The biological function of the Huntingtin
protein and its relevance to Huntington’s disease pathology. Curr. Trends
Neurol. 5, 65–78. Vonsattel, J. P., Del Amaya, M. P., and Keller, C. E. (2008). Twenty-
first century brain banking. Processing brains for research: the Columbia
University methods. Acta Neuropathol. 115, 509–532. doi: 10.1007/s00401-007-
0311-9 Schwab, C., Arai, T., Hasegawa, M., Yu, S., and McGeer, P. L. (2008). Colocalization of transactivation-responsive DNA-binding protein 43 and
huntingtin in inclusions of Huntington disease. J. Neuropathol. Exp. Neurol. 67, 1159–1165. doi: 10.1097/nen.0b013e31818e8951 Vuono, R., Winder-Rhodes, S., de Silva, R., Cisbani, G., Drouin-Ouellet, J.,
REGISTRY Investigators of the European Huntington’s Disease Network,
et al. (2015). The role of tau in the pathological process and clinical
expression of Huntington’s disease. Brain 138, 1907–1918. doi: 10.1093/brain/
awv107 Sergeant, N., Bretteville, A., Hamdane, M., Caillet-Boudin, M. L., Grognet, P.,
Bombois, S., et al. (2008). Biochemistry of Tau in Alzheimer’s disease January 2020 | Volume 13 | Article 574 Frontiers in Cellular Neuroscience | www.frontiersin.org 11 Fernández-Nogales and Lucas Tau and TNIs in HD Zhang, Z., Song, M., Liu, X., Kang, S. S., Kwon, I. S., Duong, D. M., et al. (2014). Cleavage of tau by asparagine endopeptidase mediates the neurofibrillary
pathology in Alzheimer’s disease. Nat. Med. 20, 1254–1262. doi: 10.1038/
nm.3700 Wang, Y., and Mandelkow, E. (2016). Tau in physiology and pathology. Nat. Rev. Neurosci. 17, 5–21. doi: 10.1038/nrn.2015.1 Warrick, J. M., Paulson, H. L., Gray-Board, G. L., Bui, Q. T., Fischbeck, K. H.,
Pittman, R. N., et al. (1998). Expanded polyglutamine protein forms nuclear
inclusions and causes neural degeneration in Drosophila. Cell 93, 939–949. doi: 10.1016/s0092-8674(00)81200-3 Zheng, Z., and Diamond, M. I. (2012). Huntington disease and the huntingtin
protein. Prog. Mol. Biol. Transl. Sci. 107, 189–214. doi: 10.1016/B978-0-12-
385883-2.00010-2 Wei, Y., Qu, M. H., Wang, X. S., Chen, L., Wang, D. L., Liu, Y., et al. (2008). Binding to the minor groove of the double-strand, tau protein prevents DNA
from damage by peroxidation. PLoS One 3:e2600. doi: 10.1371/journal.pone. 0002600 Zoghbi, H. Y., and Orr, H. T. (2000). Glutamine repeats and neurodegeneration. Annu. Rev. Neurosci. 23,
217–247. doi:
10.1146/annurev.neuro. 23.1.217 Zuccato, C., and Cattaneo, E. (2014). Copyright © 2020 Fernández-Nogales and Lucas. This is an open-access article
distributed under the terms of the Creative Commons Attribution License (CC BY).
The use, distribution or reproduction in other forums is permitted, provided the
original author(s) and the copyright owner(s) are credited and that the original
publication in this journal is cited, in accordance with accepted academic practice.
No use, distribution or reproduction is permitted which does not comply with
these terms. Frontiers in Cellular Neuroscience | www.frontiersin.org January 2020 | Volume 13 | Article 574 REFERENCES Huntington’s disease. Handb. Exp. Pharmacol. 220, 357–409. doi: 10.1007/978-3-642-45106-5_14 Weingarten, M. D., Lockwood, A. H., Hwo, S. Y., and Kirschner, M. W. (1975). A
protein factor essential for microtubule assembly. Proc. Natl. Acad. Sci. U S A
72, 1858–1862. doi: 10.1073/pnas.72.5.1858 Conflict of Interest: The authors declare that the research was conducted in the
absence of any commercial or financial relationships that could be construed as a
potential conflict of interest. Conflict of Interest: The authors declare that the research was conducted in the
absence of any commercial or financial relationships that could be construed as a
potential conflict of interest. Wischik, C. M., Novak, M., Thogersen, H. C., Edwards, P. C., Runswick, M. J.,
Jakes, R., et al. (1988). Isolation of a fragment of tau derived from the core of
the paired helical filament of Alzheimer disease. Proc. Natl. Acad. Sci. U S A 85,
4506–4510. doi: 10.1073/pnas.85.12.4506 Copyright © 2020 Fernández-Nogales and Lucas. This is an open-access article
distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the
original author(s) and the copyright owner(s) are credited and that the original
publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with
these terms. Witman, G. B., Cleveland, D. W., Weingarten, M. D., and Kirschner, M. W. (1976). Tubulin requires tau for growth onto microtubule initiating sites. Proc. Natl. Acad. Sci. U S A 73, 4070–4074. doi: 10.1073/pnas.73.11.4070 Yin, X., Jin, N., Gu, J., Shi, J., Zhou, J., Gong, C. X., et al. (2012). Dual-
specificity tyrosine phosphorylation-regulated kinase 1A (Dyrk1A) modulates
serine/arginine-rich protein 55 (SRp55)-promoted Tau exon 10 inclusion. J. Biol. Chem. 287, 30497–30506. doi: 10.1074/jbc.m112.355412 January 2020 | Volume 13 | Article 574 Frontiers in Cellular Neuroscience | www.frontiersin.org 12
| 3,075 |
https://github.com/Talend/ui/blob/master/packages/design-system/src/components/WIP/Accordion/Accordion.cy.tsx
|
Github Open Source
|
Open Source
|
Apache-2.0
| 2,023 |
ui
|
Talend
|
TSX
|
Code
| 438 | 1,725 |
/* eslint-disable testing-library/await-async-query */
/* eslint-disable testing-library/prefer-screen-queries */
import { Accordion, CollapsiblePanel } from './';
const SampleParagraph = () => (
<p>
Quisque efficitur, magna sit amet tempor malesuada, orci mauris vestibulum enim, quis gravida
est urna et ipsum. Nunc rutrum, magna id fermentum dignissim, magna sem volutpat risus, ut
ultrices ipsum lacus vitae sapien. Curabitur sodales risus ac nibh efficitur, dapibus posuere
ipsum bibendum. Proin erat ipsum, tempus in aliquet sed, auctor id sem. Maecenas ultrices, magna
vitae pretium condimentum, ipsum lectus hendrerit est, a ultrices lacus odio in mi. Phasellus
accumsan diam in metus dictum ultrices. In hac habitasse platea dictumst. Curabitur vestibulum
vitae libero sit amet blandit. Nulla bibendum sollicitudin dolor at vehicula. Morbi quis viverra
velit, eget ornare velit. Praesent porttitor sagittis nulla non vehicula. u
</p>
);
const WithAction = () => (
<div style={{ maxWidth: '80rem', marginLeft: 'auto', marginRight: 'auto', padding: '3rem' }}>
<CollapsiblePanel
id="panel-with-action"
title="panel with action"
action={{
icon: 'plus',
tooltip: 'action tooltip',
callback: () => window.alert('action callback'),
}}
>
<SampleParagraph />
</CollapsiblePanel>
</div>
);
context('<CollapsiblePanel />', () => {
it('should render header', () => {
cy.mount(<WithAction />);
cy.findByTestId('panel.header').should('be.visible');
cy.findByTestId('panel.section').should('not.exist');
});
it('should expand and collapse', () => {
cy.mount(<WithAction />);
cy.get('#CollapsiblePanel__control--panel-with-action').click();
cy.findByTestId('panel.section').should('be.visible');
cy.get('#CollapsiblePanel__control--panel-with-action').click();
cy.findByTestId('panel.section').should('not.exist');
});
it('should hide chevron and action when disabled', () => {
cy.mount(
<div style={{ maxWidth: '80rem', marginLeft: 'auto', marginRight: 'auto', padding: '3rem' }}>
<CollapsiblePanel
id="disabled-panel"
title="disabled panel"
action={{
icon: 'plus',
tooltip: 'action tooltip',
callback: () => window.alert('action callback'),
}}
disabled
>
<SampleParagraph />
</CollapsiblePanel>
</div>,
);
cy.get('#CollapsiblePanel__control--disabled-panel').should('not.exist');
cy.findByTestId('action.button').should('not.exist');
});
it('should display action toolip', () => {
cy.mount(<WithAction />);
cy.findByTestId('action.button')
.focus()
.should('have.attr', 'aria-describedby')
.then(describedBy => cy.get(`#${describedBy}`).should('have.text', 'action tooltip'));
});
it('should manage expanded state with accordion', () => {
cy.mount(
<div style={{ maxWidth: '80rem', marginLeft: 'auto', marginRight: 'auto', padding: '3rem' }}>
<Accordion>
<CollapsiblePanel id="panel-a" title="first panel">
<SampleParagraph />
</CollapsiblePanel>
<CollapsiblePanel id="panel-b" title="second panel">
<SampleParagraph />
</CollapsiblePanel>
<CollapsiblePanel id="panel-c" title="third panel">
<SampleParagraph />
</CollapsiblePanel>
</Accordion>
</div>,
);
cy.get('#CollapsiblePanel__control--panel-a')
.click()
.should('have.attr', 'aria-expanded', 'true');
cy.get('#CollapsiblePanel__control--panel-b')
.click()
.should('have.attr', 'aria-expanded', 'true');
cy.get('#CollapsiblePanel__control--panel-a').should('have.attr', 'aria-expanded', 'false');
});
it('should display proper title without status', () => {
cy.mount(
<div style={{ maxWidth: '80rem', marginLeft: 'auto', marginRight: 'auto', padding: '3rem' }}>
<CollapsiblePanel id="panel-a" title="MyTitle">
<SampleParagraph />
</CollapsiblePanel>
</div>,
);
cy.get('#CollapsiblePanel__control--panel-a')
.find(':nth-child(2)') // Get the second child element
.then($element => {
const classname = $element.attr('class');
expect(classname).to.match(/CollapsiblePanelHeader-module__headerTitle/);
expect(classname).to.not.match(/Status-module__status/);
const title = $element.text(); // Get the text content of the element
expect(title).to.equal('MyTitle');
});
});
it('should display status without title', () => {
cy.mount(
<div style={{ maxWidth: '80rem', marginLeft: 'auto', marginRight: 'auto', padding: '3rem' }}>
<CollapsiblePanel id="panel-a" status="successful">
<SampleParagraph />
</CollapsiblePanel>
</div>,
);
cy.get('#CollapsiblePanel__control--panel-a')
.find(':nth-child(2)') // Get the second child element
.then($element => {
const classname = $element.attr('class');
expect(classname).to.not.match(/CollapsiblePanelHeader-module__headerTitle/);
expect(classname).to.match(/Status-module__status/);
});
});
});
| 23,666 |
https://github.com/blindsubmissions/icse19replication/blob/master/generated-tests/qmosa/tests/s1006/105_freemind/evosuite-tests/accessories/plugins/time/JDayChooser_ESTest_scaffolding.java
|
Github Open Source
|
Open Source
|
MIT
| null |
icse19replication
|
blindsubmissions
|
Java
|
Code
| 569 | 7,817 |
/**
* Scaffolding file used to store all the setups needed to run
* tests automatically generated by EvoSuite
* Fri Aug 24 09:59:19 GMT 2018
*/
package accessories.plugins.time;
import org.evosuite.runtime.annotation.EvoSuiteClassExclude;
import org.junit.BeforeClass;
import org.junit.Before;
import org.junit.After;
import org.junit.AfterClass;
import org.evosuite.runtime.sandbox.Sandbox;
import org.evosuite.runtime.sandbox.Sandbox.SandboxMode;
import static org.evosuite.shaded.org.mockito.Mockito.*;
@EvoSuiteClassExclude
public class JDayChooser_ESTest_scaffolding {
@org.junit.Rule
public org.evosuite.runtime.vnet.NonFunctionalRequirementRule nfr = new org.evosuite.runtime.vnet.NonFunctionalRequirementRule();
private static final java.util.Properties defaultProperties = (java.util.Properties) java.lang.System.getProperties().clone();
private org.evosuite.runtime.thread.ThreadStopper threadStopper = new org.evosuite.runtime.thread.ThreadStopper (org.evosuite.runtime.thread.KillSwitchHandler.getInstance(), 3000);
@BeforeClass
public static void initEvoSuiteFramework() {
org.evosuite.runtime.RuntimeSettings.className = "accessories.plugins.time.JDayChooser";
org.evosuite.runtime.GuiSupport.initialize();
org.evosuite.runtime.RuntimeSettings.maxNumberOfThreads = 100;
org.evosuite.runtime.RuntimeSettings.maxNumberOfIterationsPerLoop = 10000;
org.evosuite.runtime.RuntimeSettings.mockSystemIn = true;
org.evosuite.runtime.RuntimeSettings.sandboxMode = org.evosuite.runtime.sandbox.Sandbox.SandboxMode.RECOMMENDED;
org.evosuite.runtime.sandbox.Sandbox.initializeSecurityManagerForSUT();
org.evosuite.runtime.classhandling.JDKClassResetter.init();
setSystemProperties();
initializeClasses();
org.evosuite.runtime.Runtime.getInstance().resetRuntime();
try { initMocksToAvoidTimeoutsInTheTests(); } catch(ClassNotFoundException e) {}
}
@AfterClass
public static void clearEvoSuiteFramework(){
Sandbox.resetDefaultSecurityManager();
java.lang.System.setProperties((java.util.Properties) defaultProperties.clone());
}
@Before
public void initTestCase(){
threadStopper.storeCurrentThreads();
threadStopper.startRecordingTime();
org.evosuite.runtime.jvm.ShutdownHookHandler.getInstance().initHandler();
org.evosuite.runtime.sandbox.Sandbox.goingToExecuteSUTCode();
setSystemProperties();
org.evosuite.runtime.GuiSupport.setHeadless();
org.evosuite.runtime.Runtime.getInstance().resetRuntime();
org.evosuite.runtime.agent.InstrumentingAgent.activate();
}
@After
public void doneWithTestCase(){
threadStopper.killAndJoinClientThreads();
org.evosuite.runtime.jvm.ShutdownHookHandler.getInstance().safeExecuteAddedHooks();
org.evosuite.runtime.classhandling.JDKClassResetter.reset();
resetClasses();
org.evosuite.runtime.sandbox.Sandbox.doneWithExecutingSUTCode();
org.evosuite.runtime.agent.InstrumentingAgent.deactivate();
org.evosuite.runtime.GuiSupport.restoreHeadlessMode();
}
public static void setSystemProperties() {
java.lang.System.setProperties((java.util.Properties) defaultProperties.clone());
java.lang.System.setProperty("file.encoding", "UTF-8");
java.lang.System.setProperty("java.awt.headless", "true");
java.lang.System.setProperty("java.io.tmpdir", "/tmp");
java.lang.System.setProperty("user.country", "US");
java.lang.System.setProperty("user.dir", "/home/ubuntu/evosuite_readability_gen/projects/105_freemind");
java.lang.System.setProperty("user.home", "/home/ubuntu");
java.lang.System.setProperty("user.language", "en");
java.lang.System.setProperty("user.name", "ubuntu");
java.lang.System.setProperty("user.timezone", "Etc/UTC");
java.lang.System.setProperty("sun.jnu.encoding", "UTF-8");
}
private static void initializeClasses() {
org.evosuite.runtime.classhandling.ClassStateSupport.initializeClasses(JDayChooser_ESTest_scaffolding.class.getClassLoader() ,
"org.apache.batik.ext.awt.image.codec.ImageEncoder",
"freemind.main.FreeMind",
"freemind.modes.mindmapmode.attributeactors.AttributeManagerDialog",
"freemind.view.mindmapview.EditNodeBase$EditControl",
"org.apache.xalan.res.XSLTErrorResources",
"freemind.modes.MindMap$MapSourceChangedObserver",
"org.openstreetmap.gui.jmapviewer.JobDispatcher",
"org.apache.xalan.templates.XSLTVisitor",
"freemind.extensions.MindMapHook$PluginBaseClassSearcher",
"org.apache.xalan.templates.ElemTemplateElement",
"org.apache.xpath.XPath",
"accessories.plugins.time.JDayChooser",
"freemind.controller.actions.generated.instance.Place",
"freemind.controller.NodeMouseMotionListener",
"freemind.modes.mindmapmode.MindMapMapModel$LockManager",
"accessories.plugins.time.JYearChooser",
"plugins.map.TileImage",
"org.apache.batik.svggen.DefaultExtensionHandler",
"freemind.modes.browsemode.BrowsePopupMenu",
"org.apache.xpath.objects.XObject",
"org.openstreetmap.gui.jmapviewer.MemoryTileCache",
"freemind.modes.mindmapmode.MindMapMapModel$DummyLockManager",
"freemind.main.FreeMindMain$VersionInformation",
"plugins.map.MapDialog",
"org.apache.batik.ext.awt.g2d.TransformStackElement",
"freemind.modes.mindmapmode.MindMapMapModel",
"org.jibx.runtime.IMarshallable",
"org.apache.xpath.WhitespaceStrippingElementMatcher",
"org.openstreetmap.gui.jmapviewer.JMapViewer$3",
"org.openstreetmap.gui.jmapviewer.interfaces.TileSource",
"org.openstreetmap.gui.jmapviewer.JMapViewer$2",
"freemind.view.mindmapview.MapView",
"freemind.extensions.NodeHook",
"freemind.controller.MapMouseMotionListener$MapMouseMotionReceiver",
"org.openstreetmap.gui.jmapviewer.interfaces.JMapViewerEventListener",
"plugins.map.MapDialog$ResultTableModel",
"org.apache.batik.svggen.SVGCompositeDescriptor",
"accessories.plugins.time.JSpinField$1",
"org.openstreetmap.gui.jmapviewer.JMapViewer",
"freemind.controller.MenuItemEnabledListener",
"org.apache.batik.svggen.SVGIDGenerator",
"freemind.controller.MapModuleManager$MapTitleChangeListener",
"freemind.modes.mindmapmode.actions.xml.ActorXml",
"org.apache.batik.svggen.SimpleImageHandler",
"org.apache.batik.svggen.ErrorHandler",
"freemind.modes.FreeMindAwtFileDialog",
"org.apache.xpath.ExtensionsProvider",
"org.openstreetmap.gui.jmapviewer.events.JMVCommandEvent",
"freemind.main.XMLElement",
"org.openstreetmap.gui.jmapviewer.JMapViewer$1",
"freemind.modes.FreeMindFileDialog",
"freemind.modes.mindmapmode.actions.xml.ActionPair",
"org.jibx.runtime.IUnmarshallable",
"org.openstreetmap.gui.jmapviewer.Tile",
"org.openstreetmap.gui.jmapviewer.JobDispatcher$JobThread",
"org.apache.xml.serializer.SerializerTrace",
"org.apache.batik.svggen.SVGEllipse",
"freemind.modes.browsemode.BrowseToolBar",
"org.openstreetmap.gui.jmapviewer.interfaces.TileLoaderListener",
"org.openstreetmap.gui.jmapviewer.interfaces.Attributed",
"org.apache.xalan.templates.StylesheetComposed",
"org.openstreetmap.gui.jmapviewer.tilesources.OsmTileSource$Mapnik",
"freemind.modes.MindMapNode",
"freemind.extensions.PermanentNodeHook",
"plugins.map.MapNodePositionHolder",
"freemind.controller.MapMouseWheelListener",
"freemind.main.IFreeMindSplash",
"freemind.controller.FreeMindToolBar",
"org.apache.batik.svggen.SVGGraphicObjectConverter",
"accessories.plugins.time.JDayChooser$DecoratorButton",
"org.openstreetmap.gui.jmapviewer.interfaces.MapPolygon",
"freemind.controller.actions.generated.instance.NodeAction",
"org.apache.xpath.Expression",
"freemind.modes.XMLElementAdapter",
"freemind.view.mindmapview.NodeView",
"freemind.controller.MapModuleManager$MapTitleContributor",
"org.openstreetmap.gui.jmapviewer.interfaces.TileLoader",
"freemind.modes.common.CommonNodeKeyListener$EditHandler",
"org.openstreetmap.gui.jmapviewer.tilesources.AbstractOsmTileSource",
"freemind.controller.MainToolBar",
"freemind.controller.MapModuleManager",
"freemind.main.LoggingOutputStream",
"org.apache.xml.serializer.ExtendedContentHandler",
"org.apache.batik.svggen.SVGDescriptor",
"freemind.controller.LastStateStorageManagement",
"org.openstreetmap.gui.jmapviewer.interfaces.TileCache",
"freemind.modes.mindmapmode.MindMapController",
"freemind.main.Tools$IntHolder",
"org.apache.xpath.XPathVisitor",
"org.openstreetmap.gui.jmapviewer.MemoryTileCache$CacheLinkedListElement",
"plugins.map.Registration",
"org.apache.xpath.res.XPATHMessages",
"freemind.controller.filter.Filter",
"org.apache.batik.svggen.StyleHandler",
"freemind.modes.browsemode.BrowseController",
"freemind.view.MapModule",
"org.apache.batik.svggen.ImageHandler",
"plugins.map.FreeMindMapController$MapEditNoteTextField",
"org.apache.xalan.templates.Stylesheet",
"freemind.modes.Mode",
"org.apache.batik.svggen.SVGPolygon",
"freemind.extensions.HookAdapter",
"org.apache.batik.util.XMLConstants",
"freemind.controller.filter.FilterToolbar",
"accessories.plugins.time.JMonthChooser$1",
"org.apache.xalan.res.XSLMessages",
"freemind.main.FreeMindSecurityManager",
"org.apache.batik.svggen.SVGGraphics2D",
"freemind.main.XMLParseException",
"org.openstreetmap.gui.jmapviewer.JMapController",
"freemind.controller.actions.generated.instance.XmlAction",
"freemind.controller.NodeKeyListener",
"org.openstreetmap.gui.jmapviewer.OsmFileCacheTileLoader",
"org.openstreetmap.gui.jmapviewer.AttributionSupport",
"freemind.main.FreeMindCommon",
"org.apache.batik.svggen.ImageHandlerBase64Encoder",
"freemind.common.TextTranslator",
"plugins.map.Registration$NodeVisibilityListener",
"freemind.modes.browsemode.BrowseMapModel",
"org.apache.batik.svggen.SVGFilterDescriptor",
"org.apache.batik.svggen.DOMTreeManager",
"plugins.map.JCursorMapViewer",
"accessories.plugins.time.JSpinField",
"freemind.modes.MapAdapter",
"freemind.controller.actions.generated.instance.WindowConfigurationStorage",
"org.apache.batik.svggen.DefaultImageHandler",
"org.apache.batik.svggen.SVGRectangle",
"freemind.main.FreeMindApplet",
"org.apache.batik.util.SVGConstants",
"freemind.modes.ModeController$NodeSelectionListener",
"plugins.map.Registration$CachePurger",
"org.apache.xpath.ExpressionOwner",
"freemind.controller.NodeDropListener",
"org.apache.xml.utils.QName",
"org.openstreetmap.gui.jmapviewer.Coordinate",
"freemind.main.FreeMindMain",
"freemind.extensions.HookFactory",
"org.openstreetmap.gui.jmapviewer.interfaces.MapRectangle",
"org.openstreetmap.gui.jmapviewer.OsmMercator",
"org.apache.batik.svggen.SVGGeneratorContext",
"org.apache.xml.dtm.DTMManager",
"freemind.controller.MapMouseMotionListener",
"freemind.preferences.FreemindPropertyListener",
"org.apache.xpath.ExpressionNode",
"plugins.map.FreeMindMapController$CursorPositionListener",
"freemind.controller.LastOpenedList",
"freemind.preferences.FreemindPropertyContributor",
"freemind.modes.NodeAdapter",
"freemind.main.FreeMindMain$StartupDoneListener",
"freemind.modes.FreeMindJFileDialog",
"freemind.modes.mindmapmode.MindMapMapModel$ReaderCreator",
"freemind.view.mindmapview.EditNodeBase",
"org.openstreetmap.gui.jmapviewer.tilesources.AbstractTileSource",
"org.apache.xpath.XPathContext",
"freemind.modes.mindmapmode.hooks.MindMapHookAdapter",
"freemind.modes.mindmapmode.actions.MindMapActions",
"org.apache.batik.svggen.SVGLine",
"org.openstreetmap.gui.jmapviewer.tilesources.AbstractTMSTileSource",
"org.apache.xpath.XPathVisitable",
"freemind.extensions.PermanentNodeHookAdapter",
"org.apache.batik.svggen.ErrorConstants",
"freemind.modes.mindmapmode.MindMapNodeModel",
"org.apache.batik.svggen.SVGPath",
"org.apache.batik.ext.awt.g2d.GraphicContext",
"freemind.modes.common.plugins.MapNodePositionHolderBase",
"plugins.map.MapNodePositionHolder$MapNodePositionListener",
"org.apache.batik.svggen.DefaultStyleHandler",
"org.apache.batik.util.CSSConstants",
"org.apache.batik.svggen.GenericImageHandler",
"freemind.controller.NodeDragListener",
"plugins.map.FreeMindMapController",
"freemind.modes.MindMapLinkRegistry",
"org.apache.xml.utils.PrefixResolver",
"freemind.controller.MapModuleManager$MapModuleChangeObserver",
"org.openstreetmap.gui.jmapviewer.interfaces.MapMarker",
"freemind.view.mindmapview.EditNodeTextField",
"freemind.controller.Controller",
"freemind.controller.filter.FilterController",
"org.apache.batik.svggen.ExtensionHandler",
"freemind.modes.ControllerAdapter",
"freemind.extensions.ModeControllerHookAdapter",
"freemind.main.FeedBack",
"org.apache.batik.svggen.SVGGraphics2DRuntimeException",
"freemind.modes.FreeMindFileDialog$DirectoryResultListener",
"org.apache.xalan.templates.ElemTemplate",
"org.apache.xml.utils.UnImplNode",
"org.apache.xml.dtm.DTMWSFilter",
"org.apache.batik.util.Base64EncoderStream",
"org.apache.xml.res.XMLMessages",
"org.apache.batik.svggen.SVGGraphics2DIOException",
"accessories.plugins.time.JMonthChooser",
"freemind.extensions.HookRegistration",
"freemind.controller.NodeMotionListener",
"freemind.extensions.ModeControllerHook",
"freemind.modes.browsemode.BrowseXMLElement",
"org.apache.batik.svggen.SVGPaintDescriptor",
"freemind.modes.MapAdapter$FileChangeInspectorTimerTask",
"org.apache.xalan.templates.ElemParam",
"freemind.controller.Controller$LocalLinkConverter",
"accessories.plugins.time.JDayChooser$1",
"freemind.controller.ZoomListener",
"freemind.view.mindmapview.MapView$CheckLaterForCenterNodeTask",
"org.apache.xalan.templates.ElemVariable",
"org.apache.batik.svggen.SVGArc",
"freemind.controller.MenuBar",
"freemind.controller.actions.generated.instance.MapWindowConfigurationStorage",
"accessories.plugins.time.TableSorter",
"freemind.extensions.NodeHookAdapter",
"freemind.view.mindmapview.MapView$Selected",
"plugins.map.MapDialog$CloseAction",
"org.apache.batik.ext.awt.g2d.AbstractGraphics2D",
"freemind.extensions.MindMapHook",
"freemind.view.mindmapview.MainView",
"freemind.main.LogFileLogHandler",
"org.apache.xalan.templates.XSLTVisitable",
"freemind.view.mindmapview.MapView$ScrollPane",
"org.apache.batik.svggen.DefaultErrorHandler",
"freemind.modes.mindmapmode.MindMapMapModel$DoAutomaticSave",
"freemind.main.StdFormatter",
"freemind.modes.MindMap",
"freemind.controller.actions.generated.instance.PlaceNodeXmlAction",
"freemind.controller.NodeMouseMotionListener$NodeMouseMotionObserver",
"freemind.modes.viewmodes.ViewControllerAdapter",
"org.apache.xalan.res.XSLTErrorResources_en",
"org.apache.xalan.templates.ElemExsltFunction",
"org.apache.xalan.templates.StylesheetRoot",
"freemind.common.OptionalDontShowMeAgainDialog$DontShowPropertyHandler",
"org.openstreetmap.gui.jmapviewer.TileController",
"org.apache.batik.svggen.SVGShape",
"org.apache.batik.svggen.SVGSyntax",
"org.openstreetmap.gui.jmapviewer.OsmTileLoader",
"freemind.modes.ModeController",
"org.apache.xalan.transformer.TransformerImpl"
);
}
private static void initMocksToAvoidTimeoutsInTheTests() throws ClassNotFoundException {
mock(Class.forName("javax.swing.event.AncestorListener", false, JDayChooser_ESTest_scaffolding.class.getClassLoader()));
}
private static void resetClasses() {
org.evosuite.runtime.classhandling.ClassResetter.getInstance().setClassLoader(JDayChooser_ESTest_scaffolding.class.getClassLoader());
org.evosuite.runtime.classhandling.ClassStateSupport.resetClasses(
"accessories.plugins.time.JDayChooser",
"accessories.plugins.time.JDayChooser$DecoratorButton",
"accessories.plugins.time.JDayChooser$1",
"accessories.plugins.time.JSpinField",
"accessories.plugins.time.JYearChooser",
"accessories.plugins.time.JSpinField$1",
"org.apache.batik.i18n.LocalizableSupport",
"org.apache.batik.i18n.LocaleGroup",
"org.apache.batik.util.gui.resource.ResourceManager",
"org.apache.batik.apps.svgbrowser.Resources",
"org.apache.batik.apps.svgbrowser.SVGInputHandler",
"org.apache.batik.apps.svgbrowser.JSVGViewerFrame",
"org.openstreetmap.gui.jmapviewer.Tile",
"freemind.modes.Mode",
"freemind.modes.filemode.FileMode",
"org.apache.xml.utils.UnImplNode",
"org.apache.xalan.templates.ElemTemplateElement",
"org.apache.xalan.templates.ElemTemplate",
"org.apache.xalan.templates.ElemExsltFunction",
"org.apache.batik.svggen.DefaultImageHandler",
"org.apache.batik.svggen.ImageHandlerBase64Encoder",
"org.apache.batik.svggen.DefaultExtensionHandler",
"org.apache.batik.ext.awt.g2d.AbstractGraphics2D",
"org.apache.batik.svggen.SVGGraphics2D",
"org.apache.batik.svggen.SVGGeneratorContext",
"org.apache.batik.svggen.SVGIDGenerator",
"org.apache.batik.svggen.SimpleImageHandler",
"org.apache.batik.svggen.DefaultStyleHandler",
"org.apache.batik.svggen.DefaultErrorHandler",
"org.apache.batik.ext.awt.g2d.GraphicContext",
"org.apache.batik.svggen.SVGGraphicObjectConverter",
"org.apache.batik.svggen.SVGShape",
"org.apache.batik.svggen.SVGArc",
"org.apache.batik.svggen.SVGEllipse",
"org.apache.batik.svggen.SVGLine",
"org.apache.batik.svggen.SVGPath",
"org.apache.batik.svggen.SVGPolygon",
"org.apache.batik.svggen.SVGRectangle",
"org.apache.batik.svggen.DOMTreeManager",
"org.apache.xml.res.XMLMessages",
"org.apache.xpath.res.XPATHMessages",
"org.apache.xalan.res.XSLMessages",
"org.apache.xalan.res.XSLTErrorResources",
"org.apache.xalan.res.XSLTErrorResources_en",
"org.openstreetmap.gui.jmapviewer.MemoryTileCache",
"org.openstreetmap.gui.jmapviewer.MemoryTileCache$CacheLinkedListElement",
"org.openstreetmap.gui.jmapviewer.JMapViewer",
"org.openstreetmap.gui.jmapviewer.AttributionSupport",
"org.openstreetmap.gui.jmapviewer.tilesources.AbstractTileSource",
"org.openstreetmap.gui.jmapviewer.tilesources.AbstractTMSTileSource",
"org.openstreetmap.gui.jmapviewer.tilesources.AbstractOsmTileSource",
"org.openstreetmap.gui.jmapviewer.tilesources.OsmTileSource$Mapnik",
"org.openstreetmap.gui.jmapviewer.TileController",
"org.openstreetmap.gui.jmapviewer.OsmTileLoader",
"org.openstreetmap.gui.jmapviewer.JobDispatcher$JobThread",
"org.openstreetmap.gui.jmapviewer.JobDispatcher",
"org.openstreetmap.gui.jmapviewer.JMapViewer$1",
"org.openstreetmap.gui.jmapviewer.JMapViewer$2",
"org.openstreetmap.gui.jmapviewer.JMapViewer$3",
"org.openstreetmap.gui.jmapviewer.OsmMercator",
"freemind.extensions.HookAdapter",
"freemind.extensions.NodeHookAdapter",
"freemind.extensions.PermanentNodeHookAdapter",
"freemind.modes.mindmapmode.hooks.PermanentMindMapNodeHookAdapter",
"accessories.plugins.ClonePlugin",
"freemind.main.Resources",
"tests.freemind.FreeMindMainMock",
"freemind.main.FreeMindStarter",
"org.apache.xml.serializer.SerializerBase",
"org.apache.xml.serializer.ToUnknownStream",
"org.apache.xml.serializer.AttributesImplSerializer",
"org.apache.xml.serializer.ElemContext",
"org.apache.xml.serializer.SecuritySupport12",
"org.apache.xml.serializer.SecuritySupport",
"org.apache.xml.serializer.SecuritySupport12$4",
"org.apache.xml.serializer.ToStream",
"org.apache.xml.serializer.ToXMLStream",
"org.apache.xml.serializer.ToStream$BoolStack",
"org.apache.xml.serializer.EncodingInfo",
"org.apache.xml.serializer.CharInfo",
"org.apache.xml.serializer.CharInfo$1",
"org.apache.xml.serializer.CharInfo$CharKey",
"org.apache.xml.serializer.NamespaceMappings",
"org.apache.xml.serializer.NamespaceMappings$Stack",
"org.apache.xml.serializer.NamespaceMappings$MappingRecord",
"freemind.controller.BlindIcon",
"freemind.controller.StructuredMenuHolder",
"freemind.modes.ControllerAdapter",
"freemind.modes.mindmapmode.MindMapController",
"freemind.modes.ControllerAdapter$ControllerPopupMenuListener",
"org.hsqldb.persist.HsqlProperties",
"org.hsqldb.lib.FileUtil",
"org.hsqldb.jdbc.jdbcConnection",
"org.hsqldb.DatabaseURL",
"org.hsqldb.jdbc.Util",
"org.hsqldb.store.BaseHashMap",
"org.hsqldb.lib.HashMap",
"org.hsqldb.store.HashIndex",
"org.hsqldb.lib.BaseList",
"org.hsqldb.lib.HsqlArrayList",
"org.hsqldb.resources.BundleHandler",
"org.hsqldb.Trace",
"org.hsqldb.HsqlException",
"freemind.modes.mindmapmode.hooks.MindMapNodeHookAdapter",
"plugins.collaboration.database.DatabaseBasics",
"plugins.collaboration.database.DatabaseConnectionHook",
"freemind.controller.FreeMindToolBar",
"freemind.modes.mindmapmode.MindMapToolBar",
"freemind.main.Tools",
"freemind.modes.mindmapmode.JAutoScrollBarPane",
"freemind.modes.mindmapmode.MindMapToolBar$1",
"freemind.modes.mindmapmode.MindMapToolBar$2",
"org.jibx.runtime.impl.UnmarshallingContext",
"org.apache.xalan.templates.ElemUse",
"org.apache.xalan.templates.ElemCopy",
"freemind.modes.schememode.SchemeMode",
"freemind.modes.viewmodes.ViewControllerAdapter",
"freemind.modes.schememode.SchemeController",
"freemind.main.FreeMindMain$VersionInformation",
"freemind.main.FreeMind",
"freemind.main.FreeMindApplet",
"org.apache.batik.gvt.AbstractGraphicsNode",
"org.apache.batik.gvt.CompositeGraphicsNode",
"org.apache.batik.gvt.text.ConcreteTextLayoutFactory",
"org.apache.batik.gvt.renderer.BasicTextPainter",
"org.apache.batik.gvt.text.GVTAttributedCharacterIterator$TextAttribute",
"org.apache.batik.gvt.renderer.StrokingTextPainter",
"freemind.extensions.ModeControllerHookAdapter",
"freemind.modes.mindmapmode.hooks.MindMapHookAdapter",
"plugins.map.MapDialog",
"org.apache.batik.util.AbstractParsedURLProtocolHandler",
"org.apache.batik.util.ParsedURLDefaultProtocolHandler",
"org.apache.batik.Version",
"org.apache.batik.util.ParsedURL",
"org.apache.batik.util.ParsedURLData"
);
}
}
| 43,140 |
US-201715604687-A_2
|
USPTO
|
Open Government
|
Public Domain
| 2,017 |
None
|
None
|
English
|
Spoken
| 6,833 | 8,944 |
Accordingly, the first gate structure 140N including the first gate insulating layer 142N, the first gate electrode 144N, and the first gate mask 146N sequentially stacked on the substrate 110, and the second gate structure 140P including the second gate insulating layer 142P, the second gate electrode 144P, and the second gate mask 146P sequentially stacked on the substrate 110 may be formed. The first and second gate electrodes 144N and 144P may be arranged to cross the protrusion pattern 114, and the first and second gate insulating layers 142N and 142P may be interposed between the protrusion pattern 114, and the first and second gate electrodes 144N and 144P.
The first and second gate masks 146N and 146P may be formed of a material including at least one selected from, for example, a silicon oxide layer, a silicon nitride layer, and a silicon oxynitride layer. The first and second gate masks 146N and 146P may function as a gate capping layer.
Referring to FIG. 2D, a preliminary first spacer layer 152 covering the first and second gate structures 140N and 140P may be formed on the substrate 110. The preliminary first spacer layer 152 may be formed by using, for example, a silicon nitride layer or a silicon oxynitride layer.
After the preliminary first spacer layer 152 is formed, an ion implantation process may be performed on the protrusion pattern 114 to implant impurity ions onto extension portions (not shown) of the first source/drain region 160N and the second source/drain region 160P, which are to be formed in a sequential process. The extension portions may be impurity diffusion regions of the source/drain regions 160N, 160P that extend the source/drain region to locations underneath the corresponding gate structure 140N, 140P. A heat annealing or laser annealing process may be optionally performed after the ion implantation process and may cause the implanted impurities on either side of the gate structures 140N, 140P to diffuse to locations under the gate structures 140N, 140P so that the boundaries of the source/drain exists under the gate structures 140N, 140P.
In another embodiment, the ion implantation process may be performed directly on the protrusion pattern 114 before the preliminary first spacer layer 152 is formed.
Referring to FIG. 2E, a first blocking layer 210 covering the NMOS region 110N of the substrate 110 may be formed. An anisotropic etching process may be performed on the preliminary first spacer layer 152 (refer to FIG. 2D) exposed on the PMOS region 110P of the substrate 110 using the gate structure 140P as a mask, in order to form the fin structure 112 having the protrusion portion 112 b and the pair of recesses 112R2 located at both sides of the protrusion portion 112 b.
As illustrated in FIG. 2E, the etching process may be performed until an upper surface of the protrusion pattern 114 located at both sides of the second gate structure 140P is located at a level substantially the same as or similar to a level of an upper surface of the isolation layer 120. Thus, the pair of recesses 112R2 are formed since portions of the protrusion pattern 114 (at both sides of the second gate structure 140P) are removed. Also, a portion of the protrusion pattern 114, which remains between the pair of recesses 112R2, may be the protrusion portion 112 b. The fin structure 112 may include the base portion 112 a, which is located below the protrusion portion 112 b and corresponds to a bottom surface portion of the pair of recesses 112R2, and the protrusion portion 112 b arranged on the base portion 112 a. A side wall of the protrusion portion 112 b and an upper surface of the base portion 112 a may be exposed by the anisotropic etching process.
A portion of the preliminary first spacer layer 152, which is located on a side wall of the second gate structure 140P, may not be removed by the anisotropic etching process, and may remain so as to become the second spacer 152P.
According to an exemplary embodiment, the preliminary first spacer layer 152 may be formed by using a material having an etch selectivity with respect to the second gate mask 146P, and a portion of the second gate mask 146P, which is exposed when the preliminary first spacer layer 152 is etched during the anisotropic etching process, may not be removed. When an upper portion of the protrusion pattern 114 is partially removed, an upper portion of the preliminary first spacer layer 152 located on the side wall of the second gate structure 140P may also be partially removed. In this case, unlike the illustration of FIG. 2E, an upper surface of the second spacer 152P may be a little lower than an upper surface of the second gate mask 146P.
Then, the first blocking layer 210 may be removed.
Referring to FIG. 2F, the second source/drain region 160P may be formed by forming the first strain inducing layer 162 and the second strain inducing layer 164 on the exposed surface of the fin structure 112, that is, the upper surface of the base portion 112 a and the side surface of the protrusion portion 112 b, which are exposed by the recess 112R2.
According to an exemplary embodiment, the first strain inducing layer 162 may be formed by using a semiconductor material including Ge. For example, the first strain inducing layer 162 may be un-doped silicon germanium (SiGe). For example, the first strain inducing layer 162 may have Ge content of about 10% to about 30%, or of about 10% to about 80%. The second strain inducing layer 164 may be formed by using an un-doped semiconductor material, for example, Si. The first strain inducing layer 162 may be formed by an SEG method using the fin structure 112 as a seed. The second strain inducing layer 164 may be formed by an SEG method using the first strain inducing layer 162 as a seed. The first strain inducing layer 162 and the second strain inducing layer 164 may be formed in an in-situ method (e.g., grown sequentially in the same process chamber without removal or a vacuum break of the process chamber).
According to an exemplary embodiment, the second strain inducing layer 164 may be formed to have a shape including faceted side walls. For example, the second strain inducing layer 164 may be formed to have the second side wall FS-1P. The second side wall FS-1P may extend from the first strain inducing layer 162, which is formed on the upper surface of the base portion 112 a, and be inclined at a second intersecting angle θ2 with respect to an upper surface of the substrate 110, and the third side wall FS-2P may contact an uppermost portion of the second side wall FS-1P and be inclined at a third intersecting angle θ3 with respect to the upper surface of the substrate 110. The second intersecting angle θ2 and the third intersecting angle θ3 may be within a range of about 51° to about 59°. For example, the second intersecting angle θ2 and the third intersecting angle θ3 may be within a range of about 54° to about 57°.
When the second strain inducing layer 164 is formed by using a selective epitaxial process, a growth speed along a direction perpendicular to a known crystallographic plane may be higher than a growth speed along a direction perpendicular to another crystallographic plane, according to the structure of a silicon crystal. That is, according to the growth direction, the growth speed of the second strain inducing layer 164 may vary, and a faceted side wall may be generated along a direction parallel with a crystallographic plane and along a direction perpendicular to which the growth speed is low. For example, when a main surface of the substrate 110 is arranged in parallel with a crystallographic plane {100}, a faceted side wall may be formed along a direction parallel with the crystallographic plane {111}, inclined at about 55.7° with respect to the upper surface of the substrate 110.
In an example embodiment where the second strain inducing layer 164 is formed by using the first strain inducing layer 162, formed on the upper surface of the base portion 112 a and the side surface of the protrusion portion 112 b, exposed by the recess 112R2, as a seed layer, the second side walls FS-1P, extending from a portion of the first strain inducing layer 162, which is on the upper surface of the base portion 112 a to be inclined at the second intersecting angle θ2, may be formed. Also, the third side walls FS-2P, extending from an uppermost edge of the protrusion portion 112 b to be inclined at the third intersecting angle θ3, may be formed. Also, edges of the second strain inducing layer 164 may be formed to a horizontal point where the second side walls FS-1P and the third side walls FS-2P meet
According to an exemplary embodiment, as illustrated in FIG. 2F, the second strain inducing layer 164 may have a pentagonal shaped cross-sectional plane taken along direction Y, and the pentagonal shape may be defined by a bottom surface contacting the first strain inducing layer 162, two second side walls FS-1P as edges, and two third side walls FS-2P as edges. However, the cross-sectional shape of the second strain inducing layer 164 is not limited to the pentagonal shape. For example, the second strain inducing layer 164 may be formed to further include one or more additional side walls inclined at different angles from the second and third side walls FS-1P and FS-2P.
As illustrated in FIG. 2F, the uppermost portion of the second strain inducing layer 164 is located where the two inclined side walls FS-2P contact each other. The uppermost surface of the second strain inducing layer 164 may be The, the upper portion of the second strain inducing layer 164, which is higher than the uppermost surface of the first strain inducing layer 162, may contact the side wall of the second spacer 152P.
According to an exemplary embodiment, the edges of the second strain inducing layer 164 are defined by the two second side walls FS-1P and the two third side walls FS-2P. The maximum width WM2 of the second strain inducing layer, the height H2 at a point in which the second strain inducing layer 164 has the maximum width WM2, and the height H4 of the second strain inducing layer 164 may be determined by the two second side walls FS-1P and the two third side walls FS-2P.
The source/drain capping layer 166 may be formed on the second source/drain region 160P. The source/drain capping layer 166 may cover the exposed surface of the second strain inducing layer 164. The source/drain capping layer 166 may be formed by using, for example, silicon doped with a dopant for a first conductive type, or un-doped silicon.
Referring to FIG. 2G, the preliminary second spacer layer 154 covering the preliminary first spacer layer 152, the first and second gate structures 140N and 140P, respectively, and the source/drain capping layer 166 may be formed on the NMOS region 110N and the PMOS region 110P of the substrate 110. The preliminary second spacer layer 154 may be formed by using, for example, a silicon nitride layer or a silicon oxynitride layer.
The preliminary second spacer layer 154 may cover an upper surface of the second gate structure 140, that is, an upper surface of the second gate mask 146P. Also, second spacers 152P may be interposed between side walls of the second gate structure 140P and the preliminary second spacer layer 154.
Referring to FIG. 2H, a second blocking layer 212 covering the PMOS region 110P of the substrate 110 may be formed. An anisotropic etching process may be performed on the preliminary second spacer layer 154 (refer to FIG. 2G) exposed on the NMOS region 110N of the substrate 110, in order to form the fin structure 112 having the protrusion portion 112 b and the pair of recesses 112R1 located at both sides of the protrusion portion 112 b, in the NMOS region 110N.
As illustrated in FIG. 2H, the etching process may be performed until an upper surface of a portion of the protrusion pattern 114 that is located at both sides of the first gate structure 140N is located at a level substantially the same as or similar to a level of an upper surface of the isolation layer 120.
By the anisotropic etching process, a portion of the preliminary second spacer layer 154, on the NMOS region 110N, may be removed, and only a portion of the preliminary second spacer layer 154, on the side walls of the first gate structure 140N, may remain so as to become third spacers 154N. The first spacer 152N may be interposed between the third spacer 154N and the side walls of the first gate structure 140N. Also, a portion of the preliminary second spacer layer 154, located on the PMOS region 110P, may be referred to as the fourth spacer 154P.
Then, the second blocking layer 212 may be removed.
Referring to FIG. 2I, the first source/drain region 160N may be formed on the exposed surface of the fin structure 112 on the NMOS region 110N, that is, on the upper surface of the base portion 112 a and the side surface of the protrusion portion 112 b, exposed by the pair of recesses 112R1.
According to an exemplary embodiment, the first source/drain region 160N may be formed by using a semiconductor material including silicon. For example, the first source/drain region 160N may include or essentially consist of silicon including carbon (SiC) doped with an charge carrier impurity such as phosphorous. The first source/drain region 160N may include boron, or a silicon-germanium material. The first source/drain region 160N may be formed by using, for example, an SEG method using the fin structure 112 as a seed.
According to an exemplary embodiment, the first source/drain region 160N may be formed to have a shape including faceted side walls. These faceted side walls (as well as other faceted side walls described herein) may have a planar surface. For example, the first source/drain region 160N may be formed to include the first side wall FS-1N extending from the upper surface of the base portion 112 a (refer to FIG. 2H) and inclined at the first intersecting angle θ1 with respect to the upper surface of the substrate 110, and a fourth side wall FS-2N contacting the uppermost portion of the first side wall FS-1N and inclined at a fourth intersecting angle θ4 with respect to the upper surface of the substrate 110. The first intersecting angle θ1 and the fourth intersecting angle θ4 may be within a range of about 51° to about 59°. For example, the first intersecting angle θ1 and the fourth intersecting angle θ4 may be within a range of about 54° to about 57°.
According to an exemplary embodiment, in the process of forming the first source/drain region 160N, the first source/drain region 160N may be formed to have a height H5 that is greater than the height H4 of the second source/drain region 160P, by overgrowing the first source/drain region 160N by using the upper surface of the base portion 112 a and the side surface of the protrusion portion 112 b, exposed by the recess 112R1, as a seed. As illustrated in FIG. 2I, the first source/drain region 160N may have a pentagonal cross-sectional plane taken along a perpendicular direction (that is, a cross-sectional plane taken along direction Y). However, the shape of the cross-sectional plane of the first source/drain region 160N is not limited to the pentagonal shape. For example, the first source/drain region 160N may be formed to further include one or more additional side walls inclined at different angles than the first and fourth side walls FS-1N and FS-2N, respectively, and where each may incline within different ranges than the aforementioned ranges.
The first source/drain region 160N may have the maximum width WM1 at a point in which the first side wall FS-1N and the fourth side wall FS-2N contact each other, and the maximum width WM1 of the first source/drain region 160N may be greater than the maximum width WM2 of the second source/drain region. Also, the height H1 at a point in which the first source/drain region 160N has the maximum width WM1 may be greater than the height H2 at a point in which the second source/drain region 160P has the maximum width WM2.
As illustrated in FIG. 2I, an uppermost surface of the first source/drain region 160N may be higher than an uppermost portion of the side wall of the protrusion portion 112 b, and the upper portion of the first source/drain region 160N, which is higher than the uppermost portion of the side wall of the protrusion portion 112 b, may contact a side wall of the third spacer 154N.
A portion of the protrusion portion 112 b, which is defined by the first source/drain region 160N in the NMOS region 110N, and a portion of the protrusion portion 112 b, which is defined by the second source/drain region 160P in the PMOS region 110P (for example, the first strain inducing layer 162), may be the channel region CH. The first source/drain region 160N and the second source/drain region 160P (for example, the second strain inducing layer 164) may be formed to have a conductivity type different from that of the channel region CH. For example, when the channel region CH is formed by using a semiconductor material having a p-type in the NMOS region 110N, the first source/drain region 160N may be formed by using a semiconductor material having an n-type. In example embodiments, where the channel region CH is formed by using a semiconductor material having an n-type in the PMOS region 110P, the second source/drain region 160P may be formed by using a semiconductor material having a p-type.
Referring to FIG. 2J, an upper portion of the first source/drain region 160N may be removed by performing an etch-back process on the first source/drain region 160N. By the etch-back process, the planarized first upper surface PS1 may be formed on the first source/drain region 160N. Also, the first upper surface PS1 of the first source/drain region 160N may have a shape which is rounded from a point in which the first upper surface PS1 contacts the first side wall FS-1N.
The height H3 between an uppermost portion of the first upper surface PS1 and a bottom portion of the first source/drain region 160N, along the vertical direction, may be less than the height (H5 of FIG. 2I) between an uppermost portion of the fourth side wall FS-2N and the bottom portion of the first source/drain region 160N, before the etch-back process. The height H3 of the first source/drain region 160N, after the etch-back process, may be less than or substantially the same as the height H4 of the second source/drain region 160P. For example, an etching height of the first source/drain region 160N H3 may be within a range of less than 2 nm or less than 30 nm of the height H4 of the second source/drain region 160P. However, the etching height of the first source/drain region 160N is not limited thereto.
According to an exemplary embodiment, the etch-back process may be a process which uses a dry etching method. In other exemplary embodiments, the etch-back process may be performed in-situ with in an epitaxial growth process of the first source/drain region 160N (e.g., after epitaxial growth, the first source/drain region 160N is subject to the etch-back process without removing the device from the process chamber, e.g., without a vacuum seal break). For example, the etch-back process may be performed in the in-situ method by using a hydrochloride gas, after forming the first source/drain region 160N.
An upper portion of the second source/drain region 160P is covered by the fourth spacer 154P, and thus may not be damaged by the etch-back process.
Referring to FIG. 2K, an insulating interlayer 180 may be formed on the NMOS region 110N and the PMOS region 110P of the substrate 110. According to an exemplary embodiment, the insulating interlayer 180 may be formed, for example, by using a silicon oxide layer, a silicon nitride layer, and a silicon oxynitride layer.
Then, a first contact hole 170NH and a second contact hole 170PH penetrating through the insulating interlayer 180 to expose upper surfaces of the first and second source/drain regions 160N and 160P may be formed.
The upper surface of the first source/drain region 160N, which is exposed by the first contact hole 170NH, may be referred to as the first contact landing surface 160CL-1 and the upper surface of the second source/drain region 160P, which is exposed by the second contact hole 170PH, may be referred to as the second contact landing surface 160CL-2. Since an uppermost surface of the first source/drain region 160N is lower than or substantially the same as an uppermost surface of the second source/drain region 160P (that is, the height H3 of the first source/drain region 160N is lower than or substantially the same as the height H4 of the second source/drain region 160P), the first contact landing surface 160CL-1 may be lower than the second contact landing surface 160CL-2. In some examples, one or more of the materials etched to form contact hole 170PH have a lower etch rate than that of the materials etched to form contact hole 170NH. In some examples, the second spacer layer 154 material may have a relatively higher resistance to the etchant used to etch contact hole 170PH than that of the material forming first source/drain region 160N.
Referring to FIG. 2L, the first and second contact plugs 170N and 170P may be formed in the first and second contact holes 170NH and 170PH (refer to FIG. 2K) by forming a conductive layer (not shown) filling the first and second contact holes 170NH and 170PH on the insulating interlayer 180, and then planarizing an upper portion of the conductive layer until an upper surface of the insulating interlayer 180 is exposed.
Although it is not illustrated, the first and second contact plugs 170N and 170P may be formed by using a combination of one or more materials selected from a metal, metal nitride, and metal silicide. For example, the first and second contact plugs 170N and 170P may be formed in a multilayer structure including a metal silicide layer and a metal layer, which are sequentially stacked on the first and second source/drain regions 160N and 160P. Conformal layers (insulating or conductive) (not shown) may be formed on sidewalls between insulating interlayer 180 and the metal layer.
The semiconductor device 100 is completely manufactured by performing some of the above-described, exemplary processes.
In the semiconductor device 100, the resistance between the first source/drain region 160N and the first contact plug 170N and the resistance between the second source/drain region 160P and the second contact plug 170P may be simultaneously reduced.
In the NMOS transistor 100N, the greater a volume of the first source/drain region 160N is, the less may be the resistance in the first source/drain region 160N. In the PMOS transistor 100P, the resistance of the second source/drain region 160P may be reduced by the second strain inducing layer 164 using silicon germanium. Where the volume of the first source/drain region 160N is increased by overgrowing the first source/drain region 160N, a location difference of the first and second contact landing surfaces 160CL-1 and 160CL-2 of the first and second source/drain regions 160N and 160P may be allowed to occur in the etching process of the first and second contact holes 170NH and 170PH. In particular, since an etching speed of the second source/drain region 160P, including germanium, is high, the height difference of the first and second contact landing surfaces 160CL-1 and 160CL-2 may be intensified, that is, an upper portion of the second source/drain region 160P may be excessively etched. In this case, the strain generated by the second strain inducing layer 164 using silicon germanium may be removed and thus, the resistance in the second source/drain region 160P may be increased.
However, according an exemplary method of manufacturing the semiconductor device 100, an etch-back process may be performed on the upper portion of the first source/drain region 160N, and thus, the upper surface of the first source/drain region 160N may be lowered relative to an upper surface of the second source/drain region 160P. Accordingly, the first contact landing surface 160CL-1 may be located lower than the second contact landing surface 160CL-2 and lower in relation to the first upper surface PS1 of the first source/drain region 160N. The contact hole 170NH may penetrate the first source/drain region 160N material to a larger extend than that of contact hole 170PH into the second source/drain region 160P, thus providing additional contact are for first contact plug 170N as compared to that of second contact plug 170P. Thus, the first source/drain region 160N may obtain a sufficient area for contacting the first contact plug 170N so that the first source/drain region 160N may have a low resistance. Also, the higher height of the second source/drain region 160P may prevent the above-described excessive etching, thereby preventing the removing of the strain due to a decrease in a volume of the second source/drain region 160P around the second contact landing surface 160CL-2. Accordingly, the second source/drain region 160P may also have a low resistance.
FIG. 3A is a perspective of a semiconductor device 100 a, according to an exemplary embodiment.
FIG. 3B is a cross-sectional view of the semiconductor device 100 a. FIG. 3B illustrates cross-sectional planes taken along lines A-A′, B-B′, C-C′, and D-D′ of FIG. 3A.
The semiconductor device 100 a is similar to the semiconductor device 100 described with reference to FIGS. 1A through 1C, except for capping layers 190N and 190P, and thus, descriptions will be made by focusing on the difference. Hereinafter, like reference numerals refer to like elements.
Referring to FIGS. 3A and 3B, the first capping layer 190N may be formed on a side wall of the first source/drain region 160N and the second capping layer 190P may be formed on a side wall of the second source/drain region 160P. The first capping layer 190N may be formed to surround the first side wall FS-1N of the first source/drain region 160N and the first capping layer 190N may not be formed on the first upper surface PS1 of the first source/drain region 160N. The second capping layer 190P may be formed throughout an upper surface of the fourth spacer 154P and may contact a portion of the second contact plug 170P.
According to an exemplary embodiment, the first and second capping layers 190N and 190P may include an insulating material, such as a silicon oxide layer, a silicon nitride layer, and a silicon oxynitride layer.
FIGS. 4A through 4D are cross-sectional views for describing a method of manufacturing a semiconductor device, according to an exemplary embodiment. The method described with reference to FIGS. 4A through 4D may correspond to a method of manufacturing the semiconductor device 100 a described with reference to FIGS. 3A and 3B. FIGS. 4A through 4D illustrate cross-sectional planes taken along lines A-A′, B-B′, C-C′, and D-D′ of FIG. 3A, for describing processes of manufacturing the semiconductor device 100 a.
First, an intermediate structure illustrated in FIG. 2I is formed by performing the exemplary processes described with reference to FIGS. 2A through 2I.
Referring to FIG. 4A, a preliminary capping layer 190 covering the first and second gate structures 140N and 140P and the first and second source/drain regions 160N and 160P may be formed. The preliminary capping layer 190 may be formed on the first and fourth side walls FS-1N and FS-2N of the first source/drain region 160N to a controlled thickness. The preliminary capping layer 190 may be formed by using an insulating material, such as a silicon oxide layer, a silicon nitride layer, and a silicon oxynitride layer.
Referring to FIG. 4B, a third blocking layer 214 covering the second gate structure 140P and the second source/drain region 160P may be formed on the PMOS region 110P of the substrate 110.
Next, an upper portion of the first source/drain region 160N may be removed by performing an etch-back process on the NMOS region 110N of the substrate 110. In example embodiments a portion of the preliminary capping layer (190 of FIG. 4A), which is located on the first source/drain region 160N, may also be removed.
After the etch-back process, a portion of the preliminary capping layer 190, which remains on a side wall of the first source/drain region 160N, may become the first capping layer 190N, and a portion of the preliminary capping layer 190, which is located on the second source/drain region 160P, may become the second capping layer 190P. The fourth spacer 154P may be interposed between the second capping layer 190P and the second source/drain region 160P.
Referring to FIG. 4C, an ion implantation process 51 may be performed on the first source/drain region 160N. The ion implantation process 51 may be a process for implanting n-type dopant ions.
Unlike the above process, the ion implantation process may be performed before the etch-back process is performed (e.g., on the source/drain region 160N structure shown in FIG. 4A). In this case, the ion implantation process may be performed in a state in which the upper portion of the first source/drain region 160N is covered by the preliminary capping layer 190 (refer to FIG. 4A), and a profile of dopant ions implanted in the first source/drain region 160N may be controlled.
Referring to FIG. 4D, the insulating interlayer 180 may be formed on side walls of the first gate structure 140N, the first source/drain region 160N, and the first capping layer 190N of the NMOS region 110N, and on the second capping layer 190P of the PMOS region 110P.
Next, the semiconductor device 100 a may be completed by performing the processes described with reference to FIGS. 2K and 2L.
FIG. 5A is a perspective view of a semiconductor device 100 b according to an exemplary embodiment.
FIG. 5B is a cross-sectional view of the semiconductor device 100 b. FIG. 5B illustrates cross-sectional planes taken along lines A-A′, B-B′, C-C′, and D-D′ of FIG. 5A.
The semiconductor device 100 b is similar to the semiconductor device 100 described with reference to FIGS. 1A through 1C, except for gate structures 140N-a and 140P-a, and thus, descriptions will be made by focusing on the difference. Hereinafter, like reference numerals refer to like elements.
Referring to FIGS. 5A and 5B, the first gate structure 140N-a may include a first gate electrode 144N-a and a first gate insulating layer 142N-a disposed on a bottom surface and a side wall of the first gate electrode 144N-a. The first spacer 152N may be formed on a side wall of the first gate structure 140N-a, and the third spacer 154N may be disposed on the side wall of the first gate structure 140N-a so that the first spacer 152N is interposed between the third spacer 154N and the first gate structure 140N-a.
The second gate structure 140P-a may include a second gate electrode 144P-a and a second gate insulating layer 142P-a disposed on a bottom surface and a side wall of the second gate electrode 144P-a. The second spacer 152P may be formed on a side wall of the second gate structure 140P-a, and the fourth spacer 154P may be formed on a portion of the side wall of the second gate structure 140P-a so that the second spacer 152P is interposed between the fourth spacer 154P and the second gate structure 140P-a.
FIGS. 6A through 6C are cross-sectional views for describing a method of manufacturing a semiconductor device, according to an exemplary embodiment. The method described with reference to FIGS. 6A through 6C may correspond to a method of manufacturing the semiconductor device 100 b described with reference to FIGS. 5A and 5B. FIGS. 6A through 6C illustrate cross-sectional planes taken along lines A-A′, B-B′, C-C′, and D-D′ of FIG. 5A, for describing processes of manufacturing the semiconductor device 100 b.
First, an intermediate structure illustrated in FIG. 2J is formed by performing the processes described with reference to FIGS. 2A through 2J.
Referring to FIG. 6A, a fourth blocking layer 218 may be formed by forming an insulating layer (not shown) covering the first and second gate structures 140N and 140P and the first and second source/drain regions 160N and 160P on the NMOS region 110N and the PMOS region 110P, and then, by planarizing an upper portion of the insulating layer until upper surfaces of the first and second gate structures 140N and 140P are exposed. Here, an upper surface of the first spacer 152N covering an upper portion of the first gate structure 140N may be exposed on the NMOS region 110N of the substrate 110, and an upper surface of the fourth spacer 154P covering an upper portion of the second gate structure 140P may be exposed on the PMOS region 110P of the substrate 110.
Referring to FIG. 6B, an upper portion of the fourth blocking layer 218 may be planarized to a height until upper surfaces of the first gate mask 146N and the second gate mask 146P are exposed. Accordingly, the first and third spacers 152N and 154N may be interposed between the first gate structure 140N and the fourth blocking layer 218, and the second and fourth spacers 152P and 154P may be interposed between the second gate structure 140P and the fourth blocking layer 218.
Then, a first gate hole 140NH defined by the first spacer 152N and the channel region CH, and a second gate hole 140PH defined by the second spacer 152P and the channel region CH may be formed by removing the first gate structure 140N and the second gate structure 140P.
Referring to FIG. 6C, a third gate insulating layer 154N and a fourth gate insulating layer 154P may be conformally formed on inner walls of the first gate hole 140NH and the second gate hole 140PH. A third gate electrode 144N-a and a fourth gate electrode 144P-a filling the first gate hole 140NH and the second gate hole 140PH, respectively, may be formed within the inner walls of the third gate insulating layer 154N and the fourth gate insulating layer 154P. The third gate electrode 144N-a and a fourth gate electrode 144P may be formed by depositing a metal layer to fill the first gate hole 140NH and the second gate hole 140PH and performing a planarizing step (e.g., CMP) to expose the fourth blocking layer 218.
According to an exemplary embodiment, the third and fourth gate insulating layers 154N and 154P may be formed of a high dielectric material having a higher dielectric constant than a silicon oxide layer. For example, the third and fourth gate insulating layers 154N and 154P may include HfO₂, ZrO₂, or Ta₂O₅.
According to an exemplary embodiment, the third and fourth gate electrodes 144N-a and 144P-a may include at least one metal layer. For example, the third and fourth gate electrodes 144N-a and 144P-a may be formed as a stack including two or more metal layers. For example, the third and fourth gate electrodes 144N-a and 144P-a may be formed of TiN, TaN, TiC, TaC, W, or Al, or may be formed as a stack including TiN, TaN, TiC, TaC, W, or Al. The third and fourth gate electrodes 144N-a and 144P-a may be formed by using, for example, a damascene process which uses the first and third spacers 152N and 154N and the second and fourth spacers 152P and 154P as a mold.
The first and second source/drain regions 160N and 160P may be formed after third and fourth gate structures 140N-a and 140P-a are formed. Alternatively, the third and fourth gate structures 140N-a and 140P-a may be formed after the first and second source/drain regions 160N and 160P are formed.
FIG. 7A is a perspective view of a semiconductor device 100 c according to an exemplary embodiment.
FIG. 7B is a cross-sectional view of the semiconductor device 100 c. FIG. 7B illustrates cross-sectional planes taken along lines A-A′, B-B′, C-C′, and D-D′ of FIG. 7A.
FIG. 7C is a cross-sectional view of the semiconductor device 100 c. In particular, FIG. 7C is an enlarged cross-sectional view taken along lines B-B′ and D-D′ of FIG. 7A.
The semiconductor device 100 c is similar to the semiconductor device 100 described with reference to FIGS. 1A through 1C, except for the shape of a first source/drain region 160N-a, and thus, descriptions will be made by focusing on the difference. Hereinafter, like reference numerals refer to like elements.
Referring to FIGS. 7A through 7C, the first source/drain region 160N-a may be formed to include the first side wall FS-1N extending from an upper surface of the base portion 112 a and inclined at a first intersecting angle θ1 with respect to an upper surface of the substrate 110, the fourth side wall FS-2N contacting an uppermost portion of the first side wall FS-1N and inclined at a fourth intersecting angle θ4 with respect to the upper surface of the substrate 110, and a second upper surface PS2 contacting an uppermost portion of the fourth side wall FS-2N and extending in a direction substantially parallel with the upper surface of the substrate 110.
Two fourth side walls FS-2N do not contact each other, and the second upper surface PS2 may contact the two fourth side walls FS-2N, between the two fourth side walls FS-2N. The second upper surface PS2 may flatly extend throughout the entire area or may be substantially parallel to the main surface of the substrate 110. A portion of the second supper surface PS2, which contacts the fourth side wall FS-2N, may have a rounded shape.
According to an exemplary embodiment, an upper portion of the first source/drain region 160N (refer to FIG. 2I) including two fourth side walls FS-2N contacting each other to form an edge as illustrated in FIG. 2I, may be anisotropically etched so that the second upper surface PS2 of the first source/drain region 160N-a may be formed. In other exemplary embodiments, the second upper surface PS2 of the first source/drain region 160N-a may be formed by using an additive that is used to control a growth speed according to a silicon crystallographic plane, in the process of growing the first source/drain region 160N-a. In other exemplary embodiments, the second upper surface PS2 of the first source/drain region 160N-a may be formed by adjusting a type and a flow amount of source gas, and a temperature and a pressure in a chamber, to control the growth speed according to the silicon crystallographic plane, in the process of growing the first source/drain region 160N-a.
A height H6 of the first source/drain region 160N-a, that is, a vertical distance from a bottom surface of the first source/drain region 160N-a to the second upper surface PS2 may be less than or substantially the same as the height H4 of the second source/drain region 160P.
FIG. 8A is a perspective view of a semiconductor device 100 d, according to an exemplary embodiment.
FIG. 8B is a cross-sectional view of the semiconductor device 100 d. FIG. 7B illustrates cross-sectional planes taken along lines A-A′, B-B′, C-C′, and D-D′ of FIG. 7A.
The semiconductor device 100 d is similar to the semiconductor device 100 described with reference to FIGS. 1A through 1C, except that the semiconductor device 100 d has a plurality of channel regions CH. Thus, descriptions will be made by focusing on the difference. Hereinafter, like reference numerals refer to like elements.
Referring to FIGS. 8A and 8B, the fin structure 112 having a pair of channel regions CH and the recess 112R1 located between the pair of channel regions CH may be formed on the substrate 110.
A pair of first gate structures 140N may be provided on the pair of channel regions CH, respectively. The pair of first gate structures 140N may include the first gate electrode 144N extending to cross the fin structure 112, and the first gate insulating layer 142N disposed between the channel region CH and the first gate electrode 144N. The first source/drain region 160N may be formed on a bottom surface of the recess 112R1 between side surfaces of the pair of channel regions CH, the side surfaces facing each other. A pair of first spacers 152N may be formed on upper surfaces and side walls of the pair of first gate structures 140N, and a pair of third spacers 154N may be formed on side walls of the pair of first spacers 152N.
| 45,540 |
https://github.com/luckyframework/wordsmith/blob/master/spec/support/inflector_test_cases.cr
|
Github Open Source
|
Open Source
|
MIT
| 2,023 |
wordsmith
|
luckyframework
|
Crystal
|
Code
| 863 | 3,182 |
module InflectorTestCases
SingularToPlural = {
"search" => "searches",
"switch" => "switches",
"fix" => "fixes",
"box" => "boxes",
"process" => "processes",
"address" => "addresses",
"case" => "cases",
"stack" => "stacks",
"wish" => "wishes",
"fish" => "fish",
"jeans" => "jeans",
"funky jeans" => "funky jeans",
"my money" => "my money",
"category" => "categories",
"query" => "queries",
"ability" => "abilities",
"agency" => "agencies",
"movie" => "movies",
"archive" => "archives",
"index" => "indices",
"wife" => "wives",
"safe" => "saves",
"half" => "halves",
"move" => "moves",
"salesperson" => "salespeople",
"person" => "people",
"spokesman" => "spokesmen",
"man" => "men",
"woman" => "women",
"human" => "humans",
"basis" => "bases",
"diagnosis" => "diagnoses",
"diagnosis_a" => "diagnosis_as",
"datum" => "data",
"medium" => "media",
"stadium" => "stadia",
"analysis" => "analyses",
"my_analysis" => "my_analyses",
"node_child" => "node_children",
"child" => "children",
"experience" => "experiences",
"day" => "days",
"comment" => "comments",
"foobar" => "foobars",
"newsletter" => "newsletters",
"old_news" => "old_news",
"news" => "news",
"series" => "series",
"miniseries" => "miniseries",
"species" => "species",
"quiz" => "quizzes",
"perspective" => "perspectives",
"ox" => "oxen",
"photo" => "photos",
"buffalo" => "buffaloes",
"tomato" => "tomatoes",
"dwarf" => "dwarves",
"elf" => "elves",
"information" => "information",
"equipment" => "equipment",
"bus" => "buses",
"status" => "statuses",
"status_code" => "status_codes",
"mouse" => "mice",
"louse" => "lice",
"house" => "houses",
"octopus" => "octopi",
"virus" => "viri",
"alias" => "aliases",
"portfolio" => "portfolios",
"vertex" => "vertices",
"matrix" => "matrices",
"matrix_fu" => "matrix_fus",
"axis" => "axes",
"taxi" => "taxis", # prevents regression
"testis" => "testes",
"crisis" => "crises",
"rice" => "rice",
"shoe" => "shoes",
"horse" => "horses",
"prize" => "prizes",
"edge" => "edges",
"database" => "databases",
# regression tests against improper inflection regexes
"|ice" => "|ices",
"|ouse" => "|ouses",
"slice" => "slices",
"police" => "police",
}
CamelToUnderscore = {
"Product" => "product",
"SpecialGuest" => "special_guest",
"ApplicationController" => "application_controller",
"Area51Controller" => "area51_controller",
}
UnderscoreToLowerCamel = {
"product" => "product",
"special_guest" => "specialGuest",
"application_controller" => "applicationController",
"area51_controller" => "area51Controller",
}
SymbolToLowerCamel = {
product: "product",
special_guest: "specialGuest",
application_controller: "applicationController",
area51_controller: "area51Controller",
}
CamelToUnderscoreWithoutReverse = {
"HTMLTidy" => "html_tidy",
"HTMLTidyGenerator" => "html_tidy_generator",
"FreeBSD" => "free_bsd",
"HTML" => "html",
"ForceXMLController" => "force_xml_controller",
}
CamelWithModuleToUnderscoreWithSlash = {
"Admin::Product" => "admin/product",
"Users::Commission::Department" => "users/commission/department",
"UsersSection::CommissionDepartment" => "users_section/commission_department",
}
ClassNameToForeignKeyWithUnderscore = {
"Person" => "person_id",
"MyApplication::Billing::Account" => "account_id",
}
ClassNameToForeignKeyWithoutUnderscore = {
"Person" => "personid",
"MyApplication::Billing::Account" => "accountid",
}
ClassNameToTableName = {
"PrimarySpokesman" => "primary_spokesmen",
"NodeChild" => "node_children",
}
UnderscoreToHuman = {
"employee_salary" => "Employee salary",
"employee_id" => "Employee",
"underground" => "Underground",
"_id" => "Id",
"_external_id" => "External",
}
UnderscoreToHumanWithKeepIdSuffix = {
"this_is_a_string_ending_with_id" => "This is a string ending with id",
"employee_id" => "Employee id",
"employee_id_something_else" => "Employee id something else",
"underground" => "Underground",
"_id" => "Id",
"_external_id" => "External id",
}
UnderscoreToHumanWithoutCapitalize = {
"employee_salary" => "employee salary",
"employee_id" => "employee",
"underground" => "underground",
}
MixtureToTitleCaseWithKeepIdSuffix = {
"this_is_a_string_ending_with_id" => "This Is A String Ending With Id",
"EmployeeId" => "Employee Id",
"Author Id" => "Author Id",
}
MixtureToTitleCase = {
"active_record" => "Active Record",
"ActiveRecord" => "Active Record",
"action web service" => "Action Web Service",
"Action Web Service" => "Action Web Service",
"Action web service" => "Action Web Service",
"actionwebservice" => "Actionwebservice",
"Actionwebservice" => "Actionwebservice",
"david's code" => "David's Code",
"David's code" => "David's Code",
"david's Code" => "David's Code",
"sgt. pepper's" => "Sgt. Pepper's",
"i've just seen a face" => "I've Just Seen A Face",
"maybe you'll be there" => "Maybe You'll Be There",
"¿por qué?" => "¿Por Qué?",
"Fred’s" => "Fred’s",
"Fred`s" => "Fred`s",
"this was 'fake news'" => "This Was 'Fake News'",
}
OrdinalNumbers = {
"-1" => "-1st",
"-2" => "-2nd",
"-3" => "-3rd",
"-4" => "-4th",
"-5" => "-5th",
"-6" => "-6th",
"-7" => "-7th",
"-8" => "-8th",
"-9" => "-9th",
"-10" => "-10th",
"-11" => "-11th",
"-12" => "-12th",
"-13" => "-13th",
"-14" => "-14th",
"-20" => "-20th",
"-21" => "-21st",
"-22" => "-22nd",
"-23" => "-23rd",
"-24" => "-24th",
"-100" => "-100th",
"-101" => "-101st",
"-102" => "-102nd",
"-103" => "-103rd",
"-104" => "-104th",
"-110" => "-110th",
"-111" => "-111th",
"-112" => "-112th",
"-113" => "-113th",
"-1000" => "-1000th",
"-1001" => "-1001st",
"0" => "0th",
"1" => "1st",
"2" => "2nd",
"3" => "3rd",
"4" => "4th",
"5" => "5th",
"6" => "6th",
"7" => "7th",
"8" => "8th",
"9" => "9th",
"10" => "10th",
"11" => "11th",
"12" => "12th",
"13" => "13th",
"14" => "14th",
"20" => "20th",
"21" => "21st",
"22" => "22nd",
"23" => "23rd",
"24" => "24th",
"100" => "100th",
"101" => "101st",
"102" => "102nd",
"103" => "103rd",
"104" => "104th",
"110" => "110th",
"111" => "111th",
"112" => "112th",
"113" => "113th",
"1000" => "1000th",
"1001" => "1001st",
}
UnderscoresToDashes = {
"street" => "street",
"street_address" => "street-address",
"person_street_address" => "person-street-address",
}
Irregularities = {
"person" => "people",
"man" => "men",
"child" => "children",
"sex" => "sexes",
"move" => "moves",
"cow" => "kine", # Test inflections with different starting letters
"zombie" => "zombies",
"genus" => "genera",
}
MixtureToParametize = {
"Product" => "product",
"PrimarySpokesman" => "primaryspokesman",
"special_guest" => "special_guest",
"Admin::Product" => "admin-product",
"admin/product" => "admin-product",
"this was 'fake news'" => "this-was-fake-news",
"david's Code" => "david-s-code",
}
MixtureToParametizeWithUnderscore = {
"special_guest" => "special_guest",
"Admin::Product" => "Admin_Product",
"this was 'Fake News'" => "this_was_Fake_News",
"Admin/Product" => "Admin_Product",
"david's Code" => "david_s_Code",
}
end
| 48,830 |
O76FqeHS0h8_1
|
Youtube-Commons
|
Open Web
|
CC-By
| null |
Shorts | ਕਿਸਾਨਾਂ ਨੇ ਲਾਏ ਪੱਖੇ, ਅੱਥਰੂ ਗੈਸ ਦਾ ਲੱਭਿਆ ਹੱਲ | Farmers Protest 2024 | Tear Gas | #shorts
|
None
|
Hindi
|
Spoken
| 55 | 150 |
भी पाटी ज़ु situated phum.. था द्तू गेसागQuida19 तो दर तद ख़चान तर पचचे on respectively two teams तो लगतर अना भी पषटा भी ausimadkar anto nan calm वो ळफ डवजों जंसा दे पनी दी मजे गये इनू phodri 속b paye purhisha iten तढ़ेदर वागग seamとか kach strta शारची मोस धव� bone na bo zaj.
| 17,914 |
bpt6k474663n_2
|
French-PD-Newspapers
|
Open Culture
|
Public Domain
| null |
Le Petit Parisien : journal quotidien du soir
|
None
|
French
|
Spoken
| 7,392 | 12,277 |
Puis, dans le milieu de la journée, c'est l'envahissement des tables des restaurants des Champs-Elysée», ou, dans la cohue, s'improvise, en traits mordants, la critique du nouveau Salon. On prend une revanche des approbations facilement décernées, tandis que les inquiets », les peintres qui cherchent une opinion sincère demeurent dans les alentours de leur toile, attendant un jugement qui soit impartial et désintéressé. Ah les peintres c'est en ce jour-là qu'on voit quelle place ils se sont faite dans la vie moderne. Les préjugés bourgeois sut leur compte ? Cela marque une époque assez reculée Autrefois, les pères de famille tremblaient à la pensée que leurs fils eussent la vocation de la peinture maintenant, ils les pousseraient volontiers dans cette carrière M. Stevens nous contait, à ce propos, une piquante anecdote. il y a quelque temps, un brave homme, accompagné d un gamin de quatorze ans, venait frapper à la porte de son atelier. Cher mattre. lui disait-il, je voudrais vous demander votre avis. Voici ce que fait mon fils. N'y a-t-il pas en lui, comme je le pense, l'étoffe d'un artiste qui pourra réussir? M. Stevens regarda les ébauches qu'on lui présentait, les examina de près, hocha la tête, fronça le sourcil. Vous voulez mon avis bien sincère ? dit-il. Sans doute. Eh hten faites de votre enfant tout ce que vous voudrez. excepté un peintre. Le père parut atterre; mais le gamin, triomphant, de s'écrier -Tu vois bien, papa, que je n'avais pas la vocation Quel bonheur! Je pourrai donc entrer dans le commerce C'est la légende ancienne retournée, la légende du père sceptique et du fils martyr. On dit plaisamment qu'il y a à Paris trois écoles »; on veut dire trois quartiers de peintres. On peut observer, cependant, que ces quartiers ont des physionomies bien distinctes. Les peintres de la Rive-Gauche semblent être les plus simples, les plus laborieux. C'est la rue Notre-Dame-des-Champs qui est la grande rue des arts, là-bas. Les ateliers ne sont point aussi pimpants qu'ailleurs, en général ils sont plus sérieux. Les logis confinent aussi, la plupart du temps, aux ateliers. On dirait que le voisinage de l'Ecole des Beaux-Arts fait régner là l'influence de la tradition classique. Les grands enthousiasmes qui se perdent souvent avec l'Age, hélat ont là leur domaine. On est plus fantaisiste sur la Rive-Droite, à Montmartre. C'est comme le quartier-général de la peinture militante. Là on cherche du nouveau, on bataille pour des idées hardies, on ne recuie pas devant le tapage pour attirer l'attention sur une oeuvre. L'avenue Frochot est un des centres de cette production très vivante. Le* ateliers sont souvent plut gais, plus jeunes d'aspect; l'imprévu s'y rencontre plus Et ce fioat iuasi, dans lea calés de MoAt martre, de belles et chaudes discussions sur l'art. Dans le quartier de Yiluert, enfin, c'est l'aristocratie des peintres. C'est l'école du chic et du chèque Ce ne sont plus là seulement des ateliers, ce sont des hôtels qu'ont les artistes. La place Malesherbes forme comme le centre de cette ville particulière. Sur le portail de chaque maison on pourrait écrire un nom connu. La. on n'a plus le temps de s'amuser; il n'y a plus de folles réunions de rapins, comme a Montmartre, à la villa des artistes u. Si on donne des soirées et des bals, c'est nécessité d'entretenir la renommée. On est là plus adroit et moins sincère que sur la Rive-Gauche. Ce sont les « arrivés ceux que connaît surtout l'étranger. Les peintres mondains n'ont plus le temps d'avoir la foi. comme les naïfs. Le jour du Vernissage », les représentants des trois écoles » se rencontrent, sa croisent, mais ils ne fusionnent guère. 000 Il y a encore une quatrième école ». Ce sont les peintres qui habitent la banlieue. Ce sont les grands travailleurs, ceux qui ne veulent être dérangés par aucune tentation, qui cherchent l'inspiration dans le calme, à qui il faut des ateliers plus vastes, et qui savent aussi que la fortune ne va point toujours aux nobles tentatives. Le jour du « Vernissage ils connaissent moins de monde que les autres, ils échangent moins de coups de chapeaux, mais c'est peutêtre l'œuvre d'un d'entre eux qui causera la plus de surprise. Et les pauvres refusés Ah! pour ceux-là, le jour du « Vernissage » est un jour de martyre il leur rappelle leurs cruelles déceptions les espérances emportées à vau-l'eau, les beaux rêves écroulés. Et ils maudissent le Jury, qui aurait bien pu avoir un peu plus de clémence, pensentils, pour leurs efforts. Mais quoi ils peuvent espérer du moins prendre leur revanche l'an prochain, et ils se consolent en pensant à toutes les premières épreuves des artistes qui sont devenus illustres. SALON_DE 1889 C'est notre habitude, chaque année, de donner un coup dœil d'ensemble sur le Salon de peinture et de sculpture. Celui de cette année contient un grand nomi bre d'ouvrés remarquables il donnera certat1 ne ment aux étrangers, venus à Paris pour l'Exposition, une idée excellente de l'Art français. En quelques articles publiés a intervalles, nous que nous voulons aujourd'hui, c est sans nous soucier de l'ordre des salles passer une revue rapide des principaux tableaux et statues. En ar ivant par le grand escalier, ce que l'on aperçoit tout d'abord sur le palier, c'est la ['elle (le lu Fédération, de M. Henri Martin. Superbe évocation de la Révolution française Une fièvre d'enthousiasme agite cette foule assemblée pour l'accomplissement d'un acte de foi civique. thr est au Champ-de-Mars; le soleil est éclatant.Aux premiers plans, les députés du Tters-Ëtats, les officiers de l'armée, avec les mains levées, les épées tendues, sont rangés autour de l'autel de de la loi. Au fond, la foule innombrable est baignée de lumière. un discutera beaucoup le Bac chut de U. Carolus Uuran. A coup sûr, 1 artiste ne s'est pas dépassé. Bacchus est trainé sur un char d'or, autour duquel des hommes et des femmes marI chent en dansant, en chantant et en s'embrassant. 11 nous a paru que le Bacchu» de M. Carolus uui ran n'avait pas le vin gai 11 a l'air terriblement triste, le dieu des vignes, et les gens qui rient à ses côtés semblent avoir la joiefoi-cée' Une toile dont l'effet est saisissant, c'est le Sauvetage, de M. Dawant. Elle rappelle la scènes du naufrage de la Victoria. La mer, terrible, nat les flancs du navire. Déjà, quelques passagers 'sont dans la barque de saiivetaxo. II a des I vieillards, des hommes atterrés, des mères attolues. Pendus à des cordes, des passagers descendent du vaisseau. Un matelot étreint dans ses bras un enfant que sa mère appelle du geste. Dans la barque, les marins ne sont occupés qu'a i lutier contre la vague qui voudrait tes emporter loin du navire. L'oeuvre est d'un puissant elîet 1 dramatique. Won loin de là, M. Chlgot expose une vaste composition F'uyant l'invasion. Des prêtres du Mosen-Age, précédés de leur évèque, il pied, conduisent un lourd chariot que trainent des bœufs; on y a jeté pêle-mêle les richesses de l'église. Les visages sont bouleversés, le ciel est tourmenté, dramatique. Ce n'est point sans un battement de cœur que tout Français s'arrêtera devant le tableau dont M. Boutiguy a puisé le sujet dans les récits militaires du général Ambett. Cela s'appelle Un Brave. Ecoutez, le récit du général Ambert Un peu avant cinq heures, les Allemands occupèrent Epioei au moment où les vainqueurs descendaient le faubourg Saint-Michel, un homme, sans se laisser toucher par les cris do sa femme et de ses enfants, sortit préctpltamment de sa maison et se plaça au milieu de la route, genou en terre, épaulant sa carabine. Lorsque les premiers rangs ne furent qu'à une centaine de pas, Dubois abaissa lentement sa carabine et fit feu. Un Allemand roula sur la route; presque en même temps, un second coup part;t et Ht rouler un Prussien hors des rangs. Feu! cria un officier. Ainsi mourut Dubois, le vieux soldat d'Afrique et de Crimée. » L'homme est agenouillé au milieu de la rue. Il épaula et tire sans écouter les cris affolés des femmes qui remplissent le coin de droite du tableau. Traitée très simplement, cette toile canse une Impression profonde. Un autre tableau patriotique, c'est celui de M. Gardette le général Marguerite, les joues et la langue traversées par une balle, se maintient à cheval, et, par des cris rauques, ordonne encore aux hussards de charger (bataille de Sedan, le i" septembre 1870). M. Gardette a interprété cette page sanglante avec force. C'est là certainement une des meilleures ceintures militaires qu'on ait vues depuis quelques années. M. Moreau (de Toursi s'est aussi constitue l'historien des bataille» de bon tableau En arant! est fait pour émouvoir. Un colonel, frappé mortellement, eapire dans les bras d'un soldat, mais sa main est tendue vers l'ennemi et il indique à se» troupes qu'il faut le laisser là, qu'il faut continuer à combattre. Après ces taUeaui de combat, il convient de eiter celui de M. Gabriel Ferrier les Mères mau~dissent la qiif>rre. Tonte la horde des conquérants faroucbespasse,s«ntatladévastationet la mort, à l'horizon; l'air est obsoarci par la fauve clarté des incendies et fuyant le carnage, les femmes, les mères, échevelées et demi-nues, emmènent leurs enfants. La moisson de sang est faite, et, dans la grande et sinistre clameur des combattants, la fumée s'élève et des nuages pasaent comme des oiseaux funèbres. I1 y a beaucoup de pathétique dans cette vaste composition, une violenta allure, de la science, des des notes un peu criardes c'est une belle œuvre qui n'atteint pas, cependant, à la perfection. On s arrête beaucoup devant la tableau de M. Georges Cain Une Barrirade en ft.io. Des mal. sons sont enveloppées de Xum4« jusqu'au second étage. des coups de feu partent de foutes les fenêtres et, au loin, derriars l'amoncellement de pavés et de débris qui fermt tout l'heure la rue, les casques des carabiniers apparaissent et les cuirasses luisent au soleil oblique. 1A résistance est à bout. Quelques lntrépMM tel encore an enfant tient un pistolet à la main 1 un vieil émeutier se retourne pour rappeler Ua combattants un suprême effort. Au premier pian, un tressé est couché sur un matelas, qu une femme soutient. Et sur tout cela plane l'horreur de la guerre civile. Avec 103 Hommes du Saint-Office, M. J.-P. Laurens demeure fldéle aux scènes de l'Inquisition. Quel supplice méditent-ils, ces trois vieillards assis dans un calai* gothique Deux d'entre eus encapuchonnés comme des frocards, consultent les codas ecclésiastiques pour y trouver quelque horrible condamnation, Bans doute le troisième, assis au milieu de lit sajle sur una façon de trône ecclésiastique, semble inspinr la discussion, et médite, le menton dans la main. M. Georges Roehegrosse a peint le Bal des Ardent». Un sait qu'en pleia i»al chez le roi Charles VI, de» seigneur* qui s étaient déguisés en sauvages furent brtil6s vifs. Dans une admirable salle toute ruisselante de lumiéte, ces hommes en feu, semblant des ours dont la toison se serait enflammée, se ruent au milieu des femmes en robes de brocard magnifique. ("est une évocation saisissante d'un souvenir du Moyen-Age. La chef-d'œuvre signé Tattegrain Louis XIV VUit» le champ de bataille des Dunes, hutt jours après la victoire d'un côté dans le sable, déchirés par le bec des oiseaux de proie, harcelés par les insectes, les cadavres des combattants, hommes et ahevaux de l'autre, Louis XIV, élégant, respirant des fleurs pour éviter codeur désagréable des braves gens qui se sont divoués pour sa gloire à côté. les courtisans chassent à grande coups toute la plèbe qui grouille après leurs chausses, réclamant une tumOne pour leurs misère» écloppées. Vous plalt-il de vous reposer de la vue de ces grandes scènes terribles ? Voici des tableaux ou les oiseaux chantant, où les sources courent nous les feuillages, où la belle vie éclate Tout à fait exquis la tableau que M. Raphael Collin a appelé la Jeunesse. Dans l'herbe fleurie, au pied d un tronc d'arbre ofj s'enlace le lierre, une jeune femme est assise, et lui, l'amoureux est couché sur le ventre, devant elle, l'enveluppant de son bras, le tlano frôlant ses genou][, tendant sa bouche vert la sienne et savourant 1'étreinte douce dont elle ferme le nu:ud tK-de avec ,et «nains, sur sa nuque. Hien de plus chaste et de plus voluptueux que cette double pose et qui tente mieux l'amoureux abandon des premières confidences Le Salut au Soleil, de M. Delacroix, c'est un réveil de sirènes acclamant l'aurore du haut d'un promontoire on est venue les réveiller la première flèche du Jour. Sur la mer, c'est un grand rayonnement d'or. Les dernières étoiles disparalssent et l'on voit voler les premiers alcyons. Nous recommandons une Jolie Idylle paysanne empruntée à un conte provençal d'Alphonse t'audet Un Estellos les Etoiles., deux adolescents reposés l'un prAs de t autre, tandis que pâlissent les étoiles, dans le Jour lentement revenu. Mme Demont-Breton aura le plus grand succès avec son charmant tableau intltulé l'Homme est en mer. Devant la cheminée qui éclaire le groupe, la femme d'un marin, tenant l'enfant sur ses genoux, songe à l'absent. Le sentiment de cette épouse d'humble est tout a fait joli. NI larmes envahissantes, ni vulgaire expression douloureuse dans les traits, mais bien une vague mélancolie, une peur de l'inconnu; les secrets frissonnements du coeur sont indiqués avec une grande sobriété d'expression qui les rend encore plus touchants. Le Vitriol, de M. Pelez, est un « fait-divers Une femme vêtue de noir, debout le long d'une porte par où filtre le jour, attend, les veui hagards, la bouche frémissante, l'entrée d'un personnage qu'on devine en train de monter l'escalier. Dans sa main gauche, elle tient par l'anse une sorte de tasse en métal, dont elle va jeter le terrible contenu au visage de celui qui arrive, Mme Marthe Lacote expose une étude fort habile Après le bal. Dans le boudoir, où brûle la lampe enveloppée d'un abat-jourjaune, une jeune personne, avant de revêtir son costume de nuit, lette un regard complaisant sur un miroir où se réfléchit l'image de ses chairs teintées do clarté crue. Toutes les parties de détail sont bien traitées, entre autres les satins de la robe avec ses jeux changeants de lumière. Mais il faut abréger, et nous ne pouvons que citer les Blés noirs de M. Quignon, la Faréi (te Fontainebleau de M. Léon Ricnet, le Brouillard du Matin de M. Dameron. deux portraits defemme de M. Cabanel, deux très beaux paysages de Loup-Hlanc, 1 Ambroist Paré au siège de Yelz de la de M. SchutzenM. Benjamin-Constant nous a rapporté de son voyage au Maroc le Jour des Funérailles. Un chef nègre, mort, vêtu de ses plus beaux burnous, est couché sur un tapis, au milieu d'une salle basse. Ses armes sont à ses pieds et le drapeau de la tribu à ses cblks accroupies sur le divan bas qui fait le tour de la salle, les femmes font la veillée des larmes. M. Bouguoreau expose l'Amour enfant Psyché. Dans la vie rustique. M. Capdevieille a choisi un épisode tristo et pittoresque. Il nous montre Un idiot dans le s'ldl on dit Plus joliment un « tade », l'hamme hanté des féesqui traverse une rue de village sous les quolibets des belles filles et des méenants garçons. C'est une bonne toile, un peu grande pour le motif. Un regardera avec émotion le Retour d'exil de M. Delort, représentant une femme et un enfant, en demi qui rentrent dans une maison vide. La grande attraction de la salle Xll est certainement le tableau de M. Gêrome il a représenté une Immense cage de fauves lions.tigres, panthéres-qui obéissent au dompteur, et le dompteur n'est autre qu'un petit Amour au, souriant et une flamme au front. Citons encore l'Enfant à la Vache, de M. Bol, le Chargement de foin, de M. Veyrassat, le Trio champêtre, de M. Debat-Ponsan, le Départ pour la ptche, de M. Haquette, le samedi dans un quartier jutf au Maroc, de M. Leconte de Nouv. l'Endormie de M. Poussin, (Araignée, de Il. Z1em, Atelier de modiste, de M. Darasse, les Canotiers, de M. Gueldry, et enfin les tableaux de MM. Henner.Charles Jacques, Desboutin, Allongé, Toudouzo, RossetGranger, Girardet, Rdjat, Le Blant, YoUod. etc. Il faut mentionner encore la Visite à l'hôpital, N» 89. Feuilleton du PsTiT Pajusisn. FANFAN GRAND ROMAN INÉDIT ̃mOIBEfeaCB PARTIS LE TRAIT-D'UNION VI (suite) Sur la piste Puit, avec cette obstination d'espérance qui ne la quittait pas, malgré les déceptions, malgré les échecs Qui sait?. Il le connaît peut-être. Des enfants du même Age se rencontrent parfois. font connaissance. Le hasard. Je n'ose pas dire Dieu. peut faire que ce pauvre malheureux ait trouvé sursaroutel'autre malbeuraur que je cherche. Je veux lui parler. D'ailleurs ne dois-je pas avoir compassion de lui?. Précisément accotant sa voiture au trottoir, l'enfant s'arrêtait auprès de Ramon pour reprendre haleine Mais il fut aussitôt saisi par une quinte de toux. Près de suffoquer, Il s'appuya contre le lourd fardeau qu'il traînait, se cramponnant au mur de l'autre main pour ne pas tomber en vomissant un flot de sang. Sa face d'abord congestionnée se couvrait d'une pâleur livide mes que la quinte s'apaisait Traduotlouet reproduction iuterditea» de M. Geoffroy, une excellente toile. Un ouvrier est assis au pied du lit de son enfant, dont le sourire est mélancolique plus loin, un autre enfant embrasse son (rare. Tous les pauvres petits sont dans des lits bien blancs et un jour tamisé par les rideaux tombe dans cet asile des premières misfres, qui pour quelques-uns seront touto la vie. Mais la place nous manque. Et que de noms oubliés! Le journal neDans la section de sculpture, citons rapidement la Jeanne de NI. Paul t)uboia,la Vusique de M. Falguière, le uêie de M. Vasselot, la Force brutale étouffant le Génie de M. Godebski, tes Exilés de M. Mathurin Moreau, le Premier Amour de Ni. Hector Lemaitre, le Baiser surrtme de M. Christophe, la Chanson de M. Charpentier, etc. La Grève des Professeurs Libres Dans une lettre adressée an président du Conseil municipal, les professeurs libres demandaient que le Conseil, par une subvention, les aidât à se passer des bureaux de placement. Ils ont été reçus hier par M. Chautemps, préaident du Conseil municipal, auquel ils ont Mumis leurs revendications. L'AGE DU* MARIAGE L'Allemagne est en train de refaire son Code civil. Voulant fixer rage auquel les Allemands et les Allemandes pourront se marier, âge qui varie suivant les diverses provinces, ullo a fait rechercher les règles établies dans les différents pays d'Europe. U ressort de ces recherches qu'en Rusale les hommes peuvent se marier à dix-huit ans, les femmes à seize en France et en Belgiqae, les hommes à dü-huit ans et les femmes à quinze. Il en est de mème en Hongrie pour les protestants mais les catholiques peuvent se marier les hommes à quatorze ans et les femmes à douze, comme en Espagne, en Grèce, en Portugal et en Suisse en Autriche on se marie, hommes et femmes, depuis quatorze ans. En Angleterre et en Turquie, il n'y a pas d'âge minimum. Quel est le pays le plus favorisé? On peut dite qu'il n'y a pas d'âge pour les UN MEURTRE ElTcHEMlN DE FER C'n ouvrier tuilier, qui se trouvait dans un wagon du train de Coblentz à Cologne, avait été brutal vis-à-vis de la femme d'un voyageur français. Celui-ci lui fit de vives remontrances. Alors, l'ouvrier allemand tira son couteau et blessa notre malheureux compatriote au basventre et au bras. Le coupable a été arrêté l'arrivée du train à Cologne. La victime, grièvement atteinte, a été transportée à l'hôpital de Pette ville sou état inspire des inquiétudes. Un Explorateur Afghan Nos voyageurs explorent et fouillent les contrées les plus arriérées du globo il no faudrait pas croire que ces contrées ne nous détachent pas à l'occasion, elles aussi, quelques explorateurs chargés do nous étudier à leur point de vue. M. Arminius Vambéry, qui entretient des relations continues avec l'Asie centrale, vient de recevoir à Budapest une singulière visite celle d'un explorateur afghan, possédé de l'amour des voyages et qui a poussé jusqu'en Europe, à peu près comme Mungo-Park poussait en son temps jusqu'au Cathay, c'est-4-dlre en mendiant, d'étapa en étape. Cet explorateur est un derviche; il s'appelle! Mohammed Naïm, natif de Kandahar, et appartient à la tribu afghane de Kaker. C'est un jeune homme de vingt-cinq ans à peine, pourvu d'une paire d'yeux magnifiques et d'une superbe barbe noire, avec cette hauteur de ton et d'allure qu'on trouve souvent chez les hommes de son pays, et l'insouciance la plus complète des biens de ce monde, sous ses bail-'lons. Naïm a quitté sa ville patale, il y a trois ans, pour s'en aller à Rokhara et y séjournât deux semaines en qualité de « murtd » ou novice de l'Ordre des derviches !:adrt. En retournant chez lui par Hêrat, Il a eu la curiosité de visiter l'Inde. Ayant déjà vu des Russes au delà del'Oxus, il éprouvait le besoin de voir des Anglais, afin de les comparer les uns aux autres. Cette comparaison l'a amené conclure que les Anglais, quoique infidèles comme les Russes, sont beaucoup plus sages et, par conséséquent, ont beaucoup plus de chances de finir par occuper l'Afghanistan. « Les uns, dit-il, sont, pour la sagesse, comme des hommes de quarante ans; les autres, comme des jeunes gens de 'Vingt-cinq quant aux Afghans, ce sont des enfants indisciplinés et querelloura, qui tomberont nécessairement au pouvoir de l'un ou l'autre de leurs voisins; et, comme toujours, la victoire restera au plus Ayant visité l'Inde, Naïm est passé en Arabie, puis en Egypte, puis en Syrie et en Asie-Mineure, à Constantinople, enlin en Bulgarie et en Bosnie. Ayant entendu parler là du tombeau de GuiBaba, qui marque en Occident la limité extrême du monde musulman, il résolut de s'y rendre en pèlerinage et c'est ainsi qu'il pénétra dans le monde chrétien, pour arriver bientôt à Budapest. Ce qu'il y a de vraiment curieux et de hardi dans son entreprise, c'est qu il ne sait pas un mot de hongrois et ne parait môme pas capable d'écrire une seule langue orientale. Cela ne l'empêche pas d'aller de l'avant et de recueillir sur ce qu'il volt des observations pleines de saveur. Son procédé consiste à se faire écrire sur des bouts de papier la requête des choses nécessaires à la vie Donnez-moi du pain, de l'eau, du .Mon Dieu! fit Ramon, mais cet enfant va se trouver mal! La femme compatissante s'était éloignée. Personne n'apparaissait dans la rua déserte. Il s'avança vivement vers le pauvre petit et le prit entre ses bras pour le soutenir. Celui-ci, bravement, s'était aussitôt redressé. Ça n'est rien, monsieur, dit-il. c'est mon rhume. Et voilà que c'est fini 1. Mais je vous remercie tout de même. Voudriezvous m'indiquer la rue d'Alésia?. La rue d'Alésia?. Oui, monsieur. Je dois rattraper cette rue-là, et la suivre toujours tout droit pour aller où je vais. Et où vas-tu ?. Est-ce loin ?. Dame! je n'y suis pas encore 1. C'est derrière l'hospice Sainte-Anne. Et tu viens d'où?. Du viaduc d'Auteuil. Oh! U y a un bout de chemin. mais je ne suis pas pressé. je peux aller tout doucement. Mais qui t'envoie si loin avec un pareil fardeau Ton patron?. Non, monsieur. Ce sont mes parents. Mon onde et ma tante. Nous déménageons aujourdliui, et il faut bien, u'aat-ce pas? que chacun aide, suivant ses moyens. Pourquoi n'ont-ils pas pris un homme pour traîner cette lourde charge?. Pourquoi?. Dame! je ne sai» pas-peutêtre parce qu'ils n'ont pas uw d'argent pour faire cette dépense. Une nouvelle quinte da toux empêcha l'enfant de continuer. pour une nuit., etc. il loge ces bouts de papier dans son turban. dans sus ruaucb.es, dans la bordure de sa robe ou ailleurs, et, au moment voulu, exhibe celui qui lui est nécessaire. Il a soin aussi de se ptémunit de lettres d'introduction pour les maires. les personnes Influentes ou notabies des pays qu'tl parcourt, et, à ce système renouvelé des moines franciscains, II arrive voir du pays sans manquer de rien. L'ORAGE*A PARIS Hier après-midi, vers deux heures et demie. un orage des plus violents a éclaté sur Paris, obscurcissant le ciel à ce point que dans la plupart des magasins on a dû allumer le glU, De nombreux éclairs, plusieurs coups de tonnerre formidables, une grêle abondante accomgnée de torrents depluiu.ont surpris les prornoneurs et les ont obligés & chercaer partout des Aux Champs-Elvsées, les refuges se sont bientôt trouvés remplis en un instant par la foule. Les arcades de la rue de Rivoli étaient tellement encombrées par la foule que la circulation y était devenue impossible, Avenue de l'Opéra, deux chevaux, terrifiés par l'orage, se sont emportés dans la direction dr, la place du Théâtre-Français. 11 n'y a heureusement pas eu d'accident de personnes. Au Champ-de-Mars, tous les chantiers extérieurs ont dû être abandonnés pendant plus d'une heure. DERNIERS MURS DE L4 BOURSE 3 40 Portugais. Hongre. 273 12; 93 LES OBSÈQUES DE M. JACQMIN Hier matin ont eu lieu tes obsèques de M. Jacqmin, directeur de la Compagnie de l'Est. Le corps devant être transporté à Melun, lieu 4. naissance de M. Jtcqmin, a été conduit à la gare de Lyon. Un a placé aussitôt la bière dans un fourgon, devant lequel des discours ont été prononcés. Au nom du Ministre de la Guerre, le général Haillot, chef d'état-major général. a rappelé la participation de M.Jacqmm, depuis vingt ans, a la grande a-uvre de la défense nationale.. « Sa part, a-t-il dit, dans l'organisation militalre du service des chemins de fer, dans la transformation stratégique du réseau, dans la crémation des troupes spéciales de chemin de fer, dans l'appropriation aux besoins militaires des puissantes ressources des Cpmpa^nies, cette part a toujours été considérable, souvent même prépondérante. u L'un des premiers, Il avait reconnu et apprécié le rôle capital des chemins de fer dans tes guerres modernes. Mûries et confirmées par les épreuves de 1870, qui ont coûté de mi grands efforts à la Compagnie de l'Est, ses convictions sur la nécessité d'une forte organisation de réseaux n'avaient cessé de s'accroître et de s'aflirmer. » Les leçons qu'il fit en 1872 à l'Ecole des Pontset-Chaussées, lu Hue d.ins lequel il ne tarda pas à les mettre à la portée de tous ont été pour beaucoup dans le succès des efforts que le Ministre de ta Guerre a faits pour arriver une organisation aussi parfaite quu possible. ÉCHOS ET NOUVELLES Malgré le chiffre élevé du prix d'entrée (10 frv les visiteurs ont été fort nombreux, hier, au dalon pour le vernissage, Aujourd'hui aura heu l'ouverture. ordinaire du salon. Le prix d'entrée sera, pour ce premier Jour, de 5 francs. Une nouvelle doctoresse, Mlle Marie Pierre, doit passer sa thèse le jeudi 2 maj, à une heure, à la Faculté de médecine de Pari». Voici le récit d'une aventw* amusante qui circule à Saint-Pétersbourg On raconte que l'impératrice s'étant rendue Incognito dans une église de la capital, afin d'y faire célébrer des messes pour le rétablissement de sa fille, la grande-ducheue Xénie, dont la santé a été fort ébranlée par le désastre du train impérial, à Borki, sollicite vainement, dans ce but, le pope et deux antres desservants de cette église. Isnorant la qualité de la visiteuse, les prêtres se montrèrent même peu polis envers elle et ne changèrent d'attitude qu'au moment où ils se sentirent comme frappés de la foudre en la voyant signer sur le registre paroissial qu'elle avait réclamé Marie, impératrice de Russie ». L'incident fait grand bruit à Saint-Pétersbourg. Le Petit Africain annonce que dimanche prochain 5 mai, un grand banquet en l'honneur du Centenaire de aura lieu à Oran, sous la présidence d'honneur du général Boulanger, dont une lettre sera lue aux cauvives], Un de nos confrères racontait dernièrement le suicide d'un chien qui s'était volontairement noyé parce qu'on lui tvait administré une eorrection sérieuse à coups de fouet. Nous ne savons si le fait était exact. Mais en voici un dont 1 authenticité nous est garantie par un correspondant de Montriohard Uuir-et-Gtior,1. il s'agit d'un singe etr qui mieux est, d'ua singe savant. Il s'appelait Bertrand et faisait partie d'un Cirque allaut de ville en ville. Entre autres exercices, on l'avait dressé à tirer le pistolet, tout en galopant à cheval sur un chien. Le professeur et l'élève étaient Iert bien ensemble, ce qui n'arrive pas toujours; ils ne se quittaient guère. Tout dernièrement, on ne sait pour quel motif, le malheureux dresseur résolut d'en finir avec i la vie et, d'une balle de revolver tirée dans la Il chancela de nouveau, prêt encore à tomber. Mais c'est horrible, s'écria Ramon indigné, de soumettre à un tel labeur un enfant dans cet état! Celui-ci, cependant, tout en toussant effroyablement, faisait un geste doux de la main, semblant dire: Pardonnez-moi i. c'est une minute de patience h prendre. je suis à vous tout de suite. Et en effet, lea yeux pleins de larmes causées par la suffocation tout haletant encore, ü avait un sourire sur les lèvres en répondant à M. de Montlaur Mes parents, le plus souvent, ne m'imposent pas un travail trop pénible. Aujourd'hui, c est par extraordinaire. Mais habituellement, on me soigne comme on peut. Tu as une mère ?. Non, monsieur, je suis orphelin. J'ai été élevé par mon oncle et ma tante. avec qui je suis encore. Et quels soins te donnent-ils?. Pourquoi ne t'ont-ils pas fait entrer à l'hôpital, puisque que tu es. malade. L'hôpital. j'y suis allé, monsieur. On m'arenvoyéparee queles médecinsne savaient plus quoi me donner. G'est pourquoi mon oncle et ma tante disent que ma maladie est incurable, et que par conséquent il est inutile de dépenser de l'argent pour essayer de me guérir. Ils se trompent! Alors, ils ne font rien pour toi. et tu me disais que tu étais soigné chez toi. Oh 1 monsieur, c'est que j'ai un petit ami qui lui aussi Dense comme vous que les bouche, se lit sauter la cervelle la mort fut instantanée Le singu, témoin de 1 événement, et qui, «ans doute, n'avait raa perdu un seul détail, ramassa à terre l'arme tombée de la main de san maître et, par imitation, lit exactement la même chose. On trouva ies deux cadavres coucîiès cote A côte 1 animai tenait encore le revolver entre ses doigts crispés. Le docteur C. appelé à constater la décès du dompteur, fut stupéfait de se trouver en présence d un double suicide. M. Werndl, fondateur de la Manufacture d'armes de Steyer, et que l'on a appelé le Krupp autrichien, vient de mourir. un estime que sa succession se monte àSOmillions de francs. Malgré cette situation des plus brillantes. M. H'erndl avait conservé des sortis et des habitudes tr. s simple*. Il t-availlalt sans relâche et ne quittait guère sa fabrique que pour un ou deux jours, lorsque ses traites avec l'administration militaire rendaient sa présence indispensable Vienne. On vient d'ouvrir au Buttes-Chaumont la grand musée historique du Centenaire de la Révolution, qui est lu une de M. Bin, maire du dix-huitième arroudissemuat. Le Crime de Montech Un meurtre a été commis a Mouteça (Tarn-etGaronne. Un huissier, le sieur Fauré, s'était présenté, avant-hier, chei un habitant pour opérer uue saisie. ce dernier, devenu furieux à la vue de l'officier ministériel, le menaça de lui tirer ua coup de fusil. L'huissier voulut fuir, mais le forcené, arrivé au paroxysme de la colère, se mit à sa poursuite et ut feu. M. Fauré, atteint dansla région de l'aine,tomba mort sur te coup. Le meurtrier, qui a été arrêté, n'a manifesté aucun regret de son acte criminel. lafxcoaarBTiiruèl'tomaaugttMii PAYÉ »i'<ummui3O LES PREMUitËLiPRMTATlOl Opéra-Italien. Puridanï, opéra en trois actes de Hellini L'opéra de Bellini fait partie du répertoire obligé de toutes les compagnies italiennes. il a constltué, hier. le second spectacle de la troupe qui est en ce moment à Paria. Cinquante-quatre ans se sont écoulés depuis sa première représentation, qui eut lieu précisément à Paris. Depuis ce temps, l'art musical s'est fort élargi. Il est donc certain que cette partition, qui n est plus en accord avec nos idées actuelles, n'a plus qu un intérêt pour ainsi dire historique pour nous. Elle contient toujours des pages, cependant, qui sont demeurées extrêmement brillantes, si elles se soucient assez peu de traduire les sentiments des personnages. Mais c'était le moindre souci des compositeurs italiens d'autrefois, semant des mélodies au hasard de leur inspiration. La romance d'Arturo et d'Elvira au second acte, le finale, la fameux duo où Lablache et Tamburini étaient jadis merveilleux. parait-il, ont, hier, causé leur habltuelle impression. La première soirée du Théâtre-italien ne nous avait guère donné que l'occasion d'applaudir des chanteurs français. Hier, citaient les artistes italiens qui faisaient vraiment leur apparition. L'interprétation de J Puritani, sans être de tout point parfaite, a été assurément remarquable. Mme Hepetto-Trlsoiini, qui chante avec une extrême virtuosité, dont la voix a une grande pureté, et M. Marconi, un ténor qui possède des notea d'une douceur et d'un éclat très appréciables, ont obtenu un vif succès personnel. MM. Cotognl et Lorrain et Mme Capali complètent un bon ensemble. Les artistes italiens apportant leurs habitudes à Parls et étant chez enx à la Gaité, il est entendu que nous n'avons rien à dire, cette fois,de l'extravagante manie de? saluts, des gestes emphatiquas, la main sur.le.cnur, des inclinations de teto qui coupent à chaque instant les morceaux, en guise de remerciements pour les applaudissements. P. G. IfUi liiïl¥Ielalli"Hëi Belfort, 30 avril. Une rixe san lante a eu lieu entre deux habitants de "Vieux-Thann. La femme de. 1 un de]; combattants ayant voulu se mêler à la lutte, a reçu un coup de pierre qui met ses jours en danger. Nancy, 30 avril. Le nommé Sttisse, ér>icie-r, étant allé dans son arrière-boutique pour prendre du pétrole, le liquide s'est eniiammô subitement. Entouré par les flammes, Suisse a eu à peine le temps de fuir. Le teu a bientôt envahi la maison coupant la retraite aux locataires, qui ont dû *de sauver au moyen d'échelles appliquées aux fenêtres. Un petit enfant de qnatre ans, laissé seul dans une chambre du troisième étage, a été sauvé par un sergent de pompiers de Paris, en convalescence à Nancy. Les dégéts matériels sont considérables. Rodez, 30 avril. On vient de découvrir dans une châtaigneraie. près de Baselve, le cadavre d'un homme, caché sous des feuilles mortes, Le corps était complètement nu, mais on a trouvé à environ trois kilomètres de là, des vêtements qui devaient certainement appartenir au mort. Celui-ci était le nommé Piarre Laur, habitant Baselve. On suppose dans le pays que l'infortuné a été assassiné, et que le crime accompli, son auteur, médecins et nos parents se trompent, et il me donne des médicaments. Un ami? Oui, un camarade élevé aveo moi, un cousin même. Nous nous connaissons depuis notre naissance, et nous nous aimons bien. allez! il me soutient que je peux être guéri, et il a acheté des drogues, de l'huile de foie de morue, des pilules, un tas de choses, avec l'argent de ses petits bénéfices. Il dit que cela me sauvera. L'enfant s'arrêta un moment, fatigué de parler; puis, avec un sourire navrant, tandis que son visage rayonnait d'un enthousiasme naïf et d'une affection fraternelle, il reprit Vous savez, monsieur, je ne le crois pas beaucoup. J'ai l'idée que les médecins disent la vérité et que je vais bientôt mourir. Mais il pleure quand je lui dis cela. et ma toi je fais semblant de l'écouter et je bois toutes les drogues qu'il me donne. parce que j'avalerais n'importe quoi pour nepas causer une peine à Fanfan. Fanfan' Oui, c'est le nom de mon ami. Il s'appelle Fanfan répéta Ramon d'une ,Voix toute vibrante d'émotion. Oui, monsieur. ou plutôt je ne l'ai jamais appelé autrement. Et son autre nom ?. son nom de famille ?. Son nom de famille?. Je ne sais pas, monsieur. Moi, je m'appelle Claudinet. Mon oncle La Limace et ma tante Zéphyrine sont ses père et mère. ou au moins c'est ces noms-là qu'il leur donne. Ramon chancela comme accablé tous un coup soudain. afin de faire croire à ni sttteido, a déshaBOté J» cadavre et l'a transporté a l'endroit OÙ U a été retrouve. Une enquête est commencée, Madrid, 8o awfl. ♦ Un ineeDdie considérable a éclaté hier -;orle quai de la gare d'Antequera, dans la provbue de Le quai n'été réduit en cendres. Lesiiegâts matériels sont énormes. La Vie Pot-t i..um: parait le mercredi et !»'«amedi chaque numéro, comprenant s6 colonne» de texte compact est vendu, avec une raserba illustration. i5 centimes La Grève des Tailleurs depuis samodi dernier, anime cents « pomptsrs ont abandons le travail et vinrt-flieux mais.ns ont été obligées de leur accoraer une augmentation de 5 centimes par heure, soit Si centimes de l'heure. La spécialité des « pompiers » comprend quatre mll'e ouvrier s sur les seize mille vingt-six qu accuse le damier dénombrement officiel de la population et des professions à Paris. One dépression assez importante venue du se montre à l'entrée de U Nliochc, et le !»ar" mèfiw a b»Ijtp e!e 10 m/m à la pointe de Bretagne Le.. fortes pressions pt-rsisteni toujours *mud-oms« de ngoMBe, «ailes du nord.est couvrent lest de ta RaMte (Moàwu, iil). Le$ vojiw suident 4 entre sud et ouest sur nos côtes. ils ont fraichi en Bretaijn» et sur l'Océau et sont encore faibles sur la !'tanche et en ProUn signale des pluie» générales sur tout l'ouest da continent, 4L des orage* en Allemagne et von la nij* températüra monte sur la France. ta Russie et 1 Irlande; elle baisse partout ailleurs; blùr matl le thermomètre marqua» ̃*• 4* à KuoDio Il à Vatôatia, Paris. 15 A Perpignan et a Sft«. Le baromètre est stationnai!» on Irlande, taadli qu il baisse sur le nord et 1 ouest de la France. lies vents sont K»nér*!ement faibles des région» sud En t r.mci', le temps va rester nuageux et amlinvt pluies sont toujours probables, Situation particulière aux ports français dan» la Manche, mer belle à Dunkerque, à Calais, à BouIogne, au Havre et A Cherbourg dans l'Océan mer houleuse A Brest, belle A Lortent: dans la Medtterranée, mer agitée à Marseille et A Skié, belle Nte*. Un meurtre a été commis hier soir avenue d Italie. Vers huit heures, une vive discussion s'est élevée entre un jeune homme de dix-neuf ans, nommé Eugène Potier, ouvrier ferblantier. demeurant rue de l'Espérance, ii», et un nommé Charles Perichon, mécanicien, demeurant rue Damesme, l'ne rixe ayant suivi, Pericho» «est armé cran couteau et en a plun^'é la lame à trois reprises dans le cuté gauche de son adversaire. Le malheureux jeune homme s'est adaissé sur le sol. perdant un flot de sang. Le meurtrier a pris la fuite. Le blessé a été transporté dans une pharmacie avenue d'Italie, puis, sur sa demande, à son domicile. Il a rendu le dernier soupir en arrivant. M. Debeury, commissaire de police, recherche l'auteur de ce meurtre. M. Aragon, commissaire de polioe, a arr0té hier les nommés Albert Pillon, AgA de trentecinq ans, demeurant avenue de cliehv, 182, et Auguste Cagnat, demeurant rue Baillant. 8. Ce sont deux ouvriers tailleurs qui sont inca}pés d être les auteurs d'une tentative de meurtre contre un de leurs confrères, employé chez M. Sutton. boulevard itaussmann. Apn s interrogatoire, tous deusont cteecrouéa au Dépôt. Une jeune domestique, Marie Dehaut. dU-neuf ans, en service avenue de Maurid,.à Neuilly. a accouché clandestinetnent chez ses maitres et a fait disparaitre son enfant. arrêtée et conduite chez M. Carpin, commissaire de police, Marie Dehaut a refusé de faire savoir ou elle avait jeté le petit cadavre. nn va procéder à la vidange de la fosse d'aisanca de la maison. l'n nouvel accident mortel vient de se paoduire à l'Exposition. La ouvrier, M. Charles Stephor, est tombé hier. une heure de l'après-midi, du Pavillondu Ministère de la Marine sur la berge da qual d'Orsay. Le malheureux est mort en arrivant à l'Am^ bulance du Champ-de-Mars, ou U avait été transporté. Le cheval attelè à la voiture nl 42, de la Compagnie générale, s'est emporté, hier matin, et a renversé, sur la pont d'Austerlitz, le nommé Jean Pétillot, âgé de trente-six ans, demeurant rue Beaudriconft, "il. Griévement blessé la tête,1(. Pétillot a éta transporté A la Pitlé par les aeios de M. fwruche, commissaire de police. Le cadavre d'un homme de trente-cinq ans en* viron a été retiré da la Seine, hier, au quai Saint-' Bernard. Son identité n'ayant pu être établie, le coJjps a été transporté a la Morgue. Rue Michel-Bizof "demeure un employé d'octtoi, nommé P. qui a deux enfants, âgés do dix: et quatorze ans. Le plus ieune est, parait-il, le souffre-douleur de la famille. Les voisins disent que le petit Louis est saus cesse accablé de mauvais traitements. ̃ Dimanche, P. étant de congé résolut d'aHef se promener à la t oire au pain d'êpice avec ua lits aine et une femme qui vit avec lni. Le petit Louis, bien entendu, n'était tu di la partie mais, non content de le laisser a la maison, ces vilaines gens imaginèrent de soumettre l'enfant il un épouvantable supplicie pour faire cesser ses pleurs ils le dépouillèrent comptétement de ses vêtements et lut lièrent les bras et les jambes au moyen d'une corde longue de douze mètres. Le pauvre enfant, ainsi ficelé, fut abandonné) La Limace! Cette appellation ignoble. Est-ce que cIllA il ne l'avait pas entendue?. N'était-ce pas celle dont s'était affublé la sinistre individu, auquel, dans la nuit tragique, il avait jadis livré l'enfant de lahonte f. Le longues années S'étaient écoulées de-puis lors. Néanmoins toutes les syllabes de ce uom resonnaient encore dans son cerveau. La Limace 1. Oui! il s'en souvenait bien! Il a*y anit pas d'hésitation à avoir. C'était bien le nom caractéristique, le sobriquet répugnant que le misérable avait dit lui appartenir. Alors, Ramon eut à la foie eomme un éblouissement de folle joie et un frisson de terreur une ivresse de bonheur de penser qu'il avait enfin retrouvé l'enfant perdu, une effroyable crainte de se tromper encore. pour'la centième fois. cils se fronçaient sous une pensée amére, même si c'est l'enfant, l'enfant chassé pu moi. ce n'est pas mon fils! Il redevenait calme, presque froid. fi ne s'agissait plus que d'un devoir t «jC~complir. Réparer, s'il le fallait, une exagération passible dansla punition infligée. Calmer un remords aussi, n'oaait-ll pae s'a> vouer à lui-même. Mon enfant, dit-il à Claudinet, vos parents ont cru sana doute beaucoup moins long le chemin que voua aviez à parcourij. Je vais faire conduire votre voiture par un homme. Nous nous en trous ensuite tru et set bourreaux partirent gaiement la tète du Cours de Vincennes. Peu de temps après leur départ, les cris du petit Louis révolutionnaient la maison. Plusieurs locataires s'émurent et parant volr, tes fenêtres de l'ap$arUfment de P. étant restees ouvertes, l'entant qui se tordait sur leparquet dans d'atroces souffrances. Le concierge se hâta d avertir de ce qui sepassait M. Pourrai. commissaire de police du quartier de, QuinzeVingts. Ce magistrat arriva, accoispagnê du docteur Godeau, fit ouvr r ta porte par un serrurier et io vêtit martyr fut délivré de ses liens qui avaient tracé dessillons sanglants dans ses chairs. Une foule considérable, mise au courant de ces faits monstrueux. stationnait devant ta porte est 'Quatre heures, lorsque P. rev:ntde la fête, Il lut accueilli par les cris A mort à mort Les etlortsde N. Pour»* et de seagents lurent Impuissants à le protéger, et il fut si violemment trappé par la foule furieuse qu'il était couvert de sang. Enfin il put être conduit au commissariat où Il subit un premier interrogatoire. Il a allégué pour sa défense que son fils était un mauvais su et. il té laissé en liberté provisoire: quant au petit 'is, il a été conduit à liiospice des Enfants'cistes pour être examiné par les médatins légistes. Hier, à midi et demi, le pont de l'Aima a été le théâtre d'un asse: grave accident. Le fiacre n, 3inu, dont le cheval était emballé depuis la rue Fraaçois s'engagea sur le pont, renversa deux passants et accrocha une voiture découverte portant le noù se trouvaient deux voyageurs, M. et Mme Emile Paul, de Salins (Jura de passage à Paris. Les blessés furent tout de suite transportés dans une pharmacie voisine où ils reçurent les premiers soins.
| 21,789 |
https://www.wikidata.org/wiki/Q37461432
|
Wikidata
|
Semantic data
|
CC0
| null |
Martyka
|
None
|
Multilingual
|
Semantic data
| 2,685 | 8,139 |
Martyka
family name
Martyka instance of family name
Martyka Soundex M632
Martyka Cologne phonetics 6724
Martyka Caverphone MTK111
Martyka native label
Martyka native label
Martyka writing system Latin script
Martyka attested in 2010 United States Census surname index
Martyka attested in Internet Dictionary of Polish Surnames, quotation
Martyka Wolfram Language entity code Entity["Surname", "Martyka"]
Martyka Géopatronyme ID MARTYKA
Martyka Geneanet family name ID MARTYKA
Martyka Commons category Martyka (surname)
Martyka
achternaam
Martyka is een familienaam
Martyka Soundex M632
Martyka Keulse fonetiek 6724
Martyka Caverphone MTK111
Martyka label in oorspronkelijke taal
Martyka label in oorspronkelijke taal
Martyka schriftsysteem Latijns alfabet
Martyka bevestigd in Online woordenboek met achternamen in Polen, citaat
Martyka Wolfram Language-entiteitscode Entity["Surname", "Martyka"]
Martyka Géopatronyme-identificatiecode MARTYKA
Martyka GeneaNet-identificatiecode voor familienaam MARTYKA
Martyka Commonscategorie Martyka (surname)
Martyka
Martyka
Martyka
Martyka
Martyka is 'n van
Martyka Soundex M632
Martyka inheemse etiket
Martyka inheemse etiket
Martyka skryfstelsel latynse alfabet
Martyka Commons-kategorie Martyka (surname)
Martyka
Martyka
Martyka
apelliu
Martyka instancia de apelliu
Martyka Categoría en Commons Martyka (surname)
Martyka
Martyka
Martyka
apellíu
Martyka instancia de apellíu
Martyka Soundex M632
Martyka fonética de Colonia 6724
Martyka Caverphone MTK111
Martyka nome nativu
Martyka nome nativu
Martyka sistema d'escritura alfabetu llatín
Martyka códigu d’entidá en Wolfram Language Entity["Surname", "Martyka"]
Martyka categoría de Commons Martyka (surname)
Martyka
Martyka
Martyka
Martyka
Martyka sistem panyuratan Aksara Latin
Martyka
Schreibnam
Martyka is a Schreibnam
Martyka Caverphone MTK111
Martyka Commons-Kategorie Martyka (surname)
Martyka
Martyka
Martyka
Martyka
Martyka
Martyka
anv-tiegezh
Martyka natur an elfenn anv-tiegezh
Martyka anv er yezh a orin
Martyka anv er yezh a orin
Martyka lizherenneg Lizherenneg latin
Martyka rummad eus Commons Martyka (surname)
Martyka
prezime
Martyka je prezime
Martyka Soundex M632
Martyka Cologne fonetika 6724
Martyka Caverphone MTK111
Martyka izvorni naziv
Martyka izvorni naziv
Martyka pismo latinica
Martyka kategorija na Commonsu Martyka (surname)
Martyka
Martyka
cognom
Martyka instància de cognom
Martyka Soundex M632
Martyka fonètica de Colònia 6724
Martyka Caverphone MTK111
Martyka nom en la llengua original
Martyka nom en la llengua original
Martyka alfabet alfabet llatí
Martyka atestat a índex de cognoms del cens dels Estats Units del 2010
Martyka atestat a Internetowy słownik nazwisk w Polsce, citació
Martyka codi d'entitat en Wolfram Language Entity["Surname", "Martyka"]
Martyka identificador Géopatronyme MARTYKA
Martyka identificador Geneanet de cognom MARTYKA
Martyka categoria de Commons Martyka (surname)
Martyka
Martyka
Martyka
Martyka
Martyka
Martyka
Martyka categuria in Commons Martyka (surname)
Martyka
Martyka
Martyka
příjmení
Martyka instance (čeho) příjmení
Martyka Soundex M632
Martyka kolínská fonetika 6724
Martyka Caverphone MTK111
Martyka v původním jazyce
Martyka v původním jazyce
Martyka písmo latinka
Martyka kategorie na Commons Martyka (surname)
Martyka
nôzwëskò
Martyka to je nôzwëskò
Martyka
cyfenw
Martyka enghraifft o'r canlynol cyfenw
Martyka label yn yr iaith frodorol
Martyka label yn yr iaith frodorol
Martyka system ysgrifennu yr wyddor Ladin
Martyka dynodwr Wolfram Language (endid) Entity["Surname", "Martyka"]
Martyka categori Comin Martyka (surname)
Martyka
efternavn
Martyka tilfælde af efternavn
Martyka Soundex M632
Martyka Kølnfonetik 6724
Martyka Caverphone MTK111
Martyka lokalt navn
Martyka lokalt navn
Martyka skriftsystem latinske alfabet
Martyka Commons-kategori Martyka (surname)
Martyka
Familienname
Martyka ist ein(e) Familienname
Martyka Soundex M632
Martyka Kölner Phonetik 6724
Martyka Caverphone MTK111
Martyka Name in Amts- oder Originalsprache
Martyka Name in Amts- oder Originalsprache
Martyka Schrift lateinisches Schriftsystem
Martyka bestätigt in 2010 United States Census Familiennamen-Index
Martyka bestätigt in Internet-Wörterbuch der polnischen Familiennamen, Zitat
Martyka Wolfram-Language-Entitätscode Entity["Surname", "Martyka"]
Martyka Géopatronyme-Kennung MARTYKA
Martyka Geneanet-Familiennamen-Kennung MARTYKA
Martyka Commons-Kategorie Martyka (surname)
Martyka
Familienname
Martyka ist eine Instanz von Familienname
Martyka Name in Amts- oder Originalsprache
Martyka Name in Amts- oder Originalsprache
Martyka Commons-Kategorie Martyka (surname)
Martyka
Familienname
Martyka ist eine Instanz von Familienname
Martyka Commons-Kategorie Martyka (surname)
Martyka
Martyka
Martyka
Martyka
Martyka
Martyka
Martyka
family name
Martyka instance of family name
Martyka writing system Latin script
Martyka Commons category Martyka (surname)
Martyka
surname
Martyka instance of surname
Martyka Soundex M632
Martyka Cologne phonetics 6724
Martyka Caverphone MTK111
Martyka writing system Latin script
Martyka Wolfram Language entity code Entity["Surname", "Martyka"]
Martyka Commons category Martyka (surname)
Martyka
familia nomo
Martyka estas familia nomo
Martyka Soundex M632
Martyka kolonja fonetiko 6724
Martyka nomo en originala aŭ oficiala lingvo
Martyka nomo en originala aŭ oficiala lingvo
Martyka skribo latina alfabeto
Martyka ento-kodo de programlingvo Wolfram Entity["Surname", "Martyka"]
Martyka Komuneja kategorio Martyka (surname)
Martyka
apellido
Martyka instancia de apellido
Martyka Soundex M632
Martyka fonética de Colonia 6724
Martyka Caverphone MTK111
Martyka nombre en la lengua nativa
Martyka nombre en la lengua nativa
Martyka alfabeto alfabeto latino
Martyka atestiguado en índice de apellidos del censo de los Estados Unidos de 2010
Martyka código de entidad en el lenguaje de programación Wolfram Entity["Surname", "Martyka"]
Martyka identificador Géopatronyme MARTYKA
Martyka identificador Geneanet de apellido MARTYKA
Martyka categoría en Commons Martyka (surname)
Martyka
perekonnanimi
Martyka üksikjuht nähtusest perekonnanimi
Martyka omakeelne nimetus
Martyka omakeelne nimetus
Martyka kiri ladina kiri
Martyka Commonsi kategooria Martyka (surname)
Martyka
abizen
Martyka honako hau da abizen
Martyka Soundex M632
Martyka jatorrizko izena
Martyka jatorrizko izena
Martyka alfabetoa latindar alfabetoa
Martyka Commons-eko kategoria Martyka (surname)
Martyka
Martyka nombri nativu
Martyka nombri nativu
Martyka
Martyka lesdinkeejum
Martyka lesdinkeejum
Martyka
sukunimi
Martyka esiintymä kohteesta sukunimi
Martyka Soundex M632
Martyka Kölnin fonetiikka 6724
Martyka Caverphone MTK111
Martyka nimi alkuperäiskielellä
Martyka nimi alkuperäiskielellä
Martyka kirjoitusjärjestelmä latinalaiset aakkoset
Martyka sukunimen Geneanet-tunniste MARTYKA
Martyka Commons-luokka Martyka (surname)
Martyka
sukunimi
Martyka
Martyka
ættarnavn
Martyka er eitt ættarnavn
Martyka Commonscat Martyka (surname)
Martyka
nom de famille
Martyka nature de l’élément nom de famille
Martyka Soundex M632
Martyka algorithme phonétique de Cologne 6724
Martyka Caverphone MTK111
Martyka nom dans la langue d'origine
Martyka nom dans la langue d'origine
Martyka système d'écriture alphabet latin
Martyka attesté dans index des noms de famille recensés aux États-Unis en 2010
Martyka attesté dans dictionnaire Internet des noms de famille polonais, citation
Martyka code d'entité du langage de programmation Wolfram Entity["Surname", "Martyka"]
Martyka identifiant Géopatronyme MARTYKA
Martyka identifiant Geneanet d'un nom de famille MARTYKA
Martyka catégorie Commons Martyka (surname)
Martyka
Martyka
Martyka
Martyka as en bääftnööm
Martyka nööm uun aanj spriak
Martyka nööm uun aanj spriak
Martyka skraft latiinsk alfabeet
Martyka Commons-kategorii Martyka (surname)
Martyka
Martyka
efternamme
Martyka is in efternamme
Martyka Soundex M632
Martyka Commons-kategory Martyka (surname)
Martyka
sloinne
Martyka sampla de sloinne
Martyka Soundex M632
Martyka foghraíocht Köln 6724
Martyka Caverphone MTK111
Martyka lipéad sa teanga dhúchais
Martyka lipéad sa teanga dhúchais
Martyka córas scríbhneoireachta aibítir Laidineach
Martyka catagóir Commons Martyka (surname)
Martyka
Martyka
sloinneadh
Martyka eisimpleir de sloinneadh
Martyka ainm dùthchasach
Martyka ainm dùthchasach
Martyka roinn-seòrsa Commons Martyka (surname)
Martyka
apelido
Martyka instancia de apelido
Martyka Soundex M632
Martyka fonética de Colonia 6724
Martyka Caverphone MTK111
Martyka nome na lingua orixinal
Martyka nome na lingua orixinal
Martyka alfabeto alfabeto latino
Martyka código de entidade en Wolfram Entity["Surname", "Martyka"]
Martyka identificador Geneanet de apelido MARTYKA
Martyka categoría en Commons Martyka (surname)
Martyka
Martyka héra iñe'ẽteépe
Martyka héra iñe'ẽteépe
Martyka
Martyka
Martyka
Familiename
Martyka isch e Familiename
Martyka Name i de Amts- oder Originalsprooch
Martyka Name i de Amts- oder Originalsprooch
Martyka Alphabet latynischs Alphabet
Martyka Commons-Kategori Martyka (surname)
Martyka
sliennoo
Martyka lipaid dooghyssagh
Martyka lipaid dooghyssagh
Martyka
Martyka iri sunan gida
Martyka suna a harshen gida
Martyka suna a harshen gida
Martyka tsarin rubutu Baƙaƙen boko
Martyka
Martyka
Martyka
Martyka
Martyka
Martyka
prezime
Martyka jest prezime
Martyka ime u domaćem jeziku
Martyka ime u domaćem jeziku
Martyka pismo latinica
Martyka kategorija na Zajedničkom poslužitelju Martyka (surname)
Martyka
Martyka
Martyka je swójbne mjeno
Martyka w hamtskej rěči
Martyka w hamtskej rěči
Martyka alfabet łaćonski alfabet
Martyka kategorija na Commons Martyka (surname)
Martyka
Martyka se yon non fanmi
Martyka
vezetéknév
Martyka osztály, amelynek példánya családnév
Martyka Soundex M632
Martyka Caverphone MTK111
Martyka saját nyelvén
Martyka saját nyelvén
Martyka írásrendszer latin betűs írás
Martyka Géopatronyme-azonosító MARTYKA
Martyka Geneanet-családnévazonosító MARTYKA
Martyka Commons-kategória Martyka (surname)
Martyka
Martyka
Martyka nomine original local
Martyka nomine original local
Martyka systema de scriptura alphabeto latin
Martyka categoria in Commons Martyka (surname)
Martyka
nama keluarga
Martyka adalah nama keluarga
Martyka Soundex M632
Martyka label dalam bahasa asli atau resmi
Martyka label dalam bahasa asli atau resmi
Martyka sistem penulisan aksara Latin
Martyka kode entitas Wolfram Entity["Surname", "Martyka"]
Martyka kategori di Commons Martyka (surname)
Martyka
Martyka
ahà nnà
Martyka N'ụdị ndị dị ka ahà nnà
Martyka Igwe okwu Cologne 6724
Martyka Igwe ekwentị MTK111
Martyka akara ala
Martyka akara ala
Martyka Ngalaba commons Martyka (surname)
Martyka
Martyka
Martyka
Martyka panagsurat a sistema sinuratan a Latin
Martyka kategoria ti Commons Martyka (surname)
Martyka
surnomo
Martyka esas surnomo
Martyka kategorio di Commons Martyka (surname)
Martyka
eftirnafn
Martyka er ættarnafn
Martyka Commons flokkur Martyka (surname)
Martyka
cognome
Martyka istanza di cognome
Martyka Soundex M632
Martyka fonetica Cologne 6724
Martyka Caverphone MTK111
Martyka nome originale locale
Martyka nome originale locale
Martyka sistema di scrittura alfabeto latino
Martyka codice entità Wolfram Language Entity["Surname", "Martyka"]
Martyka identificativo Géopatronyme MARTYKA
Martyka identificativo Geneanet MARTYKA
Martyka categoria su Commons Martyka (surname)
Martyka
Martyka
Martyka serese mupli lazme'e
Martyka
efternavn
Martyka
jeneng pancer
Martyka minangka jeneng pancer
Martyka kategori ing Commons Martyka (surname)
Martyka
Martyka jergilikli atı
Martyka jergilikli atı
Martyka jazıw sisteması Latın jazıwı
Martyka Commons kategoriyası Martyka (surname)
Martyka
Martyka isem aẓaran
Martyka isem aẓaran
Martyka
Martyka
Martyka
Martyka
Martyka
Martyka
tek, ata-tek, äwlet esim
Martyka
tek, ata-tek, äwlet esim
Martyka
Martyka
Martyka
Martyka
Martyka
Martyka
Nohnahme
Martyka es e Beischpell för e(n(e)) Nohnahme
Martyka Saachjobb op Wikkimehdija Commons Martyka (surname)
Martyka
Martyka mînakek ji bo paşnav
Martyka kategoriya Commonsê Martyka (surname)
Martyka
hanow
Martyka ensampel a hanow teylu
Martyka label teythyek
Martyka label teythyek
Martyka klass Commons Martyka (surname)
Martyka
nomen gentilicium
Martyka est nomen gentilicium
Martyka categoria apud Communia Martyka (surname)
Martyka
alkunya
Martyka
Familljennumm
Martyka ass eng/e(n) Familljennumm
Martyka Soundex M632
Martyka Kölner Phonetik 6724
Martyka Caverphone MTK111
Martyka Numm an der Amts- oder Originalsprooch
Martyka Numm an der Amts- oder Originalsprooch
Martyka Alphabet laténgescht Alphabet
Martyka Wolfram-Sprooch-Entitéitscode Entity["Surname", "Martyka"]
Martyka Commons-Kategorie Martyka (surname)
Martyka
Martyka sistem de scrive Alfabeta latina
Martyka
Martyka
Martyka
Martyka
Martyka
Martyka nom in la lengua original
Martyka nom in la lengua original
Martyka
Martyka
Martyka
pavardė
Martyka tai yra pavardė
Martyka pavadinimas originalo kalba
Martyka pavadinimas originalo kalba
Martyka rašto sistema lotynų abėcėlė
Martyka Vikitekos kategorija Martyka (surname)
Martyka
Martyka
Martyka
uzvārds
Martyka ir uzvārds
Martyka Soundex M632
Martyka Ķelnes fonētika 6724
Martyka Caverphone MTK111
Martyka nosaukums oriģinālvalodā
Martyka nosaukums oriģinālvalodā
Martyka alfabēts latīņu alfabēts
Martyka Commons kategorija Martyka (surname)
Martyka
Martyka
Martyka sokajy Commons Martyka (surname)
Martyka
Martyka
ingoa whānau
Martyka
nama keluarga
Martyka contoh nama keluarga
Martyka Soundex M632
Martyka label asli
Martyka label asli
Martyka sistem tulisan tulisan Rumi
Martyka kod entiti Bahasa Wolfram Entity["Surname", "Martyka"]
Martyka kategori Commons Martyka (surname)
Martyka
kunjom
Martyka istanza ta' kunjom
Martyka kategorija tal-Commons Martyka (surname)
Martyka
Martyka
Martyka
Martyka
Martyka
Martyka caverphone MTK111
Martyka
etternavn
Martyka forekomst av etternavn
Martyka Soundex M632
Martyka Köln-fonetikk 6724
Martyka Caverphone MTK111
Martyka lokalt navn
Martyka lokalt navn
Martyka alfabet det latinske alfabetet
Martyka Wolfram Language-id Entity["Surname", "Martyka"]
Martyka Géopatronyme ID MARTYKA
Martyka Geneanet familienavn ID MARTYKA
Martyka Commons-kategori Martyka (surname)
Martyka
Familiennaam
Martyka is en Familiennaam
Martyka Caverphone MTK111
Martyka Naam in de Amts- oder Originalspraak
Martyka Naam in de Amts- oder Originalspraak
Martyka Schriftsystem latiensch Alphabet
Martyka Kategorie op Commons Martyka (surname)
Martyka
Martyka kategory up Commons Martyka (surname)
Martyka
Martyka
Martyka
etternamn
Martyka førekomst av slektsnamn
Martyka Soundex M632
Martyka lokalt namn
Martyka lokalt namn
Martyka alfabet det latinske alfabetet
Martyka Wolfram Language-id Entity["Surname", "Martyka"]
Martyka Commons-kategori Martyka (surname)
Martyka
Martyka
Martyka
Martyka
Martyka
Martyka
Martyka
nom d’ostal
Martyka natura de l'element cognòm
Martyka nom dins la lenga originala
Martyka nom dins la lenga originala
Martyka alfabet alfabet latin
Martyka categoria Commons Martyka (surname)
Martyka
Martyka
Martyka
Martyka alimbawa ning apelyídu
Martyka tubung awus
Martyka tubung awus
Martyka sistema ning pamagsulat Alpabetung Latin
Martyka Kategoriya ning Commons Martyka (surname)
Martyka
Martyka ta un fam
Martyka nòmber nativo
Martyka nòmber nativo
Martyka kategoria di Commons Martyka (surname)
Martyka
Martyka catégorie de wikipedia commons Martyka (surname)
Martyka
Martyka
Martyka
Martyka
Martyka
nazwisko
Martyka jest to nazwisko
Martyka Soundex M632
Martyka Kölner Phonetik 6724
Martyka Caverphone MTK111
Martyka nazwa oryginalna
Martyka nazwa oryginalna
Martyka system pisma alfabet łaciński
Martyka poświadczone w Indeks nazwisk w spisie powszechnym USA z 2010 r.
Martyka poświadczone w Internetowy słownik nazwisk w Polsce, cytat
Martyka kod obiektu w języku Wolfram Entity["Surname", "Martyka"]
Martyka identyfikator Géopatronyme MARTYKA
Martyka identyfikator nazwiska Geneanet MARTYKA
Martyka kategoria Commons Martyka (surname)
Martyka
cognòm
Martyka
Martyka
sobrenome
Martyka instância de apelido
Martyka Soundex M632
Martyka fonética Cologne 6724
Martyka Caverphone MTK111
Martyka nome nativo
Martyka nome nativo
Martyka alfabeto alfabeto latino
Martyka código de entidade na linguagem Wolfram Entity["Surname", "Martyka"]
Martyka categoria da Commons Martyka (surname)
Martyka
nome de família
Martyka instância de sobrenome
Martyka Soundex M632
Martyka fonética Cologne 6724
Martyka Caverphone MTK111
Martyka nome nativo
Martyka nome nativo
Martyka sistema de escrita alfabeto latino
Martyka código de entidade na linguagem Wolfram Entity["Surname", "Martyka"]
Martyka categoria na Commons Martyka (surname)
Martyka
Martyka
Martyka
Martyka
Martyka
Martyka Commons Martyka (surname)
Martyka
Martyka
nume de familie
Martyka este un/o nume de familie
Martyka Soundex M632
Martyka fonetica Köln 6724
Martyka Caverphone MTK111
Martyka nume în limbile autohtone
Martyka nume în limbile autohtone
Martyka sistem de scriere alfabetul latin
Martyka categorie la Commons Martyka (surname)
Martyka
Martyka
Martyka
Martyka
Martyka
Martyka categoria de Commons Martyka (surname)
Martyka
Martyka nomu nativu
Martyka nomu nativu
Martyka alfabbetu alfabbetu latinu
Martyka catigurìa di Commons Martyka (surname)
Martyka
faimily name
Martyka instance o faimily name
Martyka native label
Martyka native label
Martyka writin seestem Laitin script alphabet
Martyka Commons category Martyka (surname)
Martyka
Martyka
goargu
Martyka lea sohkanamma
Martyka čállinvuohki latiinnalaš alfabehta
Martyka Commons-kategoriija Martyka (surname)
Martyka
Martyka
Martyka
Martyka
Martyka
maŋŋepnamma
Martyka
priezvisko
Martyka je priezvisko
Martyka v pôvodnom jazyku
Martyka v pôvodnom jazyku
Martyka písmo latinské písmo
Martyka kategória na Commons Martyka (surname)
Martyka
priimek
Martyka primerek od družinsko ime
Martyka Soundex M632
Martyka kölnska fonetika 6724
Martyka Caverphone MTK111
Martyka ime v domačem jeziku
Martyka ime v domačem jeziku
Martyka abeceda latinica
Martyka potrjeno v Cenzusni imenik priimkov Združenih držav Amerike 2010
Martyka potrjeno v Internetni slovar poljskih priimkov, citat
Martyka oznaka entitete Wolfram Language Entity["Surname", "Martyka"]
Martyka kategorija v Zbirki Martyka (surname)
Martyka
Martyka
Martyka
fuelhkienomme
Martyka
maŋepnamma
Martyka
Mazita eMhuri
Martyka
Martyka
mbiemër
Martyka instancë e mbiemër
Martyka Soundex M632
Martyka Fonetikë e Këlnit 6724
Martyka Caverphone MTK111
Martyka emërtimi në gjuhën amë
Martyka emërtimi në gjuhën amë
Martyka sistemi i shkrimit alfabeti latin
Martyka kategoria në Commons Martyka (surname)
Martyka
prezime
Martyka je prezime
Martyka kategorija na Ostavi Martyka (surname)
Martyka
Martyka
Martyka
Martyka
Martyka
Martyka
Martyka
efternamn
Martyka instans av familjenamn
Martyka Soundex M632
Martyka Kölnfonetik 6724
Martyka Caverphone MTK111
Martyka originalnamn
Martyka originalnamn
Martyka skriftsystem latinska alfabetet
Martyka belagt i efternamnsindex för folkräkningen i USA 2010
Martyka entitets-id i Wolfram language Entity["Surname", "Martyka"]
Martyka Géopatronyme-ID MARTYKA
Martyka Geneanet familjenamn-ID MARTYKA
Martyka Commons-kategori Martyka (surname)
Martyka
jina la ukoo
Martyka ni mfano wa jina la ukoo
Martyka mfumo wa uanadishi alfabeti ya Kilatini
Martyka Jamii ya vitu vya kawaida Martyka (surname)
Martyka
Martyka ôryginalne miano
Martyka ôryginalne miano
Martyka kategoryjŏ Commons Martyka (surname)
Martyka
Martyka
Martyka
Martyka
Martyka
Martyka
soyadı
Martyka nedir soyadı
Martyka sesli dizinde M632
Martyka Köln ses bilgisi 6724
Martyka Caversham ses bilgisi MTK111
Martyka yerel dildeki adı
Martyka yerel dildeki adı
Martyka yazı sistemi Latin alfabesi
Martyka Wolfram Dili varlık kodu Entity["Surname", "Martyka"]
Martyka Géopatronyme kimliği MARTYKA
Martyka Geneanet aile adı kimliği MARTYKA
Martyka Commons kategorisi Martyka (surname)
Martyka
Martyka Ntlawa wa Commons Martyka (surname)
Martyka
Martyka Wikicıyıntıqta törkem Martyka (surname)
Martyka
Martyka
Martyka
Martyka
Martyka
Martyka
Martyka istansa de cognome
Martyka Soundex M632
Martyka algoritmo fonètego de Cologne 6724
Martyka Caverphone MTK111
Martyka nome inte ła łéngua orizenałe
Martyka nome inte ła łéngua orizenałe
Martyka alfabeto alfabeto latin
Martyka ID Géopatronyme MARTYKA
Martyka ID Geneanet de nome de fameja MARTYKA
Martyka categoria Commons Martyka (surname)
Martyka
họ
Martyka là một họ
Martyka Soundex M632
Martyka nhãn bản ngữ
Martyka nhãn bản ngữ
Martyka hệ thống chữ viết bảng chữ cái Latinh
Martyka thể loại ở Commons Martyka (surname)
Martyka
Martyka
Martyka
Martyka
Martyka
no d’ famile
Martyka nateure di l’ elemint no d' famile
Martyka
apelyidu
Martyka
Martyka
ifani
Martyka
Martyka àkórí orúkọ ẹbí
Martyka Ẹ̀ka Commons Martyka (surname)
Martyka
Martyka
isibongo
Martyka isibonelo se isibongo
| 6,288 |
https://en.wikipedia.org/wiki/2008%20West%20Virginia%20Democratic%20presidential%20primary
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
2008 West Virginia Democratic presidential primary
|
https://en.wikipedia.org/w/index.php?title=2008 West Virginia Democratic presidential primary&action=history
|
English
|
Spoken
| 220 | 337 |
The 2008 West Virginia Democratic presidential primary took place on May 13, 2008 with polls closing at 7:30 p.m. EST. It was open to Democrats and Independents. The primary determined 28 delegates to the 2008 Democratic National Convention, who were awarded on a proportional basis. West Virginia's Democratic delegation also included 11 unpledged "superdelegates". The primary came late in the nomination race. Hillary Clinton won by a very wide margin, but her opponent Barack Obama maintained a substantial lead in the overall number of pledged delegate votes.
Polls
As of May 4, 2008, opinion polling showed Sen. Hillary Clinton holding a 56% to 27% lead over Sen. Barack Obama, with 17% undecided.
Some of West Virginia's superdelegates also endorsed a candidate prior to the primary. By February 20, more than a month before the election, three superdelegates had announced support for Sen. Hillary Clinton (DNC Members Marie Prezioso, Pat Maroney, and Belinda Biafore), while three had endorsed Sen. Barack Obama (Rep. Nick Rahall, Sen. Jay Rockefeller, and Sen. Robert C. Byrd).
Results
Primary date: May 13, 2008
National pledged delegates determined: 28
See also
Democratic Party (United States) presidential primaries, 2008
West Virginia Republican caucuses, 2008
References
External links
WV Secretary of State - Election Returns
West Virginia
2008 West Virginia elections
2008
May 2008 events in the United States
| 529 |
https://bpy.wikipedia.org/wiki/%E0%A6%B8%E0%A7%8D%E0%A6%9F%E0%A6%BE%E0%A6%A8%E0%A6%9F%E0%A6%A8%20%E0%A6%95%E0%A6%BE%E0%A6%89%E0%A6%A8%E0%A7%8D%E0%A6%9F%E0%A6%BF%2C%20%E0%A6%A8%E0%A7%87%E0%A6%AC%E0%A7%8D%E0%A6%B0%E0%A6%BE%E0%A6%B8%E0%A7%8D%E0%A6%95%E0%A6%BE
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
স্টানটন কাউন্টি, নেব্রাস্কা
|
https://bpy.wikipedia.org/w/index.php?title=স্টানটন কাউন্টি, নেব্রাস্কা&action=history
|
Bishnupriya Manipuri
|
Spoken
| 96 | 683 |
স্টানটন কাউন্টি (ইংরেজি:Stanton County), এহান তিলপারাষ্ট্র বা মার্কিন যুক্তরাষ্ট্রর হমবুকপিছ বারার পিছ-ঔয়াং-হমবুক লয়াগর নেব্রাস্কা ষ্টেইট/রাজ্যর কাউন্টি আহান।
ভৌগলিক উপাত্ত
শহর এহার মাপাহানর অক্ষাংশ বারো দ্রাঘিমাংশ ইলতাই । আয়তনহান (হুকানা বারো পানিহান পুলকরিয়া): ৪৩১.০৬ বর্গমাইল, অতার মা পানিহান ১.২৩ বর্গমাইল (০.২৯%) বারো হুকানাহান ৪২৯.৮৩ বর্গমাইল।
জনসংখ্যার উপাত্ত
তিলপারাষ্ট্রর (যুক্তরাষ্ট্র) ২০০০ মারির মানুলেহা (লোক গননা) অনুসারে স্টানটন কাউন্টি-র জনসংখ্যা ইলাতাই ৬৪৫৫ গ। ২৪৫২গ ঘরর ইউনিট আসে। হারি বর্গ মাইলে ৫.৭গ ঘর পরিসে বারো হারি বর্গ মাইলে ১৫.০গ মানু থাইতারা।
ইতিহাসহান
প্রশাসনিক অঞ্চলগি
স্টানটন কাউন্টির অধীনর শহরগি
নাংকরা মানু
সাকেই আসে ইকরা
পাসিতা
তিলপারাষ্ট্রর প্রশাসনিক লয়াগি
নেব্রাস্কা রাজ্যর কাউন্টিহানি
| 39,915 |
https://en.wikipedia.org/wiki/Christian%20Hausmann
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Christian Hausmann
|
https://en.wikipedia.org/w/index.php?title=Christian Hausmann&action=history
|
English
|
Spoken
| 56 | 109 |
Christian Hausmann (born 21 November 1963) is a retired German football player.
Honours
UEFA Europa League winner: 1987–88
References
External links
1963 births
Living people
German men's footballers
Men's association football midfielders
Füchse Berlin Reinickendorf players
Bayer 04 Leverkusen players
1. FC Nürnberg players
Hertha BSC players
UEFA Cup winning players
Bundesliga players
2. Bundesliga players
| 48,978 |
welshmanscandle00evangoog_5
|
English-PD
|
Open Culture
|
Public Domain
| 1,771 |
The Welshman's Candle
|
Rhys Prichard , William Evans
|
English
|
Spoken
| 8,464 | 13,213 |
Was from a dark and difmal dungeon rais'd. And made chief ruler over Egypt's race. ». 58 Jofhua too, that chieftain bold and great ! Becaufe he cleav'd unto the Lord his God, Did ev'ry army, he e*er fought with, beat- And ev*ry land fubdue, whereon he trod. 59 Of old, Elijah by the ravens care Was in the defert wond'roufly preferv'd— • Then in a fie'ry chariot through the air To heaven rap't becaufe his God he ferv'd. 60 The three young captives, by their gracious Sire, Were from the glowing furnace fave'd of yore. And walk'd unhurt, amidft the raging fire Becaufe their God they in remembrance bore. •' 61 Daniel, who thrice a day his Maker ferv'd. Retiring to his room God*s name to blcfs, Was from the lions' den unharm'd preferv'd. And wonderfully fave'd, in his diftrefs. 62 Who, to the only God, due homage paid. That did not retribution full receive ? Who e'er his glory and his pow'r dilplay'd. To whom he did not wealth and honour give? ' 63 Nd 63 No one his temple dcx)r e'er entered yet, f * : ^ To wjiom fit fatisfaftion was not made ; No prieft, the fire e'er on his altar li't,- That was not for the fervice amply paid- • 64 No one a cup of water e'er did give Unto the poor, for his Redeemer's fake, ' Who fhalt not for't an hundred-fold receive'. And of the glories- of his reign partake. 65 Chrift is the beft of Mailers, to obey, ^ And therefore IhouM the grcateft reve'rcnce claim— Chrift does the moft, and fureft wages- pay. To all that faithfully invoke his name. 66, He is a Matter, full of grace and might — ^— A Matter, glorious, and immenfejiy great A matter, that with mitres can requite And fceptres, all that on his altars wait ! ^ 6y A Matter, by whofc help they fhall be placc'd On thrones above — where peace and joys abound — Where they fhall be with endlefs glories grace'd. And with felicity eternal crown'd ! -r^ ; 68 A Matter, that will to each fervant give A glorious kingdom, and a golden crown. With fuch great things as heart can ne'er conceive. And fuch as never, here below, were known. 6^ Who wou'd not, then, fo kind a Lord regard. And fall, upon his knees before him, down; That gives each vot'ry fuch a vaft reward. So rich a kingdom, and fo bright a crown ! 70 Who wou'd not both the flefli and world defpife ? Who wou'd not Satan and his arts oppofe. That does refieft, how vattly great the prize. Which God to all his fervants does propofe ? ^ 71 Although no fervant, for his labour done, In ttriftnefs, ever yet, reward deferv'd. Yet God has promis'd — of his grace alone A throne to each that has fincerely ferv'd. 72 A [: 126 J 72 A Have to Satan, and a flave to fin, A flave to death, and to the dreary grave, Is ev'ry foul, that has in fcrvice been, ■ If he be not unto the Lord a flave, "jl When death fliall come, that irritated pow*r! To fummon ev'ry fervant to the grave- Which will fare beft, in that tremendous hour. The flave unto the flefti, or Jcfus' flave? 74 When all the world, and all it** wealthy ilote^ Shall in confuming flames pafs quite away- Which will fare beft:, in that all dreaded hour. Who to the world, or Chrift:, their homage pay?. 75 When all God's Children ftiall the flcies afccnd. And all the fl?ives of fin be thruft below ; * What bitternefs of foul muft thofe attend,, Who to their Lord did no obedience fliow ? 76 Better a finglc hour entirely lent .. Unto the fervice of our bleflfed Lord, Than a whole age in this world's fervice fpent^ , Which does no profit, or return afibrd. 77 In this world's fervice, we can nothing fave. But trouble, forrow, difcontent, and mamc ■ And muft through life be cheated to the gravc^ Leaving it naked, as we to it came. • 78 How much foe'er we ftrive, the flefli to pleafe. We fliall at laft receive no greater gains From carnal pleafures, indolence, and eafe^ Than a fliort life, and everlafting pains. 7^ Whenever we have any fin obey'd. Though we fliou'd ferve it to our lateft breath; No other wages fliall to us be paid. For our long flavery, but fliame and death. 80 By ferving Satan, thou canft get no land. Though he might kingdoms, to feduce thee, IhoW} For he has" not a foot at his command,! Befides the bottomlefs aby fs of woe : 81 Bttt 8c \i But from Chrift'sfervice, we;fhali furely gain A glorious kingdom for our place of reft- Where, through his favour, we^fliallever rdgn Inendlcfsjoys and honour, with the bleft. ? 2 Then let our ardor, whilft we live, appear. And l?t us cheerfully, to ferye him, go : For He's the very bcft of Mailers here. And that's the vdry beft of works below — ^— ^ 83 And let us ftrive to fight with ev'ry foe. That' fights with us, and Hops us whilft we fun Our heav'nly race-i-* — ^^—or hinders us to do The work, that's moft expedient; to be done, 84 O let us all, like workriien truly-wife, Juft, faithful, vigilant, and ftriftly-fair^ (Whilft yet the time of grace before us lies) With readinefs to ferve the Lord repair I 85 For if we ferve him not on earth, whilft yet It is the time of grace— whilft yet 'tis day Weftiall be headlong huri'd into the pit. Our homage to the devil, there, to pay. 86 Then, as in hell each wretched finner lies,. The folly he ftiall thfere too late repent. That he fo madly did his God defpife, Whilft fo much time in fin he idly fpent. J; There fhall he fhed fliU many a bitter tear. And cry aloyd, through mere excefs of pain-, BjLit Ihou*d he cry his eyes out, he ftiall ne'er From Satan's clutches make efcape again. 8 O, let us then, this very now, begin To ferve the Lord — whilft it to-day is call'd And bid a laft adieu to ev'ry fin, By which we hitherto have been enthrall'd ! 9 So ftiall we (when our bufi'nefs here is o'er. And at the time we want afliftance moft) Adore for ever the Almighty pow'r In heav'n above, among the* angehc hoft 90 To [ ii8 • ] 90 To which bleft place, O my Creator dread f For Jefus Ghfift's fake, our Redeemer dear. Do thou thy faithful fervants fafely lead. That we may, with thy Saints, adore thee there- Concerning Prayer, and it's propc Requifites. 1 TJUT ofF thy fhoes, e'er thou thy God daft greet JL^ Thy afS) before thou lacrificett, bin d Wafh, e'er the altar thou come'ft near, thy ffcct. And weigh, what thou requefteft, well in mind. 2 Repent, e*er thou doft God by prayV implore. And thy devotions, l^t thy deeds atten d : Be thanl^ul always, when thy pray'rs are a'cr; So (hall thy prayers up to heav'n afcend. 3 Satan will try to tempt thee, ev'ry day. The flefh wou'd fain deceive thee, ev'ry hour. The world, and it's delights, thy fall aflay: Seek thou, by pray'r, their efforts to o*erpow*n 4 Prayer is good, in ev'ry land and clime- Prayer is good, for men in ev'ry fphere- — ^ Prayer is good, at ev'ry hour and time « Prayer is good, on all accounts whatever. .^ 5 Pray*r is, a facrifice to God moft ^ue. A fure fupport, to guide the weak along A whip, to fcourge the fiend and all his crew— - A fanftuary, from ev'ry ill and wrong ! 6 Nay, conftant prayer is a golden key. Thy doors to open at the dawn of light' • A bolt, to Ihut them at the clofe of day A fort, to guard from harm,, both day and night. 7 Prayer, has foothe'd the moft obdurate breaft r Prayer, has angels with fuccefs affail'd Prayer, the fierceft fiends has difpoffefs'd Prayer, has over God himfelf prevailed ! 8 The [ i^9 ] 8 Then, with thy pray'r, let heav'n and earth fefouftd-j Like incenfe, it perfumes the* etherial plains — On earth, it gives the fiend his deepeft wound--*™- And brings to thee thjrfelf the greateft gains. 9 With iPaith-with reverence- with a foulftrung high--^ With ardent zeal, and minds that never ftray— With knowledge — with a ftrong, inceffantcry — - With clofe attention — 'tis that men Ihou'd pray. 10 Lift up thine eyes, thy knees devoutly bend, Roufe up thy fpirit, and thy bofom fmite — Open thy lip5, thy hands abroad extend. Pray with true fervor, and with all thy might. 1 1 Thou ne'er muft call on gods of gold, or ftone^ On faint or faintefs, thy requeft to grant-. But on the Lord, thro* Jefus Chrift alone. If thou wou'dft have, whatever thou doft want- 1 2 No one, but God, can our condition know. No one, but God, can give us any aid. No one, but God, can hear our prayVs, below--* To God alone then Ihou'd our pray'rs be made* 13 God bids us call on him with fervent pray'r-— God protnifes, if we'll but afk, to give — God hears each wifh, and ev'ry good defire — God can from trouble ev'ry foul relieve. 14 Not Abrah'am, nor St. James, can e'er pretend The' internal feelings of our hearts to guefs— — ■ No one, but God alone, can comprehend Our wants, our woes, our forrows, and diftrefs. 15 To give to thoufands whatfoe'er they feek. Only belongis unto the Kjngof kings- ■ Although in various languages they fpeak, * And afk at once a thoufand difPrent things* 16 The Virgin talks no En^lifh, I fuppofe. Neither does Martha, Irifli underftandy No Wellh, as I prefume, St. Clement knows. How can they then our mediatoris ftand? I 17 AbrahanPi [ i3<> 1 1 7 Abraham can ne'er our circumftances know^ Neither can John afford us any aid, Peter, in heav'n, can't hear us here below : To God alone then fhou'd our pray'rs be faid.' 1 8 The Saints, of ev'ry fex and rank, revere. But thou may'ft only Gk)d himfelf adore: Give them the honour they defcrve — but ne*cr, • On whatfoe'er pretence, their help implore. 19 There ne'er was Patriarch, or Apoftle yet- There ne'er was Prophet, as I've ever heard^ (For who cou'd fuch a circumftance forget?) That e^er to any Saint his fuit preferr'd. 20 There's not a promife in the Gofpel made. That we Ihall, any thing we beg, obtain; Unlefs, for it, we Ihall with zeal have pray'd. And that, for Jefus* fake, the fame we gain. 21 Chrift, is the only Mediator known, Chrift, is our only Advocate above. And there is none, but Jefus Chrift alone. That can, for man, the dread Creator move. 22 Whate'er requefts we (hall to God addrefs. They muft be all preferr'd, for Jefus' fake. Who fits on God's right hand in perfedt blils^ • There to receive whatever pray'rs we make. ^3 Let fome to Cathe'rine, or St. David fly. To Clement, Martha, Martin — any one: But, for my part, I never will apply] To any — but to Jefus Chrift alone. 24 Seek then with earneftnefs, whene'er you pray— ^ Seek the direftion of the Holy Ghoft: For none can, with effeft, their prayers fay, Unlel's they can of his fure guidance boaft. 25 Without the Spirit fome may have eflay'd. To talk with God, and ftrove their pray'rs to layj But no man can, without the Spirit's aid, Converfe with God, or with attention pray. 26 Unlds t '3- 1 ^6 Urilefs the confcience and the heart are join'ci^ The tongue-born prayer God will never prize j But that, which flows froni an afFefted mind. Will always prove a pleafing facrifice. 27 Seek God, both with thy mouthy and with thy heartjj For either of the two will not fuffice-. But let thy fpirit with thy mouth take parfi And then 'twill prove a harmony mofl: nice. 28 The prayV, that iflues wholly from the heart. Is better much than thofe that only fpring From the bare lips, where t*other bears no part: For fuch a prayer is an odious thing. 29 Mofes more pleafingly his God addrefs'd. Upon his journey, tho' he nothing faid, £jf.xiv.is- Than erft the Jews, when they their wants exprefs'd^ And with the lips, without the Spirit, pray*d. 30 Whatever thou alkeft, ask with faith fincere 5 Take no denial ask with fervent mind — ^— And what thou askeft, thou ftialt have-ne'er fear : Seek but with eameflnefs, thou'lt furely find. 31 The little birds their clamour never ceafe. Until their dams with food their noife have ftiird ; So man himfelf fhou'd never hold his peace, 'Till God has evry want and wifh fulfill'd. 32 How ^arneft fomic will beg ('tis ftrahge to fay !^ For pence, or food their hunger to remove ; And yet how fluggiftily the fame will pray For mercy, and the glorious joys abdve? 33 God is, to all that feek him^ mighty kind— — — - To all, that ask, he's ready ftill to grant — To grant to all, with an ungrudging mind Largely to grant, whatever they may want. 34 As a fond mother ftill inclines her ears^ When in the cradle her love'd infant cries : So God his creatures' fupplicatidns hears. Removes their preflures, and their wants fupplids. I 2 35 Fof [ '32 ] 35 For how can God but hear each Chriftian's prayV^ Since for the' eleft his holy Spirit pleads. And, on the throne of his eternal Sire, For them their Saviour ever intercedes ? 36 If thou (halt ask for ought, in Jefus' name. Thou either, what thou askeft, (halt obtain, (So thou doft earneftly entreat the fame) Or, what is more expedient, thou Ihalt gain. 37 Shou'd God to grant thee thy defire delay, Shou'd he not anfwer thy petition foon, 'Ti3 that thou may'ft with greater ardor pray. Or beg a larger, and a better boon, 38 Seek, firft, the glory of thy gracious Sire- Seek, next, celeftial happinefs to gain- God's kingdom and his righteoufnefs defire— - And all thy wants befides thou Ihalt obtain. 39 Ask thou not ought, as long as thou doft live. That is repugnant to God's holy Word : If thou ftiou'dft ask, what he's not pleas'd to pv^ Thy prayer will but irritate the Lord. 40 To covet earthly things, is very wrong. When one may gain the wealth of Paradife— - Or for fome dirty acres here to long ; But all the joys of heaven to defpife. 41 As 'tis the nature of the fwinilh kind. To tear the turf, and nuzzle in the mire : So man by nature is to earth inclin'd. And does not to celeftial blifs afpire. 42 Seek thou, whatever the fcripture does permit — Seek thou, whate'er'sallow'd thee by the Lord ^ But feek it in the manner that's moft fit. And moft concordant with his written Word.. 43 Whene'er to God thou prayeft, be fincere. And ufe no other language than thy own : Better a word or two, whofe fenfe is clear. Than thoufands mumbled in a tongue unknown. 44HC t ^33 I 4.4 He mocks hii God, and does himfelf deceive. Whoe'er attempts to ask, he knows not what. And thinks to have, e*en what he can't conceive. By mere lip-labour, and unmeaning chat, 4.5 Ne'er let thy mouth thy lagging mind outftrip, But tell thy heart to ponder well the whole : God ne'er regards the prayer of the lip. Without the full concurrence of the foul. 4.6 God, cv'ry thought and bofom fecret knows, God, is himfelf the Sire and fource of light, God, chufes pray'r, as from the heart it fl6ws ; But empty words are nothing in his fight. J.7 Caft ev'ry fin-polluted thought afide, Whilft thou to God thy prayer doft prefer; And let each worldly care, behind, be tie'd, Whilft thou doft with the Lord of hofts confer. |.8 Abra'ham 1^ not his afs approach the fcene. Where he did erft his facrifice prepare: Permit not thou a thought, that is unclean. To come — where thou doft offer up thy pray'f. .9 Like Abra'ham, thou muft drive away, whatc'er Lights on thy || facrifice-- -and boldly fight \Genj^w.\\ With ev'ry thing that hinders thee to rear The walls of Sion to their proper height. The greater earneftnefs that Satan ftiows To turn thy thoughts afidp, when thou doft pray : The more do thou his fly attacks oppofe. And fight againft him, 'till he fiees.away. 1 As the fierce lion flees, and quits his prey. Soon as the crowing of a cock he hears : So does the fell deftroyer skud away. Whene'er our faith-fraught prayers'pierce his ears. 2 The buffalo cannot that place come near. Where young pigs fqueak, or little ;chickcns cry: Neither c^n Satan on the fpot appear. Whence holy prayers are preferred on high. 1*3 53 Did f 134 ] 53 Did not the wily fiend obfervc with pain. That prayer lefllen'd his extenfive fway. And feem'd moft likely to fubvert his reign. He ne'er wou'd hinder any one to pray. 54 If thou haft thy falvation, then, at heart, ^ Thy Maker's glory, and thy own great need Of pardon — ne'er let Satan make thee ftart From hearing fermons— or thy pray'rs impede, 55 Whene'er thou prayeft unto God — ftill mmd For ev'ry order in the church to pray p Nor let thy prayers ever be confin'd To thy ownfelf — like thofe the Fagans fay; g6 For none of them are of her holy race. Who pray not for her welfare and fuccefs. But mifcreant baftards, infamous, and bafc. And enemies to Sion's happinefs. 57 If Abra'ham kindly for Gomorrah pray'd. And for the other cities of the plain : Shou'd not we Chriftians beg our Maker's aid. And choiceft bleffings for his chofen train ? 58 Chrift tells us all at any time to pray, i^i^anriiii. And ne'er the beneficial tafk give o'er: St. Paul, to Timothy does likewife fay, EpA. nX That in all places we ihou'd God adore, Sg Thrice ev'ry day, for the Almighty's aid. The pious Daniel never fail'd to pray The royal Prophet, ftill more pious, made His fuppli<;ations feven times a day. 60 Our blefled Saviour pafs'd the live-long night In prayer — though nor fin, nor guilt he knew. And fpent each day, as long as it was light. In preaching to a dull and thanklefs crew, 61 Prayer is ever of the greateft weight. In ev'ry place — at any time, or hour 5 So that the heart is in a proper ftate. To beg a favpyr from the' Almighty pgw'r. 6z Vpon t >35 1 €2 Upon the boiftrous fea, or mountain's brow. At our own home, or any where abroad, Pray'r is a duty, which we always owe ( Where-e'er we are) unto the' eternal God. 63 We all fliou'd pray, like Peter in his room, ' Or elfe, like David, when a-bed he lay, Or elfe, like Daniel, in the dungeon's gloom: In ev'ry circumftance we ftill fhou*d pray. 64 The facred fire upon the* altar li't. Never with-held from man it's radiance bright—-— To manifeft that thou lhou*dft ne'er permit Thy zeal for pray'r to be extinguifh'd quite, 65 Man is the temple, the Almighty loves ^ Man's heart the altar, gives him moft delight Pray'r is the facrifice, he moft approves -. Give him that facrifice, both morn and night. 66 Let not thy temple want this facrifice At early morn, or at the noon-tide hour'. And don't forget at night, if thou art wife. To give due praife unto the' eternal Pow'r: 6y So fhall thy God familiar be with thee. So (halt thou ever his afliftance have. So fhalt thou ever in his favour be, , And thy dear foul from all it's dangers fave. 68 There's nothing in the world that fhou'd impede Good Chriftians, their Creator to addrefs. And do the work they have to do befide-. Whatever trade, or calling they profefs. 6g A man may do his ufu'al work, and yet * With unremitted zeal and ardor pray ; For mental pray'r will ne'er retard the feet, Nor any labour of the hands delay. 70 Mofes, the while he travell'd o'er the plain, Jofhua, whilft amid the mortal fray, Chrift, on the road, and Paul upon the main, Cou'd mind their bus'nefs — and find time to pray. ^I 4 71 Although [ 136 ] JTI Although cxcufes often are allowed. In many a weighty and perplex'd affair; Yet no excufe fufficient can be fhow'd To fcreen, or palliate the negledt of pray V. 72 Thou may'ft abfent thyfelf from church, when iU> And pardon for thy abfence may 'ft implore: But, whatfoever thy complaint is, ftill Thou'rt bound to pray— until thou art no more. 73 Thou may*ft from a£t of charity forbear. When alms fufficient are not in thy pow'r: But yet thou never muft refrain fromprayV, However deftitute, however poor. 74 In ev'ry ftate, at ev'ry time and place. Prayer is feafonable and ufeful ftill; Let nothing hinder thee, in any cafe. With proper zeal this duty to fulfil. "JS Whether in deep diftrefs, or high in wealth. In ev'ry ftate of life, wherein we are. Or in difeafes, or in perfedt health, A Chriftian may addrefs his God with pray'r. 76 No locks, no bolts, nor any human powV, Nor all the world, can ftop the rapid flight Of prayV — or hinder it, at any hour. From pofting to the' immortal Sire of light. 77 Pluck from it's roots the quiv'ring tongue of man, Cut off his feet, or chain them — from his heart He ne'erthelefs, fpiteof all hindrance, can His fervent pray'rs to his Creator, dart. 78 Whether on feaft or faft, by night or day. At morn or eve, or any time you will. Prayer to heav'n can wing it's airy way Come when it will—it fhall be welcome ftill. 79 Efther, tho* queen, was not allow'd to fee (But at fome certain feafons of the year) Her royal lord — but prayer's always free To go to God, without reftraint or fear. 80 Get [ ^37 3 3 Get up, like Daniel, with the dawning light. And make thy fuit to God, at any hour. Or rife, like David, in the dead of night: For always ready is the' Almighty pow'r. 1 Tho* God to no man living does allow The honour, with his Saviour to confer—- Yet ev'ry Chriftian*s pray'r to heav'n may go. And, at all feafons, gain admittance, there. 2 Through ftorms and Ihow'rs, thro* ocean and the (ky. Through ev'ry fix'd or wand'ring ftar above. Prayer to God himfelf fhall mount on high. And. with the rapid flight of lightning move. 3 Not heav'n or earth, or any human pow*r. Authority, or angel from the Iky, Can hinder pray*r, at any time or hour. From holding conference with Chrift on high. 4 It needs not afk St. Peter for his key. But rtiay through all the angels pafs alone. Without one obftacle to block it*s way. Boldly unto our bleffed Saviour's throne. 5 Prayer will force the Deity, to hear Her plaints — and Chriftj her doleful caufe to plead— Prayer will make the Spirit interfere. With fighs and groans for her to intercede. 6 The Giver of each gift that's good, will ne'er Turn back the pray'r that's faithfully addrefs'd. But Chrift will blefs each heart that is fmcere. Nor quit him, »till he's of each wifh poffefs'd. 17 If prayer fhall not, what it afks, receive. It fome what, better yet than that, fhall gain — For Chrift an ardent pray'r will never leave To go for nought, or be preferr'd in vain. !8 What do we owe unto the gracious Pow*r, Who, to our praye'rs, does the permiffion grant To come unto his prefence, any hour. And to obtain from him whatever we want? 89 PraycV^ [ 138 1 ig Pray'r is an arm which reaches very fa r E*en from the earth unto the etherial (ky mm To her God's treafurcs never have a bar. But thence flie takes, what may her wants fupply, 90 Prayer, of old, a mighty giant flew — x Sam. xm. ^ Prayer, the lion*s mouth fhut up of yore Prayer, the gates of iron open threw Prayer, can fave a man, at any hour. 9 1 Prayer, lock'd up the heavens long from rain- Prayer, the ocean turn'd to folid land- Prayer, rai^'d up the dead to life again - There's nothing can the force of Prayer withftandf 92 What thanks Ihou'd we, then, to the Godhead pi^ Who to our Prayers a free admiflion grants. Whene'er we pleafe, without the leaft delay. And fatisfies with bounty all our wants ? 93 All due refpeft and revVence and renown. Be to the Donor of each blefling given. To him be honour, pow'r, and homage, fhown, Who kindly hears us from the higheft heaven ! Advice, before PRAYER. BEFO RE thou doft attempt to pray. Of all thy vices paft repent. And wafh the hateful filth away. That God may to thy pray'r affent. 2 God will no vile offenders hear. Nor thofe who finners are profefs'd— But they muft quit their vices, e'er The Lord will lift to their requeft. 3 If ftainVi with malice, rage, or pride. Or murder, thou ftiou'dft there repair, Where God in glory does refide. He will rejeft thy finful pray'r. 4 The [ ^39 ] 4 The curfe of Moab they fliall gain. Who pray with a polluted foul : They ask, but they Ihall not obtain, Becaufe their hands are ftain'd and foul. 5 Whoever calls upon his God Muft lay all filthinefs afide , And waih his hands quite clean from blood, Or elfe his fuit will be deny*d. 6 God *s gracious to each penitent, Whofe reformation is fincere : Then of thy wicked ways repent. And God will thy petition hear, 7 If thou wilt leave thy vices quite. Although they were in crimfon dreft. Yet Chrift fhall make them lily-white. And lend an ear to thy requeft. 8 Whene'er to pray'r thou art inclined. Be to each idle thought averfe. And leave all worldly views behind, Whilft with thy God thou doft converfe. 9 *Tis bad, to fee fome fardel foul Brought on one's back to God's own dome, But worfe to fee a world-ftain'd foul Into God's aweful prefence come. o And when thou prayeft, pray for all True Chriftians, not excepting one 5 Nor, like a felfifti heathen, call On God, to blefs thyfelf alone. : I Firft, pray for kings, that they may grace Obtain, to rule their people well. In the true faith, in wealth and peace, And may in righteoufnefs excel, 2 Then for the clergy beg his grace. Clearly thofe myfteries to teach. Which in the gofpel they may trace, '^ And flycntly it's trgths to preach. 13 For [ HO ] 13 For ev'ry magiftrate implore His aid, the vicious to reftrai n And that the Lord may grant him pow'r, Juftice and virtue to maintain. 14 Then beg a bleffing from thy God On all that in the arts delight. That they may fcatter all abroad True faith, morality, and light. 15 For all the Commons of the land Then pray unto the Lord above. That each may in his calling Hand, Replete with loyalty and light. 1 6 Pray, laftly, for the poor and low. And all, who in oppreflion live. That God to them may pity Ihow, And to each fufFe'rer comfort give. A Warning, or Admonition, to croy Man, to think on GOD in the Mocnin^ and to return him Thanks for prderriog him the preceding Night from all Evil. i T T 7 H E N firft thou wakeft, each fucceeding dij) V V Lift up to God above thy grateful eyes. And due refpeft to him be fure to pay, Ee'r other thoughts withiivthy bolom rife. 2 'Twas He, that kept the prowling foe. And watch'd thee carefully 'till break of day. And fuffer'd not his eyes repofe to know. Left in thy fleep thou (hou'dft become his prey. 3 For did not God and his celeftial train. Around his fervants keep a conftant guard. They all had by the foe, e'er this, been (lain. And fwallow'd up, afleep and unprepar'd, jfif .10 [141 1 ^ By far more dangerous is that mortals ftate. Who lies a-bed without his Saviour^s aid. Than that which did of old on Daniel wait, - When he gll night was with the lions laid. 5 The fcriptures tell us, that -by night and day — ^ The Devil roams to leek the fall of man, Juft as a lion roves in fearch of prey. And tears and mangles ev'ry beaft he can. 6 Who can forbid the lion to devour ? Who, but the Ihepherd Chrift, his flock can keejp^ That without flumbVing guards us ev*ry hour. And from the guileful fiend proteds his iheep? 7. Think, then, how much thou art in duty bound To thank thy God, who has preferv'd thee ftill From Satan's machinations, fafe and found, And from the preflure of each other ill? I As God's demands, on thee, are vaftly large. Let thy returns of praife be likewife great : The. grateful offe'ring on thy knees difcharge,. ' And, night and morn, the* incumbent talk repeat. I Think thou, how Satan flily might have ftole,. And filently deftroy'd thee, inthyfleep. And into judgement haul'd thy heedlcfs foul. If Chrift his watch around thee did not keep. D Think, that the foe thy children might have flain---' Thy riches, as his legal prey convey'd Thy houfes burn'd, and martyr'd thee with pain. Had Chrift not lent thee his Almighty aid. c Think, that perhaps he might have touched thy brain. And that thou ever hadft diftrafted rave'd. And neither reft, nor quiet known again, ^ Waft thou, by Chrift, not from his malice iave'd. > Thy gratitude, on all occafions, Ihow To thy true Shepherd, for his friendly aid^ ;. Who thee fo fafely guarded from the foe. That thou need'ft not be of his force afraid. 13 Suppofc 13 Suppofe a Jew, the moft abhorr'd of men, Shou'd guard thee fleeping in the' inclement air,' 'Mongft rave*nous beafts, or near a lion*s den : Wou'dft thou not thank him kindly for his cart? 14 And yet, though Chrift protefts thee cv^iy hour, Whilft thou amongft fierce lions fleepeft faft. Which are at all times ready to devour— — Thou ne'erthelefs art thanklefs to the laft. 15 Open thine eyes-thy Saviour's goodnefs fee . Take warning — and his loving-kindnels own- Return him thanks upon thy oended knee. For all the mercies he, to thee, has ftiown : 16 So (hall he always keep thee fafe from ill. And under his extended pinions fcreen And fo with eafe Ihall he preferve thee ftill From ev'ry harm and peril unforefeen. 17 Take heed, thy heart does not indulge a though^' Take heed, left thou on ought fhou'dft fix thine qici Take heed, that with thy lips thou fpeakeftnoughi 'Till thou haft paid thy morning facrifice. 18 To God, the prime ideas of thy heart, To God, the prime of thy expreflions give. To God, the firft-fruits of thy foul impart ; The fecond and the laft he'll not receive. 19 Juft at the dawn, before the rifing fun. The mounting lark his Maker's praifes fings : So man, e'er he has ought befides begun, Shou'd chant the praifes of the King of kings. 20 The little red-breaft, e'er he wets his bill. To his Creator chirps his morning pray'r. Who kept him the preceding night from ill, Though cold his lodging, and tho' coarfc his fare 2 1 But many a man will from his bed arife, ' More heedlefs than the fongfters of the air. Or fwine, that grunting leave their odious ftyes, Nor thank him for his providential care. 22 0,*^ [ H3 ] O, 'tis a fhame the fons of men fliou'd e'er Appear lefs grateful than the feather d quire. Who, ev'ry night and morn, their voices rear To thank and laud their everlafting Sire ! A Morning THANKSGIVING when we jfirft awake. OGod, my fafe-guard and defence, My fort, in ev'ry exigence. Receive my thanks— thou, who didft keep Me fafe^ laft night, whilft I did fleep ! I A watch, around my head, each night Thou placeft, when I'm conquer'd quite By fleep, and o'er me fpread'ft thy wing, When I've forgot each earthly thing, 3 Thou giveft me fweet eafe and reft, And ev'ry night with them I'm bleft. Whereby this feeble frame, O Lord! Is daily to it's ftrength reftor'd. 4 My gracious God does never clofe, Or wink his^yes, when I repofe. But whilft I fleep, within his arms. Secure he keeps me from all harms. 5 0, what a favour this ! — that thou The King of kings, flioud'ft ftoop fo low. As duft and aflies to regard. And unto man to be a guard! 6 The tithe can ne'er be paid by me Of all the thanks I owe to thee. Good God, the truth I freely own. Was it but for this gift alone ! 7 All glory, pow'r, thankfgiving too. All praife, refpeft, and honour due, Let us unto the Godhead pay For his proteftion, night and day. Thanks [ 144 ] Thanks to Chrift for Protedion and 13^t 1 Ti vT Y Shepherd, who my foul didft keep JVJl Laft night, whilft I was fall afleep. From the grim wolf, beneath thy win g • ] Thy praifes, from my heart. Til fing ! 2 Clofe to thy breaft, thou didft me place. And in thine arms didft me embrace. Thou eafe and reft to me didft give. And I will thank thee, whilft I live! 3 Thou hind'Fcd'ft-Satan, to deftroy Thou lynd'red'ft villains, to annoy From fires and ftorms thou didft me keep. And fufPred'ft nought to break my flecp* 4 Thy name, O Chrift ! be ever bleft. Who doft protea me, whilft I reft— • All glory be afcribe'd to thee. Who fuch refrefhmcnt giveft me. An Admonition to a MAN, wheql drefles his Body, to pray for Clotljies and A mour, for the Soul. • I TTl rH E N, in the morn, to drefs thou doft hcgi V V Pray thou that God wou'd lend to thee his aro That, like a Chriftian, thou may'ft fight therein, And boldly brave each enemy's alarms. 2 In vain doft thou, from the inclement air. Thy body guard, and from the tempeft keen. If thou doft not a proper garb prepare Thy foul from fin's deftrudtive rage to fcreen*. 3 Seek, then, to fave thee from each greedy foe. And fin's aflaults, the panoply of God .^ ' Seek it, to fliield thee from each prefling woe. And from the world, the flefli, and Satan's fraud 4I [ 145 1 4 For wc, without it, are defencelefs quite. To ev'ry enemy an eafy prey Aqd 'tis impoflible for human might, Unarm'd with it^ to conquer in the fray. 5l Prayer, whilft thojf art drefling, to beg the Armour of God, to defend thee from the aflaults of Sin. 1 ARM me with all thy panoply divine, jtX ThouLordofhofts! thouGod of matchlds might! That I may, like a Chriftian hero, Ihine, And overccime my enemies in fight! 2 From head to heel, let not a fingle part Remain expofe'd, left I receive a wound, (For great and dangerous is the tempter's art) In that fole ^t, where there's no armour found. 3 Let not the world, with all it's bawbles vile — r^ Let not the flefh, with evVy loofe defire -. Let not the devil, by fome curfed wile, Caufe me td fin againft my gracious Sire. 4 Give me, O Lord ! fufficient force and might. That I may all my enemies overcome, • And under thy viftorious banner fight, 'Till thou, in glorious peace, (halt lead me home. " ■ • Another, on the fame Subjed. 1 rr\HOlJ Rock of my falvation, lend thy aid ! J^ Arm me in all thy panoply complete, And leave no fingle member unarray'd, '"'[ Left the foul fiend thy warrior fhou'd defeat ! 2 Upon my head let Hope's gay helm be place'd • My breaft with Equity's bright corfelet grace — The belt of Penitence gird round mywaift — And, on my feet, the Gofpel's fandals lace. K 3 Give^ [ 146 ] 3 Give mc, thy word, for a two-edged fword— The fhield of faith, to ward ofFevVy daft, That Satan throws — and conftant pray'r, O Lord To force the fell invader from my heart, 4 Give me afliftance bravely to engage With all the enemies that hem mc in, With cv'ry carnal luft, and Satan's rage. The world's deceits, and ev'ry deadly fin— ■ 5 Give me aiFiftance to attack them all, » To break their ranks, and conquer them in fight- That on my knees I may right humbly fall To worfhip thee, like a true fon of light : 6 So fhall I march undaunted, ev'ry ddy^ Beneath thy ftandard, through the field of death,' And give thee praife, without the leaft difmay, O Lord, my God! whilft I have any breath. An Admonition to a Peirfon, whiM he wafh^s himfelf. 1 TT THene'er, to wafh thyfelf, thou doft VV ^ith earneftnefs to thy Creator pray,' That he'll be pleas'd to cleanfe thy foul from fin, And wafli thy errors, in Chrift's blood, away. 2 To free thy flefh from outward filth — a flood, Nay^ e'en a fea of water, wou'd be vain, Unlefs thy confcience in thy Saviour's blood Be cleans'd from vice and ev'ry inward fl:auu 3 It nought avails thee, that thy face is clean. If thy corrupted mind be void of grace: God takes no pleafure in the man, I ween, Whofe heart is not as Ipotlefs as his face. AfhoU [ H7 i A fliort Prayer, on the fame Occafion# 1 /^ Wafh me in the Blood, the Jews erftfpilt! \J O wafli me, Chriftl from ev'ry confcious guilt! ' O walh my mind from ev^ry thought obfcene ! O wafli me, from all foul pollutions, clean! 2 O walh my head and feet, and ev'ry part. As thoudidft waifh the Twelve, andcleanfemy h6art! Then wipe away my filth — and, to complete Thy work' — beftow on me the Paraclete ! 3 Wafh me in penitential tears, my King! Wafh me in Grace^s and in Peace's fpring ! Than lilies whiter, wafh me in thy gore. That I, in purity, may thee adore !— — A Morning Prayer, to be ufe'd after a Perfon is up, wafli'd, and drefs'd/. 1 /^ God of mercyi, foft-eye'd Pity's Sire ! V^ For Jefus fake, my num'rous faults pafs o'er i Which more Arithmetic, I own, require To count, than all the fands upon the fhore, 2 There's hot a law in all the facred code. That I, woe's me! have not at times tranfgrefs'd— Nor h^ thou any gift on me bcflow'd. Which I have not to vicious ends addrefs'd- 3 Bad are my thoughts, but worfe my deeds by far-^ Foul is my tongue, and infinite my fraud ■ My temper's hot, but very cold my pray'r : Pardon me all, Pve done amifs, O God!— — — 4 Pardon me all the crimes that I have done. E'en from my childhood to the prefent hour——* Nor let the vengeance on my head come down. Which I've deferv'd from thy Almighty pow'r: ^ - K a 5 Buc [ 148 ] 5 But give me grace and ftrength for ever more To worlhip thee, with fanftity of heart : Aid me, thy wond'rous goodnefs to adore In perfeft honefty, and void of art. 6 Remove each obftacle, that's in the way, / And interferes betwixt my God, and nife — ■ And give me pow'r, my due devoirs to pay. Still unfatigue'd, O Lord, my God! to theef 7 From my vain heart each filthy vice eraze, ^ Each habit IVe been ill-accuftom'd to- — - And,* whilft Fm yet alive, the vacant placlt With ev*ry grace and virtue ftock anew. 8 Teach me, to keep inviolate thy law Teach me, to love it from my very foul-; — My rule of life thence let me ever draw. And always live according to that rule. 9 Direft me, by thy facred Spirit, ftill To regulate each aft, each word, each thought; According to the diftates of thy will, And thofe commandments thou to us haft taught 10 My paflions, and my appetites reftrain, * That I henceforth no wicked aft may do; / But may, o'er fin, a perfeft conqueft gain. And that invete'rate enemy fubdue. 1 1 Help me, O Lord, with thy celcftial might, . - The world, the flefli, the devil, to oppofe — * The viftor*s crown I then may claim of right. When I have conquered thofe united foes, 12 Thy fcrvant. Lord! beneath thy wings defend^. And fcreen me there from ev'ry rude alarm; Neither permit, by any means, the fiend To do my foul,, or body, any harm. 1 3 Keep me, O Lord ! from ev'ry flip, and^ all 'The trouble, Ihame, misfortune, lofs, and ill, Difeafe, or hurt, that may to me befal ; So it be pleafing to thy i\oly will ' 14 Enahh 4. Enable me, by thy bleft Spirit's aid, ' ' ^.1 In Chriftian works to fpend the prefent day. And, whilft I in this yale of tears am ftay'd, My bounden fervice conftantly to pay. 5 O, may this day, whereon I hail thee now. Be as difcreetly and devoutly paft. As if I, for a certainty, did know. That it would be — what it may be — my laft! 6 Let me not. Lord! the moral change delay. From, morn to morn, unto my latter end 5 But, whilft it hitherto is call'd to day. Let me begin my manners to amend. 7 Let not the.flefh, with daring, infolence, Caufe. thee to doom my preciows.foul to woe — Nor for fome few precarious joys of fenfe. Condemn it to eternal pains below. S .Let not this world's delights and fleeting toys. Which vanifhi like a morning inift, away, ^Caufe me fo lofe the rights and teal joys Of that bright world, which never (hall decay. 9 Whil§: yet 'tis day, whilft yet the fun is ftrong, Caufe me to ftrive and work with all my might. In thofe concerns that to my peace belong-. Left unawares I fhou'd be caught by night. o Let me, O Chrift! be always ready dreft, (My lamp well trimnf d, and full of oil and light) - And watcK'thy coming to the wedding-feaft, Whilft heaven's gate lies open to my fight. t When moft fecure, when moft in heakh I bloom. Let me not wholly unprepare*d be caught, But make me think ftill of the day of doom, When all my faults muft to account be brought. 2 Make me refleft, whene'er I am alone. On that exadb account, which all that live, Muft for each petty fault which they have done. Nay, e'en for ev'ry idle ftory, give. K 3 23 Wipe, f ^50 J 23 Wipe, from thy well-kept regifter, away All my iniquities recorded there. And call not in my teeth, on that dread day, ^ The keen reproaches I def^rve to hear. 24. Forgive me, now, the debt I ought to pay, The countlefs fums which by thv book I owe. And with the blood of Chrift blot quite away The utmoil farthing that to thee is due:. 25 And when thou haft forgiven all that fum. Enable me to finilh my career -, That my bleft foul to Paradife may come, And with my Saviour reft for ever there: 26 When I, with all the* angelic choir divine. And heav'nly hofts, Ihall undifmay'd appear, ^ And with extreme delight to praife him join. In endlefs joy, and happinefs fincere. A Warning to guard, whilft it is yet Da againft the Aflaults of the World, d Fleih, and the Devil and to put o ajid to make ufe of, the Armour God againft them. a A S foon as thou art wake'd from thy repofc, /X Refleft — that thou haft three invete'ratc fo Arid each of them for thy deftruction waits. If thou doft not avoid his.fraudful baits : 2 And yet, alas! the weakeftof the three. Is, e'en a thoufand times, too ftrong for thee, Unlefs thou weapons canft from Chrift obtain. And borrow'd might — the viftory to g^n. ^ Then of thy Saviour eameftly entreat. That he wou'd furnifti thee with arms complete. And fill thee with true fortitude of mind. To rout thofe enemies of humankind. * 4 Up [ 151 J ^ Upon thy head the Chriftian's helmet bear. The ftrongeft hopes of heaven thou canft wear, Through which the powVfuI foveVeign of the air • Can never hurt, or force thee to defpair. 5 Place thou the fhield of Juftice at thy breaft, Aflur'd the Devil cannot e*er moleft, Or with his dread artille'ry injure thofe. Who with this fhield his fierce attacks oppofc. $ With Righteoufnefs thy girded loins furround. Nor deign to ufe Hypocrify unfound: For there's no neater, and no ftronger wear. Than a true heart join*d to a mind fmcere. 7 Thy feet with fandals from the Gofpcl grace. Be patient \n each circumftance and place; ^ Through many fufPrings and through many woes. The Chriftian to his Sovereign's palace goes. 8 Take Faith's ftrong fhield, the arrows to repel • The deadly ftiafts, fhot by the prince of hell : A lively faith in Chrifl will always cool The fie'ry darts thrown from the flaming pool. 9 Take thou the fcripture's keen, two-edged fword — Take thou the mighty falchion of the Word- For that's the trenchant blade, which at a blow Can cut and cleave our fierce infernal foe. JLO About thee always keep the arms of God, Though they be many, and oft' deem'd a load ; Left thou, without them fhou'dft perchance be found. And from the fiend receive a fatal wound 11 And of th' all-glorious Trinity entreat That this alliance thou may'fl ftill defeat. And that he'd grace and flrength to thee afford. In thy profeflion, well to ferve the Lord. 12 Shou'd Satan ever find us off our guard. And without armour, his afTaults to ward. We may be fure he'll roughly-handle thofe Who^fhall, unarm'd, his deadly force oppofe. K 4 13 For V -, r 152 ] 13 For if this helmet's, on the head, not place* The corfelet, on the breaft—and round the waift» The beit—or if our feet are ever found ' ^ Unfhod—the fiend our fouls will furely wound. ' 14 Be therefore, like a foldier,. ftill in arms. Be ftriftly-watchful againft all alarms. Left thou Ihou'dft by the guileful foe be foil*d. And of eternal happinefs defpoil'd. 15 Whene'er thou^oeft from thy room, beware. Left thou fhou'dft fall into fome latent fnarc ; For Satan ever feeks, to hook thee in. And tempt thee to commit fome mortal fin. 16 Great is his rage, but greater his deceit — - ^ Greater his fraud than force, however great — He, like a lion, prowls about each hour, Fx)r ever feeking whom he may devour. 1 7 The ferpent's cunning, and the dragon's ire. The lion's ftrength, the glaring tiger's fire. The wolfs voracioufnefs, the fox's fraud. Belong to Satan, when he roams abroad. i^ No fleep, nor reft he knows, by day or night. E'er fmce he fell from the empyrean height. But always feeks, with all his might, to flay Each heedlefs foul, he meets with in his way. 19 Thereforeof all his ftratagems, take care. Left thou ftiou'dft fall unweeting to the fnare: With ceafelefs praye'rsChrift's matchlefs aid entreat*, And Chnft will help thee, Satan to defeat. A Prayer againft the Temptations, and Aflaults of the Devil. J /^ Thou, that keepeft hell's abyfs clofe-barr'd, V^ And o'er it's gates haft fet a conftant guard, That Satan haft enchain'd, and death overthrown, Hear my complaint from thy celeftial throne ! 2 That a That bloody dragon, that malicious foe, Whom thou didft bind, and glorioufly overthrow; Still plots my ruin — if thou wilt not deign ' To grant thy help, his malice to reftrain. S Both night and day^ he roams with fleeplefs eyes. And,- like a lion, to deftroy me tries j For ever prompt and ready to devour, Didft thou not fhield me from his deadly pow'r! 4 Each night that comes, and each returning day. He fpreads his dangVous toils a-crofs my way. And into them I tumble unawares. If thou doft not preferve me from his fnares. 5 There*s no forbidden fruit, of pleafing hue. But he prefents it daily to my view ■ ■ There is no fin, but he wou'd tempt me to. That I may make my gracious God, my foe. 6 There's no good aft, on which my foul's intent. Which the tell fiend attempts not to prevent And oft, too ofi: ! his curs*d attempt fucceeds, • And puts a flop to my beft minded deeds. 7 I cannot eat a bit of bread in peace, I cannot take a wink of fleep at eafe^ I cannot drink, or any work begin, But he aflays to turn it all to fin. 8 I cannot e'en a fingle fentence fay, I cannot even bend my knee;;5 to pray. But Satan all his efforts ftill applies. To make me fin — e'en at my pray'rs he tries : , 9 Nay, O my Saviour! when I'm moft inclin'd To wdrfliip thee, with all my heart and mind.
| 7,308 |
https://github.com/system32uwu/Proyecto_UTU/blob/master/Datos/MedicoUtils/D_Analisis.vb
|
Github Open Source
|
Open Source
|
MIT
| null |
Proyecto_UTU
|
system32uwu
|
Visual Basic
|
Code
| 1,724 | 6,142 |
Imports Entidades
Imports MySql.Data.MySqlClient
Public Class D_Analisis
Dim conexion As New MySqlConnection
Public Function AltaAnalisis(a As E_Analisis) As Integer
Dim cmd As New MySqlCommand With {
.CommandType = CommandType.StoredProcedure,
.CommandText = "AltaAnalisis",
.Connection = conexion
}
cmd.Parameters.Add("NOM", MySqlDbType.VarChar, 90).Value = a.Nombre
cmd.Parameters.Add("ID_AN", MySqlDbType.Int32).Direction = ParameterDirection.Output
If Sesion.Conectar(conexion) = -1 Then
Return -1
End If
Try
cmd.ExecuteNonQuery()
Catch ex As Exception
Sesion.Cerrar(conexion)
Return -2 'no se pudo ingresar analisis
End Try
a.ID = cmd.Parameters("ID_AN").Value
Sesion.Cerrar(conexion)
Dim exitCodeParametro = AltaParametros(a)
Select Case exitCodeParametro
Case <> 1
Return exitCodeParametro
End Select
Return AltaIndicacion(a)
End Function
Public Function AltaParametros(a As E_Analisis) As Integer 'hacer algo para verificar existencia del parametro antes
If Sesion.Conectar(conexion) = -1 Then
Return -1
End If
Dim cmd As New MySqlCommand With {
.CommandType = CommandType.StoredProcedure,
.CommandText = "AltaAnalisisParametro",
.Connection = conexion
}
cmd.Parameters.Add("NOM", MySqlDbType.VarChar, 90)
cmd.Parameters.Add("UNI", MySqlDbType.VarChar, 20)
cmd.Parameters.Add("REF_MIN", MySqlDbType.Double, 8)
cmd.Parameters.Add("REF_MAX", MySqlDbType.Double, 8)
cmd.Parameters.Add("ID_P", MySqlDbType.Int32)
cmd.Parameters("ID_P").Direction = ParameterDirection.Output
Dim cmd2 As New MySqlCommand With {
.CommandType = CommandType.StoredProcedure,
.CommandText = "AltaAnalisisTieneParametro",
.Connection = conexion
}
cmd2.Parameters.Add("ID_AN", MySqlDbType.Int32)
cmd2.Parameters.Add("ID_P", MySqlDbType.Int32)
For Each p As E_Analisis.Parametro In a.Parametros
If p.ID = 0 Then
cmd.Parameters("NOM").Value = p.Nombre
cmd.Parameters("UNI").Value = p.Unidad
cmd.Parameters("REF_MIN").Value = p.ValorMinimo
cmd.Parameters("REF_MAX").Value = p.ValorMaximo
Try
cmd.ExecuteNonQuery()
p.ID = cmd.Parameters("ID_P").Value
Catch ex As Exception
Sesion.Cerrar(conexion)
Console.WriteLine("ERR" & ex.Message)
Return -5 'no se pudo ingresar parametro
End Try
Else
Console.WriteLine("El parametro ya esta registrado en la BD")
End If
cmd2.Parameters("ID_AN").Value = a.ID
cmd2.Parameters("ID_P").Value = p.ID
Try
cmd2.ExecuteNonQuery()
Catch ex As Exception
Sesion.Cerrar(conexion)
Console.WriteLine("ERR2" & ex.Message)
Return -3
End Try
Next
Sesion.Cerrar(conexion)
Return 1
End Function
Public Function AltaIndicacion(a As E_Analisis) As Integer
If Sesion.Conectar(conexion) = -1 Then
Return -1
End If
Dim cmd As New MySqlCommand With {
.CommandType = CommandType.StoredProcedure,
.CommandText = "AltaAnalisisIndicacion",
.Connection = conexion
}
cmd.Parameters.Add("NOM", MySqlDbType.VarChar, 90)
Dim cmd2 As New MySqlCommand With {
.CommandType = CommandType.StoredProcedure,
.CommandText = "AltaEspecificacion",
.Connection = conexion
}
cmd2.Parameters.Add("ID_AN", MySqlDbType.Int32).Value = a.ID
cmd2.Parameters.Add("NOM_I", MySqlDbType.VarChar, 90)
cmd2.Parameters.Add("DESCR", MySqlDbType.VarChar, 500)
For Each i As E_Analisis.Indicacion In a.Indicaciones
cmd.Parameters("NOM").Value = i.Nombre
Try
cmd.ExecuteNonQuery()
Catch ex As Exception
Console.WriteLine(ex.Message)
Sesion.Cerrar(conexion)
Return -6 'no se pudo ingresar indicacion
End Try
cmd2.Parameters("NOM_I").Value = i.Nombre
cmd2.Parameters("DESCR").Value = i.Descripcion
Try
cmd2.ExecuteNonQuery()
Catch ex As Exception
Console.WriteLine(ex.Message)
Sesion.Cerrar(conexion)
Return -6
End Try
Next
Sesion.Cerrar(conexion)
Return 1
End Function
Public Function RetornarParametros() As List(Of E_Analisis.Parametro)
Dim pList As New List(Of E_Analisis.Parametro)
Dim leer As MySqlDataReader
Dim cmd As New MySqlCommand With {
.CommandType = CommandType.StoredProcedure,
.CommandText = "ListarParametros",
.Connection = conexion
}
If Sesion.Conectar(conexion) = -1 Then
pList.Add(New E_Analisis.Parametro With {.ErrCode = -1})
Return pList
End If
Try
leer = cmd.ExecuteReader()
Catch ex As Exception
Sesion.Cerrar(conexion)
pList.Add(New E_Analisis.Parametro With {.ErrCode = -2})
Return pList
End Try
If leer.HasRows Then
While leer.Read()
pList.Add(New E_Analisis.Parametro With {
.ID = leer.GetInt32("ID"),
.Nombre = leer.GetString("nombre"),
.Unidad = leer.GetString("unidad"),
.ValorMinimo = leer.GetDouble("referencia_min"),
.ValorMaximo = leer.GetDouble("referencia_max")
})
End While
Else
pList.Add(New E_Analisis.Parametro With {.ErrCode = -8})
End If
Sesion.Cerrar(conexion)
Return pList
End Function
Public Function AnalisisExiste(nombreanalisis As String) As Integer 'si el analisis ya existe avisar y pedir que cambie el nombre
If Sesion.Conectar(conexion) = -1 Then
Return -1
End If
Dim cmd As New MySqlCommand With {
.CommandType = CommandType.StoredProcedure,
.CommandText = "AnalisisExiste",
.Connection = conexion
}
Dim leer As MySqlDataReader
cmd.Parameters.Add("NOM", MySqlDbType.VarChar, 90).Value = nombreanalisis
cmd.Parameters.Add("EXISTE", MySqlDbType.Bit).Direction = ParameterDirection.Output
Try
leer = cmd.ExecuteReader()
Catch ex As Exception
Sesion.Cerrar(conexion)
Console.WriteLine("err analisis existe" & ex.Message)
Return -2
End Try
Dim existe As Integer = cmd.Parameters("EXISTE").Value
Sesion.Cerrar(conexion)
Return existe
End Function
Public Function ConsultarResultadosAnalisis(a As E_Analisis) As Integer
If Sesion.Conectar(conexion) = -1 Then
Return -1
End If
Dim leer As MySqlDataReader
Dim cmd As New MySqlCommand With {
.Connection = conexion,
.CommandType = CommandType.StoredProcedure,
.CommandText = "ConsultaAnalisisResultados"
}
cmd.Parameters.Add("ID_C", MySqlDbType.Int32).Value = a.ConsultaReq.ID
cmd.Parameters.Add("ID_AN", MySqlDbType.Int32).Value = a.ID
Try
leer = cmd.ExecuteReader()
Catch ex As Exception
Sesion.Cerrar(conexion)
Console.WriteLine(ex.Message)
Return -2
End Try
If leer.HasRows Then
While leer.Read()
a.Parametros.Add(New E_Analisis.Parametro With {
.Nombre = leer.GetString("nombre"),
.ID = leer.GetString("ID"),
.Unidad = leer.GetString("unidad"),
.ValorMinimo = leer.GetDecimal("referencia_min"),
.ValorMaximo = leer.GetDecimal("referencia_max"),
.Valor = leer.GetDecimal("valor")
})
End While
Else
Return -8
End If
Sesion.Cerrar(conexion)
Return 1
End Function
Public Function BuscarAnalisisXNombre(nom As String) As List(Of E_Analisis)
Dim aList As New List(Of E_Analisis)
If Sesion.Conectar(conexion) = -1 Then
Sesion.Cerrar(conexion)
Dim a As New E_Analisis With {.ErrCode = -1}
aList.Add(a)
Return aList
End If
Dim leer As MySqlDataReader
Dim cmd As New MySqlCommand With {
.CommandType = CommandType.StoredProcedure,
.CommandText = "BuscarAnalisisXNombre",
.Connection = conexion
}
cmd.Parameters.Add("NOM_A", MySqlDbType.VarChar, 160).Value = nom
Try
leer = cmd.ExecuteReader()
Catch ex As Exception
Sesion.Cerrar(conexion)
Dim a As New E_Analisis With {.ErrCode = -2}
aList.Add(a)
Return aList
End Try
If leer.HasRows Then
While leer.Read()
aList.Add(New E_Analisis With {
.ID = leer.GetInt32("ID"),
.Nombre = leer.GetString("nombre")
})
End While
Else
Dim a As New E_Analisis With {.ErrCode = -8}
aList.Add(a)
End If
Sesion.Cerrar(conexion)
Return aList
End Function
Public Function ListarAnalisisDePaciente(CI_P As Integer) As List(Of E_Analisis)
Dim aList As New List(Of E_Analisis)
Dim leer As MySqlDataReader
If Sesion.Conectar(conexion) = -1 Then
Dim a As New E_Analisis With {.ErrCode = -1}
aList.Add(a)
Return aList
End If
Dim cmd As New MySqlCommand With {
.Connection = conexion,
.CommandType = CommandType.StoredProcedure,
.CommandText = "ListadoAnalisisPaciente"
}
cmd.Parameters.Add("CI_P", MySqlDbType.Int32).Value = CI_P
Try
leer = cmd.ExecuteReader()
Catch ex As Exception
Sesion.Cerrar(conexion)
Console.WriteLine(ex.Message)
Dim a As New E_Analisis With {.ErrCode = -2}
aList.Add(a)
Return aList
End Try
If leer.HasRows Then
While leer.Read()
aList.Add(New E_Analisis With {
.ID = leer.GetInt32("ID"),
.Nombre = leer.GetString("nombre"),
.ConsultaReq = New E_Atiende With {
.ID = leer.GetString("ID_Consulta"),
.Fecha = leer.GetString("fecha_c"),
.Paciente = New E_Paciente With {.Cedula = leer.GetInt32("CI_paciente")},
.Medico = New E_Medico With {.Cedula = leer.GetInt32("CI_medico")}
}})
End While
Else
Dim a As New E_Analisis With {.ErrCode = -8}
aList.Add(a)
End If
leer.Close()
Dim cmd2 As New MySqlCommand With {
.Connection = conexion,
.CommandType = CommandType.StoredProcedure,
.CommandText = "CargarFechaResultadoA"
}
cmd2.Parameters.Add("ID_C", MySqlDbType.Int32)
cmd2.Parameters.Add("ID_AN", MySqlDbType.Int32)
For Each a As E_Analisis In aList
cmd2.Parameters("ID_C").Value = a.ConsultaReq.ID
cmd2.Parameters("ID_AN").Value = a.ID
Try
leer = cmd2.ExecuteReader()
Catch ex As Exception
Sesion.Cerrar(conexion)
Console.WriteLine(ex.Message)
a.ErrCode = -2
Return aList
End Try
If leer.HasRows Then
While leer.Read()
a.FechaRes = leer.GetDateTime("fecha")
End While
End If
Next
Sesion.Cerrar(conexion)
Return aList
End Function
Public Function AltaAnalisisResultados(a As E_Analisis) As Integer
If Sesion.Conectar(conexion) = -1 Then
Return -1
End If
Dim cmd As New MySqlCommand With {
.CommandType = CommandType.StoredProcedure,
.CommandText = "AltaAnalisisResultados",
.Connection = conexion
}
cmd.Parameters.Add("ID_C", MySqlDbType.Int32).Value = a.ConsultaReq.ID
cmd.Parameters.Add("FEC_C", MySqlDbType.DateTime).Value = a.ConsultaReq.Fecha
cmd.Parameters.Add("CI_P", MySqlDbType.Int32).Value = a.ConsultaReq.Paciente.Cedula
cmd.Parameters.Add("CI_M", MySqlDbType.Int32).Value = a.ConsultaReq.Medico.Cedula
cmd.Parameters.Add("ID_AN", MySqlDbType.Int32).Value = a.ID
cmd.Parameters.Add("FEC_R", MySqlDbType.DateTime).Value = Date.Now()
cmd.Parameters.Add("ID_P", MySqlDbType.Int32)
cmd.Parameters.Add("VAL", MySqlDbType.Decimal)
For Each p As E_Analisis.Parametro In a.Parametros
cmd.Parameters("ID_P").Value = p.ID
cmd.Parameters("VAL").Value = p.Valor
Try
cmd.ExecuteNonQuery()
Catch ex As Exception
Sesion.Cerrar(conexion)
Console.WriteLine(ex.Message)
Return -2
End Try
Next
Sesion.Cerrar(conexion)
Return 1
End Function
Public Function ConsultarAnalisisRequerido(ID_C As Integer) As E_Analisis
Dim a As New E_Analisis
If Sesion.Conectar(conexion) = -1 Then
a.ErrCode = -1
Return a
End If
Dim leer As MySqlDataReader
Dim cmd As New MySqlCommand With {
.Connection = conexion,
.CommandType = CommandType.StoredProcedure,
.CommandText = "ConsultarAnalisisRequerido"
}
cmd.Parameters.Add("ID_C", MySqlDbType.Int32).Value = ID_C
Try
leer = cmd.ExecuteReader()
Catch ex As Exception
Sesion.Cerrar(conexion)
Console.WriteLine(ex.Message)
a.ErrCode = -2
Return a
End Try
If leer.HasRows Then
While leer.Read()
a.ID = leer.GetInt32("ID")
a.Nombre = leer.GetString("nombre")
End While
Else
Console.WriteLine("no encontre analisis requerido")
a.ErrCode = -8
End If
Sesion.Cerrar(conexion)
Return a
End Function
Public Function RetornarParametrosDeAnalisis(a As E_Analisis) As Integer 'usar este mismo cuando consulte los resultados
Dim leer As MySqlDataReader
Dim cmd As New MySqlCommand With {
.CommandType = CommandType.StoredProcedure,
.CommandText = "BuscarParametrosDeAnalisis",
.Connection = conexion
}
cmd.Parameters.Add("ID_AN", MySqlDbType.Int32).Value = a.ID
If Sesion.Conectar(conexion) = -1 Then
Return -1
End If
Try
leer = cmd.ExecuteReader()
Catch ex As Exception
Sesion.Cerrar(conexion)
Return -2
End Try
If leer.HasRows Then
While leer.Read()
a.Parametros.Add(New E_Analisis.Parametro With {
.ID = leer.GetInt32("ID"),
.Nombre = leer.GetString("nombre"),
.Unidad = leer.GetString("unidad"),
.ValorMinimo = leer.GetDouble("referencia_min"),
.ValorMaximo = leer.GetDouble("referencia_max")
})
End While
End If
Sesion.Cerrar(conexion)
Return 1
End Function
Public Function SugerirAnalisisSegunPyR(pyr As PreguntaRespuesta) As E_Analisis
Dim analisis As New E_Analisis
If Sesion.Conectar(conexion) = -1 Then
analisis.ErrCode = -1
Return analisis
End If
Dim leer As MySqlDataReader
Dim cmd As New MySqlCommand With {
.CommandType = CommandType.StoredProcedure,
.CommandText = "SugerirAnalisisSegunPyR",
.Connection = conexion
}
cmd.Parameters.Add("ID_P", MySqlDbType.Int32).Value = pyr.ID_Pregunta
Select Case pyr.Respuesta.GetType()
Case GetType(System.Windows.Forms.CheckBox)
Dim respuesta As String = ""
Select Case DirectCast(pyr.Respuesta, System.Windows.Forms.CheckBox).Checked
Case True
respuesta = "True"
Case False
respuesta = "False"
End Select
cmd.Parameters.Add("RES", MySqlDbType.VarChar, 7200).Value = respuesta
Case Else
cmd.Parameters.Add("RES", MySqlDbType.VarChar, 7200).Value = pyr.Respuesta.Text
End Select
Try
leer = cmd.ExecuteReader()
Catch ex As Exception
Sesion.Cerrar(conexion)
analisis.ErrCode = -2
Return analisis
End Try
If leer.HasRows Then
While leer.Read()
If Not leer.IsDBNull(0) Then
analisis = New E_Analisis With {
.Nombre = leer.GetString("nombre")}
Else
analisis.ErrCode = -8
End If
End While
Else
analisis.ErrCode = -8
End If
Sesion.Cerrar(conexion)
Return analisis
End Function
Public Function SugerirAnalisisSegunSintomas(sintoma As E_Sintoma) As E_Analisis
Dim analisis As New E_Analisis
If Sesion.Conectar(conexion) = -1 Then
analisis.ErrCode = -1
Return analisis
End If
Dim leer As MySqlDataReader
Dim cmd As New MySqlCommand With {
.CommandType = CommandType.StoredProcedure,
.CommandText = "SugerirAnalisisSegunS",
.Connection = conexion
}
cmd.Parameters.Add("SIN", MySqlDbType.VarChar).Value = sintoma.Nombre
Try
leer = cmd.ExecuteReader()
Catch ex As Exception
Sesion.Cerrar(conexion)
analisis.ErrCode = -2
Return analisis
End Try
If leer.HasRows Then
While leer.Read()
If Not leer.IsDBNull(0) Then
analisis = New E_Analisis With {
.Nombre = leer.GetString("nombrea")}
Else
analisis.ErrCode = -8
End If
End While
Else
analisis.ErrCode = -8
End If
Sesion.Cerrar(conexion)
Return analisis
End Function
Public Function SugerirAnalisisSegunSignosC(signoc As E_SignoClinico) As E_Analisis
Dim analisis As New E_Analisis
If Sesion.Conectar(conexion) = -1 Then
analisis.ErrCode = -1
Return analisis
End If
Dim leer As MySqlDataReader
Dim cmd As New MySqlCommand With {
.CommandType = CommandType.StoredProcedure,
.CommandText = "SugerirAnalisisSegunS",
.Connection = conexion
}
cmd.Parameters.Add("SIGNOC", MySqlDbType.VarChar).Value = signoc.Nombre
Try
leer = cmd.ExecuteReader()
Catch ex As Exception
Sesion.Cerrar(conexion)
analisis.ErrCode = -2
Return analisis
End Try
If leer.HasRows Then
While leer.Read()
If Not leer.IsDBNull(0) Then
analisis = New E_Analisis With {
.Nombre = leer.GetString("nombrea")}
Else
analisis.ErrCode = -8
End If
End While
Else
analisis.ErrCode = -8
End If
Sesion.Cerrar(conexion)
Return analisis
End Function
Public Function SugerirAnalisisSegunEnfermedad(enf As E_Enfermedad) As E_Analisis
Dim analisis As New E_Analisis
If Sesion.Conectar(conexion) = -1 Then
analisis.ErrCode = -1
Return analisis
End If
Dim leer As MySqlDataReader
Dim cmd As New MySqlCommand With {
.CommandType = CommandType.StoredProcedure,
.CommandText = "SugerirAnalisisSegunE",
.Connection = conexion
}
cmd.Parameters.Add("ENF", MySqlDbType.Int32).Value = enf.Nombre
Try
leer = cmd.ExecuteReader()
Catch ex As Exception
Sesion.Cerrar(conexion)
analisis.ErrCode = -2
Return analisis
End Try
If leer.HasRows Then
While leer.Read()
If Not leer.IsDBNull(0) Then
analisis = New E_Analisis With {
.Nombre = leer.GetString("nombre")}
Else
analisis.ErrCode = -8
End If
End While
Else
analisis.ErrCode = -8
End If
Sesion.Cerrar(conexion)
Return analisis
End Function
End Class
| 8,609 |
US-88610104-A_4
|
USPTO
|
Open Government
|
Public Domain
| 2,004 |
None
|
None
|
English
|
Spoken
| 4,232 | 7,293 |
[Formation of Image-Forming Layer]
[Preparation of Coating Solution for White Image-Forming Layer]
Respective components shown below were charged into a mill of a kneader and a dispersion pretreatment was performed by applying a shear force while adding a slight amount of a solvent. To the obtained dispersion, the solvent was further added to finally have the following composition, and the resulting solution was dispersed in a sand mill for 2 hours to obtain a white pigment mother liquid dispersion.
[Composition of White Pigment Mother Liquid Dispersion]
n-Propyl alcohol 234.4 parts Polyvinyl butyral (“Eslec B BL-SH”, 22.7 parts produced by Sekisui Chemical Co., Ltd.) Titanium oxide (details are shown in 100 parts Table 1)
Then, the components shown below were mixed while stirring with a stirrer to prepare a coating solution for the white image-forming layer.
[Composition of Coating Solution for White Image-Forming Layer]
n-Propyl alcohol 792.82 parts Methyl ethyl ketone 288.55 parts
Wax-Base Compounds:
(Behenic acid amide, “DIAMID BM”, 2.04 parts produced by Nippon Kasei) (Stearic acid amide, “NEWTRON 2”, 2.04 parts produced by Nippon Seika) (Lauric acid amide, “DIAMID Y”, 2.04 parts produced by Nippon Kasei) (Palmitic acid amide, “DIAMID KP”, 2.04 parts produced by Nippon Kasei) (Oleic acid amide, “DIAMID O-200”, 2.04 parts produced by Nippon Kasei) (Erucic acid amide, “DIAMID L- 2.04 parts 200”, produced by Nippon Kasei) Rosin (“KE-311”, produced by Arakawa 5.91 parts Kagaku) (component: 80 to 97% of resin acid; resin acid components: 30 to 40% of abietic acid, 10 to 20% of neoabietic acid, 14% of dihydroabietic acid, 14% of tetrahydroabietic acid) White pigment mother liquid dispersion 537.20 parts Surfactant (“Megafac F-780F”, solid 17.10 parts content: 30%, produced by Dainippon Ink & Chemicals Inc.) [Formation of White Image-Forming Layer on Light-to-Heat Conversion Layer Surface]
On the surface of the light-to-heat conversion layer formed above, the coating solution for the white image-forming layer prepared above was coated by using a wire bar for 1 minute and then, the coating was dried for 2 minutes in an oven at 100° C. to form a white image-forming layer on the light-to-heat conversion layer. At the coating of this image-forming layer, the layer thickness was adjusted to give a reflection OD of 0.30. Through these steps, a thermal transfer sheet W where a light-to-heat conversion layer and a white image-forming layer were provided in this order on a support was produced.
The thickness of the white image-forming layer in the thermal transfer sheet W was measured and found to be 0.8 μm on average.
The obtained image-forming layer had the following physical properties.
The surface hardness of the image-forming layer, which is preferably 10 g or more with a sapphire needle, was 200 g or more.
The contact angle of water was 48.1°.
-Production of Thermal Transfer Sheet Y-
The thermal transfer sheet Y was produced in the same manner as in Production of Thermal Transfer Sheet W except for using a coating solution for yellow image-forming layer having a composition shown below in place of the coating solution for white image-forming layer in Production of Thermal Transfer Sheet W. The thickness of the image-forming layer in the thermal transfer sheet Y obtained was 0.42 μm.
[Composition of Yellow Pigment Mother Liquid Dispersion]
Yellow Pigment Composition 1:
Polyvinyl butyral (“Eslec B BL-SH”, 7.1 parts produced by Sekisui Chemical Co., Ltd.) Yellow pigment (Pigment Yellow 180 12.9 parts (C.I. No. 21290) (“Novoperm Yellow P- HG”, produced by Clariant Japan)) Pigment dispersant (“SOLSPERSE S- 0.6 parts 20000”, produced by ICI) n-Propyl alcohol 79.4 parts [Composition of Yellow Pigment Mother Liquid Dispersion] Yellow Pigment Composition 2:
Polyvinyl butyral (“Eslec B BL-SH”, 7.1 parts produced by Sekisui Chemical Co., Ltd.) Yellow pigment (Pigment Yellow 139 12.9 parts (C.I. No. 56298) (“Novoperm Yellow M2R 70”, produced by Clariant Japan) Pigment dispersant (“SOLSPERSE S- 0.6 parts 20000”, produced by ICI) n-Propyl alcohol 79.4 parts [Composition of Coating Solution for Yellow Image-Forming Layer]
Yellow pigment mother liquid 126 parts dispersion prepared above [Yellow Pigment Composition 1:Yellow Pigment Composition 2 = 95:5 (by part)] Polyvinyl butyral (“Eslec B BL-SH”, 4.6 parts produced by Sekisui Chemical Co., Ltd.)
Wax-Base Compounds:
(Stearic acid amide, “NEWTRON 2”, 0.7 parts produced by Nippon Seika) (Behenic acid amide, “DIAMID BM”, 0.7 parts produced by Nippon Kasei) (Lauric acid amide, “DIAMID Y”, 0.7 parts produced by Nippon Kasei) (Palmitic acid amide, “DIAMID KP”, 0.7 parts produced by Nippon Kasei) (Erucic acid amide, “DIAMID L- 0.7 parts 200”, produced by Nippon Kasei) (Oleic acid amide, “DIAMID O-200”, 0.7 parts produced by Nippon Kasei) Nonionic surfactant (“CHEMISTAT 1100”, 0.4 parts produced by Sanyo Kasei) Rosin (“KE-311”, produced by Arakawa 2.4 parts Kagaku) Surfactant (“Megafac F-176PF”, solid 0.8 parts content: 20%, produced by Dainippon Ink & Chemicals Inc.) n-Propyl alcohol 793 parts Methyl ethyl ketone 198 parts
The obtained image-forming layer had the following physical properties.
The surface hardness of the image-forming layer, which is preferably 10 g or more with a sapphire needle, was 200 g or more.
The Smooster value on the surface, which is preferably from 0.5 to 50 mmHg (=about 0.0665 to 6.65 kPa) at 23° C. and 55% RH, was 2.3 mmHg (=about 0.31 kPa).
The coefficient of static friction on the surface, which is preferably 0.2 or less, was 0.1.
The surface energy was 24 mJ/mm² and the contact angle of water was 108.1°.
When recording was performed by using laser light under the conditions that the light intensity on the exposure surface was, 1,000 W/mm² or more and the linear velocity was 1 m/sec or more, the percentage deformation of the light-to-heat conversion layer was 150%.
-Production of Thermal Transfer Sheet M-
The thermal transfer sheet M was produced in the same manner as in Production of Thermal Transfer Sheet W except for using a coating solution for magenta image-forming layer having a composition shown below in place of the coating solution for white image-forming layer in Production of Thermal Transfer Sheet W. The thickness of the image-forming layer in the thermal transfer sheet M obtained was 0.38 μm.
[Composition of Magenta Pigment Mother Liquid Dispersion]
Magenta Pigment Composition 1:
Polyvinyl butyral (“DENKA BUTYRAL 12.6 parts #2000-L”, produced by Electrochemical Industry Co., Ltd., Vicat softening point: 57° C.) Pigment (Pigment Red 57:1 (C.I. No. 15.0 parts 15850:1) (“Symuler Brilliant Carmine 6B-229”, produced by Dainippon Ink & Chemicals Inc.)) Pigment dispersant (“SOLSPERSE S- 0.6 parts 20000”, produced by ICI) n-Propyl alcohol 80.4 parts [Composition of Magenta Pigment Mother Liquid Dispersion] Magenta Pigment Composition 2:
Polyvinyl butyral (“DENKA BUTYRAL 12.6 parts #2000-L”, produced by Electrochemical Industry Co., Ltd., Vicat softening point: 57° C.) Pigment (Pigment Red 57:1 (C.I. No. 15.0 parts 15850:1) (“Lionol Red 6B-4290G”, produced by Toyo Ink Mfg. Co., Ltd.)) Pigment dispersant (“SOLSPERSE S- 0.6 parts 20000”, produced by ICI) n-Propyl alcohol 79.4 parts [Composition of Coating Solution for Magenta Image-Forming Layer]
Magenta pigment mother liquid 163 parts dispersion prepared above [Magenta Pigment Composition 1:Magenta Pigment Composition 2 = 95:5 (by part)] Polyvinyl butyral (“DENKA BUTYRAL 4.0 parts #2000-L”, produced by Electrochemical Industry Co., Ltd., Vicat softening point: 57° C.)
Wax-Base Compounds:
(Stearic acid amide, “NEWTRON 2”, 1.0 part produced by Nippon Seika) (Behenic acid amide, “DIAMID BM”, 2.0 parts produced by Nippon Kasei) (Palmitic acid amide, “DIAMID KP”, 1.0 part produced by Nippon Kasei) (Erucic acid amide, “DIAMID L- 1.0 part 200”, produced by Nippon Kasei) (Oleic acid amide, “DIAMID O-200”, 1.0 part produced by Nippon Kasei) Nonionic surfactant (“CHEMISTAT 1100”, 0.7 parts produced by Sanyo Kasei) Rosin (“KE-311”, produced by Arakawa 4.6 parts Kagaku) Pentaerythritol tetraacrylate (“NK 2.5 parts Ester A-TMMT”, produced by Shin Nakamura Kagaku) Surfactant (“Megafac F-17GPF”, solid 1.3 parts content: 20%, produced by Dainippon Ink & Chemicals Inc.) n-Propyl alcohol 848 parts Methyl ethyl ketone 246 parts
The obtained image-forming layer had the following physical properties.
The surface hardness of the image-forming layer, which is preferably 10 g or more with a sapphire needle, was 200 g or more.
The Smooster value on the surface, which is preferably from 0.5 to 50 mmHg (=about 0.0665 to 6.65 kPa) at 23° C. and 55% RH, was 3.5 mmHg (=about 0.47 kPa).
The coefficient of static friction on the surface, which is preferably 0.2 or less, was 0.08.
The surface energy was 25 mJ/m² and the contact angle of water was 98.8°.
When recording was performed by using laser light under the conditions that the light intensity on the exposure surface was 1,000 W/mm² or more and the linear velocity was 1 m/sec or more, the percentage deformation of the light-to-heat conversion layer was 160%.
-Production of Thermal Transfer Sheet C-
The thermal transfer sheet C was produced in the same manner as in Production of Thermal Transfer Sheet W except for using a coating solution for cyan image-forming layer having a composition shown below in place of the coating solution for white image-forming layer in Production of Thermal Transfer Sheet W. The thickness of the image-forming layer in the thermal transfer sheet C obtained was 0.45 μm.
[Composition of Cyan Pigment Mother Liquid Dispersion]
Cyan Pigment Composition 1:
Polyvinyl butyral (“Eslec B BL-SH”, 12.6 parts produced by Sekisui Chemical Co., Ltd.)) Pigment (Pigment Blue 15:4 (C.I. No. 15.0 parts 74160) (“Cyanine Blue 700-10FG”, produced by Toyo Ink Mfg. Co., Ltd.)) Pigment dispersant (“PW-36”, produced 0.8 parts by Kusumoto Kasei) n-Propyl alcohol 110 parts [Composition of Cyan Pigment Mother Liquid Dispersion] Cyan Pigment Composition 2:
Polyvinyl butyral (“Eslec B BL-SH”, 12.6 parts produced by Sekisui Chemical Co., Ltd.)) Pigment (Pigment Blue 15 (C.I. No. 15.0 parts 74160) (“Lionol Blue 7027”, produced by Toyo Ink Mfg. Co., Ltd.)) Pigment dispersant (“PW-36”, produced 0.8 parts by Kusumoto Kasei) n-Propyl alcohol 110 parts [Composition of Coating Solution for Cyan Image-Forming Layer]
Cyan pigment mother liquid dispersion 118 parts prepared above [Cyan Pigment Composition 1:Cyan Pigment Composition 2 = 90:10 (by part)] Polyvinyl butyral (“Eslec B BL-SH”, 5.2 parts produced by Sekisui Chemical Co., Ltd.)) Inorganic pigment “MEK-ST” 1.3 parts
Wax-Base Compounds:
(Stearic acid amide, “NEWTRON 2”, 1.0 part produced by Nippon Seika) (Behenic acid amide, “DIAMID BM”, 1.0 part produced by Nippon Kasei) (Lauric acid amide, “DIAMID Y”, 1.0 part produced by Nippon Kasei) (Palmitic acid amide, “DIAMID KP”, 1.0 part produced by Nippon Kasei) (Erucic acid amide, “DIAMID L- 1.0 part 200”, produced by Nippon Kasei) (Oleic acid amide, “DIAMID O-200”, 1.0 part produced by Nippon Kasei) Rosin (“KE-311”, produced by Arakawa 2.8 parts Kagaku) Pentaerythritol tetraacrylate (“NK 1.7 parts Ester A-TMMT”, produced by Shin Nakamura Kagaku) Surfactant (“Megafac F-176PF”, solid 1.7 parts content: 20%, produced by Dainippon Ink & Chemicals Inc.) n-Propyl alcohol 890 parts Methyl ethyl ketone 247 parts
The obtained image-forming layer had the following physical properties.
The surface hardness of the image-forming layer, which is preferably 10 g or more with a sapphire needle, was 200 g or more.
The Smooster value on the surface, which is preferably from 0.5 to 50 mmHg (=about 0.0665 to 6.65 kPa) at 23° C. and 55% RH, was 7.0 mmHg (=about 0.93 kPa).
The coefficient of static friction on the surface, which is preferably 0.2 or less, was 0.08.
The surface energy was 25 mJ/m² and the contact angle of water was 98.8°.
When recording was performed by using laser light under the conditions that the light intensity on the exposure surface was 1,000 W/mm² or more and the linear velocity was 1 m/sec or more, the percentage deformation of the light-to-heat conversion layer was 165%.
-Production of Thermal Transfer Sheet K-
The thermal transfer sheet K was produced in the same manner as in Production of Thermal Transfer Sheet W except for using a coating solution for black image-forming layer having a composition shown below in place of the coating solution for red image-forming layer in Production of Thermal Transfer Sheet W. The thickness of the image-forming layer in the thermal transfer sheet K obtained was 0.60 μm.
[Preparation of Coating Solution for Black Image-Forming Layer]
Respective components shown below were charged into a mill of a kneader and a dispersion pretreatment was performed by applying a shear force while adding a slight amount of a solvent. To the obtained dispersion, the solvent was further added to finally have the following composition, and the resulting solution was dispersed in a sand mill for 2 hours to obtain a pigment mother liquid dispersion.
[Composition of Black Pigment Mother Liquid Dispersion]
Composition 1:
Polyvinyl butyral (“Eslec B BL-SH”, 12.6 parts produced by Sekisui Chemical Co., Ltd.) Pigment (Pigment Black 7 (Carbon Black 4.5 parts C.I. No. 77266) (“Mitsubishi Carbon Black #5”, produced by Mitsubishi Chemical, PVC blackness: 1)) Dispersion aid (“SOLSPERSE S-20000”, 0.8 parts produced by ICI) n-Propyl alcohol 79.4 parts Composition 2:
Polyvinyl butyral (“Eslec B BL-SH”, 12.6 parts produced by Sekisui Chemical Co., Ltd.) Pigment (Pigment Black 7 (Carbon Black 10.5 parts C.I. No. 77266) (“Mitsubishi Carbon Black MA-100”, produced by Mitsubishi Chemical, PVC blackness: 10)) Dispersion aid (“SOLSPERSE S-20000”, 0.8 parts produced by ICI) n-Propyl alcohol 79.4 parts
Then, the components shown below were mixed while stirring with a stirrer to prepare a coating solution for the black image-forming layer.
[Composition of Coating Solution for Black Image-Forming Layer]
Black pigment mother liquid dispersion 185.7 parts prepared above [Composition 1: Composition 2 = 70:30 (by part)] Polyvinyl butyral (“Eslec B BL-SH”, 11.9 parts produced by Sekisui Chemical Co., Ltd.)
(Stearic acid amide, “NEWTRON 2”, 1.7 parts produced by Nippon Seika) (Behenic acid amide, “DIAMID BM”, 1.7 parts produced by Nippon Kasei) (Lauric acid amide, “DIAMID Y”, 1.7 parts produced by Nippon Kasei) (Palmitic acid amide, “DIAMID KP”, 1.7 parts produced by Nippon Kasei) (Erucic acid amide, “DIAMID L- 1.7 parts 200”, produced by Nippon Kasei) (Oleic acid amide, “DIAMID O-200”, 1.7 parts produced by Nippon Kasei) Rosin (“KE-311”, produced by Arakawa 11.4 parts Kagaku) (component: 80 to 97% of resin acid; resin acid components: 30 to 40% of abietic acid, 10 to 20% of neoabietic acid, 14% of dihydroabietic acid, 14% of tetrahydroabietic acid) Surfactant (“Megafac F-176PF”, solid 2.1 parts content: 20%, produced by Dainippon Ink & Chemicals Inc.) Inorganic pigment (“MEK-ST”, 30% 7.1 parts methyl ethyl ketone solution, produced by Nissan Chemicals Industries, Ltd.) n-Propyl alcohol 1,050 parts Methyl ethyl ketone 295 parts
The particles in the obtained coating solution for the black image-forming layer were measured by a particle size distribution meter employing a laser scattering system, as a result, the average particle size was 0.25 μm and the proportion of particles of 1 μm or more was 0.5%.
The obtained image-forming layer had the following physical properties.
The surface hardness of the image-forming layer, which is preferably 10 g or more with a sapphire needle, was 200 g or more.
The Smooster value on the surface was 9.3 mmHg (1.24 kPa).
The coefficient of static friction on the surface, which is preferably 0.2 or less, was 0.08.
The surface energy was 29 mJ/m², the contact angle of water was 94.8°, the reflection optical density was 1.82, the layer thickness was 0.60 μm and the OD/layer thickness was 3.03.
When recording was performed by using laser light under the conditions that the light intensity on the exposure surface was 1,000 W/mm² or more and the linear velocity was 1 m/sec or more, the percentage deformation of the light-to-heat conversion layer was 168%.
-Production of Image-Receiving Sheet-
A coating solution for the cushion layer and a coating solution for the image-receiving layer each having the following composition were prepared.
1) Coating Solution for Cushion Layer
Vinyl chloride-vinyl acetate copolymer 20 parts (main binder) (“MPR-TSL”, produced by Nisshin Kagaku) Plasticizer (“PARAPLEX G-40”, produced 10 parts by CP. HALL. COMPANY) Surfactant (fluorine-containing 0.5 parts surfactant, coating aid) (“Megafac F- 177”, produced by Dainippon Ink & Chemicals Inc.) Antistatic agent (quaternary ammonium 0.3 parts salt) (“SAT-5 Supper (IC)”, produced by Nihon Junyaku Co., Ltd.) Methyl ethyl ketone 60 parts Toluene 10 parts N,N-Dimethylformamide 3 parts 2) Coating Solution for Image-Receiving Layer
Polyvinyl butyral (“Eslec B BL-SH”, 8 parts produced by Sekisui Chemical Co., Ltd.) Antistatic agent (“SANSTAT 2012A”, 0.7 parts produced by Sanyo Kasei) Surfactant (“Megafac F-176PF”, solid 0.1. part content: 20%, produced by Dainippon Ink & Chemicals Inc.) n-Propyl alcohol 20 parts Methanol 20 parts 1-Methoxy-2-propanol 50 parts
The coating solution for the formation of cushion layer prepared above was coated on a white PET support (“LUMIRROR #130E58”, produced by Toray Industries, Inc., thickness: 130 μm) by using a small-width coating machine and then, the coated layer was dried. Thereafter, the coating solution for the image-receiving layer was coated and dried. The coated amounts were adjusted to form a cushion layer having a dry thickness of about 20 μm and an image-receiving layer having a dry thickness of about 2 μm. The white PET support was a void-containing plastic support comprising a laminate body (total thickness: 130 μm, specific gravity: 0.8) consisting of a void-containing polyethylene terephthalate layer (thickness: 116 μm, porosity: 20%) and titanium oxide-containing polyethylene terephthalate layers (thickness; 7 μm, titanium oxide content: 2%) provided on both surfaces of the void-containing polyethylene terephthalate layer. The produced image-receiving sheet was taken up into a roll form and stored at room temperature for 1 week. Thereafter, this image-receiving sheet was used for image recording by laser light described below.
The obtained image-receiving layer had the following physical properties.
The surface roughness Ra, which is preferably from 0.4 to 0.01 μm, was 0.02 μm.
The waviness on the image-receiving layer surface, which is preferably 2 μm or less, was 1.2 μm.
The Smooster value on the image-receiving layer surface, which is preferably from 0.5 to 50 mmHg (=about 0.0665 to 6.65 kPa) at 23° C. and 55% RH, was 0.8 mmHg (=about 0.11 kPa).
The coefficient of static friction on the image-receiving layer surface, which is preferably 0.8 or less, was 0.37.
The surface energy of the image-receiving layer was 29 mJ/m² and the contact angle of water was 85°.
In this way, a multicolor image forming material comprising thermal transfer sheets W, Y, M, C and K and an image-receiving sheet was obtained.
Example 2 and Comparative Examples 1 to 4
Thermal transfer sheets W and multicolor image forming materials were obtained in the same manner as in Example 1 except for changing the titanium oxide and the thickness of the image-forming layer as shown in Table 1. Incidentally, at the coating of the image-forming layer on the light-to-heat conversion layer, the layer thickness was adjusted to give a reflection OD of 0.30.
The multicolor image forming materials obtained each was determined on the (reflection OD/thickness of image-forming layer) of the thermal transfer sheet W. Also, by using each thermal transfer sheet W, the recording sensitivity was evaluated.
-Formation of Transferred Image-
The image forming system used was the system shown in FIG. 4 and Luxel FINALPROOF 5600 was employed as the recording apparatus, The transferred image on a transferee was obtained according to the image formation sequence of this system by the transferee transfer method for use in this system.
The image-receiving sheet (56 cm×79 cm) produced above was wound around a 38 cm-diameter rotary drum having punched thereon vacuum section holes (plane density; 1 hole per area of 3 cm×8 cm) each having a diameter of 1 mm, and vacuum-adsorbed. Subsequently, the thermal transfer sheet K produced above, which was cut into 61 cm×84 cm, was superposed to uniformly protrude from the image-receiving sheet, and contact-laminated while suctioning air through the section holes by squeezing the sheet with a squeeze roller. The pressure reduction degree in the state of the section holes being closed was −150 mmHg (=about 81.13 kPa) based on 1 atm. The drum was rotated and the surface of the laminate body on the drum was irradiated with semiconductor laser light at a wavelength of 808 nm from the outside by converging the light to form a spot of 7 μm on the surface of the light-to-heat conversion layer. While moving the light toward the direction (sub-scanning) right-angled to the rotating direction (main scanning direction) of the rotary drum, an image was recorded by laser on the laminate body. The laser irradiation conditions were as follows. The laser beam used in this Example was a laser beam having a multi-beam two-dimensional arrangement comprising parallelograms forming 5 lines in the main scanning direction and 3 lines in the sub-scanning direction.
Laser power: 110 mW Rotation number of drum 500 rpm Sub-scanning pitch 6.35 μm
Ambient humidity and temperature:
- - three conditions of 20° C. and 40%, 23° C. and 50% and 26° C. and 65%
The diameter of exposure drum, which is preferably 360 mm or more, was 380 mm.
The image size was 515 mm×728 mm and the resolution was 2,600 dpi.
Also, using sequentially the thermal transfer sheets C, M and Y in place of the thermal transfer sheet K, the laser light was imagewise irradiated on each image-forming layer, the irradiated regions were sequentially transferred and stacked on the image-receiving sheet to form a predetermined multicolor image on the image-receiving sheet and after performing solid recording of the thermal transfer sheet W on the formed multicolor image, the image was re-transferred on a transparent plastic film (“Merinex 709”, produced by Teijin DuPont Films) by a thermal transfer apparatus, as a result, a clear multicolor image was obtained.
The thermal transfer apparatus used was a transfer apparatus where the coefficient of dynamic friction to polyethylene terephthalate as the construction material of the insertion table is from 0.1 to 0.7 and the transportation speed is from 15 to 50 m/sec. The Vickers hardness of the construction material for the heat roll of the thermal transfer sheet, which is preferably from 10 to 100, was 70.
The sensitivity of the thermal transfer sheet W was evaluated as follows.
-Evaluation of Sensitivity-
A solid image was recorded and the irradiation energy of laser light necessary for the gapless filling of solid image was determined.
The results are shown in Table 1.
TABLE 1 Titanium Oxide Image-Forming Product Surface Particle Layer Reflection of Tayca Crystal Surface Coverage Size Thickness Reflection OD/Layer Sensitivity Corp. Form Coating (%) (μm) (μm) OD Thickness mJ/cm² Example 1 JR805 rutile alumina/silica 8 0.29 1.6 0.3 0.188 289 Example 2 JR806 rutile alumina/silica 6 0.26 1.9 0.3 0.158 225 Comparative JR600E rutile alumina 4 0.27 2.4 0.3 0.125 372 Example 1 Comparative JR600A rutile alumina 2.5 0.25 2.4 0.3 0.125 372 Example 2 Comparative JR405 rutile alumina 0.8 0.21 2.8 0.3 0.107 650 or more Example 3 Comparative JA1 anatase none none 0.18 3.7 0.3 0.081 650 or more Example 4
As is apparent, in the multicolor image forming materials of Examples 1 and 2 where the image-forming layer of the thermal transfer sheet W contains the titanium oxide for the present invention, the multicolor image with a white base on the transparent plastic film is clearly seen in either environment, revealing effectiveness as a package, and the recording sensitivity is high.
On the other hand, in the thermal transfer sheets W not using the titanium oxide for the present invention in the image-forming layer of the thermal transfer sheet W, the layer thickness is large and the recording sensitivity is low.
This application is based on Japanese Patent application JP 2003-271836, filed Jul. 8, 2003, the entire content of which is hereby incorporated by reference, the same as if set forth at length.
1. A laser thermal transfer multicolor image forming material comprising an image-receiving sheet containing an image-receiving layer and a thermal transfer sheet containing a light-to-heat conversion layer, an image-forming layer and a support, which comprises a white thermal transfer sheet containing in the image-forming layer a titanium oxide having a particle size of 0.2 to 0.4 μm with the particle surfaces being coated by alumina and silica, wherein the coverage of alumina and silica on the titanium oxide is 6 to 9 weight %, based on the weight of the coated titanium oxide.
2. The laser thermal transfer multicolor image forming material according to claim 1, wherein the titanium oxide is a rutile type.
3. The laser thermal transfer multicolor image forming material according to claim 1, wherein in the image-forming layer of the white thermal transfer sheet, when a solid part of a recorded image on the image-forming layer is measured by a visual filter, a ratio of a reflection optical density to a layer thickness (unit: μm) of the image-forming layer is 0.15 or more.
4. The laser thermal transfer multicolor image forming material according to claim 1, wherein in the image-forming layer of the white thermal transfer sheet, the ratio of a reflection optical density to a layer thickness (unit: μm) of the image-forming layer is 0.16 or more.
5. The laser thermal transfer multicolor image forming material according to claim 3, wherein the image-forming layer of the white thermal transfer sheet has a thickness of 2.0 μm or less.
6. The laser thermal transfer multicolor image forming material according to claim 3, wherein the image-forming layer of the white thermal transfer sheet has a thickness of 1.5 μm or less.
7. The laser thermal transfer multicolor image forming material according to claim 1, wherein the light-to-heat conversion layer contains at least one of a polyamideimide resin and a polyimide resin.
8. The laser thermal transfer multicolor image forming material according to claim 1, wherein the light-to-heat conversion layer contains a polyamideimide resin binder and a cyanine dye having a sulfonic acid group..
| 1,865 |
https://github.com/svenskan/pronunciation/blob/master/vendor/swftools/src/wav2swf.c
|
Github Open Source
|
Open Source
|
MIT
| 2,018 |
pronunciation
|
svenskan
|
C
|
Code
| 1,134 | 3,852 |
/* wav2swf.c
Converts WAV/WAVE files to SWF.
Part of the swftools package.
Copyright (c) 2001 Matthias Kramm <[email protected]>
This program is free software; you can redistribute it and/or modify
it under the terms of the GNU General Public License as published by
the Free Software Foundation; either version 2 of the License, or
(at your option) any later version.
This program is distributed in the hope that it will be useful,
but WITHOUT ANY WARRANTY; without even the implied warranty of
MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
GNU General Public License for more details.
You should have received a copy of the GNU General Public License
along with this program; if not, write to the Free Software
Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA */
#include <stdlib.h>
#include <stdio.h>
#include "../lib/rfxswf.h"
#include "../lib/log.h"
#include "../lib/args.h"
#include "../lib/wav.h"
char * filename = 0;
char * outputname = "output.swf";
int verbose = 2;
int stopframe0 = 0;
int stopframe1 = 0;
#define DEFINESOUND_MP3 1 //define sound uses mp3?- undefine for raw sound.
static struct options_t options[] = {
{"h", "help"},
{"V", "version"},
{"o", "output"},
{"r", "framerate"},
{"s", "samplerate"},
{"d", "definesound"},
{"l", "loop"},
{"C", "cgi"},
{"S", "stop"},
{"E", "end"},
{"b", "bitrate"},
{"v", "verbose"},
{0,0}
};
static int loop = 0;
static int definesound = 0;
static int framerate = 0;
static int samplerate = 11025;
static int bitrate = 32;
static int do_cgi = 0;
static int mp3_bitrates[] =
{ 8, 16, 24, 32, 40, 48, 56, 64, 80, 96, 112, 128, 144, 160, 0};
int args_callback_option(char*name,char*val)
{
if(!strcmp(name, "V")) {
printf("wav2swf - part of %s %s\n", PACKAGE, VERSION);
exit(0);
}
else if(!strcmp(name, "o")) {
outputname = val;
return 1;
}
else if(!strcmp(name, "d")) {
definesound = 1;
return 0;
}
else if(!strcmp(name, "l")) {
loop = atoi(val);
definesound = 1;
return 1;
}
else if(!strcmp(name, "v")) {
verbose ++;
return 0;
}
else if(!strcmp(name, "S")) {
stopframe0 = 1;
return 0;
}
else if(!strcmp(name, "E")) {
stopframe1 = 1;
return 0;
}
else if(!strcmp(name, "C")) {
do_cgi = 1;
return 0;
}
else if(!strcmp(name, "r")) {
float f;
sscanf(val, "%f", &f);
framerate = f*256;
return 1;
}
else if(!strcmp(name, "s")) {
samplerate = atoi(val);
if(samplerate > 5000 && samplerate < 6000)
samplerate = 5512;
else if(samplerate > 11000 && samplerate < 12000)
samplerate = 11025;
else if(samplerate > 22000 && samplerate < 23000)
samplerate = 22050;
else if(samplerate > 44000 && samplerate < 45000)
samplerate = 44100;
else {
fprintf(stderr, "Invalid samplerate: %d\n", samplerate);
fprintf(stderr, "Allowed values: 11025, 22050, 44100\n");
exit(1);
}
return 1;
}
else if(!strcmp(name, "b")) {
int t;
int b = atoi(val);
if(b<=0) {
fprintf(stderr, "Not a valid bitrate: %s\n", val);
exit(1);
}
if(b>160) {
fprintf(stderr, "Bitrate must be <144. (%s)\n", val);
exit(1);
}
for(t=0;mp3_bitrates[t];t++) {
if(b== mp3_bitrates[t]) {
bitrate = b;
return 1;
}
}
fprintf(stderr, "Invalid bitrate. Allowed bitrates are:\n");
for(t=0;mp3_bitrates[t];t++) {
printf("%d ", mp3_bitrates[t]);
}
printf("\n");
exit(1);
}
else {
printf("Unknown option: -%s\n", name);
exit(1);
}
return 0;
}
int args_callback_longoption(char*name,char*val)
{
return args_long2shortoption(options, name, val);
}
void args_callback_usage(char *name)
{
printf("\n");
printf("Usage: %s [-o filename] file.wav\n", name);
printf("\n");
printf("-h , --help Print short help message and exit\n");
printf("-V , --version Print version info and exit\n");
printf("-o , --output <filename> Explicitly specify output file. (Otherwise, output will go to output.swf)\n");
printf("-r , --framerate <fps> Set file framerate to <fps> frames per second.\n");
printf("-s , --samplerate <sps> Set samplerate to <sps> frames per second (default: 11025).\n");
printf("-d , --definesound Generate a DefineSound tag instead of streaming sound.\n");
printf("-l , --loop n (Only used with -d)\n");
printf("-C , --cgi For use as CGI- prepend http header, write to stdout.\n");
printf("-S , --stop Stop the movie at frame 0\n");
printf("-E , --end Stop the movie at the end frame\n");
printf("-b , --bitrate <bps> Set mp3 bitrate to <bps> (default: 32)\n");
printf("-v , --verbose Be more verbose\n");
printf("\n");
}
int args_callback_command(char*name,char*val)
{
if(filename) {
fprintf(stderr, "Only one file allowed. You supplied at least two. (%s and %s)\n",
filename, name);
}
filename = name;
return 0;
}
extern int swf_mp3_bitrate;
extern int swf_mp3_out_samplerate;
extern int swf_mp3_in_samplerate;
int main (int argc,char ** argv)
{
SWF swf;
RGBA rgb;
SRECT r;
S32 width=300,height = 300;
TAG * tag;
int f,i,ls1,fs1;
int count;
int t;
struct WAV wav,wav2;
int blocksize;
float blockspersecond;
float framespersecond;
float samplesperframe;
float framesperblock;
float samplesperblock;
U16* samples;
int numsamples;
processargs(argc, argv);
blocksize = (samplerate > 22050) ? 1152 : 576;
blockspersecond = (float)samplerate/blocksize;
framespersecond = blockspersecond;
if(framerate)
framespersecond = framerate/256.0;
framesperblock = framespersecond / blockspersecond;
samplesperframe = (blocksize * blockspersecond) / framespersecond;
samplesperblock = samplesperframe * framesperblock;
initLog(0,-1,0,0,-1,verbose);
if(!filename) {
msg("<fatal> You must supply a filename");
exit(1);
}
if(!wav_read(&wav, filename))
{
msg("<fatal> Error reading %s", filename);
exit(1);
}
wav_convert2mono(&wav,&wav2, samplerate);
//wav_print(&wav);
//wav_print(&wav2);
samples = (U16*)wav2.data;
numsamples = wav2.size/2;
#ifdef WORDS_BIGENDIAN
/* swap bytes */
for(t=0;t<numsamples;t++) {
samples[t] = (samples[t]>>8)&0xff | (samples[t]<<8)&0xff00;
}
#endif
if(numsamples%blocksize != 0)
{
// apply padding, so that block is a multiple of blocksize
int numblocks = (numsamples+blocksize-1)/blocksize;
int numsamples2;
U16* samples2;
numsamples2 = numblocks * blocksize;
samples2 = malloc(sizeof(U16)*numsamples2);
memcpy(samples2, samples, numsamples*sizeof(U16));
memset(&samples2[numsamples], 0, sizeof(U16)*(numsamples2 - numsamples));
numsamples = numsamples2;
samples = samples2;
}
memset(&swf,0x00,sizeof(SWF));
swf.fileVersion = 5;
swf.frameRate = (int)(framespersecond*256);
swf.movieSize.xmax = 20*width;
swf.movieSize.ymax = 20*height;
swf.firstTag = swf_InsertTag(NULL,ST_SETBACKGROUNDCOLOR);
tag = swf.firstTag;
rgb.r = 0xff;
rgb.g = 0xff;
rgb.b = 0xff;
swf_SetRGB(tag,&rgb);
if(stopframe0) {
ActionTAG*action = 0;
tag = swf_InsertTag(tag, ST_DOACTION);
action = action_Stop(action);
action = action_End(action);
swf_ActionSet(tag, action);
swf_ActionFree(action);
tag = swf_InsertTag(tag, ST_SHOWFRAME);
}
swf_mp3_bitrate = bitrate;
swf_mp3_out_samplerate = samplerate;
swf_mp3_in_samplerate = samplerate;
if(!definesound)
{
int oldframepos=-1, newframepos=0;
float framesamplepos = 0;
float framepos = 0;
float samplepos = 0;
ActionTAG* a = 0;
U16 v1=0,v2=0;
tag = swf_InsertTag(tag, ST_SOUNDSTREAMHEAD);
swf_SetSoundStreamHead(tag, samplesperframe);
msg("<notice> %d blocks", numsamples/blocksize);
for(t=0;t<numsamples/blocksize;t++) {
int s;
U16*block1;
int seek = blocksize - ((int)samplepos - (int)framesamplepos);
if(newframepos!=oldframepos) {
tag = swf_InsertTag(tag, ST_SOUNDSTREAMBLOCK);
msg("<notice> Starting block %d %d+%d", t, (int)samplepos, (int)blocksize);
block1 = &samples[t*blocksize];
swf_SetSoundStreamBlock(tag, block1, seek, 1);
v1 = v2 = GET16(tag->data);
} else {
msg("<notice> Adding data...", t);
block1 = &samples[t*blocksize];
swf_SetSoundStreamBlock(tag, block1, seek, 0);
v1+=v2;
PUT16(tag->data, v1);
}
samplepos += blocksize;
oldframepos = (int)framepos;
framepos += framesperblock;
newframepos = (int)framepos;
for(s=oldframepos;s<newframepos;s++) {
tag = swf_InsertTag(tag, ST_SHOWFRAME);
framesamplepos += samplesperframe;
}
}
tag = swf_InsertTag(tag, ST_END);
} else {
SOUNDINFO info;
tag = swf_InsertTag(tag, ST_DEFINESOUND);
swf_SetU16(tag, 24); //id
#ifdef DEFINESOUND_MP3
swf_SetSoundDefine(tag, samples, numsamples);
#else
swf_SetU8(tag,(/*compression*/0<<4)|(/*rate*/3<<2)|(/*size*/1<<1)|/*mono*/0);
swf_SetU32(tag, numsamples); // 44100 -> 11025
swf_SetBlock(tag, samples, numsamples*2);
#endif
tag = swf_InsertTag(tag, ST_STARTSOUND);
swf_SetU16(tag, 24); //id
memset(&info, 0, sizeof(info));
info.loops = loop;
swf_SetSoundInfo(tag, &info);
tag = swf_InsertTag(tag, ST_SHOWFRAME);
if(stopframe1) {
ActionTAG*action = 0;
tag = swf_InsertTag(tag, ST_DOACTION);
action = action_Stop(action);
action = action_End(action);
swf_ActionSet(tag, action);
swf_ActionFree(action);
tag = swf_InsertTag(tag, ST_SHOWFRAME);
}
tag = swf_InsertTag(tag, ST_END);
}
if(do_cgi) {
if FAILED(swf_WriteCGI(&swf)) fprintf(stderr,"WriteCGI() failed.\n");
} else {
f = open(outputname,O_WRONLY|O_CREAT|O_TRUNC|O_BINARY, 0644);
if FAILED(swf_WriteSWF(f,&swf)) fprintf(stderr,"WriteSWF() failed.\n");
close(f);
}
swf_FreeTags(&swf);
return 0;
}
| 15,698 |
I9-9HHyCaj4_1
|
Youtube-Commons
|
Open Web
|
CC-By
| null |
#shorts | ਜਦੋਂ footpath ਟੱਪ ਕੇ Mysore Pak ਖਰੀਦਣ ਗਏ Rahul Gandhi , ਦੁਕਾਨਦਾਰ ਵੀ ਹੋ ਗਏ ਬਾਗੋ-ਬਾਗ | N18S
|
None
|
Haitian Creole
|
Spoken
| 1 | 2 |
None
| 19,202 |
https://math.stackexchange.com/questions/313653
|
StackExchange
|
Open Web
|
CC-By-SA
| 2,013 |
Stack Exchange
|
A French man, Gouem Xoj, Ian, Juan Andres Lopez Rosas, Kelvin Garcia, LOGAN HANSON, M.h Sohrabi, Majelly Mohale, Mikasa, Zev Chonoles, abbdallah balawi, https://math.stackexchange.com/users/264, https://math.stackexchange.com/users/63409, https://math.stackexchange.com/users/8581, https://math.stackexchange.com/users/914505, https://math.stackexchange.com/users/914506, https://math.stackexchange.com/users/914507, https://math.stackexchange.com/users/914508, https://math.stackexchange.com/users/914509, https://math.stackexchange.com/users/914513, https://math.stackexchange.com/users/914525, https://math.stackexchange.com/users/914540, https://math.stackexchange.com/users/915061, https://math.stackexchange.com/users/915132, physlf, willshf
|
English
|
Spoken
| 194 | 471 |
In $Q_8$ why $C_G(i)=C_G(-i)$
$Q_8$ is the Quaternion group. In $Q_8$ why $C_G(i)=C_G(-i)$?
Any particular reason you repeated the question 4 times? Also: what have you thought about so far? Are you familiar with the definition of $Q_8$? Do you know what $C_G$ means?
For any group $G$ and $x \in G$, $C_G(x) = C_G(x^{-1})$.
In your conclusion, $\forall y\in C_G(x), yx=xy$ means $yx^{-1}=x^{-1}y$. It's right. I got it.
More generally (if you wish): Show that for any $z\in Z(G)$, the centralizers $C_G(zg)$ and $C_G(g)$ are equal. To do this, argue that $zgc=czg$ if and only if $cg=gc$, using $zc=cz$. This applies in any $G$, and in particular in the quaternion group where $-1$ is central.
I take it $C_G(x)$ means the centralizer of $x$, which is the elements that commute with $x$. So, which elements commute with $i$? which with $-i$?
Assume $$Q_8=\langle i,j,k\mid i^2=j^2=k^2=ijk\rangle=\{i,j,k,+1,-1,-i,-j,-k\}$$ in which $$ij=k,ji=-k,~~~~jk=i,kj=-i,~~~~ki=j,jk=-i$$ If you are new to group theory, it's better to do some handy calculations to know this non abelian finite group better. Moreover, you will find out what other answers are trying to tell you via formal theoretical approaches about your question.
Mornin Amy, :-)
| 2,278 |
https://github.com/latonaio/salesforce-apex-price-recordnumber/blob/master/force-app/main/default/classes/PriceRecordSeriesNumberRestResource.cls
|
Github Open Source
|
Open Source
|
MIT
| 2,021 |
salesforce-apex-price-recordnumber
|
latonaio
|
Apex
|
Code
| 75 | 299 |
/**
* 価格レコードオブジェクトのREST
*
*/
@RestResource(urlMapping='/PriceRecordSeriesNumber/*')
global with sharing class PriceRecordSeriesNumberRestResource {
/**
* 価格レコード連続番号を取得します。
*
* @return priceMaster
*/
@HttpGet
global static List<PriceRecordSeriesNumber__c> doGetPriceRecordSeriesNumber() {
RestRequest req = RestContext.request;
//クエリパラメータがnullでない場合
String prId = req.params.get('price_record_id');
String d = req.params.get('date');
PriceRecordSeriesNumberDao dao = PriceRecordSeriesNumberDao.getInstance();
List<PriceRecordSeriesNumber__c> ps = new List<PriceRecordSeriesNumber__c>();
if (prId != null && d != null) {
Date target = Date.valueOf(d);
ps = dao.getPriceRecordSeriesNumberByPriceRecordAndEndDate(prId, target);
return ps;
}
ps = dao.getPriceRecordSeriesNumber();
return ps;
}
}
| 10,532 |
DSC/1857/DSC_18570424/MM_01/0003.xml_1
|
NewZealand-PD-Newspapers
|
Open Culture
|
Public Domain
| 1,857 |
None
|
None
|
English
|
Spoken
| 7,183 | 9,669 |
THE SILK WORM. To the Editor of the Southern Cross. Sir, — I beg leave to submit a letter received from Ka whia, with reference to silk. The writer wants mulberry seed, and I am sorry to say I have none to give him; but I will (if it is to be had in Melbourne) send you a quantity for distribution at no distant date, and if there are any silk worms to be had I will obtain some also. That silk can be produced in this province is a positive fact; and, in order to prove it, I send you two specimens of silk which Colonel Wynyard, C.8., was pleased to give me, both of which were produced in Auckland, by silk worms fed upon the native mulberry growing in his garden. I also draw your attention to a letter in the Sydney Herald 'just received, with reference to the same subject. I know there are always difficulties in the way of doing anything that is good, and silk production is not an exception to that rule, but as has been so often observed by older and wiser men, I may also remark that, "When there's a will there's a way to accomplish this, as well as many other acts of public improvement. I am, &c, Ahthuh S. Ormsby, Civil Engineer. Princes-street, 25th April, 1857. To the Editor of the Sydney Morning Herald. Sir, — If you think it deserving a corner in your paper at an early date, I send a copy of a letter received not long ago from a friend largely engaged in the manufacture of silks in Manchester. Yours respectfully, Silk. "Dear Sir, — Mr. informed me that some years ago an attempt was made to rear silk worms at or near Parramatta. "Now, the important part where labour is employed is the reeling; that could be done in England: all that would be required in Australia would be to produce the cocoons, press them by hydraulic pressure, and send them home for the rest of the labour." At the present very high price of raw silk a good opportunity presents itself for fresh experiments. We have Tape papers to the 19th of February. The ' Commercial Advertiser ' of the 14th observes : — "We c»n still make nothing of our news from the fron tier. They are so abundant and so contradictory by every post that people begin to doubt whether there has been any real news. for the last six or twelve months. The authoiities have certainly been kept awake by in cessant rumours of danger from the Caffres, and it is possible that this vigilance has been the means of avert ing the danger. We would say nothing to abate it, but we hope the time is not far distant when we shall be ablp to assure "intending emigrants" that the Cape of Good Hope does not hold its tenure of life at the good will and pleasure of savages. We are glad to see it finally admitted that Moshesh and his neighbours of the Fiee State have no cause of war, nor are likely to find any in tne conduct of that chief We are also glad to see that the impolitic ordinances respecting aliens and the Press are likely to be repudiated by the more intel ligent and least prejudiced of the inhabitants. We re garded them from the first as mere expressions of passion and resentment, under provoc ition, which a brief space of time would certainly allay. They are free as a State, but they can only flourish by virtue of freedom as a people. Most men individually ad-nit this principle, yet how few great natit ns act upon it ! Kaffraria, February 5. — Letters have come in this morning from the N.E. border which dwell strongly on the great probability of Kaffir disturbance. Our corres pondents state positively, that so far from there being any abatement of the prophet's influence, it is vastly on the increase, and that the destruction of cattle, and other means of subsistence, is greater than ever. The excite ment at first produced by the prophet's predictions has now settled down into conviction, and whatever he bids them do, however pro<posterous, is unhesitatingly exe cuted. It is confidently asserted that the colony would have been invaded by the Kaffirs long ago had it not been for the timely precautions taken to repel it — the Kaffirs being perfectly cognizant of every measure in that respect adopted by the colonial authorities. Nearly every Kaffir who was in the employ of the farmers along the N.E. border, have quitted service and returned into Kaffirland, many of the colonists being without assistance of any kind. The Kaffirs declare that their prophet has actually raised from the dead two kraals, one of men and the other of horses, which may perhaps account for, or be a key to, the sudden disappearance of Kaffirs and horses from the colony that has of late been the subject of such frequent comment. We regret to learn that the lung sickness is reported to be rapidly on the increase along the north-east border, and also within the Kat River division. A great many cattle have been lately bought of the Kaffirs by traders at prices ranging from 6s. to 12s. per head, a large proportion of which have since died of this fatal malady.— Graham's Town Journal. The German Legion. — About ten hundred of the Germans are now encamped near Fort Murray. Several of them have been into King William's Town: they are fine healthy-looking young men, and, if they only behave themselves, bid fair to make good colonists. I have not heard of any serious charges brought against them at present, and some who have visited East London since their arrival, say that the little things of which they have been guilty are nothing more than what might have been expected from a large number of persons just off a sea voyage, and not so tightly disciplined as the British soldier. I have not heard of any serious charges brought against them at present, and some who have visited East London since their arrival, say that the little things of which they have been guilty are nothing more than what might have been expected from a large number of persons just off a sea voyage, and not so tightly disciplined as the British soldier. Parties, and placed in different districts of the country. The fact is, they look upon themselves as colonists, and not as soldiers. Before the arrival of the Legion, the Kaffirs were very inquisitive to know what sort of people they were— how they looked, and whether they were different from the English. When told they were similar, they expressed themselves as not at all concerned at their coming. SOUTH AFRICA. To the Editor of the Southern Cross. Sir,— In a copy of the New Zealander of Saturday last, which I happened to get a sight of, I was much amused to see the accounts from the Wardens of the several Hundreds. The Wardens of the Auckland Hundred, who have had rather an extensive business, appear to have managed tolerably well ; leaving a good balance to their successors. The Onehunga Wardens appear to be thorough Yankees, parting the spoils amongst themselves : £24 is divided equally between the subscribing Wardens for ranging — £14 Os. lid. to Mr. Farrell, for work done ; £6 to Mr. Martin May, for book-keeping, stationery, &c.; and £4 to Mr. O'Keefe. Well may such men be clamorous for local boards. If Mr. James Harp had been there he would have been able to certify that the Wardens of Onehunga " are pressing And I am glad to see and long may live Old Ireland." But report says this is not all ; licenses are said to have been issued, the money received, but not account ed for. There must be something wrong here ; and I hope that proper enquiry will be made. What does Mr. Commissioner mean by publishing "in conformity with the 30th clause of the Crown Lands Ordinance? " Let him look at the 36th clause, and see if it is not more applicable. How is it, also, that for 21 licenses, Mr. Commissioner has handed over to the Wardens of Howick only £10 10s. ; where is the remaining 10s. 6d. gone to? I am, &c, A License Holdeb. April 13th, 1857. [We know nothing of our own personal knowledge, about the matter ; but, injustice to all parties, give me a version to the letter. It is right that the Wardens of Howick " ens should know what is being said, in order that they may set themselves straight without delay. When our correspondent says that license moneys have been received but not accounted for, we suppose him to mean — not yet accounted for. We are ourselves of opinion that there is no longer any legal authority for the election of Wardens. We believe that the Crown Lands Ordinance (Sess. x, No. I.) under which Wardenship is created, was in fact re pealed by the first clause of the Land Regulations of 1855. In Police alone, the loss of last year's crop is estimated at four millions sterling, and raw silk, worth 225 to 250 a twelvemonth ago, is now 40s. to 435. "I am sure it would prove a gold mine worth immense attention. If you could send a few cocoons as samples, we would give you an opinion." KawhU, April in, 1857 Sir, —I have often seen your praiseworthy letters, in the New Zealand papers, upon our available exports. Judging therefrom, I suppose that you are ready and willing to give any advice and encouragement to one who has long thought that silk could be and ought to be produced in this our adopted home in England. It is produced profitably. Mrs. Whisby, of Newlands, near Lymington, Hampshire, gave a narrative of her management of silk worms, before the Royal Agricultural Society of England. She says—"I have, during several years past, cultivated the mulberry, and fed silk worms upon it, with great success. I have had an opinion on the quality of the silk produced from the nuts which encourages me to hope my example will be followed by others, as a means of profit to the agriculturist, and affording employment to the industrious classes." Sir, I wish to be informed what sort of mulberry is used for feeding the silk worms. We have here a small sort of mulberry, which bears very small fruit. Is this the right sort? Or have you some in Auckland? If so, could you send me some? All expenses I will pay. For I intend, as soon as I can get the proper tree, to plant out For the silk worms; that is, if there is any chance of getting the worms. Excuse the liberty I have taken, and a few lines from you. Sir, will be esteemed a favor. Sir, will be esteemed a favor. Sir, will be esteemed a favor. Sir, will be esteemed a favor. Nathaniel BAitRisrr, Esq., Auckland. event: The defeat of Mr. O'Shanassy in East B Street in the climax to Mr. O'Shanassy's misfortunes. It is the fifth contested election that has gone against the Government; and the most pregnant with significance of them all. It leaves the Premier with his bare left to quota of Mima tors having seats, to come within the technical requirements of the Constitution Act; and it leaves him also in possession of this pleasant consciousness to meet parliament with— that in every solitary instance where the broad general issue of confidence or no confidence has been raised, the judgment of the country has been an adverse one. The result thus explains the cause of the defeat— "Bigotry seemed to have been actively engaged in behalf of the "Ami Ministerial Candidate"; and the result proves that the Catholics are feeble as compared with the Protestants, a result which ought to satisfy both sides that they can sately tolerate each other. "Being a religious rather than a political contest, no decided political inference can be drawn from it. As it happens, the successful can didrite is the more democratic of the two; but we doubt if his politics formed the ground on which he was elected. The result of this election will not prevent the Ministry from meeting the house, nor will it alter their obligation to do so. Mr. O'Shanassy has but one course to pursue, and that is to carry out the Constitution. By the operation of that Constitution, a majority of the Assembly overthrew the old Ministry and left him to form a new one. Upon these twenty-nine rests the responsibility of the future. We have not the least doubt that the voice of the Assembly will be in favor of giving the Ministry that fair trial which It was accorded to their predecessors." The New Ministry.— It is a proof of the shifts to which Mr. O'Shanassy has been driven in forming a Ministry when we find the members of his Cabinet have had to be chosen from among those of such different opinions on the leading political questions of the day The new Prime Minister has been reduced to the necessity of allowing in his Cabinet almost every question of importance to be an open question. Letters from Dumerout correspondents until it might be supposed that the subject was fairly exhausted. Then the question is reproduced and undergoes a further ventilation in discussion in the journals of the other Provinces, so that at last it may be said to be worn to tatters. The last Auckland papers received inform us that the Council, like a jury unable to agree upon its verdict, has been twice locked up, on one occasion for 21 hours, on the other for thirty hours, but without any result. A proposition was made that Mr. D. Graham and Mr. Dildy, who are both sitting for the same seat, — one of them improperly, but which of the two it would puzzle a conjuror — or a Speaker— to decide, — and Mr. Merriman, the principal member of the Provincial Executive in the Council, should resign their seats and appeal to their constituencies for re-election, but this proposal was rejected, and the Superintendent, seeing no other way to relieve himself from the disagreeable dilemma in which he is placed, has prorogued the Council, and " assumes the responsibility of carrying on the business of the Province and of actively prosecuting the several public works," without the passing by the Council of an Appropriation Act; in other words, finding he cannot govern without a Council, the Auckland Superintendent seems disposed to try if he can govern without one. Against by Mr. D. Graham, his opponent, and the matter is referred to a Committee of the Council for decision. The Committee decide against Mr. Pollen and in favor of Mr. Graham, but before the decision is made, Mr. Pollen resigns his seat, the Superintendent issues another writ, and Mr. Daldy is returned as member for the same seat for which Mr. Graham has been declared by the Committee to be duly elected. The Superintendent appears to have acted with precipitation, and like the Anarch of old "by decision more embroils the fray." The decision of the question having been remitted to the Council, it was for them to decide whether Mr. Pollen or Mr. Graham was the sitting member, but by accepting Mr. Pollen's resignation, and issuing a fresh writ, the Superintendent appears to have taken upon himself the decision of a question which had been previously submitted to another tribunal. On the other hand, if the Council was competent to decide the question and to declare Mr. Graham to have been duly elected, it was also competent to maintain its decision, and the course subsequently pursued by the Speaker and the Council in allowing Mr. Graham and Mr. Daldy both to be present, and in refusing to decide which was the real Simon Pure, is inconsistent and opposed to what they had just done before. If the Council was competent to decide between Mr. Pollen and Mr. Graham, it was equally competent to decide between Mr. Graham and Mr. Daldy. The Council seems to be in this dilemma, — having decided in favor of Mr. Graham in the first instance, it was bound to maintain its decision, and affirm that Mr. Graham's subsequent election was void. If the Council was competent to decide between Mr. Graham and Mr. Daldy, it was equally competent to decide between Mr. Graham and Mr. Daldy. This question, and exceedingly regret the disgrace which the Superintendent has brought on the institutions, the honor and dignity of which he has thus dragged in the mire. Doubtless the Council will be dissolved, and the sooner the better. (From the Lyttelton Times.) The Provincial Councils of New Zealand have all had their crises. All of them at some time or other illustrated their patriotism at the expense of public patience and to the detriment more or less of public business. But it has remained for Auckland to show us how to develop a difficulty so as to make it most amply conduce to the dignity and importance of those concerned. We do not give Auckland any very great credit. It was due to the position that it arrogates to itself to show an example to New Zealand. The most that can be said is that it has done its duty. And yet this is perhaps an unfeeling and ungenerous view of the case. The touching story which reached us by last mail of the noble self-devotion of the conscript fathers shows us that the days of Roman firmness have not passed away. The levity with which some Southerns have been inclined to give way to in talking of the Auckland "fix" is far from right. We cannot laugh at the necessity which has reduced a legislative body to play cards and read no verses. Brave Auckland councillors! The firmness of their attitude is ever before our eyes; their patriotic voices are ringing in our ears. We fancy we hear the cry of "Pic wick and Principle" replied to by that of "Cribbage and Consistency!" What a noble picture might be made of the irregular exit and entrance of honest members by unquestioned means of access, — members driven to taking it turn about to satisfy the demands of hunger or the craving for tobacco. What could exceed in mournful dignity the spectacle of a Speaker snatching a surreptitious meal behind his chair, or the sound of the audible slumbers of exhausted senators? But we refrain from drawing too much upon the feelings of our readers. We will not say that under severe pressure our own Council might not emulate the firmness of their northern brethren. We need not point out how much such scenes as those which the Auckland Council is now exhibiting are calculated to exalt the dignity of New Zealand in the eyes of strangers. Absentees Personated. Bryan James, Ariruma, sawyer, householder, at Deacon's Inn Fishwick Edward, Freeman's Bay, gentleman, freeholder, at Lucas Creek Hart George, Wyndham street, general dealer, freeholder, at Hot Springs Hyland Mark, Chancery street, labourer, householder, at Panmure Lennon John, West Queen street, shoemaker, householder, at Panmure Lennon John, West Queen street, shoemaker, householder, at Auckland Nash S. T. B. S., Shortland street, general dealer, house holder, at Scott's Inn Stackpole, George, High street, shoemaker, householder, at Papakura Sohlue Carl, Chancery street, musician, householder Warnchalt Conrad, Chancery street, musician, householder Warnchalt Conrad, Chancery street, musician, householder The last four names — polled at Lucas Creek— are those of the members of a German Brass Band that remained at Auckland for a few months some two years ago. One of the names was also polled at Panmure. Mechanics' Institute. —On Tuesday evening last a lecture on astronomy was delivered, in the Hall of the Institute, to the children attending the Sunday schools of the City, by the Rev. T. Hamer. The reverend gentleman, for the amusement as well as the instruction of the young ideas, illustrated his subject with the whole series of illuminated diagrams, both scientific and scenic judging from what we understand to be the proceeds, amounting to the handsome sum of £4 odd, we should conceive that upwards of 300 children were present; at all events the hall was crowded — the youthful and happy audience being accompanied by a goodly company of adults. The good resulting from efforts thus early to draw the attention of the young to such subjects of general importance cannot be over-rated. Voters in Colony Personated. Browning George, Mercury Bay, mariner, leaseholder. at Howick Grimmer John, Mahurangi, farmer, freeholder. at Howick McKay Angus, High street, farmer, householder. at "Waiuku Oakes John, Peter, West Queen street, boatman, house holder. at Papakura Ring Charles, Coburg street, settler, householder. at Waiuku Sullivan John, Mahurangi, settler, freeholder. at Auck land Dead Men Polled. Gavin Thomas, Chancery street, labourer, householder. at Hot Springs Hamilton William, Three Kings, ploughman, freeholder. at Deacon's Inn Leather William, Onehunga, labourer, freeholder. at Deacon's Inn Leather William, Onehunga, labourer, householder. at Auckland Smith John, Howick, labourer, householder. at Howick Thompson Richard, Chancery street, labourer, householder. at Auckland Walsh Richard, Howick, labourer, householder. at Howick Thompson Richard, Chancery street, labourer, householder. at Auckland Walsh Richard, Howick, labourer, householder. at Howick Thompson twice at North Shore and once at city Bready Philip, Queen street, carter, freeholder. Wade and Auckland Brown William, Lucas Creek, sawyer, householder. Hot Springs and Lucas Creek Collins John, Howick, labourer, householder. Ho wick and Hendersons Mill Davies Edward, Mills lane, tailor, householder. Otahuhu and Auckland Davis John, Chancery street, carpenter, house holder. Otahuhu and Auckland Finlay Matthew, Howick, farmer, householder. Howick and Onehunga Grimmer John, Mahurangi, farmer, freeholder. Brown's Mill and Howick Hickery Thomas, Panmure, farmer, freeholder. Ho wick, Panmure, and Auckland Hogan John, Panmure, labourer, householder. Panmure and Wade Holt James, Panmure, farmer, freeholder. Onehunga and Otahuhu Jones John, Panmure, farmer, freeholder. Richard James Hunt, The Settlers' Hotel, Ouhubu. Peter Brady, The Soldier's Home, Pannum. There were three new applications, viz: — Edward Stellard, Queen-street, Onehunga.— Granted. George Ferral, His residence, Onehunga.— Refused. Joseph Osborne, His residence, Onehunga.— Refused. Mr. Bracey was retained to oppose the new applications. Question that ought to "find an immediate solution. Let the reasoning of the New Zealander be fairly met. Is, he a man? Then treat him as such. If it be right to prohibit the sale of spirits and ammunition to the Maori, to also is it to the Pakeha. Besides, prohibitory laws do not always effect the good desired. The Maori has guns, ammunition; and spirits in abundance; nor is it likely that his store would be materially increased were the law repealed tomorrow. This, however, is a question for Government; and we are given to understand that Government is prepared to use its utmost endeavor in opening the way. But Governments are generally remiss. Theirs is the old jog-trot of four miles an hour instead of forty. Let us hope better things of ours. "Let the New Zealander's reasoning," says our correspondent, "be" fairly met." We can only say, that it would be difficult to do so. We who now write supported the restrictive ordinances many years ago, when they were introduced by Governor Grey, but have since learned, "with greater experience of the country, to consider them a mistake. A mistake, at all events under the present system — under the shani of treating, or professing to treat natives and Europeans as on an equal footing all over the country. Under another system, which, after further consideration, we shall probably advocate, the restrictions might perhaps be maintained. The question of native management is becoming more and more serious — more and more complicated. How much longer we shall retain the military force, on its present footing, is doubtful; but this at least is certain, that ultimately the alternative, will be offered us of paying for them, or of doing without them. And the Colony, At present, could not afford to support a single regiment, — much less two. It is even said that unless the expense of the Barracks at Taranaki — some £7000, together with the other expenses of the troop 3, caused by the late intertribal war be forthwith - defrayed, the Home Government threatens to withdraw the force at once. It is time that native management should be based on some substantial principles, comprehen sible to the Maori as well as to the Pakeha. We have been permitted to make the following extract from a letter, written by a gentleman now at Coromandel: — There is not much doing at the diggings. McLeod bought some 4 oz. (troy weight), of a digger at Waiou, of good gold. But nothing will result until the place is bought out of the natives' possession. We believe the statement concerning the Waiou may be relied upon. ANNUAL LICENSING DAY. The annual meeting of the Licensing Bench was held on Tuesday last. Present:— The Resident Magistrate (chairman), Major Greenwood, Messrs. A. Clarke, R. Graham, and Daldy. The Chairman, before entering upon business, intimated that the bonds would be taken at an adjourned meeting, to be held that day fortnight. The following applications were then considered:— RENEWALS. Allen James, Allied Arms Hotel, Albert-street— Granted. Anderson David, Hammer in Hand, Chancery-street.— This application was opposed by Mr. Merriman, on behalf of Mr. Bacon, and also with reference to the manner in which the house had been conducted. The Inspector of Police handed to the Bench two petitions against the house, and mentioned the fact of three convictions having been recorded against the former holder of the license. The Bench refused the license. Bacon William, Odd Fellows' Arms, Chancery-street.— Granted. Collins Samuel, Prince of Wales, Hobson-street— Granted. Davies Rose Ann, Prince Albert, Epsom.— Granted. Dennett Ann, Duke of Marlborough, Queen-st— Granted. De Zestre Mary, Crown and Anchor, West Queen-street. —Granted, the applicant being cautioned— one conviction for grog-selling to natives having been recorded against her. Dignan Patrick, Clanricarde Hotel, Albert-st— Granted. De Zestre Mary, Crown and Anchor, West Queen-street.— Granted. De Zestre Mary, Crown and Anchor, West Queen-street.— Granted. De Zestre Mary, Crown and Anchor, West Queen-street.— Granted. Epsom.— Granted. King James Henry, Osprey, High-street.— Granted, with a caution respecting selling to natives. Leech George, Victory of Sevastopol, Mechanics' Bay.— Granted. Levy Philip, Union Hotel, Queen-street— Granted, with a caution respecting selling to natives. Levey Solomon Hyman, Russell Wine Vaults, Shortland street. — A petition from several boatmen was presented against this application; but it was deemed frivolous, and the license granted. Londergan Thomas, Caledonia Hotel, Fort-st. — Granted, with a caution respecting selling to natives. Also cautioned with regard to some irregularities that had occurred. Also cautioned with regard to some irregularities that had occurred. McGarvey William, Trafalgar Inn, Queen-street— Granted. McGrath John, The Thistle Inn, Queen-street— Granted, with a caution respecting selling to natives. Also cautioned with regard to some irregularities — Granted, on condition of a new brick building being added, before July, 1858. Barchard Alfred, Wharf Hotel, Queen-street — Granted. A petition, signed by several merchants and Insurance agents, was presented against this application and Pilkington's. They were considered together— Mr. Merriman appearing against both, Mr. George for Mr. Pilkington and Mr. Brookfield for Mr. Barchard. The Bench decided on granting the latter; Mild refusing the former on the ground of having no back accommodation. Bolous John, Court Hotel, Queen and Victoria-streets. — Granted. Harkin William, Yew Tree Inn, Shortland-st. — Granted. Keesing Henry, jun., Commercial Inn, Shortland and High-streets. — Granted. Levick George, Pier Hotel, Official Bay. — Refused, the house being small, and a very large house being nearly finished by Mr. Palmer in the same locality. These facts were urged by Mr. Brookfield, who appeared for Mr. Palmer. MacCarthy John, Albion Inn, West Queen-st. — Granted, the applicant having promised to make several improvements. Newell Benjamin, Auckland Hotel, High-st. — Granted, conditionally that the roof be on by the 29th of June. Pilkington William James, Labour in Vain Hotel, Queen street Wharf. — Granted. Roche Thomas, Captain Cook Hotel, Eyber Pass Road. — Granted. Wood Michael, British Hotel, Queen and Durham-streets. — Granted. Renewals were all granted, viz.:—Jeremiah O'Keefe, Redan Hotel, Onehunga. Thomas C. Hallamore, Royal Hotel, Onehunga. John Forbes, Commercial Hotel, Onehunga. John Forbes, Commercial Hotel, Onehunga. John Forbes, Commercial Hotel, Onehunga. Henry Snelgar, Crown Hotel, Ouluha. was impending. About Monday, the last, it was reported, that, though dictated no doubt by good motives, was extremely injudicious, calculated seriously for endanger our relations with the Zulus, and which has actually resulted in complicating the difficulties and embarrassments of our Government. A gentleman, who acts, We believe, as interpreter at the agent's residence, and as a sort of lieutenant to Mr. Williams, volunteered to cross the river, with a small bodyguard, to endeavour to negotiate terms of peace between the belligerent parties. The proposal was unfortunately acceded to, and the Kaffir police attached to the station with the uniform at Hottentots supplied for their use by our Government, besides a number of Hottentots and other natives collected and armed for the purpose, proceeded on their dangerous mission,— their leader (Mr. Dunn) being also armed to the teeth. The very appearance of such a force (it numbered sixty men) was calculated to irritate the already excited savages, and it is not surprising that no answers were returned to repeated messages sent to Blechwayo with a view to open negotiations— more especially if it be true, as possible, that Mr. Dunn and his men took up their quarters with Umbulazi, one of the contending parties, thus, apparently at least, ranging themselves on one side and therefore being disqualified and discredited as arbitral tors between the two. At length Mr. Dunn proceeded in person towards Kechwayo's position, when he was fired upon, and the ball passed near his head. On this the army were drawn out and ordered to fire, and thus commenced the horrors of the day. A Dutchman, named Gouws (a settler at Natal) was professedly supporting Umbulazi at another point. Mr. Dunn little party thrice momentarily repulsed the huge mass of K'echwayo's army, and gallantly stood their ground for a time; but against such terrible odds successful resistance was hopeless, and the whole army of Umbulazi took to flight, as well as the Dutchman and his party, No battle, therefore, was fought, but the scene was a rout and a whole sale slaughter. Distance of seven miles before they reached the river, the further (that is the Natal) side of which afforded the only place of possible safety. Followed by a mighty mass of inturiated and triumphant savages, multitudes fell fainting by the way, and wers quickly despatched by assegais, and multitudes more fell beneath the deadly thrust of that weapon while running for their lives. The women and children who had taken refuge in kioofs and ravines prior to the actual attack were enclosed, and mercilessly but chered. Still several thousands of men, women, and children reached the Tugela, and plunged into its swollen stream, where again the spear of their brutal pursuers helped the deep and rapid current in the work of wholesale destruction. The river was reddened with blood, where it was not blackened with the shrieking forms of innumerable savages; and some idea of the number of corpses that shortly encumbered the water may be formed from the fact that they obstructed the action of the oars and the passage of the boat that conveyed the few who were able to avail themselves of it. Of Mr. Dunns' party of sixty only eight or ten returned to tell the tale of horrors, and the number of Zulus that perished by spear or water in this terrible massage is estimated to be at least six thousand. Notwithstanding all this sacrifice of life, fully 3,000 of miserable half-drowned or wounded wretches succeeded in reaching the Natal side; and since the day of the slaughter Umbulazi himself (who, at first, was said to have been killed, but who, it seems, had succeeded in concealing himself) came over with one hundred of his followers, the remnant of his army, and is now under British protection, as well as a lad, one of Panda's youngest sons. But during the events we have recorded, imminent perils, it may be assumed, before the European traders, who, with their property, were in that part of the Zulu country at the time. And indeed it is marvelous that any of them escaped. As it was, one English lad, who, there seems no reason to doubt, was acting under Gouws, in hostility to Kechwayo, fell a victim, and it is said Gouws's own son also. English traders (who were entirely neutral) escaped across the river with the utmost difficulty and peril. But the whole of their property was carried off by the victorious army: twelve waggons were enticed and sacked, and no fewer than 1,600 head of cattle be longing to the traders were carried off. Six of the waggons, with about 1000 head of cattle, had been taken in safety over the Zulu side of the river to an island in the centre; yet, even here, on this neutral ground (if it be not actually British territory) they were emptied of their contents, and the cattle driven off. The value of property and cattle thus seized is not less than £4000, whilst a large amount of the property and cattle of traders still remains in the interior of the country, at the mercy of the victorious savages. We have the concurrent testimony of the most respectable and experienced traders for the belief that but for the unfortunate attempt of Mr. Dunn and his party, clothed, in the apprehension of ignorant savages, with the authority of the British Government, no white man's lite would have been endangered, no waggon plundered, and if any trader's cattle had been taken away in the foray they would have been promptly returned on application. Up to the eve of the catastrophe, and during the known preparations, the traders had mixed freely in friendly and business intercourse with both parties, and the continued observance of a strict neutrality on our part would, it is fully believed, have prevented any loss or danger to Englishmen, as well as the very serious complications which have now arisen. We have to be thankful for two agencies in our favor, to which we believe we are indebted, at this moment, for the absence of a much more terrible peril than at present threatens us; but they are agencies of God's sending, note of man's;— the rainy season rendering the rivers frequent ly impassable, and the cattle sicken on our soil, creating a wholesome dread, where otherwise there might have been an overmastering covetousness in aid of barbarian lury. Cannot we have — we must have — an ample addition to our military force. A small cavalry force, stationed at different crossing-points along our border river, would suffice to hold it against any possible attempt at invasion; and an adequate addition of troops at the different military posts in the colony would not only insure internal peace, but facilitate the enforcement of those measures of policy on which depend the permanent tranquility and advancement of Natal. We learn from a reliable source that the chiefs in this district, living near the Zulu border, have offered their services to Mr. Shepstone, with all their fighting force, to proceed with the English to attack and punish the Zulus. It is satisfactory to find that the Natal Kafirs, or one portion of them, are at present in this loyal mood; but we hope the proposal will not be entertained. Five hundred mounted yeomen and burghers, with his Excellency at their head, would speedily set matters right in the Zulu country; and a small mounted force, posted permanently along the river, together with an adequate increase of military at the existing colonial posts, would permanently suffice to keep the peace, unbroken even by spasmodic peri odical alarms. Nor would such an increase be required long; for a state of settled security, together with the hopeful condition of industry and productive development, would speedily fill the country with a population that would be its own guarantee of peace. All parties acquainted with the Zulu country represent Kechwayo, the victorious son, and now probably actual sovereign, as a second Chaka in character, — restless, reckless, and bloodthirsty, and cherishing withal no friendly feeling towards the white man. He now commands all the hot young blood of the country, who have been kept from troubling their neighbours only by the older and more prudent counselors of Panda, whose experience extends back to the horrors of A former period, but who now are hors de combat before the rampant spirit of young Zulu land. Panda, the obese and bedridden old King, is probably now forever out of the way. The latest accounts represent him as deserted and helpless, and the madly triumphant host of Kechwayo proceeded immediately after the massacre to Panda's place, with the avowed intention of killing him, after the parricidal fashion of these barbarians. Aprihfol, 1851 No. 1025. THE SOUTHERN CROSS (From the Wellington Spectator, March 11.) The "difficulty" of the Provincial Council at Auckland seems to have reached its climax. Neither party shows any disposition to yield, and so the Government of the Province has come to a dead lock. The 'New-Zealander and the Southern Cross,' ever since the election of the 'odd man' to the Council, have descanted on nothing rise but the position of the Council its supernumerary member, and its interminable divisions; to these succeed long THE AUCKLAND DEAD LOCK. The new Minister had sustained another defeat in the rejection of Dr. Greeves, for East Bouke. The polling took place on the 20th, and the gross test was as follows:— Mr. Heales, 358; Dr. Greeves, 306; Mr. Brock, 97; Majority for Mr. Heales over Dr. Greeves 52. Enthusiastic cheers are said to have been given at Pentridge on the announcement of the majority. The following is the 'Argu' continent on the MELBOURNE. The "Parsimmon county" debating club out in Indiana, are debating the question, "Which is the proudest state—a girl with her first beau, or a woman with her first baby?" "Father, are there any boys in Parliament?" "No, my son, why do you ask that question?" "Because the papers said the other day that the members kicked Mr. Brown's Bill out of the House." A a old gentleman, who has dabbled all his life in statistics, says he never heard of more than one woman who insured her life. He accounts for this by the singular fact of one of the questions on every information paper being, "What is your position?" We must premise that the critical condition of Zulu politics, and the preparation for a deadly contest between Panda's sons for the sovereignty of the country became known more than a month ago to traders in the course of their journeyings, and by them were revealed to the British agent, on their coming out of the country. Intimations of coming events (proved subsequently to have been in the main correct) were given in the local papers for several weeks past; yet we are positively assured that Mr. Shepstone declared to traders on the border, that Government had no authentic information until Friday, the 28th ultimo, when a letter received from Mr. Shepstone, apprised them of the state of affairs. It was not until Monday that Mr. Shepstone departed for the border, where he arrived some hours after the massacre. And it does not appear that he was armed with any instructions or authority to act, or that any defensive measures had been arranged; but that he remained several days in a state of inaction, waiting for instructions from head quarters, to be forwarded on receipt of his information. He merely, as we are informed, distributed a portion of the refugees among the neighbouring chiefs in the Urn. voti d ; Btrict, and ordered cattle for their sustenance until Government should issue orders respecting them. Mongawhaie, Wairoa River, Kaipara, April 4th, 1857. "Reverend Sir, or Sirs, Believing that you only require to be made aware of any circumstances involving injustice to the New Zealand laiiders, which may have arisen through your Society, to induce you to repair it, — as also that you would dis countenance any immoral or improper uses which any property you possess or have control over may be put to, I adopt the medium of the columns of a public journal to draw your attention to the manner in which you became possessed of and still hold the property called "Mount Wesley," or "Au Roa," in this neighbour hood, as well as to the uses, (so different to the in ten ions of the grantors) to which it has lately been applied. Should I misstate, it will give me pleasure to have it removed; but the facts, as I have gathered them from good authority, are as follows: — Rather more than three years ago your Resident Minister here, the Rev. Mr. Buller, induced the Christian natives of the Au Roa property to cede to your body a large and most valuable portion of it, amounting to, perhaps, 100 acres, without any other consideration than an understanding and promise that he, or another minister, should reside on it, and that it should continue to be used for purposes connected with religious instruction — not secular ones. Mr. B iller then erected a house— the New Zealanders a chapel, and fulfilled the conditions of residence and ministrations for about a year, when, to the great regret of the natives, he was removed, and the premises, instead of being occupied by a successor, were let at a early rent to a trader, and have from that time to the present been Used as a store, and stopping place for the friends of the occupant—the character of whose society may be judged of by the fact, that in one of the drunken revels lately held for several successive days in the Mission House, my station carpenter was robbed of eighteen sovereigns and some valuable papers. To the Editor of the Southern Cross. Sir, — Having made an unintentional error in my last letter, which appeared in your last impression, I now apologize for doing so, and should be obliged by your insetting these few lines. In place of Mr. Dinnin having purchased the Butts referred to, it ought to have been Mr. Morrin of Queen Street. I am, Sir, Your obedient, W. Brodie. April 23, 1857. Correspondence. ** Our correspondence columns being impartially open, we are not to be indontified with any opinion expressed therein.**
| 1,506 |
https://github.com/RoepStoep/scaladraughts/blob/master/src/main/scala/Mode.scala
|
Github Open Source
|
Open Source
|
MIT
| 2,021 |
scaladraughts
|
RoepStoep
|
Scala
|
Code
| 102 | 225 |
package draughts
sealed abstract class Mode(val id: Int) {
lazy val name = toString.toLowerCase
def casual = this == Mode.Casual
def rated = this == Mode.Rated
def fold[A](c: => A, r: => A): A = if (this.casual) c else r
}
object Mode {
case object Casual extends Mode(0)
case object Rated extends Mode(1)
val all = List(Casual, Rated)
val byId = all map { v => (v.id, v) } toMap
def apply(id: Int): Option[Mode] = byId get id
def apply(rated: Boolean) = if (rated) Rated else Casual
val default: Mode = Casual
def orDefault(id: Int): Mode = apply(id) getOrElse default
}
| 33,230 |
https://github.com/kivy/kivy/blob/master/examples/shader/plasma.kv
|
Github Open Source
|
Open Source
|
LGPL-2.1-only, MIT, Apache-2.0
| 2,023 |
kivy
|
kivy
|
Kvlang
|
Code
| 14 | 53 |
#:kivy 1.0
<ShaderWidget>:
canvas:
Color:
rgb: 1, 0, 0
Rectangle:
pos: self.pos
size: self.size
| 19,744 |
https://pl.wikipedia.org/wiki/Saint-Roch-sur-%C3%89grenne
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Saint-Roch-sur-Égrenne
|
https://pl.wikipedia.org/w/index.php?title=Saint-Roch-sur-Égrenne&action=history
|
Polish
|
Spoken
| 52 | 141 |
Saint-Roch-sur-Égrenne – miejscowość i gmina we Francji, w regionie Normandia, w departamencie Orne.
Według danych na rok 1990 gminę zamieszkiwało 228 osób, a gęstość zaludnienia wynosiła 19 osób/km² (wśród 1815 gmin Dolnej Normandii Saint-Roch-sur-Égrenne plasuje się na 661. miejscu pod względem liczby ludności, natomiast pod względem powierzchni na miejscu 385.).
Bibliografia
Saint-Roch-sur-Egrenne
| 16,042 |
bxYAKDzrl-g_1
|
Youtube-Commons
|
Open Web
|
CC-By
| null |
Reps Call For Proper Oversight, And Legislative Intervention In Health Care Institutions.
|
None
|
English
|
Spoken
| 315 | 400 |
And Chairman of the House of Representatives, Committee on Specialty Health Care, Hon. Alex E. Buona, has said the challenge of rising cases of mental health in the country requires proper oversight and legislative intervention. He said the same applies to other health related challenges under the jurisdiction of the committee. He said there's duration inauguration of the committee at the National Assembly Complex in Apocha. He said the Committee on Specialty Health Care is established posh ones in Section 62889 of the Constitution of the Federal Republic of Nigeria, 1999, and standing orders of the House of Representatives to ensure effective oversight of the health sector of the economy. The Committee on Specialty Health Care is established for some to search on 62, 88, 89 of the Constitution of the Federal Republic of Nigeria, 1999, understanding what are the House of Representatives to ensure effective oversight of the health sector of the economy. Hon. Sika Grishosli appointed me to lead you, my Hon. Colleagues, in this assignment with Mr. Alawan Shetema as my deputy. The mandate of the committee covers hospitality hospitals, orthopedic hospitals, psychiatric hospitals, ice hospitals, blood transfusions services, ERK centers, obstructive fistula centers, School of Dental Technology, and Ora Hygiene Programme in Nigeria. School of Correctional Therapy, College of Complementary and Nutritional Medicine, School of Medical and Project Technology, and the annual Budget Estimate of the Minister of Health, and such our effort to be jointly oversighted with later committees of the, of Health Committee of the House. I'm happy to note that this committee is made aware, respected, and experienced members of the House of Representatives. And I'm personally grateful to the speaker for finding me worthy to share the committee. Hello. Hope you enjoyed the news. Please do subscribe to our YouTube channel and don't forget to hit the notification button so you get notified about fresh news updates..
| 39,012 |
2015PA020076_1
|
French-Science-Pile
|
Open Science
|
Various open science
| 2,015 |
Conception et estimation d'un modèle DSGE pour la prévision macroéconomique : un petit modèle d'économie ouverte pour le Cameroun
|
None
|
French
|
Spoken
| 7,233 | 11,497 |
Université Panthéon Assas Thèse de Doctorat / Decembre 2015 École Doctorale d’EcoGeInfoCom (ED 455) Conception et Estimation d'un Modèle DSGE pour la Prévision Macroéconomique: Un petit modèle d'économie ouverte pour le Cameroun Thèse de doctorat en Sciences Économiques soutenue le 10 Décembre 2015 par Alassa Mfouapon
Directeur de thèse : Ali Skalli Jury : M. Jean-Pierre Allegret, Professeur à l’université de ParisOuest Nanterre La Défense, M. Gilles Dufrénot, Professeur à l’Ecole d’Economie d’AixMarseille, M. Sébastien Lotz, Professeur à l’université Panthéon-Assas, M. Henry Ohlsson, Professeur à l’université d’Uppsala, Gouverneur Adjoint de la Banque de Suède, M. Marc Raffinot, Maître de conférences, HDR, à l’université Paris-Dauphine, M. Ali Skalli, Maître de conférences, HDR, à l’université Panthéon-Assas.
Mfouapon Alassa| Thèse de doctorat | Decembre 2015
Avertissement La Faculté
n’entend donner aucune approbation ni
impro
bation aux opinions
émises
dans cette thèse
;
ces opinions
doivent
être considérées comme propres
à leur auteur.
-2- Mfouapon Alassa| Thèse de doctorat | Decembre 2015 A mes parents A mes enfants A mon épouse Awa -3- Mfouapon Alassa| Thèse de doctorat | Decembre 2015
Remerciements
L'occasion est ainsi arrivée pour que j'exprime toute ma reconnaissance à l'Ecole Doctorale ED455 de l'Université Panthéon-Assas Paris II pour toute son hospitalité et tout soutien pour la réalisation de cette thèse. Beaucoup de gens ont contribué à la réalisation de ce travail de recherche d'une manière ou d'une autre. Tout d'abord, je suis d'une reconnaissance exceptionnelle à Ali Skalli mon directeur de thèse, de qui j'ai reçu de précieux conseils qui soustendent une grande partie de ce travail. Je voudrais également adresser mes sincères remerciements au Professeur Sébastien Lotz et au Professeur Antoine Billot pour leurs attentions particulières aux étudiants en doctorat Ph.D. à ED455 et au LEMMA (Laboratoire d'Economie Mathématique et de Microéconomie Appliquée), respectivement. Mes sincères remerciements sont également adressés aux différents membres du LEMMA et ERMES avec qui j'ai eu de fructueuses et enrichissantes discussions. Je suis également redevable au Professeurs Michel Juillard, Junior Maih, Stéphane Adjemian, et à Samir Alpanda qui m'ont tous aidé à faire mes premiers pas dans dynare, outil essentiel sans lequel je n'aurais pas été capable de produire des résultats dans cette thèse. Depuis le premier jour et durant toutes ces années que j'ai consacré à ce travail, je n'ai pas cessé de recevoir de toute ma famille leur affection et leur générosité et ce malgré la distance qui me séparent d'eux tous. C'est le lieu pour moi de leur faire parvenir toute mon éternelle reconnaissance. Bien que leur contribution à ce travail ne puisse être perceptible, Alain Kouassu, Belomo Guy, Didier Kouokap, Leonel Samba, Gaetan Ndo, Prince Will Benga, Amidou Kpoumie, Hamadou Sanoussi, Wilfried Bebbada, Ibrahim Njoya, etc. ont beaucoup apporté pour sa réalisation et je ne peut pas manquer une telle occasion de leur dire comment je suis reconnaissant de leur amitié et de leur soutien. Toute erreur qui subsisterait dans cette thèse serait de ma seule responsabilité. -4- Mfouapon Alassa| Thèse de doctorat | Decembre 2015 Résumé
Cette thèse propose une analyse de la dynamique macroéconomique de l’économie camerounaise. On commence par une analyse quantitative générale du cycle des affaires au Cameroun, fondée sur des données macroéconomiques annuelles que nous avons nous-mêmes assemblées. Cette première exploration laisse apparaître un certain nombre de caractéristiques qui se prêtent bien à une modélisation de type néokeynesien. Nous construisons alors un modèle dynamique stochastique d’équilibre général (DSGE) de l’économie camerounaise. Ce modèle comporte les blocs de construction de modèles DSGE néo-keynésiens standards (par exemple, la rigidité des prix et des salaires des rigidités, et des coûts d'ajustement), mais il inclut également un certain nombre de caractéristiques spécifiques (telles que l'exportation des matières premières et les revenus du pétrole entre autre) dont on montre qu’elles jouent un rôle important dans la dynamique de l'économie camerounaise. Le modèle est estimé et évalué selon une approche bayésienne. La performance du modèle DSGE en termes de prévision est comparée à celle d’un modèle de marche aléatoire, à celle d’un modèle vectoriel auto-régressif (VAR) et, enfin, à celle d’un modèle vectoriel auto-régressif de type Bayesien (BVAR). Nous trouvons que, le modèle DSGE est plus précis en matière de prévision au moins dans un horizon de courtterme. Pour ce qui est des fluctuations macroéconomiques, les chocs des prix des produits de base génèrent une expansion de la production, une augmentation de l'emploi et une baisse de l'inflation tandis que des chocs liés aux prix du pétrole ont un impact direct sur le coût marginal de production qui augmente et provoque une augmentation de l'inflation en même temps que production et emploi baissent. Not que, les chocs extérieurs et les chocs d'offre domestiques représentent une grande part des fluctuations de la production et de l'investissement. Aussi, l'évolution de la production sur l'ensemble de l'échantillon est dominée par le choc de prix des matières premières et le choc des prix du pétrole. Mots clés
: Modèles DSGE, néo-keynésien, Méthode bayésienne
, Fluctuations Macroéconomiques, Prévisions, Cameroun -5- Mfouapon Alassa| Thèse de doctorat | Decembre 2015
Abstract This thesis aims at analyzing the macroeconomic dynamics of the Cameroonian economy. It begins with a quantitative analysis of the business cycle in Cameroon, based on annual macroeconomic data, especially gathered for this purpose. This preliminary inquiry highlights a number of features that can be accounted for in a new-keynesian modelling framework. A dynamic stochastic general equilibrium (DSGE) model of the new-keynesian family is thus constructed as a mean of describing the salient feautures of the Cameroonian economy. It has the traditional blocks of new-keynesian DSGE models (Sticky prices and wages, adjustment costs, etc). But it also accounts for a number of characteristics of the Cameroonian economy that are shown to be influential in the dynamics of the cameroonian economy (e.g. oil revenues or primary goods exports). The model is then estimated and evaluated, based on a Bayesian approach. Its forecasting performance is also assessed through comparison to the performances of a random walk model, a vector autoregressive (VAR) model and a Bayesian VAR (BVAR) model. It turns out that, at least for short horizons, the DSGE model shows the highest perfromance. As to macroeconomic fluctuations, the estimated model suggests that commodity price shocks generate an output expansion, an increase in employment and a fall in inflation. In addition, oil price shocks have a direct impact on marginal costs which increase and provoke a rising in inflation while output and employment tend to fall. Foreign shoks and domestic supply shocks account for a large share of output and investment fluctuations. The evolution of output over the whole sample is dominated by commodity price shocks and oil price shocks one would expect. Keywords: DSGE Models, New-Keynesian, Bayesian Method, Macroeconomic Fluctuations, Forecasting, Cameroon -6- Mfouapon Alassa| Thèse de doctorat | Decembre 2015
Principales Abbréviations
AR: Auto-Regressive ARMA: Auto-Regressive Moving Average B: Beta BEAC: Bank of Central African States BP: Band-Pass BOF: Bank Of Finland BVAR: Bayesian Vector Auto-Regressive CEE: Central and Eastern European CAEMC: Economic Community of Central African States) CES: Constant Elasticity of Substitution CFA: African Financial Community CPI: Consumer Price Index DGP: Data Generating Process DSGE: Dynamic Stochastic General Equilibrium DM: Diebold-Mariano ECOWAS: Economic Community of West Africa States FEVD: Forecast Error Variance Decomposition G: Gamma GDP: Gross Domestic Product GMM: Generalized Method of Moment MFE: Mean Forecast Error HD: Historical Decomposition HP: Hodrick-Prescott IID: Independent and Identically Distributed IG: Inverse Gamma -7- Mfouapon Alassa| Thèse de doctorat | Decembre 2015 II: Indirect Inference IMF: International Monetary Fund IFS: International Financial Statistic INS: Institut National de Statistique IRF: Impuls Response Functions IW: Inverse Wishart LP: Likelihood Principle MA: Moving Average MH: Metroplis Hasting MCMC: Markov Chain Monte Carlo ML: Maximum Likelihood MPC: Monetary Policy Commitee NKM: New Keynesian Macroeconomics NER: Nominal Exchange Rate NR: Non Ricardian NKDSGE: New-Keynesian Dynamic Stochastic General Equilibrium NIW: Normal Inverse Wishart PI: Permanent Income RBC: Real Business Cycle RER: real Exchange Rate RW: Random Walk RMSE: Root Mean Square Error SSA: Sub-Saharan Africa TOT: Terms Of Trade TB: Trade Balance U.S.: Unitate States U.S.A: Unitate States of America VAR: Vector Auto-Regressive VARMA: Vector AutoRegressive Moving Average
-8-
Mfouapon Alassa| Thèse de doctorat | Decembre 2015 SOMMAIRE Introduction.......................................................... ................................................
12 Chapter 1: Business cycles in Cameroon: An overview..............................................
28 Introduction......................................................................................................................... 28 2Data and empirical setup................................................................................................... 31 2.1Detrending................................................................................................................ 32 2.1.1Hodrick-Prescott filter........................................................................................ 33 2.2Volatility, Persistence, and Correlations..................................................................... 34 2.2.1Volatility........................................................................................................... 35 2.2.2Persistence......................................................................................................... 35 2.2.3Cyclicality......................................................................................................... 37 3 Results : Business Cycles in Cameroon............................................................................ 38 3.1Volatility.................................................................................................................. 38 3.2Persistence................................................................................................................ 43 3.3Cyclicality................................................................................................................ 44 3.3.1Correlations with external conditions.................................................................. 45 3.3.2Components of aggregate demand....................................................................... 47 3.3.3Correlations with monetary and financial variables.............................................. 49 Conclusion...........................................................................................................................
51 Appendix A: Data Sources and Unit Root Tests..................................................................... 56 Chapter 2: A Small Open Economy New-Keynesian DSGE model for Cameroon................... 58 Introduction......................................................................................................................... 58
2Model description............................................................................................................. 62 3Model's Structure............................................................................................................. 65 3.1Households............................................................................................................... 65 3.1.1Ricardian Households......................................................................................... 66 3.1.2Non-Ricardian households.................................................................................. 72 3.1.3Structure of consumption.................................................................................... 72 3.1.4Household Labour Supply Decisions................................................................... 74 3.2Firms........................................................................................................................ 77 3.2.1Capital goods producers...................................................................................... 78 3.2.2Domestic retailer firms.......................................................................................
81 3.2.2.1Domestic retailer Firm’s problem................................................................. 82 3.2.3Intermediate goods firms.................................................................................... 86 3.2.3.1Intermediate goods firm's price setting problem............................................ 89 3.2.4Imports goods retailer......................................................................................... 93 3.2.5Commodity sector.............................................................................................. 96
-9- Mfouapon Alassa| Thèse de doctorat | Decembre 2015
3.3Government.............................................................................................................. 97 3.3.1Fiscal policy....................................................................................................... 97 3.3.2Monetary policy................................................................................................. 99 3.4Foreign sector......................................................................................................... 100 3.4.1Exports dynamics............................................................................................. 100 3.5Aggregate equilibrium of the model......................................................................... 102
Conclusion
.........
................
................
................................................................
................
103 Appendix C........................................................................................................................ 106 Appendix C1: Household’s demands for given goods and................................... 106 Appendix C 2: Linearized DSGE model.......................................................................... 110 Chapter 3: Empirical Setup: Calibration, Estimation and Evaluation.................... 120
Introduction....................................................................................................................... 120 2
Model
Calibration.......................................................................................................... 124 2.1
Calibrated
structural parameters
............................................................................... 125 2.2
Other calibrated parameters
..................................................................................... 127 3Model Estimation........................................................................................................... 130 3.1
Pri
or
distributions of the estimated parameters
......................................................... 137 3.2Pos
terior
estimates
of parameters............................................................................. 139 4Model
Evaluation: DSGE-VAR representation................................................................ 146
Conclusion
.........................................................................................................................
152 Appendix D........................................................................................................................ 155
Appendix
D 1: The Kalman filter and the Likelihood Running......................................... 155
Append
ix D 2: The MH-MCMC Simulator...................................................................... 158 Appendix D3: Convergence of the posterior distribution and parameters stability............. 162 Chapter 4: Forecasting Macroeconomic Fluctuations in Cameroon........................ 168
Introduction
.......................................
................
................................
................................
168
2Forecasting with DSGE and competing Models............................................................... 171 2.1Forecasting computation.......................................................................................... 171 2.2Forecast Evaluation................................................................................................. 172 2.3The Basics of the Alternative Forecasting models: The VAR and BVAR models........ 173 2.4Results.................................................................................................................... 174 3Impulse response function (IRF) analysis........................................................................ 177 4Forecast error variance decomposition (FEVD)............................................................... 179 5Historical decomposition (HD)....................................................................................... 182 Conclusion......................................................................................................................... 184 Appendix E........................................................................................................................ 186 Appendix E1: Impulse response to shocks....................................................................... 186 Appendix E2: Historical decomposition of shocks........................................................... 193 Appendix E3: Forecasts performance statistics................................................................ 199
10 - Mfouapon Alassa| Thèse de doctorat
|
Decembre 2015
Conclusion.......................................................................................................... 212 References........................................................................................................... 219 Index................................................................................................................... 233 Liste des Figures....................................................................................................... 233 Liste des Tableaux.................................................................................................... 235
11
- Mfou
apon A
lassa| Thèse de doctorat | Decembre 2015
"After climbing a great hill, one only finds that there are many more hills to climb." Nelson Mandela Introduction "Dynamic equilibrium theory made a quantum leap between the early 1970s and the late 1990s. In the comparatively brief space of 30 years, macroeconomists went from writing prototype models of rational expectations (think of Lucas, 1972) to handling complex constructions like the economy in Christiano, Eichenbaum, and Evans (2005). Jesus Fernandez-Villaverde
in "The
Econometrics
of
DSGE Models
"(2009,
pag.2)
De 1940 à 1960, les modèles macro-économétriques de grande taille (3000 équation et plus) se sont imposés comme un outil naturel pour étudier les sources des fluctuations macroéconomiques. Identifier les sources des fluctuations économiques est en effet plus qu'une exigence pour la conduite de politiques économiques. Historiquement, ces modèles 1 trouvent leurs racines dans l'approche de modélisation de Tinbergen (1939), puis, Klein (1950) et les développements ultérieurs de la "Cowle’s Commission". Cependant, c'est au début des années 1970, avec l'instabilité de l'économie mondiale, à la suite de la flambée des prix du pétrole, qu'une attention particulière sera portée sur l'étude des cycles économiques. L'utilisation des modèles macro-économétriques de grande taille pour l'analyse de la politique économique (voir par exemple; Ando et Le modèle de Phillips–Bergstrom (PB), le modèle de Walras–Johansen (WJ), le modèle de Walras– Leontief (WL), le modèle de Muth–Sargent (MS), et enfin les modèles d'équilibre général calculable (EGC). 1 12 - Mfouapon Alassa| Thèse de doctorat | Decembre 2015 Modigliani, 1969)
va être très critiquée. Sur le plan empirique, ces modèles vont être confrontés au défi de la concomitance d'un taux de chômage élevé et d'un fort taux d'inflation, ce qui était incompatible avec la courbe de Phillips, traditionnellement incluse dans ces modèles. Il était donc devenu nécessaire d'admettre une relation instable entre inflation et chômage, instabilité dont les modèles macroéconomiques traditionnels ne tenaient pas compte. Une autre critique, de nature méthodologique cette fois-ci, adressée à ces modèles est venue de Sims (1980). Celui-ci va remettre en question la pratique habituelle de conférer à certaines variables dans le modèle, le statut de variables exogènes. Cette pratique reposait ainsi sur une hypothèse ad hoc, qui consistait à exclure des mécanismes de rétroaction significative entre les variables incluses dans les modèles. Mais la principale critique est d’ordre théorique et a été émise par Lucas (1976). Lucas soulignait que le casse-tête empirique de la stagflation n’était que le reflet d'un problème théorique plus général. Il notait que les agents économiques se comportaient selon une approche d'optimisation dynamique et faisaient des anticipations rationnelles. Cela signifiait qu'ils maximisaient leur bien-être sur toute leur durée de vie, en tenant compte non seulement de leurs conditions économiques passées et présentes, mais aussi de leurs prospectives quant à l'avenir, en utilisant toutes les informations pertinentes dont ils disposaient, et que, bien qu'ils ne puissent pas prédire totalement l'avenir, ils pouvaient construire des attentes qui n'étaient pas systématiquement biaisées. Par conséquent, si les agents devaient anticiper tout changement dans leur environnement économique, à l'exemple d'un changement dans la politique économique, ils devraient immédiatement intégrer ces attentes dans leur prise de décision et ce, en tenant compte de ces changements dans leurs comportements actuels et futurs. Étant exclusivement orientés vers le passé, les modèles traditionnels ne pouvaient pas rendre compte du rôle des attentes sur le comportement des agents économiques et par conséquent, ils souffraient d'un important manque dans la description du fonctionnement de l'économie. Ils supposaient simplement que les relations entre les variables économiques qui étaient en vigueur dans un certain contexte seraient en mesure d'expliquer l'évolution de l'économie, même si le contexte sous-jacent venait à changer et ce, sans tenir compte du fait que la prévision de ce changement par les agents peut modifier la façon dont ils réagissent et, de cette façon, invalider les relations estimées antérieurement.
Par 13 - Mfouapon Alassa| Thèse de doctorat | Decembre 2015
conséquent,
pour prédire correctement les effets des nouvelles politiques
les modèles doivent tenir compte du rôle des attentes des agents économiques dans leurs prises de décision. Depuis lors, beaucoup de ces modèles vont être abandonnés, et des études sur les cycles économiques internationaux vont être remises sur la table. La réponse d'un bon nombre des professionnels de l'économie sera de se tourner vers l'utilisation des modèles VAR (vecteur autorégressif) pour analyser les cycles économiques. Ces modèles sont une spécification dynamique puisque chaque variable du modèle est exprimée comme une fonction des valeurs retardées de l'ensemble des variables présentes dans le modèle. En outre, ces modèles VAR ont l'avantage sur les modèles macroéconomiques traditionnels de ne pas imposer au modélisateur l’adoption d’une structure vaste et complexe. Historiquement, Sims (1980) est le premier à avoir introduit les modèles VAR comme alternative aux anciens modèles macroéconométriques. Depuis lors, la méthodologie VAR va gagner en popularité dans la recherche en macroéconomie appliquée. Une fois de plus, notons encore que cette méthodologie est née d'une insatisfaction des professionnels de l'économie avec l'utilisation des modèles macroéconométriques traditionnels qui considéraient à la suite des travaux de la "Cowle’s Commission" que le problème d'identification dans ces modèles (modèles macroéconométriques traditionnels) se résolvait en excluant certaines variables le plus souvent des variables endogènes retardées sans justifications théoriques ou statistiques. L'idée derrière cette façon de faire était que les variables pouvaient être classées comme des variables endogènes ou des variables exogènes. Les variables exogènes étaient déterminées à l'extérieur du système et pouvaient donc être traitées indépendamment des variables endogènes. Imposer des restrictions d'exclusion sur les retards de certaines variables était le moyen pratique de traiter ce problème d'identification. Sims (1980) s' interrogé sur cette façon de faire, c'est à dire, développer de vastes modèles économétriques sophistiqués et y résoudre le problème d'identification par ce qu'il a appelé "d'incroyables restrictions (non justifiée) d'exclusion" qui ne sont ni anodines ni essentielles pour la construction d'un modèle qui pourrait être utilisé pour l'analyse et l'élaboration des politiques économiques. Enfin, l'absence de consensus sur le modèle structurel approprié a conduit de nombreux économistes à se pencher plus sur l'utilisation des modèles VAR pour examiner les effets de politiques économiques alternatives. Cependant, outre le 14 - Mfouapon Alassa
|
Thèse de doctorat | Decembre 2015 fait que les modèles VAR sont sans fondement théorique et peuvent de ce fait être sujets à la critique de Lucas, tous les effets de variables omises dans la modélisation VAR sont mécaniquement incluses dans la composante résiduelle. Dans le même temps, il y a eu chez les économistes la nécessité d'une compréhension approfondie des fluctuations des cycles économiques et les corrélations dynamiques entre les variables macroéconomiques dans les économies avancées. Ce qui a conduit à l'élaboration des modèles d'équilibre général dynamique et stochastique (DSGE) (Kydland et Prescott, 1982). Contrairement aux modèles VAR, ces modèles DSGE sont des modèles micro-fondés, ce qui les met à l'abri de la critique de Lucas. Ceci est probablement la principale raison pour laquelle ils sont devenus aujourd'hui un outil puissant qui fournit un cadre cohérent pour l'élaboration des politiques économiques et les prévisions en macroéconomie. Dès lors, les modèles DSGE vont désormais être considérés comme une véritable locomotive pour les économistes dans la structuration de leur pensée afin de comprendre le fonctionnement de l'économie. Ces modèles vont ainsi être utilisés dans divers contextes, allant de l'analyse des politiques économiques à la mesure du bien-être, en passant par l'identification de chocs, l'analyse des scénarii ou la prévision économique. Ils permettent ainsi de mener à bien tous les exercices essentiellement empiriques que les modèles macroéconométriques précédents permettaient de réaliser. Ils ont en outre l'avantage d'être fortement fondés sur la théorie économique, en contraste avec la nature plus statistique des modèles VAR. Les modèles DSGE font ainsi l'objet d’une attention
2 Une fonction de réponse d'impulsion donne la réponse d'une variable à une impulsion d'une autre variable dans un système qui peut impliquer un certain nombre d'autres variables également. 15 - Mfouapon Alassa| Thèse de doctorat | Decembre 2015
particulière non seulement dans le milieu universitaire, mais aussi dans un certain nombre d'institutions non-universitaires de prise de décision, telles les banques centrales, le fond monétaire international, etc.. En fait, les modèles DSGE sont considérés comme un cadre exceptionnel doté d'une fertilisation croisée entre le sol théorique du milieu universitaire et le sol empirique des banques centrales et d'autres institutions semblables. Ils permettent aussi d'établir un lien entre les caractéristiques structurelles de l'économie et les paramètres de la forme réduite, ce qui n’était pas toujours possible avec des modèles macroéconomiques anciens. Bien que ces modèles se soient développés assez rapidement dans les pays développés (Edge et al, 2007 pour l'économie américaine; Smets et Wouters, 2004 pour la zone euro, etc.), ils sont restés un véritable défi pour les pays en développement. Un certain nombre de raisons justifient la timide percée des modèles DSGE dans le monde en développement: Tout d'abord, non seulement ces modèles nécessitent la maîtrise de nouvelles techniques de modélisation, mais ils sont aussi assez exigeants en termes de compétences techniques (statistiques) et informatiques. Deuxièmement, la nature complexe des modèles DSGE a peut-être également limité leur acceptation auprès des décideurs politiques dans la mesure où les notations qu'ils utilisent peuvent parfois se révéler plutôt incompréhensibles, créant ainsi une barrière naturelle pour la communication des résultats aux décideurs politiques, pour ne pas dire au public en général. Troisièmement, la compréhension du fonctionnement de ces modèles requiert que le macroéconomiste soit bien formé avec une bonne culture de modélisation et des compétences en statistique et enprogrammation très fortes. En outre, fournir au public une interprétation économique des équations n'est pas une tâche facile. En particulier, il est difficile d'expliquer les mécanismes de transmission ou d'identifier des canaux de transmission d'un choc ou d'une décision de politique dans toute l'économie. Dans la plupart des cas, les solutions analytiques sont l'exception plutôt que la règle, ce qui rend la recherche de solutions analytiques fiables un défi supplémentaire, auquel le praticien devrait faire face. Cela implique également que les banques centrales auraient à investir des ressources supplémentaires pour développer de tels modèles ; un objectif qui ne peut pas être prioritaire lorsque les ressources sont rares. 16 - Mfouapon Alassa| Thèse de doctorat | Decembre 2015
Pourtant, les modèles DSGE présentent aussi un certain nombre d'avantages, hautement importants pour les pays en développement. Premièrement, les modèles DSGE ont un fondement microéconomique explicite avec des agents agissant sous anticipations rationnelles. Ces modèles spécifient explicitement les objectifs et les contraintes des secteurs privé et public, et permettent la détermination des prix et des allocations de façon optimale. Les effets décisions des agents, telles que la quantité d'offre de travail et la demande de consommation ou la demande de travail et les décisions de prix par les entreprises peuvent être analysés directement. En outre, le fondement microéconomique de ces modèles permet d'avoir des relations exactes entre les paramètres de la forme réduite et les paramètres structurels du modèle, ces derniers étant moins susceptibles de changer en réponse à des changements de régime, ce qui permet de donner un sens économique à ces paramètres. De plus, à partir de l'approximation de la fonction d'utilité de l'agent représentatif, il en résulte un critère de bien-être qui est cohérent dans le modèle. De cette façon, un modèle DSGE est un outil puissant qui fournit un cadre cohérent pour la discussion et l'analyse des politiques économiques : à l'aide du critère de bien-être, les décisions de politiques alternatives peuvent facilement être évaluées dans le cadre des hypothèses du modèle. Finalement, un certain nombre d'auteurs (Smets et Wouters, 2004, Del Negro et Schorfheide, 2004; Dib, Gammoudi et Moran, 2005; Kilponen et Ripatti, 2006 et Bord et al, 2010, entre autres) montrent que les modèles DSGE ont des performances hors échantillon plus élevées que les modèles VAR non structurels ou même VAR Bayesiens (B désormais). Compte tenu de l'importance des prévisions macroéconomiques pour la conception de la politique économique, ces résultats impliquent que les pays en développement bénéficieraient également de la performance supplémentaire des modèles DSGE au-dessus de ceux de la famille des modèles VAR. Cette thèse vise à proposer un modèle DSGE d’économie ouverte pour le Cameroun. Le premier objectif ainsi poursuivi est de fournir un cadre théorique qui tient compte de la réalité de l'économie camerounaise. Cela nécessite un examen approfondi des sources de fluctuations des cycles économiques dans cette économie. Un nombre croissant d’études a exploré les sources des fluctuations économiques dans les économies américaines et européennes. Smets et Wouters (2007) ont estimé un modèle néo-keynésien pour identifier les principales forces motrices du 17 - Mfouapon Alassa|
Th
èse de doctorat
| Decembre
2015 développement de la production aux États-Unis. Justiniano, Primiceri et Tambalotti (2010) ont constaté quant à eux que la plupart de la variabilité de la production et des heures de travail dans l'économie des États-Unis est due aux chocs d'investissement et que la concurrence imparfaite est le canal de transmission le plus important. Le deuxième objectif est de concevoir un nouvel outil de prévision macroéconomique pour aider à l'élaboration de politiques économiques au Cameroun. Certaines des contributions les plus importantes mettant en évidence la performance de prévision des modèles DSGE sont celles de Smets et Wouters (2004), Del Negro et Schorfheide (2004), Dib, Gammoudi et Moran (2005), Kilponen et Ripatti (2006), et Edge et al. (2010). Dans cette littérature, les performances prévisionnelles de modèles DSGE sont évaluées par comparaison à un large éventail d'outils de prévision sans aucun fondement théorique, comme les modèles VAR et BVAR, et bien d'autres types de modèle. En revenant à la modélisation DSGE, notons en effet qu'il y a deux directions essentielles qui sous-tendent ce type de modèles: la théorie néoclassique des cycles d'affaire réelle (RBC) et la théorie néo-keynésienne des cycles d'affaire. La question principale dans les modèles RBC est que, avec des prix complètement flexibles, tout changement dans le taux d'intérêt nominal (qu’il soit choisi directement par la banque centrale ou induit par des changements dans l'offre de monnaie) va toujours de pair avec les changements du taux l'inflation, laissant inchangé le taux d'intérêt réel. Cela signifie que toute action de l'autorité monétaire n'aurait pas d'impact sur les variables réelles et laisserait donc la politique monétaire neutre, un résultat en contradiction avec l'idée largement répandue (certainement parmi les banquiers centraux) selon laquelle la politique monétaire devrait influencer le côté réel de l'économie ne seraitce qu'à court terme. En outre, du moment où les fluctuations cycliques sont la réponse optimale de l'économie aux chocs, toute politique de stabilisation ne serait pas seulement inutile, mais pourrait aussi se révéler contre-productive si elle détournait l'économie de sa réponse optimale. Ceci est en contradiction avec le point de vue néo-keynésien selon lequel les fluctuations des cycles économiques sont principalement dues à une utilisation inefficace des ressources disponibles. En outre, le rôle principal attribué à des chocs
18 - Mfou
apon
Alassa| Thèse de doctorat | Decembre 2015
technologiques dans les fluctuations économiques est en contradiction avec la vision traditionnelle des chocs technologiques comme étant une source de croissance à long terme, sans lien avec les cycles économiques et qui sont dans une large mesure considérés comme un phénomène axé sur la demande. Plus important encore, l'incapacité des modèles RBC à reproduire certains faits empiriques a commencé à préoccuper leurs utilisateurs, principalement universitaires. Ces caractéristiques des modèles RBC expliquent ainsi pourquoi en dépit de leur influence dans les milieux universitaires, ils ont eu une influence très limitée sur la pratique de la conception des politiques des banques centrales et d'autres institutions du même type. Ces insuffisances des modèles RBC ont commencé à être surmontées dans les années 1990 quand les économistes, tout en gardant la structure principale de ces modèles ont commencé à y introduire de nouvelles hypothèses. Une nouvelle école de pensée ( le néokeynésianisme) va donc voir le jour. Cette école partage cette conviction <<RBCiènne>> selon laquelle la macroéconomie nécessite des fondements microéconomiques rigoureux, d'où l'utilisation des modèles DSGE comme instrument principal dans l'élaboration des politiques économiques. Partant de la théorie RBC, le raisonnement néo-keynésien consistait à reconnaître que l'économie n'est ni parfaitement souple, ni parfaitement concurrentielle et qu'elle est soumise à une variété d'imperfections et de rigidités. C’est de cette conviction qu’est née, chez les économistes néo-keynésiens, l’idée d’introduire la concurrence monopolistique et divers types de rigidités nominales et réelles dans le modèle, en plus d'un certain nombre de perturbations aléatoires. Quelques exemples notables sont l'introduction de la rigidité des prix, à la suite des études antérieures comme Calvo (1983) qui a permis de tenir compte de l'inertie des prix, brisant ainsi l'hypothèse forte de la neutralité de la monnaie dans les modèles RBC ; l'introduction des coûts d'ajustement du capital suivant King (1991) qui a permis d’appréhender, dans les modèles néo-keynésiens, l'effet de liquidité ; et enfin, l'introduction de chocs de demande avec Rotemberg et Woodford (1995). L'idée qui sous-tend cette thèse est qu'un modèle DSGE pourrait aider à mieux comprendre et à expliquer les fluctuations économiques au Cameroun. Ainsi, si les fondements théoriques nécessaires pour conceptualiser la politique macroéconomique appropriée en réponse aux chocs exogènes sont clairement mis en place, on pourrait donc découvrir les sources les plus pertinentes des fluctuations économiques dans l'économie de ce pays. Un
19 - Mfouapon Alassa| Thèse de doctorat | Decembre 2015
objectif supplémentaire de cette recherche est d'adapter le cadre dynamique standard d'équilibre général stochastique dans la littérature existante, à l'économie camerounaise. Nous conceptualisons dans cette thèse que l'économie camerounaise est une économie avec un équilibre stable ou un sentier de croissance équilibrée et que les chocs stochastiques exogènes auxquels elle est assujettie (chocs externes ou des chocs des matières premières), provoquent ainsi son déplacement de son équilibre ou de son sentier de croissance d'une part, et générent ainsi des fluctuations de certaines variables macroéconomiques d'autre part. L'économie comporte des frictions réelles, nominales, et financières, qui ralentissent l'ajustement de l'économie lors de son retour à son état d'équilibre ou de son retour à son sentier de croissance équilibrée après un départ provoqué par un choc exogène. Par conséquent, nous soulignons l'importance des chocs exogènes comme source des fluctuations économiques au Cameroun, permettant ainsi une interprétation de ces chocs comme étant une source des fluctuations économiques, ce qui reste en ligne avec la vision consensuelle de la macroéconomie moderne (Smets et Wouters, 2003, 2007; Christiano et al., 2005; Schorfheid, 2005; etc.). Le cadre analytique que nous retenons a une structure de base de nouvelle génération des modèles néo-keynésiens d'équilibre général stochastique dynamique. D'un point de vue méthodologique, ces modèles cherchent en général à mettre l'accent sur un grand nombre de questions dans différentes économies. Ceci est d'autant plus important que l'un des défis de cette thèse est de trouver une description raisonnable de l'économie du Cameroun tout en soulignant ses spécificités d'une part, et en tenir compte dans le modèle que nous proposons d'autre part. L'environnement de base que nous adoptons est celui où un agent représentatif qui vit infiniment maximise sa fonction d'utilité qui dépend de sa consommation et de ses loisirs sous sa contrainte budgétaire intertemporelle; un grand nombre d'entreprises ont accès à une technologie identique et sont soumises à des chocs exogènes, l'économie est caractérisée par une concurrence monopolistique où les entreprises fixent les prix des biens qu'elles produisent afin de maximiser leurs profits d'une part, et d'autre part que ladite économie est aussi caractérisée par des rigidités nominales qui limitent la fréquence avec laquelle ces entreprises ajustent les prix des biens et services qu'elles vendent, ou la fréquence avec laquelle les travailleurs ajustent leurs salaires.
20 - Mfouapon Alassa| Thèse de doctorat | Decembre 2015
Cependant, en plus de ces traits distinctifs néo-keynésiens, le cadre d'analyse de cette recherche vise une photographie plus réaliste de l'économie camerounaise. Il vise ainsi à donner un accent spécifique aux caractéristiques structurelles susceptibles de rendre une telle économie plus vulnérable aux chocs exogènes. Plus précisément, il y a trois caractéristiques structurelles frappantes et bien perceptibles de l'économie camerounaise, sur lesquels nous mettons un accent particulier. Tout d'abord, nous considérons un modèle qui intègre des frictions financières qui entravent le financement des investissements et qui amplifient l'effet des fluctuations des taux d'intérêt et des taux de change sur les positions réelles de la richesse nette des emprunteurs et les bilans de l'équilibre macroéconomique (Stiglitz et al., 2006, Hostland 2009; Krugman 1999, Aghion, Bacchetta, et Benerjee 2001). Deuxièmement, le modèle intègre également le canal de transmission de taux de change dès lors que la vitesse avec laquelle les chocs des taux de change atteignant le niveau des prix domestiques semble être plus élevée dans les économies en développement que dans le monde industriel (Calvo et Reinhard 2002 Choudhri et Hakura 2006 et Devereux et Yetman, 2005). Peut-être, le trait le plus distinctif de l'économie camerounaise est que les chocs exogènes ont tendance à avoir de plus grandes amplitudes. Un fait stylisé de la macroéconomie camerounaise est que les exportations et les importations sont fortement et positivement corrélées avec le PIB tandis que les exportations nettes sont, elles, négativement corrélées avec le PIB. Ce dernier résultat est compatible avec une grande partie de la littérature empirique (voir, par exemple, Aguiar et Gopinath, 2007; Backus et Kehoe, 1992; Benczur et Ratfai, 2010; Raffo, 2008). Backus et Kehoe argumentent que ce résultat peut survenir lorsqu'un pays est emprunteur des capitaux sur les marchés internationaux. En étroite ligne avec l'expérience d'autres pays, les importations sont fortement procycliques au Cameroun. Le pays étant une économie tributaire des importations, cela pourrait signifier que les biens importés jouent un rôle important dans les fluctuations de la production au Cameroun. Aussi, les exportations sont positivement corrélées avec le PIB, ce qui suggère une forte procyclicacité des exportations au Cameroun. Ce résultat serait attendu compte tenu de la forte dépendance de l'économie de l'extérieur. L'importance des chocs exogènes peut aussi être bien illustrée par celle des prix du pétrole sur le marché mondial. En fait, les changements
21 - Mfouapon Alassa| Thèse de doctorat | Decembre 2015
dans les prix du pétrole ont une influence directe spécifique sur les petites économies ouvertes puisqu'ils affectent à la fois les décisions de consommation et influencent la structure de coûts des entreprises, d'où, finalement, une influence sur les prix intérieurs via ce canal. Malheureusement, il y a d'autres caractéristiques cruciales de l'économie camerounaise dont nous ne tenons pas compte ici et que nous laissons pour les recherches futures. Un exemple de telles caractéristiques est le «dualisme économique» (Lewis 1954), qui consiste en la partition d'une seule économie en deux secteurs dissemblants. Un de ces secteurs étant généralement de forte intensité capitalistique et exportant une partie de sa production, tandis que l'autre secteur s'appuie plus sur la main d'œuvre non qualifiée mais abondante et fournit toute sa production seulement au marché intérieur. Ce dernier secteur constitue généralement un "réservoir de main-d'oeuvre". Globalement, le modèle que nous proposons dans cette thèse est proche de celui développé par Christiano et al (2005), Altig et al. (2004), et Smets et Wouters (2003a, 2003b). Il y a trois types d'entreprises dans l'économie. Un premier type regroupe les entreprises qui produisent des variétés différenciées de biens intermédiaires échangeables. Ces entreprises produisent en utilisant le travail, le capital et le pétrole comme facteurs de production, et vendent leurs productions dans les marchés intérieurs et étrangers. Elles ont un pouvoir monopolistique sur les variétés qu'ellesproduisent et fixent les prix de leur production d'une manière échelonnée. Un deuxième type d'entreprises est celui des entreprises de la distribution des différentes variétés importées de l'étranger. Ces entreprises ont aussi un pouvoir monopolistique sur les variétés qu'elles distribuent et fixent elle aussi les prix de leur production d'une manière échelonnée. Il y a une troisième catégorie d'entreprises qui sont complètement tournées à l'exportation des matières premières (ressources naturelles) à l'étranger. Elles n'ont, en revanche, aucun pouvoir sur le marché mondial et sont preneuses de prix. Le stock de ressources naturelles est déterminé de manière exogène et est possédé par le gouvernement, ainsi que par des investisseurs étrangers. Le secteur du bois au Cameroun appartient à ce secteur d'exportation. Les produits intermédiaires locaux et étrangers sont utilisés pour fabriquer deux types de produits finis: le produit local et le produit étranger. Ces deux produits finis sont combinés avec du pétrole pour former un panier de consommation du ménage camerounais, du 22 - Mfouapon Alassa
| Thèse de doctorat | Decembre 2015
gouvernement camerounais, et de l'investisseur camerounais à travers l'accumulation de nouveaux biens d'équipement pour augmenter son capital-actions. Nous considérons deux types de ménages: les ménages ricardiens et les ménages nonricardiens. Le premier adopte d'une manière prospective des décisions d'épargne et de consommation inter-temporelle en maximisant son utilité sous contrainte budgétaire. Le second consomme son revenu net d'impôt, ne constitue pas d'épargne et ne reçoit pas non plus la part du bénéfice distribué provenant des entreprises. La politique monétaire est menée par une règle de politique de taux d'intérêt tandis que l'autorité budgétaire se comporte d'une manière qui ressemble à la règle d'équilibre structurel mise en place par le gouvernement. Le modèle présente un sentier de croissance équilibrée. A côté de ces variables endogènes, différents chocs sont introduits comme sources de fluctuations, et sous une forme log-linéaire, ces chocs sont supposés suivre un processus autorégressifs d'ordre un. Comme dans la pratique générale, les modèles DSGE n'ont pas de solution analytique claire et nous nous appuyons plutôt sur les méthodes de calcul numérique 3. Ces méthodes de calcul reposent sur la méthode de perturbation, la résolution du modèle, et la simulation du modèle DSGE autour de la position d'équilibre de l'économie ou de sa trajectoire de croissance équilibrée afin de produire des données artificielles. Ces données artificielles décrivent les réponses des variables économiques aux chocs exogènes. Un ensemble de statistiques comme les moments théoriques pourrait résumer les contributions des différents chocs exogènes aux fluctuations économiques. Dès lors que les chocs structurels sont orthogonaux (non corrélés), il est possible de décomposer sans ambiguïté la variance de l'erreur de prévision de chaque variable macroéconomique en composantes qui reflètent la variabilité exclusivement attribuable à chaque choc spécifique. L'erreur de prévision de la variance d'une variable affectée par un choc particulier détermine l'importance relative de ce choc à expliquer les fluctuations de ladite variable. Cette méthodologie de résumer les cycles économiques par une collecte de statistiques calculées à partir des données artificielles trouve ses origines dans la littérature des cycles des affaires (voir Cooley 1995). Aujourd'hui, quatre méthodes empiriques majeures existent pour générer des 3 Habituellement, les conditions d'optimalité impliquent un système d'équations non-linéaire d'ordre supérieur avec des espoirs de résolution mathématique très mince.
23 - Mfouapon Alassa| Thèse de doctorat | Decembre 2015 données
artifici
elles à partir d'un modèle DSGE théorique: le calibr
age
, la méthode d'information complète, l'estimation basée sur la méthode de maximum de vraisemblance, et la méthode bayésienne. Dans cette recherche, nous combinons deux de ces méthodes empiriques. Tout d'abord, nous utilisons les données macroéconomiques camerounaises 4 pour calibrer les paramètres du modèle DSGE qui sont liés à l'état stationnaire de l'économie en question. Nous résolvons le modèle étant données les valeurs de ces paramètres en utilisant les conditions d'optimalité non-linéaires évaluées à l'état stationnaire. Les paramètres structurels ainsi calibrés sont fonctions des variables endogènes évaluées à l'état d'équilibre ainsi que sur la moyenne de l'échantillon à long-terme. Nous en déduisons également les valeurs des paramètres non calibrés en estimant sous une approche bayésienne le modèle DSGE linéarisé en utilisant des données macroéconomiques camerounaises. Cette approche bayésienne nous permet d'aborder efficacement les questions auxquelles nous nous intéressons à savoir la performance du modèle pour les prévisions et les fluctuations macroéconomiques. Ainsi, nous effectuons des analyses de performances de prévisions pour déterminer quel modèle de prévision est le meilleur. Nous menons également des simulations dans le but d'analyser la dynamique de l'économie par le biais des fonctions de réponse d'impulsion. Finalement, nous décomposons les variances des erreurs de prévision afin d'identifier les principales forces motrices de l'économie camerounaise. Le chapitre 1 de cette thèse propose une analyse générale des cycles des affaires dans l'économie camerounaise. Il vise à proposer une description globale des cycles économiques dans ce pays à travers l'évaluation statistique des principaux phénomènes caractéristiques. Ainsi dans le cadre de ce chapitre, nous fournissons une première tentative de documentation d'un large éventail de régularités dans les fluctuations macroéconomiques du Cameroun. L'analyse est effectuée à partir de trois dimensions caractéristiques des fluctuations macroéconomiques: la volatilité de la 4 Ces données sont principalement extraites de la base de données des Statistiques financières internationales (SFI). C'est le cas de la production intérieur brut (PIB), la consommation des ménages, la croissance de la production étrangère, et le taux d'intérêt étranger. L'investissement, le taux de change réel, le taux d'intérêt national, et le taux d'inflation sont extraits dans la base de données de l'Institut National des statistiques (INS). Toutes ces données ont une fréquence annuelle allant de 1960 à 2012. 24 - Mfouapon Alassa| Thèse de doctorat | Decembre 2015
production est aussi bien un indicateur de la sensibilité de l'économie aux chocs exogènes qu'un indicateur des sources endogènes d'instabilité. Les co-mouvements des variables d'intérêt apportent une lumière sur la façon avec laquelle les fluctuations observées se rapportent à d'autres agrégats de l'économie. Plus importante encore est l'évaluation de la persistante de certains phénomènes dans les cycles des affaires camerounais. Enfin, l'analyse repose sur trois outils statistiques de base couramment utilisées dans la littérature empirique des cycles économiques. Ce sont l'écart-type utilisé comme mesure de la volatilité, les corrélations croisées comme un moyen d'analyser les co-mouvements et les auto-corrélations comme mesures de la persistance. Alors que la pratique habituelle est de s'appuyer sur des données trimestrielles pour de telles études, malheureusement pour nous, les données dont nous disposons pour le Cameroun sont seulement de périodicité annuelle. Cela est regrettable car cela peut être critiqué au motif que la fréquence annuelle ne permettrait pas de saisir pleinement la dynamique de court terme de l'économie. En outre, avec de telles données, nos résultats ne sont pas facilement comparables à ceux rapportés pour d'autres pays dans d'autres études comme celle d’Agénor et al. (2000) ou celle de Rand et Tarp (2002). Dans le chapitre 2, nous proposons un modèle DSGE descriptif de l’économie du Cameroun. Le modèle mis en place est basé sur un cadre néo-keynésien, caractérisé par des rigidités nominales et réelles. Ce cadre nous permet d'introduire des fondements microéconomiques du comportement optimisateur des agents économiques dans le système. Les entreprises sont supposées ajuster les prix avec une fréquence irrégulière tandis que les salaires sont fixés de façon échelonnée par les travailleurs. Le modèle intègre des frictions financières qui entravent le financement des investissements et amplifient l'effet des fluctuations des taux d'intérêt et taux de change sur les valeurs réelles de la richesse nette de l'emprunteur et les bilans de l'équilibre macroéconomique. Le modèle intègre également le canal de transmission de taux de change dès lors que la vitesse avec laquelle les chocs des taux de change atteignant le niveau des prix domestiques semble être plus élevée dans les économies en développement que dans le monde industriel. Les chocs externes tels que les chocs des prix du pétrole et les chocs des prix des produits de base sont intégrés dans le modèle car le Cameroun dépend fortement de l'exportation des matières premières qui le rend si vulnérables à ces différents chocs. 25 - Mfouapon Alassa| Thèse de doctorat | Decembre 2015
Le chapitre 3, prépare le terrain pour l’exploitation du modèle DSGE développé dans le chapitre 2. Deux méthodes sont utilisées pour une évaluation empirique dudit modèle. Un premier groupe de paramètres (paramètres structurels) qui influencent l'état stationnaire de l'économie vont être calibrés. En deuxième lieu, les paramètres non calibrés vont être inférés en estimant par la méthode bayésienne le modèle DSGE linéarisé en utilisant les données macroéconomiques du Cameroun. Toujours dans le cadre de ce chapitre, nous donnons un aperçu sur les mécanismes de transmission de ces chocs qui sont générateurs des fluctuations des cycles économiques. Pour ces sources et ces mécanismes de propagation desdits chocs, il nous est impératif de revoir les opérations nécessaires pour detrender les conditions d'optimalité et d'équilibre du modèle, la technique pour construire une approximation linéaire du modèle, la stratégie visant à résoudre le modèle ainsi linéarisé, donner une représentation de cette solution sous une forme espace-état qui permet de produire des projections du filtre de Kalman. Nous utilisons un simulateur pour générer des distributions a posteriori de notre modèle DSGE. Ces distributions a posteriori donnent des statistiques sommaires des estimations bayésiennes des paramètres du modèle DSGE qui sont comparés aux résultats dans la littérature existante. En outre, ce chapitre fournit des exercices empiriques dans lesquels le modèle DSGE est estimé et évalué sur la base de nos croyances et ce, à l’instar de la littérature standard des modèles DSGE. Finalement, c'est seulement dans le chapitre 4, que nous procédons à la prévision des fluctuations macroéconomiques au Cameroun.
| 24,083 |
b21987373_34
|
English-PD
|
Open Culture
|
Public Domain
| 1,835 |
A treatise on poisons, in relation to medical jurisprudence, physiology, and the practice of physic
|
Royal College of Physicians of Edinburgh
|
English
|
Spoken
| 7,348 | 9,880 |
The only opportunity, so far as I know, which has hitherto occurred of inspecting the body of a person killed rapidly by the irritant action of lead, was in the case of the drummer for- merly quoted, [p. 512.] The lower end of the gullet, the whole stomach and duodenum, a part of the jejunum, and the ascend- ing and transverse colon were greatly inflamed ; and the villous coat of the stomach appeared as if it had been macerated. The stomach contained six ounces of a reddish-brown fluid which had a sweetish, styptic, metallic taste, exhaled the odour of vinegar while evaporating, and yielded globules of lead when the dry residue was subjected to the process of reduction *. The de- tection of lead in the stomach after the patient survived nearly three days is an important fact in medico-legal chemistry. According to Professor Orfila, when the quantity of the sugar of lead has been large, the stomach in animals, instead of being red, has sometimes a peculiar blanched appearance, arising, as he supposes, from chemical action f. The blood of animals seems to be sometimes altered in nature. Dr Campbell once found it fluid. In a dog poisoned with litharge, the experimentalists of the Veterinary School at Lyons found it of a vermilion colour in the veins, and brighter than usual in the arteries if. The appearances found in the bodies of those who have died of the various forms of lead colic are different, and wholly un- connected with inflammation. * Journal Universel, xx. 353. j- Toxicologie Generale, i. 637. £ Corvisart’s Journ. do Medeeine. 522 LEAD. The valuable work of Merat contains four inspections after death from the acute or comatose form of colica pictonum. The bodies were plump, muscular, and fat. The alimentary canal was quite empty, and the colon much contracted, — in one to an extraordinary degree. The mucous coat of the alimentary canal was every where healthy. He therefore infers that the disease is an affection of the muscular coat only. It is a striking cir- cumstance, and conformable with what will be afterwards es- tablished in regard to the true narcotics, that, although both of the men died convulsed and comatose, no morbid appearance was visible within the head * * * §. Another case, which confirms the foregoing facts, has been described by Mr Deering. It was that of a lady who died convulsed after suffering in the usual man- ner, and in whose body no trace of disease could be detected any where *J*. Senac informed Tronchin that he had dissected above fifty cases of colica pictonum and found no morbid ap- pearances J. Schloepfer’ s observations on animals are to the same effect. In the rabbits which died of colica pictonum the great intestines were excessively contracted, but all the other organs of the body were healthy except the liver, which was dark and brittle §. The only instance 1 have met Avith Avhere morbid appearances were found within the head, was in a case mention- ed by Sir G. Baker of a gentleman who died apoplectic after many attacks of colica pictonum, and in whom the brain Avas found unusually soft, and blood extravasated on its surface to the amount of an ounce ||. The appearances in those Avho have been long affected Avith the paralytic form of colica pictonum have been rarely observed in modern times. I am indebted to my late colleague, Dr Dun- can, Junior , for the only good account I have been able to pro- cure of the inspection of the intestinal canal in such a case. The man, who Avas a plumber, had been long and frequently afflict- ed Avith colica pictonum and its sequela?. The intestines were dark, tender, and far advanced in putrefaction. The cardiac ori- fice of the stomach Avas so narroAv that it would only admit a * De la Colique Metallique, p. 213. + Trans, of the Lond. Med. Society, 1810, or Edin. Med. and Surg. Journal, viii. 21 1. + Tronchin de Colica Piet. p. 117. § De cffectibus liquidorum ad vias aerif. applic. p. 43. || Trans, of Lond. Coll, of Physicians, i. 460. Sb^SL Piet, ,a^t Si Xd %rJ« % \\ Tl* 'Hr,*, 1 ^'SlfeilBi,? ' trace of ik ! e"8lla1' leJTr v9**' Tronchiii that, he had dissected ovations onaniir 1 h died of colica [ contracted, but all the c Kept the liver, which wasdarUod ce I hare met with where morbid lin the head, was in a case mention- BtJenian who died apoplectic alter Duni. and in whom the brain war aod extravasated on its surface to lictonufl bted to my lueleaiwlr*^ >0 Jled- 10» & 0 lead. 523 goose-quill. The mesenteric glands were enlarged and har- dened. The thoracic duct was surrounded by many large bo- dies, like diseased glands, exactly of the colour of lead, and composed of organized cysts containing- apparently an inorganic matter. The analysis of this matter was unfortunately neglect- ed. The muscles in similar circumstances are much diseased. When the paralysis is not of long standing, it appears from the experiments of Schloepfer, (whose animals survived about three weeks,) that the whole muscular system becomes pale, blood- less, and tlaccid. When the palsy is of long standing, this change increases so much, that the muscles in some parts, as in the arms and thumbs, acquire the colour and general aspect of white fibrous tissue. Some observations on the nature of these changes will be found in the essays of Sir G. Baker *. The facts are communicated by Mr John Hunter. On exa- mining the muscles of the arm and hand of a house-painter who was killed by an accident, Mr Hunter found them all of a cream colour, and very opaque, their fibres distinct, and their texture unusually dry and tough. These alterations he at first imagined might have been the result merely of the palsy and consequent inactivity of the muscles ; but he changed his opi- nion on finding the same alterations produced by the direct ac- tion of sugar of lead on the muscles of animals ; and he infer- red that the poison gradually effected a change either on the muscles directly, or on the blood which supplied them. It is hardly necessary to observe, that whatever truth there may be in his conclusions, the reason assigned for them will not bear the inference he has drawn ; for the acetate of lead, when ap- plied directly to a muscle, effects a chemical change, in conse- quence of which the animal matter unites with the oxide of lead, — an action which we have no reason to suppose occurs in the muscles during the course of the painter’s palsy. Section IV. — Of the Treatment of Poisoning with Lead. The treatment of poisoning with lead, and the mode of pro- tecting workmen from its influence, will now require a few re- marks. For the irritant form of poisoning, a safe and effectual anti- dote exists in any of the soluble alkaline or earthy sulphates. If none of these be at hand, then the alkaline carbonates may * Trans, of Lond. Coll. Pliys. i. 317. 524 LEAD. be given, particularly the bicarbonates, which are not so irri- tating as the carbonates. The phosphate of soda is also an ex- cellent antidote. If the patient does not vomit, it will be right also to give an emetic of the sulphate of zinc. In other respects, the treatment does not differ from that of poisoning with the irritants generally. Colica pictonum is usually treated in this country with great success by a practice much followed here in colic and diarrhoea of all kinds, — the conjunction of purgatives with anodynes. A full dose of a neutral laxative salt is given, and an hour after- wards a full dose of opium. Sometimes alvine discharges take place before the opium acts, more commonly not till its action is past, and occasionally not for a considerable time afterwards. But the pain and vomiting subside, the restlessness and irrita- bility pass away, and the bowels return nearly or entirely to their natural condition. Sometimes it is necessary to repeat the practice. It is almost always successful : I have seldom seen the second dose fail to remove the colic, leaving the bowels at worst in a state of constipation. When the pulse is full and strong, I have seen venesection premised with apparent advan- tage ; in some instances it appeared to me to be called for by the flushing of the face and the violence of the spasms ; and I have never seen it otherwise than a safe remedy, notwithstand- ing the fears expressed by Dr Warren and others *. The hospital of La Charite in Paris has long enjoyed a high reputation for the treatment of this disease. The physician commences with what is called the painter’s purge, which is a decoction of half an ounce of senna in a pound of water, mixed with half an ounce of sulphate of magnesia and four ounces of the wine of antimony. Next day an ounce of sulphate of mag- nesia and three grains of tartar emetic are administered in two pounds of infusion of cassia, to keep up the operation of the first laxative. In the evening a clyster is given, containing twelve ounces of wine and half as much oil. After this the patient is made to vomit with tartar emetic, then drenched with ptisanes for several days, and the whole is wound up with an- other dose of the painter’s purge succeeded by gentle anodynes. I am not aware of any particular advantage possessed by this complicated and tormenting method of cure, which is not equal- ly possessed by the simpler plan pursued in Britain. * Trans, of Loud. Coll. Pliys. ii. 88. LEAD. 525 Among the many other methods of cure that have been pro- posed for the primary stage of this disease salivation by mer- cury deserves to be particularized. It appears to have been often used with success, the colic yielding as soon as the ptya- lism begins *. If tbe case, however, is severe, there is no time to lose in waiting for the action of the mercury to commence. The treatment in the advanced period of the disease, when the palsy is the chief symptom remaining, depends almost en- tirely on regimen. The patient must for a time at least quit altogether his unlucky trade. He should be allowed the most generous food he can digest. He ought to take frequent gentle exercise in the open air, but never to fatigue. The hands be- ing the most severely injured of the affected parts, and at the same time the most important to the workman, the practitioner’s attention should be directed peculiarly to the restoration of their muscular power. This appears to be most easily brought about by frictions, electricity, and regulated exercise, the hands being also supported in tbe intervals by splints extending from the elbows to the lingers. The dragging of the emaciated muscles by the weight of the dangling hands certainly seems to retard their recovery. When a person has been once attacked with colica pictonum, he is more easily attacked again. Hence if he is young enough, he should, if possible, change his profession for one in which he is not brought into proximity with lead. Few, however, have it in their power to do so. The prophylaxis, therefore, or mode of preventing the influence of the poison becomes a sub- ject of great importance ; and more particularly when we con- sider the vast number of workmen in different trades whose safety it is calculated to secure. On this subject many useful instructions are laid down in tbe work of Merat. He very properly sets out with insisting on the utmost regard being paid to cleanliness, — a point too much neglected by most artizans, and neglected particularly by those to whom it is most necessary, the artizans who work Avith the metals. In proof of the importance of this rule he observes he kneAv a potter who contracted the lead colic early in life when he was accustomed to go about very dirty, but for thirty * Clark, in Edin. Med. Comment, xi. 102. Berger in Horn’s Archiv fiir Mediz. Erfahrung, xi. 344. Lond. Med. and Phys. Journ. xxvi. 46. LEAD. 52 () years after had not any return of it, in consequence simply of a scrupulous attention to cleanliness. In order to secure a due degree of cleanliness three points should be attended to. In the first place, the face and hands should be washed once a-day at least, the mouth well rinsed, and the hair occasionally comb- ed. Secondly, frequent bathing is of great consequence both with a view to cleanliness and as a general tonic ; so that mas- ters should make it an object to provide their workmen with sufficient means and opportunities for practising it. Lastly, the working clothes should be made, not of woollen, but of strong, compact linen, should be changed and washed at least once and still better twice a- week, and should be worn as little as pos- sible out of the workshop. While at work a cap of some light impervious material should always be worn. Next to cleanliness the most important article of the general prophylaxis relates to the means to be employed for preventing the food of the workmen from being impregnated with lead. For this end it is essential that they never take their meals in the workshop, and that before eating they wash the lips and hands with soap and water, and brush out all particles of dirt which may have lodged under the nails. It is also of some moment that they breakfast before going to work in the morning. Derangements of the digestive organs should be watched with great care. If they appear to arise from the poison of lead, the individual should leave off work with the very first symptom, and should take a laxative. Habitual constipation should be provided against. The nature of the diet of the workmen is of some conse- quence. It should be as far as possible of a nutritive and di- gestible kind. Merat condemns in strong terms the small tart wines generally used by the lower ranks of his countrymen. They constitute a very poor drink for all artizans ; and are pe- culiarly ill adapted for those who work with lead, because, be- sides being at times themselves adulterated with that poison, they are also apt to disorder the bowels by their acidity. Beer is infinitely to be preferred. Various articles of diet have been recommended as tending to impede the operation of the poison. Hoffmann recommends brandy, the efficacy of which few work- men will dispute. There is some reason for believing that the free use of fat and fatty articles of food is a preservative. De- 4 LEAD. 527 ®W UsprtgBatei *4 1 J m the J they wash the lips and bads out all particles of dirt which >• It is also of some moment to work in the momk ■ I oi^ans should he matM with i se from the poison of lead, the with the very first symptom, Ritual constipation should he haen was informed by the proprietor and the physician of a lead mine in Styria, that the work-people were once very liable to colic and palsy, but that, after they were told by a quack doctor to eat a good deal of fat, especially at breakfast, they were ex- empt from these diseases for three years *. Another fact of the kind was communicated to Sir George Baker by a physician at Osterhoiit, near Breda. The village used to be the residence of a great number of potters, among tvhom he did not witness a single case of lead colic in the course of fifteen years ; and he attributes their immunity to their having lived much on cheese, butter, bacon, and other fatty kinds of food -f*. Mr Wilson says, in his account of the colic at Leadhills in Lanarkshire, that En- glish workmen, who live much on fat meat, suffer less than Scotchmen, who do notj. Some have likewise proposed as an additional preservative, that the exposed parts of the body should be anointed with oily or fatty matters. But Merat maintains with some reason that the lead will be thereby enabled to penetrate the cuticle more easily by friction and pressure. The observance of the preceding rules will depend of course in a great measure on the intelligence and docility of the work- men, directed by the vigilance and authority of their masters. Some other objects also of much consequence are to be attain- ed by the humanity and skill of the masters only. The workshop should be spacious, and both thoroughly and systematically ventilated, the external air being freely admitted when the weather will allow, and particular currents being es- tablished, by which floating particles are carried through the woi’kshop in certain invariable and known courses. Miners and others who work at furnaces in which lead is smelted, fused, or oxidated, should be protected by a strong draught through the furnaces. According to Mr Braid, wherever furnaces of such a construction were built at Leadhills, the colic disappear- ed, while it continued to recur where the furnaces were of the old, low-chimneyed form. Manufacturers of litharge and red- lead used formerly to suffer much in consequence of the fur- naces being so constructed as to compel them to inhale the fine * Ratio Medendi, P. I. c. ix. de Variis. f Trans, of London Coll, of Phys. ii. 457. J Ed. Phys. and Lit. Ess. i. 521. 528 LEAD. dust of the oxides. In drawing- the furnaces the hot material is raked out upon the floor, which is two or three feet below the aperture in the furnace ; and the finer particles are there- fore driven up and diffused through the apartment. But this obvious danger is now completely averted by a subsidiary chim- ney which rises in front of the drawing aperture, and through which a strong current of air is attracted from the apartment, the hot material on the ground performing the part of a fire. In white -lead manufactories a very important and simple im- provement has been effected of late in some places by abandon- ing the practice of dry-grinding. In all manufactories of the kind, the ultimate pulverizing of the white lead has been long performed under water. But in general the preparatory pro- cess of rolling, by which the carbonate is separated from the sheets of lead on which it is formed, continues to be executed dry. This is a very dangerous operation, because the work- men must inhale a great deal of the fine dust of the carbonate. In a white-lead manufactory which formerly existed at Porto- bello, the process was entirely performed under water or with damping ; and to this precaution in a great measure, was imput- ed the improvement effected by the proprietor in the health of the workmen, and their superior immunity from disease over those of Hull anti other places, where I am informed the same precaution is not taken. The only operation latterly consider- ed dangerous at the Portobello works was the emptying of the drying stove, and the packing of the white lead in barrels ; and the dust diffused in that process was kept down as much as pos- sible by the floor being maintained constantly damp. By these precautions, and by care being taken to make the workmen wash their hands and faces before leaving the works for their meals, and to administer a brisk dose of castor oil on the first appearance of any complaint of the stomach or bowels, the manufacturer succeeded in extirpating the colica pictonum en-* tirely for several years. BARYTA. 529 CNl i B, ( S5s the P»t of yery ate in ifciTS.. 5 ^ in, Pmj . ' "™ u Q® tip *,,t tuch formerly existed at Porto. performed under water or with i in a great measure, \ras imput- ■ the proprietor in the healthot' f immunity from disease over where I am informed the same works was the emptyii : tlie white lead in barrels ; and was wn as is pos* 5t „elea«?'kl*||the|W r^:*k jf the stoma the < CHAPTER XIX. OF POISONING WITH BARYTA. Baryta and its salts, the last genus of the metallic irritants which requires particular notice, are commonly arranged among earthy substances, but on account of their chemical and phy- siological properties, may be correctly considered in the pre- sent place. These poisons are worthy of notice, because they are not only very energetic, but likewise easily procured, so that they may be more extensively used, when more generally known. Section I. — Of the Chemical Tests for the preparations of Baryta. Three compounds of this substance may be mentioned, the pure earth or oxide, the muriate or hydrochlorate, and the car- bonate. The pure earth, however, is so little seen, that it is unnecessary to describe its chemical or physiological properties. The Carbonate of Baryta is met with in two states. Some- times it is native, and then commonly occurs in radiated cry- stalline masses, of different degrees of coarseness of fibre, near- ly colourless, very heavy, and effervescing with diluted muria- tic acid. It is also sold in the shops in the form of a fine pow- der of a white colour, prepared artificially by precipitating* a soluble salt of baryta with an alkaline carbonate. It is best known by its colour, insolubility in water, solubility with ef- fervescence in muriatic acid, and the properties of the resulting muriate of bartya. The Muriate , or Hydrochlorate , is the most common of the compounds of this earth, having been for some time used in medicine for scrofulous and other constitutional disorders. It is procured either by evaporating the solution of the carbonate in hydrochloric acid, or by decomposing a more common mine- ral the sulphate, by means of charcoal aided by heat, dissolving in boiling water the sulphuret so formed, and decomposing this sulphuret by hydrochloric acid. It is commonly met with in the shops irregularly crystallized L 1 in tables. It has an acrid, irritating taste, is permanent in the air, and dissolves in two parts and a half of temperate water. I he solution is distinguished from other substances by the following chemical characters. From all other metallic poisons hitherto mentioned, it is easily distinguished by means of sul- phuretted-hydrogen, which does not cause any change in bary- tic solutions. From the alkaline and magnesian salts it is dis- tinguished by the effects of the alkaline sulphates, which do not act on the former, but cause in all solutions of baryta a heavy white precipitate, which is insoluble in nitric acid. From the hydrochlorates of lime and strontia, it is to be distinguished by evaporating the solution til! it crystallizes. The crystals are known not to be hydrochlorate of lime, because they are not deliquescent. The hydrochlorate of strontia, (which resembles that of baryta in many properties, but which must be carefully distinguished as it is not poisonous,) differs in the form of the crystals, which are delicate six-sided prisms, while those of the barytic salt are four-sided tables, often truncated on two op- posite angles, sometimes on all four, — by its solubility in alco- hol, which does not take up the hydrochlorate of baryta, — and by its effect on the flame of alcohol, which it colours rose-red, while the barytic salts colour it yellow. The hydrochlorate of baryta is known from the other soluble barytic salts, by the ac- tion of nitrate of silver, which throws down a white precipitate. Vegetable and animal fluids do not decompose the solution of the hydrochlorate of baryta, except by reason of the sul- phates and carbonates which most of them contain in small quantities. But the action of its tests may be disguised, al- though the salt has not undergone decomposition. In that case the most convenient method of analysis is to add a little nitric acid, which will dissolve any carbonate of baryta that may have been formed, — to filter and then throw down the whole baryta in the form of sulphate, by means of the sulphate of soda, — and to collect the precipitate, and calcine it with charcoal for half an hour in a platinum spoon or earthen crucible, according to the quantity. A sulphuret of baryta will thus be procured, which is to be dissolved out by boiling water, and decomposed after filtration by muriatic acid. A pure solution is thus easily procured. BARYTA. 5.51 Section II. — Of the Action of the Salts of Baryta , and the Symptoms they excite in Man. The action of the Bar y tic salts on the body is energetic. Like most metallic poisons, they seem to possess a twofold ac- tion,— one local and irritating, the other remote and indicated by narcotic symptoms. This narcotic action is more decided and invariable than in the instance of any of the metallic poi- sons hitherto noticed. Such at least is the result of the expe- riments of Mr Brodie *, which have since been amply confirm- ed by Professor Orfila f and Professor Gmelin j. Orfila found that when the hydrochlorate was injected into the veins of a dog in the dose of five grains only, death ensued in six minutes, and was preceded by convulsions, at first partial, but afterwards affecting the whole body. Mr Brodie found the same effects follow in twenty minutes, when ten grains were applied to a wound in the back of a rabbit, — the convulsions being preceded by palsy, and ending in coma. Half an ounce when injected into the stomach excited the same symptoms in a cat, and prov- ed fatal in sixty-five minutes, though the animal vomited. Schloepfer observed, that Avhen a scruple, dissolved in two drachms of water, was injected into the windpipe of a rabbit, it fell down immediately, threw back its head, was convulsed in the fore-legs, and died in twelve minutes §. Gmelin observ- ed in his experiments that it caused slight inflammation of the stomach, and strong symptoms of an action on the brain, spine, and voluntary muscles. He found the voluntary muscles des- titute of contractility immediately after death ; yet the heart continued to contract vigorously for some time, even without the application of any stimulus. From some experiments made on horses by Huzard and Biron, by order of the Societe de Sante of Paris, it appears that the hydrochlorate, when given to these animals in the dose of two drachms daily, produced sudden death about the fifteenth day, without previous symptoms of any consequence |j. In the experiments now related, very little appearance of inflammation was found in the parts to which the poison was directly applied. * Philosophical Transactions, 1812, p. 218. + Toxicologic Gencralc, i. 208. | Versuche iiber die Wirkungen, &c. § Diss. Inaug. de effectibus liquidorum ad vias aerif. applic. p. 30. || Nicholson’s Journal, First Series, i. 529. 532 BARYTA. The pure earth appears to produce nearly the same effects in an inferior dose. When swallowed, the symptoms of local irritation are more violent; but death ensues in a very short space of time, and is preceded by convulsions and insensibility. The stomach after death is found of a reddish black colour, and frequently with spots of extravasated blood in its villous coat. The carbonate in a state of minute division is scarcely less active than the hydrochlorate, since it is dissolved by the acid juices of the stomach. A drachm killed a dog- in six hours; vomiting-, expressions of pain, and an approach to insensibility preceded death; and marks of inflammation were found in the stomach * * * §. Pelletier made many experiments on the poisonous properties of the carbonate. Fifteen grains of the native car- bonate killed one dog in eight hours, and another in fifteen f. Dr Campbell found it to be a dangerous poison, even when ap- plied externally. Twelve grains introduced into a wound in the neck of a cat, excited on the third day languor, slow res- piration and feeble pulse ; towards evening the animal became affected with convulsions of the hind-legs and with dilated pu- pils; and death followed not long afterwards f. This sub- stance, before its real nature was known, used at one time to be employed in some parts of England as a variety of arsenic for poisoning rats. The symptoms produced by the salts of baryta in man have seldom been particularly described. An instance is shortly noticed in the Journal of Science, where an ounce of the hydro- chlorate was taken by mistake for Glauber’s salt, and proved fatal. The patient immediately after swallowing it. felt a sense of burning in the stomach; vomiting, convulsions, headach, and deafness ensued ; and death took place within an hour §. Dr Wilson of London has lately described a distinct case of poisoning with the carbonate. The quantity taken was half a tea-cupful ; but emetics were given, and operated before any symptoms showed themselves. In two hours the patient com- plained of dimness of sight, double vision, headach, tinnitus, * Orjila, Toxicol. Gen. i. 213. + Observations sur la Strontiane. Ann. de Chimie, xxi. 119. t Diss. Inaug. de venenis Mineralibus, p. 31. § Journal of Science, iv. 382. ,,se‘l5e i* lisle®9 \letl p- ■ • ui)S«,,rl 0f (lie Iff 6 itakesixk gening of a it acci(lent one evening ur • profuse p®#11® , anbour after i edabouthrentf-toir b( lave known violent n in like manner by a qua) diciual doses. Jfr/W lion communicated toliii cashire, where the carbf animals on his estate di( the carbonate, and that and her child, i without experiencing Section I ^'° necount has yi occur in ^ usually fr ■nents hall | and lln and its r baryta. .533 '”»«« ti j ! e j . ‘"“H ’'*»mti«n loin t ■'■ Fiit,., '''Nlllit ' ?ailh ‘“tfoduced mto a wound 1 on the third day languor, slow r ; towards evening the animal beca of the hind-legs and with dilated ] 1 not long afterwards 1. This a iture was known, used at one time *ts of England as a varietr of arse 4 hv the salts of baryta in man b( ; described. A. «*» » ** U , lately teasel was 1 mate ivetf b *» $• Ip flS» > &L. p.3>' ssi. 115. and a sense of distension in the stomach, and subsequently of pains in the knees and cramps of the legs, with occasional vo- miting and purging next day ; for some days afterwards the head symptoms continued, though more mildly, and she was much subject to severe palpitations; but she was in the way of recovery when the account of her case was published *. Unpleasant effects have been observed from too large doses of the muriate administered medicinally. A case is mentioned in the Medical Commentaries of a gentleman who was directed to take sixteen drops of a solution as a stomachic, but swallowed one evening by accident seventy or eighty drops. He had soon after profuse purging without tormina, then vomiting, and half an hour after swallowing the salt excessive muscular debility, amounting to absolute paraplegia of the limbs. This state last- ed about twenty-four hours, and then gradually went off-f. I have known violent vomiting, gripes, and diarrhoea produced in like manner by a quantity not much exceeding the usual me- dicinal doses. Mr Parkes mentions that, according to informa- tion communicated to him by the proprietor of an estate in Lan - cashire, where the carbonate of baryta abounds, many domestic animals on his estate died in consequence of licking the dust of the carbonate, and that it once proved fatal to two persons, a woman and her child, who took each about a drachm J. Dr Johnstone says he once swallowed ten grains of this compound, without experiencing any bad effect §. Section III. — Of the Morbid Appearances caused by the Salts of Baryta. No account has yet been published of the morbid appearances as they occur in man. In animals the mucous membrane of the stomach is usually found of a deep-red colour, unless death take place with great rapidity, in which case the alimentary canal is healthy. In all the animals, which in Dr Campbell’s experi- ments were killed by the application of the muriate to wounds, the brain and its membranes were much injected with blood; and in one of them the appearances were precisely those of con- gestive apoplexy. * London Medical Gazette, xiv. 487. -|- Medical Commentaries, xix. 267. ■£ Parkes’s Chemical Essays, ii. 219. § Essay on Poisons, p. 145. 534 RAltYTA. Section IV. — Of the Treatment. The treatment of this variety of poisoning consists chiefly in the speedy administration of some alkaline or earthy sulphate, such as the sulphate of soda or sulphate of magnesia. The poi- son is thus immediately converted into the insoluble sulphate of baryta, which is quite inert. Orfila has related a very interest- ing experiment by which the virtue of the sulphates as antidotes is completely established. Two drachms of muriate of baryta were injected into the stomach of a dog, and in eight minutes two drachms of sulphate of soda were also introduced. The gullet was then secured by a ligature. At first efforts were made to vomit, and in an hour sulphate of baryta was discharged with the alvine evacuations. There was neither insensibility nor convulsions ; and next morning the animal evidently suffer- ed only from the ligature on the gullet. This fact not only proves the efficacy of the sulphate, but likewise shows that in the kinds of poisoning where diarrhoea occurs, the poison is very soon discharged, and ought therefore to be looked for in the evacuations from the bowels *. A few observations will be here required on the effects of the salts of Strontia on the animal frame. These compounds bear a close resemblance to the salts of baryta, and the two earths were consequently long confounded together till Dr Hope point- ed out the difference between them. One of the most striking differences is, that the salts of Strontia are very feebly poison- ous. Some experiments of this purport were made by M. Pel- letier of Paris f, and by Blumenhach ; but the most accurate re- searches are those more lately conducted by Professor Gmelin. He found that ten grains of the muriate in solution had no ef- fect when injected into the jugular vein of a dog, — that two drachms had no effect when introduced into the stomach of a rabbit, — that half an ounce was required to cause death in that way, — that two drachms of the carbonate had no effect, — and that two drachms of the nitrate, dissolved in six parts of water and given to a rabbit, merely caused increase of the frequency and hardness of the pulse and a brisk diarrhoea %. * Toxicologie Generate, i. 21G. -f- Observations sur la Strontiane, Annales do Chimic, xxi. 119. | Versuche iiber die Wirkungen, &c. 4° pj jr* rj'jjg oide r. 10 .j poison*’ nil fa®1 e“ n J |lifoUf, oth®' ,131)15 kaseC°n sono® poii $ fro® fislie' isono«s by lisra* or ptitre CHAPl OF WITH T The Vegetable Acrids are t this Order. They will not r seldom resorted to for criminal m, their symptoms, and theii the same in all. he are chiefly indebted to ledge of their MotkofMoii. sets of experiments. In the fi sou in various doses into the si ®"aalSMnd|s|,^ be«>usedinn i dt,1‘ ""sli,,."0'-'*®1'1'! t; Wr c ’Sk at ti 78, j, ‘f«fw *N. 'Ain, Hu- 'ki. V«C'‘K> >0()a ■^tS There ' . ,Was ^W, ne«hetksn[; was uTOcea occurs,!- therefore to I 1 he looked for in t(ie here required on tie elects of tlie frame, These compounds hear ts of baryta, and the two earths iuded together till Dr % point- t them. One of the most striking f Strontia are ver; his purport were madebrlW* r-siu-* Wit** • **ll «•<»'* sispart? ftheW *£*?■ lab*1 loency VEGETABLE ACKIDS. .535 The Fourth order ot the Irritant Poisons contains a great number of genera derived from the vegetable kingdom, and formerly arranged in a class by themselves under the title of Acrid Poisons. The order includes many plants of the natu- ral families Ranunculacea Cucurbitaceop. , and Euphorbiacece, and other plants scattered throughout the botanical system. It likewise comprehends a second groupe consisting of some acrid poisons from the animal kingdom, namely, Cantharides, Poi- sonous Fishes, Poisonous Serpents, and animal matters become poisonous by Disease or Putrefaction. CHAPTER OF POISONING WITH THE VEGETABLE ACRID, S. The Vegetable Acrids are the most characteristic poisons of this Order. They will not require many details, as they are seldom resorted to for criminal purposes, and their mode of ac- tion, their symptoms, and their morbid appearances are nearly the same in all. We are chieHy indebted to Professor Orfila for our know- ledge of their Mode of Action. He has subjected them to two sets of experiments. In the first place, he introduced the poi- son in various doses into the stomach, sometimes tying the gul- let, sometimes not : and, secondly, he applied the poison to the subcutaneous cellular tissue by thrusting it into a recent wound. In the former way lie found that, unless the gullet was tied, the animal soon discharged the poison by vomiting and gene- rally recovered; hut that, if the gullet was tied, death might be caused in no long time by moderate doses. The symptoms were seldom remarkable. Commonly efforts were made to vo- mit; frequently diarrhoea followed ; then languor and listless- ness ; sometimes, though not always, expressions of pain ; very rarely convulsions; and death generally took place during the first day, often within three, six, or eight hours. The appear- ances in the dead body were redness over the whole mucous coat of the stomach, at times remarkably vivid, often barely 536 VEGETABLE ACRIDS. pc rceptible, and occasionally attended with ulcers; very often a similar state of the whole intestines, more especially of the rectum ; and in some instances a slight increase of density, with diminished crepitation, in patches of the lungs. When the poison, on the other hand, was applied to a recent wound of the leg, the animal commonly whined more or less; great languor soon followed ; and death took place on the first or second day, without convulsions or any other symptom of note. It was rarely that any morbid appearance could then be discovered in the bowels. But in every instance active inflam- mation was found in the wound, extending to the limb above it and even upwards on the trunk. Every part affected was gorged with blood and serum ; and an eschar was never form- ed. The appearances in short were precisely those of Diffuse Inflammation of the cellular tissue, when it proves fatal in its early stage *. Since these poisons do not appear to act more energetically through a wound than through the stomach, it has been gene- rally inferred that they do not enter the blood, and consequent- ly that the local impression they produce is conveyed to distant organs through the nerves. This inference is correct in regard to such species of the vegetable acrids as act in small doses. But the validity of the conclusion may be questioned when the poison acts only in large doses, as is the case with many of the poisons now under consideration. For they cannot be applied to a wound over a surface equal to that of the stomach, and may therefore be more slowly absorbed in the former than in the latter situation. And, in point of fact, a few plants of the pre- sent order have been found to act through the medium of ab- sorption, as soon as chemistry discovered their active princi- ples, and thus enabled the physiologist to get rid of fallacy by using the poison in small doses. This principle has been proved to be in some plants a peculiar resin, in others a peculiar fecula or extractive matter, in others an oil, in others an alkaloid, and in others a neutral crystalline matter. But in all there exists some principle or other in which are concentrated the poison- ous properties of the plant. Some of these principles appear to act through the medium of the blood. There is no doubt, howrever, but many plants of the present * Toxicol. Gen, i. passim. VEGETABLE ACE IDS. ,537 N, H d r«oi Hut m« SJ%0( >'ervi| 1 active ‘MsaOBto «n «l ,. I.S" eprsCi)4 It I lr to act more energetically stomach, it has been gene- I tta Wood, and consequent- I >duce is conveyed to distant terence is correct in regard rids as act in small doses, I lay be questioned iviiefl the I the case with many of the j :or they caimot be applied I lat of tbe stomach, and may J order, as well as their active principles, have a totally different and very peculiar action. They produce violent spreading in- Hamniation of the subcutaneous cellular tissue, and acute inflam- mation of the stomach and intestines without entering the blood ; and death is the consequence of a sympathy of remote organs with the parts directly injured. As to their forming a natural order of poisons, it is evident, that if a general view be taken of their properties, they are dis- tinguished by obvious phenomena from the three orders hither- to noticed. But if their effects on man be alone taken into ac- count, when of course their influence on the external surface of the body must be left out of view, nothing will be discovered to distinguish them from several of the metallic irritants. The Symptoms occasioned in man by the irritant poisons of the vegetable kingdom, are chiefly those indicating inflammation of the villous coat of the stomach and intestines. When taken in large doses, they excite vomiting soon after they are swal- lowed ; by which means the patient’s life is often saved. But sometimes, like the mineral poisons that possess emetic proper- ties, the vegetable acrids present a singular uncertainty in this respect: They may be retained without much inconvenience for some length of time. If this should happen, or if the dose be less, in which case vomiting may not be produced at all, or if only part of a large dose be discharged at an early period by vomiting, — the other phenomena they give rise to are sometimes fully developed. The most conspicuous symptom then is diar- rhoea, more or less profuse. The diarrhoea and vomiting are commonly attended by twisting pain of the belly, at first remit- tent, but becoming gradually more constant, as the inflamma- tion is more and more strongly marked. Tension, fulness and tenderness of the belly, are then not unfrequent. The stools may assume all the characters of the discharges in natural in- flammation of the intestinal mucous membrane ; but an addi- tional character worthy of notice is the appearance of fragments of leaves or flowers belonging to the plant which has been swal- lowed. At the same time there is generally excessive weak- ness. Sometimes, too, giddiness and a tendency to delirium have been observed. But the latter symptoms are rare : If they oc- 538 VEGETABLE ACRIDS. curred frequently, it would be necessary to transfer any poison which produced them to the class of narcotico-acrids.
| 14,305 |
https://github.com/CodeBrauer/gabGallery/blob/master/assets/sass/main.scss
|
Github Open Source
|
Open Source
|
MIT
| null |
gabGallery
|
CodeBrauer
|
SCSS
|
Code
| 79 | 262 |
/* Colors */
// http://coolors.co/app/fafafa-a9e190-8fc93a-1eecfc-1e64cd
$white: #fafafa;
$lightgreen: #a9e190;
$green: #8fc93a;
$lightblue: #1eecfc;
$blue: #1e64cd;
/* Resets, Layout */
body {
margin: 0;
padding: 0;
}
/* Helpers */
.bg--white { background: $white; }
.bg--lightgreen { background: $lightgreen; }
.bg--green { background: $green; }
.bg--lightblue { background: $lightblue; }
.bg--blue { background: $blue; }
.color--white { color: $white; }
.color--lightgreen { color: $lightgreen; }
.color--green { color: $green; }
.color--lightblue { color: $lightblue; }
.color--blue { color: $blue; }
| 276 |
alumnioxoniensi00fostgoog_53
|
English-PD
|
Open Culture
|
Public Domain
| 1,891 |
Alumni oxonienses; the members of the University of Oxford, 1500-1714; their parentage, birthplace, and year of birth, with a record of their degrees
|
University of Oxford | Foster, Joseph, 1844-1905, [from old catalog] ed
|
English
|
Spoken
| 7,514 | 16,005 |
Wrennall, Richard, B.A. from Oxford Hall 6 Nov., 1610, M.A. 17 June, 1619; rector of Rushbury 1616, and of Easthope, (both) Salop, 1634. See Foster's Index. Wrenne, (Sir) Charles, of co. Durham, gen. 16. Brasenose Coll., matria entry under date in Dec., 1580, aged 26; student of Gray's Inn 1884, as of Binchester, co. Durham, gent.; knighted 18 May, 1607; his will dated 9 March, 1630-2, proved same year. See Foster's Grays Inn Reg. [B] Wrenn, Charles, created M.A. 3 Aug., 1660; incorporated at Cambridge 1663, and LL.D. for Literas Regias 14 Jan., 1663; of Feltwell, Norfolk, and of Ely (son of Matthew, bishop of Ely), died 1681; brother of Matthew, Thomas and William. Wrenn, Christopher, of London, pleb. St. John's Coll., matric. 14 Oct., 1608, aged 17, B.A. 36 June, 1609, M.A 37 April, 1613, proctor 1619, B.D. 31 June, 1630, licensed to preach 38 June, 1630; incorporated at Cambridge 1630; (s. of Francis, of London, mercer), born 17 Sept, 1589; domestic chaplain to bishop Andrews, and also to the royal family, rector of Fonthill Bishop 1630, and of East Knoyle, (both) Wilts, 16 33. dean of Windsor, and registrar of the order of the garter 163, dean of collegiate church of Wolverhampton, and rector of Haseley, Oxon. Z639; died at Bletchington, Oxon, 39 May, 1658; brother of Matthew 1605, and father of the next. See Robinson, i. 44 ; Lansdowne MS, 985, f. 340 ; & Foster's Index Eccl. Wren. (Sir Christopher; B. A. from Wadhau Colu 18 March, 1650-1, M.A 14 Dec., 1653 ; fellow All Souls' Coll. Nov., 1653, D.C.L. 13 Sept., 1661 ; incorporated at Cambidge 1664, professor of astronomy at Grcsham college 1657-61, Savilian professor of astronomy 1661-73, an admirable architect, and a profound mathematician ; born at East Knoyle 30 Oct., 1633; a member of Lincoln's Inn 1676 (s. Christopher last-named), surveyor-general for rebuilding St. Paul's, the parochial churches, and all other public buildings of the city after the great fire of London 1666 ; surveyor-general of all the royal works 1660-1719. Charles II, and George I.; surveyor-general for the repairs of the collegiate church of St. Peter's, Westminster, 1676-7, Windsor 1689, till unseated 30 May, 1673, president of the royal society 1680, M. P. Plympton 1685-7, Windsor 1689, till unseated 3 May, re-elected 1690, again unseated 27 May, M.P. Weymouth and Melcombe Regis 170Z-3 ; died 35 Feb., 1733-3, aged 91, buried in St. Paul's cathedral in March. S. Jiawi. ii. 167 ; Burrows, 476, 563 ; & Foster's Inn of Court Reg. Wren, Geoffrey, M. A. supd. 14 Jan., 15x0-11, clerk of the closet, and chaplain or confessor to Henry VIII., and to Henry VIII.; master of Sherborne hospital, CO. Durham; rector of Loughborough, CO. Leicester, and of Hanslope, Bucks, 15x1, canon of York 15x5-37; rector of St. Margaret, New Fish Street, London, 15x3; died 5 April, 1537. See Foster's Index Eccl. ft Genealogist, v, 330. Wren, George, s. John, of Canterbury, pleb. Magdalen Coll., matric. 1663, aged 15; demy 1663-8. B.A. 1667; M.A. from Jesus Coll., Cambridge. 1675; vicar of Bobbing 1668, and of Chalk 1669, and of Hoo St. Warburgh. (all) Kent. See Bloxam, v. 360; & Foster's Index Eccl. Wren, Joseph, s. Tha, of Bideford, Devon, pleb. St. Mary Hall, matric. 13 Aug., 1668, aged 16. A.B. 1673; rector of Croscombe 1677, and vicar d. Somerton, (both) Somerset, 1696. See Foster's Index Eccl. Wrenne, Martin, Cisterdan, B.D. supd. iz June. 1536. Wren, Matthew; B.A. from Peabkoke Hall, Cambridge, 1604-5, fellow, 1605, M.A. 1608; (formerly) incorporated 13 July, 1608, president of his college x6i6, vice-chancellor 1638, and master of Peter House, Cambridge, 1635, (s. of Francis, of London, merchant) born there 33 Dec., 1685; chaplain to Prince Charles and bishop Andrews, rector of Taverstown CO. Cambridge. x6x5, and of Bingham. Notts, 1624. canon of Winchester X633, and of Westminster X635, dean of the collegiate church of Wolverhampton 1638, bishop of Hereford 1634-5, and of Norwich X635, bishop of 1638, imprisoned in the Tower nearly 16 years, restored 1660; died 34 April, 1767; brother of Christopher 1608, and father of the three next, and of Charles x66a See Lansdaume MS. 986, f. 98; Robison, L 36; ft Foster's Index Eccl. Wren, Matthew; created M.A 9 Sept., 1666 (son of Matthew last-named), educated at Cambridge, secretary to the Earl of Clarendon, and to James, Duke of York, P.R.S., M.P. St. Michael x66x. until his death 14 June, 1673. See Fasti, ii. 253; & Foster's Parliamentary Dictuntary. Wren, Thomas, created D.Med. 3 Aug., 1660, incorporated at Cambridge 1660 (as. Matthew, bishop of Ely), F.R.S., sinecure rector of Littlebourne, Essex. 1660, rector of Northwold, Norfolk, x66x. and U. Willingham, co. Cambridge (as LL.D.). 1666, canon x663, and archdeacon of Ely (as LL.D.). 1663, canon of Southwell X664-79. See Fasti, ii. 234; & Foster's Index Eccl. JLh. Wren. (Sir) William, created M.A 3 Aug., 1660; of Wilberton, co. Cambridge (4th son of Matthew, bishop of Ely), knighted at Feb., 1684-5. MP. Cambridge. X685-7; admitted to the Middle Temple, Nov., 1689, and buried in the Temple church, following; brother of Charles 1660, etc. See Foster's Parliamentary Dictionary, Ward's Gresham Professors, 95; & Foster's Inn, of Court Reg. William, s. Tho., of Cardiff, co. Glasgow. p. p. Jesus Coll. matric. 14 July, 167X. aged 18: rector of Michaelstone-le-Pit, co. Glamozgan. x68i. See Foster's Index Eccl. Wrenholm, Edward, "ser." jESUS Coll., matric xc March, 1666-7; vicar of Caerleon x66x. rector of Lunathock-juxta-Usk 1663, and of Panteague, (alli ca Monmouth, X67X. See Foster's Index Eccl. Wrenholm, Elias; subscribed 10 Nov., x6ai; R A from Corpus Christi Coll. X5 Feb., x6a4-5. MA. 13 March, X637-8, fellow X630-48, B.D. 6 July. 1037; rector of Rudford, co. Gloucester, 1641, and of Trent, Somerset, 1644, until sequestered in X646 by the Westminster assembly; perhaps brother of Henry, John X634, and Simon. See Burrows, 496 1 Add. MS. X5,670, p. 199 : & Foster's Index Eccl. Wrenoll, Henry, s. Elias, of Gloucester (city), sacerd Corpus Christi Coll., matric 24 Feb., 1631-2. aged X9, B.A. 9 May, 1633 ; perhaps brother of ^as, etc. [ao^ Wrench, James; B.A. from Hart Hall 5 July. Z599: M.A. from Magdalen Coll. 8 July. 1653. rector of Bramber-with-Botolph, Sussex, X609. Ser Foster's Index Eccl. Wrenohe, John ; B.A. from New Coll. xx Feb. 1633-4, M.A. 30 April, X638 ; this or the next rector of Warmingham, Cheshire, 1646. See Foster's Index Eccl. John Wrench. 1500— 1714. Francis Wright. Wrenoh, John, s. Ellas," of Gloucester (city), sacerd. Corpus Christi Coll., matric. 28 April, 1634, aged 18, B.A. 3 Dec, 1635, M.A. 23 Feb., 1638-9; perhaps brother of Elias, Henry, and Simon. Wrenoll, Oliver, s. Henry, of Oxford (city), pleb.; privilegegiatus 20 Sept., x666. aged 24. Wrenoll, Richard; B. A 9 May, 1524, M.A. 2 April, 1530; "a poor schoolmaster"; perhaps of Gray's Inn 1534. See Foster's Gray's Inn Reg. Wrench, Simon, born in Gloucester, s. Elias, of Dedham, Essex, sacerd. Corpus Christi Coll., matric. 28 Nov., 1623. aged 15, B.A. 2 Dec., 1627, M.A. 5 July, 1630; vicar of Llangammarch, co. Brecon, 1631; perhaps brother of Elias, Henry, and John 1634. See Foster's Index Reel. Wrenoll, Thomas, s. John, of Oxford, pleb.; privilegegiatus 6 July, 1638, aged 30, "Hortulanus Coll. Exon. 15] Wrenford, John, of co. Worcester, pleb. Broad-gates Hall, matric. 19 Oct., 1599, aged 18; B.A. from Christ Church 31 Oct., 1604; student of Middle Temple 1604, as son and heir of John, of Longdon, co. Worcester, gent. See Foster's Inns of Court Reg. Wrenford, William; B.A. 15 Dec, 1511. Wrentmore, Benjamin, s. Robert, of Canterbury, gent. Merton Coll., matric. 2 July, 1684, aged 16, B.A. 1688, M.A. 1692; rector of Swaffield 1692, and vicar of Tunsted, (both) Norfolk, 1793, and rector of Ackworth. Yorks, 1795. See lister's Index Eccl. Wrentmore, John, s. Robert, of Canterbury, gent. Merton Coll., matric. 26 May, 1789, aged 25. Wrey, (Sir) Bouchier (subscribes "bart."), s. Bouchier, bart. Christ Church, matric. 2 July, 1789, aged 5. Wrey, (Sir) Bouchier (Feb.) 1792-1794; died Nov., 1796; brother of Chichester. See Foster's Parliamentary Dictionary. Wrey, Chichester, s. Bouchier, of Tavistock, Devon, bart. Christ Church, matric. 2 March, 1799-1794, aged 17; B.A. from Trinity Coll. 1707, M.A. 1792; re. Clerk of Tawstock, Devon, Z7Z0, brother of Bourchier. See Foster's Index Eccl, [11] Wrey, John, of Devon, gent. Hart Hall matric. Enoy under date 1567, aged 23; perhaps of North Russell, Devon, son and heir of John. Wriggle, Robert, s. John, of Frodsham, Cheshire, p.p. Brasenose Coll., matric. 29 March, Z667, aged 25. Wriggle, Edward, s. William, of Marcham, CO. Warwick (? Berks), pleb. Magdalen Hall, matric. 31 Oct., Z623, aged 20. Wriggelsworth, Edward, s. Edmond, of Oxford (city), pleb. St. John's Coll., matric. 12 July, 1661, aged 25, B.A. Z665, M.A. 1669, B. and D. Med. Z679; born in St. Mary Magdalen parish, London, 3rd Oct., 1665 (his father a mercer), admitted to Merchant Taylors' school Z657, died 30 Sept., 1701, buried in St. Giles, Oxford. See Ranson, i. 236. Wriggelsworth, Joseph, s. Edward, of Marcham, Berks, gent St. John's Coll., matric. 14 July, 1665, aged 16. Wriggelsworth, Richard, demy Magdalen Coll. 1696-1602, B.A. 10 July, 1600, M.A. 3 July, 1606; rector of Turweston, Bucks, 1610. See Bloxam, iv. 240; & Foster's Index Eccl. Wriggelsworth, William, demy Magdalen Coll. 1548 from Berks, aged 26, B.A. 24 July, 1551; rector of Hawkridge, Somerset. 556. See Bloxam, iv. 234; & Foster's Index Eccl. Wright, Abraham, s. Richard, of London, gent. St. John's Coll., matric. 13 Nov., Merchant Taylors' school X626; vicar of Oakham, Rutland, Z645, refused to be inducted until 1660, minister of St. Olave, Silver Street, London, x 655-9, died 9 May, 1690, buried in Oakham church. See Ath, iv. 275; Robinson t i. iz6; & Foster's Index Eccl. Wrighlit, Abraham, pleb. Wadham Coll., matric. 20 Feb., 1648-9, scholar by the visitors 1648, B.A. 24 Feb., 1651-2. See Burrows, 563; & Gardiner, 174, Wrighlit, Antony. R A from LINCOLN COLL. 26 March, 1556. M.A. 28 May, 1656; rector of Hunton, Kent. 1575. See Foster's Index Eccl. Wright, Antony, s. John, of Doncaster, Yorks, pleb. Lincoln Coll., matric. 7 Dec., 1632, aged 28. Wright, Antony, arm. Lincoln Coll., matric. 20 June, 1634, aged 28, B.A. 20 June, 1634, M.A. 26 April, 1637, created B.D. 2 or 2 Nov., 1642. Wright, Barnard, of Oxford, "chirurgus per domum congregationis"; privilegiatus 3 July, 1628, aged 29; admitted to practice surgery 30 June, 1628; will at Oxford proved 5 Aug., 1628. Wright, Bernard, s. B., of Basingstoke, Hants, pleb. Balliol Coll., matric. 27 Oct., 1682, aged 26. Wright, Calvert, born in Bucks, o.s. Robert, bishop of Coventry and Lichfield. Wadham Coll., matric. entry 2 Dec., 1634, aged 24, B.A. 15 Feb., 1636-7; student of Middle Temple 1639; dissipated his paternal estate of Newnham Courtney, Oxon, and died in king's bench prison 1668. See Ath. iv. 8°Z; & Foster's Inn, Court Reg. [26] Wright, Charles, s. Joh., of Worcester (city), cler. Magdalen Hall, matric. 30 March, 1628, aged 18, B.A. 1629; this or the next man vicar of Granby, Notts, 1704. rector of Knipton, CO. Leicester, 1725, and of Kilvington, Notts, 1728, on The presentation of the Duke of Rutland. See Foster's Index Eccl, Wright, Charles, s. Edm., of London, gent. Merton Coll., matric. 24 July, Z69Z, aged 29, B.A. 1695, M.A. 1796. Wright, Charles, s. C, of Leighton, Cheshire, pleb. Brasenose Coix., matric. 16 March, 1705-6, aged 18, B.A. 1709; died 24 Aug., 1710, buried in the college chapel. See GuicA, i. 380. Wright, Christopher, of Notts, arm. Magdalen Coll., matric. 26 June, 1702, aged 28, B.A. (7) Feb., 1602-22; student of Inner Temple 2008, as of Snelstone, co. Derby, gent.; brother of Lawrence same date. [O] Wright, Daniel, s. Edward, of Sutton, co. Leicester, gent. Magdalen Hall, matric. 13 May, 1742, aged 27. Wright, Edmund, B.A. 28 March, 1752. Wright, Edmund, created M. A. from Christ Church 17 Dec., 1663; perhaps student of Lincoln's Inn 1663, as of London, esq. See Foster's Inn of Court Reg. Wright, Edward, of Northants, pleb. Magdalen Hall, matric. 13 Jan., 1687-8, aged 28, B.A. 16 April, 1691, M.A. 4 July, 1692. Wright, Edward, of co. Leicester, gent. Magdalen Hall, matric. 1 March, 1694-5, aged 28, B.A. supd. 30 June, 1606. See OH.S, xii. 267. Wright, Edward, s. Edw., of Cheltenham, co. Gloucester, gent. Trinity Coll., matric. entry 1 Dec, 1602, aged 24, B.A. 1684, M.A. 1787, B.Med. 7 March, 1692-3, D.Med. 1699; one of these names F.R.S., died at Kersie in Scotland 20 Aug., 1792. Wright, Francis, of Balliol Coll., matric. 28 June, 1608-9, aged 16, B.A. IX Dec, 1603; perhaps vicar of Wellington, Salop, 1602. See Foster's Inn. Wright, Francis, born in Bucks, s. Ricbaitl. of Ever- oon, Northampton, sacerci Meston Coll., rnatric. 31 Jan., 1628-9. B.A. 30 April, 1630, fellow 1630, M.A. XI Nov., 1634; perhaps vicar of Cocking, Sussex, 1656. See Foster's Indx Eccl. Wright. (Sir) George, of London, pleb. fil. St. John's Coll., matric la July, 1588, aged 16, B.A. supd. 13 April, 1629; of Richmond, Surrey (s. Thomas, of Debham, Kent), knighted 4 July, 1604, M.P. Newton-in-Makerfield x63x-3; perhaps father of Thomas z6ax. See Robinson, L 23; & O,H,S. xii. 174. Wright. Henry, B.A. from Emanuel Coll., Cambridge, x6i3-i^, M.A 16x6; incorporated 9 July, 1632; vicar of St. John's-in-Bedford, co. Worcester, 1636. See Foster's Gradual Cantab. Wright, Henry, doctor, Balliol Coll., matric. 9 Dec., 1653, B.A. 90 March, 1656; of Dickson, Essex (son of Laurence, D. Med.), knighted by Cromwell 1658, created a baronet 11 June, 1660, M.P. Harwich 1660 and 1661, until his death 5 Feb., 1663-4; father of Henry 1678. See Foster's Parliamentary Dictionary. Wright, Henry, fellow Queen's Coll., Cambridge, S.A. 1660-1, M.A. 1664; incorporated 13 July, 1669; perhaps rector of Long Addingham, Yorks, x68o. See Foster's Index Eccl. Wright, (Sir) Henry ("bart."). s. Sir H., of London. Lincoln Coll., matric. 15 Nov., 1678, aged 16; and baronet, died in x68i. Wright, Henry, s. Th., of Widnes, co. Lancaster, gent Braskonsb Colu, matric. a July, 1680, aged 16. Wright, Henry, s. George, of Paddington, Middlesex, gent Christ Church, matric. 15 July. 1687, aged 80, B.A. 1694; perhaps rector of Up Waltham 1706-18, and of Burton, (both) Sussex, X7X3-X8. See Al. West, ao8; & Foster's Index Eccl. Wright, Henry, s. Sam., of Oxford (city), p.p. New Coll., matric. ax March, x697>8, aged 15; B.A. from University Coll. 1703; incorporated at Cambridge 171 x, and M.A from Corpus Christi Coll., Cambridge, 171 1; perhaps rector of Leathley, Yorkshire, x707-xx, or of Asfordby co. Leicester, 1733-4. See Foster's Index Eccl. [10] Wright, Immanuel, s. Richard, of Weston Faben, is Torthants, pleb. LINCOLN Coll., matric. 37 June, x6a3, aged 19, B.A. i Feb., 16a6-7. Wright, Isaac, pleb. Wadham Coll., matric. la May, 1654-5, B.A. 39 Jan., 1654-5, M.A. xi June, X657; incorporated at Cambridge 1658; rector of St. Peter Westont in Lewes, Sussex, 1670, licensed Sept., 1670, to marry Elizabeth, daughter of Lichard Holman, of Twickenham, Middlesex; rector of Poynings, Sussex, 1673, vicar of Waltham- stow, Essex, 1669, and canon of Lincoln 1684-9. See Foster's Index Eccl. Wright, James, s. John, of Billinge, co. Lancaster, pleb. Lincoln Coll., matric. entry a March, 1665-6, aged 14, R.A. 1669; M.A. from Magdalen Coll., Cambridge, 1673; s. account of his father in Calamy, ii. 353. Wright, James, "Bibliopola," s. Mich., of Marston; privilegiatus ao Sept., 1666, aged as. Wright, Jerome, of Cheshire, pleb. Brassnose Coll., matric. xx Oct., 1583, aged 15, B.A. 15 Feb., 165867, M.A. 9 July, 1691, B.D. 14 April, 1660, licensed to prutoi xa July, 1663; rector of North Fambridge, Essex, 1599. See Foster's Index Ecclesiasticus. [^'] Wright, John: B.Can.L. 4 Dec, 1508. Wright, John; B.A July, 1588. Wright, John; chorister Magdalen Coli. 1546, (femy X549, from co. Lincien, aged x8, fribv iSS3-7a» B.A. July, 1553. chapkun 1555. M.A. 31 June, 1557. B.D. supd. 39 Oct., 1565; rector of ordination 1580-x, and perhaps of Sudbrooke 1580-x, and of Ogham, (all) col Lincoln. 1581-93. See Boxam, iv. 136; & Foster's Index Ecclesiasticus. Wright, John; B.A. supd. Michaelmas term, 1556. Wright, John, student Christ Church 157a. B.A. xajune. 15771 M.A. 15 June, 1580; perhaps rector of Leckhampstead, Bucks, 1585, rector of Ufta Nervet 1593, and vicar of Sonning. (both) Berks. Grace of St. Mary Magdalen in the suburbs of Oxford 1604-15, and of South Stoke, Oxford, 1605-16; father of John 1602. See Foster's Index Eccl, [20] Wright, John, of Bristol (city), pleb. St. John's College, matric 8 May, 1602, aged 16. Wright, John, of Bucks, cler. St. Christ Church, matric 8 June, 1602, aged 19, B.A. 17 June, 1613. M.A. June, 1602; perhaps rector of Guildford St. Trinity 1618-a3, of Southwark St. Trinity 1618-a3, vicar of Buse Norton, Oxford. 1621-3, of Shalford, Surrey, 1633, and of Bumham, Bucks, 1603. See Foster's Index Eccl, Wright, John (Wright) ; B.A. from Exetks College, May, 1617. Wright, John, s. Richard, of Pulford, Cheshire, gest Brassenose College, matric 8 Nov., 1634, aged 16; perhaps M.A. Trinity College, Dublin, and minister of Billing, ca Lancaster, until ejected 1666, for nonconformity; died 1 Feb., 1685, aged 70; father of James 1666. See Calamy, ii. 353. Wright, John, of St. John's College, created M.A. 31 Aug., 1636. [as] Wright, John, s. Henry, Of North Meoles, co. Lancaster, sacerd. Brasenose Coll. matric 14 Dec, 1638, aged x8. Wright, John; M.A. from Merton Coll. 23 Aug., 1700; master of king's school at Worcester 1650; perhaps vicar of Church Honeyboume 1666x. and rector of Bredicot, (both) co. Worcester, 1669; father of Thomas X683. See Ath, i p. xviii; Burrows, s. Foster's Index Eccl. Wright, John, s. Edw., of Horwich, co. Derby, pleb. St. Alban Hall, matric. 10 July, 1668, aged 19. B.A. from Oriel Coll. x67a, M.A. 33 Jan., 1674-5; rector of Langford (or Longford), co. Derby, 1671. See Foster's Index Eccl. Wright, John, s. Robert, of Newdigate, Surrey, minister. Magdalen Coll., matric 96 Nov., 1690, aged 16, B.A. 1673; perhaps vicar of Stepney. Ididdlesex, 1679. See Foster's Index Eccl. Wright, John, s. J., of London, gen. Merton CoLL., matric 6 April, x68a, aged x6. RA. x686, fellow x688. M.A. 1691; of St. Andrew's. Holborn, clerk, licensed 9 Jan., X696-7, to marry Margaret, daughter of John William, bishop of Chichester; canon of St. Paul's 1697, vicar of Amberley 1697, rector of Bignor 1699, of Marston or Merston 1701, vicar of Donington x/oa. vicar of Arlington X709, and of Pevensey. (all) Sussex, 1701. canon 1669, and chancellor of Chichester 1701. until his death in 1719. See O,H,S, iv. 398; and Foster's Index Eccl. [30] Wright, John, s. Jo., of Worcester (city), der. Magdalen Hall, matric. 30 March, 1689-96. aged 17, B.A 1693. M.A 1696; rector of Gwyn Witley, CO. Worcester, 1701. See Foster's Index Eccl. Wright, John, s. Phil., of Peover, Cheshire, pief. Merton Coll., matric 4 July, 1690, aged 19. [1686] John Wright. 1500—1714. Robert Wright. Right, John, s. Rog., of Lichfield, co. Stafford, gent, (subscribes "pleb."). CHRIST CHURCH, matric. 13 Oct., 1699, aged 17. John, s. J., of Burrington, co. Hereford, p.p. Brasenoss Coll., matric. 16 March, 1705-6, aged 17. John, s. William, of Oxford (city), arm. Exeter Coll., matric. 6 April, 1709, aged 26; bar.-at-law. Inner Temple, 1718; brother of Martin. See Foster's Judges and Barristers. Joseph, subscribed in July, 1613; B.A. from BRASENOS Coll. 39 Jan., 1615-16, M.A. 17 Oct., 1628, incorporated at Cambridge 1663; perhaps vicar of Buckland, Berks, 1638. See Foster's Index Reel. Joseph, of Yorks, cler. 11th University Coll., matric. 31 Oct, 1617, aged 17; B.A. from St. Edmund Hall 13 Dec, 1620, M.A. a June. 1624. [5] Right, Joshua, pleb. Wadhau Coll., matric. 22 May, 1624. Right, Lawrence, of Berks, pleb. Oriel Coll., matric 26 Feb., 1607-8, aged 17, B.A. i June, 1616. Right, Laurence, of Notts, arm. Magdalen Coll., matric. 16 June, 1602, aged 15; student of Inner Temple 1608, as of Snelstone, co. Derby, gent. See Foster's Inn of Court Reg. Right, (Sir) Martin, s. William, of Oxford (city), arm. 18th century, matric. 2 March, 1708-9, aged 16; his father matriculated from Trinity Coll. 1774; baronet at Law, Inner Temple. 1774, bencher 1773, serjeant-at-law 1773, baron of exchequer 1774, judge of king's bench 1774; judge of king's bench 1774; see Foster's Judges and Barristers; & Rawl. v. 391, xxi. 18. Right, Matthew, s. M., of Crewe, Cheshire, pleb. brasenose Coll., matric. 2 May, 1775, B.A. 22 Feb., 1778-9. Right, Nathaniel; M.A., B.A. from EMMANUEL Coll., Cambridge, 1723-4, M.A. 1737; D. Med, of Bourges in France; incorporated 30 May, 1775. 638; physician to Oliver Cromwell in Scotland. See Foster's Graduati Cantab. & Fasti, L 503. Wright, Nathaniel, s. George, of Shrewsbury, Salop, gent. New Inn Hall, matric. 2 March. Z635-6, aged 72, B.A. 22 Oct., Z639. Wright, (Sir) Nathan, of Northants, sacerd. Balliol Coll., matric. entry 2 Nov., Z638, aged 14; B.A. from Merton Coll. 28 June, 1654; of Barwell, co. Leicester, and of Caldecote, co. Leicester; (s. Ekiel, B.D., rector of Thurcaston, CO. Leicester), born there 28 Feb., 1654-4, bar-at-law 1677, recorder of Leicester 1680, serjeant-at-law Z692, knighted 7 Oct., 1696, lord keeper of the great seal 1770-5; died 4 Aug., 1772; father of the next. See Foster's Judges and Barristers. Wright, Nathan, s. Nath., of Leicester (town), arm. Brasenose Coll., matric. Z696, aged 26, B.A. Z699. M.A. Z702; student of Lincoln's Inn 1698; rector of Taplow 1770, and of Famham, (both) Bucks, 1770, canon of Norwich 1773; died 17 Aug., 1772; brother of Thomas 1770. See Foster's Index Eccl. Wright, Ralph, of CO. Derby, pleb. Magdalen Hall, matric. entry under date 22 Dec, 1576, aged 25; bar-at-law. Inner Temple, 1790, as of Shelton, CO. Derby. See Foster's Judges and Barristers. Wright, Raphe, of Cheshire, pleb. Brasenose Coll., matric. May, 1798, aged 25; rector of Stanford upon-Teame, co. Worcester, 1790; father of Thomas 1775. See Foster's Index Eccl. [16] Wright, Randall, student Christ Church 1792, B.A. 1792, pleb. Merton Coll., matric. 24 Nov., Z58Z. aged 16, perhaps B.A. 6 Feb., Z598-4, fellow z^95, M.A. 23 Oct., Z598-4, then a master at Eton college, fellow z6zz; rector of Everdon, Northants, Z6Z3. See Fo&Xss^s Index Eccl., & o.H.s. iv. 276. [ao] Wright, Richard, of Dorset, pleb. Magdalen Coll., matric. 25 Nov., z58iB, aged 20, B.A. from New Coll. k Feb., z59z-2; student of Middle Temple z^98 (as son and heir of Robert, of Stourminster >fewton, Dorset, gent.), M.P. Dorchester z 597-8, and perhaps for Queenborough (Oct.) Z605-ZZ. Siee Foster's Parliamentary Dictionary. Wright, Richard, of co. Stafford, pleb. BRASENOSB Coll., matric. 22 Feb., Z604-5, aged 28. B.A. 30 Jan., Z607-8, M.A. 26 June, z6zz; perhaps rector of Exhall z6z5, vicar of Aston Cantelow z6z6, rector of Billesley Z619, and of Atherstone, (all) co. Warwick, z62a. See Foster's Index Eccl. Wright, Richard, of co. Lancaster. Brasenose Coll., matric 3 July, z6z2, aged zy, "paup. schol."," B.A. az June, Z6Z5. Wright, Richard, of Cheshire, gent Brasenose Coll., matric 28 March, z6z2, aged z6; student of Gray's Inn Z620, as son and heir of Robert, of Nantwich, Cheshire, gent See Foster's Grays Inn Reg. Wright, Richard, a. Francis, of Wargrare, Berks, pleb. Wadham Coll., matric. za March, z6z3-4, aged 29, B.A. 20 July, z6z2; rector of Tidmarsh, Berks, Z638. See Foster's Index Eccl. [26] Wright, Richard, pleb. Merton Coll., matric. 25 fSb., z6so-z. B.A. 25 Oct. Z654, M.A. 7 July, z6z7; incorporated at Cambridge 1659; perhaps vicar of Laughton Z657, and rector of Kirkby Laythorpe St. Denis Z671, and of Pilham, (all) co. Lincoln, Z676. See Burrows, 525; & Foster's Index Eccl. Wright, Richard, pleb. Brasenose Coll., matric. 9 Dec. z6s3, B.A. 6 Feb., Z656-7; one of these names vicar of Stansted Mountfichet, Herts, Z667. See Foster's Index Eccl. Wright, Richard, arm. Brasenose Coll., subscribed 25 June, Z657, B.A. z66o, M.A. Z663, B.D. z672; rector of St. Mary-on-the-Hill, Chester, Z673. Canon of Chester Z677, rector of Malpas, Cheshire, Z683. See Foster's Index Eccl. Wright, Richard, s. R., of London, p.p. Magdalen Coll., matric. 27 June, Z677, agedaz, clerk Z679-83. B.A. z68o, M.A. Z683; usher of the college school Z683-9; a sirar of Jesus Coll., Cambridge, Z672; perhaps rector of Stalbridge, Dorset, Z69S. See Bloxam, ii. 77, iii. 224; & Foster's Index Eccl. Wright, Richard, s. Joh., of Worcester (city), clerk. MAGDALEN CoLL., matrico 20 Oct, Z695, aged 28. B.A. Z699. [»0] Wright, Robert (Wright) ; perhaps fellow Trinity Coll., Cambridge, B.A. 1570-1. M.A. Z574; incorporated 9 July, ZS77. See Foster's Graduati Cantab. & Cooper, ii. 223. Wright, Robert (Ryght) ; perhaps B. A. from Trinity Coll., Cambridge, Z574-S, M.A. Z578; incorporated 12 July, Z58Z; (as. John, of Wright's Bridge, Essex) rector of Dennington, Suffolk, z589-z624, grandfather of Nathan Z638. See Foster's Graduati Cantab. & Cooper, u. 223. [1687] Robert Wright. 1500—1714- William Wright. Wright, Robert, of Herts, pleb. Trinity Coll., matrico entry under date 11 Nov., 1574, aged 14, scholar 1574, B.A. 13 June, 1580, fellow 1581, M.A. 7 July, 1584, a D. 6 April, 1592, D.D. la July, 1597, Licenced to preach 1605; warden of Wadham Coll. April-July, 1613, rector of St. John Evangelist 1589-90. of St. Katherine, Coleman Street. London, 1591, of Woodford, Essex, 1589-1619, and of Brixton Deverell, Wilts, 1596, chaplain to Q. Elizabeth, rector of Bourton-on-the-Water, co. Gloucester, 1625, and of Hayes, Middlesex, 1601, canon residentian and treasurer of Wells 1601-33, vicar of Sonning, Berks, 1604, chaplain in ordinary to Q. Elizabeth and to James I., rector of Rattendon, Essex. 1619, bishop of Bristol 1633-33, and of Lichfield and Coventry 163s, until his death at Eccleshall Aug. or Sept. 1643; father of Calvert 1634. See AtA, iv. 800; Lansdaume MS. 985, f. 38; Fasti, i. 215; & Fosters Indx Eccl. "Wriglit, Robert, of co. Derby, pleb. Jesus Coll., matric. 27 Nov., 1581, aged 17. Wright, Robert (Wright) ; B.A. from Clare Hall, (Smbridge, 1583-3, M.A. 1586; incorporated ix July, 1586. See Foster's Graduati Cantab, Wright, Robert ; subscribed 3 June, 1614. Wright, Robert, of Berks, cler. II. Merton Coll., matric. 20 Oct., 1620, aged 18, B.A. 2 Dec., 1623, fellow 2624, until his death ; buried in the chapel 24 June, 1636. See GutcA, i. app. 207. Wright, Robert, s. Adam, of Keighley, Yorks, sacerd. University Coll., matric. 5 April, 1633, aged 18, B.A. 5 July, 1636, M.A. 4 July, 1639. Wright, Samuel : B.A. from Christ's Coll., Cambridge, 1645-6; created B.D. 13 Sept., 1626; perhaps rector of Stockton, Wilts, 1659. See Foster's Index Eccl, & Calamy, i. 410. Wright, Thomas (Wright), M.A. 17 June, 1506; perhaps vicar of Althorne, Essex; admon. at Oxford 26 Dec., 1508. Wright, Thomas, B.A. 30 Jan., 1563-3. M.A. 26 Feb., 1566-7 ; perhaps rector of Broughton Sulney, Notts, 1567-7. admon. at Oxford 8 Feb., 1573. Wright, Thomas, of co. Derby, gent. Magdalen Coll., matric. 34 Nov., 1581, aged 15; student of Inner Temple 1583, as of Sneath, co. Derby. See Foster's Inn, Court Reg., [10] Wright, Thomas (Wright); B.A from Christ Church 17 Dec., 1603, M.A. 3 July, 1606; possibly rector of Wilmslow, Cheshire, 1620, until sequestered in 1664 (s. Lawrence, of Nantwich, gent.), reinstated 1660; died 30th. buried in the chancel 33 Oct., 1666. See Earwaker, i. 91. Wright, Thomas, of co. Stafford, pleb. Brasenose (LL., matric 16 June, 1620, aged 17, B.A supd. 3 June, 1619. See O.H.S. xh. 39. Wright, Thomas, of Surrey, militis fil. nat. max. St. John's Coll., matric. 16 Nov., 1631, aged 17; student of Middle Temple 1633, as son and heir of George, of Richmond, Surrey, kt. (1588 see). See Foster's Inn, Court Re/f. Wright, Thomas, subscribed 14 March, 1633-3; perhaps B.A. from Magdalen Coll. 38 Jan., 1639-3, M.A. 3 July, 1633; and vicar of Ecclesfield, Yorks, 1638. See Foster's Index. Wright, Thomas, s. Jonas, of Raleigh, co. Warwick, pleb. Lincoln Coll., matric. 35 Nov., 1631, aged 28, B.A. 23 Nov., 1636; vicar of Bitford, co. Warwick, until 1637, when sequestered by the Westminster assembly. See Add, MS. 15,671, p. 35. Wright, Thomas, s. Raphe, of Stamford-super-Treasury, co. Worcester, sacerd. Brasenose Coll., matric. 30 Jan., 1634-5, aged 17, B.A. 37 Oct., 1638; rector of Great Witley 1662, of Wigglesford 1663, and vicar of Bretforton, (all) co. Worcester, 1664. See Foster's Irulex Eccl. Wright, Thomas, pleb. Brasenose Coll., Jan. 3 April, 1653. Wright, Thomas, fellow St. John's Coll., bridge, BA. 1674. 5, M.A. 1678 (incorporation) July, 1679. B.D. 1685; perhaps rector of Cofield, Hunts, 1677, or vicar of Wyroes, Norfolk. 1686. See FasH, iL 371; & Y^-.^ Index Eccl. Wright, Thomas, s. Edw., of Witney, Oxoo, p. HART Hall, matric xa ldarch, 1674-5. Hr^^ B.A. 1678, M.A. z68i. Wright, Thomas, s. Will, of Longstool, co. Anx, Brasenose Coll., matricate Feb. 1679-5; aged 18; student of Gray's Inn 1868. See Foster Grays Inn Reg. L* Wright, Thomas, s. John, of Hunnibom, co. G^ Osster, clerk. Magdalen Hall, matric 23 Maxell 1683-3, aged 26, B.A. z686, M.A. X689L Wright, Thomas, y.s. Nathan, of Leicester (to-a^ equitis. Brasenose Coll., matric 13 MorcX X707-8, aged 26; died 3 July, 1720, buried 10 'J-e college chapel; brother of Nathan 1696. Sa^ Guik, \, 377. Wright, Thomas, s. Ric, of Crantoo, co. Lancastr', pleb. Brasenose Coll., matric x6 April, vp^ aged 19, B.A. 1733, M.A. 30 Feb., 1717-18, B. atI D. D. 1731; rector of Christ Church, Spitaln&ds, Middlesex, 1730. See Foster's Index Book. Wright, Thomas, s. T., of Thomhall. 00. Staffer! p3eb. Hart Hall, matric xa April, 1722, a^ 19, B.A. 1715. Wright, Thomas, s. Joh., of Stepney, Biddx.. cjr-. 6r asenose Coll., matric 5 Mandi X7X3-X4. ^ri X7, BA. X717. ;a5] WriATht, Walter, BCan.L. sopd. a Dec, 15CS. cnaplain, B.C.L. 19 Feb., 1537-8, D.C.L^ Julr. IC40, governor of Durham College; office-chance-chance-place of the university 1547; rector of Licklington, Oxon. 1550, of Silverton St. Mary, Devon, 1552, and St. Breck, Cornwall, 1543, archdeacon of Oxford 1543, canon of Exeter 1554, of Sarum 1559, and of Winchester 1560; died 10 May, 1561. See Londonderry MS. 981, f. 3; & Foster's Index Book. Wright, William, BA. x6 Dec, 1531, M.A. 4 Ju!r. 1531, BD. XX June, 1537, perhaps D.D. sup. 2 Nov., 1556, and rector of Coldiester St. Leoac. Essex, 1539, canon of Lincoln 1539. See Foster's Index Book. Wright, William (Wrygth). B.Can.L. 6 June, 1510. Wright, William, B.A. x8 May, 1533. M.A. 27 May. X538, master of Balliol Coix. X545-7, and 1555 until deprived X559, for refusing to take the 0^12. of supremacy. See O.II.S. I tag. Wright, William, of Beds, pleb. Corpus Christi Coll., matric 38 Nov., 1581, aged xS. [SO] Wright, William (Wright), of Northants. pleb. Magdalen Hall, matric 9 Nov., x58a, aged 17. bar.-at-law. Inner Temple, 1595, beadier 16ta. See Foster's Judges and Barristers. Wright, William. Bal from St. Mart Hall a8 I^b., xq83-4. See O.H.S. xii. xaa. Wright, William, of Devon, minister. Broadgate Hall, matric xx Dec, 1584, aged 35. Wright, William (Wright). B.A. of Cambridge; incorporated xo July, 16x0; one of these names M A. from Clare Hall, Cambridge. x6o8. Wright, William, s. William, of Ashton-under-Lyrs. CO. Lancaster, pleb. Brasenose Coll., matric 3x Feb., 1633-4. aged 17, B.A. so Oct., 1636; perhaps student of Inner Temple X638, his father of Plowland, Yorks. See Foster's Inn of Court R^, Wright, William, s. William, of London, gent. St. John's Coix., matric. 6 July, X647, VLgcAv^', born 38 Jan., 1637, admitted to Merchant Taylors' school. X640. See Burrows, 549; & Robinson's L X46. [3i] [1688] William Wright. 1500— 1714. Giles Wroughton. Tight, William, s. William, of Oxford (city), gent. TRINITY Coix., matric. 27 Nov., 1674, aged 15, (his father M.P. Oxford 1678-81); bar.-at-law, Inner Temple, 1682, treasurer 17x9, recorder of Oxford 1688, and a justice of Wales; licensed as Aug., 1683, to marry Dorothy Dunch, of Radcott, Oxon, and again as June, 1687 (then a widower), to marry Dorothy Finch, of St. Clement Danes, Middlesex; father of John 1709, and of Martin. See Foster's Judges and Barristers & Rawl v. 251. Tyrwright, William, s. William, of Columpton, Devon, gent Wadham Coll., matric. 19 July, 1679, aged 17. "Wright, William, s. Hen., of London, gent. Brase-NOSE Coll., matric. 8 June, 1714, aged 16. "Wrightington, (Sir) Edward, of co. Lancaster, arm. fil. brasenose Coll., matric. entry 9 Feb., 1593-4. aged 13; bencher of Gray's Inn 1637 (as son and heir of John of Wrightington, co. Lancaster), "one of the council of York." M.P. St. Mawes 1631-a. See Foster's Judges and Barristers. Wrightson, Thomas, "ser." All Souls' Coll., matric. 8 Dec., 1658, B.A 1666; perhaps vicar of Egham. Surrey, 1666; licensed 16 Jan., 1662-3, to marry Elizabeth Ellis, of same, and vicar of Lamberton. Middlesex, 1662-3. See Foster's Index Reel. Wrightson, Henry, s. Henry, of Langley, co. Lancaster, arm. Brasenose Coll., matric. 19 March, 1674-5, aged 19, student of Gray's Inn 1676. See Foster's Inn Reg. Wrightson, Henry, 3rd earl of Southampton, M.A. of Cambridge 1589. incorporated 19 Aug., 1659; of Gray's Inn 1588; condemned for complicity with the earl of Essex, imprisoned in the Tower Feb., 1601, to April, 1603, pardoned by the queen, restored by parliament at July, 1603, K.G. 1603, captain of the isle of Wight, and of Carisbroke Casde 1603, P.c. 1619; died at Bergen-op-Zoom 10 Nov., 1624, buried at Titchfield, Hants. See Fastis i. 260. Wright, John, of Kent, gent Broadgates Hall, matric. 3 June, 1603, aged 15. Wrightham, John, secular chaplain, B.Can. 8 May, 1520. Wroe, Richard, s. Richard, of Heaton Yate, parish of Prestwich-cura-Odham, co. Lancaster, fellow Jesus Coll., Cambridge, 1662-9, B.A. 1661-2, M.A. 1665 (incorporated 6 May, 1669), B.D. 1672, D.D. 1686, vicar of Bowdon, Cheshire, 1674-90, fellow of collegiate church of Manchester 1675, and warden 1684, domestic chaplain to the bishop of Chester and canon 1679, vicar of Garstang, co. Lancaster, 1684-96, rector of West Kirby in Wirrall, Cheshire, 1696, until his death 6 Jan., 1727-18. See Cketham vi. N.s. 148: Fasti, ii. 310; Rawl, iii. 103, v. 159; h. Foster's Index Reel, [10] Wrote, Samuel, of London, gent Brasenosb. Coll., matric. 5 Nov., 1596, perhaps student of Gray's Inn, as Samuel Wrotte of Bungay, Suffolk. See Foster's Grays Inn Reg, Wrothe, Jerome, of Herts, arm. fil. nat. max. Gloucester Hall, matric. as June, 1604, aged 15; student of Middle Temple 1609, as as. Richard, of Standon, Herts, esq. See Foster's Inn of Court Reg, Wroth, John, of Cornwall, pleb. Exeter Coll., matric. 15 Nov., 1605, aged 80, B.A. 19 June, 1609. Wroth, John, of Cornwall, pleb. Exeter Coll., matric. 15 Nov., 1605, aged 80, B.A. 19 June, 1609. Brother, John, s. J., of Blendon Hall, Kent, hart. St. John's Coll., matric. 3 Feb., 1670-1, aged 17, 3rd bart.; died 27 June, 1722. Wroth, Peter, B.C.L. supd. 7 Dec., 1563; possibly of Gray's Inn 1580. See Foster's Gray's Inn Reg. Wrothe, Robert, of London, arm. fil. nat. (3). Queen's Coll., matric. 17 April, 1688, aged 17; student of Inner Temple 1618. as son of Thomas, a bencher. See Foster's Inn of Court Reg. Wrothe, (Sir) Thomas, of London, arm. fil. nat. max. Gloucester Hall, matrici July, 1600, aged xo ; of Petherton Park, Somerset, student of Inner Temple 1607 (is. Thomas), knighted iz Nov., 1633, M.P. Bridgwater 1628-9 circa Oct., 1645-53 (L.P.). Oct., 1656-8, nimper 1659, 1660; one of the commissioners on trial of the king, but did not act; his will proved 24 Aug., 1672. See Ath. iii. 5x4 ; & Foster's Parliamentary Dictionary, Wroth, Thomas, equitis fil. nat min. Pembroke Coll., matric. 8 Dec., 1658; of Blenden Hall, Kent ; bar.-at-law. Inner Temple, 1666. See Foster's Judges and Barristers, Wroth, William, of co. Monmouth, gent Jesus Coll., matric. ai Jan., 1585-6, subscribes "scbolaris Mri. Case." Wroth, William, of co. Monmouth, gent New Inn HALL, matric. entry 27 Nov., 1590, aged 14; B.A from Christ Church x8 Feb., 1595-6 ; M.A from Jesus Coll. 26 June, 1660 ; rector of Llanvaches x6xi, and of Llanvihangel Rogiet, (both) co. Monmouth, 1663. See Foster's Index Reel, f 20] Wroth. William ; B.A from Magdalen Hall 23 May, x6x4, M.A. 2x Feb., 1617-18; master of the free school Magdalen Coll. X648, and chaplain x657-9, to the visitors. See Bloxam, 166, and iii. X65; s Burrows, 5x9. Wrottesley, (Sir) Hugh (Wrottesley), of Co. Stafford, arm. St. John's Colu. matric X5 April, X586, aged 16; of Wrottesley, co. Stafford (s. Walter), knighted 26 Aug., 16x7; died X633. Wrottesley, Walter, s. Edw., of Shiroaks. Notts, gent Wadham Coll., matric. 19 March, 1674-5, aged 80. Wrottesley, (Sir) Walter, s. Walter, of Wrottesley, co. Stafford, bart. Magdalen Hall, matric. x8 March, x5-6, aged 27; 3rd bart., of Wrottesley, licensed 27 June. X678, to marry Eleonora, daughter of Sir John Archer, of Coopersale, Essex; died 17x2. See Foster's Peerage. Wrottesley, Charles, s. C, of Lambeth, gent. Merton Coll., matricate a Jan., x67i-a, aged X7, B.A. X675, fellow X676, M.A. X679; rector of Codford St. Peter, Wilts, x68x-X730, canon of Sanun X707-29; father of the next and of William 1705. See Rawl. iii. 297; & Foster's Index Reel, 17x0-22; brother of William 1705. See Foster's Index Reel, 17x0-22; Wrougton, Francis, s. Geo., of Pewsey, Wilts, gent. Trinity Coll., matric. ax April, X693, aged 15, B.A. 4 Feb., 1696, M.A. 1699; brother of Thomas X698. Wrougton, (Sir) George, of Wilts, equitis fil. Matric. entry 4 March, 1585-6, aged X4, "Mr. Case's scholar;" of Wilcot, Wilts (3s. Sir Thomas, of Broad Hinton, Wilts), knighted xo Aug., x6x8; brother of Giles and Thomas X585. Wroughton, George, s. Geo., of Shergotd, Wilts, gent. Trinity colu, matric. 7 Feb., X693-4. aged 17; student of Inner Temple X693. See Foster's Inn of Court Reg. Wrougton, (Sir) Giles, of Wilts, equitis fil. Gloucester Hall, matric. o March, x58x-a. aged 17, "scholaris Mri. Case;" of Broad Hinton. Wilts (as. Sir Thomas) ; Wrougton, (Sir) Giles, of Wilts, equitis fil. Gloucester Hall, matric. o March, x58x-a. aged 17, "scholaris Mri. Case;" of Broad Hinton. Wilts (as. Sir Thomas) ; Wrougton, (Sir) Giles, of Wilts, equitis fil. Gloucester Hall, matric. o March, x58x-a. aged 17, "scholaris Mri. Case;" of Broad Hinton. Wilts (as. Sir Thomas) ; Wrougton, (Sir) Giles, of Wilts, equitis fil. Gloucester Hall, matric. o March, x58x-a. aged 17, "scholaris Mri. Case;" of Broad Hinton. Wilts (as. Sir Thomas) ; Wrougton, (Sir) Giles, of Wilts, equitis fil. Gloucester Hall, matric. o March, x58x-a. aged 17, " Brother of George X586, and Thomas X585. [SO] Thomas Wroughton. 1500—1714. Thomas Wyatt. Wrightington, Thomas, of Hants, gent. New COLUMBIA entry under date as Dec. 1576, aged 28. Wrightington, Hionias, of Wilts, eq. aur. fit jESUS Col., matric 5 March. 1584-5. aged 18; (4s. Sir Thomas, of Broad Hinton. >^lts); brother of George 1586. and Gtks 1580. Wrightington, Thomas, s. Geo., of Piewsej. Wilts, arm. Tkinitt COUl, matric 13 July. 1698. aged 15; RA. from Oriel Coll. 1705. M.A. 1705; rector of Sc Swithin with St. Maxy Bothaw, London. 1715; brother of Francis 1693. See Foster's Imdex Eccl. Wordsworth, William, of Codfrey, Wilts, der. W A DRAM Coix., matric 98 March, 1705, aged 17. Obligation 1705, scholar 1707, B.A. 1708; M.A. from St. John's Co., Cambridge, 1736; Member of Westbury 1730, and of Norton Bayant. Wilts, 1736, mitil his death in 1749: brother of Charles 1701. See Foster's Imdex Eccl. William, Thomas; fellow New Colx. 1513 from Winford, co. Lincoln, M.A. z John, 1531, as Wolmer; died 24 Sept., 1526, buried in the college chapel. See Guilt, i. 896; ft O.H.S, L 359. [5] Wyat, Dudley, s. John, of Worcester (city), gen. Christ Church, matric. 7 March. 1634-5, aged 26. Wyat (Sir) Francis (Wyatt), of Kent, arm. fiL naL max. St. Mart Hall, matric i July, 1603, aged 15; of Bozley Abbey, student of Gray's Inn 1603 (as s. George, of Bozley, Kent, esq.). governor of Virginia, knighted 7 July. 1618; buried at Boxley 24 Aug., 1644; brother of George. Hawte. and Henry, father of Henry 1638. See Foster's Grafs Inn. Wyatt, Francis, s. Fr., of Horstead Canes, Sussex, gen. Oriel Coll., matric a8 March, 1705. aged 17; bar.-at-law. Middle Temple, 17x2. See Foster's India Barristers. Wyatt, George, of Kent, gen. Queen's Coll., matric 6 Nov., 1608, aged 26; student of Gray's Inn 1608 (as s. George, of Boxley Abbey, Kent, esq.; brother of the next See Foster's Grafs Inn Register, Wyat, Hawte (Haut) Wat, of Kent, gent Queen's Coll., matric 35 Oct. 26x. aged 17; student of Graves Inn 161 1 (as s. George, of Boxley. Kent, esq.), served Marston chapel 1630, and vicar of Boxley. (both) Kent. 1632; died 3X July. 1638, buried at Boxley. See Foster's Imdex Rul [10] Wyat, Henry (Wiat), of Kent, gent Queen's Coll., matric 35 Oct. 26x. aged 15, R. 6 July. 1625; M.A. from All Souls' coix. 9 April. 1625; student of Gray's Inn 1625 (as s. George, of Boxley. Kent, esq.; licenced 8 Dec, x6x8, to many Catherine, daughter of Sir H. Finch, kt, of Serjeants Inn, London, and died in Jan., 1624. See Foster's Grafs Imm Reg. Wyatt, Henry (Wyatt). born in Worcester, s. Richard, of Witney, Oxon, pleb. Magdalen Coll., matric a Dec, 1636, aged x6, B.A 3X Oct. 1639. M.A. 7 July, 1642; perhaps rector of Bradenhara, Bucks. See Foster's Imdex Eccl. Wyatt, Henry, s. "Francis Wyatt." of Maydstone. Kent, militis. Trinitt Coll., matric 8 June, 1638, aged x6; student of Gray's Inn x64a See Foster's Grafs Imm, Reg. Wyat, Henry, of Oxon, doctoris fil. Pembroke Coll., matric 96 Oct, 1638, aged 15. B.A 5x June, 1642, M.A 30 April, 1649, created D.Med. 6 Dec, x66o; of St Mary Savoy, licenced 36 Feb., x66o-i, to marry Elixabeth Griffith, of the same, widow; physician to the garrison at Tangier, murdered by the Moors 3 May. 1664; brother of William 1630, and John 1633. See FasH, ii. 335; ft Bwrroms, 541. Wyatt, Henry, s. Richard, of Drayton, Berks, der. New College, matric 96 March, 1683, aged x Brother of John x666. [IB] Wyatt, Henry, s. H. of God, Sorrey, New Coll., matrico X3 June. X705, aged x&. Wyatt, John (Wyatt), of Devon, gent Exetx Coll., matrico entry under date 3 Dec. X575, aged 17; bar-at-law. Inner Temple, xy, as of Brantford. Devon; father of Philip. See Foster's Imdges and Barruters, Wyatt, John, of Worcester, plik CifRisT CatnCH. matrico aov. 1581, aged aow BLA. 23 Jan., 1589-3; perhaps rector of Worcester St Martin 16x2. See Foster's Imdex Book. Wyatt, John, of Somerset, gent Broaxgates Hall, matrico 8 Feb.. X58a-3. aged xy; perha|K rector of Priston, Somerset, 15891 See Foster's Imdex Book. Wyatt, John, of Gloucester, gent Balliol Coll., matric 15 Nov., 1605, aged 17. C. Wyatt, John, of Somerset, der. FiL Brasen COL, matric x6 June, x6xo, aged 19. B.A. from New Inn Hall 6 Feb., x6xo; canon of Combe in Wills x6ic. vicar of Winsham, Somerset x63X. See Foster's Imdex Bed. Wyatte, John, of Devon, pleb. Excmt Cot J., matric 3 May, 1633-4; rector of Tawton Bishop, Devoo, X644. See Foster's Imdex Reel. Wyat, John (Wiat), s. Thomas, of Duchingtoo, Oxon. &T. D. TRINITY CO.L., matric 15 Nov., 1633, aged 15. EA. from Oriel Coll. 5 May, 1636. M.A. 3 April, 1639; perhaps proctor X646, until has died in Oct; brother of Henry 1638. and William 1633. Wyatt, John (Wat), s. Richard, of Drayton, Berks, p. p. New Coll., matric 3 June, x6xo, aged 16. B.A. 1670b M.A. 1673; rector of Hathcroft, co. Gloucester, 1680; brother of Henry 1683. See Foster's Index. Wyatt, John William, of (S Mary Vii), Oxford City, der. Christ Church, matric entry xy Oct, xyxs. aged X4, B.A. xjxy, M.A. xyao; vicar of Hatfield Peverell X734, rector of Woodbury. Mortimer 1745, of Peldon, 1746, and of Little Waltham. (all) Fissey, X749, dee Foster's Injun Ecclesiasiicms. Wyatt, Joshua Wiett, s. John, of Exmouth, Devon, pleb. New Inn Hall, matric 31 March, X637, aged x8, B.A. xa Nov., X640; perhaps rector of Puddimore, Somerset, ejected X662 for non-conformity. See Calamy, iii. 204. Wyatt, Nicholas (Wyott) ; B.C.L. from Christ Church XI Feb., 1568-9. Wyatt, Philip (Wyott) ; s. Richard, of Witney. Ozon. pleb. Magdalen Coll., matric x6 April, 1641. aged 17. Wyatt, Richard, "ser." s. R., of Marlborough. Wilts, pleb. p. p. Exeter Coll., matric 3 April. x66i, aged x8; vicar of Uphaven, Wilts, x666. See Foster's Index RecL; 301 Wyatt, Robert, B.C.L., supd. x July, 1505, appointed esquire bedell 5 Nov., 15x8. Wyatt, Robert, B.A. from Lincoln Coll., 4 July, 1609, M.A. xy Dec. x6ia. Wyatt, Robert, s. Henry, of Taunton, Somerset, pleb. Exeter Coll., matric 8 March, x66i-a, aged 21 ; RA. from New Inn Hall, X665; rector of Chipstable, Somerset. 1670. See Foster's Index RecL Wyatt, (Sir) Thomas, poet; s. Henry, of Alington Castle, knight banneret, educated at Oxford and Cambridge, performed several embassies, and knighted x6 April, X536, M.P. Kent Jan., 1641-a, until his death xx Oct following, aged 39 ; buried at Sherborne, Dorset See AtL L xa4; Foster's Index EccL & Meame, m. 368. Thomas Wyatt. 1500 Henry Wycherley. Thomas (Watt), of co. Stafford, pl. Brasenose Coll., matrico — July, 1593, aged 19, B.A. 3 Feb., 1591S7; M.A. from Oriel Coll. ix March. 1609-3, licensed to preach 17 Dec., 1620, B.D. 27 June, 1611; rector of Racklington 1610-53, and of Newnham Courtney, (both) Oxon, 1631; father of Henry 1638, and William 1630, and Thomas 1633. See Foster's Index Eccl. Thomas (Wat), pleb. St. John's Coll., matrico. Feb., 1648-9. B.A. 4 March, 1651-3, M.A. 25 Oct, 1654, proctor 1659, B.D. x66i, D.D.
| 8,449 |
https://stackoverflow.com/questions/1432623
|
StackExchange
|
Open Web
|
CC-By-SA
| 2,009 |
Stack Exchange
|
Amy B, Chance, Christopher McGowan, David Lysaght, Dolly, Jason, KM., Kutyel, Mark Munro, Paul Turner, Tarek Sat, Yienge Lo, https://stackoverflow.com/users/138578, https://stackoverflow.com/users/2833011, https://stackoverflow.com/users/2833012, https://stackoverflow.com/users/2833013, https://stackoverflow.com/users/2833072, https://stackoverflow.com/users/2833144, https://stackoverflow.com/users/2833227, https://stackoverflow.com/users/2833278, https://stackoverflow.com/users/2833575, https://stackoverflow.com/users/2833759, https://stackoverflow.com/users/2833821, https://stackoverflow.com/users/2833876, https://stackoverflow.com/users/2834017, https://stackoverflow.com/users/2834147, https://stackoverflow.com/users/2834551, https://stackoverflow.com/users/2834552, https://stackoverflow.com/users/2834553, https://stackoverflow.com/users/65223, https://stackoverflow.com/users/8155, mrybak834, reevery, rony, user2833227, user2833759, user2833876, x-country304
|
English
|
Spoken
| 1,308 | 3,634 |
Function split string into decimals?
I'm currently trying to write a SQL Server 2005 function, which gets a string as parameter and creates a table with decimal values out of it.
The problem is, that I have to define the decimal type based on parameters. This not working snippet should demonstrate the idea:
CREATE FUNCTION [dbo].[ufn_ParseDecimal]
(
@Sequence VARCHAR(max),
@Delim CHAR(1),
@Prec INT,
@Scale INT
)
RETURNS @DecimalList TABLE (
fValue decimal(@Prec, @Scale)
)
Any ideas, how this could be done?
Two links for you: http://www.sommarskog.se/arrays-in-sql-2005.html and http://www.sommarskog.se/dynamic_sql.html (dynamic sql would be needed for the decimal from @Prec and @Scale)
This is a generic function to parse any text string into a table of values... You can easily use it to do what you are trying to accomplish:
ALTER FUNCTION [dbo].[ParseTextString] (@S Text, @delim VarChar(5))
Returns @tOut Table
(ValNum Integer Identity Primary Key,
sVal VarChar(8000))
As
Begin
Declare @dLLen TinyInt -- Length of delimiter
Declare @sWin VarChar(8000) -- Will Contain Window into text string
Declare @wLen Integer -- Length of Window
Declare @wLast TinyInt -- Boolean to indicate processing Last Window
Declare @wPos Integer -- Start Position of Window within Text String
Declare @sVal VarChar(8000) -- String Data to insert into output Table
Declare @BtchSiz Integer -- Maximum Size of Window
Set @BtchSiz = 7900 -- (Reset to smaller values to test routine)
Declare @dPos Integer -- Position within Window of next Delimiter
Declare @Strt Integer -- Start Position of each data value within Window
-- -------------------------------------------------------------------------
If @delim is Null Set @delim = '|'
If DataLength(@S) = 0 Or
Substring(@S, 1, @BtchSiz) = @delim Return
-- ---------------------------
Select @dLLen = Len(@delim),
@Strt = 1, @wPos = 1,
@sWin = Substring(@S, 1, @BtchSiz)
Select @wLen = Len(@sWin),
@wLast = Case When Len(@sWin) = @BtchSiz
Then 0 Else 1 End,
@dPos = CharIndex(@delim, @sWin, @Strt)
-- ------------------------------------
While @Strt <= @wLen
Begin
If @dPos = 0 -- No More delimiters in window
Begin
If @wLast = 1 Set @dPos = @wLen + 1
Else
Begin
Set @wPos = @wPos + @Strt - 1
Set @sWin = Substring(@S, @wPos, @BtchSiz)
-- ----------------------------------------
Select @wLen = Len(@sWin), @Strt = 1,
@wLast = Case When Len(@sWin) = @BtchSiz
Then 0 Else 1 End,
@dPos = CharIndex(@delim, @sWin, 1)
If @dPos = 0 Set @dPos = @wLen + 1
End
End
-- -------------------------------
Set @sVal = LTrim(Substring(@sWin, @Strt, @dPos - @Strt))
Insert @tOut (sVal) Values (@sVal)
-- -------------------------------
-- Move @Strt to char after last delimiter
Set @Strt = @dPos + @dLLen
Set @dPos = CharIndex(@delim, @sWin, @Strt)
End
Return
End
You can't define this adhoc in SQL.
The best you can do is to create a global temp table (##) using dynamic SQL. Then it can be used subsequently.
In T-SQL, a function has to have a concrete return type. You will not be able to return a table that contains varying data types unless you convert them to something basic to be interpreted by another process (e.g. a VARCHAR), but this would seem to subvert the purpose of your function.
What you can do is create a table using dynamic SQL, which will allow you specify precision and scale in the table definition:
DECLARE @table NVARCHAR(MAX)
SET @table = '#DecimalTable'
DECLARE @sql NVARCHAR(MAX)
DECLARE @params NVARCHAR(MAX)
SET @sql = N'CREATE TABLE ' + @table
+ '([fValue] DECIMAL (' + @Prec + ',' + @Scale + '))'
EXEC @sql
With the table defined, you should be able to insert into the rows using the CAST operator to convert the data in a similar way:
SET @sql = N'INSERT INTO ' + @table
+ 'VALUES (CAST(@Seq AS DECIMAL(' + @Prec + ',' @Scale + '))'
SET @params = N'@Seq VARCHAR(MAX)'
EXEC sp_executesql @sql, @params, @Sequence
Arguably, you may not even need the CAST operation, as SQL Server will implicitly attempt to convert your VARCHAR(MAX) expression when you insert into the DECIMAL column.
Either way, it's not pretty and I'd suggest looking at the possibility of solving your problem some other way, before you resort to using dynamic SQL and all the headaches it brings.
@Programming Hero said a function has to have a concrete return type, which is not true, see my function and example code.
sql_variant is a concrete return type, one which can hold multiple types of value. It doesn't seem suitable for this problem because it doesn't allow you to return a table of values of known type.
try this, I only coded to support decimals up to a precision of 5, but you can increase it if necessary:
CREATE FUNCTION [dbo].[ufn_ParseDecimal]
(
@Sequence VARCHAR(max),
@Delim CHAR(1),
@Prec INT,
@Scale INT
)
RETURNS sql_variant
AS
BEGIN
DECLARE @L VARCHAR(max)
DECLARE @R VARCHAR(max)
IF CHARINDEX(@Delim,@Sequence)>0
BEGIN
SET @L=LEFT(@Sequence,CHARINDEX(@Delim,@Sequence)-1)
SET @R=RIGHT(@Sequence,LEN(@Sequence)-CHARINDEX(@Delim,@Sequence))
END
ELSE
BEGIN
SET @L=@Sequence
SET @R=''
END
DECLARE @1_0 decimal(1,0)
DECLARE @1_1 decimal(1,1)
DECLARE @2_0 decimal(2,0)
DECLARE @2_1 decimal(2,1)
DECLARE @2_2 decimal(2,2)
DECLARE @3_0 decimal(3,0)
DECLARE @3_1 decimal(3,1)
DECLARE @3_2 decimal(3,2)
DECLARE @3_3 decimal(3,3)
DECLARE @4_0 decimal(4,0)
DECLARE @4_1 decimal(4,1)
DECLARE @4_2 decimal(4,2)
DECLARE @4_3 decimal(4,3)
DECLARE @4_4 decimal(4,4)
DECLARE @5_0 decimal(5,0)
DECLARE @5_1 decimal(5,1)
DECLARE @5_2 decimal(5,2)
DECLARE @5_3 decimal(5,3)
DECLARE @5_4 decimal(5,4)
DECLARE @5_5 decimal(5,5)
DECLARE @v sql_variant
IF @Prec=1
BEGIN
IF @Scale=0 BEGIN SET @1_0=RIGHT(@L,1) SET @v= @1_0 END
ELSE IF @Scale=1 BEGIN SET @1_1='0.'+LEFT(@R,1) SET @v= @1_1 END
END
ELSE IF @Prec=2
BEGIN
IF @Scale=0 BEGIN SET @2_0=RIGHT(@L,2) SET @v= @2_0 END
ELSE IF @Scale=1 BEGIN SET @2_1=RIGHT(@L,1)+'.'+LEFT(@R,1) SET @v= @2_1 END
ELSE IF @Scale=2 BEGIN SET @2_2= '0.'+LEFT(@R,2) SET @v= @2_2 END
END
ELSE IF @Prec=3
BEGIN
IF @Scale=0 BEGIN SET @3_0=RIGHT(@L,3) SET @v= @3_0 END
ELSE IF @Scale=1 BEGIN SET @3_1=RIGHT(@L,2)+'.'+LEFT(@R,1) SET @v= @3_1 END
ELSE IF @Scale=2 BEGIN SET @3_2=RIGHT(@L,1)+'.'+LEFT(@R,2) SET @v= @3_2 END
ELSE IF @Scale=3 BEGIN SET @3_3= '0.'+LEFT(@R,3) SET @v= @3_3 END
END
ELSE IF @Prec=4
BEGIN
IF @Scale=0 BEGIN SET @4_0=RIGHT(@L,4) SET @v= @4_0 END
ELSE IF @Scale=1 BEGIN SET @4_1=RIGHT(@L,3)+'.'+LEFT(@R,1) SET @v= @4_1 END
ELSE IF @Scale=2 BEGIN SET @4_2=RIGHT(@L,2)+'.'+LEFT(@R,2) SET @v= @4_2 END
ELSE IF @Scale=3 BEGIN SET @4_3=RIGHT(@L,1)+'.'+LEFT(@R,3) SET @v= @4_3 END
ELSE IF @Scale=4 BEGIN SET @4_4= '0.'+LEFT(@R,4) SET @v= @4_4 END
END
ELSE IF @Prec=5
BEGIN
IF @Scale=0 BEGIN SET @5_0=RIGHT(@L,5) SET @v= @5_0 END
ELSE IF @Scale=1 BEGIN SET @5_1=RIGHT(@L,4)+'.'+LEFT(@R,1) SET @v= @5_1 END
ELSE IF @Scale=2 BEGIN SET @5_2=RIGHT(@L,3)+'.'+LEFT(@R,2) SET @v= @5_2 END
ELSE IF @Scale=3 BEGIN SET @5_3=RIGHT(@L,2)+'.'+LEFT(@R,3) SET @v= @5_3 END
ELSE IF @Scale=4 BEGIN SET @5_4=RIGHT(@L,1)+'.'+LEFT(@R,4) SET @v= @5_4 END
ELSE IF @Scale=5 BEGIN SET @5_5= '0.'+LEFT(@R,5) SET @v= @5_5 END
END
RETURN @v
END
this sample code uses the function:
SELECT CONVERT(varchar(10),SQL_VARIANT_PROPERTY(dbo.ufn_ParseDecimal('123.4','.',4,1) , 'BaseType')),CONVERT(varchar(10),SQL_VARIANT_PROPERTY(dbo.ufn_ParseDecimal('123.4','.',4,1) , 'Precision')),CONVERT(varchar(10),SQL_VARIANT_PROPERTY(dbo.ufn_ParseDecimal('123.4','.',4,1) , 'Scale')) ,dbo.ufn_ParseDecimal('123.4','.',4,1)
UNION SELECT CONVERT(varchar(10),SQL_VARIANT_PROPERTY(dbo.ufn_ParseDecimal('123.45','.',5,2), 'BaseType')),CONVERT(varchar(10),SQL_VARIANT_PROPERTY(dbo.ufn_ParseDecimal('123.45','.',5,2), 'Precision')),CONVERT(varchar(10),SQL_VARIANT_PROPERTY(dbo.ufn_ParseDecimal('123.45','.',5,2), 'Scale')) ,dbo.ufn_ParseDecimal('123.45','.',5,2)
UNION SELECT CONVERT(varchar(10),SQL_VARIANT_PROPERTY(dbo.ufn_ParseDecimal('1.234','.',5,4) , 'BaseType')),CONVERT(varchar(10),SQL_VARIANT_PROPERTY(dbo.ufn_ParseDecimal('1.234','.',5,4) , 'Precision')),CONVERT(varchar(10),SQL_VARIANT_PROPERTY(dbo.ufn_ParseDecimal('1.234','.',5,4) , 'Scale')) ,dbo.ufn_ParseDecimal('1.234','.',5,4)
OUTPUT from sample code:
---------- ---------- ---------- ---------
decimal 4 1 123.4
decimal 5 2 123.45
decimal 5 4 1.2340
(3 row(s) affected)
CAST and DYNAMIC SQL, though I don't believe functions support the latter all that well. I was thinking along the lines of:
EXEC 'SELECT
CAST(''' +
SUBSTRING(@SEQUENCE, 1, @Prec - @Scale) +
@Delim +
SUBSTRING(@SEQUENCE, @Prec - @Scale + 1) +
"''
AS DECIMAL(' + @Prec + ', ' + @Scale + ')'
As mentioned by others, Table-Valued User-Defined-Functions must have a specific return type for each field.
The way I would get around that is to change the design slightly. Have the function break up the [sequence] in to a table of strings. Don't do the conversion yet...
CREATE FUNCTION [dbo].[ufn_ParseList] (
@Sequence VARCHAR(MAX),
@Delim CHAR(1)
)
RETURNS @List TABLE (
id INT IDENTITY(1,1),
item VARCHAR(MAX) -- You may want to use something smaller than (MAX)
)
Then, once you have a table of strings, apply the conversion you need. As mentioned by others, this would likely by dynamic SQL.
The existance of the Dynamic SQL in your main body of code, however, may be a real pain...
| 44,484 |
https://github.com/comet-syt/BAPS/blob/master/deep_learning/code/sigmoid_function.py
|
Github Open Source
|
Open Source
|
MIT
| 2,021 |
BAPS
|
comet-syt
|
Python
|
Code
| 55 | 196 |
import numpy as np
import matplotlib.pyplot as plt
def sigmoid(x, w, b):
return 1/(1 + np.exp(-x*w+b))
x = np.arange(-5.0, 5.0, 0.1)
y1 = sigmoid(x, 0.5, 0)
y2 = sigmoid(x, 1, 0)
y3 = sigmoid(x, 2, 0)
plt.plot(x, y1, "r", linestyle='--')
plt.plot(x, y2, 'g')
plt.plot(x, y3, 'b', linestyle='--')
plt.plot([0, 0], [1.0, 0.0], ":")
plt.title("sigmoid function")
plt.show()
| 18,698 |
https://qu.wikipedia.org/wiki/Lee%20Hsien%20Loong
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Lee Hsien Loong
|
https://qu.wikipedia.org/w/index.php?title=Lee Hsien Loong&action=history
|
Quechua
|
Spoken
| 111 | 305 |
Lee Hsien Loong, (Chinu simipi: 李显龙, machu Chinu simipi: 李顯龍; pinyin: Lǐ Xiǎnlóng sutiyuq runaqa, 10 ñiqin hatun puquy killapi - 1952 paqarisqa Singapur llaqtapi - ).
2004 watamanta ñawpaq kuti Singapurpa Uma kamayuqnin karqan.
Tayta: Lee Kuan Yew Mama: Kwa Geok Choo
Ñawpaq warmi: Ho Ching / Wong Ming Yang (wañusqa 1982)
Wawakuna: 4
Qillqaqkuna
Kastilla simipi:
Inlish simipi:
Kaypipas qhaway
Singapur
Hawa t'inkikuna
An interview with Lee Hsien Loong on Charlie Rose Show - 30 mins video
A brief biography at the Singapore government's website
Commanding Heights: Lee Hsien Loong
Lee Hsien Loong wins Worst Democrat Award 2006
Paqarisqa 1952
Uma kamayuq (Singapur)
Musiku ministrukuna (Singapur)
Pulitiku (Singapur)
Qhari
| 31,136 |
https://www.wikidata.org/wiki/Q515132
|
Wikidata
|
Semantic data
|
CC0
| null |
Constance Worth
|
None
|
Multilingual
|
Semantic data
| 4,980 | 13,201 |
Constance Worth
australische Schauspielerin
Constance Worth Geschlecht weiblich
Constance Worth Tätigkeit Schauspieler
Constance Worth Tätigkeit Filmschauspieler
Constance Worth LCAuth-Kennung no91017540
Constance Worth VIAF-Kennung 73416427
Constance Worth Geburtsort Sydney
Constance Worth Sterbeort Los Angeles
Constance Worth Land der Staatsangehörigkeit Australien
Constance Worth Commons-Kategorie Constance Worth
Constance Worth Geburtsdatum 1911
Constance Worth Sterbedatum 1963
Constance Worth ist ein(e) Mensch
Constance Worth IMDb-ID nm0941666
Constance Worth Bild Constance Worth 1937.jpg
Constance Worth Vorname Constance
Constance Worth Ehepartner(in) George Brent, Startzeitpunkt 1937, Endzeitpunkt 1937
Constance Worth AllMovie Personen-ID p77535
Constance Worth SFDb Personen-ID 130878
Constance Worth AlloCiné-Personen-ID 500262
Constance Worth KinoPoisk-Personen-ID 213720
Constance Worth ČSFD-Personen-ID 100432
Constance Worth Find-A-Grave-Grabstättenkennung 85874895
Constance Worth Familienname Worth
Constance Worth Todesursache Anämie
Constance Worth Wirkungsdaten (von) 1933
Constance Worth Freebase-Kennung /m/0cmbdh2
Constance Worth TMDb-Personen-ID 99751
Constance Worth Prabook-Kennung 2518111
Constance Worth Geni.com-Profilkennung 6000000018807636015
Constance Worth Film.ru-Personenkennung konstans-uort
Constance Worth GND-Kennung 1285015185
Constance Worth Kinobox-Personenkennung 921362
Constance Worth WikiTree-Kennung Howarth-1291, genannt als Constance Worth (Howarth) (19 Aug 1911 - 18 Oct 1963)
Constance Worth WorldCat-Entitäten-Kennung E39PBJw4ypMgGj3CPhjQgy6qcP
Constance Worth
Australian actress (1911-1963)
Constance Worth sex or gender female
Constance Worth occupation actor
Constance Worth occupation film actor
Constance Worth Library of Congress authority ID no91017540
Constance Worth VIAF ID 73416427
Constance Worth place of birth Sydney
Constance Worth place of death Los Angeles
Constance Worth country of citizenship Australia
Constance Worth Commons category Constance Worth
Constance Worth date of birth 1911
Constance Worth date of death 1963
Constance Worth instance of human
Constance Worth IMDb ID nm0941666
Constance Worth image Constance Worth 1937.jpg
Constance Worth given name Constance
Constance Worth spouse George Brent, start time 1937, end time 1937
Constance Worth AllMovie person ID p77535
Constance Worth Swedish Film Database person ID 130878
Constance Worth AlloCiné person ID 500262
Constance Worth Kinopoisk person ID 213720
Constance Worth ČSFD person ID 100432
Constance Worth Find a Grave memorial ID 85874895
Constance Worth educated at Ascham School
Constance Worth family name Worth
Constance Worth cause of death anemia
Constance Worth work period (start) 1933
Constance Worth Freebase ID /m/0cmbdh2
Constance Worth TMDB person ID 99751
Constance Worth Prabook ID 2518111
Constance Worth Geni.com profile ID 6000000018807636015
Constance Worth Film.ru person ID konstans-uort
Constance Worth GND ID 1285015185
Constance Worth Kinobox person ID 921362
Constance Worth WikiTree person ID Howarth-1291, subject named as Constance Worth (Howarth) (19 Aug 1911 - 18 Oct 1963)
Constance Worth WorldCat Entities ID E39PBJw4ypMgGj3CPhjQgy6qcP
Constance Worth
actriz australiana
Constance Worth sexo o género femenino
Constance Worth ocupación actor
Constance Worth ocupación actor de cine
Constance Worth identificador de autoridades de la Biblioteca del Congreso de EE. UU. no91017540
Constance Worth identificador VIAF 73416427
Constance Worth lugar de nacimiento Sídney
Constance Worth lugar de fallecimiento Los Ángeles
Constance Worth país de nacionalidad Australia
Constance Worth categoría en Commons Constance Worth
Constance Worth fecha de nacimiento 1911
Constance Worth fecha de fallecimiento 1963
Constance Worth instancia de ser humano
Constance Worth identificador IMDb nm0941666
Constance Worth imagen Constance Worth 1937.jpg
Constance Worth nombre de pila Constance
Constance Worth cónyuge George Brent, fecha de inicio 1937, fecha de fin 1937
Constance Worth identificador AllMovie de artista p77535
Constance Worth identificador SFDb de persona 130878
Constance Worth identificador AlloCiné de persona 500262
Constance Worth identificador Kinopoisk de persona 213720
Constance Worth identificador ČSFD de persona 100432
Constance Worth identificador Find a Grave 85874895
Constance Worth apellido Worth
Constance Worth causa de muerte anemia
Constance Worth inicio del periodo de actividad 1933
Constance Worth Identificador Freebase /m/0cmbdh2
Constance Worth identificador TMDB de persona 99751
Constance Worth identificador de Prabook 2518111
Constance Worth perfil en Geni.com 6000000018807636015
Constance Worth identificador GND (DNB) 1285015185
Constance Worth identificador WikiTree Howarth-1291, registrado como Constance Worth (Howarth) (19 Aug 1911 - 18 Oct 1963)
Constance Worth identificador WorldCat Entities E39PBJw4ypMgGj3CPhjQgy6qcP
Constance Worth
actrice uit Australië (1911-1963)
Constance Worth sekse of geslacht vrouwelijk
Constance Worth beroep acteur
Constance Worth beroep filmacteur
Constance Worth LCAuth-identificatiecode no91017540
Constance Worth VIAF-identificatiecode 73416427
Constance Worth geboorteplaats Sydney
Constance Worth overlijdensplaats Los Angeles
Constance Worth land van nationaliteit Australië
Constance Worth Commonscategorie Constance Worth
Constance Worth geboortedatum 1911
Constance Worth overlijdensdatum 1963
Constance Worth is een mens
Constance Worth IMDb-identificatiecode nm0941666
Constance Worth afbeelding Constance Worth 1937.jpg
Constance Worth voornaam Constance
Constance Worth huwelijkspartner George Brent, begindatum 1937, einddatum 1937
Constance Worth AllMovie-identificatiecode voor persoon p77535
Constance Worth SFDb-identificatiecode voor persoon 130878
Constance Worth AlloCiné-identificatiecode voor persoon 500262
Constance Worth Kinopoisk-identificatiecode voor persoon 213720
Constance Worth ČSFD-identificatiecode voor persoon 100432
Constance Worth Find a Grave-identificatiecode voor graf 85874895
Constance Worth familienaam Worth
Constance Worth doodsoorzaak bloedarmoede
Constance Worth werkperiode (begin) 1933
Constance Worth Freebase-identificatiecode /m/0cmbdh2
Constance Worth TMDb-identificatiecode voor persoon 99751
Constance Worth Prabook-identificatiecode 2518111
Constance Worth Geni.com-identificatiecode 6000000018807636015
Constance Worth Film.ru-identificatiecode voor acteur konstans-uort
Constance Worth GND-identificatiecode 1285015185
Constance Worth Kinobox-identificatiecode voor persoon 921362
Constance Worth WikiTree-identificatiecode Howarth-1291, genoemd als Constance Worth (Howarth) (19 Aug 1911 - 18 Oct 1963)
Constance Worth WorldCat Entities-identificatiecode E39PBJw4ypMgGj3CPhjQgy6qcP
Constance Worth
actrice australienne
Constance Worth sexe ou genre féminin
Constance Worth occupation acteur ou actrice
Constance Worth occupation acteur ou actrice de cinéma
Constance Worth identifiant Bibliothèque du Congrès no91017540
Constance Worth identifiant VIAF 73416427
Constance Worth lieu de naissance Sydney
Constance Worth lieu de mort Los Angeles
Constance Worth pays de nationalité Australie
Constance Worth catégorie Commons Constance Worth
Constance Worth date de naissance 1911
Constance Worth date de mort 1963
Constance Worth nature de l’élément être humain
Constance Worth identifiant Internet Movie Database nm0941666
Constance Worth image Constance Worth 1937.jpg
Constance Worth prénom Constance
Constance Worth conjoint ou conjointe George Brent, date de début 1937, date de fin 1937
Constance Worth identifiant AllMovie d'une personne p77535
Constance Worth identifiant Svensk Filmdatabas d'une personne 130878
Constance Worth identifiant AlloCiné nom 500262
Constance Worth identifiant Kinopoisk d'une personne 213720
Constance Worth identifiant ČSFD d'une personne 100432
Constance Worth identifiant Find a Grave de la tombe 85874895
Constance Worth nom de famille Worth
Constance Worth cause de la mort anémie
Constance Worth début de la période d'activité 1933
Constance Worth identifiant Freebase /m/0cmbdh2
Constance Worth identifiant The Movie Database d'une personne 99751
Constance Worth identifiant Prabook 2518111
Constance Worth identifiant Geni.com 6000000018807636015
Constance Worth identifiant Film.ru d'une personne konstans-uort
Constance Worth identifiant GND (DNB) 1285015185
Constance Worth identifiant Kinobox.cz d'une personne 921362
Constance Worth identifiant WikiTree Howarth-1291, sous le nom Constance Worth (Howarth) (19 Aug 1911 - 18 Oct 1963)
Constance Worth identifiant WorldCat Entities E39PBJw4ypMgGj3CPhjQgy6qcP
Constance Worth
australisk skådespelare
Constance Worth kön kvinna
Constance Worth sysselsättning skådespelare
Constance Worth sysselsättning filmskådespelare
Constance Worth id-nummer i USA:s kongressbiblioteks katalog no91017540
Constance Worth VIAF-ID 73416427
Constance Worth födelseplats Sydney
Constance Worth dödsplats Los Angeles
Constance Worth medborgare i Australien
Constance Worth Commons-kategori Constance Worth
Constance Worth födelsedatum 1911
Constance Worth dödsdatum 1963
Constance Worth instans av människa
Constance Worth IMDb-ID nm0941666
Constance Worth bild Constance Worth 1937.jpg
Constance Worth förnamn Constance
Constance Worth gift med George Brent, startdatum 1937, slutdatum 1937
Constance Worth AllMovie person-ID p77535
Constance Worth Svensk filmdatabas person-ID 130878
Constance Worth AlloCiné person-ID 500262
Constance Worth KinoPoisk person-ID 213720
Constance Worth ČSFD person-ID 100432
Constance Worth Find A Grave-ID 85874895
Constance Worth utbildad vid Ascham School
Constance Worth efternamn Worth
Constance Worth dödsorsak anemi
Constance Worth arbetsperiod (start) 1933
Constance Worth Freebase-ID /m/0cmbdh2
Constance Worth TMDB person-ID 99751
Constance Worth Prabook-ID 2518111
Constance Worth Geni.com profil-ID 6000000018807636015
Constance Worth Film.ru person-ID konstans-uort
Constance Worth Deutsche Nationalbibliotheks katalog-id-nummer 1285015185
Constance Worth Kinobox person-ID 921362
Constance Worth WikiTree person-ID Howarth-1291, omnämnd som Constance Worth (Howarth) (19 Aug 1911 - 18 Oct 1963)
Constance Worth WorldCat Entities-ID E39PBJw4ypMgGj3CPhjQgy6qcP
Constance Worth
australsk skuespiller
Constance Worth kjønn kvinne
Constance Worth beskjeftigelse skuespiller
Constance Worth beskjeftigelse filmskuespiller
Constance Worth Library of Congress autoritets-ID no91017540
Constance Worth VIAF-ID 73416427
Constance Worth fødested Sydney
Constance Worth dødssted Los Angeles
Constance Worth statsborgerskap Australia
Constance Worth Commons-kategori Constance Worth
Constance Worth fødselsdato 1911
Constance Worth dødsdato 1963
Constance Worth forekomst av menneske
Constance Worth IMDb-ID nm0941666
Constance Worth bilde Constance Worth 1937.jpg
Constance Worth fornavn Constance
Constance Worth ektefelle George Brent, startdato 1937, sluttdato 1937
Constance Worth AllMovie artist ID p77535
Constance Worth SFDb person-ID 130878
Constance Worth AlloCiné person-ID 500262
Constance Worth Kinopoisk person-ID 213720
Constance Worth ČSFD person-ID 100432
Constance Worth Find a Grave-ID 85874895
Constance Worth etternavn Worth
Constance Worth dødsårsak anemi
Constance Worth virksom fra 1933
Constance Worth Freebase-ID /m/0cmbdh2
Constance Worth TMDb person-ID 99751
Constance Worth Prabook-ID 2518111
Constance Worth Geni.com-ID 6000000018807636015
Constance Worth Film.ru person-ID konstans-uort
Constance Worth GND-ID 1285015185
Constance Worth Kinobox person-ID 921362
Constance Worth WikiTree-ID Howarth-1291, oppført som Constance Worth (Howarth) (19 Aug 1911 - 18 Oct 1963)
Constance Worth WorldCat Entities-ID E39PBJw4ypMgGj3CPhjQgy6qcP
Constance Worth
Constance Worth køn kvinde
Constance Worth beskæftigelse skuespiller
Constance Worth beskæftigelse filmskuespiller
Constance Worth LCAuth no91017540
Constance Worth VIAF 73416427
Constance Worth fødested Sydney
Constance Worth dødssted Los Angeles
Constance Worth statsborgerskab Australien
Constance Worth Commons-kategori Constance Worth
Constance Worth fødselsdato 1911
Constance Worth dødsdato 1963
Constance Worth tilfælde af menneske
Constance Worth IMDb-ID nm0941666
Constance Worth billede Constance Worth 1937.jpg
Constance Worth fornavn Constance
Constance Worth ægtefælle George Brent, starttidspunkt 1937, sluttidspunkt 1937
Constance Worth AllMovie artist-ID p77535
Constance Worth Svensk filmdatabase navn 130878
Constance Worth AlloCiné person-ID 500262
Constance Worth Kinopoisk person-ID 213720
Constance Worth ČSFD person-ID 100432
Constance Worth Find a Grave 85874895
Constance Worth efternavn Worth
Constance Worth dødsårsag Anæmi
Constance Worth arbejdsperiode (start) 1933
Constance Worth Freebase-ID /m/0cmbdh2
Constance Worth TMDb person-ID 99751
Constance Worth Geni.com-ID 6000000018807636015
Constance Worth Film.ru person ID konstans-uort
Constance Worth GND-identifikator 1285015185
Constance Worth WikiTree-identifikationskode Howarth-1291, subjekt anført som Constance Worth (Howarth) (19 Aug 1911 - 18 Oct 1963)
Constance Worth
australsk skodespelar
Constance Worth kjønn kvinne
Constance Worth yrke skodespelar
Constance Worth yrke filmskodespelar
Constance Worth LCAuth no91017540
Constance Worth VIAF-identifikator 73416427
Constance Worth fødestad Sydney
Constance Worth dødsstad Los Angeles
Constance Worth statsborgarskap Australia
Constance Worth Commons-kategori Constance Worth
Constance Worth fødselsdato 1911
Constance Worth dødsdato 1963
Constance Worth førekomst av menneske
Constance Worth IMDb-nummer nm0941666
Constance Worth bilete Constance Worth 1937.jpg
Constance Worth førenamn Constance
Constance Worth etternamn Worth
Constance Worth dødsårsak anemi
Constance Worth verksam frå 1933
Constance Worth Freebase-identifikator /m/0cmbdh2
Constance Worth TMDb person ID 99751
Constance Worth Geni.com-ID 6000000018807636015
Constance Worth GND-id 1285015185
Constance Worth Kinobox person-ID 921362
Констанс Уорт
австралийская актриса
Констанс Уорт пол или гендер женский пол
Констанс Уорт род занятий актёр
Констанс Уорт род занятий киноактёр
Констанс Уорт код LCCN no91017540
Констанс Уорт код VIAF 73416427
Констанс Уорт место рождения Сидней
Констанс Уорт место смерти Лос-Анджелес
Констанс Уорт гражданство Австралия
Констанс Уорт категория на Викискладе Constance Worth
Констанс Уорт дата рождения 1911
Констанс Уорт дата смерти 1963
Констанс Уорт это частный случай понятия человек
Констанс Уорт код IMDb nm0941666
Констанс Уорт изображение Constance Worth 1937.jpg
Констанс Уорт личное имя Констанция
Констанс Уорт супруг(а) Джордж Брент, дата начала 1937, дата окончания 1937
Констанс Уорт код персоны в AllMovie p77535
Констанс Уорт код человека в SFDb 130878
Констанс Уорт код человека в AlloCiné 500262
Констанс Уорт код человека на Кинопоиске 213720
Констанс Уорт код персоналии ČSFD 100432
Констанс Уорт код Find a Grave 85874895
Констанс Уорт учебное заведение Ascham School
Констанс Уорт фамилия Уорт
Констанс Уорт причина смерти анемия
Констанс Уорт начало периода активности 1933
Констанс Уорт код Freebase /m/0cmbdh2
Констанс Уорт код человека в TMDb 99751
Констанс Уорт код Prabook 2518111
Констанс Уорт код персоны на Geni.com 6000000018807636015
Констанс Уорт код персоны Film.ru konstans-uort
Констанс Уорт код GND 1285015185
Констанс Уорт код персоны на Kinobox.cz 921362
Констанс Уорт код персоны на WikiTree Howarth-1291, назван как Constance Worth (Howarth) (19 Aug 1911 - 18 Oct 1963)
Констанс Уорт код WorldCat Entities E39PBJw4ypMgGj3CPhjQgy6qcP
Constance Worth
ausztrál színésznő
Constance Worth nem nő
Constance Worth foglalkozás színész
Constance Worth foglalkozás filmszínész
Constance Worth LCAuth-azonosító no91017540
Constance Worth VIAF-azonosító 73416427
Constance Worth születési hely Sydney
Constance Worth halálozási hely Los Angeles
Constance Worth állampolgárság Ausztrália
Constance Worth Commons-kategória Constance Worth
Constance Worth születési idő 1911
Constance Worth halálozási idő 1963
Constance Worth osztály, amelynek példánya ember
Constance Worth IMDb-azonosító nm0941666
Constance Worth kép Constance Worth 1937.jpg
Constance Worth utónév Constance
Constance Worth házastárs George Brent, kezdet ideje 1937, befejezés ideje 1937
Constance Worth AllMovie-személyazonosító p77535
Constance Worth SFDb-személyazonosító 130878
Constance Worth AlloCiné-személyazonosító 500262
Constance Worth KinoPoiszk-személyazonosító 213720
Constance Worth ČSFD-személyazonosító 100432
Constance Worth Find a Grave-sírazonosító 85874895
Constance Worth családnév Worth
Constance Worth halál oka vérszegénység
Constance Worth aktív időszak kezdete 1933
Constance Worth Freebase-azonosító /m/0cmbdh2
Constance Worth TMDb-személyazonosító 99751
Constance Worth Prabook-azonosító 2518111
Constance Worth Geni.com-profilazonosító 6000000018807636015
Constance Worth Film.ru-személyazonosító konstans-uort
Constance Worth GND-azonosító 1285015185
Constance Worth Kinobox-személyazonosító 921362
Constance Worth WikiTree-azonosító Howarth-1291, feltüntetett név Constance Worth (Howarth) (19 Aug 1911 - 18 Oct 1963)
Constance Worth WorldCat-entitásazonosító E39PBJw4ypMgGj3CPhjQgy6qcP
Constance Worth
Constance Worth spol ženska
Constance Worth poklic igralec
Constance Worth poklic filmski igralec
Constance Worth LCCN no91017540
Constance Worth VIAF 73416427
Constance Worth kraj rojstva Sydney
Constance Worth kraj smrti Los Angeles
Constance Worth država državljanstva Avstralija
Constance Worth kategorija v Zbirki Constance Worth
Constance Worth datum rojstva 1911
Constance Worth datum smrti 1963
Constance Worth primerek od človek
Constance Worth oznaka IMDb nm0941666
Constance Worth slika Constance Worth 1937.jpg
Constance Worth ime Constance
Constance Worth zakonec George Brent, čas začetka 1937, čas konca 1937
Constance Worth AllMovie (artist) p77535
Constance Worth AlloCiné (personne) 500262
Constance Worth KinoPoisk (name) 213720
Constance Worth ČSFD (oseba) 100432
Constance Worth Find a Grave 85874895
Constance Worth priimek Worth
Constance Worth vzrok smrti anemija
Constance Worth začetek delovanja 1933
Constance Worth Freebase /m/0cmbdh2
Constance Worth oznaka osebe TMDB 99751
Constance Worth Geni.com (people) 6000000018807636015
Constance Worth GND 1285015185
Constance Worth WikiTree Howarth-1291, poimenovano kot Constance Worth (Howarth) (19 Aug 1911 - 18 Oct 1963)
Constance Worth
Constance Worth sexu femenín
Constance Worth ocupación actor
Constance Worth ocupación actor de cine
Constance Worth identificador d'autoridá de la Biblioteca del Congresu d'EEXX no91017540
Constance Worth identificador VIAF 73416427
Constance Worth llugar de nacimientu Sydney
Constance Worth llugar de fallecimientu Los Angeles
Constance Worth país de nacionalidá Australia
Constance Worth categoría de Commons Constance Worth
Constance Worth fecha de nacimientu 1911
Constance Worth data de la muerte 1963
Constance Worth instancia de humanu
Constance Worth identificador IMDb nm0941666
Constance Worth imaxe Constance Worth 1937.jpg
Constance Worth nome Constance
Constance Worth esposu George Brent, data de principiu 1937, data de fin 1937
Constance Worth identificador Find a Grave 85874895
Constance Worth educáu en Ascham School
Constance Worth apellíu Worth
Constance Worth causa de muerte Anemia
Constance Worth identificador en Freebase /m/0cmbdh2
Constance Worth identificador GND 1285015185
Constance Worth identificador WikiTree Howarth-1291, apaez como Constance Worth (Howarth) (19 Aug 1911 - 18 Oct 1963)
Constance Worth
Constance Worth
Constance Worth jinih kalamin padusi
Constance Worth karajo palakon
Constance Worth Identifikasi LCCN no91017540
Constance Worth Identifikasi VIAF 73416427
Constance Worth wafaik di Los Angeles
Constance Worth kawarganagaroan Australia
Constance Worth kategori di Commons Constance Worth
Constance Worth tanggal lahia 1911
Constance Worth tanggal kamatian 1963
Constance Worth adolah urang
Constance Worth identifikasi IMDb nm0941666
Constance Worth gambar Constance Worth 1937.jpg
Constance Worth identifikasi GND 1285015185
Constance Worth
Constance Worth jenis kelamin atau gender perempuan
Constance Worth pekerjaan pemeran
Constance Worth pekerjaan pemeran film
Constance Worth ID otoritas Perpustakaan Kongres Amerika Serikat no91017540
Constance Worth penanda VIAF 73416427
Constance Worth tempat lahir Sydney
Constance Worth wafat di Los Angeles
Constance Worth kewarganegaraan Australia
Constance Worth kategori di Commons Constance Worth
Constance Worth tanggal lahir 1911
Constance Worth tanggal kematian 1963
Constance Worth adalah manusia
Constance Worth ID IMDb nm0941666
Constance Worth gambar Constance Worth 1937.jpg
Constance Worth nama pribadi Constance
Constance Worth pasangan nikah George Brent, bermula sejak 1937, berakhir pada 1937
Constance Worth penanda makam Find a Grave 85874895
Constance Worth nama keluarga Worth
Constance Worth penyebab kematian anemia
Constance Worth masa kerja (mulai) 1933
Constance Worth penanda Freebase /m/0cmbdh2
Constance Worth penanda GND 1285015185
Constance Worth
Constance Worth nyaéta manusa
Constance Worth gambar Constance Worth 1937.jpg
Constance Worth
Constance Worth pakaryan aktor
Constance Worth tetenger VIAF 73416427
Constance Worth papan lair Sydney
Constance Worth kawarganagaran Ostrali
Constance Worth kategori ing Commons Constance Worth
Constance Worth tanggal lair 1911
Constance Worth minangka manungsa
Constance Worth gambar Constance Worth 1937.jpg
Constance Worth jeneng wèwèhan Constance
Constance Worth wayah kerja (mulai) 1933
Constance Worth tetenger Freebase /m/0cmbdh2
Constance Worth
Constance Worth
Constance Worth
Constance Worth
Constance Worth
Constance Worth
Constance Worth jantina perempuan
Constance Worth pekerjaan pelakon
Constance Worth pekerjaan pelakon filem
Constance Worth ID kewibawaan Perpustakaan Kongres no91017540
Constance Worth ID VIAF 73416427
Constance Worth tempat lahir Sydney
Constance Worth tempat kematian Los Angeles
Constance Worth negara kewarganegaraan Australia
Constance Worth kategori Commons Constance Worth
Constance Worth tarikh lahir 1911
Constance Worth tarikh kematian 1963
Constance Worth contoh manusia
Constance Worth ID IMDb nm0941666
Constance Worth gambar Constance Worth 1937.jpg
Constance Worth nama diberi Constance
Constance Worth ID orang AllMovie p77535
Constance Worth ID orang AlloCiné 500262
Constance Worth ID orang Kinopoisk 213720
Constance Worth ID orang ČSFD 100432
Constance Worth nama keluarga Worth
Constance Worth sebab kematian penyakit anemia
Constance Worth tempoh kerja (bermula) 1933
Constance Worth ID Freebase /m/0cmbdh2
Constance Worth ID profil geni.com 6000000018807636015
Constance Worth ID GND 1285015185
Constance Worth pengecam orang WikiTree Howarth-1291, dinamakan sebagai Constance Worth (Howarth) (19 Aug 1911 - 18 Oct 1963)
Constance Worth ID Entiti WorldCat E39PBJw4ypMgGj3CPhjQgy6qcP
كونستانس ورث
ممثلة أسترالية
كونستانس ورث الجنس أنثى
كونستانس ورث المهنة ممثل
كونستانس ورث المهنة ممثل أفلام
كونستانس ورث مُعرِّف مكتبة الكونغرس (LCNAF) no91017540
كونستانس ورث مُعرِّف ملف الضبط الاستنادي الافتراضي الدَّولي (VIAF) 73416427
كونستانس ورث مكان الولادة سيدني
كونستانس ورث مكان الوفاة لوس أنجلوس
كونستانس ورث بلد المواطنة أستراليا
كونستانس ورث تصنيف كومنز Constance Worth
كونستانس ورث تاريخ الميلاد 1911
كونستانس ورث تاريخ الوفاة 1963
كونستانس ورث نموذج من إنسان
كونستانس ورث مُعرِّف قاعدة بيانات الأفلام على الإنترنت (IMDb) nm0941666
كونستانس ورث الصورة Constance Worth 1937.jpg
كونستانس ورث الاسم الأول كونستانس
كونستانس ورث الزَّوج جورج برنت, تاريخ البدء 1937, تاريخ الانتهاء 1937
كونستانس ورث مُعرِّف شخص في قاعدة بيانات "كُّل الأفلام" (AllMovie) p77535
كونستانس ورث مُعرِّف شخص في قاعدة بيانات الأفلام السُّويديَّة (SFDb) 130878
كونستانس ورث مُعرِّف شخص في ألو سيني (AlloCiné) 500262
كونستانس ورث معرف كينوبويسك (Kinopoisk) 213720
كونستانس ورث مُعرِّف شخص في قاعدة بيانات الأفلام التشيكيَّة (ČSFD) 100432
كونستانس ورث مُعرِّف فرد في قاعد بيانات "أَوجِد شاهدة قبر" (FaG ID) 85874895
كونستانس ورث اسم العائلة ورث
كونستانس ورث سبب الوفاة فقر الدم
كونستانس ورث فترة العمل (البداية) 1933
كونستانس ورث مُعرِّف قاعدة البيانات الحُرَّة (Freebase) /m/0cmbdh2
كونستانس ورث معرف شخص في قاعدة بيانات الفيلم (TMDB) 99751
كونستانس ورث مُعرِّف برابوك (Prabook) 2518111
كونستانس ورث مُعرِّف ملف شخصي في موقع "جيني" (Geni.com) 6000000018807636015
كونستانس ورث مُعرِّف ممثل في موقع Film.ru konstans-uort
كونستانس ورث مُعرِّف الملف الاستنادي المُتكامِل (GND) 1285015185
كونستانس ورث مُعرِّف كينوبوكس للأشخاص (Kinopoisk) 921362
كونستانس ورث مُعرِّف شخص في ويكي الأنساب (WikiTree) Howarth-1291, باسم Constance Worth (Howarth) (19 Aug 1911 - 18 Oct 1963)
كونستانس ورث مُعرِّف كيان لدى مركز المكتبة الرقمية على الإنترنت (WC Entities) E39PBJw4ypMgGj3CPhjQgy6qcP
Constance Worth
actriu australiana
Constance Worth sexe o gènere femení
Constance Worth ocupació actor
Constance Worth ocupació actor de cinema
Constance Worth identificador LCCN no91017540
Constance Worth identificador VIAF 73416427
Constance Worth lloc de naixement Sydney
Constance Worth lloc de defunció Los Angeles
Constance Worth ciutadania Austràlia
Constance Worth categoria de Commons Constance Worth
Constance Worth data de naixement 1911
Constance Worth data de defunció 1963
Constance Worth instància de ésser humà
Constance Worth identificador IMDb nm0941666
Constance Worth imatge Constance Worth 1937.jpg
Constance Worth prenom Constance
Constance Worth cònjuge George Brent, data d'inici 1937, data de finalització 1937
Constance Worth identificador AllMovie d'artista p77535
Constance Worth identificador Svensk Filmdatabas de persona 130878
Constance Worth identificador AlloCiné de persona 500262
Constance Worth identificador Kinopoisk de persona 213720
Constance Worth identificador ČSFD de persona 100432
Constance Worth identificador Find a Grave 85874895
Constance Worth cognom Worth
Constance Worth causa de mort anèmia
Constance Worth inici del període d'activitat 1933
Constance Worth identificador Freebase /m/0cmbdh2
Constance Worth identificador TMDb de persona 99751
Constance Worth identificador Prabook 2518111
Constance Worth identificador Geni.com de perfil 6000000018807636015
Constance Worth identificador Film.ru d'actor konstans-uort
Constance Worth identificador GND (DNB-Deutsche Nationalbibliothek) 1285015185
Constance Worth identificador Kinobox de persona 921362
Constance Worth identificador WikiTree Howarth-1291, anomenat com a Constance Worth (Howarth) (19 Aug 1911 - 18 Oct 1963)
Constance Worth identificador WorldCat Entities E39PBJw4ypMgGj3CPhjQgy6qcP
Constance Worth
Constance Worth gjinia femër
Constance Worth profesioni aktor
Constance Worth profesioni aktor filmi
Constance Worth Library of Congress ID no91017540
Constance Worth VIAF ID 73416427
Constance Worth vendi i lindjes Sydney
Constance Worth vendi i vdekjes Los Axhelos
Constance Worth shtetësia Australia
Constance Worth kategoria në Commons Constance Worth
Constance Worth data e lindjes 1911
Constance Worth data e vdekjes 1963
Constance Worth instancë e njeri
Constance Worth IMDb ID nm0941666
Constance Worth imazh Constance Worth 1937.jpg
Constance Worth emri Constance
Constance Worth bashkëshort George Brent, koha e fillimit 1937, koha e përfundimit 1937
Constance Worth ID e gjetjes së varreve 85874895
Constance Worth mbiemri Worth
Constance Worth shkaku i vdekjes Anemia
Constance Worth Freebase ID /m/0cmbdh2
Constance Worth GND ID 1285015185
Constance Worth WikiTree ID Howarth-1291, referuar si Constance Worth (Howarth) (19 Aug 1911 - 18 Oct 1963)
Constance Worth
ban-aisteoir Astrálach
Constance Worth gnéas nó inscne baineann
Constance Worth gairm aisteoir
Constance Worth gairm aisteoir scannáin
Constance Worth aitheantóir LoC no91017540
Constance Worth VIAF 73416427
Constance Worth áit bhreithe Sydney
Constance Worth áit bháis Los Angeles, California
Constance Worth tír shaoránachta an Astráil
Constance Worth catagóir Commons Constance Worth
Constance Worth dáta breithe 1911
Constance Worth dáta báis 1963
Constance Worth sampla de duine
Constance Worth ID IMDb nm0941666
Constance Worth íomhá Constance Worth 1937.jpg
Constance Worth céadainm Constance
Constance Worth céile George Brent, am tosaigh 1937, am deiridh 1937
Constance Worth sloinne Worth
Constance Worth siocair bháis ainéime
Constance Worth tréimhse oibre (tosach) 1933
Constance Worth ID GND 1285015185
Constance Worth
Constance Worth geslag vroulik
Constance Worth beroep akteur
Constance Worth beroep rolprentakteur
Constance Worth LCCN no91017540
Constance Worth VIAF ID 73416427
Constance Worth geboorteplek Sydney
Constance Worth Sterfplek Los Angeles
Constance Worth land van burgerskap Australië
Constance Worth Commons-kategorie Constance Worth
Constance Worth geboortedatum 1911
Constance Worth sterfdatum 1963
Constance Worth is 'n mens
Constance Worth IMDb-identifikasiekode nm0941666
Constance Worth beeld Constance Worth 1937.jpg
Constance Worth gegewe naam Constance
Constance Worth Eggenoot George Brent, begindatum 1937, einddatum 1937
Constance Worth Find a Grave 85874895
Constance Worth familie naam Worth
Constance Worth doodsoorsaak Anemie
Constance Worth werksperiode (begin) 1933
Constance Worth Freebase-kode /m/0cmbdh2
Constance Worth GND ID 1285015185
コンスタンス・ウォース
コンスタンス・ウォース 性別 女性
コンスタンス・ウォース 職業 俳優
コンスタンス・ウォース 職業 映画俳優
コンスタンス・ウォース アメリカ議会図書館典拠管理識別子 no91017540
コンスタンス・ウォース VIAF識別子 73416427
コンスタンス・ウォース 出生地 シドニー
コンスタンス・ウォース 死没地 ロサンゼルス
コンスタンス・ウォース 国籍 オーストラリア
コンスタンス・ウォース コモンズのカテゴリ Constance Worth
コンスタンス・ウォース 生年月日 1911
コンスタンス・ウォース 死亡年月日 1963
コンスタンス・ウォース 分類 ヒト
コンスタンス・ウォース IMDb識別子 nm0941666
コンスタンス・ウォース 画像 Constance Worth 1937.jpg
コンスタンス・ウォース 名 コンスタンス
コンスタンス・ウォース 配偶者 ジョージ・ブレント, 開始日 1937, 終了日 1937
コンスタンス・ウォース AllMovie人物ID p77535
コンスタンス・ウォース スウェーデン映画データベース 人物ID 130878
コンスタンス・ウォース AlloCiné人物ID 500262
コンスタンス・ウォース キノポイスク人物識別子 213720
コンスタンス・ウォース ČSFD人物識別子 100432
コンスタンス・ウォース ファインド・ア・グレイヴ追悼識別子 85874895
コンスタンス・ウォース 姓 ワース
コンスタンス・ウォース 死因 貧血
コンスタンス・ウォース 活動開始 1933
コンスタンス・ウォース Freebase識別子 /m/0cmbdh2
コンスタンス・ウォース TMDb人物識別子 99751
コンスタンス・ウォース プラブック識別子 2518111
コンスタンス・ウォース Geni.comプロファイル識別子 6000000018807636015
コンスタンス・ウォース Film.ru俳優識別子 konstans-uort
コンスタンス・ウォース GND識別子 1285015185
コンスタンス・ウォース Kinobox人物識別子 921362
コンスタンス・ウォース ウィキツリー人物識別子 Howarth-1291, 表記名 Constance Worth (Howarth) (19 Aug 1911 - 18 Oct 1963)
コンスタンス・ウォース WorldCat Entities識別子 E39PBJw4ypMgGj3CPhjQgy6qcP
Constance Worth
Constance Worth sexo ou género feminino
Constance Worth ocupação ator
Constance Worth ocupação ator de cinema
Constance Worth número de controlo da Biblioteca do Congresso no91017540
Constance Worth identificador VIAF 73416427
Constance Worth local de nascimento Sydney
Constance Worth local de morte Los Angeles
Constance Worth país de nacionalidade Austrália
Constance Worth categoria da Commons Constance Worth
Constance Worth data de nascimento 1911
Constance Worth data de morte 1963
Constance Worth instância de ser humano
Constance Worth identificador IMDb nm0941666
Constance Worth imagem Constance Worth 1937.jpg
Constance Worth primeiro nome Constance
Constance Worth cônjuge George Brent, data inicial 1937, data final 1937
Constance Worth identificador de artista AllMovie p77535
Constance Worth identificador AlloCiné-Personalidade 500262
Constance Worth identificador Kinopoisk-Person 213720
Constance Worth identificador ČSFD de uma pessoa 100432
Constance Worth identificador Find a Grave 85874895
Constance Worth apelido Worth
Constance Worth causa da morte anemia
Constance Worth início do período de atividade 1933
Constance Worth identificador Freebase /m/0cmbdh2
Constance Worth identificador TMDb de uma pessoa 99751
Constance Worth perfil em Geni.com 6000000018807636015
Constance Worth identificador GND 1285015185
Constance Worth identificador WikiTree Howarth-1291, nomeado como Constance Worth (Howarth) (19 Aug 1911 - 18 Oct 1963)
Constance Worth identificador WorldCat Entities E39PBJw4ypMgGj3CPhjQgy6qcP
Constance Worth
Constance Worth sukupuoli nainen
Constance Worth ammatti näyttelijä
Constance Worth ammatti elokuvanäyttelijä
Constance Worth LCAuth-tunniste no91017540
Constance Worth VIAF-tunniste 73416427
Constance Worth syntymäpaikka Sydney
Constance Worth kuolinpaikka Los Angeles
Constance Worth kansalaisuus Australia
Constance Worth Commons-luokka Constance Worth
Constance Worth syntymäaika 1911
Constance Worth kuolinaika 1963
Constance Worth esiintymä kohteesta ihminen
Constance Worth IMDb-tunniste nm0941666
Constance Worth kuva Constance Worth 1937.jpg
Constance Worth etunimi Constance
Constance Worth puoliso George Brent, alkamisajankohta 1937, päättymisajankohta 1937
Constance Worth henkilön AllMovie-tunniste p77535
Constance Worth henkilön SFDb-tunniste 130878
Constance Worth henkilön AlloCiné-tunniste 500262
Constance Worth henkilön KinoPoisk-tunniste 213720
Constance Worth henkilön ČSFD-tunniste 100432
Constance Worth haudan Find A Grave -tunniste 85874895
Constance Worth sukunimi Worth
Constance Worth kuolinsyy anemia
Constance Worth työskentelyajan alku 1933
Constance Worth Freebase-tunniste /m/0cmbdh2
Constance Worth henkilön TMDb-tunniste 99751
Constance Worth Prabook-tunniste 2518111
Constance Worth Geni.com-tunniste 6000000018807636015
Constance Worth GND-tunniste 1285015185
Constance Worth WikiTree-tunniste Howarth-1291, nimellä Constance Worth (Howarth) (19 Aug 1911 - 18 Oct 1963)
كونستانس ورث
كونستانس ورث الجنس ست
كونستانس ورث الوظيفه ممثل
كونستانس ورث الوظيفه ممثل افلام
كونستانس ورث مكان الولاده سيدنى
كونستانس ورث مكان الموت لوس انجليس
كونستانس ورث الجنسيه اوستراليا
كونستانس ورث تصنيف بتاع كومونز Constance Worth
كونستانس ورث تاريخ الولاده 1911
كونستانس ورث تاريخ الموت 1963
كونستانس ورث واحد من انسان
كونستانس ورث الصوره Constance Worth 1937.jpg
كونستانس ورث متجوزه من جورج برنت, تاريخ البدايه 1937, تاريخ النهايه 1937
كونستانس ورث فايند اغريف 85874895
كونستانس ورث اتعلم فى مدرسة اشام
كونستانس ورث سبب الموت انيميا
كونستانس ورث فترة الشغل (البدايه) 1933
كونستانس ورث معرف فرى بيس /m/0cmbdh2
Constance Worth
Constance Worth sexo ou gênero feminino
Constance Worth ocupação ator
Constance Worth ocupação ator/atriz de cinema
Constance Worth identificador LCCN no91017540
Constance Worth identificador VIAF 73416427
Constance Worth local de nascimento Sydney
Constance Worth país de cidadania Austrália
Constance Worth categoria na Commons Constance Worth
Constance Worth data de nascimento 1911
Constance Worth data de morte 1963
Constance Worth instância de ser humano
Constance Worth identificador IMDb nm0941666
Constance Worth imagem Constance Worth 1937.jpg
Constance Worth primeiro nome Constance
Constance Worth cônjuge George Brent, data inicial 1937, data final 1937
Constance Worth identificador AlloCiné-Person 500262
Constance Worth identificador Kinopoisk-Person 213720
Constance Worth ID do Find a Grave 85874895
Constance Worth sobrenome Worth
Constance Worth início do período de atividade 1933
Constance Worth perfil no Geni.com 6000000018807636015
Constance Worth identificador GND 1285015185
Constance Worth identificador WorldCat Entities E39PBJw4ypMgGj3CPhjQgy6qcP
Constance Worth
Avustralyalı oyuncu (1911 – 1963)
Constance Worth cinsiyeti kadın
Constance Worth mesleği oyuncu
Constance Worth mesleği sinema oyuncusu
Constance Worth ABD Kongre Kütüphanesi yetki kimliği no91017540
Constance Worth VIAF kimliği 73416427
Constance Worth doğum yeri Sidney
Constance Worth ölüm yeri Los Angeles
Constance Worth vatandaşlığı Avustralya
Constance Worth Commons kategorisi Constance Worth
Constance Worth doğum tarihi 1911
Constance Worth ölüm tarihi 1963
Constance Worth nedir insan
Constance Worth IMDb kimliği nm0941666
Constance Worth görsel Constance Worth 1937.jpg
Constance Worth ön adı Constance
Constance Worth AllMovie kişi kimliği p77535
Constance Worth İsveç Film Veritabanı kişi kimliği 130878
Constance Worth AlloCiné kişi kimliği 500262
Constance Worth Kinopoisk kişi kimliği 213720
Constance Worth ČSFD kişi kimliği 100432
Constance Worth Find A Grave anıt kimliği 85874895
Constance Worth öğrenim gördüğü okul Ascham Okulu
Constance Worth soyadı Worth
Constance Worth ölüm nedeni Kansızlık
Constance Worth aktif yılları (başlangıç) 1933
Constance Worth Freebase kimliği /m/0cmbdh2
Constance Worth TMDb kişi kimliği 99751
Constance Worth Prabook kişi kimliği 2518111
Constance Worth Geni.com profil kimliği 6000000018807636015
Constance Worth Film.ru kişi kimliği konstans-uort
Constance Worth GND kimliği 1285015185
Constance Worth WikiTree kişi kimliği Howarth-1291, isimlendirilmesi Constance Worth (Howarth) (19 Aug 1911 - 18 Oct 1963)
Κόνστανς Γουόρθ
Κόνστανς Γουόρθ φύλο γυναίκα
Κόνστανς Γουόρθ απασχόληση ηθοποιός
Κόνστανς Γουόρθ απασχόληση ηθοποιός ταινιών
Κόνστανς Γουόρθ κωδικός αναφοράς LCCN no91017540
Κόνστανς Γουόρθ κωδικός αναφοράς VIAF 73416427
Κόνστανς Γουόρθ τόπος γέννησης Σίδνεϊ
Κόνστανς Γουόρθ τόπος θανάτου Λος Άντζελες
Κόνστανς Γουόρθ χώρα πολιτογράφησης Αυστραλία
Κόνστανς Γουόρθ κατηγορία στα Commons Constance Worth
Κόνστανς Γουόρθ ημερομηνία γέννησης 1911
Κόνστανς Γουόρθ ημερομηνία θανάτου 1963
Κόνστανς Γουόρθ είναι άνθρωπος
Κόνστανς Γουόρθ αναγνωριστικό IMDb nm0941666
Κόνστανς Γουόρθ εικόνα Constance Worth 1937.jpg
Κόνστανς Γουόρθ σύζυγος Τζορτζ Μπρεντ, ημερομηνία έναρξης 1937, ημερομηνία τερματισμού 1937
Κόνστανς Γουόρθ κωδικός αναφοράς καλλιτέχνη AllMovie p77535
Κόνστανς Γουόρθ κώδικας αναφοράς προσώπου SFDb 130878
Κόνστανς Γουόρθ κωδικός αναφοράς προσώπου AlloCiné 500262
Κόνστανς Γουόρθ κωδικός αναφοράς προσώπου KinoPoisk 213720
Κόνστανς Γουόρθ κωδικός αναφοράς προσώπου ČSFD 100432
Κόνστανς Γουόρθ κωδικός αναφοράς Find a Grave 85874895
Κόνστανς Γουόρθ αιτία θανάτου αναιμία
Κόνστανς Γουόρθ περίοδος ακμής (αρχή) 1933
Κόνστανς Γουόρθ κωδικός αναφοράς Freebase /m/0cmbdh2
Κόνστανς Γουόρθ κωδικός αναφοράς προσώπου TMDB 99751
Κόνστανς Γουόρθ κωδικός αναφοράς Prabook 2518111
Κόνστανς Γουόρθ κωδικός αναφοράς GND 1285015185
Κόνστανς Γουόρθ κωδικός αναφοράς προσώπου Kinobox 921362
콘스턴스 워스
오스트레일리아 배우
콘스턴스 워스 성별 여성
콘스턴스 워스 직업 배우
콘스턴스 워스 직업 영화 배우
콘스턴스 워스 미국 의회도서관 전거 ID no91017540
콘스턴스 워스 VIAF ID 73416427
콘스턴스 워스 출생지 시드니
콘스턴스 워스 사망한 곳 로스앤젤레스
콘스턴스 워스 국적 오스트레일리아
콘스턴스 워스 이 주제를 다루는 공용 분류 Constance Worth
콘스턴스 워스 출생일 1911
콘스턴스 워스 사망한 날 1963
콘스턴스 워스 다음 종류에 속함 사람
콘스턴스 워스 IMDb ID nm0941666
콘스턴스 워스 그림 Constance Worth 1937.jpg
콘스턴스 워스 배우자 조지 브렌트, 시작된 날 1937, 종료된 날 1937
콘스턴스 워스 AllMovie 인물 ID p77535
콘스턴스 워스 스웨덴영화데이터베이스 인물 ID 130878
콘스턴스 워스 AlloCiné 인물 ID 500262
콘스턴스 워스 Kinoposik 인물 ID 213720
콘스턴스 워스 ČSFD 인물 ID 100432
콘스턴스 워스 Find a Grave 추도 ID 85874895
콘스턴스 워스 사망 원인 빈혈
콘스턴스 워스 활동을 시작한 때 1933
콘스턴스 워스 Freebase 식별자 /m/0cmbdh2
콘스턴스 워스 TMDb 인물 ID 99751
콘스턴스 워스 프라북 ID 2518111
콘스턴스 워스 GND ID 1285015185
콘스턴스 워스 위키트리 인물 ID Howarth-1291, 다음 이름으로 불림 Constance Worth (Howarth) (19 Aug 1911 - 18 Oct 1963)
콘스턴스 워스 월드캣 엔티티 ID E39PBJw4ypMgGj3CPhjQgy6qcP
| 48,679 |
in.ernet.dli.2015.55682_31
|
English-PD
|
Open Culture
|
Public Domain
| null |
None
|
None
|
English
|
Spoken
| 6,843 | 8,989 |
I have had the honor of receiving your letter of the 10th. The turn brils will leave this camp to-morrow morning, but I cannot yet say in what numbers, as the Paymaster’s people have not yet completed their payments, and I do not know what sum in silver will remain to be carried in them. None of them are very good, and 2 of them are quite unservice- able. Indeed all the tumbrils are old and very bad. They have been in every campaign in the Mysore country since the year 1798, and 1 sent the greater number of them into Chittledroog, in an unserviceable state, in the year 1800. Lieut. Gen. Stuart to Lord Clive. Camp at Hurryhur, lOlh March, 1803. I liave endeavored, in deteimining the amount of the force of Major Gen. Wel- lesley’s detachment, to adhere .as ne.arly as possible to the principles established for the re^rulation of that question, by his Excellency the Governor General, and by your Lordship; to render the advancing detacliment sufficiently strong to inaintain its ground, until sustained; and to retain, at the same time, with the army, a force capable of nio\ing, when lequisite, to its support. The strength of the advancing (letachment, including the regiment destined to join the subsidiary force, is greater at present tlian that of the army : were the former made stronger, it would be doubtful whether the army, on an emergency, would be .able to sust.'iiii it; for the same circumstances tli.at might make suppoit necessary to the advancing detachment, would render it dilRcultfor a weaker body to effect its relief; and were the detachment weaker, it might be exposed to serious misfortunes. Upon strict military principles, I should have been solicitous to render a detach- ment, destined to proceed upon a remote service, sufficiently strong to remove the apprehension of its requiring support ; and it h.as appeared to me that I ought to recur to those principles, as the rule of my conduct, in the event of any serious hostility being offered to the force under Major Gen. Wellesley. In that case, therefore, setting aside all secondary considerations connected witli the temporary tranquillity of the frontier, I shall deem it to be the principal object of my duty to secure the general safety of the British army, by a prompt movement, to join the detachment in advance. I am, however, led, by a view of present circumstances, to think that the sup- port of the army will net be required ; as the favorable disposition already mani- fested by some of the southern jaghired.ars, and the undecided conduct of those from whom opposition might be expected, will, it is probable, enable the ad- vancing detachment, the Peshwah’s troops, and the Nizam’s force, to effect a junction. After that event, the British army will be equal to the prosecution of any service which it may be required to undertake. INDIA. 349 Goklah’s letter was only complimentary, and to request that I would protect his country. He also informs me that he is sending to me a man, whom I know to be his uncle. I have besides received, through Govind Rao, letters from Appah Sahcb and other sirdars, and one from the killadar of Darvvar. This man said to Govind Rao that he was the Peshwah’s servant, and was willing to obey all orders that he should receive from him. I learn, however, from a man at Darwar, that the killadar is much afraid that we shall attack his place : hut I have desired this man to give him assurances that we were the enemies of nobody ; and that, if he re- mained quiet, offered us no interruption, and allowed us to enjoy the re- sources of the country, he should not he molested ; and that we were advancing at the call of the Peshwah, whose orders must be obeyed. The route which I sent you yesterday did not contain the marches which must be made to join Col. Stevenson. The reason is, that, from the want of sufficient information, I have not yet determined by what route they shnll be. I am, however, making inquiries upon the subject, and I hope, in a few days, to be able to give you a decided answer upon it. I am obliged to conduct these inquiries with caution, lest, in appearing too anxious to form this junction, they should suspect that 1 think myself weak ; and that the junction is absolutely necessary for the safety of both detachments. Tlic want of water in the country will oblige both detachments to keep upon the rivers as much as possible ; and I rather believe that I must pro- ceed by the way of Beejapoor to the Beemah, and march up that river ; and that Col. Stevenson should advance and join me upon it. By that mode the Nizam’s frontier will not be uncovered for a moment. 0, Camp at Oollull. Friday, llth March, 1803. The fioo|is will enter the Marhatta territory to-morrow morning, l»ut they are not to consider it as an enemy's conntiy. The strictest order and discipline must be observed, and every tiling that is required from the country must be paid for. Major Gen. Wel- lesley will certainly punish any person who may he found guilty of a bieach of this order. The oflicers commanding coips and the lieads of departments are requested to make the followers bung in forage for the cattle. .Small guards are to he sent with the foragers, and (hey aie to see that they get wiiat may he lequired, and that what is taken is naid for. The excuse that the inhabitants will not sell their foiage will not be allowed : they have lipcii iiifonncd tliat they must sell what is rp([uired, and, if the forage is refused, it must be taken, and the price of it laid down. Commanding officers of corps and heads of dejwitments will receive from the D. A. G. a ropy of Major Gen. Wellesley's proclamation to the inhabitants of the country, wliich may as well be sent out daily with the foragers. The D. A, G. will point out to the corps, which have lately joined, certain orders issued in (his detachment since it leftSeringapatam, which, with others issued since they joined, are to he considered os standing orders ; and the officers commanding brigades will hircct those corps to copy (hem from such otheis in the brigades as may have them. If they are not at length in the orderly books of any of the corps of cavalry, Lieut. Col. ballas will he fuinished with n copy by the D. A. G. Offireui commanding brigades, or their quarter masters, will indent on the commissaiy of stores foi their distinguishing flags and stall's, and on the paymaster for the puckalioa ^'id aihficers allowed. And its the commissary of stores cannot furnish lascars for cairying •he tijgglafls, the officers arc authorized to entertain lascars for that purpose themselves, ngrccahly to the regulations. Major Gen. Wellesley requests that commanding officers will not countersign chitty for ^xtia quantities of arrack, os it cannot be allowed under present circumstances. Capt. Mackay having represented that there is no green forage to be procured in the “‘■'ghbourhood of camp, and that the elephants with this detachment, being principally ’aw elephants from Ceylon, will not eat the dry Junnaloo straw, in quantities sufficient to support them, he is authorized to purchase sugar cane for them, until other green forage can be procured from the river or jungles. 350 INDIA. Mr. Darval has equipped us but badly with servants ; but that is his own affair : he will be the loser if the accounts are not regularly kept. [ take care of the money, which is the principal point, and have it always in front of my tent, under an officer’s guard. I write to Major Robertson also, respecting some shepherds, whom I request he will send with Capt. Baynes to morrow. To Lieut, Gen. Stuart. Camp at Reitlie, 12th March, 1803. I crossed the Toombuddra into the Marhatta territory at Havanoor this morning, and marched to this place, which is upon the Werdah. The inhabitants are all in their villages, and have promised to supply the camp with every thing that the country can afford. I sent off 4 tumbrils to your camp this morning, some of them contain- ing the treasure which remains after paying the troops in this camp, out of the lac of pagodas sent here for that purpose. 1 cannot say exactly what the sum is, as I could not procure any account of it from Mr, Dar- val’s servant. Besides this sum, there arc 30,070^ rupees, belonging to the money allotted to this detachment, in Mr. Piele’s tumbril. It is part of the 80,000 pagodas sent by Mr. Ravenshaw. These rupees were put in Mr. Pielc’s tumbril for the convenience of carriage, and were forgotten by Mr, Darval’s servants. I have, however, retained 30,070^ rupees of tlie surplus money : so that I have in camp 3 lacs of pagodas clear ; and I have written to Mr Piele to request that he will pay Mr. Darval the money which he has in his tumbril. The money tumbrils are all in a very bad state : indeed, 1 am surprised that even one of them lias come on .so far as it 1ms ; and 1 think it very probable that, although einjity, it will not get back to your camp. There are 48 of the Company’s draught bullocks drawing these tumbrils. Those in the cavalry guns cannot be sent yet; as, owing to some mistake be- tween the gentlemen of the cavalry and Capt. Mackay, the bandy with the harness was left behind in the cavalry lines at Gubghurry : but I hope it will join this day, and, if it does, these bullocks will also be sent to you to-morrow. We had some deserting lost night, both of sepoys and followers : many of the bazaar people, and others attached to this bazaar with bullocks, have joined the army. However, we arc well supplied, and, by means of the stores at Hurryhur and Hullihall, I think we shall quit the Malpoorba with every bag full. Lieut. Gen. Stuart to IjOkI Clive. Camp at Hurryhur, 12tli March, 1803. Major Gen. Wellesley, having been intiusted, previously to my arrival on the frontier, with the management of all communications with the Marhatta chieftains, and selected, by your Lordship’s desire, for the command of the advancing detach- ment, has been continued in that management; as I have been desirous to pre- vent the inconveniences wliich would result to his proceedings, from the delays attending references to me on tlio subject of his transactions with the chieftains of the Marliatta state. I have informed Major Gen. Wellesley of your Lordship’s wishes regarding the employment of Major Malcolm ; and I believe no obstacles will occur to impede the exercise of the authority with which your Lordship has judged it jexpedieiu to furnish that officer, of cultivating an intercourse with the Marhatta chieftains, if the progress of affairs should render that measure necessary. INDIA. Extract from ‘The Notes relative to tlie late Transactions in the Marhatta Empire.’ Major Gen. Wellesley commenced his march from Hurryhur on the 9th March, niul crossed the Toombuddra river on the 12th. The progress of the British troops through the Marliatta territories was most successful. They were every where leccived as friends ; and almost all the chiefs in the vicinity of the rpute of the detachment joined with tlieir forces, and accompanied the British army toPoonah. The amicable conduct of the jaghiredars and of the inhabitants (arising princi- pally from the fame which the British arms had acquired in the campaign under Major Gen. Wellesley’s command against Dlioondiah Waugh) contributed to enable our army to perform this long march, at a most unfavorable season of the vear, without loss or distress. ^ Cheat merit is also to be ascribed to the ability, temper, activity, and skill of Major Gen. Wellesley, in directing the system of the supply and movement of the troops, in preventing plunder and all excess, and in conciliating the inha- bitants of the districts througli which his route was directed. '/Vie DJ G. to Lieut. Col. * * * *. Camp near Reitlie, i2lh March, 1803. The tent bearers of your battalion have represented to Major Gen. Wel- lesley that the serjeant major has given them G rupees 2 fanams and GO cash, as their wages for last month, although, as they allege, they agreed for Company’s pay and i)atta. The General, therefore, directs me to observe to you, that he is not surpiised at the frequent rcpoits of desertions of the followers of the 1st batt. 2nd regt., under such circumstances as those above stated; and, further, that if there shall be any more deseition, and the corps .shall be deprived of its proper piopoition of follow'crs of any description, the General will be under the necessity of laying the whole matter before the Commander in Chief, and of recommending that no allowances may he paid for establishments that are not actually kept up. P S —Before I could despatch the foicgoing I received your report of the (losortioii of 4 sepoys and some coolies. The General is concerned at the desertion of so many sepoys from so old an established corps, of which the report would have come more properly through the Brigade Major, but he is not sm prised at coolies deserting who are paid as yours appear to he. To the Goveinor General Karlsgy, ujiGn the Werdah, 13 l1i March, 1803. You will be anxious to hear from me as soon as possible after I have entered tlie Marhatta territory, and I lose no time in writing to you. I crossed the Toombuddra at Havanoor yesterday, and marched to this river, and made another marcli towards Savanore this day. We have been \v<;ll received by the inhabitants of the country : the villages are all full, and the camp is well supplied with forage and provisions ; 1 have no doubt whatever but that I sliall be able to bring forward, for tlie service of the Pesbwali, all the jaghiredars in tlie southern part of the empire ; and I think that all your plans will be carried into execution. This detachment of tlie army is well supplied with provisions, and every thing it can want ; and, excepting in forage, for which every large body uf troops must depend upon the country which is to be the seat of Its operations, is nearly independent of the resources of this country. We owe this state of our supplies to the flourisliing resources of Mysore, and to the case with wliich they are brought forward for the use of the British fo’mics. But any change in tlie system of government in that country Will be immediately felt, and particularly by that body of troops which ''"ib he in advance. I draw your attention to this subject, because I have learned from Gen. Stuart that Lord Clive is going to England immedi- ^l^ely, in tlie United Kingdom; and I suspect that the person who may suc- ceed to him in the government of Fort St. George is not likely to pre- serve matters in Mysore in the state in which they are at present. It is impossible to suppose otherwise than that, after a residence there for 4 years, I have acquired considerable influence in that country, which has lately been exerted to bring forward its resources fur the use of the armies, and will have the effect of keeping this body of troops well sup. plied; but this influence depends upon my retaining the command in Mysore, of which I think it probable that the new government of Madras will wish to deprive me. I had an explanation with Gen. Stuart upon this subject some time ago, and he declared that he was determined that I should exercise the command in Mysore, while in advance with the army, which he chen ima- gined that he should lead into the Marhatta territory. When leaving him, on the 8th of tliis month, I spoke to him upon it, and he desired me to make such arrangements as I might think proper, to enable me to exer* cisc the command in Mysore, while in tlie Marhatta territory. I have submitted to him these arrangements, and he has approved of them. But still I fear the new government of Madras ; one of whose objects, I believe, is to overturn the existing system in Mysore, of which I have hitherto been the principal support. I am willing to resign the command of Mysore as soon as this campaign is over ; but I am anxious that this detachment should be in a state of efficiency and well equipped : it can G. O. Camp near Reitlie, Saturday, 12ih March, 1803. Two active and intelligent sepoys to be selected in each corps of infarUry, and sent as orderlies to Major Gen. Wellesley. They are to be relieved on the Ist day of every month. When tlioic may be any considerable bieach in the line, or any accident may have hap* pned likely to occasion one, which obliges a corps to halt, the odicer commanding the corps in front of which the breach is, or which may be obliged to h.ilt, will order a drviimner to beat the long roll, which IS to be repeated by all corps in fiont of that in which there may be a breach, but not by those in the rear. The officer commanding the corps winch may have boat the long roll will acquaint the officer commanding the brigade to which he belongs of the cause : wlien the long roll shall be beat, all the corps in front of that which shall have beat it will halt. Wlion a corps in front of which there may have lieen a breach in the column shall be at the distance of 200 yards from that which precedes it in column, a drummer is to pass the taps, which are to be repeated by all the corps in front in the column, and the whole are to move forward immediately. As, however, the cattle with this detachment are good, and it is possible without hurrying either them or the troops (a practice which is again positively forbid) to close up any sii)«d interval wliich may occur, without a geneial halt of tlie column, Major Gen. Wellesley requests that officers commanding corps will not pass the long roll, unless it should 1 m) absolutely necessary that the men should halt, to enable their corps to regain their situation. G.A.O. 12th March, 1803. Ill consequence of complaints of the rioting of soldiers in the bazaar, and this day iti the villages, in the neighbourhood of the camp, which may be attended by the worst con- sequences to the detachment, and to the service in general, and the impossibility of know- ing who those soldiers are, and to what regiment they belong, if the jiractice is continued of allowing them to go about, if not dressed as soldiers. Major Gen. Wellesley desires: Ist. That no soldier be allowed to leave his lines, unless dressed as a soldier ought to be, with his side arms, excepting to go to bathe, to play at long buffets, or any other game, in front of the lines. Commanding officers of regiments are requested to give orders to their regimental sentries ujxin this subject; and the guards in camp will, in general, nave orders to stop all soldiers found out of their lines not properly dressed, who shall punished for disobedience of orders. , 2nd. No soldiers are to be allowed to go into the villages, excepting the dragoons wi their foragers, but those dragoons must be dressed in their uniform when on tins du y* Guards of Native infantry are sent to each of the regiments of European infantry, m 8 out with tlieir foragers, purposely that the Eurojicans may not be sent into the vill»g®® that service. INDIA. 353 be well supplied only by the resources of Mysore ; and I am certain of having the use of them only by keeping the command in Mysore in my own hands, I wish, therefore, if it should be possible, that the new go- vernment of Fort St. George may be prevented appointing a person to fill my situation in Mysore while I am absent. I should not have written to you on this subject, as I know that you are unwilling to interfere in matters that concern the subordinate govern- ments, only that the risk of this detachment is great ; and that, if the change is intended, advantage may be taken of Gen. Stuart’s absence from Madras to effect it. If he should be consulted, or should have time to give his opinion, I know that he will object to the measure. Malcolm had not, yesterday, reached Gen. Stuart’s camp at Hurryhur. I hear nothing of any of Holkar’s troops, and 1 do not know that we have an enemy in this country. To Lieut. Gen. Stuart. Camp at Karisgy, 13th March, 1803. The handy, with the harness, arrived in camp yesterday, after I wrote to you; and to-morrow I shall send you the bullocks which have been employed in drawing the cavalry guns. I heard yesterday evening that one of the empty treasure tumbrils had broken down near Oollull ; at which, indeed, I am not astonished, as it has been in a very bad state ever since it came from the army. 1 lind that the brinjarries like the mode of filling the bags at the stores so well, and are so active in carrying it into execution, that I think it probable that I shall be able to advance from the Malpoorha with every bag full. In that case, it will be necessary that I should have 500 bullocks more to carry on the salt beef, and 400 kegs of arrack in store at Hulli- liall, and sent from Bombay. I have accordingly arranged with the bullock owners in this camp to raise that number, which they say they can procure with great ease. I write to your secretary on this subject. 1 have a letter from Seringapatam, by which I learn that 4 carriages, for 0 pounders, with brass naves, are preparing at that place. Do you wish tliat they should be sent to your camp ? 1 enclose a paper of intelligence received from Sir W. Clarke. Ram Hao, who re.sidcs at Darwar, wrote, on the 4th, that Bappojee Scindiah was in Darwar with his troops, and much afraid of being attacked ; and he did not allude, in the most distant manner, to this agent of Holkar, nor have I received an account of him from any body else. It is very im- probable that Bappojee Scindiah will give up his fort to a Bramin sent to take it without troops. If his disposition be thus friendly to Holkar, he would probably be the fittest person for Holkar to leave in charge of the ^^ort, and it would not be necessary to send any other to take it. There- I do not believe that this intelligence of Sir W. Clarke’s is true. But if it should be true, it is a matter of some consequence. The ques- ill that case, will be, whether we ought not to send for Ball Kishen Ciungurdhur, and call upon the present possessors of the fort to give it up jo him, as the killadar appointed by the Peshwah. With such a force as have, and with all the people of the country on our side, I do not think lhat they would refuse it ; or, if they did, it is, in fact, not a strong place, vom I. . 2 a 351 INDIA. nor one which would take much time to reduce. I should be glad to be favored with your directions upon this subject. I have proceeded hitherto, in regard to Darwar, in this manner: I wrote to Ram Rao, and desired him to calm the apprehensions of Bappo- jee Scindiah ; to assure him that I was not ordered to attack him, or any body that did not molest the British troops ; that the English were the allies of the Peshwah, and that all we required from the country was, to be treated as friends by his officers and servants, and to enjoy our share of its resources, which were necessary to us. I, at the same time, gave him a hint that the Peshwah’s orders, whatever they were, must be obeyed ; and I did this, lest, notwithstanding the late orders of the Governor of Port St. George, and your present intention that Bappojee Scindiah should not be attacked, the Peshwah should press the taking possession of the fort for Ball Kishen Gungurdhur, and that it should consequently be necessary to attack it with British troops. As 1 do not credit this intelli- gence of Sir W. Clarke’s, I shall still proceed upon the same principle in all my communications with Bappojee Scindiah ; and as he is a clever fellow, it is not improbable but that, if not already in the hands of Holkar, we may make him our friend, and the fort may be as useful to us in his hands as if it were in our own. To Col. Stevenson. Camp at Det)gheTry, 14th March, 1803. 1 arrived here this morning, and I propose to continue my marches forward on the day after to-morrow. You will probably have received, from Gen. Stuart, a copy of my instructions, in which I am urgently desired to take the earliest opportunity of effecting a junction with you. You will observe, however, that other object are also held out to my attention ; the collection of, and junction with, the southern jaghiredars, and the junction with the Peshwah, should his Highness come to Meritch. At present, I think that none of these objects are incompatible. I can collect and join myself with the southern jaghiredars on my road towards you ; and if his Highness should come from Bassein, and join his army upon the Kistna, I can also join myself to him. The only inconveniences attending these different objects are, that they will take time, and that 1 cannot fix that at which I shall be in your neighbourhood. However, every thing cannot go on as we could wish. I shall make you acquainted in this letter with my intentions, as far as I can determine them, and you must make your own calculations where I cannot. I intend to march to Meritch on the Kistna, by the route of DarwaV, Belgaum, and Chickoree. I shall be at Darwar on the 22nd, at Belgaum on the 27th, at Chickoree on the 1st of April, and at Meritch on the 5th. All this, however, will depend much upofi my being able to find water on the road, of which I have not very favorable accounts. If I should be able to go by the proposed road, and should not be obliged to deviate from it to find water, I shall certainly make the marches above stated. How^ long I shall be obliged to remain at Meritch, God knows ; but my route to join you ought to be by Punderpoor. I do not know yet whether there is a road direct from Meritch to Punderpoor, or th^ nature of it ; but I imagine there must be one. At all events, there w INDIA. 305 the circuitous road by Beejapoor, mentioned in Moore^s book, on which I shall certainly be able to march. When once I arrive upon the Beemah, our junction will not be very difficult. To Lieut. Gen. Stuart. Camp at Deogherry, lOtli March, 1803. I arrived here yesterday, and halted this day, to give some rest to my brinjarries, who have joined, with Capt. Baynes. Ball Kishen Letchma, one of the Putwurdun family, arrived in this camp yesterday evening, and gives the strongest assurances of the cordial co-operation of all the sirdars of that family, in our measures for the restoration of the Peshwah’s government. Govind Rao also, who was employed by me, by your desire, for the purpose of ascertaining the dispositions of the different chiefs in the same cause, gives a most favorable account of tlicm. He had seen the killadar of Darwar, Bappojee Scindiah, who told him that it was reported that the British troops were to attack the fort ; that it was not necessary to attack it; for, if we wanted it, he would withdraw, with his family, and would give it up. The garrison is very small, consisting of about 500 horse and 1000 peons, ill paid; and Govind Rao has no doubt whatever but that the fort would be given up upon our demand of it. I have sent off the letters to the different sirdars, and have written to each to inform him of my approach, and to desire lie would join me. Upon a perusal of the letters respecting the killadary of Darwar, I do not find that any mention is made, in the copy which I have got, of the delivery of the fort to the officer commanding the British troops. It may be mentioned, however, in the sealed letter to Ball Kishen Gungurdhur. Under these circumstances, I have many doubts whether it would be ])ropcr to take any steps to get possession of this fort, even if the measure had been left to my discretion ; which, as you have desired to have my opinion upon all points, I shall detail to you. The advantage of having this fort is the security it would give to our rear, and the hold which it would give us of ihe country. In case of an accident, also, it might be ruinous to us if in the hands of an enemy. In respect, however, to these advantages and benefits, I have to observe, that, so long as your army remains upon the frontier, we shall enjoy them, whether we have the fort or not, supposing that the killadar should not he decidedly hostile to us ; and if he should be so, or should become so, and if any accident should happen to us, it would always he in your power to get possession of that fort. On the other hand, it may not be so certain that Bappojee Scindiah is hiclincd or willing to give up this fort; and if it is asked for and refused, it must he taken. To take it will not require time, hut it may occasion rtif* loss of lives : there will be some wounded, at all events, and it would be necessary to halt, to make arrangements for establisliing an hospital and a garrison in it. At the same time, I have no doubt whatever but that, to take the fort, particularly if the killadar is friendly to us, and gives promises and security that he will not interrupt our communication, 'vill occasion great jealousy of our views among the jaghiredars, and will inake them less hearty in our cause. This will be the case, particularly 2 A 2 35C INDIA. if it be true that tlie Peshwah has not given an order to Ball Kishen Gungurdhur to deliver the fort to the British commander; which order certainly does not appear in the copy of the letter to that chief ls*an8mitted to me. Upon the whole, therefore, I think that to ask for the fort is attended with risk ; that even to have possession of it may be disadvan- tageous to the line of measures which are carrying on ; and that all the advantages which can be expected from the possession of it will be ours, whether we have it or not, in consequence of your position on the frontier. A salute in your camp was heard here this morning, by which I con- clude that Malcolm is arrived : I do not, therefore, delay to send off this letter. To Major Doolan. Camp at Deogherry, 15th March, 1803. I received this morning your letter of the 13th in answer to mine of the 9th. I rather believe that the bulli»?i)is, &c., which I shall send for the supplies to Hulliliall, will arrive there*^: the 20th inst. The arrack kegs, which I mean should be sent to the detachment, are those containing 4 gallons each which come from Bpmbay, but not those of a larger size. There ought to be 400 of these, I shall require with the detachment, besides the articles detailed in my last letter of the 9th, 2000 gunny bags. If you should not be able to procure these from the paymaster’s servant, you will be so kind as to send Q Camp at DeoKlierry, Tuesday, 15th March, 1803 The (Iclachment to march to-morrow morning by the left; baggage on the left. The gerifral to beat at a tpiarter past 4 o'clock, and the assembly at a quarter past 5. The cavalry to form the advance, and will cross the river by a ford on tbeir left: they are to be followed by the details of infantry comingim piquet, under the field officer of the day, which will cross the river by the ford o» the left of the infantry. 50 pioneers to march with advance^ 100 at the head of the coluiTin of iiiftiotry, and the remainder of the corps not attaclied to departments with tiie park. The yiark and the wheel carriages in the provision department to follow the line of infantry. T b^ piquets now on duty to lorm the rear guard. , - v The quarter masters, &c., to meet the Acting D. Q. M. G. at the bead of 'the line on the march. .11 mu In future the soldiers are to receive their 2 drams at 2 differej^mes in the day. Iney will receive the first dram on marching days upon their arrrWI’^ groinid ot encam])raent, and on halting days at daylight in the morning, at the flag ()f the'tsamaiMajy of provisions, as at present. At the same time the second dram for each man delivered to the charge of the quarter masters, who will send the quarter master serjeaftts, or other trusty persons, to receive it. , .. The commissary of provisions will issue kegs to the quarter masters of regiments^ui which tlie arrack is to be kept in the regimental lines, under such a guard as the com* manding officers of regiments m.ay think proper to appoint; and the second drams be issued to tlie soldiers in their lines at the hours which the commanding officers of regi- ments may think most proper. - , n u uoArl The commissary of provisions will arrange that a sufficient number of bullocks auact.r to his department may attend the quarter masters of the 19th light dragoons, the arji‘ier) » the 74(h, and Scotch brigade, to carry the kegs on the line of march, and to more them and from the flag at the commissary of provisions when necessary. , The quarter masters will be so kind as to take care that the kegs which will to them are tilled with water as soon as emptied of arrack, in order to prevent their oe ” The arrack is to be delivered to the*19th light dragoons near the rear of ^ regiment by a conicoply, who will be sent there for that purpose; and Capt. J ^ take care that draught bullocks attend at the flag of the commissary of provisions ro r this arrack on halting days before daylight, and on marching days at the mome arrack shall reach the new ground of encampment. INDIA. 357 me that number of the bags which will have contained the rice which you will issue to the people whom I will send for it, or you will take them from the rice which will remain there. order to carry these empty bags to the detachment, or for other purposes, some bullocks may be re- quired j and I request you to call upon the amildar to be prepared with assistance of this kind, which I promise to send back to him from the Malpoorba. The number of bullocks which I may require may be 500. I have not yet decided whether I sjiall come upon the Malpoorba at Doodwar or at Turmoory. I request you to get an account of the road to the latter. To Major Doolati. Camp at Kandegy, 16th March, 1803. You will be so kind as to forward the enclosed letter to Sir W. Clarke by express. In my letter of yesterday I omitted to mention to you that I wished you to have cut, and ready to be forwarded to my camp, by people whom I shall send for them^O bamboos, each of 30 feet long : they are intended to make laddera^'^ To Lieut. Col. Close. Camp at Kandegy, 16th March, 1803. I have the pleasure to inform you that I am getting on as well as I could wish. On account of the want of water on the direct road from llurryhur to Savanorc, I have been obliged to come by a circuitous route, which has detained me longer than I should otherwise have been ; but I expect to be at or near Darwar on the 21st or 22nd, at Belgaum on the 27th, and at Meritch on the 5th April. From thence, even if obliged to go by Punderpoor, to join Col. Stevenson, I shall be at Poonah before the time at which I told you, in mv letter of the 1st Jan,, that I thought it probable that Gen. Stuart wdui® arrive there with his army. My cattle are in good cruder ; 1 get plenty of forage ; and 1 have little doubt of bringing up my detachment in good style, at least as far as the Kistiia. Our cattle* afterwards will depend upon the state of the country for forage, of which, particularly in the neighbourhood of Poonah, I have but bad accounts. I have sonyjj^ BertUVah’s letters to the sirdars to whom they were ad- dressed, -with a short letter from myself, stating that 1 had entered the country with the army, and was anxious to be joined by them. I also enclosed them a copy pf my proclamation on entering the country. To these letters sufficient time has not yet elapsed for me to receive answers ; but, by the accounts which I have received from Govind Rao, of the dis- position of all the chiefs in this part of the empire, and from the letters which I have from Goklah, the Putwurdiin, and others of inferior note, I have little doubt that all will come forward in the Peshwah’s service in this crisis. You shall hear from me as soon as I receive any answers to letters. The people of the country have received me well ; my communication IS perfectly free and secure, and the camp is supplied with all that the country affords. I believe that my passport is the only safe conduct through the country at the present moment. I enclose a copy of my proclamation, also a copy of a memorandum from Appah Saheb, and one 358 INDIA. from Goklah, with my answers. You will have observed, in my instruc- tions, that Gen. Stuart has desired me not to attempt to tajce Darwar. I think that place of great importance in a military point of view ; but as this expedition of mine partakes as much of politics as of military opera- tions, I am of opinion that it is best I should not meddle with Darwar ; particularly as in case of accident, or if the killadar should misbehave, or attempt to use the means given him by the position of his fort to annoy my communication with Mysore, Gen. Stuart will be at hand to take his fort from him. I observe that the copy of the letter from the Peshwah to Ball Kishcn Giingurdhur, which I Iiavc got, does not contain the orders to deliver the fort to the British commander. They may, however, he in the sealed letters which I have sent to that chief. The fort of Darwar gives such a hold of this country, that the pos- session of it by us, in any manner, would create great jealousy of our views in the minds of all the chiefs; but it would do this particularly if we were to hike possession without communication with Ball Kishen Gungurdhur, who is I don’t know where, and without the Peshwah’s orders to him to deliver it.
| 31,190 |
https://github.com/yitianxue333/react-native-avatar-inspection-phase1/blob/master/js/components/lib/index.js
|
Github Open Source
|
Open Source
|
Apache-2.0
| 2,018 |
react-native-avatar-inspection-phase1
|
yitianxue333
|
JavaScript
|
Code
| 9 | 34 |
export class URLclass {
static url = "http://globalfundsolutions.com/avatar_inspection/ContractorInspection/"
}
| 18,563 |
https://openalex.org/W4214507835
|
OpenAlex
|
Open Science
|
CC-By
| 2,021 |
Communication across maternal social networks during England’s first national lockdown and its association with postnatal depressive symptoms
|
Sarah Myers
|
English
|
Spoken
| 16,273 | 28,793 |
Communication Across Maternal
Social Networks During England’s
First National Lockdown and Its
Association With Postnatal
Depressive Symptoms Sarah Myers1,2* and Emily H. Emmott1
1 UCL Anthropology, University College London, London, United Kingdom, 2 BirthRites Independent Max Planck Research
Group, Max Planck Institute for Evolutionary Anthropology, Leipzig, Germany Sarah Myers1,2* and Emily H. Emmott1
1 UCL Anthropology, University College London, London, United Kingdom, 2 BirthRites Independent Max Planck Research
Group, Max Planck Institute for Evolutionary Anthropology, Leipzig, Germany Postnatal/postpartum
depression
(PND/PPD)
had
a
pre-COVID-19
estimated
prevalence ranging up to 23% in Europe, 33% in Australia, and 64% in America, and
is detrimental to both mothers and their infants. Low social support is a key risk factor
for developing PND. From an evolutionary perspective this is perhaps unsurprising, as
humans evolved as cooperative childrearers, inherently reliant on social support to raise
children. The coronavirus pandemic has created a situation in which support from social
networks beyond the nuclear family is likely to be even more important to new mothers,
as it poses risks and stresses for mothers to contend with; whilst at the same time, social
distancing measures designed to limit transmission create unprecedented alterations to
their access to such support. Using data from 162 mothers living in London with infants
aged ≤6 months, we explore how communication with members of a mother’s social
network related to her experience of postnatal depressive symptoms during the first
“lockdown” in England. Levels of depressive symptoms, as assessed via the Edinburgh
Postnatal Depression Scale, were high, with 47.5% of the participants meeting a ≥11
cut-off for PND. Quasi-Poisson regression modelling found that the number of network
members seen in-person, and remote communication with a higher proportion of those
not seen, was negatively associated with depressive symptoms; however, contact with
a higher proportion of relatives was positively associated with symptoms, suggesting
kin risked seeing mothers in need. Thematic qualitative analysis of open text responses
found that mothers experienced a burden of constant mothering, inadequacy of virtual
contact, and sadness and worries about lost social opportunities, while support from
partners facilitated family bonding. While Western childrearing norms focus on intensive
parenting, and fathers are key caregivers, our results highlight that it still “takes a village”
to raise children in high-income populations and mothers are struggling in its absence. Keywords: postnatal depression, COVID-19, social distancing, lockdown, mothers, cooperative breeding,
maternal social networks ORIGINAL RESEARCH
published: 11 May 2021
doi: 10.3389/fpsyg.2021.648002 Edited by: Edited by:
Marjorie L. Prokosch,
University of Florida, United States Reviewed by:
Jessica Ayers,
Arizona State University, United States
Kristin Snopkowski,
Boise State University, United States *Correspondence:
Sarah Myers
[email protected] Specialty section:
This article was submitted to
Evolutionary Psychology,
a section of the journal
Frontiers in Psychology Received: 31 December 2020
Accepted: 12 April 2021
Published: 11 May 2021 INTRODUCTION postnatal period is often acknowledged in public health literature
as a “vulnerable time” for mothers where they require high
levels of support (Barlow, 2015; Johnston-Ataata et al., 2018). In Western contexts, despite the nuclear-family and intensive
parenting norms (Faircloth, 2014; Sear, 2017) where fathers
are key allomothers (Emmott and Mace, 2015; Emmott et al.,
2020), public health literature shows that wider social support
remains important for a range for postnatal health indices
including maternal mental health (Crockenberg, 1981; Raj and
Plichta, 1998; Beck, 2001; Kinsey et al., 2014; Yim et al., 2015;
Emmott et al., 2020). Postnatal or postpartum depression (PND/PPD) is the term given
to a bout of Major Depressive Disorder which has onset during
pregnancy or within 4 weeks of birth (APA, 2013), though in
practice it is applied to depression occurring within the first
year from birth (Stowe et al., 2005; Halbreich and Karkun, 2006;
Skalkidou et al., 2012). PND had a pre-COVID-19 estimated
prevalence ranging up to 23% in Europe, 33% in Australia, and
64% in the United States (Arifin et al., 2018). PND predisposes
mothers to future bouts of depression (Solomon et al., 2000), and
becomes chronic in 38% of women (Vliegen et al., 2014). )
The COVID-19 pandemic has created a situation in which
support from beyond the nuclear family is likely to be even
more important to new mothers, as it poses actual and perceived
health-related risks and stresses for mothers to contend with. At
the same time, social distancing measures designed to limit viral
transmission created unprecedented alterations to their access to
such support. On the 23rd March 2020, England entered its first
“national lockdown” following the increasing spread of COVID-
19, where the government imposed social distancing measures
requiring that individuals stay at home (unless exercising,
shopping for food, or seeking medical attention), closed non-
essential businesses and childcare facilities/schools, and banned
public gatherings of more than two people. These measures
remained in full force for almost 3 months until 14th June
2020, and likely impacted the social interactions of postnatal
mothers in two primary ways: Firstly, by limiting in-person
contact beyond the household, many women were no longer
allowed to see their own mothers and other family members,
as three-generation households containing young children are
rare in the United Kingdom (Pilkauskas and Martinson, 2014). INTRODUCTION Family members, particularly maternal grandmothers, have
been identified as important sources of childcare and domestic
help in the United Kingdom (Emmott et al., 2020), meaning
lockdown likely reduced the availability of practical support
for mothers. Second, as antenatal classes and mother-baby
groups were either cancelled or moved online during lockdown,
potential interactions between new “mummy friends” were likely
prevented, particularly for women giving birth after lockdown
commenced. As female social networks often change in the
perinatal period, with new supportive connections built with
other women at a similar stage of pregnancy or motherhood
(Nolan et al., 2012; Strange et al., 2014), this likely led to
reduced social network connections among mothers, curtailing
peer support. Although the cooperative childrearing literature
typically focuses on female kin as key supporters on the grounds
of inclusive fitness, who provides support appears to be flexible
(Sear, 2021). New mothers benefit from reciprocal exchange
of mothering-related support acts with non-related women at
a similar stage of motherhood (Price et al., 2018; Finlayson
et al., 2020). While there is limited data available on maternal
social networks, mummy friends are likely to be particularly
important in Western contexts where individuals frequently live
long distances from kin. O
ll l
kd
l d
bl
“
l”
hild
i (
g
)
While the evolutionary, ultimate function of depression is still
under debate (Nettle, 2004; Hahn-Holbrook and Haselton, 2014;
Myers et al., 2016, 2017; Hagen and Thornhill, 2017; Raison and
Miller, 2017; Rantala et al., 2018), PND is associated with costs
for both mothers and their children. For example, it inhibits a
mother’s ability to care for herself and her infant (Downey and
Coyne, 1990; Boath et al., 1998), and is associated with increased
risks of a range of inflammation-related illnesses (Mykletun et al.,
2009; Keicolt-Glaser and Glaser, 2002). PND is also associated
with deficits in a range of children’s cognitive, social, and physical
developmental outcomes (Cogill et al., 1986; Gelfand and Teti,
1990; Murray and Cooper, 1997; Beck, 1998; Wright et al., 2006),
mediated in part by poorer mother-infant relations (Beck, 1995;
Murray et al., 1996; Murray and Cooper, 1997; Coyl et al., 2002;
Moehler et al., 2006; O’Hara and McCabe, 2013) which may
last a life-time (Myers and Johns, 2018). Citation: Myers S and Emmott EH (2021)
Communication Across Maternal
Social Networks During England’s
First National Lockdown and Its
Association With Postnatal
Depressive Symptoms. Front. Psychol. 12:648002. doi: 10.3389/fpsyg.2021.648002 May 2021 | Volume 12 | Article 648002 1 Frontiers in Psychology | www.frontiersin.org Lockdown Communication and Postnatal Depression Myers and Emmott Frontiers in Psychology | www.frontiersin.org INTRODUCTION Low social support, as noted, is known to
increase the risk of PND, and social isolation also has strong
links with depressive onset more generally (Lakey and Cronin,
2008). Therefore, it is crucial to understand the impact of social
distancing measures on maternal mental health and the degree
to which remote methods of communication are able to buffer
against the detrimental consequences of reduced face-to-face
contact. Here we explore how contact and communication within
a mother’s social network relates to her experience of postnatal
depressive symptoms during the first national lockdown in
England. We focus on the experience of mothers in London – the
initial epicentre of COVID-19 in England. This is due to our pre-
existing project on maternal social networks in London, which
was adjusted with the announcement of a national lockdown to
investigate the impact of social distancing measures on maternal
postnatal wellbeing. Postnatal depressive symptoms were assessed via self-report
using the Edinburgh Postnatal Depression Scale (EPDS; Cox
et al., 1987). The EPDS is the most commonly used screening
tool for PND; it consists of ten items and gives a score out of
30, with a higher score indicating higher depressive symptoms. Participants were asked to report their personal social networks
by listing everyone who is important to them, up to a maximum
of 25 alters. For each alter, participants reported their age, gender,
relationship, parental status, and age of their youngest child if
relevant. They then reported who in their network they had seen
in person, and who they had spoken to or messaged remotely
(via phone, video calls, WhatsApp, Facebook, etc.) in the last few
weeks. We also collected a range of demographic variables (See
https://osf.io/k5whj/ for survey materials.) In total, the survey
took around 15 min to complete. Women were eligible to take part if they lived and gave birth
in London, England, with a child aged 6 months or under at
the time of the survey. We took an opportunistic approach to
recruitment, advertising the study via social media platforms such
as Facebook and Twitter (social networking sites). For Facebook,
study adverts were posted on local mums/parents groups, local
residents groups, and national baby groups. Studies have shown
that social media survey recruitment can lead to an increased
proportion of middle-class participants (Topolovec-Vranic and
Natarajan, 2016). INTRODUCTION Maternal mental health
has increasingly been on the public health agenda due to the
physiological and psychological consequences for mother-infant
dyads, but also because of fiscal concerns – with the long-term
costs of maternal mental health issues in the United Kingdom
alone is estimated at £8.1 billion per 1-year cohort of births
(Bauer et al., 2014). The full impact of the ongoing COVID-19
pandemic on maternal mental health is yet to be determined,
but a picture of increased PND prevalence is rapidly emerging
(e.g., see Davenport et al., 2020; Hessami et al., 2020; Spinola
et al., 2020; Thayer and Gildner, 2020; Wu et al., 2020). As
waves of COVID-19 continue to occur, it is crucial to understand
how mothers are being impacted and what might mitigate their
exposure to PND risk factors – here we take an evolutionarily
informed focus on one such key risk factor, low social support
(Beck, 2001; Yim et al., 2015; Doyle and Klein, 2020). From an evolutionary perspective it is perhaps unsurprising
that social support plays a role in maternal mental health,
as humans evolved as cooperative childrearers where mothers
require allomaternal support from kin and non-kin for successful
reproduction (Hrdy, 1999; Hill et al., 2011; Dyble et al., 2015;
Page et al., 2017; Emmott and Page, 2019). While the sources
and nature of support vary across cultures, allomother [i.e.,
caregivers other than the mother (Hrdy, 1999)] presence and
investments are generally associated with better maternal-child
wellbeing (Sear et al., 2003; Gibson and Mace, 2005; Sear and
Mace, 2008; Sear and Coall, 2011; Meehan et al., 2014). Mothers
with infants are hypothesised to be particularly dependent on
allomaternal support due to the high direct care needs of
infants (such as prolonged carrying and high feeding frequency)
which conflict with other activities (Hrdy, 1999); indeed, the Overall, lockdown led to a notably “unusual” childrearing
environment even in Western contexts with strong nuclear
family norms, limiting mothers access to allomother support
beyond the nuclear family. Others have argued that lockdown May 2021 | Volume 12 | Article 648002 Frontiers in Psychology | www.frontiersin.org 2 Lockdown Communication and Postnatal Depression Myers and Emmott measures would be highly detrimental for families with children
(Arnot et al., 2020), particularly for mothers with infants (Doyle
and Klein, 2020). INTRODUCTION In order to track the age and educational
background of women who were signing up (thereby allowing
us to adjust recruitment strategy), eligible women were first
required to register their interests on our study site; however, due
to time constraints, all eligible women were eventually invited
via email to complete the survey. Participants were given a £5
voucher upon completion of the survey as a token of thanks. Multiple entries were prevented using IP-address checks. Ethical
approval for the survey was obtained from the UCL Research
Ethics Committee (ref. 14733/002). Sample Characteristics p
Mothers in our sample ranged in age from 19 to 47 years (mean
34.6, SD 4.2); half were first-time mothers (50.6%), while for
40.1% of women their infant was their second, 7.4% their third,
and 1.9% their fourth child. The mean age of focal infant at the
time of survey was 110 days (SD 56.6), with 115 infants born
before 23rd March 2020, and 47 born after. Males comprised
54.3% of infants. The majority (53.7%) of births were reported
to be uncomplicated, 34.6% associated with self-defined minor
complications, and 11.7% major complications. The majority of
infants were white (71.0%), 23.5% were of mixed ethnicity, and
5.6% were of other ethnicities. Only two participants reported
not having a partner. Thirty-four percent reported an annual
household income before tax of £0–75K, 19.8% £75,001–100K,
and 34.6% over £100k (10 participants reported not knowing or
preferring not to say, nine did not respond; see Supplementary
Material for a detailed breakdown); the financial situation of
the household had become worse during the pandemic for
29.0% of participants. The majority (87.0%) of participants
were not socially isolating (i.e., staying at home and not going
out because they or a household member had coronavirus
symptoms or were vulnerable/at high risk) at the time of the RESEARCH AIMS Here we take an exploratory approach to understand how social
support networks existed during England’s national lockdown
amongst London mothers, and their associations with postnatal
depressive symptoms. Specifically, we explore: (Q1) Who did
mothers keep in contact with during lockdown and how (in-
person vs. remote communication)?; (Q2) Did characteristics
of maternal social networks during lockdown vary by timing
of birth in relation to lockdown?; (Q3) How did maternal
social network characteristics and social communication during
lockdown associate with self-reported depressive symptoms
assessed via the Edinburgh Postnatal Depression Scale (EPDS;
Cox et al., 1987)? We conduct a concurrent design mixed-method
study (Leech and Onwuegbuzie, 2009) where quantitative and
qualitative analyses were carried out at the same time. Using self-
reported social network data, we quantitatively describe maternal
support networks and analyse their associations with indicators
of PND. In parallel, we thematically analyse open-text data
from the survey to explore and understand the lived experiences
of mothers with infants during England’s first lockdown. Both studies were preregistered before analysis (Quantitative
study1 and Qualitative study)2 and minor deviations from
our preregistered methods are outlined in the Supplementary
Material 1. Finally, we synthesise the quantitative and qualitative
findings to provide further insight. 2https://osf.io/82bwj 1https://osf.io/cse4a
2https://osf.io/82bwj About the Survey We use cross-sectional social network data from 162 London-
based mothers with infants aged ≤6 months, collected in May–
June 2020 (covering the first lockdown in England) using the
formr online survey platform v.0.18.0 (Arslan et al., 2020). May 2021 | Volume 12 | Article 648002 Frontiers in Psychology | www.frontiersin.org 3 Lockdown Communication and Postnatal Depression Myers and Emmott TABLE 1 | Table shows a summary overall personal network characteristics of the sample, along with a summary of patterns of communication with network alters
(N = 162). About the Survey sample 47.5% and 34.6% of women, respectively, met these
criteria for PND. survey. For a detailed breakdown of sample characteristics see
Supplementary Material 2. sample 47.5% and 34.6% of women, respectively, met these
criteria for PND. The full social network characteristics of participants can be
seen in Table 1; on average, participants’ personal networks
contained 11 alters, composed of 47.8% kin and 14.7% mummy
friends (female non-kin with infants aged 18 months or under). QUANTITATIVE ANALYSES OF SURVEY
DATA g
Levels of depressive symptoms were high in our sample. Typically, EPDS scores in the general population are heavily
skewed to the lower end of the scale (Alvarado et al., 2015;
Coll et al., 2017; Martin and Redshaw, 2018; Smith-Nielsen
et al., 2018; Boran et al., 2020); however, in our sample,
they approximated a normal distribution with a mean of
10.4 (SD 4.7) (Figure 1 and Supplementary Figure 1). While
comprehensive descriptive statistics of EPDS scores are rare in
the literature, a pre-pandemic mean of 6.4 (SD 6.9) has been
reported for English mothers at 3 months post-birth (Martin
and Redshaw, 2018) and one of 7.2 (SD 4.4) among first-
time Irish mothers at 6 weeks post-birth (Leahy-Warren et al.,
2012). Our sample EPDS scores are therefore relatively high,
and this elevation appears similar for women giving birth before
23rd March (mean 10.7, SD 4.9) and after (mean 9.9, SD
4.4), with little evidence of a correlation with days since birth
(Supplementary Figure 3). A recent meta-analysis of EPDS
usage recommends a cut-offof ≥11 to identify most women
who would meet diagnostic criteria for PND and ≥13 for
those with higher symptom levels (Levis et al., 2020); in our About the Survey Measure
Full sample
Time of birth in relation to 23rd March (before/after)
Range
Mean (SD)
Median
Range
Mean (SD)
Median
Overall network characteristics
Total number of alters
n
1, 15
11.4 (6.8)
10
2, 25/1, 25
11.9 (6.9)/10.1 (6.3)
10/9
Kin
n
1, 15
4.6 (2.5)
4
1, 15/1, 14
4.7 (2.5)/4.5 (2.5)
4/4
Mummy friends
n
0, 10
1.9 (2.2)
1
0, 10/0, 9
2.2 (2.3)/1.3 (1.9)
1/1
Seen in person in the last few weeks
Total number of alters
n
1, 14
3.9 (2.9)
3
1, 14/1, 11
3.9 (2.9)/4.0 (2.7)
3/3
%
4.5, 100
40.9 (26.2)
33.3
4.5, 100/10.0, 100
38.7 (24.8)/46.4 (29.1)
33.3/40
Kin
n
1, 10
2.3 (1.6)
2
1, 10/1, 7
2.3 (1.6)/2.4 (1.7)
2/2
%
10, 100
57.2 (31.6)
50
10, 100/14.3, 100
55.7 (31.0)/61.0 (33.2)
50/50
Mummy friends*
n
0, 5
0.5 (0.9)
0
0, 5/0, 4
0.6 (1.0)/0.4 (0.8)
0/0
%
0.0, 100
31.2 (36.8)
20
0.0, 100/0.0, 100
30.9 (36.2)/32.1 (39.4)
20/5.6
Communicated with remotely in the last few weeks
Total number of alters
n
1, 25
10.8 (6.4)
10
1, 25/1, 23
11.4 (6.6)/9.4 (5.6)
10/8
%
50.0, 100
95.4 (8.9)
100
50, 100/61.1, 100
95.6 (8.7)/95.0 (9.4)
100/100
Kin
n
0, 15
4.4 (2.5)
4
0, 15/0, 9
4.5 (2.6)/4.1 (2.1)
4/4
%
0.0, 100
94.5 (15.9)
100
0.0, 100/0.0, 100
95.2 (15.2)/92.9 (17.4)
100/100
Mummy friends*
n
0, 10
1.8 (2.1)
1
0, 10/0, 8
2.1 (2.2)/1.2 (1.8)
1/1
%
42.9, 100
98.0 (9.1)
100
42.9, 100/88.9, 100
97.4 (10.4)/99.6 (2.2)
100/100
Communicated remotely but not seen in the last few weeks
Total number of alters
n
0, 22
7.1 (5.3)
6
0, 22/0, 14
7.7 (5.6)/5.7 (4.0)
6/5
%
0.0, 100
56.9 (25.8)
60
0, 100/0, 90
59.3 (24.5)/51.0 (28.2)
64.3/57.1
Kin
n
0, 11
2.3 (2.2)
2
0, 11/0, 6
2.4 (2.3)/1.9 (1.9)
2/2
%
0.0, 100
42.3 (32.0)
50
0.0, 100/0.0, 100
44.1 (31.2)/37.9 (33.8)
50/33.3
Mummy friends*
n
0, 8
1.3 (1.6)
1
0, 8/0, 7
1.5 (1.8)/0.9 (1.5)
1/0
%
0.0, 100
66.8 (37.7)
75
0.0, 100/0, 100
66.5 (37.4)/67.5 (39.2)
75/88.9
*Sample size for percentages is 107 as some participants reported no mummy friends. TABLE 1 | Table shows a summary overall personal network characteristics of the sample, along with a summary of patterns of communication with network alters
(N = 162). Frontiers in Psychology | www.frontiersin.org Quantitative Analyses Methods Here we address the questions: (Q1) Who did mothers keep in
contact with during lockdown and how (in-person vs. remote FIGURE 1 | Histogram showing the distribution of Edinburgh Postnatal
Depression Scale (EPDS) scores (N = 162). FIGURE 1 | Histogram showing the distribution of Edinburgh Postnatal
Depression Scale (EPDS) scores (N = 162). May 2021 | Volume 12 | Article 648002 Frontiers in Psychology | www.frontiersin.org 4 Lockdown Communication and Postnatal Depression Myers and Emmott communication)?; (Q2) Did characteristics of maternal social
networks during lockdown vary by timing of birth in relation
to lockdown?; and (Q3) How did maternal social network
characteristics and social communication during lockdown
associate with Edinburgh Postnatal Depression Scale scores? following potential confounds influencing PND risk and/or social
network characteristics to determine the control variables in our
models: remote communication with social contacts, network
size, partnership status, age of the mother, age of the infant,
birth complications, infant sex, parity, has financial situation
become worse since COVID-19, socially isolating at time of
survey, infant’s ethnicity, household income, and time of birth in
relation to lockdown. To address Q1, we quantitatively described social network
characteristics and patterns of communication with network
members. We also quantified the number and percentage of
participants having either in-person or remote communication
with the following key supporters: their own mother, their
partner/infant’s father’s mother, a mummy friend. We also report
post hoc exploration of in-person communication with kin by
type (i.e., consanguineal vs. affinal), to shed light on findings
in relation to Q3. Our model selection strategy was preregistered before
exploratory analyses were conducted and stemmed from the base
directed acyclic graphs (DAGs) in Supplementary Figures 2A,B,
from which we used the R package dagitty (Textor et al.,
2016) to select our control variables; the rationales for the
relationships between our variables assumed in these DAGs
are outlined in Supplementary Material 1. We ran a single
control variable selection process using data relating to all
alters, assuming the communication variants for (i) all alters,
(ii) kin, and (iii) mummy friends share relationships with
our potential confounds. From this starting point, we first
updated the base DAGs based on the sample characteristics
determined by exploratory analysis, and then assessed whether
the implied conditional independencies from these updated
DAGs were supported by the data (McElreath, 2020). Quantitative Analyses Methods Where
independence was not supported, we updated our DAGs
accordingly and repeated assessment of the newly implied
conditional independencies until no updates were required (an
overview of this process and the final DAGs can be found
in the Supplementary Material 1; for full details see the R
code available at https://osf.io/sr6d5/). We then selected the
smallest minimally sufficient adjustment sets to adjust for in our
models. We interpret the number of alters seen to reflect in-
person network size during lockdown, and percentage of alters
seen to reflect maintenance of in-person contact within personal
networks during lockdown. We made no explicit prediction as
to whether the number or the percentage of alters seen would be
more important for predicting postnatal depressive symptoms; as
a result, model selection produced two adjustment sets, one for
when the independent variable of interest or exposure was the
number of alters seen and one for when the exposure was the
percentage of alters seen, equating to 12 models. To
address
Q2,
we
examined
differences
in
the
aforementioned network characteristics by timing of birth,
plotting the data and visually inspecting the distributions for
changes in the pattern of social networks around the 23rd March
when lockdown was imposed – which would be suggestive of
a lockdown-specific effect. We took an exploratory approach
rather than making predictions, because while the imposition of
lockdown is a clearly defined event, it is possible that increasing
public awareness led to behavioural alterations in the weeks
before lockdown and/or any impacts of lockdown took time to
develop. Secular trends may also be potentially attributable to
lockdown, but with this data alone we are unable to disentangle
them from infant age effects. g
To address Q3, we used quasi-Poisson regression models
to test for a relationship between social communication and
EPDS scores. We anticipated seeing social contacts in person
would have more of a protective effect on mental wellbeing
than communicating with them remotely; thus, a first set of
models assessed whether the number and/or percentage of (i)
all alters, (ii) kin, and (iii) mummy friends seen in person (our
independent variables) predicted EPDS score (our dependent
variable). The number of alters seen reflects a mother’s in-person
social network size during lockdown, capturing the number
of people mothers have actually seen within their “network of
important people” in the few weeks prior to the survey. Quantitative Analyses Methods While
we do not have pre-pandemic data on maternal social networks,
given the known relationship between closeness and in-person
contact (e.g., Roberts and Dunbar, 2011), we interpret percentage
of alters seen to reflect the extent to which mothers maintained
in-person contact within their personal networks of important
people during lockdown (i.e., of the important people in their
lives, what proportion did mothers see in-person). To clarify,
mothers could report a small number of alters seen, indicating a
small lockdown in-person network, but report a high percentage
of alters seen, indicating that they maintained in-person contact
with a high proportion of important people in their lives. A second set of models were then used to assess whether having
remote communication with those not seen, either as the absolute
number or percentage of (i) all alters, (ii) kin, and (iii) mummy
friends (our independent variables) predicted EPDS score (our
dependent variable). The variables retained in model selection were used as follows
(for details of the variable derivation see the Supplementary
Material 1): Independent variables: in-person communication –
number was a continuous measure of the total number of (i)
all alters, (ii) kin, or (iii) mummy friends seen in the last few
weeks; in-person communication – percentage was a continuous
measure of the percentage of (i) alters, (ii) kin, or (iii) mummy
friends seen in the last few weeks; remote communication but not
seen – number was a continuous measure of the total number
of (i) alters, (ii) kin, or (iii) mummy friends communicated
with remotely but not seen in the last few weeks; remote
communication but not seen – percentage was a continuous
measure of the percentage of (i) alters, (ii) kin, or (iii) mummy
friends communicated with remotely but not seen in the last few
weeks. Results of Quantitative Analyses Results of Quantitative Analyses
Q1: Who did mothers keep in contact with during lockdown and
how (in-person vs. remote communication)? Results of Quantitative Analyses
Q1: Who did mothers keep in contact with during lockdown and
how (in-person vs. remote communication)? Q1: Who did mothers keep in contact with during lockdown and
how (in-person vs. remote communication)? On average, women had seen one family member other
than their partner, three alters in total, and no mummy
friends in the last few weeks (Table 1), while levels of remote
communication were high across all categories of network
alters. The majority (79.0%) of mothers in our sample reported
their own mother as part of their personal network; of those,
49.2% had seen their mother in the last few weeks and 99.2%
had communicated remotely with her (38.9 and 78.4% of all
participants, respectively). Participants reported a median of 3
consanguineal kin (range 0–11) and 1 affine (range 0–6). While
on average participants reported seeing the same number of kin
across kin type (consanguineal and affinal: median 1, range 0–
6), patterns within this differed. Forty-seven and a half percent
of mothers had seen none of their own relatives, 17.9% had seen
one, 19.1% had seen two, and 15.4% had seen three or more,
with 25.3% seeing all their named consanguineal kin. On the
other hand, 1.2% had seen no affines (the two single mothers in
the sample), 8.0% had seen two affines, 4.3% had seen three or
more, with the remaining 86.4% having seen one, i.e., only their
partner, with 78.1% seeing all of their named affines. Only 19.8%
of mothers listed their partner’s mother; of those 37.5% had seen
her and 100% had communicated remotely (7.4 and 19.8% of all
participants, respectively). The majority (66.0%) of participants
reported having at least one mummy friend; of those, 54.2% had
seen a mummy friend in the last few weeks and 100% had remote
communication (35.8 and 66.0% of all participants, respectively). Weak (<0.3) to moderate (0.3 ≥r < 0.7) positive correlations
were found between the number and percentage of alters seen
across categories, while correlations between the number and
percentage remotely communicated with were weakly positive
for all alters and kin and weakly negative for mummy friends
(Supplementary Material 1). Frontiers in Psychology | www.frontiersin.org Quantitative Analyses Methods Control variables: age of infant, measured in days, was
used continuously; age of mother, measured in years, was used
continuously; parity was used as a binary categorical variable Model selection (outlined briefly below and in detail in
the Supplementary Material 1) was performed between the May 2021 | Volume 12 | Article 648002 Frontiers in Psychology | www.frontiersin.org 5 Lockdown Communication and Postnatal Depression Myers and Emmott FIGURE 2 | (A–C) Violin plots show the density distribution of network
characteristics in relation to mummy friends by timing of birth, with in-set box
plots showing the median and interquartile range [(A) N = 162; (B,C) n = 107]. of “1” (reference) vs. “2 or higher,” household income was used
as a binary categorical variable of “£0–100K” (reference) or
“over £100K,” socially isolating was used as a binary categorical
variable of either “yes” or “no” (reference); infant’s ethnicity was
used as a binary categorical variable of either “white” (reference)
or “non-white.” Results of Quantitative Analyses FIGURE 2 | (A–C) Violin plots show the density distribution of network
characteristics in relation to mummy friends by timing of birth, with in-set box
plots showing the median and interquartile range [(A) N = 162; (B,C) n = 107]. y
Q2: Did characteristics of maternal social networks during
lockdown vary by timing of birth in relation to lockdown? Q2: Did characteristics of maternal social networks during
lockdown vary by timing of birth in relation to lockdown? FIGURE 2 | (A–C) Violin plots show the density distribution of network
characteristics in relation to mummy friends by timing of birth, with in-set box
plots showing the median and interquartile range [(A) N = 162; (B,C) n = 107]. We found only limited evidence of differences in the overall
network characteristics of participants, dependent on whether
they gave birth before or during lockdown (plots by date of
birth can be seen in Supplementary Figures 4–14), with some
indication that women giving birth on or after March 23rd
had fewer mummy friends (Table 1 and Figure 2A). We found
some indication that patterns of communication with mummy
friends also differed between mothers giving birth since lockdown
commenced to those giving birth before, with those giving
birth since being less likely to have seen their mummy friends
(Figure 2B) but more likely to have communicated with them
remotely if they had not seen them (Figure 2C). Q3: How did maternal social network characteristics and
social communication during lockdown associate with Edinburgh
Postnatal Depression Scale scores? Q3: How did maternal social network characteristics and
social communication during lockdown associate with Edinburgh
Postnatal Depression Scale scores? Here we present the quasi-Poisson regression models with
the largest adjusted R2s (referred to as Models 1–3 for ease of
interpretation – Table 2), while the remaining models performing
better than chance can be seen in Supplementary Material 2;
comparison of quasi-Kullback Information Criterion (QKIC) Frontiers in Psychology | www.frontiersin.org May 2021 | Volume 12 | Article 648002 6 Lockdown Communication and Postnatal Depression Myers and Emmott TABLE 2 | Results of quasi-Poisson regression models predicting depression symptoms as assessed via the Edinburgh Postnatal Depression Scale (EPDS) (n = 153). Results of Quantitative Analyses Variables
Coef
SE
RRR
LCI
UCI
Model 1: All alters – in person communication (% as exposure)
(Intercept)
2.405
0.172
11.078
7.897
15.475
In person communication (all alters) – %
0.002
0.002
1.002
0.999
1.005
Age of infant
0.001
0.001
1.001
0.999
1.002
Infant’s ethnicity – non-white
0.044
0.082
1.045
0.889
1.225
Household income – over £100k
−0.054
0.075
0.948
0.817
1.098
In person communication (all alters) – no. −0.036
0.015
0.965
0.937
0.993
Socially isolating – yes
0.003
0.114
1.003
0.799
1.248
Variance-function-based R2
0.121
Variance-function-based R2 – adjusted
0.085
Model 2: Kin – in person communication (% as exposure)
(Intercept)
2.178
0.173
8.833
6.275
12.384
In person communication (kin) – %
0.003
0.001
1.003
1.001
1.006
Age of infant
0.001
0.001
1.001
0.999
1.002
Infant’s ethnicity – non-white
0.067
0.081
1.069
0.911
1.250
Household income – over £100k
−0.040
0.076
0.961
0.828
1.114
In person communication (kin) – no. −0.026
0.027
0.975
0.924
1.026
Socially isolating – yes
0.075
0.110
1.078
0.865
1.331
Variance-function-based R2
0.117
Variance-function-based R2 – adjusted
0.081
Model 3: All alters – remote communication but not seen (% as exposure)
(Intercept)
2.732
0.168
15.365
11.007
21.280
Remote communication but not seen (all alters) – %
−0.005
0.002
0.995
0.991
1.000
Age of infant
0.001
0.001
1.001
0.999
1.002
Household income – over £100k
−0.057
0.075
0.944
0.815
1.093
In person communication (all alters) – no. −0.051
0.017
0.950
0.918
0.983
Remote communication but not seen (all alters) – no. 0.013
0.011
1.013
0.992
1.034
Socially isolating – yes
0.006
0.112
1.006
0.803
1.248
Variance-function-based R2
0.140
Variance-function-based R2 – adjusted
0.105
Coef, coefficient; SE, standard error; RRR, relative risk ratio; LCI, 95% lower confidence interval; UCI, 95% upper confidence interval; no., number. Independent variables
of interest are in bold. (RRR = 0.995, CI 0.999, 1.000); this pattern was repeated for
the percentage of kin (RRR = 0.996, CI 0.991, 1.001), though
with upper bound confidence intervals just overlapping one (see
Supplementary Material 2). Models looking at mummy friends
specifically did not perform better than chance (results not
shown); this seems likely to be due to the widespread low levels
of contact with other mothers with infants, with 55 participants
reporting no mummy friends in their networks and on average
mothers only reporting one. Results of Quantitative Analyses Once the number of alters seen
was accounted for, contrary to expectations, point estimates for
the proportion of the network seen had a positive association
with depressive symptoms, a finding that appears to be driven
by the effect of kin: The RRR for the percentage of network
alters seen (Model 1) was 1.002 (CI 0.999, 1.005) and for kin
(Model 2) 1.003 (CI 1.001, 1.006), and while the confidence
intervals overlapped one for all alters, they narrowed when
looking specifically at kin – this may be indicative of relatives
being more likely to visit mothers in greater distress. Post hoc
single variable models containing just the percentage of network
alters seen found the direction of this effect to be the same when
not controlling for number seen (see Supplementary Material
2). Finally, as anticipated, the greater the percentage of all alters
communicated with remotely, if not seen in person, also appeared
to be associated with lower depressive symptoms (Model 3) Results of Quantitative Analyses Note, our models varied in their
performance and captured only limited variance in EPDS score,
suggesting unaccounted for factors were playing an important
role in maternal wellbeing, which is unsurprising. values indicated no clear “best” model (Burnham et al., 2011;
Kim et al., 2013). As anticipated, the overall number of network
alters seen in person over the last few weeks negatively predicted
depressive symptoms, with the relative risk ratios (RRRs) ranging
from 0.950 to 0.974 across models (Model 1 in Table 2, also
see Supplementary Material 2). Once the number of alters seen
was accounted for, contrary to expectations, point estimates for
the proportion of the network seen had a positive association
with depressive symptoms, a finding that appears to be driven
by the effect of kin: The RRR for the percentage of network
alters seen (Model 1) was 1.002 (CI 0.999, 1.005) and for kin
(Model 2) 1.003 (CI 1.001, 1.006), and while the confidence
intervals overlapped one for all alters, they narrowed when
looking specifically at kin – this may be indicative of relatives
being more likely to visit mothers in greater distress. Post hoc
single variable models containing just the percentage of network
alters seen found the direction of this effect to be the same when
not controlling for number seen (see Supplementary Material
2). Finally, as anticipated, the greater the percentage of all alters
communicated with remotely, if not seen in person, also appeared
to be associated with lower depressive symptoms (Model 3) values indicated no clear “best” model (Burnham et al., 2011;
Kim et al., 2013). As anticipated, the overall number of network
alters seen in person over the last few weeks negatively predicted
depressive symptoms, with the relative risk ratios (RRRs) ranging
from 0.950 to 0.974 across models (Model 1 in Table 2, also
see Supplementary Material 2). Frontiers in Psychology | www.frontiersin.org Theme 1: Enhancing Bonding With Baby Within the
Nuclear Family For
some
women,
lockdown
gave
them
an
unexpected
opportunity to increase the “quality time” spent with the
baby as a family, leading to perceived better bonding, improved
relationships within the nuclear family, and positive emotional
wellbeing. The stay-at-home and social distancing orders
“protected” the nuclear family from visitors and non-essential
commitments, leading to uninterrupted time and the ability to
devote attention to the baby. Often, this was accompanied by
high partner involvement, co-parenting, and practical support:
As more people worked from home or were furloughed, partners
were able to substitute maternal care allowing mothers to “take
some time” and invest in themselves – such as catching up on
sleep or exercise. g p
p
One of us (EE) conducted an inductive thematic analysis of
open-text survey responses using NVivo v12. First, 96 open-
text responses were coded in detail by EE and emerging
themes were identified. Coding saturation was experienced early
on at around 50 cases, implying relative similarity in the
content of participant responses. EE then separately discussed
emerging themes with SM and a subject-equivalent (new mother
resident in London), and sought feedback on interpretation. Following discussion, EE amended the themes and coded all
participant responses, with negative case analysis (i.e., specifically
looking for participant responses which did not fit pre-specified
themes). As a final validation step, as EE and SM do not
have direct experiences of motherhood, EE and SM discussed
findings with two mothers who had experienced lockdown with
their infants to ensure findings were plausible. To minimise
interpretive bias, the qualitative analysis method was designed
and pre-registered in advance of any reading of participant
responses (see text footnote 2) and was conducted parallel to
the quantitative analyses by SM (i.e., results from quantitative
findings were unknown at the time of qualitative analysis). Further information on the analysis process is outlined in the
Supplementary Material 1. “At first I was afraid that not being able to have any help might
effect my relationship but in [fact] it has made it so strong because
I’ve been with her all the time.. . .I have enjoyed the closeness and
my son becoming closer to his baby sister.” “The lockdown has been a big positive for my connection with
the baby. I have been able to relax and enjoy her and give
her my undivided attention versus [needing] to rush around, see
people/host people etc. Results of Qualitative Analysis We identified four themes in our participant responses: One
theme relating to the “benefits of lockdown” and three themes
relating to the “costs of lockdown” (Table 3). These themes
are not mutually exclusive and could have been experienced in
different combinations, although the extent to which they overlap
is unclear from our current study. The descriptions of each theme
and example quotes are outlined below. More example quotes are
available in the Supplementary Material 1. Qualitative Analysis Methods To complement the quantitative analysis and help with overall
inference, we conducted an inductive thematic analysis of
open-text survey responses. In our survey, we asked three May 2021 | Volume 12 | Article 648002 Frontiers in Psychology | www.frontiersin.org Frontiers in Psychology | www.frontiersin.org 7 Lockdown Communication and Postnatal Depression Myers and Emmott open-text questions: (Q1) “Is there anything you would like
to share about how you feel the COVID-19 pandemic has
affected your emotional relationship with your baby(ies)?” (Q2)
“Is there anything you would like to share about how you
feel the COVID-19 pandemic has affected your emotional
wellbeing?” and (Q3) “Before you finish the survey, we would
like to hear about anything else you feel is important to your
experiences at this unusual and difficult time. If you have any
other thoughts you would like to share, please do so below.”
Questions therefore directed participants to elaborate on bonding
with their baby(ies), their emotional wellbeing, and any other
important matters they wished to raise. Of the 162 women
who took part in the survey, 122 participants (75%) provided
a response to one or more open-text questions, with 96, 82,
and 77 participants responding to Q1, Q2, and Q3, respectively. Note, while these three questions were posed separately, the
responses to these questions do not exist independently: For
example, participants may refer back to their response in
Q1 while responding to Q2, or decide to skip Q3 as they
expressed all they wanted to in the earlier questions. This
meant responses could not be analysed by question. In total,
our data included 256 open-text responses with 61 words on
average per response. experience, our study nonetheless provides insight into the
different types of experiences mothers in London encountered
during the first national lockdown. Frontiers in Psychology | www.frontiersin.org Theme 1: Enhancing Bonding With Baby Within the
Nuclear Family It has also been a great help having my
partner home every day as it means most days I can get at least 1 h
to myself which I use to exercise or catch up on sleep.. . .Also I think
it has been an amazing positive on my partners ability to build a
bond with the baby and co-parent.” Theme 2: The Burden of Constant Mothering Theme 2: The Burden of Constant Mothering
In stark contrast to the benefits of lockdown, many women also
raised the burden of “constant mothering” due to the sudden
severing of practical support. With no alloparents available to
provide practical support and having to “do it alone,” mothers
experienced the intensification of domestic and caregiving tasks. While the availability of partner support was not always clear,
several women shared that their partners were not readily
available to provide practical support due to work conflicts. This
left mothers feeling exhausted and isolated, with no time to rest
or recuperate, and some women reported feeling overwhelmed
at the responsibility of looking after their child(ren) on their
own. Particularly for mothers with multiple children, the lack
of childcare and school closures meant women experienced
competing demands for attention. This led women to experience y
The current method, combined with the characteristics of
available data, was designed to identify underlying themes in
the collective experiences of participants. As an exploratory,
inductive design, we did not ask specific questions related to
pre-existing ideas or hypotheses. Further, as open-text survey
responses are relatively short, they are unlikely to provide
a comprehensive description of maternal experiences during
lockdown. This means that participants not raising certain
experiences in their responses did not mean they lacked those
experiences; therefore, our findings describe sample-level rather
than individual-level characteristics. While we are unable to
translate the findings to individual-level descriptors of maternal May 2021 | Volume 12 | Article 648002 Frontiers in Psychology | www.frontiersin.org 8 Lockdown Communication and Postnatal Depression Myers and Emmott TABLE 3 | Summary of themes and key findings from our qualitative analysis. Main themes
Key findings
Benefits of lockdown
1. Enhancing bonding with baby
within the nuclear family
Lockdown leading to uninterrupted time and “protection” of the nuclear family, leading to
better bonding
Facilitated by high levels of practical support from the partner
Costs of lockdown
2. The burden of constant
mothering
Lack of practical support and childcare leading to the intensification of domestic and
caregiving tasks
Increased feelings of exhaustion and guilt
3. Inadequacy of virtual contact
The lack of “incidental support” with virtual contact
Lack on information transmission and affirmative support leading to low maternal
confidence
4. Theme 2: The Burden of Constant Mothering Lost opportunities
Inability to expand mother-infant social networks
Feelings of sadness for lost experiences, for both mum and baby
Worries about baby’s development due to lack of physical contact with others TABLE 3 | Summary of themes and key findings from our qualitative analysis. guilt that they could not provide enough attention to their baby,
with a few women expressing a sense of resentment toward their
children and worsening family relationships. Overall, mothers
were forced to devote their time to motherhood, and the ability
to invest in other aspects of their lives including themselves and
their relationships were severely restricted. “I’m the sort of person that doesn’t like to ask for help, and therefore
relies on face to face contact to comfort and support me. I feel like
the support I have has diminished now that I’m not able to have
close contact with anyone outside my household. . .” Beyond support, the lack of face-to-face contact also acted as a
barrier for information transmission to mothers from peers and
health professionals. With fewer opportunities for “general chats”
where women could raise minor questions or concerns, some
women described their uncertainties around their parenting
and baby’s development. Overall, this overlapped with increased
anxiety and lower maternal confidence. “I think lockdown has made me feel like I’m not a person in my own
right anymore, just a mum which is a feeling I had early on after
my son was born but which disappeared when he was a few months
old. Not having anyone else to hold him or help out a bit makes me
feel it’s all me and it’s a lot of pressure which I can resent. I feel like
I don’t have any time to rest.” “I joined a baby group and was hoping to get to meet up and share
stories and learn how to be a mom from them and that [hasn’t
happened]. I feel very like I am making it up as I go along and have
no one to guide me as the health visitor can’t visit either. It is hard.”
“Your questions ask if I’ve had emotional support – yes, lots of
communication and video calls. Theme 2: The Burden of Constant Mothering But during lockdown we were
completely physically isolated which made us very stressed and
anxious with no one to give practical advice on general parenting.” “I joined a baby group and was hoping to get to meet up and share
stories and learn how to be a mom from them and that [hasn’t
happened]. I feel very like I am making it up as I go along and have
no one to guide me as the health visitor can’t visit either. It is hard.” “Being able to just pass my baby round the loved ones would give
me moments to enjoy without her, in the knowledge she was being
stimulated and cared for by others. Without that it’s in a much
smaller group of people to do that that leaves each of us far less time
to focus on ourselves. I certainly miss being able to have people over
and just hand them my baby so I can take 5 min to be [on] my
own. I’ve only managed to be really alone once since she was born. Similarly, I’ve only once had 20 min with my partner without my
baby being under our direct care since she was born that makes it
hard for us to foster our connection. My mum does help but often we
all sit together. I think without COVID I’d have more people offer to
take her round the block and give us these moments of calm.” “Your questions ask if I’ve had emotional support – yes, lots of
communication and video calls. But during lockdown we were
completely physically isolated which made us very stressed and
anxious with no one to give practical advice on general parenting.” Theme 4: Lost Opportunities Many mothers expressed their sense of sadness and grief in
relation to lost opportunities with other people. In particular,
women mourned the loss of “mummy friends,” as closing of
parent-baby spaces and classes meant mothers were not able
to establish new friendships for themselves and their babies as
anticipated. Some mothers explained that this meant they had
less access to peer support and advice. Further, several mothers
mourned the loss of sharing “special moments” with family
members, with specific concerns around the inability to establish
bonds and connections between the baby and wider family. Frontiers in Psychology | www.frontiersin.org Kin Support and Depressive Symptoms He seems
to have developed physically and mentally so much in the last few
months that It makes me worry more.” “I feel so guilty that he will not be able to play with other children
and worry how it will affect him.” Kin Support and Depressive Symptoms pp
p
y
p
While social network size during lockdown was associated with
lower PND risk, proportionally higher in-person contact with
kin network members - reflecting greater maintenance of their
“important” kin network during lockdown - controlling for
number of kin seen was associated with higher EPDS scores. Some of the cooperative childcare literature has noted differential
impacts by kin type, with affinal kin sometimes found to be less
beneficial and/or detrimental [most notably in relation to child
outcomes (Sear and Mace, 2008)]. However, given the lack of
variance in in-person contact with affinal kin, with most mothers
only seeing their partner, our results appear to be driven by
variations in contact with own kin. While our qualitative findings
did not reveal the exact mechanism behind this association, the
importance of practical support and in-person contact emerged
as key components of maternal experience across multiple
themes (Theme 1, 2, and 3). With this, one would expect in-
person contact to associate with lower EPDS scores. A possible
interpretation of our unexpected quantitative result is that,
assuming in-person support is a more effective form of support
(Theme 3), important kin members may have been more inclined
to maintain in-person contact to support mothers experiencing
PND symptoms. In-person contact did not only come with
COVID-19 infection risk: it also risked fines (BBC News, 2020a)
as well as public shaming and reputational damage (BBC News,
2020b). Kin members identified as important by mothers, given
their relatedness and closeness, may have been more willing to
take on these risks and potential costs to support mothers in need. However, it could also be that in-person communication with
family members under socially distanced conditions served as a
reminder of how much help mothers needed and/or were missing
out on, thereby creating or exacerbating emotional distress. Indeed, mothers raised how lost opportunities for socialisation
and support led to feelings of sadness (Theme 4). “I have a lot of worry about the developmental impact this will
[have] on my son- I have already noticed he is more needy and
although we regularly FaceTime them, I worry he won’t recognise
my family members very well when lockdown is lifted. SYNTHESIS OF QUANTITATIVE AND
QUALITATIVE FINDINGS Our sample of London mothers with infants exhibited high
levels of depressive symptoms, with the mean self-reported EPDS
score being 10.4, just 0.6 points below the recommended lower
cut-offof 11 points to identify women who may meet the
diagnostic criteria for PND (Levis et al., 2020). Forty-seven and
a half percent of participants met the ≥11 cut-offfor PND, and
35% of participants met the higher ≥13 cut-offfor PND. The
high levels of depressive symptoms in our sample were further
supported by the themes arising in our open-text responses,
with many women raising feeling stressed, anxious, and worried,
as well as experiencing feelings of loneliness and sadness –
overlapping with symptoms of PND (Cox et al., 1987; APA, 2013). Many women further reported they experienced a burden of
“constant mothering” which left them physically and emotionally
exhausted (Theme 2). Theme 3: Inadequacy of Virtual Contact During lockdown, many women relied on social media and
remote communication methods such as WhatsApp and Zoom
to keep in touch with others. A small number of mothers
explicitly mentioned they have been able to maintain or even
increase contact with others via remote communication methods,
which served as important sources of support. However, many
women commented on the inadequacy of virtual contact which
led to a sense of isolation as well as worries and anxieties. Notably, mothers expressed that remote communication did not
allow for unplanned and unsolicited support, where supporters
incidentally identify maternal or infant needs and provide
spontaneous reassurances or help. Without face-to-face contact,
family, friends, peers, and health professionals could not “see
the whole picture” regarding mothers and their infants, meaning
mothers had to actively raise issues and seek support. This
was particularly challenging for mothers who felt uncomfortable
about asking for support or had low self-efficacy, leaving them
with unmet support needs. “This isn’t how I saw my experience with my first baby and
sometimes it almost feels like grieving for an experience that we
won’t get back. She is a beautiful baby and we are so lucky to have
her. I wish I could share her and also actually discuss face to face
with people what it is like being a mother – which they would be
able to see physically.” “You’re only a first time mum once, and I was really looking
forward to this time and making new mum friends. I think I am
most sad about missing out on that.” Many mothers believed these lost opportunities led to a sub-
optimal developmental environment for the baby. In particular, May 2021 | Volume 12 | Article 648002 Frontiers in Psychology | www.frontiersin.org Frontiers in Psychology | www.frontiersin.org 9 Lockdown Communication and Postnatal Depression Myers and Emmott and remote contact may be better than no contact in mitigating
depressive symptoms. mothers were worried that the lack of social experiences might
negatively impact their baby’s long-term development. Mothers
felt face-to-face contact with wider family and other babies were
crucial for their development, which could not be adequately
substituted by video calls. This was accompanied by a sense of
guilt and worries about “over-attachment”. Frontiers in Psychology | www.frontiersin.org Peer Support and Depressive Symptoms y
p
Our quantitative results showed that, unsurprisingly, in-person
contact during lockdown was low, with mothers typically seeing
one family member other than their partner in the last few
weeks. At the same time, levels of remote communication were
high across maternal social networks. Contacting others in-
person and remotely were both associated with lower EPDS
scores, suggesting social network size during lockdown was
associated with lower PND risk. Our qualitative findings
highlight that in-person contact is important for practical
support (Theme 1 and 2), as well as effective information
transmission and emotional support (Theme 3), suggesting that
mothers with higher levels of in-person contact may have been
able to access more better-quality support, leading to lower
depressive symptoms. However, our qualitative findings also
revealed that the experience of remote communication was
often felt as inadequate (Theme 3), somewhat conflicting with
our quantitative findings. Taken together, our results perhaps
reflect that, while remote communication is “not as good” as
in-person contact, it could still bring some potential benefits; Peer Support and Depressive Symptoms
We found weak evidence that mothers who gave birth during
lockdown had fewer “mummy friends” (i.e., female friends with
young infants) compared to those who gave birth before. Further,
we did not find evidence that contact with mummy friends
was associated with lower depressive symptoms. This may be
due to the lack of variation in the number of mummy friends
reported by participants: On average, mothers in our sample
reported just one mummy friend, with 55 participants reporting
none. Nonetheless, our qualitative analysis revealed the potential
importance of mummy friends, with mothers “mourning” the
lost opportunities to make friends which could lead to maternal
anxieties (Theme 4). Mothers also reported receiving lower levels
of support and information from peers due to the inadequacy
of virtual communication (Theme 3). Mothers indicated that in-
person contact with peers is key for information transmission
and affirmative support – which, in “non-COVID-19” times,
would have helped women develop maternal capital in the form
of parenting knowledge, skill, and confidence. It may be that May 2021 | Volume 12 | Article 648002 Frontiers in Psychology | www.frontiersin.org 10 Lockdown Communication and Postnatal Depression Myers and Emmott mother’s circumstances are such that withdrawing investment
in their infant in the hope of eliciting support from others
is the least bad option (Hagen, 2003). Peer Support and Depressive Symptoms An alternative line of
reasoning – the Pathogen Host Defence Hypothesis (PATHOS-
D) – suggests that depression reflects a phenotypic suite of
behavioural and physiological responses evolved to mitigate
mortality risk linked to pathogens (Raison and Miller, 2013). Psychosocial stress is argued to have been predictive of wounding
and subsequent infection in ancestral environments – where low
social support and isolation is supposed to have increased attacks
from predatory species or conspecifics – driving selection for a
pre-emptive response. The bargaining hypothesis, along with the
related psychic pain hypothesis (Hagen and Barrett, 2007), and
arguments proposing PND evolved as a distress signal to elicit
support (Crouch, 1999; Crouch, 2002), in particular from kin
and the infant’s father (Rantala et al., 2018), would all anticipate
increased rates of PND in the childrearing conditions created
by the pandemic. The PATHOS-D would also predict elevated
rates of PND resulting from psychosocial stress associated
with lockdown. We do not consider our data to favour any
one hypothesis in particular; current hypotheses regarding the
evolution of PND and depression more generally are also not
without their critics (Nettle, 2004; Myers et al., 2016, 2017;
Rantala et al., 2018). Nonetheless, regardless of the evolutionary
origins, postnatal depressive symptoms are undoubtedly an
indicator of distress and if relatives were most likely to come to
a mother’s aid, inclusive fitness would explain why. Needs-based
kin altruism in the context of reproduction and childrearing
has been reported elsewhere (Schaffnit and Sear, 2017; Page
et al., 2019a,b), and our findings may suggest that a limited
number of family members “took the risk” to provide practical
support for mothers. mummy friends were not necessarily identified as “important
people” within maternal social networks; alternatively, it may
be that the pandemic has impeded the development of nascent
mother-mother bonds in mothers giving birth prior to lockdown
too, as well as their initial creation, leaving a wider cohort of
women with few maternal social contacts. It is also worth noting
that we used a narrow definition of mummy friends, limiting
it to those currently with young children; it is more than likely
mothers received support from friends at other stages of life too. Either way, peers may still be an important source of information
and support – a resource mothers had limited access to during
lockdown. DISCUSSION Taking the quantitative and qualitative findings together, our
results provide an in-depth description of maternal social
networks during lockdown and its potential impact on depressive
symptoms among the London mothers in our sample. The
first national lockdown in England during the COVID-19
pandemic led to a childrearing environment which greatly
minimised contact between households, curtailing access to
support networks which typically provide allocare and other
forms of social support (Emmott et al., 2020; Myers et al., 2021). In these arguably unusual times, our sample of London mothers
with infants exhibited high levels of depressive symptoms with
the mean EPDS score of 10.4 points. Forty-seven and a half
percent of participants met the ≥11 cut-offfor PND, and 35% of
participants met the higher ≥13 cut-offfor PND. This is notably
higher than the pre-pandemic estimated PND prevalence of up to
23% in Europe (based on various measurement tools and cut-offs)
(Arifin et al., 2018), but in line with other studies on maternal
mental health during the COVID-19 pandemic. For example,
recent studies conducted during the pandemic found 49% of
mothers in a United Kingdom sample (Harrison et al., 2021),
33.2% in a Canadian sample (Cameron et al., 2020), and 23.6%
in a Belgian sample (Ceulemans et al., 2020) met the ≥13 cut-off
for EPDS scores, and 44% in an Italian sample met a ≥12 cut-off
(Spinola et al., 2020). Multiple pre- vs. during-pandemic studies
have also found increased prevalence of depressive symptoms
(Wu et al., 2020; Zanardo et al., 2020); for example, a Canadian
study found a jump from 15 to 40.7% of mothers meeting a ≥13
EPDS cut-off(Davenport et al., 2020). Combined with studies
documenting elevated postnatal stress and anxiety (for example,
see: Cameron et al., 2020; Ceulemans et al., 2020; Harrison et al.,
2021), and more generalised measures of emotional wellbeing
(Dib et al., 2020), there appears to be a broad picture of maternal
emotional suffering on a wider scale than would be expected pre-
pandemic. New mothers are obviously not the only people to experience
significant reductions in their social contact, posing the question
as to whether the findings here simply reflect a population-wide
elevation in depressive symptomology; or do postnatal women
constitute a specific risk group during the ongoing pandemic. Peer Support and Depressive Symptoms Indeed, maternal support interventions in England
and other developed populations often rely on organised peer
support, with some evidence that this is associated with lower
depressive symptoms (Leger and Letourneau, 2015). Frontiers in Psychology | www.frontiersin.org DISCUSSION In
the
United
Kingdom,
cultural
norms
of
intensive
mothering arguably slowed down policy shifts to allow childcare
support during periods of lockdown (Emmott et al., 2021),
and there have been many reports of partners and other key
supporters being prohibited from antenatal appointments and
births, financial support packages have been geared toward the
male workforce, and there has been widespread rhetoric from
politicians and the popular press encouraging the gendered
division of childcare responsibilities, all to the detriment of
mothers (Emmott et al., 2021). Add to this parenting stresses
which are arguably more common in the postnatal period –
for instance, sleep deprivation, postpartum pain, the need to
learn/relearn skills such as breastfeeding – and it appears
reasonable to suggest that postnatal mothers are at particularly
high risk of depression during the ongoing pandemic. However,
there are at least two studies reporting a decrease in postnatal
depressive risk during the pandemic; southern Israeli women
giving birth in quarantine showed lower PND prevalence
(Pariente et al., 2020), as did mothers of lower socioeconomic
status (SES) in New York (Silverman et al., 2020). Rather
than casting doubt on our findings, these studies highlight
the contextually specific impact of social distancing measures;
the authors of the Israeli study speculate that the mothers
in their sample benefited from greater family support in this
context (Pariente et al., 2020), while lower SES mothers in
New York appear to have benefited from both not having to
work themselves and increased childcare support from partners
forced to stay at home (Silverman et al., 2020). These studies align
with the finding from our qualitative results that some women
experienced greater support from working-from-home partners
than they might otherwise have done. Scelza and Hinde (2019)
have recently argued that human evolution took place in “an
adaptive sociocultural perinatal complex” typified by extensive
social support for the mother-infant dyad, resulting from the
energetic and physical demands of gestation, birth, breastfeeding,
and the dependent state in which infants are born and the slow
rates at which they develop. To protect maternal mental health,
evidence suggests we should protect this perinatal complex, both
during the ongoing COVID-19 pandemic and beyond. g
Specifically relating to our quantitative study, the sample size
of women giving birth during lockdown was small (n = 47),
limiting the confidence in any apparent differences between
maternal experience dependent on timing of birth before and
during lockdown. DISCUSSION We suggest the answer to both these questions is “yes.” There
is a mounting body of work supporting the contention that
the prevalence of depression symptoms has increased at the
population level (Bueno-Notivol et al., 2021); for example, a
survey of the general adult population in the United States
found a three-fold increase compared to pre-pandemic levels
(Ettman et al., 2020) and childhood depression data from the
United Kingdom also suggests symptom elevation (Bignardi
et al., 2020). However, evidence from the United Kingdom
suggests that after an initial increase in symptoms in the run up to
lockdown (Shevlin et al., 2020), depressive symptoms in the adult
population declined from an elevated starting point across the
first 20 weeks of lockdown, suggesting people adjusted (Fancourt
et al., 2020). While our data cannot speak to other groups, given
social support and social isolation are negatively associated with
depressive symptoms across age groups in the general population
in Western contexts (Lakey and Cronin, 2008; Gariépy et al.,
2016), it seems reasonable to suggest that lessons from our
quantitative findings may generalise beyond postnatal mothers. It is also clear that the impact of the COVID-19 pandemic is It has been proposed that “depression is an adaptation
designed to detect the opportunity costs of cooperative ventures
and to subsequently bargain for increased benefits” (Hagen, 2003:
115). Under this framework, PND is argued to arise when the May 2021 | Volume 12 | Article 648002 Frontiers in Psychology | www.frontiersin.org 11 Lockdown Communication and Postnatal Depression Myers and Emmott not equitable and there is widespread evidence that structural
inequalities along such lines as socioeconomic position, race, and
gender are creating differential burdens. We would encourage
future studies examining the role of social networks in shaping
depressive experience during the pandemic across other groups,
to identify those most at risk and possible intervention strategies. approximately £76.5K; only 34% of our sample had a household
income before tax of between £0–75K. Low SES is a known
risk factor for PND, and lower SES has been found to increase
the risk of depression among adults in the United States during
the pandemic; thus it is possible the rate depressive symptoms
based on our sample were an underestimate of the actual rates in
London (although see Silverman, et al., 2020). DISCUSSION Beyond the findings regarding communication
with social network members, the confidence intervals for all
other measures in our models are wide and overlap one, which is
suggestive of a lack of statistical power. Maternal social networks
were measured by asking participants to list “important people”;
however, our qualitative results suggest contact with peers who
are not necessarily important at an individual level may be a
key aspect of maternal social networks, which we are unable to
quantitatively test in our data. Our models captured only limited
variance in depressive symptoms, suggesting unaccounted for
factors were playing an important role in maternal wellbeing,
which is unsurprising. Two important factors, known to be
predictive of PND risk, which our models cannot speak to are a
mother’s level of access to social support (Fellmeth et al., 2021) –
both in terms of received and perceived practical and emotional
support – and previous history of mental health issues (Spry et al.,
2021); for a comprehensive review of other PND risk factors see
Yim et al. (2015). We also have no data on whether participants
had sought or were currently receiving medical attention for
PND. Finally, the cross-sectional nature of our data means
inferences of the direction of causation between communication
and depressive symptoms are untestable; we also do not know
the timing of any symptom onset or prior history of depression,
which would help speak to the direction of causation. In terms of our qualitative study, the relatively brief nature
of open-text responses means that our findings are unlikely to
capture the full range and nuance of maternal experiences during
lockdown. Due to the open nature of the survey questions and the
brevity of responses, our findings provide descriptions of various
maternal experiences at sample-level. It is therefore unclear how
wide-ranging these experiences were, and if or how these themes
overlapped at an individual level. Frontiers in Psychology | www.frontiersin.org SUPPLEMENTARY MATERIAL The Supplementary Material for this article can be found online
at:
https://www.frontiersin.org/articles/10.3389/fpsyg.2021. 648002/full#supplementary-material. The legends for the Supp-
lementary Figures can be found in Supplementary Material 1. Table 1.docx – ‘Supplementary Material 1’
Table 2.xlsx – ‘Supplementary Material 2’
Image 1.TIFF – ‘Supplementary Figure 1’
Image 2.TIFF – ‘Supplementary Figure 2’
Image 3.TIFF – ‘Supplementary Figure 3’
Image 4.TIFF – ‘Supplementary Figure 4’
Image 5.TIFF – ‘Supplementary Figure 5’
Image 6.TIFF – ‘Supplementary Figure 6’
Image 7.TIFF – ‘Supplementary Figure 7’
Image 8.TIFF – ‘Supplementary Figure 8’
Image 9.TIFF – ‘Supplementary Figure 9’
Image 10.TIFF – ‘Supplementary Figure 10’
Image 11.TIFF – ‘Supplementary Figure 11’
Image 12.TIFF – ‘Supplementary Figure 12’
Image 13.TIFF – ‘Supplementary Figure 13’
Image 14.TIFF – ‘Supplementary Figure 14’
Image 15.TIFF – ‘Supplementary Figure 15’ Image 3.TIFF – ‘Supplementary Figure 3’ mage 4.TIFF – ‘Supplementary Figure 4’ DATA AVAILABILITY STATEMENT The raw data supporting the conclusions of this article will be
made available by the authors, without undue reservation. ACKNOWLEDGMENTS We would like to thank the mothers who spared their precious
time to take part in our study, University College London for
funding the project, the mothers who helped with the qualitative
analysis (Ruth Batham, Sarah Wilby, and Sarah Eberhardt), and
the members of the London School of Hygiene and Tropical
Medicine’s Evolutionary Demography Lab Group for their helpful
comments on the preregistration draft of the quantitative analysis
plan. The preregistrations for both studies can be seen elsewhere
online (Quantitative study: https://osf.io/cse4a; Qualitative study:
https://osf.io/82bwj). FUNDING As cooperative childrearers, the availability of extended
support from beyond the nuclear family is crucial, and in
our study mothers with communication with larger social
networks during lockdown fared better in terms of maternal
mental health. Since the time of our data collection, mothers
in London have experienced two further periods of lockdown –
one for approximately a month over November 2020 and the
second, beginning on December 20th and only beginning to
ease at the time of writing. Recognising the vulnerability of
new parents, from the 2nd December, households in England
with infants were allowed to form a “support bubble” and have
in-person contact with one other household (Department of
Health and Social Care, 2020), which may help alleviate the
detrimental impact of lockdown on maternal mental health. However, in-person contact comes with infection risk, and we
anticipate face-to-face contact across maternal social networks
will remain low due to ongoing restrictions. Previous studies
have found that online social contact is a valued source of social
support for mothers (Archer and Kao, 2018; Price et al., 2018;
Teaford et al., 2019). Remote communication could potentially
be a solution, with our findings of lower depressive symptoms
among mothers who had remote communication with a higher
proportion of their personal network that they had not also
seen in person. However, our qualitative findings suggest that
seeking support and information may be more challenging via
remote communication – several studies have also highlighted
the costs of remote communication, including “Zoom fatigue”
(Archer and Kao, 2018; Epstein, 2020). It is important, therefore,
that the burden of seeking contact does not fall on the mother. Instead, encouraging people to virtually reach out to the mothers
that they know may be a low-risk way of improving maternal
mental health in high-income contexts, where most people have
the means to do so. This study was funded by a University College London Strategic
Initiatives Seed-funding Small Grant – PIs: SM and EE. This study was funded by a University College London Strategic
Initiatives Seed-funding Small Grant – PIs: SM and EE. Limitations To paraphrase another study of maternal mental health during
the COVID-19 pandemic (Davenport et al., 2020), mothers
in London were not OK during England’s first lockdown,
with a substantial number of women meeting the diagnostic
criteria for PND. While Western childrearing norms focus
on intensive parenting (Faircloth, 2014), our results highlight
that it still “takes a village” to raise children in high-income
populations. Several studies from Europe and the United States
have
found
that
maternal
domestic
work
and
childcare
increased during the COVID-19 pandemic (Calarco et al., 2020; Convenience sampling, predominantly recruiting via social
media, leads to potential biases, particularly in relation to
the degree to which our sample’s use of online technology
for communication and support seeking is representative. Our
participants were relatively homogenous in terms of ethnicity
and family formation; thus, the extent to which these findings
generalise to other mothers from London, the United Kingdom,
and other high-income contexts is unknown. Further, the
median wage in London in 2019 was £38,272 (Office for
National Statistics, 2019), putting a two-person household at May 2021 | Volume 12 | Article 648002 Frontiers in Psychology | www.frontiersin.org 12 Lockdown Communication and Postnatal Depression Myers and Emmott AUTHOR CONTRIBUTIONS Del Boca et al., 2020; Prados and Zamarro, 2020; Zoch et al.,
2020), suggesting that the burden of lockdown may have
disproportionately impacted mothers. While our qualitative
results suggest high partner involvement may have been
associated with more positive experiences of lockdown, and a
Canadian study found lockdown may have encouraged greater
partner participation in domestic work and caregiving (Shafer
et al., 2020), overall, our results indicate that adequate support
within the household was either not available or not enough for
many mothers in our sample. SM led the project, designed and managed the data collection,
cleaned the data, and conducted the quantitative analysis. EE
supported the data collection and conducted the qualitative
analysis. SM and EE interpreted the quantitative and qualitative
results, and wrote the manuscript. Both authors contributed to
the article and approved the submitted version. Frontiers in Psychology | www.frontiersin.org REFERENCES S., Anwyl-Irvine, A. L., Smith, T. A., Siugzdaite, R.,
Uh, S., et al. (2020). Longitudinal increases in childhood depression during
the COVID-19 lockdown in a UK cohort. OSF Preprints doi: 10.31219/osf.io/
v7f3q Dyble, M., Salali, G. D., Chaudhary, N., Page, A., Smith, D., Thompson, J., et al. (2015). Sex equality can explain the unique social structure of hunter-gatherer
bands. Science 348, 796–798. doi: 10.1126/science.aaa5139 Boath, E. H., Pryce, A. J., and Cox, J. L. (1998). Postnatal depression: the
impact on the family. J. Reprod. Infant Psychol. 16, 199–203. doi: 10.1080/
02646839808404568 Emmott, E. H., and Mace, R. (2015). Practical support from fathers and
grandmothers is associated with lower levels of breastfeeding in the UK
millennium cohort study. PLoS One. 10:e0133547. doi: 10.1371/journal.pone. 0133547 Boran, P., Waqas, A., A¸skan, ÖÖ, Topçu, ˙I, Dogan, T., and Rahman, A. (2020). Screening of postpartum depression among new mothers in Istanbul: a
psychometric evaluation of the Turkish Edinburgh Postnatal Depression Scale. BMC Res. Notes 13:355. doi: 10.1186/s13104-020-05196-x Emmott, E. H., Myers, S., and Page, A. E. (2021). Who cares for women with
children? Crossing the bridge between disciplines. Phil. Trans. R. Soc. B doi:
10.1098/rstb.2020.0019 Emmott, E. H., and Page, A. E. (2019). “Alloparenting,” in Encyclopaedia of
Evolutionary Psychological Science, eds T. K. Schackelford and V. A. Weekes-
Shackelford (New York, NY: Springer). Bueno-Notivol, J., Gracia-García, P., Olaya, B., Lasheras, I., López-Antón, R.,
and Santabárbara, J. (2021). Prevalence of depression during the COVID-19
outbreak: a meta-analysis of community-based studies. Int. J. Clin. Health
Psychol. 21:100196. doi: 10.1016/j.ijchp.2020.07.007 Emmott, E. H., Page, A. E., and Myers, S. (2020). Typologies of postnatal support
and breastfeeding at two months in the UK. Soc. Sci. Med. 246:112791. doi:
10.1016/j.socscimed.2020.112791 Burnham, K. P., Anderson, D. R., and Huyvaert, K. P. (2011). AIC model
selection and multimodel inference in behavioral ecology: some background,
observations, and comparisons. Behav. Ecol. Sociobiol. 65, 23–25. doi: 10.1007/
s00265-010-1029-6 Epstein, H. A. B. (2020). Virtual meeting fatigue. J. Hosp. Libr. 20, 356–360. doi:
10.1080/15323269.2020.1819758 Calarco, J. M., Meanwell, E., Anderson, E., and Knopf, A. (2020). Let’s not pretend
it’s fun: how covid-19-related school and childcare closures are damaging
mothers’ well-being. SocArXiv [Preprint] doi: 10.31235/osf.io/jyvk4 Ettman, C. K., Abdalla, S. M., Cohen, G. H., Sampson, L., Vivier, P. M., and
Galea, S. (2020). Prevalence of depression symptoms in US adults before and
during the COVID-19 pandemic. JAMA Netw. Open 3:e2019686. doi: 10.1001/
jamanetworkopen.2020.19686 Cameron, E. REFERENCES Nat. 13,
363–382. doi: 10.1007/s12110-002-1020-7 Davenport, M. H., Meyer, S., Meah, V. L., Strynadka, M. C., and Khurana, R. (2020). Moms are not OK: COVID-19 and maternal mental health. Front. Glob. Womens Health 1:1. doi: 10.3389/fgwh.2020.00001 Barlow, J. (2015). Vulnerable Mothers in Pregnancy and the Postnatal Period. London: Nursing in Practice. Del Boca, D., Oggero, N., Profeta, P., and Rossi, M. (2020). Women’s Work,
Housework and Childcare, Before and During COVID-19. CESifo Working Paper
No. 8403. Rochester, NY: SSRN. Bauer, A., Parsonage, M., Knapp, M., Iemmi, V., and Adelaja, B. (2014). Costs
of Perinatal Mental Health Problems. London: Centre for Mental Health and
London School of Economics. Department of Health and Social Care (2020). Guidance: Making a Support Bubble
with Another Household. How You can Safely Expand the Group of People
You have Close Contact with During the Coronavirus (COVID-19) Pandemic. Available online at: https://www.gov.uk/guidance/making-a-support-bubble-
with-another-household (accessed December 30, 2020) BBC News (2020b). Coronavirus Lockdown: Would You Report People Who Break
the Rules?. Available online at: https://www.bbc.co.uk/news/world-52525463
(accessed March 5, 2021) BBC News (2020a). Coronavirus: More than 9,000 fines for Lockdown Breaches. Available online at: https://www.bbc.co.uk/news/uk-52489943 (accessed March
5, 2021) Dib, S., Rougeaux, E., Vázquez-Vázquez, A., Wells, J. C., and Fewtrell, M. (2020). Maternal mental health and coping during the COVID-19 lockdown in the
UK: Data from the COVID-19 New mum study. Int. J. Gynecol. Obstetr. 151,
407–414. doi: 10.1002/ijgo.13397 Dib, S., Rougeaux, E., Vázquez-Vázquez, A., Wells, J. C., and Fewtrell, M. (2020). Maternal mental health and coping during the COVID-19 lockdown in the
UK: Data from the COVID-19 New mum study. Int. J. Gynecol. Obstetr. 151,
407–414. doi: 10.1002/ijgo.13397
Downey, G., and Coyne, J. C. (1990). Children of depressed parents: an integrative
review. Psychol. Bull. 108:50. doi: 10.1037/0033-2909.108.1.50 Beck, C. T. (1995). The effects of postpartum depression on maternal-infant
interaction: a meta-analysis. Nurs. Res. 44, 298–305. jg
Downey, G., and Coyne, J. C. (1990). Children of depressed parents: an integrative
review. Psychol. Bull. 108:50. doi: 10.1037/0033-2909.108.1.50 Beck, C. T. (1998). The effects of postpartum depression on child development: a
meta-analysis. Arch. Psychiatr. Nurs. 12, 12–20. doi: 10.1016/s0883-9417(98)
80004-6 Doyle, F. L., and Klein, L. (2020). Postnatal depression risk factors: an
overview of reviews to inform COVID-19 research, clinical, and policy
priorities. Front. Glob. Womens Health 1:577273. doi: 10.3389/fgwh.2020. 577273 Beck, C. T. (2001). Predictors of postpartum depression: an update. Nurs. Res. 50,
275–285. doi: 10.1097/00006199-200109000-00004 Bignardi, G., Dalmaijer, E. REFERENCES Cogill, S. R., Caplan, H. L., Alexandra, H., Robson, K. M., and Kumar, R. (1986). Impact of maternal postnatal depression on cognitive development of young
children. Br. Med. J. 292, 1165–1167. doi: 10.1136/bmj.292.6529.1165 Alvarado, R., Jadresic, E., Guajardo, V., and Rojas, G. (2015). First validation of a
Spanish-translated version of the Edinburgh postnatal depression scale (EPDS)
for use in pregnant women. A Chilean study. Arch. Womens Ment. Health 18,
607–612. doi: 10.1007/s00737-014-0466-z Coll, C. D. V. N., da Silveira, M. F., Bassani, D. G., Netsi, E., Wehrmeister, F. C.,
Barros, F. C., et al. (2017). Antenatal depressive symptoms among pregnant
women: evidence from a Southern Brazilian population-based cohort study. J. Affect. Disord. 209, 140–146. doi: 10.1016/j.jad.2016.11.031 p p
J. Affect. Disord. 209, 140–146. doi: 10.1016/j.jad.2016.11.031 APA (2013). DSM-5 Diagnostic and Statistical Manual of Mental Disorders, 5th Edn. Washington, DC: American Psychiatric Publishing. Cox, J. L., Holden, J. M., and Sagovsky, R. (1987). Detection of postnatal
depression: development of the 10-item Edinburgh Postnatal depression scale. Br. J. Psychiatry 150, 782–786. doi: 10.1192/bjp.150.6.782 Archer, C., and Kao, K. T. (2018). Mother, baby and Facebook makes three: does
social media provide social support for new mothers? Media Int. Aust. 168,
122–139. doi: 10.1177/1329878x18783016 Coyl, D. D., Roggman, L. A., and Newland, L. A. (2002). Stress, maternal
depression, and negative mother-infant interactions in relations to infant
attachment. Infant Ment. Health J. 23, 145–163. doi: 10.1002/imhj.10009 Arifin, S. R., Cheyne, H., and Maxwell, M. (2018). Review of the prevalence of
postnatal depression across cultures. AIMS Public Health. 5:260. doi: 10.3934/
publichealth.2018.3.260 tachment. Infant Ment. Health J. 23, 145–163. doi: 10.1002/imhj.1 Crockenberg, S. B. (1981). Infant irritability, mother responsiveness, and social
support influences on the security of infant-mother attachment. Child Dev. 1,
857–865. doi: 10.2307/1129087 support influences on the security of infant-mother attachment. Child Dev. 1,
857–865. doi: 10.2307/1129087 Arnot, M., Brandl, E., Campbell, O. L. K., Chen, Y., Du, J., Dyble, M., et al. (2020). How evolutionary behavioural sciences can help us understand behaviour
in a pandemic. Evol. Med. Public Health 1, 264–278. doi: 10.1093/emph/eoa
a038 Crouch, M. (1999). The evolutionary context of postnatal depression. Hum. Nat. 10, 163–182. doi: 10.1007/s12110-999-1013-x Arslan, R. C., Walther, M. P., and Tata, C. S. (2020). formr: a study framework
allowing for automated feedback generation and complex longitudinal
experience-sampling studies using R. Behav. Res. Methods 52, 376–387. doi:
10.3758/s13428-019-01236-y Crouch, M. (2002). Bonding, postpartum dysphoria, and social ties. Hum. ETHICS STATEMENT The studies involving human participants were reviewed
and
approved
by
the
UCL
Research
Ethics
Committee. The participants provided their written informed consent to
participate in this study. May 2021 | Volume 12 | Article 648002 Frontiers in Psychology | www.frontiersin.org 13 Lockdown Communication and Postnatal Depression Myers and Emmott REFERENCES Helpful grandmothers in rural Ethiopia: a Gibson, M. A., and Mace, R. (2005). Helpful grandmothers in rural Ethiopia: a
study of the effect of kin on child survival and growth. Evol. Hum. Behav. 26,
469–482. doi: 10.1016/j.evolhumbehav.2005.03.004 Meehan, C. L., Helfrecht, C., and Quinlan, R. J. (2014). Cooperative breeding and
Aka children’s nutritional status: is flexibility key? Am. J. Phys. Anthropol. 153,
513–525. doi: 10.1002/ajpa.22415 study of the effect of kin on child survival and growth. Evol. Hum. Behav. 26,
469–482. doi: 10.1016/j.evolhumbehav.2005.03.004 Hagen, E. H. (2003). “The bargaining model of depression,” in Genetic and Cultural
Evolution of Cooperation, ed. P. Hammerstein (Cambridge, MA: MIT Press),
95–123. Moehler, E., Brunner, R., Wiebel, A., Reck, C., and Resch, F. (2006). Maternal
depressive symptoms in the postnatal period are associated with long-term
impairment of mother–child bonding. Arch. Womens Ment. Health 9, 273–278. doi: 10.1007/s00737-006-0149-5 Hagen, E. H., and Barrett, H. C. (2007). Perinatal sadness among Shuar women:
support for an evolutionary theory of psychic pain. Med. Anthropol. Q. 21,
22–40. doi: 10.1525/maq.2007.21.1.22 Murray, L., and Cooper, P. J. (1997). Effects of postnatal depression on infant
development. Arch. Dis. Childhood 77, 99–101. Hagen, E. H., and Thornhill, R. (2017). Testing the psychological pain hypothesis
for postnatal depression: reproductive success versus evidence of design. Evol. Med. Public Health 2017, 17–23. doi: 10.1093/emph/eow032 Murray, L., Fiori-Cowley, A., Hooper, R., and Cooper, P. (1996). The impact
of postnatal depression and associated adversity on early mother-infant
interactions and later infant development. Child Dev. 67, 2512–2526. doi:
10.2307/1131637 Hahn-Holbrook, J., and Haselton, M. (2014). Is postpartum depression a disease
of modern civilization? Curr. Dir. Psychol. Sci. 23, 395–400. doi: 10.1177/
0963721414547736 Myers, S., Burger, O., and Johns, S. E. (2016). Postnatal depression and reproductive
success in modern, low-fertility contexts. Evol. Med. Public Health 2016, 71–84. doi: 10.1093/emph/eow003 Halbreich, U., and Karkun, S. (2006). Cross-cultural and social diversity of
prevalence of postpartum depression and depressive symptoms. J. Affect. Disord. 91, 97–111. doi: 10.1016/j.jad.2005.12.051 Myers, S., Burger, O., and Johns, S. E. (2017). Reply to Hagen and Thornhill. Evol. Med. Public Health 2017, 24–26. doi: 10.1093/emph/eow033 Myers, S., and Johns, S. E. (2018). Postnatal depression is associated with
detrimental life-long and multi-generational impacts on relationship quality. PeerJ 6:e4305. doi: 10.7717/peerj.4305 Harrison, V., Moulds, M. L., and Jones, K. (2021). Support from friends moderates
the relationship between repetitive negative thinking and postnatal wellbeing
during COVID-19. J. Reprod. Infant Psychol. doi: 10.1080/02646838.2021. REFERENCES 1886260 [Epub ahead of print]. Myers, S., Page, A. E., and Emmott, E. H. (2021). The differential role of practical
and emotional support in infant feeding experience in the UK. Phil. Trans. R. Soc. B doi: 10.1098/rstb.2020.0031 Hessami, K., Romanelli, C., Chiurazzi, M., and Cozzolino, M. (2020). COVID-
19 pandemic and maternal mental health: a systematic review and meta-
analysis. J. Mater. Fetal Neonat. Med. 30, 1–8. doi: 10.1080/14767058.2020.184
3155 Mykletun, A., Bjerkeset, O., Øverland, S., Prince, M., Dewey, M., and Stewart, R. (2009). Levels of anxiety and depression as predictors of mortality: the HUNT
study. Br. J. Psychiatry 195, 118–125. doi: 10.1192/bjp.bp.108.054866 Hill, K. R., Walker, R. S., Božiˇcevi´c, M., Eder, J., Headland, T., Hewlett, B., et al. (2011). Co-residence patterns in hunter-gatherer societies show unique human
social structure. Science 331, 1286–1289. doi: 10.1126/science.1199071 Nettle, D. (2004). Evolutionary origins of depression: a review and reformulation. J. Affect. Disord. 81, 91–102. doi: 10.1016/j.jad.2003.08.009 Hrdy, S. B. (1999). Mother Nature: A History of Mothers, Infants, and Natural
Selection. New York, NY: Pantheon Books. Nolan, M. L., Mason, V., Snow, S., Messenger, W., Catling, J., and Upton, P. (2012). Making friends at antenatal classes: a qualitative exploration of friendship across
the transition to motherhood. J. Perinat. Educ. 21, 178–185. doi: 10.1891/1058-
1243.21.3.178 Johnston-Ataata, K., Kokanovi´c, R., and Michaels, P. A. (2018). “One of the
most vulnerable times in your life’: expectations and emotional experiences of
support in the early postnatal period,” in Paths to Parenthood, eds R. Kokanovi´c,
P. Michaels, and K. Johnston-Ataata (Singapore: Palgrave Macmillan), 187–214. doi: 10.1007/978-981-13-0143-8_9 Office
for
National
Statistics
(2019). Employee
Earnings
in
the
UK:
2019. Available
online
at:
https://www.ons.gov.uk/
employmentandlabourmarket/peopleinwork/earningsandworkinghours/
bulletins/annualsurveyofhoursandearnings/2019#:~{}:text=In%20April%
202019%2C%20London%20topped,the%20UK%20(%C2%A3585). (accessed
March 5, 2021) Keicolt-Glaser, J. K., and Glaser, R. (2002). Depression and immune function:
central pathways tomorbidity and mortality. J. Psychosom. Res. 53, 873–876. Kim, H. J., Cavanaugh, J. E., Dallas, T. A., and Foré, A. S. (2013). Model selection
criteria for overdispersed data and their application to the characterization of
a host-parasite relationship. Environ. Ecol. Stat. 21, 329–350. doi: 10.1007/
s10651-013-0257-0 O’Hara, M. W., and McCabe, J. E. (2013). Postpartum depression: current status
and future directions. Annu. Rev. Clin. Psychol. 9, 379–407. doi: 10.1146/
annurev-clinpsy-050212-185612 Kinsey, C. B., Baptiste-Roberts, K., Zhu, J., and Kjerulff, K. H. (2014). Birth-related,
psychosocial, and emotional correlates of positive maternal–infant bonding in
a cohort of first-time mothers. Midwifery 30, e188–e194. Page, A. REFERENCES E., Joyce, K. M., Delaquis, C. P., Reynolds, K., Protudjer, J. L., and
Roos, L. E. (2020). Maternal psychological distress & mental health service use
during the COVID-19 pandemic. J. Affect. Disord. 276, 765–774. Faircloth, C. (2014). “Intensive parenting and the expansion of parenting,” in
Parenting Culture Studies, eds E. Lee, J. Bristow, C. Faircloth, and J. Macvarish
(London: Palgrave Macmillan), 25–50. doi: 10.1057/9781137304612_2 Ceulemans, M., Hompes, T., and Foulon, V. (2020). Mental health status of
pregnant and breastfeeding women during the COVID-19 pandemic: a call for
action. Int. J. Gynecol. Obstetr. 151, 146–147. doi: 10.1002/ijgo.13295 Fancourt, D., Steptoe, A., and Bu, F. (2020). Trajectories of anxiety and depressive
symptoms during enforced isolation due to COVID-19: longitudinal analyses May 2021 | Volume 12 | Article 648002 Frontiers in Psychology | www.frontiersin.org 14 Lockdown Communication and Postnatal Depression Myers and Emmott of 36,520 adults in England. medRxiv [Preprint] doi: 10.1101/2020.06.03. 20120923 Leger, J., and Letourneau, N. (2015). New mothers and postpartum depression:
a narrative review of peer support intervention studies. Health Soc. Care
Commun. 23, 337–348. doi: 10.1111/hsc.12125 of 36,520 adults in England. medRxiv [Preprint] doi: 10.1101/2020.06.03. 20120923 Fellmeth, G., et al. (2021). Perinatal depression in migrant and refugee women on
the Thai-Myanmar border: does social support matter? Phil. Trans. R. Soc. B
doi: 10.1098/rstb.2020.0030 Levis, B., Negeri, Z., Sun, Y., Benedetti, A., and Thombs, B. D. (2020). Accuracy
of the Edinburgh Postnatal Depression Scale (EPDS) for screening to detect
major depression among pregnant and postpartum women: systematic review
and meta-analysis of individual participant data. BMJ 371:m4022. doi: 10.1136/
bmj.m4022 Finlayson, K., Crossland, N., Bonet, M., and Downe, S. (2020). What matters to
women in the postnatal period: a meta-synthesis of qualitative studies. PLoS
One 15:e0231415. doi: 10.1371/journal.pone.0231415 Gariépy, G., Honkaniemi, H., and Quesnel-Vallée, A. (2016). Social support and
protection from depression: systematic review of current findings in Western
countries. Br. J. Psychiatry 209, 284–293. doi: 10.1192/bjp.bp.115.169094 Martin, C. R., and Redshaw, M. (2018). Establishing a coherent and replicable
measurement model of the Edinburgh Postnatal Depression Scale. Psychiatry
Res. 264, 182–191. doi: 10.1016/j.psychres.2018.03.062 Res. 264, 182–191. doi: 10.1016/j.psychres.2018.03.062 Gelfand, D. M., and Teti, D. M. (1990). The effects of maternal depression on
children. Clin. Psychol. Rev. 10, 329–353. doi: 10.1016/0272-7358(90)90065-i McElreath, R. (2020). Statistical Rethinking: A Bayesian Course with Examples in R
and Stan. Boca Raton, FL: CRC Press. Gibson, M. A., and Mace, R. (2005). REFERENCES doi: 10.3389/fpsyt.2020.58
9916 Price, S. L., Aston, M., Monaghan, J., Sim, M., Tomblin Murphy, G., Etowa, J.,
et al. (2018). Maternal knowing and social networks: understanding first-time
mothers’ search for information and support through online and offline social
networks. Qual. Health Res. 28, 1552–1563. doi: 10.1177/1049732317748314 Spry, E. A., Moreno-Betancur, M., Middleton, M., Howard, L. M., Brown,
S. J., Molyneaux, E., et al. (2021). Preventing postnatal depression: a causal
mediation analysis of a 20-year preconception cohort. Phil. Trans. R. Soc. B
doi: 10.1098/rstb.2020.0028 etworks. Qual. Health Res. 28, 1552–1563. doi: 10.1177/10497323 Raison, C. L., and Miller, A. H. (2013). The evolutionary significance of depression
in Pathogen Host Defense (PATHOS-D). Mol. Psychiatry 18, 15–37. doi: 10. 1038/mp.2012.2 Stowe, Z., Hostetter, A. L., and Newport, D. J. (2005). The onset of postpartum
depression: implications for clinical screening in obstetrical care. Am. J. Obstetr. Gynecol. 192, 522–526. doi: 10.1016/j.ajog.2004.07.054 Raison, C. L., and Miller, A. H. (2017). Pathogen–host defense in the evolution
of depression: insights into epidemiology, genetics, bioregional differences and
female preponderance. Neuropsychopharmacology. 42, 5–27. doi: 10.1038/npp. 2016.194 Strange, C., Fisher, C., Howat, P., and Wood, L. (2014). Fostering supportive
community connections through mothers’ groups and playgroups. J. Adv. Nurs. 70, 2835–2846. doi: 10.1111/jan.12435 Raj, V. K., and Plichta, S. B. (1998). The role of social support in breastfeeding
promotion: a literature review. J. Hum. Lact. 14, 41–45. doi: 10.1177/
089033449801400114 Teaford, D., McNiesh, S., and Goyal, D. (2019). New mothers’ experiences with
online postpartum forums. MCN Am. J. Matern. 44, 40–45. doi: 10.1097/nmc. 0000000000000489 Rantala, M. J., Luoto, S., Krams, I., and Karlsson, H. (2018). Depression
subtyping based on evolutionary psychiatry: proximate mechanisms and
ultimate functions. Brain Behav. Immun. 69, 603–617. doi: 10.1016/j.bbi.2017. 10.012 Textor, J., van der Zander, B., Gilthorpe, M. S., Li´skiewicz, M., and Ellison, G. T. (2016). Robust causal inference using directed acyclic graphs: the R package
‘dagitty’. Int. J. Epidemiol. 45, 1887–1894. Roberts, S. G. B., and Dunbar, R. I. M. (2011). Communication in social networks:
effects of kinship, network size, and emotional closeness. Pers. Relat. 18, 439–
452. doi: 10.1111/j.1475-6811.2010.01310.x Thayer, Z. M., and Gildner, T. E. (2020). COVID-19-related financial stress
associated with higher likelihood of depression among pregnant women living
in the United States. Am. J. Hum. Biol. 22:e23508. Scelza, B. A., and Hinde, K. (2019). Crucial contributions: a biocultural study
of grandmothering during the perinatal period. Hum. Nat. 30, 371–397. REFERENCES E., Chaudhary, N., Viguier, S., Dyble, M., Thompson, J., Smith, D., et al. (2017). Hunter-gatherer social networks and reproductive success. Sci. Rep. 7:1153. Page, A. E., Emmott, E. H., Dyble, M., Smith, D., Chaudhary, N., Viguier, S.,
et al. (2019a). Children are important too: juvenile playgroups and maternal
childcare in a foraging population, the Agta. Phil. Trans. R. Soc. B doi: 10.1098/
rstb.2020.0026 [Epub ahead of print]. Lakey, B., and Cronin, A. (2008). “Low social support and major depression:
research, theory and methodological issues,” in Risk Factors in Depression, eds
K. S. Dobson and D. J. A. Dozois (Amsterdam: Elsevier), 385–408. doi: 10.1016/
b978-0-08-045078-0.00017-4 Page, A. E., Thomas, M. G., Smith, D., Dyble, M., Viguier, S., Chaudhary, N., et al. (2019b). Testing adaptive hypotheses of alloparenting in Agta foragers. Nat. Hum. Behav. 3, 1154–1163. doi: 10.1038/s41562-019-0679-2 Leahy-Warren, P., McCarthy, G., and Corcoran, P. (2012). First-time mothers:
social support, maternal parental self-efficacy and postnatal depression. J. Clin. Nurs. 21, 388–397. doi: 10.1111/j.1365-2702.2011.03701.x Pariente, G., Broder, O. W., Sheiner, E., Battat, T. L., Mazor, E., Salem, S. Y., et al. (2020). Risk for probable post-partum depression among women during the Leech, N. L., and Onwuegbuzie, A. J. (2009). A typology of mixed methods research
designs. Qual. Quant. 43, 265–275. doi: 10.1007/s11135-007-9105-3 May 2021 | Volume 12 | Article 648002 Frontiers in Psychology | www.frontiersin.org 15 Lockdown Communication and Postnatal Depression Myers and Emmott Smith-Nielsen, J., Matthey, S., Lange, T., and Væver, M. S. (2018). Validation of
the Edinburgh Postnatal depression scale against both DSM-5 and ICD-10
diagnostic criteria for depression. BMC Psychiatry 18:393. doi: 10.1186/s12888-
018-1965-7 COVID-19 pandemic. Arch. Womens Ment. Health 23, 767–773. doi: 10.1007/
s00737-020-01075-3 Pilkauskas, N. V., and Martinson, M. L. (2014). Three-generation family
households in early childhood: comparisons between the United States, the
United Kingdom, and Australia. Demogr. Res. 30:1639. doi: 10.4054/demres. 2014.30.60 Solomon, D. A., Keller, M. B., Leon, A. C., Mueller, T. I., Lavori, P. W., Shea,
M. T., et al. (2000). Multiple recurrences of major depressive disorder. Am. J. Psychiatry 157, 229–233. doi: 10.1176/appi.ajp.157.2.229 Prados, M., and Zamarro, G. (2020). Gender Differences in Couples’ Division
of Childcare, Work and Mental Health During COVID-19. CESR-Schaeffer
Working Paper No. 003. Rochester, NY: SSRN. Spinola, O., Liotti, M., Speranza, A. M., and Tambelli, R. (2020). Effects of COVID-
19 epidemic lockdown on postpartum depressive symptoms in a sample
of Italian mothers. Front. Psychiatry. 11:589916. REFERENCES doi:
10.1007/s12110-019-09356-2 Topolovec-Vranic, J., and Natarajan, K. (2016). The use of social media in
recruitment for medical research studies: a scoping review. J. Med. Intern. Res. 18:e286. doi: 10.2196/jmir.5698 Schaffnit, S. B., and Sear, R. (2017). Support for new mothers and fertility in the
United Kingdom: Not all support is equal in the decision to have a second child. Popul. Stud. 71, 345–361. doi: 10.1080/00324728.2017.1349924 Vliegen, N., Casalin, S., and Luyten, P. (2014). The course of postnatal depression:
a review of longitudinal studies. Harv. Rev. Psychiatry 22, 1–22. doi: 10.1097/
hrp.0000000000000013 Wright, C. M., Parkinson, K. N., and Drewett, R. F. (2006). The influence of
maternal socioeconomic and emotional factors on infant weight gain and
weight faltering (failure to thrive): data from a prospective birth cohort. Arch. Dis. Childhood 91, 312–317. doi: 10.1136/adc.2005.077750 Sear, R. (2017). Family and fertility: does kin help influence women’s fertility,
and how does this vary worldwide? Popul. Horizons 14, 18–34. doi: 10.1515/
pophzn-2017-0006 Sear, R. (2021). The male breadwinner nuclear family is not the traditional human
family, and promotion of this myth may have adverse health consequences. Phil. Trans. R. Soc. B doi: 10.1098/rstb.2020.0020 Wu, Y., Zhang, C., Liu, H., Duan, C., Li, C., Fan, J., et al. (2020). Perinatal depressive
and anxiety symptoms of pregnant women along with COVID-19 outbreak in
China. Am. J. Obstetr. Gynecol. 223, e1–e240. Sear, R., and Coall, D. (2011). How much does family matter? Cooperative breeding
and the demographic transition. Popul. Dev. Rev. 37, 81–112. doi: 10.1111/j. 1728-4457.2011.00379.x Yim, I. S., Stapleton, L. R., Guardino, C. M., Hahn-Holbrook, J., and Schetter,
C. D. (2015). Biological and psychosocial predictors of postpartum depression:
systematic review and call for integration. Annu. Rev. Clin. Psychol. 30:11. Sear, R., and Mace, R. (2008). Who keeps children alive? A review of the effects of
kin on child survival. Evol. Hum. Behav. 29, 1–8. doi: 10.1016/j.evolhumbehav. 2007.10.001 Zanardo, V., Manghina, V., Giliberti, L., Vettore, M., Severino, L., and Straface,
G. (2020). Psychological impact of COVID-19 quarantine measures in
northeastern Italy on mothers in the immediate postpartum period. Int. J. Gynecol. Obstetr. 150, 184–188. doi: 10.1002/ijgo.13249 Sear, R., Mace, R., and McGregor, I. A. (2003). The effects of kin on female fertility
in rural Gambia. Evol. Hum. Behav. 24, 25–42. doi: 10.1016/s1090-5138(02)
00105-8 Gynecol. Obstetr. 150, 184–188. doi: 10.1002/ijgo.13249 Zoch, G., Bächmann, A. C., and Vicari, B. (2020). Who cares when care closes? REFERENCES Care-arrangements and parental working conditions during the COVID-19
pandemic in Germany. Eur. Soc. doi: 10.1080/14616696.2020.1832700 [Epub
ahead of print]. Shafer, K., Scheibling, C., and Milkie, M. A. (2020). The division of domestic labor
before and during the COVID-19 pandemic in Canada: stagnation versus Shifts Shafer, K., Scheibling, C., and Milkie, M. A. (2020). The division of domestic labor
before and during the COVID-19 pandemic in Canada: stagnation versus Shifts
in Fathers’ contributions. Can. Rev. Sociol. 57, 523–549. doi: 10.1111/cars.12315 in Fathers’ contributions. Can. Rev. Sociol. 57, 523–549. doi: 10.1111/cars.12315 Shevlin, M., McBride, O., Murphy, J., Miller, J. G., Hartman, T. K., Levita, L., et al. (2020). Anxiety, depression, traumatic stress and COVID-19-related anxiety
in the UK general population during the COVID-19 pandemic. BJPsych Open
6:e125. Conflict of Interest: The authors declare that the research was conducted in the
absence of any commercial or financial relationships that could be construed as a
potential conflict of interest. Silverman, M. E., Burgos, L., Rodriguez, Z. I., Afzal, O., Kalishman, A., Callipari,
F., et al. (2020). Postpartum mood among universally screened high and
low socioeconomic status patients during COVID-19 social restrictions in
New York City. Sci. Rep. 10, 1–7. Copyright © 2021 Myers and Emmott. This is an open-access article distributed
under the terms of the Creative Commons Attribution License (CC BY). The use,
distribution or reproduction in other forums is permitted, provided the original
author(s) and the copyright owner(s) are credited and that the original publication
in this journal is cited, in accordance with accepted academic practice. No use,
distribution or reproduction is permitted which does not comply with these terms. Skalkidou, A., Hellgren, C., Comasco, E., Sylvén, S., and Sundström Poromaa,
I. (2012). Biological aspects of postpartum depression. Womens Health 8,
659–671. doi: 10.2217/whe.12.55 May 2021 | Volume 12 | Article 648002 Frontiers in Psychology | www.frontiersin.org 16
| 18,143 |
https://github.com/chenyuncai/edp-build/blob/master/test/data/dummy-project/edp-build-config.js
|
Github Open Source
|
Open Source
|
BSD-2-Clause-FreeBSD
| 2,019 |
edp-build
|
chenyuncai
|
JavaScript
|
Code
| 282 | 930 |
/***************************************************************************
*
* Copyright (c) 2013 Baidu.com, Inc. All Rights Reserved
* $Id$
*
**************************************************************************/
/**
* edp-build-config.js ~ 2013/10/15 17:48:25
* @author leeight([email protected])
* @version $Revision$
* @description
*
**/
var cwd = __dirname;
var path = require( 'path' );
/**
* 输入目录
*
* @type {string}
*/
exports.input = cwd;
exports.inputs = [path.resolve( cwd, '..', 'base' )];
/**
* 输出目录
*
* @type {string}
*/
exports.output = path.resolve( cwd, 'output' );
/**
* 排除文件pattern列表
*
* @type {Array}
*/
exports.exclude = [
'/tool',
'/doc',
'/test',
'/module.conf',
'/dep/packages.manifest',
'/dep/*/*/test',
'/dep/*/*/doc',
'/dep/*/*/demo',
'/dep/*/*/tool',
'/dep/*/*/*.md',
'/dep/*/*/package.json',
'/edp-*',
'/.edpproj',
'.svn',
'.git',
'.gitignore',
'.idea',
'.project',
'Desktop.ini',
'Thumbs.db',
'.DS_Store',
'*.tmp',
'*.bak',
'*.swp'
];
var moduleEntries = 'html,htm,phtml,tpl,vm,js';
var pageEntries = 'html,htm,phtml,tpl,vm';
/**
* 获取构建processors的方法
*
* @return {Array}
*/
exports.getProcessors = function () {
return [
new LessCompiler( {
entryExtnames: pageEntries
} ),
new CssCompressor(),
new ModuleCompiler( {
configFile: 'module.conf',
entryExtnames: moduleEntries
} ),
new JsCompressor({
compressOptions: {
warnings: false
},
sourceMapOptions: {
enable: true
}
}),
new PathMapper( {
replacements: [
{ type: 'html', tag: 'link', attribute: 'href', extnames: pageEntries },
{ type: 'html', tag: 'img', attribute: 'src', extnames: pageEntries },
{ type: 'html', tag: 'script', attribute: 'src', extnames: pageEntries },
{ extnames: moduleEntries, replacer: 'module-config' }
],
mapper: function(value) {
// 我承认比较难看，不过暂时能WORK，还有改进的空间.
return value.replace(/(^|\/)src(\/|$)/, function(match, head, tail) {
return (head === '/' ? head : '') + 'asset' + (tail === '/' ? tail : '');
}).replace('../base', 'base')
}
} )
];
};
/**
* builder主模块注入processor构造器的方法
*
* @param {Object} processors
*/
exports.injectProcessor = function ( processors ) {
for ( var key in processors ) {
global[ key ] = processors[ key ];
}
};
/* vim: set ts=4 sw=4 sts=4 tw=100: */
| 50,268 |
https://github.com/BoMil/onlineShop/blob/master/PharmacyApp/Controllers/LabelsController.cs
|
Github Open Source
|
Open Source
|
MIT
| null |
onlineShop
|
BoMil
|
C#
|
Code
| 189 | 677 |
using System;
using System.Collections.Generic;
using System.Linq;
using System.Threading.Tasks;
using Microsoft.AspNetCore.Http;
using Microsoft.AspNetCore.Mvc;
using Microsoft.EntityFrameworkCore;
using PharmacyApp.Models;
namespace PharmacyApp.Controllers
{
[Route("api/[controller]")]
[ApiController]
public class LabelsController : ControllerBase
{
private readonly PharmacyContext _context;
public LabelsController(PharmacyContext context)
{
_context = context;
}
// GET: api/Labels
[HttpGet]
public async Task<ActionResult<IEnumerable<Label>>> Getlabels()
{
return await _context.labels.ToListAsync();
}
// GET: api/Labels/5
[HttpGet("{id}")]
public async Task<ActionResult<Label>> GetLabel(int id)
{
var label = await _context.labels.FindAsync(id);
if (label == null)
{
return NotFound();
}
return label;
}
// PUT: api/Labels/5
[HttpPut("{id}")]
public async Task<IActionResult> PutLabel(int id, Label label)
{
if (id != label.LabelId)
{
return BadRequest();
}
_context.Entry(label).State = EntityState.Modified;
try
{
await _context.SaveChangesAsync();
}
catch (DbUpdateConcurrencyException)
{
if (!LabelExists(id))
{
return NotFound();
}
else
{
throw;
}
}
return NoContent();
}
// POST: api/Labels
[HttpPost]
public async Task<ActionResult<Label>> PostLabel(Label label)
{
_context.labels.Add(label);
await _context.SaveChangesAsync();
return CreatedAtAction("GetLabel", new { id = label.LabelId }, label);
}
// DELETE: api/Labels/5
[HttpDelete("{id}")]
public async Task<ActionResult<Label>> DeleteLabel(int id)
{
var label = await _context.labels.FindAsync(id);
if (label == null)
{
return NotFound();
}
_context.labels.Remove(label);
await _context.SaveChangesAsync();
return label;
}
private bool LabelExists(int id)
{
return _context.labels.Any(e => e.LabelId == id);
}
}
}
| 24,455 |
sn87062011_1914-05-12_1_4_1
|
US-PD-Newspapers
|
Open Culture
|
Public Domain
| 1,914 |
None
|
None
|
English
|
Spoken
| 2,312 | 3,378 |
HUDSON BAY CAULAFLOWER 25c per Can CROWLEY % PORTER TILLMAN-McLAURIN FOES 13 YEARS, MAKE UP COLUMBIA, S. C.—Senator B. R Tillman and John L. McLaurin shook hands here last night for the first time since their fisticuffs in the United States senate thirteen years ago. Senator Tillman met McLaurin in the state capitol. After a moment in l hesitation they approached each other with outstretched hands. They seemed to enjoy the reunion. Are you a subscriber to the Nugget “not why not? HEALTH OFFICER SLOAN SAYS TO BOIL WATER The usual crowd was missed at the city hall last night as there was scarcely a baker’s dozen in the audience when the council was called to order by Mayor Grigsby. All members answered to the roll call except Councilman Orland. The minutes of the previous meeting were read and approved. The clerk stated that two petitions had been filed by candidates for treasurer of and member of the school board! These were Fred Ayer and Mrs. Hudson Gastner. The clerk was instructed to have the ballots printed and the chairman of the street committee stated that he would see to the erection of the booths for election. The city attorney reported that he had taken up the matter of city lighting with the city power company and served written notice upon them that the contract with the city had expired. The cily health officer, Dr. Sloan, mi do a verbal report. He drew at tention of the council to the necessity i f boiling water at this lime of year, i.i (I said lie liad given notice to the pi.idle through the official paper to lu ll all drinking water which at the I ine of the break up would necessar i'v tie contaminated l>y the surface Row of water. He drew attention to iht dirt\ condition of the streets which \v uId have to np endured till the snow had melted anil to the practice of some ■ u the car tinge men dumping refuse in place where it should not be and | suggested that a few arrests mlghl I have a wholesome effect. He also drew the attention to iho fact that !M;irons were rummaging garbage and taking away old rags which were carried to their cabins and was a si urce of damage. He suggested that ills matter t>e taken up with Mr. Shields of ttie bureau of education and the practice stopped. The/ council instructed its officer clpng the lines suggested by tlie re in rt of the health officer. The chief of the fire department re pi rted two fires during the month of April, one on Third street near the school house, damage $2 and one on Second avenue in which no damage was sustained. Upon the complaint of the fielmont people the street commissioner was in f.tructed to make temporary provision by laying planking so that the ap picuch to the bridge could be reached I y footmen, after which council ad journed. For reliable news, subscribe for the Nome Daily Nugget. $2 per month. TROOPS HURRY TO MEXICO CITY opscial Nugget Service. on board California May 1::. A wirtlhsji luescage from the ship California states that federal troops on the western coast are being ordered to Mexico City to strengthen the forces there in anticipation of an attack by the forces of Zupata. The message states that all the federal troops defending San Bins and other western coast ports have evacuated the towns and are hastening to the defense of the capital. FUNERAL OF MRS. KELLY WAS HELD TODAY The funeral of Mrs. Dan Kelly took place today from the Catholic church. The church was filled to its full capacity and the impressive services of high mass was held over the remains. Father Korham sang the high mass. Many beautiful floral designs from the Robert Emmets Society, the Catholic Ladies Aid Society, and from friends of the deceased covered the casket. The large number of the friends of the deceased followed the remains to the cemetery. The body was placed in a vault and will be taken to the outside in the spring. HUERTA'S PEACE ENVOYS EN ROUTE Special Nugget Service. VERA CRUZ, May 12.-The United States government was today notified that the peace envoys appointed by Huerta had arrived at Vera Cruz on their way to Washington. The envoys arrive yesterday and expect to sail for the United States at once. AT THE NEW EAGLE Old Lewis Hurter Rye and the Famous Atherton Bourbon wine. Distilled spring 1904-1906 bought in bond and reduced to 90 percent by U. S. government, by the bottle of a gallon. SPRING TIME IS HERE. Have you had your Spring Cleaning done yet; if not, why not? We are prepared to do cleaning, pressing and repairing in the most up-to-date and thorough manner for ladies and gentlemen. We clean hats. We make alterations. Suits made to order. All work guaranteed to give satisfaction. Prices reasonable. Your patronage earnestly solicited. NOME TAILORING COMPANY Hotel Segerstrom & Hagen and Zehner Jewelry stores. If you want to keep up with the procession, subscribe for the NUOOET. RUSSIAN GOVERNMENT SEARCH FOR SEDIFER PARLEY Special Nugget Service. ST. PETERSBURG, May 12.—The Russian government has equipped and arranged an expedition in search of Lieutenant Sedff and party who slated in search of the north pole years ago. It is believed by the geographical ity of St. Petersburg that the party still alive as they have met Villa, some unforeseen accident as they were well equipped for a trip of several years. KILLED IN CARD GAME, POSSE HUNTS SLAYER Special Nugget Service. FRANKLIN FURNACE, N.J., May —Six employees of the New Jersey Zinc Company, all Russians, were playing cards in a room on the second floor of a boarding house this evening, when one accused the other of cheating and shot him through the forehead, causing instant death. The murderer then jumped from the window and made off in the darkness. He was tracked to a large patch of woods on the outskirts. A press was organized and the woods have been surrounded. Rev. Bauer will deliver his interesting lecture on “Crime, Its Causes and Cure,” in the Federated Church Thursday, May 14, 9 p. m. Admission fifty cents. NEWS NOTES Judge Tucker and Marshal Jordan arrived from Council early this morning. Marshal Jordan says the judge is a pretty good musher and held the handlebars with skill, while the Jordan took a sleep in the sled. The skit race which was run yesterday from Nome to Hastings and return was won by Gus Nystrum in a closely contested race. The distance was covered by the winner in three hours and fifty-six and one-half minutes. The time made by the runners is as follows: Gus Nystrum 3:56:30; Joe Kastara, 3:57: John Nickko, 3:68:30; Gus Peterson 4:63; Lehmann and Jens Thompson not finishing. A large crowd gathered to see the start and the bulletin board in the Board of Trade drew a large crowd who watched the progress of the race. The Ladies Aid Society, under whose auspices Dr. Bauer will deliver one of his strong lectures on "Crime, its Causes and Cure" at the Federated church Thursday night will after the lecture serve a lunch. E. Powers was placed under arrest yesterday upon the complaint of Azaizoruk for assault and battery. The case will be heard this afternoon in the commissioner’s court. John J. Meyers, proprietor of the Anvil bakery, is making some changes and Improvements in the baking department of his establishment among which will be an overhauling of his ovens which will somewhat interfere with the work for a few days. But John says improved quality is his aim and hope that he will not inconvenience his numerous patrons while making the changes. Jackson lost another of his famous red dogs last night and two others were very sick and may die. The dogs have received the best medical attendance but to no avail. Pneumonia poisoning seems to be the cause of the trouble although the dogs have been carefully fed by their owner. Mrs. Buckmaster filed her petition for the school board and has made arrangements to address the voters of Nome at the city hall next Thursday night. There are now two candidates in the field: Mrs. Buckmaster and Fred Ayer. Miss Jessie Siller, the teacher of the first and second grade in the school, took sick recently and is now confined to her room. The children in her department were dismissed for today. NOTICE OF MARSHAL'S SALE. Public notice is hereby given that by virtue of an order of sale and writ of execution dated the 25th day of April, 1914, issued out of the District Court for the Second Division, District of Alaska, on judgment rendered in said court on the 22nd day of April, 1914, in favor of Charles H. Milot and against Joseph Sliscovitch and on which judgment at the date of the issuance of said execution there was due the sum of twenty-three hundred and forty-three and 50-100 dollars bearing interest at the rate of one percent per month, I will offer for sale and sell at public vendue to the highest and best bidder for cash, on the 10th day of June, 1914, at the front door of the U.S. Court House, Nome, Alaska, at 12 o'clock noon, all of the right, title and interest of the said Joseph Sliscovich in and to those certain placer mining claims lying and being in the Cape Nome Recording Precinct, District of Alaska, and known as No. 6 Below (upper) Discovery on Hobson Creek, Hurray Bench Claim opposite No. 6 below Discovery on Hobson Creek, Discovery Claim on Manilla Creek, and now in my custody by virtue of an attachment executed by me in this action on the 23rd day of October, 1913, and also all of the right, title and interest of said Joseph Sliscovich in and to those certain placer mining claims lying and being in the Cape Nome Recording Precinct, District of Alaska, and known as No. one above discovery on Manilla Creek and Hurray Claim below upper discovery, also known as and being the same claim heretofore levied on under the said attachment as the Hurray Bench claim opposite No. 6 below Discovery on Hobson Creek, and both of said claims levied on by me under this writ on the 30th day of April, 1914. Dated at Nome, Alaska, April 30th, 1914. E. R. JORDAN, United States Marshal. Second Division, District of Alaska. CLOSING OUT SALE LADIES' WALK OVER: shoes; $3.50 $4 $5 The WALKOVER name is a guarantee that the shoe will be as great as any, probably better than most. which are retailed at a much higher price. And tomorrow, Miss Slifer was greatly improved this afternoon and expects to soon be back to her work. LOU Hart is on the street again after being confined to his room for several days by sickness. Judge Schofield is reported sick and confined to his room. It is hoped but for a few days. FORT DAVIS MAY BE RETAINED. Dr. Mustard as president of the Nome Chamber of Commerce received the following telegram from Washington today which speaks for itself: Washington, May 12. J. H. Mustard: President of the Nome Chamber of Commerce: Nome, Alaska.: Governor Strong and I visited the war department yesterday about Fort Davis. We were asked to make recommendations in writing today. I think it will be all right. JAS. WICKERSHAM, Delegate from Alaska. RECORDS Assignment of Agreement. J. J. Wackhelmer to W. E. Hug, agreement to work claim No. 1 Holyoke. Agreement. Between Fred J. Bourdon and W. E. Hug to work claim No. 1 Holyoke. NEW FURS WANTED We represent M. S. Ellas Jr. & Co., one of the largest fur house in the world. Leibzig, Hamburg, New York. By eliminating the middleman we can afford to pay you high-class Market Prices right here in Nome. JOHN FELKELI BUYER & Consignments solicited either direct or through Miners and Merchants Bank. SPRING CLEANUP. Have the People's Steam Laundry your spring cleaning. We guarantee good work. Hough dry work especially. Give us a trial. Are you a subscriber to the paper? If not, why not? FLOUR IS CHEAP. Eread only 5c. North Pole Bakery and Anvil Bakery. DOG SALMON, 8c per lb. at BESSIE STORE. Cut prices on all White Goods and Ginghams. 26c Gingham, 6 yards for $1.00. Tissue Gingham at 26c yards. Tissue Brilliantine 30c a yard. 40c Dimity at 26c yard. English Nainsook 6 yards for $1.00. Indian Linen 10c 20c, and 80c yard. D. M. C. Thread and Stamped Goods at MRS. WANGER. 2nd Ave. Opp. Court House. When you want a dish of real good ICE CREAM or SODA WATER stop at the ROSE CANDY STORE. The home of home-made hard-coffee and chocolates. PHONE MAIN 61. Coders receive prompt attention. EVAPORATED FRUIT Is This Week’s Special. Apricots 25 lb box $4.50 Raisins, 25 lb box $2.75. Apples, 25 lb box. 2.75 Féy cluster raisin, 3. j | Poach** 25 lb box.$3.00 pk8# 60 \\ j e _ „ -H. H. seeded raisin*, 2 ii j : P#ar*' 25 ,b b0x .375 Pkg.. 25 S ! j j Prun.*, 26 lb box .2.75 Fancy H- H eurrent,( 3 ■ j | j Whit* figs, 25 1b box .... 2M pkg*.50 « ! i \ LIPTON’S TEA8 AND RIPE OLIVES. •• G.' P. GOGGIN |L I»K4)1C41K4)K4)K4:K4»:»K4?i;4.T4;K»)K«;K« X »)K4fr»*4*4X4:>l(4tt4X4X4X4X4>' BACON—EGOS—BUTTER—BEEF—VEAL—PORK i • jf ' BACON—EGGS—BUTTER—BEEF—VEAL—PORK j ! \\ p p p BACON—EGGS—BUTTER—BEEF—VEAL—PORK | \ ! f H H F* __ « > ;! § g g OLD RELIABLE Jill ALASKA’S BEST \\ Hi ASK THOSE WHO KNOW if u o u ■ 3! \\ « « « NaOdt—TIVUA—.133a—UBXXIIR—soos—'NOOV3 ' ’ NHOd—avsA—.aaaa-^aaixna—sooa—noovg « NHoa—tvha—£aae—Htaxxna—sooa—noovu < . jpWMimuKi a^MmyiMwxoK^K^itiK^Miid.
| 18,166 |
sim_missionary-herald_1840-01_36_1_3
|
English-PD
|
Open Culture
|
Public Domain
| 1,840 |
The Missionary Herald 1840-01: Vol 36 Iss 1
|
None
|
English
|
Spoken
| 8,501 | 15,815 |
Mrs. Holladay (Anne Y. Minor,) born Alber- marie co. Va. April 16, 1813. Wiilard Jones, born Hillsboro’, N. H. Jul 17, 1809; graduated D. C. 1835, Lane 1838; embarked Boston July 17, 1839. Mrs. Jones (Miriam Pratt,) born Weymouth Ms. July 14, 1815. Missionary Physician. Asahel Grant, M. D. Utica N. Y.; born Marshall N. Y. Aug. 17, 1807; embarked Boston May 11, arrived Ooroomiah Oct. 24, 1835; visited Meso- potamia April 1839— Mrs. Grant (Judith S. Campbell,) Cherry Val- ley N. Y.; born Rutland N. Y. Jan. 12, 1814; died Ooroomiah Jan. 14, 1839. Assistant Missionary. William R. Stocking, born Middletown Ct. June 24, 1810; embarked Boston Jan. 7, arrived Ooroomiah June 7, 1837. Mrs. Stocking (Jerusha E, Gilbert,) Cole- brook Ct.; born Weston Ct. Nov. 6, 1809. PERSIA:—MOHAMMEDANS—1835. Station. Tabreez 1838. Missionary. James L. Merrick, born Monson Ms. Dee. 11, 1803; graduated A. C. 1830, Southern 1833; embarked Boston Aug. 20, 1834; visited Ta- breez Oct. 15, 1835; arrived Aug. 28, 1838. Mrs. Merrick (Emma a Portsmouth Eng.; married Tabreez March 11, 1839. MAHRATTAS—1813. Stations Bombay 1813; Mahim 1818—25; Tannah 1818—25; Ahmednuggur 1831; Malcom Peth 1834; Jalna 1837. Missionaries. Gordon Hall, born Tolland Ms. April 8, 1784; graduated W. C. 1808, Andover 1810; embark- ed Philadelphia Feb. 18, 1812; arrived Bomba eg 1813; died Doorlee D’hapoor Marc Mrs. Hall (Margaret Lewis,) Bombay; born England; married - 19, 1816; returned July 30, 1825; released. Samuel Newell, Roxbury Ms.; born Durham Me. July 24, 1784; graduated H. U. 1807, An- dover 1810; embarked Salem Feb. 19, 1812; ar- — Bombay March 7, 1814; died May 30, Mrs. Newell (Harriet Atwood,) born Haver- hill Ms. Oct. 10, 1793; died Port Louis, Mauri- tius Nov. 30, 1812. Mrs. Newell (Philomela Thurston,) Bedford N. H.; born Rowley Ms.; embarked Charles- town Oct. 5, 1817; arrived Bombay Feb. 23, married March 26, 1818; see J. Garrett. Samuel Nott, born Franklin Ct. Sept. 11, 1788; graduated W. C. 1808, Andover 1810; embarked Philadelphia Feb. 18, 1812; arrived Bombay Feb. 11, 1813; returned Oct. 7, 1815; rele Sept. 20, 1816. Mrs. Nott. Horatio Bardwell, Goshen Ms.; born Bel- chertown Ms. Nov. 3, 1788; graduated D. C. (M. A.) 1814, Andover 1814; embarked New- buryport Oct. 23, 1815; arrived Bombay Nov. 1, = — ~ = a released. rs. Bardwe chel Furbush,) born ver Ms. Nov. 6, 1586. ) —_ John Nichols, born Antrim N. H. June 20, 1790; graduated D. C. 1813, Andover 1816; embarked Charlestown Oct. 5, 1817; arrived Bombay Feb. 23, 1818, Tannah Nov. 1818; died Bombay Dec. 9, 1824. Mrs. Nichols (Elizabeth Shaw, Beverly Ms.; married Rev. Joseph Knight, English missionary at Nellore Oct. 19, 1826; released Allen Graves, born Rupert Vt. April 8, 1792; duated M. C. 1812, Andover 1816; embarked harlestown Oct. 5, 1817; arrived Bombay Feb. 23, Mahim March 9, 1818, Bombay Nov. 1825, Ahmednuggur Dec. 20, 1831; visited U. States Aug. 7, 2—Sept. 10, 1834; arrived Mal- —<— Peth Oct. 1834. rs. Graves (Mary Lee,) Rupert Vt.; Lebanon N. Y. ov 98, 1787; visited i July 4, 1822—June 28, 1824. dmund Frost, born Brattleboro’ Vt. Nov. 16, 1791; graduated M. C. 1820, Andover 1823; embarked Boston Sept. 27, 1823; arrived Bom- bay June 28, 1824; died Oct. 18, 1825. _Mrs. Frost (Clarissa Emerson,) born Chester N. H. Nov. 13, 1798; see H. Woodward, Ceylon. David O. Allen, Princeton Ms.; born Barre Ms. — 1800; graduated A. C. 1823, Andover 1827; embarked Boston June 5, arrived Bombay Nov. 27, 1827; visited U. States Dec. 7, 1832— rs. Allen (Myra Wood,) born Westminster Ms. Dec. 7, 1800; died Bombay Feb. 5, 1831. Mrs. Allen (Orpah Graves,) born Rupert Vt.; embarked Baston fay a1” amved con Sept. 10, 1834; married Feb. 22; 1838. é rus Stone, born Marlboro’ N. H. June 9, 1793; graduated D. C. 1822, Andover 1825; em- barked Boston June 5, arrived Bombay Dec. 28, 1827, Jalna — 1837; withdrew June 20, 1838; dismissed Aug. 22, 1839. Mrs. Stone (Atossa Frost,) born Marlboro’ N. H. 1798; died Bombay Aug. 7, 1833. Mrs. Stone (Abigail H. Kimball,) Waterford Me.; born — 1812; embarked Boston May 21, arrived Bombay Sept. 10, married Oct. 23, 1834. William Hervey, Troy N. Y.; born Kings- bury N. Y. Jan. 22, 1799; graduated W. C. 1824, Princeton 1823; embarked Boston Aug. 2, 1830; arrived Bombay March 7, Ahmednuggur Dec. 20, 1831; died May 13, 1832. Mrs. Hervey (Elizabeth H. Smith,) born em Ms. Jan. 26, 1798; died Bombay May q ; William Ramsey, Philadelphia; born Thom sontown Pa. Feb. 11, 1803; graduated N. J. C. 1821, Princeton 1826; embarked Boston Aug. 2, 1830; arrived Bombay March 7, 1831; returned ~~ 5, 1834; released June 6, 1837. rs. Ramsey (Mary Wire,) born Philadelphia Pa, Dec. 9, 1804; died Bombay June 11, 1834. Hollis Read, born Newfane Vt. Aug. 26, 1802; uated W. C. 1826, Princeton 1829; em- rked Boston Aug. 2, 1830; arrived Bombay March 7, a Dec. 20, 1831; returned March 18, 1835; released July 25, 1837. ‘Mrs. Read (Caroline Hubbell,) born Benning- ton Vt. ay 1803. Wf , George W. , duated A. C. 1827, Princeton 1831; em hed Salem, May 28, ar- rived Ahmednuggur Dec. 29, 1832; returned U. Mrs. Bowgs (Mrs. Isabella W. Adger,) W rs. rs. Isabella W. Adger,) Wins- boro’ 8. _ ' ~ Sendol B. Munger, born Shoreham Vt.; grad- uated M. C. 1828, Andover 1831; embarked Boston May 21, arrived Bombay Sept. 10, 1834; Jalna Feb. 1837. Mrs. Munger (Maria L. Andrews,) Bristol Vt. Henry Ballantine, Marion O.; born Schodack, N. Y. March 5, 1813; graduated U. O. 1829, Andover 1834; embarked Boston May 16, ar- = Oct. 11, 1835, Ahmednuggur Mrs. Ballantine (Elizabeth Darling,) born Henniker N. H. Jan. 5, 1812. Ebenezer Bu , born Grafton Vt. June 26, 1805; gradua A. C. 1831, Andover 1837; embarked Salem April 1, 1839. Mrs. Burgess (Mary Grant,) born Colebrook, Ct. Aug. 18, 1811. Ozro French, Ashford N. Y.; born Dummers- ton Vt. June 8, 1807; graduated W. C. 1834, Andover 1837; embarked Salem April 1, 1839. Mrs. French (Jane Hotchkis,) born Harpers- field N. Y. Nov. 13, 1813. Robert W. Hume, born Stamford N. Y. Nov. 8, 1809; ~~ U. C. 1834, Princeton 1837; embarked Salem April 1, 1839. Mrs. Hume (Hannah D. Sackett,) born West Springfield Ms. June 3, 1816. Assistant Missionaries. James Garrett, Utica N. Y.; born July 16 1797; embarked Boston April 6, 1820; arriv Ceylon Aug. 9, 1820, Bombay May 9, 1821; died July 16, 1831. Mrs. Garrett (Mrs. Newell,) see S. Newell; married March 26, 1822; returned Oct. 29, 1831; released. Statistical View of the Board and its Missions. JAN. William C. Sam , born on U.C. July 7, 1806; embarked Boston Dec. 22, 1832; arrived Bombay Nov. 22, 1833; died Alleppie Dec. 22, 1835. Mrs. Sampson (Mary L. Barker,) Augusta N. Y.; born Clinton N. Y. Aug. 7, 1809; return- ed June 1836; released. Amos Abbott, born Wilton N. H.; embarked — May 21, arrived Ahmednuggur Oct. 15, 834. Mrs. Abbott (Anstress Wilson,) Dunstable, .H. Geo W. Hubbard, born Hanover, N. H. Dec. oI 1809; embarked Boston May 21, arriv- ed Bombay Sept. 10, 1834, Jalna —; recalled June 20, 1837; returned Sept. 19, 1838; dismiss- ed March 12 1839, Mrs. Hubbard (Emma Burge,) born Hollis N. H. Nov. 5, 1809. Elijah A. Webster, West Bloomfield N. Y.; bern New Hartford N. Y. Feb. 20, 1813; em- barked Boston May 16, arrived Bombay Oct. 835 11, 1835. Mrs. Webster (Mariette Rawson,) Victor N. Y.; born West Stockbridge Ms. Oct. 12, 1811. Cynthia Farrar, born Marlboro’ N. H. April 20, 1795; embarked Boston June 5, arrived Bombay Dec. 28, 1827; visited U. States Jan. 1837—1839.. NOT CONNECTED WITH A MISSION. Missionaries. Adoniram Judson, Plymouth Ms.; born Mal- den Ms. Aug. 9, 1788; graduated B. U. 1807, Andover 1810; embarked Salem Feb. 19, 1812; withdrew Sept. 1, 1812; dismissed Sept. 15, 1813. Mrs. Judson (Ann Hasseltine,) born Bradford Ms. Dec. 22, 1789. Luther Rice, Northboro’ Ms.; born — 1783; graduated W. C. 1810, Andover 1811; embark- ed Philadelphia Feb 18, 1812; withdrew Oct. 23, 1812; dismissed Sept. 15, 1813. MADRAS—1836. Stations. Royapoorum 1836; Chintadrepettah 1836. Missionaries. Miron Winslow, born Williston Vt. Dec. 11, 1789; graduated M. C. 1815, Andover 1818; embarked Boston June 8, arrived Ceylon Dec. 1, 1819, Ooodooville July 4, 1820; visited U. States Sept. 18, 1833—May 2, 1836; arrived Madras (F yapoorum) Aug. 18, 1836. Mrs. Winslow (Harriet W. Lathrop,) born Norwich Ct. April 9, 1796; died Oodooville Jan. 14, 1833. Mrs. Winslow (Mrs. Carman—Catherine Wa- terbury,) born New York City Nov. 22, 1798; embarked Philadelphia Nov. 16, 1835; died Madras Sept. 23, 1837. Mrs. Winslow (Ann Spiers,) born Madras — 1812; married “' 12, 1838. John Scudder M. D., New York City; born Freehold N. J. Sept. 3, 1793; graduated N. J. C. 1811; embarked Boston June 8, 1819; arriv- ed Tillipally Dec. 17, 1819; Panditeripo July 4, 1820; ordained May 1821; arrived Chavaga- cherry Jan. 29, 1834, Madras (Chintadrepettah) Sept. 21, 1836. rs. Scudder (Harriet Waterbury,) born New York City Aug. 14, 1795. 1840. Assistant Missionary. Phineas R. Hunt, Bath N. Y.; born Arling- ton Vt. Jan. 30, 1816; embarked Boston July 30, 1839. 9 Mrs. Hunt (Abigail Nims,) Conway Ms.; born Sangerfield N. Y. Dec. 9, 1808. MADURA—1834. Stations. Madura 1834; Dindigul 1836; Shevagunga 1838; Teroomungalum 1838; Teroopoovanum 1838. Missionaries. Daniel Poor, born Danvers Ms. June 27, 1789; graduated D. C. 1811, Andover 1814; embarked Newburyport Oct. 23, 1815; arrived Ceylon March 22, 1816, Tillipally Oct. 15, 1816, Batticotta July 1, 1823, Madura March 16, 1836. Mrs. Poor (Susan Bulfinch,) born Boston —; died Tillipally May 7, 1821. Mrs. Poor (Ann Knight,) Nellore; born Glou- cestershire Eng. Sept. 10, 1790; married Jan. 21, 1823. ‘ William Todd, born Mareellus N. Y. March 8, 1801; graduated H. C. 1821, Auburn 1824; embarked Boston July 1, arrived Ceylon Oct. 28, 1833, Panditeripo—, Madura July 30, 1834, Shevagunga —; returned Feb. 28, 1839; re- leased July 16, 1839. Mrs. Todd (Lucy Brownell,) born Ledyard N. Y. Sept. 20, 1800; died Madura Sept. 11, 1835. Mrs. Todd (Mrs. Woodward,) see H. Wood- ward, Ceylon; married Batticotta Dec. 22, 1836; died Madura June 1, 1837. H. R. Hoisington—see Ceylon. J. R. Eckard, 0. Alanson C. Hall, Rochester N. Y.; born Catskill N. Y. May 29, 1808; graduated Au- burn 1834; embarked Boston Nov. 4, 1834; arrived Madura Oct. 18, 1835; returned Sept. 1836; released Aug. 29, 1837. Mrs. Hall (Frances A. Willard,) Cayuga N. Y.; died Madura Jan. 2, 1836. John J. Lawrence, born Geneseo N. Y. Jul 12, 1807; graduated U. C. 1829, Andover 1834; embarked Boston May 16, arrived Madura Oct. 18, 1835, Dindigul May 1837. Mrs. Lawrence (Mary Hulin,) Troy N. Y. Robert O. Dwight, Northampton Ms.; grad- uated Andover 1834; embarked Philadelphia Nov. 16, 1835; arrived Madura April 22, Din- digal Nov, 9, 1836. Mrs. Dwight (Mary Billings,) Conway Ms. Henry Cherry, born Pompey N. Y. March 30, 1808; graduated Auburn 1836; embarked Boston Nov. 23, 1836. Mrs. Cherry (Charlotte H. Lathrop,) born New London Ct. May 13, 1811; died Chavaga- cherry Nov. 4, 1837. Edward Cope, born New Lisbon N. Y. May 25, 1806; graduated Auburn 1836; embarked — Nov. 23, 1836; arrived Madura May 10, Mrs. Cope {(Emity Kilbourn,) Marshall N. Y. Nathaniel M. Crane, born West Bloomfield N. J. Dec. 12, 1805; graduated W. C. Pa. 1833, Auburn 1836; embarked Boston Nov. 23, 1836; arrived Madura May 10, 1837, Teroopoo- vanum —. Mrs. Crane (Julia A. J. Ostrander,) born Pompey N. Y. Oct. 7, 1809. Statistical View of the Board and its Missions. Clarendon F. oO Athens Pa.; born Dub- lin N. H. Nov. 20, 1804; graduated M. C. 1833, Andover 1836; embarked Boston Nov.~ 23, 1836; arrived Madura May 10, 1837, Teroo- mungalum —. Mrs. Muzzy (Samantha B. Robbins,) born Wardsboro’ Vt. Nov. 2, 1808. William Tracy, born Norwich Ct. June 2 1807; graduated Princeton 1835; embarked Boston Nov. 23, 1836; arrived Madura Oct. 9, 1837, Teroomungalum —. Mrs. Tracy (Emily F. Travelli,) born Phila- delphia Feb. 20, 1811. erdinand D. Ward, Rochester N. Y.; born Bergen N. Y. July 9, 1812; graduated U. C. 1831, Princeton 1834; embarked Boston Nov. 33, 1836; arrived Madura Oct. 9, 1837. Mrs. Ward (Jane Shaw,) born New York City Dec. 26, 1811. Missionary Physician. John Steele, M. D., Auburn N.Y.; born Hebron N. Y. Aug. 19, 1804; embarked Boston Nov. 23, 1836; arrived Madura May 10, 1837. Mrs. Steele (Mary Snell,) Plainfield Ms.; born — 1814. CEYLOoN—1816. Stations. ag a 1816; Batticotta 1817; Oodooville 1820; Panditeripo 1820; Manepy 1821; Chava- gacherry 1834; Varany 1834. Missionaries. James Richards, Plainfield Ms.; born Abing- ton Ms. Feb. 23, 1784; graduated W. C. 1809, Andover 1812; embarked Newburyport Oct. 23, 1815; arrived Ceylon March 22, 1816, Bat- ticotta Feb. 7, 1817, Tillipally June 25, 1821; died Aug. 3, 1822. Mrs. Richards (Sarah Bardwell,) Goshen Ms.; born Belchertown Ms. Feb. 22, 1791; married Rev. Joseph Knight, English missionary Nel- lore Sept. 17, 1893; released, Edward Warren, Middlebury Vt.; born Marl- * boro’ Ms. —- 4, 1786; graduated M. C. 1808, Andover 1812; embarked Newburyport Oct. 23, 1815; arrived Ceylon March 22, 1816, Tilli- oof Oct. 15, 1816; died Cape Town Aug. 11, 8. Benjamin C. Meigs, born Bethlehem Ct. Aug. 7, 1789; graduated Y. C. 1809, Andover 1813; embarked Newburyport Oct. 23, 1815; arrived Ceylon March 22, 1816, Batticotta June 4, 1817, Til ag March 8, 1833. Mrs. cigs (Sarah M. Peet,) born Bethlehem Ct. March 26, 1787. Daniel Poor—see Madura. Miron Winslow—see Madras. Levi Spaulding, born Jaffrey N. H. Aug. 22, 1791; graduated D. C. 1815, Andover 1818; embarked Boston June 8, 1819; arrived Ceylon Dec. 1, 1819, Oodooville June 15, 1820, Mane- py Aug. 25, 1821, Tillipally Aug. 25, 1828, —~y ~ — —— rs. Spauldin ary Christie) born An- trim N. H. Oct. 54, 1798 Henry Woodward, bom Hanover N. H. Feb. 3, 1797; graduated D. C. 1815, Princeton 1818; embarked Boston June 8, 1819; arrived Batticotta Feb. 3, 1820, Tillipally June 30, 1823, Manepy April 3, 1829, Batticotta March 8, 1833; died Coumbatoor Aug. 3, 1834. Sy 4 Statistical View of the Board and its Missions. Mrs. Woodward om Middleton,) born Crosswicks N. J. Aug. 3, 1795; died Tillipally Nov. 24, 1825. Mrs. Woodward ~- Frost,) see E. Frost, Mabrattas; married Bombay Oct. 12, 1826; see W. Todd, Madura. — “ay om ~oyn — . Apthorp, born Quincy Ms. May 31, 17985 quedeated ¥. C. 1829, Princeton 1832; embarked Boston July 1, arrived Ceylon Oct. 28, 1833, Panditeripo March 8, 1834, Va- rany Jan. 1835. rs. Apthorp (Mary Robertson,) born Alber- marie co. Va. March 0, 1808. Henry R. Hoisington, Aurora N. Y.; born Vergennes Vt. Aug. 23, 1801; graduated W. C. 1828, Auburn 1831; embarked Boston July 1, arrived Ceylon Oct. 28, 1833. Manepy —, Ma- dura Jul , 1834, Batticotta Jan. 1835. Mrs. —— (Nancy Lyman,) born Ches- ter Ms. April 12, 1804. Samuel Hutchings, born New York City Sept. 15, 1806; graduated W. C. 1828, Prince- ton 1831; embarked Boston July 1, arrived Ceylon Oct. 28, 1833; Varany July 8, 1834, Oodooville Jan. 1835, Chavagacherry — 1836. Mrs, Hutchings (Elizabeth C. Lathrop,) born New London Ct. April 16, 1813. James R. Eckard, born Philadelphia Pa. Nov. 22, 1805; graduated U. Pa. 1823; embark- ed Salem Oct. 29, 1833; arrived Batticotta March 5, 1834, Madura Feb. 16, 1835, Pandi- — June 30, 1836. rs. Eckard (Margaret E. Bayard,) Savan- nah Ga. John M. 8. Perry, Mendon Ms.; born Sharon Ct. Sept. 7, 1806; graduated Y. C. 1827, New Haven 1831; embarked Boston May 16, arrived Ceylon Sept. 24, 1835, Batticotta — 1836; died March 10, 1837. Mrs. Perry (Harriet J. Lathrop,) born Nor- wich Ct. Sept. 3, 1816; died Batticotta March 13, 1837. Missionary Physician. Nathan Ward, M. D., born Plymouth N. H. Nov. 21, 1804; embarked Boston July 1, arriv- * ed Ceylon Oct. 28, 1833, Batticotta —. Mrs. Ward (Hannah W. Clark,) born Pea- cham Vt. Assistant Missionaries. Eastman S. Minor, New Haven Ct.; born Milford Ct. July 6, 1809; embarked Salem + on 29, 1833; arrived Ceylon March 5, 1824, anepy —. Mrs. Minor (Lucy Bailey,) born New Ips- wich N. H. July 18, 1809; died Manepy June 29, 1837. Eliza Agnew, born New York City Feb. 2, 1807; embarked Boston July 30, 1839. Sarah F. Brown, Newark N. J.; born Wood- bridge N. J. Oct. 5, 1805; embarked Boston * July 30, 1839. i pA E. Lathrop, Bozrah Ct.; born Norwich Ct. Dec. 17, 1811; embarked Boston July 30, 1839. s1amM—1831. Station. Bankok 1831. Missionaries. David Abeel—see China. Charles Robinson, graduated W. C. 1829, Auburn 1832; embarked Boston June 10, 1833; arrived Bankok July 25, 1834. Jan. Mrs. Robinson (Maria Church,) Riga N. Y. Stephen Johnson, born Griswold Ct.; grad- uated A. C. 1827, Auburn 1832; embarked Boston June 10, 1833; arrived Bankok July 25, 1834; visited U. States Jan. 24, 1838— Mrs. Johnson (Maria Preston,) Rupert Vt.; died Philadelphia Pa. Jan. 8, 1839. Dan B. Bradley M. D., born Marcellus N.Y. July 18, 1804; embarked Boston July 2, 1834; — Bankok July 18, 1835; ordained Nov. 5, 1838. Mrs. Bradley (Emilie Royce,) born Clinton N. Y. July 12, 1811. Samuel P. Robbins, born Marietta O. Aug. 25, 1811; graduated U. O. 1830, Andover 1835; embarked Boston July 1, 1836; arrived Borneo .~ 24, 1837, Bankok April 24, 1838. rs. Robbins (Martha R. Pierce,) born En- field Ct. May 18, 1813. Nathan S. Benham, Byron N. Y.; born Shan- daken N. Y. Aug. 23, 1810; graduated W. R. ‘ey Hudson 1838; embarked Boston July , 1839. Mrs. Benham (Maria H. Nutting,) born Gro- ton Ms. Jan. 17, 1814. Jesse Caswell, born Middletown Vt. April 17, 1809; graduated M. C. 1832, Lane 1837; embarked Boston July 6, 1839. Mrs. Caswell (Anna T. Hemenway,) born Shoreham Vt. Aug. 4, 1812. Henry S. G. French, bora Boscawen N. H. April 27, 1807; graduated Y. C. 1834, Andover 1837; embarked Boston July 6, 1839. Mrs. French (Sarah C. Allison,) Concord N. H.; born Castine Me. Nov. 22, 1810. Asa Hemenway, born Shoreham Vt. July 6, 1810; graduated M. C. 1835, Andover 1838; embarked Boston July 6, 1839. Mrs. Hemenway (Lucia Hunt,) born Shore- ham Vt. Nov. 21, 1810. Lyman B. Peet, born Cornwall Vt. March 1, 1809; graduated M. C. 1834, Andover 1837; embarked Boston July 6, 1839. Mrs. Peet (Rebecca C. Sherrill,) born Or- well Vt. Dec. 3, 1810. Missionary Physician. Stephen Tracy M. D., born Hartford Vt.; embarked Boston July 1, arrived Singapore Dec. 17, 1836; Bankok April 24, 1838. Mrs. Tracy (Alice Dana,) born Pomfret Vt. Assistant Missionaries. Mary E. Pierce, born Butternuts N. Y. Oct. 22, 1815; embarked Boston July 6, 1839. Judith M. Taylor, born Madison N. Y. Nov. 2, 1815; embarked Boston July 6, 1839. cH1nA—1830. Stations. Canton 1830; Macao 1835. Missionaries. Elijah C. Bridgman, born Belchertown Ms. April 22, 1801; graduated A. C. 1826, Andover 1829; embarked New York Oct. 14, 1829; ar- rived Canton Feb. 19, 1830. David Abeel, graduated (M. A.) R. C. 1823; embarked New York Oct. 14, 1829; arriv Canton Feb. 19, 1830; a —— Oct. 1830; arrived Bankok July 1, 1831; visited U. States i 839; arrived Canton April ira Tracy—see Singapore. ' ~ 1840. Edwin Stevens, New Canaan Ct.; born Aug. — 1801; graduated Y. C. 1828, New Haven 1831; arrived Canton Nov. — 1832; appointed July 7, 1835; died Singapore Jan. 5, 1837. Peter Parker, M. D., Framingham Ms.; born — 1804; graduated Y. C. 1831, New Haven 1834; embarked New York June 3, arrived Canton Oct. 26, 1834. Missionary Physician. William B. Diver, M. D., Philadelphia Pa.; born Aug. — 1819; embarked New York May 8, 1839. Assistant Missionary. S. Wells Williams, born Utica N. Y. Sept. 21, 1812; embarked New York June 15, arrived Canton Oct. 26, 1833; Macao Dec. — 1835. SINGAPORE—1834. Station. Singapore 1834. Missionarves. Ira Tracy, born Hartford Vt. Jan. 15, 1806; graduated D. C. 1829, Andover 1832; embark- ed New York June 15, arrived Canton Oct. 26 1833; Singapore July 24, 1834. Mrs. Tracy (Adeline White,) born Brookfield Ms. Sept. 25, 1809; embarked Boston July 2, 1834; married Singapore Jan. 15, 1835. James T. Dickinson, Norwich Ct.; born Lowville N. Y. Oct. 27, 1806; graduated Y. C. 1826, New Haven 1829; embarked Boston July 20, 1835; arrived Singapore Feb. 6, 1836. Matthew B. Hope, M. D., Philadelphia Pa.; graduated Princeton 1834; embarked Boston uly 1, arrived Singapore Dec. 17, 1836; return- ed April 2, 1838. ; Joseph S. Travelli, born Philadelphia Pa. April 21, 1809; graduated J. C. 1833, Western 1836; embarked Boston July 1, arrived Singa- pore Dec. 17, 1836. Mrs. Travelli (Susan Irwin,) born Alleghany Pa. Aug. 22, 1815. Dyer Ball, Charleston S. C.; born West Boylston Ms. June 3, 1796; graduated U.C. 1826; embarked New York May 15, arrived Singapore Sept. 17, 1838. Mrs Ball (Lucy H. Mills,) born New Haven Ct. Dec. 16, 1807. George W. Wood, embarked New York pore Sept. 17, 1838. Mrs. Wood (Martha M. Johnson,) Morris- town N. J.; born Oct. — 1818; died Singapore March 8, 1839. Assistant Missionaries. Alfred North, Boonville N. Y.; born Exeter N. H. March 10, 1807; embarked Boston July 20, 1835; arrived Singapore Feb. 6, 1836. Mrs. North (Minerva Bryan,) Fairfield N. Y.; born Saratoga N. Y. July 14, i815. raduated D. C. 1832; ay 15, arrived Singa- INDIAN ARCHIPELAGO—1833—1834. Missionaries. Samuel Munson, born New Sharon Me. March 23, 1804; graduated B. C. 1829, Ando- ver 1832; embarked Boston June 19, arrived — Sept. 30, 1833; died Sumatra June 28, 1834. Mrs. Manson (Abigail Johnson,) Brunswick Me.; returned Oct. — 1834; released Dec. 19, 1835. VOL. XXXVI. Statistical View of the Board and its Missions. 3 Henry Lyman, born Nerthampton Ms. Nov. 23, 1809; graduated A. C. 1829, Andover 1832; embarked Boston June 10, arrived Batavia Sept. 30, 1833; died Sumatra June 28, 1834. rs. Lyman (Eliza Pond,) Boston Ms.; born Keene N. H. Nov. 20, 1809; returned Oct. — 1834; released Jan. 12, 1836. William Arms, Montrose Pa.; born Wilming- ton Vt. May 18, 1802; graduated A. C. 1830, Andover 1833; embarked New York Aug. 16, arrived Patagonia Nov. 14, 1833; returned Jan. 25, 1834; embarked Boston July 20, 1835; ar- rived Singapore Feb. 6, 1836; visited Borneo June 29, 1836; arrived Sambas —; returned Dec. 16, 1837; released June 5, 1838. Mrs. Arms (Mary Maxwell,) Philadelphia, Pa.; poe March 16, 1806; died Batavia Jan. 19, PORNEO—1838. Station. Sambas 1838. Missionaries. Elihu Doty, Bernville N. Y.; born Bern N. Y. Sept. 20, 1809; graduated R. C. 1833, New Brunswick 1835; embarked New York June 8, arrived Batavia Sept. 15, 1836; visited Borneo Oct. 30, 1833; arrived —. Mrs. Doty (Clarissa D. Ackley,) born Wash- ington Ct. Dec. 7, 1806. Jacob Ennis, born Aquackanonk N. J. Aug. 28, 1808; graduated R. C. 1832, New Bruns- wick 1836; embarked New York June 8, arriv- ed Batavia Sept. 15, 1836, Baliling Sept. 1, 1838, Borneo —. Mrs. Ennis (Henrietta B. Haines,) bom New York City June 24, 1816; visited U. S. 1819—. Elbert Nevius, graduated R. C. 1830, New Brunswick 1854; embarked New York June 8, arrived Batavia Sept. 15, 1836, Borneo —. Mrs. Nevius (Maria L. Condit.) William Youngblood, born Montgomery N. Y. Nov. 1, 1800; graduated R. C. 1832, New Brunswick 1335; embarked New York June 8, arrived Batavia Sept. 15, 1836, Borneo —. Mrs. Youngblood Montgomery N. Y.; born New York City May 28, 1808.. Frederick B. Thomson, born New Bruns- wick N. J. Nov. 5, 1809; graduated R. C. 1831, New Brunswick 1834; embarked New York May 25, arrived Borneo —. rs. Thomson (Catharine Wvyckoff,) born New Brunswick N. J. Sept. 17, 1813. William J. Pohlman, born Albany N. Y. Feb. 17, 1812; graduated R. C. 1834, New Brunswick 1837; embarked New York May 25, visited Borneo Oct. 30, 1838; arrived —. Mrs. Pohlman (Theodosia R. Scudder,) New York City; born Freehold N. J. Jan. 26, 1811. Assistant Missionary. Azuba C. Condit, embarked New York June 8, arrived Batavia Sept. 15, 1836, Borneo —. SANDWICH 1SLANDs—1820. Islands and Stations. Hawaii;—Kailua 1820; Hilo 1824; Kaawa- loa 1824; Waimea 1832; Kohala 1837. Oahu;—Honolulu 1820; Waialua 1832; Ewa 1834; Kaneohe 1834. Kauai;—Waimea 1820; Waioli 1834; Koloa 1834. 4 (Josephine Milspaugh,) _* Mauai;—Lahaina 1823; Lahainaluna 1331; Wailuku 1832; Hana 1837. Molokai;—Kaluaaha 1832. Missionaries. Hiram aes born Bennington Vt. Oct. 30, 1789; graduated M. C. 1816, Andover 1819; embarked Boston Oct. 23, 1819; arrived Hono- lulu April 19, 1820. Mrs. Bingham (Sybil Moseley,) Canandaigua N. Y.; born Westfield Ms. Sept. 14, 1792. Asa Thurston, born Fitchburg Ms. Oct. 12, 1787; graduated Y. C. 1816, Andover 1819; embarked Boston Oct. 23, 1819; arrived Kailua April 12, Honolulu Dec. 21, 1820, Kailua Nov. 5, 1823 ’ ‘ Mrs. Thurston (Lucy Goodell,) born Marl- boro’ Ms. Oct. 29, 1795. ‘ Samuel Whitney, New Haven Ct.; born Branford Ct. April 28, 1793; embarked Boston Oct. 23, 1819; arrived Honolulu April 19, Wai- mea, Kauai July 25, 1820; ordained Kailua Nov. 30, 1825; visited Washington Islands July— Dec. 1832. Mrs. Whitney (Mercy Partridge,) born Pitts- field Ms. Aug. 14, 1795. Artemas Bishop, born Pompey N. Y. Dec. 30, 1795; graduated U. C. 1819, Princeton 1822; embarked New Haven Nov. 19, 1822; arrived Kailua March 11, 1824, Ewa — 1836. Mrs. Bishop (Elizabeth Edwards,) Boston Ms.; born Marlboro’ Ms. June — 1795; died Kailua Feb. 21, 1828. Mrs. Bishop (Delia Stone,) Rochester N. Y.; born Bloomfield N. Y. May 26, 1800; embarked BostongNov. 3, 1827; married Kailua Dec. 1, 1828. William Richards, born Plainfield Ms. Aug. 22, 1793; graduated W.C. 1819, Andover 1822; embarked New Haven Nov. 19, 1822; arrived Lahaina May 31, 1823; visited U. States Dec. 9, 1886—March 27, 1838; released July 3. 1838. Mrs. Richards (Clarissa Lyman,) born North- ampton Ms. Jan. 10, 1794. Charles 8S. Stewart, born Flemington N. J. Oct. 16, 1798; graduated N. J. C. 1815, Prince- ton 1821; embarked New Haven Nov. 19, 1822; arrived Lahaina May 31, 1823; returned Oct. 15, 1825; released Aug. 12, 1830. Mrs. Stewart (Harriet B. Tiffany,) Coopers- town N. Y.; born Stamford Ct. June 24, 1798. James Ely, born Lyme Ct. Oct. 22, 1798; embarked New Haveu Nov. 19, 1822; arrived Kaawaloa April 9, 1824; ordained Honolulu June 4, 1825; returned Oct. 15, 1828; released March 24, 1830. Mrs. Ely (Louisa Everest,) born Cornwall Ct. Sept. 8, 1792. Joseph Goodrich, Wethersfield Ct.; graduat- ed Y. C. 1821; embarked New Haven Sie. 19, 1822; arrived Hilo Jan. 24, 1824; ordained Kailua Sept. 29, 1826; returned Jan. 25, releas- ed Oct. 11, 1836. Mrs. Goodrich. Lorrin Andrews, Maysville Ky.; born — Ct. — 1796; graduated J. C.e, Princeton 1825; embarked Boston Nov. 3, 1827; arrived Lahai- na May — 1828, Lahainaluna Sept. 1, 1851. Mrs. Andrews. Ephraim W. Clark, Peacham Vt.; born Ha- verhill N. H. April 25, 1799; graduated DC. 1824, Andover 1827; embarked Boston Nov. 3, 1827; arrived Honolulu March 31, 1828, Lahai- naluna Aug. 1, 1834. Mrs. Clark (Mary Kittredge,) born Mount Vernon N. H. Dec. 9, 1803. Statistical View of the Board and its Missions. Jan. Jonathan S. Green, Pawlet Vt.; born Leba- non Ct. Dec. 20, 1796; graduated Andover 1827; embarked Boston Nov. 3, 1827; arrived Honolulu March 31, 1828; visited N. W. Coast Feb. 13—Nov. 9, 1829; arrived ——- Feb. md 830, Hilo Jan. 28, 1831, Wailuku Aug. 15, 1832. Mrs. Green (Theodicia Arnold,) bom East Haddam Ct. April 3, 1792. Peter J. Gulick, born Freehold N. J. March 12, 1797; graduated N. J. C. 1825, Princeton 1827; embarked Boston Nov. 3, 1827; arrived Waimea, Kauai July 15, 1828; Koloa Dec. 31, 1834. Mrs. Gulick (Fanny H. Thomas,) born Le- banon Ct. April 16, 1798. Dwight Baldwin, M. D., Durham N. Y.; born Durham Ct. Sept. 29, 1792; graduated Y. C. 1821, Auburn 1829; embarked New Bedford Dec. 23, 1830; arrived Honolulu June 7, 1831, Waimea, Hawaii Jan. 15, 1832, Lahaina — 1835. Mrs. Baldwin (Charlotte Fowler,) born North- ford Ct. — 1805. Sheldon Dibble, graduated H. ©. 1827, Au- burn 1830; embarked New Bedford Dec. 28, 1830; arrived Honolulu Jone 7, 1331, Hilo Aug. — 1831, Lahainaluna Nov. — 1835; visit- ed U. States Nov. 24, 1837—1840. Mrs. Dibble (Maria M. ‘Tomlinson,) born April — 1808; died Lahainaluna Feb. 20, 1837. Mrs. Dibble (Antoinette Tomlinson,) Brook- >. Y¥.; embarked New York City Oct. 9, Reuben Tinker, born Chester Ms. Aug. 6, 1799; graduated A. C. 1827, Auburn 1830; em- barked New Bedford Dec. 28, 1880; arrived Honolulu June 7, 1831; visited Washington Islands July 18—Nov. 17, 1832. Mrs. Tinker (Mary T. Wood,) Madison O.; born Chester Ms. Aug. 24, 1809. William P. Alexander, born Paris Ky. July 25, 1805; graduated Princeton 1831; embarked New Bedford Nov. 26, 1831; arrived Honolulu May 17, 1832; visited Washington Islands July ° 18—Nov. 17, 1832, and July 2, 1833—May 12, 1834; arrived Waioli Sept. — 1834. Mrs. Alexander (Mary Ann McKinney,) game Pa.; born Wilmington Del. Jan. 5, 10. Richard Armstrong, born Turbotville Pa. April 13, 1205; graduated Dick. C. 1827, Princeton 1831; embarked New Bedford Nov. 26, 1831; arrived Honolulu May 17, 1832; vis- ited Washington Islands July 2, 1833—May 12, 1834; arrived Wailuku July 1835. Mrs. Armstrong (Clarissa Chapman,) born Russell Ms. May 15, 1805. John S. Emerson, born Chester Ms. Dec. 23, 1800; graduated D. C. 1826, Andover 1830; embarked New Bedford Ms. Nov. 26, 1831; arrived Waialua July — 1832. Mrs. Emerson (Ursula S. Newell,) born Nel- son N. H. Sept. 27, 1806. Cochran Forbes, born Goshen Pa. July 21, 1805; graduated Princeton 1831; embarked New Bedford Nov. 26, 1831; arrived Kasawa- loa July 10, 1832. Mrs. Forbes (Rebecca D. Smith,) Newark, N. J.; born Springfield N. J. June 21, 1805. Harvey R. Hitehcock, born Great Barring- ton Ms. March 13, 1800; graduated W. C. 1828, Auburn 1831; embarked New Bedford Nov. 26, 1831; arrived Kaluaaha Nov. — 1832. Mrs. Hitchcock (Rebecca Howard,) born Owasco N. Y. Dec. 2, 1808. 1840. Statistical View of the David B. Lyman, born New Hartford Ct. July 29, 1803; graduated W. C. 1828, Andover 1831; embarked New Bedford Nov. 26, 1831; arrived Hilo — 1832. Mrs. Lyman (Sarah Joiner,) Royalton Vt. Lorenzo Lyons, born Colrain Ms. April 18, 1807; graduated U. C. 1827, Auburn 1831; em- barked New Bedford Nov. 26, 1831; arrived Waimea, Hawaii — 1832. Mrs. Lyons (Betsey Curtis,) born Elbridge N. Y. Jan. 10, 1813; died Honolulu May 14, 1837. Mrs. Lyons (Lucia G. Smith,) Truxton N. Y.; born Burlington N. Y. — 1810; embarked Bos- ton Dec. 14, 1838; married Hilo July 14, 1838. Ephraim Spaulding, born Ludlow Vt. Dec. 10. 1802; graduated M. C. 1828, Andover 1831; embarked New Bedford Nov. 26, 1831; arrived Lahaina — 1832; visited U. States Dec. 26, 1836— Mrs. Spaulding (Julia Brooks,) born Buck- Jand Ms. April 7, 1810. Benjamin W. Parker, born Reading Ms. Oct. 13, 1803; graduated A. C. 1829, Andover 1832; embarked New London Nov. 21, 1832; arrived Honolulu May 1, 1833; visited Wash- ington Islands July 2, 1833—May 12, 1834; ar- rived Kaneohe Dec. — 1834. Mrs. Parker (Mary E. Barker,) born Bran- ford Ct. Dec. 9, 1805. Lowell Smith, born Heath Ms. Nov. 27, 1802; graduated W. C. 1829, Auburn 1832; em- barked New London Nov. 21, 1832; arrived Kaluaaha June — 1833, Ewa Nov. — 1834, Honolulu July 1, 1836. Mrs. Smith (Abba W. Tenney,) Brandon Vt.; born Barre Ms. Dec. 4, 1809. Titus Coan, born Killingworth Ct. Feb. 1, 1801; graduated Auburn 1833; embarked New York Aug. 16, arrived Patagonia Nov. 14, 1833; returned Jan. 25, 1834; embarked Boston Dec. 5, 1834; arrived Hilo Aug. — 1835. Mrs. Coan (Fidelia Church,) born Riga N. Y. Feb. 17, 1810. Isaac Bliss, born Warren Ms. Aug. 28, 1804; raduated A. C. 1828, Auburn 1831; embarked Bose Dec. 14, 1836; arrived Kohala — 1837. Mrs. Bliss (Emily Curtis,) born Elbridge N. Y. July 25, 1811. Daniel 'T. Conde, born Charlton N. Y. Feb. 3, 1807; graduated U. C. 1831, Auburn 1834; embarked Boston Dec. 14, 1836; arrived Hana — 1837. Mrs. Conde (Andelucia Lee,) born Jericho Vt. June 17, 1810; see New York Indians’ mission. Mark Ives, born Goshen Ct. Feb. 10, 1809; graduated U. C. 1833, East Windsor 1836; embarked Boston Dec. 14, 1836; arrived Hana — 1837. Mrs. Ives (Mary A. Brainerd,) born Haddam || N. Y Ct. Nov. 18, 1810. Thomas Lafon, M. D., Marion co. Mo.; born Chesterfield co. Va. Dec. 17, 1801; embarked Boston Dec. 14, 1836; arrived Koloa — 1837. Mrs. Lafon (Sophia L. Parker,) born New Bedford Ms. June 30, 1812. Missionary Physicians. Thomas Holman, M. D., Cooperstown N. Y.; embarked Boston Oct. 23, 1819; arrived Kailua April 12, withdrew July 30, 1820; dismissed May 12, 1822. Board and its Missions. 97 Abraham Blatchely, M. D., East Guilford, Ct.; embarked New Haven Nov. 19, 1822; | arrived Honolulu April 27, 1823; returned Noy. 6, 1826; released Oct. 16, 1827. Mrs. Blatchley. Gerrit P. Judd, M. D., born Paris N. Y. April 23, 1803; embarked Boston Nov. 3, 1827; arrived Honolulu March 31, 1828. Mrs. Judd (Laura Fish,) born Plainfield N. Y. April 3, 1804. Alonzo Chapin, M. D., born West Spring- field Ms. Feb. 24, 1805; graduated A. C. 1826; embarked New Bedford Nov. 26, 1631; arrived Lahaina — 1832; returned Nov. 28, 1835; re- leased March 14, 1837. Mrs. Chapin (Mary Ann Tenney,) Boston Ms.; born Newburyport Ms. May 9, 1804. Seth L. Andrews, M. D., Pittsford N. Y.; | born Putney Vt. June 24, 1809; graduated D.C. | 1831; embarked Boston Dec. 14, 1836; arrived | Kailua — 1837. | Mrs. Andrews (Parnelly Pierce,) born Wood- bury Ct. June 12, 1807. Assistant Missionaries. Daniel Chamberlain, Brookfield Ms.; em- barked Boston Oct. 23, 1819; arrived Honolulu April 19, 1820; returned March 21, released Nov. 12, 1823. Mrs. Chamberlain. ‘ a Samuel Ruggles, born Brookfield Ms, March 9, 1795; embarked Boston Oct. 23, 1819; arriv- }ed Honolulu April 19, Waimea, Kauai Jul | 1820, Hilo Jan. 24, 1824, Kaawalo@Ju — returned Jan. — 1834; released ‘No 1 Mrs. Ruggles (Nancy Wells,) born Windsor Ct. April 18, 1791. r Elisha Loomis, born Middlesex N. Y. Dec. — 1799; embarked Boston Oct. 23, 1819; arrived Honolulu April 19, 1820; returned Jan. 6, 1827; employed for a season in printing for the mission; Mackinaw Nov. 4, 1330—May 12, 1832. Mrs. Loomis (Maria T. Sartwell,) Utica N. Y.; born New Hartford N. Y. Aug. 25, 1796. Levi Chamberlain, Boston Ms.; born Dover Vt. o~- 28, 1792; embarked New Haven Nov. 19, 1822; arrived Honolulu April 27, 1823. Mrs. Chamberlain (Maria Patten,) Pequea Pa.; born Salisbury Pa. March 3, 1803; em- barked Boston Nov. 3, 1827; married Lahaina Sept. 1, 1828. Stephen Shepard, born Kingsboro’ N. Y. July 26, 1800; embarked Boston Nov. 3, 1827; arrived Honolulu March 31, 1828; died July 6, 1834. Mrs. Shepard = C. Slow,) Champion - Y.; born — Pa. March 6, 1801; returned | Jan. 6, 1835; released. Andrew Johnstone, New Bedford Ms.; em- | barked Dec. 28, 1830; arrived Honolulu June 7, 1831; dismissed April 22, 1836. Mrs. Johnstone. Edmund H. Rogers, born Newton Ms. — 1806; embarked New Bedford Nov. 26, 1831; arrived Honolulu May 17, 1832; appointed April 16, 1833; Lahainaluna — 1835. Mrs. Rogers (Mary Ward,) born Middlebu N. Y. — 1799; embarked Boston Nov. 3, 1827, arrived Honolulu March 31, 1828; married La- haina — 1833; died Honolulu May 23, 1834. — Holman (Lucia Ruggles,) ee $. Mrs. Rogers (Elizabeth M. Hitchcock,) born Great Barrington Ms. Oct. 4, 1802; embarked eee =— 28 Statistical View of the Board and its Missions. Boston Dec. 5, 1834; married Kaluaaha July 12, 1836. Lemuel Fuller, born Attleboro’ Ms. April 2, 1810; embarked New London Nov, 21, 1852; arrived Honolulu May 1, 1833; returned Dec. 1, 1833; released. Henry Dimond, New York City; born — Ct.; embarked Boston Dec. 5, 1834; arrived Hono- lula June 6, 1835. Mrs. Dimond (Ann Maria Anner,) N. Y. City. Edwin O. Hall, Rochester N. Y.; born Wal- le N. H. Oct. 21, 1810; embarked Boston Bee. 5, 1834; arrived Honolulu Jane 6, 1835; visited Oregon 1839— Mrs. Hall (Sarah L. Williams,) Brookiyn N. Y.; born Elizabethtown N. J. Oct. 27, 1812. Edward Bailey, born Holden Ms. Feb. 24, 1814; embarked Boston Dee. 14, 1836; arrived Kohala — 1837. Mrs. Bailey {Caroline Hubbard,) born Hol- den Ms. Aug. 13, 1814. Samuel! N. Castle, Medina O.; born Cazeno- via N. Y. Aug. 12, 1808; embarked Boston Dec. 14, 1836; arrived Honolulu April 10, 1837. Mrs. Castle (Angeline L. Tenny,) Plainfield N. Y.; born Sudbury Vt. Oct. 25, 1810. Amos 8. Cooke, born Danbury Ct. Dec. 1, 1810; embarked Boston Dec. 14, 1836; arrived Honolulu April 10, 1837. Mrs. Cooke (Juliette Montague,) born Sun- derland Ms. March 10, 1812. Edward Johnson, born Hollis N. H. — 1813; embarked Boston Dec. 14, 1836; arrived Wai- oli June 7, 1837. Mrs. Johnson (Lois S. Hoyt,) Warner N. H.; born Pie N. H. — 1809. HorfOn O. Knapp, March 21, 1813; embarked Boston Dec. 14, | 1836; arrived Waimea, Kauai — 1837. Mrs. Knapp (Charlotte Close,) born Green- wich Ct. May 26, 1813. Edwin Locke, born Fitzwilliam N. H. June 18, 1813; embarked Boston Dec. 14, 1836; ar- rived Waialua — 1837. Mrs. Locke (Martha L. Rowell,) born Cor- nish N. H. Nov. 9, 1812. Charles McDonald, Holmesburg Pa.; born Easton Pa. Dec. 24, 1812; embarked Boston Dec. 14, 1836; arrived Lahaina — 1837. Mrs. McDonald (Harriet T. Halsted,) born New York City Dec. 6, 1810. Bethuel Munn, Benton N. Y.; born Orange N. J. Aug. 28, 1803; embarked Boston Dec. 14, 1836; arrived Kaluaaha — 1837. Mrs. Munn (Louisa Clark,) born Skaneateles N. Y. March 3, 1810. William S. Van Duzee, Gouverneur N. Y,; | born Hartford N. Y. Jan. 12, 1811; embarked Boston Dec. 14, 1836; arrived Kaawaloa July 10, 1837. Mrs. Van Duzee (Oral Hobart,) born Homer | N. Y. Feb. 3, 1814. Abner Wilcox, born Harwinton Ct. April 19, | 1808; embarked Boston Dge. 14, 1836; arrived | Hilo — 1837. J Mrs. Wilcox (Lucy E. Hart,) Norfolk Ct.; born Cairo N. Y. Nov. 17, 1814. Maria Ogden, born Philadelphia Pa. Feb. 17, 1792; embarked Boston Nov. 3, 1827; arrived Waimea, Kauai July 15. 1828, Lahaina — 1829. Lydia Brown, born Wilton N. H. — 1780; embarked Boston Dec. 5, 1834; arrived Wailu- ku July 13, 1835. Marcia M. Smith, Truxton N. Y.; born Bur- lington N. Y. —; embarked Bostoa Dec. 14, 18985; arrived Kaneohe Sept. 1, 1837. : Jay. SOUTH AMERICA—1823—1825. Station. Buenos Ayres 1823—1825. Missionaries. John C. Brigham, born New Marlboro’ Ms. Feb. 28, 1794; graduated W. C. 1819, Andover 1822; embarked Boston July 25, arrived Buenos Ayres Oct. 24, 1823; returned via Chili, Lima, ete. Oct. 20, 1824; released July 4, 1826. Theophilus Parvin, graduated Princeton 1821; embarked Boston July 25, arrived Bue- nos Ayres Oct. 24, 1823; returned Sept., re- leased Dec. 13, 1825. CHEROKEES—1816, Stations. East of the Mississippi:—Brainerd 1817— 1839; Carmel 1819—1836; Creek Path 1820— 1837; Hightower 1823—1831; Willstown 1823 —1839; Haweis 1823—1834; Candy’s Creek 1824—1839; New Echota 1827—1834; Ahmo- hee 1831—1833; Red Clay 1835—1839; Run- ning Waters 1835—1836. ‘est of the Mississippi: —Dwight 1821 trans- ferred 1829; Mulberry 1828, transierred to Fair- field 1829; Forks of Illinois 1830, transferred to Park Hill 1836. Missionaries. Cyrus Kingsbury—see Choctaws. Loring S. Williams, do. Daniel S. Butrick, born Windsor Ms. Aug. 25, 1789; departed Boston Nov. 13, 1817; ar- born Greenwich Ct. || rived Brainerd Jan. 3, 1818. Carmel — 1823; Hightower — 1827, Carmel Sept. — 1830, Brainerd May 10, 1836, Dwight March — 1839. Mrs. Butrick (Elizabeth Proctor,) born Ips- wich Ms. Feb. 1, 1783; arrived Hightower Feb. 14, 1823; married April 29, 1827. Ard Hoyt, Wilkesbarre Pa.; born Danbury | Ct. Oct. 23, 1770; departed Philadelphia Nov. | 10, 1817; arrived Brainerd Jan. 3, 1818, Wills- town May 22, 1824; died Feb. 18, 1828. Mrs. Hoyt (Esther Booth,) Wilkesbarre Pa.; born Southbury Ct. Jan. 18, 1774; returned April — 1834; released. William Chamberlin, Wilkesbarre Pa.; born Newbury Vt. Feb. 20, 1791; departed Wilkes- | barre Nov. 24, 1817; arrived Brainerd March | 10, 1818, Willstown March 28, 1823; visited U. States Sept. — 1838— Mrs. Chamberlin (Flora Hoyt.) Wilkesharre Pa.; born Danbury Ct. July 7, 1798. Alfred Finney, born Harvard Ms. — 1790; graduated D. C. 1815; departed Randolph | Aug. 30, 1819; arrived Eliot Jan. 3, 1820; visit- jed Arkansas July 1, 1820; arrived Dwight May | 10, 1821; died June 13, 1829. Mrs. Finney (Susanna Washburn,) born Ran- dolph Vt. —; died Jan. — 1833. Cephas Washburn, born Randolph Vi. July 25, 1793; graduated U. V. 1817; departed Ran- dolph Oct. 7, 1818; arrived Eliot Jan. 3, 1820; visited Arkansas July 1, 1820; arrived Dwight May 10, 1821; visited U. States April ra Dec. — 1835. Mrs. Washburn (Abigail Woodward,) born Randolph Vt. Aug. 22, 1797. Elizur Butler, M. D., New Marlboro’ Ms.; born Norfolk Ct. June 11, 1794; departed Oct, — 1820; arrived Brainerd Jan. 10, 1821, Creek Path May 7, 1224, Haweis May 1, 1826; arrest- ed by the Georgia guard July 7, 1831; sen- ow... Oe 1840. ced to the penitentiary Sept. 16, 1832; re- || Pee by the quvesnee 5 14, 1833; arrived | Brainerd Feb. 14, 1834; visited U. States April | 16—OUct. 13, 1834; arrived Red Clay Sept. 16, |, 1835; ordained April — 1838; arrived Dwight June 10, 1839. Mrs. Butler (Esther Post,) born South Ca- naan Ct. Sept. 15, 1798; died Haweis Nov. 21, || 1829. Mrs. Butler (Lucey Ames,) born Groton Ms. | April 25, 1793; arrived Brainerd Nov. 7, 1827; || married Aug. 14, 1830. }| William Potter, born Lisbon Ct. — 1796; de- | parted Nov. 1, 1820; arrived Creek Path Jan. | 19, 1821; visited U. States July — ora — 1839; arrived Dwight June 10, 1839. Mrs. Potter, (Laura Weld) Hampton, Ct.; | born Braintree Vt. Oct. 12, 1800. | Samuel A. Worcester, Peacham Vt.; born || Worcester Ms. Jan. 19, 1798; graduated U. V. || 1819, Andover 1823; departed Boston Aug. 31, || 1825; arrived Brainerd Oct. 21, 1825, New || Echota, Nov. — 1827; arrested by the Georgia | | guard July 7, 1831; sentenced to the peniten- | tiary Sept. 16, 1832; released by the governor Jan. 14, 1833; arrived Brainerd March 15, 1834, |, Arkansas May 29, 1835, Park Hill Dec. 2, 1836. Mrs. Worcester (Ann Orr,) born Bedford | N. H. Sept. 21, 1799. | Marcus Palmer, M. D., Whiteplains N. Y.;'| born Greenwich Ct. April 24, 1795; departed {| New York April 20, 1820; arrived Union Feb. || 18, 1821, Harmony —; arrived Cherokees Feb. || 1828, Fairfield Nov. — 1829; ordained — 1830; | visited U. States Oct. 1839—. || Mrs. Palmer (Clarissa Johnson,) Colchester || Ct.; departed New York April 20, 1820; arriv- | ed Union Feb. 18, 1821; married Aug. 24, 1824; | visited U. States April 4, died Granville O. || Sept. 8, 1835. \| Mrs. Palmer (Jerusha Johnson,) born Col- || chester Ct. Oct. 14, 1804; arrived Fairfield || Jan. 3, 1833; married Feb. 7, 1836. || John Thompson, Kingsboro’ N. Y.; born — 1800; graduated M. C. 1827; departed New |! York Dec. 16, 1828; arrived Carmel Jan. 23, || 1829; Hightower Sept. — 1830; Brainerd July || 1, 1831; arrested by Georgia guard July 8, || 1831; returned April 4, released Aug. 28, | 1682. Mrs. Thompson (Ruth B. Johnson,) Shore- || ham Vt. 1 Jesse Lockwood, New Haven Ct.; born North | Salem N. Y. Nov. 11, 1802; graduated W. C. || 1830, New Haven 1833; departed New York {| Oct. 18, 1833; arrived Dwight Jan. 25, 18345 || died July 11, 1834. | Mrs. Poe es (Cassandra Sawyer.) Glou- || cester Ms.; born Henniker N. H. June 24, 1809; || returned April 14, 1835; released. | 1} j } Missionary Physicians. George L. Weed, M. D.—see Creeks. | Roderick L. Dodge, M. D., born Hartland | Vt. Sept. 7, 1808; arrived Creeks Dec. 24, 1834, Dwight —; visited U. States Oct. — 1837— Oct. — 1838; released Sept. 24, 1839. | Mrs. Dodge (Emeline Bradshaw,) Montpelier || Vt.; born Rockingham Vt. Nov. 4, 1812; arriv- | ed Dwight Dec. — 1635; married Montpelier | Aug. 22, 1838. Assistant Missionaries. Moody Hall, born Cornish N. H. Dec. 1, 1789; departed New York Jan. 22, 1817; arriv- Statistical View of the Board and its Missions. ed Brainerd March 7, 1817, Carmel Nov. 22, 1819; returned March 23, 1826; released. Mrs. Hail (Isabella Murray,) born Lansinug- burgh N. Y. April 25, 1792. Abijah Conger, borii Rockaway N. J. May 4, 1782; departed Sept. 30, arrived Brainerd Nov. 11, 1819; returned Nov. 25, 1822; released. Mrs. Conger, Rockaway N. J.; born Bridge- hamton L. I. John Vail, Rockaway N. J.; born Hanover N. J. Oct. 9, 1788; departed Sept. 30, arrived Brainerd Nov. 11, 1819; visited U. States Dec. 4, 1821—March 6, 1822; released June 18, 1839. Mrs. Julia Vail, Rockaway N. J.; born Han- cock N. J. April 1, 1789. John Talmage, Rockaway N. J.; departed Sept. 30, arrived Brainerd Nov. 11, 1819; re- turned May 25, 1820. Mrs. Talmage (— Conger,) Rockaway N. J. James Orr, Summer Hill N. Y.; born Han- cock N. H. May 19, 1791; departed New York April 18, arrived Dwight July 23, 1820. Mrs. Orr (Minerva Washburn,) born Ran- dolph Vt.; departed Aug. 30, 1819; arrived Eliot Jan. 3, 1820, Dwight May 10, married Nov. 18, 1821. Jacob Hitchcock, born Brimfield Ms. Sept. 7, 1792; departed March 5, arrived Dwight July 23, 1820. Mrs. Hitchcock (Nancy Brown,) Monson Ms.; born Eastbury Ct. Jan. 19, 1791; arrived Dwight Dec. 92. married Dec. 25, 1821. Daniel Hitchcock, born Brimfield Ms. Sept. 22, 1795; departed Sept. 1, died Washington Pa. Oct. 1, 1821. John C. Ellsworth, Greensboro’ Vt.3 born Chatham Ct. Feb. 22, 1793; departed Sept. 25, arrived Brainerd Nov. 24, 1821, Haweis April 24, 1823, Brainerd April — 1824; returned May 9, 1836; released Jan. 10, 1837. Mrs. Ellsworth (Eliza Tolmar,) born Greens- boro’ Vt. Dec. 25, 1795. Henry Parker, born Litchfield Ct. March 22, 1791; arrived Brainerd Dee. 19, 1221; released July 31, returned Oct. 1, 1832. Mrs. Parker (Philena Griffin,) born Simsbury Ct. Feb. 10, 1792. Erastus Dean, born Bristol Vt. May 13, 1798; arrived Brainerd Jan. 12, 1822; returned July — 1625; released. Mrs. Dean (Sarah Coleman,) Montpelier Vt.; born Byfield Ms. Sept. 23, 1796; returned July — 1825; died Newburyport May 21, 1826. Sylvester Ellis, born Randolph Vt. July 29, 179€; arrived Brainerd April 10, 1822, Wills- town May 22, 1824; returned Oct. 9, 1832; re- leased. Mrs. Ellis (Sarah Hoyt,) Brainerd; born Danbury Ct. Oct. 11, 1794. Ainsworth E. Blunt, born Amherst N. H. Feb. 22, 1800; departed Boston March 3, arriv- ed Brainerd April 12, 1822, Candy’s Creek Aug. 26, 1837; released June 18, 1839. Mrs. Blunt (Harriet Ellsworth,) Greensboro’ Vt.; born Chatham Ct. Sept. 25, 1790; arrived Brainerd Nov. 24, 1821; married Nov. 17, 1822. Isaac Proctor, born Ipswich Ms. May 6, 1784; arrived Brainerd Oct. 11, 1822, teen March 25, 1823, Carmel March 18, 1826, Amo- hee July 1, 1831; released June 4, returned Sept. 1833. Mrs. Fanny Proctor, West Bloomfield N. Y. Frederic Ellsworth, Greensboro’ Vt.; born— 1795; arrived Brainerd Oct. 30, 1822, Haweis = soak 22, 1824; returned April — 1626; re- eased. 30 Statistical View of the Board and its Missions. Mrs. Ellsworth (— Coleman,) Montpelier Vt. David Ga ee Choctaws. William Holland, born Belchertown Ms. Feb. 7, 1798; departed Sept. 22, arrived Brainerd Nov. 20, 1823, Candy’s Creek Nov. 17, 1824; returned July — 1837; released. Mrs. Holland (Electa Hopkins,) Peacham Vt.; born Hanover N. H. May 9, 1797. Josiah Hemmingway, Windsor Ms.; born — 1793; arrived Brainerd Nov. 20, 1823; Carmel —— returned July —, released Aug. 12, 1830. Asa Hitchcock, Brimfield Ms.; born Homer N. Y. Aug. 3, 1800; yoy Nov. 18, 1823; arrived Dwight May 4, 1824; visited U. States March — 1828—Oct. — 1829; released June 4, returned Nov. — 1839. Mrs. Hitchcock (Sophronia Sumner,) Spen- cer Ms.; died Dwight March 3, 1827. Mrs. Hitcheock (Lucy Morse,) born Spencer es 29, 1795; arrived Dwight Oct. 27, Samuel Wisner, Granville O.; born — 1794; arrived Mayhew July 21, 1821, Dwight March — 1825; released Sept. 20, 1830. Mrs. Wisner (Judith Frissell,) born Peru Ms. 1800; departed Sept. — 1820; arrived Mayhew June 11, 1821; married Jan. 5, 1822; died Dwight Aug. 24, 1829. Samuel Newton, born Woodbridge Ct. Jan. 1, 1792; de d Feb. 19, cadvel Usenany Aug. 8, 1821, Dwight Feb. — 1828, Forks of Illinois Feb. 2, 1830; released Oct. 9, 1838. Mrs. Newton (Mrs. Seely—Mary H. McCar- thy,) born Rockaway N. J. 1802; departed New York March 7, arrived Harmony Aug. 8, 1821; married June 3, 1822; died Forks of [Illinois March 30, 1835. Mrs. Newton (Mrs. Joslyn,)—see M. Joslyn, Choctaws; married Forks of Illinois July 27, 1835. William H. Manwaring, Granville O.; born Norwich Ct. — 1804; arrived Carmel April 22, 1825; returned April 3, 1826; released. Fenner Bosworth, Stow’s Square N. Y.; born 1794; departed Aug. 31, arrived Creek Path Nov. 5, 1825; returned April 10, 1828; re- leased. Mrs. Bosworth. Luke Fernal, born Nottingham N. H. April 8, 1802; arrived Brainerd — 1826; returned — 1830. Mrs. Fernal, died Brainerd Oct. 13, 1829. Aaron Gray, Oxford N. Y.; born — 1798; departed Feb. 24, arrived — April 16, 1829; released May — 1831—Nov. — 1833; died June 25, 1837. John F. Wheeler, arrived Park Hill — 1835. Mrs. Wheeler. Henry K. Copeland, Dwight; born Salisbury | Vit.; appointed June 18, 1839. Mrs. Copeland’ (Abigail H. Rice,) born Pe- tersham Ms. Oct. 23, 1805. Ellen Stetson, born Kingston Ms. March 30, | 1783; departed Sept. 1, arrived Dwight Dec. | 22, 1821. Lucy Hutchinson—see Mrs. Howes, Choc- taws. > Sophia Sawyer, Rindge N. H.,; born Fitch- burgh Ms. May 4, 1792; arrived Brainerd Nov. 20, 1825, New Echota Feb. 6, 1829, Running Waters Jan. — 1835; visited U. States July — 1836—Dec. — 1837; arrived Dwight —. Cynthia Thrall, born Windsor Ct. Dee. 13, 1791; departed May 10, 1825; arrived Dwight July 28, 1825; died Aug. 17, 1834. Jan. Erminia Nash, Lowville N. Y.; born Cum- mington Ms. Oct. 12, 1801; departed Aug. 31, arrived Creek Path Nov. 5, 1825; visited U. States July — 1837—June — 1839; arrived Dwight June 10, 1839. Delight Sargent, Pawlet Vt.; born — 1800; arrived Brainerd Nov. 7, 1827, Red Clay June — 1836; released May 16, 1837. Nancy Thompson, Blount co. Ten.; born Washington co. Va. March 20, 1792; arrived Haweis — 1826, Willstown March — 1833, Park Hill —. Hannah Kelly, born Amesbury Ms. July 24, 1783; arrived Brainerd Nov. 7, 1827; Candy’s Creek — 1828; released May 17, 1830. Catharine Fuller, born Fitchburgh Ms. Sept.
| 36,611 |
https://github.com/nhoxzunbmt/crm/blob/master/app/Http/Controllers/MR/Controller.php
|
Github Open Source
|
Open Source
|
MIT
| 2,016 |
crm
|
nhoxzunbmt
|
PHP
|
Code
| 41 | 160 |
<?php
namespace App\Http\Controllers\MR;
use App\Message;
use App\MessageReply;
use App\SMLeaveRequest;
use App\SMServiceRequest;
use App\SMPlan;
use Illuminate\Foundation\Bus\DispatchesJobs;
use Illuminate\Routing\Controller as BaseController;
use Illuminate\Foundation\Validation\ValidatesRequests;
use Illuminate\Foundation\Auth\Access\AuthorizesRequests;
use View;
abstract class Controller extends BaseController
{
use AuthorizesRequests, DispatchesJobs, ValidatesRequests;
public function __construct()
{
}
}
| 18,003 |
US-385750D-A_1
|
USPTO
|
Open Government
|
Public Domain
| null |
None
|
None
|
English
|
Spoken
| 419 | 625 |
Samuel friend
Y Miran STATES FFICEQ Patient SAMUEL FRIEND, OF DECATUR, ILLINOIS, ASSIGNOR OF THREEFOURTHS TO JOHN K. WARREN, BRADFORD K. DURFEE, AND DANIEL H, HEILMAN, OF
SAME PLACE.
ART OF TREATING CLAY.
SPECIFICATION forming part 'of Letters Patent No. 385,750, dated July 10, 1888,
A nplication tiled May 25, 12 87.
To all whom it may concern:
Be itltnown that I, SAMUEL FRIEND, of the city of Decatur, county of Macon, and State of Illinois, have invented certain new and useful Improvements in the Art of Treating Clay Preparatory to Baking or Burning, of which the following is a specification.
It is the object of my invention to enable in ferior clays to be used in the manufacture of brick and analogous articles, to insure cohe siveness and density in such articles, and to enable the same to be burned in a kiln immediately after molding without the usual delay and expense of the water-smoke process.
I accomplish my object by pulverizing the clay, heating it intensely, and subjecting" it while hot. to cold water, preferably in the form ofspray. Clay so treated is thoroughly and uniformly permeated with moisture, is spongy to the touch and very cohesive, and when burned forms articles olgrcat densityand firmness.
The first step of the process is preparatory. The second step expels the moisture, consumes deleterious substances when inferior clay is used, and highly expands the clay and the air retained therein. The third step is based on Serial No. 230,331.
(No specimens.)
the difference between the specific heat of the clay and of the air. The air is heated to a given point much sooner than the clay, and when the cold water is applied the air is condensed, while the clay remains comparatively unaffected. The heat extends the interstices of the clay, and when the air contained in the interstices is condensed by the cold water vacuums are formed, into which the water is instantaneously and irresistibly drawn. Clay so prepared, if molded at once, will have sut'- ficient heat to throw off the water-smoke, and the articles so molded may be subjected at once to the burning heat of the kiln.
I claim The method of treating clay, consisting of pulverizing, heating intensely, and subjecting while hot to cold water applied directly and practically sin'iultaneonsly to all the particles, as and for the purpose set forth.
In testimony whereof I sign my namein the presence of two subscribing witnesses.
SAMUEL FRIEND.
Attest:
L. P. GRAHAM, Z. D. W ALnER-.
| 33,626 |
https://github.com/chellmuth/hive-viewer/blob/master/lib/assets.dart
|
Github Open Source
|
Open Source
|
MIT
| 2,014 |
hive-viewer
|
chellmuth
|
Dart
|
Code
| 123 | 507 |
library assets;
import 'dart:async';
import 'dart:html';
import 'gamemodel.dart';
class AssetLibrary {
static Map assets = {};
Future _downloadsComplete;
Future downloadAssets() {
var assetNames = [
'ant-white@2x', 'grasshopper-white@2x', 'queen-white@2x', 'spider-white@2x', 'beetle-white@2x', 'mosquito-white@2x',
'ant-black@2x', 'grasshopper-black@2x', 'queen-black@2x', 'spider-black@2x', 'beetle-black@2x', 'mosquito-black@2x',
'move-tile@2x'
];
var futures = [];
for (var assetName in assetNames) {
var image = new ImageElement(src: 'images/${assetName}.png');
futures.add(image.onLoad.first);
AssetLibrary.assets[assetName] = image;
}
return Future.wait(futures);
}
static ImageElement imageNamed(String name) {
return assets["${name}@2x"];
}
static ImageElement imageForPiece(Piece piece) {
var color = piece.player == Player.WHITE ? 'white' : 'black';
switch (piece.bug) {
case Bug.SPIDER: return assets['spider-${color}@2x'];
case Bug.ANT: return assets['ant-${color}@2x'];
case Bug.BEETLE: return assets['beetle-${color}@2x'];
case Bug.GRASSHOPPER: return assets['grasshopper-${color}@2x'];
case Bug.QUEEN: return assets['queen-${color}@2x'];
case Bug.MOSQUITO: return assets['mosquito-${color}@2x'];
}
throw new Exception("Unknown bug: " + piece.bug.toString());
}
}
| 45,399 |
https://openalex.org/W2025934694
|
OpenAlex
|
Open Science
|
CC-By
| 2,010 |
A Capsid-Encoded PPxY-Motif Facilitates Adenovirus Entry
|
Harald Wodrich
|
English
|
Spoken
| 17,459 | 30,029 |
A capsid-encoded PPxY-motif facilitates adenovirus
entry.
Harald Wodrich, Daniel Henaff, Baptist Jammart, Carolina Segura-Morales,
Sigrid Seelmeir, Olivier Coux, Zsolt Ruzsics, Christopher M Wiethoff, Eric J
Kremer
To cite this version:
Harald Wodrich, Daniel Henaff, Baptist Jammart, Carolina Segura-Morales, Sigrid Seelmeir, et al.. A
capsid-encoded PPxY-motif facilitates adenovirus entry.. PLoS Pathogens, 2010, 6 (3), pp.e1000808.
10.1371/journal.ppat.1000808. hal-00523031 entry. Harald Wodrich, Daniel Henaff, Baptist Jammart, Carolina Segura-Morales,
Sigrid Seelmeir, Olivier Coux, Zsolt Ruzsics, Christopher M Wiethoff, Eric J
Kremer entry. Harald Wodrich, Daniel Henaff, Baptist Jammart, Carolina Segura-Morales,
Sigrid Seelmeir, Olivier Coux, Zsolt Ruzsics, Christopher M Wiethoff, Eric J
Kremer To cite this version: Harald Wodrich, Daniel Henaff, Baptist Jammart, Carolina Segura-Morales, Sigrid Seelmeir, et al.. A
capsid-encoded PPxY-motif facilitates adenovirus entry.. PLoS Pathogens, 2010, 6 (3), pp.e1000808. 10.1371/journal.ppat.1000808. hal-00523031 Distributed under a Creative Commons Attribution 4.0 International License Introduction proteasome
increases
the
transduction
efficiency
of
adeno-
associated virus vectors and this correlates with ubiquitylation of
capsid proteins [11,12]. The Semliki forest and the vesicular
stomatitis virus, however, do not seem to be affected by
proteasome inhibition during their entry suggesting different host
factor requirements [10]. Many viruses use the microtubule network of the host cell for
transport to their site of replication (i.e. the nucleus) [1]. Access to
the microtubule network is achieved through recruitment of
cytoplasmic dynein motor proteins followed by efficient retrograde
transport towards the nucleus [2,3]. Virus-induced cellular signaling
cascades help stimulate the directionality and efficacy of the
transport [4]. Viral interaction with dynein motor proteins occurs
either directly through capsid proteins or indirectly via hijacking of
adapters from existing transport pathways [5]. Most DNA viruses
accumulate transiently at the microtubule organizing center
(MTOC) prior to nuclear translocation [1,3,6]. How they release
from the microtubules or the MTOC and transport to nuclear pores
is poorly understood. MTOC release may involve a switch from
dynein to kinesin mediated transport, the cellular ubiquitin/
proteasome system and/or nuclear transport receptors [1,3,5–8]. A role for the ubiquitylation machinery during egress of
enveloped viruses is better understood. Egress involves the
transport of assembled capsids, subviral structures or individual
capsid proteins to assembly and budding sites at the cell surface or
at intracellular membranes [1]. Budding, and potentially traffick-
ing, to the egress site requires an intact class E vesicular sorting
pathway (VSP, [13,14]. The VSP is believed to involve the
consecutive activity of three distinct heteromeric complexes
termed endosomal sorting complexes required for transport
(ESCRT-I, -II and –III, [15]). The capsid proteins of several
enveloped viruses encode ‘late domains’ that specifically interact
with ESCRT components and redirect them towards the site of
viral egress [13]. Some late domains of the PPxY motif type (where
x can be any amino acid) require the binding of ubiquitin ligases of
the Nedd4 family of HECT-E3 ubiquitin ligases (Homologous to
E6-AP Carboxyl Terminus) for efficient ESCRT recruitment [13]. Nedd4.1 and its close relative Nedd4.2 are prototypic members Indirect evidence that the host’s ubiquitylation machinery
participates in parts of the viral entry process comes from studies
using pharmacological inhibitors of the ubiquitin/proteasome
system. For example, translocation of a murine coronavirus from
the endosome to the cytoplasm is facilitated by the ubiquitin-
proteasome system [9]. Abstract * E-mail: [email protected] ¤a Current address: Laboratoire de Microbiologie Cellulaire et Mole´culaire et Pathoge´nicite´, Universite´ de Bordeaux 2, Bordeaux, France
¤b Current address: INSERM U871, Lyon, France ¤a Current address: Laboratoire de Microbiologie Cellulaire et Mole´culaire et Pathoge´nicite´, Universite´ de Bordeaux 2, Bordeaux, Fra
¤b Current address: INSERM U871, Lyon, France Current address: Laboratoire de Microbiologie Cellulaire et Mole´culaire et Pathoge´nicite´, Universite´ de Bordeaux 2, Bordeaux, France
Current address: INSERM U871, Lyon, France A Capsid-Encoded PPxY-Motif Facilitates Adenovirus
Entry Harald Wodrich1,2¤a*, Daniel Henaff1,2, Baptist Jammart1,2¤b, Carolina Segura-Morales1,2¤c, Sigrid
Seelmeir3, Olivier Coux4, Zsolt Ruzsics3, Christopher M. Wiethoff5, Eric J. Kremer1,2
1 Institut Ge´ne´tique Mole´culaire de Montpellier, Montpellier, France, 2 Universite´ Montpellier I & II, Montpellier, France, 3 Max von Pettenkofer Institute, Gene Center, LMU
Muenchen, Muenchen, Germany, 4 Centre de Recherche en Biochimie Macromole´culaire, Montpellier, France, 5 Department of Microbiology and Immunology, Loyol
University Medical Center, Maywood, Illinois, United States of America 1 Institut Ge´ne´tique Mole´culaire de Montpellier, Montpellier, France, 2 Universite´ Montpellier I & II, Montpellier, France, 3 Max von Pettenkofer Institute, Gene Center, LMU
Muenchen, Muenchen, Germany, 4 Centre de Recherche en Biochimie Macromole´culaire, Montpellier, France, 5 Department of Microbiology and Immunology, Loyola
University Medical Center, Maywood, Illinois, United States of America PLoS Pathogens | www.plospathogens.org HAL Id: hal-00523031
https://hal.science/hal-00523031v1
Submitted on 1 Jun 2021 L’archive ouverte pluridisciplinaire HAL, est
destinée au dépôt et à la diffusion de documents
scientifiques de niveau recherche, publiés ou non,
émanant des établissements d’enseignement et de
recherche français ou étrangers, des laboratoires
publics ou privés. HAL is a multi-disciplinary open access
archive for the deposit and dissemination of sci-
entific research documents, whether they are pub-
lished or not. The documents may come from
teaching and research institutions in France or
abroad, or from public or private research centers. Distributed under a Creative Commons Attribution 4.0 International License Abstract Viruses use cellular machinery to enter and infect cells. In this study we address the cell entry mechanisms of nonenveloped
adenoviruses (Ads). We show that protein VI, an internal capsid protein, is rapidly exposed after cell surface attachment and
internalization and remains partially associated with the capsid during intracellular transport. We found that a PPxY motif
within protein VI recruits Nedd4 E3 ubiquitin ligases to bind and ubiquitylate protein VI. We further show that this PPxY
motif is involved in rapid, microtubule-dependent intracellular movement of protein VI. Ads with a mutated PPxY motif can
efficiently escape endosomes but are defective in microtubule-dependent trafficking toward the nucleus. Likewise,
depletion of Nedd4 ligases attenuates nuclear accumulation of incoming Ad particles and infection. Our data provide the
first evidence that virus-encoded PPxY motifs are required during virus entry, which may be of significance for several other
pathogens. naff D, Jammart B, Segura-Morales C, Seelmeir S, et al. (2010) A Capsid-Encoded PPxY-Motif Facilitates Adenovirus Entry. PLoS Pathog 6(3)
urnal.ppat.1000808 Editor: Ronald N. Harty, University of Pennsylvania, United States of America Editor: Ronald N. Harty, University of Pennsylvania, United States of America Received June 18, 2009; Accepted February 5, 2010; Published March 19, 2010 Received June 18, 2009; Accepted February 5, 2010; Published March 19, 2010 Copyright: 2010 Wodrich et al. This is an open-access article distributed under the terms of the Creative Comm
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Copyright: 2010 Wodrich et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: This work was supported in part by a PEPS (CNRS) idea grant to H.W., by funds from the Deutsche Forschungsgemeinschaft DFG SFB455 to Z.R., by
financial aid from the NIH (AI082430) towards C.M.W. and funding from IGMM, AFM, VML, FRM, Region LR, ARC and CRF towards E.J.K. E.J.K. and H.W. are INSERM
fellows. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist. Protein VI is exposed during Ad infection and partially
remains associated with the viral particle The fate of Ad particles immediately after internalization is only
partially characterized. In the context of endosome escape of Ad5,
very little is known about how this occurs and which, if any,
cellular proteins are involved. From in vitro studies it was proposed
that the internal capsid protein VI mediates Ad endosome escape
[28]. Previous reports showed that protein VI dissociates from the
Ad capsid very early after attachment [26,27]. p
y
y
[
]
To delineate the fate of protein VI during Ad entry we
performed infection assays and followed the intracellular distribu-
tion of the viral capsid and protein VI as a function of time. To
this end, fluorescently labeled Ad particles were adsorbed to either
human retina epithelia pigment cells (hTERT-RPE1, Figure 1) or
human osteosarcoma cells (U2OS, Figure S1) at 4uC and then
transferred to 37uC to synchronize internalization. Cells were fixed
at various times and analyzed by confocal microscopy (Figure 1). Protein VI was detected using an affinity purified polyclonal-
antiserum and the location of the MTOC was marked by
detecting the primary cilia, which originates at the MTOC using
antibodies against acetylated tubulin [32]. At 4uC viral particles
accumulated at the cell periphery showing sporadic positive
staining with the protein VI antiserum (,1%) possibly due to the
recognition of protein VI from damaged particles (Figure 1 first
row). In contrast, 5 min after the temperature shift, Ad particles
were still localized close to the cell periphery but approximately
40% of them gave a signal with the protein VI antibody indicating
that more protein VI was accessible (Figure 1, second row). After
15 min, particles had entered the cell with some localized at the
MTOC region (Figure 1, third row) and some at the nuclear rim as
described previously [6]. About 10% of the particles remained
protein VI positive, including particles at the nuclear rim. After
45 min the majority of the particles were concentrated at the
MTOC region (Figure 1, bottom row) as previously reported [3]. Protein VI staining was also concentrated at the MTOC region
but most of the signal was not particle associated. Similar results
were obtained in U2OS cells (Figure S1). Together these data
suggested that structural rearrangements leading to protein VI
exposure take place at or close to the cell surface during Ad entry. Protein VI is exposed during Ad infection and partially
remains associated with the viral particle In addition, the data showed that protein VI trafficked to the
MTOC region and partially remained associated with the capsid. interaction, a catalytical HECT domain and three to four WW-
domains for protein-protein interactions with proline-rich domains
such as the PPxY motif [16,17]. The exact role of PPxY-
recruitment of Nedd4 ligases in VSP-mediated viral budding is still
unclear. A possible link was recently shown by enhanced ESCRT
ubiquitylation through Nedd4.2 overexpression [18,19]. Late domains, including the PPxY type, have also been found in
some nonenveloped reoviruses but a general function in virus
release remains to be shown [20]. PPxY type late domains where
also described for the Ad capsid protein penton, which can interact
with ubiquitin ligases of the Nedd4 family. However, its role in Ad
infection is unclear [21]. At least in vitro, Ad infects cells by first attaching to primary
receptors, including CAR, CD46 and sialic acid, via the fiber
protein [22]. In some cells endocytosis of Ad may be triggered
by penton base-mediated signaling through alpha(v) integrins
[23–25]. In epithelial cells, Ad serotype 5 (Ad5) particles undergo
stepwise disassembly during entry, starting with detachment of the
fiber at or near the cell surface and followed by a passage through
endosomal
compartments
in
which
acidification
serves
as
additional disassembly trigger for membrane penetration and
cytosolic translocation [26,27]. Partial disassembly releases the
internal capsid protein VI, which can lyse membranes in vitro via its
predicted N-terminal amphipathic helix [28]. In the cytosol, the
particle engages in microtubule-directed transport towards the
MTOC and is translocated to the nuclear pore complex (NPC) for
nuclear import of the genome [29–31]. In this study we address the mechanisms of Ad cell entry. We
demonstrate that the internal capsid protein VI is rapidly exposed
to antibodies during cell entry, possibly at the cell surface or
immediately after endocytosis. We further determine that protein
VI remains partially associated with Ad capsids as they traffic to
MTOCs and the NPC. We identify a functional PPxY motif
within protein VI that mediates the association of protein VI with
Nedd4 E3 ubiquitin ligases and facilitates its ubiquitylation. Recombinant Ad5 in which the protein VI PPxY motif is mutated
have normal capsid morphology, escape from endosomes with Introduction Similarly, influenza viruses appear to be
trapped in an endosomal compartment upon pharmacological
inhibition of the proteasome [10]. In contrast, blocking the Nedd4.1 and its close relative Nedd4.2 are prototypic members
of this family, which is conserved from yeast to mammals [16]. They encode a N-terminal C2 domain for Ca2+-dependent lipid March 2010 | Volume 6 | Issue 3 | e1000808 1 March 2010 | Volume 6 | Issue 3 | e1000808 PPxY Motif Facilitates Adenovirus Entry similar efficiency as wildtype viruses, but are defective in genome
delivery to the nucleus. We show that the PPxY motif in protein
VI is involved in its efficient microtubule-mediated transport and
mutating it in the virus alters the intracellular targeting of Ads
towards the MTOC region concomitant with a post-entry block in
viral infectivity. Furthermore, Nedd4.1 and Nedd4.2 are involved
in Ad infection and intracellular targeting of incoming virions to
the MTOC. We propose that the PPxY motif, in other viral
systems, may also function during entry and interact with novel
cellular pathways for efficient viral entry. Author Summary Viruses exploit cellular functions during entry and exit of
cells. To redirect cellular functions for their own purpose,
viruses encode high-affinity binding sites for key-cellular
factors. One such domain is the PPxY motif, which is
present in structural proteins of several, mainly enveloped
viruses. This motif binds to ubiquitin ligases of the Nedd4
family and recruits their function to sites of virus budding
from cells. Here we show that adenoviruses also encode a
PPxY motif in the internal structural protein VI and that the
PPxY motif has an unprecedented function in virus entry. Adenoviruses with mutations in the protein VI PPxY motif
undergo
normal
endosomal
uptake
and
membrane
penetration but have reduced infectivity, altered intracel-
lular targeting and lack efficient gene-delivery. We also
find that protein VI is ubiquitylated by Nedd4 ligases in a
PPxY dependent manner following partial capsid disas-
sembly and displays rapid intracellular movement. Deple-
tion of Nedd4 ligases also alters virus movement within
cells during entry and reduces viral infectivity. Given that
PPxY motifs are important for virus exit our findings might
have uncovered an additional function for PPxY motifs
in virus entry, potentially expanding the significance of
PPxY motifs and functionally related domains for viral
replication. PLoS Pathogens | www.plospathogens.org Ad5 protein VI encodes a conserved PPxY motif
determining viral infectivity To identify possible trafficking determinants, we analyzed the
sequences of protein VI from several Ad serotypes and identified a
highly conserved ubiquitin-ligase interacting motif present in
PPxY-type viral late domains (PPxY, Figure S2). To examine the
role of this PPxY motif in Ad cell entry, we used an E1/E3-deleted
Ad5 that had the protein VI PPSY motif mutated to PGAA (Ad5-
VI-M1, detailed in Figure S3) [33,34]. This mutation, when March 2010 | Volume 6 | Issue 3 | e1000808 2 PPxY Motif Facilitates Adenovirus Entry uced into Mason-Pfizer monkey virus, was previously shown
olish late domain functions with no apparent structural
the tertiary structure could also affect the capsid composition. In
large scale preparations mutant and wt virus banded at identical
1. Timecourse of protein VI release during Ad entry. Ad5-488 was pre-bound to hTERT-RPE1 cells at 4uC (top row) and shifted to 37uC
min (second row), 15 min (third row) and 45 min (bottom row) as indicated. Protein VI was detected using anti-protein VI antibodies (left
), adenoviral particles by detecting the Alexa-488 fluorescent signal (second column) and the MTOC by staining the primary cilia (third
). A composite of all three signals including the nucleus (in grayscale) is shown to the left. The inset shows an inverted magnification of
ntative virus, protein VI and the primary cilia signals from the small dashed box. In the composite protein VI signals are shown in red, Ad is
in green, the primary cilia in grey and the nucleus in blue. Colocalization of protein VI and Ad appears as yellow. The scale bar is 10 mm. 371/journal.ppat.1000808.g001 Figure 1. Timecourse of protein VI release during Ad entry. Ad5-488 was pre-bound to hTERT-RPE1 cells at 4uC (top row) and shifted to 37uC
for 5 min (second row), 15 min (third row) and 45 min (bottom row) as indicated. Protein VI was detected using anti-protein VI antibodies (left
column), adenoviral particles by detecting the Alexa-488 fluorescent signal (second column) and the MTOC by staining the primary cilia (third
column). A composite of all three signals including the nucleus (in grayscale) is shown to the left. The inset shows an inverted magnification of
representative virus, protein VI and the primary cilia signals from the small dashed box. In the composite protein VI signals are shown in red, Ad is
shown in green, the primary cilia in grey and the nucleus in blue. PLoS Pathogens | www.plospathogens.org Ad5 protein VI encodes a conserved PPxY motif
determining viral infectivity temperatures lyse the endosome with the same efficiency as the
wt virus. Incorporation of radiolabeled amino acids was compared
to alpha-sarcin treated cells. When we added alpha-Sarcin and
Ad5-VI-wt, Ad5-VI-M1 or the Ad2ts1 mutant grown at a
permissive temperature translation was diminished in a dose-
dependent manner over at least two orders of magnitude, showing
efficient cytoplasmic delivery of the toxin. Ad2ts1 grown at the
non-permissive temperature did not inhibit translation in this assay
(Figure 2G). We observed no difference between the PPxY-mutant
virus and the wt controls. This indicated that an attenuating effect
of the PPxY-mutation occurs after endosomal lysis and prior to the
onset of replication. To determine whether the M1 mutation influences Ad cell
entry, we performed a fluorescent focus forming assay and stained
cells at 8, 12 and 24 h post-infection for expression of the E2A
protein, which marks the appearance of viral replication centers
(Figure 2D and data not shown). Compared to Ad5-VI-wt, the
Ad5-VI-M1 virus produced approximately 20-fold fewer fluores-
cent foci when equivalent numbers of viral particles were used for
infections. This suggested that steps prior to replication (i.e. internalization) require an intact PPxY motif in protein VI. We
next
characterized
the
release
of
protein
VI
from
fluorescently labeled Ad-VI-M1 and Ad5-VI-wt following syn-
chronous infections of U2OS cells using the infection assay as
described for Figure 1. Ad5-VI-wt released protein VI within
5 min (Figure 3A, left panel). In contrast, we observed a delayed
release of protein VI from Ad5-VI-M1 (15% of M1 after 5 min
compared to 38% of wt, Figure 3A) and an increase in
colocalization of viral particles with protein VI at the nucleus
(Figure 3A). This observation suggests a delayed accessibility of
protein VI within the virus or a defect in protein VI dissociation
from the virion (Figure 3A, images to the right). In addition to the
increase of protein VI capsid association, Ad5-VI-M1 appeared to
be more evenly distributed throughout the cell and did not
efficiently accumulate at the MTOC region (Figure 3B, images to
the left). Quantification revealed that 45 min post-infection
approximately 60% of the wt viral particles in proximity of the
MTOC could be found within a 10 mm radius around the MTOC
and 40% within 10–20 mm. In contrast, the localization for the
M1 virus was 50% for each region showing a decreased targeting
towards the MTOC (Figure 3B, right panel). Ad5 protein VI encodes a conserved PPxY motif
determining viral infectivity The scale bar is 100nm. C) Plaque assay comparison of Ad5-VI-wt vs. Ad5-VI-M1. Quantification of plaques at day 12 for different physical particle per cell ratios for Ad5-VI-wt and Ad5-VI-M1. Shown is the average plaque number
per 6 well (+/2 standard deviation) of three individual experiments. D) Focus forming assay. E1 complementing 911 cells were infected with Ad5-VI-
wt or Ad5-VI-M1 and replication centers were stained with E2A antibodies 24 h post-infection and at different particle per cell ratios. .5 random
fields with .200 cells were counted, standard deviation represents field-to-field variations. E) Plaque forming assay comparison of Ad5GFP-VI-wt vs. Ad5GFP-VI-M1. Quantification of GFP positive plaques at day 12 at different physical particle to cell ratios. The values show the average number of
GFP positive plaques per 6-well (+/2 standard deviation) of two independent experiments. F) Single round infection assay comparison of Ad5GFP-VI-
wt vs. Ad5GFP-VI-M1. U2OS cells were infected with increasing amounts of physical particle to cell ratios as indicated. GFP expression was quantified
using FACS. Values correspond to the average percentage of GFP positive cells of two experiments done in triplicates (+/2 standard deviation). Note
that the ,100% infection of wt infected cells at 100 physical particles per cell is saturated and not comparable to M1. G) Analysis of membrane
penetration. A549 cells were infected with Ad5-VI-wt, Ad5-VI-M1, Ad2ts1 grown at 32uC or at 38uC at different physical particle per cell ratios as
indicated and in the presence of alpha-Sarcin and translational efficiency was determined by measuring the incorporation of radiolabeled amino
acids over time. Values are given in percentage normalized to 100% translation measured in the presence of the toxin but in absence of virus. Conditions are indicated below each bar and are the mean of at least three independent experiments done in triplicates. doi:10.1371/journal.ppat.1000808.g002 wt virus remained unchanged, we used negative stain electron
microscopy. As shown in Figure 2B
capsid integrity
and
morphology of the mutant virus was indistinguishable from the
wt virus. In contrast, the infectious versus physical particle ratio of
Ad5-VI-M1 was ,20-fold lower than Ad5-VI-wt as assayed by
plaque formation on monolayers of 911 cells (Figure 2C). Because
infectious vs. physical particles can vary between preparations, we
assayed plaque size, which is more informative measurement of
propagation rate. Plaques were significantly smaller for Ad5-VI-
M1 versus Ad5-VI-wt (see below), suggesting that the altered PPxY
domain affects some stages of virus propagation. Ad5 protein VI encodes a conserved PPxY motif
determining viral infectivity Colocalization of protein VI and Ad appears as yellow. The scale bar is 10 mm. doi:10.1371/journal.ppat.1000808.g001 the tertiary structure could also affect the capsid composition. In
large-scale preparations, mutant and wt virus banded at identical
densities and gave similar yields of particles as determined by
genome and protein quantification. A biochemical analysis of the
capsid composition of purified viral particles showed no apparent
differences between wt and mutant viruses (Figure 2A and data not
shown). To confirm that viral capsid integrity between mutant and introduced into Mason-Pfizer monkey virus, was previously shown
to abolish late domain functions with no apparent structural
changes, which would impair virus assembly [35,36]. To control
for unintended mutations introduced during the cloning, we
reverted the PGAA sequence back to PPSY (Ad5-VI-wt). Because
the ,360 copies of protein VI appears to be in contact with
several proteins in the mature capsid, modifications that disrupt PLoS Pathogens | www.plospathogens.org March 2010 | Volume 6 | Issue 3 | e1000808 March 2010 | Volume 6 | Issue 3 | e1000808 3 PPxY Motif Facilitates Adenovirus Entry Figure 2. Reduced infectivity for an Ad with an altered PPxY motif. A) Biochemical comparison of Ad5-VI-wt vs. Ad5-VI-M1. Left panel;
Coomassie gel comparison of wt Ad (Ad5-VI-wt, lane 1) and Ad with PPSY in protein VI mutated to PGAA (Ad5-VI-M1, lane 2). Individual capsid
proteins are shown on the left. Right panel; western blot analysis of protein VI for Ad5-VI-wt (lane 1) and Ad5-VI-M1 (lane 2). B) Negative stain of
PLoS Pathogens | www.plospathogens.org
4
March 2010 | Volume 6 | Issue 3 | e1000808 Figure 2. Reduced infectivity for an Ad with an altered PPxY motif. A) Biochemical comparison of Ad5-VI-wt vs. Ad5-VI-M1. Left panel;
Coomassie gel comparison of wt Ad (Ad5-VI-wt, lane 1) and Ad with PPSY in protein VI mutated to PGAA (Ad5-VI-M1, lane 2). Individual capsid
proteins are shown on the left. Right panel; western blot analysis of protein VI for Ad5-VI-wt (lane 1) and Ad5-VI-M1 (lane 2). B) Negative stain of PLoS Pathogens | www.plospathogens.org March 2010 | Volume 6 | Issue 3 | e1000808 March 2010 | Volume 6 | Issue 3 | e1000808 4 PPxY Motif Facilitates Adenovirus Entry PPxY Motif Facilitates Adenovirus Entry purified Ad capsids. Electronic microscopy images of purified Ad5-VI-wt capsids (left panel) and purified Ad5-VI-M1 (right panel) are shown. The inset
in each figure shows a magnification of individual capsids. Ad5 protein VI encodes a conserved PPxY motif
determining viral infectivity In summary these
data suggest that the PPxY motif in protein VI is required for
proper uncoating and normal nuclear targeting. )
q
p
To address trafficking using a different approach, we inserted a
GFP expression cassette into the FRT site in the E1-deleted region
of the wt and the M1 mutant virus (see Figure S3 for details). The
GFP expressing viruses showed no difference in the quantitative
yield and biochemical composition after large-scale purification. We repeated plaque forming assays (Figure 2E) and single round
infection assays (Figure 2F), this time using GFP expression as the
quantification method in non-complementing U2OS cells. We
observed a reduction in infectivity in the same order of magnitude
as previously (compare Figures 2C with 2E and 2D with 2F). In
addition the GFP expression allowed us to follow the plaque
formation over time. As shown in Figure S4 the spread of the M1
mutant virus was significantly slower and led to fewer and much
smaller plaques (Figure 2E and Figure S4). Next we asked whether Ad5 endosomal lysis efficiency following
internalization is affected by the mutation in the PPxY motif of
protein VI. We infected A549 cells with 30, 300 or 3000 particles
per cell of either Ad5-VI-wt or Ad5-VI-M1 in the presence of
alpha-sarcin,
a membrane
impermeable
toxin
that
inhibits
translation when it enters the cytoplasm. Alpha-sarcin enters the
cell by virus-mediated endosomal membrane lysis thus providing a
quantifiable marker for endsome membrane lysis (Figure 2G,
[28]). We measured the incorporation of radiolabeled amino acids
over time as a means to determine translational efficiency. As
control we used the temperature sensitive Ad mutant Ad2ts1 that is
closely related to Ad5. Ad2ts1 mutants poorly lyse the endosomal
membrane when the virus is grown at non-permissive tempera-
tures due to an increased capsid stability that lacks intra-
endosomal disassembly. Ad2ts1 mutants grown at permissive PLoS Pathogens | www.plospathogens.org Intracellular dynamics of protein VI depend on the PPxY
motif and microtubules Due to the strong overlap of the signals 45 min af
infection at the MTOC region for the wt, colocalization is given as an approximate value. Right panel; Intracellular localization of protein VI a
capsids 45 min after infection. The panel shows Alexa488 labeled Ad5-VI-wt (top panel) or Ad5-VI-M1 (bottom panel) capsids in green and protein
detected with protein VI specific antibodies in red 45 min after infection of U2OS cells. Colocalization of protein VI and the capsid appear as yello
The scale bar is 10 mm. B) Ad-VI-M1 has a reduced MTOC accumulation. Left panel; Cells were infected with fluorescently labeled Ad5-VI-wt (top
Ad5-VI-M1 (bottom). Subcellular localization in a representative cell is shown after 45 min. The scale bar is 10 mm. A quantification of the MT
localization is shown to the right. Cells were synchronous infected with Alexa488 labeled Ad5-VI-wt or Ad5-VI-M1 respectively after preadsorption
the cold. 45 min post infection cells were fixed and stained for the MTOC using a rabbit anti-pericentrin antibody. To quantify the targeting of
virus towards the MTOC, confocal 0.4 mm sections were taken around the MTOC stain (,3–5 sections), and combined using maximum ima Figure 3. Adenovirus with altered PPxY motif lacks efficient protein VI release and shows reduced MTOC accumulation. A) Protein VI
release from Ad5-VI-wt vs. Ad5-VI-M1 particles. Left panel; Shown is the percentage of viral particles that are positive for protein VI co-stain (+/2
standard deviation) at different time points. Over 700 particles were counted for each condition. Due to the strong overlap of the signals 45 min after
infection at the MTOC region for the wt, colocalization is given as an approximate value. Right panel; Intracellular localization of protein VI and
capsids 45 min after infection. The panel shows Alexa488 labeled Ad5-VI-wt (top panel) or Ad5-VI-M1 (bottom panel) capsids in green and protein VI
detected with protein VI specific antibodies in red 45 min after infection of U2OS cells. Colocalization of protein VI and the capsid appear as yellow. The scale bar is 10 mm. B) Ad-VI-M1 has a reduced MTOC accumulation. Left panel; Cells were infected with fluorescently labeled Ad5-VI-wt (top) or
Ad5-VI-M1 (bottom). Subcellular localization in a representative cell is shown after 45 min. The scale bar is 10 mm. A quantification of the MTOC
localization is shown to the right. Intracellular dynamics of protein VI depend on the PPxY
motif and microtubules To understand the accumulation defect of Ad5-VI-M1 at the
MTOC, we expressed wt (VI-wt), mutant (VI-M1) and protein VI
deleted in the amphipathic helix (VI-DW) fused to mRFP in cells
and analyzed protein VI localization in relation to microtubules
(Figure 4). We found VI-wt in a punctuated distribution
throughout the cell suggesting association with a vesicular
compartment
or
tubulo-vesicular
structures
associated
with
microtubules (Figure 4, top row). In contrast, the PPxY motif
mutant VI-M1 localized to a more central compartment and was
rarely associated with the microtubules (Figure 4, middle row). Deletion
of
the
amphipathic
helix,
in
contrast,
abrogated March 2010 | Volume 6 | Issue 3 | e1000808 5 PPxY Motif Facilitates Adenovirus Entry gure 3. Adenovirus with altered PPxY motif lacks efficient protein VI release and shows reduced MTOC accumulation. A) Prot
ease from Ad5-VI-wt vs. Ad5-VI-M1 particles. Left panel; Shown is the percentage of viral particles that are positive for protein VI co-stain
ndard deviation) at different time points. Over 700 particles were counted for each condition. Due to the strong overlap of the signals 45 min
ection at the MTOC region for the wt, colocalization is given as an approximate value. Right panel; Intracellular localization of protein V
psids 45 min after infection. The panel shows Alexa488 labeled Ad5-VI-wt (top panel) or Ad5-VI-M1 (bottom panel) capsids in green and prote
ected with protein VI specific antibodies in red 45 min after infection of U2OS cells. Colocalization of protein VI and the capsid appear as ye
e scale bar is 10 mm. B) Ad-VI-M1 has a reduced MTOC accumulation. Left panel; Cells were infected with fluorescently labeled Ad5-VI-wt (to
5-VI-M1 (bottom). Subcellular localization in a representative cell is shown after 45 min. The scale bar is 10 mm. A quantification of the M
alization is shown to the right. Cells were synchronous infected with Alexa488 labeled Ad5-VI-wt or Ad5-VI-M1 respectively after preadsorpti
cold. 45 min post infection cells were fixed and stained for the MTOC using a rabbit anti-pericentrin antibody. To quantify the targeting o Figure 3. Adenovirus with altered PPxY motif lacks efficient protein VI release and shows reduced MTOC accumulation. A) Protein
release from Ad5-VI-wt vs. Ad5-VI-M1 particles. Left panel; Shown is the percentage of viral particles that are positive for protein VI co-stain (+
standard deviation) at different time points. Over 700 particles were counted for each condition. PLoS Pathogens | www.plospathogens.org Intracellular dynamics of protein VI depend on the PPxY
motif and microtubules Cells were synchronous infected with Alexa488 labeled Ad5-VI-wt or Ad5-VI-M1 respectively after preadsorption in
the cold. 45 min post infection cells were fixed and stained for the MTOC using a rabbit anti-pericentrin antibody. To quantify the targeting of the
virus towards the MTOC, confocal 0.4 mm sections were taken around the MTOC stain (,3–5 sections), and combined using maximum image PLoS Pathogens | www.plospathogens.org March 2010 | Volume 6 | Issue 3 | e1000808 6 PPxY Motif Facilitates Adenovirus Entry projection. Two concentric circles with 10 mm and 20 mm in diameter were positioned around the MTOC as shown in the left panel. Virus particles
were then counted inside the 10 mm radius and in the region between 10–20 mm. The graph to the right shows the relative abundance within the
two regions. Distribution for the wild type virus is shown on the left of the graph and for the PPxY mutated virus to the right. The analysis shows that
mutated particles are less likely to accumulate at the MTOC then wt particles. The error bar represents cell-to-cell variation (n.15, p,0.05). doi:10.1371/journal.ppat.1000808.g003 We asked whether VI-M1 showed only plus-end microtubule
directed movement. We applied nocodazole to VI-M1 transfected
cells, followed by washout of nocodazole. During treatment and
after removal of nocodazole no movement or relocalization
towards the cell center was observed for VI-M1. In contrast VI-
wt rapidly stopped and restarted bidirectional movement under
these conditions (data not shown). Together these data suggested
that protein VI is a highly mobile protein that moves along
microtubules, presumably in association with vesicular structures
whose motion depends on the PPxY motif. membrane association, causing nuclear targeting of protein VI and
redistribution of protein VI from membrane fractions into soluble
fractions ([37], and Figure 4 bottom row, data not shown). membrane association, causing nuclear targeting of protein VI and
redistribution of protein VI from membrane fractions into soluble
fractions ([37], and Figure 4 bottom row, data not shown). Owing to its association with membranes, microtubules and the viral
capsid, we next asked whether protein VI displayed intracellular
dynamics that could explain virus trafficking. We therefore performed
live-cell imaging (LCI) using cells expressing mRFP-VI-wt or mRFP-
VI-M1. We found that VI-wt was fast moving with short- and long-
range movements whereas VI-M1 was essentially motionless (Figure 5A
and Video S1). The length of the trajectories and the movement of
.300 particles were plotted (Figure 5B). Intracellular dynamics of protein VI depend on the PPxY
motif and microtubules We found that protein VI-M1
motility was greatly reduced compared to protein VI-wt. We next
asked whether VI-wt motility depends on intact microtubules and/or
actin filaments. Disrupting actin filaments with cytochalasin B had no
apparent effect on VI-wt localization or motility (Figure 5B, right panel)
suggesting that actin was not involved in the movement. In contrast,
protein VI motility in nocodazole-treated cells was strongly reduced
resembling the reduced motion observed for the M1 mutant (Figure 5B,
right panel, see also Video S2 in the supporting information). PPxY motif is essential for protein VI ubiquitylation upon
partial Ad disassembly PPxY domains are the physiological targets of ubiquitin ligases
of the Nedd4 family [16]. Therefore we asked whether protein VI
ubiquitylation depends on the PPxY motif. We adapted an in vitro
Ad disassembly assay mimicking the partial capsid disassembly
believed to occur during Ad entry by exposing virions to 48uC. Figure 4. Subcellular localization of protein VI. U2OS cells were transfected with protein VI fused to mRFP, either using wt protein VI (VI-wt, top
row), with mutated protein VI (VI-M1, middle row) or with deleted amphipathic helix (VI-DW, bottom row). Cells were co-stained for microtubules. The
protein VI-signal is shown in the left column, the microtubule stain is shown in the second column and an overlay of the signals is shown in the third
column. Protein VI fusions appear in red, microtubules in green and the nucleus in blue. The right column shows the field of cells from which the
insets (small white square) was taken. The scale bar is 10 mm, Please note that the lower panel is a higher magnification. Association of protein VI with
microtubules in tubulo-vesicular structures is indicated by arrows in the top row. Further examples of tubulo-vesicular structures can also be seen in
Video S1 showing life-cell imaging of VI-wt transfected cells. doi:10.1371/journal.ppat.1000808.g004 Figure 4. Subcellular localization of protein VI. U2OS cells were transfected with protein VI fused to mRFP, either using wt protein VI (VI-wt, top
row), with mutated protein VI (VI-M1, middle row) or with deleted amphipathic helix (VI-DW, bottom row). Cells were co-stained for microtubules. The
protein VI-signal is shown in the left column, the microtubule stain is shown in the second column and an overlay of the signals is shown in the third
column. Protein VI fusions appear in red, microtubules in green and the nucleus in blue. The right column shows the field of cells from which the
insets (small white square) was taken. The scale bar is 10 mm, Please note that the lower panel is a higher magnification. Association of protein VI with
microtubules in tubulo-vesicular structures is indicated by arrows in the top row. Further examples of tubulo-vesicular structures can also be seen in
Video S1 showing life-cell imaging of VI-wt transfected cells. doi:10.1371/journal.ppat.1000808.g004 PLoS Pathogens | www.plospathogens.org PLoS Pathogens | www.plospathogens.org March 2010 | Volume 6 | Issue 3 | e1000808 7 PPxY Motif Facilitates Adenovirus Entry Figure 5. Subcellular dynamics of protein VI. PPxY motif is essential for protein VI ubiquitylation upon
partial Ad disassembly A) U2OS cells were transfected with VI-wt (top row) or VI-M1 (bottom row) fused to mRFP an
analyzed by live-cell imaging. Frames were taken at 1 sec intervals using a Cascade 512B 2 camera. The left image in all rows shows maximum imag
projections of the full frame depicting the cell with scale bar of 10 mm. The four inverted images to the right show magnifications from the boxe
inset of four consecutive frames (in the case of VI-wt) and every fifths frame (in the case of VI-M1). In the top panel a moving particle is depicted by
grey arrow within each frame using the departure point depicted by a white arrow as reference. The lower panel shows VI-M1 not moving. B) Analys
of trajectory length and relative particle speed of VI-wt or VI-M1 (left side of both panels) or trajectory length and relative particle speed of VI-w
using drugs as indicated (right side of both panels). Movies were processed and all recorded trajectories were analyzed for length and relative spee
using the ImarisTM software package. Individual particles were plotted for length of trajectories (in mm, left panel) and the net movement (in mm
20sec, right panel) under the conditions tested (indicated below each chart). Significant differences are indicated by bars. doi:10.1371/journal.ppat.1000808.g005 Figure 5. Subcellular dynamics of protein VI. A) U2OS cells were transfected with VI-wt (top row) or VI-M1 (bottom row) fused to mRFP and
analyzed by live-cell imaging. Frames were taken at 1 sec intervals using a Cascade 512B 2 camera. The left image in all rows shows maximum image
projections of the full frame depicting the cell with scale bar of 10 mm. The four inverted images to the right show magnifications from the boxed
inset of four consecutive frames (in the case of VI-wt) and every fifths frame (in the case of VI-M1). In the top panel a moving particle is depicted by a
grey arrow within each frame using the departure point depicted by a white arrow as reference. The lower panel shows VI-M1 not moving. B) Analysis
of trajectory length and relative particle speed of VI-wt or VI-M1 (left side of both panels) or trajectory length and relative particle speed of VI-wt
using drugs as indicated (right side of both panels). Movies were processed and all recorded trajectories were analyzed for length and relative speed
using the ImarisTM software package. PLoS Pathogens | www.plospathogens.org March 2010 | Volume 6 | Issue 3 | e1000808 Protein VI binds to Nedd4 ligases via the PPxY motif Protein VI binds to Nedd4 ligases via the PPxY motif
To identify the ligase responsible for protein VI ubiquitylation,
we focused on the Nedd4-family members Nedd4.1, Nedd4.2,
AIP4/Itch, WWP1 and WWP2 because they can interact with
viral late domains that harbor PPxY motifs [38]. We first co-
expressed the VI-wt or VI-M1 mRFP fusion protein together with
each of the E3 ligases fused to GFP in U2OS cells. When
expressed alone, most ligases localized primarily to the cytoplasm
(data not shown, WWP1 localized to the plasma membrane and
WWP2 accumulated in an uncharacterized intracellular mem-
brane compartment). In contrast, when VI-wt is coexpressed with
Nedd4.1, Nedd4.2 or AIP4/Itch, the ligases are recruited to the
same membrane compartment as protein VI (Figure 7A, row 1–3). WWP1 appears to sequester protein VI at the plasma membrane
(Figure 7A, row 4). WWP2 does not colocalize with VI-wt
(Figure 7A, row 5). We did not detect significant colocalization
between VI-M1 and the E3 ligases, consistent with a PPxY-
dependent interaction (Figure S6). To determine whether any of the ligases specifically interact
with protein VI, we used purified cytosol from cells overexpressing
GFP-tagged ligases and performed pull-downs with beads coated
with recombinant protein VI-wt or VI-M1. Two ligases, Nedd4.1
and Nedd4.2, were highly enriched on VI-wt beads while none of
the other ligases showed strong binding to VI-wt- or to VI-M1-
beads
(Figure
7B). Taken
together,
these
data
suggest
a
preferential interaction between Nedd4.1 and Nedd4.2 and the
PPxY motif in protein VI, which leads to relocalization of the
ligases from the cytoplasm to a membrane compartment. PPxY motif is essential for protein VI ubiquitylation upon
partial Ad disassembly Individual particles were plotted for length of trajectories (in mm, left panel) and the net movement (in mm/
20sec, right panel) under the conditions tested (indicated below each chart). Significant differences are indicated by bars. doi:10.1371/journal.ppat.1000808.g005 and protein IIIA (which lack PPxY motifs) were not modified
(Figure S5). The ubiquitylation of protein VI was also confirmed
by using GST-ubiquitin in the above assay, followed by GST-
pulldown to show covalent modification of protein VI with
ubiquitin confirming the predominant modification with two to
three ubiquitin-moieties (data not shown). This assay dissociates the vertices including fiber, penton, protein
VI and peripentonal hexons, but leaves the remainder of the
capsid intact (Figure S5; [28]). Heat and mock-treated samples
were subjected to in vitro ubiquitylation reactions, using free
ubiquitin, recombinant E1 and E2 enzymes and purified cytosol as
source for the E3 ubiquitin ligase(s), and analyzed by western blot
(Figure 6, [28]). Western blot analysis showed that partial capsid
disassembly resulted in the appearance of protein VI reactive
signals with discrete size increments suggesting predominant
modification with two to three ubiquitin as well as some higher
molecular weight bands (lane 2, Figure 6A). In contrast, the lack of
capsid disassembly (lane 1) or cytosol (lane 3) showed no additional
protein VI reactive bands. We also tested ubiquitylation of the
capsid proteins fiber, protein IIIA and penton base as internal
control. We only detected ubiquitylation of the penton base (which
also harbors two PPxY domains at its N-terminus), while the fiber To address the role of the PPxY motif in protein VI
ubiquitylation, we repeated the in vitro ubiquitylation assay using
wt or M1 mutant protein VI purified from E. coli followed by
western blot analysis. We detected protein VI-reactive bands,
consistent with protein VI modified with two to three ubiquitin
(Figure 6B, lane 2). In contrast, no modification was observed
when the PPxY motif was mutated (Figure 6B, lane 1) or in the
absence of ATP (Figure 6B, lane 3 and 4). Using viral particles in
in vitro ubiquitylation reactions (following partial capsid disassem-
bly) protein VI of Ad5-VI-M1 was not ubiquitylated (Figure 6C, PLoS Pathogens PLoS Pathogens | www.plospathogens.org March 2010 | Volume 6 | Issue 3 | e1000808 8 PPxY Motif Facilitates Adenovirus Entry Figure 6. Protein VI is ubiquitylated following capsid d
sembly. Nedd4 ligases ubiquitylate protein VI via the PPxY and
reduce Ad transduction and MTOC accumulation reduce Ad transduction and MTOC accumulation
To further characterize the interaction between protein VI and
the ligases, we knocked down Nedd4.1, Nedd4.2, AIP4/Itch,
WWP1 and WWP2 using siRNAs (Figure 8A). The cells were then
incubated with an Ad5 vector harboring a GFP expression cassette
(AdGFP) at a low multiplicity of infection (30 physical particles per
cell) for 3 h to achieve approximately 20% transduced cells and
limit the time of virus exposure. The following day the percentage
of GFP-positive cells was quantified by flow cytometry. Most ligase
knockdowns had no significant effects on transduction, but
Nedd4.2 knockdown diminished transduction by 50% (Figure 8A). Because Nedd4.2 showed the strongest effect on Ad transduc-
tion we determined whether bacterially expressed and purified
Nedd4.2 could ubiquitylate purified protein VI in vitro. A minimal
system where cytosol was replaced by recombinant Nedd4.2 was
sufficient for protein VI ubiquitylation (Figure 8B, lane 1). The
ubiquitylation pattern was similar to that obtained with cytosol To further characterize the interaction between protein VI and
the ligases, we knocked down Nedd4.1, Nedd4.2, AIP4/Itch,
WWP1 and WWP2 using siRNAs (Figure 8A). The cells were then
incubated with an Ad5 vector harboring a GFP expression cassette
(AdGFP) at a low multiplicity of infection (30 physical particles per
cell) for 3 h to achieve approximately 20% transduced cells and
limit the time of virus exposure. The following day the percentage
of GFP-positive cells was quantified by flow cytometry. Most ligase
knockdowns had no significant effects on transduction, but
Nedd4.2 knockdown diminished transduction by 50% (Figure 8A). Figure 6. Protein VI is ubiquitylated following capsid disas-
sembly. A) Purified Ad5 particles where used in in vitro ubiquitylation
reactions, using ubiquitin, recombinant E1 and E2, an energy
regenerating system and purified cytosol as source of the E3-ligase,
and analyzed by western blot using antibodies against protein VI. Partial disassembly was induced by heat (lane 2 and 3). Cytosol was
added to the reactions in lane 1 and lane 2. Protein VI-reactive bands
are indicated by the black arrow and modified protein VI is indicated by
grey arrows. B) Reactions as in A) using bacterially expressed protein VI-
wt (lane 1 and 2) or VI-M1 (lane 3 and 4) with or without energy
regenerating system as indicated (ATP). PPxY motif is essential for protein VI ubiquitylation upon
partial Ad disassembly Protein VI-reactive bands
are indicated by the black arrow and modified protein VI is indicated by
grey arrows. B) Reactions as in A) using bacterially expressed protein VI-
wt (lane 1 and 2) or VI-M1 (lane 3 and 4) with or without energy
regenerating system as indicated (ATP). Western blot analysis using March 2010 | Volume 6 | Issue 3 | e1000808 PPxY motif is essential for protein VI ubiquitylation upon
partial Ad disassembly A) Purified Ad5 particles where used in in vitro ubiquity
reactions, using ubiquitin, recombinant E1 and E2, an e
regenerating system and purified cytosol as source of the E3-l
and analyzed by western blot using antibodies against prote
Partial disassembly was induced by heat (lane 2 and 3). Cytoso
added to the reactions in lane 1 and lane 2. Protein VI-reactive b
are indicated by the black arrow and modified protein VI is indicat
grey arrows. B) Reactions as in A) using bacterially expressed prote
wt (lane 1 and 2) or VI-M1 (lane 3 and 4) with or without e anti-protein VI antibodies is shown with ubiquitylated proteins marked
with grey arrows (VI-Ubi) and unmodified protein VI (VI) is marked with
a black arrow. C) Reactions as in A) followed by detection of protein VI
by western blot using Ad5-VI-wt (lane 1 and 2) and Ad5-VI-M1 capsids
(lane 3 and 4). Disassembly of capsids is indicated above each lane and
protein VI reactive bands are marked as in B to the right. doi:10.1371/journal.ppat.1000808.g006 anti-protein VI antibodies is shown with ubiquitylated proteins marked
with grey arrows (VI-Ubi) and unmodified protein VI (VI) is marked with
a black arrow. C) Reactions as in A) followed by detection of protein VI
by western blot using Ad5-VI-wt (lane 1 and 2) and Ad5-VI-M1 capsids
(lane 3 and 4). Disassembly of capsids is indicated above each lane and
protein VI reactive bands are marked as in B to the right. doi:10.1371/journal.ppat.1000808.g006 lane 3 and 4), while protein VI from Ad5-VI-wt was (Figure 6C,
lane 1 and 2). Thus, the PPxY motif in protein VI is inaccessible in
intact capsids but can recruit ubiquitin ligase activity from cytosol
when protein VI is released from the capsid interior. Together our
results show that protein VI ubiquitylation depends on i) virus
disassembly, ii) an intact PPxY domain and iii) the presence of a
cytosolic ubiquitylation activity. Figure 6. Protein VI is ubiquitylated following capsid disas-
sembly. A) Purified Ad5 particles where used in in vitro ubiquitylation
reactions, using ubiquitin, recombinant E1 and E2, an energy
regenerating system and purified cytosol as source of the E3-ligase,
and analyzed by western blot using antibodies against protein VI. Partial disassembly was induced by heat (lane 2 and 3). Cytosol was
added to the reactions in lane 1 and lane 2. Nedd4 ligases ubiquitylate protein VI via the PPxY and
reduce Ad transduction and MTOC accumulation Inactivation of the PPxY in the
viral context (Ad5-VI-M1) resulted in a post-entry delay that
reduced infectivity and prevented efficient accumulation of the
entering virus particles at the MTOC. While we cannot exclude
the possibility that the PPxY motif in protein VI also plays a role in
adenoviral replication, assembly or egress, our single round
infection assays showed that the majority of the titer reduction
for the mutant was related to steps prior to the initiation of
replication or the delivery and expression of a reporter gene. Moreover, our data show that the efficiency with which a toxin is
delivered to the cytosol during Ad infection is similar for mutant
and wt virus. This provides strong evidence that the PPSY motif in
protein VI has a function during cell entry, but probably only after
endosomal membrane lysis has occurred. Current structural data
place protein VI inside the assembled capsid, therefore potentially
precluding it from functions during egress at least when capsid
associated [43–45]. Our observations show that protein VI is
exposed after entry and that capsid disassembly is required for its
ubiquitylation, which is consistent with our hypothesis that the
PPxY motif is accessible only during Ad entry following partial
capsid disassembly. Furthermore, it is currently not clear whether
late domains containing PPxY motifs present in other viral
systems, which are required for viral egress, have additional
functions. Mutational inactivation of PPxY motifs in the VP40
structural protein of Ebola virus and matrix protein of rabies virus
both showed an attenuation of the virus and a reduction of
infectivity [20,46]. Interestingly, for Ebola virus, the PPxY mutants
showed no budding defect, but virus production was reduced,
which could indicate a disruption earlier on in the life cycle than
previously thought [46]. For rabies virus, Wirblich et al. describe a A hallmark of Ad5 infection is its transient accumulation at the
MTOC during entry [5]. The mutation of the PPxY in the Ad5-
VI-M1 virus seemed to alter this localization (Figure 3). Similarly,
the PPxY motif was required for Nedd4.2 dependent ubiquityla-
tion of protein VI. Because knockdown of Nedd4 ligases also
diminished transduction with AdGFP vectors we examined
accumulation at the MTOC region in cells depleted with control
shRNA and Nedd4.1 and Nedd4.2 specific shRNAs. We used the
same strategy as in Figure 3 by quantifying viral particles in
proximity to the MTOC, which was identified by stain for
pericentrin. Nedd4 ligases ubiquitylate protein VI via the PPxY and
reduce Ad transduction and MTOC accumulation Later,
Wiethoff and co-workers showed that most membrane lytic
activity of Ad viral capsids comes from the predicted N-terminal
amphipathic helix of the internal capsid protein VI, and that
membrane lytic activity required partial capsid disassembly to
release protein VI [28]. Nedd4.1 and Nedd4.2 both showed strong interaction with
protein VI in pulldown assays. To further investigate the role of
each ligase we transduced cells with lentiviral vector expressing
shRNAs against either Nedd4.1 or Nedd4.2 or luciferase as a
control. We transduced cells in a dose-dependent manner to
achieve different levels of knockdown. Transduction efficiency was
monitored using a GFP expressing lentiviral vector in control cells. Seven days post-transduction shRNA treated cells were infected
with AdGFP virus as described above and the transduction rate
was determined by flow cytometry. We observed a dose-dependent
decrease in infectivity for two different shRNAs against Nedd4.2,
which was similar to what we observed when we used siRNAs
(Figure 8C). The results for shRNAs against Nedd4.1 were less
clear. One shRNA also reduced viral infection at very high
transduction rates but to a lesser extent than shRNAs against
Nedd4.2 while a second shRNA showed no effect on Ad
transduction (Figure 8C). A combined treatment of cells with
either siRNAs or shRNAs against Nedd4.1 and Nedd4.2 did not
further decrease Ad-transduction indicating that the effects of
Nedd4-ligase knockdowns on Ad transduction may be complex
(data not shown). Here we present several lines of evidence that protein VI plays
an additional and previously unidentified role in nuclear targeting
of the Ad capsid. We show that protein VI exposure from Ad5
capsids occurs within minutes when pre-adsorbed Ad5 is shifted
from 4uC to 37uC. This is consistent with the loss of the fiber prior
to internalization and the rapid accumulation of Ad5 in the cytosol
[41,42]. We found that significant amounts of protein VI remains
partially associated with the viral capsid after the initial exposure
and until the viral particle accumulates at the MTOC or the
nuclear rim. We show that protein VI is engaged in rapid intracellular
trafficking that depends on intact microtubules and requires the N-
terminal amphipathic helix for microtubule association and the
PPxY motif for motion. To our knowledge protein VI is the first
Ad capsid protein described that possesses its own microtubule-
dependent dynamics and future work has to address if other capsid
proteins have similar properties. Nedd4 ligases ubiquitylate protein VI via the PPxY and
reduce Ad transduction and MTOC accumulation Western blot analysis using Because Nedd4.2 showed the strongest effect on Ad transduc-
tion we determined whether bacterially expressed and purified
Nedd4.2 could ubiquitylate purified protein VI in vitro. A minimal
system where cytosol was replaced by recombinant Nedd4.2 was
sufficient for protein VI ubiquitylation (Figure 8B, lane 1). The
ubiquitylation pattern was similar to that obtained with cytosol March 2010 | Volume 6 | Issue 3 | e1000808 March 2010 | Volume 6 | Issue 3 | e1000808 PLoS Pathogens | www.plospathogens.org 9 PPxY Motif Facilitates Adenovirus Entry PLoS Pathogens | www.plospathogens.org
10
March 2010 | Volume 6 | Issue 3 | e1000808 PLoS Pathogens | www.plospathogens.org March 2010 | Volume 6 | Issue 3 | e1000808 10 PLoS Pathogens | www.plospathogens.org PPxY Motif Facilitates Adenovirus Entry PPxY Motif Facilitates Adenovirus Entry Figure 7. Protein VI interacts with Nedd4 ligases via the PPxY motif. A) Protein VI (VI-wt) was N-terminally fused to mRFP and co-transfected
with GFP-Nedd4.1 (first row), GFP-Nedd4.2 (second row), GFP-AIP4/Itch (third row), GFP-WWP1 (fourth row) and GFP-WWP2 (last row). Confocal
images of representative cells are shown and the mRFP signal for protein VI (left column), the GFP signal for the ligases (center column) and the
merged signals together with DAPI stain of the nucleus (right column) is indicated above each column. Transfected plasmids are indicated. Colocalization of Nedd4 and protein VI results in a yellow signal. The scale bar is 10mm. B) Diverse GFP-tagged Nedd4 ligases were over-expressed in
cells and cytosolic extracts were used for pulldown experiments using recombinant protein VI-wt or VI-M1 coupled to beads. 10% of the input
material (IP) is shown in the first lane. Bound material for protein VI-wt (lane 2) and VI-M1 (lane 3) was detected with respective antibodies as
indicated to the right. Co-eluted protein VI detected with a protein VI specific antibody is shown as loading control in the lower lane. doi:10.1371/journal.ppat.1000808.g007 (Figure 6) and required an intact PPxY and a catalytically active
Nedd4.2 (Figure 8B, lane 2 and 3). (Figure 6) and required an intact PPxY and a catalytically active
Nedd4.2 (Figure 8B, lane 2 and 3). thus precluding accumulation at the nuclear pore complex
[26,28,39]. The role of facilitating endosomal escape during Ad
entry was initially assigned to the penton base [40]. Nedd4 ligases ubiquitylate protein VI via the PPxY and
reduce Ad transduction and MTOC accumulation MTOC accumulation for Nedd4.1 and Nedd4.2
shRNA treated cells was reduced when compared to cells treated
with control shRNA indicating that both ligases might be involved
in proper targeting of viruses towards the MTOC (Figure 8D). In summary, these data provide evidence that release of protein
VI during entry and a possible interaction between the PPxY motif
of protein VI and Nedd4-family ligases are determinants of Ad5
trafficking during infection. PLoS Pathogens | www.plospathogens.org Discussion In this study we show that the Ads internal capsid protein VI
harbors a PPxY-motif that is involved in virus entry and infectivity. For Ads, reaching the nucleus requires a series of sequential steps:
receptor-mediated endocytic uptake, partial capsid disassembly,
endosomal rupture, microtubule based transport to the MTOC
and nuclear trafficking. The link between these steps has been best
exemplified in the case of the thermostable temperature-sensitive
mutant Ad2ts1. This mutant enters cells by receptor-mediated
endocytosis, but remains in an endosomal compartment due to
increased capsid stability. Therefore, Ad2ts1 particles are directed
to lysosomes for destruction and/or recycled back to the surface PLoS Pathogens | www.plospathogens.org March 2010 | Volume 6 | Issue 3 | e1000808 11 PPxY Motif Facilitates Adenovirus Entry PPxY Motif Facilitates Adenovirus Entry Figure 8. Nedd4.2 ubiquitylates protein VI and is required for efficient Ad transduction and MTOC accumulation. A) Effects of Ne
depletion on Ad transduction. U2OS cells were transfected with siRNAs specific for Nedd4.1, Nedd4.2, AIP4/Itch, WWP1 and WWP2 or scram
siRNAs. Western blot controls for depletion are shown to the left (except for WWP1 where depletion of transfected WWP1-GFP was detected u
GFP specific antibodies because no specific antibodies were available for detection of the endogenous protein). Following depletion, cells w
transduced with AdGFP. Relative GFP expression is shown. Statistical analysis was performed using pairwise comparison using the Mann & Whit
test showing significant reduction for Nedd4.2 depleted cells. B) In vitro ubiquitylation reaction using recombinant active Nedd4.2 (lane 1 and
inactive Nedd4.2 (lane 3). Recombinant VI-wt (lane 1 and 3) or VI-M1 (lane 2) was used as substrate. Modified protein VI (grey arrows) or unmod
protein VI (black arrows) was detected following western blot analysis. Antibodies are indicated to the left of each blot. C) Dose dependent deple
of Nedd4.2 and Nedd4.1. U2OS cells were transduced with increasing amounts of shRNA expressing lentiviral vectors achieving transduction leve
PLoS Pathogens | www plospathogens org
12
March 2010 | Volume 6 | Issue 3 | e1000 Figure 8. Nedd4.2 ubiquitylates protein VI and is required for efficient Ad transduction and MTOC accumulation. A) Effects of Nedd4
depletion on Ad transduction. U2OS cells were transfected with siRNAs specific for Nedd4.1, Nedd4.2, AIP4/Itch, WWP1 and WWP2 or scrambled
siRNAs. March 2010 | Volume 6 | Issue 3 | e1000808 PLoS Pathogens | www.plospathogens.org Discussion Because eliminating the PPxY motif
from protein VI had only modest effects on MTOC accumulation,
there may be functional overlap between the PPxY in protein VI
and penton base. This is further supported by the observation that
ubiquitylation of penton could be abolished by depleting the
cytosol with protein VI indicating that maybe the same ligases are
involved (Figure S5). Earlier studies have shown that PPxY type late domains bind to
ubiquitin ligases of the Nedd4 family rather then directly to class E
VSP proteins [13]. Our study showed that the PPxY motif in
protein VI can interact with all Nedd4 ligases tested but
preferentially binds to Nedd4.1 and Nedd4.2 and re-targets them
to membranes. Owing to topological constrains, recognition of the
PPxY domain should require membrane rupture because of the
cytosolic localization of Nedd4 ligases, which according to our
data does not seem to be affected by the PPxY mutation in the M1
virus. In conclusion, our study is the first demonstration of a PPxY
motif, previously described for viral late domains, present in a non
enveloped DNA virus that exerts a function during entry. Conservation of the amphipathic helix and PPxY motif in all
Mastadenovirus suggests that protein VI fulfils a key function. We
suggest that after endocytosis cell or serotype specific capsid
disassembly cues regulate exposure, membrane-interaction and
ubiquitylation of protein VI (and possibly other capsid proteins). This could facilitate the recruitment of a common cellular
microtubule-dependent pathway for retrograde trafficking. This
mechanism could be more important in vivo in highly polarized
epithelia or neurons where long-range movement is crucial and
might be less important in cell culture models [50]. Given the
prevalence of viral late domains, ubiquitylation and trafficking
towards the MTOC our results may have uncovered a more general
mechanism by which viruses and other cargos achieve intracellular
delivery and provide a rational to look for further ‘‘early’’ functions
of PPxY motif containing late-domains in other viral systems. The PPxY motif in protein VI seems to favor interaction with
Nedd4.1 and Nedd4.2 although we observed interactions with
AIP4/Itch and WWP1 as well. It is possible that an interaction
between protein VI and WWP1, as we observe in transient
transfections, is circumvented by exposure of the PPxY domain
after the virus has entered the endosomal compartment. Discussion Western blot controls for depletion are shown to the left (except for WWP1 where depletion of transfected WWP1-GFP was detected using
GFP specific antibodies because no specific antibodies were available for detection of the endogenous protein). Following depletion, cells were
transduced with AdGFP. Relative GFP expression is shown. Statistical analysis was performed using pairwise comparison using the Mann & Whitney-
test showing significant reduction for Nedd4.2 depleted cells. B) In vitro ubiquitylation reaction using recombinant active Nedd4.2 (lane 1 and 2) or
inactive Nedd4.2 (lane 3). Recombinant VI-wt (lane 1 and 3) or VI-M1 (lane 2) was used as substrate. Modified protein VI (grey arrows) or unmodified
protein VI (black arrows) was detected following western blot analysis. Antibodies are indicated to the left of each blot. C) Dose dependent depletion
of Nedd4.2 and Nedd4.1. U2OS cells were transduced with increasing amounts of shRNA expressing lentiviral vectors achieving transduction levels as PLoS Pathogens | www.plospathogens.org March 2010 | Volume 6 | Issue 3 | e1000808 12 PPxY Motif Facilitates Adenovirus Entry PPxY Motif Facilitates Adenovirus Entry indicated (from 25–100%) and transduced with AdGFP. GFP expression levels were determined 24 h later using flow cytometry. GFP expression levels
within each condition were normalized to transduction controls of cells treated with shRNA expressing lentiviral vectors against luciferase (arbitrarily
set to 1). Values are the mean (+/2 standard deviation) of at least two experiments done in triplicates D) Accumulation of Ad at the MTOC region
following Nedd4 depletion. Fluorescently labeled Ad was used to infect cells following control depletions (shLuc) or depletion of Nedd4.1 or Nedd4.2
using (sh4.1 (1) and sh4.2 (1) as in C). Subcellular localization of viral particles was determined at 45 min. post infections. Cells were fixed and stained
for the MTOC using a pericentrin antibody. Particles were counted and scored for their relative proximity to the MTOC using two concentric circles
with 10 and 20 mm diameter around the MTOC (compare also Figure 3). The graph shows percentage of viral particles within 10mm or 10–20 mm
proximity to the MTOC as indicated. Note that in Nedd4.1 and Nedd4.2 depleted cells the relation is inverted compared to control depleted cells
showing less viral particles accumulating at the MTOC. The error bar represents cell-to-cell variation (n.15, p,0.05). doi:10.1371/journal.ppat.1000808.g008 budding defect of the late-domain mutant but also noted a
reduction of early mRNA production [20]. encodes PPxY motifs [49]. Discussion A role for
Nedd4.1 or Nedd4.2 in Ad entry is underscored by our
observation that Nedd4.2 can directly ubiquitylate protein VI
via the PPxY motif and its depletion (and to a lesser extent also
depletion of Nedd4.1) reduces Ad transduction. In addition this
depletion also reduced MTOC accumulation of viral particles
following infection, which is similar to the effect of the PPxY
mutation in the M1 virus. However the effects were modest,
indicating that additional mechanisms contribute to Ad entry. Further studies will be needed to identify a specific role for each
ligase in Ad entry and trafficking towards the MTOC and to
determine whether other ligases like AIP4/Itch and WWP1 are
involved. PLoS Pathogens | www.plospathogens.org Cell lines, cell culture and virus production Cell lines, cell culture and virus production
Immunofluorescence experiments and infection experiments
were performed using U2OS cells (human bone osteosarcoma
epithelial cells), hTERT-RPE1 cells (human retina epithelia
pigment cells, Clontech) or A549 cells (human alveolar basic cells). Cytoplasmic extracts for pulldowns were prepared from 293T cells
(human embryonic kidney cells). All cells except hTERT-RPE were
grown in DMEM GlutamaxTM (Gibco) supplemented with 10% of
fetal calf serum (FCS) (Biowest). hTERT-RPE1 cells were a kind gift
from M. Bonhivers (University of Bordeaux 2) and grown in
DMEM/HamsF12 media supplemented with 10% FCS according
to the suppliers instructions. Prior to infection experiments, cells
were serum starved for 24h to induce primary cilia growth [32]. Recombinant Ad5-VI-wt and Ad5-VI-M1 viruses and their GFP
expressing counterparts were constructed as described in the
supplemental material. Amplification of viruses was done in 293
cells and purified using double CsCl2-banding. Virus particle to cell
ratios were calculated based on the estimated copy numbers of viral
genomes. Copy numbers were calculated according to Mittereder et
al. [51]. Briefly, purified particles were diluted 1:10 in virus lysis
buffer (0.1% SDS, 10 mM Tris/HCl pH 7.4, 1 mM EDTA) and
incubated for 10 min at 56uC to release the viral genomes and the
OD260
was
determined. Calculations
were
based
on
1
OD260 = 1.161012 particles/ml [51] . How ubiquitylation of protein VI or interaction with Nedd4
ligases directs accumulation of Ads at MTOCs remains unknown. Ubiquitylated protein VI could be specifically recognized by
cellular factors. Alternatively, recruitment of Nedd4.1 and/or
Nedd4.2 by protein VI could result in the ubiquitylation of other
cellular factors that constitute an efficient transport means used by
the virus. Recent work has shown that some members of ESCRT-I
become ubiquitylated when Nedd4.2 is overexpressed [18,19]. Therefore, it is possible that Nedd4.2 (or other Nedd4-ligases)
binding to protein VI could activate the ESCRT pathway via
ubiquitylation. Whether membrane compartments or the ESCRT
pathway plays a direct role in Ad virus transport during entry
remains to be addressed. However, ESCRT components can be
found at the endosomal compartments as well as associated with
the centromeric region [47]. It is noteworthy that endosomal
escape is also required for interferon induction by Ad via yet
unknown mechanisms [48]. This pathway may also be related to
protein interaction between protein VI and Nedd4-family ligases. Release and separation of protein VI from the capsid is clearly
defective in the Ad5-VI-M1 mutant virus. Plasmids, siRNA All sequences for protein VI were derived from Ad serotype 5
(Ad5) and cloned into the GatewayTM compatible entry vector
pDONR221. Sequence verified DONR plasmids were used for
recombination into GatewayTM compatible destination vectors for
N-terminal fusion of mRFP (L30-mRFP, kindly provided by E. Bertrand). Bacterial expression vectors for protein VI are based on
pET15b. Site-directed mutagenesis was used to change amino
acids 148-PPSY-151 to 148-PGAA-151 in protein VI. N-terminal
tagged expression vectors for Nedd4.1, and Nedd4.2 were
provided by E. Bertrand [52] and tagged expression vectors for
AIP4/Itch and WWP1 were a kind gift of Paul Bieniasz
(Rockefeller University, New York). Bacterial expression vectors
for catalytically active murine GST-Nedd4.2 and the inactive
GST-Nedd4.2-DN was kindly provided by S. Kumar [53]. Microscopy and image analysis py
g
y
Confocal pictures were taken on a Zeiss LSM 510 Meta
confocal microscope or a Leica SP5 confocal microscope and
epifluorescence pictures were taken on a Zeiss Axiolmager Z1
microscope with CoolSnap HQ Photometrics camera both
equipped with MetamorphTM software. Confocal stacks where
taken every 0.5 mm with a pinhole setting of 1 for all channels to
achieve high local resolution. Images were processed using ImageJ
and
Adobe PhotoshopTM. Counting
of viral
particles was
performed using the semi-automated cell counting tool from
ImageJ. Colocalization analysis: Stacks from confocal images where
combined as Z-projection using maximum intensity, converted
into 8-bit images for each channel. Colocalization between protein
VI and Ad was then determined using the colocalization finder
plugin from ImageJ. Live-Cell Imaging: U2OS cells were seeded in Analysis of membrane penetration (Sarcin assay) A549 lung epithelial cells were plated in 96-well plates at a
density of 10,000 cells/well on the day before infection. The cells
were washed once with DMEM without cysteine or methionine
and
supplemented,
2 mM
glutamine,
10%
dialyzed
FCS,
penicillin and streptomycin (DMEM-SA) and infected with the
respective viruses in 50 ml DMEM-SA containing 0.1 mg/well a-
sarcin (Sigma). The infected cells were incubated 30 min at 4uC to
facilitate virus attachment and 90 min at 37uC to facilitate virus
internalization. After this 50 ml of DMEM-SA containing 0.1 mCi
of [35S]L-methionine (Hartmann Analytic) was added to each well
and the cells were incubated for an additional 60 min at 37uC for
labeling. The cells were then washed with 100 ml PBS and
extracted in 150 ml lyses buffer containing 1% Triton-X100,
150 mM NaCl, 10 mM MgCl2, 20 mM Tris-HCl (pH 7.5)
supplemented with 16 CompleteTM protease inhibitor cocktail
(Roche). The lysates were clarified by centrifugation at 20,000 g
for 12 min. To remove the residual [35S]L-methionine, 100 ml
cleared lysates were further purified with Zeba Desalt Spin
Columns (Pierce). The incorporation [35S]L-methionine into the
extracted fraction of newly synthesized proteins was measured by
liquid scintillation using TRI-CARB 1900CA counter (Packard). Cell lines, cell culture and virus production A lack of functional
PPxY may therefore block disassembly steps, preclude efficient
endosomal escape following the membrane lysis event or fail in the
recruitment of subsequent factors required to efficiently link the
virus with retrograde transport pathways. Penton base also Lentiviral vector production for shRNA encoding vectors was
done by the service platform for lentiviral vector production of the March 2010 | Volume 6 | Issue 3 | e1000808 March 2010 | Volume 6 | Issue 3 | e1000808 13 PPxY Motif Facilitates Adenovirus Entry Institute
Federative
de
Recherche
66
of
the
Bordeaux
2
University. Prevalidated lentiviral vectors encoding shRNAs in
the vector backbone pLKO.1 against Nedd4.1 and Nedd4.2 were
purchased from the MissionTM shRNA collection from Sigma. For
downregulation of Nedd4.1 we used NM_006154.1-1753s1c1
(sh4.1 (1), CCGGCCGGAGAATTATGGGTGTCAACTCGA-
GTTGACACCCATAATTCTCCGGTTTTT) against the cod-
ing sequence and NM_006154.1-3522s1c1 (sh4.1 (2), CCGGG-
CCTTTCTCTTGCCTGCATATCTCGAGATATGCAGGCA-
AGAGAAAGGCTTTTT) against the 39 UTR. For downregula-
tion of Nedd4.2 we used NM_015277.x-2772s1c1 (sh4.2 (1),
CCGGGCGAGTACCTATGAATGGATTCTCGAGAATCCA-
TTCATAGGTACTCGCTTTTT) against the coding sequence
and
NM_015277.x-3959s1c1
(sh4.2
(2),
CCGGCCTGTT-
TGTATGCGTTTGCTACTCGAGTAGCAAACGCATACAA-
ACAGGTTTTT) against the 39 UTR. Control vectors for
shRNAs encoded for shRNA against luciferase (Sigma) and
control vectors for transduction and estimation of the titer
encoded for GFP. determined by quantification of GFP-transduction. Only prepa-
rations with .90% activity where used. For time course
experiments, U2OS cells were seeded at semiconfluency on
coverslips. Pre-binding was done with 5000 physical particles per
cell in 100 ml at 4uC on a shaking platform for 1 h. At t0 coverslips
where rinsed in cold DMEM and transferred to pre-equilibrated
(37uC, 5% CO2) DMEM. At indicated time points the cells where
fixed and processed for IF analysis. PLoS Pathogens | www.plospathogens.org RNA interference, adenoviral transduction and FACS
analysis Depletions were performed in 12-well dishes using 26105
U2OS cells. Cells were transfected after 24 and 48 h with 20 pmol
of each siRNA duplex per well. Forty-eight hours after the first
transfection cells were transduced using 30 physical particles per
cell of Ad5-GFP virus for 3 h without prior pre-adsorption. Cells
were harvested 24 h later and analyzed by flow cytometry for GFP
expression and further processed for western blot analysis to verify
knock-down efficiency. Acquisitions were done with FACSCali-
burH or FACSCantoIIH cytometer (BD Biosciences) and the data
were processed and analyzed by the CellQuestH Pro and
FACSDIVAH software (BD Biosciences). Immunofluorescence (IF) Cells grown on coverslips were rinsed in PBS and fixed with 4%
PFA in PBS and blocked/permeabilized with IF-buffer (10% FCS
in PBS and 0.1% Saponin). Primary and secondary antibodies
where applied to the coverslip in IF-buffer for 1 h each. Cells were
mounted in DAKO mounting media containing DAPI and
analyzed by confocal- or epifluorescence microscopy. For IF
involving microtubule staining cells were treated with crosslinkers
prior to fixation. The following primary antibodies were used in
this study: mouse anti-AcTubulin (kind gift from C. Janke,
Montpellier), Mouse anti E2A (kind gift of T. Dobner, Hamburg),
rabbit anti pericentrin (Abcam) and rabbit anti-protein VI
antibodies raised against recombinant protein VI and affinity
purified
(see
supplemental
material). Secondary
antibodies
Alexa546 anti mouse was from Affinity Research and Atto647
anti rabbit was from Sigma. siRNAs were purchased as duplexes from EuroGentec (only the
reverse strand is shown): Scramble (59-CGCAAUUCGAUGUCCC-
GUGdTdT), Nedd4.1 (59-AAACAACCCAGCCAGGCUCdTdA),
Nedd4.2 (59-CUGUGACUUUGUGUUGUGGdTdA), were previ-
ously described by Segura-Morales et al. (2005), AIP4/Itch siRNAs (59-
UCAUCAUUCUGAGAAGCACdTdT, [54] , and WWP1 siRNA
(59-CUUCUACGAUCAUCAACUCdTdT) was previously described
by Chen et al. (2005). The WWP2 siRNA was a Smartpool from
Dharmacon. Western blot and antibodies Found at: doi:10.1371/journal.ppat.1000808.s002 (0.45 MB TIF) Affinity purified rabbit anti-protein VI antibodies were used at a
dilution of 1:2000. Other antibodies used for the study were:
rabbit polyclonal anti-Nedd4.1 and anti-Nedd4.2 antibodies that
were a kind gift of O. Staub (Lausanne, Switzerland) (dilution
1:1000), rabbit polyclonal anti-WWP2 antibody (sc-30052, Santa
Cruz Biotechnology) (dilution 1:200), goat polyclonal anti-WWP1
antibody (sc-11893, Santa Cruz Biotechnology) (dilution 1:200),
mouse monoclonal anti-AIP4/Itch antibody (sc-28367, Santa
Cruz Biotechnology) (dilution 1:100) and mouse monoclonal
anti-GFP antibody (Roche) (dilution 1:500). SDS-PAGE was done
using 12% poly-acrylamide gels and transferred to nitrocellulose
membranes. Membranes were blocked in TBS containing 10% of
dry-milk and 0.01% of Tween 20 (Sigma), followed by over-night
detection of antigens using primary antibodies diluted in TBS
containing 10% of dry-milk and 0.01% of Tween 20 (Sigma). Primary antibodies were detected using HRP-conjugated second-
ary antibodies against rabbit, goat or mouse (Sigma) at a dilution
of 1:5000. Specific signals were revealed using the enhanced
chemiluminescence detection system (ECL) (PerkinElmer). Figure S3
Construction of mutant Ad5 with altered PPxY motif
in protein VI using BAC technology. A) To construct a bacterial
artificial chromosome (BAC) carrying an infectious Ad5 genome,
we cloned an AdEasy system (Stratagene) based virus genome into
pKSB2 vector as described previously (Warming et al. [57];
Ruzsics et al. [34]). This recombinant Ad5 lacked the E1 and E3
regions and carried an FRT site in the place of its E1 region,
which was introduced through an FRT containing pShuttle
(Stratagene) clone. The resulting BAC, was termed pAd5-FRT
and can be reconstituted to fully infectious recombinant Ad5
viruses after transfection of E1 complementing cell lines such as
293 cells. To construct protein VI-modified viruses, pAd5-FRT
was transformed into the E. coli strain SW102, which encodes the
l-red recombination system from the bacteriophage under a heat-
inducible promoter [57]. We next amplified a Kanamycin
resistance
cassette
using
primers
with
50 nt
59
extensions
homologous to protein VI coding regions. The forward primer
was flanked with a homology located upstream to the PPSY motif
and introduced a ClaI site into the protein VI ORF without
affecting its amino acid sequence. The homology region attached
to the reverse primers carried the same ClaI site and overlapped
with the PPSY motif. Western blot and antibodies This procedure eliminated the kanamycin cassette and
reconstituted the protein VI ORF concomitant to the re-
circularisation of the ClaI treated BACs, because there was no Statistical analysis Data are presented as mean, error bars as STD. Statistical
analysis if not indicated otherwise was done using unpaired
students t-test (*:P,0.05; **:P,0.01; ***:P,0.005). Found at: doi:10.1371/journal.ppat.1000808.s001 (2.69 MB TIF) Found at: doi:10.1371/journal.ppat.1000808.s001 (2.69 MB TIF) Figure S2
Alignment of the PPxY motif in the sequence of
protein VI from different human and non-human adenovirus
serotypes. A partial alignment of protein VI sequences from
different human adenoviral serotypes as well as non-human
adenoviruses from the genus Mastadenovirus is shown. The
conserved ubiquitin ligase-recruiting motif is boxed. Sequences
were retrieved from public databases with the following accession
numbers;
canine
(CAV-2,
AP_000621),
bovine
(boAd3,
AP_000031), huAd3 (serotype B, ABB17802), huAd35 (serotype
B,
AP_000584),
huAd4
(serotype
E,
YP_068031),
huAd17
(serotype D, AP_000149), huAd2 (serotype C, AP_000174),
huAd5 (serotype C, AP_000210), huAd12 (serotype A, AP
000120), huAd40 (serotype F, NP_040861), murine (muAd1,
AP_000350). F
d
d i 10 1371/j
l
1000808 002 (0 45 MB TIF) Figure S2
Alignment of the PPxY motif in the sequence of
protein VI from different human and non-human adenovirus
serotypes. A partial alignment of protein VI sequences from
different human adenoviral serotypes as well as non-human
adenoviruses from the genus Mastadenovirus is shown. The
conserved ubiquitin ligase-recruiting motif is boxed. Sequences
were retrieved from public databases with the following accession
numbers;
canine
(CAV-2,
AP_000621),
bovine
(boAd3,
AP_000031), huAd3 (serotype B, ABB17802), huAd35 (serotype
B,
AP_000584),
huAd4
(serotype
E,
YP_068031),
huAd17
(serotype D, AP_000149), huAd2 (serotype C, AP_000174),
huAd5 (serotype C, AP_000210), huAd12 (serotype A, AP
000120), huAd40 (serotype F, NP_040861), murine (muAd1,
AP_000350). Found at: doi:10 1371/journal ppat 1000808 s002 (0 45 MB TIF) Transmission electron microscopy Three microliter of purified sample virus was adsorbed to a
carbon-coated film (200 mesh grids). The grids with adsorbed
virus were floated onto a solution of the negative stain (1% solution
of uranyl acetate). The film was picked up by a copper EM grid
and then air-dried. Specimens were examined under a HITACHI
H7650 electron microscope operating at 80 kV and images were
further processed using ImageJ software. Western blot and antibodies Two different reverse primers were
generated: one carried an unaltered PPSY motif and another that
encoded the amino acids PGAA instead of PPSY and introduced
an additional Pst I site by the new coding sequence. The PCR
products were transformed into the SW102 bacteria harbouring
the Ad5-BAC following heatshock to induce red-recombination. Chloramphenicol and kanamycin double resistant clones were
selected and BAC DNA was prepared from individual clones. The
isolated BAC DNA was digested with ClaI and subsequently re-
ligated. This procedure eliminated the kanamycin cassette and
reconstituted the protein VI ORF concomitant to the re-
circularisation of the ClaI treated BACs, because there was no Figure S3
Construction of mutant Ad5 with altered PPxY motif
in protein VI using BAC technology. A) To construct a bacterial
artificial chromosome (BAC) carrying an infectious Ad5 genome,
we cloned an AdEasy system (Stratagene) based virus genome into
pKSB2 vector as described previously (Warming et al. [57];
Ruzsics et al. [34]). This recombinant Ad5 lacked the E1 and E3
regions and carried an FRT site in the place of its E1 region,
which was introduced through an FRT containing pShuttle
(Stratagene) clone. The resulting BAC, was termed pAd5-FRT
and can be reconstituted to fully infectious recombinant Ad5
viruses after transfection of E1 complementing cell lines such as
293 cells. To construct protein VI-modified viruses, pAd5-FRT
was transformed into the E. coli strain SW102, which encodes the
l-red recombination system from the bacteriophage under a heat-
inducible promoter [57]. We next amplified a Kanamycin
resistance
cassette
using
primers
with
50 nt
59
extensions
homologous to protein VI coding regions. The forward primer
was flanked with a homology located upstream to the PPSY motif
and introduced a ClaI site into the protein VI ORF without
affecting its amino acid sequence. The homology region attached
to the reverse primers carried the same ClaI site and overlapped
with the PPSY motif. Two different reverse primers were
generated: one carried an unaltered PPSY motif and another that
encoded the amino acids PGAA instead of PPSY and introduced
an additional Pst I site by the new coding sequence. The PCR
products were transformed into the SW102 bacteria harbouring
the Ad5-BAC following heatshock to induce red-recombination. Chloramphenicol and kanamycin double resistant clones were
selected and BAC DNA was prepared from individual clones. The
isolated BAC DNA was digested with ClaI and subsequently re-
ligated. PLoS Pathogens | www.plospathogens.org Labeling and infection assays Purified
Ad
particles
were
labeled
using
the
Alexa-488
microscale protein labeling kit (Invitrogen) using the manufactur-
ers
protocol. Infectivity
of
labeled
virus
preparations
was March 2010 | Volume 6 | Issue 3 | e1000808 14 PPxY Motif Facilitates Adenovirus Entry 3.5cm glass-bottom dishes and transfected with 1.5 mg of protein
VI-expressing vectors. Twenty-four h later the medium was
replaced by pre-warmed OPTI-MEM (Gibco). Movies were
acquired on a Nikon TE 2000 microscope with Cascade 512B 2
camera using MetamorphTM software for data acquisition (120
frames, 1 frame/sec). In some cases, 2 h before the acquisition,
cells were incubated with either Nocodazole (Sigma) or Cytocha-
lasin B (Sigma) diluted respectively at 0.4 mg/ml and 5 mg/ml in
OPTI-MEM. Drugs were not removed during acquisition. Acquired movies were further processed using ImageJ to enhance
protein VI particle detection by background subtraction and
bleach correction. Particles were tracked using the spot-tracking
tool of ImarisTM software to determine the length of their
trajectories and the speed of their movement. Particle detection
size was scaled to 0.75 mm and tracks were built with a maximum
displacement of 1.5 mm between consecutive frames, a maximum
gap size of 3 frames and a minimal track length of 20 s. At least 5
cells were analyzed for each condition that equals a minimum of
300 analyzed tracks per condition. column. The inset shows a magnification of representative virus
and protein VI signals in the small white box. Protein VI signals
are shown in red, Ad is shown in green and colocalization of
protein VI and Ad is shown in yellow. The scale bar is 10 mm. The
rabbit polyclonal serum against protein VI was generated against
recombinant purified His-tagged protein VI. Rabbit serum that
reacted positive and specific against protein VI in western blots of
purified viruses was used for further affinity purification for use in
immunofluorescence applications. Affinity purification was done
using recombinant purified protein VI coupled to CnBr+-activated
sepharose beads. Bound antibodies were eluted with 0.1 M glycin
ph2, neutralized with 2M Tris pH 8.8 and dialyzed against PBS. Affinity purified antibodies were used at 1:250 dilutions in
immunofluorescence. Found at: doi:10.1371/journal.ppat.1000808.s001 (2.69 MB TIF) Supporting Information This treatment induced a recombination between the two
FRT sites (one in the pAd5-FRT derivative and one on the pO6-
A5-gfp) and induced unification of the BAC and the pO6
construct. Only the recombined construct survived the double
selection because pO6 constructs are not maintained in DH10B. This approach essentially replaced the old left end of the Ad5 BAC
by a CMV promoter driven GFP-expression cassette containing
fragment, which also possessed all the cis elements needed for virus
reconstitution as described above. Figure S5
Penton is a target for ubiquitylation following partial
disassembly of the virus. A) Localization and sequences of
conserved PPxY-motifs in protein VI and penton for Ad5 (black
box). Note that processed protein VI is shown as it is present in the
capsid during viral entry. B) Schematic representation of the in vitro
ubiquitylation assay. Virus disassembly was induced by mild heat-
treatment, in vitro ubiquitylated using ubiquitin or recombinant
GST-ubiquitin, recombinant E1 and E2, an energy regenerating
system and purified cytosol as source for the E3-ligase and
analyzed by western blot. Controls lack the mild heat-treatment. C) Western blot analysis of viral capsid proteins penton, fiber and
protein IIIA following capsid disassembly and in vitro ubiquityla-
tion. Heat-treatment is indicated above each lane. Antibodies are
indicated to the right of each blot. Specific bands are labeled
accordingly. Grey arrows indicate band shifts due to ubiquityla-
tion, black arrows indicates the unmodified protein. D) Western
blot analysis of in vitro ubiquitylation reactions of heat-treated viral
particles. Heat treatment is indicated above each lane. For
individual reactions the cytosol was depleted with recombinant
fiber beads (control), recombinant VI-wt beads or recombinant
VI-M1 beads as indicated above each lane. Reactions were blotted
with anti-penton. The assay shows that the ubiquitylation activity
can be depleted from cytosol with recombinant wt protein VI but
not when the PPSY motif is mutated. The same assay also
abolishes protein VI ubiquitylation showing that similar ubiqui-
tylation activities are responsible (data not shown). E) Protein VI
depleted cytosol renders Nedd4.2 active for penton ubiquitylation. In vitro ubiquitylation reactions using catalytically active or inactive
Nedd4.2 substituted with cytosol depleted by protein VI-wt (as
indicated above each lane) and analyzed by western blot with anti-
penton antiserum. Black arrows indicate ubiquitylated proteins,
grey arrows the unmodified protein. This assay shows that
additional cytosolic factors are required for full Nedd4.2 activity
for penton ubiquitylation. Supporting Information Figure S1
Protein VI release in U2OS cells during Ad entry. Ad5-VI-wt-488 was pre-bound to cells at 4uC (top row) and shifted
to 37uC for 5min (second row), 15min (third row) and 45min
(bottom row). Protein VI was detected using affinity purified anti-
protein VI antibodies (left column) and Ad by detecting the Alexa-
488 fluorescent signal (middle column). A composite of both
signals including the nucleus (in greyscale) is shown in the left March 2010 | Volume 6 | Issue 3 | e1000808 15 PPxY Motif Facilitates Adenovirus Entry other ClaI site present in the rest of the pAd5-FRT. If the reverse
primer with an intact PPSY motif was used for amplification, the
wild type protein VI amino acid sequence was reconstituted with a
silent genetic tag introducing a ClaI site. If the reverse primer with
PGAA motif was used for amplification, the protein VI coding
sequence was modified at two positions i) a silent genetic tag was
inserted introducing a ClaI site as above and ii) the PPSY motif
was replaced by the PGAA motif introducing a new PstI site. After
the ClaI treatment and re-ligation the modified genomes were
retransformed in E. coli DH10B. Kanamycin negative colonies
were identified by replica plating and the resulting mutants were
analysed by restriction digestions and verified by sequencing. The
mutant Ad genomes were released from the respective BACs by
Pac I digestion and transfected into 293 cells. Following the
appearance of cytopathic effects the virus was amplified and
purified by double CsCl banding, dialyzed into PBS/10%
Glycerol and snap frozen. B) To verify the identity of the purified
virions and analyse whether detectable reversion occurred during
reconstitution and propagation of the virus stocks viral DNA was
extracted from purified virions and was PCR amplified with
protein VI specific primers. The PCR products were digested with
Pst I (left) and Cla I (right) to identify the recombinant viruses with
or without the altered protein VI sequences. To insert a GFP
expression cassette we used bacterial Flp-recombination using the
FRT site in the E1-deleted region of the Ad5-VI-wt and Ad5-VI-
M1 BACs. We cloned the left end of the Ad5 (nt 1–341) flanked by
a Pac I restriction site into the plasmid pOriR6K-ie [55]; GenBank
Acc. AY700022) upstream of its FRT site. Supporting Information We also replaced its
zeocin resistance marker with an pGPS1.1(NEB) derived kana-
mycin cassette and cloned an EGFP ORF from pEGFP-N1
(Clontech) in its expression locus and termed this plasmid pO6-
A5-gfp. The pOriR6Kie derived plasmids can only be maintained
in special E. coli strains such as PIR1 (Invitrogen) because they are
dependent on the presence of R6Kc phage replicase [55]. To
carry out the recombination, E. coli strain DH10B (Invitrogen) was
co-transformed with pAd5-FRT derived BACs and pCP20
encoding the Flp-recombinase [56] and cultured at 30uC. The
Flp recombinations were carried out as described in Bubeck et al. [55]. Briefly, the E. coli cell carrying the target BACs and the Flp
expression plasmid pCP20 were transformed with the pO6-A5-
GFP and selected for chloramphenicol and kanamycin resistance
upon induction of the Flp expression by a temperature shift to
43uC. This treatment induced a recombination between the two
FRT sites (one in the pAd5-FRT derivative and one on the pO6-
A5-gfp) and induced unification of the BAC and the pO6
construct. Only the recombined construct survived the double
selection because pO6 constructs are not maintained in DH10B. This approach essentially replaced the old left end of the Ad5 BAC
by a CMV promoter driven GFP-expression cassette containing
fragment, which also possessed all the cis elements needed for virus
reconstitution as described above. Found at: doi:10.1371/journal.ppat.1000808.s003 (0.45 MB TIF)
Figure S4
The PPxY-mutant Ad5GFP-VI-M1 forms smaller
and fewer plaques. A) Shown is a comparison of the growth of
individual plaques starting from a single infected cell. E1
complementing 911 cells were infected at low multiplicity of mutant virus to the right shows a slow expansion of GFP-positive
plaques with less damage to the cell monolayer. Images are
superimpositions of the GFP signal and the phase contrast image
of the monolayer. B) The image shows the damage in the cell
monolayer caused by plaque formation on day 12. The arrow
indicates the average size of the plaque. The scale bar is 50 mm. Found at: doi:10.1371/journal.ppat.1000808.s004 (2.12 MB TIF) other ClaI site present in the rest of the pAd5-FRT. If the reverse
primer with an intact PPSY motif was used for amplification, the
wild type protein VI amino acid sequence was reconstituted with a
silent genetic tag introducing a ClaI site. Supporting Information If the reverse primer with
PGAA motif was used for amplification, the protein VI coding
sequence was modified at two positions i) a silent genetic tag was
inserted introducing a ClaI site as above and ii) the PPSY motif
was replaced by the PGAA motif introducing a new PstI site. After
the ClaI treatment and re-ligation the modified genomes were
retransformed in E. coli DH10B. Kanamycin negative colonies
were identified by replica plating and the resulting mutants were
analysed by restriction digestions and verified by sequencing. The
mutant Ad genomes were released from the respective BACs by
Pac I digestion and transfected into 293 cells. Following the
appearance of cytopathic effects the virus was amplified and
purified by double CsCl banding, dialyzed into PBS/10%
Glycerol and snap frozen. B) To verify the identity of the purified
virions and analyse whether detectable reversion occurred during
reconstitution and propagation of the virus stocks viral DNA was
extracted from purified virions and was PCR amplified with
protein VI specific primers. The PCR products were digested with
Pst I (left) and Cla I (right) to identify the recombinant viruses with
or without the altered protein VI sequences. To insert a GFP
expression cassette we used bacterial Flp-recombination using the
FRT site in the E1-deleted region of the Ad5-VI-wt and Ad5-VI-
M1 BACs. We cloned the left end of the Ad5 (nt 1–341) flanked by
a Pac I restriction site into the plasmid pOriR6K-ie [55]; GenBank
Acc. AY700022) upstream of its FRT site. We also replaced its
zeocin resistance marker with an pGPS1.1(NEB) derived kana-
mycin cassette and cloned an EGFP ORF from pEGFP-N1
(Clontech) in its expression locus and termed this plasmid pO6-
A5-gfp. The pOriR6Kie derived plasmids can only be maintained
in special E. coli strains such as PIR1 (Invitrogen) because they are
dependent on the presence of R6Kc phage replicase [55]. To
carry out the recombination, E. coli strain DH10B (Invitrogen) was
co-transformed with pAd5-FRT derived BACs and pCP20
encoding the Flp-recombinase [56] and cultured at 30uC. The
Flp recombinations were carried out as described in Bubeck et al. [55]. Briefly, the E. coli cell carrying the target BACs and the Flp
expression plasmid pCP20 were transformed with the pO6-A5-
GFP and selected for chloramphenicol and kanamycin resistance
upon induction of the Flp expression by a temperature shift to
43uC. Supporting Information Found at: doi:10.1371/journal.ppat.1000808.s005 (0.73 MB TIF) Found at: doi:10.1371/journal.ppat.1000808.s005 (0.73 MB TIF) Found at: doi:10.1371/journal.ppat.1000808.s005 (0.73 MB TIF) Figure S6
Protein VI with altered PPxY motif does not
colocalize with Nedd4 ligases. Protein VI with PPSY motif
mutated to PGAA was N-terminally fused to mRFP and co-
transfected with GFP-Nedd4.1 (top row), GFP-Nedd4.2 (second
row), GFP-AIP4/Itch (third row), GFP-WWP1 (forth row) and
GFP-WWP2 (bottom row). Confocal images of representative cells
are shown and the mRFP signal for VI (left column), the GFP
signal for the ligases (centre column) and the merged signals
together with DAPI stain of the nucleus (right column) is indicated
above each column. Transfected plasmids are indicated left of
each row. Note that the cytoplasmic localization of each ligase is
similar to that in cells without cotransfection of protein VI (data
not shown). Found at: doi:10.1371/journal.ppat.1000808.s003 (0.45 MB TIF) PLoS Pathogens | www.plospathogens.org References Khor R, McElroy LJ, Whittaker GR (2003) The ubiquitin-vacuolar protein
sorting system is selectively required during entry of influenza virus into host
cells. Traffic 4: 857–868. 31. Wodrich H, Cassany A, D’Angelo MA, Guan T, Nemerow G, et al. (2006)
Adenovirus core protein pVII is translocated into the nucleus by multiple import
receptor pathways. J Virol 80: 9608–9618. 11. Duan D, Yue Y, Yan Z, Yang J, Engelhardt JF (2000) Endosomal processing
limits gene transfer to polarized airway epithelia by adeno-associated virus. J Clin
Invest 105: 1573–1587. 32. Loktev AV, Zhang Q, Beck JS, Searby CC, Scheetz TE, et al. (2008) A BBSome
subunit links ciliogenesis, microtubule stability, and acetylation. Dev Cell 15:
854–865. 12. Yan Z, Zak R, Luxton GW, Ritchie TC, Bantel-Schaal U, et al. (2002)
Ubiquitination of both adeno-associated virus type 2 and 5 capsid proteins
affects the transduction efficiency of recombinant vectors. J Virol 76:
2043–2053. 33. Copeland NG, Jenkins NA, Court DL (2001) Recombineering: a powerful new
tool for mouse functional genomics. Nat Rev Genet 2: 769–779. 34. Ruzsics Z, Wagner M, Osterlehner A, Cook J, Koszinowski U, et al. (2006)
Transposon-assisted cloning and traceless mutagenesis of adenoviruses: Devel-
opment of a novel vector based on species D. J Virol 80: 8100–8113. 13. Bieniasz PD (2006) Late budding domains and host proteins in enveloped virus
release. Virology 344: 55–63. 35. Yasuda J, Hunter E (1998) A proline-rich motif (PPPY) in the Gag polyprotein of
Mason-Pfizer monkey virus plays a maturation-independent role in virion
release. J Virol 72: 4095–4103. 14. Williams RL, Urbe S (2007) The emerging shape of the ESCRT machinery. Nat
Rev Mol Cell Biol 8: 355–368. 15. Saksena S, Wahlman J, Teis D, Johnson AE, Emr SD (2009) Functional
reconstitution of ESCRT-III assembly and disassembly. Cell 136: 97–109. 36. Gottwein E, Bodem J, Muller B, Schmechel A, Zentgraf H, et al. (2003) The
Mason-Pfizer monkey virus PPPY and PSAP motifs both contribute to virus
release. J Virol 77: 9474–9485. 16. Ingham RJ, Gish G, Pawson T (2004) The Nedd4 family of E3 ubiquitin ligases:
functional diversity within a common modular architecture. Oncogene 23:
1972–1984. 37. Wodrich H, Guan T, Cingolani G, Von Seggern D, Nemerow G, et al. (2003)
Switch from capsid protein import to adenovirus assembly by cleavage of
nuclear transport signals. Embo J 22: 6245–6255. 17. References 22. Zhang Y, Bergelson JM (2005) Adenovirus receptors. J Virol 79: 12125–12131. 1. Brandenburg B, Zhuang X (2007) Virus trafficking - learning from single-virus
tracking. Nat Rev Microbiol 5: 197–208. 23. Meier O, Greber UF (2004) Adenovirus endocytosis. J Gene Med 6 Suppl 1:
S152–163. 2. Greber UF, Way M (2006) A superhighway to virus infection. Cell 124:
741–754. 24. Rauma T, Tuukkanen J, Bergelson JM, Denning G, Hautala T (1999) rab5
GTPase regulates adenovirus endocytosis. J Virol 73: 9664–9668. 3. Leopold PL, Crystal RG (2007) Intracellular trafficking of adenovirus: many
means to many ends. Adv Drug Deliv Rev 59: 810–821. 25. Wickham TJ, Mathias P, Cheresh DA, Nemerow GR (1993) Integrins alpha v
beta 3 and alpha v beta 5 promote adenovirus internalization but not virus
attachment. Cell 73: 309–319. 4. Greber UF (2002) Signalling in viral entry. Cell Mol Life Sc 5. Leopold PL, Pfister KK (2006) Viral strategies for intracellular trafficking:
motors and microtubules. Traffic 7: 516–523. 26. Greber UF, Willetts M, Webster P, Helenius A (1993) Stepwise dismantling of
adenovirus 2 during entry into cells. Cell 75: 477–486. 6. Bailey CJ, Crystal RG, Leopold PL (2003) Association of adenovirus with the
microtubule organizing center. J Virol 77: 13275–13287. 27. Greber UF, Webster P, Weber J, Helenius A (1996) The role of the adenovirus
protease on virus entry into cells. Embo J 15: 1766–1777. 7. Suomalainen M, Nakano MY, Keller S, Boucke K, Stidwill RP, et al. (1999)
Microtubule-dependent plus- and minus end-directed motilities are competing
processes for nuclear targeting of adenovirus. J Cell Biol 144: 657–672. 28. Wiethoff CM, Wodrich H, Gerace L, Nemerow GR (2005) Adenovirus protein
VI mediates membrane disruption following capsid disassembly. J Virol 79:
1992–2000. 8. Strunze S, Trotman LC, Boucke K, Greber UF (2005) Nuclear targeting of
adenovirus type 2 requires CRM1-mediated nuclear export. Mol Biol Cell 16:
2999–3009. 29. Saphire AC, Guan T, Schirmer EC, Nemerow GR, Gerace L (2000) Nuclear
import of adenovirus DNA in vitro involves the nuclear protein import pathway
and hsc70. J Biol Chem 275: 4298–4304. 9. Yu GY, Lai MM (2005) The ubiquitin-proteasome system facilitates the transfer
of murine coronavirus from endosome to cytoplasm during virus entry. J Virol
79: 644–648. 30. Trotman LC, Mosberger N, Fornerod M, Stidwill RP, Greber UF (2001) Import
of adenovirus DNA involves the nuclear pore complex receptor CAN/Nup214
and histone H1. Nat Cell Biol 3: 1092–1100. 10. Acknowledgments We thank E. Bertrand, P. Bienasz, M. Bonhivers, T. Dobner, E. Everitt, S. Kumar, A. Lieber, G. Nemerow and O. Staub for their generous gifts of
reagents. We thank J. Chroboczek and M. Piechazcyk for helpful
discussions during the course of this work and Michael Kann for critical
reading of the manuscript. We thank the members of the Kremer lab for
discussion. We would like to thank K. Rogowski and L. Doelken for
valuable help. We further thank the Montpellier RIO imaging platform
MRI. We like to acknowledge the excellent technical support from E. Gontier at the Electron microscopy platform of the Bordeaux imaging
Center (BIC) and the help of N. Dugot-Senant, V. Guyonnet-Duperat and
V. Pitard from the imaging, lentiviral vector production and cytometry
platforms at the Institute Federative de recherche´ 66 (IFR66) at the
University of Bordeaux 2. Video S2
Comparison of intracellular dynamics for VI-wt vs. VI-M1 vs. VI-wt (+ nocodazole). U2OS cells were transfected with
VI-wt (left and right panel) or VI-M1 (middle panel) fused to
mRFP. The cell to the right was treated with nocodazole (5 mg/ml)
prior to image acquisition. Movies were acquired using a Nikon
TE 2000 microscope equipped with Cascade 512B 2 camera at 1
frame per second. The movies were labeled and assembled using
imageJ and converted into QuickTimeTM movies. All three
displayed movies were taking at the same frame rate. The movies
show rapid intracellular movement of VI-wt at nearly real-time
(left). VI-M1
shows
strongly
reduced
movement
(middle). Treatment of VI-wt transfected cells with nocodazole, strongly
reduces the VI-wt movement resembling VI-M1 dynamics (right). Found
at:
doi:10.1371/journal.ppat.1000808.s008
(1.21
MB
MOV) Author Contributions Conceived and designed the experiments: HW CSM OC ZR CMW EJK. Performed the experiments: HW DH BJ ZR. Analyzed the data: HW DH
BJ ZR CMW. Contributed reagents/materials/analysis tools: HW CSM
SS OC ZR CMW. Wrote the paper: HW ZR CMW EJK. Found at: doi:10.1371/journal.ppat.1000808.s003 (0.45 MB TIF) Found at: doi:10.1371/journal.ppat.1000808.s003 (0.45 MB TIF) Figure S4
The PPxY-mutant Ad5GFP-VI-M1 forms smaller
and fewer plaques. A) Shown is a comparison of the growth of
individual plaques starting from a single infected cell. E1
complementing 911 cells were infected at low multiplicity of
infection with Ad5GFP-VI-wt and the PPxY mutant virus
Ad5GFP-VI-M1 for 24 h and then washed and overlayed with
agarose. Virus growth was monitored by the appearance of GFP-
positive cells and images of representative cells/plaques were taken
on days 1, 3, 9 and 12. The images in the left row show the plaque
formation of the wild type virus 1, 3, 9 and 12 days after the initial
infection (top-to-bottom). At day 9 and 12 significant large plaques
with lesions of the cell monolayer can be observed. In contrast the Found at: doi:10.1371/journal.ppat.1000808.s006 (3.90 MB TIF) Video S1
Intracellular dynamics of protein VI. U2OS cells were
transfected with VI-wt, fused to mRFP. The movie was acquired
using a Nikon TE 2000 microscope equipped with Cascade 512B
2 camera at 1 frame per second. The movie shows rapid
intracellular movement of VI-wt depicting compartments resem-
bling vesicular, tubulo-vesicular and reticular structures. PLoS Pathogens | www.plospathogens.org March 2010 | Volume 6 | Issue 3 | e1000808 March 2010 | Volume 6 | Issue 3 | e1000808 16 PPxY Motif Facilitates Adenovirus Entry Found
at:
doi:10.1371/journal.ppat.1000808.s007
(0.62
MB
MOV) Found
at:
doi:10.1371/journal.ppat.1000808.s007
(0.62
MB
MOV) PLoS Pathogens | www.plospathogens.org PPxY Motif Facilitates Adenovirus Entry PPxY Motif Facilitates Adenovirus Entry adenovirus allows refinement of capsid protein assignments. J Virol 80:
12049–12059. 51. Mittereder N, March KL, Trapnell BC (1996) Evaluation of the concentration
and bioactivity of adenovirus vectors for gene therapy. J Virol 70: 7498–7509. 44. Russell WC (2009) Adenoviruses: update on structure and function. J Gen Virol
90: 1–20. 52. Segura-Morales C, Pescia C, Chatellard-Causse C, Sadoul R, Bertrand E, et al. (2005) Tsg101 and Alix interact with murine leukemia virus Gag and cooperate
with Nedd4 ubiquitin ligases during budding. J Biol Chem 280: 27004–27012. 45. Fabry CM, Rosa-Calatrava M, Conway JF, Zubieta C, Cusack S, et al. (2005) A
quasi-atomic model of human adenovirus type 5 capsid. Embo J 24: 1645–1654. q
g
g
g J
53. Fotia AB, Ekberg J, Adams DJ, Cook DI, Poronnik P, et al. (2004) Regulation of
neuronal voltage-gated sodium channels by the ubiquitin-protein ligases Nedd4
and Nedd4-2. J Biol Chem 279: 28930–28935. 46. Neumann G, Ebihara H, Takada A, Noda T, Kobasa D, et al. (2005) Ebola
virus VP40 late domains are not essential for viral replication in cell culture. J Virol 79: 10300–10307. 54. Rossi M, Aqeilan RI, Neale M, Candi E, Salomoni P, et al. (2006) The E3
ubiquitin ligase Itch controls the protein stability of p63. Proc Natl Acad Sci U S A
103: 12753–12758. 47. Morita E, Sandrin V, Chung HY, Morham SG, Gygi SP, et al. (2007) Human
ESCRT and ALIX proteins interact with proteins of the midbody and function
in cytokinesis. Embo J 26: 4215–4227. 55. Bubeck A, Wagner M, Ruzsics Z, Lotzerich M, Iglesias M, et al. (2004)
Comprehensive mutational analysis of a herpesvirus gene in the viral genome
context reveals a region essential for virus replication. J Virol 78(15): 8026–8035. 48. Fejer G, Drechsel L, Liese J, Schleicher U, Ruzsics Z, et al. (2008) Key role of
splenic myeloid DCs in the IFN-alphabeta response to adenoviruses in vivo. PLoS Pathog 4: e1000208. doi:10.1371/journal.ppat.1000208. 56. Cherepanov PP, Wackernagel W (1995) Gene disruption in Escherichia coli:
TcR and KmR cassettes with the option of Flp-catalyzed excision of the
antibiotic-resistance determinant. Gene 158(1): 9–14. 49. Chroboczek J, Gout E, Favier AL, Galinier R (2003) Novel partner proteins of
adenovirus penton. Curr Top Microbiol Immunol 272: 37–55. 49. Chroboczek J, Gout E, Favier AL, Galinier R (2003) Novel part 57. References Shearwin-Whyatt L, Dalton HE, Foot N, Kumar S (2006) Regulation of
functional diversity within the Nedd4 family by accessory and adaptor proteins. Bioessays 28: 617–628. 38. Martin-Serrano J, Eastman SW, Chung W, Bieniasz PD (2005) HECT ubiquitin
ligases link viral and cellular PPXY motifs to the vacuolar protein-sorting
pathway. J Cell Biol 168: 89–101. 18. Usami Y, Popov S, Popova E, Gottlinger HG (2008) Efficient and specific rescue
of human immunodeficiency virus type 1 budding defects by a Nedd4-like
ubiquitin ligase. J Virol 82: 4898–4907. 39. Gastaldelli M, Imelli N, Boucke K, Amstutz B, Meier O, et al. (2008) Infectious
Adenovirus Type 2 Transport Through Early but not Late Endosomes. Traffic. 39. Gastaldelli M, Imelli N, Boucke K, Amstutz B, Meier O, et al. (2008) Infectious
Adenovirus Type 2 Transport Through Early but not Late Endosomes. Traffic. 40. Medina-Kauwe LK (2003) Endocytosis of adenovirus and adenovirus capsid
proteins. Adv Drug Deliv Rev 55: 1485–1496. 19. Chung HY, Morita E, von Schwedler U, Muller B, Krausslich HG, et al. (2008)
NEDD4L overexpression rescues the release and infectivity of human
immunodeficiency virus type 1 constructs lacking PTAP and YPXL late
domains. J Virol 82: 4884–4897. 40. Medina-Kauwe LK (2003) Endocytosis of adenovirus and adenovirus capsid
proteins. Adv Drug Deliv Rev 55: 1485–1496. 41. Svensson U (1985) Role of vesicles during adenovirus 2 internalization into
HeLa cells. J Virol 55: 442–449. 20. Wirblich C, Tan GS, Papaneri A, Godlewski PJ, Orenstein JM, et al. (2008)
PPEY motif within the rabies virus (RV) matrix protein is essential for efficient
virion release and RV pathogenicity. J Virol 82: 9730–9738. 42. Nakano MY, Boucke K, Suomalainen M, Stidwill RP, Greber UF (2000) The
first step of adenovirus type 2 disassembly occurs at the cell surface,
independently of endocytosis and escape to the cytosol. J Virol 74: 7085–7095. 21. Galinier R, Gout E, Lortat-Jacob H, Wood J, Chroboczek J (2002) Adenovirus
protein involved in virus internalization recruits ubiquitin-protein ligases. Biochemistry 41: 14299–14305. 43. Saban SD, Silvestry M, Nemerow GR, Stewart PL (2006) Visualization of alpha-
helices in a 6-angstrom resolution cryoelectron microscopy structure of PLoS Pathogens | www.plospathogens.org PLoS Pathogens | www.plospathogens.org March 2010 | Volume 6 | Issue 3 | e1000808 17 March 2010 | Volume 6 | Issue 3 | e1000808 PPxY Motif Facilitates Adenovirus Entry PPxY Motif Facilitates Adenovirus Entry Warming S, Costantino N, Court DL, Jenkins NA, Copeland NG (2005) Simple
and highly efficient BAC recombineering using galK selection. Nucleic Acids
Res 33(4): e36. 50. Salinas S, Bilsland LG, Henaff D, Weston AE, Keriel A, et al. (2009) CAR-
associated vesicular transport of an adenovirus in motor neuron axons. PLoS
Pathog 5: e1000442. PLoS Pathogens | www.plospathogens.org March 2010 | Volume 6 | Issue 3 | e1000808 PLoS Pathogens | www.plospathogens.org 18
| 14,102 |
US-77301010-A_1
|
USPTO
|
Open Government
|
Public Domain
| 2,010 |
None
|
None
|
English
|
Spoken
| 4,598 | 5,179 |
Data sharing network device having portable storage portion with network function
ABSTRACT
A data sharing network device includes a portable storage portion with network function, which has a network file management system, via which an electronic apparatus coupled to the portable storage portion manages the access of files between a memory unit of the portable storage portion with network function and a remote network host. The portable storage portion with network function includes an interface portion, a network unit for linking with the remote network host, the memory unit and a processing unit for controlling data access between the memory unit and the electronic apparatus via the interface portion, between the memory unit and a remote network host, and between the memory unit and another memory unit of another portable storage portion with network function in which data can be stored on the remote network host, on the memory unit, or on the electronic device.
CROSS REFERENCE TO RELATED TO RELATED APPLICATION
This application is a continuation-in-part of an U.S. application Ser. No. 11/704,444, filed 12 Feb. 2007, now pending, which is based on, and claims the priority benefit of Taiwan application serial no. 095143624, filed on 24 Nov. 2006. The contents of each of the above-mentioned patent applications are hereby incorporated by reference herein in its entirety and made a part of this specification.
FIELD OF THE INVENTION
The present invention relates to a data sharing network device including an electronic apparatus and a portable storage portion with network function, and more particularly to a portable storage portion with network function, so that an electronic apparatus integrated with the portable storage portion with network function may manage the access of files between a memory unit of the portable storage portion and a remote network host, between the data sharing network device comprising the memory unit and an another electronic apparatus, or between the data sharing network device and an another memory unit of an another data sharing network device.
BACKGROUND OF THE INVENTION
In many of the currently adopted manners of data processing and data storage, data to be stored is either stored in a personal computer, such as a desktop computer, a notebook computer, or a personal digital assistant (PDA), or in a remote server by linking a personal computer with the remote server via a network. When it is desired to use the disk space in the remote server as a virtual disk of the personal computer, it is necessary to set a relevant driver for the personal computer. Since such setting of driver is computer-specific, a user without carrying about that particular driver in the computer just could not use the virtual network disk drive.
In addition, due to recent popularity and widespread adoption of wireless electronic devices such as mobile phones, smart phones, 3G smart phones, electronic reader, touch sensitive tablet devices, and portable electronic game devices, to name a few, vast amounts of data are being gathered and stored in various network electronic devices, therefore, there is a need to collaborate, share, and synchronize these data located in different electronic devices by linking each of the electronic device with a remote server via a network. When an user desires to collaborate, share, and synchronize these separately-located data, a network file management system provided in one portable storage portion with network function can serve to manage the data access between the memory unit of that portable storage portion integrated in one data sharing network device with a remote network host or with other memory units integrated in other portable storage portions with network function in other data sharing network devices.
There is therefore a need to develop a data sharing network device including a portable storage portion with network function to overcome the limitations when using conventional electronic apparatuses or portable storage devices, so that an electronic apparatus integrated with the portable storage portion with network function may manage the access of files between a memory unit of the portable storage portion and a remote network host or the memory unit of another portable storage portion via a network file management system, making the portable storage portion with network function more convenient for use.
SUMMARY OF THE INVENTION
An object of the present invention is to provide a data sharing network device which includes a portable storage portion with network function that is integrated with an electronic apparatus.
Another object of the present invention is to provide a portable storage portion, into which network function is incorporated, so that an electronic apparatus coupled to or integrated with the portable storage portion with network function may manage the access of files between a memory unit of the portable storage portion and a remote network host or the memory unit of another portable storage portion belonging to another data sharing network device.
For a desktop computer or a mobile electronic apparatus, such as a notebook computer, a mobile phone, an electronic reader device, or a PDA, the portable storage portion with network function according to the present invention is compatible with an operating system supporting mass storage without the need of requiring additional drivers, and may have a storage capacity much larger than other currently available conventional portable data storage devices.
To achieve the above and other objects, the portable storage portion with network function according to the present invention includes an interface portion for for integrating with an electronic apparatus; a network unit for linking with a remote network host; a memory unit for providing access of data; and a processing unit that receives instructions of the electronic apparatus to control the access of data between the memory unit and the electronic apparatus via the interface portion, and the access of data between the memory unit and the linked remote network host or between the memory unit and another memory unit via the network unit.
Therefore, it is possible to access files located in a remote network host or from another portable storage portion with network function via the electronic apparatus and a network file management system residing either in the portable storage portion or the electronic apparatus, making the portable storage portion with network function more convenient for use.
BRIEF DESCRIPTION OF THE DRAWINGS
The structure and the technical means adopted by the present invention to achieve the above and other objects can be best understood by referring to the following detailed description of the preferred embodiments and the accompanying drawings, wherein
FIG. 1 shows a configuration of a portable storage portion with network function according to the present invention;
FIG. 2 shows a preferred example of application of the portable storage portion with network function according to the present invention in a wireless network system; and
FIG. 3 shows a preferred example of application of the portable storage portion with network function according to the present invention in a wired network system.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
Please refer to FIG. 1 that shows a configuration of a data sharing network device 100 which includes an electronic apparatus 6, a portable storage portion with network function 1, and an interface portion 2 according to a first embodiment. In this embodiment, the interface portion 2 may include, but is not limited to a flexible circuit board, a connector, a plurality of wire bonding, flip chip bonding, and other conventional integrated circuit assembly technologies. The electronic apparatus 6, includes, but is not limited to, a digital camera 7, a desktop computer 8, a notebook computer 9, a PDA (not shown), an MP3 player (not shown), or a voice pen (not shown), a mobile phone 21, a computer tablet device 22, an electronic reader device (not shown), a cable TV set-top box (not shown), a portable game device 26, a speaker system (not shown), and a liquid crystal display 27. The portable storage portion with network function 1 includes also a network unit 3, which may be a wired-network chip or a wireless-network chip and also may be located within the portable storage portion with network function 1, or instead is located outside of and coupled to the portable storage portion 1, for linking with a remote network host or a virtual hard disk. And the remote network host can also be further coupled to another portable storage portion with network function 1 in another data sharing network device 100, so that the two portable storage portions with network function 1 can thereby effectively communicate; and a memory unit 4 providing access of data; and a processing unit 5, which may include, but not limited to, a SOC (System on chip) configuration.
FIGS. 2 and 3 show preferred examples of application of the portable storage portion with network function 1 in a wireless network system and a wired network system, respectively. As shown, the portable storage portion with network function 1 is integrated with the electronic apparatus 6, including but not limited to the digital camera 7, the personal computer 8, the notebook computer 9, the PDA (not shown), the MP3 player, the mobile phone 21, the computer tablet device 22, the electronic reader device (not shown), the portable game device 26, the speaker system (not shown), the liquid crystal display 27 or the voice pen (not shown), so that the processing unit 5 inside the portable storage portion with network function 1 receives instructions from the electronic apparatus 6 for controlling access of data between the memory unit 4 and the electronic apparatus 6, access of data between the memory unit 4 and a remote network host 12 or a virtual hard disk, and access of data between the memory unit 4 and another memory unit 4 residing on the another electronic apparatus 6 through the remote network host 12, both of which are linked with the portable storage portion with network function 1 via a wired network 11 as shown in FIG. 3 or a wireless network 13 as shown in FIG. 2. In the wired network system, data is transmitted via an interface unit 18, and in the wireless network system, data is transmitted via the network unit 3 to an access point of the wireless network 13. The wireless network 13 can be in the form of a Wi-Fi broadband network, a cellular network, a 3G or 4G wireless network, a home wireless router network, etc. The interface unit 18 may be, for example, in the form of an USB interface, an SD interface, a CF interface, an XD interface, a PCMCIA interface, a 1394 interface, an infrared interface, and a Bluetooth interface. As an example, the use of the portable storage portion with network function 1 with a digital camera 7 is now further described. In an environment with a wireless network, when the digital camera 7 is coupled to or integrated with the portable storage portion with network function 1, photos taken by using the digital camera 7 may be directly stored on the remote network host 12 or the virtual hard disk via the wireless network. Therefore, the available storage capacity of the digital camera 7 may be effectively increased. On the other hand, when the digital camera 7 is used in an environment without any available network, the photos having been taken may be temporarily stored on the portable storage portion with network function 1. The photos stored inside the portable storage portion 1 may be transmitted to and stored on the remote network host 12 or the virtual hard disk or to even another portable storage portion with network function 1 integrated with another electronic apparatus 6 or digital camera 7 through the remote network host 12 as soon as a network environment is available.
As another example, the use of the portable storage portion with network function 1 with one or more computers is now further described. With the portable storage portion with network function 1, computer operation may be executed at any place on any computer or electronic apparatus 6 by having one computer or the electronic apparatus 6 integrated with the portable storage portion with network function 1 by mean of the interface portion 2, and the computer or data or multimedia data files may be stored on the remote network host 12 or on an another computer which is also integrated with the portable storage portion 1. The user can then link together the data sharing network device 100 which has the portable storage portion with network function 1 with the remote network host 12 through the interface unit 18, such as an USB interface, located on the computer integrated with the portable storage portion 1. In this manner, a user need not carry a clumsy notebook computer around, and would not be restricted or limited to a specific computer to use the remote network host 12 for accessing data stored on a plurality of computers which are integrated with the portable storage portions 1. Because all of the linked computers are comprised of integrated portable storage portions 1, therefore, operational functions such as data access rights, data network security management, user authentication and password management, data traffic control, user web interface for file sharing content management capable of real-time viewing of content information among all of linked computers, data buffering management, managing user requests to and from computers to the remote network host 12, and tracking of user data usage status at each computer integrated with the portable storage portion 1 are also provided.
Please refer to FIG. 4 that shows a configuration of a portable storage device with network function which includes an interface unit 22, a network unit 33, a memory unit 4, and a processing unit 5. The interface unit 22 may be a microSD 8-pin interface or a SDHC 9-pin interface depending upon the type and format of the portable storage device with network function being used. The network unit 33 may be an integrated IEEE 802.11 g/n WI-FI unit which operates on a 2.4 GHz band wireless network 13. The memory unit 4 may be in the form of a conventional SDHC memory card, for example. The processing unit 5, which may include, but not limited to a SOC (system on chip) configuration. The interface unit 22 is removably connected to the electronic apparatus 6 such as the digital camera 7 inside the SDHC memory card slot of the camera 7. The network unit 33 is fully integrated to provide the portable storage device with wireless broadband internet capabilities for automatically linking with a wireless access point. The wireless access point maybe be a conventional wireless router which is located in close proximity from the portable storage device such as within 20 meters. In addition, the network unit 33 can then be wirelessly linked to a remote network host 12, such as, for example, in the form of a desktop PC, upon turning on the camera 7 which has the portable storage device being coupled. The memory unit 4 is located within the portable storage device, and is used for providing access of image and video data and temporary data storage of image and video data received from the camera 7. In this embodiment, data is directly automatically stored on the remote network host 12 upon the configuration of a data sharing management software program. The data sharing management software program has a conventional graphic user interface. An user can decide upon the exact manner in which the data downloaded from the portable storage device with network function to the remote network host 12 is to be shared with one or more of the internet multimedia data hosting sites such as Flickr® or Youtube® or Facebook®, for example by using the above data sharing management software program.
The foregoing description has been directed to specific embodiments of this invention. It will be apparent, however, that other variations and modifications may be made to the described embodiments, with the attainment of some or all of their advantages. For example, it should be understood that the portable storage portion could be separated or being apart from the network function portion, wherein the network function portion could reside in the integrated electronic apparatus itself, an example would be for instance, a cell phone or wireless phone. Here, the network function portion then becomes part of the electronic apparatus itself to form a network or communication electronic device. Another possible modification can be the replacement of the interface portion 2 with an interface unit 18 described in the first embodiment in FIG. 1 that shows a configuration of a data sharing network device 100. In this modified embodiment, the interface unit 18 may include, but is not limited to an USB interface, an SD interface, a CF interface, an XD interface, a PCMCIA interface, a 1394 interface, an infrared interface, and a Bluetooth interface. Therefore, it is the object of the appended claims to cover all such variations and modifications as come within the true spirit and scope of the invention.
1. A data sharing network device, comprising: an electronic apparatus; and a portable storage portion with network function, and the portable storage portion with network function, comprising: an interface portion or an interface unit for integrating or coupling the portable storage portion with network function to an electronic apparatus, respectively; a network unit located within the portable storage portion with network function for linking with a remote network host; a memory unit located within the portable storage portion with network function providing access of data and storing data receiving from the electronic apparatus; and a processing unit located within the portable storage portion with network function that receives instructions from the electronic apparatus for controlling access of data between the memory unit and the electronic apparatus with data transmission via the interface portion or the interface unit, access of data between the memory unit and a remote network host with data transmission via the network unit, and access of data between the memory unit and a second electronic apparatus with data transmission via the network unit through the remote network host wherein data is stored on the remote network host, the memory unit, or the memory unit located within the portable storage portion with network function integrated with the second electronic apparatus.
2. The data sharing network device as claimed in claim 1 further comprising an interface unit, wherein operating under a wired network system, the data is transmitted via an interface unit, and the data sharing network device is linked together with the remote network host through the interface unit.
3. The data sharing network device as claimed in claim 1, wherein operating under a wireless network system, the data is transmitted via the network unit, and the data sharing network device is linked together with the remote network host through the network unit.
4. The data sharing network device as claimed in claim 1, wherein the interface unit is selected from the group consisting of USB interface, an SD interface, a CF interface, an XD interface, a PCMCIA interface, a 1394 interface, an infrared interface, and a Bluetooth interface.
5. A portable storage portion with network function, comprising: an interface portion for integrating the portable storage portion with network function to an electronic apparatus; a network unit located within the portable storage portion with network function for linking with a remote network host; a memory unit located within the portable storage portion with network storage function providing access of data and storing data receiving from the electronic apparatus; and a processing unit located within the portable storage portion with network function that receives instructions from the electronic apparatus for controlling access of data between the memory unit and the electronic apparatus with data transmission via the interface portion, and access of data between the memory unit and a remote network host with data transmission via the network unit wherein data is stored on the remote network host, or on the memory unit.
6. The portable storage portion with network function as claimed in claim 5, wherein the memory unit has an operating system stored therein.
7. The portable storage portion with network function as claimed in claim 5, wherein the operating system includes a network driving unit for driving the network unit.
8. The portable storage portion with network function as claimed in claim 5, wherein the operating system includes an interface driving unit for driving the interface portion.
9. The portable storage portion with network function as claimed in claim 5, wherein the operating system includes a network file management system, via which the electronic apparatus manages the access of data between the memory unit and the electronic apparatus, and between the memory unit and the remote network host.
10. The portable storage portion with network function as claimed in claim 5, wherein the operating system includes a system security unit for protecting the operating system against computer virus infection.
11. The portable storage portion with network function as claimed in claim 5, wherein the operating system includes an authentication unit for authenticating at least one user.
12. The portable storage portion with network function as claimed in claim 5, wherein the interface portion is selected from the group consisting of a flexible circuit board, a connector, a plurality of wire bonds, and a flip chip bonding.
13. The portable storage portion with network function as claimed in claim 5, wherein the electronic apparatus is selected from the group consisting of a digital camera, a personal computer, a notebook computer, a PDA, a phone, a computer tablet device, an electronic reader device, a portable game device, a speaker system, and a liquid crystal display.
14. The portable storage portion with network function as claimed in claim 5, wherein the network unit is selected from the group consisting of a wired network chip and a wireless network chip.
15. The portable storage portion with network function as claimed in claim 5, wherein the processing unit comprises a SOC (system on chip) configuration.
16. The portable storage portion with network function as claimed in claim 5, wherein the authentication unit conducts authentication in a manner selected from the group consisting of password authentication, fingerprint authentication, and voice authentication.
17. A portable storage portion with network function, comprising: an interface portion for coupling to a first electronic apparatus; a network unit coupled to the portable storage portion for linking with a remote network host; the remote network host transfer data between the portable storage portion with network function and a second electronic apparatus; a memory unit located within the portable storage portion providing access of data and storing data receiving from the first electronic apparatus; and a processing unit located within the portable storage portion that receives instructions from the first electronic apparatus for controlling access of data between the memory unit and the first electronic apparatus with data transmission via the interface portion, and access of data between the memory unit and a remote network host with data transmission via the network unit, wherein data is stored on the remote network host or on the memory unit.
18. A data sharing network device, comprising: an electronic apparatus; a network unit located outside the data sharing network device for linking with a remote network host; and a portable storage portion, and the portable storage portion, comprising: an interface portion for integrating the portable storage portion to an electronic apparatus; a memory unit located within the portable storage portion providing access of data and temporarily storing data receiving from the electronic apparatus; and a processing unit that receives instructions from the electronic apparatus for controlling access of data between the memory unit and the electronic apparatus with data transmission via the interface portion, access of data between the memory unit and a remote network host with data transmission via the network unit, and access of data between the memory unit and a second electronic apparatus with data transmission via the network unit through the remote network host wherein data is stored on the remote network host, the memory unit, or the memory unit located within the portable storage portion integrated with the second electronic apparatus.
19. A portable storage device with network function, comprising: an interface unit; one or more outside memory units, the outside memory units are coupled to the portable storage device with network function through the interface unit; a network unit coupled to the portable storage device with network function through the interface unit for linking with the internet; a memory unit located within the portable storage device providing access of data and temporarily storing data receiving from the one or more electronic apparatuses accessible from the internet and the one or more outside memory units; and a processing unit located within the portable storage device that receives instructions from the internet through the network unit via a web browser for controlling access of data between the memory unit and the one or more electronic apparatuses with data transmission via the network unit, and access of data between the memory unit and the one or more outside memory units with data transmission via the interface unit, wherein data is stored on the outside memory unit, and the portable storage device with network function is removably coupled to the electronic apparatuses through the internet, and the portable storage device with network function transfer data between the outside memory units and the electronic apparatuses through the internet.
20. A portable storage device with network function, comprising: an interface unit for coupling the portable storage portion to a first electronic apparatus; a network unit is coupled to the portable storage unit using the interface unit for linking with the internet; a memory unit located within the portable storage device providing access of data and temporarily storing data receiving from the first electronic apparatus; and a processing unit located within the portable storage device that receives instructions from a second electronic apparatus for controlling access of data between the memory unit and the second electronic apparatus with data transmission via the interface unit, wherein data from the first electronic apparatus is directly stored on the memory unit and is transferred from the memory unit to the network unit; and the data is then transferred from the network unit through the internet to the second electronic apparatus in real time; the portable storage device with network function is removably coupled to the first electronic apparatus.
21. A portable storage device with network function, comprising: an interface unit for coupling to an electronic apparatus; a network unit located within the portable storage device for automatically wirelessly linking with a remote network host through the internet upon turning on the electronic apparatus; a memory unit located within the portable storage device providing access of data and temporarily storing data receiving from the electronic apparatus; and a processing unit located within the portable storage device that receives instructions from the electronic apparatus for controlling access of data between the memory unit and the electronic apparatus with data transmission via the interface unit, and access of data between the memory unit and a remote network host with data transmission via the network unit, wherein data is directly automatically stored on the remote network host upon the configuration of a data sharing management software program on the remote network host, and the data is then transferable to one or more internet multimedia data hosting websites through the use of the data sharing management software program; the portable storage device with network function is removably coupled to the electronic apparatus, expanding storage capacity of the electronic apparatus..
| 40,596 |
https://github.com/midoritiba/goalsetter-mern-app/blob/master/backend/server.js
|
Github Open Source
|
Open Source
|
MIT
| null |
goalsetter-mern-app
|
midoritiba
|
JavaScript
|
Code
| 92 | 317 |
const path = require ('path')
const express = require('express')
const colort = require ('colors')
const connectDB = require('./config/db')
const { errorHandler } = require('./middleware/errorMiddleware')
const dotenv = require('dotenv').config()
const port = process.env.PORT || 5000
connectDB()
const app = express ()
//Middleware
app.use(express.json())
app.use(express.urlencoded({extended: false}))
//Route - Goals & Users
app.use('/api/goals', require('./routes/goalRoutes'))
app.use('/api/users', require('./routes/userRoutes'))
//Serve frontend
if(process.env.NODE_ENV === 'production'){
app.use(express.static(path.join(__dirname, '../frontend/build')))
app.get('*', (req, res) => res.sendFile(path.resolve(__dirname, '../', 'frontend', 'build', 'index.html')))
}else{
app.get('/', (req, res) => res.send('Please set to production'))
}
//Error Handler
app.use(errorHandler)
app.listen(port, () => console.log(`Server up and running on port ${port}`))
| 8,504 |
5295769_1
|
Caselaw Access Project
|
Open Government
|
Public Domain
| 1,892 |
None
|
None
|
English
|
Spoken
| 1,066 | 1,217 |
The opinion of the court was delivered by
Scott, J.
The respondent moves to strike the statement of facts because the judge before whom the cause was tried settled the statement after he had gone out of office, and, under the authority of Faulconer v. Warner, 2 Wash. 525 (27 Pac. Rep. 274), the motion must be granted. But appellant contends that he has lost his right of appeal in this case without any fault of his, and that under such circumstances this court should grant him a new trial. He cites us..to a number of cases where courts of last resort in other states have upon such grounds granted new triáis. But his application fails to make a case for such action upon our part in two particulars: First, The cause was determined in the lower court more than two months before the judge went out of office, by the expiration of his term, and there is no showing of diligence in the matters connected with the settlement of the statement. Furthermore, no application was made to the superior court to have the facts settled. Our statute provides that the party desiring to settle a statement shall apply to the "court or judge who tried the cause." It can hardly be supposed that the words "court" and "judge" were both intended to refer to the person occupying the bench at the time of the trial, and yet this must be so, if only the judge who sat at the trial can settle the statement. This would be giving no effect to the word "court." While the same judge who presided at the trial continues in office, application to settle the facts is always made to him and not to the court. The word "court" must mean something more than the judge who tried the cause. The judges change but the court continues, and it seems to me the more reasonable interpretation of the language is, that while the same judge remains on the bench, application to settle the facts should be made to him, and where he has been succeeded in office by another, the power to settle the facts rests with, or is retained by, the court, and application should be made to it by some sort of proceeding, though most likely it could afterwards be pursued to a determination before the judge at chambers. While no particular manner of proceeding therefor is pointed out by the statute, or fixed by rule, it can be instituted by motion or petition or in any proper way upon due notice to the other party. In the absence of any other regulations, the superior court could direct the proceeding by rule or order. To hold otherwise would lead to results which it seems could not have been contemplated by the legislature. If the judge whose term of office has expired can settle the statement, it must be his duty to do it. It cannot, I think, be contended successfully that it would be optional with him to act or not in the premises. If so, he could settle a statement in one case and refuse to do so in another, and the party for whom he should refuse to act would have no remedy. No such uncertain state of affairs could have been intended. If the statute does fix the power to settle the statement in the person of the judge who tried the cause, then clearly his successor or the court could not act, and if the person who was the judge can act in one case he must act in all. This would lead to a peculiar condition, if a person who has gone out of office and whose pay stopped the day his office ended, must continue to discharge some of the duties of that office indefinitely, for such uncertain time as he might be required or called upon to act to settle statements upon appeals in cases previously tried before him. While the statute provides that the notice for an application to settle a statement of facts must be given within thirty days after the rendition of judgment, and the day fixed not more than thirty days distant from the time of giving the notice, thus limiting the time in all to sixty days; it also provides that the settlement may be adjourned to a later day by order of said "court or judge," and it would be the duty of the court or judge to adjourn it in some instances where, notwithstanding the use of due diligence, more time should be required, or where the party was prevented from proceeding by circumstances over which he had no control and which he could not avoid, and the length of time he would be required to so serve would thus be rendered still more uncertain. Certainly a person who has gone out of office should not be compelled to perform the duties of that office under such circumstances, and if he cannot be compelled to act in all cases, it follows that he has no option or authority tó act in any. Apparently it would be desirable that the law should make it the duty of the judge to proceed with the settling of statements of facts after the expiration of his term of office, in necessary cases. But this is a matter for legislative attention, to fix the time within which he should so proceed and provide for his compensation. The fact that no such provisions were made in any of the statutes relating to the duties of superior court judges and their tenure of office, renders it quite certain that it was not intended to impose this onerous duty upon them after the expiration of their term of office. It is apparent from the whole legislation that it never was contemplated as a part of the contract. In a proceeding to settle a statement before a succeeding judge, to assist in ascertaining the facts, the judge who tried the cause can he subpoenaed and required to testify. The motion to strike the statement is granted and, as there is nothing left upon which error can be founded the judgment is affirmed.
Hoyt and Stiles JJ., concur.
Dunbar, J., concurs in the result.
Anders, O. J. — For the reasons given in the case of Faulconer v. Warner, I am constrained to dissent..
| 8,292 |
2365907_1
|
Court Listener
|
Open Government
|
Public Domain
| 2,013 |
None
|
None
|
Unknown
|
Unknown
| 2,907 | 3,815 |
35 Md. App. 461 (1977)
371 A.2d 674
WILLIAM THOMAS BROOKS, JR.
v.
STATE OF MARYLAND.
No. 647, September Term, 1976.
Court of Special Appeals of Maryland.
Decided April 7, 1977.
The cause was argued before MOYLAN, DAVIDSON and LISS, JJ.
Bradford C. Peabody, Assigned Public Defender, with whom was Alan H. Murrell, Public Defender, on the brief, for appellant.
Arrie W. Davis, Assistant Attorney General, with whom were Francis B. Burch, Attorney General, Arthur A. Marshall, Jr., State's Attorney for Prince George's County, and Daniel Cassidy, Assistant State's Attorney for Prince George's County, on the brief, for appellee.
LISS, J., delivered the opinion of the Court.
William Thomas Brooks, Jr., appellant, was convicted by a jury in the Circuit Court for Prince George's County of robbery with a deadly weapon, carrying a handgun and use of a handgun in the commission of a crime of violence. Sentences were imposed on each of these convictions, and it is from these judgments that this appeal was taken. It is not *463 necessary for the purposes of this appeal to relate the facts concerning the armed robbery which occurred on February 16, 1975, at a restaurant in Langley Park, Maryland.
The appellant offers five grounds for reversal of the judgments against him; we find none to be meritorious and shall affirm. He contends first that the trial court erred in not granting his motion to dismiss the indictment against him on the ground that he was denied a speedy trial. He relies on the criteria set out in Barker v. Wingo, 407 U.S. 514, 92 S. Ct. 2182, 33 L. Ed. 2d 101 (1972), as the balancing test to be applied in determining this issue. Erbe v. State, 276 Md. 541, 350 A.2d 640 (1976), is cited as authority for the proposition that the "triggering mechanism" of Barker is activated prima facie if the lapse between arrest and trial is longer than one year. The total time involved in this case is between March 31, 1975 and May 5, 1976. This delay of 14 months is sufficient to trigger scrutiny and require us to examine the reasons for the delay, the possibility of prejudice to the appellant, and the effect of the assertion or lack of assertion below of the right to a speedy trial. See Jones v. State, 279 Md. 1, 367 A.2d 1 (1976).
Our task is simplified by appellant's concession in his brief that only a total of six months of the delay is even allegedly attributable to the State. The remaining eight months are presumably assessed as with that period allowable for the orderly administration of justice and/or appellant's own dilatoriness, and cannot be charged against the State. See Jones v. State, supra; Lee v. State, 32 Md. App. 671, 363 A.2d 542 (1976); Ward v. State, 30 Md. App. 113, 351 A.2d 452 (1976).
The record shows that appellant was incarcerated in Virginia during the six months at issue, and that the Maryland prosecutor was unable to secure the cooperation of the Virginia authorities in producing appellant for trial. On at least one occasion a writ requiring appellant's presence in Maryland for the purpose of trial was returned with the notation "Writ not honored by Virginia." A careful consideration of the record convinces us that the State acted in good faith in attempting to have appellant brought to *464 Maryland. As we held in Isaacs v. State, 31 Md. App. 604, 358 A.2d 273 (1976), cert. den., 278 Md. 724 (1976); Davidson v. State, 18 Md. App. 61, 305 A.2d 474 (1973); cert. den., 269 Md. 757 (1973), the State cannot be charged with that portion of the delay resulting from appellant's criminal acts in another state or his wilful absence from Maryland. Accordingly, since no portion of the delay is "attributable" to the State, we need not examine prejudice and assertion of the right to speedy trial, and we conclude that the trial court properly denied appellant's motion to dismiss for lack of a speedy trial.
The appellant next asserts that the trial court erred in allowing the State to introduce evidence that the appellant, after having already made an exculpatory statement to the police, refused to answer other questions posed by them. The State called as one of its witnesses a Detective John Lew who testified as to certain written and oral statements made by the appellant in the course of a custodial interrogation. It was conceded that the appellant had been advised of his constitutional rights and had signed a "waiver form." When the State offered the statements into evidence, trial counsel objected on the grounds that certain portions were "not relative to this case." At a bench discussion, it was ascertained by the court that the appellant's counsel was disturbed by a statement made by his client to Detective Lew in which he disavowed having committed this crime with a black accomplice because he was prejudiced toward blacks. Counsel contended that the reading of this statement to the jury would be "too inflammatory to help." The trial court overruled the objection saying:
"I think it's relevant for the reason that there are allegations made that there are accomplices in the case and of the black race, and I am sure that's what he was questioning in regard to. Did he commit a robbery with another white and black male, and he, of course answers he's prejudiced against blacks and wouldn't commit any crime with a black. I think it's relevant. Admit the statement in total."
*465 1 Wharton, Criminal Evidence § 151 (13th ed. 1972) defines relevant evidence:
"Any evidence which is helpful in getting at the truth of a material issue is relevant, even though it is only a link in the chain of facts which must be proved to make the proposition at issue appear more or less probable.... Evidence will be excluded as irrelevant, then, when the fact which it would prove or disprove is not material to the prosecution or defense."
Applying that test, we believe that the trial court was correct in admitting the statement voluntarily made by the accused to the police. Nor do we perceive any prejudice arising from the submission to the jury of one of the reasons given by appellant in attempting to exculpate himself from the crime with which he was charged. See Brown v. State, 29 Md. App. STATE'S ATTORNEY: Did you ask him where he was on this particular night?
DETECTIVE LEW: Yes.
STATE'S ATTORNEY: Did you ever give him the name of any people he was allegedly with?
DETECTIVE LEW: No, I didn't.
STATE'S ATTORNEY: Did the defendant make any further statement at this time?
DETECTIVE LEW: No, sir.
*466 THE COURT: Did you ask him where he was that night?
THE WITNESS: Yes.
THE COURT: What's your answer.
THE WITNESS: `Witness did not reply.'"
Appeal counsel[1] has very diligently briefed both the Federal and State cases which hold that an accused's initial waiver of his right to remain silent does not preclude a later assertion of that right. He urges that we ought to apply the principles laid down in Younie v. State, 272 Md. 233, 244, 322 A.2d 211, 217 (1974), in which our Court of Appeals held that, "Silence in the context of a custodial inquisition is presumed to be an exercise of the privilege against self incrimination...." He contends that permitting the submission to the jury of the fact that the appellant remained silent in response to certain questions asked by the detective was prejudicial error.
There is, however, a fatal flaw in the appellant's argument. A careful reading of the trial transcript discloses that no objection was made to the questions asked the detective by the State's Attorney and the trial judge during the colloquy; that no motion was made to strike the testimony, nor was there any constitutional objection raised to the questions asked and the answers given. It is apparent that the appellant's counsel with the benefit of the "instant replay" of the trial transcript elected to raise the issue for the first time in the appeal before us. We have said, in too many cases to enumerate here, that we shall adhere to Maryland Rule 1085 and will not consider on appeal an issue not raised and decided in the trial court, nor will the fact that the question raised is a constitutional one defer us from the application of that rule. Smith v. State, 16 Md. App. 317, 295 A.2d 802 (1972). We therefore decline to rule on this issue.
As his third ground for reversal, the appellant maintains that the trial court erred in excluding from evidence the *467 partial transcript of the appellant's trial for another armed robbery alleged to have been committed by the appellant in nearby Virginia. The testimony which the appellant attempted to introduce was that of the owner of a restaurant in Arlington, Virginia, who allegedly stated that the armed robbery occurred on the same date and approximately the same time as the robbery in the case we here consider. The appellant suggests that the testimony would have substantiated his alibi that he was in Virginia at the time that the Maryland robbery was committed and would have explained his silence during his custodial interrogation. The appellant urges as authority for his position Contee v. State, 229 Md. 486, 184 A.2d 823 (1962), cert. denied, 374 U.S. 841 (1963), and Britton v. State, 2 Md. App. 285, 234 A.2d 274 (1967).
The appellant's ingenious effort to stretch these cases to fit his last does not withstand close scrutiny. Chief Judge Gilbert of this Court in the recent case of Thomas v. State, 32 Md. App. 465, 361 A.2d 138 (1976), discussed the general rule as to the admission of testimony given at a prior trial by a witness who later became incompetent. He there said at pp. 471-72 quoting from Contee:
"It is well settled that testimony taken at a former trial may be admitted, if it be shown that the witness is dead, insane, or beyond the jurisdiction of the court, or on diligent inquiry cannot be located, or that some other circumstance exists which shows that the witness who gave the testimony at the former trial cannot be procured as a witness at the second trial.... The writers and authorities all agree that where there was an opportunity to cross-examine the witness in the former trial, there is no violation of the right to be confronted with the witnesses against the accused, under Art. 21 of the Maryland Declaration of Rights or under the Due Process clause of the Fourteenth Amendment to the Federal Constitution. Since there is no constitutional right *468 involved, there has been a discernible tendency, we think, to liberalize the rule, which was first applied ex necessitate in the case of death." (citations omitted)
The mote in appellant's argument, however, is found in the case of Barber v. Page, 390 U.S. 719, 88 S. Ct. 1318, 20 L. Ed. 2d 255 (1968). In that case Barber and Woods were jointly charged with armed robbery. During the preliminary hearing Woods waived his privilege against self-incrimination and testified incriminating Barber. When Barber was tried in Oklahoma several months later, Woods was in a federal prison in Texas. Oklahoma made no effort to obtain Woods' presence at trial, but introduced, over petitioner's objection, the transcript of Woods' testimony at the preliminary hearing on the basis that he was out of the State and unavailable to testify. Barber was convicted; the United States Supreme Court reversed and enumerated the test for determining the admissibility of the previous testimony in such circumstances at pp. 723-25, 88 S. Ct. Whatever may have been the accuracy of that theory at one time, it is clear that at the present time increased cooperation between the States themselves and between the States and the Federal Government has largely deprived it of any continuing validity in the criminal law....
*469 ... In short, a witness is not `unavailable' for purposes of the foregoing exception to the confrontation requirement unless the prosecutorial authorities have made a good-faith effort to obtain his presence at trial." (footnotes omitted)
See also Berger v. California, 393 U.S. 314, 89 S. Ct. 540, 21 L. Ed. 2d 508 (1969); Dutton v. Evans, 400 U.S. 74, 91 S. Ct. 210, 27 L. Ed. 2d 213 (1970); Mancusi v. Stubbs, 408 U.S. 204, 92 S. Ct. 2308, 33 L. Ed. 2d 293 (1972) (dissenting opinion); State v. Collins, 265 Md. 70, 288 A.2d 163 (1972).
In this case we deal not with an assertion of a defendant's Sixth and Fourteenth Amendment right of confrontation in the face of the State's attempt to introduce prior testimony; rather, we deal with the parallel situation of a hearsay objection by the State in the face of the defendant's attempt to introduce prior testimony as a hearsay exception. Under this exception the hearsay testimony is admissible only if a proper foundation has been laid including a showing that the declarant is unavailable. Wharton, Criminal Evidence § 650 (Torcia ed. 1973); McCormick, Evidence § 253 (2d ed. 1972). The burden is on the person offering the prior recorded testimony to show that a good faith effort has been made to produce the witness in court so that the witness may be subject to cross-examination under oath, and so that the trier of the fact may observe the demeanor of the witness while giving his testimony.
The federal government and practically all states have adopted procedures for the securing of the attendance of material witnesses from another state to testify in criminal prosecutions. Both Maryland and Virginia have adopted the "Uniform Act to Secure the Attendance of Witnesses from Without a State in Criminal Proceedings."[2]
In Britton, supra, and Reckard v. State, 2 Md. App. 312, 234 A.2d 630 (1967), this Court held that the State need not resort to the provisions of the Uniform Act in order to *470 invoke the rule that testimony given at a former trial may be admitted if it is shown that the witness is beyond the boundaries of the State or, on diligent inquiry, cannot be located. In view of the Supreme Court's subsequent decision in Barber, supra, were the identical issue raised here now, we would reach the opposite result. Analogously, we now hold that a defendant must show that he used the provisions of the Act but was nonetheless unable to secure the attendance of an out-of-state witness before such a witness' testimony, given at a former trial, may be admitted.
The defendant failed completely in his duty to lay the foundation required before the trial court could consider the admissibility of the prior testimony. There is no showing that the witness was in fact unavailable and no evidence of a good faith effort to secure the attendance of the witness. Under these circumstances, the trial court was correct in sustaining the objection to the admissibility of the transcript.
Since the unavailability of the witness has not been sufficiently established, we do not reach the questions of whether there was sufficient evidence of identity of issues and parties and sufficient opportunity for cross-examination to qualify the evidence under the prior recorded testimony exception to the hearsay evidence rule. See McCormick, supra, §§ 255-57; 5 J. Wigmore, Evidence §§ 1386-88, 1396, 1404 (3rd ed. 1940).
The appellant asserts as his fourth ground for reversal the trial court's error in permitting the prosecutor to question the appellant concerning the absence of a witness who was allegedly an accomplice of the accused and who could substantiate the appellant's alibi. The appellant, who testified in his own behalf in this case, had contended that he and the accomplice, one McCurry, had been engaged in the commission of another robbery in Virginia at the time the robbery in this case occurred. Over objection, the State's Attorney was permitted to ask the appellant, "Did you try to get him here today to testify for you?" The appellant answered in the negative.
*471 The appellant argues that the controlling law is found in 1 Wharton, Criminal Evidence § 148 (13th ed. 1972). Our reading of the legal principles there enunciated convinces us that the cited sections of Wharton deal with the instructions that may be given to a jury as to the inferences which may be drawn from the failure of a party to call a witness who could testify as to material facts. In this case no such instruction was requested, nor was such an instruction given to the jury. No such inference was called to the attention of the jury in argument. We believe that the question was permissible cross-examination utilized to attack the credibility of the alleged alibi of the appellant. We find no merit in the asserted ground for reversal.
Finally, the appellant urges that his conviction for unlawfully carrying a handgun merged into the more serious offense of use of a handgun in a crime of violence. Again, no such issue was raised in the trial below. The issue is therefore not properly before us on appeal. Maryland Rule 1085.
Judgments affirmed.
Costs to be paid by appellant.
NOTES
[1] Appeal counsel was other than trial counsel.
[2] Maryland Code (1974, 1976 Cum.Supp.), Courts and Judicial Proceedings Art. § 9-301 et seq.; Virginia Code (1950, 1976 Supp.) § 19.2-272 et seq.
| 47,156 |
https://github.com/gsh0581/waimai/blob/master/src/pages/index/store/actions/constants.js
|
Github Open Source
|
Open Source
|
MIT
| null |
waimai
|
gsh0581
|
JavaScript
|
Code
| 25 | 67 |
export const ADD_TODO = 'ADD_TODO'
export const CHANGE_TAB = 'CHANGE_TAB'
export const HEAD_DATA = 'HEAD_DATA'
export const LIST_DATA = 'LIST_DATA'
export const ORDER_DATA = 'ORDER_DATA'
| 38,972 |
https://github.com/avttrue/fungus/blob/master/field/cell.h
|
Github Open Source
|
Open Source
|
MIT
| null |
fungus
|
avttrue
|
C
|
Code
| 81 | 268 |
#ifndef CELL_H
#define CELL_H
#include <QObject>
#include <QRect>
class CellInformation;
class Field;
class Cell : public QObject
{
Q_OBJECT
public:
explicit Cell(Field *parent);
QPoint getIndex();
void setPosition(const QPoint &value);
CellInformation* getOldInfo();
CellInformation *getNewInfo();
void clear();
Field *getField() const;
void applyInfo();
void flipInfo(const QPoint &value);
void invertState();
QRect getRect() const;
bool isObserved();
private:
Field* m_Field;
QPoint m_Index;
CellInformation* m_OldInformation;
CellInformation* m_NewInformation;
QRect m_Rect;
bool m_Observed; // флаг того, что клетка под наблюдением
public Q_SLOTS:
void setObservedOn();
void setObservedOff();
};
#endif // CELL_H
| 10,766 |
198800011622
|
French Open Data
|
Open Government
|
Licence ouverte
| 1,987 |
Association culturelle et sportive de l'école primaire des Huissiers
|
ASSOCIATIONS
|
French
|
Spoken
| 13 | 20 |
faire participer les enfants de l'école à des activités sportives, éducatives et culturelles
| 6,750 |
https://github.com/SpeedReflect/Endscript/blob/master/Endscript/Version.cs
|
Github Open Source
|
Open Source
|
MIT
| 2,021 |
Endscript
|
SpeedReflect
|
C#
|
Code
| 46 | 93 |
namespace Endscript
{
/// <summary>
/// Represents executable caller version that is being checked when parsing endscript files.
/// </summary>
public static class Version
{
/// <summary>
/// Major version value of executable caller.
/// </summary>
public static System.Version Value { get; set; }
}
}
| 1,961 |
https://ce.wikipedia.org/wiki/%D0%9B%D0%B8%D0%BF%D0%B5%D1%86%D1%8B
|
Wikipedia
|
Open Web
|
CC-By-SA
| 2,023 |
Липецы
|
https://ce.wikipedia.org/w/index.php?title=Липецы&action=history
|
Chechen
|
Spoken
| 108 | 389 |
Липецы () — Российн Федерацин Смоленскан областан Новодугинан кӀоштара эвла.
Бахархойн дукхалла
Климат
Климат барамера континенталан йу, амалехь барамера йовха аьхке а, барамера шийла Ӏа а ду. Ӏаьн хьалхара дакъа довха ду шолгӀачул. ХӀаваан йовхачу температуран (де-буьйсан йукъара барам) мур лаьтта 213-224 дийнахь. ГӀоролаш йоцучу муьран йукъара барам 125-148 де. Цхьацца шерашкахь хаало дикка дӀатовжар йийцинчу климатан амалех. Йочанийн шеран барам бу 645-691 мм. Кхааннах ши дакъа догӀан кепара догӀу, цхьа дакъа ло кепара хуьлу. Цхьаьна эшшара лон чкъор лаьтта декабрь болалуш, деша апрелан хьалхарчу декадехь.
Сахьтан аса
Кхузахь сахьт Москохца нийса лелаш ду. Сахьтан аса йу UTC+3.
Билгалдахарш
Хьажоргаш
Новодугинан кӀоштан индексаш
Новодугинан кӀоштан нах беха меттигаш
| 45,150 |
8112654_1
|
Court Listener
|
Open Government
|
Public Domain
| 2,022 |
None
|
None
|
English
|
Spoken
| 47 | 71 |
Opinion by
Rao, J.
In accordance with stipulation of counsel that the merchandise consists of samples similar in all material respects to those the subject of Carson M. Simon & Co. v. United States (46 Cust. Ct. 118, C.D. 2243), the claim of the plaintiff was sustained.
| 2,213 |
Subsets and Splits
Token Count by Language
Reveals the distribution of total tokens by language, highlighting which languages are most prevalent in the dataset.
SQL Console for PleIAs/common_corpus
Provides a detailed breakdown of document counts and total word/token counts for English documents in different collections and open types, revealing insights into data distribution and quantity.
SQL Console for PleIAs/common_corpus
Provides a count of items in each collection that are licensed under 'CC-By-SA', giving insight into the distribution of this license across different collections.
SQL Console for PleIAs/common_corpus
Counts the number of items in each collection that have a 'CC-By' license, providing insight into license distribution across collections.
Bulgarian Texts from Train Set
Retrieves all entries in the training set that are in Bulgarian, providing a basic filter on language.
License Count in Train Set
Counts the number of entries for each license type and orders them, providing a basic overview of license distribution.
Top 100 Licenses Count
Displays the top 100 licenses by their occurrence count, providing basic insights into which licenses are most common in the dataset.
Language Frequency in Dataset
Provides a simple count of each language present in the dataset, which is useful for basic understanding but limited in depth of insight.
French Spoken Samples
Limited to showing 100 samples of the dataset where the language is French and it's spoken, providing basic filtering without deeper insights.
GitHub Open Source Texts
Retrieves specific text samples labeled with their language from the 'Github Open Source' collection.
SQL Console for PleIAs/common_corpus
The query performs basic filtering to retrieve specific records from the dataset, which could be useful for preliminary data exploration but does not provide deep insights.
SQL Console for PleIAs/common_corpus
The query retrieves all English entries from specific collections, which provides basic filtering but minimal analytical value.
SQL Console for PleIAs/common_corpus
Retrieves all English language documents from specific data collections, useful for focusing on relevant subset but doesn't provide deeper insights or analysis.
SQL Console for PleIAs/common_corpus
Retrieves a specific subset of documents from the dataset, but does not provide any meaningful analysis or insights.
SQL Console for PleIAs/common_corpus
Retrieves a sample of 10,000 English documents from the USPTO with an open government type, providing a basic look at the dataset's content without deep analysis.
SQL Console for PleIAs/common_corpus
This query performs basic filtering to retrieve entries related to English language, USPTO collection, and open government documents, offering limited analytical value.
SQL Console for PleIAs/common_corpus
Retrieves metadata of entries specifically from the USPTO collection in English, offering basic filtering.
SQL Console for PleIAs/common_corpus
The query filters for English entries from specific collections, providing a basic subset of the dataset without deep analysis or insight.
SQL Console for PleIAs/common_corpus
This query performs basic filtering, returning all rows from the 'StackExchange' collection where the language is 'English', providing limited analytical value.
SQL Console for PleIAs/common_corpus
This query filters data for English entries from specific collections with an 'Open Web' type but mainly retrieves raw data without providing deep insights.
Filtered English Wikipedia Articles
Filters and retrieves specific English language Wikipedia entries of a certain length, providing a limited subset for basic exploration.
Filtered English Open Web Texts
Retrieves a subset of English texts with a specific length range from the 'Open Web', which provides basic filtering but limited insight.
Filtered English Open Culture Texts
Retrieves a sample of English texts from the 'Open Culture' category within a specific length range, providing a basic subset of data for further exploration.
Random English Texts <6500 Ch
Retrieves a random sample of 2000 English text entries that are shorter than 6500 characters, useful for quick data exploration but not revealing specific trends.
List of Languages
Lists all unique languages present in the dataset, which provides basic information about language variety but limited analytical insight.