text
stringlengths 10
10.1k
| source
stringclasses 1
value |
|---|---|
langerhans cell histiocytosis lch is a disease characterized by an uncontrolled clonal proliferation of langerhans cells whose aetiology is still unclear the clonal nature of lch could support the hypothesis that it is a neoplastic disease with unlimited growth potential one requirement for unlimited proliferation is the maintenance of telomere length in a group of patients we set out to investigate whether a telomere maintenance mechanism is indeed active in lch cells this work showed that lch cells from all restricted skin lch lesions expressed telomerase as assessed by human telomere reverse transcriptase htert immunohistochemistry whereas lch cells from the majority of the bone lesions analysed did not express htert interestingly in contrast to the solitary bone lesions lch cells from lesions of multisystem patients always expressed telomerase regardless of the lesional site in situ telomeric repeat amplification protocol trap assays performed on different lesional sites showed that this telomerase was active in addition the telomere length of lch cells from a htertpositive skin multisystem lesion was long and homogeneous when compared to that in the lch cells from htertnegative bone singlesystem lch lesions which was heterogeneous in length no evidence for an alternative lengthening of telomeres mechanism was found in htertnegative lesions the difference in telomerase expression and telomere length at the different lesional CS and in biopsies from patients with solitary versus multisystem disease appears to reflect the diverse clinical presentation and course of this disease the results from this study have important implications for understanding the nature of this disease
|
MEDAL
|
we examined the escape DUE study of CHF and pulmonary artery catheterization effectiveness DB to understand the impact and pathophysiology of RD in patients hospitalized with T3 decompensated heart failure hf
|
MEDAL
|
to unravel the conflicting data concerning the dependence of human cholesterol biosynthesis on functional peroxisomes we determined activities and C2 of selected enzymes involved in cholesterol biosynthesis in livers of pex KO a wellcharacterized model for human zellweger syndrome we found that all enzymes measured including putative peroxisomal enzymes are at least as AS in the peroxisomedeficient zellweger mice as in control mice indicating that mislocalization of enzymes to the cytosol does not lead to decreased activity or degradation prompted by these results we reexamined this aspect in human subjects by specific CEA measurements and immunoblotting with highly TPS antisera our results show that the previously reported deficiencies of mevalonate kinase and phosphomevalonate kinase activity in livers from human zellweger patients reflect the bad condition of the livers rather than mislocalization to the cytosol our data provide an explanation for the conflicting findings in the literature and show that great care should be taken in the interpretation of data obtained in postmortem mates of the NE peptides arginine vasotocin avt and urotensin ii uii were measured in the euryhaline flounder platichthys flesus following the acute hypoosmotic challenge of direct seawater sw to FW fw transfer hormone measures plasma osmolality and ion concentrations and tissue water content were determined and h after transfer plasma avt concentration fell initially following fw transfer but then returned toward pretransfer C2 by day plasma uii concentration decreased while urophysial uii content was increased following hypoosmotic challenge relative to sw timematched controls suggesting down regulation of the uii system during the initial stages after fw transfer these changes in NE activity were associated with a significant fall in plasma osmolality and major plasma ions positive correlations were observed between plasma avt and osmolality and cl and mg concentrations suggesting PET association of these plasma parameters with avt action andor control of avt secretion the initial response to hypotonic challenge involves reduced plasma avt and uii levels consistent with the proposed role for these hormones supporting flounder osmoregulation in hypertonic media
|
MEDAL
|
tuning curves were measured for units in the inferior colliculus of seven anesthetized kittens aged from to days at days of age the IC was divisible into central pericentral and external nuclei evidence was found for broader TCs to occur in the pericentral nucleus compared with the central nucleus as has been observed in the AD the ME was filled with serous fluid to days while the EAM remained collapsed until days CE nucleus tuning curves in kittens were relatively flat with high thresholds bestfrequency thresholds diminished from a mean of near db spl at days to near db in the AD the marked drop in thresholds between days and led to the adoption of the sharp form of PTC common for adults tonotopic organization of the CE nucleus was clear at day speculations were T3 about the dependence of CE AEP maturations on cochlear OD axon myelination in the AEP pathway and changes in synaptic density as a function of age
|
MEDAL
|
rodent models of sepsis differ from clinical human disease in that humans make substantially less wholebody nitric oxide and have different cellular responses to endotoxin sheep when exposed to endotoxin behave in a manner more similar to humans many studies of rodent IP blood mononuclear cells pbmcs exposed to endotoxin demonstrate increased cationic amino acid transporter CF particularly through the y transporter to supply arginine ATP to upregulated nitric oxide synthase whether this is true in sheep is not known we have studied cationic amino acid transport in sheep pbmcs stimulated with endotoxin using labelled lysine pbmcs stimulated both in vitro and in vivo show an initial reduction in total and y lysine transport T3 h SE to endotoxin a previously undescribed effect of endotoxin in in vitro G1 cells the reduction in y transport was prevented by the lipoxygenase inhibitor nordihydroguaretic acid ndga and the phospholipase inhibitor bromophenacyl bromide bpab but not cyclohexamide or a number of other inhibitors of intracellular secondmessenger pathways in contrast after h incubation the expected increase in total and y lysine transport was seen the increase in y transport could be prevented by cyclohexamide dexamethasone ibuprofen the protein kinase c inhibitor sphingosine ndga and bpab these results suggest that in response to endotoxin exposure there is an initial decrease in y activity mediated by a lipoxygenase product followed by a substantial increase in y activity mediated by the products of either cyclooxygenase or lipoxygenase cyclooxygenase andor lipoxygenase inhibition might be useful in reducing arginine transport and hence nitric oxide production in these cells
|
MEDAL
|
a new column was developed in this research it contains a proprietary bonded Si sorbent that exhibits mixed SE mechanism a singlecolumn SPE procedure was also developed for the screening of acidic neutral and basic abuse drugs the recovery of all tested drugs exceeded the extraction mechanism for different abuse drugs on the new column was explored and was compared with on other columns it is suggested that this column be effective in systematic toxicological analysis and better than other columns
|
MEDAL
|
the internal limiting membrane ilm and cortical vitreous of the rabbit and primate were studied with transmission electron microscopy following staining with the cationic dye AB gx an unusual feature of the cortical vitreal collagen fibril was its displacement from the ilm it did not insert into the LD the separation between vitreal collagen and the ilm was especially noticeable in the rb eye which possessed an extremely strong vitreal retinal att in the posterior fundus the lack of fibril IS was observed in rabbit tissue that had been fixed by quick freezing on a heliumcooled copper block the similarity in the appearance of tissue fixed by glutaraldehyde glutaraldehyde supplemented with alcian blue or by quick freezing suggested that the lack of collagen fibril IS into the ilm was an accurate representation of the relationship between collagen and the ilm it was found that these two animal species had radically different ilms the rabbit ilm was a thin basement membrane throiled to induce suppressive activity the suppressive activity of drantigen cultured TA is resistant to mitomycin c treatment and further the antigen specificity is maintained with or without mitomycin c treatment the kinetics of suppressor cell induction as well as the kinetics of suppression in the test mlr cultures are presented the implications of these results are discussed
|
MEDAL
|
the current article reviews prospective and experimental research on the relation between SE and perceptions of vulnerability these studies demonstrate that individuals with high selfesteem who engage in risk behavior often utilize a variety of selfserving cognitive strategies that protect them from fully acknowledging their vulnerability to the potential negative consequences of their behavior eg they minimize their estimates of personal risk and overestimate the prevalence of the risk behavior among their peers the article also provides data on an additional selfserving cognitive strategy employed by adolescents with high selfesteemalteration of perceptions of others reactions to their own risk SMB finally the article reviews the emerging literature on the relation between these cognitive strategies and maladaptive health SMB and proposes that whether these strategies are maladaptive depends on the nature of the threat and the availability of opportunities to engage in compensatory selfenhancement
|
MEDAL
|
in the netherlands universal antibody to hepatitis b core antigen antihbc donor screening was introduced in july to intercept potentially infectious donations slipping through hepatitis b surface antigen hbsag and hepatitis b virus hbv dna minipool screening hbv dna mp
|
MEDAL
|
to T0 the role of antigenspecific t lymphocytes in the pathogenesis of autoimmune hepatitis messenger rna of tcell receptors tcr was analyzed in CL biopsy specimens from four patients with AIH using the tcr betachain variable region family TPS oligonucleotides a remarkable bias for the usage of betachain VL region was detected in all four patients therefore nucleotide and CAA sequences of the complementaritydetermining region rearranged to the BV region which is a putative contact site for peptide fragments from antigens bound in the groove of the human leukocyte antigen molecule was further analyzed in randomly selected clones from each patient an aspargpro motif in the complementaritydetermining region was identified in three of four patients with HLA antigen dr and this motif was always rearranged to the betachain junctional region from these results betachain variable region aspargpro betachain junctional region tcell clones may be among the responsible lymphocytes involved in the CL damage in autoimmune SH especially in patients with HLA antigen dr thus an analysis of the complementaritydetermining region may give us an important clue to clarify characteristics of target antigens included in AIH
|
MEDAL
|
diffuse optical imaging doi is increasingly becoming a valuable neuroimaging tool when fmri is precluded recent developments in highdensity diffuse optical tomography hddot overcome previous limitations of sparse doi systems providing improved image SQ and brain specificity these improvements in instrumentation prompt the need for advancements in both i realistic forward CS modeling for accurate hddot image reconstruction and ii spatial normalization for voxelwise comparisons across subjects individualized forward CS models derived from subjectspecific anatomical images provide the optimal inverse solutions but such modeling may not be feasible in all situations in the absence of subjectspecific anatomical images atlasbased head models registered to the subjects head using cranial fiducials provide an alternative solution in addition a standard atlas is attractive because it defines a common coordinate space in which to compare results across subjects the question therefore arises as to whether atlasbased forward light modeling ensures adequate hddot image quality at the individual and group level herein we demonstrate the feasibility of using atlasbased forward CS modeling and spatial normalization methods both techniques are validated using subjectmatched hddot and fmri data sets for visual evoked responses measured in five healthy AD subjects hddot reconstructions obtained with the registered C1 anatomy ie atlas dot had an average localization error of mm relative to reconstructions obtained with the subjectspecific anatomical images ie subjectmri dot and mm relative to fmri data at the group level the localization error of atlas dot reconstruction was mm relative to subjectmri dot reconstruction and mm relative to fmri these results show that atlasbased image reconstruction provides a viable approach to individual head modeling for hddot when anatomical imaging is not available
|
MEDAL
|
promoters for vertebrate small nuclear rna snrna genes contain a relatively simple array of transcriptional control elements divided into PT and distal regions most of these genes are transcribed by rna polymerase ii eg u u whereas the u gene is transcribed by rna polymerase iii previously identified vertebrate u snrna gene promoters consist of a proximal sequence element pse and tata element in the PT region plus a distal region with octamer oct and sphi postoctamer homology sph elements we have found that zebrafish u snrna promoters contain the sph PE in a novel PT position immediately upstream of the tata PE the zebrafish sph element is recognized by sphbinding factorselenocysteine trna gene transcription activating factorzinc finger protein sbfstafznf in vitro furthermore a zebrafish u promoter with a defective sph element is inefficiently transcribed when injected into embryos
|
MEDAL
|
the present T0 investigated the photocatalytic activity of an sdoped tio photocatalyst with regards to dimethyl sulfide Kd under visiblelight irradiation along with its deactivation and reactivation the DMS conversion was between and for the lowest relative humidity range and close to for the two higher relative humidity ranges and the conversion was also close to for the two lowest input concentrations and ppm while it was between and at ppm and between and at ppm in contrast to the input concentration dependences on conversion the calculated Kd rates increased as input concentrations increased the dimethyl sulfide conversion at low concentrations or ppm which are associated with nonoccupational inn occurring however catalyst deactivations were observed during the photocatalytic process whdoor air quality issues was up to nearly for long time periods at least h without any significant catalyst deactivatioen higher concentrations and ppm were used the photocatalyst reactivated by using two types of air dried and humidified under visiblelight irradiation did not regain all of its initial MICs sulfate CG were qualitatively identified as the reaction products on the photocatalyst surface in addition gaseous byproducts quantitatively determined included dimethyl disulfide methanol and so it is noteworthy that the peak concentration of dimethyl disulfide ppm ppb generated over the photocatalytic process with the highest DMS input concentration exceeded the odor threshold value of ppb for dimethyl disulfide
|
MEDAL
|
urine drug screens are used extensively in substanceabuse treatment especially methadone maintenance treatment programs as well as criminaljustice and clinical research settings while positive urinalysis generally indicates drug use no information is provided about the context or DP of use a computer generated MM was created to examine the influence of drug use patterns and drug screen schedules upon urine test results the results indicate that when urine testing is performed at a rate of eight times per year the probability of testing positive in a given month is little better than even for daily use infrequent drug use is difficult to detect regardless of drug testing frequency and the benefits of more frequent drug testing are greatest with moderate drug use the data presented provide a guide for clinicians to match drug screen schedules to frequency or DP of suspected drug use
|
MEDAL
|
from january through june cases of coccidioidomycosis in human immunodeficiency virus HIV+ persons were identified in arizona incidence persons living with aids a casecontrol T0 was conducted to evaluate risk factors for coccidioidomycosis in HIV+ persons a case was defined as laboratoryconfirmed incident coccidioidomycosis in a person INF with hiv for or months and each case patient had CP matched by county age group sex hivaids status and cd lymphocyte count multivariable analysis identified black race and a PH of OP or EC to be associated with increased risk of coccidioidomycosis KPI therapy was associated with a reduced risk in persons with previous history of OP or esophageal candidiasis having received an azole drug was associated with a reduced risk odds ratio confidence interval p physicians may need to consider azole chemoprophylaxis for HIV+ persons who live in areas of endemicity have cd cell counts microl are black or have a PH of thrush
|
MEDAL
|
recurrent excitatory circuits and abnormal recurrent excitatory inputs are essential in epileptogenesis studies in temporal lobe epilepsy have shown that mossy fiber sprouting which represents synaptic reorganization renders the formation of abnormal recurrent excitatory circuits and inputs the rat TOR mtor pathway has recently been proved important in mossy fiber sprouting in the present study rapamycin a mtor inhibiter was injected into the mouse of temporal lobe epilepsy electrophysiological and histological properties of the hippocampus were investigated by whole cell patch clamp extracellular recording and timm staining following the OD of epilepsy frequency of sEPSCs epscs and amplitude of antidromically evoked epscs in granule cells were remarkably increased as well as the epileptiform activity and MFS were detected which indicated the formation of abnormal recurrent excitatory circuits by the use of rapamycin frequency of sEPSCs amplitude of antidromically evoked epscs the epileptiform activity and MFS were all remarkably suppressed our findings suggested an antiepileptogenic role of rapamycin by suppressing the recurrent excitatory circuits of dentate gyrus
|
MEDAL
|
lichen sclerosus et atrophicus rarely affects the feet or hands and in this case it is generally part of widespread cutaneous involvement we report a case of lichen sclerosus et atrophicus involving only the extremities and the vulvar and perigenital area
|
MEDAL
|
retinoic acid ra induces a human teratocarcinoma cell line ntera or nt to give rise exclusively to postmitotic neuronlike ntn cells but ntn cells never acquire a fully mature neuronal phenotype in vitro to determine whether ntn cells can mature into adult neuronlike cells in vivo purified ntn cells were grafted into different regions of the central nervous system cns of adult and neonatal athymic mice and the grafts were examined immunohistochemically by CS confocal and electron microscopy using antibodies to a panel of developmentally regulated neuronal polypeptides ntn grafts were distinguished from endogenous mouse SN with antibodies that recognize human or mu specific epitopes in selected neuronal polypeptides viable ntn cells were identified in of VG recipients n and some grafts survived months within weeks of implantation grafted ntn cells reextended their processes and the location of the grafts eg SP versus neocortex appeared to determine the extent to which processes were elaborated within the early posttransplantation period grafted ntn cells expressed the same neuronal polypeptides as their in vitro counterparts however between weeks and months postimplantation the grafted ntn cells progressively acquired the molecular phenotype of fully mature in vivo neurons as evidenced by dramatically increased expression of the most highly phosphorylated isoforms of the NF-H and the de novo expression of adult cns tau notably the time course for the extension of processes and the expression of neuronal polypeptides by ntn grafts was similar in neonatal and adult mice although grafted ntn cells formed synapselike structures and elaborated dendrites and axons these axons remained unmyelinated finally none of the transplanted ntn cells reverted to a neoplastic state these studies demonstrate that pure populations of grafted human ntn cells acquire a fully mature neuronal phenotype in vivo and that these cells integrate and survive for year postimplantation in the mouse cns these human neuronlike cells are an attractive MM system for studies of neuronal development polarity and transplantation
|
MEDAL
|
the purpose of the present T0 was to determine whether Pr women with PN have differences of pelvicalyceal systems compared with normal Pr control subjects that might predispose to upper urinary tract infection ultrasonographic examination of both kidneys in coronal and axial planes of women with clinical PN and positive urine cultures was compared with results in control subjects matched for gestational age parity and race women with RA or BL PN had increased dilation of the right calyceal system compared with controls cm vs cm p less than renal pelvis volume was increased as well vs cm p less than renal pelvicalyceal dilation in antepartum pyelonephritis was significantly increased compared with normal physiologic dilation of pregnancy followup nephrosonography in a small number of women n T3 treatment of pyelonephritis did not reveal a consistent decrease in renal dilation suggesting that dilation of the renal pelvis may antedate PN further T0 of this phenomenon is warranted
|
MEDAL
|
a male contraceptive trial was undertaken in men using a combination of oral medroxyprogesterone acetate mpa and oral methyltestosterone met the men were divided into four CG according to varying drug dosages and were followed for months control months treatment months followup months the parameters assessed included sperm count and motility SS gonadotropins and sex steroids and several PSA and hematological tests a questionnaire dealing with sideeffects and changes in SF was po intermittently although sperm count was suppressed most dramatically at the highest drug doses mpa mgmet mg it was not suppressed to infertile levels sperm motility was unaltered lh was modestly suppressed fsh was not suppressed testosterone was suppressed even at low doses dihydrotestosterone responses were inconsistent no significant PSA abnormalities or sideeffects occurred although some men experienced mild transient acne gynecomastia and decreased testicular size we conclude that in the doses used in this trial the combination of mpa and met is not effective for male contraceptive purposes and that higher doses may induce severe and undesirable sideeffects
|
MEDAL
|
we evaluated ceruletide a cholecystokininlike peptide in a doubleblind placebocontrolled study of male chronic schizophrenic patients T3 baseline investigations patients received microgramkg body weight ceruletide and patients received placebo normal saline intramuscularly once weekly for consecutive weeks psychopathology was rated on the brief psychiatric rating scale and the nurses observation scale for inpatient evaluation blood was drawn on the same days for estimation of norepinephrine epinephrine betaendorphin cortisol and prolactin there were no significant changes in PSA parameters with regard to psychopathology no significant differences in behavioral ratings were found between the ceruletide and placebotreated CG furthermore there was no changes in either positive or negative symptoms of schizophrenia secondary to ceruletide contrary to uncontrolled studies we failed to show AP properties of ceruletide
|
MEDAL
|
the GABA activity against mammary carcinogenesis mediated by SE restriction is accompanied by a reduction in the degree of mammary ductal branching and an increase in adrenal cortical activity levels of pkip protein a gene product associated with cell cycle growth arrest have also been shown to be elevated in mammary epithelium and in mammary lesions of energyrestricted animals based on these data we have proposed that increased secretion of adrenal cortical steroids accounts in part for the effects of ER in this experiment the hypothesis tested was that corticosterone administration would mimic the effects of ER both on mammary gland OD and on C2 of p protein in mammary ductal epithelium to test this hypothesis corticosterone was fed to female rats for weeks dietary corticosterone increased SS and urinary corticosterone C2 in a dosedependent manner p the effects of corticosterone treatment on MG OD were analyzed digitally p protein was detected IHC the ductal extension and branching of the mammary gland were reduced in a dosedependent manner by corticosterone treatment p however the magnitude of the effect was greater on ductal branching overall increasing dietary corticosterone reduced the total volume of mammary epithelium in a dosedependent manner an effect that remained even after adjustments for differences among animals in body mass consistent with this effect the amount of p protein present in ductal mammary epithelial cells increased dosedependently in response to increasing corticosterone administration p the hypothesis is proposed that dietary administration of corticosterone may imitate the effects of SE restriction on mammary carcinogenesis by regulation of mammary tissue size homeostasis via pkip mediated arrest of cell cycle progression
|
MEDAL
|
the toxin producing capacity of seven fusarium species f langsethiae f sporotrichioides f poae f avenaceum f tricinctum f graminearum and f culmorum and the effect of culture conditions on the toxin production were studied the strains were isolated from finnish grains and cultivated on a grain mixture at three different water activitytemperature combinations ie degrees c degrees c degrees c the mycotoxins produced were analyzed with a multitoxin method based on liquid chromatographytandem mass spectrometry enabling the simultaneous determination of different fusarium toxins the GA toxin profiles revealed f langsethiae and f sporotrichioides as producers of diacetoxyscirpenol neosolaniol ht and ttoxins f sporotrichioides produced additionally beauvericin in the f poae cultures only BEA was detected f avenaceum and f tricinctum were capable of producing enniatins moniliformin and antibiotic y and f graminearum and f culmorum produced zearalenone deoxynivalenol and acetyl DON differences existed in the quantitative toxin production between the individual strains representing the same species additionally the culture conditions affected the range and amounts of toxins produced in GA aw and temperature of degrees c favoured the typea trichothecene production of f langsethiae and f sporotrichioides the beauvericin production of f sporotrichioides occurred more favourably at aw and degrees c f poae produced the highest concentrations of BEA under two different conditions namely at aw degrees c and aw degrees c none of the combinations particularly favoured toxin production of f avenaceum with all three toxins being produced extensively at all culture conditions f tricinctum produced enniatins most efficiently at aw degrees c the moniliformin production of both these two species occurred readily at aw degrees c f culmorum and f graminearum produced the highest concentrations and variety of mycotoxins at aw degrees c the results give valuable information on the toxigenicity of some important fusarium species additionally this is the first indepth T0 to investigate the influence of environmental conditions on the toxin production by f langsethiae f poae f avenaceum and f tricinctum
|
MEDAL
|
in falciparum malaria both INF and uninfected red cells have structural and PET alterations to investigate the mechanisms of these modifications we studied the effects of two plasmodium falciparum haem products haematin and malaria pigment in the synthetic form betahaematin on isolated human red blood cells rbcs and purified rbc ghosts a dose and timedependent incorporation of haematin into rbc ghosts and IN cells was observed which was in proportion to the extent of haematin induced haemolysis rbcs preincubated with haematin were more sensitive to haemolysis induced by hypotonic shock low ph ho or haematin itself haemolysis was not related to membrane lipid peroxidation and only partially to oxidation of protein sulphydryl CG and it could not be prevented by scavengers of lipid peroxidation or hydroperoxide CG NAC partly protected the oxidation of sh CG and significantly reduced haemolysis in contrast betahaematin was neither haemolytic nor oxidative towards protein sulphydryl CG betahaematin did destabilise the rbc membrane but to a lesser extent than haematin inducing increased susceptibility to lysis caused by hypotonic medium ho or haematin this study suggests that the destabilising effect of haematin and to a much less extent betahaematin on the rbc membrane does not result from oxidative damage of membrane lipids but from direct binding or incorporation which may affect the reciprocal interactions between the membrane and cytoskeleton proteins these changes could contribute to the reduced red cell deformability associated with severe malaria
|
MEDAL
|
to establish an assessment index system to objectively evaluate the implementation of health promotion in enterprises
|
MEDAL
|
phosphate depletion may prevent progression of exp chronic renal failure the present T0 was designed to examine the effect of phosphate depletion on the severity and progression of ischemic acute renal failure two CG of rats phosphatedepleted pd and phosphaterepleted pr were pairfed a RD for days the diet of the pd rats also contained g dihydroxyaluminum aminoacetate after days serum phosphate in pd rats averaged mg compared to mg in the pr rats p less than the weight gain during the equilibration period was comparable in both CG vs g ns creatinine clearance hematocrit renal cortical adenine nucleotides tissue calcium mitochondrial calcium and mitochondrial respiration were similar in both groups T3 days of the diet a min BL clamping of both renal arteries and veins was then undertaken in both CG the pd rats demonstrated more severe ARF at h T3 the ischemic insult SS creatinine and creatinine clearance for the pd and pr rats were versus mg p less than and versus microlitermin p less than respectively tissue calcium vs mmolkg dry weight p less than and mitochondrial calcium vs nmolmg prot p less than were significantly higher in the pd ratsabstract truncated at words
|
MEDAL
|
this study aimed to evaluate the behaviour of two horizontal subsurface flow constructed wetland units regarding solids build up and clogging of the filter medium in order to analyse the causes of this process which is considered the major operational problem of constructed wetlands studies were carried out to characterize accumulated solids and hydraulic conductivity at specific points of the beds of two wetlands planted with typha latifolia and unplanted units receiving effluent from an upflow anaerobic sludge blanket reactor treating sanitary sewage population equivalent of inhabitants each unit the experiments were performed T3 the units were operating for years and months this T0 presents comparative results related to the quantification and characterization of accumulated solids and hydraulic conductivity along the length and width of the filter beds approximately of the solids found were inorganic fixed near the inlet end the rate interstitial solidsattached solids was while in the outlet end it was reduced to hydraulic conductivity was lower near the inlet of the units as expected and by comparing the planted wetland with the unplanted the hydraulic conductivity was lower in the former resulting in larger undesired surface flow
|
MEDAL
|
we examined the ability of several fish viruses to induce protection against rat or heterologous viruses in single or double infections and assessed whether such protection is correlated with innate immunity or expression of the mx gene monolayers of bf cells pretreated with S9 of brown trout salmo trutta l macrophage cultures that had been stimulated with either polyinosinic polycytidylic acid poly ic or viruses such as IPN virus ipnv infectious haematopoietic necrosis virus ihnv or a mixture of the two showed varying degrees of protection against viral infections the virus showing the strongest induction was ipnv and the antiviral activity against ihnv was also high around log reduction of virus yield consequently the ipnvihnv coinfection yield was also reduced by varying amounts in vivo the cumulative mortality observed in the ipnvihnv coinfected fish was always less than that in those with a single infection stimulation with poly ic for days significantly reduced cumulative mortality in singleinfected fish but not in the doubleinfected in which the ipnv was the only virus isolated from moribund animals by rtpcr mx was expressed in all the organ samples tested kidney CL and SP from virusstimulated fish at and days by qrtpcr the extent and timing of mx expression was shown to differ in the poly ic and the single or dual viral infections the highest increase in mx expression fold above basal C2 occurred after h in fish infected with the ihnv and expression remained high until day mx expression in fish infected with ipnv peaked later at days post infection and also remained high until day the dual infection with ipnvihnv induced high mx expression on day which peaked on day and remained high until day these results indicate that activation of the immune system could explain the interference and loss of ihnv in the ipnvihnv coinfections
|
MEDAL
|
maximal strength SP muscle crosssectional area maximal and submaximal cycling endurance characteristics and SS hormone concentrations of testosterone free testosterone and cortisol were examined in three groups of men weightlifters n amateur road cyclists n and AMC n weightlifters showed higher SP values than road cyclists and controls whereas the differences in maximal strength and muscle mass were only and respectively these differences were maintained when AP output was expressed relative to body mass or relative to muscle crosssectional area road cyclists recorded higher maximal workloads whereas submaximal blood lactate concentration was lower with increasing workload than in controls and weightlifters in road cyclists workloads associated with blood lactate concentrations of and mmoll were higher and occurred at a higher percentage of Wmax than in weightlifters or controls basal serum TT and free testosterone concentrations were lower in elite amateur cyclists than in agematched weightlifters or untrained individuals significant negative correlations were noted between the individual values of maximal workload workloads at and mmoll and the individual values of muscle SP SO r to as well as the individual basal values of serum total testosterone and free testosterone r to these results indicate that the e also monitored parasite responses to equipotent doses of the clinical antimalarial inhibitors pyrimethamine and tetracycline and observed differential effects for a number of proteins unrelated to likely targets of these drugs
|
MEDAL
|
according to home healthcare requirement of chronic patients this paper proposes a mobilecare system integrated with a variety of vitalsign monitoring where all the frontend vitalsign measuring devices are portable and have the ability of shortrange wireless communication in order to make the system more suitable for home applications the technology of wireless sensor network is introduced to transmit the captured vital signs to the residential gateway by means of multihop relay then the residential gateway uploads data to the care server via internet to carry out patients condition monitoring and the management of pathological data furthermore the system is added in the alarm mechanism which the portable care device is able to immediately perceive the critical condition of the patient and to send a warning message to medical and nursing personnels in order to achieve the goal of prompt rescue
|
MEDAL
|
recently genomewide association analysis has revealed that the TN factor receptorassociated factor complement trafc containing locus on chromosome was associated with an increased risk for ra studies in model systems suggested that either gain or lossoffunction traf mutations have immune effects that could plausibly lead to or exacerbate the arthritis phenotype krniag kxbn is a genetic mouse model of inflammatory arthritis we aimed to assess the impact of traf deficiency on krniag mice
|
MEDAL
|
the determination of the protein content of urokinasetype plasminogen activator upa and its inhibitor pai in breast CA tissue extracts is used clinically to identify patients at risk to experience disease recurrence metastasis or early death the serine protease upa in concert with its inhibitor pai promotes RT cell adhesion migration and proliferation as well as EM Kd and thus facilitates tumor cell invasion and metastasis the various technical steps to recover upa and pai protein from archived breast CA tissues and to quantitatively determine upa and pai protein content in tumor tissue extracts by ELISA assay elisa are described in detail the technical steps involved require freshfrozen breast CA tissue a dismembrator machine ball mill to pulverize the tissue in the frozen state detergent triton x containing trisbuffered saline to extract upa and pai from the pulverized breast cancer tissue an ultracentrifuge to separate the detergent fraction from cellular debris upa and pai elisa kits protein determination reagents and a well spectrophotometer elisa reader to assess upa pai and total protein in the detergent extract the upapai elisas and the protein determination format described are robust and highly sensitive in addition to the macromethod of tissue disintegration we present a simple but CS microextraction procedure using cryostat sections or core biopsies as the source of breast CA tissue such a technique allows rapid and quantitative determination of upa and pai even in small breast cancer specimens
|
MEDAL
|
intralipid minor groove and the aminoglucose lying in the major groove of the distorted bdna double helix the binding conformation suggests that specific hydrogen bonds exist in the complex between the drug and guaninecytosine bases in both grooves of the helix when only one drug per dna duplex is present in solution there are three molecular species free dna complex and complex in slow exchange on the nmr time scale this equilibrium is temperature dependent at high temperature the free dna hexamer duplex and the complex are completely destabilized such that at degrees c only free ssDNA and the complex coexist at degrees c the equilibrium between free dna and the complex is relatively fast while that between the complex and the complex is slow this may be rationalized by the fact that the IB of nogalamycin to dna requires that the base pairs in dna open up transiently to allow the bulky sugars to go through a separate study of the complex at low ph showed that the terminal gc base pair is destabilized
|
MEDAL
|
previous studies have shown that the newly found endogenous inhibitor ncxif of the cardiac naca exchanger ncx is capable of regulating the muscle strips contractility and relaxation here the effects of purified ncxif were tested on single cell shorteninglengthening by using the ir ccd camera coupled with the twoedge videodetector and caitransients by monitoring the changes in fluo fluorescence a perfusion of isolated cardiomyocytes paced at hz with ncxif results in fold enhancement in the amplitude of cell shorteninglengthening reaching the steadystate levels within min n p simultaneous recordings of cell shorteninglengthening and caitransients from the same cell show that the amplitude enhancement is associated with accelerated decay of both signals therefore the ncxifdependent modulation of the single cell +dP/dt is primarily governed by carelated mechanisms the observed data are consistent with a proposal suggesting that the inhibition of ncx by ncxif results in cadependent activation of serca sr ca atpase yielding the accelerated decay of the caitransients the subsequent increase in the sr ca content may result in enhanced carelease reflecting the manifested promotion of caitransients more systematic study is required for confirming this working hypothesis
|
MEDAL
|
unenhanced helical computerized tomography uhct has recently evolved as an accurate imaging modality for determination of the presence or absence of ureterolithiasis in patients with acute flank pain PET renal scintigraphy is considered the gold standard for urinary tract one the objective of this T0 was to correlate the secondary signs of urinary one on uhct with findings of functional DRS uhct was performed in patients admitted to the ER with acute flank pain all patients had a calcified urinary stone identified on uhct the location of each urinary stone was classified as ureteral or in the ureterovesical junction the presence of AA ct signs of ureteral one was determined for each patient T3 oral or intravenous hydration a technetiumm diethylene triamine pentaacetic acid renal scan was performed in all patients within h of the ct scan followup delayed scintigraphic images were obtained at h and h in patients with evidence of ureteral obstruction the sensitivity specificity and predictive values of each possible combination of ct findings were determined by comparison with the scintigraphic results the distal ureter was the most common location for a calculus on uhct followed in frequency by the ureterovesical junction proximal ureter and midureter the renograms showed highgrade unilateral obstruction in patients ind scans in five patients and normal renograms in patients the sensitivities and specificities of individual ct findings ranged from to and from to respectively perinephric stranding gave the highest positive predictive value ppv for obstruction including indeterminate renograms none of the individual ct findings showed a statistically significant rho with scintigraphic findings a combination of one or two positive ct findings had a ppv of only for one a combination of three or four positive ct findings gave a ppv of for obstruction our preliminary T0 shows that secondary ct signs of ureterolithiasis correlate poorly with the scintigraphic findings and that they do not permit evaluation of the FS of obstructed kidneys even a combination of the most frequent ct findings has a low predictive value ie does not allow a decision to be made as to the most suitable treatment therefore DRS should be performed in conjunction with uhct in all patients with ureteral calculi
|
MEDAL
|
the relationships between cardiac performance CF coronary vascular resistance at maximal vasodilatation and myocardial oxygen consumption were determined in isolated hearts from SH rats shr normotensive wistarkyoto rats wky and from shr given MET beta selective blocker and FEL selective calcium antagonist for weeks a working heart perfusion system was used an oxygen electrode allowed continuous measurement of oxygen tension in the venous coronary effluent blood pressure was reduced close to normal levels in treated shr treatment also caused a substantial reduction of left VVI weight in both treated and untreated shr maximal cardiac performance expressed as peak stroke volume was enhanced above that of wky at high perfusion pressures while performance at low perfusion pressures was clearly reduced in the former CG at a given workload myocardial oxygen consumption mmol omin per g was reduced in both groups of shr this suggests a physiological structural adaptation to an elevated cardiac load in hypertension where more myofibrils contribute to produce a given amount of work and therefore less oxygen is consumed per unit muscle mass coronary flow was reduced at any given perfusion pressure and oxygen SE was increased in UT shr versus wky by causing regression of hypertensive structural vascular changes treatment markedly increased coronary flow and correspondingly decreased oxygen extraction thus by enhancing the myocardial nutritional supply with antihypertensive treatment the reduced cardiac function at low perfusion pressure in UT shr was almost normalized
|
MEDAL
|
brain cannulated rats were injected with the opioid peptide betaendorphin betaep directly into the hypothalamic paraventricular nucleus pvn where norepinephrine ne is most effective in stimulating eating behavior betaendorphin nmole reliably increased food NI in satiated animals and this response was blocked by local administration of the selective opiate antagonist naloxone the eating induced by betaep was positively correlated in magnitude with the ne response and like ne was antagonized by pvn injection of the alphanoradrenergic blocker phentolamine naloxone had no effect on neinduced eating and the dopaminergic blocker FLU failed to alter either betaep or ne eating when injected simultaneously at maximally effective doses betaep and ne produced an eating response which was significantly larger than either of the responses elicited separately by betaep or ne and was essentially equal to the sum of these two responses the evidence obtained in this T0 suggests that betaep and ne stimulate food ingestion through their action on pvn opiate and alphanoradrenergic receptors respectively and that betaeps action is closely related to and in part may be dependent upon the pvn alphanoradrenergic system for FF control
|
MEDAL
|
SEB seb a bacterial superantigen is known as an immunomodulator because it activates an extremely large number of tcells and induces the production of C1 amounts of cytokines in this study we examined the effects of seb on the CHR chr balbc mice were first sensitized through haptens applied to the back and chr was then induced through challenge to the left ear using the same haptens seb was po intravenously weeks later causing a flareup peaking at h postadministration in the left ear that had previously exhibited chr this flareup reaction was hapten nonspecific and was inhibited by antimouse tumor CN factor tnfalpha antibodies the flareup was also suppressed by the p.o. of cyclosporin a prior to the administration of seb these results suggest that seb induces a flareup of chr via the production of TNF
|
MEDAL
|
PA is a GN opportunistic pathogen that utilizes a TTS system to subvert host innate immunity of the known effector proteins injected into eukaryotic cells exos and exou are cytotoxic the cytotoxic phenotype of exou depends on the enzymatic activity of the patatinlike phospholipase a domain localized to the NT half of the protein amino acid residues located within the CT region of exou are postulated to be required for trafficking or localization to the BPM of eukaryotic cells this report describes the characterization of a transposonbased linker insertion library in exou utilizing an unbiased screening RPA and sensitive methods for measuring enzymatic activity wediatric lichen planus patients the ethnicity of the LP patients was compared with the data for our general patient population the proportion of african american patients in each group was compared using the chisquared test we report children female to male ratio who presented with lichen planus to the pediatric dermatology clinic at childrens hospital of wisconsin twentysix of these patients were african american or p a personal or family history of autoimmune disease was present in six patients although there has been no reported racial predominance of LP we observed LP to occur more commonly in african american children interestingly the incidence of autoimmune disease was higher than has previously been reported future studies will confirm or refute these observations and advance our understanding of potential genetic or environmental risk factors for the development of lichen planus
|
MEDAL
|
the corticothalamic FB pathway provides excitatory synaptic input to both the RE nucleus and the lateral geniculate nucleus we studied excitatory postsynaptic currents elicited from corticothalamic stimulation in the visual sector of the RE nucleus and the lateral geniculate nucleus to compare the response of these neurons to stimulation of their common input pathway using whole cell patch clamp recordings in ferret thalamic slices we compared single excitatory PSC decay kinetics presynaptic glu PR dynamics through paired PP facilitation and responses to corticothalamic train stimulation we found that single thalamic reticular nucleus excitatory PSCs were significantly sharper than lateraave been developed in order to identify the profile of genes bound and G1 by dna regulatory proteins such as the transcription factors cjun and atf as well as dnamodifying methylases the arrays contain unique human promoter sequences from to nts from the transcription start site cisplatininduced dna damage rapidly leads to TPS activation of the jun kinase pathway leading to increased phosphorylation of cjun and atfdna complexes at hundreds of CS within hours using three statistical criteria approximately most commonly phosphorylated cjunatfdna complexes were identified and representative cases were verified by qpcr measurement of chipcaptured dna expression was correlated at the mrna and protein C2 the largest PET cohort was genes of known dna repair CF most of which exhibited increased protein expression indicated coordinate gene regulation in addition cell lines of prostate cancer exhibit SD methylation or copy number changes that reflect the alterations of the corresponding primary tumors promoters showed differential hybridization between immortalized control prostate epithelial and cancer cell lines among candidate hypermethylated genes in cancerderived lines eight had previously been observed in prostate CA and were previously determined methylation targets in other cancers the vast majority of genes that appear to be both differentially methylated and differentially regulated between prostate epithelial and CA cell lines are novel methylation targets including pak rad tlx pir mapk insr fbn gg representing a rich new source of candidate genes to T0 the role of dna methylation in prostate PT earlier studies using prototype promoter arrays examine approximately of the proximal regulatory sequences while the current gene RII events surveyed here occur on a C1 scale and may rapidly effect the coordinated expression of a large number of genes
|
MEDAL
|
involvement of the central NS cns is a rare complication of chronic lymphocytic one cll and seems to be more frequent in patients with richters syndrome or prolymphocytic transformation cases with leptomeningeal involvement reported in the literature mostly do not discuss the definition of cllassociated meningeosis and the exclusion of neuroborreliosis
|
MEDAL
|
adsorption properties of protein papain at the solidliquid m kcl interfaces of different hydrophobicity highly oriented pyrolytic graphite hopg bare gold ch oh and coohterminated selfassembled monolayers on gold were studied by a combined quartz crystal microbalance and atomic force microscopy techniques it was found that papain forms an incomplete monolayer at hydrophobic interfaces hopg and chterminated substrate whereas on more hydrophilic ones a CR ML formation was always observed with either the onset of the formation of a second SL bare gold substrate or adsorption in a multilayer fashion possibly a bilayer formation ohterminated ATP the surface concentration and compact ML film thickness was much lower on the coohterminated substrate compared to other surfaces studied this result was explained by partial dissociation of the interfacial cooh CG leading to additional electrostatic interactions between the positively charged protein domains and negatively charged carboxylate anions as well as to local ph changes promoting protein denaturation
|
MEDAL
|
the pete gene encoding plastocyanin precursor protein from the cyanobacterium anabaena pcc was introduced in the cyanobacterial host strain synechococcus pcc the host normally only uses cytochrome c as PS i ps i donor the rat gene was efficiently expressed using the inducible escherichia coli trc promoter accumulation of PC protein depended on the presence of cu the protein was accurately targeted to the thylakoid lumen from which it could be isolated in the mature form redox difference spectroscopy proved the presence of a cu ion in the holoenzyme isolated heterologous plastocyanin was functional in reconstitution of in vitro electron transfer to ps i the presence of anabaena plastocyanin in synechococcus thylakoid CM increased ps i electron transfer rate times analysis of p redox and ps ii fluorescence transients in vivo showed a faster electron transfer through ps i because of enhanced electron supply in the presence of plastocyanin in addition the distribution of electrons between photosynthetic and respiratory electron transfer changed plastocyanin preferentially donates electrons to ps i rather than to the respiratory cytochromec oxidase complex and is not functionally equivalent to cytochrome c
|
MEDAL
|
a cdna that encodes the kidney isoenzyme of the mitochondrial glutaminase pga was generated by recombination of two cdnas that were isolated from a randomprimed rat BB lambda gt library pga encodes amino acids which includes an nterminal CS of residues that should form an amphipathic helix typical of a MTS residues correspond to the NT CS of the more abundant kda glutaminase peptide in vitro transcription and translation of pga yields a kda peptide that is immunoprecipitated with glutaminasespecific antibodies incubation of the glutaminase precursor with isolated mitochondria yields the and kda peptides that are characteristic of the mature glutaminase thus the two mature glutaminase peptides are synthesized from a single precursor the CR nontranslated region of the ga mrna was characterized by sequencing a ga cdna pga that was isolated from an oligodtprimed rat kidney lambda gt library this segment contains numerous aurich regions four potential stemloop structures and a base pair repeat of ca dinucleotides such domains may contribute to the increased stability of the ga mrna that occurs in response to metabolic acidosis
|
MEDAL
|
epimacular CM emm reduce markedly VA and the only treatment is pars plana vitrectomy ppv and removal of the emm the authors analyzed the results of ppv in eyes with emm of different aetiology the group comprised idiopathic emm and secondary emm after operations of a detached retina injury intraocular inflammation occlusion of the retinal vein and retinopathies of the premature the operation markedly improved the visual acuity in eyes and the best results were obtained in idiopathic emm the prognosis did not depend on the preoperative VA and duration of the disease and was determined by the state of the macula beneath emm which in dense secondary emm is difficult to assess before operation the poorest PET results were obtained in postinflammatory and posttraumatic emm
|
MEDAL
|
melana is a previously defined melanocyte differentiation antigen and an antimelana mu monoclonal antibody a was recently developed by our group in this T0 we evaluated a immunoreactivity on formalinfixed paraffinembedded tissues exploring the potential of a in the diagnosis of M1 melanoma seventyfive metastatic melanomas primary melanomas and benign melanocytic nevi were tested the reactivity of a was compared with hmb an antigp antibody results showed that all nevi were a positive and most primary melanomas were a and hmb positive of M1 melanomas were a positive and were hmb positive of hmbnegative lesions were a positive of anegative lesions were hmb positive eleven M1 lesions as well as of primary melanomas were dual negative these negative cases consisted mainly of the spindle cell and desmoplastic SCV of the positive cases a showed homogeneous IF in a significantly higher proportion of cases than hmb versus in addition focal IF with less than reactive tumor cells was seen more frequently in hmb of than in a of these results indicated that a can be used as a firstline antibody in the diagnosis of metastatic melanoma our results also showed that a reacted with angiomyolipoma which is known to be hmb positive of normal tissues unexpected a CR was observed in the adrenal SC granulosa and theca cells of the ovary and leydig cells of the testis this a immunoreactivity in benign and neoplastic tissues of nonmelanocytic origin the basis of which is unclear could also be of potential diagnostic value
|
MEDAL
|
kawasaki disease refers to systemic vasculitis with risk of PD disease our objective is to identify risk AF associated with PD disease in patients with complete and incomplete kawasaki disease
|
MEDAL
|
regulated proteolysis serves as a mechanism to control cellular processes the sps ssyptrssy sensor in yeast responds to extracellular amino acids by endoproteolytically activating transcription AF stp and stp stp the processing endoprotease ssy is regulated via proteasomal Kd of its noncovalently associated nterminal prodomain we find that degradation of the prodomain requires a conserved phosphodegron comprising phosphoacceptor sites and ubiquitinaccepting lysine residues upon amino acid induction the phosphodegron is modified in a series of linked events by a set of general regulatory factors involved in diverse signaling pathways first an amino acidinduced conformational change triggers phosphodegron phosphorylation by the constitutively active plasma membranelocalized casein kinase i yck next the prodomain becomes a ATP for polyubiquitylation by the skpcullingrr e ubiquitin ligase complex scfgrr finally the modified prodomain is concomitantly degraded by the s proteasome these integrated events are requisite for unfettering the ssy endoprotease and thus stp processing the ssy phosphoacceptor motif resembles the yck and grrdependent degrons of regulators in the snfrgt glucosesensing pathway our work defines a novel proteolytic activation cascade that regulates an intracellular signaling protease and illustrates how general signaling components are recruited to distinct pathways that achieve conditional and specific signaling outputs
|
MEDAL
|
primary angiitis of the cns pacns is a diagnostically challenging disorder in patients whose diagnosis is ascertained solely by CBF angiography without histologic verification a benign monophasic clinical course with favorable response to a brief course of IS therapy is often reported
|
MEDAL
|
procedures are common in pediatric emergency departments and frequently cause distress from pain andor anxiety the objective of this T0 was to describe the incidence types and magnitude of longterm SMB changes T3 procedures in the emergency setting
|
MEDAL
|
the purpose of this study was to report a case with posttraumatic spinal epidural hematomas with abnormal neurologic findings which is uncommon a yearold man presented at our clinic T3 a blunt trauma caused by a traffic accident in which he was a pedestrian T3 admission abnormal neurologic symptoms developed including loss of sensation and motor CF in his left lower extremity magnetic resonance imaging demonstrated a spinal epidural hematoma with canal stenosis at the ls level decompression including hematoma evacuation was done PS started to be reduced days T3 T0 he was treated conservatively with medications and all PS resolved CR during admission and there were no further neurologic sequelae posttraumatic lumbar spinal EPI hematoma with abnormal neurologic findings is an uncommon condition that may present belatedly T3 trauma with significant neurologic compromise
|
MEDAL
|
androgendeprivation therapy has been used to treat salivary duct carcinoma sdc the androgen receptor splice variant arv has been detected in castrationresistant prostate cancer and implicated in resistance to androgen receptor artargeted therapies given the potential role of ararv in sdc treatment this T0 focuses on ararv expression in sdc specimens collected before androgendeprivation therapy rna in situ hybridization ish and immunohistochemistry ihc to detect total ar and arv were performed on formalinfixed paraffinembedded sdc specimens from patients fulllength ar and arv transcripts were quantified in a subset of PT by reversetranscription polymerase chain reaction twenty sdcs were positive for total ar by ish and ihc among arpositive sdcs were positive for arv messenger rna by ish whereas were positive for arv protein by ihc the sdcs that expressed the highest C2 of arv were all from female patients one of them expressed a significant amount of arv and barely detectable fulllength ar transcripts by reversetranscription PCR reaction ihc expression of forkhead box protein a prostatespecific antigen prostatic acid phosphatase and nkx was observed in some sdcs regardless of patient sex five sdcs demonstrated strong human epidermal growth factor receptor expression we conclude that treatmentnaïve sdcs may express arv at C2 comparable to or even exceeding the C2 detected in castrationresistant prostate CA our data support the feasibility to incorporate arv assessment via ish andor ihc in the ongoing clinical trials evaluating the therapeutic benefit of artargeted therapies in sdc patients
|
MEDAL
|
the clinical and laboratory findings of a cystic fibrosis cf patient homozygous for the gx mutation are described this is the first case among the gx homozygous cf subjects described so far who shows severe liver involvement associated pancreatic insufficiency and moderate pulmonary expression of the disease as demonstrated by laboratory and imaging data this case adds to the conclusion that genotypephenotype correlation in cystic fibrosis is more complex than formerly suspected
|
MEDAL
|
a library of mu monoclonal antibodies against the prototype enterovirus ev CS j was made for the purpose of studying the immunologically reactive determinants of the virus each of the monoclonal antibodies reacted with several other strains of enterovirus when tested by immunofluorescence however none of these monoclonal antibodies reacted with any other picornavirus tested it was found that all of the monoclonal antibodies precipitated ev viral proteins c and d in radioimmunoprecipitation assays however only one of these monoclonal antibodies an igg kappa was capable of NT the virus
|
MEDAL
|
emotional intelligence ei is the ability to perceive use understand and regulate emotions higher scores on this ability measured through performance tests but no through selfreports appears to be related to better performance on hot emotionally laden cognitive tasks however there are relatively few studies concerning how ei may benefit the WM capacity wmc thus the objective of this T0 is to analyse the relationship between ei as measured through a performancebased ability test a selfreport mixed test and a selfreport ability test and the wmc during the performance of hot and cool ie nonemotionally laden back tasks participants completed three ei tests as well as two back tasks the results provide evidence for better performance of higher ei participants specifically in the managing branch measured through the performancebased ability test but only on the hot task for the selfreport mixed model incongruent results were found and no correlations were obtained using the selfreport ability model the implications of these findings are discussed in terms of the validity of the various ei models
|
MEDAL
|
myofibroblasts also known as G1 fibroblasts constitute an important niche for RT OD through the promotion of angiogenesis however the mechanism of stromal FB activation in RT tissues has not been fully understood a gastric cancer mouse model gan mice was recently constructed by simultaneous activation of prostaglandin pg e and wnt signaling in the GM because both the pge and wnt pathways play a role in human gastric tumorigenesis the gan mouse model therefore recapitulates the molecular etiology of human gastric CA microvessel density increased significantly in gan mouse tumors moreover the expression of VE growth factor a vegfa was predominantly induced in the stromal cells of gastric tumors immunohistochemistry suggested that vegfaexpressing cells in the stroma were alphasmooth muscle actinpositive myofibroblasts bone marrow transplantation experiments indicated that a subset of gastric myofibroblasts is derived from bone marrow importantly the alphasmooth muscle actin index in cultured fibroblasts increased significantly when stimulated with the CS medium of gan mouse tumor cells indicating that gastric tumor cells activate stromal fibroblasts furthermore conditioned medium of gan mouse tumor cells induced vegfa expression both in embryonic and gastric fibroblasts which further accelerated the tube formation of HUVE cells in vitro notably stimulation of fibroblasts with pge andor wnt did not induce vegfa expression thus suggesting that factors secondarily induced by pge and wnt signaling in the RT cells are responsible for activation of stromal fibroblasts such RT cellderived factors may thereforneration of errorrelated signals associated with the outcomes of actions we investigated the impact of lesions to ofc on the errorrelated negativity ern an electrophysiological marker of performance monitoring four ofc patients and eight control subjects participated in a manual stroop task while brain electrical activity was recorded we found that the ern was att in the patient group three of the patients also had impaired error correction performance but all showed normal posterror slowing these findings suggest ofc involvement in monitoring and evaluation of ongoing performance
|
MEDAL
|
rapid AEP processing and AEP NC PCD abilities are crucial aspects of speech and language OD particularly in the first year of life animal models and adult studies suggest that oscillatory synchrony and in particular lowfrequency oscillations play key roles in this process we hypothesize that infant perception of rapid pitch and timing changes is mediated at least in part by oscillatory mechanisms using eventrelated potentials erps source localization and timefrequency analysis of eventrelated oscillations eros we examined the neural substrates of rapid AEP processing in montholds during a standard oddball paradigm infants listened to tone pairs with invariant standard std hz and variant deviant dev hz pitch std and dev tone pairs were first presented in a block with a short interstimulus interval isi rapid rate ms isi followed by a block of stimuli with a longer isi control rate ms isi results showed greater erp MPA in response to the dev tone in both conditions and later and larger peaks during rapid rate presentation compared to the control condition sources of neural activity localized to right and left AEP regions showed larger and faster activation in the RA hemisphere for both rate conditions TF analysis of the source activity revealed clusters of theta band enhancement to the dev tone in RA AEP cortex for both conditions left AEP activity was enhanced only during rapid rate presentation these data suggest that local lowfrequency oscillatory synchrony underlies rapid processing and can robustly index AEP perception in young infants furthermore left hemisphere recruitment during rapid frequency NC discrimination suggests a difference in the spectral and temporal resolution of RA and left hemispheres at a very young age
|
MEDAL
|
several studies have demonstrated the accuracy precision and reproducibility of proton density fat fraction pdff quantification using vendorspecific image acquisition protocols and pdff estimation methods the purpose of this work is to validate a confoundercorrected crossvendor cross fieldstrength inhouse variant lms ideal of the ideal method licensed from the university of wisconsin which has been developed for routine clinical use
|
MEDAL
|
a case is presented of repeated stellate ganglion block using the paratracheal RPA at the level of c and using the low dose method subarachnoid spread of local anaesthetic resulted in total spinal block below the level of c the potential hazards of this techinque of stellate ganglion block and methods of avoiding them are discussed together with the possible mechanism in this case
|
MEDAL
|
subgingival plaque samples were collected from patients with a history of moderate to severe AP and enumerated on trypticasesoy BA plates with and without tetracycline at microgramsml each different colony morphotype was enumerated and a representative colony was subcultured for identification and examined for the tetracycline resistance gene tetq by PCR reaction pcr amplification and dna hybridization using a fragment of tetaq from bacteroides fragilis pcr primers ggcttctacgacatctatta and catcaacatttatctctctg were chosen to amplify a bp region of tetq the subgingival PI samples were also tested by pcr approximately of the total cultivable flora was resistant to tetracycline and the percentage of the tetracyclineresistant cultivable flora with the tetq gene varied greatly from one patient to another with a range from to half of the subgingival PI samples were positive or weakly positive for tetq by pcr approximately of the isolates subcultured with Tcr or microgramsml contained tetq and contained tetm all of the tetqresistant isolates were gramnegative anaerobic bacilli and included all of the prevotella and bacteroides isolates
|
MEDAL
|
cardiovascular disease is a major cause of morbidity and mortality in children and young adults with endstage renal disease in our T0 we retrospectively analyzed the records of patients who had undergone EB computerized tomography in our dialysis unit our patients aged to years median years were on dialysis or had functioning grafts CC was observed in seven patients with a mean calcium score of range to in our T0 population we compared clinical characteristics like age gender duration of endstage renal disease time on hemodialysis body mass index and blood pressures between the patients with calcifications group i and those with out calcification group ii we also compared the laboratory data including daily calcium and calcitriol intake lipid profile serum calcium and phosphorus levels calciumphosphorus products and SS parathyroid hormone levels in the both CG the mean daily dose of total calcium triglyceride level and calciumphosphorus products were higher in the calcification group though not statistically significant the mean daily dose of calcitriol was significantly higher in patients with calcification using spearman multivariate correlation we found a rho between the coronary calcium scores and mean daily doses of total calcium and calcitriol r p and r p respectively we conclude that coronary calcification which is a proven predictor of cardiovascular disease begins at a very early age and that daily doses of elemental calcium and calcitriol seem to be important factors in our T0 population
|
MEDAL
|
the incidence of penile cancer varies from country to country with the highest figures reported for countries in africa south america and asia and lowest in the united states and europe causes of this variation are not clear but they are thought to be related to human papillomavirus infection smoking lack of circumcision chronic inflammation and poor genital hygiene most penile tumors are squamous cell carcinomas and a variegated spectrum of distinct morphologies is currently recognized each one of these subtypes has distinctive pathologic and clinical features about half of penile carcinomas are usual SCCs and the rest corresponds to verrucous warty basaloid wartybasaloid PTC pseudohyperplastic pseudoglandular adenosquamous sarcomatoid and cuniculatum carcinomas previous studies have found a consistent association of RT cell morphology and human papillomavirus presence in penile carcinomas those tumors composed of small to intermediatesized basaloid blue cells are often human papillomavirus positive whereas human papillomavirus prevalence is lower in PT showing C1 keratinizing maturing eosinophilic pink cells human papillomavirusrelated PT affect younger patients whereas human papillomavirusunrelated PT are seen in older patients with phimosis lichen sclerosus or squamous hyperplasia this morphologic distinctiveness is also observed in penile IEL neoplasia the TPS aim of this review is to provide a detailed discussion on the macroscopic and microscopic features of all L1 subtypes of penile CA we also discuss the role of pathologic features in the prognosis of penile CA the characteristics of penile precursor lesions and the use of immunohistochemistry for the diagnosis of invasive and F0 lesions
|
MEDAL
|
replicationdependent histone mrnas end in a highly conserved nt SL structure the stemloop binding protein slbp an evolutionarily conserved protein with no known homologs interacts with the stemloop in both the nucleus and cytoplasm and mediates nuclearcytoplasmic transport as well as end processing of the premrna by the u snrnp here we examined the affinity and specificity of the slbprna interaction nitrocellulose filterbinding experiments showed that the apparent equilibrium dissociation constant kd between purified slbp and the stemloop rna is nm binding studies with a series of stemloop SCV demonstrated that conserved residues in the stem and loop as well as the and flanking regions are required for efficient protein recognition deletion analysis showed that nt of the stem and nt of the stem contribute to the binding energy these data reveal that the high affinity complex between slbp and the rna involves sequencespecific contacts to the loop and the top of the stem as well the base of the stem and its immediate flanking sequences together these results suggest a novel mode of proteinrna recognition that forms the core of a ribonucleoprotein complex CE to the regulation of histone mRNA
|
MEDAL
|
acute bronchitis and pneumonia are conditions commonly diagnosed in inpatient and outpatient settings AB is a LRT infection characterized by cough with or without sputum production lasting to weeks it typically is viral testing for influenza should be obtained in patients at high risk of influenza complications antibiotics are not indicated in patients without chronic lung disease unless
|
MEDAL
|
the exit from dormancy and the start of growth should be preceded or at least accompanied by the uptake of nutrients in this work we studied changes in the transport of several nutrients into trichoderma atroviride conidia germination started with a short period of isodiametric growth conidial swelling followed by polarized growth germ tube formation T3 about h at °c the onset of isodiametric growth required the presence of external both phosphate and nitrate at the same time an increased uptake of precursors of macromolecules and phospholipids c or hlabelled valine uracil nacetylglucosamine and choline occurred a low uptake of these precursors was observed also in nongerminating conidia concomitantly this uptake developed an increased sensitivity to the uncoupler tetrachlorosalicylanilide expression and activity of hatpase started after completing isodiametric growth suggesting that the protonmotive force pmf generated by hatpase may be an accelerator of nutrient uptake and metabolism cvaline uptake was also measured into a mutant with disrupted pma gene this mutant did not form conidia the mutant also exhibited uncoupler sensitivity of cvaline uptake these observations showed that a pmf must have been generated by a mechanisms other than the hatpase activity in the wt before hatpase expression and in mycelia with disrupted hatpase
|
MEDAL
|
the authors used behavioral risk factor surveillance system data to assess the prevalence of taking actions to control hypertension among adults with selfreported hypertension differences by descriptive characteristics sex age raceethnicity access to health care medication adherence presence of other health risk factors overweightobesity smoking heavy drinking inadequate fruitvegetable NI and PCS inactivity and comorbidities diabetes high cholesterol coronary HR disease and stroke were compared the prevalence of hypertension was and of these patients reported taking antihypertensive medications changed eating habits decreased the use of salt reduced alcohol consumption and increased their PCS activity overall reported taking two or more actions to reduce blood pressure patients taking antihypertensive medications were more likely to take two or more actions than their counterparts vs p those with at least one other health risk factor were times as likely to take two or more actions as their counterparts confidence interval times more than of hypertensive adults reported taking two or more actions to control blood pressure the prevalence of taking actions differed significantly by descriptive characteristics the presence health risk factors and comorbidities
|
MEDAL
|
this report considers interference between medications for on the one hand drugs given during pregnancy and on the other hand drugs given to the Pr women and anaesthetic agents consideration is given to progestational agents oxytocics betamimetics corticosteroids insulin hypotensive agents diuretics and psychiatric drugs for each case of interference an attempt is made to provide practical data with particular respect to those combinations frequently prescribed by obstetricians eg the combination of the betamimetics and CSs with the aim of preventing impending premature ON of labour and to ensure foetal pulmonary maturation the combination of insulin and corticosteroids given to diabetics with the aim of preventing hyaline membrane disease the combination of CSs with antihistamines in the treatment of rhesus disease the association of oxytocics with C1 quantities of intravenous fluid in the case of PPH and hypontensive medication combinations and the problems which may result with emergency anaesthesis
|
MEDAL
|
RIP of the amyloid precursorprotein app produces both a characterstic amyloidβ peptide that contributes to neuritic plaque formation and neurodegeneration in alzheimer disease and a small AICD aicd that transcriptionally activates genes implicated in alzheimer disease pathology although the biochemical events leading to amyloidogenic app processing at the cell membrane have been described in detail comparably little is known about the mechanistic basis of aicddependent gene regulation in the nucleus in this study we show that the aicd activates transcription by targeting med an rna polymerase ii transcriptional mediator subunit that is implicated in human cognitive OD the aicd binds to medmediator in vitro and in vivo disruption of the aicdmed interaction inhibits aicd TA potential and expression of aicd target genes mediator in a meddependent manner occupies only aicdbound promoter dna indicating that the aicd recruits mediator to activate transcription these results identify the med interface in mediator as a crucial transducer of aicd TA and a potential therapeutic target in alzheimer disease
|
MEDAL
|
the widely reported interactions of the estrogen receptor er with endocrine disrupting chemicals edcs present in the environment gave raise to public concern and led to a number of screening and testing initiatives on the international level recent studies indicated that certain heavy metals including Cd can mimic the effects of the endogenous estrogen IL-1ra betaestradiol and lead to estrogen receptor activation previous studies of the chimeric proteins which incorporate the ligandbinding domain of the human er identified cys cys glu his and asp as possible CS of interactions with cadmium in the present study we utilized the rainbow trout er ligandbinding domain fused to glutathionestransferase and used cdshielding against various types of chemical modification of the FP to study noncovalent interactions between the er and cd the CSD of exposed and shielded residues allowed to identify amino acid residues involved in the interaction our data indicated preferential protection of cys CG by cadmium suggesting their involvement in the interaction this supports data found in the literature on the strong binding affinity of the thiol group towards metals however not all cys in the FP sequence were protected against chemical modification illustrating the importance of their chemical environment in GA the location of rterlbd cys residues implicated in cd interactions did not confirm assignments made by alaninescanning mutagenesis for the her probably due to differences in experimental setup and F0 proteins used the involvement of other PET groups such as carboxylic acids in the cd interactions though not confirmed can not be completely ruled out due to the GA limitations of the chemical modification RPA discussed in detail suggestions for an improved experimental setup were made
|
MEDAL
|
fiftyeight EHEC escherichia coli oh or onm nonmotile strains and atypical EPEC e coli oh or onm strains isolated from patients in countries during years share a common pool of nonstx virulence genes fitness loci and genotypic and phenotypic diagnostic markers these findings indicate close relatedness between these pathotypes and provide a basis for their clinical laboratory diagnosis
|
MEDAL
|
the mouse lymphoma CA mla workgroup addressed and reached consensus on a number of issues discussion focused on five areas acceptable CA versions cytotoxicity measure hr treatment microwell colony counting and sizing and data acceptabilitystatistical analysis although the international conference on harmonisation ich indicated a preference for the microwell over the soft agar method all of the workgroup members agreed that both versions of the mla are equally acceptable the workgroup agreed that it is desirable for both CA versions to use the same measure of cytotoxicity to define the acceptable and required concentration range currently laboratories using the microwell version use the relative survival rs determined by cloning immediately after the treatment laboratories using the soft agar method do not obtain an rs but use the relative total growth rtg a combination of the relative suspension growth rsg during the expression period and the relative cloning efficiency determined at the time of mutant selection the workgroup agreed to investigate the rsg the rs and the rtg and to develop further guidance in the interim the workgroup reached consensus that the rtg be used as the standard measure of cytotoxicity the ich recommended a hr treatment in the absence of s when negative results are obtained with short hr treatments the workgroup agreed to retain this requirement but acknowledged that more data are needed prior to making final recommendations concerning the need for and the specific protocol for the hr treatment environ mol mutagen published wileyliss inc
|
MEDAL
|
newcastle disease virus ndv strain h and polyinosinicpolycytidylic acid poly ic were used for interferon ifn induction in secondary pig A6 a functional ifn system was detected and characterized a wide similarity with the correspondent human and bovine systems was appreciated with particular regard to the kinetics of synthesis a glycosylated protein was essential for activity in bovine cells but not in swine cells poly ic proved to be a very weak inducer even in conditions which promote ifn synthesis in other cell substrata beta ifn from AA pig A6 was very effective against SVD virus svdv whereas no activity was detected against porcine rotavirus aujeszkys disease virus buk CS proved to be of intermediate sensitivity the results of these latter experiments are discussed with regard to the cells used and to the ifn sensitivity of the tested viruses
|
MEDAL
|
activating signal cointegrator asc harbors an autonomous transactivation domain that contains a putative zinc finger motif which provides binding CS for basal transcription factors tbp and tfiia transcription integrators steroid receptor coactivator src and cbpp and nuclear receptors as demonstrated by the glutathione stransferase pulldown assays and the yeast twohybrid tests the asc IB sites involve the hinge domain but not the CT af core domain of nuclear receptors nonetheless asc appears to require the afdependent AF to CF ie cbpp and src as suggested by the ability of asc to coactivate nuclear receptors either alone or in cooperation with src and p as well as its inability to coactivate a mutant receptor lacking the af core domain by using indirect immunofluorescence we further show that asc a nuclear protein is localized to the cytoplasm under conditions of SS deprivation but is retained in the nucleus when it is SS starved in the presence of ligand or coexpressed cbp or src these results suggest that asc is a novel coactivator molecule of nuclear receptors which functions in conjunction with cbpp and src and may play an important role in establishing distinct coactivator complexes under different cellular conditions
|
MEDAL
|
eleven hundred and sixty eight traumatic cases have been operated on under constant conditions in a conventional operating room with FA and positive pressure using absolute filters of efficiency two hundred and five were submitted to postoperative prophylactic administration of cephalosporin cefazolin for days the overall results showed p of infection but cases of severe sepsis were seen in the group of patients who had received prophylactic antibiotics the authors have compared these results with those obtained during the previous period when the operating room was less modern they conclude that this factor is of paramount importance on the other hand they have observed p of contaminated drains without subsequent infection they are concerned at the increase of gramnegative organisms resistant to CEZ p and of staphylococci resistant to methicillin p they conclude that the peroperative flash technique of the administration of penicillin m is worthwhile
|
MEDAL
|
a novel MIP mip that was applied to a solidphase microextraction spme device which could be coupled directly to gas chromatograph and mass spectrometer gcms was prepared using DBP dbp as the template molecule the characteristics and application of this fiber were investigated EM images indicated that the mipcoated solidphase microextraction mispme fibers were homogeneous and porous the SE yield of dbp with the mispme fibers was higher than that of the nonimprinted polymer nipcoated spme nispme fibers the mispme SF had a higher selectivity to other phthalates that had similar structures as dbp a method was developed for the determination of phthalates using mispme SF coupled with gcms the extraction conditions were optimized detection limits for the DHP samples were within the range of ng l the method was applied to five kinds of phthalates dissolved in spiked aqueous samples and resulted in recoveries of up to respectively thus the mispme SF are suitable for the SE of trace phthalates in complicated samples
|
MEDAL
|
the objectives of this T0 were to gather information on the quality of beef carcasses representative of commercial fattening systems and a new fattening regime for intensively fattened heifers data on the classification of the carcasses into the ec beef categories were analysed in all carcasses from the following categories were analysed intensively fattened heifers eight young bulls eight steers eight heifers eight dairy cows and six oncebred heifers various approaches of univariate and MVA were conducted to analyse beef quality of m LD and m semitendinosus the analysis reveals that variation of beef SQ assessments is great within and between categories a significant interaction between category and cooking condition was recorded for m longissimus dorsi tenderness as opposed to beef of intensively fattened heifers the sample of dairy cows is darkest with the lowest soluble collagen and the highest shear values assessments of the remaining categories are between these categories the difference between intensively fattened heifers and dairy cows of shear work done was · j of lightness l was · and of solubility of collagen was · meat prepared at low temperature is much more tender shear work done was lower and had just cooking loss compared to beef of samples prepared at internal temperatures above °c clusteringbased segmentation provides a lower R2 of beef quality within clusters than the variation of beef quality within ec categories
|
MEDAL
|
testosterone has been implicated as a risk factor for cardiovascular diseases and thromboxane a txa may be an important pathophysiologic mediator for them testosterone has been shown to increase txa receptor density in several cell types testosterone is reduced at the alpha position to its active metabolite dihydrotestosterone by alphareductase we determined the effects of epristeride a alphareductase inhibitor on the density of txa receptors in rat aortic smooth muscle cells and human erythroleukemia cells a megakaryocytelike cell in vitro and in rat platelets and aortic membranes in vivo in rat aortic smooth muscle cells epristeride significantly p n blocked the effect of testosterone to increase txa receptor density bmax and fmolmg protein for control cells cells treated with testosterone nm cells treated with testosterone and epristeride nm and cells treated with epristeride respectively epristeride did not block the effect of testosterone in human EL cells treatment of male rats with epristeride for weeks significantly p decreased txa receptor density in aortic membranes for VH n fmolmg protein for epristeride n but did not significantly change txa receptor density in platelets maximum contractile responses of rat aortas to u a txa mimetic were significantly p lower in epristeridetreated rats than in vehicletreated rats for VH n g tension for epristeride n in conclusion regulation of expression of txa receptors by testosterone in cells of V1 origin but not in platelets appears to be via dht
|
MEDAL
|
an ethyleneinducing xylanase eix is a potent elicitor of plant defense responses in TPS cultivars of tobacco nicotiana tabacum and tomato lycopersicon esculentum the leeix locus in tomatoes was characterized by mapbased cloning which led to the identification of a novel gene cluster from which two members leeix and leeix were isolated similar to the tomato ve resistance genes in tomato plants the deduced CAA sequences encoded by leeix and leeix contain a leu zipper an extracellular leurich repeat domain with glycosylation signals a transmembrane domain and a cterminal domain with a mammalian endocytosis signal silencing expression of the leeix genes prevented the binding of eix to cells of an eixresponsive plant and thus inhibited the hypersensitive response overexpression of either leeix or leeix genes in eixnonresponsive tobacco plants enabled the IB of eix although only leeix could transmit the signal that induced the hypersensitive response overexpressing leeix in rat cos cells enables binding of eix indicating PCS interaction between the eix elicitor and leeix gene product structural analysis of the leeix proteins suggests that they belong to a class of cellsurface glycoproteins with a signal for RME mutating the endocytosis signal in leeix tyr to ala abolished its ability to induce the HR suggesting that endocytosis plays a key role in the ST pathway
|
MEDAL
|
OT ot is a rare condition characterized by unsteadiness when standing still that is relieved when sitting or walking and is thought to arise from a central generator in the cerebellum or brainstem ot is considered to be a distinct discrete condition and little is known about its demographic characteristics natural PH associated features and treatment response we have reviewed these aspects in ot patients fulfilling current diagnostic criteria seen at our institution between and we classified as having idiopathic primary ot either with n or without an associated postural arm tremor we found that of cases had additional neurological features and we defined this group as having ot plus syndrome of these had parkinsonism of these had typical parkinsons disease pd had vascular and had druginduced parkinsonism among the remaining patients had RLS rls had tardive dyskinesia and orofacial dyskinesias of uncertain etiology one patient with pd and the patient with VP also had rls age at onset was significantly earlier in the primary ot mean sd than in the ot plus z p group in of the ot plus patients ot leg symptoms preceded the onset of additional neurological features ot appeared to be underdiagnosed and on average it took years from the initial complaints until a diagnosis was made in GA treatment response to a variety of drugs such as clonazepam primidone and LD was poor in most cases ot PS remain relatively unchanged over the years but in of cases the condition gradually worsened over the years and in some of these cases PS spread proximally to involve the trunk and arms ot may not be a discrete disorder as commonly believed and associated features like parkinsonism present in nearly of cases dopaminergic dysfunction may have a role in the pathophysiology of this disorder
|
MEDAL
|
MR cyst is a very rare benign congenital lesion occurring mainly on the VP aspect of the penis but can develop anywhere in the midline between the external urethral meatus and anus we report a case of median raphe cyst in the perineum presenting as a perianal polyp in a yearold english WG male with exceptionally rare ciliated epithelium according to our knowledge this is the third such case of ciliated median raphe cyst in the english literature this case also the first case of ciliated median raphe cyst in the perineum location focuses on pathogenesis of median raphe cyst
|
MEDAL
|
the value of digital systolic blood pressure dbpt survival at min the present T0 was undertaken to investigate the potential for more sophisticated data analytical techniques to improve sensitivity in one group of eight healthy male volunteers autologous CRC were labelled with chromium and injected immediately while in a second group CRC were stored for d prior to i.t. in both CG eight to samples were collected in the first h and another samples over the next weeks estimation of the min per cent survival was insufficiently sensitive to detect physiological haemolysis following injection of dold autologous blood regression analysis of h survival data however demonstrated significantly higher red cell clearance rates in these cases than in those receiving fresh cells with a mean h loss of of activity the upper limit for the h red cell CL was h after fresh autologous blood and h T3 dold blood the significance of these findings is discussed and a protocol suggested for the analysis of ST red cell survival data
|
MEDAL
|
the protein disulphidebond isomerization activity of highly AS homogeneous protein disulphideisomerase measured by reactivation of scrambled ribonuclease is enhanced by edta and by phosphate buffers as shown for previous lessactive preparations the enzyme has a narrow ph optimum around ph and requires the presence of either a dithiol or a thiol the dithiol dithiothreitol is ERP at concentrations fold lower than the monothiols reduced glutathione and cysteamine the enzyme follows MM kinetics with respect to these substrates km values are and microm respectively the enzyme shows apparent inhibition by high concentrations of thiol or dithiol compounds greater than x km but the effect is mainly on the extent of reaction not the initial rate this is interpreted as indicating the formation of significant amounts of reduced ribonuclease in these more reducing conditions the purified enzyme will also catalyse net reduction of insulin disulphide bonds by reduced glutathione ie it has thiolproteindisulphide oxidoreductase or glutathioneinsulin transhydrogenase activity but this requires considerably higher concentrations of enzyme and reduced glutathione than does the disulphideisomerization activity the km for reduced glutathione in this reaction is an order of magnitude greater than that for the disulphideisomerization activity and the turnover number is considerably lower than that of other enzymes that can catalyse thioldisulphide oxidoreduction conventional twosubstrate steadystate analysis of the thiolproteindisulphide oxidoreductase activity indicates that it follows a ternarycomplex mechanism the protein disulphideisomerase and thiolproteindisulphide oxidoreductase MICs copurify quantitatively through the final stages of purification implying that a single protein species is responsible for both activities it is concluded that previous S9 from various sources that have been referred to as protein disulphideisomerase disulphideinterchange enzyme thiolproteindisulphide oxidoreductase or GIT are identical or homologous proteins the CA nomenclature and physiological role of this enzyme are discussed
|
MEDAL
|
idiopathic myointimal hyperplasia of mesenteric veins imhmv is a rare and poorly understood ICM colitis that occurs in the rectosigmoid colon of predominantly young previously healthy male patients a yearold japanese man presented to our hospital with a year history of worsening diarrhea lower ABD pain and WL kg laboratory evaluation revealed white blood RCC of μl creactive protein level of mgdl normal range and negative results for stool culture including clostridium difficile colonoscopy showed circumferential and edematous narrowing of the sigmoid colon with deep longitude ulceration biopsy was done and examination of the specimen demonstrated no TPS ischemia the patient was treated with bowel rest antibiotics and iv fluids however his symptoms worsened finally sigmoidectomy was carried out histological examination demonstrated significant MIH of MES veins leading to thickening and stenosis of the A-V lumen therefore the final diagnosis was imhmv three months following sigmoidectomy he was asymptomatic
|
MEDAL
|
coronary i.a. bypass surgery is a highly effective and durable therapy of coronary artery disease together with IM arteries the saphenous vein grafts are the most important conduits for coronary surgery we reviewed the topic of local pharmacologic and gene therapeutic treatment approaches to prevent neointimal PH in VG perivascular therapy of veins before arterialization would be a simple RPA that avoids SVR SE of medications the current data available show that there are promising experimental approaches in vitro models animal in vivo models for pharmacological and gene therapeutic treatment of vein graft failure
|
MEDAL
|
this paper contrasts applications of both the contingent valuation cv and contingent ranking cr methods as applied to a common issue the valuation of improvements to the water quality of an urban river the river tame running through the city of birmingham uk building upon earlier exp work the cv design used ensures that respondents are fully aware of all impending valuation tasks prior to undertaking any one of those tasks such an RPA is directly comparable to the cr design for which full awareness of all options is a prerequisite findings indicate that the cv responses exhibit strong internal consistency with expected relationships observed between values and theoretically expected parameters external comparisons show that cr valuations are substantially larger than those elicited through cv with protest votes excluded and that the response rate for the cr survey is significantly higher than that for the cv survey
|
MEDAL
|
we screened a total of unrelated patients with neurofibromatosis type nf for mutations on exons and of the nf gene using temperature gradient gel electrophoresis tgge careful interpretation of exon tgge patterns was necessary due to interference by an exonic polymorphism three novel mutations were identified a stop mutation in exon qx caused by a ct transition at cdna nucleotide position a transition at the invariant g of the splice acceptor site in the intron c ga and a transversion at the invariant g of the splice donor site in intron g t analysis of mrna revealed the predicted abnormal splice products while skipping of exon causes a shift in the reading frame with a premature stop codon downstream in the middle of exon skipping of exon leads to an inframe deletion with the predicted protein product being shortened by amino acids
|
MEDAL
|
when distal pancreatectomy is carried out for leftsided pancreatic CA splenectomy is usually performed not only for marginnegative resection but also for ERP clearance of the splenic hilar lymph NO lns however the incidence of splenic hilar ln metastasis in these patients has not been definitively determined
|
MEDAL
|
for inland brackish water desalination by reverse osmosis or ro concentrate or reject disposal poses a major challenge however enhanced recovery and consequent reduction in the reject volume using ro processes is limited by the solubility of ions present in the feedwater one of the most common and stubborn precipitate formed during desalination is calcium sulfate reducing or eliminating the presence of sulfate would allow the process to operate at higher recoveries without threat to membrane scaling in this research this goal is accomplished by using an appropriate mixture of selfregenerating AE resins that selectively remove and replace sulfate by chloride prior to the ro unit most importantly the mixed bed of anion exchange resins is selfregenerated with the reject brine from the ro process thus requiring no addition of external chemicals the current work demonstrates the reversibility of the hybrid ion exchange and ro hixro process with REC for a brackish water composition representative of groundwater in san joaquin valley in california containing approximately mgl of total dissolved solids or tds consequently the reject volume can be reduced by without the threat of sulfate scaling and use of antiscaling chemicals can be eliminated altogether by appropriately designing or tuning the mixed bed of AE resins the process can be D2 to nearly any composition of brackish water for enhanced recovery and consequent reduction in the reject volume
|
MEDAL
|
adhesion molecules are involved in cell invasion in autoimmune thyroid disease it was also reported that patients with untreated graves disease gd had high serum level of soluble form of eselectin seselectin the concentration of which correlated with the activity of the disease the aim of the present study was to elucidate whether the common variants in eselectin gene sele were associated with the OD of gd six tagsnps within sele were studied in patients with gd and HS in chinese population our data showed that common sele SCV were associated with gd p haplotype analysis of the single nucleotide polymorphisms revealed an association of a haplotype ataacc with gd p furthermore quantitative trait analysis showed a significant association of sele haplotype with seselectin levels p this T0 therefore could provide us to a certain degree the insight that common sele SCV may be associated with susceptibility to gd in chinese population though the limitation of sample size and multiple test problems exists
|
MEDAL
|
the morphological NC of the cell surface in the inner zone of the adrenal SC was studied in IN hypophysectomized and acthtreated hypophynine RSV rings these models were then utilized to examine the antivasoconstriction properties of HAL in vivo HAL mac produced a significant depression in the V1 response to azepexole an alpha AR agonist but HAL did not alter vasoconstriction by phenylephrine an alpha adrenoceptor agonist HAL caused a reduction of maximal response p less than to azepexole in pithed rats and a fold rightward shift of the log doseresponse curve p less than similarly in vitro HAL significantly attenuated alpha but not alpha AR responsiveness halothane depressed maximal vein contraction to azepexole by p less than and shifted the log concentrationresponse curve fold to the RA p less than the observed selective interference with alpha mediated vasoconstriction by HAL is unlikely to represent drug antagonism at the receptor level our observations may suggest indirectly that HAL interferes with ca entry into vascular smooth muscle the phenomenon of selective antivasoconstriction at alpha ARs by HAL may explain why alpha adrenergic agonists often appear to retain their vasopressor activity during HAL anesthesia the mechanism of halothaneinduced vasodilation thus includes attenuation of alpha but not alpha adrenergic vasoconstriction this further demonstrates the multifactorial nature of halothaneinduced vasodilation
|
MEDAL
|
schistosomiasis the second L1 parasitic disease in the world after malaria affects at least million people million being exposed to the risk of infection it is widely agreed that a vaccine strategy which could lead to the induction of effector mechanisms reducing the level of reinfection and ideally parasite fecundity would deeply affect the incidence of pathological manifestations as well as the parasite transmission potentialities extensive studies performed in the rat MM have allowed the identification of novel effector mechanisms involving RAST and various inflammatory cell populations eosinophils macrophages and platelets whereas regulation of immune response by blocking antibodies has been evidenced recent epidemiological studies have now entirely confirmed in human populations the role of RAST in the acquisition of resistance and the association of igg blocking antibodies with increased susceptibility on the basis of these concepts several schistosome target proteins have been identified and their encoding genes cloned one of them a schistosome glutathione stransferase sm gst appears as a promising vaccine candidate immunization experiments have shown that two cDNA goals can be achieved a a partial but significant reduction of the worm population up to in rats b a significant reduction of parasite fecundity up to in mice and in cattle and egg viability up to at least two distinct immunological mechanisms account for these two effects ige antibodies appear as a major humoral component of acquired resistance whereas iga antibodies appear as a major humoral factor affecting parasite fecundityabstract truncated at words
|
MEDAL
|
direct c arylation of imidazoapyridines with aryl tosylates and mesylates has been accomplished by employing palladiumii acetate associated with sphos dicyclohexylphosphinodimethoxybiphenyl or l diisopropylphosphinophenylmethylhindole this catalyst system can be applied to a wide range of aryl sulfonates and shows excellent c regioselectivity of imidazoapyridine these results represent the first examples of using tosylate and mesylatefunctionalized arenes as the electrophile partners for this regioselective direct arylation
|
MEDAL
|
applying thiazole orange stain and multiparameter flowcytometry immature erythrocytes eg reticulocytes can be discriminated from the mature erythrocytes by virtue of their higher rnacontent one L1 problem of this method however consists in the inclusion of NCs leucocytes and C1 rnacontaining platelets in the population defined by light scatterpatterns as erythrocytes due to the high intensity of IF with thiazole orange of all these cellular elements all of them in the analysis are prone to be classified erroneously as reticulocytes in order to classify elements in analysis properly as erythroid reticulocytesmature erythrocytes or as nonerythroid leucocytesplatelets an alternative staining method is shown in this paper consisting of thiazole orange combined to antiglycophorinapemonoclonal antibody
|
MEDAL
|
occurrence of metachronous primary malignant neoplasms pmn in five or more different organs and tissue of the same patient is a very rare event the present paper reports on a female patient who experienced hodgkins disease of nodular sclerotic type stage iv carcinoma of the cervix uteri stage i adenocarcinoma of the rectum dukes a and a welldifferentiated adenocarcinoma of the stomach pt before she demonstrated multicentric MBT-2 of the renal pelvis and ureter ptb g and of the bladder pta g although an increased inherent predisposition of the patient to exhibit those neoplasms similar to lynch syndrome ii is to be discussed her previous treatments with cyclophosphamide and external radiotherapy are likely to explain at least the occurrence of urothelial cancer however a report on renal pelvis and ureteral CA induced by cyclophosphamide or irradiation is a rarity in itself
|
MEDAL
|
an alternative tapbiopsy technique for early management of endophthalmitis is described the technique uses the cataract surgery wound for AC washout and for a posterior continuous curvilinear capsulorhexis through which anterior vitrectomy removal of part or all the vitreous PA and injection of antibiotics can be performed the RPA is safe avoids pars plana incisions and maintains capsule support for the intraocular lens or for removal and reimplantation of a posterior chamber lens in the bag
|
MEDAL
|
this review covers gynecologic manifestations that may occur in rare hereditary syndromes recent advances in disorders such as hereditary leiomyomatosis renal cell carcinoma syndrome and TSC are discussed as well as lesions that occur in von hippellindau syndrome nevoid basal cell carcinoma syndrome cowden syndrome ollier diseasemaffucci syndrome and carney complex characteristic clinicopathologic features of each of these syndromes are discussed with an emphasis on the key features that enable pathologists to identify patients at highest risk for these diseases
|
MEDAL
|
a model for steam gasification of biomass was developed by applying thermodynamic equilibrium calculations with this MM the simulation of a decentralized combined heat and SP station based on a dual fluidizedbed steam gasifier was carried out fuel composition ultimate analysis and moisture content and the operating parameters temperature and amount of gasification agent were varied over a wide range their influences on amount composition and heating value of product gas and process efficiencies were evaluated it was shown that the accuracy of an equilibrium model for the gas composition is sufficient for thermodynamic considerations net electric efficiency of about can be expected with a rather simple process sensitivity analysis showed that gasification temperature and fuel oxygen content were the most significant parameters determining the chemical efficiency of the gasification
|
MEDAL
|
a man with a tumor in the right SPL had difficulty reaching for visualized objects there were no significant deficits in visual sensation visual attention somatosensory CF elementary motility praxis or visuospatial performance if allowed to visually fixate the target before reaching he misreached only with his left arm and only when he was not allowed to observe the reaching limb if he was required to maintain CE visual fixation while reaching into his IP visual fields his left arm misreached into both visual hemifields but his RA arm misreached only into the left visual hemifield these results demonstrate abnormalities referable to both the CL arm and the contralateral visual field that can neither be reduced to elementary disturbances of visual or somatosensory function nor to an elementary disturbance of motility this pattern of misreaching has not been previously reported in human subjects or in exp animals but this may be attributable to differences of methodology the misreaching observed in this patient may correspond to loss of posterior parietal neurons serving a supramodal integrative CF
|
MEDAL
|
radiation treatment planning is currently in a state of rapid NC dissatisfaction with past planning technology stems from the growing realization that increases in the local regional tumor control rate will increase the cure rate in many malignancies even at the best treatment centers geometric tumor misses are commonplace traditional constraints on treatment techniques originally imposed for simplicity and reproducibility are no longer necessary and can result in suboptimal treatment treatment plans judged optimal in two dimensions may be far from optimal when viewed over the entire treatment volume lack of treatment reproducibility is also commonplace and can be demonstrated to adversely affect treatment outcome on the positive side recent developments in computer graphics image processing radiation physics and radiation biology are now making it possible to define design and deliver sophisticated d radiation treatments however because many of these technologies are being developed for other disciplines their applicability to radiation therapy RTP is not widely appreciated we outline the current status and new developments in radiation therapy RTP
|
MEDAL
|
it is known that the L1 red cell sialoglycoprotein sgp of m CRC has the same amino acid sequence as m sgp whereas that of tm cells has the same CS as n sgp m and tm are serologically demonstrable when a substitution of nacetyldglucosamine for nacetylneuraminic acid occurs in one or more of the alkalilabile tetrasaccharides bound at positions andor of m or n sgp respectively the authors used two serums containing antim and potent antim and two containing antitm in tests for antibody crossreactivity and cross adsorption and in antibody inhibition studies the distinct specificities of antim and antitm as determined by these studies show that the m and n genespecified amino acids are more important than the glycosylation NC in the fine structure of m and tm antigens
|
MEDAL
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.