text
stringlengths 0
128k
|
|---|
**Author details**
Roshan Nazir1,2\*, Abhay Prasad3 , Ashish Parihar4 , Mohammed S. Alqahtani5 and Rabbani Syed5
1 Department of Chemical Engineering, Qatar University, Doha, Qatar
2 Department of Chemistry, Bilkent University, Bilkent, Ankara, Turkey
3 Department of Biological Sciences and Bioengineering, Indian Institute of Technology Kanpur, Kanpur, India
4 Department of Chemistry, Rutgers-The State University of New Jersey, New Brunswick, USA
5 Department of Pharmaceutics, College of Pharmacy, King Saud University, Riyadh, Saudi Arabia
\*Address all correspondence to<EMAIL_ADDRESS>
© 2021 The Author(s). Licensee IntechOpen. This chapter is distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/ by/3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
**213**
*Colloidal Nanocrystal-Based Electrocatalysts for Combating Environmental Problems…*
[8] Lu Y, Jiang Z-y, Xu S-w, Wu H. Efficient conversion of CO2 to formic acid by formate dehydrogenase immobilized in a novel alginate– silica hybrid gel. Catalysis Today.
[9] Kalyanasundaram K, Graetzel M. Artificial photosynthesis: biomimetic approaches to solar energy conversion and storage. Current opinion in Biotechnology. 2010;21(3):298-310.
[10] Jouny M, Luc W, Jiao F. General techno-economic analysis of CO2 electrolysis systems. Industrial & Engineering Chemistry Research.
[11] Sun Z, Ma T, Tao H, Fan Q,
Materials. 2019;31(3):576-96.
2019;48(21):5310-49.
2005;437(7059):664-70.
[13] Wang L, Chen W, Zhang D, et al. Surface strategies for catalytic CO 2 reduction: from two-dimensional materials to nanoclusters to single atoms. Chemical Society Reviews.
[14] Yin Y, Alivisatos AP. Colloidal nanocrystal synthesis and the organic–inorganic interface. Nature.
[15] Tang Y, Zheng G. Colloidal nanocrystals for electrochemical reduction reactions. Journal of colloid and interface science. 2017;485:308-27.
[16] Ji X, Song X, Li J, Bai Y,
Yang W, Peng X. Size control of gold nanocrystals in citrate reduction: the third role of citrate. Journal of
Han B. Fundamentals and challenges of electrochemical CO2 reduction using two-dimensional materials. Chem.
[12] Cargnello M. Colloidal Nanocrystals as Building Blocks for Well-Defined Heterogeneous Catalysts. Chemistry of
2006;115(1-4):263-8.
2018;57(6):2165-77.
2017;3(4):560-87.
*DOI: http://dx.doi.org/10.5772/intechopen.95338*
[1] Nazir R, Kumar A, Ali S, Saad MAS, Al-Marri MJ. Galvanic exchange as a novel method for carbon nitride supported coag catalyst synthesis for oxygen reduction and carbon dioxide conversion. Catalysts. 2019;9(10):860.
[2] Nazir R, Kumar A, Saad MAS, Ashok A. Synthesis of hydroxide nanoparticles of Co/Cu on carbon nitride surface via galvanic exchange method for electrocatalytic CO2 reduction into formate. Colloids and Surfaces A: Physicochemical and Engineering Aspects. 2020; 598:124835.
[3] Nazir R, Kumar A, Saad MAS, Ali S. Development of CuAg/Cu2O nanoparticles on carbon nitride surface for methanol oxidation and selective conversion of carbon dioxide into formate. Journal of Colloid and Interface Science. 2020; 578:726-737
[4] Nazir R, Basak U, Pande S. Synthesis of one-dimensional RuO2 nanorod for hydrogen and oxygen evolution reaction: An efficient and stable electrocatalyst. Colloids and Surfaces A: Physicochemical and Engineering
Aspects. 2019;560:141-8.
2013;2(2):191-9.
2018;2(5):825-32.
[7] Yaashikaa P, Kumar PS, Varjani SJ, Saravanan A. A review on photochemical, biochemical and electrochemical transformation of CO2 into value-added products. Journal of CO2 Utilization. 2019;33:131-47.
[5] Ma S, Kenis PJ. Electrochemical conversion of CO2 to useful chemicals: current status, remaining challenges, and future opportunities. Current Opinion in Chemical Engineering.
[6] Bushuyev OS, De Luna P, Dinh CT, et al. What should we make with CO2 and how can we make it? Joule.
**References**
*Colloidal Nanocrystal-Based Electrocatalysts for Combating Environmental Problems… DOI: http://dx.doi.org/10.5772/intechopen.95338*
|
*/
declare var Titanium$App$copyright: string;
/**
* Build type that reflects how the application was packaged.
* Returns one of the following values:
* * `development` (Simulator)
* * `test` (Device)
* * `production` (App Store / Adhoc)
*/
declare var Titanium$App$deployType: string;
/**
* Application description, determined by `tiapp.xml`.
*/
declare var Titanium$App$description: string;
/**
* Application globally-unique ID, determined by `tiapp.xml`.
*/
declare var Titanium$App$guid: string;
/**
* Shows the application's splash screen on app resume.
*/
declare var Titanium$App$forceSplashAsSnapshot: boolean;
/**
* Application ID, from `tiapp.xml`.
*/
declare var Titanium$App$id: string;
/**
* The install ID for this application.
*/
declare var Titanium$App$installId: string;
/**
* Determines whether the screen is locked when the device is idle.
*/
declare var Titanium$App$idleTimerDisabled: boolean;
/**
* Application name, determined by `tiapp.xml`.
*/
declare var Titanium$App$name: string;
/**
* Determines whether proximity detection is enabled.
*/
declare var Titanium$App$proximityDetection: boolean;
/**
* Indicates the state of the device's proximity sensor, according to the
* <Titanium.App.proximity> event.
*/
declare var Titanium$App$proximityState: boolean;
/**
* Prevents network activity indicator from being displayed.
*/
declare var Titanium$App$disableNetworkActivityIndicator: boolean;
/**
* Application publisher, from `tiapp.xml`.
*/
declare var Titanium$App$publisher: string;
/**
* Unique session identifier for the current continuous run of the application.
*/
declare var Titanium$App$sessionId: string;
/**
* Application URL, from `tiapp.xml`.
*/
declare var Titanium$App$url: string;
/**
* Application version, from `tiapp.xml`.
*/
declare var Titanium$App$version: string;
/**
* Indicates whether or not the soft keyboard is visible.
*/
declare var Titanium$App$keyboardVisible: boolean;
/**
* Indicates whether or not the user interaction shoud be tracked.
*/
declare var Titanium$App$trackUserInteraction: boolean;
/**
* Adds the specified callback as an event listener for the named event.
*/
declare function Titanium$App$addEventListener(name: string, callback: (param0: any) => any): void
/**
* Removes the specified callback as an event listener for the named event.
*/
declare function Titanium$App$removeEventListener(name: string, callback: (param0: any) => any): void
/**
* Fires a synthesized event to any registered listeners.
*/
declare function Titanium$App$fireEvent(name: string, event: any): void
/**
* Applies the properties to the proxy.
*/
declare function Titanium$App$applyProperties(props: any): void
/**
* Fire a system-level event such as <Titanium.App.EVENT_ACCESSIBILITY_ANNOUNCEMENT>.
*/
declare function Titanium$App$fireSystemEvent(eventName: string, param?: any): void
/**
* Returns the arguments passed to the application on startup.
*/
declare function Titanium$App$getArguments(): launchOptions
/**
* Gets the value of the <Titanium.App.bubbleParent> property.
*/
declare function Titanium$App$getBubbleParent(): boolean
/**
* Sets the value of the <Titanium.App.bubbleParent> property.
*/
declare function Titanium$App$setBubbleParent(bubbleParent: boolean): void
/**
* Gets the value of the <Titanium.App.apiName> property.
*/
declare function Titanium$App$getApiName(): string
/**
* Gets the value of the <Titanium.App.lifecycleContainer> property.
*/
declare function Titanium$App$getLifecycleContainer(): Titanium$UI$Window | Titanium$UI$TabGroup
/**
* Sets the value of the <Titanium.App.lifecycleContainer> property.
*/
declare function Titanium$App$setLifecycleContainer(lifecycleContainer: Titanium$UI$Window): void
/**
* Sets the value of the <Titanium.App.lifecycleContainer> property.
*/
declare function Titanium$App$setLifecycleContainer(lifecycleContainer: Titanium$UI$TabGroup): void
/**
* Gets the value of the <Titanium.App.accessibilityEnabled> property.
*/
declare function Titanium$App$getAccessibilityEnabled(): boolean
/**
* Gets the value of the <Titanium.App.analytics> property.
*/
declare function Titanium$App$getAnalytics(): boolean
/**
* Gets the value of the <Titanium.App.copyright> property.
*/
declare function Titanium$App$getCopyright(): string
/**
* Gets the value of the <Titanium.App.deployType> property.
*/
declare function Titanium$App$getDeployType(): string
/**
* Gets the value of the <Titanium.App.description> property.
*/
declare function Titanium$App$getDescription(): string
/**
* Gets the value of the <Titanium.App.guid> property.
*/
declare function Titanium$App$getGuid(): string
/**
* Gets the value of the <Titanium.App.forceSplashAsSnapshot> property.
*/
declare function Titanium$App$getForceSplashAsSnapshot(): boolean
/**
* Sets the value of the <Titanium.App.forceSplashAsSnapshot> property.
*/
declare function Titanium$App$setForceSplashAsSnapshot(forceSplashAsSnapshot: boolean): void
/**
* Gets the value of the <Titanium.App.id> property.
*/
declare function Titanium$App$getId(): string
/**
* Gets the value of the <Titanium.App.installId> property.
*/
declare function Titanium$App$getInstallId(): string
/**
* Gets the value of the <Titanium.App.idleTimerDisabled> property.
*/
declare function Titanium$App$getIdleTimerDisabled(): boolean
/**
* Sets the value of the <Titanium.App.idleTimerDisabled> property.
*/
declare function Titanium$App$setIdleTimerDisabled(idleTimerDisabled: boolean): void
/**
* Gets the value of the <Titanium.App.name> property.
*/
declare function Titanium$App$getName(): string
/**
* Gets the value of the <Titanium.App.proximityDetection> property.
*/
declare function Titanium$App$getProximityDetection(): boolean
/**
* Sets the value of the <Titanium.App.proximityDetection> property.
*/
declare function Titanium$App$setProximityDetection(proximityDetection: boolean): void
/**
* Gets the value of the <Titanium.App.proximityState> property.
*/
declare function Titanium$App$getProximityState(): boolean
/**
* Gets the value of the <Titanium.App.disableNetworkActivityIndicator> property.
*/
declare function Titanium$App$getDisableNetworkActivityIndicator(): boolean
/**
* Sets the value of the <Titanium.App.disableNetworkActivityIndicator> property.
*/
declare function Titanium$App$setDisableNetworkActivityIndicator(disableNetworkActivityIndicator: boolean): void
/**
* Gets the value of the <Titanium.App.publisher> property.
*/
declare function Titanium$App$getPublisher(): string
/**
* Gets the value of the <Titanium.App.sessionId> property.
*/
declare function Titanium$App$getSessionId(): string
/**
* Gets the value of the <Titanium.App.url> property.
*/
declare function Titanium$App$getUrl(): string
/**
* Gets the value of the <Titanium.App.version> property.
*/
declare function Titanium$App$getVersion(): string
/**
* Gets the value of the <Titanium.App.keyboardVisible> property.
*/
declare function Titanium$App$getKeyboardVisible(): boolean
declare var npm$namespace$Titanium$App$Android: {
addEventListener: typeof Titanium$App$Android$addEventListener,
removeEventListener: typeof Titanium$App$Android$removeEventListener,
fireEvent: typeof Titanium$App$Android$fireEvent,
applyProperties: typeof Titanium$App$Android$applyProperties,
getBubbleParent: typeof Titanium$App$Android$getBubbleParent,
setBubbleParent: typeof Titanium$App$Android$setBubbleParent,
getApiName: typeof Titanium$App$Android$getApiName,
getLifecycleContainer: typeof Titanium$App$Android$getLifecycleContainer,
setLifecycleContainer: typeof Titanium$App$Android$setLifecycleContainer,
getAppVersionCode: typeof Titanium$App$Android$getAppVersionCode,
getAppVersionName: typeof Titanium$App$Android$getAppVersionName,
getLaunchIntent: typeof Titanium$App$Android$getLaunchIntent,
bubbleParent: typeof Titanium$App$Android$bubbleParent,
apiName: typeof Titanium$App$Android$apiName,
lifecycleContainer: typeof Titanium$App$Android$lifecycleContainer,
R: typeof Titanium$App$Android$R,
appVersionCode: typeof Titanium$App$Android$appVersionCode,
appVersionName: typeof Titanium$App$Android$appVersionName,
launchIntent: typeof Titanium$App$Android$launchIntent,
}
/**
* Indicates if the proxy will bubble an event to its parent.
*/
declare var Titanium$App$Android$bubbleParent: boolean;
/**
* The name of the API that this proxy corresponds to.
*/
declare var Titanium$App$Android$apiName: string;
/**
* The Window or TabGroup whose Activity lifecycle should be triggered on the proxy.
*/
declare var Titanium$App$Android$lifecycleContainer: Titanium$UI$Window | Titanium$UI$TabGroup;
/**
* The `R` namespace for application resources.
*/
declare var Titanium$App$Android$R: Titanium$App$Android$R;
/**
* The version number of the application.
*/
declare var Titanium$App$Android$appVersionCode: number;
/**
* The version name of the application.
*/
declare var Titanium$App$Android$appVersionName: string;
/**
* Return the intent that was used to launch the application.
*/
declare var Titanium$App$Android$launchIntent: Titanium$Android$Intent;
/**
* Adds the specified callback as an event listener for the named event.
*/
declare function Titanium$App$Android$addEventListener(name: string, callback: (param0: any) => any): void
/**
* Removes the specified callback as an event listener for the named event.
*/
declare function Titanium$App$Android$removeEventListener(name: string, callback: (param0: any) => any): void
/**
* Fires a synthesized event to any registered listeners.
*/
declare function Titanium$App$Android$fireEvent(name: string, event: any): void
/**
* Applies the properties to the proxy.
*/
declare function Titanium$App$Android$applyProperties(props: any): void
/**
* Gets the value of the <Titanium.App.Android.bubbleParent> property.
*/
declare function Titanium$App$Android$getBubbleParent(): boolean
/**
* Sets the value of the <Titanium.App.Android.bubbleParent> property.
*/
declare function Titanium$App$Android$setBubbleParent(bubbleParent: boolean): void
/**
* Gets the value of the <Titanium.App.Android.apiName> property.
*/
declare function Titanium$App$Android$getApiName(): string
/**
* Gets the value of the <Titanium.App.Android.lifecycleContainer> property.
*/
declare function Titanium$App$Android$getLifecycleContainer(): Titanium$UI$Window | Titanium$UI$TabGroup
/**
* Sets the value of the <Titanium.App.Android.lifecycleContainer> property.
*/
declare function Titanium$App$Android$setLifecycleContainer(lifecycleContainer: Titanium$UI$Window): void
/**
* Sets the value of the <Titanium.App.Android.lifecycleContainer> property.
*/
declare function Titanium$App$Android$setLifecycleContainer(lifecycleContainer: Titanium$UI$TabGroup): void
/**
* Gets the value of the <Titanium.App.Android.appVersionCode> property.
*/
declare function Titanium$App$Android$getAppVersionCode(): number
/**
* Gets the value of the <Titanium.App.Android.appVersionName> property.
*/
declare function Titanium$App$Android$getAppVersionName(): string
/**
* Gets the value of the <Titanium.App.Android.launchIntent> property.
*/
declare function Titanium$App$Android$getLaunchIntent(): Titanium$Android$Intent
/**
* The Titanium binding of the native Android `R` class, giving access to application resources.
*/
declare type Titanium$App$Android$R = {} & Titanium$Proxy
declare var npm$namespace$Titanium$App$Properties: {
addEventListener: typeof Titanium$App$Properties$addEventListener,
removeEventListener: typeof Titanium$App$Properties$removeEventListener,
fireEvent: typeof Titanium$App$Properties$fireEvent,
applyProperties: typeof Titanium$App$Properties$applyProperties,
getBool: typeof Titanium$App$Properties$getBool,
getDouble: typeof Titanium$App$Properties$getDouble,
getInt: typeof Titanium$App$Properties$getInt,
getList: typeof Titanium$App$Properties$getList,
getObject: typeof Titanium$App$Properties$getObject,
getString: typeof Titanium$App$Properties$getString,
hasProperty: typeof Titanium$App$Properties$hasProperty,
listProperties: typeof Titanium$App$Properties$listProperties,
removeProperty: typeof Titanium$App$Properties$removeProperty,
removeAllProperties: typeof Titanium$App$Properties$removeAllProperties,
setBool: typeof Titanium$App$Properties$setBool,
setDouble: typeof Titanium$App$Properties$setDouble,
setInt: typeof Titanium$App$Properties$setInt,
setList: typeof Titanium$App$Properties$setList,
setObject: typeof Titanium$App$Properties$setObject,
setString: typeof Titanium$App$Properties$setString,
getBubbleParent: typeof Titanium$App$Properties$getBubbleParent,
setBubbleParent: typeof Titanium$App$Properties$setBubbleParent,
getApiName: typeof Titanium$App$Properties$getApiName,
getLifecycleContainer: typeof Titanium$App$Properties$getLifecycleContainer,
setLifecycleContainer: typeof Titanium$App$Properties$setLifecycleContainer,
bubbleParent: typeof Titanium$App$Properties$bubbleParent,
apiName: typeof Titanium$App$Properties$apiName,
lifecycleContainer: typeof Titanium$App$Properties$lifecycleContainer,
}
/**
* Indicates if the proxy will bubble an event to its parent.
*/
declare var Titanium$App$Properties$bubbleParent: boolean;
/**
* The name of the API that this proxy corresponds to.
*/
declare var Titanium$App$Properties$apiName: string;
/**
* The Window or TabGroup whose Activity lifecycle should be triggered on the proxy.
*/
declare var Titanium$App$Properties$lifecycleContainer: Titanium$UI$Window | Titanium$UI$TabGroup;
/**
* Adds the specified callback as an event listener for the named event.
*/
declare function Titanium$App$Properties$addEventListener(name: string, callback: (param0: any) => any): void
/**
* Removes the specified callback as an event listener for the named event.
*/
declare function Titanium$App$Properties$removeEventListener(name: string, callback: (param0: any) => any): void
/**
* Fires a synthesized event to any registered listeners.
*/
declare function Titanium$App$Properties$fireEvent(name: string, event: any): void
/**
* Applies the properties to the proxy.
*/
declare function Titanium$App$Properties$applyProperties(props: any): void
/**
* Returns the value of a property as a boolean data type.
*/
declare function Titanium$App$Properties$getBool(property: string, defaultValue?: boolean): boolean
/**
* Returns the value of a property as a double (double-precision, floating point) data type.
*/
declare function Titanium$App$Properties$getDouble(property: string, defaultValue?: number): number
/**
* Returns the value of a property as an integer data type.
*/
declare function Titanium$App$Properties$getInt(property: string, defaultValue?: number): number
/**
* Returns the value of a property as an array data type.
*/
declare function Titanium$App$Properties$getList(property: string, defaultValue?: $ReadOnlyArray<any>): any[]
/**
* Returns the value of a property as an object.
*/
declare function Titanium$App$Properties$getObject(property: string, defaultValue?: any): any
/**
* Returns the value of a property as a string data type.
*/
declare function Titanium$App$Properties$getString(property: string, defaultValue?: string): string
/**
* Indicates whether a property exists.
*/
declare function Titanium$App$Properties$hasProperty(property: string): boolean
/**
* Returns an array of property names.
*/
declare function Titanium$App$Properties$listProperties(): any[]
/**
* Removes a property if it exists, or does nothing otherwise.
*/
declare function Titanium$App$Properties$removeProperty(property: string): void
/**
* Removes all properties that have been set by the user on runtime, or does nothing otherwise.
*/
declare function Titanium$App$Properties$removeAllProperties(): void
/**
* Sets the value of a property as a boolean data type. The property will be created if it
* does not exist.
*/
declare function Titanium$App$Properties$setBool(property: string, value: boolean): void
/**
* Sets the value of a property as a double (double-precision, floating point) data type. The
* property will be created if it does not exist.
*/
declare function Titanium$App$Properties$setDouble(property: string, value: number): void
/**
* Sets the value of a property as an integer data type. The property will be created if it
* does not exist.
*/
declare function Titanium$App$Properties$setInt(property: string, value: number): void
/**
* Sets the value of a property as an array data type. The property will be created if it
* does not exist.
*/
declare function Titanium$App$Properties$setList(property: string, value: $ReadOnlyArray<any>): void
/**
* Sets the value of a property as an object data type. The property will be created if it
* does not exist.
*/
declare function Titanium$App$Properties$setObject(property: string, value: any): void
/**
* Sets the value of a property as a string data type. The property will be created if it
* does not exist.
*/
declare function Titanium$App$Properties$setString(property: string, value: string): void
/**
* Gets the value of the <Titanium.App.Properties.bubbleParent> property.
*/
declare function Titanium$App$Properties$getBubbleParent(): boolean
/**
* Sets the value of the <Titanium.App.Properties.bubbleParent> property.
*/
declare function Titanium$App$Properties$setBubbleParent(bubbleParent: boolean): void
/**
* Gets the value of the <Titanium.App.Properties.apiName> property.
*/
declare function Titanium$App$Properties$getApiName(): string
/**
* Gets the value of the <Titanium.App.Properties.lifecycleContainer> property.
*/
declare function Titanium$App$Properties$getLifecycleContainer(): Titanium$UI$Window | Titanium$UI$TabGroup
/**
* Sets the value of the <Titanium.App.Properties.lifecycleContainer> property.
*/
declare function Titanium$App$Properties$setLifecycleContainer(lifecycleContainer: Titanium$UI$Window): void
/**
* Sets the value of the <Titanium.App.Properties.lifecycleContainer> property.
*/
declare function Titanium$App$Properties$setLifecycleContainer(lifecycleContainer: Titanium$UI$TabGroup): void
declare var npm$namespace$Titanium$App$iOS: {
addEventListener: typeof Titanium$App$iOS$addEventListener,
removeEventListener: typeof Titanium$App$iOS$removeEventListener,
fireEvent: typeof Titanium$App$iOS$fireEvent,
applyProperties: typeof Titanium$App$iOS$applyProperties,
createUserDefaults: typeof Titanium$App$iOS$createUserDefaults,
cancelAllLocalNotifications: typeof Titanium$App$iOS$cancelAllLocalNotifications,
cancelLocalNotification: typeof Titanium$App$iOS$cancelLocalNotification,
registerBackgroundService: typeof Titanium$App$iOS$registerBackgroundService,
registerUserNotificationSettings: typeof Titanium$App$iOS$registerUserNotificationSettings,
scheduleLocalNotification: typeof Titanium$App$iOS$scheduleLocalNotification,
setMinimumBackgroundFetchInterval: typeof Titanium$App$iOS$setMinimumBackgroundFetchInterval,
endBackgroundHandler: typeof Titanium$App$iOS$endBackgroundHandler,
sendWatchExtensionReply: typeof Titanium$App$iOS$sendWatchExtensionReply,
createSearchQuery: typeof Titanium$App$iOS$createSearchQuery,
createSearchableIndex: typeof Titanium$App$iOS$createSearchableIndex,
createSearchableItem: typeof Titanium$App$iOS$createSearchableItem,
createSearchableItemAttributeSet: typeof Titanium$App$iOS$createSearchableItemAttributeSet,
createUserActivity: typeof Titanium$App$iOS$createUserActivity,
createUserNotificationAction: typeof Titanium$App$iOS$createUserNotificationAction,
createUserNotificationCategory: typeof Titanium$App$iOS$createUserNotificationCategory,
getBubbleParent: typeof Titanium$App$iOS$getBubbleParent,
setBubbleParent: typeof Titanium$App$iOS$setBubbleParent,
getApiName: typeof Titanium$App$iOS$getApiName,
getCurrentUserNotificationSettings: typeof Titanium$App$iOS$getCurrentUserNotificationSettings,
getSupportedUserActivityTypes: typeof Titanium$App$iOS$getSupportedUserActivityTypes,
getApplicationOpenSettingsURL: typeof Titanium$App$iOS$getApplicationOpenSettingsURL,
bubbleParent: typeof Titanium$App$iOS$bubbleParent,
apiName: typeof Titanium$App$iOS$apiName,
EVENT_ACCESSIBILITY_LAYOUT_CHANGED: typeof Titanium$App$iOS$EVENT_ACCESSIBILITY_LAYOUT_CHANGED,
EVENT_ACCESSIBILITY_SCREEN_CHANGED: typeof Titanium$App$iOS$EVENT_ACCESSIBILITY_SCREEN_CHANGED,
BACKGROUNDFETCHINTERVAL_MIN: typeof Titanium$App$iOS$BACKGROUNDFETCHINTERVAL_MIN,
BACKGROUNDFETCHINTERVAL_NEVER: typeof Titanium$App$iOS$BACKGROUNDFETCHINTERVAL_NEVER,
USER_NOTIFICATION_TYPE_NONE: typeof Titanium$App$iOS$USER_NOTIFICATION_TYPE_NONE,
USER_NOTIFICATION_TYPE_BADGE: typeof Titanium$App$iOS$USER_NOTIFICATION_TYPE_BADGE,
USER_NOTIFICATION_TYPE_SOUND: typeof Titanium$App$iOS$USER_NOTIFICATION_TYPE_SOUND,
USER_NOTIFICATION_TYPE_ALERT: typeof Titanium$App$iOS$USER_NOTIFICATION_TYPE_ALERT,
USER_NOTIFICATION_TYPE_CRITICAL_ALERT: typeof Titanium$App$iOS$USER_NOTIFICATION_TYPE_CRITICAL_ALERT,
USER_NOTIFICATION_TYPE_PROVISIONAL: typeof Titanium$App$iOS$USER_NOTIFICATION_TYPE_PROVISIONAL,
USER_NOTIFICATION_TYPE_PROVIDES_APP_NOTIFICATION_SETTINGS: typeof Titanium$App$iOS$USER_NOTIFICATION_TYPE_PROVIDES_APP_NOTIFICATION_SETTINGS,
USER_NOTIFICATION_ACTIVATION_MODE_BACKGROUND: typeof Titanium$App$iOS$USER_NOTIFICATION_ACTIVATION_MODE_BACKGROUND,
USER_NOTIFICATION_ACTIVATION_MODE_FOREGROUND: typeof Titanium$App$iOS$USER_NOTIFICATION_ACTIVATION_MODE_FOREGROUND,
USER_NOTIFICATION_BEHAVIOR_DEFAULT: typeof Titanium$App$iOS$USER_NOTIFICATION_BEHAVIOR_DEFAULT,
USER_NOTIFICATION_BEHAVIOR_TEXTINPUT: typeof Titanium$App$iOS$USER_NOTIFICATION_BEHAVIOR_TEXTINPUT,
USER_NOTIFICATION_AUTHORIZATION_STATUS_NOT_DETERMINED: typeof Titanium$App$iOS$USER_NOTIFICATION_AUTHORIZATION_STATUS_NOT_DETERMINED,
USER_NOTIFICATION_AUTHORIZATION_STATUS_AUTHORIZED: typeof Titanium$App$iOS$USER_NOTIFICATION_AUTHORIZATION_STATUS_AUTHORIZED,
USER_NOTIFICATION_AUTHORIZATION_STATUS_DENIED: typeof Titanium$App$iOS$USER_NOTIFICATION_AUTHORIZATION_STATUS_DENIED,
USER_NOTIFICATION_AUTHORIZATION_STATUS_PROVISIONAL: typeof Titanium$App$iOS$USER_NOTIFICATION_AUTHORIZATION_STATUS_PROVISIONAL,
USER_NOTIFICATION_SETTING_NOT_SUPPORTED: typeof Titanium$App$iOS$USER_NOTIFICATION_SETTING_NOT_SUPPORTED,
USER_NOTIFICATION_SETTING_ENABLED: typeof Titanium$App$iOS$USER_NOTIFICATION_SETTING_ENABLED,
USER_NOTIFICATION_SETTING_DISABLED: typeof Titanium$App$iOS$USER_NOTIFICATION_SETTING_DISABLED,
USER_NOTIFICATION_ALERT_STYLE_NONE: typeof Titanium$App$iOS$USER_NOTIFICATION_ALERT_STYLE_NONE,
USER_NOTIFICATION_ALERT_STYLE_ALERT: typeof Titanium$App$iOS$USER_NOTIFICATION_ALERT_STYLE_ALERT,
USER_NOTIFICATION_ALERT_STYLE_BANNER: typeof Titanium$App$iOS$USER_NOTIFICATION_ALERT_STYLE_BANNER,
USER_NOTIFICATION_CATEGORY_OPTION_NONE: typeof Titanium$App$iOS$USER_NOTIFICATION_CATEGORY_OPTION_NONE,
USER_NOTIFICATION_CATEGORY_OPTION_CUSTOM_DISMISS_ACTION: typeof Titanium$App$iOS$USER_NOTIFICATION_CATEGORY_OPTION_CUSTOM_DISMISS_ACTION,
USER_NOTIFICATION_CATEGORY_OPTION_ALLOW_IN_CARPLAY: typeof Titanium$App$iOS$USER_NOTIFICATION_CATEGORY_OPTION_ALLOW_IN_CARPLAY,
USER_NOTIFICATION_CATEGORY_OPTION_HIDDEN_PREVIEWS_SHOW_TITLE: typeof Titanium$App$iOS$USER_NOTIFICATION_CATEGORY_OPTION_HIDDEN_PREVIEWS_SHOW_TITLE,
USER_NOTIFICATION_CATEGORY_OPTION_HIDDEN_PREVIEWS_SHOW_SUBTITLE: typeof Titanium$App$iOS$USER_NOTIFICATION_CATEGORY_OPTION_HIDDEN_PREVIEWS_SHOW_SUBTITLE,
UTTYPE_TEXT: typeof Titanium$App$iOS$UTTYPE_TEXT,
UTTYPE_PLAIN_TEXT: typeof Titanium$App$iOS$UTTYPE_PLAIN_TEXT,
UTTYPE_UTF8_PLAIN_TEXT: typeof Titanium$App$iOS$UTTYPE_UTF8_PLAIN_TEXT,
UTTYPE_UTF16_EXTERNAL_PLAIN_TEXT: typeof Titanium$App$iOS$UTTYPE_UTF16_EXTERNAL_PLAIN_TEXT,
UTTYPE_UTF16_PLAIN_TEXT: typeof Titanium$App$iOS$UTTYPE_UTF16_PLAIN_TEXT,
UTTYPE_RTF: typeof Titanium$App$iOS$UTTYPE_RTF,
UTTYPE_HTML: typeof Titanium$App$iOS$UTTYPE_HTML,
UTTYPE_XML: typeof Titanium$App$iOS$UTTYPE_XML,
UTTYPE_PDF: typeof Titanium$App$iOS$UTTYPE_PDF,
UTTYPE_RTFD: typeof Titanium$App$iOS$UTTYPE_RTFD,
UTTYPE_FLAT_RTFD: typeof Titanium$App$iOS$UTTYPE_FLAT_RTFD,
UTTYPE_TXN_TEXT_AND_MULTIMEDIA_DATA: typeof Titanium$App$iOS$UTTYPE_TXN_TEXT_AND_MULTIMEDIA_DATA,
UTTYPE_WEB_ARCHIVE: typeof Titanium$App$iOS$UTTYPE_WEB_ARCHIVE,
UTTYPE_IMAGE: typeof Titanium$App$iOS$UTTYPE_IMAGE,
UTTYPE_JPEG: typeof Titanium$App$iOS$UTTYPE_JPEG,
UTTYPE_JPEG2000: typeof Titanium$App$iOS$UTTYPE_JPEG2000,
UTTYPE_TIFF: typeof Titanium$App$iOS$UTTYPE_TIFF,
UTTYPE_PICT: typeof Titanium$App$iOS$UTTYPE_PICT,
UTTYPE_GIF: typeof Titanium$App$iOS$UTTYPE_GIF,
UTTYPE_PNG: typeof Titanium$App$iOS$UTTYPE_PNG,
UTTYPE_QUICKTIME_IMAGE: typeof Titanium$App$iOS$UTTYPE_QUICKTIME_IMAGE,
UTTYPE_APPLE_ICNS: typeof Titanium$App$iOS$UTTYPE_APPLE_ICNS,
UTTYPE_BMP: typeof Titanium$App$iOS$UTTYPE_BMP,
UTTYPE_ICO: typeof Titanium$App$iOS$UTTYPE_ICO,
UTTYPE_MOVIE: typeof Titanium$App$iOS$UTTYPE_MOVIE,
UTTYPE_VIDEO: typeof Titanium$App$iOS$UTTYPE_VIDEO,
UTTYPE_AUDIO: typeof Titanium$App$iOS$UTTYPE_AUDIO,
UTTYPE_QUICKTIME_MOVIE: typeof Titanium$App$iOS$UTTYPE_QUICKTIME_MOVIE,
UTTYPE_MPEG: typeof Titanium$App$iOS$UTTYPE_MPEG,
UTTYPE_MPEG4: typeof Titanium$App$iOS$UTTYPE_MPEG4,
UTTYPE_MP3: typeof Titanium$App$iOS$UTTYPE_MP3,
UTTYPE_MPEG4_AUDIO: typeof Titanium$App$iOS$UTTYPE_MPEG4_AUDIO,
UTTYPE_APPLE_PROTECTED_MPEG4_AUDIO: typeof Titanium$App$iOS$UTTYPE_APPLE_PROTECTED_MPEG4_AUDIO,
currentUserNotificationSettings: typeof Titanium$App$iOS$currentUserNotificationSettings,
supportedUserActivityTypes: typeof Titanium$App$iOS$supportedUserActivityTypes,
applicationOpenSettingsURL: typeof Titanium$App$iOS$applicationOpenSettingsURL,
UserNotificationCenter: typeof npm$namespace$Titanium$App$iOS$UserNotificationCenter,
}
/**
* Indicates if the proxy will bubble an event to its parent.
*/
declare var Titanium$App$iOS$bubbleParent: boolean;
/**
* The name of the API that this proxy corresponds to.
*/
declare var Titanium$App$iOS$apiName: string;
/**
* Convenience constant for system event "accessibilitylayoutchanged".
*/
declare var Titanium$App$iOS$EVENT_ACCESSIBILITY_LAYOUT_CHANGED: string;
/**
* Convenience constant for system event "accessibilityscreenchanged".
*/
declare var Titanium$App$iOS$EVENT_ACCESSIBILITY_SCREEN_CHANGED: string;
/**
* Use with [setMinimumBackgroundFetchInterval](Titanium.App.iOS.setMinimumBackgroundFetchInterval) method.
* Specifies the smallest fetch interval supported by the system.
*/
declare var Titanium$App$iOS$BACKGROUNDFETCHINTERVAL_MIN: number;
/**
* Use with [setMinimumBackgroundFetchInterval](Titanium.App.iOS.setMinimumBackgroundFetchInterval) method.
* Used to specify a fetch interval large enough to prevent fetch operations from occurring.
*/
declare var Titanium$App$iOS$BACKGROUNDFETCHINTERVAL_NEVER: number;
/**
* The application may not present any UI upon a notification being received.
* Use with the [types](UserNotificationSettings.types) property.
*/
declare var Titanium$App$iOS$USER_NOTIFICATION_TYPE_NONE: number;
/**
* The application may badge its icon upon a notification being received.
* Use with the [types](UserNotificationSettings.types) property.
*/
declare var Titanium$App$iOS$USER_NOTIFICATION_TYPE_BADGE: number;
/**
* The application may play a sound upon a notification being received.
* Use with the [types](UserNotificationSettings.types) property.
*/
declare var Titanium$App$iOS$USER_NOTIFICATION_TYPE_SOUND: number;
/**
* The application may display an alert upon a notification being received.
* Use with the [types](UserNotificationSettings.types) property.
*/
declare var Titanium$App$iOS$USER_NOTIFICATION_TYPE_ALERT: number;
/**
* The ability to play sounds for critical alerts.
* Use with the [types](UserNotificationSettings.types) property.
*/
declare var Titanium$App$iOS$USER_NOTIFICATION_TYPE_CRITICAL_ALERT: number;
/**
* The ability to post non-interrupting notifications provisionally to the Notification Center.
* Use with the [types](UserNotificationSettings.types) property.
*/
declare var Titanium$App$iOS$USER_NOTIFICATION_TYPE_PROVISIONAL: number;
/**
* An option indicating the system should display a button for in-app notification settings.
* Use with the [types](UserNotificationSettings.types) property.
*/
declare var Titanium$App$iOS$USER_NOTIFICATION_TYPE_PROVIDES_APP_NOTIFICATION_SETTINGS: number;
/**
* The action will execute in background. Use with the
* [activationMode](Titanium.App.iOS.UserNotificationAction.activationMode) property.
*/
declare var Titanium$App$iOS$USER_NOTIFICATION_ACTIVATION_MODE_BACKGROUND: number;
/**
* The action will launch the application and execute in the foreground.
* Use with the [activationMode](Titanium.App.iOS.UserNotificationAction.activationMode) property.
*/
declare var Titanium$App$iOS$USER_NOTIFICATION_ACTIVATION_MODE_FOREGROUND: number;
/**
* Default action behavior with no additional action support.
*/
declare var Titanium$App$iOS$USER_NOTIFICATION_BEHAVIOR_DEFAULT: number;
/**
* Provides a textfield with the notification for the user to enter a text response.
*/
declare var Titanium$App$iOS$USER_NOTIFICATION_BEHAVIOR_TEXTINPUT: number;
/**
* The user has not yet made a choice regarding whether the application may post
* user notifications.
*/
declare var Titanium$App$iOS$USER_NOTIFICATION_AUTHORIZATION_STATUS_NOT_DETERMINED: number;
/**
* The application is authorized to post user notifications.
*/
declare var Titanium$App$iOS$USER_NOTIFICATION_AUTHORIZATION_STATUS_AUTHORIZED: number;
/**
* The application is not authorized to post user notifications.
*/
declare var Titanium$App$iOS$USER_NOTIFICATION_AUTHORIZATION_STATUS_DENIED: number;
/**
* The application is provisionally authorized to post non-interruptive user notifications.
*/
declare var Titanium$App$iOS$USER_NOTIFICATION_AUTHORIZATION_STATUS_PROVISIONAL: number;
/**
* The application does not support this notification type.
*/
declare var Titanium$App$iOS$USER_NOTIFICATION_SETTING_NOT_SUPPORTED: number;
/**
* The notification setting is turned on.
*/
declare var Titanium$App$iOS$USER_NOTIFICATION_SETTING_ENABLED: number;
/**
* The notification setting is turned off.
*/
declare var Titanium$App$iOS$USER_NOTIFICATION_SETTING_DISABLED: number;
/**
* No banner or alert dialog is presented when the notification is received.
*/
declare var Titanium$App$iOS$USER_NOTIFICATION_ALERT_STYLE_NONE: number;
/**
* A alert dialog is presented when the notification is received.
*/
declare var Titanium$App$iOS$USER_NOTIFICATION_ALERT_STYLE_ALERT: number;
/**
* A banner is presented when the notification is received.
*/
declare var Titanium$App$iOS$USER_NOTIFICATION_ALERT_STYLE_BANNER: number;
/**
* No options.
*/
declare var Titanium$App$iOS$USER_NOTIFICATION_CATEGORY_OPTION_NONE: number;
/**
* Send dismiss actions to the UNUserNotificationCenter object's delegate for handling.
*/
declare var Titanium$App$iOS$USER_NOTIFICATION_CATEGORY_OPTION_CUSTOM_DISMISS_ACTION: number;
/**
* Allow CarPlay to display notifications of this type.
*/
declare var Titanium$App$iOS$USER_NOTIFICATION_CATEGORY_OPTION_ALLOW_IN_CARPLAY: number;
/**
* Show the notification's title, even if the user has disabled notification previews for the app.
*/
declare var Titanium$App$iOS$USER_NOTIFICATION_CATEGORY_OPTION_HIDDEN_PREVIEWS_SHOW_TITLE: number;
/**
* Show the notification's subtitle, even if the user has disabled notification previews for the app.
*/
declare var Titanium$App$iOS$USER_NOTIFICATION_CATEGORY_OPTION_HIDDEN_PREVIEWS_SHOW_SUBTITLE: number;
/**
* Uniform type identifier for all text types.
*/
declare var Titanium$App$iOS$UTTYPE_TEXT: string;
/**
* Uniform type identifier for a plain text type, equivalent to MIME type text/plain.
*/
declare var Titanium$App$iOS$UTTYPE_PLAIN_TEXT: string;
/**
* Uniform type identifier for Unicode-8 plain text type.
*/
declare var Titanium$App$iOS$UTTYPE_UTF8_PLAIN_TEXT: string;
/**
* Uniform type identifier for Unicode-16 with byte-order mark (BOM), or if BOM is not present,
* an external representation byte order (big-endian).
*/
declare var Titanium$App$iOS$UTTYPE_UTF16_EXTERNAL_PLAIN_TEXT: string;
/**
* Uniform type identifier for Unicode-16, native byte order, with an optional byte-order mark (BOM).
*/
declare var Titanium$App$iOS$UTTYPE_UTF16_PLAIN_TEXT: string;
/**
* Uniform type identifier for Rich Text.
*/
declare var Titanium$App$iOS$UTTYPE_RTF: string;
/**
* Uniform type identifier for HTML.
*/
declare var Titanium$App$iOS$UTTYPE_HTML: string;
/**
* Uniform type identifier for XML.
*/
declare var Titanium$App$iOS$UTTYPE_XML: string;
/**
* Uniform type identifier for PDF data.
*/
declare var Titanium$App$iOS$UTTYPE_PDF: string;
/**
* Uniform type identifier for Rich Text Format Directory, that is, Rich Text with content embedding, on-disk format.
*/
declare var Titanium$App$iOS$UTTYPE_RTFD: string;
/**
* Uniform type identifier for Rich Text with content embedding, pasteboard format.
*/
declare var Titanium$App$iOS$UTTYPE_FLAT_RTFD: string;
/**
* Uniform type identifier for MLTE (Textension) format for mixed text and multimedia data.
*/
declare var Titanium$App$iOS$UTTYPE_TXN_TEXT_AND_MULTIMEDIA_DATA: string;
/**
* Uniform type identifier for WebKit webarchive format.
*/
declare var Titanium$App$iOS$UTTYPE_WEB_ARCHIVE: string;
/**
* Uniform type identifier for all image types.
*/
declare var Titanium$App$iOS$UTTYPE_IMAGE: string;
/**
* Uniform type identifier for JPEG images.
*/
declare var Titanium$App$iOS$UTTYPE_JPEG: string;
/**
* Uniform type identifier for JPEG 2000 images.
*/
declare var Titanium$App$iOS$UTTYPE_JPEG2000: string;
/**
* Uniform type identifier for TIFF images.
*/
declare var Titanium$App$iOS$UTTYPE_TIFF: string;
/**
* Uniform type identifier for PICT images.
*/
declare var Titanium$App$iOS$UTTYPE_PICT: string;
/**
* Uniform type identifier for GIF images.
*/
declare var Titanium$App$iOS$UTTYPE_GIF: string;
/**
* Uniform type identifier for PNG images.
*/
declare var Titanium$App$iOS$UTTYPE_PNG: string;
/**
* Uniform type identifier for QuickTime images.
*/
declare var Titanium$App$iOS$UTTYPE_QUICKTIME_IMAGE: string;
/**
* Uniform type identifier for Mac OS icon images.
*/
declare var Titanium$App$iOS$UTTYPE_APPLE_ICNS: string;
/**
* Uniform type identifier for Windows bitmap images.
*/
declare var Titanium$App$iOS$UTTYPE_BMP: string;
/**
* Uniform type identifier for Windows icon images.
*/
declare var Titanium$App$iOS$UTTYPE_ICO: string;
/**
* Uniform type identifier for all audiovisual content.
*/
declare var Titanium$App$iOS$UTTYPE_MOVIE: string;
/**
* Uniform type identifier for all video content without audio.
*/
declare var Titanium$App$iOS$UTTYPE_VIDEO: string;
/**
* Uniform type identifier for all audio content.
*/
declare var Titanium$App$iOS$UTTYPE_AUDIO: string;
/**
* Uniform type identifier for QuickTime movies.
*/
declare var Titanium$App$iOS$UTTYPE_QUICKTIME_MOVIE: string;
/**
* Uniform type identifier for MPEG-1 and MPEG-2 content.
*/
declare var Titanium$App$iOS$UTTYPE_MPEG: string;
/**
* Uniform type identifier for MPEG-4 content.
*/
declare var Titanium$App$iOS$UTTYPE_MPEG4: string;
/**
* Uniform type identifier for MP3 audio.
*/
declare var Titanium$App$iOS$UTTYPE_MP3: string;
/**
* Uniform type identifier for MPEG-4 audio.
*/
declare var Titanium$App$iOS$UTTYPE_MPEG4_AUDIO: string;
/**
* Uniform type identifier for protected MPEG-4 audio (iTunes music store format).
*/
declare var Titanium$App$iOS$UTTYPE_APPLE_PROTECTED_MPEG4_AUDIO: string;
/**
* Notification types and user notification categories the application is registered to use.
*/
declare var Titanium$App$iOS$currentUserNotificationSettings: UserNotificationSettings;
/**
* Provides an Array of the NSUserActivityTypes keys defined within your Titanium project.
*/
declare var Titanium$App$iOS$supportedUserActivityTypes: string[];
/**
* Returns a URL to open the app's settings.
*/
declare var Titanium$App$iOS$applicationOpenSettingsURL: string;
/**
* Adds the specified callback as an event listener for the named event.
*/
declare function Titanium$App$iOS$addEventListener(name: string, callback: (param0: any) => any): void
/**
* Removes the specified callback as an event listener for the named event.
*/
declare function Titanium$App$iOS$removeEventListener(name: string, callback: (param0: any) => any): void
/**
* Fires a synthesized event to any registered listeners.
*/
declare function Titanium$App$iOS$fireEvent(name: string, event: any): void
/**
* Applies the properties to the proxy.
*/
declare function Titanium$App$iOS$applyProperties(props: any): void
/**
* Creates and returns an instance of Titanium.App.iOS.UserDefaults.
*/
declare function Titanium$App$iOS$createUserDefaults(parameters: any): Titanium$App$iOS$UserDefaults
/**
* Cancels all scheduled local notifications.
*/
declare function Titanium$App$iOS$cancelAllLocalNotifications(): void
/**
* Cancels a local notification.
*/
declare function Titanium$App$iOS$cancelLocalNotification(id: number): void
/**
* Cancels a local notification.
*/
declare function Titanium$App$iOS$cancelLocalNotification(id: string): void
/**
* Registers a service to run when the application is placed in the background.
*/
declare function Titanium$App$iOS$registerBackgroundService(params: any): Titanium$App$iOS$BackgroundService
/**
* Registers the application to use the requested notification types and categories.
*/
declare function Titanium$App$iOS$registerUserNotificationSettings(params: UserNotificationSettings): void
/**
* Schedule a local notification.
*/
declare function Titanium$App$iOS$scheduleLocalNotification(params: NotificationParams): Titanium$App$iOS$LocalNotification
/**
* Specifies the minimum amount of time that must elapse between background fetch operations.
* Available only on iOS 7 and later.
*/
declare function Titanium$App$iOS$setMinimumBackgroundFetchInterval(fetchInterval: number): void
/**
* Marks the end of the app execution after initiating the download operation. Available only on iOS 7 and later.
*/
declare function Titanium$App$iOS$endBackgroundHandler(handlerID: string): void
/**
* Marks the end of an `openParentApplication:reply` execution by a WatchKit extension.
*/
declare function Titanium$App$iOS$sendWatchExtensionReply(handlerId: string, userInfo: any): void
/**
* Creates and returns an instance of <Titanium.App.iOS.SearchQuery>.
*/
declare function Titanium$App$iOS$createSearchQuery(parameters?: any): Titanium$App$iOS$SearchQuery
/**
* Creates and returns an instance of <Titanium.App.iOS.SearchableIndex>.
*/
declare function Titanium$App$iOS$createSearchableIndex(parameters?: any): Titanium$App$iOS$SearchableIndex
/**
* Creates and returns an instance of <Titanium.App.iOS.SearchableItem>.
*/
declare function Titanium$App$iOS$createSearchableItem(parameters?: any): Titanium$App$iOS$SearchableItem
/**
* Creates and returns an instance of <Titanium.App.iOS.SearchableItemAttributeSet>.
*/
declare function Titanium$App$iOS$createSearchableItemAttributeSet(parameters?: any): Titanium$App$iOS$SearchableItemAttributeSet
/**
* Creates and returns an instance of <Titanium.App.iOS.UserActivity>.
*/
declare function Titanium$App$iOS$createUserActivity(parameters?: any): Titanium$App$iOS$UserActivity
/**
* Creates and returns an instance of <Titanium.App.iOS.UserNotificationAction>.
*/
declare function Titanium$App$iOS$createUserNotificationAction(parameters?: any): Titanium$App$iOS$UserNotificationAction
/**
* Creates and returns an instance of <Titanium.App.iOS.UserNotificationCategory>.
*/
declare function Titanium$App$iOS$createUserNotificationCategory(parameters?: any): Titanium$App$iOS$UserNotificationCategory
/**
* Gets the value of the <Titanium.App.iOS.bubbleParent> property.
*/
declare function Titanium$App$iOS$getBubbleParent(): boolean
/**
* Sets the value of the <Titanium.App.iOS.bubbleParent> property.
*/
declare function Titanium$App$iOS$setBubbleParent(bubbleParent: boolean): void
/**
* Gets the value of the <Titanium.App.iOS.apiName> property.
*/
declare function Titanium$App$iOS$getApiName(): string
/**
* Gets the value of the <Titanium.App.iOS.currentUserNotificationSettings> property.
*/
declare function Titanium$App$iOS$getCurrentUserNotificationSettings(): UserNotificationSettings
/**
* Gets the value of the <Titanium.App.iOS.supportedUserActivityTypes> property.
*/
declare function Titanium$App$iOS$getSupportedUserActivityTypes(): string[]
/**
* Gets the value of the <Titanium.App.iOS.applicationOpenSettingsURL> property.
*/
declare function Titanium$App$iOS$getApplicationOpenSettingsURL(): string
/**
* A service that runs when the application is placed in the background.
*/
declare type Titanium$App$iOS$BackgroundService = {
/**
* A local URL to a JavaScript file containing the code to run in the background.
*/
url: string,
/**
* Stops the service from running during the current background session to conserve resources.
*/
stop(): void,
/**
* Unregisters the background service.
*/
unregister(): void,
/**
* Gets the value of the <Titanium.App.iOS.BackgroundService.url> property.
*/
getUrl(): string,
/**
* Sets the value of the <Titanium.App.iOS.BackgroundService.url> property.
*/
setUrl(url: string): void
} & Titanium$Proxy
/**
* A local notification to alert the user of new or pending application information.
*/
declare type Titanium$App$iOS$LocalNotification = {
/**
* Cancels the pending notification.
*/
cancel(): void
} & Titanium$Proxy
/**
* A search query object manages the criteria to apply when searching app content that you have previously
* indexed by using the Core Spotlight APIs.
*/
declare type Titanium$App$iOS$SearchQuery = {
/**
* A formatted string that defines the matching criteria to apply to indexed items.
*/
queryString: string,
/**
* An array of strings that represent the attributes of indexed items.
*/
attributes: string[],
/**
* Asynchronously queries the index for items that match the query object's specifications.
*/
start(): void,
/**
* Cancels a query operation.
*/
cancel(): void,
/**
* A Boolean value that indicates if the query has been cancelled (`true`) or not (`false`).
*/
isCancelled(): boolean
} & Titanium$Proxy
/**
* The SearchableIndex module is used to add or remove Ti.App.iOS.SearchableItem objects from the device search index.
*/
declare type Titanium$App$iOS$SearchableIndex = {
/**
* Indicates whether indexing is supported by the device.
*/
isSupported(): boolean,
/**
* Adds an array of Titanium.App.iOS.SearchableItem objects to the default search index.
*/
addToDefaultSearchableIndex(
Array: $ReadOnlyArray<Titanium$App$iOS$SearchableItem>,
callback: (param0: any) => any): void,
/**
* Removes all search items added by the application.
*/
deleteAllSearchableItems(callback: (param0: any) => any): void,
/**
* Removes search items based on an array of domain identifiers.
*/
deleteAllSearchableItemByDomainIdenifiers(Array: $ReadOnlyArray<string>, callback: (param0: any) => any): void,
/**
* Removes search items based on an array of identifiers.
*/
deleteSearchableItemsByIdentifiers(Array: $ReadOnlyArray<string>, callback: (param0: any) => any): void
} & Titanium$Proxy
/**
* Used to create a unique object containing all of the search information that will appear in the device search index.
*/
declare type Titanium$App$iOS$SearchableItem = {
/**
* Set of metadata properties to display for the item.
*/
attributeSet: Titanium$App$iOS$SearchableItemAttributeSet,
/**
* Identifier that represents the "domain" or owner of this item.
*/
domainIdentifier: string,
/**
* Searchable items have an expiration date or time to live. By default it is set to one month.
*/
expirationDate: string,
/**
* Unique identifier to your application group.
*/
uniqueIdentifier: string,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItem.domainIdentifier> property.
*/
getDomainIdentifier(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItem.domainIdentifier> property.
*/
setDomainIdentifier(domainIdentifier: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItem.expirationDate> property.
*/
getExpirationDate(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItem.expirationDate> property.
*/
setExpirationDate(expirationDate: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItem.uniqueIdentifier> property.
*/
getUniqueIdentifier(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItem.uniqueIdentifier> property.
*/
setUniqueIdentifier(uniqueIdentifier: string): void
} & Titanium$Proxy
/**
* The SearchableItemAttributeSet module defines metadata properties for SearchItem and UserActivity objects.
*/
declare type Titanium$App$iOS$SearchableItemAttributeSet = {
/**
* Content type of the attribute set.
*/
itemContentType: string,
/**
* A localized string to be displayed in the UI for this item.
*/
displayName: string,
/**
* An array of localized strings of alternate display names for this item.
*/
alternateNames: string[],
/**
* The complete path to the item.
*/
path: string,
/**
* File URL representing the content to be indexed.
*/
contentURL: string,
/**
* File URL pointing to a thumbnail image for this item.
*/
thumbnailURL: string,
/**
* Image data for thumbnail for this item.
*/
thumbnailData: string | Titanium$Blob,
/**
* For activities this is the unique identifier for the item this activity is related to.
*/
relatedUniqueIdentifier: string,
/**
* The date that the last metadata attribute was changed.
*/
metadataModificationDate: string,
/**
* UTI Type pedigree for an item.
*/
contentType: string,
/**
* Array of strings related to the content tree of the item.
*/
contentTypeTree: string[],
/**
* Represents keywords associated with this particular item. Example keywords might be Birthday etc.
*/
keywords: string[],
/**
* The title of the particular item.
*/
title: string,
/**
* Subject of the the item.
*/
subject: string,
/**
* Theme of the the item.
*/
theme: string,
/**
* An account of the content of the resource.
*/
contentDescription: string,
/**
* Used to reference to the resource within a given context.
*/
identifier: string,
/**
* A class of entity for whom the resource is intended or useful.
*/
audiences: string[],
/**
* Size of the document in MB.
*/
fileSize: number,
/**
* Number of pages in the item.
*/
pageCount: number,
/**
* Width in points (72 points per inch) of the document page.
*/
pageWidth: number,
/**
* Height in points (72 points per inch) of the document page.
*/
pageHeight: number,
/**
* Security (encryption) method used in the file.
*/
securityMethod: string,
/**
* Application used to create the document content (e.g. "Word","Framemaker", etc.).
*/
creator: string,
/**
* Software used to convert the original content into a PDF stream.
*/
encodingApplications: string[],
/**
* Kind that the item represents.
*/
kind: string,
/**
* Array of font names used in the item.
*/
fontNames: string[],
/**
* The sample rate of the audio data contained in the file.
*/
audioSampleRate: number,
/**
* The number of channels in the audio data contained in the file.
*/
audioChannelCount: number,
/**
* The tempo of the music contained in the audio file in Beats Per Minute.
*/
tempo: number,
/**
* The musical key of the song/composition contained in an audio file.
*/
keySignature: string,
/**
* The time signature of the musical composition contained in the audio/MIDI file.
*/
timeSignature: string,
/**
* The name of the application that encoded the data contained in the audio file.
*/
audioEncodingApplication: string,
/**
* The composer of the song/composition contained in the audio file.
*/
composer: string,
/**
* The lyricist/text writer for song/composition contained in the audio file.
*/
lyricist: string,
/**
* The title for a collection of media.
*/
album: string,
/**
* The artist for the media.
*/
artist: string,
/**
* The track number of a song/composition when it is part of an album.
*/
audioTrackNumber: number,
/**
* The recording date of the song/composition.
*/
recordingDate: string,
/**
* The musical genre of the song/composition contained in the audio file.
*/
musicalGenre: string,
/**
* Used to indicates whether the MIDI sequence contained in the file is setup for use with a General MIDI device.
*/
generalMIDISequence: number,
/**
* Metadata attribute that stores the category of instrument.
*/
musicalInstrumentCategory: string,
/**
* Metadata attribute that stores the name of instrument.
*/
musicalInstrumentName: string,
/**
* Used to indicate that using the phone number is appropriate.
*/
supportsPhoneCall: number,
/**
* Used to determine if navigation is supported.
*/
supportsNavigation: number,
/**
* Title displayed in the search container
*/
containerTitle: string,
/**
* Display of the search container
*/
containerDisplayName: string,
/**
* Identifier for the search container
*/
containerIdentifier: string,
/**
* Order the search container is displayed.
*/
containerOrder: number,
/**
* The list of editor/editors that have worked on this item.
*/
editors: string[],
/**
* The list of people who are visible in an image or movie or written about in a document.
*/
participants: string[],
/**
* The list of projects that this item is part of.
*/
projects: string[],
/**
* The date that the file was last downloaded / received.
*/
downloadedDate: string,
/**
* The date that the item was last used.
*/
lastUsedDate: string,
/**
* The date that the contents of the item were created.
*/
contentCreationDate: string,
/**
* The date that the contents of the item were last modified.
*/
contentModificationDate: string,
/**
* The date that the item was moved into the current location.
*/
addedDate: string,
/**
* Used to indicate where the item was obtained from.
*/
contentSources: string[],
/**
* Comment related to a file.
*/
comment: string,
/**
* Copyright of the content.
*/
copyright: string,
/**
* Duration in seconds of the content of the item (if appropriate).
*/
duration: number,
/**
* A list of contacts that are somehow associated with this document beyond what is captured as Author.
*/
contactKeywords: string[],
/**
* The codecs used to encode/decode the media.
*/
codecs: string[],
/**
* Used to indicate company/Organization that created the document.
*/
organizations: string[],
/**
* Media types present in the content.
*/
mediaTypes: string[],
/**
* A version specifier for this item.
*/
version: string,
/**
* Used to indicate the role of the document creator.
*/
role: string,
/**
* Whether the content is prepared for streaming. Set to `0` for not streamable and `1` for streamable.
*/
streamable: number,
/**
* The total bit rate (audio and video combined) of the media.
*/
totalBitRate: number,
/**
* The video bit rate.
*/
videoBitRate: number,
/**
* The audio bit rate.
*/
audioBitRate: number,
/**
* The delivery type of the item. Set to `0` for fast start and `1` for RTSP.
*/
deliveryType: number,
/**
* Used to designate the languages of the intellectual content of the resource.
*/
languages: string[],
/**
* Used to provide a link to information about rights held in and over resource.
*/
rights: string[],
/**
* Used to designate the entity responsible for making the resource available.
*/
publishers: string[],
/**
* Used to designate the entity responsible for making contributions to the content of the resource.
*/
contributors: string[],
/**
* Used to designate the extent or scope of the content of the resource.
*/
coverage: string[],
/**
* User rating of this item out of 5 stars.
*/
rating: number,
/**
* A description of the rating, for example, the number of reviewers.
*/
ratingDescription: string,
/**
* User play count of this item.
*/
playCount: number,
/**
* Information about the item.
*/
information: string,
/**
* Director of the item, for example, the movie director.
*/
director: string,
/**
* Producer of the content.
*/
producer: string,
/**
* Genre of the item, for example, movie genre.
*/
genre: string,
/**
* Performers in the movie.
*/
performers: string[],
/**
* Original format of the movie.
*/
originalFormat: string,
/**
* Original source of the movie.
*/
originalSource: string,
/**
* Whether or not the item is local. Set to `1` if true and `0` otherwise.
*/
local: number,
/**
* Whether or not the item has explicit content. Set to `1` for explicit or `0` for clean.
*/
contentRating: number,
/**
* URL of the item.
*/
url: string,
/**
* The fully formatted address of the item (obtained from MapKit).
*/
fullyFormattedAddress: string,
/**
* The sub-location (e.g., street number) for the item according to guidelines established by the provider.
*/
subThoroughfare: string,
/**
* The location (e.g., street name) for the item according to guidelines established by the provider.
*/
thoroughfare: string,
/**
* The postal code for the item according to guidelines established by the provider.
*/
postalCode: string,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.displayName> property.
*/
getDisplayName(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.displayName> property.
*/
setDisplayName(displayName: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.alternateNames> property.
*/
getAlternateNames(): string[],
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.alternateNames> property.
*/
setAlternateNames(alternateNames: $ReadOnlyArray<string>): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.path> property.
*/
getPath(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.path> property.
*/
setPath(path: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.contentURL> property.
*/
getContentURL(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.contentURL> property.
*/
setContentURL(contentURL: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.thumbnailURL> property.
*/
getThumbnailURL(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.thumbnailURL> property.
*/
setThumbnailURL(thumbnailURL: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.thumbnailData> property.
*/
getThumbnailData(): string | Titanium$Blob,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.thumbnailData> property.
*/
setThumbnailData(thumbnailData: string): void,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.thumbnailData> property.
*/
setThumbnailData(thumbnailData: Titanium$Blob): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.relatedUniqueIdentifier> property.
*/
getRelatedUniqueIdentifier(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.relatedUniqueIdentifier> property.
*/
setRelatedUniqueIdentifier(relatedUniqueIdentifier: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.metadataModificationDate> property.
*/
getMetadataModificationDate(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.metadataModificationDate> property.
*/
setMetadataModificationDate(metadataModificationDate: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.contentType> property.
*/
getContentType(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.contentType> property.
*/
setContentType(contentType: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.contentTypeTree> property.
*/
getContentTypeTree(): string[],
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.contentTypeTree> property.
*/
setContentTypeTree(contentTypeTree: $ReadOnlyArray<string>): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.keywords> property.
*/
getKeywords(): string[],
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.keywords> property.
*/
setKeywords(keywords: $ReadOnlyArray<string>): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.title> property.
*/
getTitle(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.title> property.
*/
setTitle(title: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.subject> property.
*/
getSubject(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.subject> property.
*/
setSubject(subject: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.theme> property.
*/
getTheme(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.theme> property.
*/
setTheme(theme: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.contentDescription> property.
*/
getContentDescription(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.contentDescription> property.
*/
setContentDescription(contentDescription: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.identifier> property.
*/
getIdentifier(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.identifier> property.
*/
setIdentifier(identifier: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.audiences> property.
*/
getAudiences(): string[],
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.audiences> property.
*/
setAudiences(audiences: $ReadOnlyArray<string>): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.fileSize> property.
*/
getFileSize(): number,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.fileSize> property.
*/
setFileSize(fileSize: number): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.pageCount> property.
*/
getPageCount(): number,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.pageCount> property.
*/
setPageCount(pageCount: number): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.pageWidth> property.
*/
getPageWidth(): number,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.pageWidth> property.
*/
setPageWidth(pageWidth: number): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.pageHeight> property.
*/
getPageHeight(): number,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.pageHeight> property.
*/
setPageHeight(pageHeight: number): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.securityMethod> property.
*/
getSecurityMethod(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.securityMethod> property.
*/
setSecurityMethod(securityMethod: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.creator> property.
*/
getCreator(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.creator> property.
*/
setCreator(creator: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.encodingApplications> property.
*/
getEncodingApplications(): string[],
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.encodingApplications> property.
*/
setEncodingApplications(encodingApplications: $ReadOnlyArray<string>): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.kind> property.
*/
getKind(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.kind> property.
*/
setKind(kind: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.fontNames> property.
*/
getFontNames(): string[],
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.fontNames> property.
*/
setFontNames(fontNames: $ReadOnlyArray<string>): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.audioSampleRate> property.
*/
getAudioSampleRate(): number,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.audioSampleRate> property.
*/
setAudioSampleRate(audioSampleRate: number): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.audioChannelCount> property.
*/
getAudioChannelCount(): number,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.audioChannelCount> property.
*/
setAudioChannelCount(audioChannelCount: number): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.tempo> property.
*/
getTempo(): number,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.tempo> property.
*/
setTempo(tempo: number): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.keySignature> property.
*/
getKeySignature(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.keySignature> property.
*/
setKeySignature(keySignature: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.timeSignature> property.
*/
getTimeSignature(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.timeSignature> property.
*/
setTimeSignature(timeSignature: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.audioEncodingApplication> property.
*/
getAudioEncodingApplication(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.audioEncodingApplication> property.
*/
setAudioEncodingApplication(audioEncodingApplication: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.composer> property.
*/
getComposer(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.composer> property.
*/
setComposer(composer: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.lyricist> property.
*/
getLyricist(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.lyricist> property.
*/
setLyricist(lyricist: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.album> property.
*/
getAlbum(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.album> property.
*/
setAlbum(album: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.artist> property.
*/
getArtist(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.artist> property.
*/
setArtist(artist: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.audioTrackNumber> property.
*/
getAudioTrackNumber(): number,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.audioTrackNumber> property.
*/
setAudioTrackNumber(audioTrackNumber: number): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.recordingDate> property.
*/
getRecordingDate(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.recordingDate> property.
*/
setRecordingDate(recordingDate: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.musicalGenre> property.
*/
getMusicalGenre(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.musicalGenre> property.
*/
setMusicalGenre(musicalGenre: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.generalMIDISequence> property.
*/
getGeneralMIDISequence(): number,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.generalMIDISequence> property.
*/
setGeneralMIDISequence(generalMIDISequence: number): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.musicalInstrumentCategory> property.
*/
getMusicalInstrumentCategory(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.musicalInstrumentCategory> property.
*/
setMusicalInstrumentCategory(musicalInstrumentCategory: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.musicalInstrumentName> property.
*/
getMusicalInstrumentName(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.musicalInstrumentName> property.
*/
setMusicalInstrumentName(musicalInstrumentName: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.supportsPhoneCall> property.
*/
getSupportsPhoneCall(): number,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.supportsPhoneCall> property.
*/
setSupportsPhoneCall(supportsPhoneCall: number): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.supportsNavigation> property.
*/
getSupportsNavigation(): number,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.supportsNavigation> property.
*/
setSupportsNavigation(supportsNavigation: number): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.containerTitle> property.
*/
getContainerTitle(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.containerTitle> property.
*/
setContainerTitle(containerTitle: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.containerDisplayName> property.
*/
getContainerDisplayName(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.containerDisplayName> property.
*/
setContainerDisplayName(containerDisplayName: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.containerIdentifier> property.
*/
getContainerIdentifier(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.containerIdentifier> property.
*/
setContainerIdentifier(containerIdentifier: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.containerOrder> property.
*/
getContainerOrder(): number,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.containerOrder> property.
*/
setContainerOrder(containerOrder: number): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.editors> property.
*/
getEditors(): string[],
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.editors> property.
*/
setEditors(editors: $ReadOnlyArray<string>): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.participants> property.
*/
getParticipants(): string[],
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.participants> property.
*/
setParticipants(participants: $ReadOnlyArray<string>): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.projects> property.
*/
getProjects(): string[],
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.projects> property.
*/
setProjects(projects: $ReadOnlyArray<string>): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.downloadedDate> property.
*/
getDownloadedDate(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.downloadedDate> property.
*/
setDownloadedDate(downloadedDate: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.lastUsedDate> property.
*/
getLastUsedDate(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.lastUsedDate> property.
*/
setLastUsedDate(lastUsedDate: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.contentCreationDate> property.
*/
getContentCreationDate(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.contentCreationDate> property.
*/
setContentCreationDate(contentCreationDate: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.contentModificationDate> property.
*/
getContentModificationDate(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.contentModificationDate> property.
*/
setContentModificationDate(contentModificationDate: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.addedDate> property.
*/
getAddedDate(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.addedDate> property.
*/
setAddedDate(addedDate: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.contentSources> property.
*/
getContentSources(): string[],
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.contentSources> property.
*/
setContentSources(contentSources: $ReadOnlyArray<string>): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.comment> property.
*/
getComment(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.comment> property.
*/
setComment(comment: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.copyright> property.
*/
getCopyright(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.copyright> property.
*/
setCopyright(copyright: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.duration> property.
*/
getDuration(): number,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.duration> property.
*/
setDuration(duration: number): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.contactKeywords> property.
*/
getContactKeywords(): string[],
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.contactKeywords> property.
*/
setContactKeywords(contactKeywords: $ReadOnlyArray<string>): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.codecs> property.
*/
getCodecs(): string[],
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.codecs> property.
*/
setCodecs(codecs: $ReadOnlyArray<string>): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.organizations> property.
*/
getOrganizations(): string[],
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.organizations> property.
*/
setOrganizations(organizations: $ReadOnlyArray<string>): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.mediaTypes> property.
*/
getMediaTypes(): string[],
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.mediaTypes> property.
*/
setMediaTypes(mediaTypes: $ReadOnlyArray<string>): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.version> property.
*/
getVersion(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.version> property.
*/
setVersion(version: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.role> property.
*/
getRole(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.role> property.
*/
setRole(role: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.streamable> property.
*/
getStreamable(): number,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.streamable> property.
*/
setStreamable(streamable: number): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.totalBitRate> property.
*/
getTotalBitRate(): number,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.totalBitRate> property.
*/
setTotalBitRate(totalBitRate: number): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.videoBitRate> property.
*/
getVideoBitRate(): number,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.videoBitRate> property.
*/
setVideoBitRate(videoBitRate: number): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.audioBitRate> property.
*/
getAudioBitRate(): number,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.audioBitRate> property.
*/
setAudioBitRate(audioBitRate: number): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.deliveryType> property.
*/
getDeliveryType(): number,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.deliveryType> property.
*/
setDeliveryType(deliveryType: number): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.languages> property.
*/
getLanguages(): string[],
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.languages> property.
*/
setLanguages(languages: $ReadOnlyArray<string>): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.rights> property.
*/
getRights(): string[],
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.rights> property.
*/
setRights(rights: $ReadOnlyArray<string>): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.publishers> property.
*/
getPublishers(): string[],
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.publishers> property.
*/
setPublishers(publishers: $ReadOnlyArray<string>): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.contributors> property.
*/
getContributors(): string[],
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.contributors> property.
*/
setContributors(contributors: $ReadOnlyArray<string>): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.coverage> property.
*/
getCoverage(): string[],
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.coverage> property.
*/
setCoverage(coverage: $ReadOnlyArray<string>): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.rating> property.
*/
getRating(): number,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.rating> property.
*/
setRating(rating: number): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.ratingDescription> property.
*/
getRatingDescription(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.ratingDescription> property.
*/
setRatingDescription(ratingDescription: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.playCount> property.
*/
getPlayCount(): number,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.playCount> property.
*/
setPlayCount(playCount: number): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.information> property.
*/
getInformation(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.information> property.
*/
setInformation(information: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.director> property.
*/
getDirector(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.director> property.
*/
setDirector(director: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.producer> property.
*/
getProducer(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.producer> property.
*/
setProducer(producer: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.genre> property.
*/
getGenre(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.genre> property.
*/
setGenre(genre: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.performers> property.
*/
getPerformers(): string[],
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.performers> property.
*/
setPerformers(performers: $ReadOnlyArray<string>): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.originalFormat> property.
*/
getOriginalFormat(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.originalFormat> property.
*/
setOriginalFormat(originalFormat: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.originalSource> property.
*/
getOriginalSource(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.originalSource> property.
*/
setOriginalSource(originalSource: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.local> property.
*/
getLocal(): number,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.local> property.
*/
setLocal(local: number): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.contentRating> property.
*/
getContentRating(): number,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.contentRating> property.
*/
setContentRating(contentRating: number): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.url> property.
*/
getUrl(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.url> property.
*/
setUrl(url: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.fullyFormattedAddress> property.
*/
getFullyFormattedAddress(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.fullyFormattedAddress> property.
*/
setFullyFormattedAddress(fullyFormattedAddress: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.subThoroughfare> property.
*/
getSubThoroughfare(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.subThoroughfare> property.
*/
setSubThoroughfare(subThoroughfare: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.thoroughfare> property.
*/
getThoroughfare(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.thoroughfare> property.
*/
setThoroughfare(thoroughfare: string): void,
/**
* Gets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.postalCode> property.
*/
getPostalCode(): string,
/**
* Sets the value of the <Titanium.App.iOS.SearchableItemAttributeSet.postalCode> property.
*/
setPostalCode(postalCode: string): void
} & Titanium$Proxy
/**
* The UserActivity module is used to enable device Handoff and to create User Activities.
*/
declare type Titanium$App$iOS$UserActivity = {
/**
* Name of the activity type.
*/
activityType: string,
/**
* Set to `true` if the user activity can be publicly accessed by all iOS users.
*/
eligibleForPublicIndexing: boolean,
/**
* Set to true if the user activity should be added to the on-device index.
*/
eligibleForSearch: boolean,
/**
* Set to true if this user activity should be eligible to be handed off to another device
*/
eligibleForHandoff: boolean,
/**
* A Boolean value that determines whether Siri can suggest the user activity as a shortcut to the user.
*/
eligibleForPrediction: boolean,
/**
* A value used to identify the user activity.
*/
persistentIdentifier: string,
/**
* Absolute date after which the activity is no longer eligible to be indexed or handed off.
*/
expirationDate: string,
/**
* An array of string keywords representing words or phrases that might help the user to find the activity in the application history.
*/
keywords: string[],
/**
* Set to true everytime you have updated the user activity and need the changes to be saved before handing it off to another device.
*/
needsSave: boolean,
/**
* An array of String keys from the userInfo property which represent the minimal information about the user activity that should be stored for later restoration.
*/
requiredUserInfoKeys: string[],
/**
* Determines if user activities are supported (`true`) or not (`false`) by the device.
*/
supported: boolean,
/**
* An optional, user-visible title for this activity such as a document name or web page title.
*/
title: string,
/**
* The userInfo dictionary contains application-specific state needed to continue an activity on another device.
*/
userInfo: any,
/**
* When no suitable application is installed on a resuming device and the `webpageURL` property is set,
* the user activity will instead be continued in a web browser by loading the specified URL.
*/
webpageURL: string,
/**
* Adds a Titanium.App.iOS.SearchableItemAttributeSet to the user activity.
*/
addContentAttributeSet(contentAttributeSet: Titanium$App$iOS$SearchableItemAttributeSet): void,
/**
* Marks the activity as currently in use by the user.
*/
becomeCurrent(): void,
/**
* Invalidates an activity when it is no longer eligible for continuation.
*/
invalidate(): void,
/**
* Marks the activity as currently **not** in use and ineligible to be continued.
*/
resignCurrent(): void,
/**
* Determines if user activities are supported (`true`) or not (`false`) by the device.
*/
isSupported(): boolean,
/**
* Deletes user activities created by your app that have the specified persistent identifiers.
*/
deleteSavedUserActivitiesForPersistentIdentifiers(persistentIdentifiers: $ReadOnlyArray<string>): void,
/**
* Deletes all user activities created by your app.
*/
deleteAllSavedUserActivities(): void,
/**
* Gets the value of the <Titanium.App.iOS.UserActivity.activityType> property.
*/
getActivityType(): string,
/**
* Sets the value of the <Titanium.App.iOS.UserActivity.activityType> property.
*/
setActivityType(activityType: string): void,
/**
* Gets the value of the <Titanium.App.iOS.UserActivity.eligibleForPublicIndexing> property.
*/
getEligibleForPublicIndexing(): boolean,
/**
* Sets the value of the <Titanium.App.iOS.UserActivity.eligibleForPublicIndexing> property.
*/
setEligibleForPublicIndexing(eligibleForPublicIndexing: boolean): void,
/**
* Gets the value of the <Titanium.App.iOS.UserActivity.eligibleForSearch> property.
*/
getEligibleForSearch(): boolean,
/**
* Sets the value of the <Titanium.App.iOS.UserActivity.eligibleForSearch> property.
*/
setEligibleForSearch(eligibleForSearch: boolean): void,
/**
* Gets the value of the <Titanium.App.iOS.UserActivity.eligibleForHandoff> property.
*/
getEligibleForHandoff(): boolean,
/**
* Sets the value of the <Titanium.App.iOS.UserActivity.eligibleForHandoff> property.
*/
setEligibleForHandoff(eligibleForHandoff: boolean): void,
/**
* Gets the value of the <Titanium.App.iOS.UserActivity.eligibleForPrediction> property.
*/
getEligibleForPrediction(): boolean,
/**
* Sets the value of the <Titanium.App.iOS.UserActivity.eligibleForPrediction> property.
*/
setEligibleForPrediction(eligibleForPrediction: boolean): void,
/**
* Gets the value of the <Titanium.App.iOS.UserActivity.persistentIdentifier> property.
*/
getPersistentIdentifier(): string,
/**
* Sets the value of the <Titanium.App.iOS.UserActivity.persistentIdentifier> property.
*/
setPersistentIdentifier(persistentIdentifier: string): void,
/**
* Gets the value of the <Titanium.App.iOS.UserActivity.expirationDate> property.
*/
getExpirationDate(): string,
/**
* Sets the value of the <Titanium.App.iOS.UserActivity.expirationDate> property.
*/
setExpirationDate(expirationDate: string): void,
/**
* Gets the value of the <Titanium.App.iOS.UserActivity.keywords> property.
*/
getKeywords(): string[],
/**
* Sets the value of the <Titanium.App.iOS.UserActivity.keywords> property.
*/
setKeywords(keywords: $ReadOnlyArray<string>): void,
/**
* Gets the value of the <Titanium.App.iOS.UserActivity.needsSave> property.
*/
getNeedsSave(): boolean,
/**
* Sets the value of the <Titanium.App.iOS.UserActivity.needsSave> property.
*/
setNeedsSave(needsSave: boolean): void,
/**
* Gets the value of the <Titanium.App.iOS.UserActivity.requiredUserInfoKeys> property.
*/
getRequiredUserInfoKeys(): string[],
/**
* Sets the value of the <Titanium.App.iOS.UserActivity.requiredUserInfoKeys> property.
*/
setRequiredUserInfoKeys(requiredUserInfoKeys: $ReadOnlyArray<string>): void,
/**
* Gets the value of the <Titanium.App.iOS.UserActivity.supported> property.
*/
getSupported(): boolean,
/**
* Sets the value of the <Titanium.App.iOS.UserActivity.supported> property.
*/
setSupported(supported: boolean): void,
/**
* Gets the value of the <Titanium.App.iOS.UserActivity.title> property.
*/
getTitle(): string,
/**
* Sets the value of the <Titanium.App.iOS.UserActivity.title> property.
*/
setTitle(title: string): void,
/**
* Gets the value of the <Titanium.App.iOS.UserActivity.userInfo> property.
*/
getUserInfo(): any,
/**
* Sets the value of the <Titanium.App.iOS.UserActivity.userInfo> property.
*/
setUserInfo(userInfo: any): void,
/**
* Gets the value of the <Titanium.App.iOS.UserActivity.webpageURL> property.
*/
getWebpageURL(): string,
/**
* Sets the value of the <Titanium.App.iOS.UserActivity.webpageURL> property.
*/
setWebpageURL(webpageURL: string): void
} & Titanium$Proxy
/**
* The UserDefaults module is used for storing application-related data in property/value pairs
* that persist beyond application sessions and device power cycles. UserDefaults allows the suiteName
* of the UserDefaults to be specified at creation time.
*/
declare type Titanium$App$iOS$UserDefaults = {
/**
* Sets the name of the suite to be used to access UserDefaults.
*/
suiteName: string,
/**
* Returns the value of a property as a boolean data type.
*/
getBool(property: string, defaultValue?: boolean): boolean,
/**
* Returns the value of a property as a double (double-precision, floating point) data type.
*/
getDouble(property: string, defaultValue?: number): number,
/**
* Returns the value of a property as an integer data type.
*/
getInt(property: string, defaultValue?: number): number,
/**
* Returns the value of a property as an array data type.
*/
getList(property: string, defaultValue?: $ReadOnlyArray<any>): any[],
/**
* Returns the value of a property as an object.
*/
getObject(property: string, defaultValue?: any): any,
/**
* Returns the value of a property as a string data type.
*/
getString(property: string, defaultValue?: string): string,
/**
* Indicates whether a property exists.
*/
hasProperty(property: string): boolean,
/**
* Returns an array of property names.
*/
listProperties(): any[],
/**
* Removes a property if it exists, or does nothing otherwise.
*/
removeProperty(property: string): void,
/**
* Removes all properties that have been set by the user on runtime, or does nothing otherwise.
*/
removeAllProperties(): void,
/**
* Sets the value of a property as a boolean data type. The property will be created if it
* does not exist.
*/
setBool(property: string, value: boolean): void,
/**
* Sets the value of a property as a double (double-precision, floating point) data type. The
* property will be created if it does not exist.
*/
setDouble(property: string, value: number): void,
/**
* Sets the value of a property as an integer data type. The property will be created if it
* does not exist.
*/
setInt(property: string, value: number): void,
/**
* Sets the value of a property as an array data type. The property will be created if it
* does not exist.
*/
setList(property: string, value: $ReadOnlyArray<any>): void,
/**
* Sets the value of a property as an object data type. The property will be created if it
* does not exist.
*/
setObject(property: string, value: any): void,
/**
* Sets the value of a property as a string data type. The property will be created if it
* does not exist.
*/
setString(property: string, value: string): void,
/**
* Gets the value of the <Titanium.App.iOS.UserDefaults.suiteName> property.
*/
getSuiteName(): string,
/**
* Sets the value of the <Titanium.App.iOS.UserDefaults.suiteName> property.
*/
setSuiteName(suiteName: string): void
} & Titanium$Proxy
/**
* An action the user selects in response to an interactive notification.
*/
declare type Titanium$App$iOS$UserNotificationAction = {
/**
* Selects how to activate the application.
*/
activationMode: number,
/**
* Custom behavior the user notification supports.
*/
behavior: number,
/**
* Set to true if the action requires the device to be unlocked. On the Apple Watch actions never require authentication.
*/
authenticationRequired: boolean,
/**
* Set to true if the action causes destructive behavior to the user's data or the application.
*/
destructive: boolean,
/**
* Identifier for this action. Used to identify the action the user pressed.
*/
identifier: string,
/**
* Title of the button displayed in the notification.
*/
title: string,
/**
* Gets the value of the <Titanium.App.iOS.UserNotificationAction.activationMode> property.
*/
getActivationMode(): number,
/**
* Sets the value of the <Titanium.App.iOS.UserNotificationAction.activationMode> property.
*/
setActivationMode(activationMode: number): void,
/**
* Gets the value of the <Titanium.App.iOS.UserNotificationAction.behavior> property.
*/
getBehavior(): number,
/**
* Sets the value of the <Titanium.App.iOS.UserNotificationAction.behavior> property.
*/
setBehavior(behavior: number): void
} & Titanium$Proxy
/**
* A set of notification actions to associate with a notification.
*/
declare type Titanium$App$iOS$UserNotificationCategory = {
/**
* Array of notification actions to associate with the group.
*/
actionsForDefaultContext: Titanium$App$iOS$UserNotificationAction[],
/**
* Array of notification actions to display for non-dialog-style notification.
*/
actionsForMinimalContext: Titanium$App$iOS$UserNotificationAction[],
/**
* A format string for the summary description used when the system groups the category's notifications.
*/
categorySummaryFormat: string,
/**
* Identifier for this category.
*/
identifier: string,
/**
* The intents related to notifications of this category.
*/
intentIdentifiers: string[],
/**
* The placeholder text to display when notification previews are disabled for the app.
*/
hiddenPreviewsBodyPlaceholder: string,
/**
* Options for how to handle notifications of this type.
*/
options: number[]
} & Titanium$Proxy
declare var npm$namespace$Titanium$App$iOS$UserNotificationCenter: {
getPendingNotifications: typeof Titanium$App$iOS$UserNotificationCenter$getPendingNotifications,
getDeliveredNotifications: typeof Titanium$App$iOS$UserNotificationCenter$getDeliveredNotifications,
removePendingNotifications: typeof Titanium$App$iOS$UserNotificationCenter$removePendingNotifications,
removeDeliveredNotifications: typeof Titanium$App$iOS$UserNotificationCenter$removeDeliveredNotifications,
requestUserNotificationSettings: typeof Titanium$App$iOS$UserNotificationCenter$requestUserNotificationSettings,
getApiName: typeof Titanium$App$iOS$UserNotificationCenter$getApiName,
apiName: typeof Titanium$App$iOS$UserNotificationCenter$apiName,
}
/**
* The name of the API that this proxy corresponds to.
*/
declare var Titanium$App$iOS$UserNotificationCenter$apiName: string;
/**
* Fetches the pending notifications asynchronously.
*/
declare function Titanium$App$iOS$UserNotificationCenter$getPendingNotifications(callback: (param0: UserNotificationCallbackResponse) => any): void
/**
* Fetches the delivered notifications asynchronously.
*/
declare function Titanium$App$iOS$UserNotificationCenter$getDeliveredNotifications(callback: (param0: UserNotificationCallbackResponse) => any): void
/**
* Removes the specified pending notifications to prevent them from being triggered.
* If no notifications are specified, all pending notifications will be removed.
*/
declare function Titanium$App$iOS$UserNotificationCenter$removePendingNotifications(notifications: $ReadOnlyArray<UserNotificationDictionary>): void
/**
* Removes the specified delivered notifications from the notification-center.
* If no notifications are specified, all delivered notifications will be removed.
*/
declare function Titanium$App$iOS$UserNotificationCenter$removeDeliveredNotifications(notifications: $ReadOnlyArray<UserNotificationDictionary>): void
/**
* Notification types and user notification categories the application is registered to use.
*/
declare function Titanium$App$iOS$UserNotificationCenter$requestUserNotificationSettings(callback: (param0: GetUserNotificationSettings) => any): void
/**
* Gets the value of the <Titanium.App.iOS.UserNotificationCenter.apiName> property.
*/
declare function Titanium$App$iOS$UserNotificationCenter$getApiName(): string
declare var npm$namespace$Titanium$Calendar: {
addEventListener: typeof Titanium$Calendar$addEventListener,
removeEventListener: typeof Titanium$Calendar$removeEventListener,
fireEvent: typeof Titanium$Calendar$fireEvent,
applyProperties: typeof Titanium$Calendar$applyProperties,
getCalendarById: typeof Titanium$Calendar$getCalendarById,
hasCalendarPermissions: typeof Titanium$Calendar$hasCalendarPermissions,
requestCalendarPermissions: typeof Titanium$Calendar$requestCalendarPermissions,
requestEventsAuthorization: typeof Titanium$Calendar$requestEventsAuthorization,
getBubbleParent: typeof Titanium$Calendar$getBubbleParent,
setBubbleParent: typeof Titanium$Calendar$setBubbleParent,
getApiName: typeof Titanium$Calendar$getApiName,
getLifecycleContainer: typeof Titanium$Calendar$getLifecycleContainer,
setLifecycleContainer: typeof Titanium$Calendar$setLifecycleContainer,
getEventsAuthorization: typeof Titanium$Calendar$getEventsAuthorization,
getCalendarAuthorization: typeof Titanium$Calendar$getCalendarAuthorization,
getAllAlerts: typeof Titanium$Calendar$getAllAlerts,
getAllCalendars: typeof Titanium$Calendar$getAllCalendars,
getAllEditableCalendars: typeof Titanium$Calendar$getAllEditableCalendars,
getSelectableCalendars: typeof Titanium$Calendar$getSelectableCalendars,
getDefaultCalendar: typeof Titanium$Calendar$getDefaultCalendar,
bubbleParent: typeof Titanium$Calendar$bubbleParent,
apiName: typeof Titanium$Calendar$apiName,
lifecycleContainer: typeof Titanium$Calendar$lifecycleContainer,
METHOD_ALERT: typeof Titanium$Calendar$METHOD_ALERT,
METHOD_DEFAULT: typeof Titanium$Calendar$METHOD_DEFAULT,
METHOD_EMAIL: typeof Titanium$Calendar$METHOD_EMAIL,
METHOD_SMS: typeof Titanium$Calendar$METHOD_SMS,
STATE_DISMISSED: typeof Titanium$Calendar$STATE_DISMISSED,
STATE_FIRED: typeof Titanium$Calendar$STATE_FIRED,
STATE_SCHEDULED: typeof Titanium$Calendar$STATE_SCHEDULED,
STATUS_NONE: typeof Titanium$Calendar$STATUS_NONE,
STATUS_CANCELLED: typeof Titanium$Calendar$STATUS_CANCELLED,
STATUS_CANCELED: typeof Titanium$Calendar$STATUS_CANCELED,
STATUS_CONFIRMED: typeof Titanium$Calendar$STATUS_CONFIRMED,
STATUS_TENTATIVE: typeof Titanium$Calendar$STATUS_TENTATIVE,
AVAILABILITY_NOTSUPPORTED: typeof Titanium$Calendar$AVAILABILITY_NOTSUPPORTED,
AVAILABILITY_BUSY: typeof Titanium$Calendar$AVAILABILITY_BUSY,
AVAILABILITY_FREE: typeof Titanium$Calendar$AVAILABILITY_FREE,
AVAILABILITY_TENTATIVE: typeof Titanium$Calendar$AVAILABILITY_TENTATIVE,
AVAILABILITY_UNAVAILABLE: typeof Titanium$Calendar$AVAILABILITY_UNAVAILABLE,
AUTHORIZATION_AUTHORIZED: typeof Titanium$Calendar$AUTHORIZATION_AUTHORIZED,
AUTHORIZATION_DENIED: typeof Titanium$Calendar$AUTHORIZATION_DENIED,
AUTHORIZATION_RESTRICTED: typeof Titanium$Calendar$AUTHORIZATION_RESTRICTED,
AUTHORIZATION_UNKNOWN: typeof Titanium$Calendar$AUTHORIZATION_UNKNOWN,
SPAN_THISEVENT: typeof Titanium$Calendar$SPAN_THISEVENT,
SPAN_FUTUREEVENTS: typeof Titanium$Calendar$SPAN_FUTUREEVENTS,
RECURRENCEFREQUENCY_DAILY: typeof Titanium$Calendar$RECURRENCEFREQUENCY_DAILY,
RECURRENCEFREQUENCY_WEEKLY: typeof Titanium$Calendar$RECURRENCEFREQUENCY_WEEKLY,
RECURRENCEFREQUENCY_MONTHLY: typeof Titanium$Calendar$RECURRENCEFREQUENCY_MONTHLY,
RECURRENCEFREQUENCY_YEARLY: typeof Titanium$Calendar$RECURRENCEFREQUENCY_YEARLY,
VISIBILITY_CONFIDENTIAL: typeof Titanium$Calendar$VISIBILITY_CONFIDENTIAL,
VISIBILITY_DEFAULT: typeof Titanium$Calendar$VISIBILITY_DEFAULT,
VISIBILITY_PRIVATE: typeof Titanium$Calendar$VISIBILITY_PRIVATE,
VISIBILITY_PUBLIC: typeof Titanium$Calendar$VISIBILITY_PUBLIC,
ATTENDEE_STATUS_UNKNOWN: typeof Titanium$Calendar$ATTENDEE_STATUS_UNKNOWN,
ATTENDEE_STATUS_PENDING: typeof Titanium$Calendar$ATTENDEE_STATUS_PENDING,
ATTENDEE_STATUS_ACCEPTED: typeof Titanium$Calendar$ATTENDEE_STATUS_ACCEPTED,
ATTENDEE_STATUS_DECLINED: typeof Titanium$Calendar$ATTENDEE_STATUS_DECLINED,
ATTENDEE_STATUS_TENTATIVE: typeof Titanium$Calendar$ATTENDEE_STATUS_TENTATIVE,
ATTENDEE_STATUS_INVITED: typeof Titanium$Calendar$ATTENDEE_STATUS_INVITED,
ATTENDEE_STATUS_NONE: typeof Titanium$Calendar$ATTENDEE_STATUS_NONE,
ATTENDEE_STATUS_DELEGATED: typeof Titanium$Calendar$ATTENDEE_STATUS_DELEGATED,
ATTENDEE_STATUS_IN_PROCESS: typeof Titanium$Calendar$ATTENDEE_STATUS_IN_PROCESS,
RELATIONSHIP_ATTENDEE: typeof Titanium$Calendar$RELATIONSHIP_ATTENDEE,
RELATIONSHIP_NONE: typeof Titanium$Calendar$RELATIONSHIP_NONE,
RELATIONSHIP_ORGANIZER: typeof Titanium$Calendar$RELATIONSHIP_ORGANIZER,
RELATIONSHIP_PERFORMER: typeof Titanium$Calendar$RELATIONSHIP_PERFORMER,
RELATIONSHIP_SPEAKER: typeof Titanium$Calendar$RELATIONSHIP_SPEAKER,
RELATIONSHIP_UNKNOWN: typeof Titanium$Calendar$RELATIONSHIP_UNKNOWN,
ATTENDEE_ROLE_UNKNOWN: typeof Titanium$Calendar$ATTENDEE_ROLE_UNKNOWN,
ATTENDEE_ROLE_OPTIONAL: typeof Titanium$Calendar$ATTENDEE_ROLE_OPTIONAL,
ATTENDEE_ROLE_REQUIRED: typeof Titanium$Calendar$ATTENDEE_ROLE_REQUIRED,
ATTENDEE_ROLE_CHAIR: typeof Titanium$Calendar$ATTENDEE_ROLE_CHAIR,
ATTENDEE_ROLE_NON_PARTICIPANT: typeof Titanium$Calendar$ATTENDEE_ROLE_NON_PARTICIPANT,
ATTENDEE_TYPE_UNKNOWN: typeof Titanium$Calendar$ATTENDEE_TYPE_UNKNOWN,
ATTENDEE_TYPE_PERSON: typeof Titanium$Calendar$ATTENDEE_TYPE_PERSON,
ATTENDEE_TYPE_ROOM: typeof Titanium$Calendar$ATTENDEE_TYPE_ROOM,
ATTENDEE_TYPE_RESOURCE: typeof Titanium$Calendar$ATTENDEE_TYPE_RESOURCE,
ATTENDEE_TYPE_NONE: typeof Titanium$Calendar$ATTENDEE_TYPE_NONE,
ATTENDEE_TYPE_REQUIRED: typeof Titanium$Calendar$ATTENDEE_TYPE_REQUIRED,
ATTENDEE_TYPE_GROUP: typeof Titanium$Calendar$ATTENDEE_TYPE_GROUP,
SOURCE_TYPE_LOCAL: typeof Titanium$Calendar$SOURCE_TYPE_LOCAL,
SOURCE_TYPE_EXCHANGE: typeof Titanium$Calendar$SOURCE_TYPE_EXCHANGE,
SOURCE_TYPE_CALDAV: typeof Titanium$Calendar$SOURCE_TYPE_CALDAV,
SOURCE_TYPE_MOBILEME: typeof Titanium$Calendar$SOURCE_TYPE_MOBILEME,
SOURCE_TYPE_SUBSCRIBED: typeof Titanium$Calendar$SOURCE_TYPE_SUBSCRIBED,
SOURCE_TYPE_BIRTHDAYS: typeof Titanium$Calendar$SOURCE_TYPE_BIRTHDAYS,
eventsAuthorization: typeof Titanium$Calendar$eventsAuthorization,
calendarAuthorization: typeof Titanium$Calendar$calendarAuthorization,
allAlerts: typeof Titanium$Calendar$allAlerts,
allCalendars: typeof Titanium$Calendar$allCalendars,
allEditableCalendars: typeof Titanium$Calendar$allEditableCalendars,
selectableCalendars: typeof Titanium$Calendar$selectableCalendars,
defaultCalendar: typeof Titanium$Calendar$defaultCalendar,
}
/**
* Indicates if the proxy will bubble an event to its parent.
*/
declare var Titanium$Calendar$bubbleParent: boolean;
/**
* The name of the API that this proxy corresponds to.
*/
declare var Titanium$Calendar$apiName: string;
/**
* The Window or TabGroup whose Activity lifecycle should be triggered on the proxy.
*/
declare var Titanium$Calendar$lifecycleContainer: Titanium$UI$Window | Titanium$UI$TabGroup;
/**
* Reminder alert delivery method.
*/
declare var Titanium$Calendar$METHOD_ALERT: number;
/**
* Reminder default delivery method.
*/
declare var Titanium$Calendar$METHOD_DEFAULT: number;
/**
* Reminder email delivery method.
*/
declare var Titanium$Calendar$METHOD_EMAIL: number;
/**
* Reminder SMS delivery method.
*/
declare var Titanium$Calendar$METHOD_SMS: number;
/**
* Alert dismissed state.
*/
declare var Titanium$Calendar$STATE_DISMISSED: number;
/**
* Alert fired state.
*/
declare var Titanium$Calendar$STATE_FIRED: number;
/**
* Alert scheduled status.
*/
declare var Titanium$Calendar$STATE_SCHEDULED: number;
/**
* Event has no status.
*/
declare var Titanium$Calendar$STATUS_NONE: number;
/**
* Event canceled status.
*/
declare var Titanium$Calendar$STATUS_CANCELLED: number;
/**
* Event canceled status.
*/
declare var Titanium$Calendar$STATUS_CANCELED: number;
/**
* Event confirmed status.
*/
declare var Titanium$Calendar$STATUS_CONFIRMED: number;
/**
* Event tentative status.
*/
declare var Titanium$Calendar$STATUS_TENTATIVE: number;
/**
* Availability settings are not supported by the event's calendar.
*/
declare var Titanium$Calendar$AVAILABILITY_NOTSUPPORTED: number;
/**
* Event has a busy availability setting.
*/
declare var Titanium$Calendar$AVAILABILITY_BUSY: number;
/**
* Event has a free availability setting.
*/
declare var Titanium$Calendar$AVAILABILITY_FREE: number;
/**
* Event has a tentative availability setting.
*/
declare var Titanium$Calendar$AVAILABILITY_TENTATIVE: number;
/**
* Event has a tentative availability setting.
*/
declare var Titanium$Calendar$AVAILABILITY_UNAVAILABLE: number;
/**
* A [eventsAuthorization](Titanium.Calendar.eventsAuthorization) value
* indicating that the application is authorized to use events in the Calendar.
*/
declare var Titanium$Calendar$AUTHORIZATION_AUTHORIZED: number;
/**
* A [eventsAuthorization](Titanium.Calendar.eventsAuthorization) value
* indicating that the application is not authorized to use events in the Calendar.
*/
declare var Titanium$Calendar$AUTHORIZATION_DENIED: number;
/**
* A [eventsAuthorization](Titanium.Calendar.eventsAuthorization) value
* indicating that the application is not authorized to use events in the Calendar.
* the user cannot change this application's status.
*/
declare var Titanium$Calendar$AUTHORIZATION_RESTRICTED: number;
/**
* A [eventsAuthorization](Titanium.Calendar.eventsAuthorization) value
* indicating that the authorization state is unknown.
*/
declare var Titanium$Calendar$AUTHORIZATION_UNKNOWN: number;
/**
* A [save](Titanium.Calendar.Event.save)/[remove](Titanium.Calendar.Event.remove) event value,
* indicating modifications to this event instance should affect only this instance.
*/
declare var Titanium$Calendar$SPAN_THISEVENT: number;
/**
* A [save](Titanium.Calendar.Event.save)/[remove](Titanium.Calendar.Event.remove) event value,
* indicating modifications to this event instance should also affect future instances of this event.
*/
declare var Titanium$Calendar$SPAN_FUTUREEVENTS: number;
/**
* Indicates a daily recurrence rule for a events reccurance frequency.
*/
declare var Titanium$Calendar$RECURRENCEFREQUENCY_DAILY: number;
/**
* Indicates a weekly recurrence rule for a events reccurance frequency.
*/
declare var Titanium$Calendar$RECURRENCEFREQUENCY_WEEKLY: number;
/**
* Indicates a monthly recurrence rule for a events reccurance frequency.
*/
declare var Titanium$Calendar$RECURRENCEFREQUENCY_MONTHLY: number;
/**
* Indicates a yearly recurrence rule for a events reccurance frequency.
*/
declare var Titanium$Calendar$RECURRENCEFREQUENCY_YEARLY: number;
/**
* Event confidential visibility.
*/
declare var Titanium$Calendar$VISIBILITY_CONFIDENTIAL: number;
/**
* Event default visibility.
*/
declare var Titanium$Calendar$VISIBILITY_DEFAULT: number;
/**
* Event private visibility.
*/
declare var Titanium$Calendar$VISIBILITY_PRIVATE: number;
/**
* Event public visibility.
*/
declare var Titanium$Calendar$VISIBILITY_PUBLIC: number;
/**
* Attendee status is unknown.
*/
declare var Titanium$Calendar$ATTENDEE_STATUS_UNKNOWN: number;
/**
* Attendee status is pending.
*/
declare var Titanium$Calendar$ATTENDEE_STATUS_PENDING: number;
/**
* Attendee status is accepted.
*/
declare var Titanium$Calendar$ATTENDEE_STATUS_ACCEPTED: number;
/**
* Attendee status is declined.
*/
declare var Titanium$Calendar$ATTENDEE_STATUS_DECLINED: number;
/**
* Attendee status is tentative.
*/
declare var Titanium$Calendar$ATTENDEE_STATUS_TENTATIVE: number;
/**
* Attendee status is invited.
*/
declare var Titanium$Calendar$ATTENDEE_STATUS_INVITED: number;
/**
* There is no Attendee status.
*/
declare var Titanium$Calendar$ATTENDEE_STATUS_NONE: number;
/**
* Attendee status is delegated.
*/
declare var Titanium$Calendar$ATTENDEE_STATUS_DELEGATED: number;
/**
* Attendee status is in process.
*/
declare var Titanium$Calendar$ATTENDEE_STATUS_IN_PROCESS: number;
/**
* Relationship is attendee.
*/
declare var Titanium$Calendar$RELATIONSHIP_ATTENDEE: number;
/**
* There is no relationship.
*/
declare var Titanium$Calendar$RELATIONSHIP_NONE: number;
/**
* Attendee is organizer.
*/
declare var Titanium$Calendar$RELATIONSHIP_ORGANIZER: number;
/**
* Attendee is performer.
*/
declare var Titanium$Calendar$RELATIONSHIP_PERFORMER: number;
/**
* Attendee is speaker.
*/
declare var Titanium$Calendar$RELATIONSHIP_SPEAKER: number;
/**
* Relationship is unknown.
*/
declare var Titanium$Calendar$RELATIONSHIP_UNKNOWN: number;
/**
* Attendee role is unknown.
*/
declare var Titanium$Calendar$ATTENDEE_ROLE_UNKNOWN: number;
/**
* Attendee role is optional.
*/
declare var Titanium$Calendar$ATTENDEE_ROLE_OPTIONAL: number;
/**
* Attendee role is required.
*/
declare var Titanium$Calendar$ATTENDEE_ROLE_REQUIRED: number;
/**
* Attendee role is chair.
*/
declare var Titanium$Calendar$ATTENDEE_ROLE_CHAIR: number;
/**
* Attendee is not a participant.
*/
declare var Titanium$Calendar$ATTENDEE_ROLE_NON_PARTICIPANT: number;
/**
* Attendee type is unknown.
*/
declare var Titanium$Calendar$ATTENDEE_TYPE_UNKNOWN: number;
/**
* Attendee type is person.
*/
declare var Titanium$Calendar$ATTENDEE_TYPE_PERSON: number;
/**
* Attendee type is room.
*/
declare var Titanium$Calendar$ATTENDEE_TYPE_ROOM: number;
/**
* Attendee type is resource.
*/
declare var Titanium$Calendar$ATTENDEE_TYPE_RESOURCE: number;
/**
* There is not attendee type.
*/
declare var Titanium$Calendar$ATTENDEE_TYPE_NONE: number;
/**
* Attendee type is required.
*/
declare var Titanium$Calendar$ATTENDEE_TYPE_REQUIRED: number;
/**
* Attendee type is group.
*/
declare var Titanium$Calendar$ATTENDEE_TYPE_GROUP: number;
/**
* A local calendar source.
*/
declare var Titanium$Calendar$SOURCE_TYPE_LOCAL: number;
/**
* A microsoft exchange calendar source.
*/
declare var Titanium$Calendar$SOURCE_TYPE_EXCHANGE: number;
/**
* A calDev calendar source.
*/
declare var Titanium$Calendar$SOURCE_TYPE_CALDAV: number;
/**
* A mobileMe calendar source.
*/
declare var Titanium$Calendar$SOURCE_TYPE_MOBILEME: number;
/**
* A subscribed calendar source.
*/
declare var Titanium$Calendar$SOURCE_TYPE_SUBSCRIBED: number;
/**
* A birthday calendar source.
*/
declare var Titanium$Calendar$SOURCE_TYPE_BIRTHDAYS: number;
/**
* Returns an authorization constant indicating if the application has access to the events in the EventKit.
*/
declare var Titanium$Calendar$eventsAuthorization: number;
/**
* Returns an authorization constant indicating if the application has access to the events in the EventKit.
*/
declare var Titanium$Calendar$calendarAuthorization: number;
/**
* All alerts in selected calendars.
*/
declare var Titanium$Calendar$allAlerts: Titanium$Calendar$Alert[];
/**
* All calendars known to the native calendar app.
*/
declare var Titanium$Calendar$allCalendars: Titanium$Calendar$Calendar[];
/**
* All calendars known to the native calendar app that can add, edit, and
* delete items in the calendar.
*/
declare var Titanium$Calendar$allEditableCalendars: Titanium$Calendar$Calendar[];
/**
* All calendars selected within the native calendar app, which may be a subset of `allCalendars`.
*/
declare var Titanium$Calendar$selectableCalendars: Titanium$Calendar$Calendar[];
/**
* Calendar that events are added to by default, as specified by user settings.
*/
declare var Titanium$Calendar$defaultCalendar: Titanium$Calendar$Calendar;
/**
* Adds the specified callback as an event listener for the named event.
*/
declare function Titanium$Calendar$addEventListener(name: string, callback: (param0: any) => any): void
/**
* Removes the specified callback as an event listener for the named event.
*/
declare function Titanium$Calendar$removeEventListener(name: string, callback: (param0: any) => any): void
/**
* Fires a synthesized event to any registered listeners.
*/
declare function Titanium$Calendar$fireEvent(name: string, event: any): void
/**
* Applies the properties to the proxy.
*/
declare function Titanium$Calendar$applyProperties(props: any): void
/**
* Gets the calendar with the specified identifier.
*/
declare function Titanium$Calendar$getCalendarById(id: string): Titanium$Calendar$Calendar
/**
* Returns `true` if the app has calendar access.
*/
declare function Titanium$Calendar$hasCalendarPermissions(): boolean
/**
* Requests for calendar access.
*/
declare function Titanium$Calendar$requestCalendarPermissions(callback: (param0: EventsAuthorizationResponse) => any): void
/**
* If authorization is unknown, will bring up a dialog requesting permission.
*/
declare function Titanium$Calendar$requestEventsAuthorization(callback: (param0: EventsAuthorizationResponse) => any): void
/**
* Gets the value of the <Titanium.Calendar.bubbleParent> property.
*/
declare function Titanium$Calendar$getBubbleParent(): boolean
/**
* Sets the value of the <Titanium.Calendar.bubbleParent> property.
*/
declare function Titanium$Calendar$setBubbleParent(bubbleParent: boolean): void
/**
* Gets the value of the <Titanium.Calendar.apiName> property.
*/
declare function Titanium$Calendar$getApiName(): string
/**
* Gets the value of the <Titanium.Calendar.lifecycleContainer> property.
*/
declare function Titanium$Calendar$getLifecycleContainer(): Titanium$UI$Window | Titanium$UI$TabGroup
/**
* Sets the value of the <Titanium.Calendar.lifecycleContainer> property.
*/
declare function Titanium$Calendar$setLifecycleContainer(lifecycleContainer: Titanium$UI$Window): void
/**
* Sets the value of the <Titanium.Calendar.lifecycleContainer> property.
*/
declare function Titanium$Calendar$setLifecycleContainer(lifecycleContainer: Titanium$UI$TabGroup): void
/**
* Gets the value of the <Titanium.Calendar.eventsAuthorization> property.
*/
declare function Titanium$Calendar$getEventsAuthorization(): number
/**
* Gets the value of the <Titanium.Calendar.calendarAuthorization> property.
*/
declare function Titanium$Calendar$getCalendarAuthorization(): number
/**
* Gets the value of the <Titanium.Calendar.allAlerts> property.
*/
declare function Titanium$Calendar$getAllAlerts(): Titanium$Calendar$Alert[]
/**
* Gets the value of the <Titanium.Calendar.allCalendars> property.
*/
declare function Titanium$Calendar$getAllCalendars(): Titanium$Calendar$Calendar[]
/**
* Gets the value of the <Titanium.Calendar.allEditableCalendars> property.
*/
declare function Titanium$Calendar$getAllEditableCalendars(): Titanium$Calendar$Calendar[]
/**
* Gets the value of the <Titanium.Calendar.selectableCalendars> property.
*/
declare function Titanium$Calendar$getSelectableCalendars(): Titanium$Calendar$Calendar[]
/**
* Gets the value of the <Titanium.Calendar.defaultCalendar> property.
*/
declare function Titanium$Calendar$getDefaultCalendar(): Titanium$Calendar$Calendar
/**
* An object that represents a single alert for an event in an calendar.
*/
declare type Titanium$Calendar$Alert = {
/**
* The absolute date for the alarm.
*/
absoluteDate: Date,
/**
* The offset from the start of an event, at which the alarm fires.
*/
relativeOffset: number,
/**
* Date/time at which this alert alarm is set to trigger.
*/
+alarmTime: Date,
/**
* Start date/time for the corresponding event.
*/
+begin: Date,
/**
* End date/time for the corresponding event.
*/
+end: Date,
/**
* Identifier of the event for which this alert is set.
*/
+eventId: number,
/**
* Identifier of this alert.
*/
+id: string,
/**
* Reminder notice period in minutes, that determines how long prior to the event this alert
* should trigger.
*/
+minutes: number,
/**
* The current state of the alert.
*/
+state: number,
/**
* Gets the value of the <Titanium.Calendar.Alert.absoluteDate> property.
*/
getAbsoluteDate(): Date,
/**
* Sets the value of the <Titanium.Calendar.Alert.absoluteDate> property.
*/
setAbsoluteDate(absoluteDate: Date): void,
/**
* Gets the value of the <Titanium.Calendar.Alert.relativeOffset> property.
*/
getRelativeOffset(): number,
/**
* Sets the value of the <Titanium.Calendar.Alert.relativeOffset> property.
*/
setRelativeOffset(relativeOffset: number): void,
/**
* Gets the value of the <Titanium.Calendar.Alert.alarmTime> property.
*/
getAlarmTime(): Date,
/**
* Gets the value of the <Titanium.Calendar.Alert.begin> property.
*/
getBegin(): Date,
/**
* Gets the value of the <Titanium.Calendar.Alert.end> property.
*/
getEnd(): Date,
/**
* Gets the value of the <Titanium.Calendar.Alert.eventId> property.
*/
getEventId(): number,
/**
* Gets the value of the <Titanium.Calendar.Alert.id> property.
*/
getId(): string,
/**
* Gets the value of the <Titanium.Calendar.Alert.minutes> property.
*/
getMinutes(): number,
/**
* Gets the value of the <Titanium.Calendar.Alert.state> property.
*/
getState(): number
} & Titanium$Proxy
/**
* An object that represents a single attendee of an event.
*/
declare type Titanium$Calendar$Attendee = {
/**
* Indicates whether this attendee is the event organizer.
*/
isOrganizer: boolean,
/**
* The attendee name.
*/
name: string,
/**
* The attendee email.
*/
email: string,
/**
* The role of the attendee.
*/
role: number,
/**
* The type of the attendee.
*/
type: number,
/**
* The status of the attendee.
*/
status: number,
/**
* Gets the value of the <Titanium.Calendar.Attendee.isOrganizer> property.
*/
getIsOrganizer(): boolean,
/**
* Sets the value of the <Titanium.Calendar.Attendee.isOrganizer> property.
*/
setIsOrganizer(isOrganizer: boolean): void,
/**
* Gets the value of the <Titanium.Calendar.Attendee.name> property.
*/
getName(): string,
/**
* Sets the value of the <Titanium.Calendar.Attendee.name> property.
*/
setName(name: string): void,
/**
* Gets the value of the <Titanium.Calendar.Attendee.email> property.
*/
getEmail(): string,
/**
* Sets the value of the <Titanium.Calendar.Attendee.email> property.
*/
setEmail(email: string): void,
/**
* Gets the value of the <Titanium.Calendar.Attendee.role> property.
*/
getRole(): number,
/**
* Sets the value of the <Titanium.Calendar.Attendee.role> property.
*/
setRole(role: number): void,
/**
* Gets the value of the <Titanium.Calendar.Attendee.type> property.
*/
getType(): number,
/**
* Sets the value of the <Titanium.Calendar.Attendee.type> property.
*/
setType(type: number): void,
/**
* Gets the value of the <Titanium.Calendar.Attendee.status> property.
*/
getStatus(): number,
/**
* Sets the value of the <Titanium.Calendar.Attendee.status> property.
*/
setStatus(status: number): void
} & Titanium$Proxy
/**
* An object that represents a single calendar.
*/
declare type Titanium$Calendar$Calendar = {
/**
* Indicates whether this calendar can be edited or deleted.
*/
+hidden: boolean,
/**
* Identifier of this calendar.
*/
+id: string,
/**
* Display name of this calendar.
*/
+name: string,
/**
* Indicates whether the calendar is selected.
*/
+selected: boolean,
/**
* Displays the source title.
*/
+sourceTitle: string,
/**
* Displays the source type.
*/
+sourceType: number,
/**
* Displays the source identifier.
*/
+sourceIdentifier: string,
/**
* Creates an event in this calendar.
*/
createEvent(properties: any): Titanium$Calendar$Event,
/**
* Gets the event with the specified identifier.
*/
getEventById(id: number): Titanium$Calendar$Event,
/**
* Gets events that occur between two dates.
*/
getEventsBetweenDates(date1: Date, date2: Date | string): Titanium$Calendar$Event[],
/**
* Gets events that occur between two dates.
*/
getEventsBetweenDates(date1: string, date2: Date | string): Titanium$Calendar$Event[],
/**
* Gets events that occur between two dates.
*/
getEventsBetweenDates(date1: Date | string, date2: Date): Titanium$Calendar$Event[],
/**
* Gets events that occur between two dates.
*/
getEventsBetweenDates(date1: Date | string, date2: string): Titanium$Calendar$Event[],
/**
* Gets events that occur on a specified date.
*/
getEventsInDate(year: number, month: number, day: number): Titanium$Calendar$Event[],
/**
* Gets events that occur during a specified month.
*/
getEventsInMonth(year: number, month: number): Titanium$Calendar$Event[],
/**
* Gets all events that occur during a specified year.
*/
getEventsInYear(year: number): Titanium$Calendar$Event[],
/**
* Gets the value of the <Titanium.Calendar.Calendar.hidden> property.
*/
getHidden(): boolean,
/**
* Gets the value of the <Titanium.Calendar.Calendar.id> property.
*/
getId(): string,
/**
* Gets the value of the <Titanium.Calendar.Calendar.name> property.
*/
getName(): string,
/**
* Gets the value of the <Titanium.Calendar.Calendar.selected> property.
*/
getSelected(): boolean,
/**
* Gets the value of the <Titanium.Calendar.Calendar.sourceTitle> property.
*/
getSourceTitle(): string,
/**
* Gets the value of the <Titanium.Calendar.Calendar.sourceType> property.
*/
getSourceType(): number,
/**
* Gets the value of the <Titanium.Calendar.Calendar.sourceIdentifier> property.
*/
getSourceIdentifier(): string
} & Titanium$Proxy
/**
* An object that represents a single event in a calendar.
*/
declare type Titanium$Calendar$Event = {
/**
* Alarms associated with the calendar item, as an array of <Titanium.Calendar.Alert> objects.
*/
alerts: Titanium$Calendar$Alert[],
/**
* Indicates whether this event is all day.
*/
allDay: boolean,
/**
* Start date/time of this event.
*/
begin: Date,
/**
* Notes for this event.
*/
notes: string,
/**
* Description of this event.
*/
+description: string,
/**
* End date/time of this event.
*/
end: Date,
/**
* Extended properties of this event.
*/
+extendedProperties: any,
/**
* Indicates whether an alarm is scheduled for this event.
*/
+hasAlarm: boolean,
/**
* Identifier of this event.
*/
+id: string,
/**
* Location of this event.
*/
location: string,
/**
* Existing reminders for this event.
*/
+reminders: Titanium$Calendar$Reminder[],
/**
* Status of this event.
*/
+status: number,
/**
* Availability of this event.
*/
+availability: number,
/**
* Boolean value that indicates whether an event is a detached instance of a
* repeating event.
*/
+isDetached: boolean,
/**
* Title of this event.
*/
title: string,
/**
* The recurrence rules for the calendar item.
*/
recurrenceRules: Titanium$Calendar$RecurrenceRule[],
/**
* Visibility of this event.
*/
+visibility: number,
/**
* The list of event attendees. This list will be empty if the event has no attendees.
*/
+attendees: Titanium$Calendar$Attendee[],
/**
* Creates an alert for this event.
*/
createAlert(data: any): Titanium$Calendar$Alert,
/**
* Creates a reminder for this event.
*/
createReminder(data: any): Titanium$Calendar$Reminder,
/**
* Gets the value of the specified extended property.
*/
getExtendedProperty(name: string): string,
/**
* Sets the value of the specified extended property.
*/
setExtendedProperty(name: string, value: string): void,
/**
* Creates an recurrence pattern for a recurring event.
* All of the properties for the recurrence rule must be set during creation.
* The recurrence rule properties cannot be modified.
*/
createRecurrenceRule(data: any): Titanium$Calendar$RecurrenceRule,
/**
* Saves changes to an event permanently.
*/
save(span: number): boolean,
/**
* Removes an event from the event store.
*/
remove(span: number): boolean,
/**
* Updates the event's data with the current information in the Calendar database.
*/
refresh(): boolean,
/**
* Adds a recurrence rule to the recurrence rule array.
*/
addRecurrenceRule(rule: Titanium$Calendar$RecurrenceRule): void,
/**
* Removes a recurrence rule to the recurrence rule array.
*/
removeRecurrenceRule(rule: Titanium$Calendar$RecurrenceRule): void,
/**
* Gets the value of the <Titanium.Calendar.Event.alerts> property.
*/
getAlerts(): Titanium$Calendar$Alert[],
/**
* Sets the value of the <Titanium.Calendar.Event.alerts> property.
*/
setAlerts(alerts: $ReadOnlyArray<Titanium$Calendar$Alert>): void,
/**
* Gets the value of the <Titanium.Calendar.Event.allDay> property.
*/
getAllDay(): boolean,
/**
* Sets the value of the <Titanium.Calendar.Event.allDay> property.
*/
setAllDay(allDay: boolean): void,
/**
* Gets the value of the <Titanium.Calendar.Event.begin> property.
*/
getBegin(): Date,
/**
* Sets the value of the <Titanium.Calendar.Event.begin> property.
*/
setBegin(begin: Date): void,
/**
* Gets the value of the <Titanium.Calendar.Event.notes> property.
*/
getNotes(): string,
/**
* Sets the value of the <Titanium.Calendar.Event.notes> property.
*/
setNotes(notes: string): void,
/**
* Gets the value of the <Titanium.Calendar.Event.description> property.
*/
getDescription(): string,
/**
* Gets the value of the <Titanium.Calendar.Event.end> property.
*/
getEnd(): Date,
/**
* Sets the value of the <Titanium.Calendar.Event.end> property.
*/
setEnd(end: Date): void,
/**
* Gets the value of the <Titanium.Calendar.Event.extendedProperties> property.
*/
getExtendedProperties(): any,
/**
* Gets the value of the <Titanium.Calendar.Event.hasAlarm> property.
*/
getHasAlarm(): boolean,
/**
* Gets the value of the <Titanium.Calendar.Event.id> property.
*/
getId(): string,
/**
* Gets the value of the <Titanium.Calendar.Event.location> property.
*/
getLocation(): string,
/**
* Sets the value of the <Titanium.Calendar.Event.location> property.
*/
setLocation(location: string): void,
/**
* Gets the value of the <Titanium.Calendar.Event.reminders> property.
*/
getReminders(): Titanium$Calendar$Reminder[],
/**
* Gets the value of the <Titanium.Calendar.Event.status> property.
*/
getStatus(): number,
/**
* Gets the value of the <Titanium.Calendar.Event.availability> property.
*/
getAvailability(): number,
/**
* Gets the value of the <Titanium.Calendar.Event.isDetached> property.
*/
getIsDetached(): boolean,
/**
* Gets the value of the <Titanium.Calendar.Event.title> property.
*/
getTitle(): string,
/**
* Sets the value of the <Titanium.Calendar.Event.title> property.
*/
setTitle(title: string): void,
/**
* Gets the value of the <Titanium.Calendar.Event.recurrenceRules> property.
*/
getRecurrenceRules(): Titanium$Calendar$RecurrenceRule[],
/**
* Sets the value of the <Titanium.Calendar.Event.recurrenceRules> property.
*/
setRecurrenceRules(recurrenceRules: $ReadOnlyArray<Titanium$Calendar$RecurrenceRule>): void,
/**
* Gets the value of the <Titanium.Calendar.Event.visibility> property.
*/
getVisibility(): number,
/**
* Gets the value of the <Titanium.Calendar.Event.attendees> property.
*/
getAttendees(): Titanium$Calendar$Attendee[]
} & Titanium$Proxy
/**
* An object that is used to describe the recurrence pattern for a recurring event.
*/
declare type Titanium$Calendar$RecurrenceRule = {
/**
* Identifier for the recurrence rule's calendar.
*/
+calendarID: string,
/**
* Frequency of the recurrence rule.
*/
+frequency: number,
/**
* The interval between instances of this recurrence. For example, a weekly
* recurrence rule with an interval of 2 occurs every other week. Must be greater than 0.
*/
+interval: number,
/**
* The days of the week that the event occurs, as an Dictionay of `daysOfWeek` and `Week`.
*/
+daysOfTheWeek: daysOfTheWeekDictionary,
/**
* The days of the month that the event occurs, as an array of number objects.
* Values can be from 1 to 31 and from -1 to -31. This parameter is only valid for
* recurrence rules of type
* [RECURRENCEFREQUENCY_MONTHLY](Titanium.Calendar.RECURRENCEFREQUENCY_MONTHLY).
*/
+daysOfTheMonth: number[],
/**
* The months of the year that the event occurs, as an array of Number objects.
* Values can be from 1 to 12. This parameter is only valid for recurrence rules of
* type [RECURRENCEFREQUENCY_YEARLY](Titanium.Calendar.RECURRENCEFREQUENCY_YEARLY).
*/
+monthsOfTheYear: number[],
/**
* The weeks of the year that the event occurs, as an array of number objects.
* Values can be from 1 to 53 and from -1 to -53. This parameter is only valid for
* recurrence rules of type [RECURRENCEFREQUENCY_YEARLY](Titanium.Calendar.RECURRENCEFREQUENCY_YEARLY).
*/
+weeksOfTheYear: number[],
/**
* The days of the year that the event occurs, as an array of number objects.
* Values can be from 1 to 366 and from -1 to -366. This parameter is only valid for
* recurrence rules of type [RECURRENCEFREQUENCY_YEARLY](Titanium.Calendar.RECURRENCEFREQUENCY_YEARLY).
*/
+daysOfTheYear: number[],
/**
* An array of ordinal numbers that filters which recurrences to include in the
* recurrence rule's frequency. For example, a yearly recurrence rule that has a
* [daysOfTheWeek](Titanium.Calendar.RecurrenceRule.daysOfTheWeek) value that specifies
* Monday through Friday, and a `setPositions` array containing 2 and -1, occurs only
* on the second weekday and last weekday of every year.
*/
+setPositions: number[],
/**
* End of a recurrence rule.
*/
+end: recurrenceEndDictionary,
/**
* Gets the value of the <Titanium.Calendar.RecurrenceRule.calendarID> property.
*/
getCalendarID(): string,
/**
* Gets the value of the <Titanium.Calendar.RecurrenceRule.frequency> property.
|
Avatar component
Create an avatar.component which will be available on top-menu layout
Please, describe fuctionality and some mocks/examples when it will be possible
|
package br.jus.stf.shared;
import javax.persistence.Column;
import javax.persistence.Embeddable;
import org.apache.commons.lang3.Validate;
import br.jus.stf.shared.stereotype.ValueObject;
/**
* @author Rafael.Alencar
* @version 1.0
* @created 14-ago-2015 18:33:46
*/
@Embeddable
public class MinistroId implements ValueObject<MinistroId>{
private static final long serialVersionUID = 1L;
@Column(name = "COD_MINISTRO", nullable = false)
private Long codigo;
MinistroId() {
}
public MinistroId(final Long codigo){
Validate.notNull(codigo, "ministroId.codigo.required");
this.codigo = codigo;
}
public Long toLong(){
return codigo;
}
@Override
public String toString(){
return codigo.toString();
}
@Override
public int hashCode() {
final int prime = 31;
int result = 1;
result = prime * result + ((codigo == null) ? 0 : codigo.hashCode());
return result;
}
@Override
public boolean equals(final Object o){
if (this == o) return true;
if (o == null || getClass() != o.getClass()) return false;
MinistroId other = (MinistroId) o;
return sameValueAs(other);
}
@Override
public boolean sameValueAs(final MinistroId other){
return other != null && this.codigo.equals(other.codigo);
}
}
|
Sclerology
History
Criticism
Books
* Insights in the Eyes, An Introduction to Sclerology by Dr. Jack Tips, ND, PhD (Mar 1996)
Links
* International Sclerology Institute
Articles
* www.healthandgoodness.com/Therapies/sclerology.html
* www.bridgetobetterhealth.com/sclerology.htm
* www.byregion.net/articles-healers/iridology.html (explaining Sclerology)
|
Talk:Lleida CF
Fair use rationale for Image:Joma.gif
Image:Joma.gif is being used on this article. I notice the image page specifies that the image is being used under fair use but there is no explanation or rationale as to why its use in this Wikipedia article constitutes fair use. In addition to the boilerplate fair use template, you must also write out on the image description page a specific explanation or rationale for why using this image in each article is consistent with fair use.
If there is other other fair use media, consider checking that you have specified the fair use rationale on the other images used on this page. Note that any fair use images uploaded after 4 May, 2006, and lacking such an explanation will be deleted one week after they have been uploaded, as described on criteria for speedy deletion. If you have any questions please ask them at the Media copyright questions page. Thank you.BetacommandBot 06:24, 5 June 2007 (UTC)
Fair use rationale for Image:UE Lleida escudo.gif
Image:UE Lleida escudo.gif is being used on this article. I notice the image page specifies that the image is being used under fair use but there is no explanation or rationale as to why its use in this Wikipedia article constitutes fair use. In addition to the boilerplate fair use template, you must also write out on the image description page a specific explanation or rationale for why using this image in each article is consistent with fair use.
BetacommandBot (talk) 12:44, 21 January 2008 (UTC)
External links modified
Hello fellow Wikipedians,
I have just modified one external link on Lleida Esportiu. Please take a moment to review my edit. If you have any questions, or need the bot to ignore the links, or the page altogether, please visit this simple FaQ for additional information. I made the following changes:
* Added archive https://web.archive.org/web/20110712142646/http://www.sport.es/es/noticias/futbol-catala/20110707/juez-echa-junyent-club-lleida-esportiu/1068713.shtml to http://www.sport.es/es/noticias/futbol-catala/20110707/juez-echa-junyent-club-lleida-esportiu/1068713.shtml
Cheers.— InternetArchiveBot (Report bug) 18:05, 3 December 2017 (UTC)
|
What primary criteria should we use in voting on questions?
An odd question, perhaps. But I think it needs to be considered.
Take for example, this question: Merge with security proposal?
As a question alone, in the Meta forums of the IT Security StackExchange, this is a good question. It is specific, on topic, and is something that the community should come to a final decision upon.
However, as an idea, it is obviously regarded as not good. I'll not go into any arguments for or against it here, but as it stands now the vote count nets out to negative three. So, either there's a lot of people disagreeing with my above assessment of the question's quality, or a lot of people are voting against the idea instead of the question.
I think this is something we need to try to standardize, so that we don't have votes competing at cross-purpose.
By tradition, voting on questions on Stack Exchange meta sites is an exception: ones does vote for or against the idea. As makerofthings wrote: “It's just a way to show sentiment on good ideas or ones we'd rather not see.”
This is not necessarily a useful traditions, but you can expect people who've been active on other Stack Exchange sites to follow it. On the other hand, you can't expect other people to know about it. So I guess the offshot is that question votes are mostly meaningless on Meta.
As for the main site, I hardly ever downvote questions. If they're not good: improve, or close. If they're ok, do nothing. If they're good, upvote.
Interesting - as this is the first StackExchange site I have seen I didn't know that, and couldn't find any faq entry or answer on the main meta to guide in this way.
That doesn't seem like a helpful practice. If there is a big important debate going on, and the voting is 50 for and 51 against, I want to know that and see points for and against in the answers, not see it swept under the rug as a "-1" question.
@nealmcb: Indeed. I'm just reporting the practice, not condoning it. I don't think the vote argument is important, 50/51 and 51/50 are equivalent, they just show a divided community. But a negatively voted question will be low in search results, which kind of makes sense for a feature request but not for other kinds of meta discussions. (I suspect the practice did start with feature requests, and got carried away.)
So now we have the question of how to answer meta questions, and how to vote on the answers. If an answer doesn't state a position, but does accurately explain current behavior, I want to appreciate that, but not vote up and thus condone the behavior :)
As @Gilles says, Meta sites are different. There are several different kinds of posts here, and voting would (should!) behave differently here too. E.g. a feature request should have the question voted on, not the answers - unless the answers clarify the request, propose an alternate solution, or add useful information. A discussion question should be voted on if you think the discussion is an important one (or a trivial one), and the answers voted on to show your opinion. Bug questions could be voted for "me too" or "not me but this is important to fix", and so on...
Also dont forget that voting on Meta has no repurcussions, there is no rep from meta votes.
For example, I downvoted the question, because I don't think it makes sense to talk about "standardizing voting" (dont take offense, @Iszi :) ). I upvoted this answer, because it points out that it doesnt make sense, on Meta. I did nothing on @Iszi's answer, because it is technically correct, but while it does add some meat to the discussion it doesn't really provide a useful answer here.
As for how to standardize the voting, I suggest we reflect upon the suggestions in the voting privileges pages.
https://security.stackexchange.com/privileges/vote-up
Whenever you encounter a question or answer that you feel is especially useful, vote it up!
Consider:
Is the question well-formed and specific?
Is the question on-topic?
Is the question objectively answerable?
Are there enough details given in the question so that it can be answered?*
Does the question pose a special challenge to the community?
https://security.stackexchange.com/privileges/vote-down
Whenever you encounter an egregiously sloppy, no-effort-expended post, or an answer that is clearly and perhaps dangerously incorrect, vote it down!
Consider:
Is the question vague and ambiguous?
Is the question off-topic?
Is the question subjective and argumentative?
Are there not enough details in the question for it to be answerable?*
Is the question too simple for the level of expertise expected in this community?
**In some cases good questions may still be lacking in detail, and these can later be expanded upon, but in many cases a lack of detail is also an attribute of a bad question.*
Well laid out Iszi. I have added a comment on that question to point here.
|
Sugar Shock
Sugar Shock is a special ground type move and the signature move of Choga.
Effect
Sugar Shock has a 30% chance of lowering the target's attack by one stage.
|
Thread:CreationAintGood/@comment-32769624-20191215223017
Enjoy your time at the wiki!
NOTICE - ''This is an automatic message. There is no need to reply!''
|
#!/bin/bash -f
#
# Database connection parameters
# Please edit these variables to reflect your environment
# - Tested on Windows with "Git Bash" as a shell
#
# Set if necessary
#export ORACLE_HOME=/app/oracle/product/12.1.0/dbhome_1
user=snomed
password=snomed
tns_name=ORCLCDB
export NLS_LANG=AMERICAN_AMERICA.UTF8
# Oracle Docker on Ubuntu does not allow removing the log file
# Do this step prior to starting Docker to execute populate scripts
# /bin/rm -f oracle.log
# touch oracle.log
ef=0
echo "See oracle.log for output"
echo "----------------------------------------" >> oracle.log 2>&1
echo "Starting ... `/bin/date`" >> oracle.log 2>&1
echo "----------------------------------------" >> oracle.log 2>&1
echo "ORACLE_HOME = $ORACLE_HOME" >> oracle.log 2>&1
echo "user = $user" >> oracle.log 2>&1
echo "tns_name = $tns_name" >> oracle.log 2>&1
echo " Create tables ... `/bin/date`" >> oracle.log 2>&1
echo "@oracle_tables.sql" | $ORACLE_HOME/bin/sqlplus $user/$password@$tns_name >> oracle.log 2>&1
if [ $? -ne 0 ]; then ef=1; fi
if [ $ef -ne 1 ]; then
echo " Load concept table data ... `/bin/date`" >> oracle.log 2>&1
$ORACLE_HOME/bin/sqlldr $user/$password@$tns_name control="concept.ctl" >> oracle.log 2>&1
if [ $? -ne 0 ]; then ef=1; fi
cat concept.log >> oracle.log
fi
if [ $ef -ne 1 ]; then
echo " Load description table data ... `/bin/date`" >> oracle.log 2>&1
$ORACLE_HOME/bin/sqlldr $user/$password@$tns_name control="description.ctl" >> oracle.log 2>&1
if [ $? -ne 0 ]; then ef=1; fi
cat description.log >> oracle.log
fi
if [ $ef -ne 1 ]; then
echo " Load identifier table data ... `/bin/date`" >> oracle.log 2>&1
$ORACLE_HOME/bin/sqlldr $user/$password@$tns_name control="identifier.ctl" >> oracle.log 2>&1
if [ $? -ne 0 ]; then ef=1; fi
cat identifier.log >> oracle.log
fi
if [ $ef -ne 1 ]; then
echo " Load relationship table data ... `/bin/date`" >> oracle.log 2>&1
$ORACLE_HOME/bin/sqlldr $user/$password@$tns_name control="relationship.ctl" >> oracle.log 2>&1
if [ $? -ne 0 ]; then ef=1; fi
cat relationship.log >> oracle.log
fi
if [ $ef -ne 1 ]; then
echo " Load relationship concrete values table data ... `/bin/date`" >> oracle.log 2>&1
$ORACLE_HOME/bin/sqlldr $user/$password@$tns_name control="relationshipconcretevalues.ctl" >> oracle.log 2>&1
if [ $? -ne 0 ]; then ef=1; fi
cat relationshipconcretevalues.log >> oracle.log
fi
if [ $ef -ne 1 ]; then
echo " Load owl expression table data ... `/bin/date`" >> oracle.log 2>&1
$ORACLE_HOME/bin/sqlldr $user/$password@$tns_name control="owlexpression.ctl" >> oracle.log 2>&1
if [ $? -ne 0 ]; then ef=1; fi
cat owlexpression.log >> oracle.log
fi
if [ $ef -ne 1 ]; then
echo " Load stated relationship table data ... `/bin/date`" >> oracle.log 2>&1
$ORACLE_HOME/bin/sqlldr $user/$password@$tns_name control="statedrelationship.ctl" >> oracle.log 2>&1
if [ $? -ne 0 ]; then ef=1; fi
cat statedrelationship.log >> oracle.log
fi
if [ $ef -ne 1 ]; then
echo " Load text definition table data ... `/bin/date`" >> oracle.log 2>&1
$ORACLE_HOME/bin/sqlldr $user/$password@$tns_name control="textdefinition.ctl" >> oracle.log 2>&1
if [ $? -ne 0 ]; then ef=1; fi
cat textdefinition.log >> oracle.log
fi
if [ $ef -ne 1 ]; then
echo " Load association table data ... `/bin/date`" >> oracle.log 2>&1
$ORACLE_HOME/bin/sqlldr $user/$password@$tns_name control="association.ctl" >> oracle.log 2>&1
if [ $? -ne 0 ]; then ef=1; fi
cat association.log >> oracle.log
fi
if [ $ef -ne 1 ]; then
echo " Load attribute value table data ... `/bin/date`" >> oracle.log 2>&1
$ORACLE_HOME/bin/sqlldr $user/$password@$tns_name control="attributevalue.ctl" >> oracle.log 2>&1
if [ $? -ne 0 ]; then ef=1; fi
cat attributevalue.log >> oracle.log
fi
if [ $ef -ne 1 ]; then
echo " Load simple refset table data ... `/bin/date`" >> oracle.log 2>&1
$ORACLE_HOME/bin/sqlldr $user/$password@$tns_name control="simple.ctl" >> oracle.log 2>&1
if [ $? -ne 0 ]; then ef=1; fi
cat simple.log >> oracle.log
fi
# No more complex maps
# if [ $ef -ne 1 ]; then
# echo " Load complex map table data ... `/bin/date`" >> oracle.log 2>&1
# $ORACLE_HOME/bin/sqlldr $user/$password@$tns_name control="complexmap.ctl" >> oracle.log 2>&1
# if [ $? -ne 0 ]; then ef=1; fi
# cat complexmap.log >> oracle.log
# fi
if [ $ef -ne 1 ]; then
echo " Load extended map table data ... `/bin/date`" >> oracle.log 2>&1
$ORACLE_HOME/bin/sqlldr $user/$password@$tns_name control="extendedmap.ctl" >> oracle.log 2>&1
if [ $? -ne 0 ]; then ef=1; fi
cat extendedmap.log >> oracle.log
fi
if [ $ef -ne 1 ]; then
echo " Load simple map table data ... `/bin/date`" >> oracle.log 2>&1
$ORACLE_HOME/bin/sqlldr $user/$password@$tns_name control="simplemap.ctl" >> oracle.log 2>&1
if [ $? -ne 0 ]; then ef=1; fi
cat simplemap.log >> oracle.log
fi
if [ $ef -ne 1 ]; then
echo " Load language table data ... `/bin/date`" >> oracle.log 2>&1
$ORACLE_HOME/bin/sqlldr $user/$password@$tns_name control="language.ctl" >> oracle.log 2>&1
if [ $? -ne 0 ]; then ef=1; fi
cat language.log >> oracle.log
fi
if [ $ef -ne 1 ]; then
echo " Load refset descriptor table data ... `/bin/date`" >> oracle.log 2>&1
$ORACLE_HOME/bin/sqlldr $user/$password@$tns_name control="refsetdescriptor.ctl" >> oracle.log 2>&1
if [ $? -ne 0 ]; then ef=1; fi
cat refsetdescriptor.log >> oracle.log
fi
if [ $ef -ne 1 ]; then
echo " Load description type table data ... `/bin/date`" >> oracle.log 2>&1
$ORACLE_HOME/bin/sqlldr $user/$password@$tns_name control="descriptiontype.ctl" >> oracle.log 2>&1
if [ $? -ne 0 ]; then ef=1; fi
cat descriptiontype.log >> oracle.log
fi
if [ $ef -ne 1 ]; then
echo " Load module dependency table data ... `/bin/date`" >> oracle.log 2>&1
$ORACLE_HOME/bin/sqlldr $user/$password@$tns_name control="moduledependency.ctl" >> oracle.log 2>&1
if [ $? -ne 0 ]; then ef=1; fi
cat moduledependency.log >> oracle.log
fi
if [ $ef -ne 1 ]; then
echo " Create indexes ... `/bin/date`" >> oracle.log 2>&1
echo "@oracle_indexes.sql"|$ORACLE_HOME/bin/sqlplus $user/$password@$tns_name >> oracle.log 2>&1
if [ $? -ne 0 ]; then ef=1; fi
fi
if [ $ef -ne 1 ]; then
echo " Create views ... `/bin/date`" >> oracle.log 2>&1
echo "@oracle_views.sql"|$ORACLE_HOME/bin/sqlplus $user/$password@$tns_name >> oracle.log 2>&1
if [ $? -ne 0 ]; then ef=1; fi
fi
echo "----------------------------------------" >> oracle.log 2>&1
if [ $ef -eq 1 ]
then
echo "There were one or more errors." >> oracle.log 2>&1
retval=-1
else
echo "Completed without errors." >> oracle.log 2>&1
retval=0
fi
echo "Finished ... `/bin/date`" >> oracle.log 2>&1
echo "----------------------------------------" >> oracle.log 2>&1
exit $retval
|
Talk:Just Dance 2016/@comment-25102147-20151101103412/@comment-5392675-20151101114117
With all the hype surrounding Focus, I'd expected it to be a better song.
|
Linq : check for null value before accessing the property
Please advice regarding the error.
This is the code
void Main()
{
var a = from id in TechnicalProducts
where id.Id == "ID-4591"
select new {
Country = id.Computers.Select (x => new {x.Location.ParentLocation.ParentLocation.ParentLocation.ParentLocation.Code}),
};
Console.WriteLine(a);
}
Error: An entry returned by the navigation property 'Code' is null and cannot be initialized. You should check for a null value before accessing this property
you can try this :
somevar = x.Location.ParentLocation.ParentLocation.ParentLocation.ParentLocation.Code ?? 0
EDIT :
your code may look something like this:
var a = from id in TechnicalProducts
where id.Id == "ID-4591"
select new {
Country = id.Computers.Select (
x => new{
x.Location.ParentLocation.ParentLocation.ParentLocation.ParentLocation.Code ?? 0
}
)};
but where would i add this line?
You could add a null check in your query:
WHERE x.Location.ParentLocation.ParentLocation.ParentLocation.ParentLocation.Code != null
Otherwise use the coalesce operator as @Behnam has suggested. This operator just returns the first non-null value in the chain.
as an additional condition in your where statement
so the stmt looks like this. right? where id.Id == "ID-14591" && x.Location.ParentLocation.ParentLocation.ParentLocation.ParentLocation.Code != null But then it gives a new error. "The name 'x' does not exist in the current context"
|
Oracle JDBC error when connecting Oracle with ServerName mode
Please answer these questions before submitting your issue.
Why do you submit this issue?
[x] Bug
Bug
Which version of SkyWalking, OS and JRE?
6.6.0
windows 10
java8
What happen?
当jdbc url为全小写时会出现URLParse解析失败的情况。
比如: jdbc:oracle:thin:@(description=(address=(host=x.x.x.x)(protocol=tcp)(port=1521))(load_balance=yes)(failover=on)(connect_data=(service_name=orcl)))
Requirement or improvement
Please describe about your requirements or improvement suggestions.
Oracle plugin doesn't belong to the Apache, It is a 3rf party plugin only.
但是问题是出现在jdbc-commons下
Again English only, if you want to add some parser logic, feel free to submit the pull request.
|
Remove success flash when updating brief response
https://trello.com/c/FGm8bi13/3-2-suppliers-may-be-missing-out-on-opportunities-due-to-misleading-banner
We believe that this success flash message is misleading some suppliers. We have some evidence to suggest that they think the flash message means that they've successfully submitted their brief response. This means that they don't press the button to submit their application.
Our evidence here is not definitive - we've got a pattern of support requests, but we've not done any user research or proper analysis.
We don't need this flash, however. Users can see on the page that their information has been updated.
For this reason, we're just going to go ahead and remove the flash. We'll check back in a few weeks to see what effect it's had on the rate of submitted brief responses and support requests.
This screenshot shows the green flash message that this PR removes:
I've checked, and can't find any functional tests that test for the presence of the flash message.
|
Doug E. Doug
Early life
Douglas Bourne was born in Brooklyn, New York to a Jamaican father and African-American mother.[1]
Career
Professional career
In theater, Doug starred in the musical Purlie. It ran from March 31 through April 3, 2005.[5]
He stars in the 2015 movie An Act of War.
Filmography
Film
Year
Film
Role
Notes
Television
Year
Title
Role
Notes
Award nominations
Year
Award
Result
Category
Film or series
|
Strip accumulator
ABSTRACT
A strip accumulator comprises a group of fixed rollers and a group of vertically movable rollers, the fixed and movable rollers being arranged in tiers with the same number of fixed tiers as movable tiers, and a number of return rollers equal to one less than the number of tiers, the strip passes over the rollers of one fixed tier and one movable tier, passing from a roller of one tier to a roller of the other tier, then over a return roller to the next pair of fixed and movable tiers.
United States Patent Gay [ 51 Sept. 26, 1972 [54] STRIP ACCUMULATOR [72]Inventor: Pierre Gay, La Tour-Enjarez, Loire,
France [22] Filed: April 21, 1971 [21] Appl. No.: 135,921
Primary Examiner-Richard A. Schacher Assistant Examiner-Gene A. ChurchAtt0rneyCameron, Ker kam & Sutton [57] ABSTRACT A strip accumulatorcomprises a group of fixed rollers and a group of vertically movable rollers, the fixed and movable rollers being arranged in tiers with thesame number of fixed tiers as movable tiers, and a number of return rollers equal to one less than the number of tiers, the strip passes over the rollers of one fixed tier and one movable tier, passing from a roller of one tier to a roller of the other tier, then over a return roller to the next pair of fixed and movable tiers.
3 Claims, 4 Drawing Figures 4r l H PATENTEU EP I 3 693, 860
sum 1 OF 4 1 PRIOR ART PATENTEDSEP26 I912 3.693.860
sumeura v A A PATENT l-instrzsmrz 3 93 50 SHEET u or 4 STRIP ACCUMULATORThis invention relates to a strip accumulator.
In the various stages in the production of metal strips, a continuous operation preceded or followed by an intermittent operation is frequently carried out on the same production line.
To this end, strip accumulators adapted to store a certain strip length are interposed in the production line.
The object of this invention is considerably to increase the strip length capable of being stored in an accumulator, for one and the sameaccumulator size. To this end, the invention provides a stripaccumulator, more particularly for metal strip, comprising two units each consisting of a plurality of rollers in groups, one of the units being fixed in position, and the other unit being movable, wherein each of the units comprises a plurality of tiers of rollers at different levels, the number of tiers being the same for both units, and the fixed unit comprises return rollers in a number equal to one less than thenumber of tiers of each of the units,
whereby a strip passes over all the rollers of the one tier of each unit, passing each time from one roller of one unit to one roller of theother unit and then passes over a return roller before passing over allthe rollers of the next tier of each unit.
It will be apparent that the multiplication and appropriate arrangement of the rollers of these two units results in a very much extended development of the length of the strip stored in the accumulatoraccording to the invention, for one and the same accumulator size.
In order that the invention may be more readily understood, a known typeof strip accumulator will be described hereinafter, followed by two embodiments of an accumulator according to the invention, which embodiments are given by way of example only, with reference to the accompanying drawings, in which:
FIG. 1 is a vertical section through a strip accumulator of known type,
FIGS. 2 and 3 are vertical sections through two different embodiments ofaccumulators according to the invention, the frame of the movable rollers being in its lower position, and
FIG. 4 is a vertical section through the embodiment of FIG. 2 but withthe movable roller frame in its upper position.
In the known type of accumulator shown in FIG. 1, the strip 1 passessuccessively over rollers 2 and 3. The axes of the rollers 2 are fixed.The axes of rollers 3 are movable, the rollers 3 being mounted on a frame 4 which is vertically movable.
In the known accumulator shown in FIG. 1, if the frame 4 movesdownwardly, the length stored in the accumulator increases, while it decreases if the frame 4 moves upwardly.
The accumulators according to the invention enable the strip storage capacity to be increased considerably for the same size of accumulator.
An embodiment of an accumulator according to the invention comprises groups of fixed-position rollers 12 (corresponding to the rollers 2 inthe known accumulator) and groups of rollers 13 mounted on a frame 14adapted to move vertically (corresponding to the rollers 3 in the knownaccumulator).
Reversing rollers 15 at the ends of the accumulator enable the strip 11to be given the correct path (return to the interior of the accumulatoror exit therefrom).
FIG. 2 shows one embodiment of the invention wherein the rollers 12 and13 are in groups of three. In
this case (as is generally the case for groups of odd number), the strip exit is on the opposite side of the accumulator to the strip entry.
FIG. 3 shows a second embodiment of the invention wherein the rollers 12and 13' are in groups of four. In this case the entry and exit of the strip are on the same side of the accumulator (this applies whenever there is' an even number of rollers in a group).
Finally, FIG. 4 shows the accumulator of FIG. 2 with the frame 14 in its upper position, showing the facility of introduction of the strip 11into the accumulator in this position of the frame 14, suchfacilitybeing an additional advantage of these accumulators.
Of course variants and improvements as to detail are possible as is the use of equivalent means without departing from the spirit and scope ofthe invention.
What is claimed is:
l. A strip accumulator, more particularly for metal strip, comprising two units each consisting of a plurality of rollers in groups, one ofthe units being fixed in position, and the other unit being movable,wherein each of the units comprises a plurality of tiers of rollers at different levels, the number of tiers being the same for both units, andthe fixed unit comprises return rollers in a number equal to one lessthan the number of tiers of each of the units, whereby a strip passes over all the rollers of the one tier of each unit, passing each time from one roller of one unit to one roller of the other unit and then passes over a return roller before passing over all the rollers of the next tier of each unit.
2 A strip accumulator according to claim 1, wherein the number of tiers of each of the units is odd, the number of return rollers being even,whereby the strip enters the accumulator at one side thereof and leave son the other side.
3. A strip accumulator according to claim 1, wherein the number of tiers of each of the units is even, the number of return rollers being odd,whereby the strip enters the accumulator on one side thereof and leave son the same side.
UNITED STATES PATENT OFFICE I CERTIFICATE OF CORRECTION Patent No.3,693,860 Dated September 26, 1972 Inventor (5) Pierre Gay It is certified that error appears in the above-identified patent and that said Letters Patent are hereby corrected as shown below:
[73] Assignee: Creusot-Loire Enterprises, Paris, France, is omitted,[30] Foreign Applica tim Priority Data France PV 70,19143, filed May 26,l970,ie omitted.
Signed and sealed this 13th day of March 1973.
(SEAL) Attest:
EDWARD M.FLETCHER,JR. ROBERT GOTTSCHALK Attesting Officer Commissioner of Patents
1. A strip accumulator, more particularly for metal strip, comprising two units each consisting of a plurality of rollers in groups, one of the units being fixed in position, and the other unit being movable, wherein each of the units comprises a plurality of tiers of rollers at different levels, the number of tiers being the same for both units, and the fixed unit comprises return rollers in a number equal to one less than the number of tiers of each of the units, whereby a strip passes over all the rollers of the one tier of each unit, passing each time from one roller of one unit to one roller of the other unit and then passes over a return roller before passing over all the rollers of the next tier of each unit. 2 A strip accumulator according to claim 1, wherein the number of tiers of each of the units is odd, the number of return rollers being even, whereby the strip enters the accumulator at one side thereof and leaves on the other side.
3. A strip accumulator according to claim 1, wherein the number of tiers of each of the units is even, the number of return rollers being odd, whereby the strip enters the accumulator on one side thereof and leaves on the same side.
|
What program can i use to create something similar to these charts
I'm using matlab and never see something similar, i saw this in a recent paper and wondering what software is used
Or Mathematica.
|
Board Thread:General Discussion/@comment-35329880-20200523072832/@comment-36145153-20200605185846
Nopenop33 wrote: That's nice. (I feel as if I'm being ignored...) Why do you feel like that?
|
//Jack Daniel Kinne. Project 4. Mobile Apps CS 480.
//'LabelDetection.java' uses code adapted from Google.
//API call was adapted from Sam Alston and Jared Conn.
package com.kinne.jack.jkp3v2;
import android.Manifest;
import android.content.Intent;
import android.content.pm.PackageManager;
import android.graphics.Bitmap;
import android.graphics.Canvas;
import android.graphics.drawable.BitmapDrawable;
import android.graphics.drawable.Drawable;
import android.os.Bundle;
import android.os.Handler;
import android.os.HandlerThread;
import android.provider.MediaStore;
import android.support.annotation.NonNull;
import android.support.v4.app.ActivityCompat;
import android.support.v7.app.AppCompatActivity;
import android.util.Log;
import android.view.View;
import android.widget.Button;
import android.widget.ImageView;
import android.widget.ProgressBar;
import android.widget.Toast;
import java.io.ByteArrayOutputStream;
import java.io.IOException;
import java.util.ArrayList;
import java.util.Collections;
import java.util.Comparator;
import java.util.List;
import java.util.Map;
public class MainActivity extends AppCompatActivity
implements ActivityCompat.OnRequestPermissionsResultCallback{
//button for taking pictures
Button btnpic;
//button for google vision
Button btndetect;
//image we will be messing with
ImageView imgTakenPic;
Bitmap bitmap;
//camera and permissions
private static final int CAM_REQUEST=1313;
private static final int PERMISSION_REQUEST_CAMERA = 0;
//running a thread
private Handler mCloudHandler;
private HandlerThread mCloudThread;
//tag and progressbar
private static final String TAG = MainActivity.class.getSimpleName();
private ProgressBar progressBar;
@Override
protected void onCreate(Bundle savedInstanceState) {
super.onCreate(savedInstanceState);
setContentView(R.layout.activity_main);
//taking a picture: button and event
btnpic = (Button) findViewById(R.id.takePhotoButton);
imgTakenPic = (ImageView)findViewById(R.id.imageView);
btnpic.setOnClickListener(new btnTakePhotoClicker());
//button to make a request of google vision
btndetect = (Button) findViewById(R.id.button_detect);
btndetect.setOnClickListener(new btnMakeRequest());
//progress bar: default is not visible
progressBar = (ProgressBar) findViewById(R.id.progressBar);
progressBar.setVisibility(View.GONE);
//thread and handler
mCloudThread = new HandlerThread("CloudThread");
mCloudThread.start();
mCloudHandler = new Handler(mCloudThread.getLooper());
}
//convert a drawable resource to a bitmap -- for default image reasons.
public static Bitmap drawableToBitmap(Drawable drawable) {
if (drawable instanceof BitmapDrawable) {
return ((BitmapDrawable) drawable).getBitmap();
}
// We ask for the bounds if they have been set
final int width = !drawable.getBounds().isEmpty() ?
drawable.getBounds().width() : drawable.getIntrinsicWidth();
final int height = !drawable.getBounds().isEmpty() ?
drawable.getBounds().height() : drawable.getIntrinsicHeight();
// Now we check it is > 0
final Bitmap bitmaps = Bitmap.createBitmap(width <= 0 ? 1 : width, height <= 0 ? 1 : height,
Bitmap.Config.ARGB_8888);
Canvas canvas = new Canvas(bitmaps);
drawable.setBounds(0, 0, canvas.getWidth(), canvas.getHeight());
drawable.draw(canvas);
return bitmaps;
}
//when camera has taken a picture.
@Override
protected void onActivityResult(int requestCode, int resultCode, Intent data) {
super.onActivityResult(requestCode, resultCode, data);
if (requestCode == CAM_REQUEST) {
// Get Extra from the intent
Bundle extras = data.getExtras();
// Get the returned image from extra
Bitmap bmp = (Bitmap) extras.get("data");
// set image
imgTakenPic.setImageBitmap(bmp);
bitmap = bmp;
//check for failure of camera
if (bmp == null){
Toast.makeText(getApplicationContext(), "camera crashed! oh no!", Toast.LENGTH_LONG).show();
}
}
}
//set up our button to take a photo
class btnTakePhotoClicker implements Button.OnClickListener{
@Override
public void onClick(View view) {
//I WILL TRY.....
try {
showCameraPreview();
}
//...TO CATCH YOU..
catch (Exception e){
//add error message maybe.
}
}
}
//handle a request for camera permission
@Override
public void onRequestPermissionsResult(int requestCode, @NonNull String[] permissions,
@NonNull int[] grantResults) {
if (requestCode == PERMISSION_REQUEST_CAMERA) {
// Request for camera permission.
if (grantResults.length == 1 && grantResults[0] == PackageManager.PERMISSION_GRANTED) {
// Permission has been granted. Start camera preview Activity.
startCamera();
} else {
// Permission request was denied.
Toast.makeText(getApplicationContext(), "permission for camera was denied.", Toast.LENGTH_LONG).show();
}
}
}
//before we launch the camera, lets make sure we have permission.
private void showCameraPreview() {
// Check if the Camera permission has been granted
if (ActivityCompat.checkSelfPermission(this, Manifest.permission.CAMERA)
== PackageManager.PERMISSION_GRANTED) {
// Permission is already available, start camera preview
startCamera();
}
else {
// Permission is missing and must be requested.
requestCameraPermission();
}
}
//Permission request
private void requestCameraPermission() {
// if permission not granted, show error.
if (ActivityCompat.shouldShowRequestPermissionRationale(this, Manifest.permission.CAMERA)) {
Toast.makeText(getApplicationContext(), "permission not granted for camera!", Toast.LENGTH_LONG).show();
}
else {
// Request the permission. Result received in onRequestPermissionResult().
ActivityCompat.requestPermissions(this,
new String[]{Manifest.permission.CAMERA}, PERMISSION_REQUEST_CAMERA);
}
}
//start the camera!
private void startCamera() {
final Intent intent = new Intent(MediaStore.ACTION_IMAGE_CAPTURE);
startActivityForResult(intent, CAM_REQUEST);
}
//make request to Google for label detection: call LabelDetection.annotateImage
class btnMakeRequest implements Button.OnClickListener{
@Override
public void onClick(View view) {
if(bitmap!=null){
ByteArrayOutputStream stream = new ByteArrayOutputStream();
bitmap.compress(Bitmap.CompressFormat.PNG, 100, stream);
final byte[] photoData = stream.toByteArray();
mCloudHandler.post(new Runnable() {
@Override
public void run() {
Log.d(TAG, "sending image to cloud vision");
// annotate image by uploading to Cloud Vision API
try {
Map<String, Float> annotations = LabelDetection.annotateImage(photoData);
Log.d(TAG, "cloud vision annotations:" + annotations);
if (annotations != null) {
//breaking here, because we are attempting to print to the ui from a thread!
printMap(annotations);
}
} catch (IOException e) {
Log.e(TAG, "Cloud Vison API error: ", e);
}
}
});
//show the progressbar!
progressBar.setVisibility(View.VISIBLE);
} else {
Toast.makeText(getApplicationContext(), "didn't select an image to annotate!", Toast.LENGTH_LONG).show();
}
}
}
//toast results of Google Vision
public void printMap(Map<String, Float> mp) {
//running on the UI thread <!!>
runOnUiThread(new Runnable() {
@Override
public void run() {
//vanish the progress bar. Poof!
progressBar.setVisibility(View.GONE);
}
});
//sort the list, highest to lowest.
List<Map.Entry<String,Float>> entries = new ArrayList<Map.Entry<String,Float>>(
mp.entrySet()
);
Collections.sort(
entries,
new Comparator<Map.Entry<String,Float>>() {
public int compare(Map.Entry<String,Float> a, Map.Entry<String,Float> b) {
return Float.compare(b.getValue(), a.getValue());
}
}
);
//arrays to hold the google api results
String labels[] = new String[ entries.size() ];
float percentage[] = new float[ entries.size() ];
// print the entries from google.
int iterator = 0;
for (Map.Entry<String,Float> pair : entries) {
//display for testing
//Toast.makeText(getApplicationContext(),pair.getKey() + " " + pair.getValue() + "% certain",Toast.LENGTH_SHORT).show();
//populate the arrays with label and percentage accuracy
labels[iterator] = pair.getKey();
percentage[iterator] = pair.getValue();
iterator++;
}
//new intent to pass to the ListResults Activity
Intent ListResultsIntent = new Intent(getApplicationContext(),ListResults.class);
//save and pass the labels, percentage, and picture.
ListResultsIntent.putExtra("labels", labels);
ListResultsIntent.putExtra("percentage",percentage);
ListResultsIntent.putExtra("picture", bitmap);
//start new activity in ListResults.java
startActivity(ListResultsIntent);
}
//cleanup threads
@Override
protected void onDestroy() {
super.onDestroy();
mCloudThread.quit();
}
}
|
Build failures due to ArrayBuffer.isView renaming
We're getting build failures that look like they are due to overzealous property renaming within the pbf lib (see https://github.com/openlayers/ol3/pull/5815#issuecomment-243933337 and https://github.com/openlayers/ol3/pull/5794#issuecomment-243938518).
It looks like this function
function Pbf(buf) {
this.buf = ArrayBuffer.isView(buf) ? buf : new Uint8Array(buf || 0);
this.pos = 0;
this.length = this.buf.length;
}
is getting compiled to this (with whitespace added):
function f(a) {
this.ac = ArrayBuffer.b(a) ? a : new Uint8Array(a || 0);
this.da = 0;
this.length = this.ac.length
}
So the isView property of ArrayBuffer is getting renamed to b.
Wondering if the Compiler lost some knowledge about ArrayBuffer with #5793.
ArrayBuffer.isView is not present in the closure-compiler externs
https://github.com/google/closure-compiler/pull/1991
|
Sending a string in C++ MPI
TL;DR I believe I am incorrectly transmitting a string with MPI_Send. What is the best way to send a string?
I'm trying to send a string from the master to the slave processes but I believe it's not sending the entire string or not reconstructi9ng it properly at the slave end.
Master MPI_Send code:
MPI_Send(&parent, sizeof(char) * selection::target_length(), MPI_BYTE, i, MSEND, MPI_COMM_WORLD);
Slave MPI_Recv Code:
char parentChars [selection::target_length()];
MPI_Recv(&parentChars, sizeof(char) * selection::target_length(), MPI_BYTE, 0, MSEND, MPI_COMM_WORLD, &status);
parent = parentChars;
The assertion assert(target.length() == candidate.length()); fails and gives the following results:
weasel: weaselparallel.cpp:34: static int selection::fitness(std::string): Assertion `target.length() == candidate.length()' failed.
↑ This is output for each slave process
And then there's the segmentation fault that I assume occurs because of the incorrectly transmitted string:
mpiexec noticed that process rank 2 with PID 23531 on node node02.emperor exited on signal 11 (Segmentation fault).
6 total processes killed (some possibly by mpiexec during cleanup)
sizeof(char) is 1.
Can you show the definition of parent?
It looks here like you're mixing C and C++, too. parentChars looks like a C VLA, but you have :: operators in there. Which is it, C or C++?
You should know that this isn't pure C++ code, variable length arrays (i.e. your parentChars array) is not part of C++, though some compilers allow it as an extension. You should not use it if you want your code to be portable.
The :: operator is for accessing a public class used as a handler. I know the code is pretty horrible but it's the skeleton code I was given and have to use. I've done the rest but just need to get the send right. parent is just declared as a string ie: string parent; and parentChars is declared like this: char parentChars [selection::target_length()];. Portability isn't an issue. Thanks for your feedback so far.
Check definition of MPI_Send and MPI_Recv, I think something is wrong
with your first argument.
Try omitting the ampersand symbol( & ) of parent and/or parentChars depends on your definition
also check the status( speifically, MPI_ERROR ) return from MPI_Recv for more information on what is happening
|
Talk:Family<EMAIL_ADDRESS>
if a member heals and stays alive for a limit of time, the safehouse will regain some health
attacking the safehouse will give you a better score for a better chance to gain a stronger loot
|
War? Crisis? What does it mean?
The More Major Ones
These are the ones that are most commonly referred to on the wiki.
Argument (Common)
Crisis (Pretty Rare)
War (very Rare)
The More Minor Ones.
These are the less referred to conflicts on the wiki, but can still be common.
Exaggeration (Pretty Common)
Misunderstanding (Somewhat Common)
Flaming (Somewhat Common)
|
Help:DynamicPageList
Fandom is using DynamicPageList3. You can find the full manual here.
Benefits of DPL
* Can display data in tables, bulleted or numbered lists, in category page style, or inline.
* Allows creation of lists with custom styles and formatting inserted in-between items.
An example page can be found in Help:Index.
How to include DPL on a page
Here is a very basic DPL query example:
category = Characters
This query above will output a list of all the pages that are in the category Characters.
This can be further customized:
Using DPL effectively
allowcachedresults = true
Use other tools for common DPL uses
* Creating simple category lists
* For creating simple category lists you might use the [[Help:CategoryTree|
* Random content
* Use RandomSelection.
* Lists of users
* Use Special:Listusers for this.
* Wiki-style forums
* Advanced uses
Things to avoid
Please avoid overusing:
* Functions using "randomcount"; they can't be cached
* Templates that are used site-wide; it creates hidden DPL calls all over the wiki
* Large queries; don't display 500 results when 20 will do the job
* More than one or two queries per page
Sometimes you need to purge
Galleries
DPL can be used to make self maintaining galleries:
Pending work
DPL can be used to make lists of things that need to be edited:
category = Stubs format = ,#%PAGE%\n,, allowcachedresults = true
DPL can be used to make a list of images that need to be categorized:
More about DPL
* The DPL 3 Manual on Fandom
* FAQ on converting legacy DPL functions to UCP
* The Manual for the version used by Fandom before UCP
* The archived DPL Manual
Further help and feedback
|
Babesia vaccines
ABSTRACT
The invention relates to Babesia proteins of a 28kDa protein family and to immunogenic fragments of such proteins, to nucleic acids encoding such proteins or fragments, to cDNA fragments, recombinant DNA molecules, live recombinant carriers, or host cells comprising such nucleic acids, to vaccines, to methods for the preparation of such vaccines, to the use of such proteins or fragments for the prophylactic or therapeutic treatment of an infection or its clinical signs caused by an organism of the family Babesiidae, and to diagnostic tests for detection of nucleic acids, antibodies or antigens of an organism of the family Babesiidae.
The invention relates to Babesia proteins of a 28 kDa protein family and to immunogenic fragments thereof, to nucleic acids encoding such proteins, to cDNA fragments, recombinant DNA molecules, live recombinant carriers, and host cells, to vaccines, to methods for the preparation of such vaccines, to the use of such proteins or fragments, and to diagnostic tests.
Babesiosis, like malaria, is a disease, which has a geographically focal occurrence. The reason for this is that the pathogen is transmitted by ticks that feed on a certain reservoir of parasites present in a vertebrate population. Only where ticks are present, Babesiosis can occur. On balance, particularly in indigenous animals, the parasite coexists with the host without causing significant disease. In many cases Babesiosis becomes a problem because of man's activities through inbreeding of genetic traits and/or transporting animals to unfamiliar environments where Babesiosis is endemic (Callow, L. L. and Dalgliesh, R. J., 1982, in: “Immunology of Parasitic Infections”, Cohen, S. and Warren, K. S. eds., p. 475-526, Blackwell Scientific).
Babesiosis also holds a threat as zoonotic agent, not only to immunocompromised humans (Gray et al., 2002, Int. J. Med. Microbiol., vol. 291, p. 108-111).
Signs of disease in naturally acquired Babesiosis usually begin 7-21 days after infection. These symptoms include: fever, anorexia, depression, anaemia, haemoglobinuria and rapidly developing weakness. Increased lacrimation, salivation and muscle tremor commonly occur. Nervous signs may develop in terminal infections, and death may occur when the disease is left untreated. Coagulation disturbances lead to increased erythrocyte-stickiness. Thrombosis is not common, but small hyaline thrombi, connected with megakaryocytes have been described. As a result the blood passage through the microvasculature is hampered, resulting in congestion of internal organs and decreased packed cell volumes (PCV). This might impair the oxygen supply to certain tissues and subsequently lead to tissue damage as a result of anoxia.
Species from the Babesiidae have now been detected to infect most mammalian species of veterinary importance (Kuttler, K. L., in M. Ristic ed.: “Babesiosis of domestic animals and man”. CRC Press, Inc., Boca Raton, Fla., 1988): Cow (B. divergens, B. bovis, B. bigemina), Swine (B. trautmanni, B. perroncitoi), Sheep (B. ovis, B. mot asi), Horse (B. equi, B. caballi), Dog (B. canis, B. rossi, B. vogel i), and Cat (B. felis, B. cati). In all these species death or more or less severe economical losses (reduction in quality or quantity of meat, milk, wool, or offspring), or severe reduction in well being are caused either as a result of the Babesia infection directly, or through facilitation of secondary infections.
Medications exist to cure an established Babesia infection, for instance dogs can be treated with imidocarb dipropionate (commercially available as Carbesia®) (Brandao et al., 2003, Vet. Paras. vol. 114, p. 253-265). However such an injection is painful due to tissue irritation. Further it suffers the common drawbacks of such anti-parasitics: the prevention of a build up of immunological memory, potential toxicity, and build up of resistance.
It has been shown that Babesiosis can be controlled by vaccination with live vaccines (Pip ano, 1995, Vet. Paras., vol. 57, p. 213-231). Such vaccines are produced by harvesting erythrocytes from infected animals. For some but not all Babesia species in vitro erythrocyte cultures have been developed, to increase the number of parasites. The infected erythrocytes from the animal or the cultures are then used to vaccinate animals.
General disadvantages of such live parasitic vaccines are that the inoculation material is largely uncontrolled, highly variable in its composition, biologically unsafe, and on the whole the process is unethical through the use of a large number of experimental animals. Additionally, Babesia parasites are very unstable; as they are strictly anaerobic, they must be kept away from oxygen or will die quickly.
Alternatively, not the parasite-infected erythrocytes themselves are used for vaccination, but the surrounding serum, or culture supernatant. Such surrounding liquids of infected erythrocytes contain so-called Soluble Parasite Antigens (SPA). Little is known about the composition of these preparations. It has been suggested that the protective activity is due to the immunising capacity of antigens of the merozoite surface coat in the serum or medium, a structure that is left behind during the process of invasion of the erythrocyte (Ristic, M. and Montenegro-James, S., 1988, in: “Babesiosis of Domestic Animals and Man”, Ristic, M. ed., p. 163-190, CRC Press). In addition, during in vitro culture a number of parasites die, thereby (internal) parasitic antigens are released into the culture medium.
Such SPA preparations are capable of inducing an immune response that, although not necessarily affecting the parasite, sufficiently reduces the clinical manifestations of infection (Schetters and Montenegro-James, S., 1995, Parasitology today, vol. 11, p. 456-462). For instance SPA from culture supernatant of an in vitro culture of Babesia canis parasite-infected erythrocytes induces protective immunity against homologous challenge infection.
An SPA vaccine for Babesia canis is available commercially as Pirodog®, and is prepared from the supernatant of a culture of a strain of Babesia canis (described in U.S. Pat. No. 4,777,036). However, such a vaccine gives in general little protection against infections with (wild type) B. canis (Le petit, C., 1988, “Piroplasmose canine et vaccination Pirodog”, Doctoral Thesis, Univ. of Nantes, France).
In general, SPA based vaccines bear the same disadvantages as the live parasitic vaccines do, in that they are largely un characterised, highly variable and require many precautions to be biologically safe. Additionally the production of such vaccines is very difficult to scale up, as that requires the infection, housing and harvesting of experimental animals to provide parasites, erythrocytes, and/or serum.
It is an object of the invention to provide proteins or fragments thereof that can serve as effective subunit vaccines for infection with Babesiidae, that are well defined, safe, stable, with easily scaleable production.
It was surprisingly found now that a subunit vaccine comprising a member of a novel Babesia protein family; the 28 kDa protein family, as well as immunogenic fragments thereof incorporate all these advantageous characteristics.
Many disadvantages of live parasite- and SPA vaccines can now be overcome by the use of a member of this novel protein family or of immunogenic fragments thereof in protein subunit vaccines produced in an expression system; such a protein is highly defined, biologically safe, the product can be stabilized much better than whole live parasites, and its production can be easily scaled up
Proteins of the novel 28 kDa protein family are characterised in that they all share a specific amino acid sequence that is very well conserved amongst the various members of said family.
In spite of the presence of this well-conserved amino acid sequence, the overall length of the proteins of the 28 kDa protein family may well be different in the various members of the family of Babesiidae. Examples of members of the 28 kDa protein family are found to have a length ranging from below 26 kDa up to over 40 kDa.
Members of the 28 kDa protein family however all comprise a stretch of amino acids that has a level of homology of at least 70% to the amino acid sequence from amino acid position 17 to position 180 in SEQ ID NO 2.
Merely as examples, in French Babesia canis isolate A, members of the 28 kDa family according to the invention, and further referred to as Bc28.1 or Bc28.2, were found to have the amino acid sequence as depicted in SEQ ID NO: 2 or 4 respectively.
The proteins of the 28 kDa protein family are expressed from their respective encoding sequences that are members of a 28 kDa multigene family from Babesiidae, and have a high level of sequence identity at the nucleic acid level.
The proteins of the 28 kDa protein family can be detected in infected erythrocytes by specific antisera. These sera recognize these specific proteins of the parasite also in Western blotting and immunoprecipitation experiments. Both proteins can be expressed in an expression system. Proteins or their fragments, expressed in this way can be used to formulate a subunit vaccine, which protects mammalian s from (signs of) disease upon infection with species of Babesiidae.
The Bc28.1 protein exists in two forms; a free 26 kDa SPA form, which is present in Babesia infected erythrocytes and in their surrounding liquid; as well as a 28 kDa bound protein form that has a GPI anchor, and is associated with the membrane of the Babesia merozoite and with the outer membrane of the infected erythrocyte.
Because Babesiidae parasites spend most of their live hidden inside the erythrocytes, therefore an immune-response is most effective when focussed on antigens that can be ‘seen’ by the immune system. The 28 kDa form of Bc28.1 is such an antigen that is presented to the exterior, which allows an immune attack specifically directed to the infected erythrocyte. The 28 kDa form of the Bc28.1 protein binds to erythrocytes. This is indicative of a role in the agglutination of erythrocytes. As this process is a major cause of pathology and the way parasites infect new erythrocytes, interference at that level also provides effective immune intervention in disease progression.
Therefore, one aspect of the invention relates to a Babesia protein, characterised in that said protein comprises an amino acid sequence having a homology of at least 70% with the amino acid sequence from amino acid position 17 to position 180 in SEQ ID NO 2, or an immunogenic fragment of said protein.
In a preferred embodiment, the Babesia protein according to the invention is characterised in that said protein comprises an amino acid sequence having a homology of at least 70% with the amino acid sequence in SEQ ID NO 2, or an immunogenic fragment of said protein.
In another preferred embodiment, the Babesia protein according to the invention is characterised in that said protein comprises an amino acid sequence having a homology of at least 70% with the amino acid sequence in SEQ ID NO 4, or an immunogenic fragment of said protein.
In a more preferred embodiment, the Babesia protein according to the invention is characterised in that it is Bc28.1 protein, preferably in the 26 kDa or in the 28 kDa form.
In an another more preferred embodiment, the Babesia protein according to the invention is characterised in that it is Bc28.2 protein.
The term “protein” is meant to incorporate a molecular chain of amino acids. A protein is not of a specific length and can, if required, be modified in vivo or in vitro, by, e.g. glycosylation, amid ation, carboxylation or phosphorylation. Inter alia, peptides, oligopeptides and polypeptides are included within the definition. A protein or peptide can be of biologic and/or synthetic origin.
A “Babesia protein” according to the invention is a protein which has a counterpart in an organism of the family Babesiidae.
Preferably the organism of the family Babesiidae is an organism selected from the group consisting of the species Babesia divergens, B. bovis, B. mot asi, B. caballi, B. equi, B. canis, B. rossi, B. vogel i, B. felis, B. cati, B. ovis, B. trautmanni, B. bigemina, B. micro ti, and B. gibson i.
More preferably the organism of the family Babesiidae is selected from the group consisting of the species Babesia canis, B. rossi, B. caballi, B. equi, B. bovis, and B. bigemina.
An “immunogenic fragment” is understood to be a fragment of a protein of the 28 kDa protein family that still has the capability to induce antibodies directed against such 28 kDa Babesia proteins.
Preferably an immunogenic fragment of a protein of the 28 kDa protein family according to the invention comprises at least 8 amino acids taken from the amino acid sequence of SEQ ID NO 2 or 4. More preferably such a fragment comprises 11, 15, 20, 30, 40, 50, 100, 150, or 200 amino acids taken from the amino acid sequence of SEQ ID NO 2 or 4, in that order of preference.
Preferably, an immunogenic fragment of a protein of the 28 kDa protein family according to the invention contains an epitope of such a protein. For instance an immunogenic fragment of a protein of the 28 kDa protein family according to the invention is formed by a part of the protein that lacks the N-terminal signal sequence and/or the C-terminal GPI anchor sequence. Other fragments are for Instance those comprising a specific epitope from a protein of the 28 kDa protein family. Such epitopes may be determined by the methods outlined below. All these immunogenic fragments are embodied in the invention.
An epitope is understood to be that part of an antigenic molecule to which a T-cell receptor will respond, or to which B-cells will produce antibodies. An epitope according to the invention will therefore induce specific T-cells or activate B-cells to produce specific antibodies such that these cells or antibodies give rise to an immune reaction that interferes with the course of an infection or disease. Thus, through such epitopes, an immune response can be generated.
In order to be antigenic, an amino acid fragments need to be of a certain length. Therefore an epitope consists of at least 8-11 amino acids for MHC I receptor binding, or of at least 11-15 amino acids for MHC II receptor binding (reviewed e.g. by R. N. Germain & D. H. Margulies, 1993, Annu. Rev. Immunol., vol. 11, p. 403-450, in: “The biochemistry and cell biology of antigen processing and presentation”). Amino acid fragments shorter than this may not be antigenic as such: they need to be coupled to a carrier, such as KLH, BSA or the like, using techniques known in the art. When coupled such short fragments may well be able to induce an immune response that is within the object of the invention.
Identification of immunogenic fragments or epitopes of a protein of the 28 kDa protein family according to the invention, can be easily performed by a variety of straightforward techniques, for instance by the so-called PEPSCAN method, or via computer algorithms that make comparisons to known epitopes.
The PEPSCAN method (WO 84/03564, and WO 86/06487, and H. Geysen et al., Proc. Natl. Acad. Sci. USA, 1984, vol. 81, p. 3998-4002, and J. of Immunol. meth., 1987, vol. 102, p. 259-274), is an easy to perform, quick and well-established method for the detection of immunologic determinants of a protein. It comprises the synthesis of a series of peptide fragments progressively overlapping the protein under study, and subsequent testing of these polypeptides with specific antibodies to the protein. Such antibodies to the proteins according to the invention can be obtained by making polyclonal or monoclonal antibodies, by using techniques well known in the art.
The use of computer algorithms in the designation of specific protein fragments as the immunologically important epitopes on the basis of their sequential and/or structural agreement with epitopes that are known, is also a well known technique. The determination of these regions can be based on a combination of the hydrophilicity criteria according to Hopp and Woods (1981, Proc. Natl. Acad. Sci. USA, vol. 78, p. 3824-3828), and the secondary structure aspects according to Chou and Fasman (1987, Advances in Enzymology, vol. 47, p. 45-148, and U.S. Pat. No. 4,554,101). Immunogenic epitopes can likewise be predicted from the protein's amino acid sequence by computer with the aid of Berzofsky's amphiphilicity criterion (1987, Science, vol. 235, p. 1059-1062 and U.S. patent application Ser. No. NTIS 07/005,885). A condensed overview of the use of these methods is found in Shan Lu (common principles; 1991, Tibtech, vol. 9, p. 238-242), Good et al. (Malaria epitopes; 1987, Science, vol. 235, p. 1059-1062), Lu (review; 1992, Vaccine, vol. 10, p. 3-7), and Berzofsky (HIV-epitopes; 1991, The FASEB Journal, vol. 5, p. 2412-2418).
An illustration of the effectiveness of using these methods was published by H. Margalit et al. (1987, J. of Immunol., vol. 138, p. 2213-2229) who describe success rates of 75% in the prediction of T-cell epitopes using such methods.
The percentage of homology between the proteins according to the invention is determined with the computer program “BLAST 2 SEQUENCES” by selecting sub-program: “BlastP” (T. Tatusova & T. Madden, 1999, FEMS Microbiol. Letters, vol. 174, p. 247-250), that can be found at www.ncbi.nlm.nih.gov/blast/bl2seq/bl2.html. The comparison-matrix that is used is: “blosum62”, with the default parameters: open gap penalty: 11; extension gap penalty: 1, and gap x_dropoff: 50.
This program lists the percentage of amino acids that are identical as “Identities”, and the percentage of amino acids that are homologous as “Positives”
For example, the amino acid sequences of Bc28.1 and Bc28.2 are aligned in FIG. 1. A high percentage of homology exists between the two proteins, especially in the N-terminal 3/4^(rs). The percentage homologies (the percentage of “positives” from the BlastP program) are presented in Table 1.
TABLE 1 Results of BlastP amino acid alignment of Bc28.1 and Bc2B.2 proteins. Percentage Amino acids homology Complete 244 91 N-terminal 180 97 C-terminal 64 73
It will be understood that, for a particular protein of the 28 kDa protein family, natural variations exist between the proteins associated with individual strains or species of Babesiidae. These variations may be demonstrated by (an) amino acid difference(s) in the overall sequence or by deletions, substitutions, insertions, inversions or additions of (an) amino acid(s) in said sequence. Amino acid substitutions, which do not essentially alter biological and immunological activities, have been described, e.g. by Neurath et al., 1979, in: “The Proteins”, Academic Press New York. Amino acid replacements between related amino acids or replacements which have occurred frequently in evolution are, i.a. Ser/Ala, Ser/Gly, Asp/Gly, Asp/Asn, Ile/Val (see Day hof, M. D., 1978, “Atlas of protein sequence and structure”, Nat Biomed. Res. Found., Washington D.C. vol. 5, suppl. 3). Other common amino acid substitutions include Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Thr/Phe, Ala/Pro, Lys/Arg, Leu/Ile, Leu/Val and Ala/Glu. Based on this information, Lipman and Pearson developed a method for rapid and sensitive protein comparison (1985, Science, vol. 227, p. 1435-1441) and determining the functional similarity between homologous proteins. Such amino acid substitutions of the exemplary embodiments of this invention, as well as variations having deletions and/or insertions are within the scope of the invention as long as the resulting proteins retain immune reactivity. Those variations in the amino acid sequence of a certain protein according to the invention that still provide a protein capable of inducing an immunological response against an organism of the family Babesiidae are considered as “not essentially influencing the immunogenicity”, and are an embodiment of the invention.
This explains why proteins of the 28 kDa protein family according to the invention, when isolated from different species, may have homology percentages of 70 or more to the amino acid sequences in SEQ ID NO: 2 or 4, while still representing the same protein with the same immunological characteristics, i.e. the capability of inducing an immunological response against an organism of the family Babesiidae.
Proteins of the 28 kDa protein family according to the invention can be obtained from member species of the Babesiidae family.
However in an even more preferred embodiment, the proteins of the 28 kDa protein family according to the invention or immunogenic fragments thereof are characterised in that they are obtained from B. divergens, B. bovis, B. mot asi, B. caballi, B. equi, B. canis, B. rossi, B. vogel i, B. felis, B. cati, B. ovis, B. trautmanni, B. bigemina, B. micro ti, or B. gibson i.
Still even more preferably the proteins of the 28 kDa protein family according to the invention or immunogenic fragments thereof are characterised in that they are obtained from Babesia canis, B. rossi, B. caballi, B. equi, B. bovis, or B. bigemina.
With respect to the current taxonomic classification, the skilled person will realise this may change over time, as new insights lead to reclassification into new groups or to addition to existing groups. However, as this does not change the protein repertoire of the organism involved, only its classification, such re-classified organisms are considered to be embodied by the invention. For example B. canis and B. rossi were formerly classified as subspecies B. canis canis and B. canis rossi.
Sibinovic K., et al. (1967, J. of Paras., vol. 53, p. 919-923) studied isolated Babesia antigens from serum of horses infected with Babesia equi and B. caballi, and from dogs infected with B. canis. Significant similarities were noted in the biochemical characteristics of the antigens from these species. The Babesia proteins of the 28 kDa protein family according to the invention as obtained from B. canis will therefore also be present in B. equi and B. caballi, and in other species of the Babesiidae family.
In Example II, section 2.2.5. and FIG. 11 the specific recognition of the 26 and 28 kDa forms of Bc28.1 protein from B. canis by an antiserum against B. rossi is disclosed. This illustrates proteins of the 28 kDa protein family present in B. rossi are immunologically related to those in B. canis.
Bc28.1 coding sequences have been obtained from geographically and genetically disparate B. canis field isolates. The deduced amino acids of a few examples of such isolates are aligned in FIG. 2. The percentage homologies (“Positives”) determined by pairwise alignment using the BlastP program are presented in Table 2.
TABLE 2 Percentage homologies of pair-wise BlastP amino acid alignments between the complete Bc28.1 proteins from geographically and genetically disparate B. canis field isolates. Bc28.1 proteins were 255 or 256 amino acids long. Robin A8 B 34.01 A8 100 B 98 98 34.01 97 97 98 Castres 98 98 97 99
Therefore, in the most preferred embodiment the invention relates to a Bc28.1 or a Bc28.2 protein or an immunogenic fragment of said proteins, characterised in that said proteins or immunogenic fragments are obtained from a B. canis isolate selected from the group consisting of A8, B, 34.01, A, Robin, and Castres.
A protein named Bd37, from Babesia divergens has been described before (EP 1050541 A1). At first instance Bd37 may appear to resemble the proteins Bc28.1 and Bc28.2. However, Bd37 and the two Bc28 proteins are totally unrelated:
- - there is no significant sequence similarity between Bd37 protein or its coding sequence, and either of the two Bc28 proteins or their coding sequences. - an antiserum against Bd37 does not recognize the 26/28 and 45 kDa proteins of B. canis that are recognized by antibodies against Bc28.1 and 28.2 respectively, neither in Western blot nor in immunoprecipitation experiments; for instance an antiserum against Bd37-His protein does not recognize a GST-Bc28.2 protein (FIG. 10, B, lane 6). - whereas both Bd37 and Bc28.1 are attached to the erythrocyte's outer membrane, Bd37 can be eluted off with 0.5 M NaCl, while Bc28.1 remains associated even at elution with 2 M NaCl (Example II, sections <IP_ADDRESS>. and <IP_ADDRESS>.)
The preferred way to produce the proteins of the 28 kDa protein family according to the invention is by using genetic engineering techniques and recombinant expression systems. These may comprise using nucleic acids, cDNA fragments, recombinant DNA molecules, live recombinant carriers, and/or host cells.
Therefore, another aspect of the invention relates to a nucleic acid, characterised in that it encodes the proteins of the 28 kDa protein family according to the invention, or an immunogenic fragment of said protein.
In a preferred embodiment the nucleic acid according to the invention comprises the nucleic acid of SEQ ID NO: 1.
In another preferred embodiment the nucleic acid according to the invention comprises the nucleic acid of SEQ ID NO: 3.
The term “nucleic acid” is meant to incorporate a molecular chain of desoxy- or ribonucleic acids. A nucleic acid is not of a specific length, therefore polynucleotides, genes, open reading frames (ORF's), probes, primers, linkers, spacers and adaptors are included within the definition. A nucleic acid can be of biologic and/or synthetic origin. The nucleic acid may be in single stranded or double stranded form. The single strand may be in sense or anti-sense orientation. Also included within the definition are modified RNAs or DNAs. Modifications in the bases of the nucleic acid may be made, and bases such as Inosine may be incorporated. Other modifications may involve, for example, modifications of the backbone.
The term “encodes” is meant to incorporate providing the possibility of protein expression, i.a. through transcription and/or translation when brought into the right context.
A nucleic acid according to the invention encodes a protein of the 28 kDa protein family according to the invention, or encodes an immunogenic fragment of said protein.
A nucleic acid according to the invention has a minimal length of 24 nucleotides taken from the nucleic acid sequence of SEQ ID NO 1 or 3, preferably a nucleic acid according to the invention comprises 50, 100, 250, or 500 nucleotides taken from the nucleic acid sequence of SEQ ID NO 1 or 3, in that order of preference.
A nucleic acid according to the invention for instance is a nucleic acid encoding a protein of the 28 kDa protein family according to the invention without a signal sequence and/or a GPI anchor. Other nucleic acids may comprise a sequence encoding a specific epitope of a protein of the 28 kDa protein family. Such nucleic acids are all embodied in the invention.
The percentage of identity between nucleic acids according to the invention is determined with the computer program “BLAST 2 SEQUENCES” by selecting sub-program: “BlastN” (T. Tatusova & T. Madden, 1999, FEMS Microbiol. Letters, vol. 174, p. 247-250), that can be found at www.ncbi.nlm.nih.gov/blast/bl2seq/bl2.html. Parameters that are used are the default parameters: reward for a match: +1; penalty for a mismatch: −2; open gap penalty: 5; extension gap penalty: 2; and gap x_dropoff: 50. Unlike the output of the BlastP program described above, the BlastN program does not list homologies, but identities; the percentage of nucleotides that are identical are indicated as “Identities”.
It is well known in the art, that many different nucleic acids can encode one and the same protein. This is a result of what is known in molecular biology as “wobble”, or the “degeneracy of the genetic code”; when several codons or triplets of mRNA will cause the same amino acid to be attached to the chain of amino acids growing in the ribosome during translation. It is most prevalent in the second and especially the third base of each triplet encoding an amino acid. This phenomenon can result in a heterology of about 30% for two different nucleic acids that still encode the same protein. Therefore, two nucleic acids having a nucleotide sequence identity of about 70% can still encode one and the same protein.
For example, the nucleic acids encoding the Bc28.1 and Bc28.2 proteins according to the invention are aligned in FIG. 3. A high percentage of identity exists between the two coding sequences, especially in the 5′ 3/4^(rs) of the coding sequence. The percentage identities from the BlastN program are presented in Table 3.
TABLE 3 Results of BlastN nucleotide sequence alignments between the nucleic acids encoding the Bc28.1 and Bc28.2 proteins according to the invention. Percentage Nucleotides identity Complete 845 94 5′ 652 97 3′ 193 81
Nucleic acids encoding the proteins of the 28 kDa protein family according to the invention can be obtained from member species of the Babesiidae family.
However in a more preferred embodiment, the nucleic acids encoding a protein of the 28 kDa protein family or immunogenic fragments thereof according to the invention are characterised in that they are obtained from B. divergens, B. bovis, B. mot asi, B. caballi, B. equi, B. canis, B. rossi, B. vogel i, B. felis, B. cati, B. ovis, B. trautmanni, B. bigemina, B. micro ti, or B. gibson i.
In an even more preferred embodiment the nucleic acids encoding a protein according to the 28 kDa protein family or immunogenic fragments thereof are characterised in that they are obtained from Babesia canis, B. rossi, B. caballi, B. equi, B. bovis, or B. bigemina.
The possibility of species being taxonomically re-classified has been discussed above. As this does not change the organism's genome, such reclassified organisms are also embodied in the invention.
Also embodied in the invention are proteins of the 28 kDa protein family and nucleic acids encoding them from non-mammalian Babesiidae; such proteins or genes are present due to the high conservation of the proteins of the 28 kDa protein family, their encoding sequences, their genes, and gene-family.
Nucleic acids encoding Bc28.1 protein have been obtained from geographically and genetically disparate B. canis field isolates. The nucleotide sequences of a few examples of such isolates are aligned in FIG. 4. The percentage identities of pairwise BlastN alignments are presented in Table 4.
TABLE 4 Percentage identities of pair-wise BlastN nucleotide sequence alignments between the nucleic acids encoding Bc28.1 proteins from geographically and genetically disparate B. canis field isolates. These nucleic acids were 849 or 852 nucleotides long. Robin A8 B 34.01 A8 100 B 98 98 34.01 97 97 98 Castres 98 98 98 98
Nucleic acids encoding the proteins of the 28 kDa protein family according to the invention can be obtained, manipulated and expressed by standard molecular biology techniques that are well-known to the skilled artisan, and are explained in great detail in standard text-books like Sambrook & Russell: “Molecular cloning: a laboratory manual” (2001, Cold Spring Harbour Laboratory Press; ISBN:<PHONE_NUMBER>). One such type of manipulations is the synthesis of a cDNA fragment from RNA, preferably from mRNA which can be isolated from parasites, or parasite-infected cells or -organisms by techniques known in the art.
Therefore, in another preferred embodiment, the invention relates to a cDNA fragment according to the invention.
The preferred method of obtaining a cDNA fragment by reverse transcription is through a polymerase chain reaction (PCR) technique. Standard techniques and protocols for performing PCR are for instance extensively described in C. Dieffenbach & G. Dveksler: “PCR primers: a laboratory manual” (1995, CSHL Press, ISBN 879694473).
In still another preferred embodiment, the invention relates to a recombinant DNA molecule comprising a nucleic acid according to the invention, or a cDNA fragment according to the invention, under the control of a functionally linked promoter.
To construct a recombinant DNA molecule according to the invention, preferably DNA plasmids are employed. Such plasmids are useful e.g. for enhancing the amount of DNA-insert, as a probe, and as tool for further manipulations. Examples of such plasmids for cloning are plasmids of the pBR, pUC, and pGEM series; all these are available from several commercial suppliers.
The nucleic acid encoding a protein of the 28 kDa protein family according to the invention or an immunogenic fragment of said protein, can be cloned into separate plasmids and be modified to obtain the desired conformation using techniques well known in the art. However they may also be combined into one construct for improved cloning or expression purposes.
Modifications to the coding sequences encoding a protein of the 28 kDa protein family according to the invention may be performed e.g. by using restriction enzyme digestion, by site directed mutations, or by polymerase chain reaction (PCR) techniques.
For the purpose of protein purification or -detection, or improvement of expression level, additional nucleic acids may be added. This may result in the final nucleic acid comprised in the cDNA fragment, or in the recombinant DNA molecule being larger than the sequences required for encoding a protein of the 28 kDa protein family. When such additional elements are inserted in frame, these become an integral part of the protein of the 28 kDa protein family that is expressed. Such fused proteins are also embodied in the invention
An essential requirement for the expression of a nucleic acid, cDNA fragment, or recombinant DNA molecule is that these are operably linked to a transcriptional regulatory sequence such that this is capable of controlling the transcription of the nucleic acid, cDNA, or recombinant DNA. Transcriptional regulatory sequences are well known in the art and comprise i.a. promoters and enhancers. It is obvious to those skilled in the art that the choice of a promoter extends to any eukaryotic, prokaryotic or viral promoter capable of directing gene transcription, provided that the promoter is functional in the expression system used.
In yet another preferred embodiment, the invention relates to a live recombinant carrier comprising a nucleic acid according to the invention, a cDNA fragment according to the invention, or a recombinant DNA molecule according to the invention.
Such live recombinant carriers (LRC's) are e.g. micro-organisms such as bacteria, parasites and viruses in which additional genetic information has been cloned, in this case a nucleic acid, a cDNA, or a recombinant DNA molecule, encoding a protein of the 28 kDa protein family according to the invention or an immunogenic fragment thereof. Target mammalian s inoculated with such LRCs will produce an immunogenic response not only against the immunogens of the carrier, but also against the heterologous protein(s) or immunogenic fragment(s) for which the genetic code is additionally cloned into the LRC, e.g. a sequence encoding a protein of the 28 kDa protein family, or an immunogenic fragment thereof.
As an example of bacterial LRCs, attenuated Salmonella strains known in the art can attractively be used.
Alternatively, live recombinant carrier parasites have i.a. been described by Vermeulen, A. N. (1998, Int. Journ. Parasitol., vol. 28, p. 1121-1130).
LRC viruses may be used as a way of transporting a nucleic acid into a target cell. Live recombinant carrier viruses are also called vector viruses. Viruses often used as vectors are Vaccinia viruses (Panic ali et al., 1982, Proc. Natl. Acad. Sci. USA, vol. 79, p. 4927), Herpesviruses (EP 047321-A2), and Retroviruses (Valerio, D. et al., 1989, in: Baum, S. J., Dicke, K. A., Lotzova, E. and Pluznik, D. H. (Eds.), “Experimental Haematology today”, Springer Verlag, New York: pp. 92-99).
The technique of in vivo homologous recombination, well known in the art, can be used to introduce a recombinant nucleic acid according to the invention into the genome of an LRC bacterium, parasite or virus of choice, capable of inducing expression of the inserted nucleic acid, cDNA or recombinant DNA according to the invention in the host animal.
Bacterial, yeast, fungal, insect, and vertebrate cell expression systems are used as host cells for expression purposes very frequently. Such expression systems are well known in the art and generally available, e.g. commercially through Invitrogen (the Netherlands).
Therefore, in yet still another preferred embodiment, the invention relates to a host cell comprising a nucleic acid according to the invention, a cDNA fragment according to the invention, a recombinant DNA molecule according to the invention, or a live recombinant carrier according to the invention.
A host cell to be used for expression of a protein of the 28 kDa protein family according to the invention may be a cell of bacterial origin, e.g. from Escherichia coli, Bacillus subtilis, Lactobacillus sp. or Caulobacter crescentus, in combination with the use of bacteria-derived plasmids or bacteriophages for expressing the sequence encoding the Bc28 protein. The host cell may also be of eukaryotic origin, e.g. yeast-cells in combination with yeast-specific vector molecules, or higher eukaryotic cells, like insect cells (Luck ow et al, 1988, Bio-technology, vol. 6, p. 47-55) in combination with vectors or recombinant baculoviruses; plant cells in combination with e.g. Ti-plasmid based vectors or plant viral vectors (Barton, K. A et al., 1983, Cell, vol. 32, p. 1033); or mammalian cells like Hela cells, Chinese Hamster Ovary cells or Crandell-Rees feline kidney-cells, also with appropriate vectors or recombinant viruses.
Next to these expression systems, plant cell, or parasite-based expression systems are attractive expression systems. Parasite expression systems are e.g. described in the French Patent Application, publication number 2 714 074, and in U.S. NTIS publication U.S. Ser. No. 08/043,109 (Hoffman, S. & Rogers, W., 1993). Plant cell expression systems for polypeptides for biological application are e.g. discussed in R. Fischer et al. (1999, Eur. J. of Biochem., vol. 262, p. 810-816), and J. Larrick et al. (2001, Biomol. Engin., vol. 18, p. 87-94).
Expression may also be performed in so-called cell-free expression systems. Such systems comprise all essential factors for expression of an appropriate recombinant nucleic acid, operably linked to a promoter that will function in that particular system. Examples are the E. coli lysate system (Roche, Basel, Switzerland), or the rabbit reticulocyte lysate system (Promega corp., Madison, USA).
The protein of the 28 kDa protein family according to the invention or immunogenic fragments of said protein is very well suited for the production of a protein subunit vaccine. Such proteins or fragments can be obtained from parasites, or from animals or cells infected with Babesiidae parasites. However, much more convenient is the use of the nucleic acids encoding the protein of the 28 kDa protein family according to the invention or an immunogenic fragment of said protein, in an expression system. This is followed by harvesting the proteins or fragments produced and formulating these into a protein subunit vaccine, e.g. by ad mixing a protein of the 28 kDa protein family according to the invention or an immunogenic fragment of said protein, and a pharmaceutically acceptable carrier.
Therefore, yet another aspect of the invention relates to a vaccine comprising a protein according to the invention or an immunogenic fragment of said protein, a nucleic acid, a cDNA fragment, a recombinant DNA molecule, a live recombinant carrier, or a host cell according to the invention, or a combination thereof, and a pharmaceutically acceptable carrier.
As described above, a protein of the 28 kDa protein family or an immunogenic fragment of said protein can advantageously be used for vaccination. If such proteins or fragments do not produce an immune response on their own, they can be coupled to a carrier such as KLH, BSA or the like.
The coupling of protein or fragments thereof can also be done to enhance or modify the immune response induced. For instance it is common practice to couple protein(-fragment)s to Tetanus toxoid to enhance the response of T-cells. Also specific effector molecules may be added, such as a toxin, to improve the killing of target cells. Such couplings can be performed
- - chemically, by coupling, conjugation or cross-linking, through dehydration, esterification, etc, of the amino acid sequences either directly or through an intermediate structure. - physically, by coupling through capture in or on a macromolecular structure, or preferably - by molecular biological fusion, through the combination of recombinant nucleic acid molecules which comprise fragments of nucleic acid capable of encoding each of the two, such that a single continuous expression product is finally produced. Molecular engineering techniques are preferred.
An alternative and efficient way of vaccination is by direct vaccination with DNA encoding the relevant antigen or epitope. Direct vaccination with DNA encoding proteins has been successful for many different proteins, as reviewed in e.g. Donnelly et al. (1993, The Immunologist, vol. 2, p. 20-26). For example in the field of anti-parasite vaccines, protection against e.g. Plasmodium yoelii has been obtained with DNA-vaccination with the P. yoelii circumsporozoite gene (Hoffman, S. et al., 1994, Vaccine, vol. 12, p. 1529-1533), and protection against Leishmania major has been obtained with DNA-vaccination with the L. major surface glycoprotein gp63 gene (Xu & Liew, 1994, Vaccine, vol. 12, p. 1534-1536).
Such a DNA vaccination can be performed with a nucleic acid, a cDNA fragment, or preferably with a recombinant DNA molecule according to the invention.
Therefore, one preferred embodiment relates to a vaccine according to the invention, characterised in that it comprises a nucleic acid, a cDNA fragment, or a recombinant DNA molecule according to the invention.
Alternatively, a vaccine according to the invention can comprise live recombinant carriers as described above, capable of expressing the protein of the 28 kDa protein family according to the invention or immunogenic fragments of said protein. Such vaccines, e.g. based upon a bacterial, a parasitic or a viral carrier or vector have the advantage over subunit vaccines that they better mimic the natural way of infection by Babesiidae. Also the presentation of the antigens by cells infected with the carriers resembles the route proteins of the 28 kDa protein family or their immunogenic fragments are presented to the immune system in a natural infection. Moreover, their self-propagation is an advantage since only low amounts of the recombinant carrier are necessary for immunisation.
Thus, another preferred embodiment relates to a vaccine according to the invention, which comprises a live recombinant carrier and a pharmaceutically acceptable carrier.
The host cells as described above can be used to express a protein of the 28 kDa protein family according to the invention or an immunogenic fragment of said protein as an expression system. After expression the proteinacious product may be harvested, but alternatively the culture medium or the complete host cells themselves may be used in a vaccine. This has the benefit of omitting purification steps, but of course requires some tolerance by the target mammalian s for the media components and/or components of the host cells.
Also embodied in the invention is a vaccine according to the invention devised of a combination from two or more types of molecules from the protein or immunogenic fragment thereof, nucleic acid, cDNA, recombinant molecule, live recombinant carrier, and host cells according to the invention. These may be combined in a single dose or in separate doses, and may be given at the same time or sequentially. For instance, a combination vaccination of an initial priming with a recombinant DNA plasmid carrying the coding sequence of a protein of the 28 kDa protein family, followed some time later by a booster vaccination with a protein of the 28 kDa protein family may advantageously be used.
Vaccines according to the invention, can be administered in amounts containing between 0.1 and 1000 μg of a protein of the 28 kDa protein family according to the invention or an immunogenic fragment of said protein per mammalian target. Smaller or larger doses can in principle be used; preferably a dose of between 50 and 200 μg of a protein of the 28 kDa protein family or an immunogenic fragment thereof is used.
For live viral vector vaccines the dose rate per animal may range from 1 to 10¹⁰ pfu, preferably 10-10⁵ pfu are used.
A pharmaceutically acceptable carrier is understood to be a compound that does not adversely effect the health of the animal to be vaccinated, at least not to the extend that the adverse effect is worse than the effects seen when the animal is not vaccinated. A pharmaceutically acceptable carrier can be e.g. sterile water or a sterile physiological salt solution. In a more complex form the carrier can e.g. be a buffer.
Often, a vaccine is mixed with stabilizers, e.g. to protect degradation-prone components from being degraded, to enhance the shelf-life of the vaccine, or to improve freeze-drying efficiency. Useful stabilizers are i.a. SPGA (Bovarnik et al., 1950, J. Bacteriology, vol. 59, p. 509), skimmed milk, gelatin s, bovine serum albumin, carbohydrates e.g. sorbitol, mannitol, trehalose, starch, sucrose, dextran or glucose, proteins such as albumin or casein or degradation products thereof, and buffers, such as alkali metal phosphates.
The vaccine according to the invention may additionally comprise a so-called “vehicle”. A vehicle is a compound to which the proteins, protein fragments, nucleic acids or parts thereof, cDNA's, recombinant molecules, live recombinant carriers, and/or host cells according to the invention adhere, without being covalently bound to it. Such vehicles are i.a. bio-microcapsules, micro-alginates, liposomes, macros ols, aluminium-hydroxide, -phosphate, -sulphate or -oxide, silica, Kaolin®, and Bentonite®, all known in the art.
An example is a vehicle in which the antigen is partially embedded in an immune-stimulating complex, the so-called ISCOM® (EP 109.942, EP 180.564, EP 242.380).
In addition, the vaccine according to the invention may comprise one or more suitable surface-active compounds or emulsifiers, e.g. Span® or Tween®.
For reasons of e.g. stability or economy the proteins, immunogenic fragments thereof, nucleic acids, cDNA's, recombinant molecules, live recombinant carriers, host cells and vaccines according to the invention may be freeze-dried. In general this will enable prolonged storage at temperatures above zero ° C., e.g. at 4° C.
Procedures for freeze-drying are known to persons skilled in the art; equipment for freeze-drying at different scales is available commercially.
Therefore, in a more preferred embodiment, the vaccine according to the invention is characterised in that it is in a freeze-dried form.
To reconstitute the freeze-dried vaccine, it may be suspended in a physiologically acceptable diluent. Such a diluent can e.g. be as simple as sterile water, or a physiological salt solution. In a more complex form it may be suspended in an emulsion as outlined in PCT/EP99/10178.
Target subjects for the vaccine according to the invention are preferably mammalian, e.g. humans or mammalian animals of veterinary importance. The target may be healthy or diseased, and may be seropositive or -negative for Babesiidae parasites or for antibodies to Babesiidae parasites. The target subject can be of any age at which it is susceptible to the vaccination and/or to the infection or clinical disease the vaccination aims to protect against.
The more preferred target mammalian s for the vaccine according to the invention are cows, horses, dogs and cats.
The vaccine according to the invention can equally be used as prophylactic and as therapeutic treatment, and interferes with the establishment and/or with the progression of an infection or its clinical symptoms of disease.
The vaccine according to the invention can be in several forms, e.g.: a liquid, a gel, an ointment, a powder, a tablet, or a capsule, depending on the desired method of application to the target.
Preferably the vaccine is in the form of an injectable liquid.
The vaccine according to the invention can be administered to the mammalian target according to methods known in the art. For instance by parenteral applications such as through all routes of injection into or through the skin: e.g. intramuscular, intravenous, intraperitoneal, intradermal, submucosal, or subcutaneous. Alternative routes of application that are feasible are by topical application as a drop, spray, gel or ointment to the mucosal epithelium of the eye, nose, mouth, anus, or vagina, or onto the epidermis of the outer skin at any part of the body; by spray as aerosol, or powder. Alternatively, application can be via the alimentary route, by combining with the food, feed or drinking water e.g. as a powder, a liquid, or tablet, or by administration directly into the mouth as a liquid, a gel, a tablet, or a capsule, or to the anus as a suppository.
The preferred application route is by intramuscular or by subcutaneous injection.
It goes without saying that the optimal route of application will depend on the particularities of the parasitic infection or clinical disease that is to be prevented or ameliorated, and the characteristics of the vaccine formulation that is used.
The scheme of the application of the vaccine according to the invention to the target mammalian can be in single or multiple doses, which may be given at the same time or sequentially, in a manner compatible with the dosage and formulation, and in such an amount as will be immunologically effective.
Preferably the vaccine is applied in one single dose that will provide sufficient immunological protection for at least a year.
In an even more preferred embodiment, the vaccine according to the invention is characterised in that it comprises an adjuvant.
An adjuvant in general is a substance that boosts the immune response of the target in a non-specific manner. Many different adjuvants are known in the art. Examples of adjuvants are Freund's Complete and -Incomplete adjuvant, vitamin E, non-ionic block polymers and polyamines such as dextransulphate, carbopol and pyran. Also very suitable are saponins, which are the preferred adjuvant. Saponins are preferably added to the vaccine at a level between 10 and 10.000 μg/ml. Within the group of saponins, the saponin Quil A® is the more preferred adjuvant. Saponin and vaccine components may be combined in ISCOMS® (EP 109.942, EP 180.564, EP 242.380).
Furthermore, peptides such as muramyldipeptides, dimethyl glycine, or tufts in, are often used as adjuvant, and mineral oil e.g. Bay ol® or Mark ol®, vegetable oils or emulsions thereof and DiluvacForte® can advantageously be used.
It goes without saying that other ways of adjuvating, adding vehicle compounds or diluents, emulsifying or stabilizing a vaccine are also embodied in the invention. Such additions are for instance described in well-known handbooks such as: “Remington: the science and practice of pharmacy” (2000, Lippincot, USA, ISBN: 683306472), and: “Veterinary vaccinology”, P. Pastor et et al. ed., 1997, Elsevier, Amsterdam, ISBN<PHONE_NUMBER>).
The vaccine according to the invention can advantageously be combined with another antigen, or immunoactive component. This can also be added in the form of its encoding nucleic acid.
Therefore, in a still even more preferred embodiment the vaccine according to the invention is characterised in that it comprises an additional immunoactive component or a nucleic acid encoding said additional immunoactive component
The additional immunoactive component(s) may be an antigen, an immune enhancing substance, and/or a vaccine; either of these may comprise an adjuvant.
The additional immunoactive component(s) when in the form of an antigen may consist of any antigenic component of human or veterinary importance. It may for instance comprise a biological or synthetic molecule such as a protein, a carbohydrate, a lipopolysacharide, a nucleic acid encoding a proteinacious antigen, or a recombinant nucleic acid molecule containing such a nucleic acid operably linked to a transcriptional regulatory sequence. Also a host cell comprising such a nucleic acid, recombinant nucleic acid molecule, or LRC containing such a nucleic acid, may be a way to deliver the nucleic acid or the additional immunoactive component. Alternatively it may comprise a fractionated or killed micro organism such as a parasite, bacterium or virus.
The additional immunoactive component(s) may be in the form of an immune enhancing substance e.g. a chemokine, or an immunostimulatory nucleic acid, e.g. a CpG motif. Alternatively, the vaccine according to the invention, may itself be added to a vaccine.
For instance a vaccine according to the invention can be combined with a preparation of a Babesia subunit vaccine protein, not being a protein of the 28 kDa protein family, to form a combination subunit vaccine against Babesiidae infection or associated clinical signs of disease.
In a yet even more preferred embodiment, the vaccine according to the invention is characterised in that said additional immunoactive component or nucleic acid encoding said additional immunoactive component is obtained from an organism selected from the group consisting of Ehrlichia canis, Babesia gibson i, B. vogel i, B. rossi, Leishmania donovani-complex, Canine parvovirus, Canine distempervirus, Leptospira interrogans serovar ca nicola, icterohaemorrhagiae, pomona, grippotyphosa, bratislava, Canine hepatitis virus, Canine parainfluenzavirus, rabies virus, Hepatozoon canis and Borrelia burgdorferi.
The protein of the 28 kDa protein family according to the invention, or the immunogenic fragment of said protein, the nucleic acid, cDNA, recombinant molecule, live recombinant carrier, and/or the host cells according to the invention for the first time allow the generation of specific antibodies against a protein of the 28 kDa protein family, or an immunogenic fragment thereof. This makes the vaccine according to the invention suitable as marker vaccine, as it allows the differentiation between parasite infected and vaccinated mammalian targets, through methods known in the art.
Alternatively, these specific antibodies may be used as a vaccine themselves, for so called “passive vaccination”.
Therefore still another preferred embodiment relates to a vaccine, characterised in that it comprises an antibody against a protein according to the invention, or an antibody against an immunogenic fragment of said protein, or a combination thereof, and a pharmaceutically acceptable carrier.
A combination in a vaccine of an antigen ‘loaded’ with antibodies against that antigen is known in the art as a “complex” vaccine.
Still another aspect of the invention relates to a method for the preparation of a vaccine according to the invention, said method comprising the ad mixing of a protein according to the invention, or an immunogenic fragment of said protein, a nucleic acid, a cDNA fragment, a recombinant DNA molecule, a live recombinant carrier, or a host cell according to the invention, or a combination thereof, and a pharmaceutically acceptable carrier.
Yet another aspect of the invention relates to a method for the preparation of a vaccine according to the invention comprising the ad mixing of antibodies against a protein or an immunogenic fragment thereof according to the invention, and a pharmaceutically acceptable carrier.
As outlined above, a vaccine obtainable by the method according to the invention can equally be used as prophylactic and as therapeutic treatment, and will interfere both with the establishment and/or with the progression of an infection or its clinical signs of disease.
Therefore, a further aspect of the invention relates to the use of a protein according the invention or an immunogenic fragment of said protein, for the manufacture of a vaccine for prophylactic or therapeutic treatment of an infection or its clinical signs caused by an organism of the family Babesiidae.
Again a further aspect of the invention relates to a diagnostic test for the detection of a nucleic acid associated with an organism of the family Babesiidae, characterised in that the test comprises a nucleic acid, said nucleic acid being at least 70% homologous to the nucleic acid sequence depicted in SEQ ID NO: 1 or 3, or a nucleic acid that is complementary to said nucleic acid, wherein either of the nucleic acids have a length of at least 12, preferably 15, more preferably 18 nucleotides.
Yet a further aspect of the invention relates to a diagnostic test for the detection of antibodies against an organism of the family Babesiidae, characterised in that said test comprises a protein according to the invention or an immunogenic fragment of said protein, or a combination thereof.
For instance a Bc28.1 and/or a Bc28.2 protein or an immunogenic fragment of either is coupled to a solid phase carrier, this is incubated with a sample to be tested, is washed, and presence of bound antibodies is detected.
Still a further aspect of the invention relates to a diagnostic test for the detection of antigenic material from an organism of the family Babesiidae, characterised in that said test comprises an antibody against a protein according to the invention or an immunogenic fragment of said protein, or a combination thereof.
For instance antibodies against a Bc28.1 and/or a Bc28.2 protein or an immunogenic fragment of either are coupled to a solid phase carrier, this is incubated with a sample to be tested, is washed, and presence of bound protein is detected.
The invention will now be further described with reference to the following, non-limiting, examples.
EXAMPLES Example 1 Identification of the Bc28 Multigene Family and Molecular Characterization of the Bc28.1 and Bc28.2 Coding Sequences
1.1. Techniques Used
1.1.1. General Techniques
<IP_ADDRESS>. Culture of Babesia canis
Isolates of Babesia canis (designated A, B, Castres, Gignac, 34.01 and Robin) were obtained from naturally infected dogs from different departments from France. They were maintained in in vitro culture according to Schetters et al. (1997, Parasitology, vol. 115, p. 485-493).
The A8 biological clone corresponded to a biological done of the isolate A from B. canis and was obtained following an adaptation of the cloning-dilution procedure described for malaria parasites (Walliker & Beale, 1993, Meth. in Molec. Biol., vol. 21, p. 57-66).
<IP_ADDRESS>. DNA Sequencing
Nucleotide sequencing was performed using the dideoxy chain termination method from alkali-denaturated double-strand templates according to Sanger et al. (1977, Proc. Natl. Acad. Sci. USA, vol. 74, p. 5463-5467) by Genome Express S.A. (Zone Astec, Grenoble, France) on both strands of the selected plasmids using T3 and T7 universal primers and various oligonucleotides derived from sequences of each strand already established.
<IP_ADDRESS>. DNA Primers
DNA primers used for isolating genomic fragments, for generation of probes and for PCR reactions are disclosed in Table 5, with reference to their respective SEQ ID number. All primers were synthesized by Sigma-Genosys (Cambridge, UK).
TABLE 5 DNA primers used during the course of the experiments SEQ ID Name Sequence (in 5′ → 3′ orientation) NO pr3 TGATGAAGCCGGCAAGAAGGT 5 E4 TACATGATACCGAATTCAATGG 6 RT1 TTACATCGTTGAGCTCAGCTACCTTGA 7 Inv5 CCATGGATTCAAGGTAGCTGAG 8 5′UTR AGTCGATACCTCCGAGAATAG 9 Fspe3 ACTGAGGATGAGAACAGGGATAGT 10 Cons3.1 CATGGATTCAAGGTAGCTGAG 11 Rspe4 GACCACAACCGCGACGGCGGCAAC 12 Rspe3G GAGCTCATTGAGGAGTACAGG 13 Rspe3C CATTACGCCCACAAATAGTCA 14 3.1expfor ATTTTGGTTCGTGGATCCACGTGCACTGAGGAT 15 3.1exprevC CCACAAATAGTCAAGCTTAACCTCTAA 16 3.1exprev GAATGAGAATCCAAGCTTCTTACCCTTGGC 17 Gene- CGACTGGAGCACGAGGACACTGA 18 Racer ® 5′ Gene- GCTGTCAACGATACGCTACGTAACG 19 Racer ® 3′ <IP_ADDRESS>. Genomic DNA Extraction, Southern Blot and Chromosomal Analysis
Genomic DNA extraction from B. canis in vitro cultures or from field samples of infected dog blood was performed on 200 μl of blood using Nucleospin® column according to the manufacturer (Macherey-Nagel). Southern blot experiments were performed using standard procedures described in Sambrook & Russell (supra).
The preparation of agarose plugs containing intact or NotI-digested chromosomes of B. canis and their separation by pulse-field gel electrophoresis (PFGE) were performed as described in Depoix et al. (2002, Parasitology, vol. 125, p. 313-321).
The Bc28 probe that was used for the DNA hybridisation experiments was obtained by performing a PCR with the combination of primers Fspe3 and Rspe4 using the plasmid carrying the Bc28.1 cDNA as DNA template. The Bc28 probe was labelled using the Nick Translation kit according to the manufacturer's instructions (Boehringer Mannheim) and as described in Depoix et al. (supra).
<IP_ADDRESS>. RNA Extraction and Northern Blot Analysis
Total RNA extraction, mRNA purification and RNA hybridisation were performed as described in Drakulovski et al. (2003, Infect. Immun., vol. 71, p. 1056-1067). The digoxigenin (DIG)-11-UTP-labelled Bc28 antisense riboprobe (complementary mRNA sequence obtained from using the primers Fspe3 and Rspe4) was synthesized according the DIG High Prime® DNA labelling kit (Boehringer Mannheim).
<IP_ADDRESS>. PCR Amplification
Amplifications were performed in a PTC-100® Programmable Thermal Controller (MJ Research, Inc) as described in Depoix et al. (supra), using Accu Taq® DNA polymerase (Sigma).
1.1.2. Identification of the Bc28.2 Genomic Fragment from B. canis by PCR with Primers Derived from the Bd37 cDNA of B. divergens
Two primers, pr 3 and E4, were used in a PCR set-up on genomic DNA from isolate A of B. canis. The conditions of annealing were the following: the annealing temperature was increased by 2° C. per cycle from 45° C. to 55° C. and then 25 cycles of amplification were performed at 55° C. These conditions allowed to amplify a 500 bp genomic fragment, that was designated Bc28.2. The PCR fragment was then cloned in the pCR II-TOPO® cloning vector according the manufacturer's instruction (Invitrogen), and sequenced.
1.1.3. Cloning of the Complete Bc28.1 cDNA Sequence of B. canis
The complete sequence from the cDNA Bc28.1 was determined by RT-PCR using primers derived from the sequence of the Bc28.2 genomic fragment for the first retrotranscription step. For the RT-PCR experiment, the GeneRacer® protocol was applied according to the manufacturer's instructions (Invitrogen) on intact mRNA from B. canis. The 5′ end sequence of the cDNA (clone 5′-Bc28.1, 5′-RACE PCR product) was determined by using the reverse primer RT1 for the first retrotranscription step. The 3′-end of the cDNA Bc28.1 (clone 3′-Bc28.1, 3′-RACE PCR product) was obtained using the forward primer Inv5, derived from the sequence of the clone 5′-Bc28.1, in the first retrotranscription step of the protocol. The 5′ and 3′ ends of the cDNA Bc28.1 were then amplified by PCR using a primer-couple corresponding to the one that was used first for each of the retrotranscription steps and with the forward GeneRacer® 5′ primer (5′-CGACTGGAGCACGAGGACACTGA-3′) or the reverse GeneRacer® 3′ primer (5′-GCTGTCAACGATACGCTACGTAACG-3′) (Table 5) provided in the GeneRacer™ kit (Invitrogen). In both cases, a single PCR product was obtained using Accu Taq® DNA polymerase (Sigma). These fragments were cloned in pCR II-TOPO, and sequenced. Sequences from the clones 5′-Bc28.1 and 3′-Bc28.1 were assembled to form the complete sequence of the Bc28.1 cDNA from B. canis.
1.1.4. Cloning of the Encoding Regions from the Bc28.1 and Bc28.2 Coding Sequences from B. canis
A specific reverse primer from the Bc28.1 and Bc28.2 nucleotide sequences was designed in order to sequence their corresponding genomic copy. The complete open reading frame (ORF) from the coding sequence Bc28.2 was amplified by PCR with the forward 5′UTR primer derived from the 5′ end of the Bc28.1 cDNA sequence and the reverse Rspe3G primer that specifically hybrid ises to the 3′ end of the genomic sequence of Bc28.2. The sequence of the complete ORF from the Bc28.1 coding sequence was amplified by PCR with the 5′UTR primer and with the reverse Rspe3C primer that specifically hybrid ises to the 3′ end of the Bc28.1 cDNA sequence. The PCR amplifications were performed using the genomic DNA from the biological clone A8 from B. canis as DNA template. Amplifications were performed with the following conditions: a 3 min step of denaturation at 94° C., a 3-step cycling program consisting of 1 min denaturation at 94° C., 1 min annealing at 55° C., and 1 min of extension at 72° C., finally followed by a 5 min step at 72° C. The PCR fragments were then cloned in pCR II-TOPO and sequenced.
1.1.5. Analysis of the Polymorphism of the Bc28.1 and Potential Bc28.2 Coding Sequences
The Bc28.1 and Bc28.2 coding sequences from the French laboratory Babesia canis isolates B, Robin, Castres, Gignac and 34.01 were amplified by PCR with the primer-couples Fspe3/Rspe3C or Fspe3/Rspe3G and a restriction map based on 5 restriction enzymes (Al uI, EcoRI, HinfI, Mb oI and MspI) was calculated for both genes. On the basis of the deduced restriction maps from the Bc28.1 coding sequence, the entire coding region of Bc28.1 from the French laboratory Babesia canis isolates B, Robin, Castres and 34.01 were amplified by PCR with the primer-couples 5′UTR/Rspe3C, and cloned and sequenced as described above (§ 1.1.2).
1.2. Results:
1.2.1. Identification of a Genomic Fragment from B. canis by PCR
Two primers, pr 3 and E4 were used in a PCR set-up with an increasing annealing temperature from 45 to 55° C. on genomic DNA from B. canis (FIG. 5).
It allowed the amplification of a fragment of approximately 500 bp (FIG. 5, lane 2; indicated with a dot). This amplification was specific since the test of each of the primers separately in control amplifications was negative (FIG. 5, lanes 5 and 6).
This clone, Bc28.2, hereafter called Bc28.2 (see below) was cloned in a pGEX® vector to be able to express a GST fusion-protein.
1.2.2. Identification of the Bc28 Multigene Family and Cloning of the Bc28.1 and Bc28.2 Coding Sequences
<IP_ADDRESS>. Cloning of the Complete Bc28.1 cDNA
In order to find a complete cDNA sequence corresponding to the genomic fragment of Bc28.2, an RT-PCR experiment on intact mRNA from B. canis was performed using the GeneRacer protocol. Firstly, a single 5′-RACE PCR product was obtained by performing the first retrotranscription step with the reverse primer RT1 derived from the sequence of the genomic clone Bc28.2 followed by a PCR with the same RT1 primer and the forward GeneRacer 5′ primer provided in the Gene Racer kit. Then, a single 3′-RACE PCR product was obtained using the forward primer Inv5, derived from the deduced sequence of the 5′-RACE PCR product, in the first retrotranscription step of the protocol followed by a PCR with the same primer and the GeneRacer 3′ primer provided in the kit. Sequences from the 5′-RACE and 3′-RACE PCR products were assembled and constitute the complete sequence of the Bc28.1 cDNA. This cDNA contained a 1039 bp sequence with a poly(A)20 tail and with an ORF of 753 nucleotides. Within the segment 5′UTR/Rspe3C of the cDNA, this ORF starts with an ATG initiation codon at nucleotide (nt) position 50 (or nt position 71 from the entire cDNA) and ends with a TAA stop codon at nucleotide position 820 (or nt position 841 from the entire cDNA).
Alignment of the Bc28.2 genomic fragment sequence with the complete sequence of the deduced cDNA revealed a significant identity in the region of primers RT1 and Inv5 between the two sequences (i.e. in the 5′ end of the Bc28.2 sequence). However, their 3′ ends were found to be very distant, suggesting the presence of at least 2 related genomic copies in the genome of B. canis for this gene. As the cDNA sequence encodes a poly-peptide of around 28 kDa, and because its 3′ end was distant from the related genomic done, it was designated Bc28.1 whereas the related genomic done was designated Bc28.2.
<IP_ADDRESS>. Design of Primer for Specific PCR Amplification of Bc28.1 and Bc28.2 Coding Sequences
As the comparison of the nucleotide sequences from the cDNA Bc28.1 and the genomic clone Bc28.2 suggested two related genomic copies in the genome of the parasite, specific primers able to amplify each of the copies were designed. The two sequences being the most distant in their 3′ end, the primers Rspe3G and Rspe3C, respectively designed to amplify the Bc28.2 and Bc28.1 coding sequence, were therefore selected from this region (FIG. 3). To demonstrate their specificity for each coding sequence, they were tested by PCR in combination with the primer Cons3.1 (FIG. 3) that is located in the 5′ end of the Bc28.2 sequence and that hybrid ises in a conserved region of the two sequences. Moreover, to certify that the two copies of related coding sequences do not derive from two subpopulations of B. canis in the isolate A, the PCR's were performed using the genomic DNA from a biological clone, clone A8 of B. canis.
The combinations of primers Cons3.1/Rspe3G and Cons3.1/Rspe3C allowed the amplification of a genomic fragment of some 300 bp for both combinations of primers (FIG. 6, A, I and II, lanes PCR). To certify that the primers Rspe3G and Rspe3C hybrid ise specifically to the Bc28.2 and Bc28.1 coding sequence respectively, the amplified fragments were digested by the restriction enzymes HinfI or MstI (FIG. 6, A, I and II, lanes H and M). Comparison of the restriction maps of the two sequences revealed the absence of two HinfI restriction sites (located at position 713 and 777 in the Bc28.1 sequence) and one MspI site (located at position 790 in the Bc28.1 sequence) in the 3′ end of the Bc28.2 sequence (FIG. 6, C; compare the restriction maps from the Bc28.1 coding sequence and the Bc28.2 genomic fragment). As expected, the HinfI and MspI digestion of the amplimer Cons3.1/Rspe3C showed a digestion of the amplified fragment in 3 and 2 fragments (FIG. 6, A, I, lanes H and M, respectively). In contrast, the Cons3.1/Rspe3G PCR fragment was not digested by these two enzymes (FIG. 6, A, II, lanes H and M), demonstrating that the primers Rspe3G and Rspe3C specifically hybrid ise to the Bc28.2 and Bc28.1 coding sequences from the biological clone A8 from B. canis.
In order to analyse the 5′ end of the Bc28.2 coding sequence, a similar PCR-RFLP was performed by using the combinations of primers Fspe3/Rspe3G and Fspe3/Rspe3C (FIG. 6, B, I and II). In both cases, the amplimers were digested by the two enzymes and the sizes of the fragments resulting from these digestions show that the 5′ end of the Bc28.2 and Bc28.1 coding sequences are conserved (FIG. 6, C; compare the restriction maps from the Bc28.1 and Bc28.2 coding sequences). Indeed, the 5′ end of the Bc28.2 coding sequence contained the single HinfI site (located at position 308 of the Bc28.1 coding sequence) and two MspI sites (located at positions 367 and 412 of the Bc28.1 coding sequence) from the Bc28.1 coding sequence in a conserved position.
In conclusion: two related Bc28 coding sequences are present in the genome of B. canis. Specific primers able to analyse each of the two copies are disclosed. The restriction map comparison shows that both copies contain a conserved 5′ end whereas their 3′ ends are very distant.
<IP_ADDRESS>. Hybridisation Experiments with a Bc28.1 Probe
The probe used for hybridisation experiments (Southern blot, Northern blot and PFGE analysis) (FIG. 7) corresponded to the coding region of Bc28.1 cDNA located between primers Fspe3 and Rspe4 (FIG. 3).
<IP_ADDRESS>.1. The Bc28.1 Coding Sequence Belongs to a Multigene Family.
First, the results of the Southern blot experiment revealed two hybrid ised fragments of some 1200 and 1400 bp when the genomic DNA of B. canis was digested with the Rs aI enzyme (FIG. 7, A, II, lane 3, indicated by arrows). As no Rs aI restriction site is present in the restriction map of the Bc28.1 cDNA, it demonstrates the presence of at least two related genomic copies, in agreement with the identification of the related sequences of Bc28.1 and Bc28.2.
Then, hybridisation experiments were performed with the Bc28.1 probe on the entire (FIG. 7, C, II) or NotI-digested (FIG. 7, D, II) chromosomes from the Babesia canis isolates A (FIG. 7, C and D, II-A) and B (FIG. 7, C and D, II-B), which had been separated by PFGE. This indicated that at least 10 genomic copies of related Bc28 coding sequences exist in the genome of B. canis (FIG. 7, D, II) and that these copies are located on the 5 chromosomes from the parasite, in both isolates (FIG. 7, C, II). The difference in sensitivity of the hybridisation signals, both for isolates A and B, shows a sequence polymorphism between the different related Bc28 sequences for a given isolate in that family.
<IP_ADDRESS>.2. Northern Blot Analysis
Whereas previously described data show there are at least 10 members related to the Bc28.1 cDNA, hybridisation of the probe on total RNA from B. canis revealed a single band of around 1.1 kb mRNA, in agreement with the size of the Bc28.1 cDNA sequence (FIG. 7, B, II). Moreover, whereas our data show that the two related coding sequences Bc28.1 and Bc28.2 encode different products (28 and 45 kDa, see example 2, section 2.2.1.), no larger mRNA that encoded the 45 kDa was detected.
In conclusion: the Bc28.1 and Bc28.2 coding sequences belong to a multigene family that is composed of at least 10 members located on the 5 chromosomes of B. canis. A single mRNA was detected that encodes a 28 kDa protein, corresponding to the Bc28.1 copy. The larger mRNA encoding the 45 kDa protein corresponding to the band recognized by the α-GST-Bc28.2 antiserum could not be detected; the small amount of protein detected in immunoprecipitation experiments indicates this mRNA is transcribed at a very low level, additionally it shows that the transcription of members from the Bc28 family is regulated.
<IP_ADDRESS>. Cloning of the Bc28.2 Coding Sequence within the Biological Clone A8 from B. canis and Comparison of its Sequences with the Bc28.1 Coding Sequence
Specific genomic fragment from the Bc28.2 coding sequence was amplified by PCR using the genomic DNA from the biological clone A8 from B. canis as DNA template with the combinations of primers 5′UTR/Rspe3G. The genomic fragment was cloned and sequenced. The genomic sequence Bc28.2 was aligned and compared with the equivalent Bc28.1 coding sequence amplified with the combination of primer 5′UTR/Rspe3C both at the nucleotide (FIG. 3) and amino acid levels (FIG. 1).
<IP_ADDRESS>.1. Comparison at the Nucleotide Level
Such a PCR amplified 845 and 852 nucleotide length sequences for the Bc28.2 and Bc28.1 genomic sequence, respectively (FIG. 3). Comparison of the Bc28.1 cDNA and genomic equivalent sequences indicated that no intronic sequence was found in the Bc28.1 coding sequence. The percentage of identity, determined using the BlastN program as described, between the Bc28.1 and Bc28.2 sequences at the nucleotide level was 94% when the comparison was performed with all 845 nucleotides from the two sequences (Table 3). However, and as suggested by the previously described comparative restriction map analysis using PCR-RFLP experiment (FIG. 6, C), comparison of the two nucleotide sequences revealed a strong conservation at the 5′ end whereas their 3′ end was polymorphic (FIG. 3). Indeed, whereas the percentage of identity at the nucleotide level was of 97% when the comparison was performed with the first 652 nucleotides from the two sequences, the comparison of the remaining 193 nucleotides from their 3′ end revealed only 81% identity (Table 3).
<IP_ADDRESS>.2. Comparison of Restriction Maps of the Bc28.1 and Bc28.2 Coding Sequences
Specific genomic fragments corresponding to the coding region of the Bc28.1 and Bc28.2 coding sequences between the primers Fspe3 and Rspe3C or Rspe3G were amplified by PCR using the genomic DNA from the biological done A8 from B. canis as DNA template. These genomic fragments corresponding to the two copies from the biological clone A8 were digested by various restriction enzymes in order to compare the restriction maps of the Bc28.1 coding sequence and of the Bc28.2 coding sequence (FIG. 8, A) within the A8 biological clone.
As previously showed, such PCR-RFLP analyses revealed that both copies shared some restriction sites, especially in their 5′ end. The main differences between the two copies are the lack of two HinfI and a single MspI restriction sites at the 3′ end of the Bc28.2 coding sequence. At the 5′ end of the two copies, the only difference is the lack of an EcoRI restriction site at the 5′ end of the Bc28.2 coding sequence (FIG. 8, A).
<IP_ADDRESS>.3. Comparison at the Amino Acid Level
Comparative analysis of the products encoded by the coding sequences of Bc28.1 and Bc28.2 was performed (FIG. 1). An ORF of 244 and 256 amino acids was predicted for the Bc28.2 and Bc28.1 genomic sequences, respectively (FIG. 1). The two ORF's were different in size since, whereas both begin at the same nucleotide position (position 50), the Bc28.2 ORF finishes with a TGA stop codon at position 784 and the Bc28.1 ORF finish with a TAA stop codon at position 820 of their nucleotide sequences (FIG. 3). As previously described, the percentage homology between the two predicted proteins was determined with the complete sequence or with the N-terminal or C-terminal of the proteins (Table 1), using the BlastP program. Comparison of the two complete proteins (on 244 residues) revealed a global homology of 91%. As previously described, whereas the N-terminal part of the two proteins was found to be very conserved (97% homology between the first 180 amino acids from the two proteins), their C-terminal parts were found to be more polymorphic, with an homology of 73% in the last 64 amino acids.
<IP_ADDRESS>.4. Predictive Analysis of the Bc28.1 and Bc28.2 Encoded Products
The proteins encoded by the Bc28cDNA.1 has a predicted molecular weight of 28.3 kDa (and a pl of 6.24) whereas the protein encoded by the Bc28.2 coding sequence has a predicted molecular weight of 27.5 kDa (and a pl of 9.30).
Analysis of the hydrophobicity profile (FIG. 9) revealed no internal hydrophobic sequence for both proteins. However, they both shared an N-terminal hydrophobic segment that corresponds to a signal peptide. A cleavage site is present between the A¹⁶ and V¹⁷ residues. In contrast to the Bc28.2 protein, the Bc28.1 protein contained another hydrophobic segment located at the C-terminal end of the protein (FIG. 9). This G²³⁶-V²⁵⁶ hydrophobic segment is a GPI anchor.
In conclusion: The two genomic copies Bc28.1 and Bc28.2 from the multigene family are predicted to encode products of around 28 kDa. Both proteins contain a cleavable signal peptide at their N-terminal parts. A GPI anchor is present on the C-terminal part of the Bc28.1 protein, but not at the C-terminal part of the Bc28.2 protein. The two related Bc28.1 and Bc28.2 nucleotide sequences, like their deduced amino acid sequences, are strongly conserved in their 5′ moiety, but are more polymorphic in their 3′ moiety.
1.2.3. Polymorphism of the Bc28.1 and Bc28.2 Coding Sequences Between Geographically and Genetically Disparate B. canis Field Isolates
<IP_ADDRESS>. Comparison of Restriction Maps of the Bc28.1 and Bc28.2 Coding Sequences by PCR-RFLP
Specific genomic fragments corresponding to the coding region of the Bc28.1 and Bc28.2 coding sequences between the primers Fspe3 and Rspe3C or Rspe3G were amplified by PCR using the genomic DNA from the French B. canis isolates A8, B, Castres, Gignac, 34.01 and Robin as DNA template. These genomic fragments corresponding to the two copies from the isolates A8, B, Robin, Castres, Gignac and 34.01 were digested by various restriction enzymes in order to compare the restriction maps of the Bc28.1 and Bc28.2 coding sequences (FIG. 8, B, C respectively) between isolates.
<IP_ADDRESS>.1. Comparison of the Bc28.1 Coding Sequence Restriction Maps
This PCR-RFLP analysis of the PCR fragments amplified with the combination of primers Fspe3/Rspe3C revealed an important conservation of the restriction maps between the Bc28.1 coding sequences from the various available isolates (FIG. 8, B).
<IP_ADDRESS>.2. Comparison of Restriction Maps of the Bc28.2 Coding Sequence
Like for the Bc28.1 coding sequence, the PCR-RFLP analysis of the PCR fragments amplified with the combinations of primers Fspe3/Rspe3G revealed an important conservation of the restriction maps between the potential Bc28.2 coding sequence from the various isolates (FIG. 8, C).
<IP_ADDRESS>. Sequencing of the Bc28.1 Coding Sequences from Different Isolates of B. canis
To confirm the conservation of the Bc28.1 coding sequences between geographically and genetically disparate B. canis field isolates, the coding region (i.e. between primers 5′UTR and Rspe3C) of the Bc28.1 coding sequence from the isolates A8, Robin, Castres, B and 34.01 were amplified by PCR, cloned, sequenced, aligned and compared both at the nucleotide (FIG. 4) and amino acid levels (FIG. 2).
<IP_ADDRESS>.1. Comparison at the Nucleotide Level
PCR with the of primer-couple 5′UTR/Rspe3C amplified a 852 nucleotide length genomic Bc28.1 sequence for the isolates B, Robin and A, and a 849 nucleotide length genomic Bc28.1 sequence for the isolates 34.01 and Castres (FIG. 4). The percentage of identity at the nucleotide level between these Bc28.1 sequences, in pairwise alignments using the BlastN program, is comprised between 100% (A8 and Robin are the closest) and 97% (Table 4), indicating a strong conservation of the coding sequence between isolates of B. canis.
<IP_ADDRESS>.2. Comparison at the Amino Acid Level
Comparative analysis of the protein encoded by the Bc28.1 coding sequence from these different isolates was performed (FIG. 2, Table 2). An ORF of 256 amino acids was obtained for the isolates B, A and Robin whereas this ORF was 255 amino acids for the isolates 34.01 and Castres (FIG. 2). As previously described, the homology between the different Bc28.1 proteins, determined in pairwise alignments using the BlastP program, was very strong, between 100% (A and Robin) and 97% (Table 2).
In conclusion: analysis of the restriction maps from the Bc28.1 and Bc28.2 coding sequences from B. canis show a strong conservation of each sequence between the different isolates. As all these isolates were collected in France, this conservation might be due to the fact that these isolates all came from the same country, even if they originate from different regions. However, evidence suggested that these isolates are genetically disparate B. canis field isolates. Indeed, their chromosomal content analysis revealed that all these isolates have a specific chromosomal profile. Moreover, the analysis of the polymorphism of the Bc28.1 coding sequence by a PCR-RFLP experiment was performed on around 60 blood samples collected from infected dogs in all parts of France and in other European countries (Germany and Hungary). Such analysis with field samples did not show the identification of other restriction patterns than the ones described in this report, in agreement with a good conservation of this coding sequence between geographically and genetically disparate B. canis field isolates.
This conservation between the Bc28.1 coding sequences and deduced proteins for the different isolates was confirmed by sequencing. It revealed an homology between the different coding sequences (identity) and encoded proteins of over 96%.
Example II Biochemical Characterization of the Bc28.1 and Bc28.2 Proteins
2.1. Techniques Used
2.1.1. Expression and Purification of GST-Bc28.2 and His-Bc28.1 Recombinant Proteins in E. coli.
<IP_ADDRESS>. Production of His-Tagged Bc28.1 Recombinant Proteins
Two recombinant Histidine tagged-Bc28.1 proteins, without the N-terminal part of Bc28.1, with and without GPI anchor at the C-terminal part, were designated His-Bc28.1C (V¹⁶-V²⁵⁶) and His-Bc28.1 (V¹⁶-K²³³) respectively. These proteins were purified by affinity chromatography on Ni-NTA beads under denaturing conditions for the His-Bc28.1C protein or under native conditions for the His-Bc28.1 protein, according to the manufacturer's instructions (Qiagen).
<IP_ADDRESS>.1. His-Bc28.1C
The Bc28.1C cDNA sequence without its N-terminal part (nt 104-865 from the entire cDNA or nt 83-844 from the 5′UTR/Rspe3c segment) was amplified by PCR using a cDNA library from Babesia canis (isolate A) as DNA template. This cDNA library was constructed, as described in Carret et al. (1999, Eur. J. Biochem., vol., 265, p. 1015-1021), with the ZAP Express® cDNA Gigapack II® Gold Cloning kit (Stratagene). PCR was performed using internally modified primers 3.1expfor and 3.1exprevC. These primers contain respectively a BamHI and HindIII restriction site to allow the cloning of the amplified sequence in BamHI/HindIII digested pQE-30 vector (Qiagen) in frame with the His-tag present in that plasmid. Then, the PCR product was purified by agarose gel electrophoresis, by loading onto a 0.8% agarose gel (electrophoresis grade, Euro bio, France) running in 0.5× TAE (made from 25× TAE stock solution, Euromedex) at 100V. The band corresponding to the desired product was excised from the gel and the DNA was isolated from the gel slices using a gel-extraction Spin kit® (Q-Bio-Gene). It was then digested with BamHI and HindIII and gel purified again. The resulting fragment was ligated into dephosphorylated BamHI/HindIII digested pQE-30 vector, by ligation with T4 DNA ligase (MBI Fermentas, France) in 1× ligase buffer (MBI Fermentas) supplemented with 2 mM ATP (Sigma), at room temperature during 3 hours. The ratio vector:insert was usually 1:3, wherein the amount of digested vector used was between 0.5 and 1 μg.
The ligation mix was transformed into JM109 super competent® E. coli cells (Promega). These cells were plated on ampicillin containing agar plates, and colonies were checked for expression of Bc28.1C protein by protein mini-expression and the recombinant protein (His-Bc28.1C; nt 118-838 from the entire cDNA, or nt 98-817 from the 5′UTR/Rspe3C segment; V¹⁶-V²⁵⁶) was purified by affinity chromatography on Ni-NTA beads under denaturing conditions. Briefly, a small scale (5 ml) bacterial culture in LB medium was initiated by 1-fold dilution of an overnight culture. After 2 h incubation at 37° C. with shaking, recombinant protein expression was induced by addition of 1 mM IPTG (Euromedex). After 3 h of induction, cells were harvested by centrifugation (15 min, 4000×g) and lysed in 1 ml of denaturing buffer (8 M urea, 1% v/v Triton X-100, 50 mM Tris, pH 8). Lysates were sonic ated for 2 minutes with 2 second pulse-pause cycle on ice, and centrifuged (10 min, 15000×g). Clarified lysates were incubated 20 min on ice with occasional shaking in the presence of 50 μl Ni-NTA agarose resin (Qiagen). Loaded resin was washed thrice with 1 ml of washing buffer (8 M urea, 1% v/v Triton X-100, 50 mM Tris, pH 6.3) and protein eluted with elution buffer (8 M urea, 1% v/v Triton X-100, 50 mM Tris, pH 4.5). The presence of recombinant protein was assessed by SDS-PAGE in 12% polyacrylamide gel, which was stained with Coomassie Brilliant blue (CBB) and by Western blot with anti-His tag monoclonal antibody (Qiagen).
Prior to large scale production of His-Bc28.1C protein, one colony positive for Bc28.1C expression was selected to check the correct in frame fusion of the Bc28.1C core with the 6×His linker.
In conclusion: a bacterial culture was produced by overnight incubation in 2 ml of LB medium, at 37° C. with shaking, and plasmid pQE-His-Bc28.1C was isolated using the Jet Quick® miniprep kit (Q-Bio-Gene). The correct in frame fusion of the Bc28.1C core with the 6× His linker was checked by sequencing. Once checked, the Bc28.1C protein was produced to a larger scale with the same protocol.
<IP_ADDRESS>.2. His-Bc28.1
The Bc28.1 cDNA sequence deleted from both the N and C-terminal parts (nt 104-787 from the entire cDNA or nt 83-766 from the 5′UTR/Rspe3C segment) was amplified by PCR using internal modified primers 3.1expfor, and 3.1exprev as described above. These primers respectively contain BamHI and HindIII restriction sites to allow the cloning of the amplified sequence in BamHI/HindIII digested pQE-30 vector in frame with the His-tag. The ligation mix was transformed into E. coli cells, cells were plated, and colonies were checked for expression of Bc28.1 protein by protein mini-expression, as described above. The recombinant protein (His-Bc28.1; nt 118-769 from the entire cDNA or nt 83-766 from the 5′UTR/Rspe3C segment; V¹⁶-K²³³) was purified by affinity chromatography on Ni-NTA beads under native condition. Briefly, a bacterial culture in LB medium was initiated by 10-fold dilution of an overnight culture, after 2 h incubation at 37° C. with shaking, recombinant protein expression was induced by addition of 1 mM IPTG (Euromedex). After 3 h of induction, cells were harvested by centrifugation (15 min, 4000×g) and resuspended in His tag lysis buffer containing 1% Triton X-100, 1 mg/ml lysosyme and 1 mM phenyl-methyl-sulphonyl fluoride (PMSF) (Sigma). Lysate was stored at −80° C. until use. After thawing, 500 U DNAse I enzyme (Life Technologies) was added, incubated 20 min on ice, next the suspension was sonic ated on ice for 2 min with 2 second pulse-pause cycles. The sonic ate was centrifuged (20 min, 9000×g) and the supernatant was filtered sequentially through 1.2, 0.45 and finally 0.22 μm filters (Pall Gelman, France). Finally, the filtrate was separated on FPLC Ni²⁺ HiT rap® columns (Pharmacia). The loaded column was washed with His tag lysis buffer supplemented with 20 mM imidazole (Sigma). The recombinant Bc28.1 protein was finally eluted in His tag lysis buffer containing 200 mM imidazole.
The His-Bc28.1C protein was purified under denaturing conditions and was injected into a rabbit to produce a polyclonal serum (α-His-Bc28.1C) (section 2.1.2.), which antiserum was used for invasion reduction assays (Example 4).
The His-Bc28.1 protein was purified under native conditions and was used for the erythrocyte binding assay (section 2.1.4.).
<IP_ADDRESS>. Production of a GST-Tagged Bc28.2 Recombinant Protein
A GST-Bc28.2 recombinant protein was produced by subcloning the 3′ end part of the Bc28.2 coding sequence in frame with GST. Firstly, the recombinant PCRII-TOPO cloning vector carrying the partial Bc28.2 sequence was digested with the restriction enzymes BamHI/EcoRI (the 5′BamHI site is from the vector and the 3′EcoRI site is from the primer E4). This BamHI/EcoRI fragment was purified by agarose gel electrophoresis as previously described, it was excised from the gel and the DNA was isolated from the gel slices using a gel-extraction Spin kit® (Q-Bio-Gene). The resulting fragment was ligated into the dephosphorylated BamHI/EcoRI digested pGEX-4T3 vector (Amersham-Pharmacia), by ligation with T4 DNA ligase (MBI Fermentas, France) in 1× ligase buffer (MBI Fermentas) supplemented with 2 mM ATP (Sigma), at room temperature during 3 hours. The ligation mix was transformed into E. coli BL21 cells (Novagen) and these cells were plated on ampicillin containing agar plates overnight. A positive colony was selected using PCR with the primers pr 3/E4 and it was induced by IPTG to check for expression of GST-Bc28.2 protein. Thus, the positive bacterial culture was grown overnight and diluted 1:10 with LB medium supplemented with ampicillin at 50 μg/ml. The culture was incubated for 1 h at 37° C. and then incubated with 0.1 mM IPTG during 3 h. Cells were harvested by centrifugation (15 min, 4000×g) and lysed by sonication in MTPBS (150 mM NaCl, 16 mM Na₂HPO4, 4 mM NaH₂PO4, pH 7.3) with 1% Triton X-100. The recombinant protein was purified by affinity chromatography on glutathione-agarose beads (Sigma) and eluted by competition with reduced glutathione, i.e. in a buffer containing 50 mM Tris (pH 8) with 45 mM glutathione (Smith & Johnson, 1988, Gene, vol. 67, p. 31-40).
2.1.2. Immunisation
A polyclonal antiserum raised against the GST-Bc28.2 or against the His-Bc28.1C protein was produced respectively in mice and in rabbits according to E. Harlow & D. Lane (“Antibodies: a laboratory manual”, ISBN<PHONE_NUMBER>). Rabbits (New Zealand White) were immunized with 50 μg of purified His-Bc28.1C recombinant proteins emulsified in Freund's Complete Adjuvant (FCA) (Sigma) subcutaneously for the first injection, and by intramuscular injection for two subsequent times using Freund's Incomplete Adjuvant (FIA) (Sigma). Balb/C mice were intraperitoneally immunized with 15 μg of GST-Bc28.2 emulsified in FCA for the first injection and in FIA for the two subsequent times. Injection of the animals was performed at 3-week intervals and the bleeding s were done 8 days before each immunisation.
The rabbit α-His-Bc28.1C antiserum was used to reduce Babesia parasite invasion into erythrocytes, see Example 4.
2.1.3. Immunological Methods
<IP_ADDRESS>. Immunoblotting
Immunoblotting was performed with purified B. canis merozoites prepared as described in Drakulovski et al. (2003, Infect. Immun., vol. 71, p. 1056-1067). The merozoites were then processed for electrophoresis and the proteins were separated by 15% SDS-PAGE. Immunoblottings were revealed using a 1:100 dilution of the polyclonal serum α-His-Bc28.1C.
<IP_ADDRESS>. Indirect Immunofluorescence Assays (IFA)
IFA were performed on B. canis parasitised erythrocytes (5% of parasitaemia) as described in Drakulovski et al. (supra) using a 1:100 dilution for the polyclonal serum α-His-Bc28.1C. Slides were mounted with Citifluor® solution (Citifluor Ltd, London, UK) for limiting extinction fluorescence and the fluorescence was detected using a fluorescence microscope (Axioscope, Zeiss).
<IP_ADDRESS>. [³⁵S]-Methionine or [³H]-Ethanolamine Radiolabeling of B. canis Culture and Immunoprecipitation
[³⁵S]-methionine radiolabeling of in vitro cultures of B. canis and immunoprecipitation experiments were performed as described in Drakulovski et al. (supra). Briefly, the [³⁵S]-methionine-radiolabeling was performed with 50 μCi/ml (1200 Ci/mmol, Amersham-Pharmacia Biotech) and a 5% starting parasitaemia. Fractions used from B. canis for immunoprecipitation experiments were: total, culture supernatant (SPA), infected-erythrocyte stroma, purified merozoite, Triton X-114 aqueous (soluble and hydrophilic antigens), and Triton X-114 detergent (insoluble and hydrophobic antigens) fractions, as source of radiolabeled antigens (10⁶ cpm). The [³H]-ethanolamine radiolabeling of the in vitro culture from B. canis was performed with 50 μCi/ml of radiolabeled component (25 μCi/mmol, Amersham-Pharmacia Biotech) with a 5% starting parasitaemia and immuno-precipitation experiments were performed with the total and SPA fractions as the source of [³H]-ethanolamine radiolabeled antigens (10⁶ cpm) from B. canis.
<IP_ADDRESS>. Protein Phase Separation by TX-114 Treatment
The proteins of B. canis from the [³⁵S]-methionine radiolabeled merozoite and infected erythrocyte stroma fractions were phase separated in Triton X-114 (Sigma) as described in Precigout et al. (1991, Infect. Immun., vol. 59, p. 2799-2805).
2.1.4. Erythrocyte Binding Assay
100 μg of His-Bc28.1 protein or His-GST (as a control) were purified under native condition according to the manufacturer's instructions (Qiagen). They were then incubated with 50 μl of canine red blood cells in 1 ml of PBS during 1 h at room temperature. Erythrocytes were harvested by centrifugation (2 min, 200×g) and resuspended in 200 μl of PBS. The suspension was then layered onto a 400 μl silicon oil cushion (Aldrich). After centrifugation (4 min, 3000×g), the supernatant and the silicon oil were discarded and the proteins bound to erythrocytes were eluted by 75 μl of 0.5 M of PO₄NaCl. Eluted proteins were resolved by SDS-PAGE and detected by an anti His-tag monoclonal antibody (Qiagen) at a 1/20.000 dilution in Western blot using the Super Signal West Pico Chemoluminescent Substrate kit according to manufacturer's instructions (Pierce).
2.1.5. Analysis of Parasitic Antigens Localised on the Surface of B. canis-Infected Erythrocytes
An in vitro culture of B. canis was firstly radiolabeled with [³⁵S]-methionine as previously described. Erythrocytes were then collected and were biotinylated in a solution of EZ link® sulfoLC NHS biotin (Pierce) (1M in PBS, pH 7.2) during 30 min at room temperature. Then, erythrocytes were washed three times with PBS and the biotinylated extract was passed on a silicone oil cushion (Aldrich), to eliminate lysed erythrocytes. After a centrifugation (20 min, 700×g), intact erythrocytes from the pellet were washed with PBS, lysed and processed for immunoprecipitation experiments as described in Drakulovski et al. (supra). Immunoprecipitations were performed with the α-His-Bc28.1C antiserum as previously described or with vaccinated/challenged serum. These vaccinated/challenged sera had been produced by giving dogs three vaccinations with an SPA, followed by a homologous challenge. Such sera had been produced for B. canis isolate A (α-A), isolate B (α-B), and B. rossi isolate F (α-F) parasites. The corresponding pre-immune dog sera were also tested as negative controls. Then, immunoprecipitated proteins were separated by SDS-PAGE and the gel, rather than to be treated for revelation of immunoprecipitation experiments, was blotted on a nitrocellulose membrane. Biotinylated proteins from the surface of erythrocytes were then revealed by incubating the membrane with a Streptavidin-POD component (Roche) at a 1/2000 dilution and by using the Super Signal® West Pico Chemoluminescent Substrate kit according to the manufacturer's instructions (Pierce). Once the total biotinylated proteins from the surface of the red blood cells were revealed, the Western blot was autoradiographed on Biomax MR film (Eastman Kodak Co) in order to certify the parasitic origin of the biotinylated proteins.
<IP_ADDRESS>. Determination of the Strength of Erythrocyte-Membrane Binding
In an attempt to analyse if the potential surface antigens from B. canis immunoprecipitated by the α-His-Bc28.1C antiserum were only attached stuck on the surface of the erythrocytes rather than being a true surface integrated antigen, the strength of their interaction with the surface of infected erythrocytes was evaluated. Erythrocytes from an in vitro culture of B. canis were radiolabeled, biotinylated and passed through a silicon oil cushion, as previously described. Intact erythrocytes were collected, incubated with an equal volume of NaCl at a concentration varying from 0.5 to 2M during 2 min at room temperature. Then, the eluate was analysed in Western blot with the α-His-Bc28.1C or with the pre-immune rabbit serum as control.
2.2. Results
2.2.1. Biochemical Characterization of the Bc28.2 Protein
The 504 bp Bc28.2 clone, was cloned in the pGEX vector to produce a purified GST-Bc28.2 recombinant protein of around 35 kDa (FIG. 10, A) that was used to produce a polyclonal antibody in mice. This α-GST-Bc28.2 serum reacts weakly but specifically in immunoprecipitation with a 45 kDa protein in the total fraction (FIG. 10, B, lane 3, indicated by an asterisk). This 45 kDa protein was also detected by the serum in the merozoite fraction but not in the stroma and SPA fractions of B. canis (data not shown). As controls, an unrelated anti-GSTBcvir15 was reactive only with its 15 kDa protein (FIG. 10, B, lane 1) and the pre-immune sera were negative (FIG. 10, B, lanes 2 and 5). The 28/26 kDa doublet of proteins immunoprecipitated by the α-His-Bc28.1C were never immunoprecipitated by the α-GST-Bc28.2 serum. Similar results were obtained with isolate B of B. canis.
In conclusion: the α-GST-Bc28.2 serum reacts with a 45 kDa protein but not with the 28/26 kDa protein doublet recognized by the α-His-Bc28.1C serum.
2.2.2. Biochemical Characterization of the Bc28.1 Protein
Two recombinant Histidine tagged-Bc28.1 proteins, without the N-terminal part of Bc28.1, but with or without the GPI anchor at the C-terminal part, designated His-Bc28.1C (V¹⁶-V²⁵⁶) and His-Bc28.1 (V¹⁶-K²³³) respectively, were purified (FIG. 12). The His-Bc28.1C protein was purified under denaturing conditions and was injected into a rabbit to produce a polyclonal serum (α-His-Bc28.1C). The His-Bc28.1 protein was purified under native conditions and was used for the erythrocyte binding assay (section 2.1.4).
<IP_ADDRESS>. The Bc28.1 Protein is a GPI Anchor Protein
A metabolic labelling of a B. canis lysate with [³H]-ethanolamine, confirmed the GPI nature of the hydrophobic C-terminal peptide of Bc28.1 product since a single ³H labeled protein of 28 kDa was specifically immunoprecipitated with the α-His-Bc28.1 C serum (FIG. 13, C, lane 2). The pre-immune serum was unreactive (FIG. 13, C, lane 1).
2.2.3. Reactivities of the α-His-Bc28.1C Serum in Immunoprecipitation Assays
<IP_ADDRESS>. Reactivity on Total Antigens and Soluble Parasitic Antigen (SPA).
A doublet of 28/26 kDa was recognised in the total fraction of B. canis by the α-His-Bc28.1C serum but only the 26 kDa protein was detected in the supernatant, i.e. SPA fraction (FIG. 12, A, lanes 2). Moreover, this doublet of 28/26 kDa proteins corresponded to proteins that were specifically recognized by the anti-A vaccinated/challenged serum (FIG. 13, A, lanes 3). Pre-immune sera from rabbit or dog were unreactive (FIG. 13, A, lanes 1 and 4, respectively).
<IP_ADDRESS>. Reactivity on Fractionated Antigens
[³⁵S]-methionine radiolabeled parasitised red blood cells were lysed with streptolysin. The sample was centrifuged and the supernatant (erythrocyte stroma fraction) was collected. The pellet (merozoite mixed with ghost) was processed through a Percoll gradient to collect enriched fractions of purified radiolabeled merozoites (merozoite fraction). One part of the merozoite and infected erythrocyte stroma fractions was used for phase separation of the proteins in TX-114. Immunoprecipitation experiments with the α-His-Bc28.1C serum were performed using erythrocyte stroma and merozoite fractions and their corresponding TX-114 aqueous- (soluble antigens, indicated Aq.) and detergent- (insoluble antigens, indicated Det.) fractions, as sources of radiolabeled antigens of B. canis (FIG. 13, B).
This shows that the α-His-Bc28.1C serum (FIG. 13, B, lanes 2) detects the 28 kDa antigen in the merozoite fraction and that this protein is present in the detergent phase, suggesting it's an insoluble antigen (FIG. 13, B, lane Det). In contrast, the 26 kDa antigen is detected in the stroma of infected erythrocyte and this protein is present in the aqueous phase, suggesting it's a soluble protein (FIG. 13, B, lane Aq).
Similar results were obtained with the isolate B (data not shown).
2.2.4. Localization of the Bc28.1 Protein by Immunofluorescence Assays
The pattern of fluorescence of the α-His-Bc28.1C serum on fixed infected erythrocytes from the isolate A of B. canis (FIG. 13, D) shows a merozoite surface labelling (picture II, as indicated by an arrow). Moreover, a strong labelling of vesicles that are present in the stroma of the infected erythrocyte was also obtained (Picture I, indicated by an arrow on the tetrad form).
2.2.5. Recognition of Bc28.1 by a B. rossi Antiserum
A vaccination/challenge serum against B. rossi, isolate F, was used in immunoprecipitation of ³⁵S labeled B. canis isolate B total antigens, which antigens had first been separated with TX-114 into a hydrophobic (detergent: Det.) and a hydrophilic (aqueous: Aq.) phase. This heterologous antiserum precipitated the 28 kDa form of Bc28.1 in the hydrophobic phase, and both the 26 and the 28 kDa form in the hydrophilic phase (FIG. 11, lanes 3 and 7), all visible just below the indicated 30 kDa marker band location. Positive and negative control antisera are included.
2.2.6. The Bc28.1 Protein Binds to Erythrocytes
The ability of the Bc28.1 protein to bind to the surface of infected erythrocytes was determined by performing an erythrocyte binding assay (FIG. 14, A). As presented in FIG. 14 (A, lane 2), the His-Bc28.1 protein was detected in Western blot by the anti-His monoclonal antibody, indicating that this protein is able to bind to canine erythrocytes. As control, no reactivity was observed when the test was performed with the unrelated His-GST (FIG. 14, A, lane 1).
2.2.7. The Bc28.1 Protein is an Erythrocyte Surface Antigen
Biotinylated intact erythrocytes, resulting from a [³⁵S]-methionine radiolabeling of an in vitro culture of B. canis (isolate A), were lysed and processed for immunoprecipitations experiments with vaccinated/challenged serum against the isolate A of B. canis (α-A) or with the α-His-Bc28.1C antiserum, and with their corresponding pre-immune sera. Immunoprecipitated proteins were separated by SDS-PAGE, the gel was blotted on a nitrocellulose membrane and biotinylated proteins from the surface of erythrocytes were revealed (FIG. 14, B, II). Once the total biotinylated proteins from the surface of the red blood cells were revealed, the Western blot was autoradiographed in order to certify the parasitic origin of the biotinylated proteins (FIG. 14, B, I). Whereas the α-His-Bc28.1C antiserum immunoprecipitated a 28/26 kDa doublet of proteins (FIG. 14, B, I, lane 2), this experiment showed that only the 28 kDa protein was biotinylated (FIG. 14, B, II, lane 2), indicating that the 28 kDa protein from the doublet is an integrated surface erythrocyte antigen of B. canis. This biotinylated 28 kDa protein was also immunoprecipitated by the α-A serum (FIG. 14, B, II, lane 3). Pre-immune sera were negative (FIG. 14, B, lanes 1 and 4).
<IP_ADDRESS>. Determination of the Strength of Erythrocyte-Membrane Binding
In an attempt to analyse if the 28.1 surface antigen from B. canis immunoprecipitated by the α-His-Bc28.1C antiserum was only attached to the surface of the erythrocytes rather than being associated with it, the strength of the interaction with the surface of infected erythrocytes was evaluated.
Radiolabeled and biotinylated intact erythrocytes were treated with an NaCl solution at a concentration varying from 0.5 to 2M. This showed the 28 kDa protein was not eluted from the surface of the erythrocyte even at a 2M concentration of NaCl. This proves that it is a true surface integrated antigen of B. canis.
In conclusion: the biochemical characterization of the Bc28.1 protein showed that the α-His-Bc28.1C serum recognized a 28/26 kDa doublet of proteins.
Both the 28 and 26 kDa proteins are recognized by immune serum of dogs infected by B. canis, suggesting that they are excellent candidates for a recombinant vaccine against infection with Babesiidae.
The data indicate that the 28 kDa is an insoluble protein with a GPI-anchor. The protein is associated with the surface of the merozoite and the infected erythrocyte. The 26 kDa protein is a soluble parasite antigen (SPA) that was identified in the infected erythrocytic and supernatant fractions. The characterisation of the 26 kDa protein as a secreted protein is in agreement with the presence of a cleavable peptide signal at the N-terminal part of the Bc28.1 protein and with the presence in vesicles within the erythrocytes stroma as detected by IFA.
Firstly, the data indicates that the Bc28.1 protein binds to erythrocytes, indicating an interaction of this protein with a ligand from the surface of the erythrocyte. As the 28 kDa product was demonstrated to be associated with the surface of the merozoite, it indicates that its infection of an erythrocyte involves this 28 kDa protein.
Secondly, the data shows also that the 28 kDa form is a surface located antigen. This analysis might also detect soluble antigen that attaches to the surface of infected erythrocytes. However, the fact that treatment of intact erythrocytes with a 2M solution of NaCl was unable to elute the Bc28.1 protein and that the biotinylated surface antigen detected is a 28 kDa protein (i.e. the form that is not a soluble antigen), proves that the 28 kDa protein is firmly associated with the infected erythrocyte's outer membrane. This is indicative of a function of the protein in the binding and coagulation of (infected) erythrocytes. Indeed, agglutination of infected erythrocytes was already described for B. canis (Schetters et al., 1997, Parasitology, vol. 115, p. 485-493). Thus the infected erythrocyte's surface located 28 kDa protein binds to an (infected) erythrocyte component in order to form aggregates that enable the parasite to infect new erythrocytes without becoming exposed to the organism's immune system.
The two functions of the 28 kDa form of the Bc28.1 protein deduced from these data (i.e. invasion and coagulation) indicate that this protein plays a crucial role in the survival of the parasite. Indeed, these two mechanisms are essential for the parasite to evade the host immune system.
Example III Vaccinations with Bc28.1 and Bc28.2 Protein Subunit Vaccines
3.1. Techniques Used
3.1.1. Animals
Male and female dogs, for instance Beagles of 6 months old, will be housed in the proper facilities. Several groups will be formed of appropriate size, based on random assignment. Blood samples will be taken before the start, and at several times during the experiment. The animal's general health will regularly be checked.
3.1.2. Vaccines
Bc28.1 and/or Bc28.2 protein will be produced for instance in a baculovirus expression vector system or in the Roche in vitro expression system. Proteins will be characterised through Western blots, quantitated preferably by an Elisa, and formulated, preferably with Quil A.
3.1.3. Vaccinations
Dogs will receive a single dose of vaccine, at two time points, with an interval of approximately three weeks. Injections will be subcutaneous.
At weekly interval blood samples will be drawn, to prepare serum, for serological analysis, preferably by Elisa.
At approximately two weeks after the second vaccination a challenge infection will be given, using an appropriate dose of live B. canis parasites.
Animals will be monitored for clinical signs of infection for a period of 14 days after challenge infection. Special attention will be given to behaviour, spleen size, size of lymph nodes, colour of the mucous membranes of mouth and eyelid, and the capillary refill time. Clinical scores will be expressed as a numeric value as described in Schetters et al., 1994 (Vet. Parasitol., vol. 52, p. 219-233).
During the challenge observation time, daily blood smears will be prepared from cit rated blood, these will be stained, and the number of parasite-infected erythrocytes will be counted. Daily haematocrit measurements will also be made.
After 14 days of challenge infection, dogs will receive chemotherapeutic treatment with Carbesia®, to cure the infection.
Example IV Reduction of Invasion by Babesia Parasites into Erythrocytes with Specific Antibodies
A rabbit polyclonal antiserum was used to prove the capability of antibodies specific for Bc28.1 protein to significantly reduce the invasion of Babesia parasites into erythrocytes.
4.1. Techniques Used
Standard Babesia cultures on dog erythrocytes were performed as described (Schetters et al., 1994, supra).
α-His-Bc28.1C antiserum had been produced as described above (section 2.1.2). In that same experiment rabbit pre-immune serum was obtained, which does not react with Bc28.1 protein (see FIG. 13). These sera were added to Babesia parasite cultures, either pure, or mixed 1:1, in the following scheme:
Serum sample nr 1: pure α-His-Bc28.1C antiserum
Serum sample nr 2: α-His-Bc28.1C antiserum and pre-immune serum mixed 1:1
Serum sample nr 3: pure pre-immune serum.
Suspension cultures contained 1% (v/v) dog red blood cells of which 1% was infected with Babesia canis parasites.
To triplicates of such suspension cultures 1:10 volume of the serum samples was added (160 μl serum(-mix) to 1.44 ml of culture), resulting in a final amount of the specific α-His-Bc28.1C antiserum in the cultures of 10, 5 or 0% v/v.
The cultures with the sera were incubated overnight, after which blood smears were prepared to determine the level of parasitaemia, by counting the number of erythrocytes that were parasite-infected by microscopy.
4.2. Results
The results of the parasite invasion reduction assays are presented in Table 6, and depicted in the graph of FIG. 15. From this it is evident parasitaemia in erythrocyte-cultures containing α-His-Bc28.1C antiserum was significantly reduced in comparison to cultures with only a specific (pre-immune) rabbit serum. The reduction of the invasion amounted to 25%, as the level of parasite infected erythrocytes was reduced from 28 to 21%.
Even in the 1:1 diluted sample of α-His-Bc28.1C serum effectively this same level of invasion reduction was reached, see Table 6
TABLE 6 results of parasite-invasion reduction assays. Parasitaemia Serum Amount of in triplicate cultures sample α-His-Bc28.1C A B C Mean St. dev. 1 10% 20% 22% 21% 20.8% 0.9% 2 5% 19% 20% 21% 20.0% 0.9% 3 0% 29% 28% 28% 28.4% 0.7%
Legend to the Figures
FIG. 1: Amino acid alignment of Bc28.1 and Bc28.2 proteins
Identities between the two sequences are indicated by asterisks and homologies by single or double dots.
For Bc28.2, the signal peptide located at the N-terminal part, and for Bc28.1 the signal peptide and the GPI anchor located at the C-terminal part are bolded. Their cleavable sites are indicated by vertical arrows.
FIG. 2: Amino acid alignment of Bc28.1 proteins from geographically and genetically disparate B. canis field isolates.
Identities between the different sequences are indicated by asterisks and homologies by single or double dots.
The signal peptide located at the N-terminal part, and the GPI anchor located at the C-terminal part of the Bc28.1 proteins are bolded.
FIG. 3: Nucleotide sequence alignment of the nucleic acids encoding the Bc28.1 and Bc28.2 proteins according to the invention.
Identities between the two sequences are indicated by asterisks.
The positions of the initiation- and stop codons for the Bc28.1 and the Bc28.2 sequences are indicated; the corresponding nucleotides are bolded.
The location and 5′-3′ orientation of primers derived from the Bc28.1 and Bc28.2 sequences are indicated by arrows and bolded; for pr 3 there is only a degenerated match.
FIG. 4: Nucleotide sequence alignment of the nucleic acids encoding the Bc28.1 protein from geographically and genetically disparate B. canis field isolates.
Identities between the two sequences are indicated by asterisks.
The position of the initiation and stop codon for each of the Bc28.1 sequences are indicated and bolded.
The location and 5′-3′ orientation of primers are indicated by arrows.
FIG. 5: Identification of the partial Bc28.2 genomic DNA fragment from B. canis.
The Bc28.2 genomic DNA fragment was isolated by PCR with primer-couple pr 3 and E4 on genomic DNA from isolate A, of B. canis (lane 1). As negative controls, each of the primers pr 3 and E4 was also tested (lanes 2 and 3, respectively).
FIG. 6: Analysis of the specificity of reverse primers Rspe3C and Rspe3G for their respective Bc28.1 and potential Bc28.2 coding sequences.
PCR's were performed by using the A8 biological clone of B. canis as DNA template. The specificity of the reverse primer Rspe3C for the Bc28.1 coding sequence (I) and of the reverse primer Rspe3G for the potential Bc28.2 coding sequence (II) was tested by their use in a PCR reaction with the forward primer Cons3.1 (A) or with the forward primer Fspe3 (B). Amplimers resulting from these PCR reactions (lane PCR) were then digested with the restriction enzyme HinfI (H) or MstI (M). (C) Recapitulative scheme of the deduced restriction maps of the Bc28.1 coding sequence, partial genomic fragment Bc28.2 and Bc28.2 coding sequence.
FIG. 7: Molecular identification of the Bc28 multigene family by hybridisation experiment.
The PCR fragment FSpe3/Rspe4 from the Bc28.1 cDNA sequence was used as a probe for hybridisation experiments. (A) Southern blot of genomic DNA from the isolate A of B. canis digested with the restriction enzymes XbaI (lanes 1), XhoI (lanes 2), Rs aI (lanes 3), NotI (lanes 4) and EcoRI (lanes 5). (B) Northern blot of total RNA from the isolate A of B. canis. (C and D) PFGE separation of entire (C) or NotI-digested (D) chromosomes of the isolates A and B of B. canis. (I) Ethidium bromide staining of the gel. (II) Corresponding gels hybrid ised with the Bc28.1 probe.
FIG. 8: Recapitulative scheme of comparative restriction maps of the Bc28.1 and Bc28.2 coding sequences.
(A) Comparative restriction maps of the Bc28.1 and Bc28.2 coding sequences between themselves within the biological clone A8 from B. canis. (B) Comparative restriction maps of the Bc28.1 coding sequence between geographically and genetically disparate B. canis field isolates. (C) Comparative restriction maps of the potential Bc28.2 coding sequence between geographically and genetically disparate B. canis field isolates. The restriction maps were performed on the basis of DNA digestion with Al uI, EcoRI, HinfI, Mb oI and MspI.
FIG. 9: Predictive hydrophobicity profile of the Bc28.1 protein
The predicted N-terminal signal peptide and C-terminal GPI anchor are boxed.
FIG. 10: Identification of the protein encoded by the Bc28.2 coding sequence of B. canis
(A) SDS-PAGE of the purified GST-Bc28.2 recombinant protein. (B) Reactivity of the α-GST-Bc28.2 on protein extract from the total fraction of [³⁵S]-methionine radio labelling of an in vitro culture of B. canis (isolate A). Immunoprecipitations were performed with the immune α-GST-Bcvir15 (lane 1), pre-immune α-GST-Bc28.2 (lane 2), immune α-GST-Bc28.2 (lane 3), immune α-His-Bc28.1C (lane 4), pre-immune α-His-Bc28.1C (lane 5) and immune α-His-Bd37 (lane 6) sera.
FIG. 11: Immunoprecipitations of hydrophilic and hydrophobic proteins of B. canis
Total, labeled (Aq.) and detergent-separated (Det.) antigens of B. canis isolate B were immunoprecipitated with: a vaccination/challenge serum directed against B. canis isolate A (α-A, lanes 1 and 5), an immune serum directed against B. canis isolate B (α-B, lanes 2 and 6), a vaccination/challenge serum directed against B. rossi isolate F (α-F, lanes 3 and 7), or an uninfected dog serum (N, lanes 4 and 8).
FIG. 12: Purification of recombinant His-Bc28.1 proteins.
SDS-PAGE of the purified recombinant His-Bc28.1C and His-Bc28.1 proteins. The His-Bc28.1C protein was purified under denaturing conditions whereas the His-Bc28.1 protein was purified under native conditions.
FIG. 13: Biochemical characterization of the Bc28.1 protein.
Immunoprecipitation experiments of [³⁵S]-methionine (A and B) or [³H]-ethanolamine (C) radiolabeled antigens from B. canis (isolate A). Immunoprecipitations were performed with pre-immune α-His-Bc28.1C serum (lanes 1), immune α-His-Bc28.1C serum (lanes 2), immune α-A (from a dog vaccinated/challenged with the isolate A of B. canis) serum (lanes 3) and pre-immune α-A serum (lanes 4). Triton-X114 insoluble (Det.) and soluble (Aq.) antigens from the merozoite and stroma fractions were immunoprecipitated with the immune α-His-Bc28.1C serum. (D) Location of the Bc28.1 protein by immunofluorescence assays. Arrows respectively indicate the labelling of vesicles within the stroma of infected erythrocytes (picture I) and of the surface of the merozoite (picture II).
FIG. 14: Analysis of the erythrocyte binding property of the Bc28.1 protein and of the surface erythrocyte located antigens of B. canis.
Erythrocyte binding assays were performed both with 100 μg of purified His-Bc28.1 protein (lane 2) or His-GST (lane 1) that were incubated with canine red blood cells. The ability of each protein to bind to erythrocyte components was revealed by an anti His-tag monoclonal antibody (Qiagen) at a 1/120.000 dilution in Western blot. (B) Parasitic antigens localised on the surface of B. canis-infected erythrocytes were analysed by immuno-precipitation experiments with the α-His-Bc28.1C serum (lanes 1), immune α-His-Bc28.1C serum (lanes 2), immune α-A (from a dog vaccinated/challenged with the isolate A of B. canis) serum (lanes 3) and pre-immune α-A serum (lanes 4). Briefly, biotinylated and [³⁵S]-methionine radiolabeled intact erythrocytes were lysed and processed for immunoprecipitation experiments with the vaccinated/challenged serum against the isolate A of B. canis (α-A) or with the α-His-Bc28.1C antiserum, and with their corresponding pre-immune sera. Immunoprecipitated proteins were separated by SDS-PAGE, the gel was blotted on a nitrocellulose membrane and biotinylated proteins from the surface of erythrocytes were revealed (II). Once the total biotinylated proteins from the surface of the red blood cells were revealed, the Western blot was autoradiographed in order to certify the parasitic origin of the biotinylated proteins (I).
FIG. 15: Results of parasite-invasion reduction assays
Cultures of Babesia canis parasites on erythrocytes were incubated or not with different amounts of a polyclonal rabbit antiserum specific for protein His-28.1C. The resulting effect on the parasitaemia was determined by counting the relative number of parasite-infected erythrocytes by microscopy.
1. An isolated amino acid sequence comprising amino acids 17 to 180 of SEQ ID NO:
2. 2. The sequence according to claim 1, comprising SEQ ID NO
2. 3. An isolated nucleic acid that encodes the sequence according to claim
1. 4. The nucleic acid according to claim 3 comprising SEQ ID NO:
1. 5. An isolated cDNA fragment comprising the nucleic acid according to claim
3. 6. A recombinant DNA molecule comprising the nucleic acid according to claim 3, under the control of a functionally linked promoter.
7. A live recombinant carrier comprising the nucleic acid according to claim
3. 8. A host cell comprising the nucleic acid according to claim
3. 9. A kit comprising the nucleic sequence of SEQ ID NO:1.
|
Gulp Imagemin - recursively
I have an uploads folder with images inside, without particular folder structure.Is there any way I can compress all images using gulp?
Here is what I tried.
const gulp = require('gulp');
const imagemin = require('gulp-imagemin');
gulp.task('imagemin', () =>
gulp.src('wp-content/uploads/*')
.pipe(imagemin())
.pipe(gulp.dest('wp-content/uploads/*'))
);
Try to use 'wp-content/uploads/**/*.'+(jpeg|jpg|png|gif|svg)
In other words: ** means "directory of any depth" and extensions makes sure that you're not passing non-image uploads to images minificator
Are you sure this s valid syntax? I get an error - jpeg is not defined?
sorry, I've mispositioned closing apostrophe, it should be a string at a whole: 'wp-content/uploads/**/*.+(jpeg|jpg|png|gif|svg)'
this path should be used as both src and dest ?
Only src, for dest you need to define plain path to directory instead of wildcard, wp-content/uploads in your case
works like charm! thank you!
|
import {Filter, ParseService, Req} from "@tsed/common";
import {OAuthBearerOptions} from "../protocols/BearerStrategy";
@Filter()
export class OAuthParamsFilter {
constructor(private parseService: ParseService) {
}
transform(expression: string, request: Req) {
const options = request.ctx.endpoint.get(OAuthBearerOptions) || {};
return this.parseService.eval(expression, options);
}
}
|
1. Introduction {#sec1-nutrients-14-02502}
Low-grade chronic inflammation plays a pivotal role in the pathogenesis and maintenance of pathological conditions such as obesity, metabolic syndrome, diabetes, and other chronic diseases \[[@B1-nutrients-14-02502]\]. The dietary treatment has been shown to effectively reduce the production of pro-inflammatory eicosanoids, thus representing a remarkable non-pharmacological approach to these conditions \[[@B2-nutrients-14-02502]\]. Recently, growing interest in the benefits of polyphenols of plant origin and omega-3 fatty acids has led scientific research to evaluate their antioxidant and anti-inflammatory effects in in vitro and in vivo studies \[[@B3-nutrients-14-02502],[@B4-nutrients-14-02502],[@B5-nutrients-14-02502],[@B6-nutrients-14-02502]\].
Since pregnancy itself represents a pro-inflammatory state, dietary and nutraceutical approaches to reduce reactive oxygen species (ROS) and eicosanoid production have been proposed to avoid more intrusive pharmacological treatments and improve pregnancy outcomes for the mother and the child \[[@B7-nutrients-14-02502]\].
Gestational diabetes mellitus (GD) represents a common pregnancy complication linked to high levels of inflammation \[[@B8-nutrients-14-02502]\]. Changes driven by the fetoplacental unit in the maternal organism led to metabolic stress over the insulin, glucose, and lipid homeostatic systems \[[@B9-nutrients-14-02502],[@B10-nutrients-14-02502]\]. Patients with GD show a damaged, altered metabolism; GD has been described as a clinical phenotype of an accelerated metabolic syndrome characterized by anti-insulin effects and dyslipidemia. This condition has been shown to negatively impact the health of both the mother and the offspring \[[@B11-nutrients-14-02502]\]. In fact, in the long term, the mother displays an increased risk of developing obesity, type 2 diabetes, hypertension, and heart disease \[[@B12-nutrients-14-02502]\]. Moreover, the critical intrauterine environment promotes predisposition to childhood obesity and diabetes through epigenetic fetal programming \[[@B13-nutrients-14-02502],[@B14-nutrients-14-02502],[@B15-nutrients-14-02502]\].
Multiple evidence suggests that polyunsaturated fatty acids (PUFA) may influence physiological and pathological status modulating metabolism, inflammation, and oxidative process. In several studies, metabolic differences in maternal and fetal PUFA have been reported between mothers with and without GD \[[@B16-nutrients-14-02502]\]. Both omega-3 and omega-6 fatty acids are involved in the process of inflammation and its resolution, generating eicosanoids and bioactive lipid mediators. The arachidonic acid/eicosapentaenoic acid ratio (AA/EPA) is a relevant biomarker of PUFA status, indicating the balance between omega-6 and omega-3 and their derived bioactive lipid mediators \[[@B17-nutrients-14-02502],[@B18-nutrients-14-02502],[@B19-nutrients-14-02502]\]. This ratio represents a sensitive marker of dietary habits, and it is useful to follow omega-3 integration compliance during clinical studies. FA composition of the blood is a biomarker of dietary fat intake, with plasma phospholipids reflecting short-term dietary fat intake compared to red blood cell membrane phospholipids that are modified after one or two months of fat intake \[[@B20-nutrients-14-02502],[@B21-nutrients-14-02502]\].
The development of GD could be induced by an increase in the inflammatory condition connected to inflammatory cytokines and oxidative stress. Platelet-activating factor (PAF) is an inflammatory mediator and could contribute to GD pathogenesis and pre-eclampsia pathogenesis. PAF levels increase in women with GD from diagnosis to 12 weeks after the diagnosis and are positively correlated with glycated hemoglobin levels and the HOMA index. An increase in PAF values describes a proinflammatory condition of GD and could worsen a condition of oxidative stress and metabolic impairment \[[@B22-nutrients-14-02502]\].
The first aim of the present randomized double-blind trial was to evaluate the metabolic effects on GD patients of anti-inflammatory, antioxidant nutraceutical supplementation with omega-3 fatty acids, anthocyanins, and alpha-cyclodextrins associated with appropriate nutritional coaching versus nutritional coaching and placebo.
The secondary aim was to assess in the whole cohort the role of metabolic and inflammatory markers to predict the severe cases of GD who require drug therapy in addition to an appropriate diet.
2. Materials and Methods {#sec2-nutrients-14-02502}
2.1. Study Design and Population {#sec2dot1-nutrients-14-02502}
From May 2018 to March 2020, we conducted a randomized, double-blind, placebo-controlled monocentric trial at Mangiagalli High Risk Maternity Centre, Fondazione IRCCS Cà Granda Ospedale Maggiore Policlinico, Milan, Italy. The study was approved by the Ethical Committee Milan Area 2 (PRE.D.I.P.2, project identification code 4004, approval number 126 on 28 March 2018).
We included patients between 24 and 28 weeks of gestation who presented a positive result to an Oral Glucose Tolerance Test with 75 gr glucose performed after 24 gestational weeks, according to the International Association of Diabetes and Pregnancy Study Group (IADPSG) recommendations (at least one of the following criteria: baseline glycemia ≥ 92 mg/dL, 1-h glycemia ≥ 180 mg/dL, 2-h glycemia ≥ 153 mg/dL) \[[@B23-nutrients-14-02502]\]. Moreover, maternal age should be ≥ 18 years. Eligible women were recruited during their first obstetric visit at the maternal-fetal medicine outpatient clinics reserved for GD patients. Written formal consent was obtained from all the patients enrolled.
We excluded multiple pregnancies, fetal malformation, maternal diseases (type 1 and type 2 diabetes, hypothyroidism and hyperthyroidism, immunological disorders), and abnormal blood glucose values before 24 weeks of gestation.
2.2. Randomization and Treatment Allocation {#sec2dot2-nutrients-14-02502}
At recruitment, women were randomly assigned to receive either anti-inflammatory nutraceutical supplements (intervention group) or placebo (control group) in sequentially labelled, opaque sealed envelopes. A computer-generated random list arranged labels with a target 1:1 allocation ratio. Participants and care providers were blinded to group assignments. Products should be taken daily for at least 70 days until the last study visit performed at 36--39 weeks of gestation.
Anti-inflammatory nutraceutical supplements included the following:Omega-3 fatty acids (pills, EnerZona Omega3Rx^®^, Enervit, Italia), at a daily dosage of 2.4 gr at breakfast;Anthocyanins (pills, EnerZona Maqui Response Capsule^®^, Enervit, Italia) at a total daily dosage of 108 mg divided into three equal intakes at breakfast, lunch, and dinner;Alpha-cyclodextrins (sachets, EnerZona Maqui Response Buste^®^, Enervit, Italia) at a total daily dosage of 15 gr divided into three equal intakes at breakfast, lunch, and dinner.
The supplementation did not present toxicity and its administration is approved under Italian regulations.
The planned sample size of the trial included 30 subjects in the intervention group and 30 subjects in the control group; it was calculated according to the hypothesis of the reduction of median blood glucose values from 87 to 78 mg/dL in patients receiving supplementation, with power 0.97 and alpha error 0.05. The power was selected according to the estimated effect of the nutraceutical supplementation.
2.3. Dietary Intervention {#sec2dot3-nutrients-14-02502}
All women received nutritional education and a personalized diet by a nutrition expert educator according to the Mediterranean standard diet referrals, the Healthy Eating Plate recommendations of Harvard University School of Public Health, and the reference intake levels of nutrients and energy for the Italian population (LARN) for pregnant women \[[@B24-nutrients-14-02502],[@B25-nutrients-14-02502]\] The daily total energy intake was distributed in three main meals (breakfast, lunch, and dinner) and in two snacks; caloric intake was calculated according to maternal pre-pregnancy BMI and weight gain. The macronutrient composition was balanced as follows: 45% of total energy from carbohydrates, with simple sugar less than 12%; 25--35% of total energy from fat (less than 7% from saturated fat and 10% from PUFA); protein intake satisfied the pregnant requirement as indicated in Recommended Assumption Levels of Energy and Nutrients for Italian Population with 50% of proteins derived from vegetal source and 50% from animal source. The quality of protein intake was regulated by the following frequencies of consumption: meat, preferable white, 2 times/week; fish, 2--3 times/week, with preference for blue fish for optimal intake of omega-3 fatty acids; legumes, 3--4 times/week; eggs, 2 times/week; cheese, 1--2 times/week; ham, 1 time/week; nuts, 20--30 gr every day. Food with high glycemic index was not allowed. Two servings of fruit and three servings of vegetables were daily advised. Olive oil was indicated as the main culinary lipid. Dietary cholesterol was lower than 200 mg/die and fiber intake was about 30 g/die.
Every woman was invited to meet the dietitian every two weeks to evaluate the weight, the fat mass, and the adherence to diet. Moreover, exercise was strongly recommended, and 30-min daily walk was suggested to accomplish this assignment.
2.4. Antenatal Monitoring and Treatment {#sec2dot4-nutrients-14-02502}
All participants were instructed to self-monitor capillary blood glucose levels (fasting and 2-h postprandial measurements) at least three times daily using a standard reflectance meter; recordings of these values were submitted to care providers during the obstetric visit.
Patients received twice-weekly antenatal testing, including ultrasonography for fetal growth and well-being maternal weight body fat mass distribution evaluation using skinfold caliper. In addition, dietary counseling was offered at each visit. The last study assessment was performed after at least 70 days of treatment at 36--39 weeks of gestation. Afterward, women underwent the protocol in use at our Institute for monitoring maternal and fetal well-being and delivery.
Personalized regimens of insulin were prescribed if the median blood glucose values were elevated in relation to fetal growth as assessed by ultrasound (fasting glucose level ≥95 mg/dL or 2-h postprandial glucose level ≥120 mg/dL if the fetal abdominal circumference was below the 75° percentile for gestational age; fasting glucose level ≥90 mg/dL or 2-h postprandial glucose level ≥110 mg/dL if the fetal abdominal circumference was equal to or above the 75° percentile for gestational age). Furthermore, obstetric examinations were performed more frequently in case of pharmacological treatment according to the protocol in use at our Institute.
Baseline characteristics, pregnancy, and neonatal outcomes were recorded for all randomized women. For measurements of metabolic, inflammatory, and antioxidant parameters, blood samples were drawn from all patients at recruitment and at the last study visit; in particular, we analyzed plasmatic glycemia, HbA1c, cholesterol, triglycerides, C-reactive protein, cortisol, erythrocyte fatty acid composition, and PAF.
2.5. Erythrocyte Fatty Acid Composition {#sec2dot5-nutrients-14-02502}
Erythrocytes (RBC) were separated by centrifugation (2000 rpm for 10 min) from heparinized blood drawn at recruitment and at the last study visit performed at 36--39 weeks of gestation and stored at −80 °C until analysis. Cell membranes of RBC (ghosts) were prepared by lysis with hypotonic buffer (phosphate 5 mM, pH 8, EDTA 0.5 mM), precipitated by centrifugation, and washed several times to eliminate hemoglobin residues.
Ghost lipids were extracted with chloroform/methanol according to Folch \[[@B26-nutrients-14-02502]\] and the fatty acid composition was determined by direct derivatization with sodium methoxide in methanol and GC-FID analysis as previously described \[[@B27-nutrients-14-02502]\]. Each sample was spiked with TG C17:0 as internal standard; a standard mixture containing all fatty acid methylesters (Sigma-Aldrich, St. Louis, MO, USA) was injected for calibration each day.
2.6. Plasmatic PAF {#sec2dot6-nutrients-14-02502}
The plasmatic PAF was measured via commercial ELISA kits (Human Platelet Activating Factor ELISA Kit, lower range of detection 0.313 ng/mL, sensitivity 0.188 ng/mL, Catalog Number E-EL-H2199, Elabscience, Houston, TX, USA) using the Biomek 4000 ELISA microplate liquid reagent dispensing automation tool (Beckman Coulter, Brea, CA, USA) and the EL405LS ELISA microplate automated washing system (BioTek Instruments, Winooski, VT, USA). The absorbance of each well was read at a wavelength of 450 nm with a Multiskan FC plate reader (Thermo Scientific, Waltham, MA, USA). The average zero standard optical density was subtracted from all absorbances, and a standard curve was generated using a four-parameter logistic (4-PL) curve fit. The concentration in the test sample was calculated through interpolation along the standard curve by multiplying the result by the dilution factor.
2.7. Statistical Analysis {#sec2dot7-nutrients-14-02502}
Statistical analysis of the data was performed using GraphPad Prism 9 for macOS (GraphPad Software, San Diego, CA, USA. Version 9.3.1 (350)). The median and interquartile range (IQR) were calculated for each variable. The medians were compared using the Mann--Whitney test. The Chi-square test of association was used to evaluate the relationships between categorical variables. A *p*-value \< 0.05 was used as the limit of statistical significance.
3. Results {#sec3-nutrients-14-02502}
Of the 56 eligible subjects, 51 women agreed to participate in this trial. The most common reason for non-participation was a reluctance to undergo treatment. The 51 participants were randomly assigned to either nutraceutical supplements (intervention group, *n* = 26) or placebo (control group, *n* = 25).
Nine patients withdrew from the study (8 in the intervention group and 1 in the placebo group) because of personal issues or gastrointestinal side effects; all of them withdrew within 15 days after randomization. Two participants (1 in the intervention group and 1 in the placebo group) were lost at follow-up since the trial was interrupted by the outbreak of the COVID-19 pandemic that caused problems with nutritional coaching in person.
3.1. Results by Randomization {#sec3dot1-nutrients-14-02502}
Forty women completed the study protocol, of whom 17 were assigned to the intervention group and 23 to the placebo group by randomization ([Figure 1](#nutrients-14-02502-f001){ref-type="fig"}). There were no significant differences as regards age, anthropometric, metabolic, and inflammatory parameters between the two groups at enrollment ([Table S1](#app1-nutrients-14-02502){ref-type="app"}). No significant differences were observed for the same indices after 12 weeks of treatment. In addition, there were no differences between the two groups in maternal and fetal outcomes, including infant weight and birth weight percentile ([Table 1](#nutrients-14-02502-t001){ref-type="table"}).
However, 4 out of 17 women in the intervention group (23.5%) and 2 out of 23 in the control group (8.7%) required pharmacological therapy to regulate blood glucose levels.
In the intervention group, 12 out of 17 enrolled subjects (70.6%) showed a reduction in the RBC AA/EPA ratio at the end of the study, while in the placebo group, 12 out of 23 enrolled patients (52.2%) showed a reduction in the AA/EPA ratio (Chi-square 1.38, *p* = 0.240) ([Figure S1](#app1-nutrients-14-02502){ref-type="app"}, panel A); as described by other authors, these data indicate poor compliance with the integration protocol \[[@B28-nutrients-14-02502]\]. PAF values were not significantly different neither at T0 nor at T12.
3.2. Results by Severity of GD {#sec3dot2-nutrients-14-02502}
Data at T0 of all the subjects enrolled were analyzed as a predictor of severity.
Of the six patients who required pharmacological intervention, 5 out of 6 (83.3%) presented with alterations in basal glycemia, while 2 (33.3%) presented with alterations in post-prandial glycemia. It took up to 8 weeks to reach a glucose control.
Patients with GD who required insulin therapy had a significantly higher BMI and pre-pregnancy weight, subscapular fold, bicipital fold, and triceps fold, as well as arm circumference and wrist circumference at T0 than patients who did not ([Table 2](#nutrients-14-02502-t002){ref-type="table"}).
Subjects who needed pharmacological intervention showed higher plasma triglycerides, CRP levels, and insulin levels at the time of diagnosis than subjects who did not require drug therapy ([Table 3](#nutrients-14-02502-t003){ref-type="table"}).
Subscapular fold and arm circumference in patients who needed insulin remained significantly greater even after 12 weeks of treatment ([Figure 2](#nutrients-14-02502-f002){ref-type="fig"}). In this group, triglyceride levels were even higher twelve weeks after diagnosis compared with subjects on diet therapy alone ([Figure 3](#nutrients-14-02502-f003){ref-type="fig"}).
Infants born to women with GD on drug treatment had a higher birth weight and birth weight percentile than infants born to women with GD who did not require medications (3855 g (IQR 3425--4090) vs. 3165 g (3013--3404) (*p* \< 0.01) and 92nd percentile (IQR 62--96) vs. 35th percentile (IQR 18--61) (*p* \< 0.001), respectively).
To assess the influence of the PUFA levels on the predisposition to the development of complicated GD, we compared subjects within the lower quartile of AA/EPA ratio in RBC at T0 (*n* = 13; AA/EPA \< 28.7; Low AA/EPA) with subjects within the higher AA/EPA ratio quartile (*n* = 13; AA/EPA \> 55.2; High AA/EPA) ([Figure S1](#app1-nutrients-14-02502){ref-type="app"}, panel B).
In the quartile with the lowest AA/EPA ratio, there was only one case of GD in which it was necessary to use drug therapy. In contrast, in the quartile with a higher AA/EPA ratio, there were 3 out of 6.
Subjects with a lower AA/EPA ratio 12 weeks after the diagnosis of GD had lower PAF levels than subjects with a higher AA/EPA ratio (*p* \< 0.05) ([Figure 4](#nutrients-14-02502-f004){ref-type="fig"}).
Subjects with a higher AA/EPA ratio gave birth four days earlier than subjects with a lower AA/EPA ratio (*p* \< 0.05) ([Figure 5](#nutrients-14-02502-f005){ref-type="fig"}).
4. Discussion {#sec4-nutrients-14-02502}
Our randomized double-blind trial analyzed key maternal metabolic and anthropometric data, gestational age at delivery, and neonatal birth weight between pregnant patients affected by GD receiving nutraceutical supplementation with omega-3 fatty acids, anthocyanins, and alpha-cyclodextrins, or placebo. Both arms of this randomized study underwent a strict dietary follow-up by a nutrition expert educator; this approach supported in a one-to-one manner a diet which increased the intake of food rich in omega-3 fatty acids, reducing the AA/EPA ratio and paring the effect of nutraceutical supplements. No statistically significant differences were observed between the groups in blood and urine measurements of metabolic, inflammatory, and antioxidant parameters.
Two factors likely influenced these results. Firstly, differences could have been covered by the expected effect of the diet, emphasizing its positive effects when multiple assessments of adherence and personalized counseling are provided to patients \[[@B29-nutrients-14-02502]\]. Opposite to this, we reported poor adherence to the supplementation protocol, as shown by the analysis of the AA/EPA ratio changes in RBC from enrollment to the end of the study.
4.1. Maternal Anthropometric Parameters {#sec4dot1-nutrients-14-02502}
Independently from allocation in the treatment and control arms, our study shows that GD patients requiring pharmacological therapy were characterized by different maternal anthropometric and metabolic baseline features. These subjects presented a greater BMI and pre-pregnancy weight, in agreement with current evidence \[[@B30-nutrients-14-02502],[@B31-nutrients-14-02502],[@B32-nutrients-14-02502]\]. Moreover, subscapular fold, bicipital fold, triceps fold, arm circumference, and wrist circumference were greater at the time of diagnosis, and this difference persisted even 12 weeks after diagnosis for subscapular fold and arm circumference.
Lately, since gestational diabetes displays a growing health impact and represents a public health challenge, greater interest has been shown in developing risk stratification and risk-based models of care to predict the need for pharmacological therapy and choose an adequate one \[[@B33-nutrients-14-02502],[@B34-nutrients-14-02502],[@B35-nutrients-14-02502]\].
Our study suggests that including skinfold thickness assessment is an easy, cost-effective tool to use in routine clinical examinations to quantify body fat percentage and describe its distribution. It only requires training to be highly reliable and reproducible. This evaluation could be exploited in addition to the assessment of body composition by bioimpedentional tools, in place of dual-energy X-ray absorptiometry \[[@B36-nutrients-14-02502]\], which is contraindicated during pregnancy and more expensive \[[@B37-nutrients-14-02502]\]. However, this approach is limited by high observer variability, which can be reduced only by following rigorous training and expertise \[[@B38-nutrients-14-02502],[@B39-nutrients-14-02502]\].
4.2. Maternal Triglycerides {#sec4dot2-nutrients-14-02502}
Triglycerides, glycated hemoglobin, insulin, and CRP confirmed their role as valuable predictors of the need for pharmacological hypoglycemic treatment \[[@B40-nutrients-14-02502]\].
An interesting finding of our study is that triglyceride levels were still higher at term in subjects requiring pharmacological therapy for GD, compared to those on diet therapy alone, independently from the arm of randomization and glycemic control. Hypertriglyceridemia has been related to impaired insulin action and β-cell function in pregnancy. This molecular mechanism has been associated with a higher risk of developing GD, even in the case of moderately elevated levels \[[@B41-nutrients-14-02502],[@B42-nutrients-14-02502],[@B43-nutrients-14-02502]\]. However, to our knowledge, there is insufficient evidence on the effects of standard treatment for diabetes on hypertriglyceridemia \[[@B44-nutrients-14-02502]\]. An exciting path for future research could be the inclusion of lipid profiles in subjects who present accelerated fetal growth despite good glycemic control achieved through therapy. The evidence of a slight increase in these values considered altogether could help to identify candidates for therapy or to accelerate decision-making in uncertain contexts.
4.3. Maternal AA/EPA Ratio and PAF {#sec4dot3-nutrients-14-02502}
The AA/EPA ratio appears to predict the metabolic dysfunction of subjects affected by GD. A high AA/EPA ratio at the time of diagnosis of GD is associated with an increase in PAF levels and a greater likelihood of drug therapy in addition to a well-controlled diet. PAF levels have proved to be inflammatory biomarkers in women with GD \[[@B22-nutrients-14-02502]\].
Interestingly, the balance between omega-3 and omega-6 fatty acids also influences gestational age at delivery. A more inflammatory condition appears to anticipate delivery. If confirmed, this data could lead to the introduction of the evaluation of the AA/EPA ratio for a better estimate of the term of gestation.
Triglycerides and AA/EPA values were associated with the need for drug therapy in addition to the diet. Moreover, in spite of good glycemic control, newborns from these subjects were significantly heavier than newborns of mothers who achieved a better lipogram profile.
4.4. Limitations {#sec4dot4-nutrients-14-02502}
The limited size of the two groups represents the most significant limitation of our work; the outbreak of the COVID-19 pandemic prevented us from reaching the planned sample size for each arm of the trial. Further studies with a larger cohort are needed to confirm our results.
Our study population was represented mainly by Caucasian women due to the usual referrals to the hospital involved. Moreover, pre-conception BMI was not considered an exclusion criterion.
In addition, in our study, the glycemic control assessment included only changes in hematic glycated hemoglobin and the proportion of patients presenting median blood glucose values 10 mg/dL below the target at the end of the study. Current evidence suggests that slight differences in response to nutritional and environmental factors are known to determine epigenetic modifications that could influence fetal metabolic programming \[[@B15-nutrients-14-02502]\]. Moreover, recent studies reveal that fetuses of GD women present alterations compared to controls even in the case of minimal glycemic changes, which are undetectable with standard clinical tests \[[@B45-nutrients-14-02502]\]. This is in line with the significant role of triglycerides and AA/EPA ratio observed in our study as regards both the need for insulin and newborn weight.
5. Conclusions {#sec5-nutrients-14-02502}
The effects of supplementation with omega-3 and antioxidants on metabolic and inflammatory parameters of women with GD were not significant compared with strict and one-to-one careful nutritional consultation that paired the effects of supplementation.
The role of the nutritional counselor and the role of doctors in charge of supporting additional therapies appeared to be of major importance as regards compliance with nutritional recommendations and nutraceutical support.
Remarkable differences were found when comparing subjects with GD who needed supportive pharmacological therapy with those who did not. In the former group, the anthropometric and metabolic parameters, particularly the skin folds and the level of triglycerides, and the AA/EPA ratio, were significantly altered in early gestation. Our preliminary data suggest that these parameters could be used for the early identification of GD subjects with higher inflammatory levels and likely candidates for pharmacological treatment, although this should be confirmed by further studies on larger cohorts. Adipose tissue is per se a proinflammatory organ and its key role in the severity of metabolic syndrome was observed in this cohort of pregnant women with gestational diabetes. Indeed, an adequate assumption of omega-3 in women with GD, either by a controlled diet or by nutraceutical supplementation, reduces the need for pharmacological therapy.
All authors thanks Equipe Enervit for the support to the study.
The following supporting information can be downloaded at: <https://www.mdpi.com/article/10.3390/nu14122502/s1>, Table S1: Age, anthropometric, metabolic, and inflammatory parameters, birth weight and birth weight percentile of the intervention group and the placebo group. Figure S1: The plot of individual AA/EPA ratio in the intervention group (IG) (n = 17) and in the placebo group (PG) (n = 23) at T0 and T12 (panel A); quartiles distribution of individual AA/EPA ratio at T0 (panel B).
Click here for additional data file.
Conceptualization, A.M.R., A.S., E.F., and G.R.; methodology, A.M.R., E.F., G.R., and G.P. (Gabriele Piuriand); software, G.P. (Gabriele Piuriand); validation, G.P. (Gabriele Piuriand); formal analysis, G.P. (Gabriele Piuriand); investigation, A.S., C.M.S., G.P. (Giulia Privitera), G.R., L.B., and P.A.C.; resources, E.F.; data curation, A.M.R., C.M.S., and G.P. (Gabriele Piuriand); writing---original draft preparation, A.M.R., C.M.S., and G.P. (Gabriele Piuriand); writing---review and editing, A.M.R., E.F., G.R., P.A.C., and V.M.; visualization, A.M.R., C.M.S., and G.P. (Gabriele Piuriand); supervision, A.M.R., E.F., and G.R.; project administration, E.F.; funding acquisition, A.M.R. and E.F. All authors have read and agreed to the published version of the manuscript.
The study was conducted in accordance with the Declaration of Helsinki and approved by the Ethics Committee Milan Area 2---Clinical Trial Center Fondazione IRCCS Ca' Granda Ospedale Maggiore Policlinico, project identification code 4004, approval number 126\_2018 on 28 March 2018.
Informed consent was obtained from all subjects involved in the study.
A.M.R. declares a contract as consultant of Zinzino AB, Sweden. Enervit SpA provided the nutraceutical support and the placebo to conduct this study; the company had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, and in the decision to publish the results.
::: {#nutrients-14-02502-f001 .fig}
Study enrollment and randomization.
::: {#nutrients-14-02502-f002 .fig}
Longitudinal trend of anthropometric parameters of subjects with GD who required therapy to normalize blood glucose levels (GD+PT) at enrollment (T0; *n* = 6) and at and the end of the study after 12 weeks (T12; *n* = 6) with subjects who did not require pharmacological intervention (GD) at T0 (*n* = 45) and at T12 (*n* = 34). GD---subjects with gestational diabetes mellitus who did not require pharmacological therapy. GD+PT---subjects with gestational diabetes mellitus who required pharmacological therapy. T0---at enrolment. T12---after 12 weeks.
::: {#nutrients-14-02502-f003 .fig}
Longitudinal trend of plasmatic metabolic and inflammatory parameters of subjects with GD who required therapy to normalize blood glucose levels (GD+PT) at enrollment (T0; *n* = 6) and at the end of the study after 12 weeks (T12; *n* = 6) with subjects who did not require pharmacological intervention (GD) at T0 (*n* = 45) and at T12 (*n* = 34). GD---subjects with gestational diabetes mellitus who did not require pharmacological therapy. GD+PT---subjects with gestational diabetes mellitus who required pharmacological therapy. T0---at enrollment. T12---after 12 weeks.
::: {#nutrients-14-02502-f004 .fig}
Comparison of PAF levels at the end of the study (after 12 weeks from randomization; T12) between subjects within the lower quartile of AA/EPA ratio in red blood cells at enrollment (*n* = 13; AA/EPA \< 28.7; Low AA/EPA) and subjects within the higher AA/EPA ratio quartile (*n* = 13; AA/EPA\> 55.2; High AA/EPA). AA/EPA---arachidonic acid/eicosapentaenoic acid ratio.
::: {#nutrients-14-02502-f005 .fig}
Comparison of the gestational age at delivery between subjects within the lower quartile of AA/EPA ratio in red blood cells at enrollment (*n* = 13; AA/EPA \< 28.7; Low AA/EPA) and subjects within the higher AA/EPA ratio quartile (*n* = 13; AA/EPA \> 55.2; High AA/EPA). AA/EPA---arachidonic acid/eicosapentaenoic acid ratio.
::: {#nutrients-14-02502-t001 .table-wrap}
Anthropometric, metabolic, and inflammatory parameters at T12 of the intervention group and the placebo group.
IG T12 (*N* = 17) PG T12 (*N* = 23) *p*
---------------------------- ------------------- ------------------- --------
Arm circumference (cm) 28.6 (26.8--29.3) 28.5 (28.0--30.0) 0.2202
Wrist circumference (cm) 15 (14.5--15.5) 15 (14.5--16.0) 0.3312
Waist circumference (cm) 94.5 (91--99) 97 (93.0--102) 0.1590
Bicipital skin fold (mm) 8.5 (7.3--10.3) 10.4 (<IP_ADDRESS>) 0.3162
Triceps skin fold (mm) 20.0 (19.0--23.4) 23.8 (18.4--27.3) 0.1195
Subscapular skin fold (mm) 15.8 (14.4--19.0) 16.4 (14.4--24) 0.2795
Glycemia (mg/dL) 72 (68--82) 71 (66--78) 0.6073
HbA1c (mmol/mol) 33 (32--36) 33 (31--34) 0.2034
Insulin (µU/mL) 9.7 (7.4--14.9) 9.3 (5.8--15.1) 0.5333
Total cholesterol (mg/dL) 269 (228--313) 250 (221--278) 0.4722
LDL cholesterol (mg/dL) 146 (114--188) 126 (106--154) 0.1166
HDL cholesterol (mg/dL) 69 (57--80) 73 (65--87) 0.5457
Triglycerides (mg/dL) 229 (181--271) 227 (195--283) 0.5490
RBC AA/EPA ratio 17.2 (11.1--30.1) 24.2 (14.9--40.2) 0.5716
Cortisol (µg/L) 29.8 (22.8--38.5) 26.3 (23.4--32.9) 0.5849
C-reactive protein (mg/dL) 0.27 (0.19--0.47) 0.23 (0.17--0.52) 0.8691
PAF (ng/dL) 33.9 (29.1--51.2) 37.7 (31.3--56.8) 0.4160
IG---intervention group. PG---placebo group. LDL---low density lipoprotein; HDL---high-density lipoprotein. RBC AA/EPA ratio---arachidonic acid/eicosapentaenoic acid ratio in cell membranes of erythrocytes. PAF---platelet-activating factor. T12---after 12 weeks from the diagnosis of GD.
::: {#nutrients-14-02502-t002 .table-wrap}
Age and anthropometric parameters at T0 of subjects with GD who required therapy to normalize blood glucose levels (GD+PT) and subjects who did not require pharmacological intervention (GD).
GD (*N* = 45) GD+PT (*N* = 6) *p*
----------------------------- ------------------- ---------------------- ------------
Age (years) 34 (32--37) 36 (32--38) 0.5985
Height (cm) 163 (160--170) 165 (162--167) 0.6358
Pre-pregnancy weight (kg) 60.0 (52.5--68.0) 69.5 (65.3--103) **0.0149**
Pre-pregnancy BMI (kg/m^2^) 22.0 (20.1--24.0) 25.8 (24.5--37.2) **0.0043**
Arm circumference (cm) 27.0 (25.0--29.8) 31.3 (29.4--43.3) **0.0054**
Wrist circumference (cm) 14.5 (13--15.5) 16.25 (15.25--17.25) **0.0099**
Waist circumference (cm) 92.0 (87.0--95.6) 98.0 (95.5--115.5) **0.0178**
Bicipital skin fold (mm) 9.0 (8.0--12.0) 13.2 (10.8--33.4) **0.0496**
Triceps skin fold (mm) 19.9 (16.1--24.0) 26.5 (20.6--40.9) **0.0325**
Subscapular skin fold (mm) 13.8 (12.0--19.0) 24.7 (19.7--36.0) **0.0049**
GD---subjects with gestational diabetes mellitus who did not require pharmacological therapy. GD+PT---subjects with gestational diabetes mellitus who required pharmacological therapy. Bold font highlights statistical significance (*p* \< 0.05).
::: {#nutrients-14-02502-t003 .table-wrap}
Metabolic and inflammatory parameters at T0 of subjects with GD who required therapy to normalize blood glucose levels (GD+PT) and subjects who did not require pharmacological intervention (GD).
GD (*N* = 45) GD+PT (*N* = 6) *p*
---------------------------- ------------------- ------------------- ------------
Glycemia (mg/dL) 73 (66--76) 74 (67--89) 0.2683
HbA1c (mmol/mol) 30 (28--32) 36 (30--38) **0.0272**
Insulin (µU/mL) 7.5 (5.7--12.6) 17.3 (7.2--25.2) **0.0409**
Total cholesterol (mg/dL) 252 (222--275) 267 (239--277) 0.2819
LDL cholesterol (mg/dL) 140 (109--162) 135 (115--171) 0.5158
HDL cholesterol (mg/dL) 80 (66--88) 60 (50--88) 0.0865
Triglycerides (mg/dL) 165 (144--203) 260 (201--295) **0.0029**
C-reactive protein (mg/dL) 0.24 (0.15--0.49) 0.5 (0.41--0.63) **0.0478**
Cortisol (µg/L) 28.6 (22.8--31.9) 24.8 (20.5--29.0) 0.1230
GD---subjects with gestational diabetes mellitus who did not require pharmacological therapy. GD+PT---subjects with gestational diabetes mellitus who required pharmacological therapy. Bold font highlights statistical significance (*p* \< 0.05).
|
require 'json'
require 'concurrent'
require 'logging'
require 'bolt/result'
require 'bolt/config'
require 'bolt/notifier'
require 'bolt/node'
require 'bolt/result_set'
module Bolt
class Executor
attr_reader :noop
attr_accessor :run_as
def initialize(config = Bolt::Config.new, noop = nil, plan_logging = false)
@config = config
@logger = Logging.logger[self]
# If a specific elevated log level has been requested, honor that.
# Otherwise, escalate the log level to "info" if running in plan mode, so
# that certain progress messages will be visible.
default_log_level = plan_logging ? :info : :notice
@logger.level = @config[:log_level] || default_log_level
@noop = noop
@run_as = nil
@notifier = Bolt::Notifier.new
end
def from_targets(targets)
targets.map do |target|
Bolt::Node.from_target(target)
end
end
private :from_targets
def on(nodes, callback = nil)
results = Concurrent::Array.new
poolsize = [nodes.length, @config[:concurrency]].min
pool = Concurrent::FixedThreadPool.new(poolsize)
@logger.debug { "Started with #{poolsize} thread(s)" }
nodes.map(&:class).uniq.each do |klass|
klass.initialize_transport(@logger)
end
nodes.each { |node|
pool.post do
result =
begin
@notifier.notify(callback, type: :node_start, target: node.target) if callback
node.connect
yield node
rescue StandardError => ex
Bolt::Result.from_exception(node.target, ex)
ensure
begin
node.disconnect
rescue StandardError => ex
@logger.info("Failed to close connection to #{node.uri} : #{ex.message}")
end
end
results.concat([result])
@notifier.notify(callback, type: :node_result, result: result) if callback
end
}
pool.shutdown
pool.wait_for_termination
@notifier.shutdown
Bolt::ResultSet.new(results)
end
private :on
def summary(action, object, result)
fc = result.error_set.length
npl = result.length == 1 ? '' : 's'
fpl = fc == 1 ? '' : 's'
"Ran #{action} '#{object}' on #{result.length} node#{npl} with #{fc} failure#{fpl}"
end
private :summary
def get_run_as(node, options)
if node.run_as.nil? && run_as
{ '_run_as' => run_as }.merge(options)
else
options
end
end
private :get_run_as
def with_exception_handling(node)
yield
rescue StandardError => e
Bolt::Result.from_exception(node.target, e)
end
private :with_exception_handling
def run_command(targets, command, options = {})
nodes = from_targets(targets)
@logger.info("Starting command run '#{command}' on #{nodes.map(&:uri)}")
callback = block_given? ? Proc.new : nil
r = on(nodes, callback) do |node|
@logger.debug("Running command '#{command}' on #{node.uri}")
node_result = with_exception_handling(node) do
node.run_command(command, get_run_as(node, options))
end
@logger.debug("Result on #{node.uri}: #{JSON.dump(node_result.value)}")
node_result
end
@logger.info(summary('command', command, r))
r
end
def run_script(targets, script, arguments, options = {})
nodes = from_targets(targets)
@logger.info("Starting script run #{script} on #{nodes.map(&:uri)}")
@logger.debug("Arguments: #{arguments}")
callback = block_given? ? Proc.new : nil
r = on(nodes, callback) do |node|
@logger.debug { "Running script '#{script}' on #{node.uri}" }
node_result = with_exception_handling(node) do
node.run_script(script, arguments, get_run_as(node, options))
end
@logger.debug("Result on #{node.uri}: #{JSON.dump(node_result.value)}")
node_result
end
@logger.info(summary('script', script, r))
r
end
def run_task(targets, task, input_method, arguments, options = {})
nodes = from_targets(targets)
@logger.info("Starting task #{task} on #{nodes.map(&:uri)}")
@logger.debug("Arguments: #{arguments} Input method: #{input_method}")
callback = block_given? ? Proc.new : nil
r = on(nodes, callback) do |node|
@logger.debug { "Running task run '#{task}' on #{node.uri}" }
node_result = with_exception_handling(node) do
node.run_task(task, input_method, arguments, get_run_as(node, options))
end
@logger.debug("Result on #{node.uri}: #{JSON.dump(node_result.value)}")
node_result
end
@logger.info(summary('task', task, r))
r
end
def file_upload(targets, source, destination, options = {})
nodes = from_targets(targets)
@logger.info("Starting file upload from #{source} to #{destination} on #{nodes.map(&:uri)}")
callback = block_given? ? Proc.new : nil
r = on(nodes, callback) do |node|
@logger.debug { "Uploading: '#{source}' to #{destination} on #{node.uri}" }
node_result = with_exception_handling(node) do
node.upload(source, destination, options)
end
@logger.debug("Result on #{node.uri}: #{JSON.dump(node_result.value)}")
node_result
end
@logger.info(summary('upload', source, r))
r
end
end
end
|
[00:28] <adonaros> Hello team/group.. i seem to be having a bit of trouble with postfix and sieve. i think its simple. anyone want to take a stab at it?
[01:12] <patdk-lap> adonaros, postfix and sieve don't even work together
[05:34] <adonaros> patdk-lap: sorry
[05:34] <adonaros> dovecot **.
[06:05] <antares231> hello everyone. im complete beginner about linux server. where do i start to learn? sorry for my english :-[
[08:36] <frickler> jamespage: regarding https://bugs.launchpad.net/tripleo/+bug/1632538 once you have the new python-rfc3986 package available, I think you should also respin the python-nova package to explicitly require the new version. otherwise nova installations might still be broken unless people do package upgrades for everything
[08:37] <frickler> running our deployment with python-rfc3986==0.2.2 works fine now
[09:11] <rbasak> nacc: looks like there are still three unverified bacula SRU bugs. Please could you take a look?
[09:40] <jonah> Hi can anyone please help as I can't seem to start mysql this morning, I get this error: ExecStart=/usr/sbin/mysqld (code=exited, status=1/FAILURE)
[09:49] <Lartza> There should be an error
[09:50] <sarnold> jonah: check journalctl for log messages?
[09:52] <jonah> sarnold: getting this:
[09:52] <jonah> /usr/bin/mysql -v
[09:52] <jonah> ERROR 2002 (HY000): Can't connect to local MySQL server through socket '/var/run/mysqld/mysqld.sock' (2)
[09:53] <Lartza> ... journalctl -u mysql
[09:56] <sarnold> how about mysqld?
[09:57] <Lartza> sarnold, Afaik some genius named the service just "mysql"
[09:57] <Lartza> Not mariadb, not mysqld, mysql...
[09:58] <sarnold> ah
[11:14] <RoyK> Lartza: as you can see in the source code, the name of the internal bits hasn't been changed https://github.com/MariaDB/server
[11:15] <Lartza> RoyK, So?
[11:15] <RoyK> the command is still mysql, the daemon is mysqld etc
[11:15] <Lartza> Yet the systemd unit to start the daemon is mysql.service
[11:16] <RoyK> makes sense
[11:16] <Lartza> Not really
[11:16] <RoyK> anyway - feel free to file a bug
[11:17] <Lartza> mariadb ships a mariadb.service and iirc mysql-server had mysqld.service so mysql.service is just...
[11:17] <Lartza> I don't see how that makes sense
[11:22] <RoyK> Lartza: looks like you're right - I'm not sure which version of mariadb ubuntu has, though
[11:23] <Lartza> xenial seems to have 10.0.27
[11:31] <RoyK> Lartza: just checked in the mariadb 10.0 source - there it's called mysql.service
[11:32] <Lartza> Hmm :/
[11:32] <RoyK> ./dist/Ubuntu/mariadb-server-10.0.postinst: deb-systemd-helper unmask mysql.service > /dev/null
[11:32] <RoyK> that's in server/debian
[11:36] <RoyK> https://github.com/MariaDB/server/blob/10.0/debian/dist/Debian/mariadb-server-10.0.postinst
[11:37] <sarnold> maybe check sources.debian.net instead, who knows how close 'upstream' mariadb is to our packaging
[12:10] <dlloyd> anyone else seeing SERVFAIL when resolving us.archive.ubuntu.com ?
[12:11] <sarnold> dlloyd: known issue, our dns providers are under ddos attack
[12:11] <dlloyd> ah ok
[12:11] <dlloyd> thanks
[12:44] <Pjusur> If I have two interfaces on the same subnett, but I want to enforce that all outgoing traffic goes from a specific interface, how do I accomplish this? IPtables?
[12:48] <sarnold> Pjusur: first guess, the 'ip' utility probably has a way to express this; maybe via setting one link up and another link down, or via routes, or perhaps you have to get familiar with http://lartc.org/howto/ to figure it out...
[12:54] <lordievader> Setting the metrics should do that, right?
[12:55] <sarnold> I'd hope so
[12:56] <sarnold> ahh, that's in ip-route. funny, I didn't expect that
[13:08] <frickler> coreycb: plugin.py(16): from openstackclient.common import utils
[13:25] <RoyK> hm - this canonical livepatch - how does that work with automatic updates? will the latter still upgrade kernels and ask for reboots? I can't find any docs on this
[13:28] <sarnold> RoyK: it should; some things can't be live-patched, and not all CVEs will be livepatched
[13:32] <coreycb> frickler, I'm not sure which client that plugin.py is coming from but I think probably one of your client packages is not upgraded to newton
[13:32] <RoyK> sarnold: ok, guess I'll just wait and see - never tried that sort of thing before
[13:32] <coreycb> frickler, http://paste.ubuntu.com/23359293/
[13:34] <joelio> RoyK: I doubt it needs a reboot, it'll be using kpatch/kexec one would assume. They'll be brief downtime, but not a wait for a full POST
[13:41] <sarnold> joelio: no, the live patching is using the in-kernel live patching mechanism. It's instant.
[13:42] <sarnold> joelio: there's some safeguards around making sure that processes currently executing in the kernel don't see the changes until after they return to userspace, but it should be visible to all processes on their next time entering the kernel
[13:43] <sarnold> joelio: this kind of live system patching of course won't work for everything; there's some things that can only be fixed by tearing the whole thing down via a reboot. So it's still important to reboot into new kernels occasoinally
[13:44] <beisner> hi coreycb, dosaboy - promoted python-oslo.service 0.9.0-1~cloud1 to liberty-updates in the cloud archiive re: https://bugs.launchpad.net/oslo.service/+bug/1524907
[13:44] <joelio> sarnold: interesting, I'd just assumed it was leveraging kpatch/kexec.. will do some digging into this
[13:45] <sarnold> joelio: http://chrisarges.net/2015/09/21/livepatch-on-ubuntu.html
[13:45] <joelio> sarnold: thanks
[13:46] <joelio> sarnold: that mentions kpatch?
[13:47] <sarnold> joelio: yeah, sorry, I focussed entirely on 'kexec' in your original statement, heh
[13:49] <joelio> sarnold: no worries :)
[13:52] <coreycb> thanks beisner
[14:07] <powersj> rbasak: during triage last night came across lp# 1483093 which is marked incomplete for >60 days, any idea why it showed up?
[14:11] <rbasak> powersj: not sure. https://bugs.launchpad.net/ubuntu/+source/squid-deb-proxy/+bug/1483093/+activity doesn't suggest anything. Did I introduce a bug in the script?
[14:12] <powersj> rbasak: I wondered that, however if you look at all the bugs page for squid-deb-proxy it shows up there as well
[14:13] <coreycb> beisner, can you do a full sweep of liberty-proposed -> liberty-updates for bug 1619452?
[14:16] <rbasak> powersj: for me its ordering looks correct in https://bugs.launchpad.net/ubuntu/+source/squid-deb-proxy/+bugs?orderby=-date_last_updated&start=0
[14:18] <powersj> rbasak: I agree, I guess I did not expect to see that bug at all given it should have expired, but I just realized it is assigned to someone so it won't expire
[14:20] <rbasak> Ah
[14:20] <rbasak> I thought the problem was that my script showed it up when not requesting a 2015 date range? Or did that not happen?
[14:20] <rbasak> Or is the script supposed to show it up?
[14:20] <powersj> no the query that I ran was for 2015, so it correctly showed up
[14:20] <rbasak> Ah
[14:20] <rbasak> Shall we unassign it?
[14:21] <powersj> yeah
[14:21] <rbasak> Done
[14:21] <powersj> cool :) thx
[14:21] <rbasak> (I didn't feel that needed an explanation as the bug is Incomplete and clear on what needs to happen next anyway)
[14:21] <powersj> agreed
[14:36] <rabbitdew> I just added a hard disk to my ubuntu VM to expand the drive on /var. I'm using LVM but I forgot to use fdisk to write a partition table to the new disk and format it LVM before adding it as a pv, growing the vg, extending the lv, and expanding the filesystem
[14:37] <rabbitdew> I don't think there's anyway that filesystem has started to fill up onto the unpartitioned space. But partprobe now throws 'Error: Can't have a partition outside the disk!' I'm really concerned it's going to bork out. Any ideas on how I can revert this?
[14:38] <rabbitdew> I'm using ext4. Can only expand a mounted fs
[14:51] <rbasak> What did you add as the pv? The whole disk then and not a partition?
[14:51] <rabbitdew> yes
[14:51] <rbasak> AFAIK, that's an acceptable and stable situation. Partitioning tools won't be able to understand the disk, that's all.
[14:51] <rabbitdew> THe whole disk (/dev/sdb)
[14:52] <rbasak> I'm not aware of anything that will let you change that without severe hackery (except for removing the data and dropping the pv, etc)
[14:52] <RoyK> rabbitdew: so pvcreate /dev/sdb ; vgextend somevg /dev/sdb ; lvextend -L something /path/to/my_lv?
[14:53] <rabbitdew> RoyK: yep, that's exactly what I did
[14:53] <RoyK> and then just resize2fs /dev/whatever ?
[14:54] <rabbitdew> Yeah
[14:54] <RoyK> no arguments to resize2fs?
[14:54] <rbasak> I see that pvresize exists.
[14:54] <rabbitdew> resize2fs /dev/logicalvolume
[14:55] <RoyK> rabbitdew: can you pastebin it all, please, including messages?
[14:55] <rbasak> So perhaps you could use that to shrink the PV a little, then use some tool to move the data up the disk, then create a partition table that fits where the data is. I don't know to what extent LVM will accept that, and that does qualify as severe hackery in my book.
[14:55] <RoyK> pvmove
[14:55] <rbasak> Oh, neat.
[14:55] <rbasak> But still, creating the partition table after the data is there is pretty hacky!
[14:56] <RoyK> just don't do it
[14:56] <rbasak> Yeah I agree
[14:56] <rbasak> Not worth it going wrong.
[14:56] <RoyK> rabbitdew: how big was the lv before you extended it?
[14:56] <rbasak> (or worse, leaving a latent problem for it to explode in a few years' time)
[14:58] <RoyK> rabbitdew: first of all - do you have a good backup?
[15:00] <rabbitdew> =) No I sure don't
[15:00] <rabbitdew> I had just created the vm yesterday as a logstash server
[15:00] <rabbitdew> http://pastebin.com/XmDefqHn
[15:00] <RoyK> rabbitdew: then - first of all - make one - there are cloud services out there that work well, crashplan, for instance
[15:01] <RoyK> rabbitdew: what's the output of vgs?
[15:04] <beisner> hi coreycb - yep, on that liberty sru / point release pkgs now.
[15:04] <rabbitdew> RoyK: I'm pretty sure it was 60GB before I resized it. Here's vgs and vgdisplay http://pastebin.com/FE2gsZmP
[15:04] <RoyK> rabbitdew: what about pvs and lvs?
[15:06] <rabbitdew> http://pastebin.com/nZY0t2KR
[15:06] <RoyK> rabbitdew: next time, if you want to use the whole disk for expansion, just do lvextend -l +100%FREE
[15:07] <rabbitdew> RoyK: Ah, that's what I had wanted to do. I'll do that in the future.
[15:07] <RoyK> you can do it now as well
[15:07] <RoyK> anyway - what did resize2fs say?
[15:12] <RoyK> rabbitdew: partprobe now throws 'Error: Can't have a partition outside the disk!' <-- I've seen similar messages when not using partitions
[15:13] <rabbitdew> I closed the terminal I had it open, so I don't have its output. But it didn't throw any errors
[15:13] <RoyK> parts in Linux seem to default to the thought of that everything must be on a partition
[15:14] <rabbitdew> It really might be cool, but I should put a good backup plan into place
[15:14] <RoyK> never had issues with it, though, apart from those messages
[15:14] <rabbitdew> I'll know later today
[15:15] <rabbitdew> I should have more than 60G of data written to it by later this afternoon
[15:15] <RoyK> anyway, please give backups a thought
[15:15] <RoyK> disks fail, it's in their nature, like everything else
[15:15] <rabbitdew> Thanks a lot for helping, also thanks rbasak
[15:16] <rabbitdew> Yeah, I hear you. I'm pretty good about backing up my workstation/laptop and everything else. Because of politics I had to fight to get a logstash server in the first place
[15:16] <rabbitdew> Disk space is cheap
[15:17] <RoyK> rabbitdew: if this is work related, I hope you have a good, centralised backup solution ;)
[15:22] <nacc> rbasak: ack, will do that to day
[15:22] <nacc> *today
[15:29] <caravaggio971> hi there
[15:29] <caravaggio971> can anyone help me in restoring a backup i made with rsnapshot?
[15:30] <theGoat> so updated one of my ubuntu instances to 16.04, i have added service to systemd for freeradius. now when i do a service freeradius start, it just hangs...when i control c out of and do a ps it's running....not sure what's hanging it. how can i debug it?
[15:30] <caravaggio971> #ubuntu-it
[16:02] <nacc> jgrimm: fyi, i think the imports are all updated in usd-import-team
[16:17] <jgrimm> nacc, cool, i'll take a look today
[16:18] <nacc> jgrimm: thanks
[16:37] <misterpink> anyone successfully setup dropbox on ubuntu server? tried 100 different ways and always get a permissions error. used an older version of dropbox that worked however it is no longer supported
[16:54] <misterpink> "unset DISPLAY" solved the permissions error issue
[17:00] <nacc> rbasak: i think i got them all, can you confirm?
[17:54] <ivoks> nacc: rbasak https://bugs.launchpad.net/ubuntu/+source/bacula/+bug/1553563 ; fix confirmed
[18:07] <stoned> Hello, is it advisable to upgrade from 14 LTS to 16 LTS?
[18:08] <RoyK> stoned: do you need to?
[18:08] <stoned> Or should I spin up a new server for 16 and go from there
[18:08] <RoyK> stoned: if you need the new stuff in 16.04, just do-release-upgrade the 14.04 one - should work fine
[18:09] <stoned> Well, kind of.
[18:09] <RoyK> stoned: if you don't need the new stuff, the old one will work fine and it'll be supported until march 2019
[18:09] <stoned> Or actually, maybe not, but... to save money
[18:09] <stoned> I need to run a website, try some web software that is only available via snaps
[18:09] <stoned> Rocketchat server for chat.stoned.io
[18:09] <RoyK> setup a vm, then
[18:09] <stoned> yeah, another vm is $20 bucks.
[18:09] <stoned> :)
[18:10] * RoyK mostly runs his stuff on his own hardware
[18:12] <stoned> you must have good b/w
[18:12] <stoned> and good h/w
[18:12] <stoned> my desktop is this
[18:12] <stoned> OS: Linux 3.16.0-4-amd64/x86_64-Distro: Debian 8.6-CPU: 4 x Intel Core2 Quad (3775.073 MHz)-Processes: 670-Uptime: 1d 4h 4m-Users: 6-Load Average: 0.21-Memory Usage: 3711.03MB/8002.49MB (-15.64%)-Disk Usage: 3392.89GB/3734.40GB (90.86%)
[18:12] <stoned> that's all I go.
[18:12] <stoned> got*
[18:13] <stoned> Who is a good ubuntu server vps provider that cheap/affordable/reliable etc. ? or is that not a good quetion here?
[18:14] <RoyK> stoned: should be sufficient to setup a few VMs
[18:15] <RoyK> a small webserver won't need more than half a gigabyte of RAM anyway, and CPU doesn't seem to be your bottleneck
[18:18] <stoned> Well, I'm on really crappy bandwidth.
[18:18] <RoyK> how much?
[18:19] <stoned> it's more about reliability, the lines here suck
[18:19] <RoyK> I see
[18:19] <stoned> it' goes out like every couple of hours if not less
[18:19] <RoyK> then - what is it you need for that new webserver that isn't in 14.04?
[18:20] <stoned> I think this thing called snaps, the rocketchat server is only available from it
[18:20] <RoyK> stoned: heh - I switched to a new ISP some five years back and the worst downtime I've had since then was an hour or two when one of their servers went down (plus perhaps an annual hang on the router)
[18:20] <stoned> I don't even really need to upgrade, I prefer older/stable/secure software
[18:20] <RoyK> right - snaps isn't in 14.04 and probably won't be
[18:21] <stoned> <- comcast customer
[18:21] <stoned> woe is me.
[18:21] <stoned> here is my currnet problem
[18:22] <RoyK> stoned: what sort of vm do you currently have? openvz or kvm?
[18:23] <stoned> https://paste.debian.net/plainh/f8575843
[18:23] <stoned> This is my current issue
[18:23] <stoned> I'm on Rackspace ATM and with ubuntu 14
[18:23] <stoned> I just wanted to play around with some chat backends
[18:23] <stoned> I guess, I should spin up another server for playing around and leave this alone?
[18:24] <RoyK> stoned: check crowncloud.net - doesn't cost a lot
[18:24] <RoyK> I have a vm there and a friend has another (which I'm mostly adminstering) - works well
[18:25] <stoned> yeah, I wanted to setup owncloud, my own vpn, and all the stuff. I kknow how to, I just need to find a good stable server. I'd stick w/ RS, but I don' tknow amazon AWS. I wonder if I should spend some money there, and learn how to use AWS and add that to my skillset.
[18:25] <stoned> So many options.
[18:25] <RoyK> crowncloud != owncloud ;)
[18:25] <stoned> But that's not really a question here
[18:26] <stoned> yes, I know :)
[18:26] <stoned> It just reminded me of it. similar word
[18:26] <RoyK> stoned: how much do you pay for your server today?
[18:26] <stoned> I don't
[18:26] <RoyK> ok
[18:26] <stoned> https://paste.debian.net/plainh/f8575843 read this
[18:26] <stoned> it will explai my issue
[18:27] <RoyK> if you can handle $4/month for a 1GB RAM thing from crowncloud, go for it
[18:27] <stoned> Sure, I can handle it.
[18:27] <stoned> Here's another thing.
[18:28] <stoned> I want to setup a server instance using a config managemenet tool
[18:28] <RoyK> but I'd advice against imaging the server - better setup a new one from scratch
[18:28] <RoyK> what sorts?
[18:28] <stoned> So I can use just that, create a config, use a tool to deploy the same server image locally in vm, and in cloud as a server instance
[18:28] <stoned> That way I can keep one config ile, and deploy servers anywhere
[18:28] <stoned> same config, same seruciry, packates, hardening, etc. etc.
[18:28] <RoyK> what sort of config management?
[18:28] <stoned> Just that on local, i can change a few php settings for dev.
[18:29] <stoned> puphhete
[18:29] <RoyK> puppet
[18:29] <RoyK> ok
[18:29] <stoned> phupphet vagrant has a rackspcae plugin
[18:29] <stoned> you can deploy ubuntu server imaes yuo create from this config file to local vm and to rackspace
[18:29] <stoned> so maybe I'll have to stick with RS for now.
[18:29] <stoned> It's $20/mo, more expensive, but whatever. It's more convenient.
[18:30] <RoyK> again, is this a kvm vm or openvz?
[18:31] <RoyK> if it's a kvm vm, you should be able to deploy an openvz container on top
[18:32] <stoned> no clue
[18:32] <stoned> I use vbox
[18:32] <RoyK> run virt-what
[18:33] <stoned> vagratn/vbox locally
[18:33] <RoyK> on the server
[18:33] <stoned> on the server, no clue
[18:33] <stoned> it's rackspace
[18:33] <stoned> Xen?
[18:33] <RoyK> virt-what will tell
[18:33] <stoned> oh
[18:33] <stoned> hang on
[18:33] <stoned> The program 'virt-what' is currently not installed. You can install it by typing:
[18:33] <stoned> apt-get install virt-what
[18:33] <stoned> hm.
[18:33] <RoyK> then install it :P
[18:34] <stoned> xen
[18:34] <stoned> xen-domU
[18:34] <stoned> yup, RS uses Xen
[18:35] <RoyK> IIRC they're rolling out kvm now, but they probably have a *lot* of old xen left
[18:35] <RoyK> anyway - with a machine on xen, you should be able to spawn an openvz container on top of that
[18:37] <stoned> hm.
[18:37] <stoned> interesting.
[18:37] <stoned> it's only got 512mb ram
[18:37] <RoyK> that's not a lot
[18:37] <stoned> yeah, cheapest one.
[18:37] <stoned> Maybe I should move away from Rackspace.
[18:37] <RoyK> so probably better get something off crowncloud :P
[18:37] <stoned> I'm checking out crowncloud
[18:37] <stoned> https://lowendbox.com/blog/crowncloud-30year-3gb-openvz-vps-and-more-in-los-angeles/
[18:38] <RoyK> I have a VM there running Zimbra with 5GB RAM and 140GB disk, costs me $16 a month
[18:38] <RoyK> https://crowncloud.net/openvz.php
[18:38] <stoned> Hm.
[18:39] <stoned> I can pay them $30 for 1 year of 2gb server?
[18:39] <stoned> cheap is usually not that great.
[18:39] <RoyK> well, I've used them for a while now, and it works well
[18:40] <RoyK> and zimbra isn't really a light-weight system
[18:40] <RoyK> perhaps I should have migrated to something else - but it works - so why bother :P
[18:45] <RoyK> stoned: if you have questions to crowncloud, the fastest way is usually to ask them on #CrownCloud here on freenode
[19:10] <nacc> ivoks: thanks!
[20:28] <dcampano> curious if people running 16.04 server use the standard timesyncd or if they install ntp?
[20:30] <docmur> I have a server running 16.04.1 LTS, I install virt-manager and libvirt, when I ssh to the server using -Y -2 I get X11 forwarding request failed on channel 0 and when I try to run virt-manager I get Failed to connect to Mir: Failed to connect to server socket: No such file or directory
[20:34] <sarnold> docmur: try -X instead; debian fiddled with the meanings of -X and -Y
[20:34] <sarnold> docmur: actually, try DISPLAY=:10 virt-manager before trying -X
[20:37] <docmur> using ssh user@host DISPLAY=:10 virt-manager did nothing and using -X is also not working :(
|
package se.l4.commons.types.mapping;
import com.github.benmanes.caffeine.cache.Caffeine;
import com.github.benmanes.caffeine.cache.LoadingCache;
/**
* Cache to use for caching the mapped output of {@link TypeMapper}.
*/
public interface OutputDeduplicator<T>
{
/**
* Cache the given instance.
*
* @param instance
* @return
*/
T deduplicate(T instance);
/**
* Get a cache that does nothing.
*
* @param <T>
* @return
*/
static <T> OutputDeduplicator<T> none()
{
return i -> i;
}
/**
* Get a cache that will keep references to all objects and replace new
* ones with previous ones if they are still referenced by other objects.
*
* @param <T>
* @return
*/
static <T> OutputDeduplicator<T> weak()
{
LoadingCache<T, T> cache = Caffeine.newBuilder()
.weakKeys()
.build(i -> i);
return cache::get;
}
}
|
Levamisole has been increasingly used as a steroid-sparing agent in steroid-sensitive nephrotic syndrome (SSNS) in children. Although the exact mechanism of action in SSNS is still unclear, it is believed that it has immunomodulatory properties. Recent studies in children with frequently relapsing nephrotic syndrome (FRNS) or steroid-dependent nephrotic syndrome (SDNS) showed that levamisole is efficacious and safe to prevent relapses \[[@CR1]\], even when administered on a daily basis \[[@CR2]\]. In children, side effects are relatively uncommon and include leukopenia (3.7%), gastrointestinal upset (2.4%), and skin rash (1.5%), which are reversible after discontinuation of the treatment \[[@CR3]\]. Additionally, ANCA positivity has been observed in up to 20% of children using levamisole \[[@CR4]\].
Recently, Hoogenboom et al. described elevated plasma creatinine levels and a corresponding decrease in the estimated glomerular filtration rate (eGFR) calculated by the Schwartz equation \[[@CR5]\] during levamisole treatment in a cohort of children with FRNS or SDNS \[[@CR6]\]. This decrease in eGFR was not progressive and normalized after levamisole was discontinued. The authors speculated that levamisole might interfere with tubular handling of creatinine resulting in a rise in creatinine levels independent of GFR. Other potential mechanisms considered were interference of levamisole with the analytical assay for creatinine or transient nephrotoxicity.
In our hospital, levamisole has been extensively used for the prevention of relapses of SSNS. A similar trend of transient elevated plasma creatinine levels has been observed. In this report, we provide additional proof that the rise in plasma creatinine is indeed the result of levamisole-induced decreased tubular creatinine secretion, rather than assay interference or impaired kidney function.
This study was conducted at the department of pediatric nephrology of Emma Children's Hospital, Amsterdam University Medical Centers, Amsterdam, the Netherlands. All SSNS patients aged between 2 and 18 years who participated in the LEARNS study were screened for the use of levamisole for the prevention of relapses and documented creatinine and at least one cystatin C (cysC) measurements. The LEARNS study is an international, randomized, placebo-controlled trial investigating the efficacy and safety of adding levamisole to corticosteroids for the prevention of relapses of the first episode of INS \[[@CR7]\]. The study was approved by the ethical committee of Amsterdam UMC, location AMC. Screened patients used levamisole in an open-label fashion after a relapse occurred. Relapses were treated according to the GPN protocol: 60 mg/m^2^/day until remission, followed by 40 mg/m^2^/alternate day for 4 weeks. After remission was achieved, levamisole (2.5 mg/kg every other day, maximum of 150 mg/dose) was initiated. A treatment duration of 12 months was intended. Reasons to discontinue levamisole included relapse, marked side effects, and prolonged remission (\> 12 months). Estimated GFR was calculated from plasma creatinine or serum cysC using the age-based full age spectrum (FAS) equations \[[@CR8]\].
Plasma creatinine concentrations were determined by a standardized enzymatic colorimetric method (Creatinine plus ver.2; Roche diagnostics, Mannheim, Germany) using the Cobas 8000 c702 module (Roche diagnostics, Mannheim, Germany). Serum cysC concentrations were determined by particle-enhanced immunonephelometry (N Latex Cystatin C; Siemens Healthineers, Erlangen, Germany) using the Atellica NEPH630 System (Siemens Healthineers, Erlangen, Germany).
To test the interference of levamisole with the creatinine analytical enzymatic assay, spare human blood samples from 9 adult patients with low (26--33 µmol/L) and high (105--108 µmol/L) plasma creatinine concentrations were spiked with increasing levamisole concentrations. Concentrations of 0, 4, 20, and 100 µM were obtained by diluting 200 mM levamisole stock solution with NaCl. All experiments were done at the Department of Clinical Chemistry of Amsterdam UMC, location VUmc.
Patient presentation {#Sec4}
Chart analysis identified six patients who received levamisole and in whom plasma creatinine and the corresponding eGFR were determined at every visit between 2018 and 2021. In all patients, plasma creatinine increased during treatment (data not shown). However, cysC had been measured at least once in three patients. CysC was determined in response to elevated plasma creatinine levels at the next visit and was only determined during levamisole treatment.
Patient 1 (female, age 6 years) received levamisole for 64 weeks during which she remained in remission. After 4 weeks, creatinine rose and remained stable between 50 and 55 µmol/L (FAS~creat~ around 90 mL/min/1.73 m^2^, while cysC was at 0.80 mg/L (FAS~cys~ 101 mL/min/1.73 m^2^). When levamisole was discontinued, plasma creatinine decreased to 39 µmol/L. However, the patient experienced a new series of relapses and levamisole was started again. Four weeks after restart, plasma creatinine rose from 40 to 56 µmol/L, again with normal cysC levels (0.79 mg/L) and corresponding FAS~cys~ (116 mL/min/1.73 m^2^) (Fig. [1a](#Fig1){ref-type="fig"}).Fig. 1**a**--**c** Graphical display of the evolution of plasma creatinine and eGFR for three different patients. The colored solid lines represent the change in plasma creatinine concentrations (left y-axis) during the course of levamisole treatment, while the dashed blue lines represent the FAS~creat~ and the black dots show the FAS~cys~ (right y-axis). The vertical dashed line indicates the start of levamisole treatment, the horizontal dashed line indicates the cut-off value for impaired kidney function (90 mL/min/1.73 m^2^; right y-axis). In patient 1 (**a**), levamisole was restarted when she experienced a second relapse after discontinuation of levamisole. **d** Presentation of the measured plasma creatinine concentration by the enzymatic assay for low and high concentrations of levamisole
In patient 2 (male, age 5 years), creatinine had risen from 38 to 49 µmol/L within 3 weeks after introduction of levamisole and continued to rise to a maximum of 69 µmol/L. When FAS~creat~ had dropped to 78 mL/min/1.73 m^2^, cysC was determined at 0.89 mg/L, corresponding to a FAS~cys~ of 102 mL/min/1.73 m^2^ (Fig. [1b](#Fig1){ref-type="fig"}). Therefore, levamisole was continued.
Patient 3 (male, age 5 years) was in partial remission when levamisole was started. Prednisolone was gradually tapered over the course of levamisole treatment. Before the start of levamisole, creatinine had been 22 µmol/L, but increased to 36 µmol/L and 42 µmol/L after 4 and 14 weeks, respectively. During levamisole treatment, FAS~creat~ (101 mL/min/m^2^) and FAS~cys~ (125 mL/min/m^2^) remained above the threshold for impaired kidney function (Fig. [1c](#Fig1){ref-type="fig"}).
Assay interference {#Sec5}
There was no interference of levamisole with the enzymatic creatinine assay. With increasing levamisole concentrations, serum creatinine concentrations did not deviate from baseline measurements, with low and high plasma creatinine concentrations showing minimal deviations up to 4% and 2.8%, respectively (Fig. [1d](#Fig1){ref-type="fig"}).
In line with Hoogenboom et al. \[[@CR6]\], we observed an increase in plasma creatinine levels in three children during levamisole treatment. Yet, this was not associated with an impaired eGFR when calculated from cysC levels. When levamisole was discontinued, creatinine levels returned to normal. Additionally, levamisole did not interfere with the analytical enzymatic assay for creatinine in plasma.
Three potential mechanisms for the elevated serum creatinine were considered: (1) nephrotoxicity, (2) interference with the analytical assay, and (3) impaired tubular secretion. Hoogenboom et al. considered nephrotoxicity of levamisole unlikely as the rise in plasma creatinine was not progressive and independent of dose and duration of treatment. This is supported by our finding that, based on cysC levels, eGFR was not impaired in our three patients. In line with these findings, inulin clearance did not change in a study in dogs treated with levamisole \[[@CR9]\].
To our knowledge, this is the first study that shows that levamisole does not interfere with the enzymatic assay to measure creatinine in plasma, not even at supra-physiological concentrations. In a study in children receiving alternate day levamisole, the C~max~ was 438 ng/mL (2.36 µM) \[[@CR10]\]. Particularly, there was no change at low and high creatinine concentrations. As children with INS are young (peak incidence 2--6 years) and have a normal kidney function, reference intervals for creatinine concentrations lie between 18 and 54 µmol/L \[[@CR11]\]. However, levamisole has a short half-life of 2.6 h \[[@CR10]\] and potential assay interference with one of its metabolites, i.e., aminorex and p-hydroxylevamisole, cannot be excluded. Having eliminated nephrotoxicity and --- presumably --- assay interference as potential mechanisms of creatinine elevation by levamisole, interference with the tubular secretion of creatinine remains as the most probable explanation.
Creatinine has a low molecular weight (113 Da), is not protein-bound, and is freely filtered across the glomerular basement membrane. Although chiefly considered a marker for GFR, creatinine is also excreted by the renal tubules \[[@CR12]\]. Tubular secretion is variable and its rate is inversely related to GFR. It can be inhibited by a number of drugs through inhibition of organic cation transporters (OCTs), of which cimetidine, trimethoprim, and fenofibrate are well-known. There is limited evidence whether levamisole is an OCT inhibitor: one study found an inhibitory effect on the rOCT1 in rat hepatocytes \[[@CR13]\]. However, whether this OCT is present in humans is uncertain.
CysC is a low-molecular weight protein (13 kDa), which has evolved as an alternative to plasma creatinine for the monitoring of kidney function \[[@CR12]\]. Serum cysC concentrations are inversely related to GFR. CysC is produced at a constant rate by nearly all nucleated cells. Like other low-molecular weight proteins, it is freely filtered across the glomerular membrane and almost entirely reabsorbed and metabolized in the proximal tubule. Therefore, only trace amounts can be found in the urine. There are no indications that cysC is secreted in the kidney tubule; still, there is some breakdown in the liver, which is relevant in severe kidney failure only and has not been linked to any drug therapy \[[@CR14]\]. A relevant interaction in the setting of INS is high-dose glucocorticoid treatment, since this increases cysC synthesis and results in an underestimation of GFR \[[@CR15]\].
In conclusion, our findings support the concept that levamisole increases plasma creatinine by interfering with the tubular secretion of creatinine and argue against nephrotoxicity and assay interference. Although an increased plasma creatinine level in children using levamisole should not prompt clinical concern, we recommend using additional cysC-based equations to confirm normal kidney function. In case of decreased creatinine-based eGFR and in the absence of an abnormal cysC-based eGFR, levamisole should not be discontinued.
The original online version of this article was revised: During the process of typesetting, the institutional author attribution "on behalf of the LEARNS consortium" was left out of the author group. The original article has been corrected.
A Correction to this paper has been published: 10.1007/s00467-022-05622-1
The authors would like to thank G.H. Khan for preparing and providing the levamisole stock solution. The LEARNS study is an interuniversity collaboration in the Netherlands that is established to perform a double blind, placebo-controlled randomized clinical trial on the efficacy of levamisole on relapses in children with a first episode of steroid-sensitive nephrotic syndrome, and to study basic mechanisms underlying nephrotic syndrome and the mode of action of levamisole. Principal investigators are (in alphabetical order): A.H.M. Bouts (Department of Pediatric Nephrology, Amsterdam UMC, location AMC, Amsterdam, the Netherlands), S. Florquin (Department of Pathology, Amsterdam UMC, location AMC, Amsterdam, the Netherlands), J.E. Guikema (Amsterdam UMC, location AMC, Amsterdam, the Netherlands), L. Haverman (Psychosocial Department, Amsterdam UMC, location AMC, Amsterdam, the Netherlands), L.P.W.J. van den Heuvel (Radboud Institute for Molecular Sciences, Radboud University Medical Center, Nijmegen, the Netherlands), E. Levtchenko (Department of Pediatric Nephrology, University Hospitals Leuven, Leuven, Belgium), R.A.A. Mathôt (Department of Hospital Pharmacy, Amsterdam UMC, location AMC, Amsterdam, the Netherlands), M.F. Schreuder (Department of Pediatric Nephrology, Radboud University Medical Center, Nijmegen, the Netherlands), B. Smeets (Radboud Institute for Molecular Sciences, Radboud University Medical Center, Nijmegen, the Netherlands ), and J.A.E. van Wijk (Department of Pediatric Nephrology, Amsterdam UMC, location AMC, Amsterdam, the Netherlands).
FV drafted the concept of this study, collected and analysed the data, and drafted the first manuscript. JS and HH designed and performed the experiments, interpreted the data, and critically reviewed the manuscript. HH designed the experiments and critically reviewed the manuscript. AB drafted the concept of this study and critically reviewed the manuscript. AHB consulted patients, drafted the concept of this study, and critically reviewed the manuscript.
F.V. and A.H.M. are supported by a consortium grant from the Dutch Kidney Foundation (CP16.03).
The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request.
The R and GraphPad syntaxes used for the development of the graphs are available upon request.
All patients described in this study are participants in the LEARNS study. The LEARNS study was approved by the Medical Ethical Committee of Amsterdam UMC, Amsterdam, the Netherlands (2017\_310).
Written informed consent has been obtained from the parents and/or patients (if applicable).
Written informed consent has been obtained from the parents and/or patients (if applicable).
The authors declare no competing interests.
|
Talk:The pasta maker/@comment-6794436-20141230010515/@comment-4937581-20141230030103
Thanks and yeah i had this idea awhile ago, I'll see if i can do better.
|
<?php
namespace App\Http\Controllers;
use App\User;
use Illuminate\Http\Request;
use Intervention\Image\Facades\Image;
class FollowsController extends Controller
{
public function __construct()
{
$this->middleware('auth');
}
public function store(User $user)
{
return $user->following()->toggle($user->profile);
}
}
|
// == Imports ===============================================================
const Promise = require('bluebird').Promise;
const uuid = require('uuid');
// == Exported Class ========================================================
class ApiCall {
constructor(method, args, uid, apiKey) {
this.apiKey = apiKey;
this.uid = uid || uuid.v4();
this.method = method;
this.arguments = args || { };
}
// Override the toJSON() method to output the JSON with underscored names,
// not mixedCase like inside JavaScript.
toJSON() {
return {
api_key: this.apiKey,
uid: this.uid,
method: this.method,
arguments: this.arguments
};
}
serialize(pretty) {
if (pretty) {
return JSON.stringify(this, null, 2);
}
return JSON.stringify(this);
}
}
// == Exports ===============================================================
module.exports = ApiCall;
|
Poisson distribution - support of the distribution
"Let N be the number of earthquakes occurring somewhere in the world in a 1-year period"
a) I have decided that this fits a poisson distribution. Is this correct? because they haven't given a mean value?
b) what are the set of values this random variable can take? So the support of the distribution of the random variable. Isn't this just 0 - infinity? how do I write this as an answer?
|
WebGoatPHP
{| style="padding: 0;margin:0;margin-top:10px;text-align:left;" |-
* valign="top" style="border-right: 1px dotted gray;padding-right:25px;" |
OWASP WebGoatPHP
GitHub Repo
What is WebGoatPHP
Why WebGoatPHP?
WebGoatPHP is suitable for:
* Web Developers, to learn how to develop secure web applications
* Penetration Testers, to learn the different kinds of attacking scenarios
* Teachers, to interactively teach students about web application security
Contribute
Different Operating Modes
* Single User Mode
* Workshop Mode
* Contest Mode
* Secure Coding Mode
Types Of Challenges
* Access Control Flaws
* AJAX Security
* Authentication Flaws
* Code Quality
* Injection Attacks
* Cross-Site Scripting(XSS) Attacks
* Brute Force Attacks
* Session Management Flaws
* Improper Error Handling
Major Contributors
* Johanna Curiel
* Shivam Dixit
* Azzeddine
* valign="top" style="padding-left:25px;width:200px;" |
Project Leader
Abbas Naderi
Quick Download
* OWASP WebGoatPHP
Classifications
* }
|
//
// Created by Paul Botros on 9/19/20.
//
#ifndef RIVER_SRC_TESTS_UUID_H_
#define RIVER_SRC_TESTS_UUID_H_
#include <random>
#include <sstream>
// From https://stackoverflow.com/questions/24365331/how-can-i-generate-uuid-in-c-without-using-boost-library
namespace uuid {
static std::random_device rd;
static std::mt19937 gen(rd());
static std::uniform_int_distribution<> dis(0, 15);
static std::uniform_int_distribution<> dis2(8, 11);
inline std::string generate_uuid_v4() {
std::stringstream ss;
int i;
ss << std::hex;
for (i = 0; i < 8; i++) {
ss << dis(gen);
}
ss << "-";
for (i = 0; i < 4; i++) {
ss << dis(gen);
}
ss << "-4";
for (i = 0; i < 3; i++) {
ss << dis(gen);
}
ss << "-";
ss << dis2(gen);
for (i = 0; i < 3; i++) {
ss << dis(gen);
}
ss << "-";
for (i = 0; i < 12; i++) {
ss << dis(gen);
};
return ss.str();
}
}
#endif //RIVER_SRC_TESTS_UUID_H_
|
import {ACCESS_TOKEN, API_BASE_URL} from '../constants';
//TODO: Instead of functions here being stateless, we can create this instance at App.js, pass the unauthenticate option and use it if there is a 401 caught.
const request = (options) => {
const headers = new Headers({
'Content-Type': 'application/json',
});
if (localStorage.getItem(ACCESS_TOKEN)) {
headers.append('Authorization', 'Bearer ' + localStorage.getItem(ACCESS_TOKEN))
}
const defaults = {headers: headers};
options = Object.assign({}, defaults, options);
return fetch(options.url, options)
.then(response =>
response.json().then(json => {
if (!response.ok) {
return Promise.reject(json);
}
return json;
})
).catch(error => {
localStorage.removeItem(ACCESS_TOKEN);
//FIXME: Duplicated notifications problem. Interceptors should be implemented instead of these.
if (error.status === 401) {
// toast((error.message) + '. Please login to continue.');
//TODO: A redirect should happen here.
} else if (error.status === 500) {
// toast('Service is currently unavailable.')
}
throw(error);
})
};
export function getCurrentUser() {
if (!localStorage.getItem(ACCESS_TOKEN)) {
return Promise.reject("No access token set.");
}
return request({
url: API_BASE_URL + "/user/me",
method: 'GET'
});
}
export function getFeed() {
if (!localStorage.getItem(ACCESS_TOKEN)) {
return Promise.reject("No access token set.");
}
return request({
url: API_BASE_URL + "/api/feed/feed",
method: 'GET'
});
}
export function postFeed(postRequest, userId) {
if (!localStorage.getItem(ACCESS_TOKEN)) {
return Promise.reject("No access token set.");
}
return request({
url: API_BASE_URL + "/api/feed/user/" + userId +"/feed",
method: 'POST',
body: JSON.stringify(postRequest)
});
}
export function deleteFeed(feedPostId) {
if (!localStorage.getItem(ACCESS_TOKEN)) {
return Promise.reject("No access token set.");
}
return request({
url: API_BASE_URL + "/api/feed/" + feedPostId,
method: 'DELETE',
body: JSON.stringify(feedPostId)
});
}
export function getTodos() {
if (!localStorage.getItem(ACCESS_TOKEN)) {
return Promise.reject("No access token set.");
}
return request({
url: API_BASE_URL + "/api/todo/todo",
method: 'GET'
});
}
export function postTodo(todoRequest) {
if (!localStorage.getItem(ACCESS_TOKEN)) {
return Promise.reject("No access token set.");
}
return request({
url: API_BASE_URL + "/api/todo/todo",
method: 'POST',
body: JSON.stringify(todoRequest)
});
}
export function updateTodo(updatedTodo) {
if (!localStorage.getItem(ACCESS_TOKEN)) {
return Promise.reject("No access token set.");
}
return request({
url: API_BASE_URL + "/api/todo/todo",
method: 'PUT',
body: JSON.stringify(updatedTodo)
});
}
export function deleteTodo(todoId) {
if (!localStorage.getItem(ACCESS_TOKEN)) {
return Promise.reject("No access token set.");
}
return request({
url: API_BASE_URL + "/api/todo/todo/" + todoId,
method: 'DELETE',
body: JSON.stringify(todoId)
});
}
export function login(loginRequest) {
return request({
url: API_BASE_URL + "/login",
method: 'POST',
body: JSON.stringify(loginRequest)
});
}
export function signup(signupRequest) {
return request({
url: API_BASE_URL + "/signup",
method: 'POST',
body: JSON.stringify(signupRequest)
});
}
|
max_shit not work
When I change max_shift, the output image remains the same, but when I use samplercustomadvanced the output image is different.
max_shift only works for Dev. Schnell only uses base shift
|
A Battle of Wits (1912 film)
A Battle of Wits (1912) is a silent drama motion picture short starring Tom Moore, Alice Joyce and Earle Foxe.
Joyce and Foxe were working together for the fourth time on this picture.
A Battle of Wits was re-released on August 27, 1915.
Cast
* Tom Moore as The Surveyor
* Alice Joyce as Sue Elwood
* Earle Foxe
* Logan Paul
* Stuart Holmes
|
Thread:MMYP999/@comment-27109830-20170921124549/@comment-27416494-20170923203033
Well hey, I'm always open to new testimony if you really want to.
|
עשר
Numeral
* 1) -teen
Usage notes
* In colloquial Modern Hebrew, the form is often used regardless of gender.
|
Talk:Fleet Air Arm
Untitled
What does the first sentence mean :"of several navies"? Do you mean several countries' navies operate together or do the British refers to navies as the US refers to fleets? Rmhermen 16:54 16 Jun 2003 (UTC)
I didn't write that, but what the writer means is that several navies around the world operate an air arm that is referred to as the Fleet Air Arm. I will edit the article to disambig that sentence. David Newton 19:30 16 Jun 2003 (BST)
Who ever wrote the bit about the catapults has it completely backwards. It was the ROYAL NAVY that introduced the "powerful catapults" - steam catapults, the USN adopted a British invention along with the angled flight deck and mirrored landing aid.
<IP_ADDRESS> 17:43, 25 April 2006 (UTC)
* The whoel history section there is a bit wonky, the Sea Vampire was the first carrier launched jet in 1948. GraemeLeggett 08:22, 26 April 2006 (UTC)
Aircraft Carriers
It says in the section called 'Fleet Air Arm' under history, that "By the end of the war the strength of the Fleet Air Arm was: 59 aircraft carriers, 3,700 aircraft, 72,000 officers and men and 56 air stations all over the world" I think I'm right in saying that the aircraft carriers are part of the surface fleet, and that the aircraft which operate from them are under the command of the FAA, in which case, the strength of the FAA shouln't include the aircraft carriers. Or was it organised differently during the war? Davepealing 19:16, 13 July 2006 (UTC)
Use of "No." in squardon names
I believe that using the word "number" (often abbreviated to "No.") before the squadron name is an Air Force usage and the Navy simply uses the number for example, in the Air Force you might say No. 3 Squadron, but the Navy would say 815 Squadron. As an ex FAA (RAN) officer, I find the use of the "No." combined with the squadron number jarring.
Unless someone can show that the RN has adopted this usage, I will change the references to remove the offending word. I note that a quick review of a number of official web pages of the RN, do not use "No." when referrring to navy squadrons.Nick Thorne 00:46, 19 August 2006 (UTC)
NAS
This article and several others use the term NAS to mean Naval Air Squadron. It may be that this is correct usage in the RN, but to the best of my knowledge NAS usually means Naval Air Station that is a land based air field operated by Naval forces.Nick Thorne 00:46, 19 August 2006 (UTC)
badge and motto
any idea on either of these. a quick search throws up a winged anchor. GraemeLeggett 12:51, 28 March 2007 (UTC)
Since you've requested it, I've added the winged badge image. QuentinUK (talk) 23:03, 30 October 2010 (UTC)
Naming
When the FAA was returned to the RN in 1937, it was not officially named the Fleet Air Arm. It was not so named until 1953. I have spoken to an ex RN pilot in 1953, he recalls the year because he was a midshipman at the time when he interviewd by his local member of parliament and asked how long he had been a member of the FAA. His reply was "a month" because the name had only been officially changed that long. Prior to that it was either known as "Navaal Aviation" or the RNAS. Someone with access to official RN history may be able to supply accurate dates. Nick Thorne 02:26, 3 April 2007 (UTC)
* From my research, I'm fairly positive that Fleet Air Arm was the term used prior to the Inskip award, when Naval Aviation was under RAF control. Whilst the old term was still in existance, and more commonly used, the correct term during the period up to 1952 was the Air Branch. I have edited it to include this, although if someone feels the minutae of naming is somewhat superfluous, I wouldn't not object to it being removed.SteveCobden (talk) 03:34, 28 March 2008 (UTC)
* In Mediterranean Front (1941), Alan Moorehead writes: "... Cunningham was soon appearing off Taranto with his fleet air arm to cripple nearly half a dozen enemy warships at anchor there." This doesn't show much, apart from that the term was used loosely (and in lower-case) during WWII to describe naval aircraft. Ericoides (talk) 13:52, 24 August 2009 (UTC)
* It was known as the Fleet Air Arm during the RAF period in the 1920s and 1930s. MilborneOne (talk) 16:53, 24 August 2009 (UTC)
* Officially, the air component of the Royal Navy between 1918 and 1936 was known as the Royal Air Force Fleet Air Arm (FAA). When operational and administrative control of air assets was returned to the Royal Navy, the air component was named the Air Branch of the Royal Navy (ABRN). However, the use of "FAA" and "Fleet Air Arm" continued in wide use, and was so firmly installed in the popular imagination that, post-War, the Royal Navy returned official usage to Royal Navy Fleet Air Arm (FAA). It is worth noting that the Air Ministry—the political and governmental administration of the RAF, retained control of research, development, procurement, and manufacture of airframes, aero engines, and complete aircraft, as well as all weapons employed by aircraft. It required direct intervention by the War Cabinet to force the Air Ministry-RAF to place more modern naval aircraft—like the Barracuda and the Firefly—into series production.
* Ranya (talk) 00:30, 12 December 2021 (UTC)
Bucaneers?
No mention is made of these aircraft, used for low level strike. Adresia (talk) 12:05, 3 February 2008 (UTC)
* Lots of aircraft used by the Fleet Arm (- refer List of aircraft of the Fleet Air Arm) are not mentioned as this is just an overview of the Fleet Air Arm. If you think that the Buccaneer was a significant milestone in the history of the Fleet Air Arm I dont think any body is going to object to you adding some information perhaps under Post-war history. MilborneOne (talk) 12:37, 3 February 2008 (UTC)
Is it true that the Royal Navy fleet Air Arm in under operation control of the RAF
I reads this and want to know if this is true. Please see reference —Preceding unsigned comment added by Jacob805 (talk • contribs) 12:21, 11 January 2009 (UTC)
This page needs lot work
in reviewing the content of this page, there is a lot of information, left out or not updated. Ships, Aircrafts, current number are all wrong. Please let me know if you need help in updating this pageJacob805 (talk) 07:56, 27 February 2009 (UTC)
* No reason why you cant correct the page yourself if it is wrong (saves us guessing what you think is wrong), please provide reliable references for anything you change. Thanks MilborneOne (talk) 18:40, 27 February 2009 (UTC)
* Not everyone has time you know.Phd8511 (talk) 19:02, 23 September 2013 (UTC)
Formation date
In the infobox it shows the date of formation as 1937 should it be 1924? MilborneOne (talk) 19:46, 8 December 2010 (UTC)
* To quote from the Fleet Air Arm archive In 1937, The Naval Air Branch, later known as the Fleet Air Arm, was returned eventually to Admiralty control. Jim Sweeney (talk) 20:19, 8 December 2010 (UTC)
* OK what confused me was the On 24 May 1939 the Fleet Air Arm was returned to Admiralty control the 1937 date is not mentioned outside of the infobox! Sorry another question if this the the Royal Navy Fleet Air Arm do we have an article on the RAF Fleet Air Arm (1924-1937) version? MilborneOne (talk) 20:35, 8 December 2010 (UTC)
* I have not seen one but it would come under the RAF article. Jim Sweeney (talk) 21:28, 8 December 2010 (UTC)
* The return of all aircraft and flying personal intended for service at sea to the operational and administrative control of the Royal Navy, as the Air Branch of the Royal Navy (ABRN), was agreed between the Air Ministry and the Admiralty in 1936, with the agreement promulgated in 1937 by HM Government Order in Council. The process was complicated and directly impacted readiness of both services, so it was done in stages, with the final stage taking place during early 1939, and the process agreed completed in May of 1939.
* One should be careful to separate floatplane aircraft and Flyingnoats from fixed-wheel aircraft. Floatplane aircraft and Flyingboats were early escapees from RAF control, and were not a part of the agreement reached in 1936. Ranya (talk) 00:39, 12 December 2021 (UTC)
792 NAS
I can't find any info of it still being active. If you can, then revert. If not, I removed it.Phd8511 (talk) 19:02, 23 September 2013 (UTC)
848 Naval Air Squadron
* and others, why is 848 Naval Air Squadron not listed in the Flying squadrons section of this article? Dreddmoto (talk) 15:43, 12 November 2014 (UTC)
* It was disbanded during December 2013 according to and it is not listed as being active on the Royal Navy website Gavbadger (talk) 15:56, 12 November 2014 (UTC)
Gavbadger, thanks for the reply. That's strange because it's mentioned on the Royal Navy website here http://www.royalnavy.mod.uk/our-organisation/the-fighting-arms/fleet-air-arm/support-and-training/commando-helicopter-force-headquarters but, it does not say anything about being disbanded. Is it going to reform and then be returned to the list in this article? Dreddmoto (talk) 14:58, 15 November 2014 (UTC)
* Maybe they forgot to remove the squadron from the HQ article. I have found no mention of it being reformed. Gavbadger (talk) 21:05, 18 November 2014 (UTC)
External links modified
Hello fellow Wikipedians,
I have just added archive links to 1 one external link on Fleet Air Arm. Please take a moment to review my edit. If necessary, add after the link to keep me from modifying it. Alternatively, you can add to keep me off the page altogether. I made the following changes:
* Added archive https://web.archive.org/20100524041233/http://www.royalnavy.mod.uk:80/operations-and-support/fleet-air-arm/naval-air-squadrons/naval-strike-wing/ to http://www.royalnavy.mod.uk/operations-and-support/fleet-air-arm/naval-air-squadrons/naval-strike-wing/
Cheers. —cyberbot II Talk to my owner :Online 09:39, 28 August 2015 (UTC)
Misleading content: angled decks
Currently, the article has
* As jets became larger, more powerful and faster they required more space to take off and land. The US Navy simply built much larger carriers. The Royal Navy had a few large carriers built and completed after the end of the war but another solution was sought. This was partly overcome by the introduction of a Royal Navy idea to angle the flight deck away from the centre line so that the aircraft landing had a clear run away from the usual forward deck park.
This has three problems. The principal one is the statement that the angled flight deck was a "Royal Navy idea;" in fact it was a joint Anglo-American development arising both independently and from discussions between officers of the two navies; for example a headline from the time reads "WASHINGTON, Nov. 14 -- Plans to build angled or canted flight decks on United States and possibly British aircraft carriers were announced jointly today by United States and British naval officers." The first tests of concept were conducted in 1952 aboard USS Midway and HMS Triumph, unmodified carriers with their deck markings repainted at an angle; the first physical angled deck was lashed up aboard USS Antietam the following year, preceding a similar mod to HMS Centaur by several months.
The second problem is a rather smaller one, the assertion that the USN "simply built much larger carriers." In fact the US supercarriers were preceded by the wholesale conversion of the wartime Essex class.
The third issue is more a sin of omission: the amount of postwar money and effort expended on the failed "flexible deck" land-on-a-mattress concept.
There is no question that the RN deserves all the credit for two tremendous postwar innovations, the steam catapult and the mirror landing system. But assigning them sole credit for the angled deck is a claim too far. --Solicitr (talk) 14:25, 29 March 2017 (UTC)
Origin of the name
I came to the article to find out if the Fleet in Fleet Air Arm is named after the place in Hampshire, or whether the name has a different origin. The article doesn't seem to offer any clarity. Olires (talk) 12:11, 30 September 2021 (UTC)
* It's the Air Arm of the naval fleet, see eg Flight magazine 1924. GraemeLeggett (talk) 13:18, 30 September 2021 (UTC)
|
File:Chris van Wyk00.jpg
Summary
Non-free use rationale:
* Article will be improved by addition of image
* Small size of image will not affect commercial value of original
|
Call $provide outside config. Angular
I know that is not possible to call $provide outside the config block. Is there any trick to inject $provide to a service calling it at $provide.decorator ?
angular.module('app', [])
.config(function($provide){
$provide.decorator('myService', function($delegate){
//inject the $provide into myService through $delegate
return $delegate;
}
})
and why do you need $provide in your service?
That is the same thing as injecting as parameter but with less abstraction.
Reuse decorator pattern implemented by angular.
@MiguelL Notice that $provide.decorator takes effect only if it is registered before the decorated service is instantiated (i.e. injected the first time).
$provide is special because it is defined by Angular internally, it can be found by injector among service providers (so it is available in config) but not among service instances.
This can be fixed easily with
angular.module('app', []).config(function ($provide) {
$provide.value('$provide', $provide);
});
But this way the components can be defined in ill-timed manner easily as well.
|
import { Action, createAction, createDataStore, ReadableDataStore } from '@bigcommerce/data-store';
enum ProjectionActionType {
Synchronize = 'SYNCHRONIZE',
}
interface SynchronizeAction<TState> extends Action<TState> {
type: ProjectionActionType.Synchronize;
payload: TState;
}
export interface DataStoreProjection<TTransformedState>
extends ReadableDataStore<TTransformedState> {
notifyState(): void;
}
export default function createDataStoreProjection<TState, TTransformedState = TState>(
store: ReadableDataStore<TState>,
stateTransformer: (state: TState) => TTransformedState,
): DataStoreProjection<TTransformedState> {
const projection = createDataStore<
TState | undefined,
SynchronizeAction<TState>,
TTransformedState
>(
(state, action) =>
action.type === ProjectionActionType.Synchronize ? action.payload : state,
store.getState(),
{ stateTransformer },
);
store.subscribe(
(state) => {
projection.dispatch(
createAction(ProjectionActionType.Synchronize, state) as SynchronizeAction<TState>,
);
},
{ initial: false },
);
return projection;
}
|
In git for-each-ref, what is the difference between %(refname) and %(upstream:remoteref)?
When using the --format option in git for-each-ref, what is the difference between the %(refname) and %(upstream:remoteref)?
In all my Git repos, whenever %(upstream:remoteref) is non-empty it is always equal to the %(refname). Is there some situation where they may be different?
You can track any remote branch from any local branch :
# from local branches feature/poc :
git branch -u origin/develop
# now typing 'git pull' will merge remote 'develop' into your local branch
You can track any branch at all from any local branch.
git checkout -tb myfeature origin/master
and your new feature branch will merge from/rebase on origin/master, whose upstream ref is in all likelihood refs/heads/master. You'll do this for instance when you're creating a new branch for the first time.
|
Prevent Spring boot application from starting up if JDBC connection can not be established
Currently,default behaviour the Spring boot server is that it starts (throws/logs error but still starts) even when it cannot establish JDBC connection to backend due to incorrect host/port or database name or authentication failures. I wanted the application to fail instead.(why to simply launch the server when it could n't connect to database or serve any requests) Any idea how to achieve the same.Also i use spring data jpa to interact the database.
Since you tagged rest, you're likely talking about a web server application, which usually runs 24/7. The database may be temporarily unavailable during startup of the web application, or at any time while it is running, so shutting down the application just because the database is not currently available is a bad idea. If you just installed or reconfigured the webapp, it's up to you to verify that every is ok, including the connection. The Spring webapp shouldn't fail because of it. Recommendation: Don't do this.
Hi @Andreas thanks for your comment. I wanted to fail only during web server start up when for example incorrect jdbc connection details are provided in properties file and not at later point of time when database is temporarily down. In such a case there is no point of starting up the server. You can reproduce this error by providing incorrect/non-existent db in jdbc url
But if there is a power failure or you're simply rebooting all servers for some reason, the webapp server will likely start the webapp before the database server has completed starting the database, so during startup, the database will be unavailable, and your webapp will fail to start, if you do this. If the webapp was allowed to start normally, it would be available for normal use soon after, when the database server is ready. If you do implement this ill-conceived logic, the webapp may fail to restart after a reboot, for no good reason. It's a maintenance nightmare.
@Andreas: what if i give incorrect jdbc url in properties file and try to start spring boot web server? What is the point of starting webapp ?I want to web app to fail in such case. I would like to start only if can successfully establish connection with db. I'm not talking about case of shutting down the application just because the database is not currently available or at later point of time.
If database server is not responding, is it because it's rebooting (temporary issue), or because you configured connection wrong (permanent issue)? How are you going to know the difference? You can't. But bad configuration is a one-time event, that you immediate check and fix. Server rebooting is a recurring issue, and you don't want to have to manually restart application if that happens. As I already said, it would be a maintenance nightmare. Letting the webapp run with bad config is temporary maintenance until you fix it.
|
# The GraphAttack Compiler
The GraphAttack compiler is adapted from the [DECADES compiler](https://github.com/PrincetonUniversity/DECADEScompiler).
Below are instructions on how to build and run the compiler:
-----
Prerequisites -----
DEC++ is built on LLVM/Clang. It is able to compile to riscv64
binaries using the riscv gcc sysroot.
To obtain these (large) depedencies, please go to the ext directory
and run build. This will a large install (~13 GB) and take several
hours. It will build LLVM and riscv64 GCC and OpenMP.
Building DEC++
-----
Once you have successfully installed/acquired the right versions of CMake and LLVM, run the following:
mkdir build
cd build
cmake ../
make
be sure that cmake is pointing to the right version of LLVM, this can be done with CMAKE variables, e.g.:
cmake -DLLVM_DIR=/home/ts20/DECADES_compiler/ext/build_llvm/lib/cmake/llvm ../
Running DEC++
-----
DEC++ can be invoked from the command line with the following possible arguments:
DEC++ -m MODE [-t] [NUM_THREADS] [-sps] [SCRATCHPAD_SIZE] [-s] [BISCUIT_SYNC_MODE] [-spp] [SIMULATOR_PREPROCESSING_SCRIPT] [--target] [TARGET] $FILE [$ARGS]
`MODE` must be one of the following:
- Native ("n"): simply compiles the source files with no LLVM transformations or passes (useful for verification of correct program output and debugging, as well as application development outside of any DECADES features)
DEC++ -m n $FILE [$ARGS]
No additional arguments are necessary.
- DECADES Base ("db"): the default DEC++ mode that identifies the `kernel` function, performs function inlining and wraps the function invocation in the tile launcher
DEC++ -m db [-t] [NUM_THREADS] [--target] [TARGET] $FILE [$ARGS]
where `NUM_THREADS` is the number of threads to utilize in parallel and `TARGET` can be either "x86" (default), "simulator" (https://github.com/PrincetonUniversity/pythia), or "riscv64" (generate a RISC-V binary to run on the DECADES FPGA emulation and chip platform). If the target is "simulator", then the path to the simulator preprocessing script is necessary:
DEC++ -m db [-t] [NUM_THREADS] [-spp] [SIMULATOR_PREPROCESSING_SCRIPT] [--target] [TARGET] $FILE [$ARGS]
- Decoupled Implicit ("di"): the decoupling compilation mode that slices the `kernel` function into supply and compute programs completely automatically
DEC++ -m di [-t] [NUM_THREADS] [--target] [TARGET] $FILE [$ARGS]
where `NUM_THREADS` is the number of threads to utilize in parallel and `TARGET` can be either "x86" (default) or "simulator".
## Workloads
We provide further workloads, used withing the DECADES project in the next repo:
https://github.com/amanocha/DECADES_Applications
## License
[BSD License (BSD 2-Clause License)](BSD-License.txt)
|
bash / Variable value is empty after the loop
I'm new to bash and try a simple loop but the value of my variable is being lost after it and I can not understand why - I have looked at few similar issues but they are all related to subshell execution of a while loop . I'm not doing but still facing issues - can someone explain me where is my mistake ?
#!/bin/bash
check_ss ()
{
command_list | awk '{print $1 $9}' > ss.out
for i in {1..8}
do grep -Pa "\x3$i" ss.out > ss$i.out
if grep -w "NotStarted" ss$i.out
then
ss$i=0
else
ss$i=1
fi
done
}
check_ss
echo $ss1
echo $ss2
echo $ss3
echo $ss4
I'm getting this on execution :
[root@lubo ~]# ./ss.sh
./ss.sh: line 21: ss1=1: command not found
./ss.sh: line 21: ss2=1: command not found
./ss.sh: line 21: ss3=1: command not found
./ss.sh: line 21: ss4=1: command not found
./ss.sh: line 21: ss5=1: command not found
./ss.sh: line 21: ss6=1: command not found
./ss.sh: line 21: ss7=1: command not found
./ss.sh: line 21: ss8=1: command not found
Thanks in advance
You need to use declare to dynamically construct a variable name.
declare "ss$i=0"
Thanks , this somehow changed the situation , but the script is still trying to execute ss1=1 as a command instead assinging a value to a variable ss1 : ./ss.sh: line 11: ss1=0: command not found
./ss.sh: line 17: ss1=1: command not found
Those error messages indicate you aren't using declare on those lines. A simple assignment must have a literal word as the LHS; any parameter expansions require the declare command.
Thanks , I did it with declare - now the command not found are not appearing anymore but when doing echo $ss1 , echo $ss2 the output is empty , it seems the variable value is lost somewhere
An array would be a better alternative to dynamic variable names.
check_ss() {
ss=()
command_list | awk '{print $1 $9}' > ss.out
for i in {1..8}; do
grep -Pa "\x3$i" ss.out > ss$i.out
if grep -w "NotStarted" ss$i.out; then
ss[$i]=0
else
ss[$i]=1
fi
done
}
check_ss
echo ${ss[1]}
echo ${ss[2]}
echo ${ss[3]}
echo ${ss[4]}
You could also get rid of the temporary files.
check_ss() {
ss=()
command_list | awk '{print $1 $9}' > ss.out
for i in {1..8}; do
if grep -Pa "\x3$i" ss.out | grep -w "NotStarted"; then
ss[$i]=0
else
ss[$i]=1
fi
done
}
I don't know what your input looks like exactly, but you might even be able to simplify it further to something like:
check_ss() {
ss=()
while read i; do
ss[$i]=1
done < <(command_list | awk '$9=="NotStarted" {print $1}')
}
or if you just want a list of the NotStarted numbers,
ss=(command_list | awk '$9=="NotStarted" {print $1}')
echo "${ss[@]}"
Thanks a lot for the quick answer , I'm trying to do the following to parse a text file which will containing a status of a service - either NotStarted or Else (Running , Initializing , Fault , etc. ) Here is the output of your proposal : [root@hp44fd96d3f8-2 ~]# cat ss1.out
1Initialising
[root@hp44fd96d3f8-2 ~]# cat ss2.out
2NotStarted
[root@hp44fd96d3f8-2 ~]# ./ss.sh
1
1
1
1
[root@hp44fd96d3f8-2 ~]#
Sorry for the formatting , not sure how to select the code or go to a new line when answering, anyway - i want to give every ss$i a value 1 = NotStarted or 0 = Running. For example ss1=1 , ss2 = 1 , ss3 = 0 , ss4 =1 and so on
|
List of Pokémon with different forms
Alolan forms
Regular=
Galarian forms
Hisuian forms
Each of these forms resembles letter of Latin alphabet with addition of exclamation (!) and question (?) marks. A to Z forms are extremmely rare but can be found in wild. All forms are common during certain events. Unown Pokédex entry has custom form switches. Spinda patterns differ in regular and shiny variants. 9 Spinda patterns have been released so far. Only one form is available at a time via Research tasks. Spinda Pokédex entry has custom form switches. Regular=
Castform
Shiny= PS Castform PS Castform PS Castform PS Castform
Deoxys
Deoxys has four different forms, varying in stats and moves. Regular=
Shiny= PS Deoxys PS Deoxys PS Deoxys PS Deoxys
Burmy and Wormadam
Shiny= PS Burmy PS Wormadam PS Burmy PS Wormadam PS Burmy PS Wormadam
Cherrim
Shiny= PS Cherrim PS Cherrim
Shellos and Gastrodon
Shiny= PS Shellos PS Gastrodon PS Shellos PS Gastrodon
Rotom
Shiny= PS Rotom PS Rotom PS Rotom PS Rotom PS Rotom PS Rotom Pokédex switch=
Giratina
Shiny= PS Giratina PS Giratina
Shaymin
Shaymin has two different forms, varying in types and cries. It has not been released yet. Regular=
Shiny= PS Shaymin PS Shaymin
Arceus
Arceus has eighteen different forms depending on its type. It has not been released yet. Regular=
Basculin
Shiny= PS Basculin PS Basculin PS Basculin
Darmanitan
Shiny= PS Darmanitan PS Darmanitan
Deerling and Sawsbuck
Forces of Nature
Kyurem
Shiny= PS Kyurem PS Kyurem PS Kyurem
Keldeo
Shiny= PS Keldeo PS Keldeo
Meloetta
Shiny= PS Meloetta PS Meloetta
Genesect
Shiny= PS Genesect PS Genesect PS Genesect PS Genesect PS Genesect Pokédex switch=
Greninja
Shiny= PS Greninja
Vivillon
Flabébé, Floette, and Florges
Furfrou
Aegislash
Aegislash has two different forms varying in stats. It has not been released yet.
Pumpkaboo and Gourgeist
Regular=
Xerneas
Shiny= PS Xerneas PS Xerneas
Zygarde
Zygarde has three different forms varying in stats. It has not been released yet.
Hoopa
Shiny= PS Hoopa PS Hoopa
Oricorio
Shiny= PS Oricorio PS Oricorio PS Oricorio PS Oricorio
Lycanroc
Shiny= PS Lycanroc PS Lycanroc PS Lycanroc
Wishiwashi
Silvally
Minior
Mimikyu
Mimikyu has two different forms varying in Pokédex description. It has not been released yet.
Solgaleo and Lunala
Solgaleo and Lunala have two different forms varying in moves. It has not been released yet.
Necrozma
Necrozma has four different forms varying in type and stats. It has not been released yet.
Magearna
Magearna has two different forms. It has not been released yet.
Cramorant
Toxtricity
Sinistea and Polteageist
Alcremie
Eiscue
Morpeko
Zacian and Zamazenta
Shiny= PS Zacian PS Zacian PS Zamazenta PS Zamazenta
Eternatus
Eternatus has two different forms varying in stats. It has not been released yet.
Urshifu
Calyrex
Trivia
* Shadow Pokémon and Purified Pokémon are also treated as different forms in game.
|
Casein paster gate improvements
March 22, 1960 G. DEARSLEY CASEIN FASTER GATE IMPROVEMENTS Filed June 27. 1957 FIG.2
FIGJ
INVENTOR. GEORGE DEARSLEY ATTORNEY Unite States CASE lN PASTER GATE IMPROVEMENTS Application June 27, 1957, Serial No. 668,562 6 Claims. c1. ills-2st This invention relates to an improved casein paster gate.
The well known casein paster currently in use in the cigarette manufacturing industry consists ofv a paste wheel, known as a marble wheel, rotating in a supply of paste, the periphery of that wheel being scraped by a scraper. That scraper has a narrow slot to provide for the entrance of a stream of paste to be carried toward a paste transfer wheel, which in turn applies the paste to an endless cigarette paper web.
The amount of paste permitted to issue through the narrow slot is adjustable by means of a vertically ad- .justable slide that operates as a gate allowing the correct amount of paste to fi ow therethrough.
The width of the slot is usually .04 inch wide and the adjustable height, generally between .02 and .03 inch, so that the opening through which the paste fi ows is quite small and subject to becoming choked by lumps of paste or other foreign matter that may accumulate in the paste.
The method currently used to clean the opening entails the use of a small diameter wire to poke through and clean the slot. Since such a wire is relatively large with regard to the. slot, it almost completely blocks the paste orifice, thereby preventing the flow of paste during cleaning periods. s
The cigarette rod, not having received any paste during that slight interval, breaks out or opens at the seam, entailing a loss in production as a result thereof.
Continual poking at such a small hole eventually alters its dimensions, resulting in a paste head of a shape other than the optimum.
It is, therefore, an object of this invention to provide a slot cleaning device that is readily available to the operator, a part of the machine, and one that cannot be misplaced.
A further object of this invention is to provide an improved paster gate device that will enable the operator to use it instantly without loss of operating time.
Another object is to provide a paster gate cleaning device operable at all times within the paster slot and one that will not vary the dimensions of that slot as a result of its continued use.
Other objects and features of the invention will appear as the description of the particular physical embodiment selected to illustrate the invention progresses. accompanying drawings, which form a part of this specification, like characters of reference have been applied to corresponding parts throughout the several views which make up the drawings.
Fig. 1 represents a sectional side view of the invention.
Fig. 2 represents a partial front view showing the relation between the scraper and the marble Wheel.
Fig. 3 is a partial perspective view of the scraper and slot.
Fig. 4 represents a perspective view of the vertically adjustable slide or gate with an integrally attached cleanin: tongue.
In the,
2,929,352 Patented Mar. 15960 In the apparatus employed v to illustrate the invention, applicants device may be used inconjunction with a cigarette machine paster of the type shown in the Warren patent, U.S. Patent No. 2,351,565. I
In the embodiment shown in Figure 1, I have shown my invention in operative position adjacent to the periphery of a conventional paster wheel 12, its lower portion immersed in paste 14.
The device consists of a rigidly secured housing 10 which serves as a paste container having a vertical end portion adjacent to which a suitably shaped vertically adjustable gate 16 is positioned. The adjustable gate 16,
at or near its lower end portion, has a lateral tongue-like on its uppermost portion a fixedly mounted knob 28. A
compression spring 32 is positioned on the stud 26 be tween the lower face of said knob 28 and the upper face of an inverted cup shaped stop member 30 to urge the gate 16 and knob 28 upwardly. The stud 26 is provided with a suitable flange 34 for the purpose of engaging with the stop member 30, thereby limiting the distance said gate 16 can travel upwardly.
The operation of the invention may briefly be described as follows: V
The paste wheel 12, partially immersed in paste 14, is rotated'in the direction of the arrow. In so rotating, the paste 14 adheres to the wheel 12 and is raised to the point on its periphery where it comes into contact with a scraper 22, having a central slot 20, which rides in contact with the wheel 12. The scraper 22 removes excess paste 14 from the wheel 12 at its contact point with the wheel 12. The slot 2i), however, permits a narrow bead 38 of paste to continue traveling with the wheel 12 to a conventional transfer wheel (not shown) which applies the paste 14 to an endless-cigarette web (not shown) in a manner well known in the art.
The amount of paste permitted to issue in the bead 38 is controlled by turning the knob 28 which, by means of the screw 26, adjusts the height of the sliding gate 16 to vary the cross-sectional area of the orifice through Evhich the paste flows thereby varying the amount of The paste 14- that was scraped from the paste wheel 32, tends to accumulate at the upstream side of the scraper, thereby clogging the paste slot 20. v
When the paste slot 24 becomes choked by lamps of paste or other foreign matter, a quick punch on the knob 28 causes the tongue 18 on the adjustable gate 16 to momentarily pass downwardly the slot 20 to crush any obstruction against the moving wheel 12, thus clearing the slot Z ii. Since this clearing action requires a fraction of a second, the paste bead flow 38 is not interrupted sufficiently to cause the cigarette rod (not shown) to break out, because the adjustable gate 16 immediately returns to its original position by reason of the spring 32, leaving the pre-selected adjustment which controls the paste t low unaltered. Higher production efliciency is thereby obtained.
As used in the manner above described, the dimensions of the slot 20 are not subject'to wear by this opera tion and the cigarette machine operator does not have to keep small pieces of wire about the machine for clean:
ing purposes, thus contributing to the over-all efliciency of the apparatus.
Fig. 2 shows the scraper22 in operative position on the periphery of the paste wheel 12. The tongue-portion 18 of the adjustable gate 16 is shown positioned within the slot 20 of the scraper 22.
From the foregoing description, it will be apparent that the apparatus herein provides for the efiicient removal of paste obstructions from a casein paster gate without interfering with the formation of a continuous seal of the cigarette rod.
The invention hereinabove described may be varied in construction within the scope of the claims, for the particular device selected to illustrate the invention is but one of. many possible embodiments of the same. The in-: vention, therefore, is not to be restricted to the precise details of the structure shown and described.
What is claimed is: a a
' 1. In a paster for a cigarette making machine comprising a paste reservoir, a wheel rotating in said reservoir, for picking up paste on its peripheral surface, a scraper having an edge riding in contact with said wheel for removing paste from the periphery thereof, said scraper having a slot formed in the edge riding in contact with said wheel for allowing a strip of paste to pass therethrough, and a flow adjusting gate moveable up and down in front of said slot for regulating the size of said slotted opening to thereby control the amount of paste passing through said slot, the improvement comprising an extension formed on said adjusting gate and extending into said slot and moveable up and down therein, the lower end of said adjusting gate and extension having a surface which has the same arcuate configuration as said wheel, means for regulating the distance said extension and adjusting gate is spaced from said wheel, and a manually operated member permitting said extension. and adjusting gate to be pushed downwardly against said .wheel to crush any paste which may clog said slot.
2. A device for cleaning out a casein scraper slot in a paster having a housing, an adjustable gate slidably attached to said housing, and a paste scraper vertically mounted adjacent to said adjustable gate, the improvement comprising a lateral tongue-like projection slidably operable within a paste slot located at the base of said paste scraper plate, a stud suitably attached to the upper end portion of said adjusting gate, a flanged stop member suitably attached to said stud membena fixedly mounted knob on the upper shank portion of said stud and a compression spring mounted on said stud between the lower face of said knob and the upper face of said flange mem her to reposition the said gate and said tongue-like projection after it has been depressed.
*3. A device for cleaning out a casein scraper slot in a paster having a housing, and means for mounting an adjustable gate adjacent to said housing, the improvement comprising a suitable clean-out tongue attached to the adjustable gate, a single slotted paste scraper adjacent to said adjustable gate, a vertical flanged stud mounted through the upper end of said adjustable gate, a knob to depress said adjustable gate and clean-out tongue, and means for returning said knob together with the adjustable gate and clean-out tongue to its pre depressed position.
4. A device for cleaning out a casein scraper slot in a paster having a housing, a vertical gate reciprocably mounted on said housing, and a paste scraper having a central narrow slot at its lower end and maintaining contact with a marble paste wheel,"the improvement comprising a lateral projection slidably operable within a paste slot, a stud suitably attached to the upper portion of said vertical gate, a knob on the upper shank portion of said stud, a suitable stop member attached to said stud, and a'cornpression spring mounted on said stud and under said knob.
5. A device for cleaning out a casein'scraper slot in a paster having a housing, an adjustable gateslidably attached to said housing; and a paste. scraper mounted adjacent to said adjustable gate, the improvement comprising a projection located at the base of said adjustable gate and operable within a paste slot located at the base of said paste scraper, a stud suitably attached to the upper end portion of said adjustable gate, a flanged stop member positioned between the upper end portion of the adjustable gate and the lower face of an adjusting knob, and means to depress and reset said adjusting knob.
6. A device for cleaning out a casein scraper slot comprising an adjustable gate having a protruding tongue at its lower end portion, a paste scraper having a slotted end portion to accommodate said protruding tongue, a flanged stud suitably attached to the upper end portion of said adjustable gate, and means to depress and reset said stud.
References Cited in the file of this patent UNITED STATES PATENTS
|
## 1.0.0 (2017-12-03)
* **(breaking)** directly expose `fromCSV` operator and no longer patch the `Observable`
* change from JavaScript to TypeScript
## 0.1.5
* update type definition
## 0.1.4
* add `noHeaderRow` and `columns` option
## 0.1.3
* fix type definition and use npm5
## 0.1.2
* fix typo
## 0.1.1
* fix a bug where commas in a string value was incorrectly treated as delimiter.
## 0.1.0
* initial release.
|
ctrl-s on linux just writes s
Using ctrl+s in the code editor just writes an s. it does not reassemble.
I am on ubuntu 22.04
I'm not sure why this happens, but f5 also reassembles so you can just use that.
I'm on Pop!OS. When the text editor is not focused, ctrl+s works. When the editor is in focus, ctrl+s writes an s. Maybe this helps.
If this is a reccurring issue on Linux, then I'll check it out on my Fedora install. Not sure why it would be OS dependent though.
Pop!OS is built on top of Ubuntu as far as I know, so might be just an Ubuntu thing
I'm on ubuntu and have the same issue.
I found the same issue and the solution here: https://github.com/godotengine/godot/issues/88768
|
Salary Calculator
Add Employee
Submit
Employees
First Name
Last Name
ID
Title
Annual Salary
Remove Employee
Total Monthly:
|
Talk:Gypsy Pirates/@comment-3507136-20120819231751/@comment-3507136-20120820122824
Its a fair enough reason :) IT's good that you want to stick with your concept.
|
import React, { Component } from 'react';
import './app.css';
import { connect } from 'react-redux';
import io from "socket.io-client";
import { HashRouter as Router, Redirect, Route, Link, Switch, hashHistory } from 'react-router-dom';
import logo from "./assets/logo.png";
import 'bootstrap';
import '../node_modules/bootstrap/dist/css/bootstrap.min.css';
import { store } from '../renderer';
import { Collapse, Navbar, NavbarToggler, NavbarBrand, Nav, NavItem, NavLink } from 'reactstrap';
import Game from "./components/Game_Page/Game";
import Home from "./components/Home_Page/Home";
import Login from "./components/Login_Page/Login";
import Lobby from "./components/Lobby_Page/Lobby";
import WaitingRoom from "./components/WaitingRoom_Page/WaitingRoom";
import { GameBoard } from "./classes/gameBoard";
import { initiateGameBoard, updateLoginStatus } from "./redux_app-state/actions/actions";
const mapStateToProps = (state = {}) => {
return {
isLoggedIn: state.User.isLoggedIn,
state: state
};
};
const mapDispatchToProps = (dispatch) => {
return {
initiateGameBoard: (gameBoard) => dispatch(initiateGameBoard(gameBoard)),
updateLoginStatus: (bool) => dispatch(updateLoginStatus(bool))
};
};
function loggedIn() {
let amILoggedIn = !!store.getState().User.isLoggedIn;
console.log("Am I logged in", amILoggedIn);
return amILoggedIn;
}
export class App extends React.Component {
constructor(props) {
super(props);
this.toggleNavbar = this.toggleNavbar.bind(this);
this.state = {
collapsed: true
};
}
componentDidMount() {
}
componentWillUnmount() {
if (tcpConnection) {
console.log("closing connection");
tcpConnection.destroy();
}
}
toggleNavbar() {
this.setState({
collapsed: !this.state.collapsed
});
}
logout() {
this.props.updateLoginStatus(false);
tcpConnection.destroy();
}
navItem(path, text) {
return <NavItem>
<div className="nav-link"><Link to={path} replace>{text}</Link></div>
</NavItem>
}
render() {
const { isLoggedIn } = this.props;
return (<Router history={hashHistory}>
<div>
<Navbar className="border-bottom" color="faded" light expand="md">
<NavbarBrand className="brand-title" onClick={()=>console.log(this.props.state)}><strong>clue-less by northraki</strong></NavbarBrand>
<NavbarToggler onClick={this.toggle} />
<Collapse isOpen={this.state.isOpen} navbar>
<Nav className="ml-auto" navbar>
{this.navItem("/", "Home")}
{ !isLoggedIn ? this.navItem("/login", "Login") : null }
</Nav>
</Collapse>
</Navbar>
<Route exact path="/" component={Home}/>
<Route exact path="/login" component={Login}/>
<Route exact path="/lobby" component={Lobby}/>
<Route exact path="/game" component={Game}/>
<Route exact path="/waitingRoom" component={WaitingRoom}/>
</div>
</Router>);
}
}
// { !isLoggedIn ? null : this.navItem("/lobby", "Lobby") }
// { !isLoggedIn ? null : <NavItem><NavLink className='cursor-pointer link' onClick={this.logout.bind(this)}>Log out</NavLink></NavItem> }
export default connect(mapStateToProps, mapDispatchToProps)(App);
|
using Domain.Models;
using System;
using System.Collections.Generic;
using System.IO;
using System.Text.Json;
namespace Infra.Data.FlatFile
{
public class Flat
{
public const string ArqCustomer = "CadastroCliente.bin";
private static List<Customer> _Customer;
public static List<Customer> CadCustomer
{
get
{
if (_Customer != null)
{
return _Customer;
}
else
{
CadCustomer = GetCadastro<Customer>(ArqCustomer);
return _Customer;
}
}
set
{
_Customer = value;
}
}
private static List<T> GetCadastro<T>(string Arquivo)
{
var path = AppDomain.CurrentDomain.BaseDirectory + Arquivo;
if (File.Exists(path))
{
return GetBin<T>(path);
}
else
{
return new List<T>();
}
}
public static void SetCadastro<T>(List<T> Cadastro, string Arquivo)
{
var path = AppDomain.CurrentDomain.BaseDirectory + Arquivo;
SetBin<T>(Cadastro, path);
}
private static List<T> GetBin<T>(string Path)
{
var json = File.ReadAllText(Path);
return JsonSerializer.Deserialize<List<T>>(json);
}
private static void SetBin<T>(List<T> Cadastro, string Path)
{
var json = JsonSerializer.Serialize(Cadastro);
File.WriteAllText(Path, json);
}
}
}
|
class Api::V3::PayloadValidator
include ActiveModel::Model
def initialize(attributes = {})
@attributes = attributes.to_hash.with_indifferent_access
super(attributes)
end
def schema_with_definitions
schema.merge(definitions: Api::V3::Schema.all_definitions)
end
def errors_hash
errors.to_hash.merge(id: id)
end
def validate_schema
JSON::Validator.fully_validate(schema_with_definitions, to_json).each do |error_string|
errors.add(:schema, error_string)
end
end
def model_name
self.class.name.demodulize.gsub(/PayloadValidator/, "")
end
def check_invalid?
if invalid?
track_invalid
true
else
false
end
end
def track_invalid
Statsd.instance.increment("merge.#{model_name}.schema_invalid")
end
end
|
Catching user input from popup with validation?
I am trying to put in a variable a value that the user has to introduce from a popup.
I have seen the function POPUP_GET_VALUES can be the adiente, but in the parameters that the function requires I see that there is a table to put the value into a field. As it is a unique value, I would like to put it within a single variable previously defined, in order to also be able to establish limits for the user to enter the value, since it has to be a percentage.
Any ideas?
Thanks!
You can use FM POPUP_TO_GET_ONE_VALUE and specify texts you want. But you should then check the format of input. For POPUP_GET_VALUES you need a table and field to reference, it will check the format for you.
Thanks! That FM is exactly what i was looking for
|
Artists | Issues | CD Reviews | Interviews | Concert Reviews | DVD/Video Reviews | Book Reviews | Who We Are | Staff | Home
Progressive Rock DVD/Video Reviews
Estradasphere
Palace of Mirrors Live DVD
Review by Gary Hill
I remember when I saw Alan Holdsworth live. My mouth was open nearly the entire set because the band was so incredible. I remember thinking that every musician could see the show because it would give them a sense of humility – and when you consider that my main musical genre was progressive rock, that says a lot. Well, I get the same feeling from watching this DVD. This band is simply incredible! They are all over the map in terms of musical styles and in terms of their compositions. The amazing thing, though, is the music is coherent and never really loses you. That’s some feat. Musicianship like this is an extremely rare commodity. These guys play ultra heavy crazed metal with symphonic and world music leanings one moment and then pure classical textures the next. I really mean it when I say that this is all over the place. I thought when hearing the album that perhaps they were able to pull such things off because it was in the studio. Well, this DVD shows that it just isn’t true. Estradasphere moves from jazz to metal to symphonic to klesmer and does it all with a tight performance that’s about as close to flawless as you can get. This might well be the most talented band currently on the face of the earth. I can’t recommend this DVD enough. While the filmography is adequate (and not much beyond) anyone interested in seeing just how far music can be taken in the right hands must pick this up. That pretty much sums it up.
This review is available in book format (hardcover and paperback) in Music Street Journal: 2008 Volume 1 at lulu.com/strangesound.
More DVD/Video Reviews
Metal/Prog Metal
Non-Prog
Progressive Rock
This work is licensed under a Creative Commons Attribution 3.0 United States License.
© 2020 Music Street Journal Site design and programming by Studio Fyra, Inc./Beetcafe.com
|
package website.automate.waml.report.io.model;
import java.util.ArrayList;
import java.util.List;
import website.automate.waml.io.model.Scenario;
import com.fasterxml.jackson.annotation.JsonIgnoreProperties;
import com.fasterxml.jackson.annotation.JsonProperty;
import com.fasterxml.jackson.annotation.JsonPropertyOrder;
@JsonPropertyOrder({"status", "message", "time", "numActionPasses", "numActionFailures", "path", "criteria", "steps"})
public class SimpleScenarioReport implements ScenarioReport {
@JsonProperty("criteria")
@JsonIgnoreProperties("name")
private Scenario scenario;
private String message;
private String path;
private ExecutionStatus status = ExecutionStatus.SUCCESS;
private Double time = 0.0;
private Integer numActionPasses = 0;
private Integer numActionFailures = 0;
private List<ActionReport> steps = new ArrayList<>();
@Override
public void updateStats() {
for (ActionReport step : steps) {
ExecutionStatus actionStatus = step.getStatus();
status = ExecutionStatus.worstOf(status, actionStatus);
setNumAction(actionStatus);
time += step.getTime();
}
}
private void setNumAction(ExecutionStatus actionStatus) {
if (actionStatus == ExecutionStatus.SUCCESS) {
this.numActionPasses++;
} else {
this.numActionFailures++;
}
}
@Override
public Scenario getScenario() {
return scenario;
}
@Override
public void setScenario(Scenario scenario) {
this.scenario = scenario;
}
@Override
public String getMessage() {
return message;
}
@Override
public void setMessage(String message) {
this.message = message;
}
@Override
public String getPath() {
return path;
}
@Override
public void setPath(String path) {
this.path = path;
}
@Override
public ExecutionStatus getStatus() {
return status;
}
@Override
public void setStatus(ExecutionStatus status) {
this.status = status;
}
@Override
public Double getTime() {
return time;
}
@Override
public void setTime(Double time) {
this.time = time;
}
@Override
public Integer getNumActionPasses() {
return numActionPasses;
}
@Override
public void setNumActionPasses(Integer numActionPasses) {
this.numActionPasses = numActionPasses;
}
@Override
public Integer getNumActionFailures() {
return numActionFailures;
}
@Override
public void setNumActionFailures(Integer numActionFailures) {
this.numActionFailures = numActionFailures;
}
@Override
public List<ActionReport> getSteps() {
return steps;
}
@Override
public void setSteps(List<ActionReport> steps) {
this.steps = steps;
}
}
|
Board Thread:Roleplaying/@comment-26178112-20160220014321/@comment-26265145-20160222015912
Meph: bzzt! Sappy.*shoots a lightning bolt at him and makes a fireball*
|
/**
*
*/
package org.bojarski.service;
import java.io.IOException;
import java.time.Instant;
import java.util.Collections;
import java.util.Date;
import javax.servlet.http.HttpServletRequest;
import javax.servlet.http.HttpServletResponse;
import org.bojarski.Constants;
import org.bojarski.configuration.Settings;
import org.bojarski.model.AuthenticationToken;
import org.springframework.beans.factory.annotation.Autowired;
import org.springframework.security.authentication.UsernamePasswordAuthenticationToken;
import org.springframework.security.core.Authentication;
import org.springframework.stereotype.Service;
import com.fasterxml.jackson.core.JsonProcessingException;
import com.fasterxml.jackson.databind.ObjectMapper;
import io.jsonwebtoken.Claims;
import io.jsonwebtoken.Jwts;
import io.jsonwebtoken.SignatureAlgorithm;
/**
* @author Arkadiusz Bojarski
*
*/
@Service
public class TokenAuthenticationService {
private final Settings settings;
@Autowired
public TokenAuthenticationService(Settings settings) {
this.settings = settings;
}
public void addAuthentication(HttpServletResponse response, Authentication authentication) throws JsonProcessingException, IOException {
Instant current = Instant.now();
String JWT = Jwts.builder()
.setSubject(authentication.getName())
.setIssuedAt(Date.from(current))
.signWith(SignatureAlgorithm.HS512, settings.getTokenSigningKey())
.compact();
AuthenticationToken token = new AuthenticationToken();
token.setAccess_token(JWT);
token.setToken_type(Constants.BEARER);
ObjectMapper mapper = new ObjectMapper();
response.setHeader(Constants.CONTENT_TYPE_HEADER, Constants.CONTENT_TYPE_JSON);
response.getWriter().write(mapper.writeValueAsString(token));
}
public Authentication getAuthentication(HttpServletRequest request) {
String payload = request.getHeader(Constants.SECURITY_AUTHORIZATION_HEADER);
if (payload != null) {
Claims claims = Jwts.parser()
.setSigningKey(settings.getTokenSigningKey())
.parseClaimsJws(payload.replaceAll(Constants.SECURITY_PREFIX, ""))
.getBody();
return new UsernamePasswordAuthenticationToken(claims.getSubject(), null, Collections.emptyList());
}
return null;
}
}
|
Add wiki images
Overview
I need to add screenshots to the documentation in the wiki. This PR uploads the images I need for the Getting Started Gude.
Added images directly to wiki instead.
|
Clifford WILLIAMS, Jr., Appellant, v. STATE of Florida, Appellee.
No. AN-128.
District Court of Appeal of Florida, First District.
Oct. 19, 1982.
Rehearing Denied Nov. 18, 1982.
Clifford Williams, Jr., pro se.
No appearance for appellee.
MILLS, Judge.
Williams appeals the trial court’s summary denial of his motion for post-conviction relief. We affirm.
The first two issues raised by Williams were previously raised on direct appeal and cannot form the basis for collateral attack. Williams v. State, 386 So.2d 538 (Fla.1980). The third issue is without merit because newly discovered evidence may not be raised in a Rule 3.850 motion, but may only be raised by petition for writ of coram nobis to the appellate court which originally affirmed the conviction. Hallman v. State, 371 So.2d 482 (Fla.1979).
AFFIRMED.
ERVIN and WIGGINTON, JJ., concur.
|
Images: Maintaining Excellence; Aircraft mechanics keep Mississippi prepared [Image 3 of 4]
Photo by Staff Sgt. Shane Hamann
Pfc. Christopher M. Lord, an aircraft mechanic from Brandon, Miss., with 1st Battalion, 185th Aviation Regiment, performs daily preflight checks on a UH-60 Black Hawk helicopter May 6, 2014 at the Combat Readiness Training Center. Aircraft mechanics ensure that the aircraft are ready for combat and state emergency missions. (U.S. Army National Guard photo by Staff Sgt. Shane Hamann, 102nd Mobile Public Affairs Detachment.)
Web Views
18
Downloads
2
Podcast Hits
0
This work, Maintaining Excellence; Aircraft mechanics keep Mississippi prepared [Image 3 of 4], by SSG Shane Hamann, identified by DVIDS, is free of known copyright restrictions under U.S. copyright law.
Date Taken:05.05.2014
Date Posted:05.07.2014 11:09
Photo ID:1320972
VIRIN:140505-Z-MX357-012
Resolution:3504x2284
Size:3.13 MB
Location:GULFPORT, MS, US
Hometown:BRANDON, MS, US
Gallery Images
Associated News
Maintaining excellence; Aircraft mechanics keep Mississippi prepared
Options
HOLIDAY GREETINGS
SELECT A HOLIDAY:
VIDEO ON DEMAND
|
What is a lagom server in lagom framework?
Inside the doc, nothing is written except a line which says " A Lagom server"
And on searching on the doc https://www.lagomframework.com/documentation/current/scala/Migration14.html#Akka-HTTP-as-the-default-server-engine
Found out that Akka-http as the default server engine.
Is it so?
|
import * as Three from "three";
// Useful for debugging issues with materials.
export const ReplaceChildMaterials = (
obj: Three.Object3D,
material: Three.Material | Three.Material[] = new Three.MeshBasicMaterial({
color: 0x999999,
}),
) =>
obj.traverse(child =>
child instanceof Three.Mesh ? (child.material = material) : undefined,
);
|
a single, slender process which is entirely naked except at the tip, where it is armed with numerous modified spines like those upon the tip of the inner lamella of the first pair of appendages in the male; while in the male there is a similar process, usually arising nearer the base, however, but always accompanied by a somewhat smaller process arising just at the base of the first and furnished with numerous long setae like the marginal setfe of the lamella itself. Hippolyte G-rcenlandica Miers. Astacus Gfcenlandicus J. C. Fabricius. Systema Entomologise, p. 416, 1 775; Entomologia systematica, ii, p. 484, 1793. Cancer aculeatvs 0. Fabricius. Fauna Grcelandica, p. 239. 1780. Alpheus aculealus Sabine, in Supplement to appendix of Parry’s [first] Voyage, p. ccxxxviii, pi. 2, figs. 5-8, 1824. Hippolyte aculeata J. C. Ross, in John Ross. Appendix to narrative of a second Voyage in search of the northwest passage, p. lxxxiii, 1835. Hippolyte armata Owen. Voyage of the Blossom, p. 88, pi. 27, fig. 2. 1839 ( $ ). Hippolyte cornula Owen. op. cit., p. 89, pi. 28, fig. 2, 1839 ( $ ). Hippolyte Grcenlandica Miers. Annals and Magazine Nat. Hist., IV, xx, p. 62 (12), 1877. Salem Harbor !, Massachusetts, 6 fathoms, 1873; also off Baker’s Island !, 20 fathoms (J. H. Emerton, 1878). Between Cape Ann and the Isles of Shoals!, 33 fathoms, gravel and stones, 1873. Casco Bay!, 1873: between Overset and Peak’s Islands, 18 fathoms, rocks and sponges; West Cod Ledge, 10 to 20 fathoms, rocky; and from the stomachs of cod taken at the last locality. Grand Menan !, Bay of Fundy, 1872; also off Flagg’s Cove!, Grand Menan, 15 fathoms, shells, mud and stones, 1873. Off Treat’s Island!, Eastport, Maine, 15 fathoms, stones, 1870. Halifax !, Nova Scotia, 1877: 16 fathoms, stones, sand and red algae; IS fathoms, fine sand, also mud and fine sand; 21 fathoms, fine sand and red algae; and 25 fathoms, gravel. Murry Bay!, Gulf of St. Lawrence (Principal J. W. Dawson). Labrador (Packard). Grinnell Land, as far north as 82° 30' (Miers). Greenland (J. C. Fabricius, O. Fabricius, Kroyer, et al.). Bering Sea and Arctic Ocean north of Bering Straits (Owen, Stimpson). The largest specimens examined were from the Bay of Fundy, the largest male 41""", the largest female 55""" in length. According to the following notes, made by Professor Veri-ill in 1870, on two males from the Bay of Fundy, this species varies considerably in coloration. A male 41""" long, from 15 fathoms, stony, north of Treat’s Island, Eastport Harbor, had the body very pale whitish gray with faint clouds of dark gray on the carapax and :i large spot of the same color on each side of each of the first five seg-
|
Error code ELIFECYCLE when pushing app to Heroku
I'm trying to push my angular project app to Heroku but recieving errors doing so. I've seen threads about deleting node_modules and doing a npm install, however, this does not work for me.
This is what the build log looks like:
-----> Installing dependencies
Installing node modules
><EMAIL_ADDRESS>install /tmp/build_5dc438c0/node_modules/nice-napi
> node-gyp-build
><EMAIL_ADDRESS>postinstall /tmp/build_5dc438c0/node_modules/esbuild
> node install.js
><EMAIL_ADDRESS>postinstall /tmp/build_5dc438c0/node_modules/core-js
> node -e "try{require('./postinstall')}catch(e){}"
><EMAIL_ADDRESS>postinstall /tmp/build_5dc438c0/node_modules/@angular/cli
> node ./bin/postinstall/script.js
added 970 packages in 13.182s
-----> Build
Detected both "build" and "heroku-postbuild" scripts
Running heroku-postbuild
><EMAIL_ADDRESS>heroku-postbuild /tmp/build_5dc438c0
> ng build --prod
Node.js version v12.18.2 detected.
The Angular CLI requires a minimum Node.js version of either v12.20, v14.15, or v16.10.
Please update your Node.js version or visit https://nodejs.org/ for additional instructions.
npm ERR! code ELIFECYCLE
npm ERR! errno 3
npm ERR<EMAIL_ADDRESS>heroku-postbuild: `ng build --prod`
npm ERR! Exit status 3
npm ERR!
npm ERR! Failed at the<EMAIL_ADDRESS>heroku-postbuild script.
npm ERR! This is probably not a problem with npm. There is likely additional logging output above.
npm ERR! A complete log of this run can be found in:
npm ERR! /tmp/npmcache.RLDGy/_logs/2022-01-12T13_45_01_544Z-debug.log
-----> Build failed
We're sorry this build is failing! You can troubleshoot common issues here:
https://devcenter.heroku.com/articles/troubleshooting-node-deploys
If you're stuck, please submit a ticket so we can help:
https://help.heroku.com/
Love,
Heroku
! Push rejected, failed to compile Node.js app.
! Push failed
What can I do to get around this error?
After adding "node": "12.20.x" to "engines":
2022-01-12T14:33:47.000000+00:00 app[api]: Build started by user<EMAIL_ADDRESS>2022-01-12T14:35:25.273203+00:00 app[api]: Deploy 8d86c039 by user<EMAIL_ADDRESS>2022-01-12T14:35:25.273203+00:00 app[api]: Release v4 created by user<EMAIL_ADDRESS>2022-01-12T14:35:26.735671+00:00 heroku[web.1]: State changed from crashed to starting
2022-01-12T14:35:31.764566+00:00 heroku[web.1]: Starting process with command `npm start`
2022-01-12T14:35:33.514980+00:00 app[web.1]:
2022-01-12T14:35:33.514991+00:00 app[web.1]: ><EMAIL_ADDRESS>start /app
2022-01-12T14:35:33.514991+00:00 app[web.1]: > ng serve
2022-01-12T14:35:33.514991+00:00 app[web.1]:
2022-01-12T14:35:33.520075+00:00 app[web.1]: sh: 1: ng: not found
2022-01-12T14:35:33.528901+00:00 app[web.1]: npm ERR! code ELIFECYCLE
2022-01-12T14:35:33.529008+00:00 app[web.1]: npm ERR! syscall spawn
2022-01-12T14:35:33.529086+00:00 app[web.1]: npm ERR! file sh
2022-01-12T14:35:33.529172+00:00 app[web.1]: npm ERR! errno ENOENT
2022-01-12T14:35:33.531393+00:00 app[web.1]: npm ERR<EMAIL_ADDRESS>start: `ng serve`
2022-01-12T14:35:33.531443+00:00 app[web.1]: npm ERR! spawn ENOENT
2022-01-12T14:35:33.531502+00:00 app[web.1]: npm ERR!
2022-01-12T14:35:33.531554+00:00 app[web.1]: npm ERR! Failed at the<EMAIL_ADDRESS>start script.
2022-01-12T14:35:33.531599+00:00 app[web.1]: npm ERR! This is probably not a problem with npm. There is likely additional logging output above.
2022-01-12T14:35:33.536011+00:00 app[web.1]:
2022-01-12T14:35:33.536202+00:00 app[web.1]: npm ERR! A complete log of this run can be found in:
2022-01-12T14:35:33.536297+00:00 app[web.1]: npm ERR! /app/.npm/_logs/2022-01-12T14_35_33_532Z-debug.log
2022-01-12T14:35:33.669631+00:00 heroku[web.1]: Process exited with status 1
2022-01-12T14:35:33.823240+00:00 heroku[web.1]: State changed from starting to crashed
2022-01-12T14:35:33.842552+00:00 heroku[web.1]: State changed from crashed to starting
2022-01-12T14:35:38.370015+00:00 heroku[web.1]: Starting process with command `npm start`
2022-01-12T14:35:40.529105+00:00 app[web.1]:
2022-01-12T14:35:40.529133+00:00 app[web.1]: ><EMAIL_ADDRESS>start /app
2022-01-12T14:35:40.529133+00:00 app[web.1]: > ng serve
2022-01-12T14:35:40.529133+00:00 app[web.1]:
2022-01-12T14:35:40.532506+00:00 app[web.1]: sh: 1: ng: not found
2022-01-12T14:35:40.536788+00:00 app[web.1]: npm ERR! code ELIFECYCLE
2022-01-12T14:35:40.536888+00:00 app[web.1]: npm ERR! syscall spawn
2022-01-12T14:35:40.536955+00:00 app[web.1]: npm ERR! file sh
2022-01-12T14:35:40.537028+00:00 app[web.1]: npm ERR! errno ENOENT
2022-01-12T14:35:40.539163+00:00 app[web.1]: npm ERR<EMAIL_ADDRESS>start: `ng serve`
2022-01-12T14:35:40.539208+00:00 app[web.1]: npm ERR! spawn ENOENT
2022-01-12T14:35:40.539258+00:00 app[web.1]: npm ERR!
2022-01-12T14:35:40.539306+00:00 app[web.1]: npm ERR! Failed at the<EMAIL_ADDRESS>start script.
2022-01-12T14:35:40.539355+00:00 app[web.1]: npm ERR! This is probably not a problem with npm. There is likely additional logging output above.
2022-01-12T14:35:40.544701+00:00 app[web.1]:
2022-01-12T14:35:40.544777+00:00 app[web.1]: npm ERR! A complete log of this run can be found in:
2022-01-12T14:35:40.544816+00:00 app[web.1]: npm ERR! /app/.npm/_logs/2022-01-12T14_35_40_539Z-debug.log
2022-01-12T14:35:40.665966+00:00 heroku[web.1]: Process exited with status 1
2022-01-12T14:35:40.748773+00:00 heroku[web.1]: State changed from starting to crashed
2022-01-12T14:35:42.234593+00:00 heroku[router]: at=error code=H10 desc="App crashed" method=GET path="/" host=miun-project-angular.herokuapp.com request_id=096b472c-7443-40cd-ba7f-b26afa11cc0a fwd="<IP_ADDRESS>" dyno=
connect= service= status=503 bytes= protocol=https
2022-01-12T14:35:42.443809+00:00 heroku[router]: at=error code=H10 desc="App crashed" method=GET path="/favicon.ico" host=miun-project-angular.herokuapp.com request_id=ff6630c8-1a6c-45f3-9d68-ab729c25ccd9 fwd="<IP_ADDRESS>" dyno= connect= service= status=503 bytes= protocol=https
2022-01-12T14:35:43.000000+00:00 app[api]: Build succeeded
2022-01-12T14:35:46.092795+00:00 heroku[router]: at=error code=H10 desc="App crashed" method=GET path="/" host=miun-project-angular.herokuapp.com request_id=34abf454-a40f-48bf-bf92-fd91e9792dea fwd="<IP_ADDRESS>" dyno=
connect= service= status=503 bytes= protocol=https
2022-01-12T14:35:46.297579+00:00 heroku[router]: at=error code=H10 desc="App crashed" method=GET path="/favicon.ico" host=miun-project-angular.herokuapp.com request_id=bb11c150-6a4d-4cf7-b4be-20711731d61d fwd="<IP_ADDRESS>" dyno= connect= service= status=503 bytes= protocol=https
2022-01-12T14:35:59.357083+00:00 heroku[router]: at=error code=H10 desc="App crashed" method=GET path="/" host=miun-project-angular.herokuapp.com request_id=cfd5c527-5b21-4d03-b08a-7e96c98caac1 fwd="<IP_ADDRESS>" dyno=
connect= service= status=503 bytes= protocol=https
2022-01-12T14:35:59.570612+00:00 heroku[router]: at=error code=H10 desc="App crashed" method=GET path="/favicon.ico" host=miun-project-angular.herokuapp.com request_id=7788fb21-3137-41ef-9ad2-3d529f32266f fwd="<IP_ADDRESS>" dyno= connect= service= status=503 bytes= protocol=https
2022-01-12T14:38:08.475690+00:00 heroku[router]: at=error code=H10 desc="App crashed" method=GET path="/" host=miun-project-angular.herokuapp.com request_id=6d3c3250-a75e-440a-925c-db8b58dc1416 fwd="<IP_ADDRESS>" dyno=
connect= service= status=503 bytes= protocol=https
2022-01-12T14:38:08.684035+00:00 heroku[router]: at=error code=H10 desc="App crashed" method=GET path="/favicon.ico" host=miun-project-angular.herokuapp.com request_id=d05edfd2-984f-433c-9c10-47eed273e9a9 fwd="<IP_ADDRESS>" dyno= connect= service= status=503 bytes= protocol=https
2022-01-12T14:38:15.011568+00:00 heroku[router]: at=error code=H10 desc="App crashed" method=GET path="/favicon.ico" host=miun-project-angular.herokuapp.com request_id=c68e2058-114b-4342-8914-1795524319b6 fwd="<IP_ADDRESS>" dyno= connect= service= status=503 bytes= protocol=https
2022-01-12T14:38:14.772764+00:00 heroku[router]: at=error code=H10 desc="App crashed" method=GET path="/" host=miun-project-angular.herokuapp.com request_id=73fde94f-dfee-4e8b-80e8-924cb59755f7 fwd="<IP_ADDRESS>" dyno=
connect= service= status=503 bytes= protocol=https
2022-01-12T14:38:17.861635+00:00 heroku[router]: at=error code=H10 desc="App crashed" method=GET path="/" host=miun-project-angular.herokuapp.com request_id=e1c0e987-e39d-4994-b8f5-f7f38c28e066 fwd="<IP_ADDRESS>" dyno=
connect= service= status=503 bytes= protocol=https
2022-01-12T14:38:18.101642+00:00 heroku[router]: at=error code=H10 desc="App crashed" method=GET path="/favicon.ico" host=miun-project-angular.herokuapp.com request_id=932a731b-a49b-48b2-a56c-b524b5f6aee1 fwd="<IP_ADDRESS>" dyno= connect= service= status=503 bytes= protocol=https
The log suggest Please update your Node.js version. The Angular CLI requires a minimum Node.js version of either v12.20, v14.15, or v16.10.
It looks like the error lies within your Angular build script in package.json rather than Heroku itself.
The Angular CLI shows in the error that it requires a minimum of Node.js v12.20, but you are currently using v12.18.2.
To force Heroku to use a specific version of Node, you can specify the version within the engines object in package.json.
Simply add this to your package.json and redeploy the app to Heroku.
"engines": {
"node": "12.20.x"
}
I'd recommend using the most recent LTS version when deploying new projects to stay as up to date for as long as possible.
Additional documentation can be found here on deploying a Node app to Heroku with custom build parameters.
This didn't work either. I will post the error logs to my og post.
@FabianTjernström I'm not totally familiar with deploying Angular applications, but I believe you may just be missing the Angular CLI in your dependencies. Heroku needs the @angular/cli package to run the ng command. See this answer to a similar question for reference on which devkit/builder packages are required to build and run the app, and ensure they are installed into the dependencies section of your package.json. https://stackoverflow.com/a/54893568/6840029
|
Timeslaughter
This game provides examples of:
* Bloody Hilarious: The game tries to be as silly with its gore as possible.
* Fartillery: Mojumbo.
* Finishing Move: Slaughter moves, which more likely than not completely dismember the opponent.
* Gorn
* Handicapped Badass: Jinsoku is blind, but you'd rarely notice considering how well he fights.
* Hollywood Tourettes: Savage. Or atleast that's what he says.
* Idiot Savant: Ug the caveman isn't very bright. That's why he lets his club do the talking.
* Names to Run Away From Really Fast: Savage.
* Off Model: The drawings in this games are awful, to say the least.
* Shout Out: A group of demons who torture a man so badly he's lost his sanity by the end of it.
* Split Personality: One moment Asylum's acting like Peewee Herman, the next he's Adolf Hitler.
|
Samurai Sentai Shinkenger
Plot
Act 9: The Tiger's Rebellion
Act 15: The Imposter and Real Deal's Arrest
Act 27: Switched Lives
Act 30: The Manipulated Academy
|
How to show a button as effect while hovering over an image?
I have an image(class photo) in my webpage and a button(class btn) named "Add to Cart". I want it to work such that when someone hovers over the product image, the "Add to cart" button starts showing over the image while the opacity of the image decreases a bit. I cant quite figure out how to make the button appear when i hover over the image. I am quite new to web development so please help. What do i write in css such that the button is only visible on top of the image when mouse is being hovered over the image.
<div>
<img class="Photo">
<button class= "btn">
<div>
<style>
.btn:hover{
}
<style
Post a code snippet a least please
In order to connect the image (class="photo") and the button (class="btn") you need some form of container (e.g. a div element with class="container") that contains both.
You can then use the transition css property, to do the smooth switch of opacity:
.btn {
display: none;
}
.container:hover .btn {
display: inline-block;
position: absolute;
}
.container:hover .photo {
opacity: 0.5;
transition: 0.3s;
}
|
Biocompatible crosslinkers for controlled degradation of polymer hydrogels
ABSTRACT
The present disclosure relates generally to hydrogel biomaterials. In particular, the present disclosure is directed to compositions and methods for developing hydrolytically degradable hydrogels.
CROSS-REFERENCE TO RELATED APPLICATIONS
This application claims priority to U.S. Provisional Patent Application No. 62/990,761, filed on Mar. 17, 2020, which is hereby incorporated by reference in its entirety.
BACKGROUND OF THE DISCLOSURE
The present disclosure relates generally to hydrogel biomaterials. In particular, the present disclosure is directed to compositions and methods for developing hydrolytically degradable hydrogels.
Hydrogel biomaterials have been extensively studied due to their ability to form swell able networks with properties mimicking soft biological tissues. Hydrogels are also useful as delivery systems for protein, drug, and nucleic acids, as substrates for basic biological research, as matrices for cell encapsulation and transplantation, and as in vitro models for drug screening. Biodegradable hydrogels are particularly valuable because they allow native tissue regeneration and modulate drug and cell delivery in matrix-type devices, without the need for removal surgeries.
Degradable hydrogels can be formed from both natural and synthetic polymers. Enzymatic and hydrolytic degradation are the two major physiologically relevant mechanisms that confer degradability to hydrogel matrices. One widely used synthetic hydrogel is poly(ethylene glycol) (PEG), which has the advantages of being non-immunogenic, inert, and biocompatible. PEG polymer is not degradable under physiological conditions, however. Thus, degradable moieties must be introduced to fabricate degradable PEG hydrogels.
Techniques employed to impart degradation to PEG hydrogels include incorporating enzymatically cleavable peptide crosslinkers or hydrolytically degradable monomers or copolymers, such as polylactic acid (PLA) and poly glycolic acid (PGA). All of these methods have advantages and drawbacks. For example, peptide crosslinkers' reliance on enzymes can result in inconsistent degradation rates. PEG-PLA and PEG-PGA hydrogels are hydrolytically degradable, but can be associated with protein denaturation due to the copolymer hydrophobicity and acidic degradation products. In another example, multi arm PEG-amine crosslinked with an ester-containing amine-reactive PEG derivative has been described as a hydrolytically degradable scaffold for protein delivery. This polymer was entirely hydrophilic, but the nonspecific crosslinking reaction may lead to covalent bonding between the polymer network and the encapsulated proteins. Thus drawback has been alleviated using PEG-multiacrylates and PEG-dithiols to form fully hydrophilic hydrogels with highly specific crosslinking chemistry. However, control of degradation of these hydrogels is limited. The dithiol crosslinkers presently available offer little variability in degradation rates, which restricts their application. Other ways to control hydrogel degradation include varying the polymer molecular weight, using different end-functionalities of these PEG macro mer, and varying the molar ratio of the reactive groups. However, these methods significantly affect hydrogel mechanical and physical properties.
Accordingly, there exists a need for compositions and methods for controlling hydrogel degradation. The crosslinkers of the present disclosure provide for controlled gelation kinetics and crosslinking density with only minor changes in hydrogel properties. Hydrogels of the present disclosure are useful in a variety of tissue engineering and drug delivery applications due to their controlled gelation and degradation.
BRIEF DESCRIPTION OF THE DISCLOSURE
In one aspect, the present disclosure is directed to a hydrogel crosslinker of formula (I),
wherein m is at least 10 repeating units; n₁ and n₂ ranges from 1 to 5 repeating units; X and Y are independently selected from C, CR¹, NR², O, SR³, and aryl; and R¹, R², and R³ are independently selected from H, alkyl, alkoxy, aryl, hydroxyl, amino, nitro, carboxyl, a halogen, a polar pendant group, and a non-polar pendant group.
In one aspect, the present disclosure is directed to a hydrolytically degradable hydrogel comprising a crosslinker of formula (I),
wherein m is at least 10 repeating units; n₁ and n₂ ranges from 1 to 5 repeating units; X and Y are independently selected from C, CR¹, NR², O, SR³, and aryl; and R¹, R², and R³ are independently selected from H, alkyl, alkoxy, aryl, hydroxyl, amino, nitro, carboxyl, a halogen, a polar pendant group, and a non-polar pendant group; and a polymer.
In one aspect, the present disclosure is directed to a method of preparing a hydrolytically degradable hydrogel, the method comprising: providing a hydrogel precursor solution; providing to the hydrogel precursor solution a crosslinker of formula (I),
wherein m is at least 10 repeating units; n₁ and n₂ ranges from 1 to 5 repeating units; X and Y are independently selected from C, CR¹, NR², O, SR³, and aryl; and R¹, R², and R³ are independently selected from H, alkyl, alkoxy, aryl, hydroxyl, amino, nitro, carboxyl, a halogen, a polar pendant group, and a non-polar pendant group; allowing the hydrogel precursor solution and crosslinker to polymerize to form a hydrolytically degradable hydrogel.
BRIEF DESCRIPTION OF THE DRAWINGS
The patent or patent application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee.
The disclosure will be better understood, and features, aspects and advantages other than those set forth above will become apparent when consideration is given to the following detailed description thereof. Such detailed description makes reference to the following drawings, wherein:
FIG. 1 shows the basic crosslinker structure, where m and n can be a different number of repeating units, and wherein m is greater than 10, and n₁ and n₂ can range from 1 to 5 repeating units.
FIG. 2 shows one embodiment of the basic crosslinker structure wherein n₁=2 repeating units and n₂=2 repeating units, and illustrating a and β positions away from the carbonyl carbon of the ester group, which are modified to impart hydrolytic degradation of the crosslinker.
FIG. 3 depicts gelation time for hydrogels formed with 4-arm PEG-Ac and PEG-dithiol crosslinkers. Lightly shaded bars represent aryl crosslinkers. * indicates significance (p<0.05) between all groups and # indicates significance (p<0.05) between compared groups.
FIGS. 4A-4D depict thiol consumption of hydrogels formed with PEG-diacrylate (PEG-DA) and seven dithiol crosslinkers to show the effect of hydrogel structure on reaction efficiency, as determined by Ellman's assay. Lightly shaded bars represent aryl crosslinkers. Reciprocal of thiol concentration as a function of time for hydrogels crosslinked with dithiol crosslinkers of gelation time>2 minutes (FIG. 4A). Reciprocal of thiol concentration as a function of time for hydrogels formed with PEG-DD1 (FIG. 4B). Percent thiol consumption for hydrogels made with seven dithiol crosslinkers (FIG. 4C). Gelation constant of hydrogels formed with PEG-diacrylate and seven dithiol crosslinkers. ^(#) indicates p<0.05 for thiol consumption compared to all groups (FIG. 4D).
FIGS. 5A and 5B depicts acrylate consumption of hydrogels formed with PEG-DA and seven dithiol crosslinkers (3 Ac:1 SH) to determine the effect of hydrogel structure on reaction efficiency, as measured by ¹H NMR. Representative spectra of ¹H NMR of PEG-DD2M crosslinker (top), PEG-DA macro mer (middle), and PEGDA-PEGDD2M polymer (bottom). The orange box at 5.83 ppm indicates the acrylate triplet peak used to measure acrylate consumption as compared to the PEG repeat unit at 3.52-3.62 ppm. The green box indicates the peaks at 2.54-2.83 ppm used to qualitatively determine that the PEG-DA-PEG-DD2M reaction had occurred (FIG. 5A). Relative percent acrylate consumption as measured by ¹H NMR for hydrogels formed with seven dithiol crosslinkers. Lightly shaded bars represent aryl crosslinkers (FIG. 5B).
FIGS. 6A and 6B depicts initial swelling (Q_(M)) (FIG. 6A) and mesh size (ξ) (FIG. 6B) of hydrogels formed from 4-arm PEG-Ac crosslinked with seven dithiol crosslinkers. * indicates significance (p<0.05) between all groups and ^(#) indicates significance (p<0.05) between compared groups. Lightly shaded bars represent aryl crosslinkers.
FIGS. 7A-7D depict rheological measurements of hydrogels formed with 4-arm PEG-Ac and seven dithiol crosslinkers to determine the effect of hydrogel structure on hydrogel viscoelasticity. Storage moduli (G′) of all hydrogels made with indicated crosslinkers; data shown were collected at 1 Hz. Lightly shaded bars represent aryl crosslinkers. * indicates significance (p<0.05) between all groups and ^(#) indicates significance (p<0.05) between compared groups (FIG. 7A). Representative data for G′ and G″) as a function of angular frequency is shown for PEG-DD1 (FIG. 7B). Representative data for G′ and G″ as a function of angular frequency is shown for PEG-DD1P (FIG. 7C). Lines are provided in FIGS. 7B and 7C to guide the eye. Correlation between initial G′ and gelation time (FIG. 7D).
FIGS. 8A-8D depict degradation of hydrogels formed with 4-arm PEG-Ac and seven dithiol crosslinkers to determine the effect of crosslinker structure on degradation. Normalized Q_(M) over time until complete degradation (FIG. 8A). Normalized Q_(M) over time until complete degradation for PEG-DD1 (FIG. 8B). Degradation time of hydrogels formed with seven dithiol crosslinkers (FIG. 8C). Degradation rate of hydrogels formed with seven dithiol crosslinkers (FIG. 8D). Lightly shaded bars represent aryl crosslinkers. * indicates significance (p<0.05) between all groups and ^(#) indicates significance (p<0.05) between compared groups.
FIGS. 9A-9D depict cell viability measurements of hydrogels formed with 4-arm PEG-Ac and seven dithiol crosslinkers to determine the effect of hydrogel structure on cell viability. Image of U87 cells encapsulated in hydrogel crosslinked with PEG-DD2 at 48 hours (FIG. 9A). Scale bar represents 100 μm. Percent viability of U87 cells encapsulated in hydrogels made with the respective crosslinkers and cultured for 48 hours (FIG. 9B). Schematic of hydrogel leachable experiment (FIG. 9C). Percent viability of U87 cells exposed for 48 hours to leachables (collected at 24 hours, 48 hours and complete degradation) from hydrogels made with the respective crosslinkers (FIG. 9D). All hydrogels and their degradation products were cytocompatible. Lightly shaded bars represent aryl crosslinkers.
DETAILED DESCRIPTION
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosure belongs.
In one aspect, the present disclosure is directed to a hydrogel crosslinker of formula (I),
wherein m is at least 10 repeating units; n₁ and n₂ ranges from 1 to 5 repeating units; X and Y are independently selected from C, CR¹, NR², O, SR³, and aryl; and R¹, R², and R³ are independently selected from H, alkyl, alkoxy, aryl, hydroxyl, amino, nitro, carboxyl, a halogen, a polar pendant group, and a non-polar pendant group. Suitable ary ls are phenyl and naphthyl. Suitable alkoxy are methoxy, ethoxy, propoxy, butoxy, pentoxy, hexoxy, heptoxy, octoxy, nonoxy, deco xy, undeco xy, and dodoxy. Suitable halogens include fluro, chloro, bromo, and iodo. Suitable alkyl s include methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, undecyl, and dodecyl.
The positions away from the carbonyl carbon of the ester group are referred to herein as the α position, the β position, the γ position, the δ position, and the ε position. The α position refers to the carbon closest to the carbonyl carbon. As an example, when n₁ and n₂ are independently 1, the crosslinker would only possess an α position between the carbonyl carbon and thiol. As used herein, the β position refers to the carbon second closest to the carbonyl carbon. As an example, when n₁ and n₂ are independently 2, the crosslinker would possess an α position and a β position. As used herein, the γ position refers to the carbon third closest to the carbonyl carbon. As an example, when n₁ and n₂ are independently 3, the crosslinker would possess an a position, a β position, and a γ position. As used herein, the δ position refers to the carbon fourth closest to the carbonyl carbon. As an example, when n₁ and n₂ are independently 4, the crosslinker would possess an α position, a β position, a γ position and a δ position. As used herein, the ε position refers to the carbon fifth closest to the carbonyl carbon. As an example, when n₁ and n₂ are independently 5, the crosslinker would possess an a position, a β position, a γ position, a δ position, and a ε position. FIG. 2 shows an embodiment of a crosslinker where n₁=2 repeating units and n₂=2 repeating units, and indicating the α position and the β position.
In one aspect, the present disclosure is directed to a hydrolytically degradable hydrogel comprising a crosslinker of formula (I),
wherein m is at least 10 repeating units; n₁ and n₂ ranges from 1 to 5 repeating units; X and Y are independently selected from C, CR¹, NR², O, SR³, and aryl; and R¹, R², and R³ are independently selected from H, alkyl, alkoxy, aryl, hydroxyl, amino, nitro, carboxyl, a halogen, a polar pendant group, and a non-polar pendant group; and a polymer. Suitable ary ls are phenyl and naphthyl. Suitable alkoxy are methoxy, ethoxy, propoxy, butoxy, pentoxy, hexoxy, heptoxy, octoxy, nonoxy, deco xy, undeco xy, and dodoxy. Suitable halogens include fluro, chloro, bromo, and iodo. Suitable alkyl s include methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, undecyl, and dodecyl.
Suitable polymers can be poly(ethylene glycol) (PEG), poly(enthylene glycol)-di-acrylate (PEG-DA), multi-arm poly(ethylene glycol)-acrylate (PEG-Ac), poly(ethylene glycol)-dithiol (PEG-diSH), poly(ethylene glycol) di vinyl sulfone (PEG-diVS), multi-arm poly(ethylene glycol) vinyl sulfone (PEG-VS), poly(enthylene glycol)-di-methacrylate (PEG-DMA), multi-arm poly(ethylene glycol)-methacrylate (PEG-MAc), poly(ethylene glycol)-di-allyl ether (PEG-di AE), multi-arm poly(ethylene glycol)-allyl ether (PEG-AE), poly(ethylene glycol)-di-vinyl ether (PEG-diVE), multi-arm poly(ethylene glycol)-vinyl ether (PEG-VE), poly(ethylene glycol)-di-maleimide (PEG-diMI), multi-arm poly(ethylene glycol)-maleimide (PEG-MI), poly(ethylene glycol)-di-norborene, multi-arm poly(ethylene glycol)-norborene, poly(ethylene glycol)-di-vinyl carbonate, multi-arm poly(ethylene glycol)-vinyl carbonate, polyethylene glycol oligofumarate.
The hydrogel can have a degradation time ranging from minutes to months, including about 18 hours to about 16 days.
The hydrogel can have a gelation time ranging from about 1 minute to about 22 minutes.
The hydrogel can have a storage modulus ranging from about 3 kPa to about 10 kPa.
The hydrogel can have a mesh size ranging from about 7 nm to 13 nm.
The hydrogel can further include a cell.
The hydrogel can further include proteins and drugs.
In one aspect, the present disclosure is directed to a method of preparing a hydrolytically degradable hydrogel, the method comprising: providing a hydrogel precursor solution; providing a crosslinker of formula (I),
wherein m is greater than 10 repeating units, n₁ and n₂ can range from 1 to 5 repeating units, X and Y are independently selected from C, CR¹, NR², O, SR³, and aryl, and R¹, R², and R³ are independently selected from H, alkyl, alkoxy, aryl, hydroxyl, amino, nitro, carboxyl, a halogen, a polar pendant group, and a non-polar pendant group; allowing the hydrogel precursor solution and crosslinker to polymerize to form a hydrolytically degradable hydrogel. Suitable ary ls are phenyl and naphthyl. Suitable alkoxy are methoxy, ethoxy, propoxy, butoxy, pentoxy, hexoxy, heptoxy, octoxy, nonoxy, deco xy, undeco xy, and dodoxy. Suitable halogens include fluro, chloro, bromo, and iodo. Suitable alkyl s include methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, undecyl, and dodecyl.
The hydrogel precursor solution includes at least one polymer. Suitable polymers include poly(ethylene glycol) (PEG), poly(enthylene glycol)-di-acrylate (PEG-DA), multi-arm poly(ethylene glycol)-acrylate (PEG-Ac), poly(ethylene glycol)-dithiol (PEG-diSH), poly(ethylene glycol) di vinyl sulfone (PEG-diVS), multi-arm poly(ethylene glycol) vinyl sulfone (PEG-VS), poly(enthylene glycol)-di-methacrylate (PEG-DMA), multi-arm poly(ethylene glycol)-methacrylate (PEG-MAc), poly(ethylene glycol)-di-allyl ether (PEG-di AE), multi-arm poly(ethylene glycol)-allyl ether (PEG-AE), poly(ethylene glycol)-di-vinyl ether (PEG-diVE), multi-arm poly(ethylene glycol)-vinyl ether (PEG-VE), poly(ethylene glycol)-di-maleimide (PEG-diMI), multi-arm poly(ethylene glycol)-maleimide (PEG-MI), poly(ethylene glycol)-di-norborene, multi-arm poly(ethylene glycol)-norborene, poly(ethylene glycol)-di-vinyl carbonate, multi-arm poly(ethylene glycol)-vinyl carbonate, polyethylene glycol oligofumarate.
The hydrogel can have a degradation time ranging from minutes to months, including about 18 hours to about 16 days.
The hydrogel can have a gelation time ranging from about 1 minute to about 22 minutes.
The hydrogel can have a storage modulus ranging from about 3 kPa to about 10 kPa.
The hydrogel can have a mesh size ranging from about 7 nm to 13 nm.
The method can further include adding a cell to one of the hydrogel precursor solution, the crosslinker, and the hydrolytically degradable hydrogel.
The method can further include adding a protein, a drug, and combinations to one of the hydrogel precursor solution, the crosslinker, and the hydrolytically degradable hydrogel.
EXAMPLE Example 1 Materials and Methods
Poly(ethylene glycol)-di-acrylate (PEG-DA; 5 kDa), 4-arm PEG-acrylate (4-arm PEG-Ac; 10 kDa), and PEG-dithiol (PEG-diSH; 3.4 kDa) are from Laysan Bio, Inc. (Arab, Ala.). PEG-OH (3.4 kDa) is from Electron Microscopy Sciences (Hatfield, Pa.). Dithioerithritol (DTT), penicillin/streptomycin (pen/strep), and 4-mercaptophenylacetic acid is from Millipore Sigma (St. Louis, Mo.). Thioglycolic acid is from Acros Organics (Geel, Belgium). P-toluenesulfonic acid and fetal bovine serum (FBS) are from VWR (Radnor, Pa.). 3-mercaptoisobutyric acid and 4-mercaptohydrocinnamic acid are from TCI America (Portland, Oreg.). Toluene, 3-mercaptopropionic acid, 2-mercaptopropionic acid, 5,5 dithio-bis (2-nitrobenzoic acid) (Ellman's reagent), Roswell Park Memorial Institute (RPMI) 1640 Medium, and CellTiter 96® AQueous One Solution Cell Proliferation (MTS) Assay are from Thermo Fisher Scientific (Rockford, Ill.). LIVE/DEAD cell assay is from Invitrogen (Eugene, Oreg.). 3,3′-Dioctadecyloxacarbocyanine Perchlorate (DiOC₁₈) is from AAT Bio quest (Sunnyvale, Calif.). Silicone isolator sheets (0.5 mm thick), from Grace Bio Labs (Bend, Oreg.), were used as spacers. Rain-X® is from a local hardware store. U87 cells are from ATCC (Manassas, Va.).
Crosslinker Synthesis
A Fischer esterification reaction was used to synthesize six PEG-diester-dithiol crosslinkers (names in brackets chosen for ease of discussion): PEG-dithiolglycolate (named PEG-diester-dithiol-1 or PEG-DD1), PEG-dithiolpropionate (named PEG-diester-dithiol-2 or PEG-DD2), PEG-di-3-mercaptoisobutyrate (named PEG-diester-dithiol-2-methyl or PEG-DD2M), PEG-di-2-mercaptopropanoate (named PEG-diester-dithiol-1-methyl or PEG-DD1M), PEG-di-4-mercaptophenylacetate (named PEG-diester-dithiol-1-phenyl or PEG-DD1P), and PEG-di-4-mercaptohydrocinnamate (named PEG-diester-dithiol-2-phenyl or PEG-DD2P) (Table 1). First, PEG-OH was dried using azeotropic distillation in toluene under an inert atmosphere of argon. The dried PEG-OH was re-dissolved in anhydrous toluene, and the desired mercaptocarboxylic acid (e.g., mercaptoacetic acid for PEG-DD1) was added at 20-times molar excess to the reaction flask in the presence of DTT (reducing agent; 1 mmol) and p-toluenesulfonic acid (catalyst; 0.4 mmol) and allowed to reflux for 24 hours at ˜120° C.-140° C. (temperature of oil bath) under argon with stirring. The product solution was cooled and concentrated under rotary evaporation. The product was precipitated 3 times with ice-cold acetone and recovered via vacuum filtration. The product crosslinkers were dried overnight under vacuum and stored in a desiccating container at −20° C. until use. The average product yield was ˜80% and the average derivatization was >90% as confirmed by proton nuclear magnetic resonance (¹H NMR).
TABLE 1 Structures, abbreviations, and pK_(a) values of crosslinkers synthesized in this study. PEG-diSH was commercially obtained and used as a non-ester-containing reference crosslinker. All crosslinkers had a molecular weight of 3.4 kDa and were water soluble. Crosslinker Name Abbreviation Chemical Structure Thiol pK_(a) PEG-dithiol PEG-diSH
~10.5-10.7 [44] PEG- diester- dithiol-2 PEG-DD2
~9.4-9.6 [44] PEG- diester- dithiol-2- methyl PEG-DD2M
~9.4-9.6 [44] PEG- diester- dithiol-1 PEG-DD1
~7.9-8.1 [44, 47] PEG- diester- dithiol-1- methyl PEG-DD1M
~7.9-8.1 [44, 47] PEG- diester- dithiol-1- phenyl PEG-DD1P
~6.5 [52, 53] PEG- diester- dithiol-2- phenyl PEG-DD2P
~6.5 [52, 53]
Hydrogel Fabrication
All hydrogels used in the Examples were 10% w/v in PEG. First, 20% w/v stock solutions of the 4-arm PEG-Ac and crosslinkers were prepared in 0.3 M triethanolamine (TEA), pH 7.4 immediately before use. Hydrogels were then formed using 4-arm PEG-Ac and PEG-dithiol crosslinkers at a molar ratio of acrylate to thiol of 1:1. The hydrogel precursor solution was mixed well and solution droplets were sandwiched between glass slides coated with RAIN-X and separated by 500 μm spacers. Hydrogels were allowed to gel for 1 hour at 37° C.
Gelation Time
Hydrogel gelation was determined using the inverted tube method. Briefly, hydrogels were prepared as described above in a microfuge tube at room temperature and inverted until the solution stopped flowing upon inversion due to the force of gravity.
Thiol and Acrylate Consumption for Determining Gelation Kinetics and Reaction Efficiency
Gelation kinetics and reaction efficiency were measured by thiol consumption as a function of time, using Ellman's assay according to the manufacturer's protocol. All standards and Ellman's reagent (10 mM) were reconstituted in 0.1 M sodium phosphate reaction buffer pH 8 with 1 mM ethylenediaminetetraacetic acid (EDTA). The dithiol crosslinkers were allowed to react with a 3-fold molar excess of PEG-DA (SH:Ac ratio of 1:3). The kinetics of thiol consumption was followed by taking aliquots at predetermined time intervals and diluting 10 times with deionized (DI) water to quench the reaction. Upon completion of the reaction, thiol in each aliquot was estimated by adding 250 μl of reaction buffer and 5 μl of Ellman's reagent (10 mM) to 25 μl of each sample and standard. The mixture was incubated for 15 minutes at room temperature and absorbance was measured at 412 nm using a spectrophotometer (Spectra Max i3, Molecular Devices, Sunnyvale, Calif.). The reciprocal of thiol molar concentration (1/[SH]) was plotted against time to determine the second-order rate constant as given by the slope of the straight line. Percent thiol consumption was determined by comparing the amount of remaining thiol at the end of the reaction to the initial thiol concentration.
Acrylate consumption was determined using ¹H NMR (Bruker Avance III HD 700 MHz). Crosslinkers were allowed to react with PEG-DA as described above (a molar excess of at SH:Ac of 1:3) to form a viscous solution and then lyophilized overnight. The samples were dissolved in deuterated water (D₂O) at 15 mM. All 1D ¹H NMR spectra were measured with noesypr1d pulse sequence at 298 K. To estimate acrylate consumption, the ratio of one of the acrylate triplet peaks (5.83 ppm) to the PEG repeat unit (3.52-3.62 ppm) was compared to the same ratio of an unreacted PEG-DA control. The appearance of additional peaks around 2.54-2.83 ppm, where the thioether-ester link formed, indicated qualitatively that the crosslinkers had reacted with the PEG-DA.
Swelling Ratio, Degradation Time, Mesh Size and Crosslink Density
To measure initial swelling ratio, 10% w/v gels (25 μL precursor solution volume) were prepared as previously described and weighed to determine initial mass before swelling (M_(G)). They were then soaked in 1×PBS, pH 7.4 for 4 hours at room temperature. To determine the swollen mass (M_(S)), gels were blotted with a KIMWIPE® and weighed. Gels were dried in an oven at 60° C. for 24 hours and weighed to obtain the dry mass (M_(D)). Initial swelling ratio was calculated as Q_(M)=M_(S)/M_(D).
Additionally, degradation was followed by measuring Q_(M) as a function of time. M_(S) was measured at specific time points until gels lacked physical integrity. Q_(M) was calculated for each time point and normalized to the Q_(M) of the non-swollen network at time zero (M_(G)/M_(D)). Initial mesh size (ξ) and crosslink density (v_(c)) were calculated via the Flory-Rehner theory.
Rheological Measurements
Rheological measurements were performed using an AR-2000 ex rheometer (TA Instruments) with 20 mm parallel plate geometry. The absence of slip was verified by running experiments with various gap heights. A frequency of 1-10 rad/s and a constant strain of 1%, which was within the linear viscoelastic region, were used for testing all gels. For testing, gels (250 μL, 10% w/v, 500 μm thickness) were equilibrium-swollen for 2 hours at room temperature in PBS, pH 7.4 and cut into discs of 200 mm in diameter. Prior to measurements, excess water from the gel surface was blotted carefully using a KIMWIPE®.
Cell Culture and Maintenance
U87 glioblastoma cells were cultured in RPMI medium, supplemented with 10% FBS and 1% pen/strep in a humidified environment at 37° C. and 5% CO₂. For cell maintenance, medium was replaced every 2-3 days until ˜80% cell confluency was reached. To subculture, confluent cells were harvested by a 5-minute exposure to 0.05% trypsin/0.02% EDTA.
Cytotoxicity Testing
Cell Viability upon Encapsulation in 3D Hydrogels
LIVE/DEAD assay was used to assess cell viability according to the manufacturer's protocol. U87 glioblastoma cells were incubated with the fluorescent green membrane stain DiOC₁₈ for 24 hours and harvested with trypsin. 4-arm PEG-Ac and the PEG-dithiol crosslinkers were dissolved in 0.3 M TEA and added to the cell suspension to bring the PEG concentration to 10% w/v and the cell concentration to 1×10⁶ cells/mL. The cell-laden gel precursor solution was mixed, pipetted at 30 μL per well of a 24-well plate and incubated for 30 minutes to allow gelation. RPMI medium supplemented with 10% FBS and 1% pen/strep was added to each well to fully cover the gels. Cells seeded on tissue culture polystyrene (TCP) were used as control. All cells were grown for an additional 24 or 48 hours, when fluorescent red nucleolus stain propidium iodide (PI) was added to each well at 0.01 mg/mL to stain necrotic cells. After 1 hour of incubation, images of the cultured cells were taken under a fluorescent microscope (Axiovert 200M; Thornwood, N.Y.) and Image-J software was used to analyze the images. The cell counter plug-in was used to count viable and necrotic cells, and percent cell viability was calculated as the number of live cells divided by the total number of cells×100%.
Hydrogel Leachables and Degradation Products
To evaluate the cytotoxicity of hydrogel leachables and degradation products, 10% w/v gels (50 μL precursor solution volume) were soaked in 500 μL RPMI medium (with 10% v/v FBS and 1% pen/strep) until complete degradation. Medium was collected at 24 and 48 hours and at complete degradation (different gels were used for each time point) and frozen at −20° C. until use. For PEG-DD1, which degraded in less than 24 hours, the 24 hours represented complete gel degradation. U87 cells were seeded at 5×10⁴ cells/mL in a 96-well plate and incubated overnight. Medium was then replaced by conditioned medium (containing leachables or degradation products) and cells were incubated for additional 48 hours. Cell viability was determined with a cell proliferation assay (MTS) according to manufacturer protocol. Absorbance was measured at 490 nm on a spectrophotometer (Spectra Max i3, Molecular Devices, Sunnyvale, Calif.). Cells cultured in non-conditioned medium were used as controls. Relative percent viability was determined by normalizing the sample absorbance to that of the control.
Statistical Analysis
Results were expressed as average±SD of triplicate samples from three independent experiments. Multiple samples were compared using single factor analysis of variance (ANOVA) followed by a post-hoc analysis. A two-tailed Student's t-test was used to compare between two samples. Differences between data sets were considered significant when p<0.05.
Results
Crosslinker Design
A Fischer esterification reaction was used to synthesize six PEG-based diester-dithiolcrosslinkers. The non-ester-containing PEG-diSH crosslinker was commercially obtained and used as a control. The crosslinkers were designed to allow a systematic exploration of the effect of their chemical structure on gel degradation kinetics (Table 1). Because the changes in chemical structure resulted in changes in thiol pK_(a), how the pK_(a) would affect gel formation was also determined. The pK_(a) values were obtained from the literature or estimated by comparing crosslinker structures to molecules with similar structures and known pK_(a). The crosslinker abbreviations were chosen as follows. All crosslinkers were designated as PEG-DD, which stands for PEG-diester-dithiol. To designate the number of methylene groups between the ester and the thiol, the notation 1 and 2 as in PEG-DD1 and PEG-DD2 was used. A pendant methyl group in β position to the carbonyl carbon is designated with an M as in PEG-DD1M. In the aryl crosslinkers, a phenyl group in β position to the thiol is designated with a P as in PEG-DD1P. The chemical structure of PEG-DD2M was chosen, because the methyl group in the vicinity of the ester was expected to impart steric hindrance and increase hydrophobicity, compared to PEG-DD2, prolonging degradation Similar considerations were applied to PEG-DD1M compared to PEG-DD1. The chemical structures of PEG-DD1P and PEG-DD2P included thiophenyls to study the effects of pK_(a) and aryl versus alkyl thiols. The phenyl group was also expected to have an electron-withdrawing effect on the carbonyl carbon of the ester group, facilitating degradation.
Gelation Time
The effect of crosslinker structure on gelation time at a reaction pH of 7.4 was examined (FIG. 3). Note that adjusting the pH to achieve similar gelation time is discussed later. The resulting crosslinker structures presented gelation times ranging from ˜90 seconds to 16 minutes, and several trends were observed. Overall, gels prepared with the developed crosslinkers fell into two general categories, fast-gelling (≤5 minutes) and slow-gelling (≥14 minutes). At a constant pH of 7.4, gelation correlated with the thiol pK_(a). Crosslinkers with a thiol pK_(a)<9 had fast gelation times, while those with a thiol pK_(a)>9 had slow gelation times. Moreover, the chemical structure near the thiol, namely aryl versus alkyl, affected gelation time. Largely, aryl crosslinkers (PEG-DD1P, PEG-DD2P) produced shorter gelation times than alkyl crosslinkers. Incorporating an ester bond in the crosslinker chemical structure significantly decreased gelation times compared to the non-ester-containing control, PEG-diSH. Additionally, gelation time increased with increased hydrophobicity as a result of a pendant methyl group (as in PEG-DD2 vs. PEG-DD2M, PEG-DD1 vs. PEG-DD1M) or longer carbohydrate chain between the ester and the thiol (as in PEG-DD1 vs. PEG-DD2, and PEG-DD1M vs. PEG-DD2M). Further, incorporating electron-withdrawing groups significantly accelerated gelation times (as in PEG-DD2P compared to PEG-DD2 and PEG-DD2M). PEG-DD1 was the fastest-gelling crosslinker, 19-times faster than the slowest, PEG-DD2.
Reaction Efficiency
To determine reaction efficiency, thiol consumption was measured by Ellman's reagent (FIGS. 4A-4D) and acrylate consumption by ¹H NMR (FIGS. 5A and 5B). The rate of thiol consumption varied from 0.3 to 4.8 mM⁻¹ min⁻¹ and corroborated gelation time data: faster gelation time corresponded to faster thiol consumption rate. Gels with PEG-DD2 and PEG-DD2M, which showed slower gelation, also showed slower thiol consumption of ˜0.3 mM⁻¹ min⁻¹. Conversely, fast-gelling hydrogels made with PEG-DD1, PEG-DD1M, PEG-DD1P, and PEG-DD2P showed faster thiol consumption, 4.8, 1.0, 2.1, and 1.9 mM⁻¹ min⁻¹, respectively. Total thiol consumption ranged from 88 to 96%. The slow-gelling crosslinkers, PEG-diSH, PEG-DD2, and PEG-DD2M, had a maximum thiol consumption of ˜96%. Conversely, the fast-gelling hydrogels showed lower levels of thiol consumption, with PEG-DD1, PEG-DD1M, PEG-DD1P, and PEG-DD2P showing thiol consumptions of 89%, 88%, 92%, and 93%, respectively.
For acrylate consumption measurements, the acrylate groups were at a 3-times molar excess to the thiol groups to avoid hydrogel formation. Hence, a 100% acrylate consumption was assumed if the ratios of one of the acrylate triplet peaks (5.83 ppm) to the PEG repeat unit (3.52-3.62 ppm) was ≥33.3%, signifying that ⅓ of the acrylate groups had been consumed. A representative ¹H NMR spectra for PEG-DA (control), PEG-DD2M, and PEG-DA reacted with PEG-DD2M are shown in FIG. 5A. While the PEG-DD2M crosslinker showed two peaks at 2.83, these peaks were absent in the PEG-DA. However, the PEG-DA spectra included the addition of three acrylate peaks around 6 ppm; the peak at 5.83 (orange square) was used for consumption analysis. When the crosslinker reacted with the PEG-DA, the additional peaks at 2.83 (green square) indicated the two polymers had reacted. Total acrylate consumption is presented in FIG. 5B. PEG-diSH, PEG-DD2, PEG-DD2M showed almost complete acrylate consumption of ˜96%. Again, the fast-gelling crosslinkers, namely PEG-DD1, PEG-DD1M, PEG-DD1P, and PEG-DD2P, showed lower, but not significantly different percent acrylate consumption of 94%, 92%, 90%, and 85%, respectively. In summary, the chemical structure of the crosslinkers had a minimal effect on their reaction efficiency.
Initial Swelling Ratio, Mesh Size, and Crosslink Density of PEG Hydrogels
The effect of crosslinker chemical structure on the initial swelling ratio (Q_(M)), mesh size (ξ), and crosslink density (v_(c)) of hydrogels made with 4-arm PEG-Ac at pH 7.4 was examined (FIGS. 6A and 6B). Initial Q_(M) ranged from 17 to 31 (FIG. 6A), which correlated with values from the literature. For example, Q_(M) was reported to be ˜19 for gels made with PEG-diSH and 4-arm PEG-Ac. All ester-containing crosslinkers, except for PEG-DD1, showed a significantly lower initial Q_(M) than the non-ester containing PEG-diSH control. PEG-DD1 had a significantly higher Q_(M) than PEG-diSH and all other crosslinkers. Without being bound by theory, this may be due to a complete mesh not forming, resulting in a highly swell able gel. ξ was directly proportional to the Q_(M) (FIG. 6B), where gels with higher Q_(M) showed higher ξ. ξ varied from 7-13 nm for all hydrogels, when gelation was conducted at a constant pH.
Crosslink density (Table 2) was inversely related to Q_(M) and ξ, with a range of 0.17-0.56 mmol cm⁻³. Gels with higher Q_(M) and ξ demonstrated lower crosslink density and gels with lower Q_(M) and ξ showed higher v_(c). Gels crosslinked with PEG-DD1 showed lower v_(c) than other gels. Percent deviation from ideal v_(c) ranged from 76 to 93%, and was highest for the fast-gelling gels. Additionally, gels made with crosslinkers of similar chemical structures showed comparable deviation from ideal v_(c), indicating v_(c) was influenced by crosslinkers' chemical structure.
TABLE 2 Crosslink density (ν_(c)) and percent deviation from ideal ν_(c) of hydrogels formed with the developed crosslinkers. ν_(c) experimental % Deviation from ν_(c) ideal Crosslinker (mmol cm⁻³) (2.33 mmol cm⁻³) PEG-diSH 0.28 87.8 PEG-DD2 0.36 84.7 PEG-DD2M 0.39 83.3 PEG-DD1 0.17 92.6 PEG-DD1M 0.44 81.0 PEG-DD1P 0.48 79.2 PEG-DD2P 0.56 75.9
Storage Modulus
Initial storage modulus (G′) ranged from 3 to 10 kPa for all gels tested (FIG. 7A). Representative data on G′ and G″ as a function of frequency for PEG-DD1 and PEG-DD1P is shown in FIG. 7B. The data indicate that the moduli were mostly independent of frequency (for a low frequency range) and that G′ was orders of magnitude higher than G″, underscoring the viscoelastic nature of the developed gels. Generally, G′ was inversely related to initial Q_(M) and ξ, where gels with higher initial Q_(M) showed lower G′. These data corroborated the hypothesis that a smaller ξ results in gels of higher moduli due to their ability to resist motion more readily than those of larger ξ. Further, crosslinker chemical structure influenced G′, when gels were formed at a constant pH. Increased hydrophobicity between the thiol and the ester resulted in a higher G′ as in PEG-DD1 vs. PEG-DD2, PEG-DD2 vs. PEG-DD2M, PEG-DD1 vs. PEG-DD1M, and PEG-DD1P vs. PEG-DD2P. Notably, gels made with PEG-DD1 presented relatively low G′ of 2.9 kPa, which may be a result of a combination of the terminal thiol pK_(a) during gelation and the hydrophilicity of the crosslinker.
Hydrogel Degradation Measured by Swelling
Degradation was measured indirectly by following the change in Q_(M) over time. Gels made with the synthesized ester-containing crosslinkers degraded more quickly than those crosslinked with the non-ester-containing crosslinker, PEG-diSH, with degradation times ranging from 18 hours to 16 days (FIGS. 8A-8D). Gels made with PEG-DD1 degraded most quickly. Comparatively, gels made with PEG-DD1M took longer to degrade due to increased steric hindrance and hydrophobicity caused by the additional methyl group in the ester vicinity. A similar observation was made for gels formed with the crosslinkers PEG-DD2 vs. PEG-DD2M. Conversely, the degradation rates of PEG-DD1P and PEG-DD2P were slightly reduced compared to PEG-DD1M and PEG-DD2M, respectively. Without being bound by theory, it is believed that this may be due to the electron-withdrawing phenyl group near the ester moiety.
Adjustment of Reaction pH to Account for Rate of Thiol Deprotonation
For all characterizations above, a single reaction pH was used for consistency. To determine the effect of pH on gelation time, the reaction pH was adjusted for the following crosslinkers: PEG-DD1 (pH 6.25), PEG-DD1P and PEG-DD2P (pH 6.2). By decreasing the reaction pH, a gelation time of ˜15 minutes for all three crosslinkers was achieved, which was similar to the gelation time of PEG-DD2. The slow-gelling PEG-DD2 was used for comparison. Similar gelation times resulted in similar initial properties, including Q_(M), ξ, and v_(c) (Table 3). While degradation times were also affected by reaction pH, the change was minimal. Degradation time of gels crosslinked with PEG-DD1 increased from 18 hours to 28 hours, and gels made with PEG-DD1P and PEG-DD2P increased from 6 days and 12 days to ˜7 days and 13 days, respectively. Overall, these results showed that when thiol deprotonation rate was standardized, hydrogels made with crosslinkers of different moieties near the ester have similar initial properties, but different degradation times.
TABLE 3 Initial properties and degradation times of hydrogels made with the developed crosslinkers at different pH, chosen to account for the rate of thiol deprotonation. PEG-DD2 hydrogels prepared at pH 7.4 are shown for comparison. ↑ indicates 1 to 5-fold change, ↑↑ indicates 6 to 9-fold change, and ↑↑↑ indicates ≥10-fold change from hydrogels made with the same crosslinker at pH 7.4. Gelation Reaction Time Initial ξ v_(c) Degradation Crosslinker pH (min) Initial Q_(M) (nm) (mmol/cm³) Time (d) PEG-DD2 7.4 15.7 ± 0.6 21.6 ± 0.6 8.7 ± 0.3 3.5 ± 0.2 8.0 ± 0.5 PEG-DD1 6.25 15.8 ± 1.0 24.1 ± 2.5 9.8 ± 1.0 1.9 ± 0.4 1.2 ± 0.2 ↑↑↑ ↓ ↓ ↑ ↑ PEG-DD1P 6.2 16.6 ± 1.2 22.5 ± 1.7 9.2 ± 0.8 2.1 ± 0.4 6.8 ± 0.9 ↑↑ ↑ ↑ ↓ ↑ PEG-DD2P 6.2 14.1 ± 1.2 19.7 ± 1.5 7.9 ± 1.1 3.1 ± 0.8 13.5 ± 0.7 ↑↑ ↑ ↑ ↓ ↑
Crosslinker Cytotoxicity: Hydrogel Encapsulation, Leachables, Degradation Products
Cytotoxicity of the synthesized crosslinkers was determined in two separate experiments: by directly encapsulating cells during gel formation and by exposing cells to leachables and degradation products. Gels made with the commercially available PEG-diSH crosslinker were used as a control. At least 90% of U87 cells remained viable 48 hours after encapsulation in gels made with the 6 synthesized crosslinkers (FIGS. 9A and 9B). The cytotoxicity of leachables at 24 hours and 48 hours, and at gel degradation (FIGS. 9C and 9D) was also determined. Cells showed ˜90% viability for all gel types after exposure to leachables from all three time points: 24 hours, 48 hours, and complete degradation. Because gels crosslinked with PEG-DD1 degraded in <24 hours, the cell viability after 24 hours degradation was equivalent to cell viability after complete degradation (only the 24-hour data is shown). These data indicate that the developed crosslinkers as well as the resulting hydrogels were cytocompatible and also compatible with direct cell encapsulation.
These Examples present a library of hydrolytically degradable and chemically distinct PEG-based crosslinkers, which result in hydrogels with diverse degradation times. PEG hydrogels were prepared by a conjugate addition reaction between 4-arm PEG-Ac and the synthesized PEG-diester-dithiol crosslinkers. This conjugate addition occurs between a thiolate ion (a deprotonated thiol) and an α-β unsaturated ester as in an acrylate or vinyl sulfone group. This reaction mechanism is advantageous because it is a mild, highly specific reaction that can occur at physiologically relevant conditions, and ultimately form reproducible networks via step-wise polymerization. Acrylate end-functionalized PEG, when reacted via conjugate addition, forms a thioether-ester bond. While the ester bond in unreacted PEG-acrylate is only slightly hydrolytically degradable, the proximity of the thioether group to the PEG-acrylate ester increases the sensitivity of that ester to hydrolytic degradation by several orders of magnitude. This leads to cleavage of the modified ester and the breakdown of the crosslinked network on time periods appropriate for many drug delivery and tissue engineering applications.
To achieve tunable hydrogel properties, crosslinkers were designed with hydrolytically degradable moieties, namely ester bonds. Ester hydrolysis occurs via nucleophilic attack of the carbonyl carbon by hydronium ions and is influenced by chemical moieties near the ester. For example, hydrophobic groups near the ester diminish water access and resist nucleophilic attack from occurring readily. Also, chemical moieties that withdraw from or donate electrons to the carbonyl carbon influenced its nucleophilicity and further affected hydrolysis. Thus, the strategy was to modulate degradation by varying the chemical moieties in the ester vicinity. This was accomplished by incorporating methylene spacers between the ester and the thiol (hydrophobicity), methyl pendant groups (hydrophobicity and steric hindrance), and phenyl groups between the ester and thiol (electron withdrawing). Increasing the number of methylene spacers slowed degradation by increasing hydrophobicity near the ester and also by diminishing the influence of the electron-withdrawing thiol group. Additionally, methyl pendant groups further increased hydrophobicity and provided steric hindrance near the ester, slowing degradation. Finally, incorporating phenyl groups accelerated degradation by withdrawing electrons and making the carbonyl carbon a better nucleophile. These strategies resulted in degradation times ranging from 18 hours to 16 days. Additional strategies, such as using a multi-arm PEG-vinyl sulfone as opposed to PEG-acrylate or changing polymer molecular weight and concentration, can result in further changes in degradation time, underscoring the flexibility of the chosen approach. The developed hydrogels showed degradation time ranges similar to other available PEG hydrogels. For example, PEG-diacrylate hydrogels formed by conjugate addition with DTT had degradation times of up to 21 days, and PEG-PLA with increasing numbers of lactoyl units had times of 4 days to 17 days.
To determine whether modulating the crosslinker chemical structure would change initial hydrogel physical and mechanical properties, extensive characterizations were performed. It was believed that changes in the chemical structure near the thiol would change thiol pK_(a) (Table 1) and gelation time. When manipulating the crosslinker chemical structures but keeping a constant reaction pH of 7.4, gelation times were either fast (≤5 minutes) or slow (≥14 minutes) (FIG. 3). These differences can be explained by looking at how the reaction promotes deprotonation of the thiol group, resulting in a thiolate ion. The formation of the thiolate is controlled by the pH of the surrounding solvent and the inductive effects of chemical moieties near the terminal thiol, which modulate its pK_(a). For example, the crosslinker PEG-DD1 has only one methylene spacer between the ester and the thiol moieties. This shifted the electron cloud toward the thiol, increasing its electronegativity and allowing it to easily lose a proton and form the thiolate ion. Overall, for a set reaction pH, thiols with a lower pK_(a) can more easily lose a proton, leading to faster gelation than thiols with higher pK_(a). The Examples showed that the crosslinkers with a thiol pK_(a)<9 had quick gelation (Table 1), which is corroborated by other studies where the threshold between slow- and fast-gelling crosslinkers pK_(a) was determined to be ˜8.5-8.7. As previously discussed, thiol pK_(a) was influenced by neighboring groups. For instance, PEG-DD1 had a pK_(a) of ˜7.9-8.1 due to the proximity of the ester and the thiol. This allowed it to become a better electron acceptor and therefore to more easily form thiolate ions. Further separation of the thiol from the ester, as in PEG-DD2 (pK_(a) ˜9.4-9.6) stabilized the thiol and reduced its ability to form the thiolate ion, slowing gelation. In summary, the gelation times of the designed crosslinkers resulted from the pK_(a) of the terminal thiol, which was modulated by the substituent groups near the thiol and aryl versus alkyl thiols.
Next, the reaction efficiency and reaction kinetics were analyzed by measuring thiol and acrylate consumption upon reaction completion (FIGS. 4 and 5). Reaction efficiency is affected by molecule (in this case crosslinker thiol) pK_(a), which is influenced by chemical groups near the thiol. Ideally, a complete reaction between the acrylate and thiolate is observed. This would indicate that a complete meshwork can be formed between the PEG macro mer and the crosslinker, leading to similar hydrogel mechanical properties. Experiments were performed with a 3-fold molar excess of Ac to SH to observe the inherent reaction efficiency of the crosslinkers independent of crosslinked network formation. When a network is formed, not all available end groups can react due to decreased mobility and range upon gelation. Hence, although all crosslinkers may have a high reaction efficiency, that may not result in a high crosslinking efficiency and formation of an ideal network (as seen in Table 2). Rather, gelation time and rate of thiol deprotonation affect network formation, giving gels formed with different crosslinkers different initial properties (when not controlled for rate of thiol deprotonation). For example, PEG-DD1 had a high reaction rate and reaction efficiency but presented a non-ideal network.
Alkyl crosslinkers with two methylene spacers between the ester and the thiol, such as PEG-DD2 and PEG-DD2M, consumed thiol at rates similar to the non-ester-containing crosslinker, PEG-diSH. Further, crosslinkers of similar structures could be grouped according to their reaction efficiency, such as PEG-DD2 and PEG-DD2M, PEG-DD1 and PEG-DD1M, or PEG-DD1P and PEG-DD2P. This fits with other findings that crosslinkers of similar chemical structure show minor differences in reaction efficiency. The aryl crosslinkers PEG-DD1P and PEG-DD2P also had higher thiol consumption rates than the alkyl crosslinkers (excluding PEG-DD1), which could be due to the influence of the phenyl group; the phenyl group near the thiol lowered the thiol pK_(a) (Table 1), increasing thiol consumption. Acrylate consumption followed trends similar to those observed in the thiol consumption data. These results indicated almost complete acrylate and thiol consumption independent of the crosslinker chemical structure and reactivity, signifying that different degradation rates were not linked to reaction efficiency alone.
Initial physical properties of hydrogels, namely, Q_(M), ξ, v_(c), and G′ were then analyzed (FIGS. 6 and 7). While most crosslinkers formed gels with somewhat similar properties, gels crosslinked with PEG-DD1 were notable outliers. It should be noted that Q_(M) and ξ are inversely proportional to v_(c) and G′. While significant differences were observed between all gels, the range of initial properties was still relatively narrow (excluding PEG-DD1). These differences could be due to the differences in the crosslinkers' inherent hydrophobicity. Hydrogels made with PEG-DD1 presented a very high Q_(M) (31.6) and ξ (12.5 nm) and low v_(c) (0.173 mmol cm⁻³) and G′ (2.9 kPa) compared to all other gels. This may be caused by the low thiol pK_(a) and rapid gelation of PEG-DD1 (90 seconds) leading to an incomplete network, as supported by the data presented above, allowing increased water influx into the hydrogel.
Chemical structure of the crosslinkers affected hydrogel degradation. Gels made with ester-containing crosslinkers degraded faster than gels made with the non-ester-containing control crosslinker, PEG-diSH. Hydrolysis can be controlled by affecting the stability of the carbonyl carbon or restricting water access to it. Degradation was influenced by the methylene spacers between the ester and the thiol and the identity of the chemical moieties near the ester. A shorter spacer between the ester and thiol groups increased thiol acidity and made the ester more susceptible to nucleophilic attack. Conversely, greater distance between the two groups increased hydrophobicity and stability of the ester, reducing its liability to nucleophilic attack and slowing degradation. These concepts are seen in the following comparisons. Gels made with crosslinkers with shorter methylene spacers between the thiol and ester (e.g. PEG-DD1, PEG-DD1M, PEG-DD1P) degraded faster than those made with crosslinkers with longer spacers between the thiol and the ester, but otherwise similar structures (e.g. PEG-DD2, PEG-DD2M, PEG-DD2P). Incorporating methyl groups further increased hydrophobicity and possibly steric hindrance, further slowing degradation. For instance, gels made with crosslinkers containing additional hydrophobic methyl groups, PEG-DD1M and PEG-DD2M, degraded more slowly than those not containing pendant groups between the ester and thiol—PEG-DD1 and PEG-DD2, respectively. Further, destabilization of the carbonyl carbon was introduced by incorporating an electronegative phenyl group between the ester and thiol into PEG-DD1P and PEG-DD2P. PEG-DD1P showed significantly faster degradation than PEG-DD2. However, PEG-DD2P degraded in a relatively long time of ˜12 days. Without being bound by theory, this could be affected by an increase in hydrophobicity in PEG-DD2P, which increased stability and slowed degradation. These data show that the hydrogels made with the developed crosslinkers showed varied degradation due to differing chemical structures.
Trends were also observed between gelation and degradation time; the fast-gelling gels were fast-degrading, and the slow-gelling gels were slow-degrading. Gels made with PEG-DD2P were the exception; though fast-gelling (3 minutes), these were slow-degrading (12 days). This may be due to the large distance between the phenyl and ester groups. The high electronegativity of the phenyl group sped gelation. However, the greater distance between the phenyl and ester, as compared to PEG-DD1P, decreased the phenyl group influence on degradation. Rather, the ester was stabilized by the methylene groups, slowing degradation.
The ability to maintain similar mechanical and physical properties, while varying gel degradation times was also analyzed. Because gels crosslinked with PEG-DD1 showed significantly different initial properties than those made with other crosslinkers, whether changing the reaction pH in accordance with the thiol pK_(a) would alter the initial properties by reducing the thiol deprotonation rate was determined (Table 3). By the Henderson-Hasselbalch equation, it was determined that at a reaction pH of 7.4, ˜25% of the PEG-DD1 thiols were deprotonated and able to interact with PEG-Ac. By reducing the reaction pH to 6.25, the deprotonated thiols decreased to ˜1.8%. This value correlated with the percentage of deprotonated thiols (˜0.8%) in PEG-DD2 at pH 7.4. Consequently, the gelation time increased to 15.8 minutes, which also affected the crosslinked network, as seen in the decreased initial Q_(M) and ξ, and the increased v_(c) to values closer to gels made with the other alkyl crosslinkers. Further, while still short, degradation time increased to >24 hours, which correlated with a tighter ξ and higher v_(c).
Also, the differences in alkyl versus aryl thiols lead to different gel properties. Due to the presence of the phenyl groups, the aryl crosslinkers (PEG-DD1P and PEG-DD2P) are inherently more hydrophobic than the alkyl crosslinkers. Further, the alkyl thiols reacted faster than the aryl thiols once deprotonated because of their inherent nucleophilicity. However, this depended on the crosslinkers' deprotonation rate, and as the thiol consumption data show, the aryl crosslinkers deprotonate more quickly than the alkyl crosslinkers. Because the pK_(a) of the aryl crosslinkers is ≤7, and they react so quickly, how reducing the reaction pH (and thus increasing gelation time) would affect network formation was analyzed. This also slightly affected gels' initial properties and slowed degradation. These results show that the initial properties could be maintained, while affecting degradation time, by modulating the gels' reaction pH. Overall, final gel properties depended on the reaction kinetics. Finally, by adjusting the reaction pH in accordance with the crosslinker thiol pK_(a), the desired gel properties were achieved, and changing only the crosslinker changed degradation time without significantly affecting the initial properties.
Lastly, biocompatibility of gels made with the designed crosslinkers was analyzed. U87 cells survived encapsulation in gels made with all crosslinkers. Moreover, the gel leachables and degradation products were found to be non-cytotoxic to cells exposed to the gel leachables and degradation products. The developed gels were biocompatible and hydrophilic, permitting biomedical applications including drug delivery systems, as substrates for basic biological research, as matrices for cell encapsulation and transplantation, and as in vitro models for drug screening.
Degradable PEG-based crosslinkers with distinct chemical structures were synthesized and demonstrated tuning of degradation rates by modulating crosslinkers' chemical structure. Altering chemical moieties near the ester achieved a range of degradation times appropriate for biomedical applications. Finally, all developed crosslinkers supported high cell viability during encapsulation and exposure to hydrogel leachables and degradation products.
Crosslinkers of the present disclosure provide degradation times of hydrogels prepared using the crosslinkers ranging from hours to weeks due to differing chemical structures, particularly the moieties between the ester and thiol groups. Longer degradation rates are achieved using crosslinkers with longer carbohydrate chain length and steric hinderance, whereas using electron-withdrawing groups provides hydrogels with accelerated degradation rates. Change in degradation is coupled to gelation time: fast-gelling hydrogels were also fast-degrading and slow-gelling hydrogels were also slow-degrading.
What is claimed is:
1. A hydrogel crosslinker of formula (I),
wherein m is at least 10 repeating units; n₁ and n₂ ranges from 1 to 5 repeating units; X and Y are independently selected from C, CR¹, NR², O, SR³, and aryl; and R¹, R², and R³ are independently selected from H, alkyl, alkoxy, aryl, hydroxyl, amino, nitro, carboxyl, a halogen, a polar pendant group, and a non-polar pendant group.
2. A hydrolytically degradable hydrogel comprising a crosslinker of formula (I),
wherein m is at least 10 repeating units; n₁ and n₂ ranges from 1 to 5 repeating units; X and Y are independently selected from C, CR¹, NR², O, SR³, and aryl; and R¹, R², and R³ are independently selected from H, alkyl, alkoxy, aryl, hydroxyl, amino, nitro, carboxyl, a halogen, a polar pendant group, and a non-polar pendant group; and a polymer.
3. The hydrolytically degradable hydrogel of claim 2, wherein the polymer comprises poly(ethylene glycol) (PEG), poly(enthylene glycol)-di-acrylate (PEG-DA), multi-arm poly(ethylene glycol)-acrylate (PEG-Ac), poly(ethylene glycol)-dithiol (PEG-diSH), poly(ethylene glycol) di vinyl sulfone (PEG-diVS), multi-arm poly(ethylene glycol) vinyl sulfone (PEG-VS), poly(enthylene glycol)-di-methacrylate (PEG-DMA), multi-arm poly(ethylene glycol)-methacrylate (PEG-MAc), poly(ethylene glycol)-di-allyl ether (PEG-di AE), multi-arm poly(ethylene glycol)-allyl ether (PEG-AE), poly(ethylene glycol)-di-vinyl ether (PEG-diVE), multi-arm poly(ethylene glycol)-vinyl ether (PEG-VE), poly(ethylene glycol)-di-maleimide (PEG-diMI), multi-arm poly(ethylene glycol)-maleimide (PEG-MI), poly(ethylene glycol)-di-norborene, multi-arm poly(ethylene glycol)-norborene, poly(ethylene glycol)-di-vinyl carbonate, multi-arm poly(ethylene glycol)-vinyl carbonate, polyethylene glycol oligofumarate, and combinations thereof.
4. The hydrolytically degradable hydrogel of claim 2, comprising a degradation time ranging from minutes to months.
5. The hydrolytically degradable hydrogel of claim 2, comprising a gelation time ranging from about 1 minute to about 22 minutes.
6. The hydrolytically degradable hydrogel of claim 2, comprising a storage modulus ranging from about 3 kPa to about 10 kPa.
7. The hydrolytically degradable hydrogel of claim 2, comprising a mesh size ranging from about 7 nm to 13 nm.
8. The hydrolytically degradable hydrogel of claim 2, further comprising a cell.
9. The hydrolytically degradable hydrogel of claim 2, further comprising a protein.
10. The hydrolytically degradable hydrogel of claim 2, further comprising a drug.
11. A method of preparing a hydrolytically degradable hydrogel, the method comprising: providing a hydrogel precursor solution; providing to the hydrogel precursor solution a crosslinker of formula (I),
wherein m is at least 10 repeating units; n₁ and n₂ ranges from 1 to 5 repeating units; X and Y are independently selected from C, CR¹, NR², O, SR³, and aryl; and R¹, R², and R³ are independently selected from H, alkyl, alkoxy, aryl, hydroxyl, amino, nitro, carboxyl, a halogen, a polar pendant group, and a non-polar pendant group; and allowing the hydrogel precursor solution and crosslinker to polymerize to form a hydrolytically degradable hydrogel.
12. The method of claim 11, wherein the hydrogel precursor solution comprises at least one of poly(ethylene glycol) (PEG), poly(enthylene glycol)-di-acrylate (PEG-DA), multi-arm poly(ethylene glycol)-acrylate (PEG-Ac), poly(ethylene glycol)-dithiol (PEG-diSH), poly(ethylene glycol) di vinyl sulfone (PEG-diVS), multi-arm poly(ethylene glycol) vinyl sulfone (PEG-VS), poly(enthylene glycol)-di-methacrylate (PEG-DMA), multi-arm poly(ethylene glycol)-methacrylate (PEG-MAc), _poly(ethylene glycol)-di-allyl ether (PEG-di AE), multi-arm poly(ethylene glycol)-allyl ether (PEG-AE), poly(ethylene glycol)-di-vinyl ether (PEG-diVE), multi-arm poly(ethylene glycol)-vinyl ether (PEG-VE), poly(ethylene glycol)-di-maleimide (PEG-diMI), multi-arm poly(ethylene glycol)-maleimide (PEG-MI), poly(ethylene glycol)-di-norborene, multi-arm poly(ethylene glycol)-norborene, poly(ethylene glycol)-di-vinyl carbonate, multi-arm poly(ethylene glycol)-vinyl carbonate, and polyethylene glycol oligofumarate.
13. The method of claim 11, wherein the hydrolytically degradable hydrogel has a degradation time ranging from minutes to months.
14. The method of claim 11, wherein the hydrolytically degradable hydrogel has a gelation time ranging from about 1 minute to about 22 minutes.
15. The method of claim 11, wherein the hydrolytically degradable hydrogel has a storage modulus ranging from about 3 kPa to about 10 kPa.
16. The method of claim 11, wherein the hydrolytically degradable hydrogel has a mesh size ranging from about 7 nm to 13 nm.
17. The method of claim 11, further comprising adding a cell to at least one of the hydrogel precursor solution, the crosslinker, and the hydrolytically degradable hydrogel.
18. The method of claim 11, further comprising adding a protein to at least one of the hydrogel precursor solution, the crosslinker, and the hydrolytically degradable hydrogel.
19. The method of claim 11, further comprising adding a drug to at least one of the hydrogel precursor solution, the crosslinker, and the hydrolytically degradable hydrogel.
|
Thread:Pockyhe/@comment-22439-20150208204243
Hi, welcome to ! Thanks for your edit to the File:P2.jpg page.
Please leave me a message if I can help with anything!
|
/**
* Copyright 2022 Google LLC
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
* You may obtain a copy of the License at
*
* https://www.apache.org/licenses/LICENSE-2.0
*
* Unless required by applicable law or agreed to in writing, software
* distributed under the License is distributed on an "AS IS" BASIS,
* WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
* See the License for the specific language governing permissions and
* limitations under the License.
*/
// [START drive_recover_drives]
/**
* Find all shared drives without an organizer and add one.
* @param{string} userEmail user ID to assign ownership to
* */
async function recoverDrives(userEmail) {
// Get credentials and build service
// TODO (developer) - Use appropriate auth mechanism for your app
const {GoogleAuth} = require('google-auth-library');
const {google} = require('googleapis');
const auth = new GoogleAuth({
scopes: 'https://www.googleapis.com/auth/drive',
});
const service = google.drive({version: 'v3', auth});
const drives = [];
const newOrganizerPermission = {
type: 'user',
role: 'organizer',
emailAddress: userEmail, // Example: '[email protected]'
};
let pageToken = null;
try {
const res = await service.drives.list({
q: 'organizerCount = 0',
fields: 'nextPageToken, drives(id, name)',
useDomainAdminAccess: true,
pageToken: pageToken,
});
Array.prototype.push.apply(drives, res.data.items);
for (const drive of res.data.drives) {
console.log(
'Found shared drive without organizer:',
drive.name,
drive.id,
);
await service.permissions.create({
resource: newOrganizerPermission,
fileId: drive.id,
useDomainAdminAccess: true,
supportsAllDrives: true,
fields: 'id',
});
}
pageToken = res.nextPageToken;
} catch (err) {
// TODO(developer) - Handle error
throw err;
}
return drives;
}
// [END drive_recover_drives]
module.exports = recoverDrives;
|
How to get binary representation of window.location.href when href is a local file url?
Is there any way to get the binary representation (Blob, ArrayBuffer, or something else) of the source HTML when window.location.href is a local file url?
This is simply an attempt to get a binary view of the original html file for various operations; I am not trying to load the html into itself.
This is readily accomplished by making a XmlHttpRequest to access the html as binary when the original is remote, but I know of no way to accomplish it if the original html is a local file.
Can you clarify? You're opening a local HTML file and you want to load the same file as a binary? Inside itself?
I've edited the original question in an attempt to clarify for you.
|
Implement MICLe
Paper name: Big Self-Supervised Models Advance Medical Image Classification
Affiliation: Google Research and Health
Year: 2021
Citations: 74
+3.6 top1 accuracy improvement over SimCLR
Thanks for your suggestion, we will check it later.
Paper name: Big Self-Supervised Models Advance Medical Image Classification Affiliation: Google Research and Health Year: 2021 Citations: 74
+3.6 top1 accuracy improvement over SimCLR
+1
@fangyixiao18 it is not completed, why did you close it?
We have added it to our backlog, feel free to reopen it if you think it is needed.
|
Thread:<IP_ADDRESS>/@comment-22439-20150430145118
Hi, welcome to ! Thanks for your edit to the Spring 2015 Event page.
Please leave me a message if I can help with anything!
|
Nuevo León Archives and Libraries
Monterrey
Historical Archive in Nuevo León (Archivo General del Estado de Nuevo León)
The Historical Achive of Nuevo León is located at:
Among the many and varied documents that we can consult in this archive...
* You can find pre-1940 civil registration documents.
Libraries
Telephone: Email: [mailto: ] Website: [ ]
Museums
Telephone: Email: [mailto: ] Website: [ ]
|
import React from 'react';
import { ActivityIndicator, Animated, Easing, Keyboard, Text } from 'react-native';
import PropTypes from 'prop-types';
import { ScaledSheet } from 'react-native-size-matters';
import Aicon from 'react-native-vector-icons/FontAwesome';
import Touchable from 'react-native-platform-touchable';
import { colors, elevation } from '../../utils/theme';
export default class ButtonRound extends React.PureComponent {
constructor(props) {
super(props);
this.state = {
activity: false,
};
this.animatedRotation = new Animated.Value(0);
}
componentWillReceiveProps(nextProps) {
if (this.props.activity !== nextProps.activity && nextProps.activity === false) {
this.animatedRotation = new Animated.Value(0);
this.setState({ activity: false });
}
}
handleAnimatedPress = () => {
Keyboard.dismiss();
if (this.props.animated) {
Animated.timing(
this.animatedRotation, {
toValue: 1,
duration: 300,
easing: Easing.linear,
useNativeDriver: true,
}
).start(() => {
this.setState({ activity: true }, () => {
setTimeout(() => {
this.props.onPress();
}, 500);
});
});
} else {
this.props.onPress();
}
}
render() {
const { activity } = this.state;
const {
// activity,
buttonStyles,
icon,
iconLabel,
iconStyles,
// onPress,
} = this.props;
const spin = this.animatedRotation.interpolate({
inputRange: [0, 1],
outputRange: ['0deg', '360deg']
});
return (
<Touchable
activeOpacity={0.8}
background={Touchable.Ripple(colors.primary, false)}
hitSlop={{ top: 5, right: 5, bottom: 5, left: 5 }}
onPress={this.handleAnimatedPress}
style={[styles.button, buttonStyles, elevation]}
>
{
activity ?
<ActivityIndicator
animating={activity}
color={colors.white}
size={'small'}
/>
:
<Animated.View style={{ transform: [{ rotate: spin }] }}>
{
iconLabel ?
<Text style={[styles.icon, iconStyles]}>{iconLabel}</Text>
:
<Aicon name={icon} style={[styles.icon, iconStyles]} />
}
</Animated.View>
}
</Touchable>
);
}
}
ButtonRound.propTypes = {
activity: PropTypes.bool.isRequired,
animated: PropTypes.bool,
buttonStyles: PropTypes.shape({}),
icon: PropTypes.string,
iconLabel: PropTypes.string,
iconStyles: PropTypes.shape({}),
onPress: PropTypes.func.isRequired,
};
ButtonRound.defaultProps = {
animated: false,
activity: false,
buttonStyles: {},
icon: '',
iconLabel: '',
iconStyles: {},
onPress: () => {},
};
const styles = ScaledSheet.create({
button: {
alignItems: 'center',
backgroundColor: colors.primary,
borderRadius: 100,
bottom: '15@vs',
height: '45@ms',
justifyContent: 'center',
position: 'absolute',
right: '15@s',
width: '45@ms',
zIndex: 10,
},
icon: {
color: colors.white,
fontSize: '[email protected]',
},
});
|
these orchards.
The apple crop in this part of our county has been almost a total failure, not enough for home use. A great amount of injury has been done to the apple crop by rust or blight of the leaf, and as a result the prospect is not at all encouraging for a large crop the coming season.
Small fruits were injured very much by the extreme wet weather that prevailed early in the season. Strawberries were greatly damaged and did not produce to exceed one half a full crop. Yellows has prevailed to an alarming extent in our peach orchards, where the parties in charge have been negligent and have not complied with the requirements of the law.
In localities and orchards where the yellows law has been enforced, and all diseased trees have been promptly removed and destroyed, root and top, there is a perceptible decrease each year in the number of affected trees. Very many of our peach-growers have fallen into what has proven to be a very costly and objectionable practice, that of cutting down their diseased trees and then permitting the stumps and tops to remain in the orchard for an indefinite time. Experience has, I think, fully demonstrated the folly of this practice, as whole orchards have been lost where this custom has been followed for any considerable length of time.
After a number of years' experience as commissioner under the yellows law, I am fully convinced that the disease can be eradicated from an orchard or locality by prompt and thorough work in destroying all affected trees.
There will be about the usual number of peach trees planted the com ing season. Small fruits of all kinds are receiving more attention from growers than in former years. Currants and gooseberries are being exten sively planted.
sive orchards are planting for commercial purposes.
Peach trees have made a good growth the past season and the wood and buds seem to be well matured and in condition to withstand a pretty low temperature if necessary; and, should the winter from this on prove at all favorable, western Allegan county can be relied upon for a supply of peaches the coming season.
ABOUT LAWTON AND PAW PAW.
In considering the condition of fruitgrowing near Lawton and Paw Paw, at the present time, it is plainly apparent to an observer that considerable change has taken place in the last fifteen years, in methods of cultivation and varieties of fruit grown. The acreage of berries of all kinds is very much less than it was a few years ago, and is plainly on the decline, these fruits giving away to grapes.
That the high lands near Lawton and Paw Paw were especially well adapted to the growing of choice grapes, became evident as soon as vines in these localities came into bearing, and in consequence grape culture has been extended and enlarged until it has become the leading branch of the fruit industry in this vicinity. The variety most largely grown is the
|
The People of the State of New York, Respondent, v James Lewis, Appellant.
Judgment unanimously affirmed. Memorandum: Defendant was charged with criminal possession of a forged instrument in the second degree (Penal Law § 170.25). He moved to suppress identification evidence and his inculpatory oral statement on the ground that they were the products of his unlawful arrest. The court denied the motion, and thereafter defendant pled guilty as charged.
The evidence at the suppression hearing demonstrated that, within minutes after hearing a police radio report of a criminal incident at a bank on Culver Road, a Rochester Police Officer observed defendant, who matched the description given over the radio broadcast, walking within a few blocks from the scene of the crime. The officer approached defendant and told him that there had been an incident at the bank. He asked defendant if "he would go back to the bank” with him and defendant agreed to do so. Defendant was frisked before he entered the police car, but he was not handcuffed. Upon his return to the bank, defendant was identified by a bank clerk as the man who had attempted to cash a stolen check. Defendant was arrested and taken to police headquarters where, after being given Miranda warnings, he made an inculpatory oral statement.
At the conclusion of the suppression hearing, the court rendered its oral decision from the Bench. Although the decision included findings of fact and conclusions of law, the court failed to address the specific issues presented by the parties. Defendant contended that he was unlawfully seized on less than reasonable suspicion when he was placed in a police car and returned to the scene of the crime (see, People v Hicks, 68 NY2d 234). The People contended that defendant consented to return to the scene, and thus he was neither seized nor arrested until after he was identified by the bank clerk. In denying defendant’s motion, the suppression court made no specific finding concerning either of those issues. Nevertheless, we affirm.
On determination of a motion to suppress evidence, the court "must set forth on the record its findings of fact, its conclusions of law and reasons for its determination” (CPL 710.60 [6]). The failure to do so is not fatal, however, where, as here, there has been a full and fair hearing. In such instances, this court may make its own findings of fact and conclusions of law (see, People v Burrows, 53 AD2d 1038, 1039; People v Denti, 44 AD2d 44, 47).
Here, it is evident from the record that defendant is not entitled to suppression of either the identification testimony or his oral confession (see, People v Gonzalez, 116 AD2d 661). The proof that defendant consented to be transported to the bank is uncontradicted and compelling. We find, therefore, that defendant voluntarily accompanied the police officer to the bank. Since "[c]onsent is a valid substitute for probable cause” (People v Hodge, 44 NY2d 553, 559), we need not further address defendant’s argument that he was detained on less than reasonable suspicion (see, People v Morales, 42 NY2d 129, 138 [Wachtler, J., concurring], cert denied 434 US 1018). (Appeal from Judgment of Supreme Court, Monroe County, Bergin, J.—Criminal Possession Forged Instrument, 2nd Degree.) Present—Dillon, P. J., Callahan, Denman, Green and Pine, JJ.
|
Heine-Cantor Theorem
Theorem
Let $M_1$ and $M_2$ be metric spaces.
Let $f: M_1 \to M_2$ be a continuous mapping.
If $M_1$ is compact, then $f$ is uniformly continuous on $M_1$.
Proof
Let $f: M_1 \to M_2$ be continuous.
Let $\epsilon > 0$.
Then by definition:
Consider any $x, y \in M_1$ which satisfy $d_1 \left({x, y}\right) < \delta$.
Thus:
* From $d_1 \left({x, x_i}\right) < \delta \left({x_i}\right)$ we have:
* $d_2 \left({f \left({x}\right), f \left({x_1}\right)}\right) \le \dfrac \epsilon 2$
* From $d_1 \left({y, x_i}\right) \le 2 \delta$ we have:
* $d_2 \left({f \left({y}\right), f \left({x_1}\right)}\right) \le \dfrac \epsilon 2$
So:
Alternate proof
We can also prove the theorem using the notion of sequential compactness.
To do so, take $M_1$ and $M_2$ as before, but assume $M_1$ is sequentially compact.
Suppose $f:A_1 \to A_2$ is continuous but not uniformly continuous.
But this contradicts the fact that we chose $x_n$ and $y_n$ to always be at least $\epsilon$ apart.
Note
If a mapping is uniformly continuous it is not necessarily compact.
|
// https://www.geeksforgeeks.org/topological-sorting-indegree-based-solution/
// https://en.wikipedia.org/wiki/Topological_sorting
/**
* Time Complexity.
* O(V + E),
* running time linear in the number of nodes plus the number of edges.
*
* Space Complexity.
* O(V), by Sedgewick
* O(V + E), by bigocheatsheet
*/
class TopologicalSort {
constructor() {}
/**
* Returns a topologically sorted order of a graph or null.
*
* @param {Graph} G
* @returns {number[]|null}
*/
topologicalSort(G) {
// create an array to store indegrees of all vertices. Initialize all indegrees as 0
const indegree = new Array(G.V());
for (let v = 0; v < G.V(); v++) {
indegree[v] = 0;
}
// traverse adjacency lists to fill indegrees of
// vertices. This step takes O(V+E) time
for (let v = 0; v < G.V(); v++) {
const temp = G.adj(v).toArray()
temp.forEach((w) => {
indegree[w]++;
});
}
// Create a queue and enqueue all vertices with indegree 0
const q = new Queue();
for (let v = 0; v < G.V(); v++) {
if (indegree[v] === 0) {
q.enqueue(v); // add()
}
}
// initialize count of visited vertices
let count = 0;
// create an array to store result (a topological ordering of the vertices).
const topOrder = new Array(G.V());
while (!q.isEmpty()) {
// extract front of queue (or perform dequeue) and add it to topological order
let u = q.dequeue(); // poll()
topOrder.push(u);
// iterate through all its neighbouring nodes
// of dequeued node u and decrease their in-degree by 1 (remove edge from the graph)
const adjToU = G.adj(u).toArray();
adjToU.forEach((w) => {
// if in-degree becomes zero, add it to queue
if (--indegree[w] === 0) {
q.enqueue(w); // add()
}
});
count++;
}
// check if there was a cycle
if (count !== G.V()) {
console.log('There exists a cycle in the graph.');
return null;
}
// a topologically sorted order
return topOrder;
}
}
|
Googles recaptcha disrupts html 5 validation
I have a form with HTML 5 validation in it that is working fine.
When an user clicks <input type="submit"> the validation is triggered.
But I add Google recaptcha to it the validation is no linker triggered.
Any suggestions?
<input type="submit" class="g-recaptcha btn btn-info pull-right" data-sitekey="*`***************************************" data-callback="YourOnSubmitFn">
<script src="https://www.google.com/recaptcha/api.js"></script>
<script>
function YourOnSubmitFn(token) {
document.getElementById('contact').submit();
}
</script>
There is a workaround here and the issue is discussed also in github.
workaround using jquery:
JS:
$('#form-contact').submit(function (event) {
event.preventDefault();
grecaptcha.reset();
grecaptcha.execute();
});
function formSubmit(response) {
// submit the form which now includes a g-recaptcha-response input
}
Html:
<script src="https://ajax.googleapis.com/ajax/libs/jquery/2.1.1/jquery.min.js"></script>
<script src="https://www.google.com/recaptcha/api.js"></script>
<form action="?">
<div class="g-recaptcha"
data-sitekey="your-key"
data-size="invisible"
data-callback="formSubmit">
</div>
<button type="submit">Submit</button>
</form>
In pure JS you can listen to form submit this way:
var ele = /*Your Form Element*/;
if(ele.addEventListener){
ele.addEventListener("submit", callback, false); //Modern browsers
}else if(ele.attachEvent){
ele.attachEvent('onsubmit', callback); //Old IE
}
|
Talk:Perspective Manipulation/@comment-4013655-20130113010001/@comment-5935730-20130113043530
It's only canon if its the same. Nerf it down bro.
|
<?php
header("Access-Control-Allow-Origin: *");
ini_set('display_errors', 1);
ini_set('display_startup_errors', 1);
error_reporting(E_ALL);
$ids = $_REQUEST['ids'];
$capacity = $_REQUEST['capacity'];
$power = $_REQUEST['power'];
$ch = curl_init();
curl_setopt($ch, CURLOPT_URL, 'http://localhost:8081/eval');
curl_setopt($ch, CURLOPT_RETURNTRANSFER, 1);
curl_setopt($ch, CURLOPT_CUSTOMREQUEST, 'GET');
curl_setopt($ch, CURLOPT_POSTFIELDS, "{\"ids\":[$ids],\"capacity\":$capacity,\"power\":$power}");
$headers = array();
$headers[] = 'Content-Type: application/json';
curl_setopt($ch, CURLOPT_HTTPHEADER, $headers);
$result = curl_exec($ch);
if (curl_errno($ch)) {
echo 'Error:' . curl_error($ch);
}
echo json_encode($result);
curl_close($ch);
|
Can we use history file for auditing purpose
We have a common testing environment on AIX for all 15-20 persons. There might be chances that somebody deleted the files mistakenly. In such scenarios, it is very difficult to know who deleted files from a specific location.
I would like to generate a report for that same so that we can trace it. In fact, I am looking for following information :
< ExecutedCmd>
How can we do that by using shell script ?
Please suggest.
are you using bash? if so you could grep -i "<executedcmd>" /home/*/.bash_history
Yes, bash. But how i will get an information about follwoing:
<sshd_id>ipAddress:portNumber< ExecutedCmd>
In fact i would like to generate a report for auditing purpose and send it to an email id for auditing purpose.
Any suggestions ?
All users in my team using a generic account therefore it is merely impossible to track who mistakenly detected some files.
In current scenario it is impossible to trace when, what and from where files are deleted by whom.
I appreciate your response regarding this request.
How can we do it by shell script ?
that would be difficult, i don't wanna say impossible but it might be. /var/log/wtmp(x) holds login info. .bash_history (depending on verbosity) could tell you time, PID, etc. given a time range (.bash_history) you could match that time with /var/log/wtmp(x) or lastlog (last)
If a user's shell can write to .bash_history, then the that user can also modify or truncate it. They could also simply kill -9 $$ so that the shell doesn't have a chance to write to history on exit.
Accountability can not exist in an environment with only one user account. For this reason and for many others (granular access control, reliable privilege revocation, account termination upon dismissal, etc.), you should really set up a separate account for each person.
Further, finding out who deleted a file is not going to solve your problem; the file is gone anyway. If the data is mission-critical, it should be backed up regularly and incrementally. There are many ways to do this. rsync with --link-dest is appropriate for large-scale system backups whereas some kind of source control would work better for something like a directory full of text files.
|
---
title: "Modern R with the tidyverse"
author: "Bruno Rodrigues"
date: "2020-03-31"
tags: [Tidyverse, Data Science, Machine Learning, Statistics, Models]
link: "https://b-rodrigues.github.io/modern_R/"
length_weight: "16.3%"
pinned: false
---
This book will teach you how to use R to solve you statistical, data science and machine learning problems. Importing data, computing descriptive statistics, running regressions (or more complex machine learning models) and generating reports are some of the topics covered. No previous experience with R is needed. [...] This book is still being written. Chapters 1 to 8 are almost ready, but more content is being added
(especially to chapter 8). 9 and 10 are empty for now. Some exercises might be at the wrong place
too and more are coming. You can purchase an ebook version of this book on ...
|
import torch as t
from torch import nn
from torch.utils.data import Dataset, DataLoader
from torch.optim import Adam
import numpy as np
import cv2
import os
batch_size = 16
img_size = 32
latent_dim = 64
channels = 1
lr = 0.00001 #0.0002
b1, b2 = 0.5, 0.999
n_epochs = 50
n_ch = 100 # Number of channels in initial convolution layers
sample_interval = 200 # Save a generated image every sample_interval number of batches
write_dir = '../images/gan_lin_test/'
data_dir = '../data/bub_single_24new/'
os.makedirs(write_dir, exist_ok=True)
Zeros = t.zeros((batch_size, 1, img_size, img_size))
Ones = t.ones((batch_size, 1, img_size, img_size))
class Data(Dataset):
def __init__(self):
self.data = [cv2.imread(data_dir + im, cv2.IMREAD_GRAYSCALE)//255 for im in os.listdir(data_dir) if '-0.png' in im]
self.data = t.Tensor([im for im in self.data if im.shape == (img_size, img_size)])
self.len = self.data.shape[0]
def __len__(self):
return self.len
def __getitem__(self, index):
return self.data[index]
dataset = Data()
dataloader = DataLoader(dataset, batch_size=batch_size, shuffle=True)
img_shape = (channels, img_size, img_size)
class Generator(nn.Module):
# Takes as input a random tensor of size (batch_size, latent_dim) generated by noise()
def __init__(self):
super(Generator, self).__init__()
def block(in_feat, out_feat, normalize=True):
layers = [nn.Linear(in_feat, out_feat)]
if normalize:
layers.append(nn.BatchNorm1d(out_feat, 0.8))
layers.append(nn.LeakyReLU(0.2, inplace=True))
return layers
self.model = nn.Sequential(
*block(latent_dim, 2*latent_dim, normalize=False),
*block(2*latent_dim, 4*latent_dim),
*block(4*latent_dim, 8*latent_dim),
*block(8*latent_dim, 16*latent_dim),
nn.Linear(16*latent_dim, int(np.prod(img_shape))),
nn.Sigmoid()
)
def forward(self, z):
img = self.model(z)
img = img.view(img.size(0), *img_shape)
img = t.where(img > 0.5, Ones, img)
return img
class Discriminator(nn.Module):
# Takes as input a data image or image generated by Generator
def __init__(self):
super(Discriminator, self).__init__()
self.model = nn.Sequential(
nn.Linear(int(np.prod(img_shape)), 8*latent_dim),
nn.LeakyReLU(0.2, inplace=True),
nn.Linear(8*latent_dim, 4*latent_dim),
nn.LeakyReLU(0.2, inplace=True),
nn.Linear(4*latent_dim, 1),
nn.Sigmoid(),
)
def forward(self, img):
img_flat = img.view(img.size(0), -1)
validity = self.model(img_flat)
return validity
def generate_noise():
return t.rand((batch_size, latent_dim))
# Loss function
adversarial_loss = nn.BCELoss()
G = Generator()
D = Discriminator()
# Optimizers
optimizer_G = Adam(G.parameters(), lr=lr, betas=(b1, b2))
optimizer_D = Adam(D.parameters(), lr=lr, betas=(b1, b2))
for epoch in range(n_epochs):
for i, data_imgs in enumerate(dataloader):
# Configure generator input
data_shape = data_imgs.shape
data_imgs = data_imgs.view(data_imgs.shape[0], channels, data_imgs.shape[1], data_imgs.shape[2])
# Adversarial ground truths
valid = t.ones((data_shape[0], 1), requires_grad=False)
fake = t.zeros((data_shape[0], 1), requires_grad=False)
# ----------------
# Train Generator
# ----------------
optimizer_G.zero_grad()
# Sample noise as generator input
noise = generate_noise()
# Generate a batch of images
gen_imgs = G(noise)
gen_imgs = gen_imgs[:data_shape[0]]
# Loss measures generator's ability to fool the discriminator
G_loss = adversarial_loss(D(gen_imgs), valid)
G_loss.backward()
optimizer_G.step()
# --------------------
# Train Discriminator
# --------------------
optimizer_D.zero_grad()
# Measure discriminator's ability to classify real from generated samples
real_loss = adversarial_loss(D(data_imgs), valid)
fake_loss = adversarial_loss(D(gen_imgs.detach()), fake)
D_loss = (real_loss + fake_loss) / 2
D_loss.backward()
optimizer_D.step()
# ----------------
# Log Progress
# ----------------
print(
"[Epoch %d/%d] [Batch %d/%d] [D loss: %f] [G loss: %f]"
% (epoch, n_epochs, i, len(dataloader), D_loss.item(), G_loss.item())
)
batches_done = epoch*len(dataloader) + i
if batches_done % sample_interval == 0:
os.makedirs(write_dir + str(batches_done), exist_ok=True)
for j, gen_im in enumerate(gen_imgs):
cv2.imwrite('%s%d/%d.png' % (write_dir, batches_done, j), gen_im[0].detach().numpy()*255)
|
Help:Champion pages
Infobox
Lead section
Example
Lore
Base statistics
Abilities
Skins
Patch history
Patch history uses a certain type of formatted table here:
The table above contains a space for the rows of the table.
* rowspan=2| ???
* - align="left"
* - align="left"
* Base Stats
* 570 → 530
* 57 → 49
* 40/75/110/145 → 35/70/105/140
* 40/75/110/145 → 35/70/105/140
This is the actual adjustments. See the Manual of Style for more information.
After that...
At the very bottom of the page, the Template:Champions should be placed. It is a navbox.
|
README docs restructuring
[x] All tests passed. If this feature is not already covered by the tests, I added new tests.
[x] This pull request is on the dev branch.
[x] I used gofmt for formatting the code before submitting the pull request.
This PR makes the following restructuring modifications to the README documentation. See the changed README in my forked branch.
Created a new "docs" directory at the top of the repository.
Moved the "template" directory currently under the root to be inside the new "docs" directory.
Created the following new files inside the new "docs" directory: install-github.md, install-gitlab.md and install-bitbucket-server.md.
Adjust the main README to the above changes.
Add links back to the main README page from the 3 new documentation pages.
Add links back to the GitHub Installation page from the GitHub Templates page.
Looks Good!
If I had to make any change, I'd consider separating template/github-actions into template plus a subdirectory of github-actions, since we'll likely be adding frogbot-config.yml to the templates dir as well as maybe more in the future.
@yahavi what do you think about these changes?
|
Fandom
Paul Kruse
54,875pages on
this wiki
Add New Page
Talk0 Share
Paul Kruse
Position Left Wing
Height
Weight
6 ft 0 in (1.83 m)
202 lb (92 kg)
Teams Calgary Flames
New York Islanders
Buffalo Sabres
San Jose Sharks
Nationality Canadian
Born March 15 1970 (1970-03-15) (age 46),
Merritt, BC, CAN
NHL Draft 83rd overall, 1990
Calgary Flames
Pro Career 1990 – 2004
Paul Johannes Kruse (born February 25, 1971, in Merritt, British Columbia, Canada) is a former National Hockey League left wing. He was drafted in the fourth round, 83rd overall, by the Calgary Flames in the 1990 NHL Entry Draft.
After playing three seasons in the Western Hockey League with the Moose Jaw Warriors and Kamloops Blazers, Kruse joined the International Hockey League's Salt Lake Golden Eagles. After splitting three seasons between the Golden Eagles and the Flames, he joined the Flames full-time in the 1993–94 season.
During the 1996–97 season, Kruse was acquired by the New York Islanders. At the trade deadline of the 1997–98 season, he was traded, along with Jason Holland, to the Buffalo Sabres for Jason Dawe. Kruse was a member of the Buffalo Sabres team which went to the Stanley Cup Finals in the 1998–99 season, appearing in ten playoff games during the run.
Kruse's last NHL appearance came when he dressed for one game for the 2000–01 San Jose Sharks. He went to Europe after the season, playing two years in the United Kingdom's British Ice Hockey Superleague for the Sheffield Steelers and the Belfast Giants and one more year playing in Austria playing for EHC Black Wings Linz before retiring.
External linksEdit
This page uses content from Wikipedia. The original article was at Paul Kruse. The list of authors can be seen in the page history. As with Ice Hockey Wiki, the text of Wikipedia is available under the Creative Commons Attribution-Share Alike License 3.0 (Unported) (CC-BY-SA).
Ad blocker interference detected!
Wikia is a free-to-use site that makes money from advertising. We have a modified experience for viewers using ad blockers
Wikia is not accessible if you’ve made further modifications. Remove the custom ad blocker rule(s) and the page will load as expected.
|
Articles | Volume 16, issue 4
Atmos. Chem. Phys., 16, 2611–2629, 2016
https://doi.org/10.5194/acp-16-2611-2016
Atmos. Chem. Phys., 16, 2611–2629, 2016
https://doi.org/10.5194/acp-16-2611-2016
Research article
03 Mar 2016
Research article | 03 Mar 2016
Understanding cirrus ice crystal number variability for different heterogeneous ice nucleation spectra
Sylvia C. Sullivan et al.
Related authors
Effects of Secondary Organic Aerosol Water on fine PM levels and composition over US
Stylianos Kakavas, Spyros Pandis, and Athanasios Nenes
Atmos. Chem. Phys. Discuss., https://doi.org/10.5194/acp-2022-815,https://doi.org/10.5194/acp-2022-815, 2023
Preprint under review for ACP
Short summary
Chemical evolution of primary and secondary biomass burning aerosols during daytime and nighttime
Amir Yazdani, Satoshi Takahama, John K. Kodros, Marco Paglione, Mauro Masiol, Stefania Squizzato, Kalliopi Florou, Christos Kaltsonoudis, Spiro D. Jorga, Spyros N. Pandis, and Athanasios Nenes
Atmos. Chem. Phys. Discuss., https://doi.org/10.5194/acp-2022-658,https://doi.org/10.5194/acp-2022-658, 2022
Revised manuscript under review for ACP
Short summary
Use of Lidar Aerosol Extinction and Backscatter Coefficients to Estimate Cloud Condensation Nuclei (CCN) Concentrations in the Southeast Atlantic
Emily D. Lenhardt, Lan Gao, Jens Redemann, Feng Xu, Sharon P. Burton, Brian Cairns, Ian Chang, Richard A. Ferrare, Chris A. Hostetler, Pablo E. Saide, Calvin Howes, Yohei Shinozuka, Snorre Stamnes, Mary Kacarab, Amie Dobracki, Jenny Wong, Steffen Freitag, and Athanasios Nenes
Atmos. Meas. Tech. Discuss., https://doi.org/10.5194/amt-2022-262,https://doi.org/10.5194/amt-2022-262, 2022
Preprint under review for AMT
Short summary
Role of K-feldspar and quartz in global ice nucleation by mineral dust in mixed-phase clouds
Marios Chatziparaschos, Nikos Daskalakis, Stelios Myriokefalitakis, Nikos Kalivitis, Athanasios Nenes, Maria Gonçalves Ageitos, Montserrat Costa-Surós, Carlos Pérez García-Pando, Medea Zanoli, Mihalis Vrekoussis, and Maria Kanakidou
Atmos. Chem. Phys. Discuss., https://doi.org/10.5194/acp-2022-551,https://doi.org/10.5194/acp-2022-551, 2022
Revised manuscript accepted for ACP
Short summary
Biomass burning and marine aerosol processing over the southeast Atlantic Ocean: a TEM single-particle analysis
Caroline Dang, Michal Segal-Rozenhaimer, Haochi Che, Lu Zhang, Paola Formenti, Jonathan Taylor, Amie Dobracki, Sara Purdue, Pui-Shan Wong, Athanasios Nenes, Arthur Sedlacek III, Hugh Coe, Jens Redemann, Paquita Zuidema, Steven Howell, and James Haywood
Atmos. Chem. Phys., 22, 9389–9412, https://doi.org/10.5194/acp-22-9389-2022,https://doi.org/10.5194/acp-22-9389-2022, 2022
Short summary
Related subject area
Subject: Aerosols | Research Activity: Atmospheric Modelling | Altitude Range: Troposphere | Science Focus: Physics (physical properties and processes)
Meteorological export and deposition fluxes of black carbon on glaciers of the central Chilean Andes
Rémy Lapere, Nicolás Huneeus, Sylvain Mailler, Laurent Menut, and Florian Couvidat
Atmos. Chem. Phys., 23, 1749–1768, https://doi.org/10.5194/acp-23-1749-2023,https://doi.org/10.5194/acp-23-1749-2023, 2023
Short summary
Future changes in atmospheric rivers over East Asia under stratospheric aerosol intervention
Ju Liang and Jim Haywood
Atmos. Chem. Phys., 23, 1687–1703, https://doi.org/10.5194/acp-23-1687-2023,https://doi.org/10.5194/acp-23-1687-2023, 2023
Short summary
Modeling the influence of chain length on secondary organic aerosol (SOA) formation via multiphase reactions of alkanes
Azad Madhu, Myoseon Jang, and David Deacon
Atmos. Chem. Phys., 23, 1661–1675, https://doi.org/10.5194/acp-23-1661-2023,https://doi.org/10.5194/acp-23-1661-2023, 2023
Short summary
How aerosol size matters in aerosol optical depth (AOD) assimilation and the optimization using the Ångström exponent
Jianbing Jin, Bas Henzing, and Arjo Segers
Atmos. Chem. Phys., 23, 1641–1660, https://doi.org/10.5194/acp-23-1641-2023,https://doi.org/10.5194/acp-23-1641-2023, 2023
Short summary
Microphysical, macrophysical, and radiative responses of subtropical marine clouds to aerosol injections
Je-Yun Chun, Robert Wood, Peter Blossey, and Sarah J. Doherty
Atmos. Chem. Phys., 23, 1345–1368, https://doi.org/10.5194/acp-23-1345-2023,https://doi.org/10.5194/acp-23-1345-2023, 2023
Short summary
Cited articles
Barahona, D.: On the ice nucleation spectrum, Atmos. Chem. Phys., 12, 3733–3752, https://doi.org/10.5194/acp-12-3733-2012, 2012.
Barahona, D. and Nenes, A.: Parameterization of cirrus cloud formation in large-scale models: Homogeneous nucleation, J. Geophys. Res., 113, D11211, https://doi.org/10.1029/2007JD009355, 2008.
Barahona, D. and Nenes, A.: Parameterizing the competition between homogeneous and heterogeneous freezing in cirrus cloud formation – monodisperse ice nuclei, Atmos. Chem. Phys., 9, 369–381, https://doi.org/10.5194/acp-9-369-2009, 2009a.
Barahona, D. and Nenes, A.: Parameterizing the competition between homogeneous and heterogeneous freezing in ice cloud formation – polydisperse ice nuclei, Atmos. Chem. Phys., 9, 5933–5948, https://doi.org/10.5194/acp-9-5933-2009, 2009b.
Barahona, D. and Nenes, A.: Dynamical states of low temperature cirrus, Atmos. Chem. Phys., 11, 3757–3771, https://doi.org/10.5194/acp-11-3757-2011, 2011.
Download
Short summary
We use the adjoint model of a cirrus parameterization to quantify sources of crystal variability for various ice-nucleating spectra and output from CAM5. The sensitivities can be directly linked to nucleation regime and efficiency of various INP. The lab-based spectrum calculates much higher INP efficiencies than field-based ones, owing to aerosol surface properties. The sensitivity to temperature tends to be low, due to the compensating effects of temperature on INP spectrum parameters.
Altmetrics
Final-revised paper
Preprint
|
require 'rails_helper'
RSpec.describe Admin::SkillsController, type: :controller do
it_behaves_like 'an authenticated controller', 'index'
it_behaves_like 'an authenticated controller', 'new'
describe 'with a logged in user' do
before do
sign_in create(:user)
end
describe '#index' do
before do
5.times { create(:skill) }
get :index
end
it 'populates @skills with the correct number of skills' do
skills = controller.instance_variable_get(:@skills)
expect(skills.size).to eq(5)
end
end
describe '#new' do
before do
get :new
end
it 'creates a new Skill and assigns it to @skill' do
skill = controller.instance_variable_get(:@skill)
expect(skill.class).to eq(Skill)
expect(skill.new_record?).to be_truthy
end
end
describe '#create' do
let(:title) { 'Ruby' }
let(:level) { 95.97 }
let(:params) do
{
title: title,
level: level
}
end
context 'with params set' do
it 'creates a new Skill with the details' do
count = Skill.count
post :create, skill: params
expect(Skill.count).to eq(count + 1)
end
it 'saves the given details to a new Skill' do
post :create, skill: params
skill = Skill.last
expect(skill.title).to eq(title)
expect(skill.level).to eq(level)
end
it 'redirects the user to the skill page' do
post :create, skill: params
skill = controller.instance_variable_get(:@skill)
expect(response).to redirect_to(admin_skill_path(skill))
end
end
context 'with incorrect params' do
let(:title) { nil }
before do
post :create, skill: params
@skill = controller.instance_variable_get(:@skill)
end
it 'renders the edit page' do
expect(response).to have_rendered('admin/skills/new')
end
it 'populates error messages' do
expect(@skill.errors).not_to be_nil
end
end
end
describe '#show' do
before do
@skill = create(:skill)
get :show, id: @skill.id
end
it 'assigns the @skill instance variable' do
skill = controller.instance_variable_get(:@skill)
expect(skill).to eq(@skill)
end
end
describe '#edit' do
let(:skill) { create(:skill) }
before do
get :edit, id: skill.id
end
it 'populates the @skill instance variable' do
instance_skill = controller.instance_variable_get(:@skill)
expect(instance_skill.class).to eq(Skill)
expect(instance_skill).to eq(skill)
end
it 'raises an error if the id is invalid' do
expect do
delete :edit, id: 1000
end.to raise_error(ActionController::RoutingError)
end
end
describe '#update' do
let(:title) { 'PHP' }
let(:level) { 53.4 }
let(:params) do
{
title: title,
level: level
}
end
let(:skill) { create(:skill) }
context 'with a valid skill id' do
before do
patch :update, id: skill.id, skill: params
end
it 'renders the show template' do
expect(response).to redirect_to(admin_skill_path(skill))
end
it 'populates @skill correctly' do
instance_skill = controller.instance_variable_get(:@skill)
expect(instance_skill).to be_a(Skill)
end
it 'successfully updates the skill' do
updated_skill = Skill.find(skill.id)
expect(updated_skill.title).to eq(title)
expect(updated_skill.level).to eq(level)
end
end
end
describe '#destroy' do
before do
@skill = create(:skill)
end
it 'redirects to the index page' do
delete :destroy, id: @skill.id
expect(response).to redirect_to(admin_skills_path)
end
it 'successfully removes a skill' do
skill_count = Skill.count
delete :destroy, id: @skill.id
expect(Skill.count).to eq(skill_count - 1)
end
end
end
end
|
/** \copyright
* Copyright (c) 2020, Balazs Racz
* All rights reserved.
*
* Redistribution and use in source and binary forms, with or without
* modification, are permitted provided that the following conditions are met:
*
* - Redistributions of source code must retain the above copyright notice,
* this list of conditions and the following disclaimer.
*
* - Redistributions in binary form must reproduce the above copyright notice,
* this list of conditions and the following disclaimer in the documentation
* and/or other materials provided with the distribution.
*
* THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS"
* AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
* IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
* ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT HOLDER OR CONTRIBUTORS BE
* LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR
* CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF
* SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS
* INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN
* CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
* ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
* POSSIBILITY OF SUCH DAMAGE.
*
* \file VirtualMemorySpace.hxx
*
* Implementation of a memory space where the values are not stored in a
* contiguous storage area but are read and written via callbacks.
*
* @author Balazs Racz
* @date 10 Aug 2020
*/
#ifndef _OPENLCB_VIRTUALMEMORYSPACE_HXX
#define _OPENLCB_VIRTUALMEMORYSPACE_HXX
#include "openlcb/ConfigEntry.hxx"
#include "openlcb/ConfigRepresentation.hxx"
#include "openlcb/MemoryConfig.hxx"
#include "utils/SortedListMap.hxx"
namespace openlcb
{
/// Implementation of a memory space where the values are not stored in a
/// contiguous storage area but are read and written via callbacks.
class VirtualMemorySpace : public MemorySpace
{
public:
VirtualMemorySpace()
: isReadOnly_(false)
{
}
/// @returns whether the memory space does not accept writes.
bool read_only() override
{
return isReadOnly_;
}
/// @returns the lowest address that's valid for this block.
address_t min_address() override
{
return minAddress_;
}
/// @returns the largest valid address for this block. A read of 1 from
/// this address should succeed in returning the last byte.
address_t max_address() override
{
return maxAddress_;
}
/// @return the number of bytes successfully written (before hitting end
/// of space).
/// @param destination address to write to
/// @param data to write
/// @param len how many bytes to write
/// @param error if set to non-null, then the operation has failed. If the
/// operation needs to be continued, then sets error to
/// MemorySpace::ERROR_AGAIN, and calls the Notifiable
/// @param again when a re-try makes sense. The caller should call write
/// once more, with the offset adjusted with the previously returned
/// bytes.
size_t write(address_t destination, const uint8_t *data, size_t len,
errorcode_t *error, Notifiable *again) override
{
if ((destination > maxAddress_) || ((destination + len) <= minAddress_))
{
*error = MemoryConfigDefs::ERROR_OUT_OF_BOUNDS;
return 0;
}
if (destination + len > maxAddress_ + 1)
{
len = maxAddress_ + 1 - destination;
}
*error = 0;
unsigned repeat;
const DataElement *element = nullptr;
ssize_t skip = find_data_element(destination, len, &element, &repeat);
string payload;
size_t written_len;
if (skip > 0)
{
// Will cause a new call be delivered with adjusted data and len.
return skip;
}
else if (skip < 0)
{
HASSERT(element);
// We have some missing bytes that we need to read out first, then
// can perform the write.
address_t field_start = destination + skip;
if (!(cacheOffset_ == field_start &&
(cachedData_.size() >= (size_t)-skip)))
{
cacheOffset_ = field_start;
cachedData_.clear();
bn_.reset(again);
element->readImpl_(repeat, &cachedData_, bn_.new_child());
if (!bn_.abort_if_almost_done())
{
// did not succeed synchronously.
bn_.notify(); // our slice
*error = MemorySpace::ERROR_AGAIN;
return 0;
}
cachedData_.resize(element->size_); // pads with zeroes
}
// Now: cachedData_ contains the payload in the current storage.
payload = cachedData_;
written_len =
std::min((size_t)len, (size_t)(element->size_ + skip));
memcpy(&payload[-skip], (const char *)data, written_len);
}
else // exact address write.
{
HASSERT(element);
payload.assign((const char *)data,
std::min((size_t)len, (size_t)element->size_));
written_len = payload.size();
}
bn_.reset(again);
element->writeImpl_(repeat, std::move(payload), bn_.new_child());
if (bn_.abort_if_almost_done())
{
cachedData_.clear();
return written_len;
}
else
{
// did not succeed synchronously.
bn_.notify(); // our slice
*error = MemorySpace::ERROR_AGAIN;
return 0;
}
}
/** @returns the number of bytes successfully read (before hitting end of
* space). If *error is set to non-null, then the operation has failed. If
* the operation needs to be continued, then sets error to ERROR_AGAIN, and
* calls the Notifiable @param again when a re-try makes sense. The caller
* should call read once more, with the offset adjusted with the previously
* returned bytes. */
size_t read(address_t source, uint8_t *dst, size_t len, errorcode_t *error,
Notifiable *again) override
{
if ((source > maxAddress_) || ((source + len) <= minAddress_))
{
*error = MemoryConfigDefs::ERROR_OUT_OF_BOUNDS;
return 0;
}
if (source + len > maxAddress_ + 1)
{
len = maxAddress_ + 1 - source;
}
*error = 0;
unsigned repeat;
const DataElement *element = nullptr;
ssize_t skip = find_data_element(source, len, &element, &repeat);
if (skip > 0)
{
memset(dst, 0, skip);
return skip;
}
// Now: skip <= 0
HASSERT(element);
string payload;
bn_.reset(again);
element->readImpl_(repeat, &payload, bn_.new_child());
if (!bn_.abort_if_almost_done())
{
// did not succeed synchronously.
bn_.notify(); // our slice
*error = MemorySpace::ERROR_AGAIN;
return 0;
}
payload.resize(element->size_); // pads with zeroes
size_t data_len = std::min(payload.size() + skip, len);
memcpy(dst, payload.data() - skip, data_len);
return data_len;
}
protected:
/// Function that will be called for writes.
/// @param repeat 0 to number of repeats if this is in a repeated
/// group. Always 0 if not repeated group.
/// @param contents data payload that needs to be written. The data
/// bytes of this container start at the address_.
/// @param done must be notified when the write is complete (possibly
/// inline).
using WriteFunction = std::function<void(
unsigned repeat, string contents, BarrierNotifiable *done)>;
/// Function that will be called for reads.
/// @param repeat 0 to number of repeats if this is in a repeated
/// group. Always 0 if not repeated group.
/// @param contents the payload to be returned from this variable shall
/// be written here. Will be zero-padded to size_ bytes if shorter.
/// @param done must be notified when the read values are ready. The
/// call will be re-tried if this does not happen inline.
using ReadFunction = std::function<void(
unsigned repeat, string *contents, BarrierNotifiable *done)>;
/// Typed WriteFunction for primitive types.
template <typename T>
using TypedWriteFunction = typename std::function<void(
unsigned repeat, T contents, BarrierNotifiable *done)>;
/// Typed ReadFunction for primitive types. @return the read value if the
/// read was successful. If the read did not complete, return 0.
template <typename T>
using TypedReadFunction = typename std::function<T (
unsigned repeat, BarrierNotifiable *done)>;
/// Setup the address bounds from a single CDI group declaration.
/// @param group is an instance of a group, for example a segment.
template <class G> void set_bounds_from_group(const G &group)
{
minAddress_ = group.offset();
maxAddress_ = group.offset() + group.size() - 1;
}
/// Expand the address bounds from a single CDI group declaration.
/// @param group is an instance of a group, for example a segment.
template <class G> void expand_bounds_from_group(const G &group)
{
minAddress_ = std::min(minAddress_, (address_t)group.offset());
maxAddress_ = std::max(
maxAddress_, (address_t)(group.offset() + group.size() - 1));
}
/// Register an untyped element.
/// @param address the address in the memory space
/// @param size how many bytes this elements occupes
/// @param read_f will be called to read this data
/// @param write_f will be called to write this data
void register_element(address_t address, address_t size,
ReadFunction read_f, WriteFunction write_f)
{
elements_.insert(DataElement(address, size, read_f, write_f));
}
/// Registers a string typed element.
/// @param entry is the CDI ConfigRepresentation.
/// @param read_f will be called to read this data
/// @param write_f will be called to write this data
template <unsigned SIZE>
void register_string(const StringConfigEntry<SIZE> &entry,
ReadFunction read_f, WriteFunction write_f)
{
expand_bounds_from_group(entry);
register_element(entry.offset(), SIZE, read_f, write_f);
}
/// Registers a numeric typed element.
/// @param T is the type argument, e.g. uint8_t.
/// @param entry is the CDI ConfigRepresentation.
/// @param read_f will be called to read this data
/// @param write_f will be called to write this data
template <typename T>
void register_numeric(const NumericConfigEntry<T> &entry,
TypedReadFunction<T> read_f, TypedWriteFunction<T> write_f)
{
expand_bounds_from_group(entry);
auto trf = [read_f](unsigned repeat, string *contents,
BarrierNotifiable *done) {
T result = read_f(repeat, done);
contents->clear();
contents->resize(sizeof(T));
*((T *)&((*contents)[0])) =
NumericConfigEntry<T>::endian_convert(result);
};
auto twf = [write_f](unsigned repeat, string contents,
BarrierNotifiable *done) {
contents.resize(sizeof(T));
T result = NumericConfigEntry<T>::endian_convert(
*(const T *)contents.data());
write_f(repeat, result, done);
};
register_element(
entry.offset(), entry.size(), std::move(trf), std::move(twf));
}
/// Registers a repeated group. Calling this function means that the
/// virtual memory space of the group will be looped onto the first
/// repetition. The correct usage is to register the elements of the first
/// repetition, then register the repetition itself using this call. Nested
/// repetitions are not supported (either the outer or the inner repetition
/// needs to be unrolled and registered for each repeat there).
/// @param group is the repeated group instance. Will take the start
/// offset, repeat count and repeat size from it.
template <class Group, unsigned N>
void register_repeat(const RepeatedGroup<Group, N> &group)
{
RepeatElement re;
re.start_ = group.offset();
re.end_ = group.end_offset();
re.repeatSize_ = Group::size();
HASSERT(re.repeatSize_ * N == re.end_ - re.start_);
repeats_.insert(std::move(re));
expand_bounds_from_group(group);
}
/// Bounds for valid addresses.
address_t minAddress_ = 0xFFFFFFFFu;
/// Bounds for valid addresses. A read of length 1 from this address
/// should succeed in returning the last byte.
address_t maxAddress_ = 0;
/// Whether the space should report as RO.
unsigned isReadOnly_ : 1;
private:
/// We keep one of these for each variable that was declared.
struct DataElement
{
DataElement(address_t address, address_t size, ReadFunction read_f,
WriteFunction write_f)
: address_(address)
, size_(size)
, writeImpl_(write_f)
, readImpl_(read_f)
{
}
/// Base offset of this variable (first repeat only).
address_t address_;
/// Size of this variable. This is how many bytes of address space this
/// variable occupies.
address_t size_;
/// Function that will be called for writes.
WriteFunction writeImpl_;
/// Function that will be called for reads.
ReadFunction readImpl_;
};
/// STL-compatible comparator function for sorting DataElements.
struct DataComparator
{
/// Sorting operator by address.
bool operator()(const DataElement &a, const DataElement &b) const
{
return a.address_ < b.address_;
}
/// Sorting operator by address.
bool operator()(unsigned a, const DataElement &b) const
{
return a < b.address_;
}
/// Sorting operator by address.
bool operator()(const DataElement &a, unsigned b) const
{
return a.address_ < b;
}
};
/// Represents a repeated group.
struct RepeatElement
{
/// Offset of the repeated group (first repeat).
uint32_t start_;
/// Address bytes per repeat.
uint32_t repeatSize_;
/// Address byte after the last repeat.
uint32_t end_;
};
/// STL-compatible comparator function for sorting RepeatElements. Sorts
/// repeats by the end_ as the key.
struct RepeatComparator
{
/// Sorting operator by end address.
bool operator()(const RepeatElement &a, const RepeatElement &b) const
{
return a.end_ < b.end_;
}
/// Sorting operator by end address against a lookup key.
bool operator()(uint32_t a, const RepeatElement &b) const
{
return a < b.end_;
}
};
/// Look up the first matching data element given an address in the virtual
/// memory space.
/// @param address byte offset to look up.
/// @param len how many bytes long range to search from address.
/// @param ptr will be filled with a pointer to the data element when
/// found, or filled with nullptr if no data element overlaps with the
/// given range.
/// @param repeat output argument, filled with zero or the repetition
/// number.
/// @return 0 if an exact match is found. -N if a data element is found,
/// but N first bytes of this element are not covered. A number N in
/// [1..len-1] if a data element is found, but this many bytes need to be
/// skipped from address to arrive at the given data element's offset. len
/// if there was no data element found (in which case also set ptr to
/// null).
ssize_t find_data_element(address_t address, address_t len,
const DataElement **ptr, unsigned *repeat)
{
*repeat = 0;
*ptr = nullptr;
bool in_repeat = false;
address_t original_address = address;
ElementsType::iterator b = elements_.begin();
ElementsType::iterator e = elements_.end();
// Align in the known repetitions first.
auto rit = repeats_.upper_bound(address);
int max_repeat = 0;
if (rit == repeats_.end())
{
// not a repeat.
}
else
{
if (rit->start_ <= address && address < rit->end_)
{
// we are in the repeat.
unsigned cnt = (address - rit->start_) / rit->repeatSize_;
*repeat = cnt;
if (address + rit->repeatSize_ < rit->end_)
{
// Try one repetition later too.
max_repeat = 1;
}
// re-aligns address to the first repetition.
address -= cnt * rit->repeatSize_;
in_repeat = true;
b = elements_.lower_bound(rit->start_);
e = elements_.lower_bound(rit->start_ + rit->repeatSize_);
}
}
LOG(VERBOSE,
"searching for element at address %u in_repeat=%d address=%u "
"len=%u",
(unsigned)original_address, in_repeat, (unsigned)address,
(unsigned)len);
for (int is_repeat = 0; is_repeat <= max_repeat; ++is_repeat)
{
auto it = std::upper_bound(b, e, address, DataComparator());
if (it != elements_.begin())
{
auto pit = it - 1;
// now: pit->address_ <= address
if (pit->address_ + pit->size_ > address)
{
// found overlap
*ptr = &*pit;
return (ssize_t)pit->address_ -
(ssize_t)address; // may be negative!
}
// else: no overlap, look at the next item
}
// now: it->address_ > address
if ((it != elements_.end()) && (address + len > it->address_))
{
// found overlap, but some data needs to be discarded.
*ptr = &*it;
return it->address_ - address;
}
if (in_repeat)
{
// We might be too close to the end of a repetition, we will
// try with the next repeat instead.
address -= rit->repeatSize_;
*repeat += 1;
if (original_address + rit->repeatSize_ >= rit->end_)
{
// We ran out of repeats. Look at the range beyond the
// group instead.
b = elements_.lower_bound(rit->end_);
e = elements_.end();
*repeat = 0;
}
}
else
{
break;
}
}
// now: no overlap either before or after.
LOG(VERBOSE, "element not found for address %u",
(unsigned)original_address);
return len;
}
static constexpr unsigned NO_CACHE = static_cast<address_t>(-1);
/// Offset in the memory space at which cachedData_ starts.
address_t cacheOffset_ = NO_CACHE;
/// Stored information for read-modify-write calls.
string cachedData_;
/// Container type for storing the data elements.
typedef SortedListSet<DataElement, DataComparator> ElementsType;
/// Stores all the registered variables.
ElementsType elements_;
/// Stores all the registered variables.
SortedListSet<RepeatElement, RepeatComparator> repeats_;
/// Helper object in the function calls.
BarrierNotifiable bn_;
}; // class VirtualMemorySpace
} // namespace openlcb
#endif // _OPENLCB_VIRTUALMEMORYSPACE_HXX
|
Is it possible to force Node.js / Electron app to use high-performance (discrete) GPU programmatically?
I have an Electron app and I'm trying to figure out if there's a way to programmatically force OS to run it on high-performance (discrete) GPU instead of the integrated GPU.
Is there a CLI command / hack that can force OS to do this (similarly to how games automatically run on discrete GPU)?
I found this thread, but I'm not sure how to apply it for Node.js:
// Enable dedicated graphics for NVIDIA:
extern "C"
{
__declspec(dllexport) unsigned long NvOptimusEnablement = 0x00000001;
}
// Enable dedicated graphics for AMD Radeon:
extern "C"
{
__declspec(dllexport) int AmdPowerXpressRequestHighPerformance = 1;
}
Have you looked into gpu.js? The linked blog post offers useful examples.
Edit:
Ah, entire app. How about the Electron flag --force_high_performance_gpu?
If that doesn't work someone here figured out a way to restart the app on dGPU. ...although the thread also mentions it's on dedicated by default, so maybe something changed in the last couple years?
This library is for running code on GPU, not the app itself
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.