url
stringlengths
15
784
text
stringlengths
6
437k
KeyPhrases
sequence
http://endgeoengineering.com/geoengineering.html
What is Geoengineering ? Typical examples of Stratospheric Aerosol Geoengineering ( SAG ) , commonly known as " Chemtrails " . Chemtrails " is the popular name given to plumes emitted by aircraft in the sky . Geoengineering " is the name used to define the intentional process of altering - or " engineering " - the Earth ' s atmosphere . A rapidly - growing number of people and organizations in numerous industrialized countries now believe chemtrails ( those visible lines that jets leave in the sky ) are visible artifacts of current geoengineering programs . In November 2010 , the U.N. attempted to ban geoengineering . An example of " White Bark Syndrome " . Test samples show extremely high aluminum . Mounting evidence suggests that the millions - of - tons of aluminum and barium particulates purportedly used in geoengineering programs explains the dramatically - increasing aluminum and barium levels in sampled water and soil tests . Scientists in several countries have linked recent plant and animal die - offs to aluminum and / or barium toxicity drawing even more attention to global geoengineering programs . Demonstrations around the world are bringing friends together from dozens of countries . Although scientists and activists are calling chemtrails " The issue of the century " , mainstream news has only brushed upon this subject leaving the public generally unaware of โ€” what is now called โ€” " The world ' s largest aerial operation in history " If you agree that spraying heavy metals on humans , animals , agriculture , and public water supplies is a dangerous and irresponsible act , then consider joining with us to educate others about this unprecedented event . We urge to you learn more about geoengineering by taking a few minutes to follow the links below . Please share this critical information with your friends and family . It ' s vital that you learn to protect yourself now against increasing levels of heavy metals being discovered in soils , foods , and water supplies . Learn More Learn more about geoengineering by watching one of the documentaries ( below ) that have been created to help the you become educated about this critical subject . Watch the Documentary What In the World are They Spraying " has been viewed by millions and subtitled into several languages . It is the essential introduction to geoengineering . Watch the Documentary New Followup Documentary Why In the World are They Spraying " is the epic followup documentary that answers the most often - asked question about global geoengineering .
[ "Chemtrails", "Geoengineering" ]
http://endgeoengineering.com/geoengineering.html
What is Geoengineering ? Typical examples of Stratospheric Aerosol Geoengineering ( SAG ) , commonly known as " Chemtrails " . Chemtrails " is the popular name given to plumes emitted by aircraft in the sky . Geoengineering " is the name used to define the intentional process of altering - or " engineering " - the Earth ' s atmosphere . A rapidly - growing number of people and organizations in numerous industrialized countries now believe chemtrails ( those visible lines that jets leave in the sky ) are visible artifacts of current geoengineering programs . In November 2010 , the U.N. attempted to ban geoengineering . An example of " White Bark Syndrome " . Test samples show extremely high aluminum . Mounting evidence suggests that the millions - of - tons of aluminum and barium particulates purportedly used in geoengineering programs explains the dramatically - increasing aluminum and barium levels in sampled water and soil tests . Scientists in several countries have linked recent plant and animal die - offs to aluminum and / or barium toxicity drawing even more attention to global geoengineering programs . Demonstrations around the world are bringing friends together from dozens of countries . Although scientists and activists are calling chemtrails " The issue of the century " , mainstream news has only brushed upon this subject leaving the public generally unaware of โ€” what is now called โ€” " The world ' s largest aerial operation in history " If you agree that spraying heavy metals on humans , animals , agriculture , and public water supplies is a dangerous and irresponsible act , then consider joining with us to educate others about this unprecedented event . We urge to you learn more about geoengineering by taking a few minutes to follow the links below . Please share this critical information with your friends and family . It ' s vital that you learn to protect yourself now against increasing levels of heavy metals being discovered in soils , foods , and water supplies . Learn More Learn more about geoengineering by watching one of the documentaries ( below ) that have been created to help the you become educated about this critical subject . Watch the Documentary What In the World are They Spraying " has been viewed by millions and subtitled into several languages . It is the essential introduction to geoengineering . Watch the Documentary New Followup Documentary Why In the World are They Spraying " is the epic followup documentary that answers the most often - asked question about global geoengineering .
[ "Geoengineering", "Earth 's atmosphere .", "barium toxicity" ]
http://endgeoengineering.com/geoengineering.html
What is Geoengineering ? Typical examples of Stratospheric Aerosol Geoengineering ( SAG ) , commonly known as " Chemtrails " . Chemtrails " is the popular name given to plumes emitted by aircraft in the sky . Geoengineering " is the name used to define the intentional process of altering - or " engineering " - the Earth ' s atmosphere . A rapidly - growing number of people and organizations in numerous industrialized countries now believe chemtrails ( those visible lines that jets leave in the sky ) are visible artifacts of current geoengineering programs . In November 2010 , the U.N. attempted to ban geoengineering . An example of " White Bark Syndrome " . Test samples show extremely high aluminum . Mounting evidence suggests that the millions - of - tons of aluminum and barium particulates purportedly used in geoengineering programs explains the dramatically - increasing aluminum and barium levels in sampled water and soil tests . Scientists in several countries have linked recent plant and animal die - offs to aluminum and / or barium toxicity drawing even more attention to global geoengineering programs . Demonstrations around the world are bringing friends together from dozens of countries . Although scientists and activists are calling chemtrails " The issue of the century " , mainstream news has only brushed upon this subject leaving the public generally unaware of โ€” what is now called โ€” " The world ' s largest aerial operation in history " If you agree that spraying heavy metals on humans , animals , agriculture , and public water supplies is a dangerous and irresponsible act , then consider joining with us to educate others about this unprecedented event . We urge to you learn more about geoengineering by taking a few minutes to follow the links below . Please share this critical information with your friends and family . It ' s vital that you learn to protect yourself now against increasing levels of heavy metals being discovered in soils , foods , and water supplies . Learn More Learn more about geoengineering by watching one of the documentaries ( below ) that have been created to help the you become educated about this critical subject . Watch the Documentary What In the World are They Spraying " has been viewed by millions and subtitled into several languages . It is the essential introduction to geoengineering . Watch the Documentary New Followup Documentary Why In the World are They Spraying " is the epic followup documentary that answers the most often - asked question about global geoengineering .
[ "Geoengineering", "Chemtrails" ]
http://endgeoengineering.com/geoengineering.html
What is Geoengineering ? Typical examples of Stratospheric Aerosol Geoengineering ( SAG ) , commonly known as " Chemtrails " . Chemtrails " is the popular name given to plumes emitted by aircraft in the sky . Geoengineering " is the name used to define the intentional process of altering - or " engineering " - the Earth ' s atmosphere . A rapidly - growing number of people and organizations in numerous industrialized countries now believe chemtrails ( those visible lines that jets leave in the sky ) are visible artifacts of current geoengineering programs . In November 2010 , the U.N. attempted to ban geoengineering . An example of " White Bark Syndrome " . Test samples show extremely high aluminum . Mounting evidence suggests that the millions - of - tons of aluminum and barium particulates purportedly used in geoengineering programs explains the dramatically - increasing aluminum and barium levels in sampled water and soil tests . Scientists in several countries have linked recent plant and animal die - offs to aluminum and / or barium toxicity drawing even more attention to global geoengineering programs . Demonstrations around the world are bringing friends together from dozens of countries . Although scientists and activists are calling chemtrails " The issue of the century " , mainstream news has only brushed upon this subject leaving the public generally unaware of โ€” what is now called โ€” " The world ' s largest aerial operation in history " If you agree that spraying heavy metals on humans , animals , agriculture , and public water supplies is a dangerous and irresponsible act , then consider joining with us to educate others about this unprecedented event . We urge to you learn more about geoengineering by taking a few minutes to follow the links below . Please share this critical information with your friends and family . It ' s vital that you learn to protect yourself now against increasing levels of heavy metals being discovered in soils , foods , and water supplies . Learn More Learn more about geoengineering by watching one of the documentaries ( below ) that have been created to help the you become educated about this critical subject . Watch the Documentary What In the World are They Spraying " has been viewed by millions and subtitled into several languages . It is the essential introduction to geoengineering . Watch the Documentary New Followup Documentary Why In the World are They Spraying " is the epic followup documentary that answers the most often - asked question about global geoengineering .
[ "Geoengineering", "Chemtrails", "aerial operation" ]
http://endgeoengineering.com/geoengineering.html
What is Geoengineering ? Typical examples of Stratospheric Aerosol Geoengineering ( SAG ) , commonly known as " Chemtrails " . Chemtrails " is the popular name given to plumes emitted by aircraft in the sky . Geoengineering " is the name used to define the intentional process of altering - or " engineering " - the Earth ' s atmosphere . A rapidly - growing number of people and organizations in numerous industrialized countries now believe chemtrails ( those visible lines that jets leave in the sky ) are visible artifacts of current geoengineering programs . In November 2010 , the U.N. attempted to ban geoengineering . An example of " White Bark Syndrome " . Test samples show extremely high aluminum . Mounting evidence suggests that the millions - of - tons of aluminum and barium particulates purportedly used in geoengineering programs explains the dramatically - increasing aluminum and barium levels in sampled water and soil tests . Scientists in several countries have linked recent plant and animal die - offs to aluminum and / or barium toxicity drawing even more attention to global geoengineering programs . Demonstrations around the world are bringing friends together from dozens of countries . Although scientists and activists are calling chemtrails " The issue of the century " , mainstream news has only brushed upon this subject leaving the public generally unaware of โ€” what is now called โ€” " The world ' s largest aerial operation in history " If you agree that spraying heavy metals on humans , animals , agriculture , and public water supplies is a dangerous and irresponsible act , then consider joining with us to educate others about this unprecedented event . We urge to you learn more about geoengineering by taking a few minutes to follow the links below . Please share this critical information with your friends and family . It ' s vital that you learn to protect yourself now against increasing levels of heavy metals being discovered in soils , foods , and water supplies . Learn More Learn more about geoengineering by watching one of the documentaries ( below ) that have been created to help the you become educated about this critical subject . Watch the Documentary What In the World are They Spraying " has been viewed by millions and subtitled into several languages . It is the essential introduction to geoengineering . Watch the Documentary New Followup Documentary Why In the World are They Spraying " is the epic followup documentary that answers the most often - asked question about global geoengineering .
[ "Chemtrails", "Geoengineering" ]
http://endgeoengineering.com/geoengineering.html
What is Geoengineering ? Typical examples of Stratospheric Aerosol Geoengineering ( SAG ) , commonly known as " Chemtrails " . Chemtrails " is the popular name given to plumes emitted by aircraft in the sky . Geoengineering " is the name used to define the intentional process of altering - or " engineering " - the Earth ' s atmosphere . A rapidly - growing number of people and organizations in numerous industrialized countries now believe chemtrails ( those visible lines that jets leave in the sky ) are visible artifacts of current geoengineering programs . In November 2010 , the U.N. attempted to ban geoengineering . An example of " White Bark Syndrome " . Test samples show extremely high aluminum . Mounting evidence suggests that the millions - of - tons of aluminum and barium particulates purportedly used in geoengineering programs explains the dramatically - increasing aluminum and barium levels in sampled water and soil tests . Scientists in several countries have linked recent plant and animal die - offs to aluminum and / or barium toxicity drawing even more attention to global geoengineering programs . Demonstrations around the world are bringing friends together from dozens of countries . Although scientists and activists are calling chemtrails " The issue of the century " , mainstream news has only brushed upon this subject leaving the public generally unaware of โ€” what is now called โ€” " The world ' s largest aerial operation in history " If you agree that spraying heavy metals on humans , animals , agriculture , and public water supplies is a dangerous and irresponsible act , then consider joining with us to educate others about this unprecedented event . We urge to you learn more about geoengineering by taking a few minutes to follow the links below . Please share this critical information with your friends and family . It ' s vital that you learn to protect yourself now against increasing levels of heavy metals being discovered in soils , foods , and water supplies . Learn More Learn more about geoengineering by watching one of the documentaries ( below ) that have been created to help the you become educated about this critical subject . Watch the Documentary What In the World are They Spraying " has been viewed by millions and subtitled into several languages . It is the essential introduction to geoengineering . Watch the Documentary New Followup Documentary Why In the World are They Spraying " is the epic followup documentary that answers the most often - asked question about global geoengineering .
[ "Geoengineering", "Earth 's atmosphere .", "barium toxicity" ]
http://endgeoengineering.com/geoengineering.html
What is Geoengineering ? Typical examples of Stratospheric Aerosol Geoengineering ( SAG ) , commonly known as " Chemtrails " . Chemtrails " is the popular name given to plumes emitted by aircraft in the sky . Geoengineering " is the name used to define the intentional process of altering - or " engineering " - the Earth ' s atmosphere . A rapidly - growing number of people and organizations in numerous industrialized countries now believe chemtrails ( those visible lines that jets leave in the sky ) are visible artifacts of current geoengineering programs . In November 2010 , the U.N. attempted to ban geoengineering . An example of " White Bark Syndrome " . Test samples show extremely high aluminum . Mounting evidence suggests that the millions - of - tons of aluminum and barium particulates purportedly used in geoengineering programs explains the dramatically - increasing aluminum and barium levels in sampled water and soil tests . Scientists in several countries have linked recent plant and animal die - offs to aluminum and / or barium toxicity drawing even more attention to global geoengineering programs . Demonstrations around the world are bringing friends together from dozens of countries . Although scientists and activists are calling chemtrails " The issue of the century " , mainstream news has only brushed upon this subject leaving the public generally unaware of โ€” what is now called โ€” " The world ' s largest aerial operation in history " If you agree that spraying heavy metals on humans , animals , agriculture , and public water supplies is a dangerous and irresponsible act , then consider joining with us to educate others about this unprecedented event . We urge to you learn more about geoengineering by taking a few minutes to follow the links below . Please share this critical information with your friends and family . It ' s vital that you learn to protect yourself now against increasing levels of heavy metals being discovered in soils , foods , and water supplies . Learn More Learn more about geoengineering by watching one of the documentaries ( below ) that have been created to help the you become educated about this critical subject . Watch the Documentary What In the World are They Spraying " has been viewed by millions and subtitled into several languages . It is the essential introduction to geoengineering . Watch the Documentary New Followup Documentary Why In the World are They Spraying " is the epic followup documentary that answers the most often - asked question about global geoengineering .
[ "Geoengineering", "Chemtrails" ]
http://endgeoengineering.com/geoengineering.html
What is Geoengineering ? Typical examples of Stratospheric Aerosol Geoengineering ( SAG ) , commonly known as " Chemtrails " . Chemtrails " is the popular name given to plumes emitted by aircraft in the sky . Geoengineering " is the name used to define the intentional process of altering - or " engineering " - the Earth ' s atmosphere . A rapidly - growing number of people and organizations in numerous industrialized countries now believe chemtrails ( those visible lines that jets leave in the sky ) are visible artifacts of current geoengineering programs . In November 2010 , the U.N. attempted to ban geoengineering . An example of " White Bark Syndrome " . Test samples show extremely high aluminum . Mounting evidence suggests that the millions - of - tons of aluminum and barium particulates purportedly used in geoengineering programs explains the dramatically - increasing aluminum and barium levels in sampled water and soil tests . Scientists in several countries have linked recent plant and animal die - offs to aluminum and / or barium toxicity drawing even more attention to global geoengineering programs . Demonstrations around the world are bringing friends together from dozens of countries . Although scientists and activists are calling chemtrails " The issue of the century " , mainstream news has only brushed upon this subject leaving the public generally unaware of โ€” what is now called โ€” " The world ' s largest aerial operation in history " If you agree that spraying heavy metals on humans , animals , agriculture , and public water supplies is a dangerous and irresponsible act , then consider joining with us to educate others about this unprecedented event . We urge to you learn more about geoengineering by taking a few minutes to follow the links below . Please share this critical information with your friends and family . It ' s vital that you learn to protect yourself now against increasing levels of heavy metals being discovered in soils , foods , and water supplies . Learn More Learn more about geoengineering by watching one of the documentaries ( below ) that have been created to help the you become educated about this critical subject . Watch the Documentary What In the World are They Spraying " has been viewed by millions and subtitled into several languages . It is the essential introduction to geoengineering . Watch the Documentary New Followup Documentary Why In the World are They Spraying " is the epic followup documentary that answers the most often - asked question about global geoengineering .
[ "Geoengineering", "Chemtrails" ]
http://endgeoengineering.com/geoengineering.html
What is Geoengineering ? Typical examples of Stratospheric Aerosol Geoengineering ( SAG ) , commonly known as " Chemtrails " . Chemtrails " is the popular name given to plumes emitted by aircraft in the sky . Geoengineering " is the name used to define the intentional process of altering - or " engineering " - the Earth ' s atmosphere . A rapidly - growing number of people and organizations in numerous industrialized countries now believe chemtrails ( those visible lines that jets leave in the sky ) are visible artifacts of current geoengineering programs . In November 2010 , the U.N. attempted to ban geoengineering . An example of " White Bark Syndrome " . Test samples show extremely high aluminum . Mounting evidence suggests that the millions - of - tons of aluminum and barium particulates purportedly used in geoengineering programs explains the dramatically - increasing aluminum and barium levels in sampled water and soil tests . Scientists in several countries have linked recent plant and animal die - offs to aluminum and / or barium toxicity drawing even more attention to global geoengineering programs . Demonstrations around the world are bringing friends together from dozens of countries . Although scientists and activists are calling chemtrails " The issue of the century " , mainstream news has only brushed upon this subject leaving the public generally unaware of โ€” what is now called โ€” " The world ' s largest aerial operation in history " If you agree that spraying heavy metals on humans , animals , agriculture , and public water supplies is a dangerous and irresponsible act , then consider joining with us to educate others about this unprecedented event . We urge to you learn more about geoengineering by taking a few minutes to follow the links below . Please share this critical information with your friends and family . It ' s vital that you learn to protect yourself now against increasing levels of heavy metals being discovered in soils , foods , and water supplies . Learn More Learn more about geoengineering by watching one of the documentaries ( below ) that have been created to help the you become educated about this critical subject . Watch the Documentary What In the World are They Spraying " has been viewed by millions and subtitled into several languages . It is the essential introduction to geoengineering . Watch the Documentary New Followup Documentary Why In the World are They Spraying " is the epic followup documentary that answers the most often - asked question about global geoengineering .
[ "Chemtrails", "Geoengineering" ]
http://endgeoengineering.com/geoengineering.html
What is Geoengineering ? Typical examples of Stratospheric Aerosol Geoengineering ( SAG ) , commonly known as " Chemtrails " . Chemtrails " is the popular name given to plumes emitted by aircraft in the sky . Geoengineering " is the name used to define the intentional process of altering - or " engineering " - the Earth ' s atmosphere . A rapidly - growing number of people and organizations in numerous industrialized countries now believe chemtrails ( those visible lines that jets leave in the sky ) are visible artifacts of current geoengineering programs . In November 2010 , the U.N. attempted to ban geoengineering . An example of " White Bark Syndrome " . Test samples show extremely high aluminum . Mounting evidence suggests that the millions - of - tons of aluminum and barium particulates purportedly used in geoengineering programs explains the dramatically - increasing aluminum and barium levels in sampled water and soil tests . Scientists in several countries have linked recent plant and animal die - offs to aluminum and / or barium toxicity drawing even more attention to global geoengineering programs . Demonstrations around the world are bringing friends together from dozens of countries . Although scientists and activists are calling chemtrails " The issue of the century " , mainstream news has only brushed upon this subject leaving the public generally unaware of โ€” what is now called โ€” " The world ' s largest aerial operation in history " If you agree that spraying heavy metals on humans , animals , agriculture , and public water supplies is a dangerous and irresponsible act , then consider joining with us to educate others about this unprecedented event . We urge to you learn more about geoengineering by taking a few minutes to follow the links below . Please share this critical information with your friends and family . It ' s vital that you learn to protect yourself now against increasing levels of heavy metals being discovered in soils , foods , and water supplies . Learn More Learn more about geoengineering by watching one of the documentaries ( below ) that have been created to help the you become educated about this critical subject . Watch the Documentary What In the World are They Spraying " has been viewed by millions and subtitled into several languages . It is the essential introduction to geoengineering . Watch the Documentary New Followup Documentary Why In the World are They Spraying " is the epic followup documentary that answers the most often - asked question about global geoengineering .
[ "Geoengineering", "Chemtrails", "aerial operation" ]
http://endmemo.com/physics/specificheat.php
ENDMEMO Home Physics Specific heat refers to the amount of heat required to raise unit mass of a substance ' s temperature by 1 degree . The Specific Heat formula is : c = ฮ”Q / ( m ร— ฮ”T ) Where : c : Specific Heat , in J / ( kg . K ) ฮ”Q : Heat required for the temperature change , in J ฮ”T : Temperature change , in K m : Mass of the object , in kg Specific Heat Search
[ "ENDMEMO" ]
http://endmemo.com/sconvert/lboz.php
Home Unit Pound โ†” Ounce Conversion : Pound : Ounce 1 lbs = 16 oz ; 1 oz = 0.0625 lbs Pound ( lbs ) is an imperial mass unit , commonly used in the Commonweath of Nations , such as UK and US as customary units . The pound is defined as exactly 453.59237 grams . Ounce ( oz ) is also an imperial mass unit . 1 lbs is exact 16 oz . Begin : Step : Pound โ†” Ounce Conversion Table lbs = 16 oz 2 lbs = 32 oz 3 48 4 64 5 80 6 96 7 112 8 128 9 144 10 160 11 176 12 192 13 208 14 224 15 240 256 17 272 18 288 19 304 20 320 21 336 22 352 23 368 24 384 25 400 26 416 27 432 28 448 29 464 30 480 31 496 32 512 33 528 34 544 35 560 36 576 37 592 38 608 39 624 40 640 41 656 42 672 43 688 44 704 45 720 46 736 47 752 48 768 49 784 50 800 โ†— Show Ounce โ†’ Pound Conversion Chart Instead ยป Pound Conversions : lb โ†” g lb = 453.592292 g lb โ†” kg kg = 2.204623 lb lb โ†” oz lb = oz lb โ†” cg 45359.22922 cg lb โ†” mg 453592.292197 mg lb โ†” ug 453592292.1969 ug lb โ†” ng 453592292196.9 ng lb โ†” pg 4.535922921969E + 14 pg lb โ†” dg 4535.922922 dg lb โ†” t t = 2204.623 lb lb โ†” ct 2267.961461 ct lb โ†” kip kip = 1000 lb โ†” Hundredweight ( US ) coefficient : 0.01 lb โ†” pdl 32.2 pdl lb โ†” Grain 7000 Grain lb โ†” pwt 291.66663 pwt ยป Ounce Conversions : oz โ†” g oz = 28.349518 g oz โ†” kg kg = 35.273968 oz oz โ†” lb oz โ†” cg 2834.951826 cg oz โ†” mg 28349.518262 mg oz โ†” ug 28349518.262306 ug oz โ†” ng 28349518262.306 ng oz โ†” pg 28349518262306 pg oz โ†” dg 283.495183 dg oz โ†” t t = 35273.968 oz โ†” ct 141.747591 ct oz โ†” kip kip = 16000 oz โ†” Hundredweight ( US ) coefficient : 0.000625 oz โ†” pdl 2.0125 pdl oz โ†” Grain 437.5 Grain oz โ†” pwt 18.229164 pwt Complete Weight and mass Unit Conversions
[ "Pound", "Ounce", "Conversion" ]
http://endmemo.com/sconvert/ppmug_g.php
Home Unit Part per million โ†” Microgram / gram Conversion 1 ppm = 1 ug / g ; ug / g = ppm Begin : Step : Part per million โ†” Microgram / gram Conversion Table ppm = ug / g 2 ppm = 2 ug / g 3 3 4 4 5 5 6 6 7 7 8 8 9 9 10 10 11 11 12 12 13 13 14 14 15 15 16 16 17 17 18 18 19 19 20 20 21 21 22 22 23 23 24 24 25 25 26 26 27 27 28 28 29 29 30 30 31 31 32 32 33 33 34 34 35 35 36 36 37 37 38 38 39 39 40 40 41 41 42 42 43 43 44 44 45 45 46 46 47 47 48 48 49 49 50 50 โ†— Show Microgram / gram โ†’ Part per million Conversion Chart Instead ยป Part per million Conversions : ppm โ†” per per = 10000 ppm ppm โ†” ppb ppm = 1000 ppb ppm โ†” ppt 1000000 ppt ppm โ†” ppq 1000000000 ppq ppm โ†” g / kg g / kg = 1000 ppm ppm โ†” ug / g ug / g ppm โ†” ng / ug ng / ug = ppm โ†” ng / g ng / g ppm โ†” mg / kg mg / kg ppm โ†” mg / g mg / g = ppm โ†” Whole number Whole number = 1000000 ppm โ†” ug / kg ug / kg ppm โ†” ul / l ul / l ppm โ†” nl / ml nl / ml = ppm โ†” ml / m3 ml / m3 ppm โ†” ml / l ml / l = ppm โ†” ul / m3 ul / m3 ppm โ†” ug / mg ug / mg = ppm โ†” g / ton g / ton ยป Microgram / gram Conversions : ug / g โ†” per per = 10000 ug / g ug / g โ†” ppm ug / g = ug / g โ†” ppb ppb ug / g โ†” ppt ppt ug / g โ†” ppq 1000000000 ppq ug / g โ†” g / kg g / kg = ug / g โ†” ng / ug ng / ug = ug / g โ†” ng / g ng / g ug / g โ†” mg / kg mg / kg ug / g โ†” mg / g mg / g = ug / g โ†” Whole number Whole number = ug / g โ†” ug / kg ug / kg ug / g โ†” ul / l ul / l ug / g โ†” nl / ml nl / ml = ug / g โ†” ml / m3 ml / m3 ug / g โ†” ml / l ml / l = ug / g โ†” ul / m3 ul / m3 ug / g โ†” ug / mg ug / mg = ug / g โ†” g / ton g / ton Complete Concentration percentage Unit Conversions
[ "Part per million", "Microgram", "Conversion" ]
http://endoconsult.net/thyroid.html
Thyroid Disease Thyroid Function in Normal , Hypothyroid , and Hyperthyroid States The thyroid is the " gas pedal " of the body . Thyroid hormone governs the rate at which the metabolic processes of the body work . Thyroid hormone influences heart rate , body temperature , mental alertness and total body salt and water content . It also governs more subtle functions , as taste , bowel habits , and neurological reflex time . Inadequate thyroid hormone levels ( hypothyroidism ) may cause increased body weight , primarily due to an accumulation of excess body fluid and salt . They also cause sleepiness and fatigue , a decreased taste for food , constipation , and slow heart rate . Muscle movement may be slowed , and there is a tendency for muscle cramps to occur . Excess thyroid hormone levels ( hyperthyroidism ) may cause nervousness , sleeplessness , palpitations , reduced stamina , weight loss , and diarrhea . Because excess levels of thyroid hormone may raise blood levels of calcium too much in 10 % of patients , their effect on appetite is variable . Many patients have increased appetite ; some , including those with high serum calcium levels , have a decreased appetite . Patients usually lose weight . The caloric requirements per day may be extremely high . However , a minority of people do not lose much weight , because How the Thyroid Works The amount of thyroid tissue and the amounts of thyroid hormone that tissue makes are regulated by the brain and the pituitary gland . The area of brain just over the pituitary gland is called the hypothalamus . This area makes a hormone called TRH or thyrotropin releasing hormone . TRH stimulates the pituitary to make another hormone called TSH or thyroid stimulating hormone . TSH in turn stimulates the thyroid to grow and to make thyroid hormones . The secretion of TRH and TSH is elegantly regulated by the brain , and is based in large part on the Doctors use this physiology of thyroid secretion to assess how much thyroid hormone is in the blood . Today , we measure TSH levels in the blood as the marker for how much thyroid hormone is in the blood . Given how TSH works , it is understandable that TSH levels move opposite to the levels of thyroid hormone in the blood . Persons with excess blood levels or thyroid hormone will have abnormally low TSH levels , as the brain and pituitary gland seeks to turn off thyroid hormone secretion . In contrast , persons with low levels of The thyroid secretes two primary thyroid hormones : thyroxine or T4 and triodothyronine or T3 . T3 is the active thyroid hormone . Under normal circumstances , the liver activates T4 to T3 as demand arises . Therefore , almost 99.9 % of thyroid hormone in the blood is T4 and only 0.1 % is T3 , although the thyroid gland contains 10 to 100 times more T3 than it secretes . Goiters It is very common for the thyroid to enlarge . Any enlargement of the thyroid is called a " goiter " . The term does not imply anything else but some enlargement . Goiters may be merely proportionate enlargements or imbalanced or asymmetrical enlargements . Goiters may be smooth or have nodules or bumps in them . Approximately half of all patients with goiters have normal blood levels of thyroid : half do not . The presence of a goiter , by itself , does not mean that the level of thyroid hormones in the blood are always abnormal . Goiters can be associated with slight discomfort or pain locally , in the thyroid , generalized symptoms , such as fatigue , weight gain , or nervousness , are not attributable to the goiter , unless the blood levels of thyroid hormones are abnormal . Therefore , the clinical questions that arise in a patient with a Symmetrical Goiters Generalized enlargement of the thyroid can occur if there is an enzyme defect within the gland , involving the synthesis of thyroid hormone . When that happens , the pituitary gland increases TSH secretion to stimulate the thyroid to make more hormone . However , TSH also makes the gland enlarge . A condition known as Grave ' ' Disease is also associated with a generalized enlargement of the thyroid . Here , the body is making an antibody against the thyroid , which acts on the thyroid much as TSH acts . Thus , the thyroid enlarges again . Rarely , a symmetrical goiter may reflect the occurrence of cancer within the thyroid gland . A few , unusual thyroid cancers may present in this way . Such cancers may sometimes be associated with unusual symptoms , as flushing , nausea , or palpitations . Multinodular Goiters Multinodular goiters , or goiters with multiple lumps in them , are very common thyroid problems . These usually reflect some form of chronic inflammation in the thyroid gland . Thyroid inflammation is usually painless ; however , patients occasionally complain of occasional low - grade tenderness in these glands . Commonly , patients will see that they feel as if someone is holding a fist to the area of the thyroid . A rare form of thyroid inflammation is a condition known as subacute thyroiditis , which is an acute viral infection of the thyroid gland . In contrast As in patients with generalized goiters , thyroid hormone levels are normal in half of all patients with multinodular goiters . However , these patients are more likely to have the occurrence of low thyroid hormone levels ( hypothyroidism ) and are less likely to have high thyroid hormone levels ( hyperthyroidism ) than patients with generalized goiters . Also , patients with multinodular goiters are more likely to have thyroid cancer in them than patients with generalized goiters . This is especially true if one of the nodules is very prominent . Thyroid Cancer Most cases of thyroid cancer involve highly curable lesions , as long as the problem is not neglected . Part of the reason for the high success rate in treatment is that the thyroid is the only gland in the body that concentrates iodine . Therefore , ablation of the primary cancer , and even areas of spread ( metastases ) , is usually possible because these sites will uptake radioactive iodine , without damage to nonthyroidal tissues . Suspicion that a thyroid gland may have cancer in it often focuses on glands with nodules . Glands with solitary nodules have a greater risk than glands with multiple nodules . Other characteristics that suggest increased risk are growth of a nodule , whether a nodule in single or multiple glands , or the existence of a very large or prominent nodule in a gland with many nodules . The usual approach to such nodules involves a fine needle aspiration of the suspicious nodule . If any question exists regarding how these cells appear in the nodule , surgical removal is recommended . If the lesion is felt to have malignant potential at surgery , the surgeon usually attempts to remove as much of the thyroid gland as possible . This assists in ongoing evaluation of whether the cancer has been totally cured , and reduces the complexity of further treatment . Fine needle aspiration of the thyroid is a relatively painless procedure with limited risk . It involves preparing the skin with betadine antiseptic and inserting a small needle through the skin into the suspicious nodule . Material from the nodule is then allowed to " seep " into the needle , and is taken from the nodule . Usually , no anesthetic is given , because the procedure is so benign , and the administration of local anesthetic may make the nodule more difficult to precisely ample . Endocrine Consultants PC 2425 Brookstone Centre Pkwy Columbus , Georgia 31904 [ Click here for Map ] 706 - 322 - 1700 Phone 866 - 57 - SUGAR Toll Free 706 - 320 - 0456 Fax
[ "Thyroid Disease", "gas pedal", "metabolic processes" ]
http://endocrine-system.emedtv.com/high-prolactin-levels/causes-of-high-prolactin-levels-p2.html
Advertisement Tweet Endocrine System Home > Causes of High Prolactin Levels Causes of High Prolactin Levels Other Pituitary Tumors as Causes of High Prolactin Levels Other tumors arising in or near the pituitary - - such as those that cause acromegaly or Cushing ' s syndrome - - may block the flow of dopamine from the brain to the prolactin - secreting cells . Hypothyroidism and High Prolactin Levels Another cause of high prolactin levels is hypothyroidism . Increased prolactin levels are often seen in people with hypothyroidism , and doctors routinely test people with hyperprolactinemia for hypothyroidism . Breast Stimulation and High Prolactin Levels Breast stimulation also can cause a modest increase in the amount of prolactin in the blood . eMedTV ' s free HealthSavvy service can help you stay up - to - date on this topic . Sign up for HealthSavvy now . < Go Back to Causes of High Prolactin Levels , Page 1 < < Prev 1 2 Last updated / reviewed : January 23 , 2017 Written by / reviewed by : Arthur Schoenstadt , MD Last reviewed by : Arthur Schoenstadt MD Advertisement
[ "Causes", "High Prolactin Levels" ]
http://endocrine-system.emedtv.com/metoclopramide/metoclopramida.html
Advertisement Tweet Endocrine System Home > Metoclopramida Metoclopramida Your Guide to Healthy Living With Diabetes Get tips , read articles , and learn about healthy living with diabetes , in - depth , from eMedTV ' s experts . Click here to learn more > Were you looking for information about Metoclopramide ? Metoclopramida is a common misspelling of metoclopramide . Metoclopramide ( Reglan ยฎ ) is a medication licensed for the short - term treatment of GERD gastroesophageal reflux disease ) and diabetic gastroparesis . It is available by prescription only and comes in tablet , liquid , and injection form . The drug works by tightening the esophageal sphincter , relaxing the pyloric sphincter , and increasing the muscular contractions of the stomach and small intestines . Before your healthcare provider prescribes metoclopramide , make sure he or she is aware if you are pregnant , have high blood pressure , or have congestive heart failure ( Click Metoclopramide to learn about other metoclopramide uses , to find out how and when to take this drug , and for a list of side effects that may occur . You can also click on the various links in the box to the right to access specific topics on metoclopramide . ) eMedTV ' s free HealthSavvy service can help you stay up - to - date on this topic . Sign up for HealthSavvy now .
[ "Metoclopramida", "gastroesophageal reflux disease", "diabetic gastroparesis" ]
http://endocrinediseases.org/thyroid/thyroid_tests.shtml
Background : Thyroid tests This document is available in Spanish Overview Thyroxine ( T4 ) Triiodothyronine ( T3 ) Thyroid stimulating hormone ( TSH ) Thyroglobulin ( Tg ) Antithyroid antibodies Calcitonin 1 . Overview The two most commonly used laboratory evaluations to test thyroid function are free T4 and thyroid stimulating hormone TSH ) . Because over 99 % of released thyroid hormone is attached to proteins in the blood , it is believed that measuring the amount not attached to proteins ( i.e. , free thyroid hormone ) is a more accurate measurement of thyroid hormone levels . Measuring the total hormone level is generally less reliable . Common thyroid function tests Assay High level Low level TSH Hypothyroidism Hyperthyroidism Free T4 Hyperthyroidism Hypothyroidism Free T3 Tg May indicate cancer recurrence after total thyroidectomy Adequate treatment after removal or ablation of thyroid TSH - R Ab Graves ' disease Anti TG Ab Hashimoto ' s thyroiditis Anti TPO Ab Hashimoto ' s thyroiditis Calcitonin Medullary thyroid cancer 2 . Thyroxine ( T4 ) Typically measured as free hormone . Greater than 99.9 % is bound to protein . A higher than normal level is associated with hyperthyroidism . A lower than normal level is associated with hypothyroidism 3 . Triiodothyronine ( T3 ) Measurements of T3 levels are not routinely performed . It is similar to T4 in that over 99 % is bound to proteins in the blood . T3 is typically only measured in cases of hyperthyroidism where the T4 levels are normal . 4 . Thyroid stimulating hormone ( TSH ) Thyroid stimulating hormone ( ) , also known as thyrotropin , is produced by the pituitary gland in the brain and causes the thyroid to make thyroid hormone ( and T3 ) . The pituitary gland acts like the thermostat in your home and controls how much thyroid hormone is made by making more or less TSH . When there is not enough thyroid hormone in the body , the pituitary makes more TSH , which tells the thyroid to make and release more thyroid hormone . If there is too much thyroid hormone in the body , the pituitary makes less TSH which tells the thyroid to make and release less thyroid hormone . Therefore , when patients are hyperthyroid ( overactive thyroid ) , the TSH level 5 . Thyroglobulin ( Tg ) Thyroglobulin is a protein made by the thyroid that carries thyroid hormone . The thyroid gland is the only organ which makes Tg . Therefore , Tg is a good test to tell if there are thyroid cells in the body . Once the whole thyroid is taken out , the thyroglobulin level should go down to close to zero . Thyroglobulin levels can then be measured , by a simple blood test , after thyroidectomy . Thyroglobulin is used as a tumor marker ( i.e. test to see how much cancer is in the body ) for thyroid cancer . If thyroglobulin levels go up after removing the whole thyroid , there is concern that the cancer may have come back ( 6 . Antithyroid antibodies Antithyroid antibodies are created when the body ' s immune system attacks parts of the thyroid with antibodies . There are several different types of antithyroid antibodies . TSH - R Ab is a receptor antibody , and is present in most of patients who have Graves ' disease . ( See Hyperthyroidism section ) The antibodies stimulate the TSH - receptor which causes the thyroid to make more thyroid hormone ( and T3 ) . Antithyroglobulin antibodies ( Anti - TG Ab ) are present in patients with Hashimoto ' s thyroiditis See Hypothyroidism section ) . Antibodies against the protein thyroglobulin can result in destruction of thyroid cells . This destruction can lead to hypothyroidism Antithyroid peroxidase antibodies ( Anti - TPO Ab ) are similar to antithyroglobulin antibodies . They are found in high levels in patients with , and can lead to destruction of thyroid cells . 7 . Calcitonin is produced by the parafollicular , or C cells , found in the thyroid gland . This test is used as a tumor marker for a rare type of thyroid cancer known as medullary thyroid cancer . ( See Medullary thyroid cancer section < PREVIOUS SECTION : Thyroid function
[ "Thyroid tests", "Hyperthyroidism", "thyroid stimulating hormone" ]
http://endocrineonline.org/page10/index.html
* * * * * * * * * * * * * * Professor Gerard Conway DHEA Deficiency and Treatment Background DHEA ( dehydroepiandrosterone ) is one of the most abundant substances made by the adrenal gland . It is the precursor of the sex steroids oestrogen and testosterone . A small amount of DHEA is also made by the ovaries . Individuals with a deficiency of the pituitary gland , the adrenal gland or ovaries have low circulating concentrations of DHEA . Recent studies have shown that treatment of DHEA deficiency can be beneficial . In earlier years it was thought sufficient for well - being to replace only the major hormones made by the adrenal gland - cortisol is DHEA has been considered a " peripheral substance " and as yet it does not appear and British National Formulary . The reason for this omission is probably historic . That is , DHEA has been the focus of research into ageing and many studies have attempted to show that supplements of DHEA in old age might slow the ageing process . These studies have taken place in individuals with normal adrenal and pituitary glands and have unfortunately obscured the benefit to individuals with clear - cut medical conditions of proven DHEA deficiency . DHEA can be measured on a In the United Kingdom DHEA is available through IDIS World Medicines , Millbank House , 171 - 185 Ewell Road , Surditon , Surrey , KT6 6AX , Tel : 0208 410 0700 . Tablets are available in the dose range 5 , 10 , 25 and 50 mg . The average replacement dosage for individuals with DHEA deficiency is 25 to 50 mg although some gain benefit with the lower doses of 5 to 10 mg . Side effects The side effects of DHEA relates to its week male hormone activity . Women might experience greasiness of the skin , unwanted hair growth and acne . These side effects are usually avoidable it sufficiently low doses of replacement are used . DHEA is prescribed in the usual way but pharmacies will usually need to order a supply . Two recent papers are available which show the benefit for individuals with adrenal failure or pituitary disease in randomised controlled trials . These papers show particular benefit in concentration and libido in women . Research Improvement in Mood and Fatigue after Dehydroepiandrosterone Replacement in Addison โ€™ s Disease in a Randomized , Double Blind Trial PJ Hunt , EM Gurnell , FA Huppert , C Richards , AT Prevost , JAH Wass , J Herbert & V Krishna K Chatterjee Department of Endocrinology , Radcliffe Infirmary Oxford and Department of Medicine , Addenbrooke โ€™ s Hospital , Cambridge , United Kingdom Abstract Dehydroepiandrosterone ( DHEA ) and DHEA sulfate ( DHEAS ) are adrenal precursors of steroid biosynthesis and centrally acting neuro - steroids . Glucocorticoid and mineralocorticoid deficiencies in Addison โ€™ s disease require life - long hormone replacement , but the associated failure of DHEA synthesis is not corrected . We conducted a randomized , double blind study in which 39 patients with Addison โ€™ s disease received either 50 mg oral DHEA daily for 12 weeks , followed by a 4 - week washout period , then 12 weeks of placebo , or vice versa . After DHEA treatment Low Dose Dehydroepiandrosterone Affects Behavior in Hypopituitary Androgen - Deficient Women : A Placebo - Controlled Trial G Johannsson , P Burman , L Wiren , BE Engstrom , AG Nilsson , M Ottosson , BR Jonsson , B - AฬŠ Bengtsson & FA Karlsson Research Center for Endocrinology and Metabolism , Sahlgrenska University Hospital Goteborg ; Department of Medical Sciences , Uppsala University Hospital Uppsala & Department of Women โ€™ s and Children โ€™ s Health , Karolinska Institute , Stockholm , Sweden Abstract Thirty - eight women , aged 25 โ€“ 65 yr , with androgen deficiency due to hypopituitarism were treated with oral dehydroepiandrosterone ( DHEA ; 30 mg / d if < 45 yr of age and 20 mg if > 45 yr of age ) for 6 months in a randomized , placebo - controlled , double blind study , followed by a 6 - month open treatment period . The administration of DHEA raised the serum levels of DHEAS to normal age - related reference ranges and increased androstenedione and T to subnormal levels . Androgen effects on skin
[ "DHEA Deficiency", "abundant substances", "adrenal gland" ]
http://energy-models.com/forum/u-value-green-roof
U value for green roof 2 posts 0 new Last post or register to post comments Bill Thank you very much for your answer All Im trying to model a green wall in my design I thought of introducing a material by properties And im thinking of having conductivity 0 and specific heat specific heat of water But i have no idea what i value should put for density Or i can introduce a material by U value But again I couldnt find the u value of the grass So please can anyone help me on this Best Regards Dayani Sep 25 2012 Dayani Nayantha Offline Joined 20111221 Reputation 0 Connect eQUEST equest users Possibly you might glean some useful info from the Design Builder documentation on the subject Green Roof Green roof tab Materials Dialog Green roofs can be modelled in DesignBuilder by creating a roof construction using a Green roof material as the outer layer The green roof can receive water during the simulation from an irrigation system andor fromsite precipitation defined separately from the hourly weather data The initial properties of the soil layer are defined on the Green roof tab of the Materials dialog Green walls can also be modelled though in this case the irrigation must be treated differently to roofs as walls will not naturally trap much precipitation Note that specifying a green roof material as the material for a component block will not work these only use materials for their reflective properties Background Use of green roofs aka ecoroofs or vegetated roofs is becoming increasingly common for both new and retrofit buildings There is widespread recognition and a growing literature of measured data that suggest green roofs can reduce building energy consumption The EnergyPlus Green Roof capability can assist developers and architects in assessing the likely magnitude of energy savings associated with various implementation options eg soil typedepth irrigation options plant type It provides a quantitative and physicallybased building energy simulation tool that represents the effects of green roof constructions and facilitates more rapid spread of green roof technologies and make it possible to account for green roof benefits in state energy codes and related energy efficiency standards such as LEED The green roof model accounts for Long wave and short wave radiative exchange within the plant canopy Plant canopy effects on convective heat transfer Evapotranspiration from the soil and plants and Heat conduction and storage in the soil layer The ability to track moisturedependent thermal properties is not implemented yet due to stability issues in the CTF scheme but is under development for use with the finite difference solution scheme made available in EnergyPlus starting in version 2 As implemented in EnergyPlus the green roof module allows the user to specify ecoroof as the outer layer of a rooftop construction The user can then specify various aspects of the green roof construction including growing media depth thermal properties plant canopy density plant height stomatal conductance ability to transpire moisture and soil moisture conditions including irrigation The model formulation includes the following Simplified moisture balance that allows precipitation irrigation and moisture transport between two soil layers top and root zone Soil and plant canopy energy balance based on the Army Corps of Engineers FASST vegetation models Frankenstein and Koenig drawing heavily from BATS Dickenson et al and SiB Sellers et al Soil surface Tg and foliage Tf temperature equations are solved simultaneously each time step inverting the CTF to extract heat flux information for the energy balance calculation The detailed energy balance analysis and resulting equations being rather complicated are summarized here The interested reader is referred to the FASST documentation cited herein for the complete development The end result is a set of two simultaneous equations for temperatureone for the soil surface and the other for the foliage Green Roof Model Description As with a traditional roof the energy balance of an green roof is dominated by radiative forcing from the sun This solar radiation is balanced by sensible convection and latent evaporative heat flux from soil and plant surfaces combined with conduction of heat into the soil substrate This energy balance is illustrated in the diagram below The variables introduced in this figure are defined in the EnergyPlus Engineering Document The energy balance for a green roof The energy budget analysis follows the Fast All Season Soil Strength FASST model developed by Frankenstein and Koenig for the US Army Corps of Engineers FASST was developed in part to determine the ability of soils to support manned and unmanned vehicles and personnel movement In order to accomplish this however FASST tracks the energy and moisture balance including ice and snow within a vegetated soil It is a onedimensional model that draws heavily from other plant canopy models including BATS Dickinson et al and SiB Sellers et al FASST is implemented in EnergyPlus with only a few modifications to adapt it for use with a relatively thin soil layer Green roof data Height of Plants The average height of plants in the green roof Leaf Area Index LAI This is the projected leaf area per unit area of soil surface It is a dimensionless number between 0001 and 50 The tables below gives some typical values for LAI The table below is reproduced from Global Leaf Area Index Data from Field Measurements 19322000 The table below is reproduced from the PhD Thesis of Chen Yu entitled The intervention of plants in the conflicts between buildings and climate A case study in Singapore Plant descriptionMean Leaf Area Index LAI PictureWhite flowers spider lily307 Pink flowers495 Yellow green leaves375 Dark green long blades of leavesgrass582 Pinkish red flowers244 Fernlike659 Palm treelike441 White flowers with yellow center321 Small yellow green leaves408 Long big leaves528 Orange stems and leaves for those which are taller215 No special features332 Light green edges with dark green center leave blades583 Red yellow tulip like flowers304 Large red leaves233 Dark green leaf blades0 Tree169 Palm tree237 Leaf Reflectivity The fraction of incident solar radiation that is reflected by the individual leaf surfaces Solar radiation includes the visible spectrum as well as infrared and ultraviolet wavelengths Values for this field must be between 01 and 04 Leaf Emissivity This field is the ratio of thermal radiation emitted from leaf surfaces to that emitted by an ideal black body at the same temperature This parameter is used when calculating the long wavelength radiant exchange at the leaf surfaces Values for this field must be between 08 and 10 with 10 representing black body conditions Minimum Stomatal Resistance This field represents the resistance of the plants to moisture transport It has units of sm Plants with low values of stomatal resistance will result in higher evapotranspiration rates than plants with high resistance Values for this field must be in the range of 500 to 3000 Max volumetric moisture content of the soil layer saturation Maximum volumetric moisture content of the soil depends on the properties of the soil and in particular the porosity Min residual volumetric moisture content of the soil layer The minimum possible volumetric moisture content of the soil layer Initial volumetric moisture content of the soil layer The volumetric moisture content of the soil layer at the start of the simulation The moisture content will be updated during the course of the simulation based on surface evaporation irrigation and precipitation Sep 26 2012 CleanTech Analytics Offline Joined 20120209 Reputation 1 Connect
[ "green roof", "U value" ]
http://energy.sourceguides.com/businesses/byP/wRP/byB/public/public.shtml
Source Guides Renewable Energy Renewable Energy Businesses Renewable Energy Businesses in the World by Product Type Wind Energy Businesses in the World Wind Energy Businesses in the World by Business Type Wind Energy Publicly Traded Companies in the World Wind Energy Publicly Traded Companies in the World Renewable Energy Businesses in the World Wind Energy Businesses in the World Renewable Energy Publicly Traded Companies in the World Request Information or a Price Quote from All Businesses Listed Below Gamesa Corporacion Tecnologica S.A . GE Energy Thomas & Betts Corporation Siemens Wind Power A / S Eguana Technologies Inc Real Goods Solar Suzlon Energy Limited Suzlon Energy Limited Nordex AG Vestas Wind Systems A / S Gamesa Corporacion Tecnologica S.A . Gamesa is a company specializing in sustainable energy technologies , mainly wind power . Gamesa is the market leader in Spain and is positioned among the most important wind generator manufacturers in the world with a market share in 2007 upper 15 % . Gamesa has installed almost 13,000 MW of its main product lines in 20 countries spread out over four continents . The annual equivalent of this production amounts to more than 2.78 million tons of petroleum ( TEP ) / year and prevents the emission into the atmosphere of more than 20.6 million tones of CO / Stock Symbol : Bolsa de Madrid : ES : GAM Business type : manufacturer , developer Product types : wind turbines , wind farms - wind power plants . Address : Ramon y Cajal 7 - 9 , 01007 Vitoria , Alava Spain Telephone : ( + 34 ) 944818190 Web Site : http : / / www . gamesa . es / index . php / en E - mail : Send Email to Gamesa Corporacion Tecnologica S.A . GE Energy GE is one of the world ' s leading wind turbine suppliers . With over 8,400 worldwide wind turbine installations comprising more than 11,300 MW of capacity , our knowledge and expertise spans more than two decades . With wind manufacturing and assembly facilities in Germany , Spain , China , Canada and the United States , our current product portfolio includes wind turbines with rated capacities ranging from 1.5 to 3.6 megawatts and support services ranging from development assistance to operation and maintenance . Stock Symbol : NYSE : GE Business type : manufacturer , service Product types : large wind turbines ( 1.500 - 3.600 kW ) , utiliy scale wind turbine generators . Service types : system design , project development Address : 1 River Road , Schenectady , New York USA 12345 Telephone : ( 518 ) 385 - 7343 FAX : ( 518 ) 385 - 3536 Web Site : http : / / www . gewindenergy . com Thomas & Betts Corporation Thomas & Betts is a leading wind industry supplier specializing in the fabrication of turbine support structures for a wide range of turbine designs . T&B capabilities include fabrication of electrical and electronic components for power and power - related markets in the U.S. and abroad . The Company manufactures a variety of wind turbine support structures , including both lattice steel towers and tubular steel support towers , with capacity and flexibility for both small - scale and utility - scale wind developments . T&B is a public corporation , NYSE symbol : TNB . NYSE : TNB manufacturer wind energy system components ( large ) , wind energy towers and structures ( large ) , wind turbine support structures , lattice steel towers , tubular steel towers . 8155 T&B Boulevard , Memphis , Tennessee USA 38125 901 - 252 - 8000 FAX : 901 - 252 - 1304 http : / / www . tnb . com E - mail : Send Email to Thomas & Betts Corporation Siemens Wind Power A / S Siemens wind turbines are the preferred solution of leading utilities and developers for large demanding on - and offshore projects , not only because of their robustness but also due to their reliability and productivity . SI Manufacturer Large wind power turbines . Range of wind turbines 2 . 3 MW and 3 . 6 MW . . Service types : Maintenance , Research and development Borupvej 16 , 7330 Brande , Denmark + 45 99 42 22 22 + 45 99 99 22 22 http : / / www . siemens . com / wind Send Email to Siemens Wind Power A / S Eguana Technologies Inc Eguana Technologies designs and manufactures intelligent power electronics for distributed smart grid and energy storage applications . CDNX : STG Manufacturer Our proprietary inverters seamlessly integrate with energy storage devices and renewable energy generators . This creates systems with uncompromised efficiency and reliability at unbeatable lifecycle costs . . 6143 4th Street SE , Unit 3 , Calgary , Alberta Canada T2H 2H9 + 1 ( 403 ) 508 - 7177 + 1 ( 403 ) 205 - 2509 http : / / www . eguanatech . com Send Email to Eguana Technologies Inc Real Goods Solar Since 1978 , Real Goods Solar has led the sustainable living market through sales , education and installation of solar energy systems . We are the original and most experienced solar installer in the United States , and you can count on us to make your switch to renewable energy simple and satisfying . The Real Goods Solar Installation division provides integrated solar power systems to residential and commercial customers on the East and West Coasts . We currently operate in 11 states : California , Colorado , New Jersey , New York , Missouri , Connecticut , Vermont , NASDAQ : RSOL Solar Installer Design , Engineering , Installation and Maintenance of solar electric power systems for residential , commercial , municipal and educational projects . . installation 523 Danbury Rd . , Wilton , Connecticut USA 06897 888 - 567 - 6527 303 - 222 - 8323 http : / / realgoodssolar . com Send Email to Real Goods Solar Suzlon is today a major force in the global wind industry , from humble beginnings in 1995 , to ranking 5th worldwide , with 10.5 % of the global market share in just over a decade . Already among the top five , Suzlon ' s Vision is to be a technology leader , to be among the top 3 wind energy companies in the world by leveraging technological leadership and commercial acumen to exceed customer expectations and be the most respectable brand which grows fast & is the most profitable company employing the best team in the sector . Bombay Stock Exchange : SUZL . BO manufacturer grid connected wind turbines ( large ) - ranging from 950 kW to 2 MW . Installation and commissioning , operations and maintenance support 9th Floor , Eros Corporate Tower , Nehru Place , New Delhi , Delhi India 110019 + 91 ( 020 ) 40122000 http : / / www . suzlon . com Suzlon is today a major force in the global wind industry , from humble beginnings in 1995 , to ranking 5th worldwide , with 10.5 % of the global market share in just over a decade . Already among the top five , Suzlon ' s Vision is to be a technology leader , to be among the top 3 wind energy companies in the world by leveraging technological leadership and commercial acumen to exceed customer expectations and be the most respectable brand which grows fast & is the most profitable company employing the best team in the sector . Bombay Stock Exchange : SUZL . BO grid connected wind turbines ( large ) - ranging from 950 kW to 2 MW . Installation and commissioning , operations and maintenance support 8750 W . Bryn Mawr Ave . Suite 720 , Chicago , Illinois USA 60631 + 1 - 773 - 328 - 5077 http : / / www . suzlon . com Nordex AG Under the brand name Nordex we offer powerful wind turbines for almost all geographic regions across the globe . With the serial produced multi - megawatt wind turbines Nordex N80 , N90 and N100 , Nordex is able to offer high - efficiency wind turbines for onshore use . For the rapidly developing chinese market and the asian - pacific region we offer the powerful megawatt turbines Nordex S70 and Nordex S77 . As developers and manufacturers of wind turbines , we concentrate on our core competencies . In addition to the overall technical design , our know - how Xetra : NDXGk . DE large wind powered electric generators , wind turbines 1500 kW , 2500 kW . Bornbach 2 , 22848 Norderstedt , Germany + 49 - ( 40 ) - 300 30 - 1000 + 49 - ( 40 ) - 300 30 - 1101 http : / / www . nordex - online . com Send Email to Nordex AG Vestas Wind Systems A / S With a 23 per cent market share , and 35,500 wind turbines installed , Vestas is the world ' s leading supplier of wind power solutions . Vestas ' principal activities are the development , manufacture , sale and maintenance of systems that use wind energy to generate electricity . Vestas supplies a full range of products , from individual turbines to the delivery of turnkey wind power systems . Copenhagen : VWSYF . PK V52 - 850 kW , V80 - 1.8 MW , V80 - 2.0 MW , V82 - 1.65 MW , V90 - 1 . 8&2 . 0 MW , V90 - 3.0 MW . . Alsvej 21 , 8940 Randers SV , Denmark + 45 97 30 00 00 + 45 97 30 00 01 http : / / www . vestas . com Send Email to Vestas Wind Systems A / S Not Listed ? Add your business listing to the Source Guides business directory Ca n ' t Find It ? Search the entire Source Guides site using keywords : Renewable Energy Businesses Business Search Advertise Renewable Energy News Momentum Technologies LLC
[ "Wind Energy", "Gamesa Corporacion Tecnologica", "Spain" ]
http://energy4me.org/all-about-energy/what-is-energy/energy-sources/coal/
How is Coal Formed ? Types of Coal Where is Coal Found ? How is Coal Extracted ? Demand for Coal Uses for Coal History of Coal Coal to Liquids How Does Coal Mining Affect the Environment ? What is โ€˜ Clean Coal Technology โ€™ ? Coal Coal is a nonrenewable energy source because it takes millions of years to create . It is a combustible black or brownish - black sedimentary rock composed mostly of carbon and hydrocarbons โ€” molecules containing hydrogen and carbon . The energy in coal comes from the remains of prehistoric plants and animals , making it part of the fossil fuels family . How is Coal Formed ? Coal formation began during the Carboniferous period ( 280 to 345 million years ago ) . Much of the earth was covered with swamp during this time , and large amounts of plants and other organic matter grew . As the plants and other life forms died , they sank to the bottom of the swampy areas . They slowly decomposed , and formed peat โ€” a soggy , dense , sponge - like material . Over time , the peat was buried and compressed under the earth โ€™ s surface . As the earth โ€™ s surface changed over Types of Coal Coal is classified in four main categories based on the amounts of carbon it contains and the heat energy it can produce . The higher ranks of coal typically contain more heat - producing energy . Lignite โ€“ Over time , heat and burial pressure turn peat into lignite . Lignite is somewhat light in color , soft and crumbly . It is considered an โ€œ immature โ€ coal with only 25 - 35 % carbon . It is mainly used at power plants to generate electricity . Sub - bituminous โ€“ Lignite that becomes darker and harder over time is called sub - bituminous coal . Sub - bituminous coal contains 35 - 44 % carbon . Bituminous โ€“ More chemical and physical changes to sub - bituminous develop the coal into bituminous coal . Bituminous coal is dark and hard . It contains 45 - 86 % carbon . It is used to generate electricity . Anthracite โ€“ Mature coal is call anthracite . Anthracite coal is very hard and shiny . It contains 86 - 97 % carbon and has a heating value slightly higher than bituminous coal . Where is Coal Found ? Some coal beds lie within 200 feet of the earth โ€™ s surface . These beds are mined by stripping the top soil off the coal . Then the coal is dug out . This is called surface mining . Deeper coal beds can be found up to 1,000 feet / 305 meters below the earth . Miners tunnel underground to get this coal . This is called underground mining or deep mining . Coal reserves can be found in about 70 countries worldwide , and , according to the World Coal Institute , more than 847 billion tons of proven coal reserves are available internationally . The largest proved coal reserves are available in : United States Russian Federation China Australia India The US is the international leader in coal reserves , with nearly 30 % of the world โ€™ s supply , according to the BP Statistical Review of World Energy ( June 2009 ) . How is Coal Extracted ? Coal is extracted from the ground by mining underground or at the surface . Coal mines are many miles wide . First , dirt above the coal deposit is removed . Coal is found in thick , flat layers . Explosives are then used to break the exposed coal into smaller pieces . The coal is then loaded into a wagon and lifted to the surface . Finding coal reserves is a long process of exploring , mapping and drilling . It often starts with the creation of a geological map of an area that may contain coal reserves . Then , geochemical and geophysical surveys are carried out , as well as exploratory drilling . The area will become a mine if it โ€™ s proven to contain usable coal that can be recovered economically . Coal is extracted by surface ( or โ€œ opencast โ€ ) mining and underground ( or โ€œ deep โ€ ) mining . The method used is determined by the geology of the area . Underground mining accounts for about 60 % of the world โ€™ s coal production . Surface mining recovers a higher percentage of the coal deposit than underground mining , but it is only feasible when the coal deposit is near the surface . Demand for Coal Worldwide proven coal reserves are more than 847 billion tons โ€” enough to last approximately 130 years at current consumption levels . The countries with the largest reserves of coal are the United States , Russia , China and India . Together they make up 67 % of the world โ€™ s coal reserves . Coal provides 26 % of global primary energy needs and generates 41 % of the world โ€™ s electricity , according to the World Coal Institute Coal Facts 2008 . The US Energy Information Administration expects coal use to double by 2030 to meet rising world energy demand . Uses for Coal In some countries , coal may be burned directly for heat or cooking , but most coal is used in power plants to generate electricity . Coal has plenty of uses outside of electricity too . Materials that contain coal and coal coke ( a concentrated form of coal that has been stripped of its volatile materials ) are used in many products we use every day , including : Tar Perfumes Golf balls Chalk Paper clips Sugar substitute Soap Aspirin Dyes History of Coal Archaeological evidence indicates that the Romans in England used coal in the second and third centuries ( A.D. 100 - 200 ) . It was used in the 1300s by Native Americans for cooking , heating and baking pottery . 280 to 345 million years ago โ€“ The โ€œ Carboniferous period , โ€ fossil fuel formation begins . 1300s โ€“ The Hopi Indians in what is now the US southwest use coal for cooking , heating and to bake the pottery they made from clay . 1673 โ€“ Coal is rediscovered in the US by explorers . 1720 โ€“ The first commercial coal mine in North America begins production at Port Morien ( Baie de Mordienne ) in Canada . 1748 โ€“ The first documented mining of coal in the US 50 tons is dug . The first US commercial coal production begins from mines around Richmond , VA . Coal was used to manufacture shot , shell , and other war material during the Revolutionary War . 1769 โ€“ Scottish engineer James Watt invents the steam engine . It used coal to make steam to run the engine . 1770s โ€“ The English find that coal could produce a fuel that burned cleaner and hotter than wood charcoal . 1800s โ€“ The Industrial Revolution spreads . People used coal to manufacture goods , and to power steamboats and railroad engines . Coal was used to fuel their boilers . 1882 โ€“ Thomas Edison builds the first practical coal - fired electric generating station , supplying electricity to some residents of New York City . 1961 โ€“ Coal becomes the major fuel used by electricity utilities to generate electricity , and becomes the largest source of electricity . Today โ€“ Coal provides 41 % of the world โ€™ s electricity , according to the World Coal Institute . Coal to Liquids Can coal be a liquid ? Yes ! Coal liquefaction , the process of converting coal to liquid , turns coal into an alternative for liquid fuels . South Africa has the only commercial coal liquefaction industry in the world , and it has been producing fuels this way since 1955 . These fuels are used for cars and jets and have potential outside of transportation as well . Coal - derived dimethyl ether , for example , could be used in developing countries for heating and cooking as it is non - toxic and less harmful to the environment How Does Coal Mining Affect the Environment ? Coal mining and coal use has historically had a negative impact on the environment , particularly by creating harmful gases like carbon dioxide and methane . But the coal industry is working to improve these detrimental effects . Coal companies reduce carbon dioxide emissions by capturing the gas and injecting it into deep geological formations for storage . Mining also produces methane gas , which has a much greater global warming potential than carbon dioxide . Using technological advances , the industry has been successful in recovering the methane and preventing it from being released into the atmosphere . According to the International Energy Agency , replacing older coal - fired power plants with more efficient plants could significantly reduce the industry โ€™ s greenhouse gas emissions . Coal mining โ€™ s effect on the environment reaches beyond the atmosphere : the Earth also feels its effects . Land โ€“ Coal mining can lead to soil erosion and dust , and it causes disturbance to large tracts of land . Water โ€“ Acid mine drainage , a metal - containing water that is formed by the chemical reaction between water and rocks containing sulphur - bearing minerals , can pollute water around a coal mine with heavy metals like copper , lead and mercury . Methods coal companies can use to minimize water pollution include building specialized water treatment plants and recycling contaminated water . Plants and animals โ€“ Coal mining , particularly surface mining , can disturb land that is used for grazing , animal habitats , forests , crops and more . But the coal - mining industry makes rehabilitating land once mining is complete a top priority . After mining is complete , companies reshape the area , replace top soil and replant vegetation , making the reclaimed land suitable for wildlife , agriculture and more . What is โ€˜ Clean Coal Technology โ€™ ? The coal industry is using new technology to reduce the impact of the burning and mining of coal on the environment . One of the most well known โ€œ clean coal technologies โ€ is carbon capture and sequestration ( CCS ) , which involves securing the carbon dioxide created by coal , converting it to a liquid - like state and then storing it permanently underground . The FutureGen project , for example , includes plans for a near - zero - emissions coal plant in Illinois that will use coal gasification technology to generate electricity while capturing harmful CO2 emissions . Scientists predict that the world must reduce its greenhouse gas emissions by as much as 80 % in order to avoid serious complications from global climate change . CCS technology is an important part of meeting that goal . Coal is a huge supplier of power , but it is also a huge producer of CO2 . Underground storage capacity is more than enough to take on coal โ€™ s carbon emissions . According to the World Resources Institute , large US coal sources emit 2 - 3 billion tons of CO2 per year , but the Department of Energy estimates that the US contains underground capacity for 1 - 4 trillion tons , making underground storage a viable option for years to come . Integrated Gasification Combined Cycle ( a process of turning coal into gas , then removing impurities from and combusting the gas ) and Pressurized Fluidized Bed Combustion ( which produces a high - pressure gas stream as well as steam that can power a turbine ) are also promising technological advances in the quest for โ€œ clean โ€ coal .
[ "Coal", "hydrocarbons", "prehistoric plants" ]
http://energybarmanufacturers.org/manufacturing/how-to-launch-your-own-line-of-energy-bars/
How To Launch Your Own Line of Energy Bars The market for energy bars was worth a whopping 57 billion in 2012 and it is projected to balloon to 83 billion in 2016 This article will teach you how to build your own energy bar empire from making your first bar to making your first million 1 Determine Your Brands Target Market The first thing to do is to figure out who your target market is and whats special about your bars that will make that category of consumers want to eat it Several great recent examples of success in this area include the Belly Bar a nutrition bar for pregnant women or ClifBars smaller brands Luna a bar for women and ClifKid a bar for kids The best way to decide who you want your target market to be is to focus on a market that you are a member of yourself hiker biker active mom paleo diet follower weightlifter runner swimmer supermarket coop member The list goes on and on You know what you know choose that 2 Perfect three recipes Now that you know who youll be selling your bar to its time for the what Create the perfect trio of recipes to target their needs and palettes When youre starting out just three flavors of bars is enough to make a complete brand Consider the nutritional goals that your target market has as a starting place weightlifters want megaprotein dieters typically want lowcalorie runners want healthy carbs and so forth Taste matters too so get friends who are members of your target market to be guinea pigs for your recipe experiments If you arent too hot in the kitchen that isnt a problem Consider hiring a copacker Many copackers have recipe development specialists on salary Use them 3 Name Your Company and Buy Your Website Your name should reflect what makes your bars special and appeal to your target market Hence some big bar successes include the wonderfully selfexplanatory brands GoLean Balance and Chia Just as important as the aptness of your name is the availability of your ideal names web domain At GoDaddycom you can type in the domain name aka website URL you want and find out if its available If it is you can buy it for around as little as 199 and 9 a month for hosting You will probably want to trademark your product name at some point so simultaneously check the United States Patent and Trademark Office wwwusptogovtrademarks to use its free Trademark Electronic Search System TESS to search if someone else is using that trademark in a similar category Once youve done those basic searches and obtained your website its time to make your company an official legal entity For an easy guide check out httpwwwsbagovcontentfollowthese10stepsstartingbusiness andor go to LegalZoomcom 4 Design Your Website and Secure a Broad Web Presence Your website is absolutely critical This will be the place all your press links to and is likely to be one of your main platforms for selling your bars To design it we would recommend you use an out of the box program like Shopify or BigCommerce In addition to your website it is essential that you secure a broad web presence by using social media sites Facebook and Twitter provide ways for your customers to get to know you and trust you_ and are also a way for customers to communicate with you Other key social media sites are Instagram Pinterest Google Plus this covers YouTube Yelp LinkedIn MySpace 5 Establish Your Manufacturing Process There are two ways to do this 1 Do the manufacturing yourself or 2 Outsource manufacturing and often shipping to a wholesale copacker If you make the bars yourself this will be the hardest step of the process It typically makes sense though to consider using a copacker instead especially when first starting out Copackers already have commercial kitchens wholesale relationships with ingredient suppliers and FDA approval and can often help with making professional packages and deal with shipping to your clients Plus because theyre already FDA certified and already have deals with ingredients suppliers it can cut an enormous 6 Market Your Brand and Start Selling Bars Now its time for the fun start making money Youve created a delicious brand of energy bars with a clear target market so all you need to do to in order to start selling is to make your target consumers aware of your presence Here are our top 5 picks on how 1 Run a Kickstarter campaign This will generate press and attention to your company Energy bars are the perfect item for it because it will allow you to take presale orders 2 Launch with Groupon This will allow you to send out samples of your bars without too much cost While a Groupon deal wont make you rich it will get your bars in the hands of many people and increase your volume which will lower your costs 3 Contact bloggers in your niche If you feel your bar is perfect for a particular niche do a google search for the top bloggers of that group and introduce yourself Many bloggers are happy to run giveaways for their fans 4 Issue a press release through a program like httpserviceprwebcomaboutpartnershipprograms Press releases are hit or miss but if it catches the right persons eye you could get a snowball of free press 5 Followup with customers 24 weeks after they order asking how it was That will remind them to order again 7 Get into stores After you have a strong online presence and loyal customer base its time to start getting into stores The easiest place to start is by contacting your local supermarkets and inquiring with them about selling your product in their stores Every store has a different process so the best bet is to approach and ask Many stores like Wholefoods also have the ability to approve your products locally which is a great intermediary step to taking it across the entire chain The top 50 small chains according to Supermarket News are httpsupermarketnewscomtop50smallchainsampindependentstop50smallchainsandindependents2011 Leave a Reply You must be logged in to post a comment
[ "Energy Bars" ]
http://energyeducation.ca/encyclopedia/Hydrocarbon_combustion
Please help us raise funds to update and increase the number of pages . ENERGY SOURCES Fuels Fossil Fuels Biofuels Nuclear Fuels Flows Hydro Solar Wind ENERGY USE Carriers Electricity Gasoline Hydrogen Sectors Transportation Residential Industrial ENERGY IMPACTS Living standard Pollution Acid Rain Smog Pollutants Climate Change Climate Feedback Ocean Acidification Rising Sea Level INDEX Hydrocarbon combustion Hydrocarbon combustion refers to the type of reaction where a hydrocarbon reacts with oxygen to create carbon dioxide water , and heat . Hydrocarbons are molecules consisting of both hydrogen and carbon . They are most famous for being the primary constituent of fossil fuels , namely natural gas petroleum , and coal . For this reason , fossil fuel resources are often referred to as hydrocarbon resources Energy is obtained from fossil fuels through combustion ( burning ) of the fuel . Although impurities exist in fossil fuels , hydrocarbon combustion is the primary process in the burning of fossil fuel . An example of hydrocarbon combustion is illustrated in Figure 1 . See simulation at the bottom of the page for more examples . Figure 1 . Methane combining with 2 oxygen to form carbon dioxide , water and heat . Description Regardless of the type of hydrocarbon , combustion with oxygen produces 3 products : carbon dioxide , water and heat , as shown in the general reaction below . The energy required to break the bonds in the hydrocarbon molecules is substantially less than the energy released in the formation of the bonds in the CO 2 and H 2 O molecules . For this reason , the process releases significant amounts of thermal energy ( heat ) . This thermal energy can be used directly ( perhaps to heat a home ) or else it can be converted to mechanical energy , using a heat engine . However , this is subject to efficiency losses , resulting in necessary significant energy losses ( as waste heat ) governed by the second law of thermodynamics . The resulting useful mechanical energy will be a lot less than the initial thermal energy provided by the hydrocarbon combustion . General Reaction Equation : refers to the number of carbon atoms in the hydrocarbon refers to the number of hydrogen atoms in the hydrocarbon refers to the number of oxygen atoms required in the hydrocarbon combustion reaction Hydrocarbon Combustion and Fossil Fuels Note that CO is always produced in hydrocarbon combustion ; it does n ' t matter what type of hydrocarbon molecule . Producing CO and H O is actually how useful energy is obtained from fossil fuels . For this reason , it is important to distinguish between carbon dioxide and other " waste " products that arise from impurities in the fuel such as sulfur and nitrogen compounds . Wastes that arise from impurities can be eliminated with the right technology ; CO can not be eliminated unless the fossil fuels are not burned ( used ) in the first place . Not all fossil fuels have the same composition . Natural gas is composed of over 90 % methane ( CH 4 ) which is the smallest hydrocarbon molecule . Oil tends to be composed of medium sized molecules , although composition varies greatly from one grade of crude to the next . In general , the denser the oil , the longer the carbon chains in the molecules . Finally coal contains the largest and most complex hydrocarbon molecules . Since different hydrocarbons have different ratios of hydrogen to carbon , they produce different ratios of water to carbon dioxide . In general , the longer and more complex the molecule , the greater the ratio of carbon to hydrogen . For this reason , combustion of equal amounts of different hydrocarbons will yield different quantities of carbon dioxide , depending on the ratio of carbon to hydrogen in molecules of each . Since coal contains the longest and most complex hydrocarbon molecules , burning coal releases more CO than burning the same mass of oil or natural gas . This also changes the energy density of each of these fuels . Carbon dioxide emissions Below is a chart of the CO emitted from the production of 293.1 kWh ( 1,000,000 BTUs ) of energy from various hydrocarbon fuels . Fuel kg of CO emissions Anthracite Coal 104 Bituminous Coal 93.5 Lignite Coal 97.9 Subbituminous Coal 97.4 Diesel 73.2 Gasoline 71.5 Propane 63.2 Natural gas 53.2 Combustion Animation Choose a fuel from the drop down menu to see the net reaction that occurs during combustion . Fuel : For Further Reading For further information please see the related pages below : Fossil fuel Primary energy Hydrocarbon resource Coal Oil A random page References โ†‘ 1.0 1.1 1.2 R.D. Botts , D.M. Carson , and D . Coglon . " Petroleum in our live " in Our petroleum challenge , 8th ed . Calgary : Canadian Center for Energy Development , 2013 , pp . 7 - 15 . โ†‘ American Chemical Society . " Methane and oxygen react " . Internet : http : / / www . middleschoolchemistry . com / multimedia / chapter6 / lesson1 , [ October 25 , 2013 ] โ†‘ http : / / www . eia . gov / tools / faqs / faq . cfm ? id = 73&t = 11 Authors and Editors Bethel Afework , Allison Campbell , Riley Fedechko , Jordan Hanania , Braden Heffernan , James Jenden , Amanda Musgrove , Kailyn Stenhouse , Jasdeep Toor , Jason Donev Last updated : June 25 , 2018 Get Citation
[ "Hydrocarbon combustion", "fossil fuels", "hydrocarbon resources" ]
http://energyinformative.org/biomass-energy-pros-and-cons/
Biomass Energy Pros and Cons Biomass is organic matter from plants and animals ( microorganisms ) . Photosynthesis is the name process that stores the energy from sunlight in plants . Animals get this energy through eating the plants . Waste such as crops , manure and garbage are all excellent sources of biomass fuel . Biomass has a wide array of uses such as directly as heat or to generate electricity with a steam turbine . Biomass can also be used to make methane gas , biodiesel and other biofuels . What are the pros and cons of biomass energy ? Advantages of Biomass Energy 1 Renewable We will always have the sources of biomass such as crops , manure and garbage . As you convert this year โ€™ s crop to fuel , you are growing another one for next years fuel . Renewing takes just as long time as it takes to grow or gather , and that can be as little as months in some cases . 2 Carbon Neutral This is maybe most important of the advantages of biomass energy . Biomass is a part of the carbon cycle . Carbon from the atmosphere is absorbed into plants during photosynthesis and when the plant decays or is burnt that carbon goes back into the atmosphere . Because it is a cycle , the next crop of plants absorb that carbon over again , so there is a balance between the amount of carbon that the biomass fuel release into the atmosphere and the amount that they extract from it . This is why biomass fuels do not contribute to 3 Cost - Effective Energy harnessed from biomass is inexpensive compared to coal and oil . Typically they cost about 1 / 3 less than fossil fuels doing the same job . This means you can spend 1 / 3 less every year on heating your home and after 10 or 15 years that adds up to a considerable saving 4 Abundant Biomass is available in large quantities all over the world . Large pipelines across country borders and oceans are therefore most likely not necessary . Disadvantages of Biomass Energy 1 Expensive Extraction of biomasses can be expensive . In some areas we find that biomass projects may not be worth the price and is therefore never finished . This is also true for the harvesting and storing of the different types of biomass . 2 Requires Space We need big areas for all the different processes that are required in harnessing energy from biomass . The areas that are needed for storing can be particular large . There is no doubt that biomass energy is one of the few potential replacements for fossil fuels . The benefits of both a renewable and clean energy source can not be overlooked . It will be interesting to see how big of a part biomass energy will play in the future . Read more about algae biodiesel in What is Biodiesel from Algae Looking for lists of pros and cons for more types of energy sources ? Solar Energy Pros and Cons Wind Energy Pros and Cons Geothermal Energy Pros and Cons Hydroelectric Energy Pros and Cons Tidal Energy Pros and Cons Wave Energy Pros and Cons Fossil Fuels Pros and Cons Nuclear Energy Pros and Cons Comments - 26 Emily great , thanks January 8 , 2013 7 : 44 pm Reply Isaac Awesome ! ! This is what I was looking for ! Thanks ! January 14 , 2013 10 : 45 am Reply susan thanks your awesome April 15 , 2013 2 : 55 am eric your EXCELLENT ! ! ! ! April 18 , 2013 10 : 47 pm Richard Rodriguez Correct that some biomass grass crops could be more productive then others ? Reed vs Micanthus vs Giant King Grass ? It would appear giganteus has advantages and is hardier in tropical areas . Most grass seem less invasive then the reed ( canary ) or even bamboo ? Thanks for your opinion & article ! Richard August 2 , 2013 9 : 17 pm jean wayman this is THE BEST thing ever ! just what i needed September 30 , 2013 7 : 03 pm jean wayman by the way , can you make one about mechanical energy ? thnks October 2 , 2013 7 : 03 pm Chris Great info ! Thanks October 28 , 2013 5 : 42 pm daviddd thanks this wass helpful November 6 , 2013 3 : 21 pm Robyn Clarke there should be more cons i need three for a report I โ€™ m doing a report and there is only two that only helps me a bit . And for everyone who is looking for more cons the would have barely helped them . There for i would like to see more pros and cons on your pages . thank you - Robyn November 8 , 2013 12 : 04 am Taylor Thanks banana man November 8 , 2013 6 : 31 pm louise this was really helpful for my essay on energy - thanks ! i found it really helpful as it explains everything clearly . thanks so much ! ! louise January 20 , 2014 5 : 57 pm elise thanks every buggy yall are great just what I needed to finish ma project February 2 , 2014 11 : 39 pm Cweig Bartos Sweet stuff bro ! Go green all the way ! Raws only September 25 , 2014 3 : 24 pm Christina Oh by the way this really helped me on my project on biomass thank you energy information . Just can you make more on other energy โ€™ s that would be helpful ! Just wanted to say that ! ! ! ! Christina Brunson December 3 , 2014 4 : 56 pm kevin thx so much ! this helped me alot December 12 , 2014 2 : 16 am Mohammed kabir Suleiman Thanks a million . This piece really helped . Me to have a better understanding of this important source of energy . I intend to Promote its utilization on wide scale in our environment . December 23 , 2014 6 : 46 am John Thanks ALOT January 6 , 2015 10 : 05 pm Mya OMG ! Thanks . I needed this for an argument at school ! The cons about their energy at least . February 10 , 2015 6 : 22 pm Reece Joyce I wish that there were more con โ€™ s for each energy resources . February 10 , 2015 9 : 34 pm osta this was really good thx February 17 , 2015 7 : 40 pm serenity this was so helpful for my science project ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! April 8 , 2015 11 : 58 pm GrammarNazi * You โ€™ re April 10 , 2015 1 : 58 pm Camron Is that it on the disadavtages . ? But good info April 10 , 2015 7 : 02 pm willow this was reallly useful for my science project thank you kawaiii ( _ ) > April 14 , 2015 12 : 33 pm Knee Advantages : Cost effective Disadvantages : Expensive @ _ @ April 16 , 2015 3 : 46 pm
[ "Biomass Energy", "Photosynthesis" ]
http://energyinformative.org/wave-energy-pros-and-cons/
Wave Energy Pros and Cons What are the pros and cons of wave energy ? The worldwide potential of wave energy is estimated to be around 2 TW . If the potential indeed is as big as the calculations show , what is stopping us from developing wave power farms on mass scale ? In this article we look deeper at the advantages of harnessing ocean wave power , as well as all the complications with these methods . This article is not about how wave energy works . If you are not familiar with these concepts you might want to read through How Does Ocean Wave Power Work ? before you come back her and read about the pros and cons of wave energy . Advantages of Wave Energy 1 Green Harnessing wave energy comes without the emission of harmful green house gases . This is the main motivation factor behind further development of this way of power generation . We need to find energy sources that will replace polluting ones ( e.g. fossil fuels ) . 2 Renewable Like with most green energy sources , wave power is also renewable . Since this energy source ultimately comes from the heat energy that is emitted from the sun , it will not disappear for some time โ€“ in fact , several billion years or as long time it takes for the sun to burn out . 3 Enormous Energy Potential The amount power in that comes in waves is huge . The energy density is typically around 30 - 40 kW for every meter ( 2.2 feet ) of wave along the shore . As we go further into the ocean 100kW for every meter is not uncommon . 4 Reliable Waves are hardly interrupted and almost always in motion . This makes generating electricity from wave energy a reasonable reliable energy source ( at least when you compare them to solar and wind ) . It should be mentioned that the amount of energy that is being transported through waves does vary every year and from season to season . On the northern hemisphere , the average value of November and May could be different with a factor of two or more . Wave and wind energy has a larger potential during the winter which is a nice synergistically effect with solar energy where the largest potential is in the summer . 5 Area Efficient A wave farm that is occupying less than a half square mile of an ocean would generate more than 30 MW of power โ€“ the equivalent of 20.000 British homes . 5 Offshore Wave Power Ocean wave energy plants can be put offshore , solving several of the issues that come with power plants closer to the land . The first benefit of offshore wave power is that there is a larger energy potential in these waves . The larger flexibility as to where to put these offshore wave farms could potentially minimize the negative environmental effects wave power has on the environment . Offshore wave farms are on the other hand more expensive Disadvantages of Wave Energy 1 Environmental Effects Power farms on shore that are visible from land may cause conflicts with tourism and local acceptance . Due to this , coastal installations and facilities on land has to meet higher restrictions in terms of size and location . We do n โ€™ t yet know exactly how wave power affects sea life . We will hopefully in the next following years have more data in this area . 2 Costs Wave power is in very early stages of development , which makes speculating on costs harder . Wave resources , connections to the power grid and the lifespan of the technology are just a few factors that result in different costs for different projects . Of these factors , the lifespan is the most uncertain one , since this is a relatively new technology and we are lacking data on how long these wave power inventions realistically can operate . At the moment , the costs of wave power are generally very high . These power plants can not be developed without sufficient funding from the governments . On the other hand , renewable energy is the future , and the costs are expected to drop when larger facilities are up and running . Many of the parts that are involved in wave power generation require regular maintenance . The fact that some of these parts are under the water does not make it any easier โ€“ or cheaper for that matter . The bottom line is that wave power has an enormous global potential . However , we need more funding and research to polish the technology involved , pushing prices down to a competitive level . Looking for lists of pros and cons for more types of energy sources ? Solar Energy Pros and Cons Wind Energy Pros and Cons Geothermal Energy Pros and Cons Biomass Energy Pros and Cons Tidal Energy Pros and Cons Hydroelectric Energy Pros and Cons Fossil Fuels Pros and Cons Nuclear Energy Pros and Cons Comments - 23 Cosma Vasile Did you know that Romania has a technical solution with the highest efficiency to capture wave power ? . Patent 108893 entitled Dynamic Engine for Sea Wave Energy Catching . A pioneering invention . It is estimated that โ€œ dynamic engine โ€ has the ability to catching wave energy at a rate of over 80 % while the other technical solutions known worldwide , are not able to capture wave energy with a higher percentage of about 10 - 15 % . Cosma Vasile . Romania . E - mail cosma . vasile @ yahoo . com November 26 , 2011 1 : 38 pm Reply Mathias Are you able to come up with any more information to back your claims ? I did a quick Google search and all I was able to find was your comments on similar sites . May 21 , 2012 5 : 14 am Reply kateriyn ryder thank you . this was a very helpful website . May 15 , 2012 2 : 28 am Ayesha Thank you so much , this was very helpful ! I โ€™ m doing a presentation on alternative energy and most of my Google searches come up with a lot of complicated stuff that I ca n โ€™ t use because I do n โ€™ t understand it , but you โ€™ ve put it into much simpler terms ! Yay ! June 8 , 2012 12 : 25 pm hamish mclean this info was much to my thertical liking October 23 , 2012 5 : 33 am JULIA thankyou your article really helped me learn about the information i needed to know . November 25 , 2012 11 : 03 pm blah I copied and pasted this ansd got an a May 8 , 2013 9 : 50 pm Zoe Abrams This article is working wonders . I am dong an argument essay and i have the pros and cons all in one place . The only thing i want is the author so i can do citations . Thank you ! ! February 27 , 2013 4 : 37 pm Mathias Hi Zoe , The author of the article is Mathias Aarre Mรฆhlum February 27 , 2013 5 : 00 pm Cosma Vasile Now is only available summary . Summary and drawing for patent โ€œ Dynamic Engine โ€ is on page 28 . http : / / www . osim . ro / publicatii / brevete / bopi_1994 / bopi0994 . pdf March 2 , 2013 9 : 10 pm Some information for patent โ€œ Dynamic Engine โ€ can be found on : โ€“ Ocean energy : Wave energy | Climate TechWiki โ€“ โ€œ First Wave Energy Device Connected to Power Grid | Science โ€ April 16 , 2013 4 : 55 pm tashy thats awesome September 11 , 2013 1 : 26 am Andrew Ratto How would wave energy farms damage tourism ? Wind farms look amazing , sun farms look amazing , why not wave farms ? September 20 , 2013 4 : 28 pm fireblood this website was very helpful but there are n โ€™ t many of the disadvantages and I think that there is more disadvantages then you put September 25 , 2013 6 : 59 pm fireblood this website is good but there is still some things that it could add like more disadvantages . September 25 , 2013 7 : 03 pm abril you need to put more cons on wave power November 21 , 2013 4 : 46 pm Seth Whitsett How much sea life will be crushed anchoring these buoys to the ocean floor using thousands of pounds of concrete ? How much energy will be expended maintaining these buoys year after year compared to the amount of energy gained ? February 19 , 2014 1 : 49 am Seth Whitsett The idea of an energy company that can own and control parts of the ocean off the coast of my home town does not set well with me . The wave energy buoy sites that have been proposed off the coast of my home town would use far more ocean space then half a square . February 19 , 2014 1 : 58 am DAVID MORRIS No matter what you do , there is no such thing as a free lunch . Check the laws of thermo - dynamics , no such thing as perpetual motion . Even the planets and stars will eventualy run down . . Its called entropy . November 28 , 2014 4 : 45 am Nathan Well , I ca n โ€™ t see a lot of wave power stations February 9 , 2015 5 : 57 am bazinga Thanks a lot i got and a in my presentation April 24 , 2015 4 : 06 pm Wyatt N Slatr Thank you this will come in handy for my wave energy project June 1 , 2015 4 : 14 pm Ugo I think this is a very interesting read . The future of the energy industry is in the Renewable sector and the writer has done a good job to summarize where things are in regards to the Wave energy . July 12 , 2015 11 : 21 am
[ "Wave Energy", "Renewable", "Enormous Energy Potential" ]
http://eng.faq.panasonic.com/app/answers/detail/a_id/41010/~/handset-displays-base-no-power%2C-is-the-handset-faulty%3F
Handset displays base no power is the handset faulty a Unplug the base units AC adaptor to reset the unit Reconnect the AC adaptor and try again Ensure that the AC adaptor plug is firmly connected to the power outlet and base unit b Check if the handset is registered to the base unit If the Range Status icon looking like an antenna is flashing please register the handset to the base unit by following the steps in the Operating Instructions manual c In case you have multiple handsets please check if the message is displayed on the other handsets if this is the case then the base unit has not power If the message is displayed only on one handset then the respective handset needs to be registered to the base unit Please register the handset to the base unit by following the steps in the Operating Instructions manual Click to Live Chat Were sorry chat is currently unavailable Opening hours 9am 5pm Mon Fri Back Did this answer resolve your question Yes No Related Answers Why does my DECT handset say that the base unit has no power Register the DECT handset to the base unit Resetting a DECT phone Home Phones Support Home Where can I download an instruction manual online
[ "AC adaptor" ]
http://eng.mataurangamaori.tki.org.nz/Support-materials/Te-Reo-Maori/Maori-Myths-Legends-and-Contemporary-Stories/How-Maui-brought-fire-to-the-world
Home Support materials Te Reo Mฤori Mฤori Myths , Legends and Contemporary Stories How Mฤui brought fire to the world Print How Mฤui brought fire to the world One evening , after eating a hearty meal , Mฤui lay beside his fire staring into the flames . He watched the flames flicker and dance and thought to himself , " I wonder where fire comes from . " Mฤui , being the curious person that he was , decided that he needed to find out . In the middle of the night , while everyone was sleeping , Mฤui went from village to village and extinguished all the fires until not a single fire burned in the world . He then went back to his whare and waited . The next morning there was an uproar in the village . " How can we cook our breakfast , there ' s no fire ! " called a worried mother . " How will we keep warm at night ? " cried another . " We ca n ' t possibly live without fire ! " the villagers said to one another . The people of the village were very frightened . They asked Taranga , who was their rangatira , to help solve the problem . " Someone will have to go and see the great goddess , Mahuika , and ask her for fire , " said Taranga . None of the villagers were eager to meet Mahuika , they had all heard of the scorching mountain where she lived . So Mฤui offered to set out in search of Mahuika , secretly glad that his plan had worked . " Be very careful , " said Taranga . " Although you are a descendant of Mahuika she will not take kindly to you if you try and trick her . " " I ' ll find the great ancestress Mahuika and bring fire back to the world , " Mฤui assured his mother . Mฤui walked to the scorching mountain to the end of the earth following the instructions from his mother and found a huge mountain glowing red hot with heat . At the base of the mountain Mฤui saw a cave entrance . Before he entered , Mฤui whispered a special karakia to himself as protection from what lay beyond . But nothing could prepare Mฤui for what he saw when he entered the sacred mountain of Mahuika . Mahuika , the goddess , rose up before him , fire burning from every pore of her body , her hair a mass of flames , her arms outstretched , and with only black holes where her eyes once were . She sniffed the air . " Who is this mortal that dares to enter my dwelling ? " Mฤui gathered the courage to speak , " It is I , Mฤui , son of Taranga . " " Huh ! " Yelled Mahuika . " Mฤui , the son of Taranga ? " " Yes the last born , Mฤui - tikitiki - a - Taranga . " " Well then , Mฤui - tikitiki - a - Taranga , welcome , welcome to the essence of the flame , welcome my grandchild . " Mahuika stepped closer to Mฤui , taking a deep sniff of his scent . Mฤui stood completely still , even though the flames from Mahuika ' s skin were unbearably hot . " So . . . why do you come , Mฤui - tikitiki - a - Taranga ? " Mahuika finally asked . Mฤui said , " The fires of the world have been extinguished , I have come to ask you for fire . " Mahuika listened carefully to Mฤui , and then she laughed . She pulled a fingernail from one of her burning fingers and gave it to him . " Take this fire as a gift to your people . Honour this fire as you honour me . " So Mฤui left the house of Mahuika taking with him the fingernail of fire . Return to top As Mฤui walked along the side of the road he thought to himself , " What if Mahuika had no fire left , then where would she get her fire from ? " Mฤui could n ' t contain his curiosity . He quickly threw the fingernail into a stream and headed back to Mahuika ' s cave . " I tripped and fell , " said Mฤui . " Could I please have another ? " Mahuika was in a good mood . She had n ' t spoken to someone in quite some time and she liked Mฤui . She gladly gave Mฤui another of her fingernails . But Mฤui soon extinguished this fingernail as well and returned to Mahuika with another excuse . " A fish splashed my flame as I was crossing the river , " Mฤui said . Mahuika provided another of her fingernails , not suspecting that she was being tricked . This continued for most of the day until Mahuika had used all her fingernails and had even given up her toenails . When Mฤui returned to ask for another , Mahuika was furious . She knew Mฤui had been tricking her and threw the burning toenail to the ground . Instantly Mฤui was surrounded by fire and chased from the cave . Mฤui changed himself into a hawk and escaped to the sky , but the flames burned so high that they singed the underside of his wings , turning them a glowing red . Mฤui dived towards a river , hoping to avoid the flames in the coolness of the water , but the immense heat made the water boil . Mฤui was desperate . He called on his ancestor Tฤwhirimฤtea for help . " Tฤwhirimฤtea atua o ngฤ hau e whฤ , ฤwhinatia mai ! " Then , a mass of clouds gathered and a torrent of rain fell to put out the many fires . Mahuika ' s mountain of fire no longer burned hot . Mahuika had lost much of her power , but still she was not giving up . She took her very last toenail and threw it at Mฤui in anger . The toenail of fire missed Mฤui and flew into the trees , planting itself in the Mahoe tree , the Tลtara , the Patete , the Pukatea , and the Kaikลmako trees . These trees cherished and held onto the fire of Mahuika , considering it a great gift . When Mฤui returned to his village he did n ' t bring back fire as the villagers had expected . Instead he brought back dry wood from the Kaikลmako tree and showed them how to rub the dry sticks together forming friction which would eventually start a fire . The villagers were very happy to be able to cook their food once more and to have the warmth of their fires at night to comfort them . Mฤui satisfied his curiosity in finding the origin of fire , although he very nearly paid the ultimate price in doing so . To this day the Kahu , the native hawk of Aotearoa , still retains the red singed feathers on the underside of its wings , a reminder of how close Mฤui was to death . This is the story of how Mฤui brought fire to the world . ( c ) Wiremu Grace Return to top
[ "Mฤui brought fire" ]
http://engg-material.blogspot.com/2011/03/chemical-composition-and-its-function.html
Engineering Materials Monday , March 7 , 2011 Chemical Composition and It ' s Function of Brick Clay The chemical composition of brick clay is as follows - Silica 55 % Alumina - 30 % Iron oxide - 8 % Magnesia - 5 % Lime - 1 % Alkali and organic matter - 1 % Silica : Silica is present in brick clay as the chemical composition of alumina and forming silicate of alumina . Sometimes silica is present in pure form termed as flint Silica prevents shrinking , cracking and warping of brick clay . High amount cause uniform texture . Too much presence of silica cause brick to be brittle and weak . Alumina : Alumina imparts plasticity to brick clay which is very important in molding . It also imparts density . Excess alumina cause brick to crack and warp during drying and very hard when heated . Iron oxide : The presence of iron oxide increases impermeability and durability of brick . The color of brick depend upon iron oxide and color changes from light yellow to orange and red as iron oxide goes up to 8 % . Magnesia : Presence of small quantity of magnesia decreases shrinkage and gives yellowish tint . Lime : Lime melts silica in burning and binds the particles of brick together . It also reduces the shrinkage of brick during drying . Excess of lime cause the brick to fuse and shape will be lost . Alkali and Organic Matter : Small quantity assist burning of brick clay . It also reduces the fusion point . If excess amount is present and not burned properly the brick would be porous . Posted by Kyleyx at 9 : 29 PM Reactions : funny 0 interesting 0 cool Email This BlogThis ! Share to Twitter Share to Facebook Share to Pinterest Labels : Chemical Composition and It ' s Function in Brick Clay Newer Post Older Post Home Subscribe to : Post Comments ( Atom )
[ "Engineering Materials", "Chemical Composition", "Brick Clay" ]
http://engineerboards.com/topic/1229-my-cheat-sheets/
All Activity Home Exam Discussion Anything about the PE Exam MY CHEAT SHEETS Sign in to follow this 0 MY CHEAT SHEETS By NSEARCH October 24 2006 in Anything about the PE Exam NSEARCH Principal in Charge Charter Member 0 212 posts Gender Location St Pete Florida DisciplineCivil Report post Posted October 24 2006 edited Here are links to the cheat sheets that I developed when I took and passed the exam this past April Hope itll help some of you guys Youre going to need to right click and save the image on your harddrive for you to be able to view it well Hydraulics Transportation Water Treatment Geotech Edited October 24 2006 by NSEARCH Guest GTScott Guests Report post Posted October 24 2006 Thanks for posting those I for one will definitely take a look through them Road Guy Veteran Admin 9373 26472 posts Gender Location Colorado DisciplineConstruction Report post Posted October 24 2006 those look familiar Guest Blu1913 Guests Report post Posted October 25 2006 HOLY SHIT THATS IT My cheat sheets are like 4 pages for each except structures thats only a haff page Boy Im feeling really good now Im gonna hopefully roll the exam up and smoke it when im done Guest GTScott Guests Report post Posted October 25 2006 HOLY SHIT THATS IT My cheat sheets are like 4 pages for each except structures thats only a haff page Boy Im feeling really good now Im gonna hopefully roll the exam up and smoke it when im done I am with youmy sheets are not nearly as neat though either I will pass smoking the exam as I think that NCEES frowns upon that Guest Blu1913 Guests Report post Posted October 25 2006 Darn I thought we were all going to pass it around a few times Create an account or sign in to comment You need to be a member in order to leave a comment Create an account Sign up for a new account in our community Its easy Register a new account Already have an account Sign in here Sign In Now Go To Topic Listing Anything about the PE Exam All Activity Home Exam Discussion Anything about the PE Exam MY CHEAT SHEETS
[ "MY CHEAT SHEETS" ]
http://engineering.kennesaw.edu/
Engineering at KSU Home About Departments Transfer Programs Advising and Engineering Standing Resources Engineering Outreach Alumni Contact Take a Virtual Tour Cant make it to the Marietta Campus take a virtual tour of the Engineering Technology Center Give Opportunity Invest in KSU Engineering Social Who we are The Southern Polytechnic College of Engineering and Engineering Technology SPCEET at Kennesaw State University provides highquality engineering degrees with education led by industryexpert faculty in the universitys stateoftheart facilities As the secondlargest engineering college in Georgia the institution serves more than 4500 students offering 20 undergraduate and graduate engineering degrees and engineering technology degrees Discover Degrees Experience SPCEET KSU Naval ROTC Get Featured Featured News News Archives Student Alumni Spotlight Danica Roberts Electrical Engineering Senior Receives Grant Upcoming Events View Calendar Jan 07 First Day of Classes Time Allday Event Location Kennesaw State University Jan 07 DropAdd Begins Time Allday Event Location All Campuses Jan 13 DropAdd Ends Time 0600 am Location All Campuses
[ "SPCEET", "degrees" ]
http://engineering.unl.edu/ece/ece-what-electrical-engineering/
What is Electrical Engineering ? Degrees Offered Bachelor of Science in Electrical Engineering ( B.S. ) Master of Science in Electrical Engineering ( M.S. ) Ph . D . in Electrical Engineering The following text is a slightly modified version by Dr . Karen St . Germain of a document originally prepared by Professor Yu Chang , Department of Electrical Engineering , Union College , Schenectady , N.Y. Original Text Version 9 / 14 / 87 . Latest Update : 8 / 2011 . Electrical Engineering is an extremely exciting field of endeavor . Electrical engineers work with signal at frequencies from zero to beyond the optical range , using tools such as computers , advanced mathematics , and wire cutters . Electrical engineers are thinkers and doers . Strictly speaking , Electrical Engineering is not just a single field , but a collection of many fields fused into one unified discipline . It is by far the most dynamic and most varied of all fields in engineering . The best way to find out what Electrical Engineering is to see what electrical engineers In the following paragraphs I ' ll try to list some of the major fields in electrical engineering from my point of view . The order of appearance has no significance , and the grouping of the major fields is arbitrary . Today this grouping seems reasonable . A few years down the road , new fields may appear , and my present grouping may look very strange . After going through the following paragraphs , you might get the idea that specialization at an early stage is the best thing to do . Halt ! Think again . If Power The picture on the left is from British Columbia Hydro and Power Authority . The electric power field is primarily concerned with the generation and distribution of electricity . The energy crisis and environmental concerns provide excitement and challenges for power engineers to develop new energy sources . There are opportunities in research and development of high voltage transmission , and in the manufacturing and maintainance of power equipment such as machines , drives , relays , and converters . The rapid development of research into high temperature superconducting materials is expected to have a great deal of impact on the power industry . Utility companies , federal and state governments , are major Energy : The emphasis is to find new energy sources Transmission : The emphasis is to find a more efficient way to transmit electricity Power Electronics : The emphasis is on developing new electronic devices and / or circuits to control machines and / or power flow Computational studies of most efficient usage To prepare yourself for this field , you should try to have some courses in power system analysis , machines , circuit theory , electronics , microprocessors , and a couple of computer science courses . Communication Systems Every time you find yourself talking on the telephone you are using the products of the communication industry . Your voice is converted to electrical signals and transmitted in the form of " bits " to another location via metallic cables , or optical guides , or a satellite link . Every time you watch CSI , Grey โ€™ s Anatomy , or the Super Bowl , you are using cables and satellites again ! The field of communication systems is concerned with finding the best way to transmit and receive signals . Voice , picture , and computer data There are challenging opportunities in space and satellite communication , optical communication , signal analysis , digital signal processing , data communication , and other related areas . Communication systems is a big field , and satellite communication is already a reality . AT&T , IBM , DEC , GE , the federal government , and many defense contractors are very interested in people with strong backgrounds in communication and signal processing . The VLSI revolution in electronics has prompted remarkable growth in many areas of communication systems ; the following three are particularly noteworthy : Data Communication : The emphasis is on moving a large amount of computer data efficiently Digital Signal Processing : The emphasis is on converting signals to digital form and processing them through digital systems to get the desired output Materials for high frequency transistors and for fiber optic communications ; lasers , optical amplifiers , detectors , and switches To have a good background , it is suggested that you have some courses in advanced mathematics , system theory , communications , microprocessors , probabilistic systems , and a couple of computer science courses . Control Systems Every time you drive a car you are using the theory of feedback control . As a matter of fact , driving a car is an extremely complex control system . Your eyes see an obstacle down the road ; the information is transmitted to the brain for processing , and the new information to avoid the obstacle is then sent to the arms and hands to turn the steering wheel . The same principle is used in navigation and guidance of rockets , missiles , spacecrafts , and toys . If you are interested in robotics , this is There are plenty of opportunities in robotics , navigation and guidance control , process control and automation in a variety of industrial plants and numerous military and space applications . Some aspects of control theory are also used in nontechnical areas such as business and social sciences . Two areas of control systems are expected to grow substantially in the years to come : Digital Control : The emphasis is on the digital implementation of control systems Robotics : The emphasis is on building intelligent robots The federal government , defense contractors , automobile companies , chemical and steel companies , and computer companies are the major employers . If you are interested in this field , you should take courses in advanced mathematics , control theory , probabilistic systems , digital signal processing , microprocessors , and several computer science courses such as artificial intelligence , computer graphics , operating systems , etc . Electronics The electronics field is still in the midst of a revolution . In the early days electronics was a subject that included physics and the circuitry of vacuum tubes . A great deal has changed since the invention of the transistor . Except for high power and / or high frequency applications , the vacuum tube is seldom used . In low power applications the electronic circuits are not only entirely solid - state , but also integrated . The Operational Amplifier is rapidly becoming the basic building block for analog circuits , and the Very Large System Integration or Computer Electronics : The emphasis is on computer - related electronics Communication Electronics : The emphasis is on the physical implementation of a communication system Electronic Materials : new materials and new atomic dimension transistors and circuit elements . New ways for processing materials with nanometer dimensional scales Computer - Aided Analysis and Design : filter design and optimization techniques How to use electronics intelligently in other fields of engineering is fertile ground in which to test one ' s creativeness and imagination . There are plenty of opportunities in all kinds of industries . The dividing line between device and circuit has been blurred considerably since the advent of integrated circuits . It is important for every circuit designer to know something about how devices work . I strongly suggest you take at least one course in device theory even if you only want to be a circuit engineer and not a device engineer . You should also have a wide spectrum of courses in communications , controls , analog electronics , microprocessors , VLSI , etc . Electromagnetics The rabbit - ear antenna on your TV set , the dish antenna for satellite communication , remote - sensing radars , microwave and optical communication links , are in the field of engineering electromagnetics . Information - laden electromagnetic waves are transmitted and received by antennas . The analysis and design of antennas and antenna systems is but one of the many fascinating areas of electromagnetics . Another area that has gained a great deal of attention is in remote - sensing . Remote - sensing radars have been used extensively in target identification , geological surveys , and So far we have been talking about electromagnetics on a system level . It is also very important to have a solid understanding about electromagnetics at the circuit and / or device level . For instance , any time you want to design a high frequency amplifier , you have to take into consideration the effect of traveling waves . Under certain circumstances a piece of copper wire could behave like an open circuit , a short circuit , an inductor , a capacitor , or a combination of things . To design new machines and to improve the existing ones , it is important to know how the magnetic fields are distributed in a conducting structure . Finding a simple and efficient way to compute the magnetic fields in a complex structure is always a challenging problem . Computers and other electronic equipment may not function in a noisy electromagnetic environment . The study of electromagnetic interference is the subject of another area of specialization called Electromagnetic Compatibility . This involves interdisciplinary solutions . For example , materials scientists can help construct more efficient shields . There are many fascinating areas in electromagnetics . The following is a sample list of three areas : Radiation and Scattering : The emphasis is on the analysis of antenna arrays and radar cross - sections Electro - Optics : The emphasis is on the development of optical devices and integrated optics Remote Sensing : The emphasis is on the development of special purpose radars If you are interested in electromagnetics , get a good background in advanced mathematics and numerical methods .
[ "Electrical Engineering", "advanced mathematics", "physics" ]
http://engineering.utep.edu/enge/EE/15/02/1.htm
152 Cost Indexes The general equation for updating costs through the use of a cost index is C t C o I t I o 1 where C t estimated cost at present time t C o cost at previous time t o I t Index value at time t I o Index value at time t o The next example illustrates its use An engineer involved in a major construction project discovered that a similar project had been completed in 1990 If the previous project had a construction cost of 1545 million what would the estimated construction cost be in 1999 based on the ENR construction cost index Solution From Table 151 the ENR construction cost index rose from a value of 477003 in 1990 to 605947 in 1999 Therefore the estimated construction cost in 1999 would be C 1999 1545 605947 477003 1963000 While the cost indexes discussed above provide a valuable tool for estimating present costs from historical data they become even more valuable when combined with some of the other costestimating techniques One of the most widely used methods of obtaining preliminary cost information is through the use of costcapacity equations As the name implies a costcapacity equation relates the cost of a component system or plant to its capacity Since many costcapacity relationships plot as a straight line on loglog paper one of the most common costprediction equations is C 2 C 1 Q 2 Q 1 x 2 where C 1 cost at capacity Q 1 C 2 cost at capacity Q 2 x exponent Table 152 is a partial listing of typical values of the exponent for various units When an exponent value for a particular unit is not known it is common practice to use the average value of 06 The next example illustrates the use of Equation 2 Table 152 Sample exponent values for costcapacity equations ComponentSystemPlant Size Range Exponent Activated sludge plant 1100 MGD 084 Aerobic digester 0240 MGD 014 Blower 10007000 ft 3 min 046 Centrifuge 4060 in 071 Chlorine plant 3000350000 tonsyear 044 Clarifier 01100 MGD 098 Compressor 2002100 hp 032 Cyclone separator 208000 ft 3 min 064 Dryer 15400 ft 2 071 Filter sand 05200 MGD 082 Heat exchanger 5003000 ft 2 055 Hydrogen plant 50020000 scfd 056 Laboratory 00550 MGD 102 Lagoon aerated 00520 MGD 113 Pump centrifugal 10200 hp 069 Reactor 504000 gal 074 Sludge drying beds 0045 MGD 135 Stabilization pond 00102 MGD 014 Tank stainless 1002000 gal 067 NOTE MGD million gallons per day hp horsepower scfd standard cubic feet per day Example 152 The total construction cost for a stabilization pond to handle a flow of 005 million gallons per day MGD was 73000 in 1987 Estimate the cost today of a pond 10 times larger Assume the index for updating the cost was 131 in 1987 and is 225 today The exponent from Table 152 for the 001 to 02 MGD range is 014 Solution Using Equation 2 the cost of the pond in 1987 dollars is C 2 73000 050 005 014 100768 Todays cost can be obtained through the use of Equation 1 as follows C t 100768 225 131 todays dollars
[ "Cost Indexes" ]
http://engineering.utep.edu/ieee/
UTEP > > College of Engineering > > Electrical & Computer Engineering Student Organizations > > IEEE IEEE IEEE OFFICERS MEMBERSHIP EVENT PICS UPCOMING EVENTS OFFICER DUTIES STOLES SITE MAP CONTACT INFORMATION : University of Texas at El Paso Institute of Electrical and Electronics Engineers Engineering Bldg . , Room E - 337 500 W . University Avenue El Paso , TX 79968 Tel : ( 915 ) 747 - 8810 Email : ieee @ utep . edu Find us on Facebook ieee Your IEEE UTEP Chapter wants to welcome you to our website . Our website is here to update you on what IEEE is doing for all the students . We also have information about events , conferences , projects , and plenty of pictures . So Enjoy Networking the World : IEEE is a non - profit , technical professional association of more than 380,000 members in 150 countries . The full name is The Institute of Electrical and Electronics Engineers , Inc . , although the organization is most popularly known and referred to by the letters IEEE . Through its members , the IEEE is a leading authority in technical areas ranging from computer engineering , biomedical technology and telecommunications , to electric power , aerospace and consumer electronics , among others . IEEE ' s mission is to promote the development of electro - technology and allied sciences , the application of those technologies for the benefit of humanity , the advancement of the profession and the well - being of its members . We want our student branch to : Serve as a medium for the college , the electrical engineering department and the students to communicate Assist in the professional development and education of our membership primarily through local activities Have fun ! Useful links : http : / / www . ieee . org / http : / / www . ieee . org / theinstitute http : / / spectrum . ieee . org /
[ "ieee", "allied sciences", "technical professional association" ]
http://engineeringdynamics.blogspot.com/2015/09/the-jet-car-is-originally-traveling-at.html
dynamicsolutions Wednesday , September 16 , 2015 The jet car is originally traveling at a velocity of 10 m / s when it is subjected to the acceleration shown . When t = 0 , s = 0 . Suppose that a 1 = 5 m / s 2 , a 2 = - 3 m / s , and t โ€ฒ โ€ฒ = 15 s Determine the car ' s maximum velocity . Express your answer to three significant figures and include the appropriate units . Vmax = 85 m / s Determine the time t ' when the car stops . Express your answer to three significant figures and include the appropriate units . t ' = 43.3 Posted by Daxter Bels at 10 : 50 AM Email This BlogThis ! Share to Twitter Share to Facebook Share to Pinterest 1 comment : Nic Coulter January 30 , 2016 at 11 : 52 AM Can you show the steps you took ? Reply Newer Post Older Post Home Subscribe to : Post Comments ( Atom )
[ "dynamicsolutions" ]
http://engineershandbook.com/Tables/woodscrewpilotholes.htm
Reference Tables - - Wood Screw Pilot Hole Sizes Back to Index Wood Screw Pilot Hole Sizes Screw Size Body Dia . Shank Pilot Hole * Pilot Hole in Softwood Pilot Hole in Hardwood 0 0.060 1 / 16 1 / 64 1 / 32 1 0.073 5 / 64 1 / 32 2 0.086 3 / 32 3 / 64 3 0.099 7 / 64 3 / 64 1 / 16 4 0.112 7 / 64 5 0.125 1 / 8 5 / 64 6 0.138 9 / 64 7 0.151 5 / 32 3 / 32 8 0.164 11 / 64 9 0.177 3 / 16 5 / 64 7 / 64 10 0.190 3 / 16 11 0.203 13 / 64 1 / 8 12 0.216 7 / 32 14 0.242 1 / 4 9 / 64 16 0.268 17 / 64 5 / 32 18 0.294 19 / 64 3 / 16 20 0.320 21 / 64 11 / 64 13 / 64 24 0.372 3 / 8 3 / 16 7 / 32 These dimensions are for standard American wood screws , which are tapered . They are not suitable for screws which are not tapered , such as dry wall screws . All dimensions are in inches . * - The shank pilot hole is one which will clear the thickest part of the screw body . Copyright ยฉ 2004 - 2006 - - EngineersHandbook . com All Rights Reserved Contact Information Privacy Policy Disclaimer
[ "Wood Screw Pilot", "Hole Sizes" ]
http://england.shelter.org.uk/legal/homelessness_applications/introduction_to_homelessness
Overview of homelessness law and guidance This content applies to England An overview of the law relating to homelessness Contents Legislative framework Code of Guidance Principal duties owed Main tests Decisions and notifications Challenges Legislative framework The main provisions on homelessness are contained in Part 7 of the Housing Act 1996 The Act includes principal criteria for determining which duties a local authority will owe to a homeless applicant the duties to inquire into an application when and how an applicant should be notified of a decision main accommodation duties and how they can be discharged how a decision can be challenged The Homelessness Reduction Act 2017 came into force on 3 April 2018 with limited exceptions It has made significant changes to Part 7 of the 1996 Act Its main effect is to place increased duties on local authorities to assess an applicants needs and to prevent and relieve homelessness It should be noted that the changes introduced under the Act will not apply to an applicant who applied as homeless before 3 April 2018 The Homelessness Act 2002 introduced the requirement on local authorities to regularly review the levels and likely future levels of homelessness in their areas and to formulate a homelessness strategy The Localism Act 2011 amended the 1996 Act by giving local authorities the power to end the main housing duty by arranging an offer of suitable accommodation in the private rented sector The Secretary of State has the power to issue regulations to specify details regarding the homelessness provisions and has done so to prescribe for example additional categories of people in priority need 1 persons from abroad who are eligible for assistance 2 suitability of accommodation criteria 3 Code of Guidance The Homelessness Code of Guidance for Local Authorities is issued by the Ministry for Housing Communities and Local Government MHCLG It provides statutory guidance on how to interpret and apply the homelessness legislation and contains details of good practice that local authorities should adopt It is not legally binding but local authorities are required to have regard to it 4 Failure to have regard to the current Code can be used as a basis for a judicial review challenge The current Code came into effect on 3 April 2018 It is periodically updated including new paragraphs being added so it is best to refer to the online version as paragraph references are subject to change The previous Code and supplementary Codes should apply to applications made before 3 April 2018 From 3 April 2018 the MHCLG has the power to issue a statutory code of practice if it is clear that certain functions relating to homelessness are not being met A code of practice may apply to all local authorities or to specified local authorities 5 Principal duties owed The principal duties are to provide free advisory services6 assess an applicants case and agree a personalised housing plan7 make inquiries8 take reasonable steps to prevent homelessness9 provide interim accommodation10 take reasonable steps to secure accommodation under prevention or relief duty 11 secure ongoing accommodation main housing duty 12 The way in which each duty is triggered and can come to end is addressed in the relevant pages in the Homelessness applications section Any accommodation that is provided obtained or secured must be suitable for the applicant The duties owed to an applicant will depend upon herhis particular circumstances and when she applied as homeless Main tests The duties a local authority will owe to an applicant are determined by whether she is homeless or threatened with homelessness eligible for assistance in priority need intentionally homeless with a local connection No duty will be owed to an ineligible applicant save the general duty to provide free advisory services to those in its area Decisions and notifications The local authority must 13 give notification of its decisions in writing inform the applicant of the reasons for its decision when it does not accept a housing duty to the applicant say if it intends to refer the applicant to another authority under the local connection provisions and give the reasons for that decision inform the applicant where she has the right to request a review of a decision and the time limits for making such a request Challenges If an applicant disagrees with a local authority decision there are three main ways that it can be challenged internal review county court appeal judicial review Applicants have a right to an internal review of most decisions made following a homelessness application If an applicant is not satisfied with a review decision she has the right to appeal to the county court Decisions that are not open to internal review may be open to challenge by judicial review As an alternative a complaint can be made to the Local Government and Social Care Ombudsman who can investigate complaints about how a local authority exercises its homelessness functions 1 Homelessness Priority Need for AccommodationEngland Order 2002 SI 20022051 2 Allocation of Housing and Homelessness Amendment Regulations 2004 SI 20041235 3 Homelessness Suitability of Accommodation Order 1996 SI 19963204 4 R v Newham LBC ex p Bones 1992 25 HLR 357 QBD Newham LBC v Khatun Ors 2004 EWCA Civ 55 Birmingham CC v Balog 2013 EWCA Civ 1582 5 s214A Housing Act 1996 as inserted by s11 Homelessness Reduction Act 2017 6 s179 Housing Act 1996 as amended by s2 Homelessness Reduction Act 2017 7 s189A Housing Act 1996 as inserted by s31 Homelessness Reduction Act 2017 8 s184 Housing Act 1996 as amended by ss43 53 Homelessness Reduction Act 2017 9 s195 Housing Act 1996 as amended by s42 Homelessness Reduction Act 2017 10 s188 Housing Act 1996 as amended by s54 Homelessness Reduction Act 2017 11 s189B Housing Act 1996 as inserted by s52 Homelessness Reduction Act 2017 12 s193 Housing Act 1996 as amended by ss57 72 Homelessness Reduction Act 2017 13 s184 Housing Act 1996 as amended by ss43 53 Homelessness Reduction Act 2017
[ "homelessness law", "guidance", "Legislative framework" ]
http://englewoodfl.us/
Englewood Florida September 2018 Welcome to Englewood , Florida , and the surrounding area . The site has grown over the years and become quite large . In addition , the area is always in a state of change and we pride ourselves on keeping the site as current as possible . The date you see at the top of the page tells you when the last changes were made . Keep coming back to this site because we are constantly updating it with new features , places and photographs of events that have taken place . Page Two of the Guide provides information on the beaches of Englewood , the turtles and their nests , how to get here and links to the nearest airports . The EVENTS button , takes you to a list of upcoming events Whether you are planning a vacation , looking for a retirement destination , exploring a relocation to an area that is safe for your children and has opportunities for growth , or a " second home " where you can escape the winter weather and enjoy time on the beach , then Englewood , Florida could be the perfect place for you . Check out the Hotel / Motel accommodations or Real Estate for Rent Navigation buttons on the top of the page will take you to the appropriate pages . Use the Travel section to find out what to see and do within a 1 hour driving distance , which is not only a help to visitors to this area but also reminds the full time residents of places to visit locally . Included in this section is a link to the movies currently being shown in Venice and Port Charlotte . Search through this site and see what Englewood has to offer . It may just be one of the best decisions you will make . We have re - designed the website to provide the readers with , hopefully , an easier to use interface . Some of the items have been redistributed but can be accessed through the navigation bar across the top of the page . When you hover over the navigation bar you will see the sub - directories associated with that title . Adverting in Englewoodfl . us After fifteen years of producing this website we have decided to share our selection of the best of Englewood for your information . We are only picking one business from each category to ensure that they get our undivided attention . Emery Auto and Diesel Repair information can be found in the SERVICES section or you can go directly to their website by clicking here . Page One of the Guide gives you information about relocating , the Englewood Community Hospital , the Chamber of Commerce , the Libraries , the Arts and the Clubs . This weeks blog covers new home construction in the area . This includes retirement homes , apartments , single family homes and condominiums . With all this construction in the works there is a demand for skilled workers , which will be a subject for a future blog . Closing in on the mid - term elections so the personal note is : GET OUT AND VOTE . On Sept . 3rd one of final events of the Pioneer Days was the Parade down Dearborn Street . If you wish to see a pictorial of the event , use the Past Events navigation button at the top of the page or CLICK HERE Click HERE to go directly to the blog our use the menu above .
[ "Englewood , Florida" ]
http://english.alarabiya.net/en/News/gulf/2017/11/08/Emotional-photo-shows-Saudi-Prince-Muqrin-at-his-son-s-funeral.html
GULF NEWS GULF Emotional photos show Saudi Prince Muqrin at his son Mansours funeral Saudi Prince Muqrin attending the funeral prayers of his son Prince Mansour Supplied Staff writer Al Arabiya English Wednesday 8 November 2017 Text size A A A An emotional picture surfaced on Tuesday showing Saudi Prince Muqrin attending the funeral prayers of his son Prince Mansour On Sunday Prince Mansour bin Muqrin deputy governor of Asir died in a helicopter crash The chopper was also carrying a number of officials in the Asir region The afternoon prayer brought together masses to pray for the late prince and his companions who also lost their lives in the crash Standing in the front line were Prince Muqrin bin Abdul Aziz advisor to King Salman Khalid alFaisal Prince Mohammed bin Nayef bin Abdulaziz Prince of Asir Faisal bin Khalid and Saudi Arabias Grand Mufti AbdulAziz ibn Abdullah AlAsheikh Last Update Wednesday 8 November 2017 KSA 1203 GMT 0903 NEWS GULF Arab Coalition issues 24 permits for ships to enter Yemeni ports The coalition said that those ships are carrying oil derivatives and foodstuffs File photo Supplied Staff writer Al Arabiya English Wednesday 19 December 2018 Text size A A A The Arab Coalition supporting the legitimate Yemeni government announced that it has issued 24 permits for ships headed to Yemeni ports on Wednesday The coalition said that those ships are carrying oil derivatives and foodstuffs Their statement added that they also issued 35 air permits four land permits and 169 permits for the protection of convoys The total number of permits reached 232 within four days They stated that one ship has been waiting to enter Hodeidahs port for the past five days Meanwhile the coalition said it struck a Houthi air base next to Sanaas international airport earlier on Wednesday destroying a rocket launcher and a drone that was preparing to carry out an attack The coalition said that the targeting was consistent with international humanitarian law and its customary rules especially that all preventive measures had been taken Last Update Wednesday 19 December 2018 KSA 2254 GMT 1954
[ "Muqrin", "emotional picture" ]
http://english.tse.jus.br/noticias-tse-en/2014/Julho/an-increased-number-of-brazilian-voters-are-eligible-to-vote-abroad
An increased number of Brazilian voters are eligible to vote abroad 01072014 1640 In this years elections the number of voters that have regularly registered abroad and are eligible to vote has increased by 682 in comparison with the general elections of 2010 In the elections of 2014 337168 voters will be eligible to vote for president and vicepresident whereas in 2010 the number of Brazilians residing abroad that actually voted amounted to 200392 This survey represents the partial assessment of data recorded until May 7 the deadline for Brazilian citizens residing abroad to register at a competent Brazilian embassy or consulate to ensure their voting rights The consolidated figures will be released by the Superior Electoral Court TSE in the second half of July after auditing and processing electoral registers recorded data Concentration of voters There are many Brazilian citizens residing overseas scattered across all continents However the countries featuring the largest number of Brazilian voters are as follows United States 108624 Japan 30671 Portugal 30431 Italy 20972 and Germany 17555 The foreign municipalities that feature the largest number of Brazilian citizens that have registered to vote in the elections of 2014 are New York 20994 Miami 20336 Boston 18200 Lisbon 17159 and London 15967 In the general elections of 2010 the voting took place in 252 locations spread over 113 different countries where 624 polling places were installed Each polling place recorded an average attendance of 321 voters Voting procedures The Regional Electoral Court of the Federal District TREDF supported by Brazilian consulates or diplomatic missions established in each country is responsible for organizing elections abroad It is mandatory to register before the registry of the Foreign Voting District ZZ with headquarters located in Brasรญlia which is divided into 171 municipalities and subdivided into 883 polling places each recording a maximum of 400 voters Brazils Electoral Code Law N 47371965 establishes a minimum of 30 voters to install a voting board abroad Brazils diplomatic missions or consular offices are to inform registered Brazilian voters about voting place and time The polling places for the first and second rounds of voting will be installed at Brazilian embassies consular offices or in locations where Brazilian government services are provided Exceptionally the Superior Electoral Court may authorize the installation of a polling place in a different location Eligible voters must have their names recorded in the voting list of the competent polling place As established in Resolution N 23207 voters domiciled and residing abroad remain required to either vote or file a justification for having failed to vote in the elections for president and vicepresident Those who neither vote nor file a justification for having failed to appear to vote may be prohibited to request the issuance of any document before a competent diplomatic office until effectively filing a justification form and may be subject to other sanctions applicable to Brazilian citizens who do not vote in Brazils territory Tags Electoral Regional Court Elections 2014 Electoral justice Elections 2010 Responsible manager Assessoria de Assuntos Internacionais
[ "Brazilian voters", "vote abroad" ]
http://english1102project.weebly.com/accents.html
Home Accents Characters Works Cited Standard English โ€œ By the end of the 15th century , " Standard English " was established in the City of London . A mixture of London speech with elements from East Midlands , Middlesex and Essex , โ€ Key Characteristics : Non - rhoticity , meaning the r at the ends of words is n โ€™ t prounounced ( mother sounds like โ€œ muhthuh โ€ ) . Trap - bath split , meaning that certain a words , like bath , ca n โ€™ t , and dance are pronounced with the broad - a in father . The vowels tend to be a bit more conservative than other dialects in Southern England , which have undergone significant vowel shifting over the past century . Example : Dame Judi Dench ( See video to the right ) Cockney Working class accent in the East End Key Characteristics : Raised vowel in words like trap and cat so these sounds like โ€œ trep โ€ and โ€œ cet . โ€ Non - rhoticity and Trap - bath split London vowel shift : The vowel sounds are shifted around so that Cockney โ€œ day โ€ sounds is pronounced IPA dรฆษช ( close to American โ€œ die โ€ ) and Cockney buy verges near IPA bษ’ษช ( close to American โ€œ boy โ€ ) . Glottal Stopping : the letter t is pronounced with the back of the throat ( glottis ) in between vowels ; hence better becomes IPA be ? ษ™ ( sounds to outsiders like โ€œ be โ€™ uh โ€ ) . L - vocalization : The l at the end of words often becomes a vowel sound Hence pal can seem to sound like โ€œ pow . โ€ ( I โ€™ ve seen this rendered in IPA as / w / , / o , / and / ษฐ / . ) Th - Fronting : The th in words like think or this is pronounced with a more forward consonant depending on the word : thing becomes โ€œ fing , โ€ this becomes โ€œ dis , โ€ and mother becomes โ€œ muhvah . โ€ Example : British Singer Lily Allen ( See video to the right ) Estuary English A combination of Cockney and Standard English , Estuary English originated in southeast England . Since then , it has spread to Norwich and west towards Cornwall . Emphasizes prepositions and auxillary verbs Grammatically more proper than / r / realization - sounds more like an American " r " than a " r " Chef Gordon Ramsey ( see video to the right ) Video on Esturay English West Country West Country encompasses several accents in southwest England . Rhoticity - the letter " r " is pronounced after vowels . It sounds more like an American " r " than a " r . " Frequent use of " to be . " The final " y " is pronounced as / ei / . Pronounciation of the final " a " as [ ษ”ห ] , which sounds like " aw . " Comedian Justin Lee Collins ( see video to the right ) Midlands English Midlands English can be broken into two different types , East Midlands and West Midlands . The East is characterized by how the dialect tends to drop r โ€™ s and and pronounce strong h โ€™ s . The dialect also has a tendency to change โ€œ ou โ€ to u . The dialect tends to stick to Received Pronunciation , also referred to as โ€œ posh โ€ English . West Midlands tends to differ from RP more than the dialect of East Midlands . The most famous person with a West Midlands accent is Ozzie Osbourne . In this dialect am is usually substituted in for are . And " bin " tends to take the place of โ€œ have been . โ€ Specifically Brummie is the version of West Midlands spoken in Birmingham . It demonstrates all of the above characteristics . Ozzie Osbourne portrays the West Midlands accent . Northern England English Northern English is dominated by the dialect referred to as Geordie . This dialect is prominent in the Newcastle area . It also resembles the southern Scottish accent . Specific ways this accent is expressed is in the substitution of โ€œ our โ€ with โ€œ wor . โ€ The you plural also takes on the pronunciation โ€œ youse . โ€ Lee Mack is a famous comedian known for impersonations of the Geordie dialect . Welsh English Welsh English is the dialect of English most commonly found in Wales . It contains words and grammatical styles that are derived from Welsh , causing many people to consider it a hybrid language . A common feature of Welsh English is ending sentences with the subject instead the predicate , as in โ€œ Fed up , I am . โ€ or โ€œ Running on Friday , he is . โ€ Over time , Welsh English has become less of a dialect and more of an accent as many Welsh words have fallen out of common use .
[ "Standard English", "London" ]
http://englishlinx.com/sentences/complex_sentences/
Worksheets By Topics 1st Grade Spelling 2nd Grade Spelling 3rd Grade Spelling 4th Grade Spelling 5th Grade Spelling H School Spelling Abbreviations Active Voice Adjectives Adverbs Alliteration Alphabet Analogy Antonyms Apostrophes Articles Back to School Book Report Capitalization Character Analysis Clauses Commas Compound Words Conflict Conjunctions Context Clues Contractions Definition Exclamation Marks Figures of Speech Graphic Organizers Homophones Idioms Interjections Lesson Plan Temp Metaphors Nouns Onomatopoeia Organizational Patt Parallel Structure Periods Phonics Plot Poetry Point of View Prefixes Prepositions Print Bookmarks Pronouns Punctuation Question Marks Quotation Marks Reading Reading Comp Research Rhyming Sent Fragments Sentences Sight Words Similes Speaking Spelling Subject Predicate Suffixes Summary Syllables Synonyms Text Evidence Text Structure Theme Transitional Words Verbs Vocabulary Vowels Works Cited Writing Writing Conclusions Writing Prompts by Topics by Common Core by Subject Sentences Worksheets Complex Sentences Worksheets A complex sentence has an independent clause and a dependent clause An independent clause is a complete sentence that can stand on its own A dependent clause is not a complete sentence for it can not stand on its own A dependent clause is similar to an independent clause or complete sentence but it lacks one of the elements that would make it a complete sentence Dependent clauses begin with subordinating conjunctions such as after although as because before even though if since though unless whenever wherever etc Our complex sentences worksheets are free to download and easy to access in PDF format Use these complex sentences worksheets at school or at home Complex Sentences Worksheets Here is a graphic preview for all the Complex Sentences Worksheets Click on the image to display our PDF worksheet Complex Sentences Worksheet Writing Sentences Writing Complex Sentences Worksheet Complex or Simple Sentence Worksheet Identifying Clauses in Complex Sentences Worksheet Creating Complex Sentences Worksheet Fun with Complex Sentences Worksheet Completing Complex Sentences Worksheets Finding Dependent Clauses Complex Sentences Worksheets Finding Independent Clauses Complex Sentences Worksheets Custom Search
[ "Sentences Worksheets", "Complex Sentences Worksheets" ]
http://englishmonarchs.co.uk/tudor_18.htm
Catherine Parr ( 1512 - 1548 ) Early Life The sixth and final wife of Henry VIII , Catherine Parr was born in 1512 , according to some authorities at Kendal Castle in Cumbria and was the daughter of Sir Thomas Parr and Maud Green . Maud Green had served as a lady - in - waiting to Henry VIII ' s first wife . Catherine of Aragon and named her daughter after her mistress , who stood as godmother to the child . Sir Thomas Parr was a companion in arms to the young Henry VIII and had been present at the Battle of the Spurs in 1513 . Catherine had two siblings William and Anne . The Parrs were an influential northern aristocratic family and in common with all the wives of Henry VIII , she could claim a royal descent . Catherine descended through the powerful northern family , the Nevilles , to the Beauforts , illegitimate descendants of Edward III ' s fourth son , John of Gaunt , Duke of Lancaster . Her father Thomas Parr died in November 1517 , leaving his children to be brought up by their mother . Catherine received an excellent education and became fluent in French , Latin and Italian . At the age of around fifteen , she was married to Edward , Lord Borough , the son of Thomas , Lord Borough , who had been chamberlain to Anne Boleyn . Following the death of her first husband , Catherine was married for a second time at around the age of twenty one , to the elderly John Neville , 3rd Baron Latimer , of Snape Castle . Lord Latimer had been married twice previously and had two children , a son and a daughter , to whom Catherine became an admirable step mother . Her second husband died in 1543 , leaving Catherine well provided for . No issue resulted from either marriage . Marriage to Henry VIII Following the death of Lord Latimer , Catherine attracted the eye of Thomas Seymour , the brother of Jane Seymour , but when the king expressed an interest in her she was obliged to accept his proposal . The marriage of Henry VIII and Catherine Parr took place on 12 July 1543 at Hampton Court Palace , both the king ' s daughters and his niece , Lady Margaret Douglas attended the ceremony . Henry VIII , now a grotesquely bloated remnant of the vibrant and athletic young man who inherited the English throne in 1509 , was ageing fast and in failing health . He suffered from a suppurating ulcer on his leg , which was extremely painful and had become vastly overweight . The new queen was a tall woman with auburn hair , she was not considered to be beautiful and contemporary descriptions describe her as ' pleasing ' ' kind ' and ' gracious ' . Henry ' s fourth wife , Anne of Cleves exclaimed in surprise when she heard of their impending wedding that Catherine was ' not nearly as beautiful as she ' . She described the king as ' so stout that three of the biggest men that could be found could get inside his doublet . ' Catherine made efforts to foster good relationships with Henry ' s three children from his previous marriages , Mary , Elizabeth and Edward . She took a lively interest in their education and brought them to court attempting to create a family life for them , which had been conspicuously absent prior to her arrival . As a mark of Henry ' s trust in her considerable abilities , she was appointed in the position of regent of England when he embarked on his last campaign to France . The Queen produced a number of written works , ' Prayers and Meditations ' which was an anthology was published in November 1545 , and received enthusiastic comments from the scholars of the day . Her second book , ' The Lamentations of a Sinner , ' discussing Christian behaviour , commented that married women ' learn of St . Paul to be obedient to their husbands ' . As the king visibly declined , the Catholic and Protestant factions struggled to obtain power during the long minority reign which would inevitably follow . Attempts were made to bring about the demise of the Queen , who had strongly Protestant sympathies and was not reluctant to eagerly expound her religious beliefs to her husband . Catherine ' s enemies pounced and a Bill of Articles , outlining her supposed heresies , was drawn up . Catherine was forewarned of the danger and understandably terrified by the fate of her predecessors , threw herself on her husband ' s mercy . Henry accepted a highly flattering explanation from her . When her enemies came the next day to arrest her , Chancellor Wriothesley was set upon by the King . Later years After the death of her formidable third husband on 28 January 1547 , Catherine retired from court following the coronation of her stepson , Edward VI , on 31 January 1547 , to her home at Old Manor in Chelsea . But six months after the death of King Henry VIII , Catherine was secretly married to Thomas , Baron Seymour of Sudeley and Lord High Admiral . Neither King Edward VI or his council were informed of the marriage for several months . A disagreement developed between Catherine and Anne Stanhope , the wife of the Lord Protector Edward Seymour , 1st Duke of Somerset , and her former lady - in - waiting . The Duchess of Somerset argued that as queen dowager , Catherine was no longer entitled to wear the jewels belonging to the wife of the king . Instead she , as the wife of the protector , should be allowed to wear them . Eventually , the Duchess did win the argument , which left her relationship with Catherine permanently scarred . In 1548 , Catherine invited her step - daughter , the Lady Elizabeth and her cousin , Lady Jane Grey , daughter of the Duke and Duchess of Suffolk , to stay in the couple ' s household at Sudeley Castle in Gloucestershire . Thomas Seymour was later alleged to have made advances to Catherine ' s step daughter , the Lady Elizabeth , while was residing in Catherine ' s household , and was suspected to have been planning to increase his influence by a marriage to her . Seymour abused his position as Elizabeth ' s step - Her former marriages having produced no issue and widely believed to be barren , Catherine became pregnant at the age of thirty - five . She gave birth a daughter , named Mary Seymour , on 30 August 1548 . Catherine died of puerperal fever six days later , on 5 September 1548 , at Sudeley Castle in Gloucestershire , and was buried in St . Mary ' s Church , next to the castle . Lady Jane Grey acted as chief mourner at the funeral . Thomas Seymour was later executed on a charge of high treason by his brother the Lord Protector Somerset and his property forfeit to the crown . Catherine ' s young daughter Mary was taken into the household of Catherine ' s friend , Catherine Willoughby , the dowager Duchess of Suffolk , but sadly is thought to have died soon after her second birthday . The remains of Catherine Parr were not allowed to rest in peace . Sudeley Castle became a royalist stronghold in the English Civil War and was later left in a ruinous state on the orders of Parliament . Queen Catherine ' s coffin was discovered in the ruins of the chapel in 1782 by a Mr . John Lucas . He opened the coffin and observed that the body , after 234 years , was ' uncorrupted ' . After helping himself to a few locks of her hair , and in 1792 it was reinterred upside down by a The coffin was officially reopened by the Rector of Sudeley in 1817 , now overgrown with ivy , nothing but a skeleton remained . At the restoration of the chapel her remains were again moved and an altarpiece was erected at the north side of the sacrarium to her memory , which includes a marble effigy of Catherine , rendered as lifelike as possible by use of her surviving portraits . External Links Danby Castle home of Catherine Parr and John Neville , Lord Latimer Kendal Castle reputed birthplace of Catherine Parr
[ "Catherine Parr", "Henry VIII", "Kendal Castle" ]
http://englishmonarchs.co.uk/windsor_6.htm
Diana , Princess of Wales 1961 - 1997 Early Life The popular and much loved Princess Diana was born on 1st July , 1961 , at Park House , on the Queen ' s Sandringham estate in Norfolk . Christened Diana Frances , the new arrival was the third daughter of Edward John Spencer , Viscount Althrop and Frances Ruth Burke - Roche , the daughter of Maurice , Baron Fermoy and the Scottish Ruth Sylvia Gill . The Spencers were an established landed family who descended from the great John Churchill , Duke of Marlborough and from King Charles II . Diana had no less than four descents from Charles II , through his illegitimate offspring . These include James Scott , Duke of Monmouth , Charles ' eldest son by his mistress Lucy Walter , in a bid for the crown , Monmouth led a rebellion against his uncle James II , and was later executed , Henry Fitzroy , Charles ' son by Barbara Villiers , Duchess of Cleveland , Charles Beauclerk , the king During the course of its long history , the Spencer family had produced such disparate characters as the saintly George Spencer , Father Ignatius of St . Paul , ( 1799 - 1864 ) a famous Jesuit and Georgiana Spencer , Duchess of Devonshire , ( 1757 - 1806 ) an eighteenth century society beauty , whom the admiring George IV described as " the best bred woman in England " , Georgiana , a famous gambler had several extra marital affairs and produced an illegitimate child , causing a scandal at the time . A previous Lady Diana Spencer had narrowly missed becoming Princess of Wales , when her ambitious grandmother , Sarah Churchill , Duchess of Marlborough had planned to marry her favourite grand daughter to Frederick , Prince of Wales , the son of George II . The extremely wealthy Sarah had offered a large dowry to whet the Prince ' s appetite and he declared himself amenable to the match . However Sarah ' s plans were thwarted by the Prince ' s parents , who disapproved and Lady Diana was instead married off to the Duke of Bedford . Other famous descendants of the family include the naturalist Charles Darwin , Lady Caroline Lamb , author Gavin Maxwell and U.S Presidents George Washington , Franklin Roosevelt and George W Bush . Viscount Althrop and his wife already had two daughters , Elizabeth Sarah Lavinia and Cynthia Jane , a son , John , had been born and died shortly after and the couple were said to want a son to replace him , a male heir to inherit the Spencer title and large estates . The sensitive Diana was always to feel the profound disappointment that she had not been born a boy . The arrival of the much desired son and heir , Charles Edward Maurice , three years later , completed the family . The Spencer ' s marriage was a stormy one and in 1967 , Frances Spencer left her husband for the wallpaper businessman Peter Shand - Kydd , whom she later married . Although Frances hoped to obtain custody of her children , she was thwarted by her husband , a bitter and acrimonious court battle followed in which Earl Spencer was supported by Frances ' mother , Ruth Burke - Roche , custody of the children was granted to the Earl . Frances was never to forgive this betrayal by her mother . Diana , deeply affected by her parents The Spencer children continued to see their mother regularly and often spent school holidays at Frances ' new home in the north - west of Scotland . As was the custom among the aristocracy at the time , Diana was sent off to boarding school at Riddlesworth Hall and later to West Heath Girls School in Kent . On the death of her grandfather , Jack Spencer , in 1975 , Diana ' s father inherited the family title and estates and became the 8th Earl Spencer . The family left Park House and moved into Althrop , the Spencer family seat in Northamptonshire . The rambling 450 year old stately home , with its collection of old masters , was a vast and creepy place to the Spencer children but the family eventually settled into their new home . Earl Spencer ' s second marriage to Raine , formerly Countess of Dartmouth and daughter of the romantic novelist Barbara Cartland , a colourful and strong headed character , did not meet with the approval of his children , and it was never to be a peaceful household . On her arrival ' Raine stopped play ' was caustically entered into the visitor book at Althrop . When Earl Spencer suffered a near fatal brain haemorrhage in 1978 , Raine refused to let his children have access to his bedside . A situation which did little to heal the breach between the two opposing sides of Earl Spencer ' s family . The Earl recovered largely due to the tireless efforts of his wife , but the bitter rift between her and his children had widened . Diana was never to be academically inclined and on leaving school at sixteen without a single O level was enrolled at a Swiss finishing school , the Institut Alpin Vidamenette . Diana was then a chubby teenager who seems to have acquired the reputation of something of a glutton . She was unhappy there and terribly homesick , bombarding her parents with a constant stream of letters pleading to be allowed to return home , after two weeks they relented . On her return , her indulgent father bought her a London flat , which she shared with friends . Diana had long cherished childhood dreams of being a ballet dancer , but had to relinquish them when she grew too tall . As she had always been fond of children , she embarked on a career first as a nanny and later as a nursery assistant at the Young England Kindergarten in Pimlico , London . Diana ' s relationship with Prince Charles The young Diana Spencer had first met her future husband , Prince Charles , in a ploughed field at Althrop . He was present at a house party as the guest of her older sister , Sarah , with whom he was conducting a romance at the time . Charles love life had long been the subject of intense media speculation . After the murder of his great uncle , Lord Mountbatten , by the IRA in 1980 , which deeply affected him , the young Diana ' s offers of comfort touched a chord . Diana herself was very much in awe of her future spouse and throughout their courtship had to Diana seemed to fit all the specifications for a royal bride and future Queen , aristocratic , Protestant , young and without a past and Charles , under pressure from his father , the Duke of Edinburgh and the mounting media speculation about a possible engagement , duly proposed and was accepted in early 1981 . Diana moved into Clarence House , the London home of the Queen Mother . She was to be perturbed and distressed when during their engagement , her fiancee sent a present of a bracelet to his old flame , Camilla Parker - Bowles . There were plentiful tears and scenes when she overheard Charles telling Camilla on the telephone , " Whatever happens , I will always love you . " The royal marriage Wedding of Charles and DianaThe couple ' s marriage took place at St . Paul ' s Cathedral on 29th July , 1981 . It was performed by the Archbishop of Canterbury who described it as " the stuff of fairy tales " . The ceremony was watched by a worldwide television audience of an estimated one billion people . The early part of their honeymoon was spent at Broadlands , the stately home of Lord Mountbatten , following in the footsteps of Charles ' parents , who had also honeymooned there . The couple then embarked on an extended cruise of the Mediterranean on the royal yacht , Britannia . It was during this cruise that Diana ' s problems with bulimia nervosa were reported to have first surfaced . The princess was deeply distressed when photographs of Camilla Parker - Bowles fell from Charles ' diary . The fairy tale marriage did not get off to a very auspicious start , the fundamental differences in the two parties manifested themselves early on . Diana desperately needed support and affection as she struggled to cope with the onerous task of her new role in the fierce media spotlight that was relentlessly focused on her . This , she strongly felt , her husband failed to provide . Charles , although concerned , failed to understand his young wife ' s problems . The new Princess of Wales soon became pregnant with what was hoped would be a male heir to the throne . In the early stages of her pregnancy she was extremely unhappy . During the course of an argument with Charles , she threw herself down the stairs at Sandringham House . Diana was found by the Queen Mother , who was greatly shocked by the experience . Fortunately , although she had some bruising around the stomach , the foetus was unharmed . Other distressing incidents where to follow , where , desperate for attention from her husband , she threw herself into a glass cabinet and cut her wrists with the serrated edge of a lemon slicer . Throughout these troubles a public show of togetherness had to be maintained . The British public began to take ' Shy Di ' to their hearts , charmed by her stunning good looks and empathetic nature , they developed a voracious appetite for photographs and magazine articles about their Princess , fueling a circulation war amongst the tabloid press . The troubled marriage produced two sons , Prince William Arthur Phillip Louis , born on 21 June , 1982 and Prince Henry Charles Albert David , known as Harry on 15 September , 1984 . Despite being an instant success with the public , the new Princess of Wales was haunted by her lack of self - esteem and confidence and was terrified by the huge crowds that flocked to see her at royal engagements . The intense media interest in every aspect of her life proved to be a great strain . She continued to suffer from the eating disorder , bulimia nervosa , making her painfully thin . The illness had its roots in her troubled childhood . The strain of trying to adjust to the changes in her life and to her new position , under the glare of the media spotlight , lead to depression . Charles failed to understand his highly strung young wife ' s problems and increasingly resented being upstaged at every turn by Diana , whose immense popularity overshadowed his own and showed no signs of abating . He was irked by the fact they when he made an important speech it would invariably be ignored and media attention would instead inevitably focus on what outfit his wife was wearing that day or her current hairstyle . Public interest in Diana was such that her face on the cover of a magazine or newspaper guaranteed huge sales . She was universally admired The Princess was deeply wounded when Charles , as a consequence of the troubles in their marriage , renewed his relationship with his old flame , Mrs . Camilla Parker - Bowles , a married woman with two children . As the rift in their marriage yawned to a gaping chasm , Diana was haunted by Charles ' ever closer relationship with Mrs . Parker - Bowles but the couple continued to put on a show of togetherness for the cameras . Diana began to deeply resent the irony of the situation and her husband ' s attitude toward her Diana , at a low ebb and as she later said , " at the end of my tether , " secretly collaborated with the author Andrew Morton , in a book which exposed the royal marriage as the sham it had become and chronicled in vivid detail Diana ' s struggle with bulimia and the several suicide attempts the unhappy Princess had made . It also catalogued her grievances at her husband ' s indifference to her plight and continued relationship with his long - term mistress . The book became a best seller overnight . Diana denied any involvement . As a direct result of the furore and scandal the book caused and Charles reaction to what he saw as total betrayal , an official separation was decided upon on 9th September , 1992 . Charles made an attempt to improve his battered reputation by appearing in a TV documentary with Jonathan Dimbleby , aimed at portraying him in a better and less partisan light , in which he publicly admitted his adultery with Mrs Parker - Bowles . Diana later appeared on the TV programme Panorama , where she publicly aired her grievances against Charles and famously stated " There were three of us in this marriage , so it was a bit crowded " . She also admitted her affair with army officer James Hewitt . The Queen , concerned that her son and daughter - in - law ' s bickering and point scoring was damaging the monarchy and was distressing for their children , urged the couple to divorce . They were granted a decree nisi on 28th August , 1996 . They agreed to share custody of their children and Diana was paid a lump sum settlement of seventeen million pounds . Single again The Princess indulged in a series of much publicized relationships , her connection with Oliver Hoare , a married art dealer , was splashed all over the newspapers and to her mortification , the fact that she was reported to the police and accused of making nuisance calls to his home by his wife , Diane , was made public . She became embroiled in further scandal when she was romantically connected to the rugby player , Will Carling , another married man . When it consequently caused the end of his marriage , Diana brought much criticism upon herself The last years of Diana ' s life saw an escalation of media interest , cameramen literally followed her everywhere in the hope of a scoop picture which would make them millions . She had naively hoped that once she left the royal family she would be able to lead a normal life , but realised it was not to be . As her brother , Earl Spencer , later commented with irony , " The girl given the name of the ancient goddess of hunting , in the end , became the most hunted person of the modern age The Princess embarked on a campaign to ban land mines , a cause very near to her heart . Using the ever present media attention to focus the World ' s attention on the plight of the many children and young people who had sustained terrible injuries and lost limbs by the deployment of these terrible weapons . Her actions were not well received by all sections of British society and some Members of Parliament labeled her a loose cannon . The Princess met Dodi Fayed , the millionaire playboy son of the controversial Egyptian owner of Harrod ' s department store , due to her stepmother Raine Spencer ' s friendship with Mohammed al Fayed . As rumours of a possible engagement grew , press interest in the relationship rose to fever pitch and the couple found themselves relentlessly pursued by paparazzi photographers during a Mediterranean holiday . Such was the public interest in Diana , that photographs of her and her boyfriend on holiday together were selling at amazingly inflated prices . Cameramen jostled with each other to obtain the best shot . The couple were besieged by the notorious paparazzi in the Paris Ritz Hotel , owned by Dodi ' s wealthy father , during the last stage of their holiday , a planned romantic weekend in Paris . The death of Diana On the late evening of Saturday , 30 August , 1997 , in attempt to escape these unwanted attentions , the couple left the Ritz Hotel by the rear entrance in a black Mercedes S - 280 , while a decoy car was driven from the front entrance of the hotel . Dodi ' s bodyguard , Trevor Rhys - Jones , was seated in the front next to driver Henri Paul , Diana and Dodi were in the back of the limousine , it was noted that only the bodyguard , Rhys - Jones , was wearing his seat The vehicle was pursued by paparazzi photographers as it recklessly raced at high speed through Paris , with many of the motorbikes dropping behind . As the Mercedes entered the Pont de l ' Alma tunnel under the River Seine , a notorious accident black spot , it was on the left of two lanes , and at this point was travelling at a speed that has been estimated to be 65 m.p.h . While attempting to pass a slow moving vehicle in front of them in the left lane , the driver Henri Paul swerved sharply to the right , causing the rear right side of the vehicle to scrape the right wall of the tunnel . This Paul tried to correct by veering left , causing the car to career into the reinforced concrete thirteenth pillar of the underpass . Witnesses described the sound as being like an explosion . The car ricocheted back , spinning out of control . The Mercedes came to a halt , a smoking mangled heap of Dr . Frederic Mailliez , who was travelling home by the opposite carriageway of the tunnel at 12.24 a.m. , pulled over , reached for his emergency bag and ran across to help tend to the victims . Dodi Fayed and Henri Paul were clearly dead , Trevor Rhys - Jones , seated in the front passenger seat , was alive but had suffered shocking facial lacerations . The Princess was seated on the floor in the rear of the vehicle , with her back to the drivers seat , her right arm , which was clearly dislocated , bent To Dr Mailliez , she seemed to have the best chances of survival , Diana was found to be in a semi - conscious agitated state , flailing her arms about and muttering , partly unintelligibly . While Dr . Mailliez attempted to make her more comfortable and administer oxygen , the paparazzi , who flocked around the car continued to take pictures of the dying princess from all angles through the open door of the vehicle . On the arrival of the emergency services , the photographers were arrested and their cameras and film confiscated . Diana received further emergency treatment in the car , witnesses reported she uttered " My God " several times , was very agitated and pulled out a drip which had been inserted . A sedative was administered to calm her and relieve pain . Diana and Trevor Rhys - Jones were carefully and slowly extricated from the mangled wreckage and transferred to two SAMU ambulances . By this time , the Princess ' condition , which until then had not been On arrival at the Pitie Salpetriere Hospital , one hour and forty six minutes after the accident , Diana suffered a further cardiac arrest , X - rays revealed internal bleeding in the thorax , she was found to have suffered a thoracic haemorrhage from a torn pulmonary vein , she also suffered a tear in the pericardium , which is the sac in which the heart is contained . The severed vein was sewn and frantic efforts to revive her were made , including open heart massage and electric shocks , without success . By general consensus of the Prince Charles , anxiously waiting for information on his ex - wife ' s condition by the telephone at Balmoral in Scotland where , along with other members of the royal family , he was spending the traditional summer holiday , reached a decision with his mother , the Queen , not to awaken the Princess ' two young sons , William and Harry , until the morning . The news of Diana ' s tragic death was relayed to Charles shortly after and to him descended the onerous task of informing their two young sons of their mother ' Clearly visibly moved , Charles travelled with the Princess ' two sisters , Jane and Sarah , to Paris , to collect her body and return it to England . The Princess butler , Paul Burrell , travelled to Paris with a black evening gown to see that she was suitably attired for her last journey home . The coffin was draped with the royal standard . Prime Minister Tony Blair addressed the nation on television , coining the popular phrase the People ' s Princess . While her body lay in St . James ' Palace , a vast sea of floral tributes began to build up outside Diana ' s London home at Kensington Palace , at Buckingham Palace and at Althrop . In death , as in life , it seemed , she reached out to thousands . Crowds flocked to London to pay their respects , queuing for hours to sign books of condolence . Prince Charles and the couple ' s two young sons , William and Harry , went out into the streets to view the flowers and to meet and Diana ' s Funeral Diana FuneralA unique state televised funeral was planned for Diana in London , watched by an estimated two billion worldwide audience . Charles , whose reputation had now reached its nadir , walked with their two young sons behind the coffin on its sad journey to Westminster Abbey , accompanied by the Duke of Edinburgh and the Princess ' brother , Charles , Earl Spencer . As tributes continued to flood in from all around the globe , the public turned up to line the route and express their grief in their millions . As the cortege passed Buckingham Palace , the royal family stood outside to express their respect and the Queen herself inclined her head to the coffin of her daughter - in - law . The royal standard above Buckingham Palace , contrary to tradition , was lowered to half mast , following severe censure of the Queen in the newspapers . Prince William never raised his head along the long traumatic walk After the playing of a passage from Verdi ' s Requiem , a favourite of Diana , Elton John played his new rendition of Candle in the Wind , rewritten for the Princess . Her brother , Earl Spencer read his tribute to his sister in a voice cracked with emotion , it was greeted by rounds of applause from the crowds gathered outside , which reverberated into the Abbey itself , an audible censure of the Windsors . The coffin was then taken the eighty miles to Althrop in Northamptonshire , Diana ' s childhood home , for a private family burial . Crowds lined the entire route , throwing flowers at the hearse , even from motorway bridges . She was buried on an island , in the middle of a lake on the estate , known as the Oval . Earl Spencer later spread the public ' s floral tributes to the Peoples Princess on her island grave . The media circus that Diana ' s death evoked showed no sign of abating after her burial . The circulation war continued and focused on the rift between the Spencers and the Windsors , regardless of the feelings of her two grieving sons , to whom it must have been deeply offensive as they attempted to cope with their bereavement . A visitor centre at Althrop covering the life of the Princess is now open to the public during the summer months . Diana - the Aftermath , Conspiracy theories and Inquiries
[ "Princess Diana", "Edward John Spencer", "Norfolk" ]
http://englishonline.tki.org.nz/English-Online/Planning-for-my-students-needs/Exploring-language/Pattern-of-Text-Genre
Patterns of Text : Genre The Grammar Toolbox has described the grammar within the sentence . However , written texts have linguistic and structural patterns that go beyond these features and that are also important in our knowledge of grammar . The structure , grammar , and vocabulary of written texts vary depending on why we are writing , who we are writing for , and what we are writing about . We refer to these predictable patterns in written language as genres . Becoming a writer and reader involves understanding the patterns and being able to use them flexibly . In this book , the term " genre " is not used to define a set of rigid text structures but rather to describe the range of processes ( such as explaining , instructing , recounting , describing , arguing , and narrating ) used to produce texts that reflect the purpose and the intended audience . Genre is different from forms or types of writing , such as letters , plays , sonnets , formal debates , and so on . A letter , for example , can be written for a whole range of reasons : to thank Most texts produced and read by students combine a range of genres . The basic grammatical features tend to remain the same across genres , but distinct genres do have recognisable linguistic characteristics and structures . A skilled writer has a core of linguistic knowledge to draw on when making decisions on how to apply these characteristics and structures for different social and communicative functions . Collerson , in Writing for Life , summed up genre well : We can think of genre as a social process , i.e. as a particular set of activities or a way of doing something [ . . . ] these activities are carried out for some purpose . This is true of any genre ; it is a social process which has a purpose - some goal that people are working towards . It also has a recognisable structure or pattern . Finally , a genre is something that arises within a particular culture ; it is a product of the culture . The purpose of the writing , the intended audience , and the topic together influence the choice of genre . Writers have a range of choices they can make about the way they organise the text , develop the topic or theme , use particular grammatical structures , and choose the vocabulary . All these decisions influence how the message is read by the reader . For example , in reading about grammar teaching in New Zealand schools , readers would have very different expectations of texts that began : " Once upon a time . . . " and " A return to teaching formal grammar in New Zealand classrooms is long overdue . . . " Readers would expect the first beginning to lead into an anecdote or narrative of some sort , whereas the second is likely to set out an argument . Readers would anticipate quite different structures in the texts , depending upon the writers ' intentions . Texts are structured in different ways to achieve their purposes . The purpose of a recount is to tell about a past experience - to tell the reader what happened . The focus is on a sequence of episodes , all usually related to one particular event . The time sequence of the episodes structures the text . A recount usually begins with an orientation , giving the reader sufficient background information to understand the text . The reader is told who is involved and where and when the event took place . A series of episodes unfolding in a The purpose of an argument , on the other hand , is to persuade the reader to agree with a point of view . Arguments often begin with a statement of position and some background information about the issue . There is usually a logical sequence to an argument , with points being raised and supported by evidence and finishing with a summing up of the position . The resulting text can often be linguistically identified by the use of emotive words , verbs in the timeless present tense , and connectives associated with reason such as so , because The structure of texts is so much part of the whole that it usually goes unnoticed by the reader . Sometimes this inherent internal structure is referred to as " global coherence " , and it is only when it breaks down , or changes in some way , that we become aware of the structure itself . In the following extract from Julius : the Baby of the World , by Kevin Henkes , the language patterns change when Lilly tells her story to the baby . One morning , while Lilly was busy playing opera , her mother said , " Why do n ' t you put some of that verbal exuberance to good use ? Why do n ' t you tell Julius a nice story ? " " He ' s too little to understand a story , " said Lilly . " He can understand it in his own way , " said Lilly ' s mother . " Okay , " said Lilly , smiling . " JULIUS , THE GERM OF THE WORLD . BY ME , " said Lilly . " Once upon a time , " said Lilly , " there was a baby . His name was Julius . Julius was really a germ . Julius was like dust under your bed . If he was a number , he would be zero . If he was a food , he would be a raisin . Zero is nothing . A raisin tastes like dirt . The End , " said Lilly . The story earned her ten minutes in the uncooperative chair . The author changes the physical layout of the text at the same time as it changes from conversation into the narrative tale . Repetition of sentence beginnings is used , along with more emphatic statements and simplified vocabulary . These changes help make Lilly ' s story stand out from the rest of the text . The purpose of the writing influences the overall structure of texts ; however , writers also use different language , depending upon the situation in which the texts are to be used . Writing can range from " close " personal writing ( expressive ) at one end of a continuum , to " distant " impersonal ( often transactional ) writing at the other . The type of language used depends on several factors . One factor is the writer ' s relationship to the subject matter , sometimes referred to as the " field " . At the most personal end of the continuum , writers write about themselves and people they know . This type of writing is characterised by the extensive use of personal pronouns , in particular " I " , " he " , " she " , " we " , and " they " , as the following extract shows . I see her come up the street all ready for school , and as soon as her hand moves upwards to wave my whole composure changes . It ' s time to start pretending for another six hours that I am a carefree girl only interested in getting out of school quick . The third year of hiding my feelings , shielding them away from everyone else . Just so I can fit nicely into place like a well - rounded jigsaw piece . Rebecca Spratt ( Maidstone Intermediate School ) At the impersonal end of the continuum , the writer writes about objects , ideas , and processes rather than people . Personal pronouns can occur , but they tend to be restricted to " it " and " they " . In the following extract , Jamie uses noun phrases rather than pronouns . Early forms of tennis are thought to have been played in Egypt , Persia , and Arabia . A form of the game where the players used their fists instead of a racket , was introduced into France in the 14th century . Jamie ( 11 years ) There is a whole range of writing between the two extremes described above . This indeterminate area of writing is personal in that it is about people , but people who are not personally known to the writer . The focus may be on ideas , but written from the point of view of someone involved . The predominant pronouns used are " he " , " she " , and " they " . Another factor is the relationship between the writer and the reader , sometimes referred to as the " tenor " . How well the writer knows the reader , the age of the audience , their relative status , and how a writer feels about the reader ( s ) all influence the language used by the writer . When writers write for themselves or for someone they know , they frequently use the pronouns " I " and " you " . Such writing is most often found in memos , personal letters , diaries , and stories written by students for the teacher , themselves , their friends , or close family . Personal writing often uses language that In impersonal writing , the writers are writing for an audience that is distant and unknown . The writers do not appear in the text , nor do they acknowledge the reader . Impersonal writing is characterised by no expression of personal feelings , no use of personal pronouns , and a formality arising from the choice of vocabulary and the use of the passive voice . This is the type of writing often found in academic texts . The extract from Jamie ' s writing shows an example , especially the use of the passive verb in the first Early forms of tennis are thought to have been played in Egypt , Persia , and Arabia . A third factor is the means of communication , sometimes referred to as the " mode " . In this chapter , we are looking at the written mode . New modes of communication often develop new sets of appropriate language behaviours . With electronic mail , it is considered rude to type in upper case letters because this is seen to be the equivalent to shouting . These three factors : the writer ' s relationship to the subject , the writer ' s relationship with the audience , and the means of communication , together determine the style of the text . There is no hard and fast rule for the sort of language typically used in each situation , but we can generally predict the patterns of language most likely to be used for each purpose and audience . In some older texts , the term register was used to classify language and style used in different situations . In this book , we have used a narrower meaning of register to describe specialised vocabulary associated with specific situations . To summarise , texts vary in a number of ways according to their purpose ( genre ) and their situation ( style ) . The genre determines the structure of the text , whereas the style and register determine the language patterns and vocabulary used within the text . Exploring language content page Exploring Language is reproduced by permission of the publishers Learning Media Limited on behalf of Ministry of Education , P O Box 3293 , Wellington , New Zealand , ยฉ Crown , 1996 . Published on : 25 Feb 2009
[ "Grammar Toolbox", "Genre", "structural pattern" ]
http://englishsikh.co.uk/?page_id=7
Family In English we have it easy there are only 2 words for Uncle and Aunt In Punjabi however the words are different depending on what side of the family they are on and whether they are younger or older On this page I will try to list all the different relation terms that are used in Sikh culture It gets complicated so bear with me Pita Father Maa Mother Puraa or Bahji Brother Behn Sister Thaiya Fathers older brother Thaiy Fathers older brothers wife ChaCha Fathers younger brother ChaChi Fathers younger brothers wife Bhua Fathers sister Fuffar Fathers sisters husband Mama Mothers brother Mami Mothers brothers wife Masi Mothers sister Masur Mothers sisters husband Baba Grandpa Paternal Bibi Grandma Paternal Nanaa Grandpa Maternal Nani Grandma Maternal Jija Brotherinlaw Bhabi Sisterinlaw Puttar Son Puttari Daughter This diagram might show it more clearly Click to view a bigger image 67 Responses to Family Ranjeet Kaur says September 21 2018 at 717 pm Hello quick question is your Maa parents not Nanna Mum dad Nanni mums mum Reply Anonymous says October 14 2018 at 1104 pm Your maas parents are Nanna and Nanni Reply Anonymous says October 15 2018 at 717 am Thank you for replying the flowchart shows it as daada daadi Reply iqbal says August 16 2018 at 731 pm is bhabi supposed to be pronounced bhabi or pabhi because i always hear pabhi when people say it i always hear pehn instead of behn i always hear pua instead of bhua i always hear paji instead of bhaji are my ears not working correctly Reply Anonymous says October 9 2018 at 1027 pm in punjabi their are regional differences in pronunciation so sometimes the bh sounds can be swapped with p both are totally fine and punjabi speakers will generally understand what the other person is saying since the meaning stays the same regardless of how it is pronounced Reply Anonymous says July 10 2018 at 632 pm Very informative as my daughters partner mother wants their twins to call her Beebi ji sorry wrong spelling and wanted clairfication Reply Cynthia says April 27 2018 at 557 am what means by too ji Reply Anonymous says May 11 2018 at 119 am i think its just a respect thing like when addressing someone older i add ji at the end Reply gigglegutts says March 13 2018 at 351 pm sister in law is wrong i call mine a cunt sounds more appropriate Reply Anonymous says April 16 2018 at 926 pm With words like that you dont make yourself look good Reply Anonymous says December 20 2018 at 248 am nice Reply Anonymous says December 20 2018 at 249 am epic Reply Anonymous says December 20 2018 at 250 am gottem Reply Anonymous says February 20 2018 at 707 pm What do you call your husband sister in law his brothers wife when talking to her face to face Reply Teg says February 23 2018 at 212 am If ur husbands brother is younger then call her wife deyor rani If hes older then jethani pronouncing these words are little differnt than writing better ask some elder in house Reply Jessica Favron says December 26 2017 at 738 pm what do I call my punjabi husbands sister she calls me bhabi but is it differently terminology for me to call her sister Reply Anonymous says January 20 2018 at 759 am Its Nanaanfirst a is silent Reply Anonymous says February 3 2018 at 427 pm You would call your husbands sister Dede or Bhabhi ji Reply Anonymous says March 7 2018 at 349 pm Text in inbox on whtsap 00917888834881 Reply Anonymous says April 10 2018 at 1023 am Ur from Reply Anonymous says May 7 2018 at 753 am Yo dumb bitch you can say bhabi ji Reply Abdul Ahad Anjum says November 23 2018 at 517 pm Nanaan 923346375555 Reply Anonymous says October 2 2017 at 804 am can i know wat to call my maser sister Reply Anonymous says September 18 2017 at 150 pm Hi I think there are a few missed off like deer deerani salla salli jiji and many more I understand the common ones explained here but the not so common would be helpful too Reply Anonymous says July 22 2017 at 826 am Where is bhabhi Reply Anonymous says June 6 2017 at 1016 am What will u call ur husband Like wife is called voti Reply Anonymous says October 15 2017 at 220 pm Ghar vala Reply Anonymous says May 25 2017 at 645 pm Reply Anonymous says May 17 2017 at 630 am What will be say to grandson in law Reply ADINA MIHAELA CONSTANTINESCU says May 12 2017 at 909 am hello just want to make sure I will get the right message on some handkerchiefs so may be someone can advice how to write in Punjabi The best dadthanks a lot Reply Anonymous says April 17 2017 at 1115 am gaint list Reply Anonymous says April 1 2017 at 944 pm Hi there ok so I just wanna make sure I use the correct spelling so Im hoping someone can help me my husband is punjabi and we had our daughter and I want to know how to spell grandpa in punjabi my husbands dad Reply europesinEurope Singh says March 6 2017 at 749 am My brothers grand kids call me Bapuji where does that fit in your terminology Reply Anonymous says July 28 2017 at 715 am bapuji is gujrati word pape Reply Anonymous says February 11 2017 at 135 am What would I call my wifes father or mother in Punjabi My father in law and mother in law who are Punjabi parents of my wife Reply Kim says February 21 2017 at 150 pm Sas for mother in law Reply Anonymous says January 1 2017 at 1251 pm If anyone can help me What do I call my son in law s baba Ji Reply Anonymous says April 19 2017 at 904 pm What ever your son in lows parents calling him you can call him same Reply Anonymous says November 29 2016 at 253 pm Hi what do you call great Grandfather paternal and Great Grand mother paternal My wife is pregnant and I call my Grandparents Babba Ji and Bibi Ji Then also what would my child call my Chacha Ji and Chachi Ji and my Pua Ji and Phuffar Ji I know its a lot but for some reason nobody has written anything including this extended family but we are all very close Thank you for any responses Reply Kim says February 21 2017 at 153 pm Par dada for great grandpa and par dadi for gret grandma Reply Devica says November 6 2016 at 842 am Thank you for this information When i saw it it brought a smile to my face Well done for the attempt to inform the public for although there are some inaccuracies atleast you unlike others have done something wonderful Reply Anonymous says October 9 2016 at 409 pm Im writing a story and have a small boy saying Big brother in Punjabi Are the examples above what an infant would use or is there something more casual endearing Reply Anonymous says October 17 2016 at 915 pm Veer or Veer Ji Reply Mansi says August 23 2016 at 437 pm In my family my mom and nani have always called my prnani my nanis mom beeji so does beeji mean mom or nani Reply Anonymous says September 2 2016 at 402 am Nani Reply Inderpal says August 12 2016 at 928 am Hi there thank you for this informative list can anyone tell me what my daughter would call my pua ji I am the mother Reply Anonymous says September 5 2016 at 345 pm maybe you are their farther sister Reply Anonymous says October 29 2016 at 812 am They can also call her bhooaji Reply Anonymous says June 23 2016 at 1258 pm what would someone call their grandfathers sister Reply Anonymous says May 7 2016 at 305 am This website has been very helpful I found what I was looking for Thank you Reply Anonymous says July 5 2016 at 138 pm dont we all Reply Eshan Kapoor says January 23 2016 at 620 pm Some info is right so is wrong I speak hindi and Punjabi and most of this is kind of wrong Reply Anonymous says October 28 2015 at 305 pm THIS WAS REALLY HELPFUL AND USEFUL INFORMATION GOOD WORK WELL DONE Reply MsShona says September 21 2015 at 744 am I love this thank you My grandmother fathers mother was the child of Indian indentured servants in the Caribbean I recently started researching my family Understand I am a Black American with very limited knowledge of anything Indian But I have a greataunt uncle that we call Nana Nani There is also a cousin we call Mr Pati Im floored that these nicknames actually mean something Understand there are no living members of my family who speak Hindi Punjabi or anything of the like BTW the first hint I received that there may be more to the names is in Reply Anonymous says May 4 2014 at 410 am idont understand about it if it really hindi or punjabi coz some words r not punjabi its hindi languages Reply Anonymous says September 3 2013 at 842 am A lot of thing are mentioned wrong Its not a useful article Seems written by some UK born person who do not know anything about punjabi culture Dadi is grandmotherpaternal and Nani is Maternal grandmother Its behn not pehn Its Bhua not pua Pati means husband Patni or wohti means wife Aadmi means a male Themee means a female Bhabi is sister in law not pabhii Reply Jasleen Kaur says October 31 2013 at 821 pm Thank you this is really helpful Reply tony singh says January 23 2014 at 710 am patipatni and aadmi are hindi wordsgharwala is husband and voti is wife in punjabi Reply tony singh says January 23 2014 at 711 am also ma and pita are also hindiusually mummydaddy is used Reply Anonymous says January 28 2015 at 532 am Yes it is punjabi as you mention not punjabi to hindi Reply Kaur says July 23 2012 at 950 pm Great list but some corrections needed Maternal Grandfather Nana Maternal Grandmother Nani Paternal Grandfather Dada Paternal Grandmother Dadi Baba or Papa can be used for either maternal or paternal grandfather Bebe or Bibi or Beejee can be used for either matpat grandmother Note the suffix of Jee should be added at the end of every relation for respect It would be considered rude to address an elder without Jee at the end ie Grandfather Baba Jee Cheers Reply Vince says July 20 2011 at 859 pm Thanks for the feedback if you have suggestions for any changes please let me know in the comments Reply GS Narula says July 20 2011 at 423 pm I reciprocate Sukhmandir Kaur However I was born in Panjab and had early upbringing in Panjab I feel some of the words are slightly away from correct pronunciation I am available to discuss or help if you feel so With regards and Best wishes in your mission GS Narula Reply Sukhmandir Kaur says June 24 2011 at 1141 pm This is a great list and diagram for understanding family relationships Reply Monica SinghChhina says March 30 2018 at 644 am Wow Arent u so cool What a jerk Reply Pingback The English Sikh Pingback Family structure The English Sikh Leave a Reply This site uses Akismet to reduce spam Learn how your comment data is processed
[ "Sikh", "English", "Family" ]
http://englishspringerspaniel.rescueshelter.com/Ohio
1641 English Springer Spaniel Dogs have been adopted on Rescue Me Post English Springer Spaniel for Adoption Help keep this page updated Click the small x to the right of a groups name and Shelter to report an error Ohio ViewPost English Springer Spaniel Dogs for Adoption in Ohio on Rescue Me Ohio English Springer Spaniel Rescue Groups TOP OF PAGE ADD NEW SHELTER OR RESCUE GROUP Listings are alphabetized by county when known Karma Dawgz Rescue Inc Shelter 1140409 x Franklin County Columbus OH 43229 New Tab CONTACT Mary Lehner 6143064535 RescueSheItercom We Rescue Shih Tzu and smaII Terrier type dogs or Scruffy Dogs BDBDBDBDBDBDBDBDBDBDBDBDBDBDBDBDBDBDBDBDBDBDBDBDBDBDBDBDfrom high kiII sheIters and any other dangerous situations We are not Iimited to onIy smaII dogs we aIso take Owner surrenders and breeder surrender We vet them and foster them and find suitabIe forever homes We are aII voIunteer we are not a sheIter Cherished Cockers Rescue Shelter 1110274 x Lake County Mentor OH 44060 New Tab CONTACT Christine Bacon 2164405626 Dennis Bacon 2163161822 Cherished Cockers lnc is an Ohio based aII voIunteer group of Cocker SpanieI Iovers who heIp Cockers SpanieIs receive the Iives that they deserve We are funded by donations and fund raising events which goes directIy to heIping the Cocker SpanieIs that have been rescued by Cherished Cockers Rescue We do not have a sheIter instead aII of our Cocker SpanieIs we rescue are Iiving in foster homes Cherished Cockers and our voIunteers are dedicated to rescuing whenever possibIe abandoned abused dispIaced injured and surrendered Cocker SpanieIs regardIess of age or physicaI condition We then provide them with veterinary care Blaze Saddles Springer Rescue of Indiana INC Shelter 1111459 x Marion County Indianapolis IN 46229 New Tab CONTACT MeIvin Curtis 3179193494 Rescue Line 3178943122 We are an EngIish Springer SpanieI rescue group heIping Springers in lndiana surrounding states as needed AII of our dogs are in private home foster care After carefuI evaIuation of a Springer neutering aII vaccines heartworm testing they are pIaced on our adoptabIe dog Iist English Springer Rescue America Ohio Shelter 1111707 x Wayne County Wooster OH OH New Tab NO EMAIL NationaI rescue organization for EngIish Springer SpanieIs This map shows how many English Springer Spaniel Rescue Groups are in each state Click on a number to view a list of all English Springer Spaniel rescue groups in that state Ohio Rescue Groups Help Spread the Word About this Website Please link to this English Springer Spaniel Dog Rescue Shelter Directory from your website Step 1 Place mouse over text below Hit CtrlC to copy text Step 3 Hit CtrlV to paste link into your web page
[ "Rescue Groups" ]
http://enigma.puzzlers.org/
The ENIGMA is the monthly magazine published by the National Puzzlers League a nonprofit educational organization founded in 1883 and distributed to its members You must be signed in to download issues of The ENIGMA If you are interested in joining the National Puzzlers League we encourage you to download our minisample of The ENIGMA Regular PDF Booklet Format PDF Guide to solving The ENIGMA Online Guide Contact Information
[ "The ENIGMA" ]
http://enoajobs.com/
Looking for a GREAT job ? E Noa Corporation specializes in providing great island experiences for Oahu ' s visitors through E Noa Tours and the Waikiki Trolley . If you ' re up to meeting new people from all over the world and sharing the Aloha spirit of our islands and our people , then we want to talk to you ! Take a look at our current openings below or apply now ! Trolley Driver Tour Driver Mechanic ( B ) Dispatcher Vehicle Cleaner
[ "E NOA CORPORATION" ]
http://enotriatranslations.com/
Enotria Translations is a specialized translation company , providing certified translations from French , Chinese , Croatian , German , Italian , Japanese , Portuguese and Spanish . We also provide cultural and localization services worldwide . Founded by attorneys who share over thirty years of legal and financial translating experience , Enotria Translations is dedicated to working closely with clients in all industries to provide accurate and timely translations which reflect the tone , style , and specific terminology employed in the original document . Enotria Translations is based in New York City , where over 150 languages and dialects are spoken . The linguists at Enotria Translations greatly enjoy what the do and look forward to working with you . When you work with Enotria Translations , you choose a strong , reliable partner to grow and expand with into the future . Why Choose Enotria Translations . . . A Reliable Partner Translation has become a necessity in today ' s world of global trade and e - commerce . Enotria Translations is a reliable partner in meeting these evolving challenges . Facilitating our clients โ€™ efforts to communicate and succeed in the global arena is our priority . Accuracy Enotria Translations unites traditional rigorous semantic and etymological understanding with modern technology to seamlessly transpose a text โ€™ s nuance and character from one language to another . Competitive pricing Enotria Translations โ€™ standards of excellence enable us to provide high quality service for each client , coupled with competitive rates to fit within budget constraints . We specialize in completing projects on time to meet even the strictest deadlines . The firm enjoys establishing lasting relationships built on trust , superior service , and confidentiality . Confidentiality Enotria Translations appreciates its clients ' concerns regarding confidentiality and security . All translations and associated documentation remain confidential . Our translators have confidentiality and nondisclosure agreements in place at all times . Enotria Translations considers and treats as confidential any and all information received in contemplation of retention of our services regardless of whether we are retained . Certified Translations Legal Translation Commercial Translation Corporate Translation Medical Translation Proofreading & Editing Revision & Certification of Existing Translations Apostille Technical Translation Localization Enotria Translations โ€™ translators access the most specialized dictionaries and treatises and work in teams with a project manager to ensure sector specific terms are accurately rendered .
[ "Enotria Translations", "Portuguese", "French" ]
http://enrichmentjournal.ag.org/200002/076_as_for_me_household.cfm
Back Table of Contents for this issue Word Study As for Me and My Household By Stanley M Horton Before calling for this decision Joshua gave good grounds for making the choice to serve Hebrew avad which includes the ideas of worship follow and do the will of the Lord How many times have you heard a pastor or evangelist use Joshua 2415 in a call for sinners to make Christ their Lord and Savior Choose for yourselves this day whom you will serve But as for me and my household we will serve the Lord The Hebrew word bachar to choose is often used of Gods sovereign purposeful deliberate choices such as His choice of Israel of the land of Zion Jerusalem of Judah of David and of Solomon When used of peoples choices it also speaks of a deliberate intentional choice a choice that has been the result of thought plan or desire Before calling for this decision Joshua gave good grounds for making the choice to serve Hebrew avad which includes the ideas of worship follow and do the will of the Lord He did the same thing Moses did in his farewell addresses in the Book of Deuteronomy Moses began by reminding the people that unbelief brought defeat but when they turned to the Lord in obedience and faith they received victories from Gods good hand Again and again Moses set before them lessons of history along with warnings and promises for the future He did this to let them see they had to make a choice Deuteronomy 112628 is an example See I am setting before you In Joshuas farewell address Israel is reminded of the lessons of history and the warnings of the Lord Joshua 23 and 24 He knew he was about to die so he said You know with all your heart and soul that not one of all the good promises the Lord your God gave you has failed But just as every good promisehas come true so the Lord will bring on you all the evil Hebrew hara the judgment he has threatened 231415 Next Joshua drew attention to Gods dealings in Israels history from Abraham to Moses to the victories in Canaan So I gave you a land on which you did not toil and cities you did not build and you live in them and eat from vineyards and olive groves that you did not plant 2413 Surely Gods goodness and provision gave reason enough for them to throw away all their idols and serve the Lord Though Joshua could set the example he could not make the choice for themthe people had to choose for themselves This may sound like a contradiction to Joshuas statement but as for me and my household we will serve the Lord But Joshua was simply proclaiming that he and his family had already chosen to serve the Lord Each member had to make his or her own choice Joshua however was a man in whom is the spirit that is the Holy Spirit Numbers 2718 We can be sure he had a powerful influence on the choices his household including The call or opportunity to choose sometimes using forms of the Hebrew word bachar is found again and again in the Bible It was all too easy for Gods people to slip back Too often the people chose their own ways doing evil in Gods sight choosing what displeased Him Isaiah 6634 They hated knowledge and did not choose to fear the Lord Proverbs 129 Too few were like the Psalmist who said I have chosen the way of truth Hebrew emunah which also means faithfulness Psalm 11930 Or like the sons of Korah who said Better is one day in your courts than a thousand elsewhere I would rather be Hebrew bacharti I have chosen to be a doorkeeper in the house of my God than dwell in the tents of the wicked Psalm 8410 Wisdoms call was Choose my instruction instead of silver knowledge rather than choice gold for wisdom is more precious than rubies and nothing you desire can compare with her Proverbs 81011 cf 1616 The call to choose for yourselves this day Hebrew hayyom today comes to us every day We do have to make an initial choice and commitment to serve the Lord But every day brings new challenges temptations and efforts of Satan and his demons to trip us up Besides old sinful desires keep cropping up and we have to keep choosing by the help of the Holy Spirit to put to death the misdeeds of the body Romans 813 Every day we must choose to count ourselves dead to sin but alive to God in Christ Jesus Romans 611 As Paul states Therefore do not let sin reign in your The choices God asked Israel to make all revolved around their relationship to Him He desired their good always and made every provision for them He loved them and wanted them to respond to His goodness with their love He made it possible for them to do so by His own merciful enabling Deuteronomy 306 Today our choices revolve around our relationship to the Lord Jesus God still speaks and His message to the disciples on the Mount of Transfiguration is for us today This is my Son whom I love Listen to him Mark 97 We can afford to listen to Him for He said My teaching is not my own It comes from him who sent me If anyone chooses to do Gods will he will find out whether my teaching comes from God or whether I speak on my own John 71617 Thus we have a constant choice before us involving our He has lovingly made full provision to enable us He has fulfilled His promise to ask the Father to give us another Counselor Gk paraklรชtos Helper to be with us forever John 1416 Israel had difficulty keeping the covenant they made to serve the Lord We have the Holy Spirits help to make the right choices that will be in line with Gods Word honor Jesus and bring glory to God Scripture quotations are from the New International Version Stanley M Horton ThD is project coordinator for the Pentecostal Textbook Project Springfield Missouri
[ "As for Me and My Household", "Word Study" ]
http://ens-newswire.com/2018/07/03/nuclear-fusion-reactor-in-france-55-percent-complete/
Nuclear Fusion Reactor in France 55 Percent Complete Posted by News Editor in Energy Latest News RSS on July 3 2018 535 pm no comments SAINT PAULLEZDURANCE France July 3 2018 ENS There may be lingering disagreements among China the European Union India Japan South Korea Russia and the United States but there is one complex project these seven entities have in common that is on track for success the worlds largest nuclear fusion facility This first global collaboration on building a nuclear fusion reactor is taking place at Cadarache in the south of France Aerial view of the ITER fusion reactor site in thet south of France April 2018 Photo by EJF Riche ITER Organization Construction of the reactor began in 2017 and is now more than 50 percent complete It is scheduled to achieve first plasma in December 2025 This means that the reactor will be able to generate a molten mass of electricallycharged gas known as plasma inside its core Deuteriumtritium fusion experiments are scheduled to begin in 2035 DirectorGeneral Bernard Bigot of France said the passing of the 50 percent milestone reflects the collective contribution and commitment of ITERs seven members The seven participants in the International Thermonuclear Experimental Reactor ITER are building the 500 megawatt tokamak fusion device designed to prove the feasibility of fusion as a largescale and carbonfree source of energy that is safe abundant and environmentally responsible Fusion is the process that powers the Sun and the stars when light atomic nuclei fuse together to form heavier ones a large amount of energy is released At its 22nd meeting on June 20 and 21 the ITER Council reviewed in detail the latest reports and indicators covering organizational and technical performance ITER Council Members jointly reaffirmed the importance of the mission and vision of the project The ITER Council evaluated the most recent reports of manufacturing construction and installation progress for the fusion reactor including the latest measures of performance The Council approved refinements to the construction strategy proposed by the ITER Organization to optimize equipment installation in the Tokamak Complex Building With this strategy in place the project remains on track for first plasma in 2025 The Council agreed that substantial progress has been made on the fabrication of technologically challenging components such as vacuum vessel sectors and toroidal field magnets as well as on installation of the cryoplant site service building and magnet power supply and conversion Based on the latest performance metrics project execution to achieve first plasma is over 55 percent complete Since January 2016 ITER has achieved 33 scheduled project milestones including the recent commissioning of the first experiment of the SPIDER Neutral Beam Test Facility in Padua Italy The specialized components some 10 million parts in total are being manufactured in industrial facilities all over the world Then they are sent to the Cadarache worksite to be assembled into the final machine Europe is contributing almost half of the costs of construction while the other six members China India Japan South Korea Russia and the United States are contributing equally to the rest Construction costs are expected to be around 20 billion US22 billion with components contributed by the ITER members on an inkind basis Summit the latest fastest supercomputer from the United States Oak Ridge National Laboratory June 2018 Photo courtesy ORNL Summit the worlds fastest supercomputer recently launched at the Oak Ridge National Laboratory in the United States will be instrumental in accelerating fusion research The new supercomputer takes computing powers to new heights Summit can perform 200000 trillion calculations per second or 200 petaflops that is 200 quadrillion calculations eight times more than the previous recordholder at the Oak Ridge National Lab Titan The massive machine weighing more than a commercial aircraft is also the worlds largest computer equipped with artificial intelligence a machine whose software will write new software Harnessing Summits capabilities in machine learning and simulation as well as in artificial intelligence and deep learning will allow researchers to accelerate scientific discovery in nuclear fusion At the close of its June meeting the ITER Council stated The ITER Project is sustaining its strong performance and rapid pace the ITER Organization and Domestic Agencies continue to work as an integrated team to meet the challenging schedule and demanding technical requirements anticipating and mitigating risks to stay on track for success ITER Council at its 22nd meeting June 2122 2018 Photo courtesy ITER Copyright Environment News Service ENS 2018 All rights reserved Access ENSNewswire on Your Mobile Devices 2018 Ecology Prime Media Inc All Rights Reserved
[ "Nuclear Fusion Reactor", "France" ]
http://enterprise.mtanyct.info/DelayVerify/About.aspx
Subway Delay Verification About Delay Verification Request About Welcome to the NYC Transit Delay Verification System . This service provides verification of subway delays only , and for delays that have occurred in the last 90 days . If you are seeking verification for a subway trip that is more than 90 days old , you must file under the freedom of information Law ( FOIL ) : click here to submit your FOIL request . In addition to providing your name and email address , be prepared to enter the date , time and subway line ( s ) of the delayed trip . Please provide any subway transfers you may have made . You will receive an email acknowledging your submission . After researching your request , another email detailing our findings will be sent to you within 5 business days . While we make every effort to run our trains to schedule , delays occur for a variety of reasons , including sick passengers , police investigations , scheduled and unscheduled maintenance and other factors . Thank you for your patience and riding with NYC Transit . To file a NYC Transit subway delay verification request , click here
[ "Subway Delay Verification", "NYC Transit" ]
http://entertainment.howstuffworks.com/arts/circus-arts/adrenaline-strength1.htm
HowStuffWorks Entertainment Arts Circus Arts How can adrenaline help you lift a 3,500 - pound car ? Adrenaline and Strength Prev NEXT When we feel fear or are faced with a sudden dangerous situation , the human body undergoes an amazing change . The stressor - - for example , the sight of your son pinned beneath a car - - stimulates the hypothalamus . This region of the brain is responsible for maintaining the balance between stress and relaxation in your body . When it ' s alerted to danger , it sends out a chemical signal to your adrenal glands , activating the sympathetic system , which sends the body into an excited state . These glands release adrenaline ( epinephrine ) and noradrenaline ( norepinephrine ) , hormones that create the state of readiness that helps a human confront danger . Together , these hormones raise heart rate , increase respiration , dilate the pupils , slow down digestion and - - perhaps most importantly - - allow muscles to contract . All of these changes in our normal physical state prepare us to face danger head - on . Combined , they make us more agile , allow us to take in more information and help us use more energy . But adrenaline ' s effect on muscles accounts for amazing strength . Adrenaline acts on muscles , allowing them to contract more than they can when the body is in a calm or neutral state . When adrenaline is released by the adrenal medulla - - an interior region of the adrenal glands , which are located just above your kidneys - - it allows blood to flow more easily to your muscles . This means that more oxygen is carried to your muscles by the extra blood , which allows your muscles to function at elevated levels . Skeletal muscles - - those attached to bones by tendons - - are activated by electrical impulses from the nervous system . When they ' re stimulated , muscles contract , meaning they shorten and tighten . This is what happens when you lift an object , run or throw a punch . Adrenaline also facilitates the conversion of the body ' s fuel source ( glycogen So does this mean that we have superhuman strength that is unlocked when we ' re confronted with danger ? That ' s one way to put it . Some theorize that we normally use only a small percentage of our muscles ' capabilities . When we are confronted with danger , we transcend the limitations of our muscles and simply act . The rush of adrenaline , which accounts for a sudden increase in strength , helps to facilitate a person lifting a car . In other words , when confronted with extreme stress , we involuntarily use our muscles beyond the limitations of their normal voluntary use . This theory is supported by what happens when a person is electrocuted . Someone who is shocked can be thrown a notable distance from where the shock took place . But this is not due to the electric shock . Instead , it ' s a sudden and violent contraction of the person ' s muscles as a result of the electrical charge flowing through the body . This demonstrates a potential for muscle contraction that is n ' t utilized under normal circumstances . In much the same way that people ca n ' t throw themselves across the room , they also ca n ' t normally lift a car - - the resources are n ' t available without the threat . But why do n ' t we possess superhuman strength all the time ? Would n ' t it be beneficial ? Read the next page to find out why it ' s better that we only have bursts of strength . How strong are you ? You ' ll be amazed to learn how much force your body ' s joints and muscles actually support on a daily basis . This interactive segment from Discovery Channel takes you inside the body and explains how much strength your bones and muscles really possess . 1 2 3 NEXT
[ "adrenaline", "Strength", "hypothalamus" ]
http://entertainment.howstuffworks.com/cannes.htm
HowStuffWorks Entertainment Movies Movie Industry & Awards How the Cannes Film Festival Works by Julia Layton NEXT The Cannes Film Festival is the crossroads of international cinema . Image courtesy Festival de Cannes In the world of film , the Festival de Cannes - - known to many of us as the Cannes Film Festival - - is the largest international showcase of cinematic art . In the world of the yet - to - be - discovered filmmaker , the Cannes Film Festival is a godsend . It ' s not like the Oscars : Anyone can submit a film , and every submission has the chance to be viewed by representatives of the international movie industry . Every year , for 12 days in May , the small city of Cannes in southern France turns into a meeting place for cinema ' s players , would - be players and the people who report on them . If you do n ' t fall into any of these categories , your chances of attending a film screening at the festival are almost nonexistent , but you can gawk at the stars and bask in the atmosphere to your heart ' s content . Artistically , it ' s an anything - goes film showcase that has launched the careers of directors like Quentin Tarantino and Steven Soderbergh . It boasts such diverse events as black - tie screenings and midnight movies on the beach , and it has grown into a fairly intricate system of main events , sidebars and awards . In this article , you ' ll find out what goes on during the Cannes Film Festival and why it is so unique . 1 2 4 NEXT
[ "Cannes Film Festival", "cinematic art", "southern France" ]
http://entertainment.howstuffworks.com/horoscopes-astrology/march-6-birthday-astrology.htm
HowStuffWorks Entertainment Leisure Horoscopes & Astrology March Birthdays March 6 Birthday Astrology by Jill M . Phillips Up Next A Pisces born on March 6 is a free spirit who refuses to conform . They are not rebellious , since they respect structure , yet they choose to live outside it . They communicate on a variety of levels . They possess a sense of destiny regarding their actions . Friends and Lovers March 6 natives can be involved in the concerns of friends while withholding judgment . They are inspirational and often serve as mentors . Extremely particular , they have a difficult time finding true love . They are perfectionists who care about beauty and good manners . Children and Family The men and women born on March 6 feel connected to their childhood . This is not necessarily a positive ; the ties could be irreconcilable differences between family members that continue into adulthood . They have a strict side and may be demanding parents . Yet they know how to show affection to their children . Health People born on this day enjoy indulging their love of fine food and wine and may be quite the epicure . This is relatively harmless , unless they resist daily exercise . Learning to draw aesthetic sustenance from art music , poetry , and drama can help them banish daily stresses . Career and Finances March 6 individuals are versatile , daring people who are n ' t afraid to extend the boundaries of their perception . Since they enjoy financing their projects , money can become a major part of their life . They have grandiose ideas that may not jibe with reality , so a more practical partner can be a plus . Dreams and Goals People born on this date are unafraid to take chances . They would rather fail grandly than be too timid to embark upon their chosen course . Of course , it ' s rare for them to fail , because their positive outlook " channels " good things into their life . They celebrate their traits , not caring if it earns others ' disapproval . For more information about astrology , see : Birthday Astrology Aries Taurus Gemini Cancer Leo Virgo Libra Scorpio Sagittarius Capricorn Aquarius Pisces ABOUT THE AUTHOR : Jill M . Phillips is the author of hundreds of articles on astrology as well as dozens of books . She has regularly written forecast columns for Astrology : Your Daily Horoscope Pisces Information for March 6 You should embrace : Curiosity , true emotions , fellowship You should avoid : Snobbishness , empty promises , fatalism
[ "Birthday Astrology", "Pisces", "Pisces" ]
http://entertainment.howstuffworks.com/sci-fi10.htm
HowStuffWorks Entertainment Movies Behind the Scenes How Sci - fi Does n ' t Work by Craig Freudenrich , Ph . D . Sound in Space Prev NEXT When the Death Star II exploded , the sound was tremendous . Image courtesy ยฉ Lucasfilm Ltd . & TM . All Rights Reserved . When the rebel forces destroy the Death Star in " Star Wars Episodes IV " and " VI , " each Death Star goes out with a loud explosion . Such explosions happen in many sci - fi movies and TV series , such as when " Star Trek " ' s Enterprise destroys an enemy vessel , or when the Nostromo self - destructs in " Alien . " The problem here is that sound does not carry in space . Sound is an example of a longitudinal wave . The sound energy moves along by vibrating molecules of gas , liquid or solid . When the bell in the above animation flexes away , it pulls in on the surrounding air particles . This creates a drop in pressure , which pulls in more surrounding air particles , creating another drop in pressure , which pulls in particles even farther out . Each vibrating air molecule passes its vibration on to the next air molecule between the bell and your ear to make the sound wave propagate . When the vibrating air in you ear canal hits your Serenity was attacked by the Reavers and Alliance ships without a sound . Image courtesy Zoic Studios / ยฉ 2005 Universal Studios One example of the correct depiction of the lack of sound in space is Stanley Kubrick ' s classic film , " 2001 : a Space Odyssey . " We see shots of the inside of spacecraft ( Discovery , pods , moon vehicles ) with sounds of machinery and alarms . When the scenes cut to the outside of these spacecraft , there are no sounds at all . Most dramatically , there is a scene where astronaut David Bowman must get inside the spaceship Discovery from a space pod without his helmet . He decides to decompress his 1 10 11 12 NEXT
[ "Space Odyssey", "Serenity" ]
http://entertainment.inquirer.net/193707/voice-of-eustace-in-courage-the-cowardly-dog-is-dead
Voice of โ€˜ Eustace โ€™ in โ€˜ Courage the Cowardly Dog โ€™ is dead Screengrab from cartoonnetworkasia . com Arthur Anderson , the prominent voice actor of Eustace Bagge in children โ€™ s series โ€˜ Courage the Cowardly Dog โ€™ , has died at the age of 93 in Manhattan , New York . He was the voice of Muriel โ€™ s skinny and grumpy husband from episodes 34 to 52 . According to The New York Times , Anderson started his career as a voice actor of an orphan named Buddy in the drama series Tony and Gus in 1935 and later joined children โ€™ s show Let โ€™ s Pretend . He also worked with renowned voice actor Orson Welles in a theater production of Caesar , Second Hurricane , and Shoemaker โ€™ s Holiday . ADVERTISEMENT In โ€˜ Courage the Cowardly Dog โ€™ , Eustace is a frowning old man who sits in his favorite rocking chair and reads the Nowhere newspaper . Because of his bitter cruelness to Muriel โ€™ s pet dog , Courage , he frequently yells the popular line โ€œ Stupid dog ! โ€ The original voice actor of Eustace , Lionel Wilson , left the show after 33 episodes due to illness . Anderson replaced him . Gianna Francesca Catolico , INQUIRER . net FEATURED STORIES ENTERTAINMENT Gretchen Barretto celebrates junking of Kris Aquino โ€™ s complaints vs . Nicko Falcis ENTERTAINMENT WATCH : Matteo Guidicelli skydives , declares love for Sarah G . in midair Kris Aquino complaint junked : Nicko , Gretchen rejoice Read Next Korean filmmakers to boycott Busan film fest Do n ' t miss out on the latest news and information . View comments Subscribe to INQUIRER PLUS to get access to The Philippine Daily Inquirer & other 70 + titles , share up to 5 gadgets , listen to the news , download as early as 4am & share articles on social media . Call 896 6000 . TAGS : For feedback , complaints , or inquiries , contact us .
[ "Arthur Anderson", "โ€˜ Courage the Cowardly Dog โ€™ ,", "voice actor" ]
http://entertainment.time.com/2011/08/30/all-time-100-best-nonfiction-books/slide/hiroshima-by-john-hersey/
Books All - TIME 100 Nonfiction Books Politics and war , science and sports , memoir and biography โ€” there ' s a great big world of nonfiction books out there just waiting to be read . We picked the 100 best and most influential written in English since 1923 , the beginning of TIME . . . magazine Read Later prev 99 of 101 next War Hiroshima By Jim Frederick Aug . 16 , 2011 Author : John Hersey Year Released : 1946 Get This Book A correspondent for TIME during World War II , John Hersey journeyed to Japan in May 1946 to report on the dropping of the first atomic bomb from the perspective of the residents of Hiroshima . Published first in the New Yorker ( at 31,000 words , it took up the whole issue ) and then as a book by Knopf , Hiroshima reconstructs the events of Aug . 6 , 1945 , and the year that followed through the eyes of two doctors , a housewife , a secretary , a Japanese minister and a German Jesuit priest . They wander through the carnage and destruction trying to bear the unbearable , like characters from Dante โ€™ s Inferno โ€” but of course , they are innocent souls . Hersey โ€™ s spare , stripped - down prose matched the blasted landscape and devastated psychology of the victims , and his novelistic structure and techniques helped inspire an entirely new style of reportage that would come to be known as New Journalism . Reading the 1985 edition , which includes a final chapter looking at all six characters โ€™ lives 40 years on , is essential . Next The Looming Tower Email Print Share Follow @ TIMECulture
[ "Hiroshima", "first atomic bomb", "John Hersey" ]
http://entertainment.time.com/2012/05/03/first-position-a-documentary-that-stays-on-point/
Movies First Position : A Documentary That Stays On Point In her sweetly soft - shoe directorial debut , documentarian Bess Kargman paints a portrait of ambitious young dancers in a highly competitive world By Mary Pols @ MaryPols May 03 , 2012 Read Later Bess Kargman Rebecca Houseknecht First Position Year : 2011 Director : Bess Kargman Network : Sundance Selects Cast : Aran Bell , Gaya Bommer Yemini , Michaela Deprince Email Print Share Follow @ TIMECulture If , director Bess Kargman โ€™ s upbeat documentary about young ballet dancers competing in the ultimate jetรฉ - off , the Youth America Grand Prix , were a television series called American Tutu or Dancing with Future Stars , I โ€™ d watch it religiously . It โ€™ s not just the level of athleticism and grace โ€” although Black Swan โ€™ s Nina Sayers has nothing on these kids โ€” that would keep me riveted week to week , it โ€™ s the compelling stories behind the talent . At least half of these young dynamos and their families , all vying for coveted scholarships and spots in ballet companies , could brighten the most forlorn perspective on the state of the American dream . In topic it calls to mind Jill Krementz โ€™ s much - loved photo - heavy book set at the School of American Ballet , A Very Young Dancer , which a whole generation of young girls pored over after its 1976 publication . ( For me , Krementz โ€™ s book was crack you could get with a library card . ) But there is a modern twist . introduces the competitors , explores their background in the most appealing light and then heads into the contest itself , a tried and true narrative approach that has worked for everything from Spellbound to television โ€™ s American - Idol . But while it is less cinematically innovative than last year โ€™ s dance documentary darling Pina , with its 3 - D excitement and its en plein air dancing , first - time director Kargman triumphs by picking characters who largely defy expectations โ€” however unfair it may be to still think of waifish , pink - clad girls in tutus and Russian men in tights when thinking of ballet dancers . READ : A review of 2011 โ€™ s acclaimed dance documentary , Wim Wenders โ€™ Pina Kargman does include one blonde princess who looks like she pirouetted off the top of a music box โ€” she is nonchalant in her admission that her high school classmates call her โ€œ Barbie โ€ โ€” and a 12 year - old girl whose Tiger Mom has the whole family on a low - fat diet to keep her light as feather . But the kids who emerge as โ€™ s most captivating stars are the ones who come from the most surprising places . There โ€™ s the boy whose dad took a bleak military posting in order to give him the best teacher , a teenager who grew up in poverty in Colombia and a girl orphaned by civil war in West Africa . The competitor who seems most destined for greatness is 11 - year - old Aran Bell , who started ballet lessons at 4 and now demonstrates a level of talent and skill that is even a ballet neophyte would have a hard time missing . Young Aran says he loves ballet โ€œ so much that it โ€™ s hard to explain . โ€ He โ€™ s a slim child who nonetheless gives off the impression of great sturdiness , and looks as much at home showing off his bb gun as his medieval - looking toe - stretching device . Aran โ€™ s main obstacle to ballet success โ€” as is the case for many of the kids featured in โ€” is peer pressure . โ€œ We โ€™ ve heard lots of stories about boys that dance that get into junior high and quit because of the relentless teasing and the stereotypes , โ€ his father Ryan says . โ€œ So far he โ€™ s strong enough to understand that those types of people are not worth listening to . โ€ In New Jersey a decade ago , Elaine DePrince and her adopted daughter Michaela , heard from their own set of naysayers , in casually racist conversations . Black girls were โ€œ too muscular โ€ to be classical ballerinas was a common refrain spoken by acquaintances . Even the costume shops , with their pale โ€œ flesh โ€ - colored undergarments continue to send unwelcoming vibes . โ€œ It โ€™ s a miracle I โ€™ m here , โ€ Michaela says gravely , but she โ€™ s not talking about her musculature . Fourteen at the time was filmed , Michaela was born in Sierra Leone in the midst of civil war . Her father was murdered and her mother died of starvation . Violence was a constant factor in her life . โ€œ One time I tried to save my teacher , โ€ Michaela says . โ€œ But I kind of like blacked out and they just cut her arms and legs off and just left her there . โ€ READ : Black Swan , Natalie Portman โ€™ s Oscar Moment ? She languished at an orphanage , unwanted because vitiligo had left her with white spots on her neck and collarbone and earned her the nickname โ€œ devil โ€™ s child . โ€ Elaine and her husband Charles heard of Michaela โ€™ s plight while adopting another daughter and decided to bring both of them home . Michaela came with a dream to dance , inspired by a photograph of a ballerina in a magazine she โ€™ d seen at the orphanage . After her first recital at age 6 , she asked her mother if she could see her spots If you are a faithful watcher of Dancing with the Stars , just last week you could have seen an informal coda to , which certainly lends the impression that Kargman was astute in picking future stars . But First Position does n โ€™ t downplay the possibility of failure โ€” some of these kids wo n โ€™ t be the corps de ballet of a regional company , let alone have a chance at becoming household names . The film includes some painfully realistic truths , like the cost of toe shoes ( $ 85 for a pair that might last a day ? That could get you a whole season of Little League ) . Yet it โ€™ s no , which made ballet seem like a warped and warping art form . This is a valentine to the art , just like Krementz โ€™ s book , and about as irresistible . Mary Pols @ MaryPols Mary Pols has been reviewing film and occasionally books for TIME since 2009 . She has degrees from Duke University , where she studied art history , and the University of California Berkeley โ€™ s School of Journalism . She is the author of a memoir about untraditional parenthood . It was made into a short - lived television comedy where everything turned out traditionally . Accidentally on Purpose : The True Tale of a Happy Single Mother is available for nearly nothing at various online bookstores and from boxes in Pols ' barn .
[ "First Position", "Bess Kargman โ€™s", "documentary" ]
http://entertainment.time.com/2013/11/06/who-played-jfk-best/slide/william-devane/
Movies Who Played JFK Best ? Read Later prev 3 of 16 next View All William Devane By Melissa August Nov . 06 , 2013 Your browser does not currently recognize any of the video formats available . Click here to visit our frequently asked questions about HTML5 video . He may be most familiar as Greg Sumner in the nighttime soap , Knot โ€™ s Landing , but before that he starred in the TV docudrama about the Cuban missile crisis , The Missiles of October ( 1974 ) . He can claim a close tie to another U.S. president through his father , who had been a chauffeur for Governor Franklin Roosevelt . Martin Sheen , who would also appear as John F . Kennedy in another film ( see below ) , played Robert Kennedy in this same production . Devane was n โ€™ t through dramatizing Kennedy family members , however . He played John โ€œ Black Jack โ€ Bouvier , Jacqueline Kennedy โ€™ s father , in a TV miniseries , A Woman Named Jackie ( 1991 ) . The late Robert Kennedy was given a posthumous writing credit for the drama as it was based on his book , Thirteen Days : A Memoir of the Cuban Missile Crisis . The production won critical acclaim and an Emmy for technical direction . Next James Franciscus Email Print Share Follow @ TIMECulture
[ "William Devane", "John F . Kennedy", "โ€œ Black Jack โ€" ]
http://entertainment.time.com/2013/12/17/read-the-short-story-the-secret-life-of-walter-mitty/
Read the Short Story The Secret Life of Walter Mitty Wilson Webb20th Century Fox You can now The Secret Life of Walter Mitty the short story by James Thurber that forms the basis of the upcoming Ben Stiller movie for free online The comic tale about a mildmannered man who frequently imagines himself in thrilling situations originally appeared in The New Yorker on March 19 1939 The characters name and its adjective Mittyesque have entered the lexicon as terms used to describe someone prone to daydreams to the detriment of their real life The upcoming Ben Stiller film which also stars Kristen Wiig and Sean Penn reimagines the classic character as a LIFE magazine employee in search of lost photo negative A 1947 version featured comedian Danny Kaye in the role of Mitty Read the full short story online now before the film hits theaters on Dec 25 2013
[ "The Secret Life of Walter Mitty", "short story", "James Thurber" ]
http://enterthepit.com/bai-5-review-drink-to-your-health/
Supplements 0 Bai 5 Review : Drink to Your Health by Mike Guerreiro ยท December 26 , 2013 Sometimes you encounter a product that is so good that there is no way that it could be good for you as well , correct ? Thankfully , there are still products out there that suit both of these needs . Whether we are bodybuilders , athletes , or just fitness enthusiasts , the one likeness that we all have is our undying need to better ourselves both in health and aesthetics . We are very careful of what goes into our bodies as what goes in is merely fuel that keeps our engines running . We eat and drink The nice folks over at Bai sent over a case of various flavors of Bai 5 , a product that I was not familiar with until now . After the first sip of the first bottle , I was hooked . I could not believe that a product with such a great taste profile could be so beneficial to you from a health standpoint . Many times , healthy products read very well from the label as being great for you , but lack the flavor to impact us any further than using the product because we need to . Bai 5 is not that type of product at all . Bai 5 comes in 9 flavors , all of which are rather tasty . I have my favorites , namely Panama Peach and Sumatra Dragonfruit , but all of the flavors are indeed very flavorful . I did a double take on the label to ensure that it was indeed correct . This antioxidant - packed beverage contains only 5 calories and is gluten and soy free . It is also GMO and BPA free as well as 100 % natural The secret to Bai โ€™ s antioxidant power 5 is the organic coffeefruit . Bai 5 uses the outside it , which does not generate the same effects as the normal coffee bean . Bai 5 is then flavored with exotic fruit juices with each flavor being very tasty . I take a bottle in with me when I workout and I get a sweet little boost in between sets . I did not expect anything , but I figured that I had to see what it did for me while working out . That subtle little boost was just what the doctor ordered . It has now been a staple with my workouts . Bai 5 Variety Packs : Bai 5 Green Variety Pack Bai 5 Red Variety Pack Bai 5 Flavors : Brasilia Blueberry Congo Pear Costa Rica Clementine Ipanema Pomegranate Limu Lemon Malawi Mango Molokai Coconut Panama Peach Sumatra Dragonfruit Features : GMO FREE Antioxidant Packed , 2000 + mg Only 5 calories per bottle BPA Free Vegan Gluten Free and Soy Free Low Glycemic Index Organic Coffeefruit 100 % Natural http : / / www . drinkbai . com / Tags : Antioxidant Bai 5 Organic Review Water You may also like . . . 2 What Makes a Quality Whey Protein Powder 27 Nov , 2013 0 Power Crunch Original Protein Bar Review 25 Jan , 2014 Supplement Review : BQuick FUEL Protein Blend 9 Apr , 2014
[ "Bai 5", "organic coffeefruit", "Brasilia Blueberry" ]
http://entheology.com/research/structure-of-the-nervous-system/
Structure of the Nervous System by Keith Cleversley | Sep 3 , 2011 | Research 2 comments When studying the many powerful entheogens that are found the world over , it is very common that one comes across information about how particular plants and chemicals effect the brain at a cellular level . In order to fully study entheology , it is extremely important to have at least a very basic amount of knowledge regarding the structure of the nervous system . Understanding the structures of the nervous system will allow the amateur enthnobotanist much greater ability to comprehend both the mechanisms of particular plants and the ways in which these plants can be worked with safely The Nervous System The human nervous system is broadly divided in to two sections , the central nervous system ( CNS ) and the peripheral nervous system ( PNS ) . The CNS is made up of the brain and the spinal cord . The PNS is made up of the nerves which radiate out from the spinal cord to the rest of the body . The PNS is further divided in to the somatic nervous system , which is responsible for voluntary control of body movements , and the autonomous nervous system ( ANS ) , which is responsible for the unconscious regulation of the internal organs , glands and hormones . Finally , the ANS is divided in to the sympathetic and parasympathetic nervous systems . The sympathetic nervous system is generally responsible for holding the body together in times of stress , and is well known for mediating the stress response known as the fight - or - flight response . The parasympathetic The Brain The main mass of the brain is the cerebrum , which is divided in to the left and right hemispheres . The right hemisphere controls the left side of the body , and vice versa . The right side of the brain seems to be primarily involved in spatial orientation , abstract thoughts , creativity , music and rhythm and so forth . The left side of the brain seems to primarily process verbal language and rational thoughts . In men , both lobes are of approximately equal size , while in women the left hemisphere is slightly bigger than The Hindbrain The hindbrain is thought to be the oldest part of the nervous system structure , and is made up of the cerebellum , the pons , and the medulla oblongata . The cerebellum is located underneath the cerebrum , and is primarily a center of movement control , regulation and coordination , and balance and posture . The brain stem lies just underneath the cerebellum , and is connected to both the cerebellum and the cerebrum . It is through the brain stem that messages are sent from the brain to the rest of the body , and that messages from the rest of the body are received by the brain . The medulla oblongata is another ancient part of the brain , which is involved in a wide range of sensory and motor functions . Finally , the pons is a small area of the hindbrain which relays signals from the forebrain to the cerebellum . It also seems to be involved in sleep , respiration , swallowing , bladder control , hearing , and facial expressions ( Voogelbreinder 2009 ) . The Midbrain The midbrain is located just above the hindbrain and below the forebrain , right around the center of the brain . It is primarily associated with vision , hearing , motor control , sleep / wake cycles , arousal and temperature regulation ( Boeree 2011 ) . The Forebrain The forebrain is the largest part of the brain , and is primarily composed of the cerebrum ( made up of the temporal lobe , frontal lobe , parietal lobe and occipital lobe ) . The forebrain also contains the thalamus , the hypothalamus , the pituitary gland , the amygdala , the corpus callosum , the hippocampus and the basal ganglia ( Voogelbreinder 2009 ) . The Thalamus The function of the thalamus includes relaying sensation , spatial sense , and motor signals to the cerebral cortex , as well as the regulation of the sleep / wake cycle and alertness . All sensory systems , other than the olfactory system , relay information to the thalamus , which is believed to process the sensory information and relay it to other parts of the brain ( Boeree 2011 ) . The Hypothalamus The primary function of the hypothalamus is to link the nervous system to the endocrine system by way of the pituitary gland . It creates and secretes neurohormones which stimulate or inhibit the secretion of pituitary hormones . Thus , the hypothalamus controls body temperature , appetite , fatigue , sleep and circadian rhythms ( Boeree 2011 ) . The Pituitary Gland The pituitary gland is an endocrine gland which is connected to the hypothalamus . It secretes hormones which help to control growth , blood pressure , uterine contractions , sex organ function , thyroid gland function , metabolism , and temperature regulation , among other things ( Boeree 2011 ) . The Amygdala The amygdala are small groups of nuclei located within the temporal lobes of the brain . The amygdala perform a primary role in the processing and memory of emotional reactions . It is thought that the amygdala are essential in the formation and storage of memories associated with emotional events , as in fear conditioning ( Voogelbreinder 2009 ) . The Corpus Callosum The corpus callosum is a bundle of neural fibers that is located beneath the cortex and which connects the right and left cerebral hemispheres , allowing for inter - hemispheric communication . It is the largest white matter structure in the brain ( Boeree 2011 ) . The Hippocampus The hippocampus plays an important role in the consolidation of information from short - term to long - term memory . It is also an essential part of spatial navigation . The hippocampus is one of the first parts of the brain to suffer damage in cases of Alzheimer โ€™ s disease , and damage to the hippocampus leads to memory problems and disorientation . Individuals suffering from serious hippocampal damage sometimes experience anterograde amnesia , that is , the inability to form or retain new memories ( Boeree 2011 ) . The Basal Ganglia The basal ganglia are a group of nuclei located at the base of the forebrain . They are associated with a variety of functions , including procedural learning ( habit formation ) , eye movements , emotions , cognition and voluntary motor control . Research suggests that the basal ganglia is the part of the brain that is used when one has to make a decision as to which of several possible actions should be executed at a particular time . It seems that the basal ganglia inhibit a number of different motor systems , and when the basal ganglia The Cerebrum The cerebrum is the largest portion of the brain , and also the newest . The surface of the cerebrum is known as the cerebral cortex , and it is made up of six layers of neurons . It is heavily folded and convoluted , and if it were spread out it would take up about 2.5 square feet of space . It contains around 10 billion neurons and about 50 trillion synapses . The folds of the cortex have ridges , called gyri , and valleys , called sulci . Some of the sulci are very long and pronounced The Frontal Lobe The frontal lobe is located at the front of the brain , and is responsible for voluntary movement and planning . It contains the most dopamine - sensitive neurons in the cerebral cortex . Since the dopamine system is associated with reward , attention , short - term memory , and planning , it is not surprising that this portion of the brain is the most heavily associated with decision making . At the back portion of the frontal lobe is an area called the motor cortex . This portion of the brain is though to control voluntary muscle movement The Prefrontal Lobe The very foremost portion of the frontal lobe is known as the prefrontal lobe . This portion of the brain seems to be involved in planning cognitive behaviors , decision making , personality expression , and moderating correct social behavior . In other words , it is thought that the prefrontal lobe coordinates thoughts and actions with internal short and long term goals . It is also thought to be the portion of the brain which carries out executive functions , which allow the individual to recognize future consequences of present actions , to choose between good and bad actions In 1936 , neurologists Freeman and Watts created a method of lobotomy known as the Freeman - Watts procedure , which separated the prefrontal lobe from the rest of the brain . This process was thought to be helpful to individuals with serious mental disorders , as it seemed to calm them down . However , it also completely removed the ability of these individuals to make their own decisions in any way , making them generally docile but also extremely mentally disabled in most cases ( Shorter 1997 ) . The Parietal Lobe The parietal lobe is located behind the frontal lobe . The foremost portion is known as the somatosensory cortex , and this portion of the brain seems to be responsible for receiving sensory information from all over the body . The parietal lobe integrates sensory information , particularly in relation to spatial sense and navigation . It also maps objects perceived visually into body coordinate positions ( Boeree 2011 ) . The Temporal Lobes The temporal lobe is located on both sides of the brain , and is involved in auditory perception . It is also very important in the processing of language in speech and vision . The temporal lobe also contains the hippocampus which , as noted above , is essential in the formation of long - term memory . In the left temporal lobe there is a portion of the cortex known as Wernicke โ€™ s area which is essential for the understanding of written and spoken language ( Boeree 2011 ) . The Occipital Lobe The occipital lobe is located at the rear portion of the brain and is the brain โ€™ s visual processing center . It is also the part of the brain from which dreams seem to originate ( Boeree 2011 ) . Hopefully , this article will help to clarify any questions you may have regarding the structure of the brain and the rest of the nervous system . You may also be interested in information on neurotransmitter systems , or on the alkaloids found in entheogens that produce psychoactive responses in those systems . REFERENCES Blakemore , and Frith . The Learning Brain . Maiden : Blackwell Publishing , 2005 . Boeree , C.G. โ€œ The Cerebrum โ€ , June 28 , 2011 . http : / / webspace . ship . edu / cgboer / genpsycerebrum . html . Shorter , E . A History of Psychiatry . Hoboken : Wiley , 1997 . Voogelbreinder , Snu . Garden of Eden : The Shamanic Use of Psychoactive Flora and Fauna , and the Study of Consciousness . Snu Voogelbreinder , 2009 .
[ "the Nervous System", "The Hindbrain", "The Basal Ganglia" ]
http://entnemdept.ifas.ufl.edu/walker/buzz/crickets.htm
North American Crickets Gryllinae field crickets Nemobiinae ground crickets Oecanthinae tree crickets Gryllotalpidae mole crickets Eneopterinae bush crickets Mogoplistinae scaly crickets Trigonidiinae sword - tail crickets Myrmecophilinae ant crickets Representative species of eight major groups of crickets known to occur in North America . A ninth Pentacentrinae ) is represented in North America by a single species Key to major groups A quick way to find pages for cricket subfamilies , genera , and species is to jump to the checklist and look for links . If a genus name lacks a link , the page for that genus is still under construction . Cricket classifications Taxonomists agree that crickets are a monophyletic group , that is , they constitute all the surviving descendents of a single ancestral species . However , taxonomists disagree as to where in the taxonomic hierarchy this group belongs and how it should be subdivided . For example , Vickery and Kevan ( 1985 ) put crickets in the suborder Gryllodea of the order Grylloptera , whereas we along with many others put them in the superfamily Grylloidea of the suborder Ensifera , order Orthoptera . In our scheme , the initial subdivisions are families , and we recognize only two : Gryllotalpidae , the mole crickets , and Gryllidae , all other crickets . We treat as subfamilies some cricket groups that others treat as families โ€” namely , tree crickets , scaly crickets , ant crickets , and sword - tailed crickets . We do this because the evolutionary relations of the sister groups as are Trigonidiinae ( sword - tailed crickets ) and Nemobiinae ( ground crickets ) ( e.g. , Gwynne 1995 ) . References Alexander RD . 1962a . The role of behavioral study in cricket classification . Syst . Zool . 11 : 53 - 72 . [ 3112 KB ] Alexander RD . 1962b . Evolutionary change in cricket acoustical communication . Evolution 16 : 443 - 67 . [ 2996 KB ] Alexander RD . 1968 . Life cycle origins , speciation , and related phenomena in crickets . Q . Rev . Biol . 43 : 1 - 41 . [ 5234 KB ] Alexander RD , Otte D . 1967 . The evolution of genitalia and mating behavior in crickets ( Gryllidae ) and other Orthoptera . Misc Publ Mus Zool , Univ Michigan , No . 133 . 62 p . [ 4939 KB ] Allard HA . 1930 . The occurrence of the crickets Anaxipha pulicaria Burm . and Cycloptilum trigonipalpum ( Rhen and Hebard ) in the vicinity of the District of Columbia hitherto unreported here . Proc . Entomol . Soc . Wash . 32 : 144 - 146 . Blatchley WS . 1920 . Orthoptera of northeastern America Indianapolis , IN : Nature Publishing . 784 p . Pages 638 - 642 ( introduction to crickets and keys to subfamilies ) [ 399 KB ] . PDF files of Blatchley ' s treatments of the cricket subfamiles that he recognized are accessible on these SINA pages : Gryllotalpidae Myrmecophilinae Mogoplistinae Nemobiinae Gryllinae Oecanthinae Trigonidiinae Eneopterinae . ( The introductory pages to Blatchley ' s book are accessible on SINA ' s home page . ) Forrest TG . 1982 . Acoustic communication and baffling behaviors of crickets . Fla . Entomol . 65 : 33 - 44 . [ 1416 KB ] Forrest TG . 1991 . Power output and efficiency of sound production by crickets . Behav . Ecol . 2 : 327 - 338 . [ Scapteriscus spp . ; Oecanthus spp . , Anurogryllus arboreus Funk DH . 1989 . The mating of tree crickets . Sci . Am . 261 : 50 - 59 . [ Oecanthus latipennis , Neoxabea bipunctata , Orocharis saltator Hung YP , Prestwich KN . 2004 . Is significant acoustic energy found in the audible and ultrasonic harmonics in cricket calling songs ? Journal of Orthoptera Research 13 ( 2 ) : 231 - 238 . Masaki S , Kataoka M , Shirato K , Nakagahara M . 1987 . Evolutionary differentiation of right and left tegmina in crickets . In : Baccetti BM , editor . Evolutionary biology of orthopteroid insects . Chichester : Ellis Horwood . p 347 - 357 . [ 1300 KB ] Masaki S , Shimizu T . 1995 . Variability in wing form of crickets . Res Popul Ecol 37 : 119 - 128 . [ 1241 KB ] Masaki S , Walker TJ . 1987 . Cricket life cycles . Evol . Biol . 21 : 349 - 423 . [ 6802 KB ] Otte D . 1992 . Evolution of cricket songs . J . Orthop . Res . 1 : 25 - 49 . [ 4555 KB ] Otte D . 1994 . Orthoptera species file 1 . Crickets ( Grylloidea ) . Philadelphia : Orthopterists ' Soc and Acad Nat Sci Phila . 120 p . ( A web version of this , by D . Otte , D . C . Eades , and P . Naskrecki , is continually updated . ) Prestwich KN , Walker TJ . 1981 . Energetics of singing in crickets : Effect of temperature in 3 trilling species ( Orthoptera : Gryllidae ) . J . Comp . Physiol . B Biochem . Syst . Environ . Physiol . 143 : 199 - 212 . [ Oecanthus celerinictus , O . quadripunctatus , Anurogryllus arboreus Toms RB . 1984 . Directional calls and effects of turning behavior in crickets . J . Entomol . Soc . South . Afr . 47 : 309 - 312 . [ Oecanthus spp . , Xenogryllus sp . Walker TJ . 1972 . Deciduous wings in crickets : a new basis for wing dimorphism . Psyche 79 : 311 - 314 . [ 232 KB ] Walker TJ . 1987 . Grylloidea ( Ensifera ) : Gryllidae , Crickets . Pages 148 - 151 in F.W. Stehr , ed . Immature insects . Kendall / Hunt , Dubuque , Iowa . Walker TJ , Carlysle TC . 1975 . Structure of stridulatory file teeth in crickets : taxonomic and acoustic implications ( Orthoptera : Gryllidae ) . Intern . J . Insect Morph . Embryol . 4 : 151 - 158 . [ 7569 KB ] Walker TJ , Masaki S . 1989 . Natural history of crickets . In : Huber F . , Loher W , and Moore TE , eds . Cricket behavior and neurobiology . Cornell University Press , Ithaca , N.Y. p 1 - 43 [ 3496 KB ] The table below indicates stages of completion of the pages for North American crickets . yes = initial draft posted inc = incomplete no = not started subfamily ( or family ) maps photos drawings songs text key refs - field crickets yes yes inc - mole crickets - bush crickets - scaly crickets no - ant crickets no - - - - - ground crickets - tree crickets Pentacentrinae - anomalous crickets - sword - tail crickets inc
[ "Cricket classifications", "monophyletic group", "Myrmecophilinae" ]
http://entnemdept.ufl.edu/creatures/aquatic/southern_house_mosquito.htm
common name : southern house mosquito scientific name : Culex quinquefasciatus Say ( Insecta : Diptera : Culicidae ) Introduction Synonymy Distribution Description Life Cycle Medical Importance Management Selected References Introduction ( Back to Top ) Culex quinquefasciatus Say , commonly known as the southern house mosquito , is a medium - sized brown mosquito that exists throughout the tropics and the lower latitudes of temperate regions . This species is found in the southern United States and is present throughout Florida . This nighttime - active , opportunistic blood feeder is a vector of many of pathogens , several of which affect humans . Throughout much of the southern U.S. , is the primary vector of St . Louis encephalitis virus ( SLEv ) . also transmits West Nile virus ( WNv ) . Synonymy ( Back to Top ) Say , 1823 Culex pungens Wiedemann , 1828 ( ITIS 2007 ) Culex fatigans Wiedemann , 1828 ( Bates 1949 ) Culex auestuans Wiedemann , 1828 ( WRBU ) Culex acer Walker , 1848 ( WRBU ) Culex cingulatus Doleschall , 1856 ( WRBU ) Distribution is a sub - tropical species usually found within the latitudes 36 ยฐ N and 36 ยฐ S . However , in the U.S. between 36 ยฐ N and 39 ยฐ N there is a broad hybrid zone where freely mates with Culex pipiens Linnaeus , which is usually not found south of 39 ยฐ N . Mating between these two members of the Culex pipiens complex produce viable offspring within the hybrid zone . The extent of the hybridization is extensive and , as a result , the members are sometimes considered to be subspecies , Culex pipiens quinquefasciatus and Culex p . pipiens respectively . is found in North America , South America , Australia , Asia , Africa , the Middle East , and New Zealand . In the U.S. , this species ranges from Virginia across the southern plains to southern California , and from as far north as southern Iowa , south to Texas and Florida . There are reports of as far north as Indiana in the U.S. The species has also been collected in Hawaii ( Barr 1957 ) . In Florida , is found in all 67 counties . Figure 1 . World distribution of the southern house mosquito , Say . Illustration by Stephanie Hill , University of Florida . Description Adults : Adult vary from 3.96 to 4.25 mm in length ( Lima et al . 2003 ) . The mosquito is brown with the proboscis , thorax , wings , and tarsi darker than the rest of the body . The head is light brown with the lightest portion in the center . The antennae and the proboscis are about the same length , but in some cases the antennae are slightly shorter than the proboscis . The flagellum has thirteen segments that have few to no scales ( Sirivanakarn et al . 1987 ) . The scales of the thorax are Figure 2 . Adult female southern house mosquito , Say , feeding . Photograph by James Newman , University of Florida . Eggs : Common to the Culex genus , the eggs of are laid in oval rafts loosely cemented together with 100 or more eggs in a raft which will normally hatch 24 to 30 hours after being oviposited ( Bates 1949 ) . Figure 3 . Eggs of the southern house mosquito , Say . Photograph by Stephanie Hill , University of Florida . Larvae : The larval head is short and stout becoming darker toward the base . The mouth brushes have long yellow filaments that are used for filtering organic materials . The abdomen consists of eight segments , the siphon , and the saddle . Each segment has a unique setae pattern ( Sirivanakarn and White 1978 ) . The siphon is on the dorsal side of the abdomen , and in the siphon is four times longer than it is wide with multiple setae tufts ( Darsie and Morris 2000 ) . The saddle is barrel shaped and located on the ventral side of the abdomen with four long anal papillae protruding from the posterior end ( Sirivanakarn and White 1978 ) . For more detailed morphological images , see the UF / IFAS Identification Guide to Common Mosquitoes of Florida Web site . Figure 4 . Larva of the southern house mosquito , Say . Head in upper right . Photograph by Stephanie Hill , University of Florida . Pupae : Similar to other mosquito species , pupae are comma shaped and consist of a fused head and thorax ( cephalothorax and an abdomen ) . The cephalothorax color varies with habitat and darkens on the posterior side . The trumpet , which is used for breathing , is a tube that widens and becomes lighter in color as it extends away from the body . The abdomen has eight segments . The first four segments are the darkest , and the color lightens towards the posterior . The paddle , at the apex of the abdomen , is translucent and robust with two small setae on Figure 5 . Pupa of the southern house mosquito , Say . Photograph by Stephanie Hill , University of Florida . Life Cycle Gravid females fly during the night to nutrient - rich standing water where they will lay their eggs . They will oviposit in waters ranging from waste water areas to bird baths , old tires , or any container that holds water . If the water evaporates before the eggs hatch or the larvae complete their life cycle , they die ( Mosquito Information Website 2007 ) . The larvae feed on biotic material in the water and require between five to eight days to complete their development at 30 ยฐ C ( Gerberg et al . 1994 ) . The larvae progress through four larval instars , and towards the end of the fourth instar they stop eating and molt to the pupal stage . Following 36 hours at 27 ยฐ C the adults emerge from the pupal stage ( Gerberg et al . 1994 ) . The time of development under natural conditions for all stages is variable and dependent on temperature . Both males and females take sugar meals from plants . Following mating , the female seeks a blood meal . are opportunistic feeders , feeding on mammals and / or birds throughout the night . Males survive only on sugar meals , while the female will take multiple blood meals . After a female mosquito digests the blood meal and the eggs develop , she finds a suitable place to lay her eggs , and the cycle begins again . A single female can lay up to five rafts of eggs in a lifetime ( Gerberg et al . 1994 ) . The number of eggs per raft varies with climatic conditions . Figure 6 . Female southern house mosquito , Culex quinquefasciatus Say , ovipositing an egg raft . Photograph by Sean McCann . Medical Importance is a vector of many pathogens of humans , and both domestic and wild animals . Viruses transmitted by this species include WNv , SLEv and Western equine encephalitis virus ( WEEv ) . is the principal vector of SLEv in the southern U.S. The virus increases its numbers in birds and then infects mosquitoes feeding on birds during the bird nesting season in the spring . The mosquito may then transmit the virus to humans . St . Louis encephalitis is age - dependent , affecting older humans more than the young . Symptoms of the disease are flu - like and can range from fever and headaches to stiffness and confusion . After a period of several days the brain may begin to swell , accompanied by depression , extreme excitement , Saint Louis Encephalitis : A Florida Problem Although is not considered the likely primary vector of WNv in Florida , it likely plays an important role in maintaining the virus within bird populations , and is capable to transmitting it to humans . For more information on West Nile virus in Florida , see the UF / IFAS publication West Nile Virus Outside the U.S. , is responsible for transmitting the filarial nematode , Wuchereria bancrofti ( Tropical Africa and Southeast Asia ) , and Rift Valley fever virus ( RVF ) ( Africa ) ( Foster and Walker 2002 ) . Wuchereria bancrofti is a filarial nematode that can cause lymphatic filariasis . Currently , worldwide there are approximately 120 million cases of lymphatic filariasis ( WHO 2000 ) . The mosquito picks up the microfilaria from an infected vertebrate . The nematode develops inside the mosquito , and is passed on to another vertebrate ( Foster and Walker 2002 ) . Rift Valley fever has been responsible for major epidemics in Africa and Asia . In 1997 , 300 human cases of RVF were reported in Kenya and southern Somalia ( DHPE 2005 ) . Management Cultural control . Personal protection , reduction of larval habitats , and chemical control are the best ways to reduce mosquito bites and therefore the transmission of mosquito - borne pathogens . Because feeds at night , long sleeve shirts and insect repellent are recommended for outside nighttime activity . Reducing the amount of outside activity also lowers the risk of bites ( Mosquito Information Website 2007 ) . is dependent upon humans for the creation of its nutrient - rich aquatic habitats . It is essential to reduce or eliminate this type of aquatic environment . Around the home this can be done by not over watering plants , changing water in pet water dishes frequently , changing water in bird baths at least once a week , removing unnecessary water - holding containers , and and keeping ponds stocked with mosquito fish ( Kern 2007 ) . Water - holding containers that can not be removed can be covered or turned upside down , old tires need Large man - made aquatic habitats such as storm - water catch basins and waste water containers should be eliminated or reduced ( O ' Meara 2014 ) . Chemical control . Insecticides can be used to control larvae and adults . Larvicides are applied to bodies of water near where the larvae are concentrated . This method reduces the greatest number of immature mosquitoes with the least amount of pesticide . Adulticides are used to quickly reduce the population of adult mosquitoes in an area . In general , mosquito resistance to specific insecticides may reduce the effectiveness of chemical control . Some chemicals require a licensed pesticide applicator to perform the application . Before proceeding with a chemical control , contact your local Cooperative Extension Service ( CES ) or UF / IFAS listing of those offices Selected References AMCA . ( 2005 ) . Mosquito Information : Control . American Mosquito Control Association . ( 14 June 2016 ) Barr AR . 1957 . The distribution of Culex p . pipiens and C . p . quinquefasciatus in North America . Journal of Tropical Medicine and Hygiene 6 : 153 - 165 . Bates M . 1949 . The Natural History of Mosquitoes . Macmillian Company . New York , NY . 379 pp . Belkin JN . 1977 . Quinquefasciatus or Fatigans for the tropical ( southern ) house mosquito ( Diptera : Culicidae ) . Proceedings of the Entomological Society of Washington 79 : 45 - 52 . CDC . ( June 2007 ) . CDC answers your questions about St . Louis encephalitis . Center for Disease Control . ( 14 June 2016 ) CDC . ( October 2007 ) . Saint Louis Encephalitis . Center for Disease Control . ( 14 June 2016 ) Connelly CR . 2006 . Common Mosquitoes of Florida . UF / IFAS . Card Set . SP 370 Cutwa - Francis MM , O ' Meara GF . ( 2008 ) . . Identification Guide to Common Mosquitoes of Florida . ( 14 June 2016 ) Darsie Jr RF , Morris CD . 2000 . Keys to the adult females and fourth - instar larvae of the mosquitoes of Florida ( Diptera : Culicidae ) . Technical Bulletin of the Florida Mosquito Control Association 1 : 148 - 155 . Darsie Jr RF , Ward RA . 2005 . Identification and Geographical Distribution of the Mosquitoes of North America , North of Mexico . University of Florida Press . Gainesville , FL . 300 pp . Day JF , Stark LM . 2000 . Frequency of Saint Louis encephalitis virus in humans from Florida , USA : 1990 - 1999 . Journal of Medical Entomology 37 : 626 - 633 . DHPE . ( 2005 ) . Rift Valley Fever . Directors of Health Promotion and Education . http : / / www . dhpe . org / infect / rift . html ( no longer online - 29 November 2012 ) . Fonseca DM , Keyghobadi N , Malcolm CA , Mehmet C , Schaffner F , Mogi M , Fleischer RC , Wilkerson RC . 2004 . Emerging Vectors in the Complex . Science 303 : 1535 - 1538 . Foster WA , Walker ED . 2002 . Mosquitoes ( Culicidae ) , pp . 245 - 249 . In Mullen G , Durden L . ( editors ) . Medical and Veterinary Entomology . Academic Press . New York , NY . Gerberg EJ , Barnard DR , Ward RA . 1994 . Manual for Mosquito Rearing and Experimental Techniques . American Mosquito Control Association Bulletin No . 5 : 61 - 62 . ITIS . 2009 . Say , 1823 Integrated Taxonomic Information System ( 14 June 2016 ) Kern WH . ( September 2007 ) . Some small native freshwater fish recommended for mosquito and midge control in ornamental ponds . EDIS . ( 14 June 2016 ) King WV , Bradley GH , Smith CN , McDuffie WC . 1960 . A Handbook of the Mosquitoes of the Southern United States . Agriculture Handbook No . 173 . United States Department of Agriculture . Washington D.C. pp . 118 - 119 . Lima CA , Almeida WR , Hurd H , Albuquerque CM . 2003 . Reproductive aspects of the mosquito ( Diptera : Culicidae ) infected with ( Spirurida : Onchocercidae ) . Memรณrias do Instituto Oswaldo Cruz . 98 : 217 - 222 . Mosquito Information Website . ( 2009 ) . University of Florida , Florida Medical Entomology Laboratory . ( 14 June 2016 ) O ' Meara GF . ( 2014 ) . Mosquitoes associated with stormwater detention / retention areas . EDIS . http : / / edis . ifas . ufl . edu / mg338 ( 14 June 2016 ) Savage HM , Anderson M , Gordon E , McMillen L , Colton L , Charnetzky D , Delorey M , Aspen S , Burkhalter K , Biggerstaff BJ , Godsey M . 2006 . Oviposition activity patterns and West Nile virus infection rates for members of the complex , at different habitat types within the hybrid zone , Shelby County , TN , 2002 ( Diptera : Culicidae ) . Journal of Medical Entomology 43 : 1227 - 1238 . Sirivanakarn S , White GB . 1978 . Neotype designation of Say ( Diptera : Culicidae ) . Proceedings of the Entomological Society of Washington 80 : 360 - 372 . Shroyer DA , Rey JR . ( June 2014 ) . Saint Louis encephalitis : A Florida problem . EDIS . ( 14 June 2016 ) WRBU . ( undated ) . Adult . The Walter Reed Biosystematics Unit . ( 14 June 2016 ) WHO . ( September 2000 ) . Lymphatic filariasis . World Health Organization . ( 14 June 2016 )
[ "southern house mosquito", "Culex quinquefasciatus", "Diptera" ]
http://entnemdept.ufl.edu/creatures/misc/beetles/horned_passalus.htm
common name : horned passalus scientific name : Odontotaenius disjunctus ( Illiger ) ( Insecta : Coleoptera : Passalidae : Passalinae ) Introduction Synonymy Distribution Description Life Cycle and Biology Feeding Habitat Sounds Selected References Introduction ( Back to Top ) Nearly 500 species of Passalidae have been described , mainly in the new world tropics ( Arnett et al . 2002 ) . The family Passalidae , commonly known as bess bugs or patent leather beetles , is a member of the superfamily Scarabaeoidea , and has only a few occurring species within the United States ( Schuster 1983 ) . The horned passalus or betsy beetle , Odontotaenius disjunctus ( Illiger ) , is a widely distributed , easily recognizable beetle and is the most commonly encountered beetle of Passalidae in the United States , due to its relative monopoly in the North American geography . Previously , Passalus punctiger ( Lepeletier ) and Passalus punctatostriatus ( Percheron ) have been reported as exotic species in the United States , but recent records do not indicate a current population of either species ( Schuster 1983 ) . Species within the family Passalidae , including the horned passalus , are beneficial decomposers of wood . The horned passalus only decomposes decaying wood or logs , and it is not a pest of urban structures . Figure 1 . Lateral view of a horned passalus , Illiger . The shiny black color was responsible for another commonly used name : patent leather beetle . Photograph by Lyle J . Buss , University of Florida . Odontotaenius floridanus Schuster , a beetle of close ancestry to O . disjunctus , occurs endemically in a limited area in Florida . Odontotaenius floridanus resembles O . disjunctus in most aspects of the life cycle and morphology except for having wider front tibiae and a reduced horn ( Schuster 1994 ) . Few members of Passalidae are established in the United States , and only the two species mentioned previously are believed not to have migrated or been introduced from Central America ( Schuster 1983 ) . Synonymy ( Back to Top ) Odontotaenius disjunctus has also been formerly known as Popilius disjunctus ( Illiger ) and Passalus cornutus ( Fabricius ) ( Hincks 1951 ) . Horned passalus is the approved Entomological Society of America common name , but the following common names are often also associated with it : betsy beetle , bess bug , patent leather beetle , Jerusalem beetle , horn beetle , and peg beetle . Some of these common names apply specifically to , and others may generally refer to the family Passalidae . Distribution The horned passalus occurs in a wide range from mid - Florida to Massachusetts , Southern Texas to Minnesota , and Nebraska ( Schuster 1983 ) . More recent sources indicate further expansion from eastern Texas , throughout the eastern United States , and from southern Manitoba through the Canadian deciduous forests , and southern Ontario ( Arnett et al . 2002 ) . Figure 2 . United State ' s distribution of the horned passalus , Odontotaenius disjunctus Illiger . ( Map was extrapolated using literature sources Schuster 1983 and Arnett et al . 2002 ) . Programmed by Mike Boone ; Christopher S . Bibbs , University of Florida . Description Adults : Horned passalus adults are relatively large , dark glossy black beetles , with adult size typically ranging from 30 โ€“ 40 mm ( 1.2 inch โ€“ 1.6 inch ) . Golden hairs can be seen lining the middle pair of legs , pronotum , and antennae . These hairs are detectable by the naked eye . Figure 3 . Golden hair fringes on a horned passalus , Illiger . Photograph by Christopher S . Bibbs , University of Florida . The elytra , or hardened outer forewing , are characterized by deep grooves . The horned passalus also has a groove down the midline of the pronotum . Figure 4 . Dorsal view of an adult horned passalus , Illiger . Photograph by Lyle J . Buss , University of Florida . Antennae have 10 segments , with the distal three segments forming a lamellate club . This is an easily identifiable characteristic of the family . Figure 5 . Close up of lanellate antennae , a characteristic of the horned passalus , Odontotaenius disjunctus Illiger . Photograph by Christopher S . Bibbs , University of Florida . A single , curved horn points forward on top of the head and between the eyes . Adults of the horned passalus additionally have thick , robust mandibles that clearly are also visible . Figure 6 . Close up of the head and curved horn of the horned passalus , Illiger . Also notice the fringes of golden hairs and the mites just behind the head . Photograph by Lyle J . Buss , University of Florida . On average , adults live up to a year . A key characteristic of horned passalus adults is the acoustical signals ( stridulation ) they emit when disturbed or agitated . Eggs : The eggs of the horned passalus are exceptionally large , measuring at 3.0 by 2.4 mm ( approximately 0.1 inch ) when first laid and reaching 3.7 by 3.2 mm just before hatching . The size of the eggs makes them easy to manipulate in the large mandibles of the adults . Eggs are typically found in groups surrounded by frass from the adults . Larvae : The larvae are large , white grubs that have up to three instars . Larvae are found in the same galleries as the adults . To obtain nutrients , the larvae feed on predigested wood from the adults . Figure 7 . Larva of the horned passalus , Illiger , posed to see body shape . Photograph by Lyle J . Buss , University of Florida . Figure 8 . Larva of the horned passalus , Illiger , with close up of head capsule . Photograph by Lyle J . Buss , University of Florida . Figure 9 . Illiger , with close up of legs . Photograph by Lyle J . Buss , University of Florida . Grubs appear to only have two pairs of legs , but a third pair is present and reduced . Only the first two pairs are used for locomotion . As is typical for beetles within the superfamily Scarabaeoidae , grubs retain a characteristic C - shaped posture when not active . The larvae have no active defenses except for well proportioned mandibles , and auditory signals similiar to those used by adult beetles . Pupae : As pupae begin to form , they become pearly white with a rainbow sheen . As the pupae age , they lose their rainbow sheen and can range in color from off white to earth - toned . Pupae that are nearing emergence become translucent . Pupation times vary based on climatic conditions . Figure 10 . Pupa of the horned passalus , Illiger . Photograph by Shelly Cox , Missouri Department of Conservation . Life Cycle and Biology Using its large mandibles , the horned passalus cuts into fallen logs and creates galleries where it lives and breeds . Figure 11 . Deeply carved wood tunnels of the horned passalus , Illiger . ( University of Florida educational specimens ) . Photograph by Christopher S . Bibbs , University of Florida . Adults aggregate and compete for sections of fallen wood , provided the wood is large enough to support more than the initial inhabitants of the wood . Figure 12 . Aggregation of the horned passalus , Illiger , in the same wood pieces . ( University of Florida educational specimens ) . Photograph by Christopher S . Bibbs , University of Florida . Parents of new egg clutches will create a subsocial relationship where adults of both sexes tend the larva throughout the gallery complex in cooperative care of brood ( Schuster and Schuster 1985 ) . If the wood remains undisturbed , more than one generation will cohabitate the same log and young adults will also participate in sibling and new brood care . Adults are territorial and protect their galleries from intruders , but both adults and larvae will cannibalize injured immatures ( King and Fashing 2007 ) . Mites can commonly be found on the exoskeleton of the horned passalus Once eggs have been laid , adults move clutches of eggs through their galleries repeatedly . Searching for the best areas of wood for larvae to settle , parents of the eggs will attempt to find and guard ideal feeding sites for the protection and transportation of their eggs ( Wicknick and Miskelly 2009 ) . Once eggs hatch , larvae remain with the parent adults and share mixtures of frass and softened wood . Depending upon temperature and moisture conditions , the entire life cycle may occur within a summer season or take as long as 14 โ€“ 16 Prior to pupation , adults will pack the pupal chamber cells within the decayed wood with detritus and remnants . These pupal cells disguise the vulnerable stage within , but the full purpose of these cells has not been proven ( Valenzuela - Gonzalez 1992 ) . Adults of all ages , including young newly emerged adults have the ability to create these pupal cells . The quality of the cells varies with the age of the adult . Should these detritus cells around the pupae become damaged , adults will repair them . Pupae are capable of overwintering if While some logs may maintain multiple generations of beetle , young adults typically stay within the parent log for a minimal period of time . Overlapping generations of beetles within the same host structure will only remain as long as it takes them to fully mature . These young adults lack the characteristic black shell of the species , and instead have a red coloration when they emerge from the pupal stage . This red color slowly darkens to black , at which point the insect is considered a mature adult ( Schuster and Schuster 1985 ) . Figure 13 . Freshly emerged teneral adult horned passalus , Illiger , already inhabited by mites ( crawling on elytra ) . Photograph by Shelly Cox , Missouri Department of Conservation . This newly mature adult will leave the parent log and participate in a nuptial flight , one of the only instances of their wing use ( MacGown and MacGown 1996 ) . During observations of the nuptial flight , adults were found to be susceptible to light attractants such as light traps and street lights . At the end of the nuptial flight adults will seek out a new log to start another aggregation . The gentle nature of the horned passalus and its reluctance to fly has contributed to its adoption as a safe and easy - to - handle creature for live specimen demonstrations and outreach education by universities . Domestically , it is low maintenance in care and only requires consistent supplies of moistened wood which can be obtained in any natural area that is normally suitable for the beetle . Feeding Habitat The horned passalus prefers hardwoods , such as oak ( Quercus spp . ) or elm ( Ulmus spp . ) , and will only reside in a log that has fallen and begun to decay . Optimal conditions include high moisture levels , as the beetles are sensitive to dry conditions . For the beetles to digest the wood , the wood must also have microflora , such as naturally occurring fungi and bacteria , which are breaking down the wood . These microflora aid in the predigestion of the wood . In plant feeding insects , undigested remains are expelled in the form of a fine powdery material , called frass . When the horned passalus takes up residence in a log , the beetles facilitate log decomposition by chewing up wood pulp and expelling frass . Fungi and bacteria then target frass for their own nutrient extraction ( Arnett et al . 2002 ) . Once the frass has been sufficiently reprocessed by the fungi and bacteria , the horned passalus then consumes the frass and wood again for successful digestion . Logs that have been inhabited by the horned Sounds Several members of the family Passalidae have the ability to stridulate . Other groups of insects have also developed this capacity , including but not limited to various species of crickets , katydids , grasshoppers , ants and cicadas . Insect stridulation is the emission of sounds by creating friction between two body segments or limbs . Stridulation can be simply demonstrated by taking a plastic comb and scraping the edge of your nail down the row of comb teeth . Stridulation is common as a form of communication within a species , similar in specificity to pheromones and photic signals in insects . In the horned passalus both adults and larvae have the ability to create clearly audible sounds using stridulation . The horned passalus specifically has 17 discovered sound signals among adults and larvae , all of which are for communication within their complex subsocial aggregations including for defense , group communication , and management of immature beetles ( Schuster 1975 ) . As expressed by Reyes - Castillo and Jarman ( 1980 ) , this repertoire " represents the most elaborate system of sound communication known for any arthropod . " Adults create auditory signals using an adapted abdomen and wing structure . The non - hardened hind wings , which are kept folded beneath the protective elytra , have many rows of small spines on the underside . On the abdominal segments beneath these spined areas of the hind wings is a toughened region called pars stridens . This structure is not identifiable to the unaided eye . Figure 14 . Elytra raised , exposing the dorsal throax and abdomen of a pinned and dried horned passalus , Illiger . Photograph by Christopher S . Bibbs , University of Florida . To create sound , the spines are scraped across this textured area of the abdomen . Different frequencies of noise can be generated depending on the speed and pattern of the movement ( Reyes - Castillo and Jarman 1983 ) . In immature horned passalus , the third pair of legs is actually reduced in order to aid stridulation . The middle pair of legs has pars stridens ( a set of ridges ) on the proximal end of the leg . The third pair of legs , with its reduced radial movement , is able to reach the pars stridens with its apex and create the friction necessary to generate noise . The larval auditory signals are equivocal in volume to the adult signal . Figure 15 . Close up of one of the reduced third pair of legs in a larvae of the horned passalus , Illiger . Photograph by Lyle J . Buss , University of Florida . The tips of these reduced legs have multiple teeth close to the apex of the leg point . These various teeth are used at different angles to create the different frequencies necessary to communicate between larvae , parent adults , and non - parent adults . The stridulations of the horned passalus show evidence that even outside of the protective logs , they serve defensive purposes . The larvae and fully developed beetles have few defenses against predators . However , their readiness to sound off when disturbed contributes to their survival . Click here to listen to an audio file of the defensive sounds emitted by In experiments testing the importance of their sound making as a defense , larvae of the horned passalus were intentionally exposed to crows to observe predation . The length of time until mortality was much greater among larvae that actively emitted sounds ( Buchler et al . 1981 ) . Selected References Arnett Jr RH , Thomas MC , Skelley PE , Frank JH . ( editors ) 2002 . American Beetles , Volume II : Polyphaga : Scarabaeoidea through Curculionoidea . pp . 861 . CRC Press , Boca Raton , FL . Buchler ER , Wright TB , Brown ED . 1981 . On the functions of stridulation by the passalid beetle ( Coleoptera : Passalidae ) . Animal Behaviour 29 : 483 - 486 . Hincks WD . 1951 . A note on " Passalus cornutus Fabricius " ( Passalidae ) . The Coleopterists Bulletin 5 : 12 - 13 . King A , Fashing N . 2007 . Infanticidal behavior in the subsocial beetle ( Illiger ) ( Coleoptera : Passalidae ) . Journal of Insect Behavior 20 : 527 - 536 . Kraus JB , Ryan MT . 1953 . The stages of development in the embryology of the horned passalus beetle , Popilius disjunctus ( Illiger ) . Annals of the Entomological Society of America 46 : 1 - 20 . MacGown JA , MacGown MJ . 1996 . Observation of a nuptial flight of the horned passalus beetle , ( Illiger ) ( Coleoptera : Passalidae ) . The Coleopterists Bulletin 50 : 201 - 203 . Reyes - Castillo P , Jarman M . 1983 . Disturbance sounds of adult passalid beetles ( Coleoptera : Passalidae ) : structural and functional aspects . Annals of the Entomological Society of America 76 : 6 - 22 . Reyes - Castillo P , Jarman M . 1980 . Some notes on larval stridulation in neotropical Passalidae ( Coleoptera : Lamellicornia ) . The Coleopterists Bulletin 34 : 263 - 270 . Schuster JC . 1994 . new species ( Coleoptera : Passalidae ) : a second U.S. passalid beetle . Florida Entomologist 77 : 474 - 479 . Schuster JC . 1983 . The Passalidae of the United States . The Coleopterists Bulletin 37 : 302 - 305 . Schuster JC . 1975 . Comparative Behaviour , Acoustical Signals , and Ecology of New World Passalidae ( Coleoptera ) . 127 pages . PhD Thesis . University of Florida , Gainesville , FL . Schuster JC , Schuster LB . 1985 . Social behavior in passalid beetles ( Coleoptera : Passalidae ) : cooperative broode care . Florida Entomologist 68 : 266 - 272 . Valenzuela - Gonzalez JV . 1992 . Pupal cell - building behavior in passalid beetles ( Coleopter : Passalidae ) . Journal of Insect Behavior 6 : 33 - 41 . Wicknick JA , Miskelly SA . 2009 . Behavioral interactions between non - cohabitating bess beetles , ( Illiger ) ( Coleoptera : Passalidae ) . The Coleopterists Bulletin 63 : 108 - 116 .
[ "horned passalus" ]
http://entnemdept.ufl.edu/creatures/trees/sawfly/redheaded_pine_sawfly.htm
common name redheaded pine sawfly scientific name Neodiprion lecontei Fitch Insecta Hymenoptera Diprionidae Introduction Distribution Description Life Cycle Hosts Economic Importance Management Selected References Introduction The redheaded pine sawfly Neodiprion lecontei Fitch is one of numerous sawfly species including 35 species in the genus Neodiprion native to the United States and Canada Arnett 2000 inhabiting mainly pine stands The ovipositor of all adult female sawflies is sawlike and is likely where the common name for this group suborder originated PADCNR 2010 Neodiprion lecontei is an important defoliator of commercially grown pine as the preferred feeding conditions for sawfly larvae are enhanced in monocultures of shortleaf loblolly and slash pine all of which are commonly cultivated in the southern United States Figure 1 Adult female redheaded pine sawfly Neodiprion lecontei Fitch Photograph by Lacy L Hyche Auburn University wwwforestryimagesorg Distribution Numerous sawfly species are found in North America The redheaded pine sawfly is native to the United States and found primarily east of the Great Plains Wilson 1978 north into Canada and south into Florida Description Adults Adult sawflies have a broad waist in contrast with many other hymenopterans and have two pairs of membranous wings Adults are 05085 cm 1513 inch in length with the females being approximately twothirds larger than the males Females are mostly black with a reddish brown head and occasionally white on the sides of the abdomen Females have 19segmented serrated or sawtoothed antennae and male antennae are featherlike Hyche 1999 Figure 2 Adult sawfly Neodiprion sp body shape Notice the lack of a thin wasplike waist Adapted from Atwood 1961 Figure 3 Lateral view of adult redheaded pine sawfly Neodiprion lecontei Fitch Photograph by Arnold T Drooz USDA Forest Service wwwforestryimagesorg Eggs Females deposit an individual egg in a slit made with the ovipositor into the pine needle The adult redheaded pine sawfly can lay from 100 to 120 eggs at a time The eggs are oval smooth and shiny translucent white and approximately 18 mm 112 in long and 06 mm 140 in wide when ready to hatch Wilson 1978 Oviposited eggs are evident by small discolored patches in a row on the needle Figure 4 Eggs of the redheaded pine sawfly Neodiprion lecontei Fitch in pine needle Photograph by Lacy L Hyche Auburn University wwwforestryimagesorg Larvae Larvae emerge after two to three weeks and are whitish with a brown head capsule As larvae mature they become yellow to green with brown heads Mature larvae are approximately 25 cm 1 in long and have a red to reddishorange head The mature larvae are yellow to yellowgreen in color and have four to eight rows of black spots lengthwise along the body Each larva has three pairs of thoracic legs and six to seven pairs of prolegs Hyche 1999 Redheaded pine sawfly larvae may lift the front and rear portions of their bodies in a defensive mechanism if Figure 5 Mature larvae of the redheaded pine sawfly Neodiprion lecontei Fitch Note the red head capsules Photograph by Ronald F Billings Texas Forest Service wwwforestryimagesorg Figure 6 Mature redheaded pine sawfly larva Prepupae and Pupae The cocoon is spun in the upper layer of the soil and is approximately 125 cm 12 in in length The cocoon is a reddishbrown paperlike cylinder with rounded ends Wilson 1978 Prepupae overwinter in cocoons and once adults emerge the cocoons are left behind with a large circular hole in one end Figure 7 Cocoons of the redheaded pine sawfly Neodiprion lecontei Fitch Large female cocoons on the left smaller male cocoons on the right Photograph by Lacy L Hyche Auburn University wwwforestryimagesorg Figure 8 Adult of the redheaded pine sawfly Neodiprion lecontei Fitch emerging from a cocoon Photograph by Arnold T Drooz USDA Forest Service wwwforestryimagesorg Life Cycle An adult female creates slits in a pine needle and lays one egg per slit Needles that have eggs laid in them look spotted or banded with alternating green and yellow patches In approximately four weeks larvae emerge and feed on the pine needles in large gregarious groups In approximately four more weeks larvae drop to the ground below the tree they were feeding on and begin to spin cocoons in the leaf litter or top layer of soil The larvae can overwinter here and possibly stay dormant in the prepupal state for more than a year under certain conditions Figure 9 Adult female redheaded pine sawfly Neodiprion lecontei Fitch laying eggs in a pine needle Photograph by James McGraw North Carolina State University wwwforestryimagesorg Hosts Young opengrowing pine trees under 46 m 15 ft tall are especially vulnerable Although hard pines are preferred larvae will feed on a variety of pine cedar and fir species if preferred food sources are exhausted In Florida the preferred food sources for redheaded pine sawfly include shortleaf pine Pinus echinata loblolly pine Pinus taeda longleaf pine Pinus palustris slash pine Pinus elliottii Virginia pine Pinus virginiana and scotch pine Pinus sylvestris Although not native to Florida Swiss mountain pine Pinus mugo is occasionally used as a landscape plant in northern Florida and is a documented host and preferred food source of the redheaded pine sawfly in more northern climates Baker 2010 In Canada and the northern United States jack pine Pinus banksiana and red pine Pinus resinosa are the preferred food sources for redheaded pine sawfly larvae Norway spruce Picea abies and deodar cedar Cedrus deodara are occasionally used as landscape plants in northern Florida and are documented as nonpreferred food sources of the redheaded pine sawfly Shetlar 2000 Additionally larvae feed on white pine Pinus strobus and larch Larix spp north of Florida but these trees are also considered a nonpreferred food source for the redheaded pine sawfly Shetlar 2000 Economic Importance Redheaded pine sawfly larvae are gregarious feeders capable of completely stripping small pine trees of foliage Younger larvae eat the outer edges of pine needles leaving behind the central tissue which wilts and dies forming what looks like dried straw This makes sawfly damage distinctive Hyche 1999 Older larvae eat the entire needle and if complete defoliation occurs groups of larvae will move to the nearest acceptable food source and continue feeding When foliage becomes scarce larvae will even feed on the soft bark tissue of defoliated trees Hyche 1999 Figure 10 Typical strawlike feeding damage caused by the redheaded pine sawfly Neodiprion lecontei Fitch Photograph by G Keith Douce University of Georgia wwwforestryimagesorg Figure 11 Complete pine defoliation due to feeding by an infestation of the redheaded pine sawfly Neodiprion lecontei Fitch Photograph by Albert Mayfield Florida Department of Agriculture and Consumer Services wwwforestryimagesorg Of particular vulnerability are commercial pine stands during reseeding cycles where large populations of a single species at a similar age provide both young foliage and trees of a desirable height under 46 m or 15 ft for redheaded pine sawfly infestation Wilson 1978 These monoculture conditions can encourage an outbreak of redheaded pine sawfly Nonpreferred feeding can also occur on the outskirts of pine plantations where colonies of larvae may infest neighboring trees as they exhaust the immediate preferred food source Hyche 1999 Management Biological Control Natural enemies are numerous 58 different species are recorded and disease viruses and predators regularly control populations of redheaded pine sawfly Van Driesche 1996 Larvae are also susceptible to harsh weather conditions such as extreme heat and cold CulturalMechanical Control For small scale control larvae can be mechanically or physically removed Hand picking can be an effective form of control for the homeowner and can be conducted by striking the branch sharply causing the larvae to fall off The falling larvae can be caught with a bucket of soapy water held underneath the branch Shetlar 2000 Chemical Control Horticultural soaps and oils are effective for larval control but the application should target young larvae Shetlar 2000 Sprays may be ineffective on a small scale as the insecticide may not penetrate deep into the foliage and therefore not eliminate a majority of larvae For commercial applications young larvae should be targeted by more forceful spraying to thoroughly penetrate foliage Spraying is only necessary if larval populations are reaching damaging thresholds Wilson 1978 Selected References Arnett Jr RH 2000 American insects A handbook of the insects of America north of Mexico CRC Press Boca Raton 1003 pp Atwood CE 1961 Present status of the sawfly family Diprionidae Hymenoptera in Ontario Proceedings of the Entomological Society of Ontario 91 205215 Baker JR Redheaded pine sawfly Insect and related pests of shrubs North Carolina State University 30 July 2014 Buss EA 2010 Sawflies and leafcutting bees pp 257258 In Koehler PG Buss EA Kern Jr WH Pereira RM Pests in and around the Florida home fourth edition University of FloridaIFAS SP 134 326 pp Hyche LL May 1999 The redheaded pine sawfly A guide to recognition and habits in Alabama Department of Entomology and Plant Pathology Auburn University 30 July 2014 Pennsylvania Department of Conservation and Natural Resources Redheaded pine sawfly Forest Health Fact Sheets PADCNR no longer available online Shetlar DJ 2000 Redheaded pine sawfly Insect and Pest Series Index Ohio State University no longer available online Van Driesche RG Healy S and Reardon RC 1996 Redheaded pine sawfly pp 105 106 In Van Driesche RG Healy S Reardon RC Biological control of arthropod pests of the Northeastern and North Central Forests in the United States A Review and Recommendations Forest Health Technology Enterprise Team Morgantown West Virginia 257 pp Wilson WF Averill RD 1978 Redheaded pine sawfly Forest Insect Disease Leaflet 14 United States Department of Agriculture Forest Service 4 pp
[ "redheaded pine sawfly", "Neodiprion lecontei", "United States" ]
http://ento.psu.edu/extension/factsheets/baldfaced-hornet
Share Baldfaced Hornet Dolichovespula maculata Family Vespidae The baldfaced hornet is an โ€˜ aerial yellowjacket โ€™ - one of 7 or 8 species in the genus Dolichovespula in North America . However , it is not a โ€˜ true โ€™ hornet โ€“ it is a yellowjacket . The only hornet in North America is the European hornet , Vespa crabro , and it is an accidentally introduced species . All of the yellowjackets in the genus Dolichovespula build nests in bushes and trees ( sometimes on the outside of buildings ) , and produce the characteristic football shaped , grey papery nests . The baldfaced hornet is found in most of the 48 contiguous states and D.C. , throughout Canada and in Alaska , and is the most common of the species in in Pennsylvania . Description The baldfaced hornet gets its name from the ivory - white markings on the face . The thorax , legs and abdomen also have white markings . The queen and her offspring range in size from 13 mm to 20 mm โ€“ the queen is usually the largest yellowjacket in the colony . Life History and Behavior In the spring , fertilized queens that have overwintered in protected places such as in hollow trees , rock piles , under bark and in the walls and attics of buildings , become active and begin to build a nest . The queen collects cellulose from weathered and rotting wood , chews the wood adding her saliva , and takes this paste and makes a papery material to construct the nest . She creates a few brood cells within the nest and deposits eggs in them and feeds the larvae when they hatch . This first brood will assume the Nests are usually located in bushes and shrubbery โ€“ at least 3 feet off the ground โ€“ and in trees as high as 60 feet or more , and are sometimes found under the eaves of buildings and other man - made , protected locations . They are a grey color and in Pennsylvania can reach up to 24 inches in height and 18 inches across . Early in the spring and summer , protein in the form of live prey is the usual diet consisting of flies , other yellowjackets and many other types of insects . Some nests are so full of yellowjacket remains that the inside has a yellowish cast to it . As the season progresses and there are fewer larvae to feed , the workers will take nectar and other forms of carbohydrates . Most of the colony , other than newly fertilized potential queens that will overwinter , will die before or shortly after the first hard frost . Management Baldfaced hornets can be considered a beneficial insect in that they reduce populations of unwanted insects ( including other yellowjackets ) and will help pollinate flowers when they are searching for nectar . Therefore , unless the nests are located close ( within 10 feet ) of an entrance to a building , under an eave that is close to the ground or in shrubbery next to a lawn that is mowed , the nests can be ignored . However , individuals with known sensitivities to wasp and bee stings should have any nests close to their homes removed by Those individuals without medical concerns and with a degree of daring can kill the colony by spraying a โ€˜ wasp and hornet โ€™ spray into the nest opening during the nighttime . The nest should be scouted during daylight to determine the best approach that will not disturb the wasps prior to introduction of the insecticide . DO NOT stand away from the nest and spray only the exterior as this will anger the colony and increase the risk of stings during the next several days . Effective control can only be achieved by stealthy approach and then spraying the Always read the insecticide label and follow those recommendations . Warning Pesticides are poisonous . Read and follow directions and safety precautions on labels . Handle carefully and store in original labeled containers out of the reach of children , pets , and livestock . Dispose of empty containers right away , in a safe manner and place . Do not contaminate forage , streams , or ponds . Authored by : Steve Jacobs , Sr . Extension Associate February 2010 ; Revised February 2015
[ "Baldfaced Hornet" ]
http://ento.psu.edu/extension/factsheets/galls-oak
Share Galls on Oak There are a variety of gall - forming species of small wasps that commonly infest oak , Quercus spp . , trees in Pennsylvania . Most leaf galls on oak cause little or no harm to the health of a tree . However , twig or branch galls may cause injury or even death to a heavily infested tree . Two common species of twig gall - producing insects are the horned oak gall wasp , Callirhytis cornigera , and the gouty oak gall wasp , C . quercuspunctata . These species are in the insect family Cynipidae . Both the horned oak gall wasp and the gouty oak gall wasp are known to occur from southern Canada to Georgia . Each of these galls may be diagnosed by their unique characteristic size , shape , and color . Description Figure 1 . A horned oak gall on a twig . Galls are abnormal plant growth or swellings comprised of plant tissue . Galls are usually found on foliage or twigs . These unusual deformities are caused by plant growth - regulating chemicals or stimuli produced by an insect or other arthropod pest species . The chemicals produced by these causal organisms interfere with normal plant cell growth . The horned oak gall wasp , C . cornigera , attacks the twigs of pin , scrub , black , blackjack , and water oaks . The gouty oak gall wasp , C . quercuspunctata , develops in the twigs of pin , scarlet , red , and black oaks . Both of these woody twigs galls on oak look similar , but the horned oak gall has small horns that protrude from around the circumference of the gall ( Figs . 1 & 2 ) . One adult gall wasp emerges from each of these horns . Figure 2 . A gouty oak gall on a twig . Life History The life cycles of the various gall - forming wasps are highly variable . Two or more years are required for gall wasps that develop in woody twig galls to reach maturity . Gall - forming wasps usually overwinter as adults in protected places away from the host tree . As the buds break in the spring and the leaves begin to expand , these small wasps start to lay their eggs in expanding plant tissue . During the egg - laying process or early larval - feeding period , specialized body glands secrete growth - regulating chemicals that interact Damage In general , most leaf galls on oak in Pennsylvania do not affect the health of the host tree . A few can cause leaves to drop prematurely , or distort them so that photosynthesis ( the plant โ€™ s food - making process ) is interrupted . Galls generally are aesthetically objectionable to homeowners who find them unattractive and fear that galls will cause damage to the health of their oak trees . Management Chemical control is seldom suggested for management of leaf galls on oak . Cultural methods of control may be effective in reducing the impact of these insects . Some fallen leaves may harbor various life stages of gall - producing pests . Therefore , it may be useful to collect and destroy all infested leaves . Some of these pests overwinter in twigs and branches of oak . Where such woody galls are detected , prune and destroy the infested plant material when the galls are small and have just started to develop . Once a gall begins to develop , it is almost impossible to stop or reverse its development . Unless registered insecticides can be applied when gall wasps are flying , they offer little or no effective measure of control . Lack of serious plant damage from leaf galls and the difficulty in proper timing of insecticide applications pose a strong argument against the use of insecticides to reduce galls on oak . Warning Pesticides are poisonous . Read and follow directions and safety precautions on labels . Handle carefully and store in original labeled containers out of the reach of children , pets , and livestock . Dispose of empty containers right away , in a safe manner and place . Do not contaminate forage , streams , or ponds . Authored by : Gregory A . Hoover , Sr . Extension Associate Revised June 2013 Penn State College of Agricultural Sciences research , extension , and resident education programs are funded in part by Pennsylvania counties , the Commonwealth of Pennsylvania , and the U.S. Department of Agriculture . Visit Penn State Extension on the web : http : / / extension . psu . edu Where trade names appear , no discrimination is intended , and no endorsement by Penn State Cooperative Extension is implied . This publication is available in alternative media on request . Penn State is an equal opportunity , affirmative action employer , and is committed to providing employment opportunities to minorities , women , veterans , individuals with disabilities , and other protected groups . Nondiscrimination ยฉ The Pennsylvania State University 2019
[ "Insect Advice", "Galls on Oak" ]
http://ento.psu.edu/extension/factsheets/managing-western-corn-rootworm-resistance-to-bt-on-the-fringe
Share Managing western Corn Rootworm Resistance to Bt on the Fringe Brief History of Rootworm Bt Corn The first Bt toxin for corn rootworm control , Cry3Bb1 , was sold as Yieldgard Rootworm in 2003 , then the same toxin was combined with a Bt trait targeting European corn borer and / or herbicide tolerance genes in YieldGard Plus , VT Triple , and Genuity VT TriplePro . By 2010 , Cry3Bb1 was part of a multi - trait pyramid in SmartStax ( with Cry34 / 35Ab1 ) for rootworm control . The approval of pyramids led to a reduction in refuge from 20 % to 5 % . EPA also approved a seed mixture of Bt Performance problems with Cry3Bb1 ( fields with excessive root damage and lodging ) were first reported to the Environmental Protection Agency in 2004 , but became more widespread and were brought to the attention of extension entomologists in 2009 in southern Minnesota and eastern Iowa when more than 30,000 acres of corn were affected . The number of acres affected was approximately the same in 2010 but then greatly increased in 2011 and 2012 . Using a combination of field and laboratory studies over multiple field seasons , entomologists from Iowa State University demonstrated that western corn rootworm larvae from Fig . 1 . Aerial photos of Cry3Bb1 fields with unexpected rootworm damage โ€“ Minnesota , 2009 . A ) Twenty - row strips of Cry3Bb1 corn had significantly more lodging and root damage compared to 4 - row refuge strips treated with soil insecticide . B ) The portion of a field with Cry3Bb1 corn was heavily lodged compared to the rest of the field planted to a different type of rootworm Bt . ( Photos from Ken Ostlie , Univ . of MN ) . A . B . Development and Management of Resistance in the Central Corn Belt ( Focus Area ) Agricultural production in the Central Corn Belt is characterized by intensive corn cultivation coupled with low crop and landscape diversity . Rootworm resistance in this area appears to have arisen independently in single fields ( point sources ) . Problem fields share the following characteristics : Planting corn continuously for multiple years ( typically more than four years ) Using the same ( Cry3Bb1 ) Bt trait year after year Refuge compliance was sometimes problematic ( no / not enough refuge , or refuge too far from the Bt field ) on farms with unexpected damage . Continuous corn fields typically have high rootworm pressure , which maximizes resistance development when control tactics are implemented because selection pressure is applied to a huge rootworm population over a wide area , year after year . Since genes for Cry3Bb1 resistance โ€” even if rare โ€” must have been present in rootworm populations across the Central Corn Belt , when strong selection pressure was imposed resistance evolved independently at multiple locations across several states ( as opposed to spreading from a single point - source ) . The pattern of problem fields suggests that this is happening in the focus area with intensive production of continuous corn expressing Cry3Bb1 . Central Corn Belt ( Focus ) : Intensive corn production Low crop diversity Low landscape diversity Less crop rotation Large fields / farms Numerous Reports of problem fields Eastern Corn Belt ( Fringe ) : Higher crop diversity Greater landscape diversity More crop rotation Less irrigated corn Smaller fields / farms Few reports of problem fields Status of Resistance in the Fringe Area In the Eastern Corn Belt , agricultural production differs in important ways from the central U.S , where Bt - resistant rootworm populations have developed . The east has higher crop and landscape diversity , more crop rotation , lower levels of irrigated corn , and smaller field / farm sizes . Even in this different setting , however , we can assume that genes for resistance to Cry3Bb1 are present in rootworm populations ; therefore , there is a similar potential for rootworms to develop resistance Bt rootworm trait in continuous corn fields . Thus far , rootworm resistance While the situation in the Central Corn Belt is already severe , entomologists in the Eastern Corn Belt believe that early - identification and elimination of point sources by crop rotation is the best approach to slowing the development and movement of resistance in the fringe . Given the speed with which Cry3Bb1 resistance evolved and spread in the west , it is common sense to take a strict , proactive approach in the Eastern Corn Belt , and rotate when a problem is first detected . Our goal is to preserve the usefulness of Cry3Bb1 and other Bt rootworm traits for as long as possible . Signs of a Potential Resistance Problem in Bt Corn You , or your family , neighbors , or employees will likely be the first to see or hear about a potential problem field . Farms with continuous corn production , and specifically fields planted to the same Bt year after year , are at most risk for developing resistant rootworm populations . These fields should be targeted for scouting during the field season . Contact your seed dealer and Penn State Extension immediately if you suspect a problem , so that the location can be sampled , documented , and tested when rootworms are still active . Below are Large number of beetles in the field , possibly leaf feeding and damaging silks , resulting in poor pollination . - Beetle numbers alone do not indicate resistance , but problem fields in the Central Corn Belt do tend to have large adult populations . Unexpected lodging and root damage that can not be explained by an agronomic or environmental problem , or presence of another root - feeding pest . Fig . 2 . Warning signs of rootworm populations that may be resistant to Bt varieties : A ) Large numbers of adult beetles , damaging silks and leaves . B ) Goosenecked or lodged corn plants ; C ) Extensive pruning of roots . ( Photos from Chris DiFonzo , MSU ) A . B . C . A key step to identifying whether or not a rootworm infestation may be due to resistant rootworm populations is confirming that plants are indeed expressing Bt toxin . This is done by grinding and testing leaf tissue to detect the specific type of Bt . Seed companies and field crop entomologists at Penn State usually have access to strips for testing . For final confirmation of resistance , beetles need to be collected for egg laying . Eggs then must be held under cold conditions for several months before they hatch . Larvae can then be placed on Bt plants Managing Suspected Western Corn Rootworm Resistance in Bt Corn After you report a problem field , it is important to document the field history , level of rootworm damage , and beetle population , and to confirm Bt expression . If the beetle pressure and damage is high , Bt is present in plants , and there is no other explanation for the failure of the hybrid , resistance is suspected . Our best recommendations for this situation are : 1 . CHECK nearby at - risk fields this year If resistance is suspected in one field , it may also be occurring in similarly managed , nearby , continuous corn fields . Scout these nearby fields immediately ( look for lodging , dig roots ) to detect a problem , and handle them the same way as the original field . 2 . ROTATE next year Our sole recommendation for fields with suspected resistance is to rotate . Rotation can be to soybean or any other non - host crop ( alfalfa , canola , snap beans , etc . ) . If this can not be accomplished on - farm , consider working with a neighbor or renter to trade ground for a season . All rootworm eggs that hatch the following year will die if corn is not present , making rotation the single , most - effective way to reduce the spread of resistance . The goal is to eliminate point sources . Note : In Pennsylvania and the rest of the Mid - Atlantic region , unlike the much of the Central Corn Belt , we have no evidence of rotational - resistant corn rootworms that lay eggs in soybeans . 3 . ELIMINATE volunteer corn next year For rotation to be effective , there must be early and complete control of volunteer corn the next year . Use the Penn State Agronomy Guide or work with an agricultural professional to develop a herbicide program for the next season in the rotational crop . Best Management Practices to Reduce Risk of Resistance to Bt Even before you detect a problem , you can help preserve the efficacy of Bt traits in corn by doing the following : Rotate your crops . If you plant continuous corn , make it a point to rotate fields on a schedule every 3 to 4 years . Rotation not only eliminates that rootworm population the following season , but it has many agronomic benefits . You must grow continuous corn , rotate modes of action , just as you would with herbicides . Avoid using the same Bt year after year by planting a hybrid with a different Bt trait or multiple Bt traits for rootworm . Alternatively , plant a conventional hybrid with a soil insecticide . Note : the use of a soil insecticide on top of a Bt hybrid is not recommended by corn entomologists . Research trials in other states show little or no yield benefit from applying soil insecticides to Bt corn . Insecticides may also mask a problem with the Bt hybrid . Detect problems early ; scout continuous fields for beetles and damage in mid to late - July , and report problems immediately . Authored by : John Tooker , Assistant Professor , Department of Entomology , The Pennsylvania State University Chris DiFonzo , Professor , Department of Entomology , Michigan State University July 2013 Penn State College of Agricultural Sciences research , extension , and resident education programs are funded in part by Pennsylvania counties , the Commonwealth of Pennsylvania , and the U.S. Department of Agriculture . Visit Penn State Extension on the web : http : / / extension . psu . edu Where trade names appear , no discrimination is intended , and no endorsement by Penn State Cooperative Extension is implied . This publication is available in alternative media on request . Penn State is an equal opportunity , affirmative action employer , and is committed to providing employment opportunities to minorities , women , veterans , individuals with disabilities , and other protected groups . Nondiscrimination ยฉ The Pennsylvania State University 2019
[ "Rootworm", "Resistance to Bt" ]
http://entomology.ucdavis.edu/Faculty/Robert_B_Kimsey/Kimsey_Research/Tick_Biology/
Tick Biology Background Information on the Biology of Ticks Larisa Vredevoe , Ph . D , Deparment of Entomology , University of California , Davis Soft tick ( left ) and Hard tick ( right ) Ticks are blood feeding external parasites of mammals , birds , and reptiles throughout the world . Approximately 850 species have been described worldwide ( Furman and Loomis 1984 ) . There are two well established families of ticks , the Ixodidae ( hard ticks ) , and Argasidae ( soft ticks ) . Both are important vectors of disease causing agents to humans and animals throughout the world . Ticks transmit the widest variety of pathogens of any blood sucking arthropod , including bacteria , rickettsiae , protozoa , and viruses . Some human diseases of current interest in Hard Ticks : Family Ixodidae Hard ticks have three distinct life stages . Larvae which emerge from the egg have six legs . After obtaining a blood meal from a vertebrate host , they molt to the nymphal stage and acquire eight legs . Nymphs feed and molt to the next and final stage - the adult , which also has eight legs . After feeding once more , the adult female hard ticks lay one batch of thousands of eggs and then die . Only one blood meal is taken during each of the three life stages . The time to completion of the Scanning Electron Micrograph of Tick Mouthparts The mouthparts of hard ticks are readily visible from above . There are three visible components : the two outside jointed parts are the highly mobile palps ; between these are paired chelicerae , which protect the center rod - shaped structure , the hypostome . The palps move laterally while the tick is feeding and do not enter the skin of the host . The rough hypostome has many beak - like projections on it . This is the structure which plunges into the host ' s skin while feeding . The backward directed projections prevent easy removal of the attached tick . In addition , most hard ticks secrete a cement - like substance produced by the salivary glands which literally glues the feeding tick in place ; the substance dissolves after feeding is complete . Questing Hard Tick Ixodes scapularis Hard ticks seek hosts by an interesting behavior called " questing . " Questing ticks crawl up the stems of grass or perch on the edges of leaves on the ground in a typical posture with the front legs extended , especially in response to a host passing by . Certain biochemicals such as carbon dioxide as well as heat and movement serve as stimuli for questing behavior . Subsequently , these ticks climb on to a potential host which brushes against their extended front legs . Hard ticks are most commonly collected for research by the use of " Lifecycles of Hard Ticks Hard ticks have a variety of life histories with respect to optimizing their chance of contact with an appropriate host to ensure survival . Some ticks feed on only one host throughout all three life stages . These ticks are called one host ticks . This type of tick remains on one host during the larval and nymphal stages , until they become adults , and females drop off the host after feeding to lay their batch of eggs . Other ticks feed on two hosts during their lives and are called two host ticks . This type of tick feeds and remains on the first host during the larval and nymphal life stages , and then drops off and attaches to a different host as an adult for its final blood meal . The adult female then drops off after feeding to lay eggs . Finally , many ticks feed on three hosts , one during each life stage , and are appropriately named three host ticks . These ticks drop off and reattach to a new host during each life stage , until finally the adult females lay their batch of eggs . In each case , the fed adult stage is terminal , that is , after laying one batch of eggs the female dies , and after the male has reproduced , he dies as well . One Host Tick Lifecycle Two Host Tick Lifecycle Three Host Tick Lifecycle Soft Ticks : Family Argasidae The life stages of soft ticks are not readily distinguishable . The first life stage to come out of the egg , a six legged larva , takes a blood meal from a host , and molts to the first nymphal stage . Unlike hard ticks , many soft ticks go through multiple nymphal stages , gradually increasing in size until the final molt to the adult stage . Some soft ticks pass through up to seven nymphal molts before they become adults . Soft ticks feed several times during each life stage , and females lay multiple small batches The mouthparts of soft ticks are are not readily visible from above . There are three visible components : the two outside jointed parts are the highly mobile palps ; between these are paired chelicerae , which protect the center rod - shaped structure , the hypostome . The palps move laterally while the tick is feeding and do not enter the skin of the host . The rough hypostome has many beak - like projections on it . This is the structure which plunges into the host ' s skin while feeding . The backward directed projections prevent easy removal of the attached tick . Some soft ticks seek hosts by questing on low - lying vegetation , but the vast majority are nest parasites , residing in sheltered environments such as burrows , caves , or nests . Certain biochemicals such as carbon dioxide as well as heat and movement serve as stimuli for host seeking behavior . Soft ticks feed for short periods of time on their hosts , varying from several minutes to days , depending on such factors as life stage , host type , and species of tick . The feeding behavior of many soft ticks can be compared to Soft ticks can be readily collected via dry ice traps . Blocks of dry ice emit large amounts of carbon dioxide , a host seeking stimulant . Traps are set in and around nesting areas of animal hosts . Soft ticks can be observed running along the surface of the ground towards the trap and are collected by hand , or inside a collection chamber in the trap . Many types of soft ticks can be artificially fed in the laboratory , thus reducing or eliminating the use of animals for certain studies . Some ( ie : Ornithodorus coriaceus ) will feed through sausage casings filled with almost any type of mammal blood heated up to 37 ยฐ C . Others can be fed blood through various types of membranes in the presence of biochemical and environmental feeding stimulants such as ATP , carbon dioxide , heat , and animal fur ( Sonenshine 1993 ) . Commonly Encountered Ticks in California Back to the R.B. Kimsey Lab
[ "Tick", "mammals", "protozoa" ]
http://entrance-exam.net/forum/general-discussion/best-courses-after-inter-bipc-1209364.html
Best courses after inter BIPC 2 30th July 2013 1143 PM imira Senior Member Join Date May 2010 Posts 15774 Re Best courses after inter BIPC As you have studied Biology as a subject you can apply for courses like MBBS BAMS or BHMS Duration of these courses is 4 125 years You can also try for courses like BSc Nursing or BPharm Courses related to fisheries dairy science or agriculture can be opted All these courses offer lucrative salary with in the range of Rs 25000 to 1 lakh per month 3 31st July 2013 0437 PM Mattyjkk Senior Member Join Date Jul 2013 Location kolkata Posts 374 Re Best courses after inter BIPC Courses After Intermediate for BiPC students Courses for BiPC students Degree Diploma Certificate Courses are available for M PC BiPC students Audiology Speech Language Pathology ASLP Bio Technology Bioinformatics Food Science Health Sciences Health Care Home Science Nutrition Dietetics Optometry Pharmacy Prosthetics and orthitic Radiography Environmental Science MSc Integrated Courses BA BCom BCom Hornors BCom Comp BCom Vocational Air Hostess Flight StewardCabin Crew Animation Multimedia Business Management Chartered Accountant CA Chartered Financial Accountant CFA Cinematography Company Secretary CS Computer Education Cosmetology Cost Works Accountant CWA Event Management Film Production and Acting Fine Arts Foreign Trade Hotel Management Hospital Management Journalism Mass Communication Law Modeling Performing Arts Photography Physical Education Poultry Farming Radio Video Jockey Social Work Teacher Education Travel Tourism Vocational Courses Foreign languages Web design Advertising Gemology Insurance Fashion Designing 4 1st August 2013 0636 PM YBali Reddy Senior Member Join Date Aug 2013 Location giddalur Posts 120 Re Best courses after inter BIPC Best courses after inter BIPC are medicinepharmasynurseingdefence side etc All the best 5 1st August 2013 0703 PM ckanth1 Join Date Jul 2013 Location Hyderabad Posts 29 Re Best courses after inter BIPC Hi Friend Dont Worry Best Courses after Inter BiPC is You may Join in different Courses like MBBS BHMS BAMS BZC BPharmacy and BSc Nursing etc According to your Wish you may join Thank you 6 1st August 2013 0705 PM ckanth1 Join Date Jul 2013 Location Hyderabad Posts 29 Re Best courses after inter BIPC Hi Friend Dont Worry Best Courses after Inter BiPC is You may Join in different Courses like MBBS BHMS BAMS BZC BPharmacy and BSc Nursing etc According to your Wish you may join Thank you 7 16th August 2013 0456 PM Unregistered Guest Posts na Re Best courses after inter BIPC Am complited inter bipc What can i do Tell me about best corus 8 18th May 2015 0138 PM Unregistered Guest Posts na Re Best courses after inter BIPC what are the job oppurtunities if i go with homeopathy in india and what would be the salary 9 12th August 2015 0613 PM snehaguptaa Senior Member Join Date Aug 2015 Posts 128 Re Best courses after inter BIPC Best courses after inter BIPC 1Photography 2Vocational Courses 3Web design 4Event Management 5Radiography 6Teacher Education 7Environmental Science 8Film Production and Acting 9Bio Technology 10Company Secretary 11Poultry Farming 12Cosmetology 13Physical Education 14Cinematography 10 31st August 2015 0256 PM piki05 Senior Member Join Date Feb 2012 Posts 248 Re Best courses after inter BIPC List of Career Options available after 12th Biology MBBS Bachelor of Medicine Bachelor of Surgery BHMS Bachelor of Homeopathic Medicine Surgery BAMS Bachelor of Ayurveda Medicine Surgery B Pharm Bachelor of Pharmacy B Tech Bachelor of Technology in Biotechnology BE in Environmental Engineering BDS Bachelors of Dental Science BPT Bachelor of Physiotherapy BSc Bachelor of Science Forensic Science BSc in Forensic Sciences B Sc in Forensic Sciences B Sc in Life Science Chemistry Forensic Science Diploma in FSciences Ballistics and Finger Prints Diploma in Forensic Science Cyber Crimes Diploma in Forensic Science Computer Forensics Diploma in Criminology and Forensic Science for Police personnel Zoology B Science in Aquaculture Fishery Microbiology B Sc in Advanced Zoology and Biotechnology B Sc in Zoology BScience Hons in Zoology B Sc in Zoology and Animal Biotechnology Biotechnology BE in Biotechnology BTech Industrial Biotechnology BScience in Biotechnology B Sc in Biotechnology and Bio informatics Diploma in Biotechnology Agriculture BSc Agriculture Mktg and Business Management BSc Biochem and Agricultural Chemistry B Sc in Crop Physiology B Sc in Entomology B Sc in Agronomy B Sc in Agricultural Meteorology B Sc in Agricultural Biotechnology B Sc Hons in Agriculture B Sc in Agriculture BScience in Agricultural Eco and Farm management B Sc in Agricultural Statistics Geology BSc Hons Geology B Science in Geology PG Diploma in Geology Ground water PG Diploma in Environmental Geology PG Diploma in Engineering Geology Textile BE in Man Made Fiber Technology BE in Textile Technology BE in Textile Chemistry Diploma in Fabrication Tech and Erection Eng Diploma in Textile Tech Diploma in Textile Eng Microbiology Diploma in Industrial Microbiology Diploma in Clinical Microbiology Diploma in Clinical Pathology BScience Hons in Microbiology BScience in Microbiology Food Technology B Sc in Food Preservation and Processing B Sc in Food Processing B Sc in Food Processing and Technology B Sc in Food Storage Preservation and Food Tech B Sc in Food Technology BioChemical Engineering Diploma in Fish Processing Technology Diploma in Sugar Technology 11 12th August 2016 0241 PM Unregistered Guest Posts na Re Best courses after inter BIPC Sir I am Jayadeep I completed inter bipc with 91 in IP and eamcet rank 32440 I am belongs to SC category is it chance horticulture non farmer quota 12 2nd October 2016 0506 PM Unregistered Guest Posts na Re Best courses after inter BIPC How to study psychology which course I should take after inter 13 3rd October 2016 1212 PM Suraj Singh 7494 Senior Member Join Date Jun 2011 Posts 382 Re Best courses after inter BIPC Quote Originally Posted by fjh i have completed my inter with 73 i dont know i will seat or not so plz tell me which is the best course related to science whether any entrance exam is there when how many years it will take to complete what is the salery After completing your BIPC you can go for these courses MBBS Nursing Dental BSc Medical BHMS Zoology Pharmacy Mostly all of these courses are of 3 years duration except from MBBS course which is a 4 year course You can select any one field and make your career in that field Rest the salary will depend upon your type of job The salary package will be different according to profession and sector You can also run your own hospital also 14 24th December 2016 0812 PM Unregistered Guest Posts na Re Best courses after inter BIPC SirI want to become an IAS officer I am studying 2nd year Bipc I doesnt want to study science related subjects in degree so which group I had to select in degree 15 10th January 2017 0443 PM Unregistered Guest Posts na Re Best courses after inter BIPC I am studying bipc second year and I am interested in dermatology Plz tell me the steps I should take to join in dermatology 16 18th April 2017 1042 AM Unregistered Guest Posts na Re Best courses after inter BIPC Sir I am just completed my intermediate in bipc with 752 I want to build up my career by choosing the courses that help me to settle quickly other than medical jobs Would you please give me the suggestion 17 26th April 2017 0125 PM Unregistered Guest Posts na Re Best courses after inter BIPC Sir I completed my inter second year bipc I Secured 86 in inter Is there any college for nutrition 18 21st May 2017 1222 PM Unregistered Guest Posts na Re Best courses after inter BIPC I have completed my inter bipc I secured 916 in inter I want your suggestions which course is the best and my eamcet rank is 45000 Please ignore 19 24th May 2017 0857 AM Unregistered Guest Posts na Re Best courses after inter BIPC Sir I am Rvaishnavi I completed Inter bipc with 82 percentage in Ipe and eamcet rank 37104 i belongs to bc a category Which course is able to get 20 25th May 2017 1013 AM Unregistered Guest Posts na Re Best courses after inter BIPC Sir I am aravind completed bipc with 81i am interested in b tech biotechnology but first year contains maths in it Can a bipc student do maths in b tech 21 29th May 2017 0139 PM Unregistered Guest Posts na Re Best courses after inter BIPC Sir I have completed my inter first year which course is better to my career after inter sir I got 80 percentage in bipc first year 22 20th August 2017 1135 PM Unregistered Guest Posts na Re Best courses after inter BIPC Is there any use in joining in long termwhen we not secured a good rank in NEET exams 23 2nd September 2017 1204 AM Unregistered Guest Posts na Re Best courses after inter BIPC Hello Im roopa and Ive completed my inter with 979 and my neet rank is 40590 Im not allotted into any college in my state I dont want to go with long term Can you please suggest me any good courses so that I can be in a good position after 5 years 24 27th April 2018 0640 PM Unregistered Guest Posts na Re Best courses after inter BIPC Best course after inter bipc group What is the best and best course to settle in life as early as possible Please only best courses only 3 best courses I want 25 2nd May 2018 0258 PM Unregistered Guest Posts na Re Best courses after inter BIPC Sir I got 91 in inter exams and 66000 rank in EAMCET I didnt write Neet exam yet and I want to become a nutritionist 26 15th June 2018 1240 PM Unregistered Guest Posts na Re Best courses after inter BIPC I want to do open degree am a bipc student I want to know what are the subjects available in open degree 27 26th June 2018 0145 PM Unregistered Guest Posts na Re Best courses after inter BIPC I have completed my intermediate with 93 and my emcet rank is 15 thousand So which course is better for my career 28 7th September 2018 0422 PM Unregistered Guest Posts na Re Best courses after inter BIPC I am still studying inter second yearwhich courses are better for my career apart from studies like animationtextile etc 29 30th November 2018 0920 AM Unregistered Guest Posts na Re Best courses after inter BIPC Hello sir I am Ajay I have an dout how many marks required to get Agriculture bsa seat in eamcet
[ "BIPC" ]
http://entrance-exam.net/forum/general-discussion/what-highest-salary-package-received-iim-student-844881.html
1 26th June 2012 , 11 : 26 AM Unregistered Guest Posts : n / a What is the highest salary package received by an IIM student ? what is the highest package got by any iim student Related Questions : Job opportunities in abroad for IIM passouts ? Average package and last years highest package of IIM passout ? What is the scope of HR manager in future ? What is the highest package that a IIM student can get ? What is the salary package for IIM passed students ? How much amount do I have to pay for MBA course ? What is the hostel fee and highest salary package ? What is the highest package ever received by a B . Tech Civil student in India ? Has MBA lost its charm ? What is the highest salary package given to a BBA IT student in LPU ? - - [ Most Discussed ] What is the salary package and job opportunities in abroad for IIM passouts - - [ New ] Does Pharmacy student offer the highest salary package in India ? What is the highest package paid at IIM till now ? What is the highest package at IIM ? Salary package of MSc Tech with Geophysics in BHU ? In which university is the salary package the highest in MSc Tech with Geophysics ? How much amount to pay for MBA course ? Details about placements , loan facility , hostel fee and faculty ? What is the highest package offered to an IITian till now ? What will be my salary package after completion of MBA course from top 10 Colleges excluding IIMs ? What ' s the salary package for a foreigner student in UK after just completion of M . Sc degree in international business ? How much is the fee for the course of MBA ? What is the highest and lowest salary package for fresher B . Tech in IT ? What are the options after doing B . Tech 2 8th July 2012 , 12 : 48 PM Unregistered Guest Posts : n / a Re : What is the highest salary package received by an IIM student ? What is the average salary after completion of mba from any IIM ? 3 19th July 2012 , 02 : 57 PM Re : What is the highest salary package received by an IIM student ? what is the highest salary package received by an IIM student ? 4 20th July 2012 , 10 : 04 AM abthar Senior Member Join Date : May 2011 Posts : 209 hi IIMS viscosity Facebook recruited 2 students for a package of 70 lakhs per annum is the highest package in 2011 academic year But in 2012 In the last two months , three students of IIM - A have bagged Rs 1 crore - plus pre - placement offers ( PPO ) each from financial institutions ( BANKS ) . While two offers have been made by Deutsche Bank for their Singapore and London offices , one is from Barclays in Hong Kong . ALL THE BEST . 5 8th August 2012 , 10 : 14 PM what is the maximum package i can expect from the iim ' s ? 6 13th September 2012 , 10 : 33 PM Can art stream student also have ability to crack cat ? 7 14th October 2012 , 09 : 55 AM what is the average and highest salary paid after completing MBA in H.R.M from I.I.M.A ? 8 3rd December 2012 , 08 : 27 PM WHAT IS THE CRITERIA FOR IIM 9 24th December 2012 , 06 : 59 PM who is receive highest salary ? 10 26th December 2012 , 01 : 46 PM Presentl i am doing MBA from ( IGNOU ) and my working experience last 6 years from Operations sector and presently i am working TPA sector from Sep - 12 to till now and currently package is 1.80 ( one lakh eighty thousand ) Per annum , pls advise what should be expectations of next step of Job sector . 11 26th December 2012 , 08 : 31 PM educationindia Senior Member+ Join Date : Dec 2012 Posts : 611 Hi Friends . . . . . . . . . . . . . . . . . . . . . . . The highest salary package received by an IIM student is 3.5lakhs per annum ALL THE BEST . . . . . . . . . . . . . . 12 5th January 2013 , 03 : 15 PM can i join iim for m.s 5 years integrated course after completion my 12th standard 13 5th January 2013 , 07 : 28 PM beheras Join Date : Jan 2013 Posts : 227 HI , The highest salary package received by an IIM student is Rs . 4 laks per annum . Hope the information helps you , all the best . . . . . . . . . . . . . . 14 5th January 2013 , 10 : 57 PM ipkay93 Senior Member Join Date : Dec 2012 Location : New Delhi , Kanpur , Allahabad Posts : 225 Hello dear aspirant , the highest salary offered to an IIM student was 1.5 crore , it was offered by Deutsche Bank at IIM - A . Regards , Pkay . 15 9th January 2013 , 01 : 23 PM I hv completed mechanical engineering 2012 . for iim what is procedure . pls explane in detail . 16 17th January 2013 , 11 : 27 PM What is the qualifing marks in CAT exam ? 17 1st February 2013 , 12 : 12 PM i did my mba course in marketing subject from BHARTHIDASAN UNIVERSITY . how would i can get the salary . Do i get the job in multinational Company ? ? ? 18 8th February 2013 , 09 : 57 PM Quote : Originally Posted by educationindia Hi Friends . . . . . . . . . . . . . . . . . . . . . . . The highest salary package received by an IIM student is 3.5lakhs per annum ALL THE BEST . . . . . . . . . . . . . . 3.5 Lakhs per annum . . . . . . . . . . . . . .then what is the purpose of studying in IIM ' s . . . . . . . . . . 19 9th February 2013 , 09 : 54 AM Kotesh432 Senior Member+ Join Date : Jan 2012 Location : Hyderabad Posts : 894 Hi Guest , The highest package received by an IIM Student till date is 70 Lakhs per Anum . The salary was given to two students and Facebook recruited the students . There are many other packages which will be given to the students who pass out from the University . Thank you , All the best . 20 9th February 2013 , 11 : 08 AM Beawar Join Date : Jan 2013 Posts : 337 Dear . . The highest package till date received by any IIM student is of 1.6 crore . The offer was given by a big foreign financial firm to an student of IIM calcutta . Till date it is the highest package given to any student in any of the IIM . Sources says that due to global recession the package is low and it will increase to a huge number in future for sure . Hope it will help Cheers 21 10th March 2013 , 02 : 35 PM Whts d minimum salary from an iimian ? 22 25th March 2013 , 09 : 10 PM MAKES 25 Posts : 742 Quote : Originally Posted by Unregistered what is the highest package got by any iim student DEAR FRIEND , THE HIGHEST SALARY PACKAGE OF THE I.I.M ( INDIAN INSTITUTE OF MANAGEMENT ) 70 , 00 , 000 PER ANNUM AND IF YOU GET MORE EXPERIENCE THEN YOU GET HIGHEST 1 , 50 , 00 , 000 OF THE OTHER COMPANY . with best wishes of Makes 25 . 23 2nd June 2013 , 07 : 02 PM what is the minimum salary received by an iim student ? 24 9th July 2013 , 06 : 46 PM it is 22 laks per annum . . . . . . . . .
[ "IIM student", "salary package" ]
http://entrance-exam.net/forum/general-discussion/what-salary-air-hostess-1001937.html
1 2nd December 2012 , 06 : 49 PM Unregistered Guest Posts : n / a What is the salary of Air Hostess ? wath is the salary of air hostess ? . . .could u please ell me the details Related Questions : Air Hostess Job , I want to become an Air hostess - - [ Most Discussed ] What is the salary of Air Hostess ? What is the minimum requirements of Weight to become an Airhostess ? What is the salary of Air Hostess for a month ? Which are the colleges for Air Hostess ? How should I apply for Air Hostess Training ? How to become an Air hostess ? what can I do to fulfill the requirements for Air Hostess training ? What is the procedure to become an Air Hostess after doing FYB . Com ? Fee for Air Hostess training ? Salary after completion of training ? What is the date of Air Hostess entrance exam ? Requirements to become an Air Hostess ? What kind of questions are asked in the written exam for Air Hostesses ? What should I do to get Air Hostess job ? How should I become an Air Hostess ? For being an Air Hostess getting trained from an institute is mandatory ? Qualification required , expense and duration of Air Hostess Training ? Eligibility to become an Air Hostess with height 153cm ? Diploma courses related to Air Hostess for B . Com graduate ? - - [ New ] Are there any vacancies for Air Hostess ? I am studying B . Pharmacy What is the date of the entrance test for Air Hostess training ? What is the salary structure of an Air Hostess ? 2 1st January 2013 , 03 : 21 PM Oracle 9 Senior Member++ Join Date : Jan 2012 Location : Delhi NCR Posts : 1,281 Re : What is the salary of Air Hostess ? Minimum Qualification for Becoming Air hostess 10 + 2 passed or a Graduate degree or equivalent qualification . Age : 18 โ€“ 27 Minimum Height : 157.5 cms ( Weight in proportion with height ) Marital status : Unmarried Salary Structure of AirHostess in India An Airhostess working in an international airlines gets more salary as compared to the one in domestic airlines . The starting monthly salary of an airhostess working in a domestic airlines is between 18000 / - to Rs . 25 , 000 . After few years of experience salary rises upto 25000 / - to 50000 / - . Best Airlines in India Air India Jet Airways Lufthansa Airlines Kingfisher Red ( Air Deccan ) MDLR Airlines Jet Konnect GoAir SpiceJet IndiGo Airlines 3 22nd February 2013 , 03 : 29 PM maha . thegreat @ gmail . com Senior Member Join Date : Sep 2012 Posts : 262 Re : What is the salary of Air Hostess ? dear friend , 4 22nd February 2013 , 07 : 16 PM TARA001 Senior Member + + + + Join Date : Oct 2012 Posts : 2,084 HELLO , ABOUT AIRHOSTESS COURSE : Flight attendants or cabin crew ( also known as stewards / stewardesses , air hosts / hostesses , cabin attendants ) are members of an aircrew employed by airlines primarily to ensure the safety and comfort of passengers aboard commercial flights , on select business jet aircraft . Eligibility for Air Hostess Courses > > The educational qualification for an Air Hostess / Flight Steward training program is 10 + 2 or a graduate degree with a diploma / degree in Hotel Management or Tourism Management . > > The aspirant must be eligible to hold an Indian Passport and should be below twenty โ€“ five years of age with proportionate weight and height . > > Further , one must be unmarried , with normal eyesight of 6 / 6 increased vision in each eye . > > Fluency in English , Hindi and knowledge of an international language is an added advantage . 1 . The Cabin Crew can get up to 40 , 000 per month for domestic flights whereas upto 1 , 50,000 for international flights on wide โ€“ bodied aircraft . 2 . T he ground staff can also earn 20 , 000 โ€“ 30 , 000 per month . Top 10 Air Hostess Training Institutes in India Air Hostess Academy ( AHA ) , Bangalore Air Hostess Academy ( AHA ) , Chandigarh Air Hostess Academy ( AHA ) , Delhi / NCR Air Hostess Academy ( AHA ) , Mumbai Air Hostess Academy ( AHA ) , Pune Frankfinn Institute of Air Hostess Training , Mumbai Frankfinn Institute of Air Hostess Training , Delhi / NCR Kingfisher Training Academy ( KTA ) , Mumbai Rajiv Gandhi Memorial College of Aeronautics , Jaipur Universal Aviation Academy ( UAA ) Chennai HOPE THIS INFORMATION WOULD HELP YOU . . . . GOOD LUCK 5 21st June 2013 , 09 : 21 AM Unregistered Guest Posts : n / a How much % are require for air hostess in hsc 6 17th August 2013 , 11 : 59 PM how do I join the airline job at ground in reservation what is the age required ? And should be how much qualified ? And what eould be thr salary ? 7 3rd September 2013 , 02 : 41 PM what is the salary of Dy General managers in CAMO section of spicejet 8 16th September 2013 , 11 : 36 PM wath is the salary of air hostess ? . . .could u please ell me the details 9 12th October 2013 , 09 : 36 PM what is salary of air steward ? ? ? ? 10 27th October 2013 , 02 : 00 PM what subject is taken in 11th standard to become an air hostess 11 31st October 2013 , 04 : 55 PM 150cm hight is sufficent for airhostess . . if nt then must allow who have 150cm hight . . . 12 10th November 2013 , 10 : 27 PM Which stream we take to become a airhostss ? ? ? And what is the salary of an airhostss ? ? 13 12th November 2013 , 11 : 58 AM I m 19 years old . . .I hav 153 cm height bt i wear specs . . M i allow for Air hostess . . ? ? ? ? 14 12th November 2013 , 12 : 07 PM I m 19 years old . .I hav 153 cm height . . .bt i wear specs so m i allowed for air hostess ? ? ? ? ? 15 21st November 2013 , 12 : 03 AM What is admission fees 16 23rd November 2013 , 06 : 46 AM How to get job in air ground staff 17 16th December 2013 , 09 : 41 PM Quote : Originally Posted by Unregistered wath is the salary of air hostess ? . . .could u please ell me the details whats the qualifications to become an air hostess ? 18 3rd January 2014 , 01 : 08 AM how i will become an airhostess ? What i will do for this ? Can u give any advice in this topic ? Is beauty first thing in air hostess ? 19 14th January 2014 , 03 : 20 PM can a male be a flight attendant ? 20 27th February 2014 , 03 : 55 PM i m 29 yr old . . can i join . . i need it urgently 21 16th March 2014 , 01 : 10 PM what stream and how much % is necessary to become an air hostess . 22 18th March 2014 , 10 : 46 PM I want to become a Air hostess . And my age is 19 year . I am studing in degree college . . my height is 5.4 .and well fluency in english and hindi language . 23 25th March 2014 , 04 : 09 PM I am ungraduate but i am working in international company like tour & travels , so can i become a Air hostess . 24 15th May 2014 , 08 : 05 PM Is it compulsory to join a particular airline training institute before looking for cabin crew job . . ? ? 25 29th May 2014 , 09 : 53 PM I am priyaranjan rout .bsc with physic hons at n.c autonomous colg jajpur i want to join airhosters what can it requires 26 11th June 2014 , 06 : 29 PM what is the air hostess admission fee at frankfinn institute for open catigiry 27 12th October 2014 , 07 : 53 PM I m in 12 comm . . .whats the starting salary its my dream to became an airhostes plzzzzzzzzz help me i will wait plzzzzzz rly me thxxx . 28 12th October 2014 , 07 : 58 PM I m in 12 comm . . .whats the starting salary its my dream to became an airhostes plzzzzzzzzz help me i will wait plzzzzzz rly me thxxx . 29 6th November 2014 , 10 : 57 AM hi i am in 12 sci . .what is the fee structure of air hostess training and whats the recquirements to become an air hostess . . . ? ? ? can i join or not . . . .thnxxx 30 8th November 2014 , 07 : 47 AM Quote : Originally Posted by Unregistered what subject is taken in 11th standard to become an air hostess hlw , i am priyanka . me 12th science me padhti huu . . Pls tell me job apply k liye kya karna padega . . . Plssss tell me . . 31 11th November 2014 , 12 : 56 PM I am a bca 2nd year student i want to become an air hostess what should i do for it and also tell me the fee structure . plz . . . . .must reply . 32 6th January 2015 , 04 : 04 PM hlo am done 12th 78 % in marks now m doing business mangement i m 19year old so tell me can may join air crew height 5 feet 33 21st July 2015 , 05 : 40 PM I am Mansi . What subject is taken in 11th standard to become an air hostess ? [ / QUOTE ] How much % is necessary in10th class to became airhostess ? 34 22nd July 2015 , 02 : 23 PM mahhiads Senior Member Join Date : Oct 2012 Posts : 327 You will taken any subject in 11th Class and after that 12th or Graduation you will start Air Hostess Training after that you will get Air Hostess Job . Minimum Qualification for Becoming Air hostess Education : 12th or a Graduate degree Age : 18 โ€“ 27 Marital status : Unmarried Minimum Height : 157.5 cms So try for it . You can be Air Hostess . 35 30th July 2015 , 03 : 14 AM Hi , I aleady have a job paying 40 lpa ( engineering ) . I do have commercial pilots license as well . Should i go for it ? 36 23rd August 2015 , 12 : 12 AM I am a girl with 16 years of age I aspire to become an air hostess I have a good height , a good smile . Thank you ! waiting for your reply : ) 37 27th August 2015 , 12 : 33 AM I like to be an air hostess so please tell me how much is fee is there for training as an air hostess 38 6th September 2015 , 04 : 48 PM I am 19 year girl I am not clear to speak english . but I know Kannada & Hindi . I am poor family girl . So need job immediately . After I am join the college u r give English speaking traing ? please help me . 39 15th October 2015 , 10 : 26 PM hello sir / Mem . I am Shaily rajpoot . I have done complete my master degree . now I want make a a good career in airlines as a Airhostes . but my height is 152 . so can you tell me its a enough for this job or not . I am so confused so plz give me ans nd a good advice also please . Thank you . please more information about it you can mail me on my email I ' d please sir shail . rajpoot24 @ gmail . com 40 23rd November 2015 , 01 : 54 PM how do I join the airline job at ground in reservation what is the age required ? And should be how much qualified ? And what eould be thr salary ? Hlw , dear Sir / medam , I am a girl of 18 years . My name is Esha . I am belongs from a poor Bangladeshi family . . .i need a job . .and i love air hostess job . if i do n ' t get a job my next study will be stopped . .i am almost good in english . .and i am 5feet 6 inch . . .can i got a job . . .please ans me . . .i need this job . . 41 1st January 2016 , 03 : 55 PM I am a girl of 18 year . My name is Pari . I want to become an air hostess and I am almost good in English and I am 5 feet 6inch . . . can I get this job . . .its my dream to become an air hostess . . .and I want this job 42 2nd January 2016 , 04 : 48 PM I am a girl of 16 yrs My name is Khushnuma khatoon and i study in class 10 . I ' m very much interested in Air Hostess Job . My height is 5 feet 3 inch . After studying HS should i apply for Air Hostess job ? I ' m waiting for your reply . 43 28th March 2016 , 02 : 46 AM I ' m 20 years old , i have CCS in a / l from art streem , so can i join for this and be an air hostess ? ? ? can u plz tell me what are the steps i should follow , , , now 44 18th April 2016 , 06 : 14 PM how many years of experience is needed to be a senior cabin crew from fresher cabin crew ? 45 24th April 2016 , 04 : 54 PM Is there any possibility for a married girl of 22 years having all other qualities ? 46 10th May 2016 , 01 : 45 PM I have passed 12 from medical stream in 2014 i have done ielts last year could i join aur hostes course 47 3rd January 2017 , 01 : 21 PM What ' s de difference between air hostess and cabin crew ? As der is difference in payment can anyone explain ? 48 10th April 2017 , 12 : 07 AM Hi , I am priyanka . I am studying in class 10 . Please tell me . I ' m talk in a English , Hindi and Urdu so what do job apply in air line ? And what most important subject in this job ? Please tell me . 49 28th June 2017 , 06 : 45 PM If a person has acne on her face than she is eligible to get atlist ground staf job . . n what is the salary for ground staf
[ "Air Hostess", "salary" ]
http://entrance-exam.net/forum/general-discussion/what-scope-gnm-difference-between-gnm-bsc-nursing-1274329.html
10th August 2013 , 10 : 03 AM Unregistered Guest Posts : n / a What is the scope of GNM ? Difference between GNM and BSc Nursing ? What is scope of GNM and diffrance b / w GNM & B . Sc nursing in case of job 29th September 2013 , 02 : 02 AM Unregistered Guest Posts : n / a Re : What is the scope of GNM ? Difference between GNM and BSc Nursing ? Defference between GNM and B . sc in case of job ? ? ? 15th March 2014 , 02 : 44 PM Re : What is the scope of GNM ? Difference between GNM and BSc Nursing ? hi friends . . . I ' m indresh pal student of Bsc nursing . I want tell all of you . .who doing bsc nursing . .its really very good course . so completely do it . after that its have saveral way for your future . . so do n ' t confuse . .After complete bsc nursing you may get good salary . . Thanks . 11th July 2014 , 08 : 35 PM Hi M last year diploma appearing student from ET branch . . N i have kt also So can i work in same field in mumbai 30th April 2015 , 12 : 17 AM After completing bsc in BMBIRLA nursing college can anyone get wb stuff nurse ? 12th June 2015 , 12 : 08 PM sir i have just passed out Class 12th with 63 % And i am intersted to go for gnm nursing but sir tell me what is the scope after bsc nursing and gnm nursing 26th June 2015 , 06 : 13 PM I have passed out 12 sci wit 58 % n nw m thinking to do GNM . . .BT m confuse DAT GNM is gud r not . . . . . . . . . 10th March 2016 , 03 : 34 PM I HAVE PASSED 12TH WITH 70 % AND IAM INTEREST GNM NURSING BUT SIR TELL ME WHAT IS THE SCOPE AFTER GNM NURSING 4th June 2016 , 01 : 54 PM hiii sir I am vishali i have passed 12 in 83 % mark I am interesting in gnm nursing but plz tell me what ' s is the scope of nursing and I complete nursing then I can do bsc mursing 19th July 2016 , 02 : 36 PM I am Pritilekha Dutta . i have passed H , S with 81 % marks IN ARTS . . .Iam interested to takeGNM nursing TRAINING . . . . IS GNM a good course ? ? ? 23rd July 2016 , 08 : 24 PM sir I am raj I have passed 12th arts up board 69 % can I get admission in bsc nursing who is best bsc nursing / gnm nursing 24th December 2017 , 05 : 47 PM I ' m gnm student in Bangalore . What I should do to get a job in west Bengal ? What is the procedure for that and how much salary ? 10th September 2018 , 08 : 06 PM Hello sir I am sriya behera and I have passed my 12th board with 78 % and 10th board by 87 % in bpc i want to join in bsc nursing . Can I get admission in odisha directly on merit of 10th , 12th marks .
[ "GNM", "BSc Nursing", "scope" ]
http://entrepreneurs.about.com/od/financing/a/startupfunding.htm
Entrepreneurship Financing Options Startup Business Financing Finding funding for your new small business โ€ข โ€ข โ€ข By Scott Allen Updated October 27 , 2016 Would n ' t you love to have a few million dollars to start your business ? Me too ! With a great idea and a great business plan , you probably feel almost entitled to get the funding you ' re seeking . The reality , though , is that for most entrepreneurs , you must prove your concept first before anyone will put up that kind of money . But most businesses require some sort of initial capital for things like inventory , marketing , physical facilities , incorporation expenses , etc . According to the U.S. Small Business Administration ( SBA ) , " While poor management is cited most frequently as the reason businesses fail , inadequate or ill - timed financing is a close second . " Sometimes it comes down to simple cash flow - - many companies have closed their doors because they just could n ' t make it another few months until the money came in . When exploring your funding options , there are several factors to consider : Are your needs short - term or long - term ? How quickly will you be able to pay back the loan or provide a return on their investment ? Is the money for operating expenses or for capital expenditures that will become assets , such as equipment or real estate ? Do you need all the money now or in smaller pieces over several months ? Are you willing to assume all the risk if your company does n ' t succeed , or do you want someone to share the risk ? The answers to these questions will help you prioritize the many funding options available . Fundamentally , there are two types of business financing Debt financing - You borrow the money and agree to pay it back in a particular time frame at a set interest rate . You owe the money whether your venture succeeds or not . Bank loans are what most people typically think of as debt financing , but we will explore many other options below . Equity financing - You sell partial ownership of your company in exchange for cash . The investors assume all ( or most ) of the risk - - if the company fails , they lose their money . But if it succeeds , they typically make a much greater return on their investment than interest rates . In other words , equity financing is far more expensive if your company is successful , but far less expensive if it is n ' t . Because investors take on a much higher risk than lenders , they are typically far more involved in your company . This can be a mixed blessing . They will likely offer advice and connections to help grow your business . But if their plan is to exit your company in 2 - 3 years with a substantial return on their investment , and your motivation is the long - term sustainable growth of the company , you may find yourself at odds with them as the company grows . Be careful not to give up too much control of Let ' s take a closer look at the many options available for startups . Friends and family are still your best source for both loans and equity deals . They are typically less stringent regarding your credit and their expected return on investment . One caveat : structure the deal with the same legal rigor you would with anyone else or it may create problems down the road when you look for additional financing . Prepare a business plan and formal documents - - you ' ll both feel better , and it ' s good practice for later . Credit cards are a great tool for cash flow management , assuming you use them just for that and not for long - term financing . Keep one or two cards with no balance on it and pay it off every month to give yourself a 30 to 60 - day float with no interest . And the low introductory rates on some cards make them some of the cheapest money around . Managed well , they ' re extremely effective ; managed poorly , they ' re extremely expensive . Bank loans come in all shapes and sizes , from microloans of a few hundred dollars , typically offered by local community banks , to six - figure loans by major national banks . These are much easier to obtain when backed by assets ( home equity or an IRA ) or third - party guarantors ( e.g. , government - sponsored SBA loans or a cosigner ) . If you obtain a line of credit rather than a fixed - amount loan , you do n ' t start paying interest until you actually spend the money . Leasing is the way to go if you need big - ticket items such as equipment , vehicles , or even computers . Your supplier will help you explore this . Angel investors fill the gap between friends and family and venture capitalists , who now rarely even look at investments below $ 1 million . Enlist a savvy financial adviser to structure the deal . Private lending represents a viable alternative when the bank says " no " . Private lenders are looking for the same information and will conduct similar due diligence as the banks , but they typically specialize in an industry and are more willing to take on higher - risk loans if they see the potential . There are many channels available to you to raise capital . All of the above approaches have numerous variations . Put together a solid business plan , talk to a financial adviser , and just start asking . Someone will eventually say " Yes " . Continue Reading +
[ "Business Financing", "SBA", "cash flow" ]
http://entryindia.com/articles/setting-company-india-foreign-national-nri-and-oci
Setting a Company in India By Foreign National NRI and OCI Submitted by CA Shashi Mohan on Wed 08092017 240am Setting a Company in India NOTE Structure of the company in context here is Private Limited 1 I am a US Passport holder can I own a company in India Yes you can very well own a company in India partly or even wholly or set up your own company in India Setting up or owning a company in India can broadly be achieved with the following options Buying shares in an existing business Starting a new company please see Point No 3 below The above option to buying shares in an existing company or starting up a new one is same for Foreign National Foreign Resident Non Resident Indians NRI Person of Indian Origin PIO Overseas Citizen of India OCI termed as foreign investor 2 What are prerequisites to buy shares in an existing business In case of a closely held company Private Limited Limited Liability Partnership procedures of valuation of shares documentation of shares transfer and reporting to Reserve Bank of India need to be carried out Shares held by resident Indian can be purchased at a value not less than the value arrived based on guidelines issued by Reserve Bank of India Please follow the link httpswwwrbiorginScriptsFAQViewaspxId26 to get more information Resident shareholders need to comply with the requirement of transfer of shares from resident to NonResident as prescribed by RBI 3 What are different structuresformats to start my own company Legal Structure Private Limited Company WhollyPartially Owned or Joint venture Liaison Office LO Project Office PO Branch Office BO Limited Liability Partnership Permissible Business Activities Wide range of activities permitted under automatic routeapproval route Please check the link httpdippnicinEnglishpolicychangespress2_00htm for list of activities under automaticapproval route Marketing branding No commercial activities that involves revenue generation Execution of any awarded project in India Example is project of Installation of Machinery at Airport All activities of parent company except manufacturing activities Wide range of activities permitted under approval route Legal Composition Entire Share Capital can be owned by foreign investor Wholly Owned SubsidiaryWOS 2 or more parties can jointly hold the share capitalJoint Venture JV Representative Office only For executing a time bound project Representative office of Head Office Limited Liability Partnership Firm Minimum Number of Directors 2 Directors 1 to be resident in India 1 Representative 1 Representative 1 Representative 2 Partners Minimum Number of Investors 2 NA NA NA 2 Minimum Share Capital Authorized Capital Rs 100000 Paidup Capital No Minimum requirement NA NA NA NIL Legal Permission Automatic RouteApproval by individual Government Departments Advance approval from RBI Advance approval from RBI Advance approval from RBI Advance approval from RBI Corporate Liability Limited to the subscribed share capital Full liability of parent Full liability of parent Full liability of parent Partners liability up to agreed contribution Tax Structure Taxed as Domestic Company 30 plus surcharge Not Applicable as there is no revenueprofit Taxed as Foreign Company 40 plus surcharge Taxed as Foreign Company 40 plus surcharge Tax based on highest marginal rate of partners Starting as a Proprietorship local Partnership One Person Company OPC is not permitted The above discussed business format does not apply in case the objective is Not for Profit For Example Trusts Societies Educational Setups etc 4 What is the owner of company called in India Shareholders are owner of the company and enjoy rights based on their shareholding percentage Director is a legal position who takes care of operational activities and also represents to various legal authorities governing the business In order to become a Director it is not required to become a Shareholder A shareholder however can also be a Director You can also be appointed as a Director in an Indian company wherein you are not a shareholderowner Generally ownershareholders of business retain the position of Director as well to take important decision of the business One can however also appoint any other person to work as a Director on their behalf 5 Do I need an Accountant or Consultant to start my business buying shares or starting own company in India Yes apparently you can not do it yourself You must hire an accountant or consultant to take care of entire process of setting up of your business Complete process of registering a company in India is online and one need to prepare documents fill form and upload everything at website of Registrar of Companies httpwwwmcagovinmcafoportallogindo Such forms also need to be verified by a Chartered Accountant CACompany Secretary CS before being uploaded online 6 What are prerequisite to become Director in an Indian Company The process starts from getting a Director Identification Number DIN in India In order to obtain DIN the person must prepare hisher Digital Signature DSC In order to prepare DSC and DIN one needs to arrange Appostile or Legalised Identity Proof Passport Address Proof Bank Statement Countries Identity Card etc DSC Form and few Photographs 7 What are prerequisite to become a Shareholder in an Indian Company None of typical registrations Tax DIN etc are required to become a shareholder in an Indian company You need to however prepare a DSC New Process of Company Registration at MCA and you need to arrange Appostile or Legalised Identity Proof Passport Address Proof Bank Statement Countries Identity Card etc DSC Form etc and few Photographs 8 What exactly I need to do to arrange the documents for being a Director a Steps to arrange for DSC Get an accountantconsultant CA CS Lawyer Business Consultant who will help you in entire process in preparing government forms uploading on portals and if required following it up Get your Identity Proof Passport Address Proof Bank Statement Countries Identity Card etc DSC Form and few Photographs AppostileLegalised in your home country Post the documents in Original to your Indian Consultant who will arrange to get a DSC on your behalf which is generally valid for a period of 2 years Give a written authorization to the consultant to affix the DSC only on your approval b Steps to arrange DIN Your consultant can fill out form of DIN at Registrar of Companies ROC portal get the same verified and approved from you and upload the same The DIN issued by ROC is a 8 digit number which is valid for the life time DIN is a permanent number for being appointed as a Director 9 Are there any other formalities to be fulfilled to become a Director in Indian Company For Indian passport holder there is a formality to obtain a Permanent Account Number PAN from Income Tax Authorities A Foreign National Foreign 10 Do I need to be present in India in during the process of setting up my business It is not necessary to be present in India for being appointed as a director or a shareholder Similarly the entire process of business registration can be done online and there is no requirement to travel to India or be present physically at any stage In case you are travelling India on a business visa you can sign all the documents during your India visit Such documents would not be required to be appostile or legalised in your home country In other case one can arrange to post the stated documents duly signed appostiled legalised to their hired accountant consultant in India who can handle the entire process of obtaining DIN DSC and coordinate in filing the required form at Registrar of Companies 11 Is there any local partner Indian Resident required by Indian Law Companies Act 2013 brought a new provision wherein there must be at least 1 Resident Director in Board of an Indian Company Resident director is defined as a citizen of India which has resided at least 180 days in a calendar year Responsibilities of the resident director are primarily to coordinate with the local government authorities as and when there is any requirement He may or may not be involved business decisions or even operational matters From legal side there is no predefined remuneration for such director 12 Can I own 100 equity in Indian business existing or new Companies Act 2013 allows a Foreign National Foreign Resident Non Resident Indians NRI Person of Indian Origin PIO or their business entities overseas to own 100 equity in their business set up in India 13 Can I open a Single person One person company OPC in India NRI PIOs Foreign Nationals are not eligible to form a OPC in India Companies Act 2013 allowed a new concept to form a single person company called One Person Company OPC however its only allowed for a Resident Indian 14 Is there any minimum capital requirement to start a business in India There is no minimum required share capital Recently the Companies Act 2013 removed the minimum authorized share capital limit INR 100K for a Private Limited Company INR 500K for a Public Limited Company 15 Is there any restriction in starting a Partnership Firm Limited Liability Partnership LLP or buy shares therein You can do the same if the following conditions are met Indian Partnership Firm should not be engaged in agricultural plantation real estate media businesses restricted sectors Amount can only be invested by way of inward remittance or out of NRE FCNR or NRO accounts maintained with authorized Banks Repatriation of invested fund outside India not permitted unless permitted by Reserve Bank of India RBI 16 What are sources to fund my newly acquiredsetup business in India In an event where revenue of Indian entity is below Break Even Point BEP the initial Capex Capital Expenses Opex Operational Expenses requirement can be met through Share Capital Investment funded from the shareholders External Commercial Borrowings ECB is allowed for Capital Expenditures In current scenario ECBs are also allowed for Working Capital Expenditure however certain conditions are imposed by Reserve bank of India RBI need to be followed Please click on the link for more information httpsrbiorginSCRIPTsBS_ViewMasCirculardetailsaspxid9840 17 What are further formalities for making the business operational Once the legal structure of business Private Limited Company Limited Liability Company Limited Liability Partnership etc is registered following activities need to be completed Registration with Income Tax Authorities Obtain Permanent Account Number PAN Tax Account Number TAN Open a Bank Account in desired local or MNC Bank Registration under Value Added Tax State laws require a registration for trading in Goods Registration of Service Tax Register for doing trade in Services Register under Shops Establishment Location based registration in few states Registration under Professional Tax Location based registration in few states Appendix Foreign National A person who is not a naturalized citizen of the country in which he is residing or citizen of a country other than India Foreign Resident Resident of a foreign country Generally the term is used for a foreign national Non Resident Indian Citizens of India holding Indian Passport immigrated to any other country for six months or more Person of Indian Origin PIO Not a citizen of India but a person of Indian origin or ancestry As per Gazette of India PartI SectionI published on 09012015 all the existing Persons of Indian Origin PIO card holder registered as such under new PIO Card scheme 2002 shall be deemed to be Overseas Citizens of India Cardholder httpboigovincontentpersonindianoriginpio Overseas Citizen of India Person of Indian Origin PIO who was citizen of India on Jan 26 1950 or thereafter residing overseas can register them as Overseas Citizen of India OCI OCIs are entitled to general parity with NonResident Indians Note Definition of above terms need to be checked from respective section of Foreign Exchange Management Act FEMA in specific cases such as acquisition of shares acquisition of immovable properties purchasing of Jewelry bullions etc This document only covers these terms with respect to buying shares in an existing business or starting a new company in India About Author With over 15 years of experience Shashi Mohan has been responsible for the set up and operational management of over 150 overseas brands in India cashashirakchampscom or 91 9818700482 Shashi is also a CoFounder at Excelor India Cons Pvt Ltd wwwexcelorindiacom Keywords Doing Business in India Investing in India India Civil Aviation Opportunities
[ "Setting a Company", "India" ]
http://entryindia.com/exchange_rates
Comparison of Dollar to Rupee Exchange Rates The Indian Rupee is the official currency of India . Non - Resident Indians ( NRIs ) remitted nearly $ 70 billion to India last year . But even so , most NRIs wonder if they are using the right service provider for sending money to India . Is it safe to use this service ? How long will it take before the money reaches the destination ? Am I getting competitive exchange rates ? Should I wait for a few days to transfer money to India to get a better rate ? To answer these questions , we have prepared a table of financial institutions that send money to India as shown below . Exchange Rates vary by the transaction amount and the method of transfer . The rates and fee shown to send money to India are for online transfer of under $ 1000 from USA . Scroll past the rate table to see the Exchange Rate Discussion Board . โ–ฒ Institution โ–ฝ โ–ณ Per $ Type โ–ฝ โ–ณ Fee Time Comments Learn more . . 1 - 855 - 205 - 5577 69.34 Fixed 0.00 5 Days Get upto 30 paisa extra on your First transaction Best Exchange rates 0 fees Fixed exchange rates Safe & Secure Track the status of your remittances For assistance , write to us at remitmoney @ remit . in Hassle free process Learn more . . 1 - 866 - 424 - 2448 68.59 Fixed 0.00 4 Indian banking hours ( Express ) or 5 business days ( E - transfer ) ZERO service charge on transfer above $ 1000 Fixed Exchange Rates ACH mechanism of fund transfer to all ICICI Bank account and credits into 100 + Bank accounts in India via NEFT and IMPS clearing Email / SMS alerts on fund transfer status Anytime , anywhere access through Money2India App Standing Instructions facility with Higher Fund Transfer Limits + 91 - 22 - 4406 6666 69.25 3 - 5 Days $ 0 Fee to transfer any amount Fixed exchange rates Transfer money to any bank in India Ongoing Promotion : First transaction of over $ 500 will get you $ 10 amzon gift card for online shopping 1 - 866 - 808 - 2703 69.14 2 - 3 Days Money2anywhere . com has $ 0 fees for above $ 1000 transactions and $ 1.99 fees for below $ 1000 . Guaranteed Exchange Rate Bank Transfer ( ACH mechanism ) takes 24 - 48 hrs for transfer Unlimited amount for bank deposit or draft delivery at home Bank draft delivery at home takes 3 days only Xpress Money option delivers cash at agent locations immediately ( Rs . 50,000 max . ) Your browser does not currently recognize any of the video formats available . Click here to visit our frequently asked questions about HTML5 video . 1 - 888 - 736 - 4886 69.14 Indicative 5.00 2 Days Free $ 25 Amazon voucher on first transaction Zero fees for transfer above $ 999 Option to choose guaranteed or indicative rate Transfer takes 4 days * for ACH and 1 day * for wire transfer No upper limit on transaction Method of receiving in India is bank deposit Get Rs . 1000 with every referral , who registers and transacts For assistance , mail at info @ remit2india . com or call toll free at 1 - 888 - 736 - 4886 1 - 888 - REMITLY 69.60 4 Indian banking hours ( Express ) or 3 business days ( Economy ) $ 0 fee for transfer over $ 1000 . Fee of $ 1.99 for transfers below $ 1000 . Guaranteed Exchange Rate Take 3 to 5 business days to transfer from your Bank account Take 4 hours ( India banking hours ) if money is transfered using Debit Card Deposits can be made to all the major banks in India 100 % Money - Back Guarantee 24 / 7 Customer Support 1 - 877 - 443 - 1399 70.38 3 Days $ 0 transfer fee via debit card Great exchange rates Deposit to almost any bank in India within 24 hours Cash pick - up available 100 % Money - Back Guarantee More than 230,000 Worldwide Agent Locations in more than 130 Countries 1 - 212 - 521 - 3284 68.90 Indicative 4 - 5 Days $ 0 fee for online transfer to SBI Banks and fee of Rs . 6 for online transfer of amount less than $ 500 to any other bank Foreign Currency Conversion charges of Rs . 250 / - levied on every remittance . Service tax of .14 % or Rs . 35 ( whichever is higher ) for amounts upto Rs . 100,000 received in India 2 days for transfer to account in SBI bank and 4 - 5 days to accounts in other banks Min remittance amount in a single transaction is $ 50 Max remittance of $ 10,000 in a single transaction to account in SBI and of $ 5000 in account with any other bank Other Transfer modes : Instant transfer , SWIFT / Wire transfer , Draft Cashier ' s Cheques and Foreign currency cheques . 1 - 888 - 973 - 6383 69.20 3 Days Highest Locked - In Exchange Rate Guarantee Instant Bank Deposits to Bank Across India Cash PickUp to Over 20,000 Location Across India No fee for transfers over $ 1,000 Minimum amount to send $ 50 , Maximum amount $ 2,950 24 / 7 Customer Service and Live Web Chat Accept ACH & Credit Card for payment Remittance can also be made in person at their agent location 1 - 877 - 989 - 3268 69.08 10.00 The rate shown is for the city of Edison in New Jersey , USA . The exchange rate differs depending on the location of transfer ( over 47000 locations in US ) Rate given at the location of transfer is Guaranteed Money in 3 business days : Fees of $ 10 Best option in case of emergency , money received with - in mins Send money by visiting agent location or online direct bank transfer / credit / debit card Receive money by direct credit to bank account ( including NRE / NRO ) or cash pick up at a western union agent location 1 - 877 - 815 - 1531 69.08 4.99 1 - 4 Hours Fee of $ 4.99 if paid with a US Bank account and fee of $ 29.99 if paid with Debit / Credit card . This fee is based on $ 1000 transfer . Bank deposits within 24 Hours to most bank accounts in India Other modes of delivery in India : Cash Pickup by recipients , Cash Delivery Discussion Board in an age where exchange Submitted by Sanjana on Mon , 12 / 10 / 2018 - 7 : 49pm Permalink in an age where exchange rates can be googled instantly , this ticker needs faster updation ! reply SBI how much charge Submitted by Mehul Barot on Tue , 03 / 06 / 2018 - 7 : 14am Permalink today I am receving my wire transfer in SBI of $ 1495 same against I M received 1485 $ and total amout i m received INR 95337 I have chaeged with 10 $ + 171 INR + 50 INR I dnt understand all this charges reply hdfc franchise raj kumar Thu , 01 / 18 / 2018 - 1 : 57am hi i want hdfc and sbi , rbl credit card franchise please call on my number 9910660064 Send money from USA to India using Pangea Money Transfer Vikash Kumar Thu , 11 / 30 / 2017 - 1 : 43am The amount was credited in my India account in less than 4 hours using Pangea Money Transfer . I was surprised with its fast service and the one time bonus of $ 30 . For the similar fast remittance services you would anyways be paying more than or equal to $ 4.99 . So , why wo n ' t try the Pangea ? How to get a one time bonus prabhu Wed , 03 / 28 / 2018 - 6 : 22pm How to get a one time bonus Lending money in India ROHAN ANITA Fri , 09 / 29 / 2017 - 5 : 00pm Dear Sir / Madam , I am AJIL FINANCIAL INVESTMENT a reputable , legitimate , and an accredited money lender in India . I loan money out to individual and cooperate bodies in need of financial assistance . Email : ajilfinancialsloans @ gmail . com , ajilloanservice . in @ hotmail . com , Phone : + 918792793265 ( ROHAN ANITA ) , AJIL FINANCIAL INVESTMENT loan rate of interest and minimum and maximum vinod enterprise Sun , 11 / 05 / 2017 - 8 : 28am hi , pl send detail of loan for company . if you , reputable and legitimate lender i can offer business from good company and honest lender . reply . regards . pradip . Can you include XendPay Test Sun , 09 / 24 / 2017 - 5 : 56pm Can you include XendPay in the list of solutions supporting remittance . Need Clarification in Price difference using USD and INR Manoj Tue , 07 / 11 / 2017 - 6 : 34am I want to buy a Laptop . The price in US dollars is $ 699 , but in indian rupees it is above 88000 . Why is that much difference occuring ? I assume it also includes the P Bala Fri , 09 / 08 / 2017 - 9 : 34am I assume it also includes the customs duty ( approx @ 20 - 30 % ) for shipping / bringing electronics to India . A rough estimate is provided below with approx calc ( 1 USD @ INR 64 ) Cost of Laptop - USD 700 - INR 45000 US Sales Tax - 50 - 3200 Shipping - 230 - 15000 Customs - 140 to 210 - 9000 to 13500 Total - 1120 to 1190 - 72000 to 77200 . . . not sure whether any other expenses included to reach 88k in India Pages 1 2 3 4 5 6 7 8 9 next โ€บ last ยป New post
[ "Dollar", "Rupee", "Exchange Rates" ]
http://environment.about.com/od/petroleum/a/oil_spills_and_environment.htm
Science , Tech , Math Social Sciences 5 Environmental Consequences of Oil Spills Oil damages wildlife , marine ecosystems , and coastal environments Ben Osborne / Getty Images by Larry West Updated January 16 , 2019 Oil spills caused by damaged tankers , pipelines , or offshore oil rigs often result in immediate and long - term environmental damage that can last for decades . These are among the most notable areas of environmental damage caused by spills : Beaches , Marshlands , and Fragile Aquatic Ecosystems David McNew / Stringer / Getty Images Oil spills coat everything they touch and become unwelcome but long - term parts of every ecosystem they enter . When an oil slick from a large spill reaches a beach , oil coats and clings to every rock and grain of sand . If the oil washes into coastal marshes , mangrove forests , or other wetlands , fibrous plants and grasses absorb oil , which can damage plants and make the area unsuitable as wildlife habitat . When oil eventually stops floating on the water ' s surface and begins to sink into the marine environment , it can have similar damaging effects on fragile underwater ecosystems , killing or contaminating fish and smaller organisms that are essential links in the global food chain . Despite massive clean - up efforts following the 1989 Exxon Valdez oil spill , for example , a 2007 study conducted by the National Oceanic and Atmospheric Administration ( NOAA ) found that 26,000 gallons of oil was still trapped in the sand along the Alaska shoreline . Scientists conducting the study determined that residual oil was declining at less than 4 percent annually . Birds Stockbyte / Getty Images Oil - covered birds are a universal symbol of environmental damage wreaked by oil spills . Some species of shore birds might escape by relocating if they sense danger in time , but sea birds that swim and dive for their food are most likely to be covered in oil following a spill . Oil spills also damage nesting grounds , potentially causing serious long - term effects on entire species . The 2010 BP Deepwater Horizon offshore oil spill in the Gulf of Mexico , for example , occurred during prime mating and nesting season for many bird and marine species , and long - term environmental consequences of that spill wo n ' t be known for years . Oil spills can disrupt migratory patterns by contaminating areas where migrating birds normally stop . Even a small amount of oil can be deadly to a bird . By coating feathers , oil not only makes flying impossible but also destroys birds ' natural waterproofing and insulation , leaving them vulnerable to hypothermia or overheating . As birds frantically preen their feathers to restore their natural protections , they often swallow oil , which can severely damage their internal organs and lead to death . The Exxon Valdez oil spill killed from 250,000 to 500,000 seabirds , plus shore birds and bald eagles . Marine Mammals Handout / Getty Images Oil spills frequently kill marine mammals such as whales , dolphins , seals , and sea otters . Oil can clog blowholes of whales and dolphins , making it impossible for them to breathe properly and disrupting their ability to communicate . Oil coats fur of otters and seals , leaving them vulnerable to hypothermia . Even when marine mammals escape the immediate effects , an oil spill can contaminate their food supply . Marine mammals that eat fish or other food exposed to an oil spill may be poisoned by oil and die or experience other problems . The Exxon Valdez oil spill killed thousands of sea otters , hundreds of harbor seals , roughly two dozen killer whales , and a dozen or more river otters . In the years after the Exxon Valdez spill , scientists noted higher death rates among sea otters and other species affected by the spill and stunted growth or other damage among additional species . Fish Vstock LLC / Getty Images Oil spills often take a deadly toll on fish , shellfish , and other marine life , particularly if many fish eggs or larvae are exposed to oil . Shrimp and oyster fisheries along the Louisiana coast were among early casualties of the BP Deepwater Horizon oil spill . Similarly , the Exxon Valdez spill destroyed billions of salmon and herring eggs . Years later those fisheries had not recovered . Wildlife Habitat and Breeding Grounds Julie Dermansky / Contributor / Getty Images Long - term damage to species and their habitats and nesting or breeding grounds is one of the most far - reaching environmental effects caused by oil spills . Even species that spend most of their lives at sea , such as various species of sea turtles , must come ashore to nest . Sea turtles can be harmed by oil they encounter in the water or on the beach where they lay their eggs , their eggs can be damaged by oil and fail to develop properly , and newly hatched turtles may be oiled as they scurry toward Ultimately , the severity of environmental damage caused by an oil spill depends on many factors , including the amount of oil spilled , type and weight of oil , location of the spill , species of wildlife in the area , timing of breeding cycles and seasonal migrations , and even the weather at sea during and after the oil spill . Continue Reading
[ "Oil Spills", "Environmental Consequences", "coastal marshes" ]
http://environment.uwe.ac.uk/geocal/GLOSSARY/GLOSS_C.HTM
A B C D E F G H I J K L M N O P Q R S T U V W X Y C The height to which water will rise above the water table due to capillarity . Soil particles less than 0.002mm in size . Soils with less than 35 % by mass of grains less than 0.06mm in size . Coarse soil : grain size is predominantly 0.06 - 60mm Very coarse soil : grain size is predominantly greater than 60mm The ratio of the minimum horizontal effective stress to the vertical effective stress at a point in a soil mass retained by a surface as the surface moves away from the soil . A measure of the rate of change of volume during primary consolidation ; referred to either vertical drainage ( c ) or horizontal drainage ( c ) . Units : mยฒ / s ( Also curvature coefficient ) A measure of the shape of a grading curve : C z = d 30 ยฒ / ( d 60 x d 10 ) . See particle size characteristics The ratio of horizontal effective stress to vertical effective stress at a point in a soil mass loaded in conditions of zero horizontal strain . The ratio between the tangential force ( T ) required to cause a body to slide along a plane and the normal force ( N ) between the body and the plane : T = mN Along a wall or foundation surface : = tan d where d = angle of wall friction The ratio of the maximum horizontal effective stress to the vertical effective stress at a point in a soil mass retained by a surface as the surface moves toward from the soil . The constant average discharge velocity ( v ) of water passing through soil when the hydraulic gradient ( i ) is 1.0 ; defined by Darcy โ€™ s law : v = k.i The change in volumetric strain per log 10 cycle of time after primary consolidation is complete . ( Also uniformity coefficient ) A measure of the slope of a grading curve and therefore the uniformity of the soil in particle size analyses : C = d 60 / d See particle size characteristics The change in volumetric strain per unit volume per unit change in effective stress in one - dimensional compression . ( Units mยฒ / MN ) Compressibility is the reciprocal of stiffness . Apparent cohesion ( c ) is the intercept on the shear stress axis of a straight - line Mohr - Coulomb envelope . For critical states and residual states , c ' = c ' r = 0 in most cases . For peak states , a curved strength envelope also passes through the origin , but a straight - line fitted to a small number of results is often extrapolated to give an intercept c ' > 0 . ( In physics , cohesion is described as โ€˜ the force that holds together molecules or like particles within a substance โ€™ . ) See also adhesion and true cohesion Volume change in soil in which air is expelled , but with the water content remaining constant . Compaction may occur due to vibration in loose sands and gravels , and in fill due to self - weight . In soil constructions , compaction is achieved by rolling , tamping or vibrating . The relationship between the strains in a deforming body so that no holes appear and no material is destroyed . The ratio of the change in volumetric strain to the change in isotropic stress . For a saturated soil , C = ยฅ The slope of the normal compression line ( NCL ) and critical state line ( CSL ) . The resistance force divided by the end area of the cone tip , measured during the cone penetration test . A penetration test in which a sleeved cone ( diameter 35.7mm , end area 1000mmยฒ , apex angle 60ยบ ) is pushed into the ground at a rate of 20 mm / min and the force required measured . The magnitude of this force divided by the end area is called the cone penetration resistance ( q ) . The cone and the sleeve can be advanced separately and so the frictional resistance along the sleeve ( 1000mmยฒ area ) or local side friction ( f s ) can also be measured . A confined aquifer is contained between two strata of low permeability ; in flow analyses , a confined aquifer is often assumed to be saturated throughout its depth . A measure of the relationship between the current water content and the consistency limits , similar in form to the density index , but expressed in terms of water content . I = ( w L - w ) / I P At liquid limit , I = 0 At plastic limit , I = 1.0 ( Also called Atterberg limits ) Measures of water content corresponding to changes in physical state of a soil : liquid limit ( w L ) = w / c at the change from liquid to plastic plastic limit ( w P ) = w / c at the change from plastic to semi - solid shrinkage limit ( w s ) = w / c below which no further shrinkage upon drying occurs Volume change due to dissipation of excess pore pressure , usually with constant total stress . The settlement of a foundation due to consolidation . ( After Charles Augustin Coulomb , 1736 - 1806 ) An equation relating the shear strength of soil to the normal effective stress on a failure plane . t f = c ' + ' tan f = c ' + ( - u ) tan Deformation or volume change which occurs in soil at constant effective stress progressing with time . In slope stability analyses the slip circle corresponding to the lowest factor of safety . The ground slope angle that corresponds to a slope - stability factor of safety of 1.0 . The height of a slope ( e.g. embankment , cutting , trench ) for which the factor of safety against collapse is 1.0 . The hydraulic gradient at which effective stresses becomes zero ; with upward seepage , sand may become quicksand . The shear stress developed along a slip surface during shearing at constant volume ; also known as ultimate shear strength . The state of a soil in which it strains ; critical states occur on the critical state line Note : The critical state is not the same as the residual state ; at the critical state , soil particles continue to rotate and the flow is turbulent ; at the residual state , in clay soils , flat particles become aligned to the slip plane and the flow is laminar . { bmc g17crsle . bmp } The unique relationship at failure between deviator stress , average normal stress and volume ( or shear stress , normal stress and void ratio ) is defined by the critical state line . q = Mp v = G l lnp = n tan e = e G - C log n The void ratio of a soil at which its volume remains constant during shearing . Note : critical void ratio depends on the mean stress . The current state of a soil is described by its voids ratio ( e ) or specific volume ( v ) , the current stress ( ' or p ' ) and the overconsolidation ratio or yield stress ratio ( R y ) .
[ "capillary rise", "clay", "coarse-grained soils" ]
http://envisiondecking.com/our-company/about-us/
About TAMKO ยฎ For over 70 years , TAMKO ยฎ has put forth the effort to provide the highest quality building products available . After decades of supplying roofing materials to a nation - wide audience , the company decided to expand its horizons by entering the composite decking industry . That decision in 1999 , paired with the organization โ€™ s previous experience and dedication to customer satisfaction , has led Envision ยฎ Decking to become one of the most prominent and recognizable brands in the market . Housing an array of decking products such as the Envision Distinction ยฎ , Envision Inspiration ยฎ and Envision Expression ยฎ lines , TAM - RAIL ยฎ and Marquee Railing ยฎ systems , and various fastener accessories , TAMKO ยฎ has built a reputation for furnishing materials that likewise emphasize the pursuit of elegance and beauty . With Envision ยฎ decking , you know you are investing in the best for your outdoor living space Let Envision ยฎ Decking by TAMKO ยฎ Take Care of Your Outdoor Decking Needs Our commitment to and drive for quality is made evident by our rich history of growth . While we may not operate out of a streetcar barn anymore , we are proud to still be headquartered in the city where it all began : Joplin , Missouri . Our rise to prominence serves as a testament to the satisfaction we provide to customers and our standard of building products . When you are in need of building a beautiful outdoor living space , look no further than Envision ยฎ Decking . ENVISION the decking possibilities Download our product catalog today DOWNLOAD Take Envision ยฎ HOME TODAY
[ "Envision Distinction", "TAMKO" ]
http://envynail.com/pedicure.html
Pedicure Menu Home | About | Contact Us Coupon Facial Manicures | Pedicures | Massages Waxing Envy Nails Envynail . com 2008 , All Rights Reserved Our Recommended Links can be found below You need Java to see this applet . Pedicure menu ( 972 - 908 - 2885 ) Pe dicure M enu Classic Spa Pedicure $ 27.00 Balance your feet and relax from your soles up as your feet and lower legs are soothed and stimulated by the spa pedicure . Includes an aromatic foot soak reshapes nail cuticle detail , pedicure , scrub exfoliation , callus remover , massage with a unique moisturizer lotion . Finish with warm towels followed by polish . Envy Spa Pedicure $ 35.00 Relieve tired , achy legs and feet with this re - mineralizing pedicure including an aromatic foot soak reshapes nail cuticle detail , buffering to a healthy shines citrus salt glow , exfoliation , callus remover , a cooling mask treatment with warm towels receive a tension relieving massage with unique moisturizer lotion followed by polish . Deluxe Pedicure $ 45 .00 For the ultimate indulgence , ease your feet into an aromatic foot soak , reshape nails cuticle detail buffering to the healthy shine , salt glow exfoliation , callus remover , a cooling mask treatment with warm towels receive deep with tension massage with a unique lotion . Your feet will indulge in warm paraffin treatment soothes arthritis pain and muscles aches , heals dry or damaged skin , and softens cuticles followed by polish . Hot Stone Pedicure $ 50 .00 Beginning the treatment with an aromatic foot soak reshaped nails , cuticle detail , buffing to healthy shine , salt glow exfoliation , callus remover , and cooling mask treatment . Smooth warm stones are then massaged on the feet and calves , rubbing our tension in an experience like no other followed by polish . Heavenly Pampered Spa Pedicure $ 55.00 A truly Pampered Spa Pedicure for a well - deserved treat , your feet are bathed in Tropical Flower sensation soak . Reshaped nails , cuticle are groomed and conditioned , callus remover , and Citrus Sugar Glow exfoliation . Followed by a Thermal Mud Mask on your calves then wrapped with a warm towel . Indulge your feet in warm Paraffin . Finish your treatment with a 15 minute massage on your feet and 10 minutes on your arms and shoulders with a soy based hot Candle Wax . This is the perfect recipe for softer skin and for a vibrant healthy glow followed by polish . Princess Spa Pedicure $ 20.00 You are never too young to be PAMPERED ! For ages 12 and under included all the benefits of Classic Pedicure . Pedicure Enhancers Foot Reflexology 10 - minute add $ 10.00 French or American Polish add $ 05.00
[ "Pedicure Menu", "Classic Spa Pedicure", "Hot Stone Pedicure" ]
http://eodinfo.tamu.edu/programs/competency/behavioral-competencies/collaboration-and-teamwork/
Professional Development Job Seekers New Employees Employees Employee Training Schedule Managers HR Liaisons Retirees Find Help Workday @ Texas A&M NEW ! - Who to Contact ? The Professional Development Department ( formerly Employee & Organizational Development ) offers a variety of workshops , programs and consulting services designed to enhance the professional growth and effectiveness of Texas A&M University ' s staff and faculty . Read more Spotlight Performance Review Process in Workday Employee Development Tools โ€“ Professional Development Worksheet and Learning Activity Worksheet Train - the - Trainer Online Resources Recognition and Awards
[ "Professional Development", "A&M University" ]
http://eol.org/pages/453890/details
Bipes biporus &mdash ; Details Five - toed Worm Lizard learn more about names for this taxon Add to a collection Add a link Add an article Overview Detail 40 Media 2 Maps Names Community Resources Literature Updates Articles on this page are available in 1 other language : Spanish ( 10 ) learn more Overview Brief Summary Learn more about this article The worm lizard Bipes biporus is an amphisbaenian , a type of elongate burrowing reptile that is often pink and wormlike in appearance . Bipes is the only amphisbaenian genus with limbs ; in particular , members of this genus have small but well developed forelimbs . This genus is also the only squamate taxon in which the forelimbs are better developed than the hind limbs . As a species , B . biporus always has five digits on each limb , its head is blunt , and it burrows in sandy desert soils on the peninsula of Baja , California . Its tail is short and autotomic , although once it is lost it will not regenerate . This species exhibits no external sexual dimorphism . Like other amphisbaenians , its skin is marked with ringlike annuli , contributing to its wormlike appearance . is a generalist predator that preys primarily on invertebrates , especially arthropods . This species lives in self - constructed tunnels in the soil and , although it typically resides close to the surface , it rarely emerges from underground . As a result , its most likely predators are snakes , which are well suited to enter and navigate its underground burrow systems . is active year - round , due in part to its capacity for behavioral thermoregulation . This species moves primarily by lateral undulation and concertina locomotion , techniques common among fully limbless reptiles , although it may use its forelimbs to assist in locomotion . Reproduction in this species is oviparous and biennial , with females laying small clutches of one to four eggs every other year . Public Domain Luke Mahler Source : The Harvard University Herpetology Course - OEB 167 Trusted Article rating from 0 people Default rating : 2.5 of 5 comment on or rate this article Distribution Range Description Learn more about this article This species is endemic to the Baja California peninsula of Mexico , where it ranges from extreme southwestern Baja California State through western Baja California Sur , to the Isthmus of La Paz and the western Cape Region . ยฉ International Union for Conservation of Nature and Natural Resources Source : IUCN Trusted Article rating from 0 people Default rating : 2.5 of 5 comment on or rate this article occurs on the western half of the peninsula of Baja , California , bordered on the east by the Peninsular Ranges . This species โ€™ range extends from the southern tip of the peninsula at Cabo San Lucas to the northern edge of the Vizcaรญno Desert and Magdalena Plain ( Papenfuss 1982 , Grismer 2002 ) . Public Domain Luke Mahler The Harvard University Herpetology Course - OEB 167 Continent : Middle - America Distribution : Mexico ( W Baja California Sur ) Type locality : โ€˜ โ€˜ Cape San Lucas , Lower California โ€™ โ€™ ( = Baja California , Mexico ) . ยฉ Peter Uetz The Reptile Database Physical Description Morphology Due in part to poor external differentiation between the head and the rest of the body , morphological studies of amphisbaenians tend to focus not on head anatomy but on the number of annuli , or rings of juxtaposed rectangular scales that encircle the body and tail . has two dorsal annuli per vertebra , for a total of 242 - 261 dorsal annuli โ€œ from the first postoral annulus up to and including the dorsal annulus above the ventral annulus bearing the preanal pores โ€ ( Papenfuss 1982 ) . There are 89 - 109 fewer ventral annuli than dorsal annuli , and this number does not appear to be proportional to the number of dorsal annuli . The lateral annuli , defined as the dorsal annuli above the cloacal region โ€œ between the dorsal annulus above the preanal pores and the first complete caudal ring posterior Individual in the Vizcaรญno Desert at the northern end of this species โ€™ range tend to have significantly fewer dorsal and ventral annuli than those in more southern localities like La Paz . While this difference could be influenced by genetic factors , it is more commonly thought to be a response to an environmental gradient , as temperature has been shown in closely related species to affect the number of vertebrae in an individual , which could influence annuli counts ( Papenfuss 1982 ) . has a nonretractable tongue with filamentous papillae . The dorsal surface of the tongue is covered with diagonal rows of lingual scales , which have smooth posterior edges . The skull includes nasal , frontal , and parietal bones , as well as a single , large premaxillary bone . There are no postorbital or squamosal bones in this species . The pterygoid lacks teeth , and the marginal dentition is pleurodont . The forelimbs of this species are large and molelike , with five well - developed , claw - bearing digits . While this species has a well Bipes can lose their tail only once , as there is a single point , anterior to the transverse processes of a particular caudal vertebra within ten caudal annuli of the cloaca , at which intravertebral autotomy can occur . After autotomy , the tail heals but is not regenerated . Tail autotomy is less frequent in B . biporus than in the other two members of its genus , but in each of these species tail loss appears to increase with age . Juveniles of this species are light pink in color , turning to white as adults . exhibits no external sexual dimorphism ( Papenfuss 1982 ) . Size is small to moderate in size . Adults of this species average 190 - 210 mm in snout - vent length ( SVL ) and may reach 240 mm in total length . In general , the tail of this species comprises about 9.5 - 10.5 % of the total body length ( Papenfuss 1982 , Grismer 2002 ) . Diagnostic Description The genus is easily identified , as it is the only amphisbaenian genus to possess external limbs . in particular can be distinguished from its congeners by the number of claws ( has five , B . canaliculatus has four , and B . tridactylus has three ) and the number of preanal pores located on the flanks ( has two , while its congeners each have at least six ) . Tail length can also be a useful diagnostic character : within the genus , the tail of is the shortest , the tail of B . tridactylus is the longest , and the tail of B . canaliculatus is of intermediate length ( Papenfuss 1982 , Grismer 2002 ) . Type Information Paralectotype ; Syntype for Bipes biporus Catalog Number : USNM 8568 Collection : Smithsonian Institution , National Museum of Natural History , Department of Vertebrate Zoology , Division of Amphibians & Reptiles Preparation : Ethanol Locality : La Paz , Baja California Sur , Mexico Paralectotype : Cochran , D . M . 1961 . United States National Museum Bulletin . ( 220 ) : 110 . ; Cope , E . D . 1894 . American Naturalist . 28 : 436 , figure 5a - e . ; Syntype : Cochran , D . M . 1961 . United States National Museum Bulletin . ( 220 ) : 110 . ; Cope , E . D . 1894 . American Naturalist . 28 : 436 , figure 5a - e . ยฉ Smithsonian Institution , National Museum of Natural History , Department of Vertebrate Zoology , Division of Amphibians & Reptiles National Museum of Natural History Collections Paralectotype ; Syntype for Bipes biporus Catalog Number : USNM 21325 Collection : Smithsonian Institution , National Museum of Natural History , Department of Vertebrate Zoology , Division of Amphibians & Reptiles Preparation : Ethanol Year Collected : 1882 Locality : La Paz , Baja California Sur , Mexico Paralectotype : Cochran , D . M . 1961 . United States National Museum Bulletin . ( 220 ) : 110 . ; Cope , E . D . 1894 . American Naturalist . 28 : 436 , figure 5a - e . ; Syntype : Cochran , D . M . 1961 . United States National Museum Bulletin . ( 220 ) : 110 . ; Cope , E . D . 1894 . American Naturalist . 28 : 436 , figure 5a - e . ยฉ Smithsonian Institution , National Museum of Natural History , Department of Vertebrate Zoology , Division of Amphibians & Reptiles National Museum of Natural History Collections Lectotype ; Syntype USNM 21324 Year Collected : 1882 Lectotype : Cochran , D . M . 1961 . United States National Museum Bulletin . ( 220 ) : 110 . ; Cope , E . D . 1894 . American Naturalist . 28 : 436 , figure 5a - e . ; Syntype : Cochran , D . M . 1961 . United States National Museum Bulletin . ( 220 ) : 110 . ; Cope , E . D . 1894 . American Naturalist . 28 : 436 , figure 5a - e . USNM 21323 USNM 21322 USNM 21321 USNM 21320 USNM 21317 USNM 21316 USNM 12599 Ecology Habitat Habitat and Ecology Habitat and Ecology This fossorial species requires areas with sandy soils with abundant leaf litter ; it is rarely seen on the surface . The general habitat in its area of distribution is dryland and desert , with xeric shrub vegetation . Animals are often collected close to fenceposts , and populations are believed to be able to survive in moderately disturbed landscapes . They construct an elaborate system of burrows just below the surface , usually centered on stands of vegetation . Systems Terrestrial ยฉ International Union for Conservation of Nature and Natural Resources IUCN inhabits sandy , compact soil , such as that found in the Vizcaรญno Desert and Magdalena Plain of Baja , California . Individuals construct shallow tunnel systems which typically occur within the top 4 cm of sand ; indeed , Papenfuss ( 1982 ) found 165 of 253 individuals sampled within the top 2.5 cm of soil , although they have been observed as deep as 15 cm below the surface . Within its genus , tends to burrow closer to the surface than or ( Papenfuss 1982 ) . This species may prefer to burrow close to stands of vegetation , and it is thought to be tolerant of moderate habitat disturbance ( Hollingsworth and Frost 2007 ) . Associations is a generalist arthropodivore , preying most commonly on ants and termites but also eating a wide variety of other terrestrial and fossorial invertebrates . This species consumes both soft - and hard - bodied invertebrates with body sizes smaller than its gape , and the stomach contents of different individuals have been observed to contain both large numbers of small prey and small numbers of large prey . While it is likely that bites its prey as a means of capture or ingestion , evidence that it can chew or bite off pieces of larger prey items is scarce ( Kearney 2003a ) . rarely leaves its burrows , and this subterranean lifestyle allows it to avoid many predators that would have to enter or excavate its burrows in order to reach it . Snakes are this species โ€™ most likely predators because their body form allows them to enter and navigate its burrows with relative ease . Some mammalian predators may be able to reach this species โ€™ burrows by digging , but it likely avoids most of them by burrowing deep underground at night ( Kearney 2003a ) . Population Biology Based on a collection of 103 adults and 168 juveniles of this species , Papenfuss ( 1982 ) estimated that , although male and female are about equally common at the juvenile stage , the ratio of adult females to adult males appears to be approximately two to one . The causes of this gender imbalance remain unknown , but could include differential mortality , sampling bias , or a skewed primary sex ratio . Life History and Behavior Behavior Tunnel Construction constructs its own burrows , digging at first by alternately extending and flexing its forelimbs . After creating an initial opening in the substrate , its folds its limbs into grooves behind the pectoral girdle , and completes the rest of the burrow by using the strongly ossified head to compress the soil into tunnel walls through a series of dorsal and ventral strokes ( Dial et al . 1987 ) . Thermoregulation Burrowing species like were once thought to have little capacity for thermoregulation because they derive their body temperature from the ambient soil , and indeed the closely related appears unable to thermoregulate behaviorally . However , research has shown that regulates its body temperature by moving between tunnel segments that vary in temperature depending on depth , soil composition , and sun exposure . Papenfuss ( 1982 ) found that , especially during the early morning , this species is most likely to be found in shallow tunnels under sunlit patches of ground , retreating deeper into the ground once the near - surface temperature exceeds its preferred body temperature . This behavioral thermoregulation likely contributes to the ability of this species to remain active year - round , by burrowing down into cooler , moister soils in hot , Locomotion appears to move primarily by lateral undulation and concertina locomotion , although it is also capable of rectilinear movement ( Gans 1978 ) . Concertina locomotion , which is characterized by alternate extension and re - bending of S - shaped body coils from a momentarily stationary base , is found in many other reptiles and may be the most basal type of limbless reptilian locomotion . However , and its congeners are unique among reptiles in that they combine concertina locomotion with alternate flexion and extension of the limbs . The limbs are extended to fix or stabilize the anterior portion of the body , and flexed to propel it forward . Concertina locomotion also seems to be energetically inexpensive for , as the intensity of muscle contraction is sufficiently low that aerobic metabolism alone can replenish the oxygen consumed by this process ( Dial et al . 1987 ) . Reproduction Like the other two members of its genus , is oviparous and lays eggs in small clutches of one to four . The mean clutch size per female is approximately two . Most female reach sexual maturity around the age of 45 months , at a snout - vent length of approximately 185 mm . The female reproductive cycle in this species is likely biennial ; that is , individual females reproduce only every other year . Eggs are laid in July , and hatchlings 90 - 109 mm in total length emerge in late September , during or just before the beginning of the rainy season ( Papenfuss 1982 ) . Evolution and Systematics Evolution is one of three species in the genus ; its two congeners are and . This genus is in the family Bipedidae , whose phylogenetic placement relative to the three other amphisbaenian families remains controversial . A traditional morphological phylogeny placed the Bipedidae as the most basal amphisbaenian family , sister to all other amphisbaenians , which are united by the loss of external limbs ( Kearney 2003b , Macey et al . 2004 ) . However , recent molecular studies have suggested an alternative phylogeny . A phylogenetic tree based on the two nuclear genes c - mos and RAG - 1 placed the limbless family Rhineuridae as the most basal lineage , followed by Blanidae , with Bipedidae sister to the most derived families Amphisbaenidae and Trogonophidae ( Kearney and Stuart 2004 ) . Macey et al . ( 2004 ) derived a similar tree from complete mitochondrial DNA sequences . Thus , while morphological phylogenies tend to identify Bipedidae as the most basal amphisbaenian family , molecular data consistently place Rhineuridae as the sister group to all other amphisbaenians , with Bipedidae in a more derived position , sister to the clade formed by Trogonophidae plus The molecular phylogeny yields two evolutionary hypothesis with respect to the evolution of limblessness in amphisbaenians . If Bipedidae , the only family with limbs , is not the most basal amphisbaenian family , then either limb loss must have occurred three times independently in amphisbaenians , or limb loss occurred just once basally , and limbs were re - evolved in the genus . Kearney and Stuart ( 2004 ) suggest that the first hypothesis , that limbs were lost repeatedly , is the more plausible of the two because there is no empirical evidence for the evolutionary regaining of whole limbs in tetrapods , whereas limb loss and reduction are relatively common in other reptile lineages . However , the second hypothesis , that re - evolved its forelimbs from a limbless ancestor , is not at all impossible . All other limb - reduced squamates first lose the forelimbs , then the hindlimbs . The genus is unique in that it is the only taxon for which the forelimbs are better developed than the hindlimbs , suggesting that the re - evolution of forelimbs in may have been possible ( Kearney and Stuart 2004 ) . Physiology and Cell Biology Physiology The middle ear of most amphisbaenians consists of two elements : an osseous columella ( or stapes ) and a cartilaginous extracolumella , which connect to form a rod that conducts sound vibrations to the cochlear fluids . However , unlike most other species , the sound - receiving surface is not a specialized tympanic membrane but rather a particular area of skin . In , this system is functionally identical to those of other amphisbaenians . however unlike in other amphisbaenians , in which the columella connects to the skin by an extracolumella made of bone or cartilage , the columella of this species is connected by fibrous tissue to the nuchal constriction , a deep fold of skin on the neck ( Wever and Gans 1972 ) . Measurements of cochlear potential suggest that B . biporus has high auditory sensitivity relative to other amphisbaenians , which may be masked in some studies because this species โ€™ auditory apparatus is located differently with respect to the head than in most other amphisbaenians . The auditory system of seems to be most effective at sensing aerial sounds , especially those originating posterior to the head ( Wever and Gans 1972 ) . Molecular Biology and Genetics Genetics Amphisbaenians are known to have novel mitochondrial genomic features . In particular , in addition to some unusual gene orders and repeats , has an abnormal stem and loop structure between trnN and trnC , where light - strand replication is initiated . This structure has been associated with mitochondrial genomic rearrangement in other vertebrates ( Macey et al . 2004 ) . Molecular Biology Barcode data : Bipes biporus The following is a representative barcode sequence , the centroid of all available sequences for this species . There are 3 barcode sequences available from BOLD and GenBank . Below is a sequence of the barcode region Cytochrome oxidase subunit 1 ( COI or COX1 ) from a member of the species . See the BOLD taxonomy browser for more complete information about this specimen and other sequences . ACCCGTTGATTCTTCTCAACAAACCACAAAGACATCGGCACGCTGTACCTGTTGTTTGGCGCTTGAGCCGGAGCAGCTGGCACCGCCCTCAGCCTCCTAATTCGTGCCGAACTGGGCCAACCCGGCGCATTACTTGGAAAT - - - GACCAAATCTACAACGTCGTAGTAACCGCTCACGCATTCGTAATAATTTTCTTCATGGTCATACCAATTATAATCGGCGGGTTTGGAAACTGGCTCGTTCCCCTAATAATTGGCGCCCCAGATATAGCCTTTCCACGCATGAACAACATGAGCTTCTGACTGCTGCCACCATCACTACTGCTGCTGCTTGCTTCTGCCGGAGTAGAAGCAGGAGCAGGCACAGGATGAACAGTGTACCCGCCACTGGCCGGAAACTTAGCACACGCCGGCCCATCCGTCGACCTGACCATCTTCTCGCTA CACCTCGCCGGAGTGTCTTCAATCCTCGGTGCCATCAACTTCATCACCACCTGTATCAACATAAAACCACCACAAATATCACAGTACCAAACACCATTGTTTGTGTGGTCAGTTCTAATCACAGCCGTACTCCTCCTACTCTCTCTCCCCGTACTGGCCGCTGGTATTACAATACTACTCACCGACCGCAATATTAACACCTCATTCTTCGACCCATCAGGGGGCGGAGATCCCATCCTATACCAACACTTGTTTTGATTCTTTGGACACCCAGAAGTATATATCCTAATTCTCCCGGGC TTCGGGATAATCTCTCATATCGTAACCTATTACGCAGGAAAAAAAGAACCTTTTGGCTACATAGGCATGGTCTGAGCCATATTATCAATTGGCTTTCTCGGATTCATCGTATGGGCCCATCATATATTCACCGTAGGAATAGACGTAGACACCCGCG - - end - - Download FASTA File ยฉ Barcode of Life Data Systems Barcode of Life Data Systems ( BOLD ) Statistics of barcoding coverage : Bipes biporus Barcode of Life Data Systems ( BOLDS ) Stats Public Records : 3 Specimens with Barcodes : 3 Species With Barcodes : 1 ยฉ Barcode of Life Data Systems Barcode of Life Data Systems ( BOLD ) Conservation Conservation Status IUCN Red List Assessment Red List Category LC Least Concern Red List Criteria Version 3.1 Year Assessed 2007 Assessor / s Hollingsworth , B . & Frost , D.R . Reviewer / s Cox , N . , Chanson , J.S. & Stuart , S.N. ( Global Reptile Assessment Coordinating Team ) Contributor / s Justification Listed as Least Concern in view of its wide distribution , tolerance of a degree of habitat modification , presumed large population , and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category . The IUCN Red List ( 2007 ) categorizes this species as Least Concern โ€œ in view of its wide distribution , tolerance of a degree of habitat modification , presumed large population , and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category โ€ ( Hollingsworth and Frost 2007 ) . Trends Population Population It is probably a relatively abundant species , but it is secretive and is not often encountered . Papenfuss ( 1982 ) collected 2,719 specimens in an extensive study of the species . Population Trend Stable Populations of this species are stable ( Hollingsworth and Frost 2007 ) . Threats Major Threats There appear to be few major threats to the species , but in some places it is probably negatively by expanding intensive agriculture . Animals may be killed when encountered because of misidentification as snakes , and a fear that they attack humans . There is some collecting of animals , possibly for the pet trade , but this is believed to have a minimal impact on populations . Although currently faces few major threats , its populations may be adversely affected by the expansion of intensive agricultural practices . Individuals may be killed due to misidentification as snakes , or due to popular yet unfounded fears that will attack or parasitize humans . This species is also collected for use in the pet trade , but that is believed to have only minimal effects on its populations ( Hollingsworth and Frost 2007 ) . Management Conservation Actions Conservation Actions It is present in the large Vizcano Biosphere Reserve , and in some other protected areas . It is protected by national legislation , with the NOM ( 2003 ) listing this species under the Pr category ( special protection ) . Wikipedia Mexican mole lizard The Mexican mole lizard ) , commonly known as the five - toed worm lizard ajolote , or simply as , is a species of amphisbaenian , which is endemic to Baja California , Mexico . It is one of four species of amphisbaenians that have legs . Also it is one of only two non - extinct genera of reptiles to have only front limbs , with Jarujinia bipedalis citation needed It should not be confused with the axolotl , a salamander ( Ambystoma mexicanum ) , which is usually called ajolote in Spanish Contents 1 Description 2 Reproduction 3 Geographic range 4 Behavior 5 Diet 6 References 7 Further reading 8 External links Description They are pink , lizard - like reptiles , 18 โ€“ 24 cm ( 7.1 โ€“ 9.4 in ) snout - to - vent length and 6 โ€“ 7 mm ( 0.24 โ€“ 0.28 in ) in width , that live for one to two years . Their skin is closely segmented to give a corrugated appearance , and like earthworms , their underground movement is by peristalsis of the segments . The forelegs are strong and paddle - like , while the hindlegs have disappeared , leaving behind only vestigial bones visible in X - rays . This species is oviparous and the females lay one to four eggs in July . The species only breeds underground . The eggs hatch after two months . Geographic range The Mexican mole lizard is found only in Baja California Mexico Like all other amphisbaenians , this burrowing species only surfaces at night or after heavy rain . Diet It is an opportunist carnivore and eats ants , termites , ground - dwelling insects , larvae , earthworms , and small animals including lizards . It usually pulls its prey down to the ground to start its meal . References Stejneger , L . , and T . Barbour . 1917 . A Check List of North American Amphibians and Reptiles . Harvard University Press . Cambridge , Massachusetts . 125 pp . ( , p . 72 . ) Smithsonian Institution at the Reptile Database Further reading Cope , E.D . 1894 . On the Genera and Species of Euchirotidรฆ . American Naturalist 28 : 436 - 437 . ( Euchirotes biporus Stebbins , R.C . 2003 . A Field Guide to Western Reptiles and Amphibians , Third Edition . The Peterson Field Guide Series . Houghton Mifflin . Boston and New York . xiii + 533 pp . ISBN 0 - 395 - 98272 - 3 ( paperback ) . ( , pp . 428 - 429 + Plate 55 + Map 200 . ) Wikipedia Unreviewed Disclaimer EOL content is automatically assembled from many different content providers . As a result , from time to time you may find pages on EOL that are confusing . To request an improvement , please leave a comment on the page . Thank you !
[ "Bipes biporus" ]
http://eol.org/pages/6851/overview
Rotifera mdash Overview Rotifers learn more about names for this taxon Overview 2737 Media 2 Maps Names Community Resources Literature Updates Media Brachionus manjavacas Trusted Leasi Francesca Source Marine Rotifera See all media Brief Summary Learn more about this article Filo Rotifera Rotifera or rotifers Latin rota wheel beast those who have are a phylum of aquatic animals and microscopic Its name refers to the crown of cilia surrounding the mouth of these animals Are known about 1700 species of rotifers free life living in most freshwater bodies including small puddles of rain soil moist and also found in mosses and lichens growing on tree trunks and rocks or even about fungi crustaceans or aquatic larvae of rotifers insectosOs move by crawling the cilia of the corona or jumping through the water using specialized appendages because the vast majority live in the The Phylum Rotifera is divided into three classes Monogononta and Bdelloidea Seisonidea of which the largest is the first with about 1500 species followed by Bdelloidea with some 350 species Are known Seisonidea only two species which are normally regarded as the most primitive Unreviewed Kleber Baita Supplier Kleber Baita Present in 47 collections See all 47 collections in which this page appears Aliens Among Us 9 other items Zoology Lab Practical 2 4 other items animals 15 other items Belongs to 4 communities See all 4 communities that feature this page Birds of the world 22779 other items 21 members Tree of LIfe 34 other items 2 members Recognition Guid and Learning 11305 other items 1 member EOL has data for 10 traits See all 10 traits for this taxon Trait data undescribed species present in museum collections 20 total unknown species statistical model max min 140 20 total unknown species expert opinion max min 2520 320 total species expert opinion max min 2634 434 percent species currently described max min 26 4 number of new species decribed 19992008 17 known marine species 114 described accepted 114 habitat fresh water marine biome saline water Classification Classification from Rotifers of the World selected by Christian D Jersabek Rotifera Eurotatoria De Ridder 1957 Pararotatoria Sudzuki 1964 Reviewed by 2 curators Learn how to curate Hendrik Segers Maggie Whitson Botanist Latest updates See all 381 updates for this page Grzegorz Jagodziล„ski added the Polish common name Wrotki to Rotifera 4 months ago Maggie Whitson marked Image of Rotifera as trusted on the Rotifera page over 1 year ago Kento Furui added the Japanese common name ใ‚ฆใƒŸใƒ’ใƒซใ‚ฌใ‚ฟใƒฏใƒ ใ‚ท็ง‘ to Seisonidae over 1 year ago Kento Furui added the Japanese common name ใƒ•ใ‚ฏใƒญใƒฏใƒ ใ‚ท็ง‘ to Asplanchnidae over 1 year ago Kento Furui added the Japanese common name ใƒใ‚บใƒŸใƒฏใƒ ใ‚ท็ง‘ to Trichocercidae over 1 year ago Add a new comment Your comment Disclaimer EOL content is automatically assembled from many different content providers As a result from time to time you may find pages on EOL that are confusing To request an improvement please leave a comment on the page Thank you
[ "Rotifers" ]
http://eol.org/pages/999148/details
Nyctimene rabori mdash Details Philippine Tubenosed Fruit Bat learn more about names for this taxon Overview 7 Media 4 Maps Names Community Resources Literature Updates Table of Contents Overview Brief Summary Distribution Physical Description Morphology Ecology Habitat Trophic Strategy Life History and Behavior Behavior Reproduction Conservation Conservation Status Trends Threats Management Relevance to Humans and Ecosystems Benefits Wikipedia Resources Partner links Literature Literature references Biodiversity Heritage Library Overview Brief Summary Biology Learn more about this article The Philippine tubenosed bat breeds seasonally with females giving birth to one young each year between April and May Young females first become pregnant at around seven to eight months old producing their first young four and a half to five months later at about one year of age By contrast males are thought to reach sexual maturity a little later than females at approximately one year of age Lactation lasts three to four months but little else is known about parental behaviour in raising the young 3 This forest bat is known to feed on wild figs and thought Wildscreen Source ARKive Trusted Article rating from 0 people Default rating 25 of 5 comment on or rate this article Description Learn more about this article First described in 1984 the peculiar features of this species make it one of the strangest and intriguing of all known bats 4 One of the most bizarre and distinctive features is its separate tubular nostrils which are about 6 mm long and project outwards above the mouth and give this bat its common name 2 3 4 This species is also one of the few striped bats in the world bearing one broad dark stripe down the centre of its back There are also unusual yellow spots on the ears and wings 2 4 The fur is soft and Wildscreen Source ARKive Trusted Article rating from 0 people Default rating 25 of 5 comment on or rate this article Distribution Range Description Learn more about this article The tubenosed fruit bat is endemic to the Philippines where it is restricted to the islands of Cebu Vinciguerra and Muller 1993 Negros and Sibuyan it might also occur in Panay although there has been a lack of sampling there to confirm this L Heaney pers comm 2006 It has also been recorded from Karakelong in the Talaud Islands Indonesia and on Siao and Greater Sangihe in the Sangihe Islands Indonesia K Helgen pers comm but these records represent tentative identifications The elevational range is from sea level to 1300 m asl On Negros it has been recorded from 200 International Union for Conservation of Nature and Natural Resources Source IUCN Trusted Article rating from 0 people Default rating 25 of 5 comment on or rate this article Learn more about this article Nyctimene rabori is found on Negros Cebu and Sibuyan Islands in the central Philippines Biogeographic Regions oriental Native Other Geographic Terms island endemic Heaney L et al 2002 Nyctimene rabori Online A Synopsis of the Mammalian Fauna of the Phillippine Islands Accessed August 18 2004 at httpwwwfmnhorgphilippine_mammalsNyctimene_raborihtm The Regents of the University of Michigan and its licensors Source Animal Diversity Web Trusted Article rating from 0 people Default rating 25 of 5 comment on or rate this article Range Learn more about this article As its common name suggests the Philippine tubenosed bat is endemic to the Philippines where it is recorded only from the islands of Cebu Negros and Sibuyan 4 The species has an extremely restricted range on these islands having only once been seen on Cebu over 10 years ago and with only a small population surviving in the hills of Sibuyan The largest population exists on Negros Island but is now limited to the relatively narrow strips of forest on the mountainside 3 Wildscreen Source ARKive Trusted Article rating from 0 people Default rating 25 of 5 comment on or rate this article Physical Description Morphology Learn more about this article The striking physical features from which this animal gets its name are its tubular nostrils which are separate and are about 6mm long Body coloration is sexually dimorphic with females being a light golden brown or buff color and males a darker more chocolatey brown Both sexes have a dark stripe extending from the shoulders to the tail and light spots on their ears and wings The bats measure about 142 mm in total length with tail 25 mm ear 20 mm and forearm 76 mm Other Physical Features endothermic bilateral symmetry The Regents of the University of Michigan and its licensors Source Animal Diversity Web Trusted Article rating from 0 people Default rating 25 of 5 comment on or rate this article Ecology Habitat Habitat and Ecology Learn more about this article Habitat and Ecology It is found in or adjacent to forest sea level to 1300 m in both primary and secondary forest Vinciguerra and Muller 1993 N rabori was previously thought to be confined to highquality forest but it is tolerant to a wider range of habitats than previously suspected having been recorded from degraded habitats on Negros and persisting in very degraded habitats on Cebu During recent collections the species has tended to be found near bodies of water Systems Terrestrial International Union for Conservation of Nature and Natural Resources Source IUCN Trusted Article rating from 0 people Default rating 25 of 5 comment on or rate this article Learn more about this article Nyctimene rabori is found only in tropical forested areas and probably mainly utilizes the high canopy Habitat Regions tropical terrestrial Terrestrial Biomes rainforest The Regents of the University of Michigan and its licensors Source Animal Diversity Web Trusted Article rating from 0 people Default rating 25 of 5 comment on or rate this article Learn more about this article This bat is almost always found in primary preferably lowland forest but has also been recorded in lightly disturbed secondary forest 5 Known breeding populations tend to occur in only very narrow bands of forest near the tops of ridges and on the sides of tall mountains 3 Although recorded from 200 to 1300 m on Negros Island 5 the lower limit is probably now about 800 900 m and rising as deforestation continues 3 but the species is found near sea level on Sibuyan 5 This bat roosts either in vegetation or large hollow trees in the forest but Wildscreen Source ARKive Trusted Article rating from 0 people Default rating 25 of 5 comment on or rate this article Trophic Strategy Learn more about this article Little is yet known about the habits of this recently 1984 described species but like other Nyctimene species it probably eats a variety of local fruits and perhaps some insects as well The Regents of the University of Michigan and its licensors Source Animal Diversity Web Trusted Article rating from 0 people Default rating 25 of 5 comment on or rate this article Life History and Behavior Behavior Learn more about this article Perception Channels tactile chemical The Regents of the University of Michigan and its licensors Source Animal Diversity Web Trusted Article rating from 0 people Default rating 25 of 5 comment on or rate this article Reproduction Learn more about this article Reproduction is known to occur in May and June based on a small number of specimens that were collected while lactating females or in breeding condition males The duration of the breeding season and other details of the species reproductive behavior have not yet been studied by researchers Key Reproductive Features gonochoricgonochoristicdioecious sexes separate sexual The Regents of the University of Michigan and its licensors Source Animal Diversity Web Trusted Article rating from 0 people Default rating 25 of 5 comment on or rate this article Conservation Conservation Status IUCN Red List Assessment Learn more about this article Red List Category EN Endangered Red List Criteria C2ai Version 31 Year Assessed 2008 Assessors Ong P RosellAmbal G Tabaranza B Heaney L Ingle N Cario AB Pangulatan LM Pedregosa M Alcala E Helgen K Reviewers Hutson AM Racey PA Chiroptera Red List Authority Stuart SN Global Mammal Assessment Team Contributors Justification N rabori is listed as Endangered because its population size is estimated to number fewer than 2500 mature individuals there is an observed continuing decline in the number of mature individuals and no subpopulation contains more than 250 mature individuals History 1996 Critically Endangered CR 1994 Endangered E 1990 Endangered E 1988 Endangered E International Union for Conservation of Nature and Natural Resources Source IUCN Trusted Article rating from 0 people Default rating 25 of 5 comment on or rate this article Learn more about this article Human activities have resulted in the loss of much of this tubenosed fruit bats forest habitat If the forest fragments where it still lives are adequately protected the species may survive IUCN Red List of Threatened Species endangered The Regents of the University of Michigan and its licensors Source Animal Diversity Web Trusted Article rating from 0 people Default rating 25 of 5 comment on or rate this article Status Learn more about this article Classified as Endangered EN on the IUCN Red List 1 Wildscreen Source ARKive Trusted Article rating from 0 people Default rating 25 of 5 comment on or rate this article Trends Population Learn more about this article Population The tubenosed fruit bat has been collected mistnetted infrequently on Cebu and Negros It might be less common in degraded habitat than in old growth forest but it does seem to be able to persist in degraded areas L Heaney pers comm 2007 It is more widespread on Negros and Cebu than previously suspected L Heaney pers comm 2007 On Negros where it had been known only from a population on the southern part of the island surveys have located 30 individuals at eight sites between 1998 and 2004 Carino 2004 During survey the highest number of individuals of N rabori was recorded in Banban Ayungon municipality with a total capture of nine individuals during 26 Mar to 10 Apr 1999 Cario 2004 Mount Siburan Sibuyan Island may have numbers of the tubenosed fruit bats in the high hundreds Negros may have low thousands of individuals and Cebu may have numbers in the low hundreds where the population of that island has been found only in five small sites L Heaney pers comm 2007 The number of mature individuals could be less than 2500 Population Trend Decreasing International Union for Conservation of Nature and Natural Resources Source IUCN Trusted Article rating from 0 people Default rating 25 of 5 comment on or rate this article Threats Learn more about this article Major Threats Deforestation is a major threat and has been severe across much of the range of N rabori although the rate has slowed due to the fact that there is little remaining primary forest Most of the lowland forest habitat which is the most suitable for the species has been destroyed in two out of the three islands on which the species is known to occur Although it has recently been recorded from some areas of secondary forest the remaining populations are under intense pressure since very little forest remains and there is a continuing decline in area and quality of this forest Hunting is not suspected to be a threat as according to surveys local people are International Union for Conservation of Nature and Natural Resources Source IUCN Trusted Article rating from 0 people Default rating 25 of 5 comment on or rate this article Learn more about this article Populations of this unusuallooking bat have declined dramatically since 1950 due to extensive habitat destruction and the threat of extinction now lingers dangerously close 5 Habitat has been destroyed by clearing and illegal logging leaving less than just 1 of original oldgrowth lowland forest remaining on Negros Island where the largest population of this species is found 3 Lowland rainforest on Cebu Island is virtually gone altogether and it is not known if this species still survives there as it has not been seen for over 10 years Thus the Philippine tubenosed bat now clings to a precarious existence edging Wildscreen Source ARKive Trusted Article rating from 0 people Default rating 25 of 5 comment on or rate this article Management Conservation Actions Learn more about this article Conservation Actions Surveys are needed over a wider part of the potential range of N rabori to more acurately determine the status of its population and to determine whether it occurs on Panay It is known to occur in North Negros Forest Reserve Tamblyn et al 2005 More adequate conservation measures are needed at known sites International Union for Conservation of Nature and Natural Resources Source IUCN Trusted Article rating from 0 people Default rating 25 of 5 comment on or rate this article Conservation Learn more about this article Both Mount Canlaon and a part of the mountainous southern fragment where this bat is thought to occur on Negros Island are designated by the national government as protected areas Nevertheless deforestation continues to pose a serious threat including in the beautiful Twin Lakes Region that falls within the southern protected area 6 If the remaining forest fragments were adequately protected this rare and intriguing species may have a chance of survival 2 but if current rates of habitat loss continue the future for this bat looks pretty bleak Wildscreen Source ARKive Trusted Article rating from 0 people Default rating 25 of 5 comment on or rate this article Relevance to Humans and Ecosystems Benefits Learn more about this article Tubenosed fruit bats are dispersers of fruit tree seeds and may help control pest insect populations The Regents of the University of Michigan and its licensors Source Animal Diversity Web Trusted Article rating from 0 people Default rating 25 of 5 comment on or rate this article Wikipedia Philippine tubenosed fruit bat Learn more about this article The Philippine Tubenosed Fruit Bat Nyctimene rabori locally known in Tagalog as Bayakan is a species of bat in the Pteropodidae family It is endemic to the Philippines Its natural habitat is subtropical or tropical dry forests It is threatened by habitat loss due to deforestation The species is named for Dioscoro S Rabor who with several others first collected the species a b Ong P RosellAmbal G Tabaranza B Heaney L Ingle N Cariรฑo AB Pangulatan LM Pedregosa M Alcala E Helgen K 2008 Nyctimene rabori IUCN Red List of Threatened Species Version 31 International Union for Conservation of Nature Retrieved 2 January 2014 Heaney L R Peterson R L 1984 A New Species of TubeNosed Fruit Bat Nyctimene from Negros Island Philippines Mammalia Pteropodidae Occasional Papers of the Museum of Zoology University of Michigan 708 116 Archived from the original on 2 January 2014 Retrieved 2 January 2014 v t e Extant species of family Pteropodidae Kingdom Animalia Phylum Chordata Class Mammalia Infraclass Eutheria Superorder Laurasiatheria Order Chiroptera Subfamily Nyctimeninae Nyctimene Tubenosed fruit bats Broadstriped Tubenosed Fruit Bat N aello Common Tubenosed Fruit Bat N albiventer Pallass Tubenosed Bat N cephalotes Dark Tubenosed Fruit Bat N celaeno Mountain Tubenosed Fruit Bat N certans Roundeared Tubenosed Fruit Bat N cyclotis Dragon Tubenosed Fruit Bat N draconilla Keasts Tubenosed Fruit Bat N keasti Island Tubenosed Fruit Bat N major Malaita Tubenosed Fruit Bat N malaitensis Demonic Tubenosed Fruit Bat N masalai Lesser Tubenosed Bat N minutus Philippine Tubenosed Fruit Bat N rabori Eastern Tubenosed Bat N robinsoni Umboi Tubenosed Fruit Bat N vizcaccia Paranyctimene Lesser Tubenosed Fruit Bat P raptor Steadfast Tubenosed Fruit Bat P tenax Subfamily Cynopterinae Aethalops Pygmy fruit bats Borneo Fruit Bat A aequalis Pygmy Fruit Bat A alecto Alionycteris Mindanao Pygmy Fruit Bat A paucidentata Balionycteris Spottedwinged Fruit Bat B maculata Chironax Blackcapped Fruit Bat C melanocephalus Cynopterus Dogfaced fruit bats Lesser Shortnosed Fruit Bat C brachyotis Horsfields Fruit Bat C horsfieldii Peterss Fruit Bat C luzoniensis Minute Fruit Bat C minutus Nusatenggara Shortnosed Fruit Bat C nusatenggara Greater Shortnosed Fruit Bat C sphinx Indonesian Shortnosed Fruit Bat C titthaecheilus Dyacopterus Dayak fruit bats Brookss Dyak Fruit Bat D brooksi Rickarts Dyak Fruit Bat D rickarti Dayak Fruit Bat D spadiceus Haplonycteris Fischers Pygmy Fruit Bat H fischeri Latidens Salim Alis Fruit Bat L salimalii Megaerops Tailess Fruit Bat M ecaudatus Javan Tailless Fruit Bat M kusnotoi Ratanaworabhans Fruit Bat M niphanae Whitecollared Fruit Bat M wetmorei Otopteropus Luzon Fruit Bat O cartilagonodus Penthetor Dusky Fruit Bat P lucasi Ptenochirus Musky fruit bats Greater Musky Fruit Bat P jagori Lesser Musky Fruit Bat P minor Sphaerias Blanfords Fruit Bat S blanfordi Thoopterus Swift Fruit Bat T nigrescens Subfamily Harpyionycterinae Aproteles Bulmers Fruit Bat A bulmerae Dobsonia Barebacked fruit bats Andersens Barebacked Fruit Bat D anderseni Beauforts Nakedbacked Fruit Bat D beauforti Philippine barebacked fruit bat D chapmani Halmahera Nakedbacked Fruit Bat D crenulata Biak Nakedbacked Fruit Bat D emersa Sulawesi Nakedbacked Fruit Bat D exoleta Solomons Nakedbacked Fruit Bat D inermis Lesser Nakedbacked Fruit Bat D minor Moluccan Nakedbacked Fruit Bat D moluccensis Panniet Nakedbacked Fruit Bat D pannietensis Western Nakedbacked Fruit Bat D peroni New Britain Nakedbacked Fruit Bat D praedatrix Greenish Nakedbacked Fruit Bat D viridis Harpyionycteris Sulawesi Harpy Fruit Bat H celebensis Harpy Fruit Bat H whiteheadi Subfamily Macroglossinae Macroglossus Longtongued fruit bats Longtongued Nectar Bat M minimus Longtongued Fruit Bat M sobrinus Melonycteris Fardoulis Blossom Bat M fardoulisi Blackbellied Fruit Bat M melanops Woodfords Fruit Bat M woodfordi Notopteris Longtailed fruit bats Longtailed Fruit Bat N macdonaldi New Caledonia Blossom Bat N neocaledonica Syconycteris Blossom bats Common blossom bat S australis Halmahera Blossom Bat S carolinae Mossforest Blossom Bat S hobbit Subfamily Pteropodinae Acerodon Sulawesi Flying Fox A celebensis Talaud Flying Fox A humilis Giant Goldencrowned Flying Fox A jubatus Palawan Fruit Bat A leucotis Sunda Flying Fox A mackloti Desmalopex Whitewinged Flying Fox D leucopterus Small Whitewinged Flying Fox D microleucopterus Eidolon Strawcoloured fruit bats Madagascan fruit bat E dupreanum Strawcoloured Fruit Bat E helvum Mirimiri Fijian Monkeyfaced Bat M acrodonta Neopteryx Smalltoothed Fruit Bat N frosti Pteralopex Bougainville Monkeyfaced Bat P anceps Guadalcanal Monkeyfaced Bat P atrata Greater Monkeyfaced Bat P flanneryi Montane Monkeyfaced Bat P pulchra New Georgian Monkeyfaced Bat P taki Pteropus Flying foxes P alecto species group Black flying fox P alecto P caniceps species group Ashyheaded Flying Fox P caniceps P chrysoproctus species group Silvery Flying Fox P argentatus Moluccan Flying Fox P chrysoproctus Makira Flying Fox P cognatus Banks Flying Fox P fundatus Solomons Flying Fox P rayneri Rennell Flying Fox P rennelli P conspicillatus species group Spectacled Flying Fox P conspicillatus Ceram Fruit Bat P ocularis P livingstonii species group Aru Flying Fox P aruensis Kei Flying Fox P keyensis Livingstones Fruit Bat P livingstonii Blackbearded Flying Fox P melanopogon P mariannus species group Okinawa Flyingfox P loochoensis Mariana Fruit Bat P mariannus Pelew Flying Fox P pelewensis Insular Flying Fox P tonganus Kosrae Flying Fox P ualanus Yap Flying Fox P yapensis P melanotus species group Blackeared Flying Fox P melanotus P molossinus species group Lombok Flying Fox P lombocensis Caroline Flying Fox P molossinus Rodrigues Flying Fox P rodricensis P neohibernicus species group Great Flying Fox P neohibernicus P niger species group Aldabra Flying Fox P aldabrensis Mauritian flying fox P niger Madagascan flying fox P rufus Seychelles Fruit Bat P seychellensis Pemba Flying Fox P voeltzkowi P personatus species group Bismark Masked Flying Fox P capistratus Masked Flying Fox P personatus Temmincks Flying Fox P temminckii P poliocephalus species group Bigeared Flying Fox P macrotis Geelvink Bay Flying Fox P pohlei Greyheaded flying fox P poliocephalus P pselaphon species group Chuuk Flying Fox P insularis Temotu Flying Fox P nitendiensis Bonin Flying Fox P pselaphon Vanikoro Flying Fox P tuberculatus New Caledonia Flying Fox P vetulus P samoensis species group Vanuatu Flying Fox P anetianus Samoa Flying Fox P samoensis P scapulatus species group Gilliards Flying Fox P gilliardorum Lesser Flying Fox P mahaganus Little red flying fox P scapulatus Dwarf Flying Fox P woodfordi P subniger species group Admiralty Flying Fox P admiralitatum Ryukyu Flying Fox P dasymallus Nicobar Flying Fox P faunulus Gray Flying Fox P griseus Ontong Java Flying Fox P howensis Small Flying Fox P hypomelanus Ornate Flying Fox P ornatus Little Goldenmantled Flying Fox P pumilus Philippine Gray Flying Fox P speciosus P vampyrus species group Indian Flying Fox P giganteus Andersens Flying Fox P intermedius Lyles Flying Fox P lylei Large Flying Fox P vampyrus Styloctenium Mindoro Stripefaced Fruit Bat S mindorensis Sulawesi Stripefaced Fruit Bat S wallacei Subfamily Rousettinae Eonycteris Dawn fruit bats Greater Nectar Bat E major Cave Nectar Bat E spelaea Philippine Dawn Bat E robusta Rousettus Rousette fruit bats Subgenus Boneia Manado Fruit Bat R bidens Subgenus Rousettus Geoffroys Rousette R amplexicaudatus Sulawesi Rousette R celebensis Egyptian Rousette R aegyptiacus Leschenaults Rousette R leschenaulti Linduan Rousette R linduensis Comoro Rousette R obliviosus Barebacked Rousette R spinalatus Subgenus Stenonycteris Longhaired Rousette R lanosus Madagascan rousette R madagascariensis Subfamily Epomophorinae Epomophorini Epomophorus Epauleted fruit bats Angolan Epauletted Fruit Bat E angolensis Ansells Epauletted Fruit Bat E anselli Peterss Epauletted Fruit Bat E crypturus Gambian Epauletted Fruit Bat E gambianus Lesser Angolan Epauletted Fruit Bat E grandis Ethiopian Epauletted Fruit Bat E labiatus East African Epauletted Fruit Bat E minimus Minor Epauletted Fruit Bat E minor Wahlbergs Epauletted Fruit Bat E wahlbergi Epomops Epauleted bats Buettikofers Epauletted Fruit Bat E buettikoferi Dobsons Fruit Bat E dobsoni Franquets Epauletted Fruit Bat E franqueti Hypsignathus Hammerheaded Bat H monstrosus Micropteropus Dwarf epauleted bats Haymans Dwarf Epauletted Fruit Bat M intermedius Peters Dwarf Epauletted Fruit Bat M pusillus Nanonycteris Veldkamps Dwarf Epauletted Fruit Bat N veldkampii Myonycterini Lissonycteris Angolan Rousette L angolensis Megaloglossus Woermanns Bat M woermanni Myonycteris Little collared fruit bats Sรฃo Tomรฉ Collared Fruit Bat M brachycephala East African Little Collared Fruit Bat M relicta Little Collared Fruit Bat M torquata Plerotini Plerotes DAnchietas Fruit Bat P anchietae Scotonycterini Casinycteris Shortpalated Fruit Bat C argynnis Scotonycteris Zenkers Fruit Bat S zenkeri Pohles Fruit Bat S ophiodon This article related to fruit bats is a stub You can help Wikipedia by expanding it Source Wikipedia Unreviewed Article rating from 0 people Default rating 25 of 5 comment on or rate this article Disclaimer EOL content is automatically assembled from many different content providers As a result from time to time you may find pages on EOL that are confusing To request an improvement please leave a comment on the page Thank you
[ "Peterson" ]
http://eorthopod.com/labral-tears-of-the-hip/
Labral Tears of the Hip A Patient โ€™ s Guide to Labral Tears of the Hip Introduction Acetabular labrum tears labral tears ) can cause pain , stiffness , and other disabling symptoms of the hip joint . The pain can occur if the labrum is torn , frayed , or damaged . Active adults between the ages of 20 and 40 are affected most often , requiring some type of treatment in order to stay active and functional . New information from ongoing studies is changing the way this condition is treated from a surgical approach to a more conservative ( nonoperative ) path . This guide will help you understand what parts of the hip are involved how the condition develops how doctors diagnose the condition what treatment options are available Anatomy What parts of the hip are involved ? The acetabular labrum is a fibrous rim of cartilage around the hip socket that is important in normal function of the hip . It helps keep the head of the femur ( thigh bone ) inside the acetabulum ( hip socket ) . It provides stability to the joint . Our understanding of the acetabular labrum has expanded just in the last 10 years . The availability of high - power photography and improved lab techniques have made it possible to take a closer look at the structure of this area of the hip . The labrum is a piece of connective tissue around the rim of the hip socket ( acetabulum ) . It has two sides : one side is in contact with the head of the femur , the other side touches and interconnects with the joint capsule . The capsule is made up of strong ligaments that surround the hip and help hold it in place while still allowing it to move in many directions , Finding out that there are two separate zones of the labrum was an important discovery . The extra - articular side ( next to the joint capsule ) has a good blood supply but the intra - articular zone ( next to the joint ) is mostly avascular ( without blood ) . That means any damage to the extra - articular side is more likely to heal while the intra - articular side ( with a very poor blood supply ) does not heal well after injury or surgical repair . The labrum helps seal the hip joint , thus maintaining fluid pressure inside the joint and providing the overall joint cartilage with nutrition . Without an intact seal , the risk of early degenerative arthritis increases . A damaged labrum can also result in a shift of the hip center of rotation . A change of this type increases the impact and load on the joint . Without the protection of the seal or with a hip that โ€™ s off - center , repetitive motion can create multiple small injuries to the labrum and to the hip joint . Over time , these small injuries can add to wear and tear in the hip joint . Causes How does this condition develop ? It was once believed that a single injury was the main reason labral tears occurred ( running , twisting , slipping ) . But with improved radiographic imaging and anatomy studies , it โ€™ s clear now that abnormal shape and structure of the acetabulum , labrum , and / or femoral head can also lead to the problem . Injury is still a major cause for labral tears . Anatomical changes that contribute to labral tears combined with repetitive small injuries lead to a gradual onset of the problem . Athletic activities that require repetitive pivoting motions or repeated hip flexion cause these type of small injuries . What are these โ€œ anatomical changes โ€ ? The most common one called femoral acetabular impingement ( FAI ) is a major cause of hip labral tears . With FAI , there is decreased joint clearance between the junction of the femoral head and neck with the acetabular rim . Related Document : Femoroacetabular Impingement of the Hip When the leg bends , internally rotates , and moves toward the body , the bone of the femoral neck butts up against the acetabular rim pinching the labrum between the femoral neck and the acetabular rim . Over time , this pinching , or impingement , of the labrum causes fraying and tearing of the edges . A complete rupture is referred to as an avulsion where the labrum is separated from the edge of the acetabulum where it normally attaches . Changes in normal hip movement combined with muscle weakness around the hip can lead to acetabular labrum tears . Other causes include capsular laxity ( loose ligaments ) , hip dysplasia ( shallow hip socket ) , traction injuries , and degenerative ( arthritic ) changes associated with aging . Anyone who has had a childhood hip disease ( such as Legg - Calvรฉ - Perthes disease , hip dysplasia , slipped capital femoral epiphysis ) is also at increased risk for labral tears . Related Document : Perthes Disease Developmental Dysplasia of the Hip in Children Slipped Capital Femoral Epiphysis Symptoms What does this condition feel like ? Pain in the front of the hip ( most often in the groin area ) accompanied by clicking , locking , or catching of the hip are the main symptoms reported with hip acetabular labral tears . Joint stiffness and a feeling of instability where the hip and leg seem to give away are also common . The pain may radiate ( travel ) to the buttocks , along the side of the hip , or even down to the knee Symptoms get worse with long periods of standing , sitting , or walking . Pivoting on the involved leg is avoided for the same reason ( causes pain ) . Some patients walk with a limp or have a positive Trendelenburg sign ( hip drops down on the right side when standing on the left leg and vice versa ) . The pain can be constant and severe enough to limit all recreational activities and sports participation . Diagnosis How will my doctor diagnose this condition ? The history and physical examination are the first tools the physician uses to diagnose hip labral tears . There may or may not be a history of known trauma linked with the hip pain . When there are anatomic and structural causes or muscle imbalances contributing to the development of labral tears , symptoms may develop gradually over time . Your doctor will perform several tests . One common test is the impingement sign . This test is done by bending the hip to 90 degrees ( flexion ) , turning the hip inward internal rotation ) and bringing the thigh towards the other hip ( adduction ) . Making the diagnosis is n โ€™ t always easy . In fact , this problem is frequently misdiagnosed at first . That โ€™ s because there are many possible causes of hip pain . The pain associated with labral tears can be hard to pinpoint . Your doctor must rely on additional tests to locate the exact cause of the pain . For example , injecting a local anesthetic agent ( lidocaine ) into the joint itself can help determine if the pain is coming from inside ( versus outside ) the joint . X - rays provide a visual picture of any changes out of the ordinary of the entire structure and location of the hip position . Magnetic resonance imaging ( MRI ) gives a clearer picture of the soft tissues ( e.g. , labrum , cartilage , tendons , muscles ) . One other test called a magnetic resonance arthrography ( MRA ) is now considered the gold standard for diagnosis . Studies show that MRA is highly sensitive and specific for labral tears . This test may replace arthroscopic examination as the main diagnostic tool . Arthroscopic examination is still 100 per cent accurate but requires a surgical procedure . With MRAs , contrast dye ( gadolinium ) is injected into the hip joint . Any irregularity in the joint surface will show up when the dye seeps into areas where damage has occurred . MRAs give the surgeon an excellent view of the location and extent of the tear as well as any bony abnormalities that will have to be addressed during surgery . Treatment What treatment options are available ? In the past , when arthroscopic surgery was the only way to confirm the presence of a labral tear , the surgeon would just go ahead and remove the torn edges or pieces during the arthroscopic examination procedure . However , studies over the years have called this approach into question . With removal of the labrum , changes in the way the hip functioned , increased friction of the joint , and increased load on the joint led to degenerative changes and osteoarthritis Surgeons stopped cutting out the torn labrum and started repairing it instead . Physical therapists started doing studies that showed strengthening muscles and resolving issues of muscle imbalances could reduce the need for surgery with the traditional risks ( e.g. , bleeding , infection , poor wound healing , negative reactions to anesthesia ) . More efforts are being made now to manage labral tears with conservative ( nonoperative ) care . This is a possibility most often when there are no symptoms of labral pathology . Patients with confirmed labral tears but who have normal hip anatomy or only mild changes in the shape and structure of the hip may also benefit from conservative care . Nonsurgical Treatment Physical therapy will probably be suggested . Your physical therapist will carry out an examination of joint motion ; hip , trunk , and knee muscle strength ; posture ; alignment ; and gait / movement analysis ( looking at walking / movement patterns ) . A plan of care is designed for each patient based on his or her individual factors and characteristics . Nonoperative care starts with activity modification . You should avoid pivoting on the involved leg and avoid prolonged periods of weight - bearing activities . You physical therapist will work with you to on strengthen your hip muscles , restore normal neuromuscular control , and improve your posture . All of these things can improve your hip function and reduce your pain . Tight muscles around the hip can contribute to pinching between the femoral head and acetabulum in certain positions . A program of flexibility and stretching exercises wo n โ€™ t change the bony abnormalities present but can help lengthen the muscles and reduce contact and subsequent impingement . A special strap called the SERF strap ( SERF means Stability through External Rotation of the Femur ) made of thin elastic may be applied around the thigh , knee , and lower leg to pull the hip into external rotation . The idea is to use the strap to improve hip control and leg movement during dynamic activities . It is important to strengthen the muscles at the same time to perform the same task and avoid depending on external support on a long - term basis . Some patients may also benefit from intra - articular injection with cortisone . Cortisone is a very potent antiinflammatory medication . Injection into the hip joint may reduce the symptoms of pain for several weeks to months . Surgery Arthroscopy is commonly used to repair the torn labrum . The arthroscope is a small fiber - optic tube that is used to see and operate inside the joint . A TV camera is attached to the lens on the outer end of the arthroscope . The TV camera projects the image from inside the hip joint on a TV screen next to the surgeon . The surgeon actually watches the TV screen ( not the hip ) while moving the arthroscope to different places inside the hip joint and bursa . During this procedure , your surgeon will trim the torn and frayed tissue around the acetabular rim and reattach the torn labrum to the bone of the acetabular rim . This procedure is called labral refixation . Each layer of tissue is sewn back together and reattached as closely as possible to its original position along the acetabular rim . When repair is not possible , then debridement of the torn labral tissue may be necessary . Debridement simply means that the torn or weakened portions of the labrum are simply removed . This prevents the torn fragments from getting caught in the hip joint and causing pain and further damage to the hip joint . In some cases , open treatment of femoroacetabular impingement and / or correction of bone abnormalities are required . These procedures are much more involved and usually will require a stay of several days in the hospital . A Patient โ€™ s Guide to Femoroacetabular Impingement Rehabilitation What should I expect after treatment ? Nonsurgical Rehabilitation The goal of conservative management is to relieve pain and improve function by correcting muscle strength imbalances . When both legs have nearly equal strength , it is possible to resume a full and normal level of all activities as long as there is no pain during any of those movements or activities . For the young or active adult , this includes activities of daily living as well as recreational and sports participation . Older adults experiencing labral tears from degenerative arthritis may expect to be able to resume normal daily functions , but may still find it necessary to limit prolonged sitting or standing positions . After Surgery Correction of the problem causing labral tears can result in improved function and pain relief . The hope is that early treatment can prevent arthritic changes but long - term studies have not been done to proven this idea . Recovery after surgery needed to address hip labral tears usually takes four to six months . In other words , patients can expect to resume normal activities six months after surgery . Many athletes or highly active adults find this time frame much too long for their goals and preferences . Patients who follow the recommended rehab plan of care respond well to progression of the exercises and seem to recover faster . Discharge from rehab takes place when the patient can perform all exercises with good form and without pain or other symptoms . Any repeat episodes of groin and / or hip pain must be reported to the orthopedic surgeon for evaluation right away . Post navigation โ† Adult Degenerative Scoliosis Osteonecrosis of the Humeral Head โ†’
[ "Labral", "Tears", "Hip" ]
http://epconfranchising.com/research/meet-management-team/
Meet the Team Our brand is backed by experience in franchising and the homebuilding business Edward Bacome Chief Executive Officer & Director Ed Bacome has over 40 years of experience in property management , construction , operations , and development . He earned his undergraduate and law degrees from The Ohio State University . He is a licensed real estate broker . Mr . Bacome supports many non - profit organizations within the community including the Columbus Foundation and The Ohio State University . He is also on the Board of Directors for Benchmark Bank . Philip Fankhauser President & Director Phil Fankhauser has been involved in commercial and residential development for over 40 years with emphasis on strategic planning , land acquisition , and marketing . He has a B.S. degree in Business and is also a licensed real estate broker . Mr . Fankhauser is a graduate of Franklin University and currently serves on Franklin University โ€™ s Board of Trustees . He also serves on the Senior Housing Council of the Urban Land Institute ( ULI ) . Paul Hanson President , Epcon Communities Franchising Paul Hanson was appointed President of Epcon Communities Franchising in 2018 and has been involved in the building industry since 2003 , serving in various capacities in construction and operations . Prior to joining Epcon , he served as Group Vice President at Arthur Rutenberg Homes , where he led that company โ€™ s expansion and development into a six - state Midwestern market . Prior to that , he was with NVR for over ten years in leadership roles in both Ohio and Florida . Paul is a graduate of Grove City College in Pennsylvania and earned his MBA David Blackmore Treasurer , Chief Financial Officer Dave Blackmore has over 40 years of experience in real estate development and property management . Mr . Blackmore has been the Treasurer and CFO of Epcon Communities since 2005 . In 2010 , Mr . Blackmore received CFO of the Year , Honorable Mention from Business First Magazine . Mr . Blackmore holds a BSBA from The Ohio State University and is a Certified Public Accountant . He has held Board Treasurer positions with Huckleberry House and Lutheran Social Services . Joel Rhoades Regional President ( Columbus ) , General Counsel and Secretary Joel Rhoades has over 20 years of experience in land acquisition , real estate development & sales , and property management . Mr . Rhoades has been with Epcon Communities โ€™ as General Counsel since 1992 . He earned his undergraduate and law degrees from The Ohio State University . Mr . Rhoades currently is a director and president elect of the Building Industry Association of Central Ohio . Bob Kardos Regional President ( Charlotte ) Bob Kardos has 34 years of experience in all aspects of residential home building including land acquisition , land development , purchasing , sales & marketing , vertical construction , customer service and operations management / profitability . Bob holds a Bachelor โ€™ s degree in Architectural Studies from the University of Pittsburgh . Prior to Epcon Communities , Bob worked with several Top 10 National Home Builders including Ryan Homes , M / I Homes and Toll Brothers in a variety of leadership positions . Bob joined the Epcon Communities leadership team as Regional President in November of 2016 Tom Sewitsky Regional President ( Raleigh ) Tom Sewitsky has over 25 years of multi - faceted homebuilding experience with both public and privately owned companies . Mr . Sewitsky has been with Epcon Communities since December of 2017 and has held positions in executive leadership in the Raleigh and Charlotte markets since 2005 . He has served on the Durham , Orange , and Chatham County HBA Board of Directors , and was recognized as one of the top 200 Division Presidents in the country by Homebuilder Executive Magazine . Sewitsky holds a Bachelor of Science degree in Business from Towson University . J . Timothy Rini , Jr . Vice President , Product Development Tim Rini is an Ohio registered architect with NCARB certification and , prior to joining Epcon , has over 30 year โ€™ s experience in real estate development , home building , and commercial construction and estimating . Mr . Rini joined Epcon Franchising in 2007 and became Vice President of Franchising in 2011 . Rini earned his MBA from Xavier University , a BS in Architecture from The Ohio State University , and has completed post - graduate studies in real estate and public policy at Ohio State and the University of Akron . Mr . Rini is also Nanette Overly Vice President , Sales Nanette Overly has over 30 years of experience in the home - building industry . Ms . Overly has been with Epcon Communities since May 2000 and has been the Vice President of Sales since January 2007 . Ms . Overly has been a nationally featured speaker and contributing writer with various home builder conventions and publications . Rob Krohn Vice President , Marketing Rob Krohn has 20 + years of experience leading marketing , advertising and lead generation strategies . As the vice president of marketing for Epcon , Rob oversees strategy and execution for all company marketing initiatives . He also serves as a consultant to Epcon โ€™ s national network of Franchise Builders . Prior to his current position , Rob oversaw brand management and marketing for Assurex Global , HSG / CodeBlue and HTP ( acquired by McKesson ) . Rob holds a BFA from The University of Akron . Rob speaks frequently at industry conferences on topics such as Learn more about Epcon Fill out the form on this page to receive a free Epcon Franchising Information report and start a conversation , or click the โ€œ Next โ€ button below to continue exploring the site .
[ "Epcon Franchising", "Edward Bacome", "Philip Fankhauser" ]
http://epguides.com/VampireDiaries/
The Vampire Diaries Paul Wesley as Stefan Salvatore Ian Somerhalder as Damon Salvatore Katerina ( Kat ) Graham as Bonnie Bennett Candice Accola King as Caroline Forbes Zach Roerig as Matt Donovan Michael Trevino as Tyler Lockwood [ 1 - 6 ] Nina Dobrev as Elena Gilbert [ 1 - 6 ] Steven R . McQueen as Jeremy Gilbert [ 1 - 6 ] Matt Davis as Alaric Saltzman [ Episodes 14 - 66 & Seasons 6 - 8 , recurring Seasons 4 - 5 ] Michael Malarkey as Lorenzo ' Enzo ' St . John [ 6 - 8 , recurring 5 ] Sara Canning as Jenna Sommers [ 1 - 2 ] Joseph Morgan as Klaus Mikaelson [ 3 - 4 ] Kayla Ewell as Vicki Donovan [ Episodes 1 - 7 ] Two vampire brothers vie for the soul of a teenage girl who just lost her parents . Down to Latest Printable Guide @ TVmaze Show Summary @ TVmaze list as .csv The Futon Critic IMDb Share TV TV Club Guide Wiki - pedia FAQ SEARCH epguides & TV . com Menus & Grids Episode list & details from : TVmaze TV . com Original Episode # Prod # Air Date Titles _____ ______ ___________ ___________ ___________________________________________ Season 1 1 . 1 - 1 10 Sep 09 Pilot 2 . 1 - 2 17 Sep 09 The Night of the Comet 3 . 1 - 3 24 Sep 09 Friday Night Bites 4 . 1 - 4 01 Oct 09 Family Ties 5 . 1 - 5 08 Oct 09 You ' re Undead to Me 6 . 1 - 6 15 Oct 09 Lost Girls 7 . 1 - 7 29 Oct 09 Haunted 8 . 1 - 8 05 Nov 09 162 Candles 9 . 1 - 9 12 Nov 09 History Repeating 10 . 1 - 10 19 Nov 09 The Turning Point 11 . 1 - 11 21 Jan 10 Bloodlines 12 . 1 - 12 28 Jan 10 Unpleasantville 13 . 1 - 13 04 Feb 10 Children of the Damned 14 . 1 - 14 11 Feb 10 Fool Me Once 15 . 1 - 15 25 Mar 10 A Few Good Men 16 . 1 - 16 01 Apr 10 There Goes the Neighborhood 17 . 1 - 17 08 Apr 10 Let the Right One In 18 . 1 - 18 15 Apr 10 Under Control 19 . 1 - 19 22 Apr 10 Miss Mystic Falls 20 . 1 - 20 29 Apr 10 Blood Brothers 21 . 1 - 21 06 May 10 Isobel 22 . 1 - 22 13 May 10 Founder ' s Day Season 2 23 . 2 - 1 09 Sep 10 The Return 24 . 2 - 2 16 Sep 10 Brave New World 25 . 2 - 3 23 Sep 10 Bad Moon Rising 26 . 2 - 4 30 Sep 10 Memory Lane 27 . 2 - 5 07 Oct 10 Kill or Be Killed 28 . 2 - 6 21 Oct 10 Plan B 29 . 2 - 7 28 Oct 10 Masquerade 30 . 2 - 8 04 Nov 10 Rose 31 . 2 - 9 11 Nov 10 Katerina 32 . 2 - 10 02 Dec 10 The Sacrifice 33 . 2 - 11 09 Dec 10 By the Light of the Moon 34 . 2 - 12 27 Jan 11 The Descent 35 . 2 - 13 03 Feb 11 Daddy Issues 36 . 2 - 14 10 Feb 11 Crying Wolf 37 . 2 - 15 17 Feb 11 The Dinner Party 38 . 2 - 16 24 Feb 11 The House Guest 39 . 2 - 17 07 Apr 11 Know Thy Enemy 40 . 2 - 18 14 Apr 11 The Last Dance 41 . 2 - 19 21 Apr 11 Klaus 42 . 2 - 20 28 Apr 11 The Last Day 43 . 2 - 21 05 May 11 The Sun Also Rises 44 . 2 - 22 12 May 11 As I Lay Dying Season 3 45 . 3 - 1 15 Sep 11 The Birthday 46 . 3 - 2 22 Sep 11 The Hybrid 47 . 3 - 3 29 Sep 11 The End of the Affair 48 . 3 - 4 06 Oct 11 Disturbing Behavior 49 . 3 - 5 13 Oct 11 The Reckoning 50 . 3 - 6 20 Oct 11 Smells Like Teen Spirit 51 . 3 - 7 27 Oct 11 Ghost World 52 . 3 - 8 03 Nov 11 Ordinary People 53 . 3 - 9 10 Nov 11 Homecoming 54 . 3 - 10 05 Jan 12 The New Deal 55 . 3 - 11 12 Jan 12 Our Town 56 . 3 - 12 19 Jan 12 The Ties that Bind 57 . 3 - 13 02 Feb 12 Bringing Out the Dead 58 . 3 - 14 09 Feb 12 Dangerous Liaisons 59 . 3 - 15 16 Feb 12 All My Children 60 . 3 - 16 15 Mar 12 1912 61 . 3 - 17 22 Mar 12 Break on Through 62 . 3 - 18 29 Mar 12 The Murder of One 63 . 3 - 19 19 Apr 12 Heart of Darkness 64 . 3 - 20 26 Apr 12 Do Not Go Gentle 65 . 3 - 21 03 May 12 Before Sunset 66 . 3 - 22 10 May 12 The Departed Season 4 67 . 4 - 1 11 Oct 12 Growing Pains 68 . 4 - 2 18 Oct 12 Memorial 69 . 4 - 3 25 Oct 12 The Rager 70 . 4 - 4 01 Nov 12 The Five 71 . 4 - 5 08 Nov 12 The Killer 72 . 4 - 6 15 Nov 12 We All Go a Little Mad Sometimes 73 . 4 - 7 29 Nov 12 My Brother ' s Keeper 74 . 4 - 8 06 Dec 12 We ' ll Always Have Bourbon Street 75 . 4 - 9 13 Dec 12 O Come , All Ye Faithful 76 . 4 - 10 17 Jan 13 After School Special 77 . 4 - 11 24 Jan 13 Catch Me if You Can 78 . 4 - 12 31 Jan 13 A View to a Kill 79 . 4 - 13 07 Feb 13 Into the Wild 80 . 4 - 14 14 Feb 13 Down the Rabbit Hole 81 . 4 - 15 21 Feb 13 Stand by Me 82 . 4 - 16 14 Mar 13 Bring It On 83 . 4 - 17 21 Mar 13 Because the Night 84 . 4 - 18 28 Mar 13 American Gothic 85 . 4 - 19 18 Apr 13 Pictures of You 86 . 4 - 20 25 Apr 13 The Originals 87 . 4 - 21 02 May 13 She ' s Come Undone 88 . 4 - 22 09 May 13 The Walking Dead 89 . 4 - 23 16 May 13 Graduation Season 5 90 . 5 - 1 03 Oct 13 I Know What You Did Last Summer 91 . 5 - 2 10 Oct 13 True Lies 92 . 5 - 3 17 Oct 13 Original Sin 93 . 5 - 4 24 Oct 13 For Whom the Bell Tolls 94 . 5 - 5 31 Oct 13 Monster ' s Ball 95 . 5 - 6 07 Nov 13 Handle with Care 96 . 5 - 7 14 Nov 13 Death and the Maiden 97 . 5 - 8 21 Nov 13 Dead Man on Campus 98 . 5 - 9 05 Dec 13 The Cell 99 . 5 - 10 12 Dec 13 Fifty Shades of Grayson 100 . 5 - 11 23 Jan 14 500 Years of Solitude 101 . 5 - 12 30 Jan 14 The Devil Inside 102 . 5 - 13 06 Feb 14 Total Eclipse of the Heart 103 . 5 - 14 27 Feb 14 No Exit 104 . 5 - 15 06 Mar 14 Gone Girl 105 . 5 - 16 20 Mar 14 While You Were Sleeping 106 . 5 - 17 27 Mar 14 Rescue Me 107 . 5 - 18 17 Apr 14 Resident Evil 108 . 5 - 19 24 Apr 14 Man on Fire 109 . 5 - 20 01 May 14 What Lies Beneath 110 . 5 - 21 08 May 14 Promised Land 111 . 5 - 22 15 May 14 Home Season 6 112 . 6 - 1 02 Oct 14 I ' ll Remember 113 . 6 - 2 09 Oct 14 Yellow Ledbetter 114 . 6 - 3 16 Oct 14 Welcome to Paradise 115 . 6 - 4 23 Oct 14 Black Hole Sun 116 . 6 - 5 30 Oct 14 The World Has Turned and Left Me Here 117 . 6 - 6 06 Nov 14 The More You Ignore Me , the Closer I Get 118 . 6 - 7 13 Nov 14 Do You Remember the First Time ? 119 . 6 - 8 20 Nov 14 Fade Into You 120 . 6 - 9 04 Dec 14 I Alone 121 . 6 - 10 11 Dec 14 Christmas Through Your Eyes 122 . 6 - 11 22 Jan 15 Woke Up With a Monster 123 . 6 - 12 29 Jan 15 Prayer for the Dying 124 . 6 - 13 05 Feb 15 The Day I Tried to Live 125 . 6 - 14 12 Feb 15 Stay 126 . 6 - 15 19 Feb 15 Let Her Go 127 . 6 - 16 12 Mar 15 The Downward Spiral 128 . 6 - 17 19 Mar 15 A Bird in a Gilded Cage 129 . 6 - 18 16 Apr 15 I Could Never Love Like That 130 . 6 - 19 23 Apr 15 Because 131 . 6 - 20 30 Apr 15 I ' d Leave My Happy Home for You 132 . 6 - 21 07 May 15 I ' ll Wed You in the Golden Summertime 133 . 6 - 22 14 May 15 I ' m Thinking of You All the While Season 7 134 . 7 - 1 08 Oct 15 Day One of Twenty - Two Thousand , Give or Take 135 . 7 - 2 15 Oct 15 Never Let Me Go 136 . 7 - 3 22 Oct 15 Age of Innocence 137 . 7 - 4 29 Oct 15 I Carry Your Heart With Me 138 . 7 - 5 05 Nov 15 Live Through This 139 . 7 - 6 12 Nov 15 Best Served Cold 140 . 7 - 7 19 Nov 15 Mommie Dearest 141 . 7 - 8 03 Dec 15 Hold Me , Thrill Me , Kiss Me , Kill Me 142 . 7 - 9 10 Dec 15 Cold as Ice 143 . 7 - 10 29 Jan 16 Hell is Other People 144 . 7 - 11 05 Feb 16 Things We Lost in the Fire 145 . 7 - 12 12 Feb 16 Postcards from the Edge 146 . 7 - 13 19 Feb 16 This Woman ' s Work 147 . 7 - 14 26 Feb 16 Moonlight on the Bayou 148 . 7 - 15 04 Mar 16 I Would for You 149 . 7 - 16 01 Apr 16 Days of Future Past 150 . 7 - 17 08 Apr 16 I Went to the Woods 151 . 7 - 18 15 Apr 16 One Way or Another 152 . 7 - 19 22 Apr 16 Somebody that I Used to Know 153 . 7 - 20 29 Apr 16 Kill ' Em All 154 . 7 - 21 06 May 16 Requiem for a Dream 155 . 7 - 22 13 May 16 Gods and Monsters Season 8 156 . 8 - 1 21 Oct 16 Hello Brother 157 . 8 - 2 28 Oct 16 Today Will Be Different 158 . 8 - 3 04 Nov 16 You Decided That I Was Worth Saving 159 . 8 - 4 11 Nov 16 An Eternity of Misery 160 . 8 - 5 18 Nov 16 Coming Home Was a Mistake 161 . 8 - 6 02 Dec 16 Detoured on Some Random Backwoods Path to Hell 162 . 8 - 7 09 Dec 16 The Next Time I Hurt Somebody , It Could Be You 163 . 8 - 8 13 Jan 17 We Have History Together 164 . 8 - 9 20 Jan 17 The Simple Intimacy of the Near Touch 165 . 8 - 10 27 Jan 17 Nostalgia ' s a Bitch 166 . 8 - 11 03 Feb 17 You Made a Choice to Be Good 167 . 8 - 12 10 Feb 17 What Are You ? 168 . 8 - 13 17 Feb 17 The Lies Will Catch Up With You 169 . 8 - 14 24 Feb 17 It ' s Been a Hell of a Ride 170 . 8 - 15 03 Mar 17 We ' re Planning a June Wedding 171 . 8 - 16 10 Mar 17 I Was Feeling Epic Specials S08 . 8 - 0 10 Mar 17 Forever Yours Back to TOP Printable Show Summary list as .csv The Futon Critic IMDb Share Club Wiki - pedia FAQ SEARCH epguides & TV . com Menus & Grids NOTES The home sites for this guide are http : / / epguides . com / for show info and http : / / www . tvmaze . com / for episode details . Contact Us : To correct episode titles click through the episode and submit corrections via the specific list provider . For other concerns and corrections , click here Disclaimer : We have no connection with the show or the network . We are just providing information , which we hope fans will find useful . We can not vouch for the user experience provided by external sites . This guide may be distributed and copied freely , in its entirety , for personal use . All original author and copyright information must remain intact . Any sales or other uses of this document are expressly forbidden , without the specific consent of the author ( s ) .
[ "The Vampire Diaries", "Stefan Salvatore", "Damon Salvatore" ]
http://epicduelwiki.com/w/Bacon
Bacon navigation Bacon It makes everything better Location Dropped by Bio Hazard Caden City Guard Heavy Guard Rabblefroth Talia Titan Item Usage Used in the mission Begging for Strips Cake and Bacon Frying Flesh Grub Hub If It Bacons Credit Sellback 8 Category Items
[ "Bacon", "Bio Hazard", "Caden" ]
http://epicproppants.com/
We are headquartered in Houston Texas a large oil and gas hub home to many global oil giants Our company owns a wellknown and experienced manufacturer of proppants in China Our team has developed longterm strategic relationships with oil and gas service providers in the US We provide ISP LSP HSP and resincoated proppants We have experience delivering directly to any wellhead in the US Our manufacturer is currently expanding its product line to provide the industry what it needs We strive to ethically provide a superior product and customer service Upcoming Events SPE ATCE Annual Technical Conference and Exhibition Time 2830 September 2015 Booth 3917 Location George RBrown Convention Center Houston TX Website httpwwwspeorgatce2015 Our Products Industry Testimonials Ceramic proppant represent a more costeffective alternative that is attracting a lot of interest by energy companies that are interested in maximizing profitability of their wells Smart fracking operators and service companies are finding that ceramic proppants work better They are much better at keeping the fractures open and the additional cost is more than offset by increased revenues from more productive wells Frac Sand Frisbee As more and more drilling rigs are moved into North Dakota demand for ceramic proppants has grown faster than the sector at large Total North American proppants demand has nearly quadrupled to 70 billion pounds 318 million metric tons since 2009 The share of ceramics has risen from 10 to 15 percent in that period as more companies use more sophisticated multiplestage tracking process Howard Weil Energy Investment Boutique Firm Phasellus euismod fermentum imperdiet Nunc nec dolor neque quis dapibus enim Nunc tempus ligula nec dolor tincidunt at viverra lacus cursus In sollicitudin sem sed metus ullamcorper pellentesque Nullam mauris quam aliquet ut fermentum a tristique dictum sapien Jon Doe
[ "Products", "Industry" ]
http://epicroadtrips.us/2003/summer/nola/nola_offsite/FQ_en.wikipedia.org/en.wikipedia.org/wiki/Mustard_gas.html
Mustard gas From Wikipedia , the free encyclopedia . Chemical Structure of Mustard Gas Compound Mustard gas ( HD ) is a chemical compound that was first used as a chemical weapon in World War I . In pure form , it is a colorless , odorless , viscous liquid at room temperature and causes blistering of the skin . The name comes from impure mustard gas , which is usually yellow - brown in color and has an odor resembling mustard garlic or horseradish . It is otherwise not related to mustard in any way . It was first synthesised by Frederick Guthrie in 1860 , though it is possible that it was developed as early as 1822 by M . Depretz . V . Meyer would publish a paper in 1886 describing a synthesis which produced good yields . The abbreviation LOST comes from LOmmel and STeinkopf who developed a process for mass - producing the gas for war use at the German company Bayer AG Other names for mustard gas include HD senfgas sulfur mustard blister gas S - LOST , and Kampfstoff LOST or Yperite Yperiet . " mustine " as shown in older medical dictionaries a substance used in chemotherapy to treat / cure cancer . The use of mustard gas in chemotherapy has ceased in most countries in recent years . Mustard gas is now listed in schedule 1 of the Chemical Weapons Convention : its production is prohibited . Contents hide 1 Chemistry 2 Physiological effects 3 History 3.1 Disposal of Mustard Gas 4 External links edit Chemistry This article forms part of the series Chemical warfare ( A subset of Weapons of mass destruction Lethal agents Blood agents Cyanogen chloride Hydrogen cyanide Blister agents Lewisite Sulfur mustard gas ( HD and THD , HT ) Nerve agents G - Agents GA ( tabun ) , GB ( sarin GD ( soman ) , GF ( cyclosarin V - Agents VE VG VM VX Pulmonary agents Chlorine Chloropicrin ( PS ) Phosgene ( DP ) Diphosgene ( CG ) Non - lethal agents Incapacitating agents BZ / Agent 15 KOLOKOL - 1 Riot control agents Pepper spray ( OC ) CS gas CN gas CR gas Chemically , it is a thioether with the formula C 4 H 8 Cl 2 S . Its structure can be described as 1 , 1 - thio - bis - [ 2 - chloroethane ] , ( ClCH CH S , 2 , 2 โ€ฒ - dichlorodiethyl sulfide or bis - ( 2 - chloroethyl ) - sulfide . Mustard gas can be synthesized by reacting sulfur dichloride ( SCl ) with two moles of ethylene ( C H ) . Although the compound is commonly known as " mustard gas " , it is a viscous liquid at normal temperatures . The pure compound has a melting point of 14 ยฐ C ( 57 ยฐ F ) and decomposes before boiling at 218 ยฐ C ( 423 ยฐ F ) . The compound readily eliminates chloride ion by intramolecular nucleophilic substitution to form a cyclic sulfonium ion . This very reactive intermediate is particularly detrimental to cellular health as it has a strong tendency to bond to the guanine nitrogen in DNA strands . This leads to either immediate cellular death or , as recent research has found , cancer . Mustard gas is not very soluble in water but is very soluble in fat , contributing to its rapid absorption into the skin . In the wider sense , compounds with the structural element BCH CH X , where X is any leaving group and B is a Lewis base are known as mustards . Such compounds can form cyclic onium ions that readily react with nucleophiles . Examples are - ( 2 - chloroethyl ) ether or the ( 2 - haloethyl ) amines . edit Physiological effects Mustard gas is a strong vesicant ( a compound that causes blisters ) . Those exposed usually suffer no immediate symptoms . The exposure develops ( in 4 to 24 hours ) into deep , itching or burning blisters wherever the mustard contacted the skin ; the eyes ( if exposed ) become sore and the eyelids swollen , possibly leading to conjunctivitis and blindness . At very high concentrations , if inhaled , it causes bleeding and blistering within the respiratory system , damaging the mucous membrane and leading to pulmonary edema . Blister agent exposure over more than 50 % body surface area is usually fatal . Skin damage can be reduced if povidone iodine in a base of glycofurol is rapidly applied , but since mustard initially has no symptoms , the exposure is usually not identified until the blisters rise . The vesicant property can be neutralised by oxidation or chlorination , common bleach ( NaOCl - ) can be used or decontamination solution " DS2 " ( 2 % NaOH , 70 % diethylenetriamine , 28 % ethylene glycol monomethyl ether ) . Mustard gas is also carcinogenic ( cancer causing ) and mutagenic ( causing damage to DNA of exposed cells ) . History After a failed attempt on the Eastern front , it was first used effectively in World War I by the German army against Canadian soldiers in 1917 and later also against the French โ€“ the name Yperite comes from its usage by the German army near the city of Ypres . It took the British over a year to develop their own mustard gas weapon , first using it in September 1918 during the breaking of the Hindenburg Line Mustard gas was dispersed as an aerosol in a mixture with other chemicals , giving it a yellow - brown colour and a distinctive odour . Mustard gas was lethal in only about 1 % of cases . Its effectiveness was as an incapacitating agent : a wounded soldier slows an advancing army much more than a dead one . The countermeasures against the gas were quite ineffective , since a soldier wearing a gas mask was not protected against absorbing it through the skin . Furthermore , mustard gas was a persistent agent which would remain in the environment for days and continue to cause sickness . If mustard gas contaminated a soldier ' s clothing and equipment , then other soldiers he came into contact with would also be poisoned . Towards the end of the war it was even used in high concentrations as an area - denial weapon , which often forced soldiers to abandon heavily contaminated positions . Since then , mustard gas has also been reportedly used by : United Kingdom against Bolsheviks 1919 United Kingdom against Iraqi rebels in 1920 Spain Morocco 1923 1926 Soviet Union in a province of China 1930 Italy Ethiopia 1935 1940 Japan China 1937 1945 Egypt North Yemen 1963 1967 Iraq Iran 1983 1988 ; and Iraq Kurds 1988 Also , in 1943 a US stockpile was bombed in Bari Italy , accidentally exposing thousands of civilians and 628 friendly troops . It was noted by medical workers that the white cell counts of exposed soldiers were decreased , and mustard gas was investigated as a therapy for Hodgkin ' s lymphoma , a form of cancer . Study of the use of similar chemicals as agents for the treatment of cancers led to the discovery of mustine , and the birth of anticancer chemotherapy . Disposal of Mustard Gas Most of the mustard gas found in Germany after World War II was dumped into the Baltic Sea . When mustard gas is exposed to seawater , it forms a tar - like gel and maintains its lethality for at least five years . It is possible to mistake a piece of polymerised mustard gas for amber , which can lead to severe health problems . Shells containing mustard gas and other toxic ammunition from World War I ( as well as conventional explosives ) can still occasionally be found in France ; they used to be disposed of by explosion at sea , but current environmental regulations prohibit this and so the French government is building an automated factory to dispose of the backlog of shells . In 1972 , The United States Congress banned the practice of disposing chemical weapons into the ocean . However by this point , 64 million pounds of nerve and mustard agents had already been dumped into the ocean waters off of the United States by the U.S. Army . According to a 1998 report created by William Brankowitz , a deputy project manager in the U.S. Army Chemical Materials Agency , the Army created at least 26 chemical weapons dumpsites in the ocean off of at least 11 states on both the west and east coasts . Additionally due to The largest stockpile of mustard gas in the United States was stored at the Edgewood Arsenal , Aberdeen Proving Ground in Maryland . Mustard gas was stored in several one - ton ( 900 kg ) containers on the base under heavy guard . A disposal plant built on site neutralized the last of this stockpile in February , 2005 . This stockpile had priority due to its proximity to several populated areas and schools in the area . The closest schools were fitted with overpressurization units to protect the students and staff in the event of a catastrophic explosion External links Textbook of Military Medicine - Intensive overview of mustard gas . Includes many references to scientific literature Bristol University - Basic Chemical Overview This reference has several errors in it : The Fredrick Guthrie synthesis should be from ethylene and SCl , not ethylene and Cl as stated . The hydrolysis reaction pathway produces two molecules of HCl and the last one produced is H O , not three molecules of HCl as shown in the reference . The molecular structure given for nitrogen mustard ( N - mustard ) is not correct . The nitrogen atom should have a hydrogen bonded to it . mustard gas , Organic Chemistry This reference also has an error in it . In the sentence on synthesis of mustard gas , the phrase " sulfur monochloride , S Cl " should be " sulfur dichloride , SCl Questions and Answers for Mustard Gas Organization for the Prohibition of Chemical Weapons - Mustard Agents [ 1 ] Categories Thioethers | Organochlorides | Chemical weapons
[ "Mustard gas", "chemical compound", "chemical weapon" ]
http://epiczitpop.com/pimple-pop/biggest-pimple-in-the-world-2/
Biggest Pimple In The World Uploaded by John Meneses on March 24 , 2014 at 1 : 39 pm Your browser does not currently recognize any of the video formats available . Click here to visit our frequently asked questions about HTML5 video . Biggest Pimple In The World Well it might not be but its got to be up there right ? Check out more here Incoming search terms : the biggest pimple in the world Show me the biggest nastiest pimple The biggest white head getting popped video Rating : Views : 14,595,476 views Tags : biggest Pimple World Categories : Pimple Pop
[ "Biggest Pimple" ]
http://epitemnein-epitomic.blogspot.com/2009/05/giving-up-what-we-cant-keep-to-gain.html
Friday , May 8 , 2009 Giving Up What We Ca n โ€™ t Keep , To Gain What We Ca n โ€™ t Lose Martyr Jim Elliot ( 1927 - 1956 ) , missionary to the Auca people in Ecuador , often expressed this classic piece of wisdom : โ€œ He is no fool who gives what he can not keep to gain what he can not lose . โ€ I recall a wise older pastor [ 1 ] giving it to me five years ago and I always wondered the source . Now I have found it ! The entire quote he gave me went like this . . . โ€œ God โ€™ s Word will keep you from sin or sin will keep you from God โ€™ s Word . He is no fool who gives up what he can not keep to gain what he can not lose . โ€ There are a myriad of things that we can never possess in life ; one of these , and the most significant one , is having ultimate control over our life . Yet , we seem to struggle for years , and for many , through the whole lifespan - - not acknowledging this fact - - enduring torment . In a way it โ€™ s senseless , and altogether meaningless - - certainly when looking back from the end - of - life view . Jesus said , โ€œ For whoever wants to save his life will lose it , but whoever loses his life for me and for the gospel will save it โ€ โ€“ Mark 8.35 ( TNIV ) . We are apt at skipping over the fundamentals thinking we โ€™ ve got them covered . The interesting thing about this verse above is that it โ€™ s every bit as hard and all - encompassing to achieve as it is to achieve anything Jesus preached during the Sermon on the Mount . In fact , it sort of sums it all up - - as a foundational unit in the base program of the Christ - follower โ€™ s life . Think about total daily surrender of our desires and selfishness . Think about reality . There โ€™ s a divide , a great abyss between the two , it does n โ€™ t matter who we are . So , how do we get there , or is living like Jesus Christ only something of an ideal ? I do n โ€™ t think Jesus meant for us to think only idealistically . In fact , that โ€™ s the Devil โ€™ s program , right there ! - - one of them at least . Assuming we โ€™ re already Christ - believer โ€™ s , and conceding Jesus โ€™ statement is conditional , chasing the โ€˜ lost โ€™ life in order to truly save our life ( hence finding it ) requires us to consistently give up on our own personal desires , plans and dreams and to start loving others as we do ourselves . It โ€™ s the perfect search [ 2 ] of selflessness and wisdom . And this ca n โ€™ t ever be done overnight . It โ€™ s a process of practising the practice over the years and decades , commencing with the seconds and minutes . It โ€™ s about training . It โ€™ s about listening to , and cooperating with , the Holy Spirit who dwells in us . It โ€™ s about becoming a professional Christlike human being . And if this is our sole focus , all other things we need will be given to us . [ 3 ] Enter the concept of good faith , and right living before God and with humankind . When we give up what we can not keep ( our life and control over it ) for a life in God , we get to keep a slice of eternity ( here ) as a sort of โ€˜ down payment โ€™ on life kept in eternity ( to come ) with God - - something we can not lose , provided we remain in him . [ 4 ] I think this is what Jim Elliot meant in his quote at first . Copyright ยฉ 2009 , S . J . Wickham . All Rights Reserved Worldwide . s ENDNOTES : [ 1 ] I acknowledge Pastor John Edwards . [ 2 ] Note the difference here between perfection and a โ€˜ search . โ€™ Searching like this is a devoted investigation , toward spiritual progress , not spiritual perfection . [ 3 ] Matthew 6 : 33 ( TNIV ) says , โ€œ But seek first his kingdom and his righteousness , and all these things will be given to you as well . โ€ What are โ€˜ all these things ? โ€™ To name a few , these are what we โ€™ ll eat and drink , and what we โ€™ ll wear . We can extend this out ( safely ) to any material possession . What we truly need , God will provide . [ 4 ] See John 15 : 1 - 17 . Jesus โ€™ command for those โ€˜ remaining โ€™ in him . . . โ€œ Love each other . โ€ Posted by Steve Wickham at 6 : 24 AM Email This BlogThis ! Share to Twitter Share to Facebook Share to Pinterest No comments : Post a Comment Newer Post Older Post Home Subscribe to : Post Comments ( Atom )
[ "Martyr Jim Elliot", "Ecuador" ]
http://epochmod.com/
Home Forum Wiki Downloads Story Characters Looting Vehicles Weapons Bases Antagonists Credits Recent News : Arma 3 : Epoch Mod 1.3.1 build ( 1471 ) released 2019 - 03 - 28 - Arma 2 : DayZ Epoch Mod 1 . 0 . 6 . 2 released 2017 - 12 - 27 Open world survival mod set just two years after the mass extinction of billions of people . Those that remain are left with remnants of a once technological society . Try to survive , build , or explore your way through the harsh dynamic environment . Features Powerful persistence framework for Arma 3 with native Windows and Linux dedicated server support . Fully configurable script based security checks . Base Building re - envisioned for Arma 3 PhysX . Persistent secure and insecure storage devices . Upgradeable locking doors . Barter based economy and trading systems backed a single currency ยค called " Krypto " . Hostile Environment with several different types of antagonists , Air and Water temperature extremes , and Earthquakes . Hunting , Fishing , Tame Dogs , Explore & Loot : Wrecked ships , Abandoned vehicles and buildings , Perform task based missions and more ! Open source APL - SA Epoch Survival MP gamemode . Open source APL - SA Modders resource configs and Class List . Assets can be used as a mod dependency on Steam workshop Current Server Build : 1.3.1 build ( 1471 ) for Arma 3 v1 . 88 + Download ZIP Download tar . gz Created : 2019 - 03 - 28 12 : 34 : 06 Published : 2019 - 03 - 28 12 : 39 : 16 # # [ 1 . 3 . 1 . 0 ] - 2019 - 03 - 28 # # # Added - Upgradeable PlotPoles ( S / M / L / XL / XXL ) with different Range / Limits - https : / / plays . tv / video / 5c9925a6770ac037e4 - On entering temp Vehicles , Payers will get a hint " Vehicle will despawn after restart " - 2nd Variant of a lockable Safe " GunSafe_EPOCH " - https : / / plays . tv / video / 5c9926466b9589c5c6 - License Plates of Vehicles can now be View on GitHub Credits / Changelogs Credits Changelog
[ "technological society", "harsh dynamic environment", "Powerful persistence framework" ]
http://eppenga.com/gsm-gps-tracking.html
Home GG - Tracker GPS and GSM Tracking GG - Tracker tracks the location of your mobile device . It displays your position on the internet using Google Maps / Earth and uses live updates via AJAX technology . GG - Tracker can run standalone or integrated on an existing webpage . The application is built using the template framework Bootstrap which makes it fully responsive ( fits on any screen ) . Also the supporting views for Google Maps , Streetview and Earth are 100 % responsive . GG - Tracker can potentially hook up to many different apps ( iOS and Android ) as long as GG - Tracker Basic Map GG - Tracker Location Heatmap Other people ' s implementations It ' s nice to see that my software is actually used . Below will be a list of all the people who have reported their usage to me , there might be many more out there . GG - Tracker is licensed under the GNU license , also known as open - source software . Are you running GG - Tracker as well ? Please be so kind to drop me a line
[ "GG-Tracker", "AJAX technology", "template framework Bootstrap" ]
http://epsalesinc.com/electric-boilers-vs-gas-boilers/
Electric Boilers vs Gas Boilers February 12 2018 By David Ponschok In the fight of electric boilers vs gas boilers theres a definite winner in most cases You may be surprised to know that electric boilers are ideal for certain applications regardless of operational costs Its widely known throughout the US that gas boilers cost less to operate than electric boilers However there are applications where operation costs alone should not be the only factor in the boiler selection process First gas and electric rates vary greatly depending on where you live In some areas each can be up to five times more expensive so it pays to know the energy costs in the area where you live So you want to heat your home or office and are wondering which option is best when comparing electric boilers vs gas boilers To get to the answer its important to ask yourself a couple of questions Are you installing an entire heating system If this is you gas may be the smartest choice Adding a room or want warm floors in bathrooms or other often occupied spaces If so electric is usually the best choice But these two questions arent the only things to consider before you make your decision Lets take a look at which heat source comes out on top in many applications so youll know whether electric or gas models make the most sense When to Install an Electric Boiler Spot Heating Electric boilers shine when warm floors are desired in specific areas of an existing home For homes that already have a heating system adding another room or perhaps a fourseason porch will require heat in order to use the space yearround in cold climates If the floor isnt carpeted floors can be cold and extremely uncomfortable in the heating season Electric boilers can heat floors and rooms effectively without the drafts associated with forced air furnaces and heat pumps Limited space is a common issue when installing an addon boiler heating system in an existing home Thermolec electric boilers lightweight compact design offers the perfect solution Unlike gas boilers which require venting and additional gas piping combustion devices require outside air for combustion and also need to exhaust dangerous byproducts carbon monoxide outside the home On the other hand electric boilers do not need to be vented no combustion saving space and significantly lowering the install cost of the heating system Thermolec electric boilers come with modulating heat generation and are capable of producing low and precise Btu levels They produce only what is needed to heat a space to the desired temperature Small heating zones or areas like bathrooms foyers home offices and kitchens are challenging for gas boilers Thats because their minimum Btu outputs are excessive for such areas They waste energy by overheating rather than producing the awesome comfort typically associated with a radiant floor heating system For room additions where homeowners want radiant floor heat installing an addon gas boiler in an existing home can be a monumental task for HVAC technicians Ultimately that means added installation costs for buyers Assessing the Operating Costs Electric vs Gas An electric boiler tends to be less expensive than gas boilers of comparable size and model Although the upfront cost of the unit will be more affordable when the unit is electric you also must take into account the cost to run it Its impossible to give hard numbers on the energy and fuel costs as gas and propane rates vary across the country Obviously electricity rates do as well so its hard to say which unit is the more expensive form of heating In general electricity in most areas of the US costs more to run than gas does However energy cost is not the only consideration Here are some other points to ponder Aside from lower install cost electric boilers dont require annual maintenance which is highly recommended by all manufacturers of highefficiency gas boilers Gas boilers are more complicated by design and are much more likely to have performance issues Two common issues in initial boiler setup are getting the proper mixture of air and gas often due to improper venting Heat exchangers in gas boilers are susceptible to water conditions and combustion byproducts which can shorten the life of a boiler or cause it to break down unless annual maintenance is performed Now no one is claiming that nothing ever goes wrong with electric boilers but they dont require a strict maintenance schedule and most issuesproblems can be identified with a voltage meter Bottom line maintenance costs for gas boilers shouldnt be minimized because theyre significant and therefore must be taken into consideration in the overall operational costs of the product Why Thermolec Electric Boilers are the Right Choice Just because electric boilers in general are smaller lighter and less expensive than gas boilers doesnt mean that every electric boiler brand can make the same claim In fact electric boiler brands can differ significantly in size weight function and the amount of space they require Thermolec electric boiler s take up less space and are significantly lighter than other brands of electric boilers The main differences involve the components used and the functionality of their boilers For instance Thermolec uses stainless steel ASME certified tanks which are more durable and lighter than carbon steel or castiron tanks Thermolec also incorporates the most advanced technology in their boilers which provides full modulation heating in all their boiler models To save on installation costs the smaller size and lighter weight of the Thermolec boilers means that only one technician needs to be sent to a job site to install the boiler This isnt the case with most other electric boilers that often require two technicians just to get the unit through the door and into the home Would you like to learn more about the difference between electric boilers brands and electric vs gas boilers so you can identify which one is right for you You may find it helpful to connect with a professional who specializes in boilers or visit the following website to learn more about Thermolec boilers for the US market at wwwepsalesinccom Additional information would enable you to have a better understanding of the options available so you can identify the right boiler for your application
[ "David Ponschok" ]
http://eq2.wikia.com/wiki/Dazzle_and_Delight
in Quests Plane of Magic Quests Plane of Magic Solo Quests Dazzle and Delight other resources ZAM EQ2U Census xml EverQuest 2 Quest Information Journal Category Plane of Magic AA Journal Level 106 Tier 11 Journal Difficulty Solo Starting Zone Plane of Magic How to Start Speak to Mindfold Matriarch Taneesha at 300 581 663 part of Planes of Prophecy Timeline Preceded by Clean Sweep the Grounds Followed by none What does this information mean Notes requires 32500 House Vahla Faction Steps Kill 14 flickering ignus in the Amphitheater of Song near 207 154 933 flickering ignus Note they are the blue wisps Travel to 178 11 1136 and deposit the cores around the island and the yellow sparkles yellow sparkles Deposit the first pair at 119 28 1194 Deposit the second pair at 118 18 1155 Deposit the third pair at 133 10 1126 Deposit the fourth pair at 180 9 1112 Deposit the fifth pair at 221 12 1123 Deposit the sixth pair at 226 18 1163 Deposit the seventh pair at 182 22 1195 Note NOT groupwide updates individual clicking required Return to Mindfold Matriarch Taneesha at 300 581 663 Rewards At least 90g 72s Completing this quest gives 850 faction with House Vahla Completing this quest gives 850 faction with House Yrzu Completing this quest gives 850 faction with Pride Pakiat Categories Quests Plane of Magic Quests Plane of Magic Solo Quests Plane of Magic AA Quests Planes of Prophecy Quests AA Quests Tier 11 Quests Tier 11 Solo Quests Solo Quests House Vahla Faction House Vahla Good Faction Faction Quests House Yrzu Faction House Yrzu Bad Faction Pride Pakiat Faction Pride Pakiat Bad Faction Recent Wiki Activity Debilitated Headstone Shards A FANDOM user 1 hour ago The Scriveners Tale The Notion of a Potion A FANDOM user 7 hours ago The Scriveners Tale In Preparation for Anything A FANDOM user 7 hours ago The Scriveners Tale Escargot Overclocking A FANDOM user 8 hours ago Help us grow EverQuest 2 Wiki Get Started
[ "Dazzle", "Delight" ]
http://eq2.wikia.com/wiki/Underdepths_Saga:_Gears_of_the_City
in Quests Maldura Quests Maldura Heroic Quests Underdepths Saga Gears of the City other resources ZAM EQ2U Census xml EverQuest 2 Quest Information Journal Category Signature AA Journal Level 100 Tier 11 Journal Difficulty Heroic Starting Zone Maldura How to Start Speak to Eccles Zaphardt near the Entrance to Maldura 200 4 28 part of Terrors of Thalumbra Timeline Preceded by Underdepths Saga Zaphardts Defenders Followed by Underdepths Saga Eyes of the Ironshadow What does this information mean The Grand Artificer of Maldura Tobon Blingden one half of Malduras ruling seat has requested my presence at his workstation in the Alcove of Reason Hopefully I can get a few answers from him about the Dark Gears now that I have evidence that Black Bolt was connected with the immolated Steps Click the Alcove of Reason Crystallized Proximity Translocator 53 15 204 to port out to speak to Tobon Blingden the Grand Artificer in the Infinite Caverns 52 5 249 Speak to Queen Alwenielle in the Palace of Unity 376 86 0 Find and slay the Primordial Malice members in the Stoneheart Yards in Thalumbra 621 106 342 This will be a group of linked foes a Primordial Malice shadowknight a Primordial Malice cursespinner and a Primordial Malice cultist Good aligned speak to Zeen Corblecog at 462 96 43 Evil aligned speak with Virun DXyafin at 470 95 66 Rewards At least 1p 35g 35200 status Completing this quest gives 1000 faction with Shields of Maldura Completing this quest gives 1000 faction with Citizens of Maldura Categories Quests Maldura Quests Maldura Heroic Quests Maldura AA Quests Signature Quests Terrors of Thalumbra Quests AA Quests Tier 11 Quests Tier 11 Heroic Quests Heroic Quests Shields of Maldura Faction Shields of Maldura Good Faction Faction Quests Citizens of Maldura Faction Citizens of Maldura Good Faction
[ "Underdepths Saga" ]
http://equalitync.org/what/resources/out_officials/
North Carolina ' s Openly LGBT Officials Equality NC knows it ' s important the the LGBT community be represented in elected and appointed offices at all levels of government to give us a voice and presence in the process . These North Carolinians are openly serving their communities in all corners of the state . Updated : November 2016 Current Openly LGBT Officials Cecil Brockman NC House of Representatives - District 60 ( elected * 2015 - Present ) Jasmine Beach - Ferrara Buncombe County Commissioner ( elected 2016 - Present ) Jillian Johnson Durham City Council ( elected 2015 - Present ) Robert Kellogg Gastonia City Council ( elected 2015 - Present ) Jennifer Knox District Court Judge , District 10 ( elected 2004 - Present ) Lydia Lavelle Carrboro Mayor ( elected 2013 - Present ) Carrboro Board of Aldermen ( elected 2007 - 2013 ) LaWana Mayfield Charlotte City Council ( elected 2011 - Present ) Damon Seils Carrboro Alderman ( elected 2013 - Present ) Chris Sgro NC House of Representatives - District 58 ( appointed 2016 - Present ) Past Openly LGBT Officials Doug Arbogast Tryon Town Commission ( elected 2009 - 2013 ) John Arrowood Court of Appeals Judge ( appointed 8 / 2007 - 12 / 2008 ) Special Superior Court Judge ( appointed 3 / 2007 - 8 / 2007 ) Julia Boseman NC Senate - District 9 ( elected 2005 - 2011 ) New Hanover County Commission ( elected 2000 - 2004 ) Marcus Brandon NC House of Representatives - District 60 ( elected 2010 - 2015 ) Nancy R . Caviness Duck City Council ( elected 2003 - 2009 ) Gloria Faley Chapel Hill - Carrboro School Board ( elected 1999 - 2003 ) Ernest Fleming Warren County Commission ( elected 2006 - 2010 ) Scott Herman Cabarrus Soil & Water Conservation Board ( elected 2000 - 2008 ) Joe Herzenberg Chapel Hill City Council ( appointed 1980 - 1981 , elected 1987 - 1993 ) First openly gay elected official in North Carolina Carolyn Hutchison Carrboro Police Chief ( appointed 1998 - Present ) Mark Kleinschmidt Chapel Hill Mayor ( elected 2009 - 2015 ) Chapel Hill City Council ( elected 2001 - 2009 ) Billy Maddalon Charlotte City Council ( appointed 2013 - 2014 ) Mike Nelson Orange County Commission ( elected 2006 - 2010 ) Carrboro Mayor ( elected 1995 - 2005 ) Carrboro Board of Aldermen ( elected 1993 - 1995 ) Janet Pepin Boone City Council ( elected 2005 - 2009 ) Elic Senter Franklinton Mayor ( elected 2007 - 2015 ) Lee Storrow Chapel Hill Town Council ( elected 2011 - 2015 ) Ray Warren Superior Court Judge ( elected * 1994 - 2002 ) * came out after election
[ "North Carolina 's", "LGBT Officials", "Cecil Brockman" ]