question
stringlengths 7
1.06k
| op2
stringlengths 2
358
| op1
stringlengths 2
370
| op4
stringlengths 2
399
| category
stringclasses 6
values | op3
stringlengths 2
355
| exam_id
int64 1
210
| cop
int64 0
4
| unique_id
stringlengths 36
36
| year
stringclasses 5
values |
|---|---|---|---|---|---|---|---|---|---|
The cell-mediated hypersensitivity reaction, according to the classification of Gell and Coombs, is of type: | III. | IV. | I. | Biology | II. | 63 | 1 | cdcfdbf5-f65c-4a3a-b6aa-165bc8597ed0 | 2020 |
The domain of the TCR complex with signal transmitting function is: | The CD3 proteins and the zeta chain. | The α chain and the β chain of the TCR. | B7 (CD80 and CD86). | Biology | The proteins Igα and Igβ. | 64 | 2 | fe314a5f-0589-48a1-8544-255dfd0a2b2b | 2020 |
The serum obtained after repeated systemic immunizations with a protein antigen will predominantly contain antibodies: | Low affinity IgG. | Monomeric IgA. | High-affinity IgM. | Biology | High affinity IgG. | 65 | 3 | add6271f-4873-4ed0-bbfe-8ff5542e6aeb | 2020 |
Which of the following organs are considered primary lymphoid organs?: | Bone marrow, thymus and spleen. | Bone marrow and spleen. | Thymus and spleen. | Biology | Bone marrow and thymus. | 66 | 3 | b2220b68-8d01-439f-a119-0267a146e92c | 2020 |
It can act as an antigen presenting cell: | T lymphocyte. | Macrophage. | Plasma cell. | Biology | Eosinophil. | 67 | 1 | 6a59d856-af27-4432-86b9-f1f9f2c6b5c5 | 2020 |
The most abundant immunoglobulin in the intestinal mucosa is: | IgG. | IgM. | IgA. | Biology | IgE. | 68 | 4 | e7585ce8-7682-4652-b748-556d2a8bd494 | 2020 |
The self-tolerance of T cells to self-antigens takes place in: | Thymus. | Spleen. | MALT. | Biology | Bone Marrow. | 69 | 2 | dfd65ad6-edd9-4650-b15f-4b8780cbb785 | 2020 |
The M cells are: | Specialized enterocytes in mucus secretion. | Macrophages. | Intraepithelial lymphocytes residing in the intestine. | Biology | Specialized enterocytes in the uptake of antigens. | 70 | 3 | 6b3fd8d4-b8d8-42f0-a287-724abed0fce1 | 2020 |
The natural killer cells (NK): | They present CD4 and CD8 markers on their surface. | They possess immunological memory. | They are involved in the recognition of antigenic determinants of tumor cells. | Biology | They phagocytize foreign particles. | 71 | 4 | fc93869b-e6cd-43af-8250-328031a848a0 | 2020 |
Which of the following cells is a phagocyte capable of destroying microorganisms?: | Mast cell. | Plasma cell. | Neutrophil. | Biology | T lymphocyte. | 72 | 4 | ee9d020c-87e4-4d7c-becb-31fb7a7290ab | 2020 |
The deficiency of the C1-inhibitor component is clinically associated with: | Hemolysis. | Angioedema. | Systemic Lupus Erythematosus. | Biology | Bacterial infections. | 73 | 1 | c10d4be2-c88a-4e77-b0b2-066be1de32c1 | 2020 |
it is not a mechanism of tumor evasion to the action of the immune system: | Surface expression of T lymphocyte inhibitory proteins. | Decrease in the expression of class I HLA molecules. | Production of immunosuppressive cytokines. | Biology | Expression of tumor antigens on the cell surface. | 74 | 3 | b06d4223-3fc1-43ff-a640-de83e9d8d29f | 2020 |
it is not considered a primary immunodeficiency, associated with a monogenic defect that affects T lymphocytes, the syndrome of: | Wiskott-Aldrich. | DiGeorge. | Job's or Hyper IgE Syndrome. | Biology | Good. | 75 | 3 | 157603c3-b885-454e-ba9e-69519fd9433c | 2020 |
What technique allows quantification of circulating cells secreting cytokines or antibodies? | Radioimmunoassay. | ELISA. | RNAseq. | Biology | ELISpot. | 76 | 3 | f8f19f7f-342a-4cf7-ade6-83ceb67ef782 | 2020 |
How much type 1 error or alpha error can be accepted at most in a research study? | 50%. | 95%. | Equal to or less than 5%. | Biology | Between 6% and 20%. | 79 | 4 | 2511944b-8692-4c3d-ba95-fe142d50e517 | 2020 |
Which non-parametric statistical test is used for independent samples with dependent and independent variables of categorical type? | Wilcoxon Test. | Chi-Squared. | Friedman Test. | Biology | ANOVA test. | 80 | 1 | 87258420-05fe-405b-826e-1795188791a8 | 2020 |
A trait is recessive if it manifests: | In heterozygosity. | Only in homozygosis. | Regardless of sex. | Biology | At least in one child and in one of their parents. | 81 | 1 | 4dbcfc9b-958f-4683-9437-644543ae607f | 2020 |
How many chromosomes are there in a woman's egg? | 23 autosomes and 1 sex chromosome. | 23 autosomes and 2 sex chromosomes. | 22 autosomes and 1 sex chromosome. | Biology | 22 chromosomes. | 82 | 4 | 262183f2-5e71-4b82-afa7-3a85d3aa5313 | 2020 |
Which of these chromosomal alterations is balanced?: | Translocation. | Deletion. | Duplication. | Biology | Isochromosome. | 83 | 2 | a8805e34-b030-4d78-9489-392110a0fa04 | 2020 |
The underlined nucleotide sequence GTACTACGTGTGTGTGTGTGTGTGTGTGTAAAAG is: | Promoter. | Microsatellite. | Short Interspersed Elements (SINE). | Biology | Tandem repeated gene. | 84 | 1 | 11adc778-a747-440b-a7da-5512fcf9cffe | 2020 |
Which human chromosomal region is located near the telomere of the short arm of chromosome 3? | 3p25. | tel3p. | 25p3. | Biology | 3q25. | 85 | 2 | 6cff733e-3503-452b-9487-03e51629c602 | 2020 |
The segregation of homologous chromosomes occurs in: | Mitotic anaphase. | Anaphase I. | Metaphase II. | Biology | Pachytene. | 86 | 1 | 26736241-c526-4728-a44f-1731d6b5e483 | 2020 |
Two homologous chromosomes from different cellular types and healthy individuals have: | The same alleles, for each locus. | The same band pattern, after a G-banding. | The same genes, but located in different chromosomal regions. | Biology | Different loci. | 87 | 1 | c2e19166-1edd-4314-94d3-3af8ae27eab6 | 2020 |
The DNA pol α complex has: | 3'-5' exonuclease activity. | High processivity. | 3'-5' DNA polymerase activity. | Biology | 5´- 3´ RNA polymerase activity. | 89 | 3 | 68906b9f-6ded-49e1-aacc-2953fef89001 | 2020 |
An enhancer is a consensus sequence in the: | End of the intron, recognized by the spliceosome. | Amino carboxyl end of a protein. | DNA to which a protein binds to activate transcription. | Biology | RNA to which the ribosome binds to begin translation. | 90 | 4 | 3f1e8d6c-6c23-4a4d-81d2-4add7090d926 | 2020 |
Which of the following unbalanced human karyotypes is viable? | 45, XX, -2. | 47, XX, +X. | 45, XY, -2. | Biology | 47, XX, +2. | 91 | 1 | 5b7dc4af-1b46-4310-8c07-0249c2097981 | 2020 |
What is the probability of a child of a couple, where both suffer from a heterozygous autosomal dominant disease, inheriting said disease? | 75%. | 100%. | 25%. | Biology | 50%. | 92 | 2 | 67900ec2-91e8-4bb0-9246-990a6c0758ee | 2020 |
The sequence that is located 30bp upstream of the transcription start sites in humans is: | ATAG. | ATGA. | CGCA. | Biology | TATA. | 94 | 3 | cb35875b-44e4-49f4-aa49-473e6f6d4988 | 2020 |
Inbreeding in human populations increases: | The frequency of recessive alleles. | The frequency of dominant alleles. | Mutation rates. | Biology | Homozygosity. | 95 | 3 | 8d5a3d89-7103-4041-b5f4-1e0ee0cbc8e5 | 2020 |
The equivalence of a centimorgan (cM) is the recombination frequency of: | 5%. | 1%. | 25%. | Biology | 10%. | 96 | 1 | 98b6a253-3057-4446-bc24-153f80a2e47c | 2020 |
Chromosomal banding is performed with: | Giemsa. | Crystal violet. | SYBR Green. | Biology | Propidium iodide. | 97 | 2 | 3438f60d-4f0b-409f-a997-19455bdb9773 | 2020 |
Which of these phenotypes corresponds to Klinefelter syndrome? | 45,X0. | 47,XXY. | 47, XXX. | Biology | 47, XYY. | 98 | 1 | 01b96ff8-bc1c-4993-9b5e-3a32e3417d51 | 2020 |
Genomic imprinting depends on: | Tissue in which it is expressed. | Parental origin. | Degree of homology between them. | Biology | Type of promoter it possesses. | 99 | 1 | 5cdf7c75-1e1c-4bea-8ea7-438b7ce5af94 | 2020 |
In interphase, to what type of chromatin would the telomere zone correspond to? | Facultative euchromatin. | Constitutive euchromatin. | Facultative heterochromatin. | Biology | Constitutive heterochromatin. | 100 | 3 | 161894c9-9ed3-4a52-be2c-82899d900b85 | 2020 |
Which histone does not form part of the central core of the nucleosome?: | H2A. | H1. | H4. | Biology | H3. | 101 | 1 | 04247806-7268-49c9-be71-5d1d6bda9069 | 2020 |
Bacteria differ from eukaryotic cells by: | The existence of DNA exclusively. | The presence of ribosomes. | A high consumption of glucose. | Biology | The absence of a nuclear envelope. | 104 | 3 | 8d4a5c22-ec5b-4c92-b002-8b212c74a64d | 2020 |
Which of the following bacterial species would not grow on a MacConkey agar?: | Shigella dysenteriae. | Klebsiella pneumoniae. | Enterobacter cloacae. | Biology | Enterococcus faecalis. | 105 | 3 | 7120ce01-3f51-4441-a59b-d6002e7614c5 | 2020 |
Meropenem is a: | Antibacterial. | Antiviral. | Antiparasitic. | Biology | Antifungal. | 106 | 2 | 0e3125e1-7d83-4589-adb4-23f2ada10ce6 | 2020 |
Human coronaviruses: | They are the causative agents of seasonal flu. | They are DNA viruses. | They are included in the official vaccination schedule. | Biology | They are responsible for Severe Acute Respiratory Syndrome (SARS). | 107 | 3 | d872e289-380a-49ab-bc85-6d38fa76d1dc | 2020 |
The resistance of Staphylococcus aureus to methicillin is due to the presence of the gene: | rmtA. | vanA. | qnrA. | Biology | mecA. | 108 | 3 | 40fd5d58-b2e7-4533-8bba-75e1d130dfe7 | 2020 |
Regarding Streptococcus pyogenes, it is false that: | It causes rheumatic fever. | It is a frequent cause of pharyngotonsillitis. | The M protein of the cell wall is associated with its virulence. | Biology | It is a species resistant to penicillin. | 109 | 3 | 4b2fd702-056b-4694-a27b-6b607a5e1b17 | 2020 |
Regarding Listeria monocytogenes, it is false that: | It is an intracellular bacteria. | There is direct human-to-human transmission. | It can be transmitted from the mother to the fetus through the placenta. | Biology | It is a common contaminant of many foods. | 110 | 1 | 46680112-1868-41f0-812b-3241140dbe01 | 2020 |
Which of the following Bacillus species causes food poisoning?: | Bacillus cereus. | Bacillus anthracis. | Bacillus subtilis. | Biology | Bacillus circulans. | 111 | 2 | e42c1939-e152-4464-9e41-2c1a6471f45d | 2020 |
are not effective for the treatment of Streptococcus pneumoniae infections: | Macrolides. | Beta-lactams. | Aminoglycosides. | Biology | Fluoroquinolones. | 112 | 4 | 4914523e-ebae-44e3-b073-6c5b3ad2ef52 | 2020 |
Which of the following statements is false?: | Boutonneuse fever is transmitted through tick bites. | Chlamydia trachomatis causes sexually transmitted infections. | Rickettsia conorii is the causative agent of Q fever. | Biology | Coxiella burnetii is an intracellular pathogen. | 113 | 4 | 8ec8cc09-c762-4d12-b2bf-779d8bfaf2ee | 2020 |
Tularemia is a disease caused by bacteria of the genus: | Francisella. | Brucella. | Tsukamurella. | Biology | Pasteurella. | 114 | 2 | 35b0e122-74d9-4c80-9029-7a0f195818a4 | 2020 |
Actinomycosis: | It is native to South America. | It is an infection caused by fungi. | It is a viral infection. | Biology | It is treated with penicillin. | 115 | 3 | 2f39f8b4-0fe7-45f7-b30b-a17706b84c33 | 2020 |
Which component of Neisseria meningitidis is part of the conjugate vaccines? | Porins. | Pilines. | Hemoglobin binding proteins. | Biology | Polysaccharide capsule. | 116 | 3 | 126b4150-f28c-41b0-9ccb-6af75822f097 | 2020 |
The transmission of the infection by Bordetella pertussis is carried out through: | Contaminated food. | Insects and other arthropods. | Respiratory secretions. | Biology | Contaminated water. | 117 | 4 | 0c86b553-812f-4cc1-be7d-e098e81470f4 | 2020 |
Helicobacter pylori: | Produces urease. | It is immobile. | It is a Gram-positive bacillus. | Biology | Reduce the nitrates. | 118 | 2 | 89f30610-2dad-4af1-9e7c-e645747059b7 | 2020 |
Among the enterobacteria causing gastroenteritis, the following is not found: | Salmonella enterica. | Enterobacter cloacae. | Shigella sonnei. | Biology | Yersinia enterocolitica. | 119 | 1 | af98f8d8-1f7b-484a-8a40-b16b3a61003a | 2020 |
Among the infections associated with Pseudomonas aeruginosa, the following is not found: | Pneumonia in intubated patients. | External otitis associated with swimming in pools. | Endocarditis after dental manipulation. | Biology | Bacteremia in immunocompromised patients. | 120 | 4 | 3cf9f175-85a8-4b2c-b744-d589ed74d900 | 2020 |
One of the following statements regarding Burkholderia cepacia is false: | Causes severe lung infections in patients with cystic fibrosis. | It is a non-fermenting Gram-negative bacillus. | It is usually sensitive to most antibiotics. | Biology | It can colonize damp surfaces and is an opportunistic pathogen. | 121 | 4 | cc5b85d1-0082-4e33-9070-b9dbaacce06b | 2020 |
Which non-fermenting Gram-negative bacillus, resistant to multiple antibiotics, causes infection transmitted within hospitals? | Klebsiella pneumoniae. | Acinetobacter baumannii. | Campylobacter jejuni. | Biology | Enterobacter cloacae. | 122 | 1 | 87488c52-3c8b-475f-a2c0-04572af6ecb4 | 2020 |
Enterobacteria producing extended-spectrum beta-lactamases are usually resistant to the following beta-lactams, except: | Carbapenems. | Penicillins. | Cephalosporins. | Biology | Monobactams. | 123 | 2 | 492ee3c0-3425-455e-b873-eca1fa74a6f0 | 2020 |
Which of the following characteristics of Mycobacterium tuberculosis is false?: | It is acid-alcohol resistant (Ziehl-Neelsen stain). | It is a strict aerobic bacillus. | The wall has many lipids, including mycolic acids. | Biology | It has rapid growth in culture mediums. | 124 | 3 | e775db44-9954-4c6f-b5aa-59896fd89f90 | 2020 |
Lyme Disease: | Humans get infected through ticks. | It is caused by Borrelia recurrentis. | The treatment is based on the combination of isoniazid and rifampicin. | Biology | The disease is located in Africa. | 125 | 2 | 7491eca2-ba8b-42d0-8b58-f6da11a2e788 | 2020 |
Regarding the Candida genus, it is false: | They do not grow in conventional culture mediums. | They are yeast-like microorganisms that can produce pseudohyphae. | The most common species in clinical samples is Candida albicans. | Biology | They colonize humans and other mammals. | 126 | 2 | adfa8db7-82a0-42cc-9575-c9f53d4544f7 | 2020 |
In RNA viruses: | Its RNA is stable and long-lasting. | Negative RNAs do not have a envelope. | There is a greater propensity to suffer mutations. | Biology | An example is parvovirus. | 127 | 4 | 9513b6f7-f915-41c0-919c-970ada7cf42d | 2020 |
it is not considered a laboratory method to diagnose viral infections: | Optical Microscopy. | Detection of viral proteins (antigens and enzymes). | Detection of viral genetic material. | Biology | Detection of specific antibodies. | 128 | 2 | 140c69f0-7867-4750-a51d-3841ad9f88e9 | 2020 |
Cytomegalovirus: | It belongs to the subfamily Betaherpesvirinae. | It does not cause congenital infection. | The infection has a marked seasonal incidence. | Biology | It disappears from the organism once the disease is overcome. | 129 | 2 | 0fe110be-2031-43d4-a2ce-9f9227283d7a | 2020 |
The viruses from the Herpesviridae family: | They encode DNA polymerase, which is a target for antiviral drugs. | They have a helical capsid. | They lack a covering. | Biology | The replication of DNA and the assembly of the capsid take place in the cytoplasm. | 130 | 2 | 0450d846-1bb7-4799-a8ec-50c379687bdd | 2020 |
is not a marker of Epstein-Barr virus infection: | Anti-epstein-barr nuclear antigen antibodies (EBNA). | Rapid Plasma Reagin (RPR). | Heterophil antibodies. | Biology | Anti-viral capsid antigen (VCA) antibodies. | 131 | 1 | de6e4546-4601-4311-8511-2f434b4df832 | 2020 |
Among the opportunistic diseases characteristic of advanced stages of the infection by the human immunodeficiency virus type 1, the following is not included: | Influenza A virus pneumonia. | Esophageal Candidiasis. | Kaposi's Sarcoma. | Biology | Cytomegalovirus Retinitis. | 132 | 2 | 4df8b93c-7bd7-4582-8e7e-a12fe734f094 | 2020 |
Which hepatitis virus does not lead to chronic infection?: | Hepatitis B virus. | Hepatitis A virus. | Hepatitis D virus. | Biology | Hepatitis C Virus. | 133 | 1 | 8b362473-ab40-4eb3-a279-1ff0c0d7b861 | 2020 |
The vaccine for the hepatitis B virus consists of: | The envelope protein of the virus (surface antigen). | Live attenuated viruses. | Inactivated whole viruses. | Biology | A combination of surface proteins and viral capsid. | 134 | 2 | eacc0ef6-80d3-4ab0-8268-eac61c6bf038 | 2020 |
What is the transmission vector of African trypanosomiasis? | Mosquito of the Aedes genus. | Snail of the Bulinus genus. | Fly of the Glossina genus. | Biology | The triatomine of the Rhodnius prolixus genus. | 135 | 4 | 6a52d26f-0b02-4728-9daf-4118d1b83b49 | 2020 |
What infective phase of the Plasmodium parasite does the Anopheles mosquito inject when biting a patient? | Schizont. | Trophozoite. | Merozoite. | Biology | Sporozoite. | 136 | 3 | 5c9ac8cd-3634-48f4-9e16-4ed31664e8b1 | 2020 |
What parasitic disease causes megaviscera in its chronic phase? | The American trypanosomiasis. | Schistosomiasis. | Amebiasis. | Biology | Malaria. | 137 | 2 | 6f1bd5a1-988e-405a-ad52-8b86e1a00df8 | 2020 |
What pathogen can cause keratitis in contact lens wearers? | Entamoeba coli. | Entamoeba histolytica. | Entamoeba hartmanni. | Biology | Acanthamoeba. | 138 | 3 | 7ce3e4d4-deb2-4cb7-a6bb-64b1060f2ab5 | 2020 |
Which of the following parasites can cause severe hyperinfestation after the use of corticosteroids?: | Giardia lamblia. | Toxoplasma gondii. | Strongyloides stercoralis. | Biology | Enterobius vermicularis. | 139 | 4 | d2bb3ddf-6dbf-4a4e-bcbb-540fa873ab7e | 2020 |
In an enzymatic reaction, the enzyme: | Change the equilibrium constant of the reaction. | Shifts the reaction equilibrium to the right. | It alters the energy difference between reactants and products. | Biology | Increases the speed of the reaction. | 140 | 3 | 73270c7c-c344-45fa-bd81-db8689f80082 | 2020 |
Which of the following estrogens is produced in the largest quantity by the ovaries and is used in the study of ovarian function?: | Estradiol. | Estriol. | Hydroxyestrone. | Biology | Epiestriol. | 141 | 2 | 342dc7ab-3678-4ca7-b4a7-85cee51bb3ff | 2020 |
Which molecule is measured, using an enzymatic method, to estimate the concentration of triglycerides? | Amylase. | Glycerol. | Lipase. | Biology | Phospholipids. | 142 | 1 | 8a304398-d7c4-462b-bb37-e5a9318c726f | 2020 |
For the diagnosis of an acute myocardial infarction: | Cardiac troponin T has the highest sensitivity and CK-MB has the highest specificity. | CK-MB is the biomarker with the highest sensitivity and cardiac troponin T is the one with the highest specificity. | Cardiac troponin T has the highest sensitivity and specificity. | Biology | CK-MB has the highest sensitivity and specificity. | 143 | 4 | 5f3bdf04-fcb6-4722-a545-83f37913f6d0 | 2020 |
What characteristics do triglycerides have?: | They are esters of 3 fatty acids plus 1 glycerol. | They are formed by 3 glycerols. | They cannot be synthesized by the liver. | Biology | They are hydrogenated derivatives of glycerol. | 144 | 2 | 6bd840dd-e387-4eb5-8d3c-4f71e301d8c8 | 2020 |
What is the amphibolic intermediate where the catabolic pathways of carbohydrates, lipids, and proteins converge? | Glucose-6-phosphate. | Pyruvate. | Acetyl-CoA. | Biology | Citrate. | 145 | 4 | 923935dc-5b48-4839-b7e7-bed3ea900565 | 2020 |
Which of the following enzymes catalyzes an anaplerotic reaction?: | Pyruvate carboxylase. | Aconitase. | Citrate synthase. | Biology | Succinate dehydrogenase. | 146 | 2 | 7e0a8f61-a9e5-4003-8de8-873a3f2a4678 | 2020 |
What activation of which process produces an excess of ketone bodies in the plasma? | Glycogen catabolism. | Glucose metabolism. | Catabolism of lipids. | Biology | Cholesterol catabolism. | 147 | 4 | 7b7d8ca1-938c-4161-97ee-0922a7368c94 | 2020 |
Why is heat produced in the catabolism of brown fat? | Release of phosphoenolpyruvate. | Uncontrolled hydrolysis of ATP. | Degradation of beta-hydroxybutyrate. | Biology | Uncoupling of the mitochondrial proton gradient. | 148 | 3 | ad77ef90-95c0-4519-b50d-4809cc966ce7 | 2020 |
is not considered a diagnosis of diabetes mellitus: | A blood glucose level at 120 minutes after oral glucose overload (75 grams) greater than or equal to 200 mg/dL. | A fasting basal blood glucose level (at least 8 hours) of 126 mg/dL or higher on two separate determinations. | The finding of a random blood glucose level higher than 140 mg/dL. | Biology | A glycated hemoglobin result in blood greater than or equal to 6.5%. | 149 | 4 | d217dd0a-5e3c-449c-a4d6-6eca713aff70 | 2020 |
The biochemical marker of choice for the diagnosis of Paget's disease is: | Hydroxylysine. | N-terminal propeptide of type 1 collagen. | Alkaline phosphatase. | Biology | Carboxyterminal telopeptide of type 1 collagen. | 150 | 4 | 26aa9fcb-8429-467e-8e78-51eedbc7d012 | 2020 |
For the management of primary hyperparathyroidism, the following are not considered reference markers in blood determinations: | Parathyroid hormone. | Vitamin D. | Growth hormone. | Biology | Calcium. | 151 | 4 | 232a494b-696b-44b7-b7d4-3ad28a6f2be4 | 2020 |
What characterizes gynecomastia in men from a biochemical point of view? | Increase in the FSH/LH ratio. | Increase in prolactin levels. | Increase in the estrogen/androgen ratio. | Biology | Increase in progesterone levels. | 152 | 4 | 9bbe4094-4b7b-4423-bdbb-25fa5aacfc22 | 2020 |
What characterizes hypocalcemia associated with type I rickets dependent on vitamin D? | Functional defect of the 1-25(OH) vitamin D. | Deficiency of the specific vitamin D receptor. | Functional defect of PTH. | Biology | Deficiency of renal 1-alpha-hydroxylase. | 153 | 3 | e88ee303-948a-462d-b69a-b5aa4ea4d37c | 2020 |
Of the following tumor markers, which one should not be used in a hemolyzed sample? | Ca.15.3. | Alpha-fetoprotein (AFP). | ProGRP (Gastrin-associated peptide). | Biology | Neuron-specific enolase (NSE). | 155 | 3 | 2728cebd-4603-42c0-b20a-9edd33bbf753 | 2020 |
What marker is the most sensitive and specific for monitoring patients with differentiated thyroid cancer? | Thyroglobulin. | Free thyroxine. | Free Triiodothyronine. | Biology | TSH (thyrotropin). | 156 | 2 | 6eb18517-d9ee-4f1c-a177-137956e3c1df | 2020 |
The ROMA (Risk of Ovarian Malignancy Algorithm), what tumor markers does it combine to calculate the risk of epithelial ovarian cancer? | Ca.125 and Ca.19.9. | Ca.19.9 and CEA (carcinoembryonic antigen). | HE-4 (human epididymis protein 4) and CEA (carcinoembryonic antigen). | Biology | Ca.125 and HE-4 (human epididymis protein 4). | 157 | 3 | 386f4289-e706-42ef-8bc4-47f54cfa17ce | 2020 |
Cardiolipin is a: | Phosphoglyceride. | Sphingolipid. | Ganglioside. | Biology | Steroid. | 158 | 2 | b8a66237-0d0f-4fb4-b89f-5212eb47c898 | 2020 |
Which of the following enzymes related to the metabolism of purines is deficient in Lesch-Nyhan syndrome?: | Argininosuccinate synthetase. | Carbamoyl phosphate synthetase II. | Aspartate transcarbamylase. | Biology | Hypoxanthine-guanine phosphoribosyltransferase. | 159 | 3 | 10abec6e-c48c-439a-a078-7e9584a24272 | 2020 |
The primer for glycogen biosynthesis is: | Glycogen synthase. | UDP-glucose. | Glycogenin. | Biology | Dolichol phosphate. | 160 | 4 | 2802d999-8757-4748-a354-2997a1737a67 | 2020 |
Phosphatidate is a common intermediate for the biosynthesis of: | AMP and GMP. | Cholesterol and Ketone Bodies. | Triacylglycerols and sphingolipids. | Biology | Triacylglycerols and phosphoglycerides. | 161 | 3 | 4cef6b73-4b14-4d37-a6fa-2e4312c30fa3 | 2020 |
In the oxidative phase of the pentose phosphate pathway: | FAD is consumed. | NADPH is produced. | Oxygen is required. | Biology | Transaldolases are involved. | 162 | 1 | 3b10075d-67ce-4a69-b2fd-5b4ea723c443 | 2020 |
The myoglobin: | Binds oxygen with higher affinity than hemoglobin A. | It is made up of two homodimers. | Binds oxygen in a cooperative manner. | Biology | Binds oxygen with less affinity than hemoglobin A. | 163 | 2 | c36e732b-5070-4894-95df-e2951d5634bd | 2020 |
Which of the following molecules activates glycolysis and inhibits gluconeogenesis?: | Acetyl-CoA. | NADPH. | Glucose-6-phosphate. | Biology | AMP. | 164 | 3 | a0aad773-d87a-4b85-985f-5079519775ac | 2020 |
The carnitine: | It transports long-chain fatty acids to the mitochondrial matrix. | It is the longest chain fatty acid that can be oxidized in the mitochondria. | Its complete oxidation provides 106 molecules of ATP. | Biology | Controls the flip-flop pores. | 165 | 2 | ab592a0e-6441-4fe4-b19c-f97eab048f64 | 2020 |
The nicotinic acetylcholine receptor: | Lets any ion pass. | It opens or closes in response to changes in pH. | It is composed of five subunits. | Biology | It opens in response to the binding of K+ and closes when it binds Na+. | 166 | 4 | de121c1e-91a3-42de-a586-037d48ce8ec0 | 2020 |
The formation of a peptide bond: | It is followed by a translocation of the tRNAs and the mRNA in the ribosome. | It takes place in the spliceosome. | It occurs in a peptide chain in the direction from the beta carboxyl end to the epsilon amino end. | Biology | Requires three molecules of ATP. | 167 | 2 | 55755f4a-4e65-4676-baa1-db26db3bb032 | 2020 |
How can epigenetics be defined? | All modifications that affect the regulation of genes, heritable or not, that do not alter the DNA sequence. | All mutations acquired by an individual after birth. | They are the DNA methylation processes after cell differentiation. | Biology | All the molecular mechanisms that affect histones. | 168 | 2 | b33c9af4-bf83-48ec-a7d0-3301a9a33e07 | 2020 |
What characteristics does the DNA circulating in the plasma of a pregnant woman have? | It is a mixture of maternal DNA and fetal DNA. | What is found in the plasma are microparticles loaded with RNA only. | A pregnant woman has a lot of DNA in plasma and its origin cannot be determined, nor are there techniques for its isolation. | Biology | DNA cannot be detected in plasma. | 169 | 2 | f117e643-06a8-4d61-a40c-73433c1eb2bd | 2020 |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.